U.S. patent application number 10/837105 was filed with the patent office on 2006-02-16 for corn event tc1507 and methods for detection thereof.
This patent application is currently assigned to Dow AgroSciences LLC. Invention is credited to Eric Barbour, James Wayne Bing, Guy A. Cardineau, Robert F. JR. Cressman, Manju Gupta, Mary E. Hartnett Locke, David Hondred, Joseph W. Keaschall, Michael G. Koziel, Terry EuClaire Meyer, Daniel Moellenbeck, Kenneth Edwin Narva, Wilas Nirunsuksiri, Steven W. Ritchie, Marjorie L. Rudert, Craig D. Sanders, Aihua Shao, Steven Jeffrey Stelman, David S. Stucker, Laura Ann Tagliani, William M. Van Zante.
Application Number | 20060037095 10/837105 |
Document ID | / |
Family ID | 33435118 |
Filed Date | 2006-02-16 |
United States Patent
Application |
20060037095 |
Kind Code |
A9 |
Barbour; Eric ; et
al. |
February 16, 2006 |
Corn event TC1507 and methods for detection thereof
Abstract
The invention provides DNA compositions that relate to
transgenic insect resistant maize plants. Also provided are assays
for detecting the presence of the maize TC1507 event based on the
DNA sequence of the recombinant construct inserted into the maize
genome and the DNA sequences flanking the insertion site. Kits and
conditions useful in conducting the assays are provided.
Inventors: |
Barbour; Eric; (Johnston,
IA) ; Bing; James Wayne; (Ankeny, IA) ;
Cardineau; Guy A.; (Tempe, AZ) ; Cressman; Robert F.
JR.; (Wilmington, DE) ; Gupta; Manju; (Carmel,
IN) ; Hartnett Locke; Mary E.; (Mickleton, NJ)
; Hondred; David; (Ankeny, IA) ; Keaschall; Joseph
W.; (Clive, IA) ; Koziel; Michael G.;
(Raleigh, NC) ; Meyer; Terry EuClaire; (Urbandale,
IA) ; Moellenbeck; Daniel; (Granger, IA) ;
Narva; Kenneth Edwin; (Carlsbad, CA) ; Nirunsuksiri;
Wilas; (Auburn, WA) ; Ritchie; Steven W.;
(Omaha, NE) ; Rudert; Marjorie L.; (Boone, IA)
; Sanders; Craig D.; (Bear, DE) ; Shao; Aihua;
(Johnston, IA) ; Stelman; Steven Jeffrey; (San
Diego, CA) ; Stucker; David S.; (Johnston, IA)
; Tagliani; Laura Ann; (Zionsville, IN) ; Van
Zante; William M.; (Urbandale, IA) |
Correspondence
Address: |
PIONEER HI-BRED INTERNATIONAL, INC.
7250 N.W. 62ND AVENUE
P.O. BOX 552
JOHNSTON
IA
50131-0552
US
|
Assignee: |
Dow AgroSciences LLC
E.I. duPont deNemours and Company
Pioneer Hi-Bred International, Inc.
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20050039226 A1 |
February 17, 2005 |
|
|
Family ID: |
33435118 |
Appl. No.: |
10/837105 |
Filed: |
April 30, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60467772 |
May 2, 2003 |
|
|
|
Current U.S.
Class: |
800/278 ;
435/6.13; 536/23.2; 800/320.1 |
Current CPC
Class: |
C12N 15/8286 20130101;
Y02A 40/146 20180101; C12Q 1/686 20130101; Y10S 435/975 20130101;
C12Q 2600/16 20130101; C12Q 1/6895 20130101; C12Q 2600/13 20130101;
C12N 15/8277 20130101 |
Class at
Publication: |
800/278 ;
800/320.1; 536/023.2; 435/006 |
International
Class: |
A01H 1/00 20060101
A01H001/00; C12N 15/82 20060101 C12N015/82; A01H 5/00 20060101
A01H005/00; C12Q 1/68 20060101 C12Q001/68; C07H 21/04 20060101
C07H021/04 |
Claims
1. An isolated DNA molecule comprising a nucleotide sequence
identified as SEQ ID NO:21.
2. An isolated DNA molecule comprising a nucleotide sequence
identified as SEQ ID NO:22.
3. An isolated DNA molecule comprising a nucleotide sequence
identified as SEQ ID NO:24.
4. An isolated DNA molecule comprising a nucleotide sequence
identified as SEQ ID NO:26.
5. An isolated DNA molecule comprising a nucleotide sequence
identified as SEQ ID NO:27.
6. A kit for identifying event TC1507 in a biological sample which
detects a TC1507 specific region, said kit comprising at least a
first primer, which recognizes a sequence within SEQ ID NO:21 or
within SEQ ID NO:22.
7. The kit of claim 6, further comprising at least a second primer
which recognizes a sequence within SEQ ID NO:25.
8. The kit of claim 6, further comprising at least a second primer
which recognizes a sequence within SEQ ID NO:22.
9. The kit of claim 6, wherein the first primer recognizes a
sequence within SEQ ID NO:21.
10. The kit of claim 6, wherein the first primer recognizes a
sequence within SEQ ID NO:22.
11. The kit of claim 7, wherein said at least first and second
primers comprise the sequence of SEQ ID NO: 1 and SEQ ID NO:2,
respectively.
12. The kit of claim 7, wherein said at least first and second
primers comprise the sequence of SEQ ID NO:2 and SEQ ID NO:23,
respectively.
13. The kit of claim 8, wherein said at least first and second
primers comprise the sequence of SEQ ID NO:3 and SEQ ID NO:5,
respectively.
14. The kit of claim 8, wherein said at least first and second
primers comprise the sequence of SEQ ID NO:4 and SEQ ID NO:5,
respectively.
15. A DNA detection kit specific for junction DNA of maize event
TC1507 and its progeny comprising at least one DNA molecule of a
sufficient length of contiguous DNA polynucleotides to function in
a DNA detection method, that is homologous or complementary to SEQ
ID NO: 26.
16. A DNA detection kit specific for junction DNA of maize event
TC1507 and its progeny comprising at least one DNA molecule of a
sufficient length of contiguous DNA polynucleotides to function in
a DNA detection method, that is homologous or complementary to SEQ
ID NO: 27.
17. A kit for identifying event TC1507 in a biological sample, said
kit comprising a specific probe comprising a sequence which
hybridizes with SEQ ID NO:21 and SEQ ID NO:25, contiguous
therewith.
18. A kit for identifying event TC1507 in a biological sample, said
kit comprising a specific probe comprising a sequence which
hybridizes with SEQ ID NO:22 and SEQ ID NO:25, contiguous
therewith.
19. A DNA detection kit comprising: at least one DNA molecule of a
sufficient length of contiguous nucleotides homologous or
complementary to SEQ ID NO:26 or SEQ ID NO:27 that functions as a
DNA primer or probe specific for maize event TC1507 and its
progeny.
20. A DNA construct comprising: a first and second expression
cassette, wherein said first expression cassette in operable
linkage comprises (a) a maize ubiquitin promoter; (b) a 5'
untranslated exon of a maize ubiquitin gene; (c) a maize ubiquitin
intron; (d) a Cry1F encoding DNA molecule; and (e) a 3' ORF25
transcriptional terminator; and said second expression cassette
comprising in operable linkage (i) a CaMV 35S promoter; (ii) a pat
encoding DNA molecule; and (iii) a 3' transcriptional terminator
from (CaMV) 35S.
21. A plant comprising the DNA construct of claim 20.
22. A plant of claim 21, wherein said plant is a corn plant.
23. A method for identifying event TC1507 in a biological sample,
comprising detecting a TC1507 specific region with a probe or first
primer which specifically recognizes a sequence within SEQ ID NO:21
or SEQ ID NO:22.
24. The method of claim 23, further comprising amplifying a DNA
fragment from a nucleic acid present in said biological sample
using a polymerase chain reaction with at least two primers,
wherein said first primer recognizes a sequence within SEQ ID NO:21
or SEQ ID NO:22, and a second primer recognizes a sequence within
SEQ ID NO:22 or SEQ ID NO: 25.
25. The method of claim 24, wherein said first primer recognizes a
sequence within SEQ ID NO:21 and said second primer recognizes a
sequence within SEQ ID NO: 25.
26. The method of claim 23, wherein said first primer recognizes a
sequence within SEQ ID NO:22 and a second primer recognizes a
sequence within SEQ ID NO:22.
27. The method of claim 25, wherein said first and second primers
comprise the sequence of SEQ ID NO:2 and SEQ ID NO:1
respectively.
28. The method of claim 25, wherein said first and second primers
comprise the sequence of SEQ ID NO:2 and SEQ ID NO:23
respectively.
29. The method of claim 26, wherein said first and second primers
comprise the sequence of SEQ ID NO:3 and SEQ ID NO:5
respectively.
30. The method of claim 26, wherein said first and second primers
comprise the sequence of SEQ ID NO:4 and SEQ ID NO:5
respectively.
31. The method of claim 27, comprising amplifying a fragment of
about 912 bp using a TC1507 PCR identification protocol.
32. The method of claim 28, comprising amplifying a fragment of
about 844 bp using a TC1507 PCR identification protocol.
33. The method of claim 29, comprising amplifying a fragment of
about 342 bp using a TC1507 PCR identification protocol.
34. The method of claim 30, comprising amplifying a fragment of
about 252 bp using a TC1507 PCR identification protocol.
35. A method of detecting the presence of maize event TC1507 or
progeny thereof in a biological sample, comprising: (a) extracting
a DNA sample from said biological sample; (b) providing DNA primer
molecules SEQ ID NO: 1 and SEQ ID NO:2; (c) providing DNA
amplification reaction conditions; (d) performing said DNA
amplification reaction, thereby producing a DNA amplicon molecule;
and (e) detecting said DNA amplicon molecule, wherein the detection
of said DNA amplicon molecule in said DNA amplification reaction
indicates the presence of maize event TC1507.
36. A method of detecting the presence of maize event TC1507 or
progeny thereof in a biological sample, comprising: (a) extracting
a DNA sample from said biological sample; (b) providing DNA primer
molecules SEQ ID NO:2 and SEQ ID NO:23; (c) providing DNA
amplification reaction conditions; (d) performing said DNA
amplification reaction, thereby producing a DNA amplicon molecule;
and (e) detecting said DNA amplicon molecule, wherein the detection
of said DNA amplicon molecule in said DNA amplification reaction
indicates the presence of maize event TC1507.
37. A method of detecting the presence of maize event TC1507 or
progeny thereof in a biological sample, comprising: (a) extracting
a DNA sample from said biological sample; (b) providing DNA primer
molecules SEQ ID NO:3 and SEQ ID NO:5; (c) providing DNA
amplification reaction conditions; (d) performing said DNA
amplification reaction, thereby producing a DNA amplicon molecule;
and (e) detecting said DNA amplicon molecule, wherein the detection
of said DNA amplicon molecule in said DNA amplification reaction
indicates the presence of maize event TC1507.
38. A method of detecting the presence of maize event TC1507 or
progeny thereof in a biological sample, comprising: (a) extracting
a DNA sample from said biological sample; (b) providing DNA primer
molecules SEQ ID NO:4 and SEQ ID NO:5; (c) providing DNA
amplification reaction conditions; (d) performing said DNA
amplification reaction, thereby producing a DNA amplicon molecule;
and (e) detecting said DNA amplicon molecule, wherein the detection
of said DNA amplicon molecule in said DNA amplification reaction
indicates the presence of maize event TC1507.
39. An isolated DNA molecule comprising the amplicon produced by
the method of claim 35.
40. An isolated DNA molecule comprising the amplicon produced by
the method of claim 36.
41. An isolated DNA molecule comprising the amplicon produced by
the method of claim 37.
42. An isolated DNA molecule comprising the amplicon produced by
the method of claim 38.
43. A method of detecting the presence of DNA corresponding to the
TC1507 event in a sample, the method comprising: (a) contacting the
sample comprising maize DNA with a polynucleotide probe that
hybridizes under stringent hybridization conditions with DNA from
maize event TC1507 and does not hybridize under said stringent
hybridization conditions with a non-TC1507 maize plant DNA; (b)
subjecting the sample and probe to stringent hybridization
conditions; and (c) detecting hybridization of the probe to the
DNA, wherein detection of hybridization indicates the presence of
the TC1507 event.
44. An isolated DNA nucleotide primer sequence comprising a
sequence selected from the group consisting of SEQ ID NO:1, 2, 3,
4, 5, 23, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 or
its complement.
45. An isolated DNA nucleotide primer sequence of claim 44
comprising a sequence selected from the group consisting of SEQ ID
NO: 1, 2, 3, 4, 5 and 23 or its complement.
46. A pair of DNA molecules comprising: a first DNA molecule and a
second DNA molecule, wherein the DNA molecules are of a sufficient
length of contiguous nucleotides of SEQ ID NO:26 or its complement
to function as DNA primers or probes diagnostic for DNA extracted
from a TC1507 corn plant or progeny thereof.
47. A pair of DNA molecules comprising: a first DNA molecule and a
second DNA molecule, wherein the DNA molecules are of a sufficient
length of contiguous nucleotides of SEQ ID NO:27 or its complement
to function as DNA primers or probes diagnostic for DNA extracted
from a TC1507 corn plant or progeny thereof.
48. An isolated DNA molecule comprising a junction sequence
comprising a sequence selected from the group consisting of SEQ ID
NO: 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 and
complements thereof.
49. A method for confirming seed purity, comprising detection of a
TC1507 specific region with a specific primer or probe which
specifically recognizes a sequence within SEQ ID NO:21 or SEQ ID
NO:22, in a seed sample.
50. A method for screening seeds for the presence of event TC1507,
comprising detection of a TC1507 specific region with a specific
primer or probe which specifically recognizes a sequence within SEQ
ID NO:21 or SEQ ID NO:22 in a sample of a seed lot.
51. An insect resistant corn plant, or parts thereof, wherein DNA
having at least one nucleotide sequence selected from the group
consisting of SEQ ID NO: 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56 and 57 and complements thereof forms part of the plant's
genome.
52. A descent plant of the insect resistant corn plant of claim 51
wherein DNA having at least one nucleotide sequence selected from
the group consisting of SEQ ID NO: 45, 46, 47, 48, 49, 50, 51, 52,
53, 54, 55, 56 and 57 and complements thereof forms part of the
plant's genome.
53. Seed of a plant of claim 51 or 52.
54. A method of producing an insect resistant corn plant comprising
breeding with a plant of claim 51 or 52, and selecting progeny by
analyzing for at least one nucleotide sequence selected from the
group consisting of SEQ ID NO: 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56 and 57 and complements thereof.
55. An isolated DNA sequence comprising a sequence selected from
the group consisting of DNA having at least one nucleotide sequence
selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 23, 45, 46,
47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 and complements
thereof.
56. A pair of isolated DNA sequences, each comprising at least ten
nucleotides and which when used together in a DNA amplification
procedure will produce an amplicon diagnostic for event TC1507.
57. The pair of isolated DNA sequences of claim 56 wherein each is
chosen from SEQ ID NO:26.
58. The pair of isolated DNA sequences of claim 56 wherein each is
chosen from SEQ ID NO:27.
59. A method of detecting the presence of the TC1507 event
insertion in corn tissue comprising: (a) selecting a primer pair
each comprising at least ten nucleotides from SEQ ID NO:26 or SEQ
ID NO:27 wherein each member of the pair is on opposite sides of a
sequence diagnostic for said TC1507 event insertion; (b) contacting
a sample of said corn tissue with said primer pair; (c) performing
DNA amplification and analyzing for an amplicons.
60. The method of claim 59 wherein said primer pair is selected
from the group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 23, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56 and 57 and complements thereof.
61. A method of detecting the presence of the TC1507 event
insertion in corn tissue comprising: (a) contacting a sample of
said corn tissue with a polynucleotide probe that hybridizes under
stringent hybridization conditions with one or more. DNA sequence
selected from the group consisting of SEQ ID NO: 45, 46, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56 and 57 and complements thereof; (b)
subjecting said sample and probe to stringent hybridization
conditions; and (c) analyzing for hybridization of the probe.
62. A DNA detection kit comprising a polynucleotide probe that
hybridizes under stringent hybridization conditions with one or
more DNA sequences selected from the group consisting of SEQ ID NO:
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 and
complements thereof.
63. A DNA detection kit comprising a primer pair each comprising at
least 10 nucleotides from SEQ ID NO:26 and SEQ ID NO:27, wherein
each is on opposite sides of a sequence diagnostic for the TC1507
event insertion.
64. The DNA detection kit of claim 61 wherein said primer pair is
selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 23, 45, 46,
47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 and complements
thereof.
65. A kit for identifying event TC1507 in a biological sample which
detects TC1507 specific region within SEQ ID NO: 24.
66. A method for identifying TC1507 in a biological sample which
detects a TC1507 specific region within SEQ ID NO: 24.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/467,772, filed May 2, 2003.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of plant
molecular biology, specifically the invention relates to a DNA
construct for conferring insect resistance to a plant. The
invention more specifically relates to an insect resistant corn
plant TC1507 and to assays for detecting the presence of corn plant
TC1507 DNA in a sample and compositions thereof.
BACKGROUND OF THE INVENTION
[0003] This invention relates to the insect resistant corn (Zea
mays) plant TC1507, also referred to as maize line TC1507 or maize
event TC1507, and to the DNA plant expression construct of corn
plant TC1507 and the detection of the transgene/flanking insertion
region in corn plant TC1507 and progeny thereof.
[0004] Corn is an important crop and is a primary food source in
many areas of the world. Damage caused by insect pests is a major
factor in the loss of the world's corn crops, despite the use of
protective measures such as chemical pesticides. In view of this,
insect resistance has been genetically engineered into crops such
as corn in order to control insect damage and to reduce the need
for traditional chemical pesticides. One group of genes which have
been utilized for the production of transgenic insect resistant
crops are the delta-endotoxins from Bacillus thuringiensis (B.t.).
Delta-endotoxins have been successfully expressed in crop plants
such as cotton, potatoes, rice, sunflower, as well as corn, and
have proven to provide excellent control over insect pests.
(Perlak, F. J et al. (1990) Bio/Technology 8, 939-943; Perlak, F.
J. et al. (1993) Plant Mol. Biol. 22: 313-321; Fujimoto H. et al.
(1993) Bio/Technology 11: 1151-1155; Tu et al. (2000) Nature
Biotechnology 18:1101-1104; PCT publication number WO 01/13731; and
Bing J W et al. (2000) Efficacy of Cry1F Transgenic Maize,
14.sup.th Biennial International Plant Resistance to Insects
Workshop, Fort Collins, Colo.).
[0005] The expression of foreign genes in plants is known to be
influenced by their location in the plant genome, perhaps due to
chromatin structure (e.g., heterochromatin) or the proximity of
transcriptional regulatory elements (e.g., enhancers) close to the
integration site (Weising et al., Ann. Rev. Genet 22:421-477,
1988). At the same time the presence of the transgene at different
locations in the genome will influence the overall phenotype of the
plant in different ways. For this reason, it is often necessary to
screen a large number of events in order to identify an event
characterized by optimal expression of an introduced gene of
interest. For example, it has been observed in plants and in other
organisms that there may be a wide variation in levels of
expression of an introduced gene among events. There may also be
differences in spatial or temporal patterns of expression, for
example, differences in the relative expression of a transgene in
various plant tissues, that may not correspond to the patterns
expected from transcriptional regulatory elements present in the
introduced gene construct. For this reason, it is common to produce
hundreds to thousands of different events and screen those events
for a single event that has desired transgene expression levels and
patterns for commercial purposes. An event that has desired levels
or patterns of transgene expression is useful for introgressing the
transgene into other genetic backgrounds by sexual outcrossing
using conventional breeding methods. Progeny of such crosses
maintain the transgene expression characteristics of the original
transformant. This strategy is used to ensure reliable gene
expression in a number of varieties that are well adapted to local
growing conditions.
[0006] It would be advantageous to be able to detect the presence
of a particular event in order to determine whether progeny of a
sexual cross contain a transgene of interest. In addition, a method
for detecting a particular event would be helpful for complying
with regulations requiring the pre-market approval and labeling of
foods derived from recombinant crop plants, for example, or for use
in environmental monitoring, monitoring traits in crops in the
field, or monitoring products derived from a crop harvest, as well
as for use in ensuring compliance of parties subject to regulatory
or contractual terms.
[0007] It is possible to detect the presence of a transgene by any
nucleic acid detection method known in the art including, but not
limited to, the polymerase chain reaction (PCR) or DNA
hybridization using nucleic acid probes. These detection methods
generally focus on frequently used genetic elements, such as
promoters, terminators, marker genes, etc., because for many DNA
constructs, the coding region is interchangeable. As a result, such
methods may not be useful for discriminating between different
events, particularly those produced using the same DNA construct or
very similar constructs unless the DNA sequence of the flanking DNA
adjacent to the inserted heterologous DNA is known. For example, an
event-specific PCR assay is described in U.S. Pat. No. 6,395,485
for the detection of elite event GAT-ZM1. Accordingly, it would be
desirable to have a simple and discriminative method for the
identification of event TC1507.
SUMMARY OF THE INVENTION
[0008] This invention relates preferably to methods for producing
and selecting an insect resistant monocot crop plant. More
specifically, a DNA construct is provided that when expressed in
plant cells and plants confers resistance to insects. According to
one aspect of the invention, a DNA construct, capable of
introduction into and replication in a host cell, is provided that
when expressed in plant cells and plants confers insect resistance
to the plant cells and plants. The DNA construct is comprised of a
DNA molecule named PH18999A and it includes two transgene
expression cassettes. The first expression cassette comprises a DNA
molecule which includes the promoter, 5' untranslated exon, and
first intron of the maize ubiquitin (Ubi-1) gene (Christensen et
al. (1992) Plant Mol. Biol. 18:675-689 and Christensen and Quail
(1996) Transgenic Res. 5:213-218) operably connected to a DNA
molecule encoding a B.t. 6-endotoxin identified as Cry1F (U.S. Pat.
Nos. 5,188,960 and 6,218,188) operably connected to a DNA molecule
comprising a 3' ORF25 transcriptional terminator isolated from
Agrobacterium tumefaciens (Barker et al. (1983) Plant Mol. Biol.
2:335-350). The second transgene expression cassette of the DNA
construct comprises a DNA molecule of the cauliflower mosaic virus
(CaMV) .sup.35S promoter (Odell J. T. et al. (1985) Nature 313:
810-812; Mitsuhara et al. (1996) Plant Cell Physiol. 37: 49-59)
operably connected to a DNA molecule encoding a phosphinothricin
acetyltransferase (PAT) gene (Wohlleben W. et al. (1988) Gene 70:
25-37) operably connected to a DNA molecule comprising a 3'
transcriptional terminator from (CaMV) .sup.35S (see Mitsuhara et
al. (1996) Plant Cell Physiol. 37: 49-59). Plants containing the
DNA construct are also provided.
