Alteration of amino acid compositions in seeds

Abstract

The present invention provides a method for enhancing the nutritional value of seeds and seeds produced by the method.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation application of co-pending U.S. application Ser. No. 09/020,716 filed Feb. 9, 1998, which is herein incorporated in it's entirety by reference.

BACKGROUND OF THE INVENTION

[0002] Feed formulations based on crop plants must typically be supplemented with specific amino acids to provide animals with essential nutrients which are necessary for their growth. This supplementation is necessary because, in general, crop plants contain low proportions of several amino acids which are essential for, and cannot be synthesized by, monogastric animals.

[0003] The seeds of crop plants contain different classes of seed proteins. The amino acid composition of these seeds reflects the composition of the prevalent classes of proteins. Amino acid limitations are usually due to amino acid deficiencies of these prevalent protein classes.

[0004] Among the amino acids necessary for animal nutrition, those that are of limited availability in crop plants include methionine, lysine, and threonine. Attempts to increase the levels of these amino acids by breeding, mutant selection, and/or changing the composition of the storage proteins accumulated in the seeds of crop plants, have met with limited success, or were accompanied by a loss in yield.

[0005] For example, although seeds of corn plants containing a mutant transcription factor, (opaque 2), or a mutant .alpha.-zein gene, (floury 2), exhibit elevated levels of total and bound lysine, there is an altered seed endosperm structure which is more susceptible to damage and pests. Significant yield losses are also typical.

[0006] An alternative means to enhance levels of free amino acids in a crop plant is the modification of amino acid biosynthesis in the plant. The introduction of a feedback-regulation-insensitive dihydrodipicolinic acid synthase ("DHDPS") gene, which encodes an enzyme that catalyzes the first reaction unique to the lysine biosynthetic pathway, into plants has resulted in an increase in the levels of free lysine in the leaves and seeds of those plants. An increase in the levels of free lysine in the embryo results in reduced amount of oil in the seed. Further free lysine can be lost during the wet milling process reducing the feed value of the gluten product of the process.

[0007] The expression of the lysC gene, which encodes a mutant bacterial aspartate kinase that is desensitized to feedback inhibition by lysine and threonine, from a seed-specific promoter in tobacco plants, has resulted in an increase in methionine and threonine biosynthesis in the seeds of those plants. See Karchi et al.; The Plant J.; Vol. 3; p. 721; (1993). However, expression of the lysC gene results in only a 6-7% increase in the level of total threonine or methionine in the seed. The expression of the lysC gene in seeds has a minimal impact on the nutritional value of those seeds and, thus, supplementation of feed containing lysC transgenic seeds with amino acids, such as methionine and threonine, is still required.

[0008] There are additional molecular genetic strategies available for enhancing the amino acid quality of plant proteins. Each involves molecular manipulation of plant genes and the generation of transgenic plants.

[0009] Protein sequence modification involves the identification of a gene encoding a major protein, preferably a storage protein, as the target for modification to contain more codons of essential amino acids. An important aspect of this approach is to be able to select a region of the protein that can be modified without affecting the overall structure, stability, function, and other cellular and nutritional properties of the protein.

[0010] The development of DNA synthesis technology allows the design and synthesis of a gene encoding a new protein with desirable essential amino acid compositions. For example, researchers have synthesized a 292-base pair DNA sequence encoding a polypeptide composed of 80% essential amino acids and used it with the nopaline synthetase (NOS) promoter to construct a chimeric gene. Expression of this gene in the tuber of transgenic potato has resulted in an accumulation of this protein at a level of 0.02% to 0.35% of the total plant protein. This low level accumulation is possibly due to the weak NOS promoter and/or the instability of the new protein.

[0011] Tobacco has been used as a test plant to demonstrate the feasibility of this approach by transferring a chimeric gene containing the bean phaseolin promoter and the cDNA of a sulfur-rich protein Brazil Nut Protein ("BNP"), (18 mol % methionine and 8 mol % cysteine) into tobacco. Amino acid analysis indicates that the methionine content in the transgenic seeds is enhanced by 30% over that of the untransformed seeds. This same chimeric gene has also been transferred into a commercial crop, canola, and similar levels of enhancement were achieved.

[0012] However, an adverse effect is that lysine content decreases. Additionally, BNP has been identified as a major food allergen. Thus it is neither practical nor desirable to use BNP to enhance the nutritional value of crop plants.

[0013] Thus, there is a need to improve the nutritional value of plant seeds. The genetic modification should not be accompanied by detrimental side effects such as allergenicity, anti-nutritional quality or poor yield.

SUMMARY OF THE INVENTION

[0014] It is an object of the present invention to provide a seed, the endosperm of which contains elevated levels of an essential amino acid.

[0015] It is a further object of the present invention to provide methods for increasing the nutritional value of feed.

[0016] It is a further object of the present invention to provide methods for genetically modifying seeds so as to increase amounts of essential amino acids which are present in relatively low amounts in unmodified seeds.

[0017] It is a further object of the present invention to provide methods for increasing the nutritional content of seeds without detrimental side effects such as allergenicity or anti-nutritional quality.

[0018] It is a further object of the present invention to provide methods for increasing the nutritional content of seeds while maintaining a high yield.

[0019] It is a further object of the present invention to provide a method for the expression of a polypeptide in a seed having levels of a preselected amino acid sufficient to reduce or obviate feed supplementation.

[0020] According to the present invention a transformed plant seed is provided, the endosperm of which is characterized as having an elevated level of at least one preselected amino acid compared to a seed from a corresponding plant which has not been transformed, wherein the amino acid is lysine, threonine, or tryptophan and optionally a sulfur-containing amino acid.

[0021] Also provided is a seed from a plant which has been transformed to express a heterologous protein in the endosperm of the seed, wherein the seed exhibits an elevated level of an essential amino acid.

[0022] An expression cassette is also provided comprising a seed endosperm-preferred promoter operably linked to a structural gene encoding a polypeptide having an elevated level of a preselected amino acid. Transformed plants and seeds containing the expression cassette are also provided.

[0023] A method for elevating the level of a preselected amino acid in the endosperm of plant seed is also provided. The method comprises the transformation of plant cells by introducing the expression cassette, recovering the transformed cells, regenerating a transformed plant and collecting the seeds therefrom.

DETAILED DESCRIPTION OF THE INVENTION

[0024] As used herein, a "structural gene" means an exogenous or recombinant DNA sequence or segment that encodes a polypeptide.

[0025] As used herein, "recombinant DNA" is a DNA sequence or segment that has been isolated from a cell, purified, synthesized or amplified.

[0026] As used herein, "isolated" means either physically isolated from the cell or synthesized in vitro on the basis of the sequence of an isolated DNA segment.

[0027] As used herein, the term "increased" or "elevated" levels of the preselected amino acid in a protein means that the protein contains an elevated amount of a preselected amino acid compared to the amount in an average protein.

[0028] As used herein, "increased" or "elevated" levels or amounts of preselected amino acids in a transformed plant or seed are levels which are greater than the levels or amounts in the corresponding untransformed plant or seed.

[0029] As used herein, "polypeptide" means proteins, protein fragments, modified proteins, amino acid sequences and synthetic amino acid sequences.

[0030] As used herein, "transformed plant" means a plant which comprises a structural gene which is introduced into the genome of the plant by transformation.

[0031] As used herein, "untransformed plant" refers to a wild type plant, i.e., one where the genome has not been altered by the introduction of the structural gene.

[0032] As used herein, "plant" includes but is not limited to plant cells, plant tissue and plant seeds.

[0033] As used herein, "seed endosperm-preferred promoter" is a promoter which preferentially promotes expression of the structural gene in the endosperm of the seed.

[0034] As used herein with respect to a structural gene encoding a polypeptide, the term "expresses" means that the structural gene is incorporated into the genome of cells, so that the product encoded by the structural gene is produced within the cells.

[0035] As used herein, the term "essential amino acid" means an amino acid which is synthesized only by plants or microorganisms or which is not produced by animals in sufficient quantities to support normal growth and development.

[0036] As used herein, the term "high lysine content protein" means that the protein has at least about 7 mole % lysine, preferably about 7 mole % to about 50 mole % lysine, more preferably about 7 mole % to about 40 mole % lysine and most preferably about 7 mole % to about 30 mole %.

[0037] As used herein, the term "high sulfur content protein" means that the protein contains at least about 6 mole % methionine and/or cysteine, preferably about 6 mole % to about 40 mole %, more preferably about 6 mole % to about 30 mole % and most preferably 6 mole % to 25 mole %.

[0038] The present invention provides a transformed plant seed, the endosperm of which is characterized as having an elevated level of a preselected amino acid compared to the seed of a corresponding plant which has not been transformed. It is preferred that the level of preselected amino acid is elevated in the endosperm in preference to other parts of the seed.

[0039] The preselected amino acid is an essential amino acid such as lysine, cysteine, methionine, threonine, tryptophan, arginine, valine, leucine, isoleucine, histidine or combinations thereof; preferably, the preselected amino acid is lysine, threonine, cysteine, tryptophan, or combinations thereof and optionally methionine. It is especially preferred that the polypeptide has an increased content of lysine as well as a sulfur containing amino acid, i.e., methionine and/or cysteine.

[0040] The polypeptide can be an endogenous or heterologous protein. When an endogenous protein is expressed, the preselected amino acid is lysine, cysteine, threonine, tryptophan, arginine, valine, leucine, isoleucine, histidine or combinations thereof and optionally methionine. When the protein is a heterologous protein, any of the above described preselected amino acids or combinations thereof is present in elevated amounts.

[0041] Generally the amount of preselected amino acid in the seed of the present invention is at least about 10 percent by weight greater than in a corresponding untransformed seed, preferably about 10 percent by weight to about 10 times greater, more preferably about 15 percent by weight to about 10 time greater and most preferably about 20 percent to about 10 times greater.

[0042] A polypeptide having an elevated amount of the preselected amino acid is expressed in the transformed plant seed endosperm in an amount sufficient to increase the amount of at least one preselected amino acid in the seed of the transformed plant, relative to the amount of the preselected amino acid in the seed of a corresponding untransformed plant.

[0043] The choice of the structural gene is based on the desired amino acid composition of the polypeptide encoded by the structural gene, and the ability of the polypeptide to accumulate in seeds. The amino acid composition of the polypeptide can be manipulated by methods, such as site-directed mutagenesis of the structural gene encoding the polypeptide, so as to result in expression of a polypeptide that is increased in the amount of a particular amino acid. For example, site-directed mutagenesis can be used to increase levels of lysine, methionine, cysteine, threonine and/or tryptophan and/or to decrease levels of asparagine and/or glutamine.

[0044] The derivatives differ from the wild-type protein by one or more amino acid substitutions, insertions, deletions or the like. Typically, amino acid substitutions are conservative. In the regions of homology to the native sequence, variants preferably have at least 90% amino acid sequence identity, more preferably at least 95% identity.

[0045] Typical examples of suitable proteins include barley chymotrypsin inhibitor, barley alpha hordothionin, soybean 2S albumin proteins, rice high methionine protein and sunflower high methionine protein and derivatives of each protein.

[0046] Barley alpha hordothionin has been modified to increase the level of particular amino acids. The sequences of genes which express modified alpha hordothionin proteins with enhanced essential amino acids are based on the mRNA sequence of the native Hordeum vulgare alpha hordothionin gene (accession number X05901, Ponz et al., 1986, Eur. J. Biochem. 156:131-135).

[0047] Modified hordothionin proteins are described in U.S. Ser. No. 08/838,763 filed Apr. 10,1997; Ser. No. 08/824,379 filed Mar. 26, 1997; Ser. No. 08/824,382 filed Mar. 26, 1997; and U.S. Pat. No. 5,703,409 issued Dec. 30, 1997 the disclosures of which are incorporated herein in their entirety by reference.

[0048] Alpha hordothionin is a 45-amino acid protein which is stabilized by four disulfide bonds resulting from eight cysteine residues. In its native form, the protein is especially rich in arginine and lysine residues, containing 5 residues (10%) of each. However, it is devoid of the essential amino acid methionine.

[0049] Alpha hordothionin has been modified to increase the amount of various amino acids such as lysine, threonine or methionine. The protein has been synthesized and the three-dimensional structure determined by computer modeling. The modeling of the protein predicts that the ten charged residues (arginine at positions 5, 10, 17, 19 and 30, and lysine at positions 1, 23, 32, 38 and 45) all occur on the surface of the molecule. The side chains of the polar amino acids (asparagine at position 11, glutamine at position 22 and threonine at position 41) also occur on the surface of the molecule. Furthermore, the hydrophobic amino acids, (such as the side chains of leucine at positions 8, 15, 24 and 33 and valine at position 18) are also solvent-accessible.

[0050] The Three-dimensional modeling of the protein indicates that the arginine residue at position 10 is important to retention of the appropriate 3-dimensional structure and possible folding through hydrogen bond interactions with the C-terminal residue of the protein. A lysine, methionine or threonine substitution at that point would disrupt this hydrogen bonding network, leading to a destabilization of the structure. The synthetic peptide having this substitution could not be made to fold correctly, which supported this analysis. Conservation of the arginine residue at position 10 provides a protein which folds correctly.

[0051] Alpha hordothionin has been modified to contain 12 lysine residues in the mature hordothionin peptide, referred to as HT12. (Rao et al., 1994, Protein Engineering 7(12):1485-1493 and WO 94/16078 published Jul. 21, 1994) The disclosure of each of these is incorporated herein by reference in their entirety.

[0052] Further analysis of substitutions which would not alter the 3-dimensional structure of the molecule led to replacement of Asparagine-11, Glutamine-22 and Threonine-41 with lysine residues with virtually no steric hindrance. The resulting compound contains 27% lysine residues.

[0053] Other combinations of these substitutions were also made, including changes in amino acid residues at one or more of positions 5, 11, 17, 19, 22, 30 and 41 are lysine, and the remainder of the residues at those positions are the residues at the corresponding positions in the wild type hordothionin.

[0054] Since threonine is a polar amino acid, the surface polar amino acid residues, asparagine at position 11 and glutamine at position 22, can be substituted; and the charged amino acids, lysine at positions 1, 23, 32 and 38 and arginine at positions 5, 17, 19, and 30, can also be substituted with threonine. The molecule can be synthesized by solid phase peptide synthesis.

[0055] While the above sequence is illustrative of the present invention, it is not intended to be a limitation. Threonine substitutions can also be performed at positions containing charged amino acids. Only arginine at position 10 and lysine at position 45 are important for maintaining the structure of the protein. One can also substitute at the sites having hydrophobic amino acids. These include positions 8, 15, 18 and 24.

