U.S. patent application number 10/913245 was filed with the patent office on 2006-02-09 for inducible expression systems for modulating the expression of target genes in eukaryotic cells and non-human animals.
Invention is credited to Stephen W. Fesik, Xiaoyu Lin, Yu Shen.
Application Number | 20060031945 10/913245 |
Document ID | / |
Family ID | 35262074 |
Filed Date | 2006-02-09 |
United States Patent
Application |
20060031945 |
Kind Code |
A1 |
Shen; Yu ; et al. |
February 9, 2006 |
Inducible expression systems for modulating the expression of
target genes in eukaryotic cells and non-human animals
Abstract
The present invention relates to inducible expression systems
and to compositions and methods for modulating the expression of at
least one target gene in an eukaryotic cell and non-human
animal.
Inventors: |
Shen; Yu; (Gurnee, IL)
; Fesik; Stephen W.; (Gurnee, IL) ; Lin;
Xiaoyu; (Evanston, IL) |
Correspondence
Address: |
ROBERT DEBERARDINE;ABBOTT LABORATORIES
100 ABBOTT PARK ROAD
DEPT. 377/AP6A
ABBOTT PARK
IL
60064-6008
US
|
Family ID: |
35262074 |
Appl. No.: |
10/913245 |
Filed: |
August 6, 2004 |
Current U.S.
Class: |
800/8 ;
435/320.1; 435/325; 536/23.1 |
Current CPC
Class: |
C12N 15/111 20130101;
A01K 2217/058 20130101; C12N 2830/003 20130101; A01K 2217/05
20130101; A01K 2267/0393 20130101; A01K 2267/0331 20130101; C12N
2310/14 20130101; C12N 2310/53 20130101; C12N 9/1247 20130101; A01K
67/0271 20130101; C12N 2310/111 20130101; C12N 2330/30 20130101;
A01K 2227/105 20130101 |
Class at
Publication: |
800/008 ;
536/023.1; 435/320.1; 435/325 |
International
Class: |
A01K 67/00 20060101
A01K067/00; C12N 5/02 20060101 C12N005/02; C07H 21/02 20060101
C07H021/02 |
Claims
1. A RNA pol III dependent promoter sequence comprising a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and a second tetracycline operator located between the TATA
element and the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is identical to a polynucleotide
sequence of the second tetracycline operator.
2. The promoter sequence of claim 1 wherein the first tetracycline
operator and the second tetracycline operator each have a
polynucleotide sequence selected from the group consisting of:
actctatcattgatagagttat (SEQ ID NO:1), tccctatcagtgatagaga (SEQ ID
NO:2), tccctatcagtgatagagacc (SEQ ID NO:3) and
tccctatcagtgatagagagg (SEQ ID NO:4).
3. The promoter sequence of claim 1 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
4. A RNA pol III dependent promoter sequence comprising a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and which forms a portion of the PSE or TATA element and a
second tetracycline operator located between the TATA element and
the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is identical to a polynucleotide
sequence of the second tetracycline operator.
5. The promoter sequence of claim 4 wherein the first tetracycline
operator and the second tetracycline operator each have a
polynucleotide sequence selected from the group consisting of:
actctatcattgatagagttat (SEQ ID NO:1), tccctatcagtgatagaga (SEQ ID
NO:2), tccctatcagtgatagagacc (SEQ ID NO:3) and
tccctatcagtgatagagagg (SEQ ID NO:4).
6. The promoter sequence of claim 5 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
7. A RNA pol III dependent promoter sequence comprising a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and a second tetracycline operator located between the TATA
element and the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is different than a polynucleotide
sequence of the a second tetracycline operator, provided that when
the first tetracycline operator has the polynucleotide sequence of:
actctatcattgatagagttat (SEQ ID NO:1), the second tetracycline
operator does not have a polynucleotide sequence of:
ctccctatcagtgatagagaaa (SEQ ID NO:5).
8. The promoter sequence of claim 7 wherein the second tetracycline
operator has a polynucleotide sequence selected from the group
consisting of: tccctatcagtgatagaga (SEQ ID NO:2),
tccctatcagtgatagagacc (SEQ ID NO:3) and tccctatcagtgatagagagg (SEQ
ID NO:4).