[0009] According to another aspect of the invention, compositions
and methods are provided for identifying a novel corn plant
designated TC1507, which methods are based on primers or probes
which specifically recognize the 5' and/or 3' flanking sequence of
TC1507. DNA molecules are provided that comprise primer sequences
that when utilized in a PCR reaction will produce amplicons unique
to the transgenic event TC1507. These molecules may be selected
from the group consisting of: TABLE-US-00001
5'-GTAGTACTATAGATTATATTATTCGTA (SEQ ID NO: 1) GAG-3';
5'-GCCATACAGAACTCAAAATCTTTTCCG (SEQ ID NO: 2) GAG-3';
5'-CTTCAAACAAGTGTGACAAA-3'; (SEQ ID NO: 23)
5'-TGTGGTGTTTGTGGCTCTGTCCTAA-3'; (SEQ ID NO: 3)
5'-AGCACCTTTTCATTCTTTCATATAC-3'; (SEQ ID NO: 4) 5'-GACCTCCCCA
CAGGCATGAT TGATC-3'; (SEQ ID NO: 5)
and complements thereof. The corn plant and seed comprising these
molecules is an aspect of this invention. Further, kits utilizing
these primer sequences for the identification of the TC1507 event
are provided.
[0010] An additional aspect of the invention relates to the
specific flanking sequences of TC1507 described herein, which can
be used to develop specific identification methods for TC1507 in
biological samples. More particularly, the invention relates to the
5' and/or 3' flanking regions of TC1507, SEQ ID NO:21 and SEQ ID
NO:22, respectively, which can be used for the development of
specific primers and probes. The invention further relates to
identification methods for the presence of TC1507 in biological
samples based on the use of such specific primers or probes.
[0011] According to another aspect of the invention, methods of
detecting the presence of DNA corresponding to the corn event
TC1507 in a sample are provided. Such methods comprise: (a)
contacting the sample comprising DNA with a DNA primer set, that
when used in a nucleic acid amplification reaction with genomic DNA
extracted from corn event TC1507 produces an amplicon that is
diagnostic for corn event TC1507; (b) performing a nucleic acid
amplification reaction, thereby producing the amplicon; and (c)
detecting the amplicon.
[0012] DNA molecules that comprise the novel transgene/flanking
insertion region, SEQ ID NO: 26 and SEQ ID NO: 27 and are
homologous or complementary to SEQ ID NO: 26 and SEQ ID NO: 27 are
an aspect of this invention.
[0013] DNA sequences that comprise the novel transgene/flanking
insertion region, SEQ ID NO:26 are an aspect of this invention. DNA
sequences that comprise a sufficient length of polynucleotides of
transgene insert sequence and a sufficient length of
polynucleotides of maize genomic and/or flanking sequence from
maize plant TC1507 of SEQ ID NO:26 that are useful as primer
sequences for the production of an amplicon product diagnostic for
maize plant TC1507 are included.
[0014] In addition, DNA sequences that comprise the novel
transgene/flanking insertion region, SEQ ID NO:27 are provided. DNA
sequences that comprise a sufficient length of polynucleotides of
transgene insert sequence and a sufficient length of
polynucleotides of maize genomic and/or flanking sequence from
maize plant TC1507 of SEQ ID NO:27 that are useful as primer
sequences for the production of an amplicon product diagnostic for
maize plant TC1507 are included.
[0015] According to another aspect of the invention, the DNA
sequences that comprise at least 11 or more nucleotides of the
transgene portion of the DNA sequence of SEQ ID NO:26 or
complements thereof, and a similar length of 5' flanking maize DNA
sequence of SEQ ID NO:26 or complements thereof are useful as DNA
primers in DNA amplification methods. The amplicons produced using
these primers are diagnostic for maize event TC1507. Therefore, the
invention also includes the amplicons produced by DNA primers
homologous or complementary to SEQ ID NO:26.
[0016] According to another aspect of the invention, the DNA
sequences that comprise at least 11 or more nucleotides of the
transgene portion of the DNA sequence of SEQ ID NO:27 or
complements thereof, and a similar length of 3' flanking maize DNA
sequence of SEQ ID NO:27 or complements thereof are useful as DNA
primers in DNA amplification methods. The amplicons produced using
these primers are diagnostic for maize event TC1507. Therefore, the
invention also includes the amplicons produced by DNA primers
homologous or complementary to SEQ ID NO:27.
[0017] More specifically, a pair of DNA molecules comprising a DNA
primer set, wherein the DNA molecules are identified as SEQ ID NO:
1 or complements thereof and SEQ ID NO: 2 or complements thereof;
SEQ ID NO: 2 or complements thereof and SEQ ID NO: 23 or
complements thereof; SEQ ID NO: 3 or complements thereof and SEQ ID
NO: 5 or complements thereof; SEQ ID NO: 4 or complements thereof
and SEQ ID NO: 5 or complements thereof are aspects of the
invention.
[0018] Further aspects of the invention include the amplicon
comprising the DNA molecules of SEQ ID NO: 1 and SEQ ID NO: 2; the
amplicon comprising the DNA molecules of SEQ ID NO: 2 and SEQ ID
NO: 23; the amplicon comprising the DNA molecules of SEQ ID NO: 3
and SEQ ID NO: 5; and the amplicon comprising the DNA molecules of
SEQ ID NO: 4 and SEQ ID NO: 5.
[0019] According to another aspect of the invention, methods of
detecting the presence of a DNA molecule corresponding to the
TC1507 event in a sample, such methods comprising: (a) contacting
the sample comprising DNA extracted from a corn plant with a DNA
probe, molecule that hybridizes under stringent hybridization
conditions with DNA extracted from corn event TC1507 and does not
hybridize under the stringent hybridization conditions with a
control corn plant DNA; (b) subjecting the sample and probe to
stringent hybridization conditions; and (c) detecting hybridization
of the probe to the DNA. More specifically, a method for detecting
the presence of a DNA molecule corresponding to the TC1507 event in
a sample, such methods, consisting of (a) contacting the sample
comprising DNA extracted from a corn plant with a DNA probe
molecule that consists of sequences that are unique to the event,
e.g. junction sequences, wherein said DNA probe molecule hybridizes
under stringent hybridization conditions with DNA extracted from
corn event TC1507 and does not hybridize under the stringent
hybridization conditions with a control corn plant DNA; (b)
subjecting the sample and probe to stringent hybridization
conditions; and (c) detecting hybridization of the probe to the
DNA.
[0020] In addition, a kit and methods for identifying event TC1507
in a biological sample which detects a TC1507 specific region
within SEQ ID NO: 24 are provided.
[0021] DNA molecules are provided that comprise at least one
junction sequence of TC1507 selected from the group consisting of
SEQ ID NO:45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 and
complements thereof; wherein a junction sequence spans the junction
between heterologous DNA inserted into the genome and the DNA from
the corn cell flanking the insertion site, i.e. flanking DNA, and
is diagnostic for the TC1507 event.
[0022] According to another aspect of the invention, methods of
producing an insect resistant corn plant that comprise the steps
of: (a) sexually crossing a first parental corn line comprising the
expression cassettes of the present invention, which confers
resistance to insects, and a second parental corn line that lacks
insect resistance, thereby producing a plurality of progeny plants;
and (b) selecting a progeny plant that is insect resistant. Such
methods may optionally comprise the further step of back-crossing
the progeny plant to the second parental corn line to producing a
true-breeding corn plant that is insect resistant.
[0023] The present invention provides a method of producing a corn
plant that is resistant to insects comprising transforming a corn
cell with the DNA construct PH18999A (SEQ ID NO:25), growing the
transformed corn cell into a corn plant, selecting the corn plant
that shows resistance to insects, and further growing the corn
plant into a fertile corn plant. The fertile corn plant can be self
pollinated or crossed with compatible corn varieties to produce
insect resistant progeny.
[0024] The invention further relates to a DNA detection kit for
identifying maize event TC1507 in biological samples. Preferably
the kit of the invention comprises a first primer which
specifically recognizes the 5' or 3' flanking region of TC1507, and
a second primer which specifically recognizes a sequence within the
foreign DNA of TC1507, or within the flanking DNA, for use in a PCR
identification protocol. The invention also relates to a kit for
identifying event TC1507 in biological samples, which kit comprises
a specific probe having a sequence which corresponds or is
complementary to, a sequence having between 80% and 100% sequence
identity with a specific region of event TC1507. Preferably the
sequence of the probe corresponds to a specific region comprising
part of the 5' or 3' flanking region of event TC1507.
[0025] The methods and kits encompassed by the present invention
can be used for different purposes such as, but not limited to the
following: to identify event TC1507 in plants, plant material or in
products such as, but not limited to, food or feed products (fresh
or processed) comprising, or derived from plant material;
additionally or alternatively, the methods and kits of the present
invention can be used to identify transgenic plant material for
purposes of segregation between transgenic and non-transgenic
material; additionally or alternatively, the methods and kits of
the present invention can be used to determine the quality of plant
material comprising maize event TC1507. The kits may also contain
the reagents and materials necessary for the performance of the
detection method.
[0026] This invention further relates to the TC1507 corn plant or
its parts, including, but not limited to, pollen, ovules,
vegetative cells, the nuclei of pollen cells, and the nuclei of egg
cells of the corn plant TC1507 and the progeny derived thereof. The
corn plant and seed TC1507 from which the DNA primer molecules of
the present invention provide a specific amplicon product is an
aspect of the invention.
[0027] The foregoing and other aspects of the invention will become
more apparent from the following detailed description and
accompanying drawing.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1. Linear map showing the transgenic insert PH18999A,
as well as the sequences flanking the transgenic insert.
DETAILED DESCRIPTION
[0029] The following definitions and methods are provided to better
define the present invention and to guide those of ordinary skill
in the art in the practice of the present invention. Unless
otherwise noted, terms are to be understood according to
conventional usage by those of ordinary skill in the relevant art.
Definitions of common terms in molecular biology may also be found
in Rieger et al., Glossary of Genetics: Classical and Molecular,
5th edition, Springer-Verlag; New York, 1991; and Lewin, Genes V,
Oxford University Press: New York, 1994. The nomenclature for DNA
bases as set forth at 37 CFR 1.822 is used.
[0030] As used herein, the term "comprising" means "including but
not limited to".
[0031] As used herein, the term "corn" means Zea mays or maize and
includes all plant varieties that can be bred with corn, including
wild maize species.
[0032] As used herein, the term "TC1507 specific" refers to a
nucleotide sequence which is suitable for discriminatively
identifying event TC1507 in plants, plant material, or in products
such as, but not limited to, food or feed products (fresh or
processed) comprising, or derived from plant material.
[0033] As used herein, the terms "insect resistant" and "impacting
insect pests" refers to effecting changes in insect feeding,
growth, and/or behavior at any stage of development, including but
not limited to: killing the insect; retarding growth; preventing
reproductive capability; and the like.
[0034] As used herein, the terms "pesticidal activity" and
"insecticidal activity" are used synonymously to refer to activity
of an organism or a substance (such as, for example, a protein)
that can be measured by numerous parameters including, but not
limited to, pest mortality, pest weight loss, pest attraction, pest
repellency, and other behavioral and physical changes of a pest
after feeding on and/or exposure to the organism or substance for
an appropriate length of time. For example "pesticidal proteins"
are proteins that display pesticidal activity by themselves or in
combination with other proteins.
[0035] "Coding sequence" refers to a nucleotide sequence that codes
for a specific amino acid sequence. As used herein, the terms
"encoding" or "encoded" when used in the context of a specified
nucleic acid mean that the nucleic acid comprises the requisite
information to guide translation of the nucleotide sequence into a
specified protein. The information by which a protein is encoded is
specified by the use of codons. A nucleic acid encoding a protein
may comprise non-translated sequences (e.g., introns) within
translated regions of the nucleic acid or may lack such intervening
non-translated sequences (e.g., as in cDNA).
[0036] "Gene" refers to a nucleic acid fragment that expresses a
specific protein, including regulatory sequences preceding (5'
non-coding sequences) and following (3' non-coding sequences) the
coding sequence. "Native gene" refers to a gene as found in nature
with its own regulatory sequences. "Chimeric gene" refers any gene
that is not a native gene, comprising regulatory and coding
sequences that are not found together in nature. Accordingly, a
chimeric gene may comprise regulatory sequences and coding
sequences that are derived from different sources, or regulatory
sequences and coding sequences derived from the same source, but
arranged in a manner different than that found in nature.
"Endogenous gene" refers to a native gene in its natural location
in the genome of an organism. "Foreign" refers to material not
normally found in the location of interest. Thus "foreign DNA" may
comprise both recombinant DNA as well as newly introduced,
rearranged DNA of the plant. A "foreign" gene refers to a gene not
normally found in the host organism, but that is introduced into
the host organism by gene transfer. Foreign genes can comprise
native genes inserted into a non-native organism, or chimeric
genes. A "transgene" is a gene that has been introduced into the
genome by a transformation procedure. The site in the plant genome
where a recombinant DNA has been inserted may be referred to as the
"insertion site" or "target site".
[0037] As used herein, "insert DNA" refers to the heterologous DNA
within the expression cassettes used to transform the plant
material while "flanking DNA" can exist of either genomic DNA
naturally present in an organism such as a plant, or foreign
(heterologous) DNA introduced via the transformation process which
is extraneous to the original insert DNA molecule, e.g. fragments
associated with the transformation event. A "flanking region" or
"flanking sequence" as used herein refers to a sequence of at least
20 base pair, preferably at least 50 base pair, and up to 5000 base
pair which is located either immediately upstream of and contiguous
with or immediately downstream of and contiguous with the original
foreign insert DNA molecule. Transformation procedures leading to
random integration of the foreign DNA will result in transformants
containing different flanking regions characteristic and unique for
each transformant. When recombinant DNA is introduced into a plant
through traditional crossing, its flanking regions will generally
not be changed. Transformants will also contain unique junctions
between a piece of heterologous insert DNA and genomic DNA, or 2
pieces of genomic DNA, or 2 pieces of heterologous DNA. A
"junction" is a point where 2 specific DNA fragments join. For
example, a junction exists where insert DNA joins flanking DNA. A
junction point also exists in a transformed organism where 2 DNA
fragments join together in a manner that is modified from that
found in the native organism. "Junction DNA" refers to DNA that
comprises a junction point.
[0038] As used herein, "heterologous" in reference to a nucleic
acid is a nucleic acid that originates from a foreign species, or,
if from the same species, is substantially modified from its native
form in composition and/or genomic locus by deliberate human
intervention. For example, a promoter operably linked to a
heterologous nucleotide sequence can be from a species different
from that from which the nucleotide sequence was derived, or, if
from the same species, the promoter is not naturally found operably
linked to the nucleotide sequence. A heterologous protein may
originate from a foreign species, or, if from the same species, is
substantially modified from its original form by deliberate human
intervention.
[0039] "Regulatory sequences" refer to nucleotide sequences located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences may include
promoters, translation leader sequences, introns, and
polyadenylation recognition sequences.
[0040] "Promoter" refers to a nucleotide sequence capable of
controlling the expression of a coding sequence or functional RNA.
In general, a coding sequence is located 3' to a promoter sequence.
The promoter sequence consists of proximal and more distal upstream
elements, the latter elements are often referred to as enhancers.
Accordingly, an "enhancer" is a nucleotide sequence that can
stimulate promoter activity and may be an innate element of the
promoter or a heterologous element inserted to enhance the level or
tissue-specificity of a promoter. Promoters may be derived in their
entirety from a native gene, or be composed of different elements
derived from different promoters found in nature, or even comprise
synthetic nucleotide segments. It is understood by those skilled in
the art that different promoters may direct the expression of a
gene in different tissues or cell types, or at different stages of
development, or in response to different environmental conditions.
Promoters that cause a nucleic acid fragment to be expressed in
most cell types at most times are commonly referred to as
"constitutive promoters". New promoters of various types useful in
plant cells are constantly being discovered; numerous examples may
be found in the compilation by Okamuro and Goldberg (1989)
Biochemistry of Plants 15:1-82. It is further recognized that since
in most cases the exact boundaries of regulatory sequences have not
been completely defined, nucleic acid fragments of different
lengths may have identical promoter activity.
[0041] The "translation leader sequence" refers to a nucleotide
sequence located between the promoter sequence of a gene and the
coding sequence. The translation leader sequence is present in the
fully processed mRNA upstream of the translation start sequence.
The translation leader sequence may affect numerous parameters
including, processing of the primary transcript to mRNA, mRNA
stability and/or translation efficiency. Examples of translation
leader sequences have been described (Turner and Foster (1995) Mol.
Biotechnol. 3:225-236).
[0042] The "3' non-coding sequences" refer to nucleotide sequences
located downstream of a coding sequence and include polyadenylation
recognition sequences and other sequences encoding regulatory
signals capable of affecting mRNA processing or gene expression.
The polyadenylation signal is usually characterized by affecting
the addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. The use of different 3' non-coding sequences is
exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
[0043] A "protein" or "polypeptide" is a chain of amino acids
arranged in a specific order determined by the coding sequence in a
polynucleotide encoding the polypeptide.
[0044] A DNA construct is an assembly of DNA molecules linked
together that provide one or more expression cassettes. The DNA
construct may be a plasmid that is enabled for self replication in
a bacterial cell and contains various endonuclease enzyme
restriction sites that are useful for introducing DNA molecules
that provide functional genetic elements, i.e., promoters, introns,
leaders, coding sequences, 3' termination regions, among others; or
a DNA construct may be a linear assembly of DNA molecules, such as
an expression cassette. The expression cassette contained within a
DNA construct comprise the necessary genetic elements to provide
transcription of a messenger RNA. The expression cassette can be
designed to express in prokaryote cells or eukaryotic cells.
Expression cassettes of the present invention are designed to
express most preferably in plant cells.
[0045] The DNA molecules of the invention are provided in
expression cassettes for expression in an organism of interest. The
cassette will include 5' and 3' regulatory sequences operably
linked to a coding sequence of the invention. "Operably linked"
means that the nucleic acid sequences being linked are contiguous
and, where necessary to join two protein coding regions, contiguous
and in the same reading frame. Operably linked is intended to
indicate a functional linkage between a promoter and a second
sequence, wherein the promoter sequence initiates and mediates
transcription of the DNA sequence corresponding to the second
sequence. The cassette may additionally contain at least one
additional gene to be cotransformed into the organism.
Alternatively, the additional gene(s) can be provided on multiple
expression cassettes or multiple DNA constructs.
[0046] The expression cassette will include in the 5' to 3'
direction of transcription: a transcriptional and translational
initiation region, a coding region, and a transcriptional and
translational termination region functional in the organism serving
as a host. The transcriptional initiation region (i.e., the
promoter) may be native or analogous, or foreign or heterologous to
the host organism. Additionally, the promoter may be the natural
sequence or alternatively a synthetic sequence. The expression
cassettes may additionally contain 5' leader sequences in the
expression cassette construct. Such leader sequences can act to
enhance translation.
[0047] It is to be understood that as used herein the term
"transgenic" includes any cell, cell line, callus, tissue, plant
part, or plant the genotype of which has been altered by the
presence of a heterologous nucleic acid including those transgenics
initially so altered as well as those created by sexual crosses or
asexual propagation from the initial transgenic. The term
"transgenic" as used herein does not encompass the alteration of
the genome (chromosomal or extra-chromosomal) by conventional plant
breeding methods or by naturally occurring events such as random
cross-fertilization, non-recombinant viral infection,
non-recombinant bacterial transformation, non-recombinant
transposition, or spontaneous mutation.
[0048] A transgenic "event" is produced by transformation of plant
cells with a heterologous DNA construct(s), including a nucleic
acid expression cassette that comprises a transgene of interest,
the regeneration of a population of plants resulting from the
insertion of the transgene into the genome of the plant, and
selection of a particular plant characterized by insertion into a
particular genome location. An event is characterized
phenotypically by the expression of the transgene. At the genetic
level, an event is part of the genetic makeup of a plant. The term
"event" also refers to progeny produced by a sexual outcross
between the transformant and another variety that include the
heterologous DNA. Even after repeated back-crossing to a recurrent
parent, the inserted DNA and flanking DNA from the transformed
parent is present in the progeny of the cross at the same
chromosomal location. The term "event" also refers to DNA from the
original transformant comprising the inserted DNA and flanking
sequence immediately adjacent to the inserted DNA that would be
expected to be transferred to a progeny that receives inserted DNA
including the transgene of interest as the result of a sexual cross
of one parental line that includes the inserted DNA (e.g., the
original transformant and progeny resulting from selfing) and a
parental line that does not contain the inserted DNA.
[0049] An insect resistant TC1507 corn plant can be bred by first
sexually crossing a first parental corn plant consisting of a corn
plant grown from the transgenic TC1507 corn plant and progeny
thereof derived from transformation with the expression cassettes
of the present invention that confers insect resistance, and a
second parental corn plant that lacks insect resistance, thereby
producing a plurality of first progeny plants; and then selecting a
first progeny plant that is resistant to insects; and selfing the
first progeny plant, thereby producing a plurality of second
progeny plants; and then selecting from the second progeny plants
an insect resistant plant. These steps can further include the
back-crossing of the first insect resistant progeny plant or the
second insect resistant progeny plant to the second parental corn
plant or a third parental corn plant, thereby producing a corn
plant that is resistant to insects.
[0050] As used herein, the term "plant" includes reference to whole
plants, plant organs (e.g., leaves, stems, roots, etc.), seeds,
plant cells, and progeny of same. Parts of transgenic plants
understood to be within the scope of the invention comprise, for
example, plant cells, protoplasts, tissues, callus, embryos as well
as flowers, stems, fruits, leaves, and roots originating in
transgenic plants or their progeny previously transformed with a
DNA molecule of the invention and therefore consisting at least in
part of transgenic cells, are also an aspect of the present
invention.
[0051] As used herein, the term "plant cell" includes, without
limitation, seeds, suspension cultures, embryos, meristematic
regions, callus tissue, leaves, roots, shoots, gametophytes,
sporophytes, pollen, and microspores. The class of plants that can
be used in the methods of the invention is generally as broad as
the class of higher plants amenable to transformation techniques,
including both monocotyledonous and dicotyledonous plants.