[0056] Since methionine is a hydrophobic amino acid, the surface hydrophobic amino acid residues, leucine at positions 8, 15, and 33, and valine at position 18, were substituted with methionine. The surface polar amino acids, asparagine at position 11, glutamine at position 22 and threonine at position 41, are substituted with methionine. The molecule is synthesized by solid phase peptide synthesis and folds into a stable structure. It has seven methionine residues (15.5%) and, including the eight cysteines, the modified protein has a sulfur amino acid content of 33%.

[0057] While the above-described proteins are illustrative of suitable polypeptides which can be expressed in the transformed plant, it is not intended to be a limitation. Methionine substitutions can also be performed at positions containing charged amino acids. Only arginine at position 10 is important for maintaining the structure of the protein through a hydrogen-bonding network with serine at position 2 and lysine at position 45. Thus, one can substitute methionine for lysine at positions 1, 23, 32, and/or 38, and for arginine at positions 5, 17, 19 and/or 30.

[0058] Many other proteins are also appropriate, for example the protein encoded by the structural gene can be a lysine and/or sulfur rich seed protein, such as the soybean 2S albumin described in U.S. Ser. No. 08/618,911 filed Mar. 20,1996, and the chymotrypsin inhibitor from barley, Williamson et al., Eur. J Biochem 165:99-106 (1987), the disclosures of each are incorporated by reference.

[0059] Derivatives of these genes can be made by site directed mutagenesis to increase the level of preselected amino acids in the encoded polypeptide. For example the gene encoding for the barley high lysine polypeptide (BHL), is derived from barley chymotrypsin inhibitor, U.S. Ser. No. 08/740,682 filed Nov. 1, 1996 and PCT/US97/20441 filed Oct. 31, 1997, the disclosures of each are incorporated herein by reference. The gene encoding for the enhanced soybean albumin gene (ESA), is derived from soybean 2S albumin described in U.S. Ser. No. 08/618,911, the disclosure of which is incorporated herein in its entirety by reference.

[0060] Other examples of sulfur-rich plant proteins within the scope of the invention include plant proteins enriched in cysteine but not methionine, such as the wheat endosperm purothionine (Mak and Jones; Can. J. Biochem.; Vol. 22; p. 83J; (1976); incorporated herein in its entirety by reference), the pea low molecular weight albumins (Higgins et al.; J. Biol. Chem.; Vol. 261; p. 11124; (1986); incorporated herein in its entirety by reference) as well as 2S albumin genes from other organisms. See, for example, Coulter et al.; J. Exp. Bot.; Vol. 41; p. 1541; (1990); incorporated herein in its entirety by reference.

[0061] Such proteins also include methionine-rich plant proteins such as from sunflower seed (Lilley et al.; In: Proceedings of the World Congress on Vegetable Protein Utilization in Human Foods and Animal Feedstuffs; Applewhite, H. (ed.); American Oil Chemists Soc.; Champaign, Ill.; pp. 497-502; (1989); incorporated herein in its entirety by reference), corn (Pedersen et al.; J. Biol. Chem., p. 261; p. 6279; (1986); Kirihara et al.; Gene, Vol. 71; p. 359; (1988); both incorporated herein in its entirety by reference), and rice (Musumura et al.; Plant Mol. Biol.; Vol. 12; p. 123; (1989); incorporated herein in its entirety by reference).

[0062] The present invention also provides a method for genetically modifying plants to increase the level of at least one preselected amino acid in the endosperm of the seed so as to enhance the nutritional value of the seeds.

[0063] The method comprises the introduction of an expression cassette into regenerable plant cells to yield transformed plant cells. The expression cassette comprises a seed endosperm-preferred promoter operably linked to a structural gene encoding a polypeptide elevated in content of the preselected amino acid.

[0064] A fertile transformed plant is regenerated from the transformed cells, and seeds are isolated from the plant. The structural gene is transmitted through a complete normal sexual cycle of the transformed plant to the next generation.

[0065] The polypeptide is synthesized in the endosperm of seed of the plant which has been transformed by insertion of the expression cassette described above. The sequence for the nucleotide molecule, either RNA or DNA, can readily be derived from the amino acid sequence for the selected polypeptide using standard reference texts.

[0066] Plants which can be used in the method of the invention include monocotyledonous cereal plants. Preferred plants include maize, wheat, rice, barley, oats, sorghum, millet and rye. The most preferred plant is maize.

[0067] Seeds derived from plants regenerated from transformed plant cells, plant parts or plant tissues, or progeny derived from the regenerated transformed plants, may be used directly as feed or food, or further processing may occur.

Transformation

[0068] The transformation of plants in accordance with the invention may be carried out in essentially any of the various ways known to those skilled in the art of plant molecular biology. These include, but are not limited to, microprojectile bombardment, microinjection, electroporation of protoplasts or cells comprising partial cell walls, and Agrobacterium-mediated DNA transfer.

I. DNA Used for Transformation

[0069] DNA useful for introduction into plant cells includes DNA that has been derived or isolated from any source, that may be subsequently characterized as to structure, size and/or function, chemically altered, and later introduced into the plant.

[0070] An example of DNA "derived" from a source would be a DNA sequence or segment that is identified as a useful fragment within a given organism, and which is then synthesized in essentially pure form. An example of such DNA "isolated" from a source would be a useful DNA sequence that is excised or removed from the source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.

[0071] Therefore, useful DNA includes completely synthetic DNA, semi-synthetic DNA, DNA isolated from biological sources, and DNA derived from RNA. The DNA isolated from biological sources, or DNA derived from RNA, includes, but is not limited to, DNA or RNA from plant genes, and non-plant genes such as those from bacteria, yeasts, animals or viruses. The DNA or RNA can include modified genes, portions of genes, or chimeric genes, including genes from the same or different genotype.

[0072] The term "chimeric gene" or "chimeric DNA" is defined as a gene or DNA sequence or segment comprising at least two DNA sequences or segments from species which do not recombine DNA under natural conditions, or which DNA sequences or segments are positioned or linked in a manner which does not normally occur in the native genome of untransformed plant.

[0073] A structural gene of the invention can be identified by standard methods, e.g., enrichment protocols, or probes, directed to the isolation of particular nucleotide or amino acid sequences. The structural gene can be identified by obtaining and/or screening of a DNA or cDNA library generated from nucleic acid derived from a particular cell type, cell line, primary cells, or tissue.

[0074] Screening for DNA fragments that encode all or a portion of the structural gene can be accomplished by screening plaques from a genomic or cDNA library for hybridization to a probe of the structural gene from other organisms or by screening plaques from a cDNA expression library for binding to antibodies that specifically recognize the polypeptide encoded by the structural gene.

[0075] DNA fragments that hybridize to a structural gene probe from other organisms and/or plaques carrying DNA fragments that are immunoreactive with antibodies to the polypeptide encoded by the structural gene can be subcloned into a vector and sequenced and/or used as probes to identify other cDNA or genomic sequences encoding all or a portion of the structural gene.

[0076] Portions of the genomic copy or copies of the structural gene can be partially sequenced and identified by standard methods including either DNA sequence homology to other homologous genes or by comparison of encoded amino acid sequences to known polypeptide sequences.

[0077] Once portions of the structural gene are identified, complete copies of the structural gene can be obtained by standard methods, including cloning or polymerase chain reaction (PCR) synthesis using oligonucleotide primers complementary to the structural gene. The presence of an isolated full-length copy of the structural gene can be verified by comparison of its deduced amino acid sequence with the amino acid sequence of native polypeptide sequences.

[0078] As discussed above, the structural gene encoding the polypeptide can be modified to increase the content of particular amino acid residues in that polypeptide by methods well known to the art, including, but not limited to, site-directed mutagenesis. Thus, derivatives of naturally occurring polypeptides can be made by nucleotide substitution of the structural gene so as to result in a polypeptide having a different amino acid at the position in the polypeptide which corresponds to the codon with the nucleotide substitution. The introduction of multiple amino acid changes in a polypeptide can result in a polypeptide which is significantly enriched in a preselected amino acid.

[0079] As noted above, the choice of the polypeptide encoded by the structural gene will be based on the amino acid composition of the polypeptide and its ability to accumulate in seeds. The amino acid can be chosen for its nutritional value to produce a value-added trait to the plant or plant part. Amino acids desirable for value-added traits, as well as a source to limit synthesis of an endogenous protein include, but are not limited to, lysine, threonine, tryptophan, methionine, and cysteine.

Expression Cassettes and Expression Vectors

[0080] According to the present invention, a structural gene is identified, isolated, and combined with a seed endosperm-preferred promoter to provide a recombinant expression cassette.

[0081] The construction of such expression cassettes which can be employed in conjunction with the present invention are well known to those of skill in the art in light of the present disclosure. See, e.g., Sambrook et al.; Molecular Cloning: A Laboratory Manual; Cold Spring Harbor, N.Y.; (1989); Gelvin et al.; Plant Molecular Biology Manual; (1990); Plant Biotechnology: Commercial Prospects and Problems, eds Prakash et al.; Oxford & IBH Publishing Co.; New Delhi, India; (1993); and Heslot et al.; Molecular Biology and Genetic Engineering of Yeasts; CRC Press, Inc., USA; (1992); each incorporated herein in its entirety by reference.

[0082] Preferred promoters useful in the practice of the invention are those seed endosperm-preferred promoters that allow expression of the structural gene selectively in seed endosperm to avoid any potential deleterious effects associated with the expression of the structural gene in the embryo.

[0083] It has been found that when endosperm-preferred promoters are employed, the total level of the preselected amino acid in the seed is increased compared to a seed produced by employing an embryo-preferred promoter, such as the globulin1 promoter. When the globulin1 promoter is employed, the polypeptide is expressed by the structural gene, but the total amount of the preselected amino acid is not increased.

[0084] Examples of suitable promoters include, but are not limited to, 27 kD gamma zein promoter and waxy promoter. See the following relating to the 27 kD gamma zein promoter: Boronat, A., Martinez, M. C., Reina, M., Puigdomenech, P. and Palau, J.; Isolation and sequencing of a 28 kD glutelin-2 gene from maize: Common elements in the 5' flanking regions among zein and glutelin genes; Plant Sci. 47:95-102 (1986) and Reina, M., Ponte, I., Guillen, P., Boronat, A. and Palau, J., Sequence analysis of a genomic clone encoding a Zc2 protein from Zea mays W64 A, Nucleic Acids Res. 18(21):6426 (1990). See the following site relating to the waxy promoter: Kloesgen, R. B., Gierl, A., Schwarz-Sommer, Z S. and Saedler, H., Molecular analysis of the waxy locus of Zea mays, Mol. Gen. Genet. 203:237-244 (1986). The disclosures each of these are incorporated herein by reference in their entirety.

[0085] However, other endosperm-preferred promoters can be employed.

II. Delivery of DNA to Cells

[0086] The expression cassette or vector can be introduced into prokaryotic or eukaryotic cells by currently available methods which are described in the literature. See for example, Weising et al., Ann. Rev. Genet. 2:421-477 (1988). For example, the expression cassette or vector can be introduced into plant cells by methods including, but not limited to, Agrobacterium-mediated transformation, electroporation, PEG poration, microprojectile bombardment, microinjection of plant cell protoplasts or embryogenic callus, silicon fiber delivery, infectious viruses or viroids such as retroviruses, the use of liposomes and the like, all in accordance with well-known procedures.

[0087] The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al., Embo J. 3:2717-2722 (1984). Electroporation techniques are described in Fromm et al., Proc. Natl. Acad. Sci. 82:5324 (1985). Ballistic transformation techniques are described in Klein et al., Nature 327:70-73 (1987). The disclosure of each of these is incorporated herein in its entirety by reference.

[0088] Introduction and expression of foreign genes in plants has been shown to be possible using the T-DNA of the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens. Using recombinant DNA techniques and bacterial genetics, a wide variety of foreign DNAs can be inserted into T-DNA in Agrobacterium. Following infection by the bacterium containing the recombinant Ti plasmid, the foreign DNA is inserted into the host plant chromosomes, thus producing a genetically engineered cell and eventually a genetically engineered plant. A second approach is to introduce root-inducing (Ri) plasmids as the gene vectors.

[0089] Agrobacterium tumefaciens-mediated transformation techniques are well described in the literature. See, for example Horsch et al., Science 233:496-498 (1984), and Fraley et al., Proc. Natl. Acad. Sci. 80:4803 (1983). Agrobacterium transformation of maize is described in U.S. Pat. No. 5,550,318. The disclosure of each of these is incorporated herein in its entirety by reference.

[0090] Other methods of transfection or transformation include (1) Agrobacterium rhizogenes-mediated transformation (see, e.g., Lichtenstein and Fuller In: Genetic Engineering, vol. 6, PWJ Rigby, Ed., London, Academic Press, 1987; and Lichtenstein, C. P., and Draper, J,. In: DNA Cloning, Vol. II, D. M. Glover, Ed., Oxford, IRI Press, 1985). Application PCT/US87/02512 (WO 88/02405 published Apr. 7, 1988) describes the use of A. rhizogenes strain A4 and its Ri plasmid along with A. tumefaciens vectors pARC8 or pARC16 (2) liposome-mediated DNA uptake (see, e.g., Freeman et al., Plant Cell Physiol. 25:1353, 1984), (3) the vortexing method (see, e.g., Kindle, Proc. Natl. Acad. Sci., USA 87:1228, (1990). The disclosure of each of these is incorporated herein in its entirety by reference.

[0091] DNA can also be introduced into plants by direct DNA transfer into pollen as described by Zhou et al., Methods in Enzymology, 101:433 (1983); D. Hess, Intern Rev. Cytol., 107:367 (1987); Luo et al., Plane Mol. Biol. Reporter, 6:165 (1988). The disclosure of each of these is incorporated herein in its entirety by reference.

[0092] Expression of polypeptide coding genes can be obtained by injection of the DNA into reproductive organs of a plant as described by Pena et al., Nature, 325:274 (1987). The disclosure of which is incorporated herein in its entirety by reference.

[0093] DNA can also be injected directly into the cells of immature embryos and the rehydration of desiccated embryos as described by Neuhaus et al., Theor. Appl. Genet., 75:30 (1987); and Benbrook et al., in Proceedings Bio Expo 1986, Butterworth, Stoneham, Mass. pp. 27-54 (1986). The disclosure of each of these is incorporated herein in its entirety by reference.