9. The promoter sequence of claim 7 wherein the first tetracycline
operator has the polynucleotide sequence of: tccctatcagtgatagagacc
(SEQ ID NO:2) and the second tetracycline operator has the
polynucleotide sequence of: actctatcattgatagagttat (SEQ ID
NO:1).
10. The promoter sequence of claim 7 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
11. A RNA pol III dependent promoter sequence comprising a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and which forms a portion of the PSE or TATA element and a
second tetracycline operator located between the TATA element and
the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is different than a polynucleotide
sequence of the second tetracycline operator, provided that when
first tetracycline operator has the polynucleotide sequence of:
actctatcattgatagagttat (SEQ ID NO:1), the second tetracycline
operator has a polynucleotide sequence of: ctccctatcagtgatagagaaa
(SEQ ID NO:5).
12. The promoter sequence of claim 11 wherein the second
tetracycline operator has a polynucleotide sequence selected from
the group consisting of: tccctatcagtgatagaga (SEQ ID NO:2),
tccctatcagtgatagagacc (SEQ ID NO:3) and tccctatcagtgatagagagg (SEQ
ID NO:4).
13. The promoter sequence of claim 11 wherein the first
tetracycline operator has the polynucleotide sequence of:
tccctatcagtgatagagacc (SEQ ID NO:2) and the second tetracycline
operator has the polynucleotide sequence of: actctatcattgatagagttat
(SEQ ID NO:1).
14. The promoter sequence of claim 11 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
15. A vector comprising: at least one RNA pol III dependent
promoter sequence of claim 1 operably linked to at least one
polynucleotide sequence of interest.
16. The vector of claim 15 wherein the at least one polynucleotide
sequence of interest is DNA or cDNA.
17. A vector comprising: at least one RNA pol III dependent
promoter sequence of claim 5 operably linked to at least one
polynucleotide sequence of interest.
18. The vector of claim 17 wherein the at least one polynucleotide
sequence of interest is DNA or cDNA.
19. A vector comprising: at least one RNA pol III dependent
promoter sequence of claim 7 operably linked to at least one
polynucleotide sequence of interest.
20. The vector of claim 19 wherein at least one polynucleotide
sequence of interest is DNA or cDNA.
21. A vector comprising: at least one RNA pol III dependent
promoter sequence of claim 11 operably linked to at least one
polynucleotide sequence of interest.
22. The vector of claim 21 wherein the at least one polynucleotide
sequence of interest is DNA or cDNA.
23. An eukaryotic cell comprising the vector of claim 15.
24. An eukaryotic cell comprising the vector of claim 17.
25. An eukaryotic cell comprising the vector of claim 19.
26. An eukaryotic cell comprising the vector of claim 21.
27. A transgenic non-human animal comprising: a transgene
comprising at least one polynucleotide sequence of interest
operably linked to a RNA pol III dependent promoter sequence,
wherein transcription of said polynucleotide sequence of interest
produces an RNA molecule that modulates expression of at least one
target gene in said transgenic non-human animal and further wherein
said promoter sequence comprises a TATA element, a proximal
sequence element (PSE) 5' to the TATA element, and a
transcriptional start site (TSS) 3' to the TATA element, a first
tetracycline operator located between the PSE and TATA element and
a second tetracycline operator located between the TATA element and
the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is identical to a polynucleotide
sequence of the second tetracycline operator.
28. The animal of claim 27 wherein the first tetracycline operator
and the at second tetracycline operator each have a polynucleotide
sequence selected from the group consisting of
actctatcattgatagagttat (SEQ ID NO:1), tccctatcagtgatagaga (SEQ ID
NO:2), tccctatcagtgatagagacc (SEQ ID NO:3) and
tccctatcagtgatagagagg (SEQ ID NO:4).
29. The animal of claim 27 wherein the promoter is a U6 promoter,
H1 promoter or a 7SK promoter.
30. The animal of claim 27, wherein said animal is selected from
the group consisting of: mouse rat, dog, cat, pig, cow, goat,
sheep, primate and guinea pig.
31. The animal of claim 27 wherein at least one polynucleotide
sequence of interest is DNA or cDNA.