[0052] "Transformation" refers to the transfer of a nucleic acid
fragment into the genome of a host organism, resulting in
genetically stable inheritance. Host organisms containing the
transformed nucleic acid fragments are referred to as "transgenic"
organisms. Examples of methods of plant transformation include
Agrobacterium-mediated transformation (De Blaere et al. (1987)
Meth. Enzymol. 143:277) and particle-accelerated or "gene gun"
transformation technology (Klein et al. (1987) Nature (London)
327:70-73; U.S. Pat. No. 4,945,050, incorporated herein by
reference). Additional transformation methods are disclosed
below.
[0053] Thus, isolated polynucleotides of the present invention can
be incorporated into recombinant constructs, typically DNA
constructs, which are capable of introduction into and replication
in a host cell. Such a construct can be a vector that includes a
replication system and sequences that are capable of transcription
and translation of a polypeptide-encoding sequence in a given host
cell. A number of vectors suitable for stable transfection of plant
cells or for the establishment of transgenic plants have been
described in, e.g., Pouwels et al., (1985; Supp. 1987) Cloning
Vectors: A Laboratory Manual, Weissbach and Weissbach (1989)
Methods for Plant Molecular Biology, (Academic Press, New York);
and Flevin et al., (1990) Plant Molecular Biology Manual, (Kluwer
Academic Publishers). Typically, plant expression vectors include,
for example, one or more cloned plant genes under the
transcriptional control of 5' and 3' regulatory sequences and a
dominant selectable marker. Such plant expression vectors also can
contain a promoter regulatory region (e.g., a regulatory region
controlling inducible or constitutive, environmentally- or
developmentally-regulated, or cell- or tissue-specific expression),
a transcription initiation start site, a ribosome binding site, an
RNA processing signal, a transcription termination site, and/or a
polyadenylation signal.
[0054] It is also to be understood that two different transgenic
plants can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce plants that are homozygous for both
added, exogenous genes. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated, as
is vegetative propagation. Descriptions of other breeding methods
that are commonly used for different traits and crops can be found
in one of several references, e.g., Fehr, in Breeding Methods for
Cultivar Development, Wilcos J. ed., American Society of Agronomy,
Madison Wis. (1987).
[0055] A "probe" is an isolated nucleic acid to which is attached a
conventional detectable label or reporter molecule, e.g., a
radioactive isotope, ligand, chemiluminescent agent, or enzyme.
Such a probe is complementary to a strand of a target nucleic acid,
in the case of the present invention, to a strand of isolated DNA
from corn event TC1507 whether from a corn plant or from a sample
that includes DNA from the event. Probes according to the present
invention include not only deoxyribonucleic or ribonucleic acids
but also polyamides and other probe materials that bind
specifically to a target DNA sequence and can be used to detect the
presence of that target DNA sequence.
[0056] "Primers" are isolated nucleic acids that are annealed to a
complementary target DNA strand by nucleic acid hybridization to
form a hybrid between the primer and the target DNA strand, then
extended along the target DNA strand by a polymerase, e.g., a DNA
polymerase. Primer pairs of the present invention refer to their
use for amplification of a target nucleic acid sequence, e.g., by
the polymerase chain reaction (PCR) or other conventional
nucleic-acid amplification methods. "PCR" or "polymerase chain
reaction" is a technique used for the amplification of specific DNA
segments (see, U.S. Pat. Nos. 4,683,195 and 4,800,159; herein
incorporated by reference).
[0057] Probes and primers are of sufficient nucleotide length to
bind to the target DNA sequence specifically in the hybridization
conditions or reaction conditions determined by the operator. This
length may be of any length that is of sufficient length to be
useful in a detection method of choice. Generally, 11 nucleotides
or more in length, preferably 18 nucleotides or more, and more
preferably 22 nucleotides or more, are used. Such probes and
primers hybridize specifically to a target sequence under high
stringency hybridization conditions. Preferably, probes and primers
according to the present invention have complete DNA sequence
similarity of contiguous nucleotides with the target sequence,
although probes differing from the target DNA sequence and that
retain the ability to hybridize to target DNA sequences may be
designed by conventional methods. Probes can be used as primers,
but are generally designed to bind to the target DNA or RNA and not
be used in an amplification process.
[0058] Specific primers can be used to amplify an integration
fragment to produce an amplicon that can be used as a "specific
probe" for identifying event TC1507 in biological samples. When the
probe is hybridized with the nucleic acids of a biological sample
under conditions which allow for the binding of the probe to the
sample, this binding can be detected and thus allow for an
indication of the presence of event TC1507 in the biological
sample. Such identification of a bound probe has been described in
the art. The specific probe is preferably a sequence which, under
optimized conditions, hybridizes specifically to a region within
the 5' or 3' flanking region of the event and preferably also
comprises a part of the foreign DNA contiguous therewith.
Preferably the specific probe comprises a sequence of at least 80%,
preferably between 80 and 85%, more preferably between 85 and 90%,
especially preferably between 90 and 95%, and most preferably
between 95 and 100% identical (or complementary) to a specific
region of the event.
[0059] Methods for preparing and using probes and primers are
described, for example, in Molecular Cloning: A Laboratory Manual,
2.sup.nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. 1989 (hereinafter,
"Sambrook et al., 1989"); Current Protocols in Molecular Biology,
ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New
York, 1992 (with periodic updates) (hereinafter, "Ausubel et al.,
1992"); and Innis et al., PCR Protocols: A Guide to Methods and
Applications, Academic Press: San Diego, 1990. PCR primer pairs can
be derived from a known sequence, for example, by using computer
programs intended for that purpose such as the PCR primer analysis
tool in Vector NTI version 6 (Informax Inc., Bethesda Md.);
PrimerSelect (DNASTAR Inc., Madison, Wis.); and Primer (Version
0.5, .COPYRGT. 1991, Whitehead Institute for Biomedical Research,
Cambridge, Mass.). Additionally, the sequence can be visually
scanned and primers manually identified using guidelines known to
one of skill in the art.
[0060] A "kit" as used herein refers to a set of reagents for the
purpose of performing the method of the invention, more
particularly, the identification of the event TC1507 in biological
samples. The kit of the invention can be used, and its components
can be specifically adjusted, for purposes of quality control (e.g.
purity of seed lots), detection of event TC1507 in plant material,
or material comprising or derived from plant material, such as but
not limited to food or feed products. "Plant material" as used
herein refers to material which is obtained or derived from a
plant.
[0061] Primers and probes based on the flanking DNA and insert
sequences disclosed herein can be used to confirm (and, if
necessary, to correct) the disclosed sequences by conventional
methods, e.g., by re-cloning and sequencing such sequences. The
nucleic acid probes and primers of the present invention hybridize
under stringent conditions to a target DNA sequence. Any
conventional nucleic acid hybridization or amplification method can
be used to identify the presence of DNA from a transgenic event in
a sample. Nucleic acid molecules or fragments thereof are capable
of specifically hybridizing to other nucleic acid molecules under
certain circumstances. As used herein, two nucleic acid molecules
are said to be capable of specifically hybridizing to one another
if the two molecules are capable of forming an anti-parallel,
double-stranded nucleic acid structure.
[0062] A nucleic acid molecule is said to be the "complement" of
another nucleic acid molecule if they exhibit complete
complementarity. As used herein, molecules are said to exhibit
"complete complementarity" when every nucleotide of one of the
molecules is complementary to a nucleotide of the other. Two
molecules are said to be "minimally complementary" if they can
hybridize to one another with sufficient stability to permit them
to remain annealed to one another under at least conventional
"low-stringency" conditions. Similarly, the molecules are said to
be "complementary" if they can hybridize to one another with
sufficient stability to permit them to remain annealed to one
another under conventional "high-stringency" conditions.
Conventional stringency conditions are described by Sambrook et
al., 1989, and by Haymes et al., In: Nucleic Acid Hybridization, a
Practical Approach, IRL Press, Washington, D.C. (1985), departures
from complete complementarity are therefore permissible, as long as
such departures do not completely preclude the capacity of the
molecules to form a double-stranded structure. In order for a
nucleic acid molecule to serve as a primer or probe it need only be
sufficiently complementary in sequence to be able to form a stable
double-stranded structure under the particular solvent and salt
concentrations employed.
[0063] In hybridization reactions, specificity is typically the
function of post-hybridization washes, the critical factors being
the ionic strength and temperature of the final wash solution. The
thermal melting point (Tm) is the temperature (under defined ionic
strength and pH) at which 50% of a complementary target sequence
hybridizes to a perfectly matched probe. For DNA-DNA hybrids, the
Tm can be approximated from the equation of Meinkoth and Wahl
(1984) Anal. Biochem. 138:267-284: Tm=81.5.degree. C.+16.6 (log
M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. Tm is reduced by about 1.degree. C. for each
1% of mismatching; thus, Tm, hybridization, and/or wash conditions
can be adjusted to hybridize to sequences of the desired identity.
For example, if sequences with >90% identity are sought, the Tm
can be decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the Tm for the
specific sequence and its complement at a defined ionic strength
and pH. However, severely stringent conditions can utilize a
hybridization and/or wash at 1, 2, 3, or 4.degree. C. lower than
the Tm; moderately stringent conditions can utilize a hybridization
and/or wash at 6, 7, 8, 9, or 10.degree. C. lower than the Tm; low
stringency conditions can utilize a hybridization and/or wash at
11, 12, 13, 14, 15, or 20.degree. C. lower than the Tm.
[0064] Using the equation, hybridization and wash compositions, and
desired Tm, those of ordinary skill will understand that variations
in the stringency of hybridization and/or wash solutions are
inherently described. If the desired degree of mismatching results
in a Tm of less than 45.degree. C. (aqueous solution) or 32.degree.
C. (formamide solution), it is preferred to increase the SSC
concentration so that a higher temperature can be used. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, New York); and Ausubel et al., eds. (1995) Current
Protocols in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0065] As used herein, a substantially homologous sequence is a
nucleic acid molecule that will specifically hybridize to the
complement of the nucleic acid molecule to which it is being
compared under high stringency conditions. Appropriate stringency
conditions which promote DNA hybridization, for example, 6.times.
sodium chloride/sodium citrate (SSC) at about 45.degree. C.,
followed by a wash of 2.times.SSC at 50.degree. C., are known to
those skilled in the art or can be found in Current Protocols in
Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
Typically, stringent conditions will be those in which the salt
concentration is less than about 1.5 M Na ion, typically about 0.01
to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and
the temperature is at least about 30.degree. C. for short probes
(e.g., 10 to 50 nucleotides) and at least about 60.degree. C. for
long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of a
destabilizing agent such as formamide. Exemplary low stringency
conditions include hybridization with a buffer solution of 30 to
35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at
37.degree. C., and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Exemplary moderate stringency conditions include
hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at
37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C. Exemplary high stringency conditions include
hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C.,
and a wash in 0.1.times.SSC at 60 to 65.degree. C. In a preferred
embodiment, a nucleic acid of the present invention will
specifically hybridize to one or more of the nucleic acid molecules
unique to the TC1507 event or complements thereof or fragments of
either under moderately stringent conditions.
[0066] Methods of alignment of sequences for comparison are well
known in the art. Thus, the determination of percent identity
between any two sequences can be accomplished using a mathematical
algorithm. Non-limiting examples of such mathematical algorithms
are the algorithm of Myers and Miller (1988) CABIOS 4:11-17; the
local homology algorithm of Smith et al. (1981) Adv. Appl. Math.
2:482; the homology alignment algorithm of Needleman and Wunsch
(1970) J. Mol. Biol. 48:443-453; the search-for-similarity-method
of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-2448;
the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci.
USA 87:2264, modified as in Karlin and Altschul (1993) Proc. Natl.
Acad. Sci. USA 90:5873-5877.
[0067] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0); the ALIGN
PLUS program (version 3.0, copyright 1997); and GAP, BESTFIT,
BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software
Package, Version 10 (available from Accelrys, 9685 Scranton Road,
San Diego, Calif. 92121, USA). Alignments using these programs can
be performed using the default parameters.
[0068] The CLUSTAL program is well described by Higgins and Sharp,
Gene 73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153
(1989); Corpet, et al., Nucleic Acids Research 16: 10881-90 (1988);
Huang, et al., Computer Applications in the Biosciences 8: 155-65
(1992), and. Pearson, et al., Methods in Molecular Biology 24:
307-331 (1994). The ALIGN and the ALIGN PLUS programs are based on
the algorithm of Myers and Miller (1988) supra. The BLAST programs
of Altschul et al. (1990) J. Mol. Biol. 215:403 are based on the
algorithm of Karlin and Altschul (1990) supra. The BLAST family of
programs which can be used for database similarity searches
includes: BLASTN for nucleotide query sequences against nucleotide
database sequences; BLASTX for nucleotide query sequences against
protein database sequences; BLASTP for protein query sequences
against protein database sequences; TBLASTN for protein query
sequences against nucleotide database sequences; and TBLASTX for
nucleotide query sequences against nucleotide database sequences.
See, Current Protocols in Molecular Biology, Chapter 19, Ausubel,
et al., Eds., Greene Publishing and Wiley-Interscience, New York
(1995). Alignment may also be performed manually by inspection.
[0069] To obtain gapped alignments for comparison purposes, Gapped
BLAST (in BLAST 2.0) can be utilized as described in Altschul et
al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in
BLAST 2.0) can be used to perform an iterated search that detects
distant relationships between molecules. See Altschul et al. (1997)
supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default
parameters of the respective programs (e.g., BLASTN for nucleotide
sequences, BLASTX for proteins) can be used. See
www.ncbi.hlm.nih.gov.
[0070] As used herein, "sequence identity" or "identity" in the
context of two nucleic acid or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. When sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said
to have "sequence similarity" or "similarity". Means for making
this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif.).
[0071] As used herein, "percentage of sequence identity" means the
value determined by comparing two optimally aligned sequences over
a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0072] Regarding the amplification of a target nucleic acid
sequence (e.g., by PCR) using a particular amplification primer
pair, "stringent conditions" are conditions that permit the primer
pair to hybridize only to the target nucleic-acid sequence to which
a primer having the corresponding wild-type sequence (or its
complement) would bind and preferably to produce a unique
amplification product, the amplicon, in a DNA thermal amplification
reaction.
[0073] The term "specific for (a target sequence)" indicates that a
probe or primer hybridizes under stringent hybridization conditions
only to the target sequence in a sample comprising the target
sequence.
[0074] As used herein, "amplified DNA" or "amplicon" refers to the
product of nucleic acid amplification of a target nucleic acid
sequence that is part of a nucleic acid template. For example, to
determine whether a corn plant resulting from a sexual cross
contains transgenic event genomic DNA from the corn plant of the
present invention, DNA extracted from the corn plant tissue sample
may be subjected to a nucleic acid amplification method using a DNA
primer pair that includes a first primer derived from flanking
sequence adjacent to the insertion site of inserted heterologous
DNA, and a second primer derived from the inserted heterologous DNA
to produce an amplicon that is diagnostic for the presence of the
event DNA. Alternatively, the second primer may be derived from the
flanking sequence. The amplicon is of a length and has a sequence
that is also diagnostic for the event. The amplicon may range in
length from the combined length of the primer pairs plus one
nucleotide base pair to any length of amplicon producible by a DNA
amplification protocol. Alternatively, primer pairs can be derived
from flanking sequence on both sides of the inserted DNA so as to
produce an amplicon that includes the entire insert nucleotide
sequence of the PH18999A expression construct, see FIG. 1,
approximately 6.2 Kb in size. A member of a primer pair derived
from the flanking sequence may be located a distance from the
inserted DNA sequence, this distance can range from one nucleotide
base pair up to the limits of the amplification reaction, or about
twenty thousand nucleotide base pairs. The use of the term
"amplicon" specifically excludes primer dimers that may be formed
in the DNA thermal amplification reaction.
[0075] Nucleic acid amplification can be accomplished by any of the
various nucleic acid amplification methods known in the art,
including the polymerase chain reaction (PCR). A variety of
amplification methods are known in the art and are described, inter
alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR
Protocols: A Guide to Methods and Applications, ed. Innis et al.,
Academic press, San Diego, 1990. PCR amplification methods have
been developed to amplify up to 22 Kb of genomic DNA and up to 42
Kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA
91:5695-5699, 1994). These methods as well as other methods known
in the art of DNA amplification may be used in the practice of the
present invention. It is understood that a number of parameters in
a specific PCR protocol may need to be adjusted to specific
laboratory conditions and may be slightly modified and yet allow
for the collection of similar results. These adjustments will be
apparent to a person skilled in the art.
[0076] The amplicon produced by these methods may be detected by a
plurality of techniques, including, but not limited to, Genetic Bit
Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994)
where a DNA oligonucleotide is designed which overlaps both the
adjacent flanking DNA sequence and the inserted DNA sequence. The
oligonucleotide is immobilized in wells of a microwell plate.
Following PCR of the region of interest (using one primer in the
inserted sequence and one in the adjacent flanking sequence) a
single-stranded PCR product can be hybridized to the immobilized
oligonucleotide and serve as a template for a single base extension
reaction using a DNA polymerase and labeled ddNTPs specific for the
expected next base. Readout may be fluorescent or ELISA-based. A
signal indicates presence of the insert/flanking sequence due to
successful amplification, hybridization, and single base
extension.
[0077] Another detection method is the Pyrosequencing technique as
described by Winge (Innov. Pharma. Tech. 00: 18-24, 2000). In this
method an oligonucleotide is designed that overlaps the adjacent
DNA and insert DNA junction. The oligonucleotide is hybridized to a
single-stranded PCR product from the region of interest (one primer
in the inserted sequence and one in the flanking sequence) and
incubated in the presence of a DNA polymerase, ATP, sulfurylase,
luciferase, apyrase, adenosine 5' phosphosulfate and luciferin.
dNTPs are added individually and the incorporation results in a
light signal which is measured. A light signal indicates the
presence of the transgene insert/flanking sequence due to
successful amplification, hybridization, and single or multi-base
extension.
[0078] Fluorescence Polarization as described by Chen et al.,
(Genome Res. 9:492-498, 1999) is a method that can be used to
detect an amplicon of the present invention. Using this method an
oligonucleotide is designed which overlaps the flanking and
inserted DNA junction. The oligonucleotide is hybridized to a
single-stranded PCR product from the region of interest (one primer
in the inserted DNA and one in the flanking DNA sequence) and
incubated in the presence of a DNA polymerase and a
fluorescent-labeled ddNTP. Single base extension results in
incorporation of the ddNTP. Incorporation can be measured as a
change in polarization using a fluorometer. A change in
polarization indicates the presence of the transgene
insert/flanking sequence due to successful amplification,
hybridization, and single base extension.
[0079] Taqman.RTM. (PE Applied Biosystems, Foster City, Calif.) is
described as a method of detecting and quantifying the presence of
a DNA sequence and is fully understood in the instructions provided
by the manufacturer. Briefly, a FRET oligonucleotide probe is
designed which overlaps the flanking and insert DNA junction. The
FRET probe and PCR primers (one primer in the insert DNA sequence
and one in the flanking genomic sequence) are cycled in the
presence of a thermostable polymerase and dNTPs. Hybridization of
the FRET probe results in cleavage and release of the fluorescent
moiety away from the quenching moiety on the FRET probe. A
fluorescent signal indicates the presence of the flanking/transgene
insert sequence due to successful amplification and
hybridization.
[0080] Molecular Beacons have been described for use in sequence
detection as described in Tyangi et al. (Nature Biotech.
14:303-308, 1996). Briefly, a FRET oligonucleotide probe is
designed that overlaps the flanking and insert DNA junction. The
unique structure of the FRET probe results in it containing
secondary structure that keeps the fluorescent and quenching
moieties in close proximity. The FRET probe and PCR primers (one
primer in the insert DNA sequence and one in the flanking sequence)
are cycled in the presence of a thermostable polymerase and dNTPs.
Following successful PCR amplification, hybridization of the FRET
probe to the target sequence results in the removal of the probe
secondary structure and spatial separation of the fluorescent and
quenching moieties. A fluorescent signal results. A fluorescent
signal indicates the presence of the flanking/transgene insert
sequence due to successful amplification and hybridization.
[0081] A hybridization reaction using a probe specific to a
sequence found within the amplicon is yet another method used to
detect the amplicon produced by a PCR reaction.
[0082] The present invention is further defined in the following
Examples. It should be understood that these Examples, while
indicating preferred embodiments of the invention, are given by way
of illustration only. From the above discussion and these Examples,
one skilled in the art can ascertain the essential characteristics
of this invention, and without departing from the spirit and scope
thereof, can make various changes and modifications of the
invention to adapt it to various usages and conditions. Thus,
various modifications of the invention, in addition to those shown
and described herein, will be apparent to those skilled in the art
from the foregoing description. Such modifications are also
intended to fall within the scope of the appended claims.
[0083] The disclosure of each reference set forth herein is
incorporated herein by reference in its entirety.
EXAMPLES
Example 1
Transformation of Maize by Particle Bombardment and Regeneration of
Transgenic Plants Containing the Cry1F Gene
[0084] A DNA molecule of 6.2 Kb, designated PH18999A (see FIG. 1
and SEQ ID NO:25), which includes a first transgene expression
cassette comprising the promoter, 5' untranslated exon, and first
intron of the maize ubiquitin (Ubi-1) gene (Christensen et al.
(1992) Plant Mol. Biol. 18:675-689 and Christensen and Quail (1996)
Transgenic Res. 5:213-218) operably connected to a DNA molecule
encoding a Bacillus thuringiensis 6-endotoxin identified as Cry1F
(U.S. Pat. Nos. 5,188,960 and 6,218,188) operably connected to a
DNA molecule comprising a 3' ORF25 transcriptional terminator
isolated from Agrobacterium tumefaciens (Barker et al. (1983) Plant
Mol. Biol. 2:335-350), and a second transgene expression cassette
comprising a DNA molecule of the cauliflower mosaic virus (CaMV)
.sup.35S promoter (Odell J. T. et al. (1985) Nature 313: 810-812;
Mitsuhara et al. (1996) Plant Cell Physiol. 37:49-59) operably
connected to a DNA molecule encoding the selectable marker,
phosphinothricin acetyltransferase (PAT) gene (Wohlleben W. et al.
(1988) Gene 70:25-37) operably connected to a DNA molecule
comprising a 3' transcriptional terminator from (CaMV) .sup.35S
(see Mitsuhara et al. (1996) Plant Cell Physiol. 37:49-59) was used
to transform maize embryo tissue.
[0085] B.t. Cry1F maize plants were obtained by microprojectile
bombardment using the Biolistics.RTM. PDS-1000He particle gun
manufactured by Bio-Rad, Hercules, Calif.; essentially as described
by Klein et al. (1987) Nature, UK 327(6117):70-73. Immature embryos
isolated from maize ears, harvested soon after pollination were
cultured on callus initiation medium for several days. On the day
of transformation, microscopic tungsten particles were coated with
purified PH18999A DNA (SEQ ID NO:25) and accelerated into the
cultured embryos, where the insert DNA was incorporated into the
cell chromosome. Only insert PH18999A was used during
transformation and no additional plasmid DNA was incorporated into
the transformant. After bombardment, embryos were transferred to
callus initiation medium containing glufosinate as the selection
agent. Individual embryos were kept physically separate during
culture, and the majority of explants died on the selective
medium.