[0094] Plant cells useful for transformation include cells cultured in suspension cultures, callus, embryos, meristem tissue, pollen, and the like.

[0095] A variety of plant viruses that can be employed as vectors are known in the art and include cauliflower mosaic virus (CaMV), geminivirus, brome mosaic virus, and tobacco mosaic virus.

[0096] Typical vectors useful for expression of genes in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens described by Rogers et al., Meth. In Enzymol., 153:253-277 (1987). These vectors are plant integrating vectors in that on transformation, the vectors integrate a portion of vector DNA into the genome of the host plant. The disclosure of which is incorporated herein in its entirety by reference.

[0097] A particularly preferred vector is a plasmid, by which is meant a circular double-stranded DNA molecule which is not a part of the chromosomes of the cell. Exemplary A. tumefaciens vectors useful herein are plasmids pKYLX6 and pKYLX7 of Schardl et al., Gene, 61:1-11 (1987) and Berger et al., Proc. Natl. Acad. Sci. U.S.A., 86:8402-8406 (1989). Another useful vector herein is plasmid pBI101.2 that is available from Clontech Laboratories, Inc. (Palo Alto, Calif.). The disclosure of each of these is incorporated herein in its entirety by reference.

[0098] A cell in which the foreign genetic material in a vector is functionally expressed has been "transformed" by the vector and is referred to as a "transformant".

[0099] Either genomic DNA or cDNA coding the gene of interest may be used in this invention. The gene of interest may also be constructed partially from a cDNA clone and partially from a genomic clone.

[0100] When the gene of interest has been isolated, genetic constructs are made which contain the necessary regulatory sequences to provide for efficient expression of the gene in the host cell.

[0101] According to this invention, the genetic construct will contain (a) a genetic sequence coding for the polypeptide of interest and (b) one or more regulatory sequences operably linked on either side of the structural gene of interest. Typically, the regulatory sequences will be a promoter or a terminator. The regulatory sequences may be from autologous or heterologous sources.

[0102] The cloning vector will typically carry a replication origin, as well as specific genes that are capable of providing phenotypic selection markers in transformed host cells. Typically, genes conferring resistance to antibiotics or selected herbicides are used. After the genetic material is introduced into the target cells, successfully transformed cells and/or colonies of cells can be isolated by selection on the basis of these markers.

[0103] Typical selectable markers include genes coding for resistance to the antibiotic spectinomycin (e.g., the aada gene), the streptomycin phosphotransferase (SPT) gene coding for streptomycin resistance, the neomycin phosphotransferase (NPTII) gene encoding kanamycin or geneticin resistance, the hygromycin phosphotransferase (HPT) gene coding for hygromycin resistance.

[0104] Genes coding for resistance to herbicides include genes which act to inhibit the action of acetolactate synthase (ALS), in particular the sulfonylurea-type herbicides (e.g., the acetolactate synthase (ALS) genes containing mutations leading to such resistance in particular the S4 and/or Hra mutations), genes coding for resistance to herbicides which act to inhibit action of glutamine synthase, such as phosphinothricin or basta (e.g., the pat or bar gene), or other such genes known in the art. The bar gene encodes resistance to the herbicide basta, and the ALS gene encodes resistance to the herbicide chlorsulfuron.

[0105] Typically, an intermediate host cell will be used in the practice of this invention to increase the copy number of the cloning vector. With an increased copy number, the vector containing the gene of interest can be isolated in significant quantities for introduction into the desired plant cells.

[0106] Host cells that can be used in the practice of this invention include prokaryotes, including bacterial hosts such as E. coli, S. typhimurium, and Serratia marcescens. Eukaryotic hosts such as yeast or filamentous fungi may also be used in this invention. Since these hosts are also microorganisms, it will be essential to ensure that plant promoters which do not cause expression of the polypeptide in bacteria are used in the vector.

[0107] The isolated cloning vector will then be introduced into the plant cell using any convenient transformation technique as described above.

III. Regeneration and Analysis of Transformants

[0108] Following transformation, regeneration is involved to obtain a whole plant from transformed cells and the presence of structural gene (s) or "transgene(s)" in the regenerated plant is detected by assays. The seed derived from the plant is then tested for levels of preselected amino acids. Depending on the type of plant and the level of gene expression, introduction of the structural gene into the plant seed endosperm can enhance the level of preselected amino acids in an amount useful to supplement the nutritional quality of those seeds.

[0109] Using known techniques, protoplasts and cell or tissue culture can be regenerated to form whole fertile plants which carry and express the gene for a polypeptide according to this invention.

[0110] Accordingly, a highly preferred embodiment of the present invention is a transformed maize plant, the cells of which contain at least one copy of the DNA sequence of an expression cassette containing a gene encoding a polypeptide containing elevated amounts of an essential amino acid, such an HT12, BHL or ESA protein.

[0111] Techniques for regenerating plants from tissue culture, such as transformed protoplasts or callus cell lines, are known in the art. For example, see Phillips et al.; Plant Cell Tissue Organ Culture; Vol. 1; p. 123; (1981); Patterson et al.; Plant Sci.; Vol. 42; p. 125; (1985); Wright et al.; Plant Cell Reports; Vol. 6; p. 83; (1987); and Barwale et al.; Planta; Vol. 167; p. 473; (1986); each incorporated herein in its entirety by reference. The selection of an appropriate method is within the skill of the art.

[0112] Examples of the practice of the present invention detailed herein relate specifically to maize plants. However, the present invention is also applicable to other cereal plants. The expression vectors utilized herein are demonstrably capable of operation in cells of cereal plants both in tissue culture and in whole plants. The invention disclosed herein is thus operable in monocotyledonous species to transform individual plant cells and to achieve full, intact plants which can be regenerated from transformed plant cells and which express preselected polypeptides.

[0113] The introduced structural genes are expressed in the transformed plant cells and stably transmitted (somatically and sexually) to the next generation of cells produced. The vector should be capable of introducing, maintaining, and expressing a structural gene in plant cells. The structural gene is passed on to progeny by normal sexual transmission.

[0114] To confirm the presence of the structural gene (s) or "transgene(s)" in the regenerating plants, or seeds or progeny derived from the regenerated plant, a variety of assays can be performed. Such assays include Southern and Northern blotting; PCR; assays that detect the presence of a polypeptide product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf, seed or root assays; and also, by analyzing the phenotype of the whole regenerated plant.

[0115] Whereas DNA analysis techniques can be conducted using DNA isolated from any part of a plant, RNA will be expressed in the seed endosperm and hence it will be necessary to prepare RNA for analysis from these tissues.

[0116] PCR techniques can be used for detection and quantitation of RNA produced from introduced structural genes. In this application of PCR it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances PCR techniques, while useful, will not demonstrate integrity of the RNA product.

[0117] Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and will only demonstrate the presence or absence of an RNA species.

[0118] While Southern blotting and PCR may be used to detect the structural gene in question, they do not provide information as to whether the structural gene is being expressed. Expression may be evaluated by specifically identifying the polypeptide products of the introduced structural genes or evaluating the phenotypic changes brought about by their expression.

[0119] Assays for the production and identification of specific polypeptides may make use of physical-chemical, structural, functional, or other properties of the polypeptides. Unique physical-chemical or structural properties allow the polypeptides to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography.

[0120] The unique structures of individual polypeptides offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as Western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques.

[0121] Additional techniques may be employed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing following purification. Although these are among the most commonly employed, other procedures may be additionally used.

[0122] Very frequently, the expression of a gene product is determined by evaluating the phenotypic results of its expression. These assays also may take many forms, including but not limited to, analyzing changes in the chemical composition, morphology, or physiological properties of the plant. In particular, the elevated preselected amino acid content due to the expression of structural genes encoding polypeptides can be detected by amino acid analysis.

[0123] Breeding techniques useful in the present invention are well known in the art.

[0124] The present invention will be further described by reference to the following detailed examples. It is understood, however, that there are many extensions, variations, and modifications on the basic theme of the present invention beyond that shown in the examples and description, which are within the spirit and scope of the present invention.

EXAMPLES

Example 1

Construction of the HT12 Gene and of other Genes Encoding Polypeptides having an Elevated Level of a Preselected Amino Acid.

[0125] As noted above, the sequence of the HT12 gene is based on the mRNA sequence of the native Hordeum vulgare alpha hordothionin gene (accession number X05901, Ponz et al., 1986, Eur. J. Biochem. 156:131-135) modified to introduce 12 lysine residues into the mature hordothionin peptide (See Rao et al., 1994, Protein Engineering 7(12):1485-1493, and WO 94/16078 published Jul. 21, 1994).

[0126] The alpha hordothionin cDNA comprising the entire alpha hordothionin coding sequence is isolated by rt-PCR of mRNA from developing barley seed. Primers are designed based upon the published alpha hordothionin sequence to amplify the gene and to introduce a Ncol site at the start (ATG) codon and a BamHI site after the stop codon of the thionin coding sequence to facilitate cloning.

[0127] Primers are designated as HTPCR1 (5'-AGTATAAGTAAACACACCATCACACCCTTGAGGCCCTTGCTGGTGGCCATGGTG-3') and HTPCR2 (5'-CCTCACATCCCTTAGTGCCTAAGTTCGACGTCGGGCCCTCTAGTCGACGGATCC A-3'). These primers are used in a PCR reaction to amplify alpha hordothionin by conventional methods. The resulting PCR product is purified and subcloned into the BamHI/Ncol digested pBSKP vector (Stratagene, LaJolla, Calif.) and sequenced on both strands to confirm its identity. The clone is designated pBSKP-HT (seq. ID 1). Primers are designed for single stranded DNA site-directed mutagenesis to introduce 12 codons for lysine, based on the peptide structure of hordothionin 12 (Reference Rao et al., 1994, Protein Engineering 7(12):1485-1493) and are designated HT12mut1 (5'-AGCGGAAAATGCCCGAAAGGCTTCCCCAAATTGGC-3'), HT12mut2 (5'-TGCGCAGGCGTCTGCAAGTGTAAGCTGACTAGTAGCGGAAAATGC-3'), HT12mut3 (5'-TACAACCTTTGCAAAGTCAAAGGCGCCAAGAAGCTTTGCGCAGGCGTCTG-3'), HT12mut4 (5'-GCAAGAGTTGCTGCAAGAGTACCCTGGGAAGGAAGTGCTACAACCTTTGC-3').

[0128] Sequence analysis is used to verify the desired sequence of the resulting plasmid, designated pBSKP-HT12 (seq. ID 2).

[0129] Similarly, genes encoding other derivatives of hordothionine, as described above, (See U.S. Ser. No. 08/838,763 filed Apr. 10, 1997; Ser. No. 08/824,379 filed Mar. 26, 1997; Ser. No. 08/824,382 filed Mar. 26, 1997; and U.S. Pat. No. 5,703,409 issued Dec. 30, 1997), the gene encoding enhanced soybean albumin (ESA) (See U.S. Ser. No. 08/618,911), and genes encoding BHL and other derivatives of the barley chymotrypsin inhibitor (See U.S. Ser. No. 08/740,682 filed Nov. 1, 1996 and PCT/US97/20441 filed Oct. 31, 1997) are constructed by site directed mutagenesis from pBSKP-HT, a subclone of the soybean 2S albumin 3 gene in the pBSKP vector (Stratagene, LaJolla, Calif.), and a subclone of the barley chymotrypsin inhibitor in the pBSKP vector, respectively.

Example 2

Construction of Vectors for Seed Preferred Expression of Polypeptides having an Elevated Level of a Preselected Amino Acid.

[0130] A 442 bp DNA fragment containing the modified hordothionin gene encoding HT12 is isolated from plasmid pBSKP-HT12 by Ncol/BamHI restriction digestion, gel purification and is ligated between the 27 kD gamma zein promoter and 27 kD gamma zein terminator of the Ncol/BamHI digested vector PHP3630. PHP 3630 is a subclone of the endosperm-preferred 27 kD gamma zein gene (Genbank accession number X58197) in the pBSKP vector (Stratagene), which is modified by site directed mutagenesis by insertion of a Ncol site at the start codon (ATG) of the 27 kD gamma zein coding sequence. The 27 kD gamma zein coding sequence is replaced with the HT12 coding sequence. The resulting expression vector containing the chimeric gene construct gz::HT12::gz, designated as PHP8001 (Seq. ID 3),is verified by extensive restriction digest analysis and DNA sequencing.

[0131] Similarly, the 442 bp DNA fragment containing the HT12 coding sequence is inserted between the globulin1 promoter and the globulin1 terminator of the embryo preferred corn globulin1 gene (Genbank accession number X59083), and between the waxy promoter and the waxy terminator of the endosperm-preferred waxy gene (Genbank accession number M24258). The globulin1 and waxy coding sequences, respectively, are replaced with the HT12 coding sequence. The resulting chimeric genes glb1::HT12::glb1, and wx::HT12::wx are designated as PHP 7999 (Seq. ID 4), and PHP 5025 (Seq. ID 5).

[0132] In a like manner, expression vectors containing genes encoding other derivatives of hordothionine (See Rao et al., 1994, Protein Engineering 7(12):1485-1493, and WO 94/16078 published Jul. 21, 1994), the gene encoding enhanced soybean albumin (ESA) (See U.S. Ser. No. 08/618,911,), and genes encoding BHL and other derivatives of the barley chymotrypsin inhibitor (See U.S. Ser. No. 08/740,682 filed Nov. 1, 1996 and PCT/US97/20441 filed Oct. 31, 1997) are constructed by insertion of the corresponding coding sequences between the promoter and terminator of the 27 kD gamma zein gene, the globulin1 gene and the waxy gene, respectively. Resulting chimeric genes are for example gz::ESA::gz and gz::BHL::gz, designated as PHP11260 (Seq. ID 6) and as PHP11427 (Seq. ID 7), respectively.

[0133] The resulting expression vectors are used in conjunction with the selectable marker expression cassettes PHP3528 (enhanced CAMV::Bar::PinII) for particle bombardment transformation of maize immature embryos.

Example 3

Preparation of Transgenic Plants

[0134] The general method of genetic transformation used to produce transgenic maize plants is mediated by bombardment of embryogenically responsive immature embryos with tungsten particles associated with DNA plasmids, said plasmids consisting of a selectable and an unselectable marker gene.

Preparation of Tissue

[0135] Immature embryos of "High Type II" are the target for particle bombardment-mediated transformation. This genotype is the F.sub.1 of two purebred genetic lines, parent A and parent B, derived from A188.times.B73. Both parents are selected for high competence of somatic embryogenesis. See Armstrong et al., "Development and Availability of Germplasm with High Type II Culture Formation Response," Maize Genetics Cooperation Newsletter, Vol. 65, pp. 92 (1991); incorporated herein in its entirety by reference.