32. The animal of claim 27 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
33. A transgenic non-human animal comprising: a transgene
comprising at least one polynucleotide sequence of interest
operably linked to a RNA pol III dependent promoter sequence,
wherein transcription of said polynucleotide sequence of interest
produces an RNA molecule that modulates expression of at least one
target gene in said transgenic non-human animal and further wherein
said promoter sequence comprises a TATA element, a proximal
sequence element (PSE) 5' to the TATA element, and a
transcriptional start site (TSS) 3' to the TATA element, a first
tetracycline operator located between the PSE and TATA element and
which forms a portion of the PSE or TATA element and a second
tetracycline operator located between the TATA element and the TSS,
wherein the first tetracycline operator has a polynucleotide
sequence that is identical to a polynucleotide sequence of the
second tetracycline operator.
34. The animal of claim 33 wherein the first tetracycline operator
and the at second tetracycline operator each have a polynucleotide
sequence selected from the group consisting of:
actctatcattgatagagttat (SEQ ID NO:1), tccctatcagtgatagaga (SEQ ID
NO:2), tccctatcagtgatagagacc (SEQ ID NO:3) and
tccctatcagtgatagagagg (SEQ ID NO:4).
35. The animal of claim 33 wherein the promoter is a U6 promoter,
H1 promoter or a 7SK promoter.
36. The animal of claim 33 wherein said animal is selected from the
group consisting of mouse, rat, dog, cat, pig, cow, goat, sheep,
primate and guinea pig.
37. The animal of claim 33 wherein the polynucleotide sequence of
interest is DNA or cDNA.
38. The animal of claim 33 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
39. A transgenic non-human animal comprising: a transgene
comprising at least one polynucleotide sequence of interest
operably linked to a RNA pol III dependent promoter sequence,
wherein transcription of said polynucleotide sequence of interest
produces and RNA molecule that modulates expression of at least one
target gene in said transgenic non-human animal and further wherein
said promoter sequence comprises a TATA element, a proximal
sequence element (PSE) 5' to the TATA element, and a
transcriptional start site (TSS) 3' to the TATA element, a first
tetracycline operator located between the PSE and TATA element and
a second tetracycline operator located between the TATA element and
the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is different than a polynucleotide
sequence of the a second tetracycline operator, provided that when
the first tetracycline operator has the polynucleotide sequence of:
actctatcattgatagagttat (SEQ ID NO:1), the second tetracycline
operator does not have a polynucleotide sequence of:
ctccctatcagtgatagagaaa (SEQ ID NO:5).
40. The animal of claim 39 wherein the second tetracycline operator
has a polynucleotide sequence selected from the group consisting
of: tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ
ID NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4).
41. The animal of claim 39 wherein the first tetracycline operator
has the polynucleotide sequence of: tccctatcagtgatagagacc (SEQ ID
NO:2) and the second tetracycline operator has the polynucleotide
sequence of: actctatcattgatagagttat (SEQ ID NO:1).
42. The animal of claim 39 wherein the promoter is a U6 promoter,
H1 promoter or a 7SK promoter.
43. The animal of claim 39 wherein said animal is selected from the
group consisting of mouse, rat, dog, cat, pig, cow, goat, sheep,
primate and guinea pig.
44. The animal of claim 39 wherein the polynucleotide sequence of
interest is DNA or cDNA.
45. The animal of claim 39 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
46. A transgenic non-human animal comprising: a transgene
comprising at least one polynucleotide sequence of interest
operably linked to a RNA pol III dependent promoter sequence,
wherein transcription of said polynucleotide sequence of interest
produces an RNA molecule that modulates expression of at least one
target gene in said transgenic non-human animal and further wherein
said promoter sequence comprises a TATA element, a proximal
sequence element (PSE) 5' to the TATA element, and a
transcriptional start site (TSS) 3' to the TATA element, a first
tetracycline operator located between the PSE and TATA element and
which forms a portion of the PSE or TATA element and a second
tetracycline operator located between the TATA element and the TSS,
wherein the first tetracycline operator has a polynucleotide
sequence that is different than a polynucleotide sequence of the a
second tetracycline operator, provided that when the first
tetracycline operator has the polynucleotide sequence of:
actctatcattgatagagttat (SEQ ID NO:1), the second tetracycline
operator does not have a polynucleotide sequence of:
ctccctatcagtgatagagaaa (SEQ ID NO:5).