[0086] Those embryos that survived and produced healthy,
glufosinate-resistant callus tissue were assigned unique
identification codes representing putative transformation events,
and continually transferred to fresh selection medium. Plants were
regenerated from tissue derived from each unique event and
transferred to the greenhouse. Leaf samples were taken for
molecular analysis to verify the presence of the transgene by PCR
and to confirm expression of the Cry1F protein by ELISA. Plants
were then subjected to a whole plant bioassay using European corn
borer insects. Positive plants were crossed with inbred lines to
obtain seed from the initial transformed plants. A number of lines
were evaluated in the field. The TC1507 event was selected from a
population of independent transgenic events based on a superior
combination of characteristics, including insect resistance and
agronomic performance (see Bing J W et al. (2000) Efficacy of Cry1F
Transgenic Maize, 14.sup.th Biennial International Plant Resistance
to Insects Workshop, fort Collins, Colo., herein incorporated by
reference).
Example 2
Identification of Nucleotides Comprising the Flanking Sequence 5'
to the Transgenic Insert DNA in Bacillus thuringiensis Cry1F Maize
Line TC1507
[0087] To identify a DNA fragment that included sequence 5' to the
PH18999A insert in event TC1507, Spe I restriction enzyme fragments
from event TC1507 genomic DNA were size selected on agarose gels,
purified, and screened by Southern analysis to confirm
hybridization to a Cry1F probe. Following confirmation of
hybridization and fragment size, the fragments of interest were
cloned into a pBluescript II SK (+).TM. cloning vector to prepare
an enriched size selected plasmid based genomic DNA library. A
probe homologous to a portion of the Cry1F gene was used to screen
the plasmid library for positive clones. A positive clone was
identified, purified by additional screening, and confirmed to
result in a positive signal when hybridized to the Cry1F probe.
Nearly 3 Kb of the Spe I fragment contained in the isolated
positive clone was sequenced using a primer walking approach. To
initiate the first sequencing run, a primer that binds to a known
sequence in the cloning vector DNA was designed to sequence a
portion of the DNA of interest. A second sequencing run over the
same region using another primer oriented in the reverse direction
provided second strand coverage. Primer walking was accomplished by
repeatedly using sequence data from previous runs to design new
primers that were then used to extend the next round of sequencing
further into the DNA of interest until the flanking sequence 5' to
the inserted transgenic DNA in maize event TC1507 was obtained.
Specific sequence information is provided in Example 4.
Example 3
Confirmation of Flanking Sequence 5' to the B.t. Cry1F Maize Line
TC1507 Insert
[0088] To confirm the 5' flanking sequence of the B.t. Cry1F maize
line TC1507 insert, PCR primer pairs were designed to obtain
overlapping PCR products extending from the 5' flanking region into
the full-length PH18999A transgenic insert. PCR products were
successfully amplified from B.t. Cry1F maize line TC1507 genomic
DNA, isolated, and sequenced for Region 1 through Region 6, shown
in Table 1, and confirmed to match the previously determined
sequence from the Spe I fragment, described in Example 2. However,
the region from bp 2358 to bp 2829, immediately adjacent and 5' to
the start of the full-length insert was recalcitrant to PCR
amplification and appeared to be larger than the sequence obtained
from the Spe I clone described above. The use of primer pairs
flanking this region and the Advantage.RTM.-GC 2 Polymerase Mix (BD
Biosciences Clontech, Palo Alto, Calif.) was successful in
amplifying PCR products from B.t. Cry1F maize line TC1507 genomic
DNA for sequencing. The amplification conditions used to produce
amplicons with the Advantage.RTM.-GC 2 system are shown in Table
10. The DNA primer pairs used to confirm the sequence in the region
from bp 2358 to 2829 are those listed in SEQ ID NO: 1 and SEQ ID
NO:2; and SEQ ID NO:2 and SEQ ID NO:23. Sequence from this region
is described in Table 1 (Regions 7a, 7b, 7c, and 8).
Example 4
Event TC1507 5' Flanking Sequence.
[0089] A description of each region is provided in Table 1.
TABLE-US-00002 Region 1 (SEQ ID NO: 28) Maize genomic (no
significant homology) 1 ACTAGTTTCC TAGCCCGCGT CGTGCCCCTA CCCCACCGAC
GTTTATGGAA 51 GGTGCCATTC CACGGTTCTT CGTGGCCGCC CCTAAGGATG
TAAATGGTCG 101 GTAAAATCCG GTAAATTTCC GGTACCGTTT ACCAGATTTT
TCCAGCCGTT 151 TTCGGATTTA TCGGGATATA CAGAAAACGA GACGGAAACG
GAATAGGTTT 201 TTTTTCGAAA ACGGTACGGT AAACGGTGAG ACAAACTTAC
CGTCCGTTTT 251 CGTATTTCTC GGGAAACTCT GGTATATTCC CGTATTTGTC
CCGTATTTTC 301 CCGACCCACG GACCTGCCAA TCAACCATCA GCCAGTCAGC
CCATCCCCAC 351 AGCTATGGCC CATGGGGCCA TGTTGGCCAC ATGCCCACGC
AACGCAAGGC 401 AGTAAGGCTG GCAGCCTGGC ACGCATTGAC GCATGTGGAC
ACACACAGCC 451 GCCGCCTGTT CGTGTTTCTG TGCCGTTGTG CGAGACTGTG
ACTGCGAGTG 501 GCGGAGTCGG CGAACGGCGA GGCGTCTCCG GAGTCTGGAC
TGCGGCTGTG 551 GACAGCGACG CTGTGACGGC GACTCGGCGA AGCCCCAAGC
TACCAAGCCC 601 CCAAGTCCCC ATCCATCTCT GCTTCTCTGG TCATCTCCTT
CCCCTGGTCG 651 ATCTGCAGGC GCCAGACCG Region 2 (SEQ ID NO: 29)
Undescribed maize genomic sequence (complement) 670 G CCGAAGCATC
ACGAAACGCA CTAAGACCTC 701 GAAGGAGTCA AACCACTCCT CCGAGGCCTC
GGGGGCTACA CCCGGCGGGT 751 GCGCTCGCGC GCACCCACCG GAACAAAATG
TAACCGAGAA AGGTCGGTCC 801 CCTTGCAAAA AAAGTGCGAC AAAAGCCTCC
AAGCGAGTAT TAACACTCAC 851 TTTGAGGCTC GGGGGCTAC Region 3 (SEQ ID NO:
30) Fragment of maize Huck-1 retrotransposon 870 T GTCGGGGACC
ATAATTAGGG GTACCCCCAA 901 GACTCCTAAT CTCAGCTGGT AACCCCCATC
AGCACAAAGC TGCAAAGGCC 951 TGATGGGTGC GATTAAGTCA AGGCTCGGTC
CACTCAAGGG ACACGATCTC 1001 GCCTCGCCCG AGCCCAGCCT CGGGCAAGGG
CGGCCGACCC CGAGGATTCA 1051 CGTCTCGCCC GAGGGCCCCC TCAAGCGACG
GGCACACCTT CGGCTCGCCC 1101 GAGGCCCATT CTTCGCCGAG AAGCAACCTT
GGCCAGATCG CCACACCGAC 1151 CGACCGTATC GCAGGAGCAT TTAATGCGAG
GATCGCCTGA CACCTTATCC 1201 TGACGCGCGC TCTTCAGTCG ACAGAGCCGA
AGTGACCGCA ATCACTTCGC 1251 CGCTCCACTG ACCGACCTGA CAAGAAGACA
GCGCCGCCTG CGTCGCTCCG 1301 ACTGCTGTGC CACTCGACAG AGTGAGGCTG
ACAGCAGCCA AGTCCGGCCT 1351 CGGGCGCCAT AGGAAGCTCC GCCTCGCCCG
ACCCTAGGGC TCGGACTCGG 1401 CCTCGGCTCC GGAAGACGAC GAACTACGCT
TCGCCCGACC CCAGGGCTTG 1451 GACTCAGCCT CGGCTCCGGA AGACGACGAA
TTCCGCCTCG CCCGACCCCA 1501 GGGCTCGGAC TCGGCCTCGG CTCCAGAAGA
CGACGAACTC CGCCTCGCCC 1551 GACCCCAGGG CTCGGACTCA GCCTCGGCTC
CGGAAGACGA CGAACTCCGC 1601 CTCGCCCGAC CCCAGGGCTC GGACTCAGCC
TCGGCCTCAG ACGATGGTCT 1651 CCGCCTCGCC CGACCCGGGG CTCGGACTCG A
Region 4 (SEQ ID NO: 31) Fragment of cry1F gene 1682 CCTTTCTAT
CGGACCTTGT 1701 CAGATCCTGT CTTCGTCCGA GGAGGCTTTG GCAATCCTCA
CTATGTACTC 1751 GGTCTTAGGG GAGTGGCCTT TCAACAAACT GGTACGAATC
ACACCCGCAC 1801 ATTCAGGAAC TCCGGGACCA TTGACTCTCT AGATGAGATA
CCACCTCAAG 1851 ACAACAGCGG CGCACCTTGG AATGACTACT CCCATGTGCT
GAATCATGTT 1901 ACCTTTGTGC GCTGGCCAGG TGAGATCTCA GGTTCCGACT
CATGGAGAGC 1951 ACCAATGTTC TCTTGGACGC ATCGTAGCGC TACCCCCACA
AACACCATTG 2001 ATCCAGAGAG AATCAC Region 5 (SEQ ID NO: 32) Fragment
of maize chloroplast rpoC2 gene 2017 TCAT TCTTCAAGAA CTGCATATCT
TGCCGAGATC 2051 CTCATCCCTA AAGGTACTTG ACAATAGTAT TATTGGAGTC
GATACACAAC 2101 TCACAAAAAA TACAAGAAGT CGACTAGGTG GATTGGTCCG
AGTGAAGAGA 2151 AAAAAAAGCC ATACAGAACT CAAAATCTTT TCCGGAGATA
TTCATTTTCC 2201 TGAAGAGGCG GATAAGATAT TAGGTGGCAG TTTGATACCA
CCAGAAAGAG 2251 AAAAAAAAGA TTCTAAGGAA TCAAAAAAAA GGAAAAATTG
GGTTTATGTT 2301 CAACGGAAAA AATTTCTCAA AAGCAAGGAA AAGTATT Region 6
(SEQ ID NO: 33) Fragment of maize chloroplast or ubiZM1(2) promoter
2338 GTG GCTATTTATC 2351 TATC Nucleotides 2355-2358 (CGT) connect
Region 6 to Region 7a. Region 7a (SEQ ID NO: 34) Fragment of pat
gene 2358 GCA GCTGATATGG CCGCGGTTTG TGATATCGTT AACCATTACA 2401
TTGAGACGTC TACAGTGAAC TTTAGGACAG AGCCACAAAC ACCACAAGAG 2451
TGGATTGATG ATCTAGAGAG GTTGCAAGAT AGATACCCTT GGTTGGTTGC 2501
TGAGGTTGAG GGTGTTGTGG CTGGTATTGC TTACGCTGGG CCCTGGAAGG 2551
CTAGGAAC Region 7b (SEQ ID NO: 35) Fragment of pat gene
(complement) (complement) 2559 CC TCAACCTCAG CAACCAACCA ATGGTATCTA
TCTTGCAACC 2601 TCTCTAGATC ATCAATCCAC TCTTGTGGTG TTTGTGGCTC
TGTCCTAAAG 2651 TTCACTGTAG ACGTCTCAAT GTAATGGTTA ACGATATCAC AAACCG
Region 7c (SEQ ID NO: 36) Fragment of cry1F gene (complement) 2697
AGAG 2701 AAGAGGGATC T Region 8 (SEQ ID NO: 37) Fragment of
Polylinker 2712 CGAAGCTTC GGCCGGGGCC CATCGATATC CGCGGGCATG 2751
CCTGCAGTGC AGCGTGACCC GGTCGTGCCC CTCTCTAGAG ATAATGAGCA 2801
TTGCATGTCT AAGTTATAAA AAATTACCA Region 9 (SEQ ID NO: 25)
Full-length insert of PHI8999A
Example 5
Description of the Flanking Sequence 5' to the Insert in Maize
Event TC1507
[0090] In order to more fully describe the event TC1507 5' flanking
sequence, homology searching was done against the GenBank public
databases (release 122, 2/01) using the Basic Local Alignment
Search Tool (BLAST). The BLAST program performs sequence similarity
searching and is particularly useful for identifying homologs to an
unknown sequence. In addition to searching the public databases,
pairwise alignments were performed using AlignX (InforMax Inc.,
Bethesda, Md.) to look for homology between the maize event TC1507
flanking sequence and the PH18999A transgenic insert. The results
of these homology searches are presented in Table 1. The TC1507 5'
flanking sequence is numbered with base 1 being the furthest 5' to
the insert and base 2830 at the starting point of the full-length
PH18999A transgenic insert (see FIG. 1). The percent identity
values indicate the percentage of identical matches across the
length of the sequences analyzed.
[0091] In most cases, similarity searching with the event TC1507 5'
flanking sequence resulted in a match to one unique sequence based
on a very high percent identity value. Those sequences are
identified in Table 1. In addition, there are two regions in the
TC1507 5' DNA flanking sequence with high similarity to more than
one known sequence. In regions 870-1681 and 2338-2354, the percent
identity scores with both sequence fragments are sufficiently high
that a single match (homolog) cannot be determined. The two
possible homologs for each of these regions are indicated in Table
1.
[0092] Highly similar sequences were identified for all but the
first 669 base pairs of sequence. Generally, the results of
similarity searching indicate high homology with maize genomic
sequences 5' to base 1681. The region from base 1682 to the start
of the PHI8999A insert at position 2830 contains some fragments
associated with the transformation event. TABLE-US-00003 TABLE 1
Sequence summary for event TC1507 insert Location Location in in
SEQ ID Size % homologous Region NO: 24 bp Identity Homolog sequence
Description 1 1-669 669 N/A.sup.1 N/A N/A No significant homology
detected 2 670-869 200 90.5 AF123535 52432-52632 Undescribed
(complement) maize genomic sequence 3 870-1681 812 89.4 AF050439
1-801 Fragment of maize Huck-1 retrotransposon 5' LTR.sup.2 86.6
AF050438 1-797 Fragment of maize Huck-1 retrotransposon 3' LTR 4
1682-2016 335 100.0 PHI8999A 3149-3483 Fragment of cry1F gene 5
2017-2337 321 100.0 X86563 29429-29749 Fragment of maize
chloroplast rpoC2 gene (RNA polymerase beta-2 subunit) 6 2338-2354
17 100.0 X86563 97643-97659 Fragment of maize chloroplast trnI gene
(tRNA- Ile) 82.4 PHI8999A 182-197 Fragment of maize ubiZM1(2)
promoter 7a 2358-2558 201 100.0 PHI8999A 5320-5475 Fragment of pat
gene 7b 2559-2696 138 99 PHI8999A 5336-5518 Fragment of pat
(complement) gene 7c 2697-2711 15 100.0 PHI8999A 2544-2558 Fragment
of (complement) cry1F gene 8 2712-2829 118 100.0 PHI8999A 36-153
Fragment of polylinker region (bases 36-80) and ubiZM1(2) promoter
(bases 81-153) 9 2830-9015 6186 100.0 PHI8999A 11-6196 Full-length
insert of PHI8999A 10 9016-9565 550 100.0 PHI8999A 3906-4456
Inverted ORF25 (complement) terminator 11 9566-9693 128 100.0
NC_001666 121851-121978 Fragment of (complement) & maize
chloroplast 100759-100886 rps12 rRNA (23S ribosomal RNA) 12
9696-10087 392 99 NC_001666 17091-17483 Fragment of (complement)
maize chloroplast genome 13 10088-10275 188 99 PHI8999A 5333-5520
Fragment of pat (complement) gene 14 10278-10358 81 100 NC_001666
137122-137202 Fragment of (complement) maize chloroplast "ORF241" -
hypothetical protein gene 15 10359-10612 254 N/A.sup.1 N/A N/A No
significant homology detected 16 10613-11361 749 N/A.sup.1 N/A N/A
No description available .sup.1N/A; not applicable .sup.2LTR; long
terminal repeat
Example 6
Confirmation of the Presence of Regions 1, 2, and 3 in an
Unmodified Control Corn Line
[0093] PCR analysis was used to determine if Regions 1, 2, and 3
(Table 1) in the 5' flanking region of Event TC1507 are present in
an unmodified control corn line used for transformation to produce
maize event TC1507 and thus represents a border with corn genomic
DNA. Nine different PCR analyses were carried out on genomic DNA
prepared from TC1507 and the unmodified control corn line Hi-II
(see Armstrong (1994) The Maize Handbook, ed. Freeling and Walbot,
Springer-Verlag, New York, pp. 663-671, for information on Hi-II)
as outlined in Table 2 using the primer sequences shown in Table 3.
Two reactions were designed to amplify DNA within Region 1 of the
5' flanking region from bp 25 to 324 (Reaction A-300 bp amplicon);
and from bp 25 to 480 (Reaction B--456 bp amplicon). The expected
amplicons were present in both the Hi-II unmodified corn line and
in maize event TC1507. One PCR primer pair, Reaction C, spanned
Region 2 to Region 3 of the 5' flanking region from bp 759 to 1182
(424 bp amplicon) and again produced PCR products of the expected
size in both Hi-II and TC1507. Reaction D, spanned Region 1 to
Region 3 of the 5' flanking region from bp 415 to 1182 (768 bp
amplicon) and again produced PCR products of the expected size in
both Hi-II and TC1507. Reactions E and F were designed as specific
primer pairs for the pat gene region of the full-length insert of
PH18999A in TC1507 and thus an amplicon in the unmodified Hi-II
corn line is not expected. The results indicate that both Reactions
E and F are specific for a maize line transformed with apat gene
region and produce the expected amplicon, whereas no amplicon was
produced in the unmodified Hi-II corn line. Reaction G was also
designed as a primer pair that would produce an amplicon of 366 bp
in the maize event TC1507 and no amplicon in the unmodified Hi-II
corn line.
[0094] Reactions H and I were designed as specific primer pairs for
TC1507 that would span the end of the transgenic insert into the 5'
flanking region. In both Reactions H and I, the reverse primer was
located in the ubiquitin promoter region of the full-length
PH18999A insert (Region 9 in Table 1) and the forward primer was
located in Region 5, the rpoC2 gene fragment (see Table 1).
Reaction H and Reaction I both produced an amplicon in maize line
TC1507 and did not produce an amplicon in the unmodified control
corn line. These results indicate that both Reactions H and I are
specific for the TC1507 event.
[0095] The PCR results show that the undescribed sequence (Region
1) is present in the unmodified corn line Hi-II and that Regions 1,
2 and 3, are contiguous in the unmodified corn line Hi-II. The DNA
sequences amplified in Reactions A, B, C, and D are not unique to
the 5' flanking region of maize event TC1507 but are also present
in the unmodified corn line Hi-II. TABLE-US-00004 TABLE 2 PCR
reactions for sequence 5' to the PHI8999A insert in maize event
TC1507 and for regions within the full-length insert of PHI8999A in
maize event TC1507 Amplicon Region in TC1507 present PCR flanking
sequence Amplicon in maize Amplicon Amplicon or PHI8999A present
line Reaction Location Size (bp) insert In Hi-II TC1507 A 25-324 bp
300 Region 1 Yes Yes in TC1507 flanking sequence B 25-480 bp 456
Region 1 Yes Yes in TC1507 flanking sequence bp in TC1507 3
flanking sequence D 415-1182 bp 768 Region 1 to Yes Yes in TC1507
5' Region3 flanking sequence E 4750-5794 bp 1045 Region 9 (in full-
No Yes Not Unique in PHI8999A length insert of to TC1507 PHI8999A
35S promoter to pat gene) F 4827-5308 bp 482 Region 9 (in full- No
Yes Not Unique in PHI8999A length insert of to TC1507 PHI8999A 35S
promoter to pat gene) Detects cry1F 366 Spans 335 bp No Yes cry1F
sequence cry1F sequence in fragment in in 5' flanking 5' flanking
5' flanking sequence and sequence and same region in full-length
sequence in the insert of full-length insert PHI8999A H 2158 bp in
912 Region 5 to Region 9 No Yes Unique to Region 5 Unique to
Insertion TC1507 (rpoC2 gene Event fragment) to [SPANS UNIQUE 3069
bp in JUNCTION Region 9 REGIONS] (full-length insert of PHI8999A I
2158 bp in 844 Region 5 to Region 9 No Yes Unique to Region 5
Unique to Insertion TC1507 (rpoC2 gene Event fragment) to [SPANS
UNIQUE 3001 bp in JUNCTION Region 9 REGIONS] (full-length insert of
PHI8999A)
[0096] TABLE-US-00005 TABLE 3 PCR primers for sequence 5' to the
PHI8999A insert in TC1507 and for regions within the full-length
insert of PHI8999A in maize event TC1507 Amplicon Primer Sequences
Reaction Size (bp) Primer Pair 5' to 3' A 300 SEQ ID NO:10
CCCCTACCCCACCGACGTTTAT SEQ ID NO:11 TTGATTGGCAGGTCCGTGGGTC B 456
SEQ ID NO:10 CCCCTACCCCACCGACGTTTAT SEQ ID NO:12
CACAACGGCACAGAAACACGAA C 424 SEQ ID NO:13 GCGCACCCACCGGAACAAAATG
SEQ ID NO:14 TCCTCGCATTAAATGCTCCTGC D 768 SEQ ID NO:15
CCTGGCACGCATTGACGCATGT SEQ ID NO:14 TCCTCGCATTAAATGCTCCTGC E 1045
SEQ ID NO:6 TAGAGGACCTAACAGAACTCGCCGT SEQ ID NO:7
GAGCTGGCAACTCAAAATCCCTTT F 482 SEQ ID NO:8
AAAATCTTCGTCAACATGGTGGAGC SEQ ID NO:9 TAATCTCAACTGGTCTCCTCTCCGG G
366 SEQ ID NO:19 GGCTCGGACTCGACCTTTCTAT SEQ ID NO:20
GCAGTTCTTGAAGAATGAGTGA H 912 SEQ ID NO:1
GTAGTACTATAGATTATATTATTCGTAGAG SEQ ID NO:2
GCCATACAGAACTCAAAATCTTTTCCGGAG I 844 SEQ ID NO:2
GCCATACAGAACTCAAAATCTTTTCCGGAG SEQ ID NO:23
CTTCAAACAAGTGTGACAAA
Example 7
Flanking Sequence 3' to Inserted Transgenic DNA in Maize Event
TC1507
[0097] Two separate PCR approaches were used to extend the length
of the sequence information 3' to the full-length PH18999A insert
in maize event TC1507. In the first approach PCR primer pairs were
designed to amplify a product that spanned the junction between the
full-length insert and the inverted ORF25 terminator, see FIG. 1
for a depiction of the inverted ORF25 terminator. A forward primer
was located at the end of the full-length PH18999A insert and a
series of reverse primers were located at 100 bp intervals in the
inverted sequence. In this manner the length of the inverted
fragment present in the maize event TC1507 could be determined
within a 100 bp region based on the successful PCR reactions. This
method indicated the inverted fragment contained the majority of
the ORF25 terminator but no Cry1F sequence. PCR fragments were
isolated and sequenced from this region.