[0136] Ears from F.sub.1 plants are selfed or sibbed, and embryos are aseptically dissected from developing caryopses when the scutellum first becomes opaque. The proper stage occurs about 9-13 days post-pollination, and most generally about 10 days post-pollination, and depends on growth conditions. The embryos are about 0.75 to 1.5 mm long. Ears are surface sterilized with 20-50% Clorox for 30 min, followed by 3 rinses with sterile distilled water.

[0137] Immature embryos are cultured, scutellum oriented upward, on embryogenic induction medium comprised of N6 basal salts (Chu et al., "Establishment of an Efficient Medium for Anther Culture of Rice Through Comparative Experiments on the Nitrogen Sources," Scientia Sinica, (Peking), Vol. 18, pp. 659-668 (1975); incorporated herein in its entirety by reference; Eriksson vitamins (See Eriksson, T., "Studies on the Growth Requirements and Growth Measurements of Haplopappus gracilis," Physiol. Plant, Vol. 18, pp. 976-993 (1965); incorporated herein in its entirety by reference), 0.5 mg/l thiamine HCl, 30 gm/l sucrose, 2.88 gm/l L-proline, 1 mg/l 2,4-dichlorophenoxyacetic acid, 2 gm/l Gelrite, and 8.5 mg/l AgNO.sub.3.

[0138] The medium is sterilized by autoclaving at 121.degree. C. for 15 min and dispensed into 100.times.25 mm petri dishes. AgNO.sub.3 is filter-sterilized and added to the medium after autoclaving. The tissues are cultured in complete darkness at 28.degree. C. After about 3 to 7 days, generally about 4 days, the scutellum of the embryo has swelled to about double its original size and the protuberances at the coleorhizal surface of the scutellum indicate the inception of embryogenic tissue. Up to 100% of the embryos display this response, but most commonly, the embryogenic response frequency is about 80%.

[0139] When the embryogenic response is observed, the embryos are transferred to a medium comprised of induction medium modified to contain 120 gm/l sucrose. The embryos are oriented with the coleorhizal pole, the embryogenically responsive tissue, upwards from the culture medium. Ten embryos per petri dish are located in the center of a petri dish in an area about 2 cm in diameter. The embryos are maintained on this medium for 3-16 hr, preferably 4 hours, in complete darkness at 28.degree. C. just prior to bombardment with particles associated with plasmid DNAs containing the selectable and unselectable marker genes.

[0140] To effect particle bombardment of embryos, the particle-DNA agglomerates are accelerated using a DuPont PDS-1000 particle acceleration device. The particle-DNA agglomeration is briefly sonicated and 10 .mu.l are deposited on macrocarriers and the ethanol allowed to evaporate. The macrocarrier is accelerated onto a stainless-steel stopping screen by the rupture of a polymer diaphragm (rupture disk). Rupture is effected by pressurized helium. Depending on the rupture disk breaking pressure, the velocity of particle-DNA acceleration may be varied. Rupture disk pressures of 200 to 1800 psi are commonly used, with those of 650 to 1100 psi being more preferred, and about 900 psi being most highly preferred. Rupture disk breaking pressures are additive so multiple disks may be used to effect a range of rupture pressures.

[0141] Preferably, the shelf containing the plate with embryos is 5.1 cm below the bottom of the macrocarrier plafform (shelf #3), but may be located at other distances. To effect particle bombardment of cultured immature embryos, a rupture disk and a macrocarrier with dried particle-DNA agglomerates are installed in the device. The He pressure delivered to the device is adjusted to 200 psi above the rupture disk breaking pressure. A petri dish with the target embryos is placed into the vacuum chamber and located in the projected path of accelerated particles. A vacuum is created in the chamber, preferably about 28 inches Hg. After operation of the device, the vacuum is released and the petri dish is removed.

[0142] Bombarded embryos remain on the osmotically adjusted medium during bombardment, and preferably for two days subsequently, although the embryos may remain on this medium for 1 to 4 days. The embryos are transferred to selection medium comprised of N6 basal salts, Eriksson vitamins, 0.5 mg/l thiamine HCl, 30 gm/l sucrose, 1 mg/l 2,4-dichlorophenoxyacetic acid, 2 gm/l Gelrite, 0.85 mg/l AgNO.sub.3 and 3 mg/l bialaphos. Bialaphos is added filter-sterilized. The embryos are subcultured to fresh selection medium at 10 to 14 day intervals. After about 7 weeks, embryogenic tissue, putatively transgenic for both selectable and unselected marker genes, is seen to proliferate from about 7% of the bombarded embryos. Putative transgenic tissue is rescued, and that tissue derived from individual embryos is considered to be an event and is propagated independently on selection medium. Two cycles of clonal propagation is achieved by visual selection for the smallest contiguous fragments of organized embryogenic tissue.

[0143] For regeneration of transgenic plants, embryogenic tissue is subcultured to medium comprised of MS salts and vitamins (Murashige, T. and F. Skoog, "A revised medium for rapid growth and bio assays with tobacco tissue cultures"; Physiologia Plantarum; Vol. 15; pp. 473-497; 1962; incorporated herein in its entirety by reference), 100 mg/l myo-inositol, 60 gm/l sucrose, 3 gm/l Gelrite, 0.5 mg/l zeatin, 1 mg/l indole-3-acetic acid, 26.4 ng/l cis-trans-abscissic acid, and 3 mg/l bialaphos in 100.times.25 mm petri dishes and incubated in darkness at 28.degree. C. until the development of well-formed, matured somatic embryos can be visualized. This requires about 14 days.

[0144] Well-formed somatic embryos are opaque and cream-colored, and are comprised of an identifiable scutellum and coleoptile. The embryos are individually subcultured to germination medium comprised of MS salts and vitamins, 100 mg/l myo-inositol, 40 gm/l sucrose and 1.5 gm/l Gelrite in 100.times.25 mm petri dishes and incubated under a 16 hr light: 8 hr dark photoperiod and 40.mu. Einsteinsm.sup.-2 sec.sup.-1 from cool-white fluorescent tubes. After about 7 days, the somatic embryos have germinated and produced a well-defined shoot and root. The individual plants are subcultured to germination medium in 125.times.25 mm glass tubes to allow further plant development. The plants are maintained under a 16 hr light: 8 hr dark photoperiod and 40.mu. Einsteinsm.sup.-2 sec.sup.-1 from cool-white fluorescent tubes.

[0145] After about 7 days, the plants are well-established and are transplanted to horticultural soil, hardened off, and potted into commercial greenhouse soil mixture and grown to sexual maturity in a greenhouse. An elite inbred line is used as a male to pollinate regenerated transgenic plants.

Preparation of Particles

[0146] Fifteen mg of tungsten particles (General Electric) , 0.5 to 1.8 .mu.m, preferably 1 to 1.8 .mu.m, and most preferably 1 .mu.m, are added to 2 ml of concentrated nitric acid. This suspension is sonicated at 0.degree. C. for 20 min (Branson Sonifier Model 450, 40% output, constant duty cycle). Tungsten particles are pelleted by centrifugation at 10,000 rpm (Biofuge) for 1 min and the supernatant is removed. Two ml of sterile distilled water is added to the pellet and sonicate briefly to resuspend the particles. The suspension is pelleted, 1 ml of absolute ethanol is added to the pellet and sonicated briefly to resuspend the particles. Rinse, pellet, and resuspend the particles a further 2 times with sterile distilled water, and finally resuspend the particles in 2 ml of sterile distilled water. The particles are subdivided into 250 .mu.l aliquots and stored frozen.

Preparation of Particle-Plasmid DNA Association

[0147] The stock of tungsten particles is sonicated briefly in a water bath sonicator (Branson Sonifier Model 450, 20% output, constant duty cycle) and 50 .mu.l is transferred to a microfuge tube. Plasmid DNA is added to the particles for a final DNA amount of 0.1 to 10 .mu.g in 10 .mu.l total volume, and briefly sonicated. Preferably 1 .mu.g total DNA is used. Specifically, 5 .mu.l of PHP8001 (gz::HT12::gz) and 5 .mu.l of PHP3528 (enhanced CAMV::Bar::PinII), at 0.1 .mu.g/.mu.l in TE buffer, are added to the particle suspension. Fifty .mu.l of sterile aqueous 2.5 M CaCl.sub.2 are added, and the mixture is briefly sonicated and vortexed. Twenty .mu.l of sterile aqueous 0.1M spermidine are added and the mixture is briefly sonicated and vortexed. The mixture is incubated at room temperature for 20 min with intermittent brief sonication. The particle suspension is centrifuged, and the supernatant is removed. Two hundred fifty .mu.l of absolute ethanol is added to the pellet and briefly sonicated. The suspension is pelleted, the supernatant is removed, and 60 .mu.l of absolute ethanol is added. The suspension is sonicated briefly before loading the particle-DNA agglomeration onto macrocarriers.

Example 4

Analysis of Seed from Transgenic Plants for Recombinant Polypeptides having an Elevated Level of a Preselected Amino Acid.

Preparation of Meals from Corn Seed

[0148] Pooled or individual dry seed harvested from transformed plants from the greenhouse or the field are prepared in one of the following ways: [0149] A. Seed is imbibed in sterile water overnight (16-20 hr) at 4.degree. C. The imbibed seed is dissected into embryo, endosperm and pericarp. The embryos and endosperm are separately frozen in liquid N.sub.2, the pericarps are discarded. Frozen tissue is ground with a liquid N.sub.2 chilled ceramic mortar and pestle to a fine meal. The meals are dried under vacuum and stored at -20.degree. C. or -80.degree. C. [0150] B. Dry whole seed is ground to a fine meal with a ball mill (Klecko), or by hand with a ceramic mortar and pestle. For analysis of endosperm only, the embryos are removed with a drill and discarded. The remaining endosperm with pericarp is ground with a ball mill or a mortar and pestle. ELISA Analysis

[0151] Rabbit polyclonal anti HT12 antisera are produced with synthetic HT12 (See Rao et al. supra) at Bethyl laboratories. An HT12 ELISA assay is developed and performed by the Analytical Biochemistry department of Pioneer Hi-Bred International, Inc., essentially as described by Harlow and Lane, Antibodies, A Laboratory Manual, Cold Springs Harbor Publication, New York (1988). Quantitative ELISA assays are first performed on pooled meals to identify positive events. Positive events are further analyzed by quantitative ELISA on individual kernels to determine the relative level of HT12 expression and transgene segregation ratio. Among 97 events tested, 59 show HT12 expression levels >1000 ppm. The highest events have HT12 expression levels at 2-5% of the total seed protein. Typical results for HT12 levels for whole kernels of wild type corn, for one event (TC2031) of corn transformed with the gz::HT12::gz chimeric gene, expressing HT12 in the endosperm, for one event (TC320) of corn transformed with the wx::HT12::wx chimeric gene, expressing HT12 in the endosperm, and for one event (TC2027) of corn transformed with the glb1::HT12::glb1 chimeric gene, expressing HT12 in the embryo, are in Table 1.

[0152] Similarly, antisera are produced, ELISA assays are developed and assays of seed from transformed plants are performed for other derivatives of hordothionine (See Rao et al., 1994, Protein Engineering 7(12):1485-1493, and WO 94/16078 published Jul. 21, 1994), for the enhanced soybean albumin (ESA) (See U.S. Ser. No. 08/618,911) and for BHL and other derivatives of the barley chymotrypsin inhibitor (See U.S. Ser. No. 08/740,682 filed Nov. 1, 1996 and PCT/US97/20441 filed Oct. 31, 1997), respectively.

Polyacrylamide Gel and Immuno Blot Analysis

[0153] SDS extracts of meals, molecular weight markers, and a synthetic HT12 positive control (see Rao et al. supra) are separated on 16.5% or 8-22% polyacrylamide gradient Tris-Tricine gels (Schagger, H. and Von Jagow, G., 1987, Anal. Biochem., 166:368). For immuno blot analysis, gels are transferred to PVDF membranes in 100 mM CAPS, pH 11; 10% methanol using a semidry blotter (Hoefer, San Francisco, Calif.). After transfer the membrane is blocked in BLOTTO (4% dry milk in Tris-buffered saline, pH 7.5) (Johnson, D. A., Gausch, J. W., Sportsman, J. R., and Elder, J. H. 1984, Gene Anal. Techn. 1:3). The blots are incubated with rabbit anti-HT12 (same as used for ELISA) diluted 1:2000 to 1:7500 in BLOTTO 2 hr at room temperature (22.degree. C.) or overnight at 4.degree. C. Blots are washed 4-5.times. with BLOTTO, then incubated 1-2 hr with horseradish peroxidase-goat anti-rabbit IgG (Promega, Madison, Wis.) diluted 1:7500 to 1:15000 in BLOTTO. After secondary antibody, the blots are washed 3.times. with BLOTTO followed by 2 washes with Tris-buffered saline, pH 7.5. Blots are briefly incubated with enhanced chemiluminescence (ECL, Amersham, Arlington Heights, Ill.) substrate, and wrapped in plastic wrap. Reactive bands are visualized after exposure to x-ray film (Kodak Biomax MR) after short exposure times ranging from 5-120 sec.

[0154] HT12 transgenic seed shows a distinctive band not seen in wild type seed at the correct molecular weight and position as judged by the HT12 positive control standard and molecular weight markers. These results indicate that the expressed HT12 prepropeptide is being correctly processed like native HT in barley. Novel polypeptide bands co-migrating with the HT12 positive control are also observed in Coomassie stained polyacrylamide gels loaded with 10 mg total extracted protein indicating substantial expression and accumulation of HT12 protein in the seed.

[0155] Similarly, other derivatives of hordothionin, soybean albumin, the enhanced soybean albumin (ESA), BHL and other derivatives of the barley chymotrypsin inhibitor are detected by polyacrylamide gel and immuno blot analysis.

Amino Acid Composition Analysis

[0156] Meals from seed, endosperm or embryo that express a recombinant polypeptide having an elevated level of a preselected amino acid are sent to the University of Iowa Protein Structure Facility for amino acid composition analysis using standard protocols for digestion and analysis.

[0157] Typical results for the amino acid composition of whole kernels of wild type corn, for one event (TC2031) of corn transformed with the gz::HT12::gz chimeric gene, expressing HT12 in the endosperm, for one event (TC320) of corn transformed with the wx::HT12::wx chimeric gene, expressing HT12 in the endosperm, and for one event (TC2027) of corn transformed with the glb1::HT12::glb1 chimeric gene, expressing HT12 in the embryo, are in Table 1. TABLE-US-00001 TABLE 1 HT12 ELISA analysis and amino acid composition of meal from whole kernels from wild type corn and from transformed corn expressing recombinant HT12. transgene none wx::HT12::wx gz::HT12::gz glb1::HT12::glb1 event wild-type TC320 TC2031 TC2027 ELISA HT12 protein protein protein protein ppm 0.00 ppm 6200 ppm 8000 ppm 22600 Meal % Meal % Meal % Meal % AA n = 3 n = 2 n = 3 n = 4 Lys 0.29 0.38 0.39 0.24 Arg 0.52 0.58 0.56 0.45 Cys 0.12 0.19 0.17 0.22

[0158] The results in Table 1 demonstrate corn expressing recombinant HT12 in the endosperm shows a significant increase of the preselected amino acid lysine. TABLE-US-00002 TABLE 2 Sequence Information SEQUENCE ID PROMOTER GENE Seq. 1: pBSKP-HT None 3361-2947 Seq. 2: pBSKP-HT12 None 3361-2947 Seq. 3: PHP8001 gz::HT12::gz 676-2198 2199-2612 expression vector Seq. 4: PHP7999 glb1::HT12::glb1 3271-1834 1834-1420 expression vector Seq. 5: PHP5025 wx::HT::wx 43-1342 1343-1757 expression vector Seq. 6: PHP 11260 gz::ESA::gz 676-2198 2199-2675 expression vector Seq. 7: PHP11427 gz::BHL::gz 676-2198 2199-2450

[0159] The invention is not limited to the exact details shown and described, for it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention defined by the claims.

Sequence CWU 1

1

22 1 3363 DNA Artificial Sequence pBSKP vector with native alpha hordothionin sequence from Hordeum vulgare located from nucleotide 3361 to nucleotide 2947. 1 tcgacctcga gggggggccc ggtacccagc ttttgttccc tttagtgagg gttaattgcg 60 cgcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt 120 ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc 180 taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc 240 cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct 300 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 360 gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 420 atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 480 ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 540 cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 600 tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 660 gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 720 aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 780 tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 840 aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 900 aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 960 ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 1020 ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 1080 atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 1140 atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa 1200 tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag 1260 gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg 1320 tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga 1380 gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag 1440 cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa 1500 gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc 1560 atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca 1620 aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg 1680 atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat 1740 aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc 1800 aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg 1860 gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg 1920 gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt 1980 gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca 2040 ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata 2100 ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac 2160 atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa 2220 gtgccaccta aattgtaagc gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa 2280 tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat 2340 agaccgagat agggttgagt gttgttccag tttggaacaa gagtccacta ttaaagaacg 2400 tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac 2460 catcacccta atcaagtttt ttggggtcga ggtgccgtaa agcactaaat cggaacccta 2520 aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg agaaaggaag 2580 ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg 2640 taaccaccac acccgccgcg cttaatgcgc cgctacaggg cgcgtcccat tcgccattca 2700 ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc ttcgctatta cgccagctgg 2760 cgaaaggggg atgtgctgca aggcgattaa gttgggtaac gccagggttt tcccagtcac 2820 gacgttgtaa aacgacggcc agtgagcgcg cgtaatacga ctcactatag ggcgaattgg 2880 agctccaccg cggtggcggc cgctctagaa ctagtggatc cgtcgactag agggcccgac 2940 gtcgaactta ggcactaagg gatgtgaggc cagcatcacc gttgcagaaa ttgacacaag 3000 catcaccaca attttccaaa tagagtttca tttcttcgtc gtcagcagct gcgttgacca 3060 tgtagtcaca catggaagcc ctacacccca agttgcaata cttgacggtg tctggttcat 3120 ctgagttgga cacaagggcc aatttgggga agcctgtagg gcattttccg ctacttgtga 3180 gtttacacct acagacgcct gcgcataact tctgagcacc acggacgcgg caaaggttgt 3240 agcagtttct tcctagggtg ctcctgcagc aactcttgcc ttctacttgc acctgttcga 3300 gaaccaaccc cagtataagt aaacacacca tcacaccctt gaggcccttg ctggtggcca 3360 tgg 3363 2 3365 DNA Artificial Sequence pBSKP vector with a modified gene based on Hordeum vulgare located from nucleotide 3361 to nucleotide 2947. 2 tcgacctcga gggggggccc ggtacccagc ttttgttccc tttagtgagg gttaattgcg 60 cgcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt 120 ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc 180 taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc 240 cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct 300 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 360 gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 420 atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 480 ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 540 cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 600 tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 660 gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 720 aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 780 tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 840 aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 900 aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 960 ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 1020 ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 1080 atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 1140 atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa 1200 tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag 1260 gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg 1320 tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga 1380 gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag 1440 cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa 1500 gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc 1560 atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca 1620 aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg 1680 atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat 1740 aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc 1800 aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg 1860 gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg 1920 gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt 1980 gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca 2040 ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata 2100 ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac 2160 atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa 2220 gtgccaccta aattgtaagc gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa 2280 tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat 2340 agaccgagat agggttgagt gttgttccag tttggaacaa gagtccacta ttaaagaacg 2400 tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac 2460 catcacccta atcaagtttt ttggggtcga ggtgccgtaa agcactaaat cggaacccta 2520 aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg agaaaggaag 2580 ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg 2640 taaccaccac acccgccgcg cttaatgcgc cgctacaggg cgcgtcccat tcgccattca 2700 ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc ttcgctatta cgccagctgg 2760 cgaaaggggg atgtgctgca aggcgattaa gttgggtaac gccagggttt tcccagtcac 2820 gacgttgtaa aacgacggcc agtgagcgcg cgtaatacga ctcactatag ggcgaattgg 2880 agctccaccg cggtggcggc cgctctagaa ctagtggatc cgtcgactag agggcccgac 2940 gtcgaactta ggcactaagg gatgtgaggc cagcatcacc gttgcagaaa ttgacacaag 3000 catcaccaca attttccaaa tagagtttca tttcttcgtc gtcagcagct gcgttgacca 3060 tgtagtcaca catggaagcc ctacacccca agttgcaata cttgacggtg tctggttcat 3120 ctgagttgga cacaagggcc aatttgggga agcctttcgg gcattttccg ctactagtca 3180 gcttacactt gcagacgcct gcgcaaagct tcttggcgcc tttgactttg caaaggttgt 3240 agcacttcct tcccagggta ctcttgcagc aactcttgcc ttctacttgc acctgttcga 3300 gaaccaaccc cagtataagt aaacacacca tcacaccctt gaggcccttg ctggtggcca 3360 tggtg 3365 3 5360 DNA Artificial Sequence Modified gene based on Hordeum vulgare from nucleotide 2199 to nucleotide 2612 in Zea mays expression vector. Zea mays promoter from nucleotide 676 to nucleotide 2198. 3 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat tggagctcca 660 ccgcggtggc ggccgctcta gattatataa tttataagct aaacaacccg gccctaaagc 720 actatcgtat cacctatcta aataagtcac gggagtttcg aacgtccact tcgtcgcacg 780 gaattgcatg tttcttgttg gaagcatatt cacgcaatct ccacacataa aggtttatgt 840 ataaacttac atttagctca gtttaattac agtcttattt ggatgcatat gtatggttct 900 caatccatat aagttagagt aaaaaataag tttaaatttt atcttaattc actccaacat 960 atatggatct acaatactca tgtgcatcca aacaaactac ttatattgag gtgaatttgg 1020 tagaaattaa actaacttac acactaagcc aatctttact atattaaagc accagtttca 1080 acgatcgtcc cgcgtcaata ttattaaaaa actcctacat ttctttataa tcaacccgca 1140 ctcttataat ctcttctcta ctactataat aagagagttt atgtacaaaa taaggtgaaa 1200 ttatctataa gtgttctgga tattggttgt tggctcccat attcacacaa cctaatcaat 1260 agaaaacata tgttttatta aaacaaaatt tatcatatat catatatata tatatatcat 1320 atatatatat aaaccgtagc aatgcacggg catataacta gtgcaactta atacatgtgt 1380 gtattaagat gaataagagg gtatccaaat aaaaaacttg ttgcttacgt atggatcgaa 1440 aggggttgga aacgattaaa cgattaaatc tcttcctagt caaaattgaa tagaaggaga 1500 tttaatatat cccaatcccc ttcgatcatc caggtgcaac cgtataagtc ctaaagtggt 1560 gaggaacacg aaagaaccat gcattggcat gtaaagctcc aagaatttgt tgtatcctta 1620 acaactcaca gaacatcaac caaaattgca cgtcaagggt attgggtaag aaacaatcaa 1680 acaaatcctc tctgtgtgca aagaaacacg gtgagtcatg ccgagatcat actcatctga 1740 tatacatgct tacagctcac aagacattac aaacaactca tattgcatta caaagatcgt 1800 ttcatgaaaa ataaaatagg ccggacagga caaaaatcct tgacgtgtaa agtaaattta 1860 caacaaaaaa aaagccatat gtcaagctaa atctaattcg ttttacgtag atcaacaacc 1920 tgtagaaggc aacaaaactg agccacgcag aagtacagaa tgattccaga tgaaccatcg 1980 acgtgctacg taaagagagt gacgagtcat atacatttgg caagaaacca tgaagctgcc 2040 tacagccgtc tcggtggcat aagaacacaa gaaattgtgt taattaatca aagctataaa 2100 taacgctcgc atgcctgtgc acttctccat caccaccact gggtcttcag accattagct 2160 ttatctactc cagagcgcag aagaacccga tcgacaccat ggccaccagc aagggcctca 2220 agggtgtgat ggtgtgttta cttatactgg ggttggttct cgaacaggtg caagtagaag 2280 gcaagagttg ctgcaagagt accctgggaa ggaagtgcta caacctttgc aaagtcaaag 2340 gcgccaagaa gctttgcgca ggcgtctgca agtgtaagct gactagtagc ggaaaatgcc 2400 cgaaaggctt ccccaaattg gcccttgtgt ccaactcaga tgaaccagac accgtcaagt 2460 attgcaactt ggggtgtagg gcttccatgt gtgactacat ggtcaacgca gctgctgacg 2520 acgaagaaat gaaactctat ttggaaaatt gtggtgatgc ttgtgtcaat ttctgcaacg 2580 gtgatgctgg cctcacatcc cttagtgcct aagttcgacg tcgggccctc tagtcgacgg 2640 atccccggcg gtgtccccca ctgaagaaac tatgtgctgt agtatagccg ctgcccgctg 2700 gctagctagc tagttgagtc atttagcggc gatgattgag taataatgtg tcacgcatca 2760 ccatgcatgg gtggcagtgt cagtgtgagc aatgacctga atgaacaatt gaaatgaaaa 2820 gaaaaaagta ttgttccaaa ttaaacgttt taacctttta ataggtttat acaataattg 2880 atatatgttt tctgtatatg tctaatttgt tatcatccat ttagatatag acaaaaaaaa 2940 atctaagaac taaaacaaat gctaatttga aatgaaggga gtatatattg ggataatgtc 3000 gatgagatcc ctcgtaatat caccgacatc acacgtgtcc agttaatgta tcagtgatac 3060 gtgtattcac atttgttgcg cgtaggcgta cccaacaatt ttgatcgact atcagaaagt 3120 caacggaagc gagtcgacct cgaggggggg cccggtaccc agcttttgtt ccctttagtg 3180 agggttaatt gcgcgcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta 3240 tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc 3300 ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg 3360 aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg 3420 tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 3480 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 3540 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 3600 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 3660 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 3720 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 3780 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 3840 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 3900 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 3960 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 4020 gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 4080 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 4140 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 4200 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 4260 agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 4320 atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg 4380 cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg 4440 actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc 4500 aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc 4560 cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa 4620 ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc 4680 cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg 4740 ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc 4800 cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat 4860 ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg 4920 tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc 4980 ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg 5040 aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat 5100 gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg 5160 gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg 5220 ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct 5280 catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac 5340 atttccccga aaagtgccac 5360 4 5511 DNA Artificial Sequence Modified gene based on Hordeum vulgare from nucleotide 1834 to nucleotide 1420 in Zea mays expression vector. Zea mays promoter from nucleotide 3271 to nucleotide 1834. 4 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cttttatgaa taataataat 420 gcatatctgt gcattactac ctgggataca agggcttctc cgccataaca aattgagttg 480 cgatgctgag aacgaacggg gaagaaagta agcgccgccc aaaaaaaacg aacatgtacg 540 tcggctatag caggtgaaag ttcgtgcgcc aatgaaaagg gaacgatatg cgttgggtag 600 ttgggatact taaatttgga gagtttgttg catacactaa tccactaaag ttgtctatct 660 ttttaacagc tctaggcagg atataagatt tatatctaat ctgttggagt tgcttttaga 720 gtaacttttc tctctgtttc gtttatagcc gattagcaca aaattaaact aggtgacgag 780 aaataaagaa aaacggaggc agtaaaaaat acccaaaaaa atacttggag atttttgtct 840 caaaattatc ttctaatttt aaaagctaca tattaaaaat actatatatt aaaaatactt 900 cgagatcatt gcttgggatg ggcagggcca atagctaatt gctaaggatg ggctatattt 960 atgtatcgtc tgaaacatgt aggggctaat agttagatga ctaatttgct gtgttcgtac 1020 ggggtgctgt ttgagcctag cgatgaaggg tcatagtttc atacaagaac tcacttttgg 1080 ttcgtctgct gtgtctgttc tcagcgtaac ggcatcaatg gatgccaaac tccgcaaggg 1140 gacaaatgaa gaagcgaaga gattatagaa cacgcacgtg tcattattta tttatggact 1200 tgcctcagta gcttacagca tcgtacccgc acgtacatac tacagagcca cacttattgc 1260 actgcctgcc gcttacgtac atagttaaca cgcagagagg tatatacata cacgtccaac 1320 gtctccactc aggctcatgc tacgtacgca cgtcggtcgc gcgccaccct ctcgttgctt 1380 cctgctcgtt ttggcgagct agagggcccg acgtcgaact taggcactaa gggatgtgag 1440 gccagcatca ccgttgcaga aattgacaca agcatcacca caattttcca aatagagttt 1500 catttcttcg tcgtcagcag ctgcgttgac catgtagtca cacatggaag ccctacaccc 1560 caagttgcaa tacttgacgg tgtctggttc atctgagttg gacacaaggg ccaatttggg 1620 gaagcctttc gggcattttc cgctactagt cagcttacac ttgcagacgc ctgcgcaaag 1680 cttcttggcg cctttgactt tgcaaaggtt gtagcacttc cttcccaggg tactcttgca 1740 gcaactcttg ccttctactt gcacctgttc gagaaccaac cccagtataa gtaaacacac 1800 catcacaccc ttgaggccct tgctggtggc catggtgtag tgtcgactgt gatatcctcg 1860 ggtgtgtgtt ggatccttgg gttggctgta tgcagaacta aagcggaggt ggcgcgcatt 1920 tataccagcg ccgggccctg gtacgtggcg cggccgcgcg gctacgtgga ggaaggctgc 1980 gtggcagcag acacacgggt cgccacgtcc cgccgtactc tccttaccgt gcttatccgg 2040 gctccggctc ggtgcacgcc agggtgtggc cgcctctgag cagactttgt cgtgttccac 2100 agtggtgtcg tgttccgggg actccgatcc gcggcgagcg accgagcgtg taaaagagtt 2160 cctactaggt