[0098] In the second approach PCR primers were designed to walk out
into the flanking DNA sequence from the inverted ORF25 terminator
region as determined in the PCR experiment described above. Genomic
DNA isolated from two to three individual plants of event TC1507
and an unmodified control corn line was digested with various
restriction enzymes and then ligated to adaptors specific for the
restriction enzyme used for digestion (Universal Genome Walker.TM.
Kit, Clontech Laboratories, Inc. and Devon et al. (1995) Nucleic
Acids Res. 23:1644-1645). Primary PCR was carried out using an
ORF25 terminator specific primer and a primer homologous to the
adaptor sequence ligated onto the digested DNA. In order to
increase the specificity of the reaction a nested secondary PCR was
performed again with another ORF25 terminator specific primer and a
secondary primer homologous to the adaptor sequence with the
secondary primers being internal to the respective primers used in
the primary PCR. Products produced by the nested PCR were analyzed
by agarose gel electrophoresis and fragments unique to TC1507 DNA
samples were isolated and sequenced. Fragments were amplified from
both the ORF25 terminator contained within the full-length insert
and from the targeted (inverted) ORF25 terminator on the 3' end of
the full-length PH18999A insert. Fragments from the full-length
insert were of a predicted size based on the knowledge of the
restriction enzyme sites located in the full-length insert.
Fragments produced from the 3' inverted ORF25 terminator appeared
as fragments of unexpected size. Sequence analysis of amplified
fragments from the 3' inverted ORF25 terminator resulted in
flanking DNA sequence of 1043 bp. Resultant sequence from the above
series of genome walking experiments was used to design additional
primers to walk further out from the insert into the bordering
maize genome with a final 3' flanking sequence, of 2346 bp.
[0099] In order to describe the TC1507 3' flanking sequence,
homology searching was done against the GenBank public databases
using the Basic Local Alignment Search Tool (BLAST). The BLAST
program performs sequence similarity searching and is particularly
useful for identifying homologs to an unknown sequence. In addition
to searching the public databases, alignments were performed using
SeqMan 4.05.TM., Martinez and Needleman-Wunsch alignment algorithms
(DNASTAR Inc.) to look for homology between the TC1507 3' flanking
sequence and the PHI8999A transgenic insert. The results of these
homology searches are presented in Table 1. The percent identity
values indicate the percentage of identical matches across the
length of the sequences analyzed. The results of similarity
searching for the 3' flanking sequence indicate high homology with
three regions of maize chloroplast DNA, a 188 bp fragment of the
pat gene, and 254 bp of DNA (Region 15, Table 1) with no
significant homology. An additional 749 bp (Region 16) beyond
Region 15 (see Table 1) was also sequenced. No similarity searching
results are available for Region 16.
[0100] PCR analysis on control and TC1507 genomic DNA determined
that the 254 bp sequence (Region 15, fragment of maize chloroplast
"ORF241") is present in the maize genome. The DNA sequence of
Region 15 in the 3' flanking region is not unique to the 3'
flanking region of maize event TC1507 but is also present in the
unmodified control corn line. The TC1507 3' flanking sequence is
presented in Example 8 and diagrammed in FIG. 1.
Example 8
Sequence of the Region 3' to the End of the Full-Length-Insert DNA
in maize Event TC1507.
[0101] A description of each region is in Table 1. TABLE-US-00006
Region 10 (SEQ ID NO: 38) Fragment of ORF25 Terminator (complement)
9016 CTCAC TCCGCTTGAT CTTGGCAAAG ATATTTGACG 9051 CATTTATTAG
TATGTGTTAA TTTTCATTTG CAGTGCAGTA TTTTCTATTC 9101 GATCTTTATG
TAATTCGTTA CAATTAATAA ATATTCAAAT CAGATTATTG 9151 ACTGTCATTT
GTATCAAATC GTGTTTAATG GATATTTTTA TTATAATATT 9201 GATGATATCT
CAATCAAAAC GTAGATAATA ATAATATTTA TTTAATATTT 9251 TTGCGTCGCA
CAGTGAAAAT CTATATGAGA TTACAAAATA CCGACAACAT 9301 TATTTAAGAA
ACATAGACAT TAACCCTGAG ACTGTTGGAC ATCAACGGGT 9351 AGATTCCTTC
ATGCATAGCA CCTCATTCTT GGGGACAAAA GCACGGTTTG 9401 GCCGTTCCAT
TGCTGCACGA ACGAGCTTTG CTATATCCTC GGGTTGGATC 9451 ATCTCATCAG
GTCCAATCAA ATTTGTCCAA GAACTCATGT TAGTCGCAAC 9501 GAAACCGGGG
CATATGTCGG GTATCTCGAG CTCGCGAAAG CTTGGCTGCA 9551 GGTCGACGGA TCCTT
Region 11 (SEQ ID NO: 39) Fragment of maize chloroplast rps12 rRNA
gene (complement) 9566 CAACA AAAGGGTACC TGTACCCGAA ACCGACACAG 9601
GTGGGTAGGT AGAGAATACC TAGGGGCGCG AGACAACTCT CTCTAAGGAA 9651
CTCGGCAAAA TAGCCCCGTA ACTTCGGGAG AAGGGGTGCC CCC Nucleotides
9694-9695 (CG) connect Region 11 to Region 12. Region 12 (SEQ ID
NO: 40) Fragment of maize chloroplast genome 9696 CTAAC 9701
AATAAACGAA TACGGTTTAT GTATGGATTC CGGTAAAATA CCGGTACTCG 9751
ATTTCATAAG AGTCGAATAG GAAGTTAAGA TGAGGGTGGT ATCATCATAA 9801
AAATGGAGTA GTATCCTAAA TTATACTAAT CCACGTATGA TATGTATGCC 9851
TTTCCTTATC AACCGGAAGT AGTGCAAAAA AAATTCTATA CTGCACTGCT 9901
CTCTTTTTAC TGAGAAATGC AAAAAAATAA AAGTGAAGTA AGGGTGCCCC 9951
ATAGATATTT GATCTTGCCT CCTGTCCCCC CCCCCCTTTT TTCATCAAAA 10001
ATTTCCATGA AAAAAGAAAA GATGAATTTG TCCATTCATT GAACCCTAGT 10051
TCGGGACTGA CGGGGCTCGA ACCCGCAGCT TCCGCCT Region 13 (SEQ ID NO: 41)
Fragment of pat gene (complement) 10088 GTT CCTAGCCTTC 10101
CAGGGCCCAG CGTAAGCAAT ACCAGCCACA GCACCCTCAA CCTCAGCAAC 10151
CAACCAAGGG TATCTATCTT GCAACCTCTC TAGATCATCA ATCCACTCTT 10201
GTGGTGTTTG TGGCTCTGTC CTAAAGTTCA CTGTAGACGT CTCAATGTAA 10251
TGGTTAACGA TATCACAAAC CGCGG Nucleotides 10276-10277 (AA) connect
Region 13 to Region 14. Region 14 (SEQ ID NO: 42) Fragment of maize
chloroplast ORF241 (complement) 10278 CAC AAGAACGAAA GCACCTTTTC
10301 ATTCTTTCAT ATACTAGGGG TTTTTACTTG GAAAAGACAA TGTTCCATAC 10351
TAAAGGAT Region 15 (SEQ ID NO: 43) Maize genomic (no significant
homology) 10359 AG CTGCAGAAGC CGCCACCGTC TTGAGGACCT TCCGGGGAGC
10401 CAGACCGGTC GAACCGTGCC TCCACTTGCT AAGGAGAAAG GGAAAATCAG 10451
GGCCAGGACA TACGAAGGAG GAGCCAGAAC GAAGATATCC TAAGATACTT 10501
ACTCGCTCCG GGCCATGATC AATCATGCCT GTGGGGAGGT CTCTCGCACC 10551
TCGATCCATG AAGGTACCAC CGAGGTCTGC CCCGCCGCCG GCTTCGGTAC 10601
CGTCCTCGCC TT Region 16 (SEQ ID NO: 44) Maize genomic 10613
GGGCGCCC GAGGCACCCG GGGGATGGAC TGCCCAGGCG 10651 CAGCCACGAC
GACCCAAGGA TCACCCTCCT GCGCAGTCGG CACGAGCAAT 10701 AGTTCTCGGG
GAACAGGCAG CTTGGCCTGA CTCCCCGGGG TCACCTCAAC 10751 TACCTCGGCC
GAGGGGTCAA GTACCCCCTC AGTCCGCCCC CGCTCTTCGG 10801 ACCGGGACCC
CGACGTCCCG GCCCCGGATA CCGACGGCAC CAGCCCGCTC 10851 GGGGGCTGGC
TTGACGACCC CTGGCCCAGC CTCAGATCTG GGCTGAGGCC 10901 GAGGCAGGCG
GCCATGTCGT CGTCTTCATC ATCGTCTTCA TCATCGTCGT 10951 CGTCATCAGG
CGTCTCCGGC GACGGCTCCC TTGGGAGCCC CTCCCTCTCC 11001 TGCCGACGAC
GAAGCCTTTC CAAGGCATCC CGAGCCCACG TCCGCTCGTG 11051 GGCCCGAGCC
TTCTTTGCGT CCTTCTTCTC CTTCCTCTTC TCCGCGGTGA 11101 CCCTCCGCGC
AGCTCGGTCC ACCGCATCCT CCGGGACTGG TGGCAGGGAA 11151 GGCTTGTGAT
GCCCTACCTC CTGGAGACAG ACGAAAAGTC TCAGCTATGA 11201 GAACCGAGGG
CAATCTGACG CAAGAAGGAA GAAGGAGCGG ATACTCACCA 11251 GAGACACGCA
CCCGCGATCG GGACGCATTA AGGGCTGGGA AAAAGTGCCG 11301 GCCTCTAATT
TCGCTACCGT GCCGTCCACC CACCTGTGGA GGTCATCGAT 11351 GGGAAGGGGA A
Example 9
Confirmation of the Presence of Region 15 in the Unmodified Control
Corn Line
[0102] PCR analysis was used to determine if the undescribed region
of sequence on the end of the 3' flanking sequence (Region 15 in
Table 1) is present in the unmodified control corn line used for
transformation to produce maize event TC1507 and thus represents a
border with corn genomic DNA. Successful PCR amplification of
Region 15 in both maize line TC1507 and the unmodified Hi-II
control corn line revealed that Region 15 was indeed present in
corn genomic DNA. Five different PCR analyses were carried out on
genomic DNA prepared from TC1507 and the unmodified Hi-II control
corn line as outlined in Table 7 below using the primer sequences
shown in Table 8. Three reactions were designed to amplify DNA
within Region 15 of the 3' flanking region; Reaction L--producing a
175 bp amplicon, Reaction M --producing a 134 bp amplicon, and
Reaction N--producing a 107 bp amplicon. The expected amplicons
were present in both the unmodified control corn line and in maize
line TC1507.
[0103] Reactions J and K were designed as specific primer pairs for
TC1507 that would span the end of the insert into the 3' flanking
region. In Reaction J, the forward primer was located in the pat
gene fragment on the 3' end of the full-length PH18999A insert
(Region 13 in Table 1) and the reverse primer was located in the
undefined Region 15. In Reaction K the forward primer was located
in the chloroplast hypothetical protein gene on the 3' end of the
full-length insert (Region 14 in Table 1) and the reverse primer
was located in the undefined Region 15. Both Reaction J and
Reaction K produced an amplicon in maize line TC1507 and did not
produce an amplicon in the unmodified control corn line. The
results indicate that both Reactions J and K are specific for the
TC1507 event.
[0104] The PCR results indicate that the undescribed sequence
(Region 15) of the 3' flanking sequence of TC1507 is also present
in genomic DNA isolated from the unmodified Hi-II control corn
line. The DNA sequences amplified in Reactions L, M, and N are not
unique to the 3' flanking region of TC1507 but are also present in
the unmodified control corn line. TABLE-US-00007 TABLE 7 PCR
reactions for sequence 3' to the PHI8999A insert in maize event
TC1507 Amplicon Region in TC1507 Amplicon present Amplicon 3'
flanking present in maize line Reaction Size (bp) sequence in
Control TC1507 J 342 Region 13 (pat gene No Yes fragment) to Region
15 K 252 Region 14 No Yes (chloroplast gene) to Region 15 L 175
Region 15 Yes Yes M 134 Region 15 Yes Yes N 107 Region 15 Yes
Yes
[0105] TABLE-US-00008 TABLE 8 PCR primers for sequence 3' to the
PH18999A insert in maize event TC1507 Amplicon Primer Sequences
Reaction Size (bp) Primer Pair 5' to 3' J 342 SEQ ID NO:3
TGTGGTGTTTGTGGCTCTG TCCTAA SEQ ID NO:5 GACCTCCCCACAGGCATGA TTGATC K
252 SEQ ID NO:4 AGCACCTTTTCATTCTTTC ATATAC SEQ ID NO:5
GACCTCCCCACAGGCATGA TTGATC L 175 SEQ ID NO:16 AAGCCGCCACCGTCTTGAG
GACCTT SEQ ID NO:5 GACCTCCCCACAGGCATGA TTGATC M 134 SEQ ID NO:17
GTCGAACCGTGCCTCCACT TGCTAA SEQ ID NO:5 GACCTCCCCACAGGCATGA TTGATC N
107 SEQ ID NO:18 AGAAAGGGAAAATCAGGGC CAGGAC SEQ ID NO:5
GACCTCCCCACAGGCATGA TTGATC
Example 10. PCR Primers
[0106] DNA event specific primer pairs were used to produce an
amplicon diagnostic for TC1507. These event primer pairs include,
but are not limited to, SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 2
and SEQ ID NO: 23; SEQ ID NO: 3 and SEQ ID NO: 5; and SEQ ID NO: 4
and SEQ ID NO: 5. In addition to these primer pairs, any primer
pair derived from SEQ ID NO: 26 and SEQ ID NO: 27 that when used in
a DNA amplification reaction produces a DNA amplicon diagnostic for
TC1507 is an aspect of the present invention. The amplification
conditions for this analysis are illustrated in Table 9, however,
any modification of these methods that use DNA primers or
complements thereof to produce an amplicon DNA molecule diagnostic
for TC1507 is within the ordinary skill of the art. The preferred
amplification conditions for reactions utilizing the PCR primers
identified in SEQ ID NOS: 1, 2, and 23 are illustrated in Table 10.
In addition, control primer pairs, which include SEQ ID NOS: 10 and
11; SEQ ID NOS: 10 and 12; SEQ ID NOS: 13 and 14; SEQ ID NOS: 14
and 15; SEQ ID NOS: 5 and 16; SEQ ID NOS: 5 and 17; and SEQ ID NOS:
5 and 18; for amplification of an endogenous corn gene are included
as internal standards for the reaction conditions. Also included
are primer pairs that will produce an amplicon in transgenic events
containing apat gene (SEQ ID NOS: 6 and 7; SEQ ID NOS: 8 and 9),
and a primer pair that will produce an amplicon in transgenic
events containing a cry1F gene (SEQ ID NOS: 19 and 20).
[0107] The analysis of plant tissue DNA extracts to test for the
presence of the TC1507 event should include a positive tissue DNA
extract control (a DNA sample known to contain the transgenic
sequences). A successful amplification of the positive control
demonstrates that the PCR was run under conditions which allow for
the amplification of target sequences. A negative, or wild-type,
DNA extract control in which the template DNA provided is either
genomic DNA prepared from a non-transgenic plant, or is a
non-TC1507 transgenic plant, should also be included. Additionally
a negative control that contains no template corn DNA extract will
be a useful gauge of the reagents and conditions used in the PCR
protocol.
[0108] Additional DNA primer molecules of sufficient length can be
selected from SEQ ID NO: 26 and SEQ ID NO: 27 by those skilled in
the art of DNA amplification methods, and conditions optimized for
the production of an amplicon that may differ from the methods
shown in Table 9 or Table 10 but result in an amplicon diagnostic
for event TC1507. The use of these DNA primer sequences with
modifications to the methods shown in Table 9 and Table 10 are
within the scope of the invention. The amplicon wherein at least
one DNA primer molecule of sufficient length derived from SEQ ID
NO: 26 and SEQ ID NO: 27 that is diagnostic for event TC1507 is an
aspect of the invention. The amplicon wherein at least one DNA
primer of sufficient length derived from any of the genetic
elements of PHI8999A that is diagnostic for event TC1507 is an
aspect of the invention. The assay for the TC1507 amplicon can be
performed by using a Stratagene Robocycler, MJ Engine, Perkin-Elmer
9700, or Eppendorf Mastercycler Gradient thermocycler, or by
methods and apparatus known to those skilled in the art.
TABLE-US-00009 TABLE 9 PCR Conditions: Conditions: Kit used:
Perkin-Elmer AmpliTAQ Gold kit Volume Component 5 .mu.l template
(10 ng/.mu.l) 4 .mu.l 2 .mu.l each primer (10 .mu.M) 2 .mu.l 10X
PCR Gold Buffer 2 .mu.l 25 mM MgCl.sub.2 2 .mu.l 50X dNTP's (10 mM)
0.1 .mu.l Amplitaq Gold Polymerase 4.9 .mu.l H.sub.2O 20 .mu.l
Total Cycling Parameters GeneAmp .RTM. PCR System 9700 9 min
92.degree. C. 30 cycles: 94.degree. C. 30 sec 60.degree. C. 30 sec
72.degree. C. 1 min 7 min 72.degree. C. Hold 4.degree. C.
[0109] TABLE-US-00010 TABLE 10 PCR Conditions used with the
Advantage .RTM.-GC 2 Polymerase Mix: Conditions: Kit used:
Advantage .RTM.-GC 2 Polymerase Mix Volume Component 5 .mu.l
template (10 ng/.mu.l) 5 .mu.l 2.5 .mu.l each primer (10 .mu.M) 10
.mu.l 5x GC2 Buffer 10 .mu.l GC melt (1.0 M final conc.) 1.5 .mu.l
50X dNTP's (10 mM) 1.0 .mu.l Advantage GC2 Polymerase 17.5 .mu.l
H.sub.2O 50 .mu.l Total Cycling Parameters GeneAmp .RTM. PCR System
9700 5 min 94.degree. C. 35 cycles: 94.degree. C. 1 min 60.degree.
C. 2 min 72.degree. C. 3 min 7 min 72.degree. C. Hold 4.degree.
C.
[0110] Having illustrated and described the principles of the
present invention, it should be apparent to persons skilled in the
art that the invention can be modified in arrangement and detail
without departing from such principles. We claim all modifications
that are within the spirit and scope of the appended claims.