acgttcattg tatctggacg acgggcagcg gacaatttgc tgtaagagag 2220 gggcagtttt tttttagaaa aacagagaat tccgttgagc taattgtaat tcaacaaata 2280 agctattagt tggttttagc ttagattaaa gaagctaacg actaatagct aataattagt 2340 tggtctatta gttgactcat tttaaggccc tgtttcaatc tcgcgagata aactttagca 2400 gctatttttt agctactttt agccatttgt aatctaaaca ggagagctaa tggtggtaat 2460 tgaaactaaa ctttagcact tcaattcata tagctaaagt ttagcaggaa gctaaacttt 2520 atcccgtgag attgaaacgg ggcctaaatc tctcagctat ttttgatgca aattactgtc 2580 actactggaa tcgagcgctt tgccgagtgt caaagcctga aaaacactcc gtaaagactt 2640 tgcctagtgt gacactcgac aaagagatct cgacgaacag tacatcgaca acggcttctt 2700 tgtcgagtac tttttatcgg acacttgaca aagtctttgt cgagtgaact acattgaaac 2760 tctatgattt tatgtgtagg tcacttaggt ttctacacat agtacgtcac aactttaccg 2820 aaacattatc aaatttttat cacaacctct atatatgata tcatgacatg tggacaagtt 2880 tcattaattt ctgactttat ttgtgtttta tacaattttt aaacaactag ataacaagtt 2940 cacggtcatg tttagtgagc atggtgcttg aagattctgg tctgcttctg aaatcggtcg 3000 taacttgtgc tagataacat gcatatcatt tattttgcat gcacggtttt ccatgtttcg 3060 agtgacttgc agtttaaatg tgaattttcc gaagaaattc aaataaacga actaaatcta 3120 atatttatag aaaacatttt tgtaaatatg taattgtgcc aaaatggtac atgtagatct 3180 acatagtgta ggaacatacc acaaaaagtt tggttggcaa aataaaaaaa ataaaatata 3240 ctttatcgag tgtccaagga tggcactcgg caagcttggc gtaatcatgg tcatagctgt 3300 ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 3360 agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac 3420 tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 3480 cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 3540 gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 3600 ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 3660 ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 3720 atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 3780 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 3840 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcaatgc tcacgctgta 3900 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 3960 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 4020 acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 4080 gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 4140 ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 4200 ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 4260 gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 4320 ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 4380 agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 4440 ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 4500 gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 4560 catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 4620 cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 4680 cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 4740 gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 4800 tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 4860 gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 4920 tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 4980 gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 5040 gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 5100 taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 5160 tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 5220 ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 5280 taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 5340 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 5400 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta 5460 ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt c 5511 5 5115 DNA Artificial Sequence Gene from Hordeum vulgare from nucleotide 1343 to nucleotide 1757 in Zea mays expression vector. Zea mays promoter from nucleotide 43 to nucleotide 1342. 5 gttgggagct ctcccatatg gtcgacctgc aggcggccgc tctagaacta gtggatcccc 60 ccctcgaggt cgacggtatc gataagcttg atatcttaca aggcccagcc cagcgaccta 120 ttacacagcc cgctcgggcc cgcgacgtcg ggacacatct tcttccccct tttggtgaag 180 ctctgctcgc agctgtccgg ctccttggac gttcgtgtgg cagattcatc tgttgtctcg 240 tctcctgtgc ttcctgggta gcttgtgtag tggagctgac atggtctgag caggcttaaa 300 atttgctcgt agacgaggag taccagcaca gcacgttgcg gatttctctg cctgtgaagt 360 gcaacgtcta ggattgtcac acgccttggt cgcgtcgcgt cgcgtcgcgt cgatgcggtg 420 gtgagcagag cagcaacagc tgggcggccc aacgttggct tccgtgtctt cgtcgtacgt 480 acgcgcgcgc cggggacacg cagcagagag cggagagcga gccgtgcacg gggaggtggt 540 gtggaagtgg agccgcgcgc ccggccgccc gcgcccggtg ggcaacccaa aagtacccac 600 gacaagcgaa ggcgccaaag cgatccaagc tccggaacgc aacagcatgc gtcgcgtcgg 660 agagccagcc acaagcagcc gagaaccgaa ccggtgggcg acgcgtcatg ggacggacgc 720 gggcgacgct tccaaacggg ccacgtacgc cggcgtgtgc gtgcgtgcag acgacaagcc 780 aaggcgaggc agcccccgat cgggaaagcg ttttgggcgc gagcgctggc gtgcgggtca 840 gtcgctggtg cgcagtgccg gggggaacgg gtatcgtggg gggcgcgggc ggaggagagc 900 gtggcgaggg ccgagagcag cgcgcggccg ggtcacgcaa cgcgccccac gtactgccct 960 ccccctccgc gcgcgctaga aataccgagg cctggaccgg gggggggccc cgtcacatcc 1020 atccatcgac cgatcgatcg ccacagccaa caccacccgc cgaggcgacg cgacagccgc 1080 caggaggaag gaataaactc actgccagcc agtgaagggg gagaagtgta ctgctccgtc 1140 gaccagtgcg cgcaccgccc ggcagggctg ctcatctcgt cgacgaccag gttctgttcc 1200 gatccgatcc gatcctgtcc ttgagtttcg tccagatcct ggcgcgtatc tgcgtgtttg 1260 atgatccagg ttcttcgaac ctaaatctgt ccgtgcacac gtcttttctc tctctcctac 1320 gcagtggatt aatcgccatg gccaccagca agggcctcaa gggtgtgatg gtgtgtttac 1380 ttatactggg gttggttctc gaacaggtgc aagtagaagg caagagttgc tgcaagagta 1440 ccctgggaag gaagtgctac aacctttgca aagtcaaagg cgccaagaag ctttgcgcag 1500 gcgtctgcaa gtgtaagctg actagtagcg gaaaatgccc gaaaggcttc cccaaattgg 1560 cccttgtgtc caactcagat gaaccagaca ccgtcaagta ttgcaacttg gggtgtaggg 1620 cttccatgtg tgactacatg gtcaacgcag ctgctgacga cgaagaaatg aaactctatt 1680 tggaaaattg tggtgatgct tgtgtcaatt tctgcaacgg tgatgctggc ctcacatccc 1740 ttagtgccta agttcgacgt cgggccctct agatgcggcc cgggtgaaga gttcgccctg 1800 cagggcccct gatctcgcgc gtggtgcaaa gatgttggga catcttctta tatatgctgt 1860 ttcgcttatg tgatatggac aagtatgtgt agatgcttgc ttgtgctagt gtaatgtagt 1920 gtagtggtgg ccagtggcac aacctaataa gcgcatgaac taattgcttg cgtgtgtagt 1980 taagtaccga tcggtaattt tatattgcga gtaaataaat ggacctgtag tggtggagta 2040 aataatccct gctgttcggt gttcttatcg ctcctcgtat agatattata tagagtacat 2100 ttttctctct ctgaatccta cgtgtgtgaa atttctatat cattactgta aaatttctgc 2160 gttccaaaag agaccatagc ctatctttgg ccctgtttgt ttcggcttct ggcagcttct 2220 ggccaccaaa agctgctgcg gactgccaaa cgctcagatt ttcagctagc ttctataaaa 2280 ttagttgggg caaaaaccat ccaaaatcaa tataaacaca taatcggttg agtcgttgta 2340 atattaggaa tctgtcactt tctagatcct gagccctatg aacaacttta tctttctcca 2400 tacgtaatcg taatgatact cagattctct ccacagccag attctcctca cagccagatt 2460 ttcagaaaag ctggtcagaa aaaagttaaa ccaaacagac cctttgtgta tgcatggatc 2520 ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt tagagcttta 2580 cggcacctcg accgcaaaaa acttgatttg ggtgatggtt cacgtagtgg gccatcgccc 2640 tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg 2700 ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt 2760 ttgccgattt cggcctattg gttaaaaaat gagctgattt aacaaatatt taacgcgaat 2820 tttaacaaaa tattaacgtt tacaatttcg cctgatgcgg tattttctcc ttacgcatct 2880 gtgcggtatt tcacaccgca tacaggtggc acttttcggg gaaatgtgcg cggaacccct 2940 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 3000 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 3060 cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 3120 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 3180 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 3240 tttaaagttc tgctatgtca tacactatta tcccgtattg acgccgggca agagcaactc 3300 ggtcgccggg cgcggtattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 3360 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 3420 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 3480 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 3540 gccataccaa acgacgagcg tgacaccacg atgcctgtag caatgccaac aacgttgcgc 3600 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 3660 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 3720 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 3780 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 3840 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 3900 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 3960 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 4020 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 4080 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 4140 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 4200 ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 4260 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 4320 tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 4380 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 4440 tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg 4500 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 4560 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 4620 tgatgctcgt caggggggcg gagcctatcg aaaaacgcca gcaacgcggc ctttttacgg 4680 ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 4740 gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 4800 gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc 4860 cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg 4920 ggcagtgagc gcaacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta 4980 cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca 5040 ggaaacagct atgaccatga ttacgccaag ctatttaggt gacactatag aatactcaag 5100 ctatgcatcc aacgc 5115 6 5392 DNA Artificial Sequence Gene from Glycine max from nucleotide 2199 to nucleotide 2675 in Zea mays expression vector. Zea mays promoter from nucleotide 676 to nucleotide 2198. 6 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat tggagctcca 660 ccgcggtggc ggccgctcta gattatataa tttataagct aaacaacccg gccctaaagc 720 actatcgtat cacctatcta aataagtcac gggagtttcg aacgtccact tcgtcgcacg 780 gaattgcatg tttcttgttg gaagcatatt cacgcaatct ccacacataa aggtttatgt 840 ataaacttac atttagctca gtttaattac agtcttattt ggatgcatat gtatggttct 900 caatccatat aagttagagt aaaaaataag tttaaatttt atcttaattc actccaacat 960 atatggatct acaatactca tgtgcatcca aacaaactac ttatattgag gtgaatttgg 1020 tagaaattaa actaacttac acactaagcc aatctttact atattaaagc accagtttca 1080 acgatcgtcc cgcgtcaata ttattaaaaa actcctacat ttctttataa tcaacccgca 1140 ctcttataat ctcttctcta ctactataat aagagagttt atgtacaaaa taaggtgaaa 1200 ttatctataa gtgttctgga tattggttgt tggctcccat attcacacaa cctaatcaat 1260 agaaaacata tgttttatta aaacaaaatt tatcatatat catatatata tatatatcat 1320 atatatatat aaaccgtagc aatgcacggg catataacta gtgcaactta atacatgtgt 1380 gtattaagat gaataagagg gtatccaaat aaaaaacttg ttgcttacgt atggatcgaa 1440 aggggttgga aacgattaaa cgattaaatc tcttcctagt caaaattgaa tagaaggaga 1500 tttaatatat cccaatcccc ttcgatcatc caggtgcaac cgtataagtc ctaaagtggt 1560 gaggaacacg aaagaaccat gcattggcat gtaaagctcc aagaatttgt tgtatcctta 1620 acaactcaca gaacatcaac caaaattgca cgtcaagggt attgggtaag aaacaatcaa 1680 acaaatcctc tctgtgtgca aagaaacacg gtgagtcatg ccgagatcat actcatctga 1740 tatacatgct tacagctcac aagacattac aaacaactca tattgcatta caaagatcgt 1800 ttcatgaaaa ataaaatagg ccggacagga caaaaatcct tgacgtgtaa agtaaattta 1860 caacaaaaaa aaagccatat gtcaagctaa atctaattcg ttttacgtag atcaacaacc 1920 tgtagaaggc aacaaaactg agccacgcag aagtacagaa tgattccaga tgaaccatcg 1980 acgtgctacg taaagagagt gacgagtcat atacatttgg caagaaacca tgaagctgcc 2040 tacagccgta tcggtggcat aagaacacaa gaaattgtgt taattaatca aagctataaa 2100 taacgctcgc atgcctgtgc acttctccat caccaccact gggtcttcag accattagct 2160 ttatctactc cagagcgcag aagaacccga tcgacaccat gaccaagttc acaatcctcc 2220 tcatctctct tctcttctgc atcgcccaca cttgcagcgc ctccaaatgg cagcaccagc 2280 aagatagctg ccgcaagcag cttaaggggg tgaacctcac gccctgcgag aagcacatca 2340 tggagaagat ccaaggccgc ggcgatgacg atgatgatga tgacgacgac aatcacattc 2400 tcaggaccat gcgggggaag aatcactaca tacggaagaa ggaaggaaaa gacgaagacg 2460 aagaagaaga aggacacatg cagaagtgct gcgctttgca ctggcatttg gggctcttaa 2520 gctcgctcat ttctgtgctg cagaagataa tggagaacca gagcgaggaa ctggaggaga 2580 aggagaagaa gaaaatggag aaggagctta tgaacttggc tactatgtgc aggtttgggc 2640 ccatgatcgg gtgcgacttg tcctccgatg actaagttga tccccggcgg tgtcccccac 2700 tgaagaaact atgtgctgta gtatagccgc tggctagcta gctagttgag tcatttagcg 2760 gcgatgattg agtaataatg tgtcacgcat caccatgcat gggtggcagt ctcagtgtga 2820 gcaatgacct gaatgaacaa ttgaaatgaa aagaaaaaag tattgttcca aattaaacgt 2880 tttaaccttt taataggttt atacaataat tgatatatgt tttctgtata tgtctaattt 2940 gttatcatcc atttagatat agacgaaaaa aaatctaaga actaaaacaa atgctaattt 3000 gaaatgaagg gagtatatat tgggataatg tcgatgagat ccctcgtaat atcaccgaca 3060 tcacacgtgt ccagttaatg tatcagtgat acgtgtattc acatttgttg cgcgtaggcg 3120 tacccaacaa ttttgatcga ctatcagaaa gtcaacggaa gcgagtcgac ctcgaggggg 3180 ggcccggtac ccagcttttg ttccctttag tgagggttaa ttgcgcgctt ggcgtaatca 3240 tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga 3300 gccggaagca taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt 3360 gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 3420 atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 3480 actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 3540 gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 3600 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 3660 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 3720 ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 3780 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 3840 agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 3900 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 3960 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 4020 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 4080 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 4140 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 4200 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 4260 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 4320 aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 4380 tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 4440 atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata 4500 cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 4560 gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 4620 gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 4680 tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 4740 tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 4800 tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 4860 aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 4920 atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 4980 tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 5040 catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 5100 aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 5160 tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 5220 gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 5280 tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 5340 tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc ac 5392 7 5173 DNA Artificial Sequence Gene from Hordeum vulgare from nucleotide 2199 to nucleotide 2450 in a Zea mays expression vector. Zea mays promoter from nucleotide 676 to nucleotide 2198. 7 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc gcgcgtaata cgactcacta