[0111] All publications and published patent documents cited in
this specification are incorporated herein by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
Sequence CWU 1
1
57 1 30 DNA Artificial Sequence Event specific primer sequence
designed for TC1507 1 gtagtactat agattatatt attcgtagag 30 2 30 DNA
Artificial Sequence Event specific primer sequence designed for
TC1507 2 gccatacaga actcaaaatc ttttccggag 30 3 25 DNA Artificial
Sequence Event specific primer designed for TC1507. 3 tgtggtgttt
gtggctctgt cctaa 25 4 25 DNA Artificial Sequence Event specific
primer for TC1507. 4 agcacctttt cattctttca tatac 25 5 25 DNA
Artificial Sequence Genomic DNA primer sequence 5 gacctcccca
caggcatgat tgatc 25 6 25 DNA Artificial Sequence Primer in full
length insert, 35S promoter to pat gene 6 tagaggacct aacagaactc
gccgt 25 7 24 DNA Artificial Sequence Primer in full length insert,
35S promoter to pat gene 7 gagctggcaa ctcaaaatcc cttt 24 8 25 DNA
Artificial Sequence Primer in full length insert, 35S promoter to
pat gene 8 aaaatcttcg tcaacatggt ggagc 25 9 25 DNA Artificial
Sequence Primer in full length insert, 35S promoter to pat gene 9
taatctcaac tggtctcctc tccgg 25 10 22 DNA Artificial Sequence Primer
- Zea mays genomic DNA 10 cccctacccc accgacgttt at 22 11 22 DNA
Artificial Sequence Primer - Zea mays genomic DNA 11 ttgattggca
ggtccgtggg tc 22 12 22 DNA Artificial Sequence Primer - Zea mays
genomic DNA. 12 cacaacggca cagaaacacg aa 22 13 22 DNA Artificial
Sequence Primer - Zea mays genomic DNA. 13 gcgcacccac cggaacaaaa tg
22 14 22 DNA Artificial Sequence Primer - Zea mays genomic DNA. 14
tcctcgcatt aaatgctcct gc 22 15 22 DNA Artificial Sequence Primer -
Zea mays genomic DNA. 15 cctggcacgc attgacgcat gt 22 16 25 DNA
Artificial Sequence Primer - Zea mays genomic DNA. 16 aagccgccac
cgtcttgagg acctt 25 17 25 DNA Artificial Sequence Primer - Zea mays
genomic DNA. 17 gtcgaaccgt gcctccactt gctaa 25 18 25 DNA Artificial
Sequence Primer - Zea mays genomic DNA. 18 agaaagggaa aatcagggcc
aggac 25 19 22 DNA Artificial Sequence Cry1F sequence primer 19
ggctcggact cgacctttct at 22 20 22 DNA Artificial Sequence Cry1F
sequence primer 20 gcagttcttg aagaatgagt ga 22 21 2829 DNA 5'
flanking sequence of event TC1507 21 actagtttcc tagcccgcgt
cgtgccccta ccccaccgac gtttatggaa ggtgccattc 60 cacggttctt
cgtggccgcc cctaaggatg taaatggtcg gtaaaatccg gtaaatttcc 120
ggtaccgttt accagatttt tccagccgtt ttcggattta tcgggatata cagaaaacga
180 gacggaaacg gaataggttt tttttcgaaa acggtacggt aaacggtgag
acaaacttac 240 cgtccgtttt cgtatttctc gggaaactct ggtatattcc
cgtatttgtc ccgtattttc 300 ccgacccacg gacctgccaa tcaaccatca
gccagtcagc ccatccccac agctatggcc 360 catggggcca tgttggccac
atgcccacgc aacgcaaggc agtaaggctg gcagcctggc 420 acgcattgac
gcatgtggac acacacagcc gccgcctgtt cgtgtttctg tgccgttgtg 480
cgagactgtg actgcgagtg gcggagtcgg cgaacggcga ggcgtctccg gagtctggac
540 tgcggctgtg gacagcgacg ctgtgacggc gactcggcga agccccaagc
taccaagccc 600 ccaagtcccc atccatctct gcttctctgg tcatctcctt
cccctggtcg atctgcaggc 660 gccagaccgg ccgaagcatc acgaaacgca
ctaagacctc gaaggagtca aaccactcct 720 ccgaggcctc gggggctaca
cccggcgggt gcgctcgcgc gcacccaccg gaacaaaatg 780 taaccgagaa
aggtcggtcc ccttgcaaaa aaagtgcgac aaaagcctcc aagcgagtat 840
taacactcac tttgaggctc gggggctact gtcggggacc ataattaggg gtacccccaa
900 gactcctaat ctcagctggt aacccccatc agcacaaagc tgcaaaggcc
tgatgggtgc 960 gattaagtca aggctcggtc cactcaaggg acacgatctc
gcctcgcccg agcccagcct 1020 cgggcaaggg cggccgaccc cgaggattca
cgtctcgccc gagggccccc tcaagcgacg 1080 ggcacacctt cggctcgccc
gaggcccatt cttcgccgag aagcaacctt ggccagatcg 1140 ccacaccgac
cgaccgtatc gcaggagcat ttaatgcgag gatcgcctga caccttatcc 1200
tgacgcgcgc tcttcagtcg acagagccga agtgaccgca atcacttcgc cgctccactg
1260 accgacctga caagaagaca gcgccgcctg cgtcgctccg actgctgtgc
cactcgacag 1320 agtgaggctg acagcagcca agtccggcct cgggcgccat
aggaagctcc gcctcgcccg 1380 accctagggc tcggactcgg cctcggctcc
ggaagacgac gaactacgct tcgcccgacc 1440 ccagggcttg gactcagcct
cggctccgga agacgacgaa ttccgcctcg cccgacccca 1500 gggctcggac
tcggcctcgg ctccagaaga cgacgaactc cgcctcgccc gaccccaggg 1560
ctcggactca gcctcggctc cggaagacga cgaactccgc ctcgcccgac cccagggctc
1620 ggactcagcc tcggcctcag acgatggtct ccgcctcgcc cgacccgggg
ctcggactcg 1680 acctttctat cggaccttgt cagatcctgt cttcgtccga
ggaggctttg gcaatcctca 1740 ctatgtactc ggtcttaggg gagtggcctt
tcaacaaact ggtacgaatc acacccgcac 1800 attcaggaac tccgggacca
ttgactctct agatgagata ccacctcaag acaacagcgg 1860 cgcaccttgg
aatgactact cccatgtgct gaatcatgtt acctttgtgc gctggccagg 1920
tgagatctca ggttccgact catggagagc accaatgttc tcttggacgc atcgtagcgc
1980 tacccccaca aacaccattg atccagagag aatcactcat tcttcaagaa
ctgcatatct 2040 tgccgagatc ctcatcccta aaggtacttg acaatagtat
tattggagtc gatacacaac 2100 tcacaaaaaa tacaagaagt cgactaggtg
gattggtccg agtgaagaga aaaaaaagcc 2160 atacagaact caaaatcttt
tccggagata ttcattttcc tgaagaggcg gataagatat 2220 taggtggcag
tttgatacca ccagaaagag aaaaaaaaga ttctaaggaa tcaaaaaaaa 2280
ggaaaaattg ggtttatgtt caacggaaaa aatttctcaa aagcaaggaa aagtattgtg
2340 gctatttatc tatccgtgca gctgatatgg ccgcggtttg tgatatcgtt
aaccattaca 2400 ttgagacgtc tacagtgaac tttaggacag agccacaaac
accacaagag tggattgatg 2460 atctagagag gttgcaagat agataccctt
ggttggttgc tgaggttgag ggtgttgtgg 2520 ctggtattgc ttacgctggg
ccctggaagg ctaggaaccc tcaacctcag caaccaacca 2580 atggtatcta
tcttgcaacc tctctagatc atcaatccac tcttgtggtg tttgtggctc 2640
tgtcctaaag ttcactgtag acgtctcaat gtaatggtta acgatatcac aaaccgagag
2700 aagagggatc tcgaagcttc ggccggggcc catcgatatc cgcgggcatg
cctgcagtgc 2760 agcgtgaccc ggtcgtgccc ctctctagag ataatgagca
ttgcatgtct aagttataaa 2820 aaattacca 2829 22 2346 DNA 3' flanking
sequence of event TC1507 22 ctcactccgc ttgatcttgg caaagatatt
tgacgcattt attagtatgt gttaattttc 60 atttgcagtg cagtattttc
tattcgatct ttatgtaatt cgttacaatt aataaatatt 120 caaatcagat
tattgactgt catttgtatc aaatcgtgtt taatggatat ttttattata 180
atattgatga tatctcaatc aaaacgtaga taataataat atttatttaa tatttttgcg
240 tcgcacagtg aaaatctata tgagattaca aaataccgac aacattattt
aagaaacata 300 gacattaacc ctgagactgt tggacatcaa cgggtagatt
ccttcatgca tagcacctca 360 ttcttgggga caaaagcacg gtttggccgt
tccattgctg cacgaacgag ctttgctata 420 tcctcgggtt ggatcatctc
atcaggtcca atcaaatttg tccaagaact catgttagtc 480 gcaacgaaac
cggggcatat gtcgggtatc tcgagctcgc gaaagcttgg ctgcaggtcg 540
acggatcctt caacaaaagg gtacctgtac ccgaaaccga cacaggtggg taggtagaga
600 atacctaggg gcgcgagaca actctctcta aggaactcgg caaaatagcc
ccgtaacttc 660 gggagaaggg gtgccccccg ctaacaataa acgaatacgg
tttatgtatg gattccggta 720 aaataccggt actcgatttc ataagagtcg
aataggaagt taagatgagg gtggtatcat 780 cataaaaatg gagtagtatc
ctaaattata ctaatccacg tatgatatgt atgcctttcc 840 ttatcaaccg
gaagtagtgc aaaaaaaatt ctatactgca ctgctctctt tttactgaga 900
aatgcaaaaa aataaaagtg aagtaagggt gccccataga tatttgatct tgcctcctgt
960 cccccccccc cttttttcat caaaaatttc catgaaaaaa gaaaagatga
atttgtccat 1020 tcattgaacc ctagttcggg actgacgggg ctcgaacccg
cagcttccgc ctgttcctag 1080 ccttccaggg cccagcgtaa gcaataccag
ccacagcacc ctcaacctca gcaaccaacc 1140 aagggtatct atcttgcaac
ctctctagat catcaatcca ctcttgtggt gtttgtggct 1200 ctgtcctaaa
gttcactgta gacgtctcaa tgtaatggtt aacgatatca caaaccgcgg 1260
aacacaagaa cgaaagcacc ttttcattct ttcatatact aggggttttt acttggaaaa
1320 gacaatgttc catactaaag gatagctgca gaagccgcca ccgtcttgag
gaccttccgg 1380 ggagccagac cggtcgaacc gtgcctccac ttgctaagga
gaaagggaaa atcagggcca 1440 ggacatacga aggaggagcc agaacgaaga
tatcctaaga tacttactcg ctccgggcca 1500 tgatcaatca tgcctgtggg
gaggtctctc gcacctcgat ccatgaaggt accaccgagg 1560 tctgccccgc
cgccggcttc ggtaccgtcc tcgccttggg cgcccgaggc acccggggga 1620
tggactgccc aggcgcagcc acgacgaccc aaggatcacc ctcctgcgca gtcggcacga
1680 gcaatagttc tcggggaaca ggcagcttgg cctgactccc cggggtcacc
tcaactacct 1740 cggccgaggg gtcaagtacc ccctcagtcc gcccccgctc
ttcggaccgg gaccccgacg 1800 tcccggcccc ggataccgac ggcaccagcc
cgctcggggg ctggcttgac gacccctggc 1860 ccagcctcag atctgggctg
aggccgaggc aggcggccat gtcgtcgtct tcatcatcgt 1920 cttcatcatc
gtcgtcgtca tcaggcgtct ccggcgacgg ctcccttggg agcccctccc 1980
tctcctgccg acgacgaagc ctttccaagg catcccgagc ccacgtccgc tcgtgggccc
2040 gagccttctt tgcgtccttc ttctccttcc tcttctccgc ggtgaccctc
cgcgcagctc 2100 ggtccaccgc atcctccggg actggtggca gggaaggctt
gtgatgccct acctcctgga 2160 gacagacgaa aagtctcagc tatgagaacc
gagggcaatc tgacgcaaga aggaagaagg 2220 agcggatact caccagagac
acgcacccgc gatcgggacg cattaagggc tgggaaaaag 2280 tgccggcctc
taatttcgct accgtgccgt ccacccacct gtggaggtca tcgatgggaa 2340 ggggaa
2346 23 20 DNA Artificial Sequence Event specific primer sequence
designed for TC1507 23 cttcaaacaa gtgtgacaaa 20 24 11361 DNA
Artificial Sequence The sequence represents the transgenic insert
in maize line TC1507 as well as the sequence flanking the insertion
sites. 24 actagtttcc tagcccgcgt cgtgccccta ccccaccgac gtttatggaa
ggtgccattc 60 cacggttctt cgtggccgcc cctaaggatg taaatggtcg
gtaaaatccg gtaaatttcc 120 ggtaccgttt accagatttt tccagccgtt
ttcggattta tcgggatata cagaaaacga 180 gacggaaacg gaataggttt
tttttcgaaa acggtacggt aaacggtgag acaaacttac 240 cgtccgtttt
cgtatttctc gggaaactct ggtatattcc cgtatttgtc ccgtattttc 300
ccgacccacg gacctgccaa tcaaccatca gccagtcagc ccatccccac agctatggcc
360 catggggcca tgttggccac atgcccacgc aacgcaaggc agtaaggctg
gcagcctggc 420 acgcattgac gcatgtggac acacacagcc gccgcctgtt
cgtgtttctg tgccgttgtg 480 cgagactgtg actgcgagtg gcggagtcgg
cgaacggcga ggcgtctccg gagtctggac 540 tgcggctgtg gacagcgacg
ctgtgacggc gactcggcga agccccaagc taccaagccc 600 ccaagtcccc
atccatctct gcttctctgg tcatctcctt cccctggtcg atctgcaggc 660
gccagaccgg ccgaagcatc acgaaacgca ctaagacctc gaaggagtca aaccactcct
720 ccgaggcctc gggggctaca cccggcgggt gcgctcgcgc gcacccaccg
gaacaaaatg 780 taaccgagaa aggtcggtcc ccttgcaaaa aaagtgcgac
aaaagcctcc aagcgagtat 840 taacactcac tttgaggctc gggggctact
gtcggggacc ataattaggg gtacccccaa 900 gactcctaat ctcagctggt
aacccccatc agcacaaagc tgcaaaggcc tgatgggtgc 960 gattaagtca
aggctcggtc cactcaaggg acacgatctc gcctcgcccg agcccagcct 1020
cgggcaaggg cggccgaccc cgaggattca cgtctcgccc gagggccccc tcaagcgacg
1080 ggcacacctt cggctcgccc gaggcccatt cttcgccgag aagcaacctt
ggccagatcg 1140 ccacaccgac cgaccgtatc gcaggagcat ttaatgcgag
gatcgcctga caccttatcc 1200 tgacgcgcgc tcttcagtcg acagagccga
agtgaccgca atcacttcgc cgctccactg 1260 accgacctga caagaagaca
gcgccgcctg cgtcgctccg actgctgtgc cactcgacag 1320 agtgaggctg
acagcagcca agtccggcct cgggcgccat aggaagctcc gcctcgcccg 1380
accctagggc tcggactcgg cctcggctcc ggaagacgac gaactacgct tcgcccgacc
1440 ccagggcttg gactcagcct cggctccgga agacgacgaa ttccgcctcg
cccgacccca 1500 gggctcggac tcggcctcgg ctccagaaga cgacgaactc
cgcctcgccc gaccccaggg 1560 ctcggactca gcctcggctc cggaagacga
cgaactccgc ctcgcccgac cccagggctc 1620 ggactcagcc tcggcctcag
acgatggtct ccgcctcgcc cgacccgggg ctcggactcg 1680 acctttctat
cggaccttgt cagatcctgt cttcgtccga ggaggctttg gcaatcctca 1740
ctatgtactc ggtcttaggg gagtggcctt tcaacaaact ggtacgaatc acacccgcac
1800 attcaggaac tccgggacca ttgactctct agatgagata ccacctcaag
acaacagcgg 1860 cgcaccttgg aatgactact cccatgtgct gaatcatgtt
acctttgtgc gctggccagg 1920 tgagatctca ggttccgact catggagagc
accaatgttc tcttggacgc atcgtagcgc 1980 tacccccaca aacaccattg
atccagagag aatcactcat tcttcaagaa ctgcatatct 2040 tgccgagatc
ctcatcccta aaggtacttg acaatagtat tattggagtc gatacacaac 2100
tcacaaaaaa tacaagaagt cgactaggtg gattggtccg agtgaagaga aaaaaaagcc
2160 atacagaact caaaatcttt tccggagata ttcattttcc tgaagaggcg
gataagatat 2220 taggtggcag tttgatacca ccagaaagag aaaaaaaaga
ttctaaggaa tcaaaaaaaa 2280 ggaaaaattg ggtttatgtt caacggaaaa
aatttctcaa aagcaaggaa aagtattgtg 2340 gctatttatc tatccgtgca
gctgatatgg ccgcggtttg tgatatcgtt aaccattaca 2400 ttgagacgtc
tacagtgaac tttaggacag agccacaaac accacaagag tggattgatg 2460
atctagagag gttgcaagat agataccctt ggttggttgc tgaggttgag ggtgttgtgg
2520 ctggtattgc ttacgctggg ccctggaagg ctaggaaccc tcaacctcag
caaccaacca 2580 atggtatcta tcttgcaacc tctctagatc atcaatccac
tcttgtggtg tttgtggctc 2640 tgtcctaaag ttcactgtag acgtctcaat
gtaatggtta acgatatcac aaaccgagag 2700 aagagggatc tcgaagcttc
ggccggggcc catcgatatc cgcgggcatg cctgcagtgc 2760 agcgtgaccc
ggtcgtgccc ctctctagag ataatgagca ttgcatgtct aagttataaa 2820
aaattaccac aactggaaga gcggttaccc ggaccgaagc ttcggccggg gcccatcgat
2880 atccgcgggc atgcctgcag tgcagcgtga cccggtcgtg cccctctcta
gagataatga 2940 gcattgcatg tctaagttat aaaaaattac cacatatttt
ttttgtcaca cttgtttgaa 3000 gtgcagttta tctatcttta tacatatatt
taaactttac tctacgaata atataatcta 3060 tagtactaca ataatatcag
tgttttagag aatcatataa atgaacagtt agacatggtc 3120 taaaggacaa
ttgagtattt tgacaacagg actctacagt tttatctttt tagtgtgcat 3180
gtgttctcct ttttttttgc aaatagcttc acctatataa tacttcatcc attttattag
3240 tacatccatt tagggtttag ggttaatggt ttttatagac taattttttt
agtacatcta 3300 ttttattcta ttttagcctc taaattaaga aaactaaaac
tctattttag tttttttatt 3360 taataattta gatataaaat agaataaaat
aaagtgacta aaaattaaac aaataccctt 3420 taagaaatta aaaaaactaa
ggaaacattt ttcttgtttc gagtagataa tgccagcctg 3480 ttaaacgccg
tcgacgagtc taacggacac caaccagcga accagcagcg tcgcgtcggg 3540
ccaagcgaag cagacggcac ggcatctctg tcgctgcctc tggacccctc tcgagagttc
3600 cgctccaccg ttggacttgc tccgctgtcg gcatccagaa attgcgtggc
ggagcggcag 3660 acgtgagccg gcacggcagg cggcctcctc ctcctctcac
ggcacggcag ctacggggga 3720 ttcctttccc accgctcctt cgctttccct
tcctcgcccg ccgtaataaa tagacacccc 3780 ctccacaccc tctttcccca
acctcgtgtt gttcggagcg cacacacaca caaccagatc 3840 tcccccaaat
ccacccgtcg gcacctccgc ttcaaggtac gccgctcgtc ctcccccccc 3900
ccccctctct accttctcta gatcggcgtt ccggtccatg gttagggccc ggtagttcta
3960 cttctgttca tgtttgtgtt agatccgtgt ttgtgttaga tccgtgctgc
tagcgttcgt 4020 acacggatgc gacctgtacg tcagacacgt tctgattgct
aacttgccag tgtttctctt 4080 tggggaatcc tgggatggct ctagccgttc
cgcagacggg atcgatttca tgattttttt 4140 tgtttcgttg catagggttt
ggtttgccct tttcctttat ttcaatatat gccgtgcact 4200 tgtttgtcgg
gtcatctttt catgcttttt tttgtcttgg ttgtgatgat gtggtctggt 4260
tgggcggtcg ttctagatcg gagtagaatt ctgtttcaaa ctacctggtg gatttattaa
4320 ttttggatct gtatgtgtgt gccatacata ttcatagtta cgaattgaag
atgatggatg 4380 gaaatatcga tctaggatag gtatacatgt tgatgcgggt
tttactgatg catatacaga 4440 gatgcttttt gttcgcttgg ttgtgatgat
gtggtgtggt tgggcggtcg ttcattcgtt 4500 ctagatcgga gtagaatact
gtttcaaact acctggtgta tttattaatt ttggaactgt 4560 atgtgtgtgt
catacatctt catagttacg agtttaagat ggatggaaat atcgatctag 4620
gataggtata catgttgatg tgggttttac tgatgcatat acatgatggc atatgcagca
4680 tctattcata tgctctaacc ttgagtacct atctattata ataaacaagt
atgttttata 4740 attattttga tcttgatata cttggatgat ggcatatgca
gcagctatat gtggattttt 4800 ttagccctgc cttcatacgc tatttatttg
cttggtactg tttcttttgt cgatgctcac 4860 cctgttgttt ggtgttactt
ctgcaggtcg actctagagg atccaacaat ggagaacaac 4920 atacagaatc
agtgcgtccc ctacaactgc ctcaacaatc ctgaagtaga gattctcaac 4980
gaagagaggt cgactggcag attgccgtta gacatctccc tgtcccttac acgtttcctg
5040 ttgtctgagt ttgttccagg tgtgggagtt gcgtttggcc tcttcgacct
catctggggc 5100 ttcatcactc catctgattg gagcctcttt cttctccaga
ttgaacagtt gattgaacaa 5160 aggattgaga ccttggaaag gaatcgggcc
atcactaccc ttcgtggctt agcagacagc 5220 tatgagatct acattgaagc
actaagagag tgggaagcca atcctaacaa tgcccaactg 5280 agagaagatg
tgcgtatacg ctttgctaac acagatgatg ctttgatcac agccatcaac 5340
aacttcaccc ttaccagctt cgagatccct cttctctcgg tctatgttca agctgctaac
5400 ctgcacttgt cactactgcg cgacgctgtg tcgtttgggc aaggttgggg
actggacata 5460 gctactgtca acaatcacta caacagactc atcaatctga
ttcatcgata cacgaaacat 5520 tgtttggata cctacaatca gggattggag
aacctgagag gtactaacac tcgccaatgg 5580 gccaggttca atcagttcag
gagagacctt acacttactg tgttagacat agttgctctc 5640 tttccgaact
acgatgttcg tacctatccg attcaaacgt catcccaact tacaagggag 5700
atctacacca gttcagtcat tgaagactct ccagtttctg cgaacatacc caatggtttc
5760 aacagggctg agtttggagt cagaccaccc catctcatgg acttcatgaa
ctctttgttt 5820 gtgactgcag agactgttag atcccaaact gtgtggggag
gacacttagt tagctcacgc 5880 aacacggctg gcaatcgtat caactttcct
agttacgggg tcttcaatcc cgggggcgcc 5940 atctggattg cagatgaaga
tccacgtcct ttctatcgga ccttgtcaga tcctgtcttc 6000 gtccgaggag
gctttggcaa tcctcactat gtactcggtc ttaggggagt ggcctttcaa 6060