tagggcgaat tggagctcca 660 ccgcggtggc ggccgctcta gattatataa tttataagct aaacaacccg gccctaaagc 720 actatcgtat cacctatcta aataagtcac gggagtttcg aacgtccact tcgtcgcacg 780 gaattgcatg tttcttgttg gaagcatatt cacgcaatct ccacacataa aggtttatgt 840 ataaacttac atttagctca gtttaattac agtcttattt ggatgcatat gtatggttct 900 caatccatat aagttagagt aaaaaataag tttaaatttt atcttaattc actccaacat 960 atatggatct acaatactca tgtgcatcca aacaaactac ttatattgag gtgaatttgg 1020 tagaaattaa actaacttac acactaagcc aatctttact atattaaagc accagtttca 1080 acgatcgtcc cgcgtcaata ttattaaaaa actcctacat ttctttataa tcaacccgca 1140 ctcttataat ctcttctcta ctactataat aagagagttt atgtacaaaa taaggtgaaa 1200 ttatctataa gtgttctgga tattggttgt tggctcccat attcacacaa cctaatcaat 1260 agaaaacata tgttttatta aaacaaaatt tatcatatat catatatata tatatatcat 1320 atatatatat aaaccgtagc aatgcacggg catataacta gtgcaactta atacatgtgt 1380 gtattaagat gaataagagg gtatccaaat aaaaaacttg ttgcttacgt atggatcgaa 1440 aggggttgga aacgattaaa cgattaaatc tcttcctagt caaaattgaa tagaaggaga 1500 tttaatatat cccaatcccc ttcgatcatc caggtgcaac cgtataagtc ctaaagtggt 1560 gaggaacacg aaagaaccat gcattggcat gtaaagctcc aagaatttgt tgtatcctta 1620 acaactcaca gaacatcaac caaaattgca cgtcaagggt attgggtaag aaacaatcaa 1680 acaaatcctc tctgtgtgca aagaaacacg gtgagtcatg ccgagatcat actcatctga 1740 tatacatgct tacagctcac aagacattac aaacaactca tattgcatta caaagatcgt 1800 ttcatgaaaa ataaaatagg ccggacagga caaaaatcct tgacgtgtaa agtaaattta 1860 caacaaaaaa aaagccatat gtcaagctaa atctaattcg ttttacgtag atcaacaacc 1920 tgtagaaggc aacaaaactg agccacgcag aagtacagaa tgattccaga tgaaccatcg 1980 acgtgctacg taaagagagt gacgagtcat atacatttgg caagaaacca tgaagctgcc 2040 tacagccgta tcggtggcat aagaacacaa gaaattgtgt taattaatca aagctataaa 2100 taacgctcgc atgcctgtgc acttctccat caccaccact gggtcttcag accattagct 2160 ttatctactc cagagcgcag aagaacccga tcgacaccat gaagtcggtg gagaagaaac 2220 cgaagggtgt gaagacaggt gcgggtgaca agcataagct gaagacagag tggccggagt 2280 tggtggggaa atcggtggag aaagccaaga aggtgatcct gaaggacaag ccagaggcgc 2340 aaatcatagt tctaccggtt ggtacaaagg tgggtaagca ttataagatc gacaaggtca 2400 agctttttgt ggataaaaag gacaacatcg cgcaggtccc cagggtcggc tagcctcgag 2460 atccccggcg gtgtccccca ctgaagaaac tatgtgctgt agtatagccg ctggctagct 2520 agctagttga gtcatttagc ggcgatgatt gagtaataat gtgtcacgca tcaccatgca 2580 tgggtggcag tctcagtgtg agcaatgacc tgaatgaaca attgaaatga aaagaaaaaa 2640 gtattgttcc aaattaaacg ttttaacctt ttaataggtt tatacaataa ttgatatatg 2700 ttttctgtat atgtctaatt tgttatcatc catttagata tagacgaaaa aaaatctaag 2760 aactaaaaca aatgctaatt tgaaatgaag ggagtatata ttgggataat gtcgatgaga 2820 tccctcgtaa tatcaccgac atcacacgtg tccagttaat gtatcagtga tacgtgtatt 2880 cacatttgtt gcgcgtaggc gtacccaaca attttgatcg actatcagaa agtcaacgga 2940 agcgagtcga cctcgagggg gggcccggta cccagctttt gttcccttta gtgagggtta 3000 attgcgcgct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc 3060 acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga 3120 gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 3180 tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 3240 cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 3300 gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga 3360 aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 3420 gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 3480 aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 3540 gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 3600 ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 3660 cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 3720 ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 3780 actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 3840 tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca 3900 gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 3960 ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 4020 cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 4080 ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt 4140 tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc 4200 agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc 4260 gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata 4320 ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg 4380 gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc 4440 cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct 4500 acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa 4560 cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt 4620 cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca 4680 ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac 4740 tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca 4800 atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt 4860 tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc 4920 actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca 4980 aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata 5040 ctcatactct tcctttttca atattattga agcatttatc agggttattg tctcatgagc 5100 ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc 5160 cgaaaagtgc cac 5173 8 54 DNA Artificial Sequence Primer designed based upon the alpha hordothionin sequence from Hordeum vulgare to amplify the gene and to introduce a NcoI site at the start (ATG) codon and a BamHI site after the stop codon of the thionin coding sequence to facilitate cloning. 8 agtataagta aacacaccat cacacccttg aggcccttgc tggtggccat ggtg 54 9 55 DNA Artificial Sequence Primer designed based upon the alpha hordothionin sequence of Hordeum vulgare to amplify the gene and to introduce a NcoI site at the start (ATG) codon and a BamHI site after the stop codon of the thionin coding sequence to facilitate cloning. 9 cctcacatcc cttagtgcct aagttcgacg tcgggccctc tagtcgacgg atcca 55 10 35 DNA Artificial Sequence Primer designed for single stranded DNA site-directed mutagenesis to introduce into the native Hordeum vulgare alpha hordothionin gene 12 codons for lysine, based on the peptide structure of hordothionin 12. 10 agcggaaaat gcccgaaagg cttccccaaa ttggc 35 11 45 DNA Artificial Sequence Primer designed for single stranded DNA site-directed mutagenesis to introduce into the native Hordeum vulgare alpha hordothionin gene 12 codons for lysine, based on the peptide structure of hordothionin 12. 11 tgcgcaggcg tctgcaagtg taagctgact agtagcggaa aatgc 45 12 50 DNA Artificial Sequence Primer designed for single stranded DNA site-directed mutagenesis to introduce into the native Hordeum vulgare alpha hordothionin gene 12 codons for lysine, based on the peptide structure of hordothionin 12. 12 tacaaccttt gcaaagtcaa aggcgccaag aagctttgcg caggcgtctg 50 13 50 DNA Artificial Sequence Primer designed for single stranded DNA site-directed mutagenesis to introduce into the native Hordeum vulgare alpha hordothionin gene 12 codons for lysine, based on the peptide structure of hordothionin 12. 13 gcaagagttg ctgcaagagt accctgggaa ggaagtgcta caacctttgc 50 14 609 DNA Pisum sativum CDS (18)...(410) 14 tttctttcta tcaaaca atg gct tcc gtt aaa ctc gct tct ttg atg gtc 50 Met Ala Ser Val Lys Leu Ala Ser Leu Met Val 1 5 10 ttg ttt gcc aca tta ggt atg ttc ctg aca aaa aac gta gga gca gca 98 Leu Phe Ala Thr Leu Gly Met Phe Leu Thr Lys Asn Val Gly Ala Ala 15 20 25 agc tgc aat ggg gtt tgt tct cca ttt gag atg cca cca tgt ggc tct 146 Ser Cys Asn Gly Val Cys Ser Pro Phe Glu Met Pro Pro Cys Gly Ser 30 35 40 tca gcc tgt cga tgt atc cct gtt ggt cta gtt gtt ggt tac tgc aga 194 Ser Ala Cys Arg Cys Ile Pro Val Gly Leu Val Val Gly Tyr Cys Arg 45 50 55 cat cca tct gga gtt ttc ttg agg acg aat gat gaa cac cct aac tta 242 His Pro Ser Gly Val Phe Leu Arg Thr Asn Asp Glu His Pro Asn Leu 60 65 70 75 tgt gag tct gat gcc gat tgt agg aag aaa gga agt ggt aac ttt tgc 290 Cys Glu Ser Asp Ala Asp Cys Arg Lys Lys Gly Ser Gly Asn Phe Cys 80 85 90 ggt cat tat cct aat cct gat att gaa tat gga tgg tgt ttt gcc tct 338 Gly His Tyr Pro Asn Pro Asp Ile Glu Tyr Gly Trp Cys Phe Ala Ser 95 100 105 aaa tct gaa gca gaa gac ttt ttc tct aag att acc caa aaa gac ttg 386 Lys Ser Glu Ala Glu Asp Phe Phe Ser Lys Ile Thr Gln Lys Asp Leu 110 115 120 ttg aag agt gtt tcc act gct taa tttccatatc cagaacaaaa ccatgcatgc 440 Leu Lys Ser Val Ser Thr Ala * 125 130 aagacatggt gaagctatct agtactttaa ataaacaaac tttgtttcca acataggagt 500 tggatttcta agatacgcat cacaattcca ataaatgtta tatgtgcatg gttccagtgt 560 tgtaatatat gcagtttctt ttcaaataat aaatcttata tcacaattg 609 15 130 PRT Pisum sativum 15 Met Ala Ser Val Lys Leu Ala Ser Leu Met Val Leu Phe Ala Thr Leu 1 5 10 15 Gly Met Phe Leu Thr Lys Asn Val Gly Ala Ala Ser Cys Asn Gly Val 20 25 30 Cys Ser Pro Phe Glu Met Pro Pro Cys Gly Ser Ser Ala Cys Arg Cys 35 40 45 Ile Pro Val Gly Leu Val Val Gly Tyr Cys Arg His Pro Ser Gly Val 50 55 60 Phe Leu Arg Thr Asn Asp Glu His Pro Asn Leu Cys Glu Ser Asp Ala 65 70 75 80 Asp Cys Arg Lys Lys Gly Ser Gly Asn Phe Cys Gly His Tyr Pro Asn 85 90 95 Pro Asp Ile Glu Tyr Gly Trp Cys Phe Ala Ser Lys Ser Glu Ala Glu 100 105 110 Asp Phe Phe Ser Lys Ile Thr Gln Lys Asp Leu Leu Lys Ser Val Ser 115 120 125 Thr Ala 130 16 1240 DNA Zea mays CDS (234)...(776) 16 gaattcattg acaacccttg acatgtaaag ttgattcata tgtataagaa agcttaatga 60 tctatctgta catccaaatc catgtactat gtttccacgt catgcaacgc aacattccaa 120 aaccatggat catctataaa tggctagctc ccacatatga actagtctct atcatcatcc 180 aatccagatc agcaaagcgg cagtgcgtag agaggatcgt cgaacagaac agc atg 236 Met 1 aag atg gtc atc gtt ctc gtc gtg tgc ctg gct ctg tca gct gcc tgc 284 Lys Met Val Ile Val Leu Val Val Cys Leu Ala Leu Ser Ala Ala Cys 5 10 15 gcc tct gca atg cag atg ccc tgc ccc tgc gcg ggg ctg cag ggc ttg 332 Ala Ser Ala Met Gln Met Pro Cys Pro Cys Ala Gly Leu Gln Gly Leu 20 25 30 tac ggc gct ggc gcc ggc ctg acg acg atg atg ggc gcc ggc ggg ctg 380 Tyr Gly Ala Gly Ala Gly Leu Thr Thr Met Met Gly Ala Gly Gly Leu 35 40 45 tac ccc tac gcg gag tac ctg agg cag ccg cag tgc agc ccg ctg gcg 428 Tyr Pro Tyr Ala Glu Tyr Leu Arg Gln Pro Gln Cys Ser Pro Leu Ala 50 55 60 65 gcg gcg ccc tac tac gcc ggg tgt ggg cag acg agc gcc atg tac cag 476 Ala Ala Pro Tyr Tyr Ala Gly Cys Gly Gln Thr Ser Ala Met Tyr Gln 70 75 80 ccg ctc cgg caa cag tgc tgc cag cag cag atg agg atg atg gac gtg 524 Pro Leu Arg Gln Gln Cys Cys Gln Gln Gln Met Arg Met Met Asp Val 85 90 95 cag tcc gtc gcg cag cag ctg cag atg atg atg cag ctt gag cgt gcc 572 Gln Ser Val Ala Gln Gln Leu Gln Met Met Met Gln Leu Glu Arg Ala 100 105 110 gct gcc gcc agc agc agc ctg tac gag cca gct ctg atg cag cag cag 620 Ala Ala Ala Ser Ser Ser Leu Tyr Glu Pro Ala Leu Met Gln Gln Gln 115 120 125 cag cag ctg ctg gca gtc cag ggt ctc aac ccc atg gcc atg atg atg 668 Gln Gln Leu Leu Ala Val Gln Gly Leu Asn Pro Met Ala Met Met Met 130 135 140 145 gcg cag aac atg ccg gcc atg ggt gga ctc tac cag tac cag tac cag 716 Ala Gln Asn Met Pro Ala Met Gly Gly Leu Tyr Gln Tyr Gln Tyr Gln 150 155 160 ctg ccc agc tac cgc acc aac ccc tgt ggc gtc tcc gct gcc att ccg 764 Leu Pro Ser Tyr Arg Thr Asn Pro Cys Gly Val Ser Ala Ala Ile Pro 165 170 175 ccc tac tac tga ttcatgatat ttgggaaatc tcctctatcc atccctctct 816 Pro Tyr Tyr * 180 atctatatat gtaataatgc agtaagacga cacacattat catgtgtggt atgaccaata 876 atatatgcat cataataaag ttttggtttt aaagaattat cggacgcttg atatctatga 936 tgctggataa atcaaaactt ctcatataaa ttgtaaatat ttcaaaatct ctatttaggc 996 tccaatggag agcatatggg tagagtagta tatatgcttg aaatactaac aactagcaaa 1056 gtgcgggcac gttgctacat gctcatttat gctcgagcat ggagtataaa acataaagat 1116 atatatgttc cattggcctg gtaaacgctg gatataggtt taaagccaac aactcatggt 1176 tcgaatcccc atttatatat aatccataat tttagcgctt tttaccattt aaattttgga 1236 gtaa 1240 17 180 PRT Zea mays 17 Met Lys Met Val Ile Val Leu Val Val Cys Leu Ala Leu Ser Ala Ala 1 5 10 15 Cys Ala Ser Ala Met Gln Met Pro Cys Pro Cys Ala Gly Leu Gln Gly 20 25 30 Leu Tyr Gly Ala Gly Ala Gly Leu Thr Thr Met Met Gly Ala Gly Gly 35 40 45 Leu Tyr Pro Tyr Ala Glu Tyr Leu Arg Gln Pro Gln Cys Ser Pro Leu 50 55 60 Ala Ala Ala Pro Tyr Tyr Ala Gly Cys Gly Gln Thr Ser Ala Met Tyr 65 70 75 80 Gln Pro Leu Arg Gln Gln Cys Cys Gln Gln Gln Met Arg Met Met Asp 85 90 95 Val Gln Ser Val Ala Gln Gln Leu Gln Met Met Met Gln Leu Glu Arg 100 105 110 Ala Ala Ala Ala Ser Ser Ser Leu Tyr Glu Pro Ala Leu Met Gln Gln 115 120 125 Gln Gln Gln Leu Leu Ala Val Gln Gly Leu Asn Pro Met Ala Met Met 130 135 140 Met Ala Gln Asn Met Pro Ala Met Gly Gly Leu Tyr Gln Tyr Gln Tyr 145 150 155 160 Gln Leu Pro Ser Tyr Arg Thr Asn Pro Cys Gly Val Ser Ala Ala Ile 165 170 175 Pro Pro Tyr Tyr 180 18 2562 DNA Zea mays CDS (1137)...(1589) 18 aagcttgcta ctttctttcc ttaatgttga tttccccttt gttagatgtt ctttgtgtta 60 tatacactct gtatacaagg atgcgataca cacatcagct agtcctaatg atgccaccga 120 ctttacttga ggaaaaggaa acaaatatga tgtggccatc acattctcaa taacaatgac 180 catgtgcgca atgacatacc atcatatttg atatcataaa aataaattta ttatcaaagt 240 aaacatatag ttcatatatc agatattaaa gtgataagaa caaatattac attttatctt 300 atataaaatg acgaaaaagg tacgagttga aaaggagtcc aacccctttt ttatagcttg 360 ttcggttgct tgttctcttc ggctagcgag gtggtagaat gtgagagtgt tgcgcgtgga 420 ttcccgtcgt agtgttctta ggtgatttct cacggcccat ctgtgatata gcgactcata 480 tgtggtgtaa tagcccattg ggagaagggg agagatatag atctacgtga tttgcacgtg 540 atgcacgacg aacgaaactg gtggtttaaa gtagtagagg tttgtcatta gaggtgtaaa 600 tggtacatat attatccgtt catattcgaa tttgatccgt ataagagggc taagatctaa 660 tccgtataca agtccaagta ttaagtatcc gatccatatc ggatctttat ccgtatccgt 720 atactcaaaa tttgatgttt aagattttaa tatatattta aactttatag gaactcgata 780 atatttgtat ctgatttgaa ttatgaaaac aaatatggaa cgattaattt cagtctatat 840 ccgttccgat atttgtcatg ctttgctaaa aataccttta caaggcatct tgtgcagatt 900 atatattaat ctgaaatcag ttagagaagc ctacaaattt gaccaaatgc cgagtcatcc 960 ggcttatccc ctttccaact ttcagttctg caagcgccag aaatcgtttt tcatctacat 1020 tgtctttgtt gcctgcatac atctataaat aggacctgct agatcaatcg cagtccatcg 1080 gcctcagtcg cacatatcta ctatactata ctctaggaag caaggacacc accgcc atg 1139 Met 1 gca gcc aag atg ctt gca ttg ttc gct ctc cta gct ctt tgt gca agc 1187 Ala Ala Lys Met Leu Ala Leu Phe Ala Leu Leu Ala Leu Cys Ala Ser 5 10 15 gcc act agt gcg acc cat att cca ggg cac ttg cca cca gtc atg cca 1235 Ala Thr Ser Ala Thr His Ile Pro Gly His Leu Pro Pro Val Met Pro 20 25 30 ttg ggt acc atg aac cca tgc atg cag tac tgc atg atg caa cag ggg 1283 Leu Gly Thr Met Asn Pro Cys Met Gln Tyr Cys Met Met Gln Gln Gly 35 40 45 ctt gcc agc ttg atg gcg tgt ccg tcc ctg atg ctg cag caa ctg ttg 1331 Leu Ala Ser Leu Met Ala Cys Pro Ser Leu Met Leu Gln Gln Leu Leu 50 55 60 65 gcc tta ccg ctt cag acg atg cca gtg atg atg cca cag atg atg acg 1379 Ala Leu Pro Leu Gln Thr Met Pro Val Met Met Pro Gln Met Met Thr 70 75 80 cct aac atg atg tca cca ttg atg atg ccg agc atg atg tca cca atg 1427 Pro Asn Met Met Ser Pro Leu Met Met Pro Ser Met Met Ser Pro Met 85 90 95 gtc ttg ccg agc atg atg tcg caa ata atg atg cca caa tgt cac tgc 1475 Val Leu Pro Ser Met Met Ser Gln Ile Met Met Pro Gln Cys His Cys 100 105 110 gac gcc gtc tcg cag att atg ctg caa cag cag tta cca ttc atg ttc 1523