caaactggta cgaatcacac ccgcacattc aggaactccg ggaccattga ctctctagat
6120 gagataccac ctcaagacaa cagcggcgca ccttggaatg actactccca
tgtgctgaat 6180 catgttacct ttgtgcgctg gccaggtgag atctcaggtt
ccgactcatg gagagcacca 6240 atgttctctt ggacgcatcg tagcgctacc
cccacaaaca ccattgatcc agagagaatc 6300 actcagattc ccttggtgaa
ggcacacaca cttcagtcag gaactacagt tgtaagaggg 6360 ccggggttca
cgggaggaga cattcttcga cgcactagtg gaggaccatt cgcgtacacc 6420
attgtcaaca tcaatgggca acttccccaa aggtatcgtg ccaggatacg ctatgcctct
6480 actaccaatc taagaatcta cgttacggtt gcaggtgaac ggatctttgc
tggtcagttc 6540 aacaagacaa tggataccgg tgatccactt acattccaat
ctttctccta cgccactatc 6600 aacaccgcgt tcacctttcc aatgagccag
agcagtttca cagtaggtgc tgataccttc 6660 agttcaggca acgaagtgta
cattgacagg tttgagttga ttccagttac tgccacactc 6720 gagtaaggat
ccgtcgacct gcagccaagc tttcgcgagc tcgagatccc cgacatatgc 6780
cccggtttcg ttgcgactaa catgagttct tggacaaatt tgattggacc tgatgagatg
6840 atccaacccg aggatatagc aaagctcgtt cgtgcagcaa tggaacggcc
aaaccgtgct 6900 tttgtcccca agaatgaggt gctatgcatg aaggaatcta
cccgttgatg tccaacagtc 6960
tcagggttaa tgtctatgta tcttaaataa tgttgtcggt attttgtaat ctcatataga
7020 ttttcactgt gcgacgcaaa aatattaaat aaatattatt attatctacg
ttttgattga 7080 gatatcatca atattataat aaaaatatcc attaaacacg
atttgataca aatgacagtc 7140 aataatctga tttgaatatt tattaattgt
aacgaattac ataaagatcg aatagaaaat 7200 actgcactgc aaatgaaaat
taacacatac taataaatgc gtcaaatatc tttgccaaga 7260 tcaagcggag
tgagggcctc atatccggtc tcagttacaa gcacggtatc cccgaagcgc 7320
gctccaccaa tgccctcgac atagatgccg ggctcgacgc tgaggacatt gcctaccttg
7380 agcatggtct cagcgccggc tttaagctca atcccatccc aatctgaata
tcctatcccg 7440 cgcccagtcc ggtgtaagaa cgggtctgtc catccacctc
tgttgggaat tccggtccgg 7500 gtcacctttg tccaccaaga tggaactgcg
gccgcggacc gaattcccat ggagtcaaag 7560 attcaaatag aggacctaac
agaactcgcc gtaaagactg gcgaacagtt catacagagt 7620 ctcttacgac
tcaatgacaa gaagaaaatc ttcgtcaaca tggtggagca cgacacgctt 7680
gtctactcca aaaatatcaa agatacagtc tcagaagacc aaagggcaat tgagactttt
7740 caacaaaggg taatatccgg aaacctcctc ggattccatt gcccagctat
ctgtcacttt 7800 attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat
gccatcattg cgataaagga 7860 aaggccatcg ttgaagatgc ctctgccgac
agtggtccca aagatggacc cccacccacg 7920 aggagcatcg tggaaaaaga
agacgttcca accacgtctt caaagcaagt ggattgatgt 7980 gatatctcca
ctgacgtaag ggatgacgca caatcccact atccttcgca agacccttcc 8040
tctatataag gaagttcatt tcatttggag aggacagggt acccggggat ccaccatgtc
8100 tccggagagg agaccagttg agattaggcc agctacagca gctgatatgg
ccgcggtttg 8160 tgatatcgtt aaccattaca ttgagacgtc tacagtgaac
tttaggacag agccacaaac 8220 accacaagag tggattgatg atctagagag
gttgcaagat agataccctt ggttggttgc 8280 tgaggttgag ggtgttgtgg
ctggtattgc ttacgctggg ccctggaagg ctaggaacgc 8340 ttacgattgg
acagttgaga gtactgttta cgtgtcacat aggcatcaaa ggttgggcct 8400
aggatccaca ttgtacacac atttgcttaa gtctatggag gcgcaaggtt ttaagtctgt
8460 ggttgctgtt ataggccttc caaacgatcc atctgttagg ttgcatgagg
ctttgggata 8520 cacagcccgg ggtacattgc gcgcagctgg atacaagcat
ggtggatggc atgatgttgg 8580 tttttggcaa agggattttg agttgccagc
tcctccaagg ccagttaggc cagttaccca 8640 gatctgagtc gacctgcagg
catgcccgct gaaatcacca gtctctctct acaaatctat 8700 ctctctctat
aataatgtgt gagtagttcc cagataaggg aattagggtt cttatagggt 8760
ttcgctcatg tgttgagcat ataagaaacc cttagtatgt atttgtattt gtaaaatact
8820 tctatcaata aaatttctaa ttcctaaaac caaaatccag tggcgagctc
gaattcgagc 8880 tcgagcccgg gtggatcctc tagagtcgac ctgcagaagc
ttcggtccgg cgcgcctcta 8940 gttgaagaca cgttcatgtc ttcatcgtaa
gaagacactc agtagtcttc ggccagaatg 9000 gcctaactca aggccctcac
tccgcttgat cttggcaaag atatttgacg catttattag 9060 tatgtgttaa
ttttcatttg cagtgcagta ttttctattc gatctttatg taattcgtta 9120
caattaataa atattcaaat cagattattg actgtcattt gtatcaaatc gtgtttaatg
9180 gatattttta ttataatatt gatgatatct caatcaaaac gtagataata
ataatattta 9240 tttaatattt ttgcgtcgca cagtgaaaat ctatatgaga
ttacaaaata ccgacaacat 9300 tatttaagaa acatagacat taaccctgag
actgttggac atcaacgggt agattccttc 9360 atgcatagca cctcattctt
ggggacaaaa gcacggtttg gccgttccat tgctgcacga 9420 acgagctttg
ctatatcctc gggttggatc atctcatcag gtccaatcaa atttgtccaa 9480
gaactcatgt tagtcgcaac gaaaccgggg catatgtcgg gtatctcgag ctcgcgaaag
9540 cttggctgca ggtcgacgga tccttcaaca aaagggtacc tgtacccgaa
accgacacag 9600 gtgggtaggt agagaatacc taggggcgcg agacaactct
ctctaaggaa ctcggcaaaa 9660 tagccccgta acttcgggag aaggggtgcc
ccccgctaac aataaacgaa tacggtttat 9720 gtatggattc cggtaaaata
ccggtactcg atttcataag agtcgaatag gaagttaaga 9780 tgagggtggt
atcatcataa aaatggagta gtatcctaaa ttatactaat ccacgtatga 9840
tatgtatgcc tttccttatc aaccggaagt agtgcaaaaa aaattctata ctgcactgct
9900 ctctttttac tgagaaatgc aaaaaaataa aagtgaagta agggtgcccc
atagatattt 9960 gatcttgcct cctgtccccc cccccctttt ttcatcaaaa
atttccatga aaaaagaaaa 10020 gatgaatttg tccattcatt gaaccctagt
tcgggactga cggggctcga acccgcagct 10080 tccgcctgtt cctagccttc
cagggcccag cgtaagcaat accagccaca gcaccctcaa 10140 cctcagcaac
caaccaaggg tatctatctt gcaacctctc tagatcatca atccactctt 10200
gtggtgtttg tggctctgtc ctaaagttca ctgtagacgt ctcaatgtaa tggttaacga
10260 tatcacaaac cgcggaacac aagaacgaaa gcaccttttc attctttcat
atactagggg 10320 tttttacttg gaaaagacaa tgttccatac taaaggatag
ctgcagaagc cgccaccgtc 10380 ttgaggacct tccggggagc cagaccggtc
gaaccgtgcc tccacttgct aaggagaaag 10440 ggaaaatcag ggccaggaca
tacgaaggag gagccagaac gaagatatcc taagatactt 10500 actcgctccg
ggccatgatc aatcatgcct gtggggaggt ctctcgcacc tcgatccatg 10560
aaggtaccac cgaggtctgc cccgccgccg gcttcggtac cgtcctcgcc ttgggcgccc
10620 gaggcacccg ggggatggac tgcccaggcg cagccacgac gacccaagga
tcaccctcct 10680 gcgcagtcgg cacgagcaat agttctcggg gaacaggcag
cttggcctga ctccccgggg 10740 tcacctcaac tacctcggcc gaggggtcaa
gtaccccctc agtccgcccc cgctcttcgg 10800 accgggaccc cgacgtcccg
gccccggata ccgacggcac cagcccgctc gggggctggc 10860 ttgacgaccc
ctggcccagc ctcagatctg ggctgaggcc gaggcaggcg gccatgtcgt 10920
cgtcttcatc atcgtcttca tcatcgtcgt cgtcatcagg cgtctccggc gacggctccc
10980 ttgggagccc ctccctctcc tgccgacgac gaagcctttc caaggcatcc
cgagcccacg 11040 tccgctcgtg ggcccgagcc ttctttgcgt ccttcttctc
cttcctcttc tccgcggtga 11100 ccctccgcgc agctcggtcc accgcatcct
ccgggactgg tggcagggaa ggcttgtgat 11160 gccctacctc ctggagacag
acgaaaagtc tcagctatga gaaccgaggg caatctgacg 11220 caagaaggaa
gaaggagcgg atactcacca gagacacgca cccgcgatcg ggacgcatta 11280
agggctggga aaaagtgccg gcctctaatt tcgctaccgt gccgtccacc cacctgtgga
11340 ggtcatcgat gggaagggga a 11361 25 6186 DNA Artificial Sequence
The sequence represents the DNA molecule used to transform maize
line TC1507. This sequence represents insert PHI8999A. 25
caactggaag agcggttacc cggaccgaag cttcggccgg ggcccatcga tatccgcggg
60 catgcctgca gtgcagcgtg acccggtcgt gcccctctct agagataatg
agcattgcat 120 gtctaagtta taaaaaatta ccacatattt tttttgtcac
acttgtttga agtgcagttt 180 atctatcttt atacatatat ttaaacttta
ctctacgaat aatataatct atagtactac 240 aataatatca gtgttttaga
gaatcatata aatgaacagt tagacatggt ctaaaggaca 300 attgagtatt
ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc 360
tttttttttg caaatagctt cacctatata atacttcatc cattttatta gtacatccat
420 ttagggttta gggttaatgg tttttataga ctaatttttt tagtacatct
attttattct 480 attttagcct ctaaattaag aaaactaaaa ctctatttta
gtttttttat ttaataattt 540 agatataaaa tagaataaaa taaagtgact
aaaaattaaa caaataccct ttaagaaatt 600 aaaaaaacta aggaaacatt
tttcttgttt cgagtagata atgccagcct gttaaacgcc 660 gtcgacgagt
ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa 720
gcagacggca cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc
780 gttggacttg ctccgctgtc ggcatccaga aattgcgtgg cggagcggca
gacgtgagcc 840 ggcacggcag gcggcctcct cctcctctca cggcacggca
gctacggggg attcctttcc 900 caccgctcct tcgctttccc ttcctcgccc
gccgtaataa atagacaccc cctccacacc 960 ctctttcccc aacctcgtgt
tgttcggagc gcacacacac acaaccagat ctcccccaaa 1020 tccacccgtc
ggcacctccg cttcaaggta cgccgctcgt cctccccccc cccccctctc 1080
taccttctct agatcggcgt tccggtccat ggttagggcc cggtagttct acttctgttc
1140 atgtttgtgt tagatccgtg tttgtgttag atccgtgctg ctagcgttcg
tacacggatg 1200 cgacctgtac gtcagacacg ttctgattgc taacttgcca
gtgtttctct ttggggaatc 1260 ctgggatggc tctagccgtt ccgcagacgg
gatcgatttc atgatttttt ttgtttcgtt 1320 gcatagggtt tggtttgccc
ttttccttta tttcaatata tgccgtgcac ttgtttgtcg 1380 ggtcatcttt
tcatgctttt ttttgtcttg gttgtgatga tgtggtctgg ttgggcggtc 1440
gttctagatc ggagtagaat tctgtttcaa actacctggt ggatttatta attttggatc
1500 tgtatgtgtg tgccatacat attcatagtt acgaattgaa gatgatggat
ggaaatatcg 1560 atctaggata ggtatacatg ttgatgcggg ttttactgat
gcatatacag agatgctttt 1620 tgttcgcttg gttgtgatga tgtggtgtgg
ttgggcggtc gttcattcgt tctagatcgg 1680 agtagaatac tgtttcaaac
tacctggtgt atttattaat tttggaactg tatgtgtgtg 1740 tcatacatct
tcatagttac gagtttaaga tggatggaaa tatcgatcta ggataggtat 1800
acatgttgat gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat
1860 atgctctaac cttgagtacc tatctattat aataaacaag tatgttttat
aattattttg 1920 atcttgatat acttggatga tggcatatgc agcagctata
tgtggatttt tttagccctg 1980 ccttcatacg ctatttattt gcttggtact
gtttcttttg tcgatgctca ccctgttgtt 2040 tggtgttact tctgcaggtc
gactctagag gatccaacaa tggagaacaa catacagaat 2100 cagtgcgtcc
cctacaactg cctcaacaat cctgaagtag agattctcaa cgaagagagg 2160
tcgactggca gattgccgtt agacatctcc ctgtccctta cacgtttcct gttgtctgag
2220 tttgttccag gtgtgggagt tgcgtttggc ctcttcgacc tcatctgggg
cttcatcact 2280 ccatctgatt ggagcctctt tcttctccag attgaacagt
tgattgaaca aaggattgag 2340 accttggaaa ggaatcgggc catcactacc
cttcgtggct tagcagacag ctatgagatc 2400 tacattgaag cactaagaga
gtgggaagcc aatcctaaca atgcccaact gagagaagat 2460 gtgcgtatac
gctttgctaa cacagatgat gctttgatca cagccatcaa caacttcacc 2520
cttaccagct tcgagatccc tcttctctcg gtctatgttc aagctgctaa cctgcacttg
2580 tcactactgc gcgacgctgt gtcgtttggg caaggttggg gactggacat
agctactgtc 2640 aacaatcact acaacagact catcaatctg attcatcgat
acacgaaaca ttgtttggat 2700 acctacaatc agggattgga gaacctgaga
ggtactaaca ctcgccaatg ggccaggttc 2760 aatcagttca ggagagacct
tacacttact gtgttagaca tagttgctct ctttccgaac 2820 tacgatgttc
gtacctatcc gattcaaacg tcatcccaac ttacaaggga gatctacacc 2880
agttcagtca ttgaagactc tccagtttct gcgaacatac ccaatggttt caacagggct
2940 gagtttggag tcagaccacc ccatctcatg gacttcatga actctttgtt
tgtgactgca 3000 gagactgtta gatcccaaac tgtgtgggga ggacacttag
ttagctcacg caacacggct 3060 ggcaatcgta tcaactttcc tagttacggg
gtcttcaatc ccgggggcgc catctggatt 3120 gcagatgaag atccacgtcc
tttctatcgg accttgtcag atcctgtctt cgtccgagga 3180 ggctttggca
atcctcacta tgtactcggt cttaggggag tggcctttca acaaactggt 3240
acgaatcaca cccgcacatt caggaactcc gggaccattg actctctaga tgagatacca
3300 cctcaagaca acagcggcgc accttggaat gactactccc atgtgctgaa
tcatgttacc 3360 tttgtgcgct ggccaggtga gatctcaggt tccgactcat
ggagagcacc aatgttctct 3420 tggacgcatc gtagcgctac ccccacaaac
accattgatc cagagagaat cactcagatt 3480 cccttggtga aggcacacac
acttcagtca ggaactacag ttgtaagagg gccggggttc 3540 acgggaggag
acattcttcg acgcactagt ggaggaccat tcgcgtacac cattgtcaac 3600
atcaatgggc aacttcccca aaggtatcgt gccaggatac gctatgcctc tactaccaat
3660 ctaagaatct acgttacggt tgcaggtgaa cggatctttg ctggtcagtt
caacaagaca 3720 atggataccg gtgatccact tacattccaa tctttctcct
acgccactat caacaccgcg 3780 ttcacctttc caatgagcca gagcagtttc
acagtaggtg ctgatacctt cagttcaggc 3840 aacgaagtgt acattgacag
gtttgagttg attccagtta ctgccacact cgagtaagga 3900 tccgtcgacc
tgcagccaag cttttcgcga gctcgagatc cccgacatat gccccggttt 3960
cgttgcgact aacatgagtt cttggacaaa tttgattgga cctgatgaga tgatccaacc
4020 cgaggatata gcaaagctcg ttcgtgcagc aatggaacgg ccaaaccgtg
cttttgtccc 4080 caagaatgag gtgctatgca tgaaggaatc tacccgttga
tgtccaacag tctcagggtt 4140 aatgtctatg tatcttaaat aatgttgtcg
gtattttgta atctcatata gattttcact 4200 gtgcgacgca aaaatattaa
ataaatatta ttattatcta cgttttgatt gagatatcat 4260 caatattata
ataaaaatat ccattaaaca cgatttgata caaatgacag tcaataatct 4320
gatttgaata tttattaatt gtaacgaatt acataaagat cgaatagaaa atactgcact
4380 gcaaatgaaa attaacacat actaataaat gcgtcaaata tctttgccaa
gatcaagcgg 4440 agtgagggcc tcatatccgg tctcagttac aagcacggta
tccccgaagc gcgctccacc 4500 aatgccctcg acatagatgc cgggctcgac
gctgaggaca ttgcctacct tgagcatggt 4560 ctcagcgccg gctttaagct
caatcccatc ccaatctgaa tatcctatcc cgcgcccagt 4620 ccggtgtaag
aacgggtctg tccatccacc tctgttggga attccggtcc gggtcacctt 4680
tgtccaccaa gatggaactg cggccgcgga ccgaattccc atggagtcaa agattcaaat
4740 agaggaccta acagaactcg ccgtaaagac tggcgaacag ttcatacaga
gtctcttacg 4800 actcaatgac aagaagaaaa tcttcgtcaa catggtggag
cacgacacgc ttgtctactc 4860 caaaaatatc aaagatacag tctcagaaga
ccaaagggca attgagactt ttcaacaaag 4920 ggtaatatcc ggaaacctcc
tcggattcca ttgcccagct atctgtcact ttattgtgaa 4980 gatagtggaa
aaggaaggtg gctcctacaa atgccatcat tgcgataaag gaaaggccat 5040
cgttgaagat gcctctgccg acagtggtcc caaagatgga cccccaccca cgaggagcat
5100 cgtggaaaaa gaagacgttc caaccacgtc ttcaaagcaa gtggattgat
gtgatatctc 5160 cactgacgta agggatgacg cacaatccca ctatccttcg
caagaccctt cctctatata 5220 aggaagttca tttcatttgg agaggacagg
gtacccgggg atccaccatg tctccggaga 5280 ggagaccagt tgagattagg
ccagctacag cagctgatat ggccgcggtt tgtgatatcg 5340 ttaaccatta
cattgagacg tctacagtga actttaggac agagccacaa acaccacaag 5400
agtggattga tgatctagag aggttgcaag atagataccc ttggttggtt gctgaggttg
5460 agggtgttgt ggctggtatt gcttacgctg ggccctggaa ggctaggaac
gcttacgatt 5520 ggacagttga gagtactgtt tacgtgtcac ataggcatca
aaggttgggc ctaggatcca 5580 cattgtacac acatttgctt aagtctatgg
aggcgcaagg ttttaagtct gtggttgctg 5640 ttataggcct tccaaacgat
ccatctgtta ggttgcatga ggctttggga tacacagccc 5700 ggggtacatt
gcgcgcagct ggatacaagc atggtggatg gcatgatgtt ggtttttggc 5760
aaagggattt tgagttgcca gctcctccaa ggccagttag gccagttacc cagatctgag
5820 tcgacctgca ggcatgccgc tgaaatcacc agtctctctc tacaaatcta
tctctctcta 5880 taataatgtg tgagtagttc ccagataagg gaattagggt
tcttataggg tttcgctcat 5940 gtgttgagca tataagaaac ccttagtatg
tatttgtatt tgtaaaatac ttctatcaat 6000 aaaatttcta attcctaaaa
ccaaaatcca gtggcgagct cgaattcgag ctcgagcccg 6060 ggtggatcct
ctagagtcga cctgcagaag cttcggtccg gcgcgcctct agttgaagac 6120
acgttcatgt cttcatcgta agaagacact cagtagtctt cggccagaat ggcctaactc
6180 aaggcc 6186 26 3830 DNA Artificial Sequence Sequence that
represents part of the PHI8999A insert as well as flanking sequence
5' to the insert. 26 actagtttcc tagcccgcgt cgtgccccta ccccaccgac
gtttatggaa ggtgccattc 60 cacggttctt cgtggccgcc cctaaggatg
taaatggtcg gtaaaatccg gtaaatttcc 120 ggtaccgttt accagatttt
tccagccgtt ttcggattta tcgggatata cagaaaacga 180 gacggaaacg
gaataggttt tttttcgaaa acggtacggt aaacggtgag acaaacttac 240
cgtccgtttt cgtatttctc gggaaactct ggtatattcc cgtatttgtc ccgtattttc
300 ccgacccacg gacctgccaa tcaaccatca gccagtcagc ccatccccac
agctatggcc 360 catggggcca tgttggccac atgcccacgc aacgcaaggc
agtaaggctg gcagcctggc 420 acgcattgac gcatgtggac acacacagcc
gccgcctgtt cgtgtttctg tgccgttgtg 480 cgagactgtg actgcgagtg
gcggagtcgg cgaacggcga ggcgtctccg gagtctggac 540 tgcggctgtg
gacagcgacg ctgtgacggc gactcggcga agccccaagc taccaagccc 600
ccaagtcccc atccatctct gcttctctgg tcatctcctt cccctggtcg atctgcaggc
660 gccagaccgg ccgaagcatc acgaaacgca ctaagacctc gaaggagtca
aaccactcct 720 ccgaggcctc gggggctaca cccggcgggt gcgctcgcgc
gcacccaccg gaacaaaatg 780 taaccgagaa aggtcggtcc ccttgcaaaa
aaagtgcgac aaaagcctcc aagcgagtat 840 taacactcac tttgaggctc
gggggctact gtcggggacc ataattaggg gtacccccaa 900 gactcctaat
ctcagctggt aacccccatc agcacaaagc tgcaaaggcc tgatgggtgc 960
gattaagtca aggctcggtc cactcaaggg acacgatctc gcctcgcccg agcccagcct
1020 cgggcaaggg cggccgaccc cgaggattca cgtctcgccc gagggccccc
tcaagcgacg 1080 ggcacacctt cggctcgccc gaggcccatt cttcgccgag
aagcaacctt ggccagatcg 1140 ccacaccgac cgaccgtatc gcaggagcat
ttaatgcgag gatcgcctga caccttatcc 1200 tgacgcgcgc tcttcagtcg
acagagccga agtgaccgca atcacttcgc cgctccactg 1260 accgacctga
caagaagaca gcgccgcctg cgtcgctccg actgctgtgc cactcgacag 1320
agtgaggctg acagcagcca agtccggcct cgggcgccat aggaagctcc gcctcgcccg
1380 accctagggc tcggactcgg cctcggctcc ggaagacgac gaactacgct
tcgcccgacc 1440 ccagggcttg gactcagcct cggctccgga agacgacgaa
ttccgcctcg cccgacccca 1500 gggctcggac tcggcctcgg ctccagaaga
cgacgaactc cgcctcgccc gaccccaggg 1560 ctcggactca gcctcggctc