Asp Ala Val Ser Gln Ile Met Leu Gln Gln Gln Leu Pro Phe Met Phe 115 120 125 aac cca atg gcc atg acg att cca ccc atg ttc tta cag caa ccc ttt 1571 Asn Pro Met Ala Met Thr Ile Pro Pro Met Phe Leu Gln Gln Pro Phe 130 135 140 145 gtt ggt gct gca ttc tag atagaaatat ttgtgttgta tcgaataatg 1619 Val Gly Ala Ala Phe * 150 agttgacatg ccatcgcgtg tgactcatta ttaacaataa aacaagtttc ctcttattat 1679 ctttttatat ctctccctat ccatttttgc aaagcccatt atcctttact ccctaagtcc 1739 caatatattt tagaccttaa attgtatgtc tatattcaaa agaatgacaa taaatctaga 1799 catatatata aaacacatac attaagtatt gtatgaatct attaaaatgc taaaacgact 1859 aatattatgg gacggaggga gtactttatt agtagattac attgttattt tctctattcc 1919 aaatataagt ctggtttttc aatcaatcaa tatatattac catgtccaaa cattttgaat 1979 tatatatcta ggtgcagcat ccgtgcacga tcgtaaaaga agcagtcacg gtgttggtcc 2039 caaaaactaa tcgtccgttg tcggtcacct ataaagattc atgaagagaa ccaaaataag 2099 gcaatataat taatgtaata tgactcctcc ttttgaatta cttaggaata acataagcaa 2159 acaaaaaaag gagaagatca aggtaaataa aggcattttg tgagaaaaca tggaagcata 2219 agaatgcata agtaatgatt tgtgtctctt tatatttttt ttattcacgt gaatttacat 2279 agataccatc ggatgttcga tggtaataca atgatgcctt agctccgaga gcttcgaatg 2339 atgagcgatt taaaaatact cctatcaatt gttcgaaagt tctttgtctc atgcatgggc 2399 aatgtacctc tatttatagg gacggtgcga cgtacaaatt tgtataaaat tatattttta 2459 ttcccaaatc ctatgcatat gtgtcgggga ccataattag gggtaccctc aaggctccta 2519 attctcagct ggtaacccca tcagcataaa gctgcaaagg cct 2562 19 150 PRT Zea mays 19 Met Ala Ala Lys Met Leu Ala Leu Phe Ala Leu Leu Ala Leu Cys Ala 1 5 10 15 Ser Ala Thr Ser Ala Thr His Ile Pro Gly His Leu Pro Pro Val Met 20 25 30 Pro Leu Gly Thr Met Asn Pro Cys Met Gln Tyr Cys Met Met Gln Gln 35 40 45 Gly Leu Ala Ser Leu Met Ala Cys Pro Ser Leu Met Leu Gln Gln Leu 50 55 60 Leu Ala Leu Pro Leu Gln Thr Met Pro Val Met Met Pro Gln Met Met 65 70 75 80 Thr Pro Asn Met Met Ser Pro Leu Met Met Pro Ser Met Met Ser Pro 85 90 95 Met Val Leu Pro Ser Met Met Ser Gln Ile Met Met Pro Gln Cys His 100 105 110 Cys Asp Ala Val Ser Gln Ile Met Leu Gln Gln Gln Leu Pro Phe Met 115 120 125 Phe Asn Pro Met Ala Met Thr Ile Pro Pro Met Phe Leu Gln Gln Pro 130 135 140 Phe Val Gly Ala Ala Phe 145 150 20 562 DNA Oryza sativa CDS (51)...(455) 20 cgtctacacc atctggaatc ttgtttaaca ctagtattgt agaatcagca atg gca 56 Met Ala 1 gca tac acc agc aag atc ttt gcc ctg ttt gcc tta att gct ctt tct 104 Ala Tyr Thr Ser Lys Ile Phe Ala Leu Phe Ala Leu Ile Ala Leu Ser 5 10 15 gca agt gcc act act gca atc acc act atg cag tat ttc cca cca aca 152 Ala Ser Ala Thr Thr Ala Ile Thr Thr Met Gln Tyr Phe Pro Pro Thr 20 25 30 tta gcc atg ggc acc atg gat ccg tgt agg cag tac atg atg caa acg 200 Leu Ala Met Gly Thr Met Asp Pro Cys Arg Gln Tyr Met Met Gln Thr 35 40 45 50 ttg ggc atg ggt agc tcc aca gcc atg ttc atg tcg cag cca atg gcg 248 Leu Gly Met Gly Ser Ser Thr Ala Met Phe Met Ser Gln Pro Met Ala 55 60 65 ctc ctg cag cag caa tgt tgc atg cag cta caa ggc atg atg cct cag 296 Leu Leu Gln Gln Gln Cys Cys Met Gln Leu Gln Gly Met Met Pro Gln 70 75 80 tgc cac tgt ggc acc agt tgc cag atg atg cag agc atg caa caa gtt 344 Cys His Cys Gly Thr Ser Cys Gln Met Met Gln Ser Met Gln Gln Val 85 90 95 att tgt gct gga ctc ggg cag cag cag atg atg aag atg gcg atg cag 392 Ile Cys Ala Gly Leu Gly Gln Gln Gln Met Met Lys Met Ala Met Gln 100 105 110 atg cca tac atg tgc aac atg gcc cct gtc aac ttc caa ctc tct tcc 440 Met Pro Tyr Met Cys Asn Met Ala Pro Val Asn Phe Gln Leu Ser Ser 115 120 125 130 tgt ggt tgt tgt tga tcaaacgttg gttacatgta ctctagtaat aaggtgttgc 495 Cys Gly Cys Cys * atactatcgt gtgcaaacac tagaaataag aaccattgaa taaaatatca atcattttca 555 gacttgc 562 21 134 PRT Oryza sativa 21 Met Ala Ala Tyr Thr Ser Lys Ile Phe Ala Leu Phe Ala Leu Ile Ala 1 5 10 15 Leu Ser Ala Ser Ala Thr Thr Ala Ile Thr Thr Met Gln Tyr Phe Pro 20 25 30 Pro Thr Leu Ala Met Gly Thr Met Asp Pro Cys Arg Gln Tyr Met Met 35 40 45 Gln Thr Leu Gly Met Gly Ser Ser Thr Ala Met Phe Met Ser Gln Pro 50 55 60 Met Ala Leu Leu Gln Gln Gln Cys Cys Met Gln Leu Gln Gly Met Met 65 70 75 80 Pro Gln Cys His Cys Gly Thr Ser Cys Gln Met Met Gln Ser Met Gln 85 90 95 Gln Val Ile Cys Ala Gly Leu Gly Gln Gln Gln Met Met Lys Met Ala 100 105 110 Met Gln Met Pro Tyr Met Cys Asn Met Ala Pro Val Asn Phe Gln Leu 115 120 125 Ser Ser Cys Gly Cys Cys 130 22 45 PRT Triticum aestivum 22 Lys Ser Cys Cys Lys Ser Thr Leu Gly Arg Asn Cys Tyr Asn Leu Cys 1 5 10 15 Arg Ala Arg Gly Ala Gln Lys Leu Cys Ala Asn Val Cys Arg Cys Lys 20 25 30 Leu Thr Ser Gly Leu Ser Cys Pro Lys Asp Phe Pro Lys 35 40 45

Claims

1. A method for increasing the nutritional value of a cereal plant seed comprising: transforming a host plant cell with a vector comprising an expression cassette comprising a seed endosperm-preferred promoter operably linked to a structural gene encoding a polypeptide elevated in content of a preselected amino acid; recovering the transformed cells; regenerating a transformed plant; and recovering the seeds therefrom.

2. A seed produced by the method of claim 1.

3. The seed according to the method of claim 1 wherein the preselected amino acid is lysine, threonine or tryptophan and optionally a sulfur-containing amino acid.