cggaagacga cgaactccgc ctcgcccgac cccagggctc 1620 ggactcagcc
tcggcctcag acgatggtct ccgcctcgcc cgacccgggg ctcggactcg 1680
acctttctat cggaccttgt cagatcctgt cttcgtccga ggaggctttg gcaatcctca
1740 ctatgtactc ggtcttaggg gagtggcctt tcaacaaact ggtacgaatc
acacccgcac 1800 attcaggaac tccgggacca ttgactctct agatgagata
ccacctcaag acaacagcgg 1860 cgcaccttgg aatgactact cccatgtgct
gaatcatgtt acctttgtgc gctggccagg 1920 tgagatctca ggttccgact
catggagagc accaatgttc tcttggacgc atcgtagcgc 1980 tacccccaca
aacaccattg atccagagag aatcactcat tcttcaagaa ctgcatatct 2040
tgccgagatc ctcatcccta aaggtacttg acaatagtat tattggagtc gatacacaac
2100 tcacaaaaaa tacaagaagt cgactaggtg gattggtccg agtgaagaga
aaaaaaagcc 2160 atacagaact caaaatcttt tccggagata ttcattttcc
tgaagaggcg gataagatat 2220 taggtggcag tttgatacca ccagaaagag
aaaaaaaaga ttctaaggaa tcaaaaaaaa 2280 ggaaaaattg ggtttatgtt
caacggaaaa aatttctcaa aagcaaggaa aagtattgtg 2340 gctatttatc
tatccgtgca gctgatatgg ccgcggtttg tgatatcgtt aaccattaca 2400
ttgagacgtc tacagtgaac tttaggacag agccacaaac accacaagag tggattgatg
2460 atctagagag gttgcaagat agataccctt ggttggttgc tgaggttgag
ggtgttgtgg 2520 ctggtattgc ttacgctggg ccctggaagg ctaggaaccc
tcaacctcag caaccaacca 2580 atggtatcta tcttgcaacc tctctagatc
atcaatccac tcttgtggtg tttgtggctc 2640 tgtcctaaag ttcactgtag
acgtctcaat gtaatggtta acgatatcac aaaccgagag 2700 aagagggatc
tcgaagcttc ggccggggcc catcgatatc cgcgggcatg cctgcagtgc 2760
agcgtgaccc ggtcgtgccc ctctctagag ataatgagca ttgcatgtct aagttataaa
2820 aaattaccac aactggaaga gcggttaccc ggaccgaagc ttcggccggg
gcccatcgat 2880 atccgcgggc atgcctgcag tgcagcgtga cccggtcgtg
cccctctcta gagataatga 2940 gcattgcatg tctaagttat aaaaaattac
cacatatttt ttttgtcaca cttgtttgaa 3000 gtgcagttta tctatcttta
tacatatatt taaactttac tctacgaata atataatcta 3060 tagtactaca
ataatatcag tgttttagag aatcatataa atgaacagtt agacatggtc 3120
taaaggacaa ttgagtattt tgacaacagg actctacagt tttatctttt tagtgtgcat
3180 gtgttctcct ttttttttgc aaatagcttc acctatataa tacttcatcc
attttattag 3240 tacatccatt tagggtttag ggttaatggt ttttatagac
taattttttt agtacatcta 3300 ttttattcta ttttagcctc taaattaaga
aaactaaaac tctattttag tttttttatt 3360 taataattta gatataaaat
agaataaaat aaagtgacta aaaattaaac aaataccctt 3420 taagaaatta
aaaaaactaa ggaaacattt ttcttgtttc gagtagataa tgccagcctg 3480
ttaaacgccg tcgacgagtc taacggacac caaccagcga accagcagcg tcgcgtcggg
3540 ccaagcgaag cagacggcac ggcatctctg tcgctgcctc tggacccctc
tcgagagttc 3600 cgctccaccg ttggacttgc tccgctgtcg gcatccagaa
attgcgtggc ggagcggcag 3660 acgtgagccg gcacggcagg cggcctcctc
ctcctctcac ggcacggcag ctacggggga 3720 ttcctttccc accgctcctt
cgctttccct tcctcgcccg ccgtaataaa tagacacccc 3780 ctccacaccc
tctttcccca acctcgtgtt gttcggagcg cacacacaca 3830 27 3347 DNA
Artificial Sequence Sequence that represents part of the PHI8999A
insert as well as flanking sequence 3' to the insert. 27 cccactatcc
ttcgcaagac ccttcctcta tataaggaag ttcatttcat ttggagagga 60
cagggtaccc ggggatccac catgtctccg gagaggagac cagttgagat taggccagct
120 acagcagctg atatggccgc ggtttgtgat
atcgttaacc attacattga gacgtctaca 180 gtgaacttta ggacagagcc
acaaacacca caagagtgga ttgatgatct agagaggttg 240 caagatagat
acccttggtt ggttgctgag gttgagggtg ttgtggctgg tattgcttac 300
gctgggccct ggaaggctag gaacgcttac gattggacag ttgagagtac tgtttacgtg
360 tcacataggc atcaaaggtt gggcctagga tccacattgt acacacattt
gcttaagtct 420 atggaggcgc aaggttttaa gtctgtggtt gctgttatag
gccttccaaa cgatccatct 480 gttaggttgc atgaggcttt gggatacaca
gcccggggta cattgcgcgc agctggatac 540 aagcatggtg gatggcatga
tgttggtttt tggcaaaggg attttgagtt gccagctcct 600 ccaaggccag
ttaggccagt tacccagatc tgagtcgacc tgcaggcatg cccgctgaaa 660
tcaccagtct ctctctacaa atctatctct ctctataata atgtgtgagt agttcccaga
720 taagggaatt agggttctta tagggtttcg ctcatgtgtt gagcatataa
gaaaccctta 780 gtatgtattt gtatttgtaa aatacttcta tcaataaaat
ttctaattcc taaaaccaaa 840 atccagtggc gagctcgaat tcgagctcga
gcccgggtgg atcctctaga gtcgacctgc 900 agaagcttcg gtccggcgcg
cctctagttg aagacacgtt catgtcttca tcgtaagaag 960 acactcagta
gtcttcggcc agaatggcct aactcaaggc cctcactccg cttgatcttg 1020
gcaaagatat ttgacgcatt tattagtatg tgttaatttt catttgcagt gcagtatttt
1080 ctattcgatc tttatgtaat tcgttacaat taataaatat tcaaatcaga
ttattgactg 1140 tcatttgtat caaatcgtgt ttaatggata tttttattat
aatattgatg atatctcaat 1200 caaaacgtag ataataataa tatttattta
atatttttgc gtcgcacagt gaaaatctat 1260 atgagattac aaaataccga
caacattatt taagaaacat agacattaac cctgagactg 1320 ttggacatca
acgggtagat tccttcatgc atagcacctc attcttgggg acaaaagcac 1380
ggtttggccg ttccattgct gcacgaacga gctttgctat atcctcgggt tggatcatct
1440 catcaggtcc aatcaaattt gtccaagaac tcatgttagt cgcaacgaaa
ccggggcata 1500 tgtcgggtat ctcgagctcg cgaaagcttg gctgcaggtc
gacggatcct tcaacaaaag 1560 ggtacctgta cccgaaaccg acacaggtgg
gtaggtagag aatacctagg ggcgcgagac 1620 aactctctct aaggaactcg
gcaaaatagc cccgtaactt cgggagaagg ggtgcccccc 1680 gctaacaata
aacgaatacg gtttatgtat ggattccggt aaaataccgg tactcgattt 1740
cataagagtc gaataggaag ttaagatgag ggtggtatca tcataaaaat ggagtagtat
1800 cctaaattat actaatccac gtatgatatg tatgcctttc cttatcaacc
ggaagtagtg 1860 caaaaaaaat tctatactgc actgctctct ttttactgag
aaatgcaaaa aaataaaagt 1920 gaagtaaggg tgccccatag atatttgatc
ttgcctcctg tccccccccc ccttttttca 1980 tcaaaaattt ccatgaaaaa
agaaaagatg aatttgtcca ttcattgaac cctagttcgg 2040 gactgacggg
gctcgaaccc gcagcttccg cctgttccta gccttccagg gcccagcgta 2100
agcaatacca gccacagcac cctcaacctc agcaaccaac caagggtatc tatcttgcaa
2160 cctctctaga tcatcaatcc actcttgtgg tgtttgtggc tctgtcctaa
agttcactgt 2220 agacgtctca atgtaatggt taacgatatc acaaaccgcg
gaacacaaga acgaaagcac 2280 cttttcattc tttcatatac taggggtttt
tacttggaaa agacaatgtt ccatactaaa 2340 ggatagctgc agaagccgcc
accgtcttga ggaccttccg gggagccaga ccggtcgaac 2400 cgtgcctcca
cttgctaagg agaaagggaa aatcagggcc aggacatacg aaggaggagc 2460
cagaacgaag atatcctaag atacttactc gctccgggcc atgatcaatc atgcctgtgg
2520 ggaggtctct cgcacctcga tccatgaagg taccaccgag gtctgccccg
ccgccggctt 2580 cggtaccgtc ctcgccttgg gcgcccgagg cacccggggg
atggactgcc caggcgcagc 2640 cacgacgacc caaggatcac cctcctgcgc
agtcggcacg agcaatagtt ctcggggaac 2700 aggcagcttg gcctgactcc
ccggggtcac ctcaactacc tcggccgagg ggtcaagtac 2760 cccctcagtc
cgcccccgct cttcggaccg ggaccccgac gtcccggccc cggataccga 2820
cggcaccagc ccgctcgggg gctggcttga cgacccctgg cccagcctca gatctgggct
2880 gaggccgagg caggcggcca tgtcgtcgtc ttcatcatcg tcttcatcat
cgtcgtcgtc 2940 atcaggcgtc tccggcgacg gctcccttgg gagcccctcc
ctctcctgcc gacgacgaag 3000 cctttccaag gcatcccgag cccacgtccg
ctcgtgggcc cgagccttct ttgcgtcctt 3060 cttctccttc ctcttctccg
cggtgaccct ccgcgcagct cggtccaccg catcctccgg 3120 gactggtggc
agggaaggct tgtgatgccc tacctcctgg agacagacga aaagtctcag 3180
ctatgagaac cgagggcaat ctgacgcaag aaggaagaag gagcggatac tcaccagaga
3240 cacgcacccg cgatcgggac gcattaaggg ctgggaaaaa gtgccggcct
ctaatttcgc 3300 taccgtgccg tccacccacc tgtggaggtc atcgatggga aggggaa
3347 28 669 DNA Zea mays 28 actagtttcc tagcccgcgt cgtgccccta
ccccaccgac gtttatggaa ggtgccattc 60 cacggttctt cgtggccgcc
cctaaggatg taaatggtcg gtaaaatccg gtaaatttcc 120 ggtaccgttt
accagatttt tccagccgtt ttcggattta tcgggatata cagaaaacga 180
gacggaaacg gaataggttt tttttcgaaa acggtacggt aaacggtgag acaaacttac
240 cgtccgtttt cgtatttctc gggaaactct ggtatattcc cgtatttgtc
ccgtattttc 300 ccgacccacg gacctgccaa tcaaccatca gccagtcagc
ccatccccac agctatggcc 360 catggggcca tgttggccac atgcccacgc
aacgcaaggc agtaaggctg gcagcctggc 420 acgcattgac gcatgtggac
acacacagcc gccgcctgtt cgtgtttctg tgccgttgtg 480 cgagactgtg
actgcgagtg gcggagtcgg cgaacggcga ggcgtctccg gagtctggac 540
tgcggctgtg gacagcgacg ctgtgacggc gactcggcga agccccaagc taccaagccc
600 ccaagtcccc atccatctct gcttctctgg tcatctcctt cccctggtcg
atctgcaggc 660 gccagaccg 669 29 200 DNA Zea mays 29 gccgaagcat
cacgaaacgc actaagacct cgaaggagtc aaaccactcc tccgaggcct 60
cgggggctac acccggcggg tgcgctcgcg cgcacccacc ggaacaaaat gtaaccgaga
120 aaggtcggtc cccttgcaaa aaaagtgcga caaaagcctc caagcgagta
ttaacactca 180 ctttgaggct cgggggctac 200 30 812 DNA Zea mays
Fragment of maize Huck-1 retrotransposon 30 tgtcggggac cataattagg
ggtaccccca agactcctaa tctcagctgg taacccccat 60 cagcacaaag
ctgcaaaggc ctgatgggtg cgattaagtc aaggctcggt ccactcaagg 120
gacacgatct cgcctcgccc gagcccagcc tcgggcaagg gcggccgacc ccgaggattc
180 acgtctcgcc cgagggcccc ctcaagcgac gggcacacct tcggctcgcc
cgaggcccat 240 tcttcgccga gaagcaacct tggccagatc gccacaccga
ccgaccgtat cgcaggagca 300 tttaatgcga ggatcgcctg acaccttatc
ctgacgcgcg ctcttcagtc gacagagccg 360 aagtgaccgc aatcacttcg
ccgctccact gaccgacctg acaagaagac agcgccgcct 420 gcgtcgctcc
gactgctgtg ccactcgaca gagtgaggct gacagcagcc aagtccggcc 480
tcgggcgcca taggaagctc cgcctcgccc gaccctaggg ctcggactcg gcctcggctc
540 cggaagacga cgaactacgc ttcgcccgac cccagggctt ggactcagcc
tcggctccgg 600 aagacgacga attccgcctc gcccgacccc agggctcgga
ctcggcctcg gctccagaag 660 acgacgaact ccgcctcgcc cgaccccagg
gctcggactc agcctcggct ccggaagacg 720 acgaactccg cctcgcccga
ccccagggct cggactcagc ctcggcctca gacgatggtc 780 tccgcctcgc
ccgacccggg gctcggactc ga 812 31 335 DNA Artificial Sequence
Represents part of PHI8999A insert sequence - fragment of cry1F
gene 31 cctttctatc ggaccttgtc agatcctgtc ttcgtccgag gaggctttgg
caatcctcac 60 tatgtactcg gtcttagggg agtggccttt caacaaactg
gtacgaatca cacccgcaca 120 ttcaggaact ccgggaccat tgactctcta
gatgagatac cacctcaaga caacagcggc 180 gcaccttgga atgactactc
ccatgtgctg aatcatgtta cctttgtgcg ctggccaggt 240 gagatctcag
gttccgactc atggagagca ccaatgttct cttggacgca tcgtagcgct 300
acccccacaa acaccattga tccagagaga atcac 335 32 321 DNA Zea mays
Fragment of maize chloroplast rpoC2 gene 32 tcattcttca agaactgcat
atcttgccga gatcctcatc cctaaaggta cttgacaata 60 gtattattgg
agtcgataca caactcacaa aaaatacaag aagtcgacta ggtggattgg 120
tccgagtgaa gagaaaaaaa agccatacag aactcaaaat cttttccgga gatattcatt
180 ttcctgaaga ggcggataag atattaggtg gcagtttgat accaccagaa
agagaaaaaa 240 aagattctaa ggaatcaaaa aaaaggaaaa attgggttta
tgttcaacgg aaaaaatttc 300 tcaaaagcaa ggaaaagtat t 321 33 17 DNA
Artificial Sequence Represents part of PHI8999A insert
sequence-fragment of ubiZM1(2) promoter; also a fragment of the
maize chloroplast trn1 gene 33 gtggctattt atctatc 17 34 201 DNA
Artificial Sequence Represents part of PHI8999A insert sequence -
fragment of pat gene 34 gcagctgata tggccgcggt ttgtgatatc gttaaccatt
acattgagac gtctacagtg 60 aactttagga cagagccaca aacaccacaa
gagtggattg atgatctaga gaggttgcaa 120 gatagatacc cttggttggt
tgctgaggtt gagggtgttg tggctggtat tgcttacgct 180 gggccctgga
aggctaggaa c 201 35 138 DNA Artificial Sequence Represents part of
PHI8999A insert sequence - fragment of pat gene (complement) 35
cctcaacctc agcaaccaac caatggtatc tatcttgcaa cctctctaga tcatcaatcc
60 actcttgtgg tgtttgtggc tctgtcctaa agttcactgt agacgtctca
atgtaatggt 120 taacgatatc acaaaccg 138 36 15 DNA Artificial
Sequence Represents part of PHI8999A insert sequence - fragment of
cry1F gene (complement) 36 agagaagagg gatct 15 37 118 DNA
Artificial Sequence Represents part of PHI8999A insert sequence -
fragment of polylinker 37 cgaagcttcg gccggggccc atcgatatcc
gcgggcatgc ctgcagtgca gcgtgacccg 60 gtcgtgcccc tctctagaga
taatgagcat tgcatgtcta agttataaaa aattacca 118 38 550 DNA Artificial
Sequence Represents part of PHI8999A insert sequence - fragment of
ORF25 terminator (complement) 38 ctcactccgc ttgatcttgg caaagatatt
tgacgcattt attagtatgt gttaattttc 60 atttgcagtg cagtattttc
tattcgatct ttatgtaatt cgttacaatt aataaatatt 120 caaatcagat
tattgactgt catttgtatc aaatcgtgtt taatggatat ttttattata 180
atattgatga tatctcaatc aaaacgtaga taataataat atttatttaa tatttttgcg
240 tcgcacagtg aaaatctata tgagattaca aaataccgac aacattattt
aagaaacata 300 gacattaacc ctgagactgt tggacatcaa cgggtagatt
ccttcatgca tagcacctca 360 ttcttgggga caaaagcacg gtttggccgt
tccattgctg cacgaacgag ctttgctata 420 tcctcgggtt ggatcatctc
atcaggtcca atcaaatttg tccaagaact catgttagtc 480 gcaacgaaac
cggggcatat gtcgggtatc tcgagctcgc gaaagcttgg ctgcaggtcg 540
acggatcctt 550 39 128 DNA Zea mays Fragment of maize chloroplast
rps12 rRNA gene (complement) 39 caacaaaagg gtacctgtac ccgaaaccga
cacaggtggg taggtagaga atacctaggg 60 gcgcgagaca actctctcta
aggaactcgg caaaatagcc ccgtaacttc gggagaaggg 120 gtgccccc 128 40 392
DNA Zea mays Fragment of maize chloroplast genome 40 ctaacaataa
acgaatacgg tttatgtatg gattccggta aaataccggt actcgatttc 60
ataagagtcg aataggaagt taagatgagg gtggtatcat cataaaaatg gagtagtatc
120 ctaaattata ctaatccacg tatgatatgt atgcctttcc ttatcaaccg
gaagtagtgc 180 aaaaaaaatt ctatactgca ctgctctctt tttactgaga
aatgcaaaaa aataaaagtg 240 aagtaagggt gccccataga tatttgatct
tgcctcctgt cccccccccc cttttttcat 300 caaaaatttc catgaaaaaa
gaaaagatga atttgtccat tcattgaacc ctagttcggg 360 actgacgggg
ctcgaacccg cagcttccgc ct 392 41 188 DNA Artificial Sequence
Represents part of PHI8999A insert sequence - fragment of pat gene
(complement) 41 gttcctagcc ttccagggcc cagcgtaagc aataccagcc
acagcaccct caacctcagc 60 aaccaaccaa gggtatctat cttgcaacct
ctctagatca tcaatccact cttgtggtgt 120 ttgtggctct gtcctaaagt
tcactgtaga cgtctcaatg taatggttaa cgatatcaca 180 aaccgcgg 188 42 81
DNA Zea mays Fragment of maize chloroplast ORF241 (complement) 42
cacaagaacg aaagcacctt ttcattcttt catatactag gggtttttac ttggaaaaga
60 caatgttcca tactaaagga t 81 43 254 DNA Zea mays 43 agctgcagaa
gccgccaccg tcttgaggac cttccgggga gccagaccgg tcgaaccgtg 60
cctccacttg ctaaggagaa agggaaaatc agggccagga catacgaagg aggagccaga
120 acgaagatat cctaagatac ttactcgctc cgggccatga tcaatcatgc
ctgtggggag 180 gtctctcgca cctcgatcca tgaaggtacc accgaggtct
gccccgccgc cggcttcggt 240 accgtcctcg cctt 254 44 749 DNA Zea mays
44 gggcgcccga ggcacccggg ggatggactg cccaggcgca gccacgacga
cccaaggatc 60 accctcctgc gcagtcggca cgagcaatag ttctcgggga
acaggcagct tggcctgact 120 ccccggggtc acctcaacta cctcggccga
ggggtcaagt accccctcag tccgcccccg 180 ctcttcggac cgggaccccg
acgtcccggc cccggatacc gacggcacca gcccgctcgg 240 gggctggctt
gacgacccct ggcccagcct cagatctggg ctgaggccga ggcaggcggc 300
catgtcgtcg tcttcatcat cgtcttcatc atcgtcgtcg tcatcaggcg tctccggcga
360 cggctccctt gggagcccct ccctctcctg ccgacgacga agcctttcca
aggcatcccg 420 agcccacgtc cgctcgtggg cccgagcctt ctttgcgtcc
ttcttctcct tcctcttctc 480 cgcggtgacc ctccgcgcag ctcggtccac
cgcatcctcc gggactggtg gcagggaagg 540 cttgtgatgc cctacctcct
ggagacagac gaaaagtctc agctatgaga accgagggca 600 atctgacgca
agaaggaaga aggagcggat actcaccaga gacacgcacc cgcgatcggg 660
acgcattaag ggctgggaaa aagtgccggc ctctaatttc gctaccgtgc cgtccaccca
720 cctgtggagg tcatcgatgg gaaggggaa 749 45 20 DNA Artificial
Sequence 5' event flanking sequence; junction between regions 3 and
4 45 tcggactcga cctttctatc 20 46 20 DNA Artificial Sequence 5'
event flanking sequence; junction between regions 4 and 5 46
agagaatcac tcattcttca 20 47 20 DNA Artificial Sequence 5' event
flanking sequence; junction between regions 5 and 6 47 gaaaagtatt
gtggctattt 20 48 20 DNA Artificial Sequence 5' event flanking
sequence; junction between regions 6 and 7a 48 tctcaaggcc
gcagctgata 20 49 20 DNA Artificial Sequence 5' event flanking
sequence; junction between regions 7a and 7b 49 ggctaggaac
cctcaacctc 20 50 20 DNA Artificial Sequence 5' event flanking
sequence; junction between regions 7b and 7c 50 tcacaaaccg
agagaagagg 20 51 20 DNA Artificial Sequence 5' event flanking
sequence; junction between regions 7c and 8 51 agagggatct
cgaagcttcg 20 52 20 DNA Artificial Sequence 5' event flanking
sequence; junction between regions 8 and 9 52 aaaattacca caactggaag
20 53 20 DNA Artificial Sequence 3' event flanking sequence;
junction between regions 9 and 10 53 agctatgttt ctcactccgc 20 54 20
DNA Artificial Sequence 3' event flanking sequence; junction
between regions 10 and 11 54 acggatcctt caacaaaagg 20 55 20 DNA
Artificial Sequence 3' event flanking sequence; junction between
regions 11 and 12 55 gtgccccccg ctaacaataa 20 56 20 DNA Artificial
Sequence 3' event flanking sequence; junction between regions 12
and 13 56 gcttccgcct gttcctagcc 20 57 20 DNA Artificial Sequence 3'
event flanking sequence; junction between regions 13 and 14 57
aaaccgcgga acacaagaac 20
* * * * *
References