47. The animal of claim 46 wherein the second tetracycline operator
has a polynucleotide sequence selected from the group consisting
of: tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ
ID NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4).
48. The animal of claim 46 wherein the first tetracycline operator
has the polynucleotide sequence of: tccctatcagtgatagagacc (SEQ ID
NO:2) and the second tetracycline operator has the polynucleotide
sequence of: actctatcattgatagagttat (SEQ ID NO:1).
49. The animal of claim 46 wherein the promoter is a U6 promoter,
H1 promoter or a 7SK promoter.
50. The animal of claim 46 wherein said animal is selected from the
group consisting of: mouse, rat, dog, cat, pig, cow, goat, sheep,
primate and guinea pig.
51. The animal of claim 46 wherein the polynucleotide sequence of
interest is DNA or cDNA.
52. The animal of claim 46 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
53. A method for inducing transcription of at least one
polynucleotide sequence of interest in an eukaryotic cell, wherein
transcription of said polynucleotide sequence of interest produces
an RNA molecule that modulates the expression of at least one
target gene in said cell, the method comprising the steps of: a.
providing an eukaryotic cell; b. transforming said eukaryotic cell
with at least one vector comprising at least one polynucleotide
sequence of interest operably linked to a RNA pol III dependent
promoter sequence, wherein said promoter sequence comprises a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and a second tetracycline operator located between the TATA
element and the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is identical to a polynucleotide
sequence of the second tetracycline operator; and c. contacting the
cell with an inducing agent that binds to a tet repressor and
causes the promoter to transcribe the polynucleotide sequence of
interest, and the transcription of said polynucleotide sequence of
interest produces an RNA molecule that modulates the expression of
at least one target gene in said cell.
54. The method of claim 53 wherein the at least one polynucleotide
sequence of interest is DNA or cDNA.
55. The method of claim 53 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
56. The method of claim 53 wherein the at least one vector further
comprises a second polynucleotide sequence operable linked to a
second promoter, wherein said second polynucleotide sequence
encodes a tet repressor that binds to at least one of the tet
operators of the promoter.
57. The method of claim 53 the at least one vector further
comprises a first polynucleotide sequence of interest and a second
polynucleotide sequence of interest each of which are linked in
tandem.
58. The method of claim 57 wherein the at least one vector further
comprises a third polynucleotide sequence operable linked to a
second promoter, wherein said third polynucleotide sequence encodes
a tet repressor that binds to at least one of the tet operators of
the promoter.
59. The method of claim 57 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest and the transcription
of the first polynucleotide sequence of interest produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence of
interest produces a second RNA molecule that modulates the
expression of a second target gene.
60. The method of claim 53 wherein step b further comprises the
step of transforming the eukaryotic cell with a second vector
comprising a polynucleotide sequence operably linked to a promoter,
wherein said polynucleotide sequence encodes a tet repressor that
binds to at least one tet operator of the promoter.
61. The method of claim 60 wherein the at least one vector further
comprises a first polynucleotide sequence of interest and a second
polynucleotide sequence of interest each of which are linked in
tandem.
62. The method of claim 61 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest and the transcription
of the first polynucleotide sequence of interest produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence of
interest produces a second RNA molecule that modulates the
expression of a second target gene.
63. The method of claim 53 wherein the inducing agent is
doxycycline or tetracycline.
64. The promoter sequence of claim 53 wherein the at least one
first tetracycline operator and the at least one second
tetracycline operator each have a polynucleotide sequence selected
from the group consisting of: actctatcattgatagagttat (SEQ ID NO:1),
tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ ID
NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4).
65. The promoter sequence of claim 53 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
66. A method for inducing transcription of at least one
polynucleotide sequence of interest in an eukaryotic cell, wherein
transcription of said polynucleotide sequence of interest produces
an RNA molecule that modulates the expression of at least one
target gene in said cell, the method comprising the steps of: a.
providing an eukaryotic cell; b. transforming said eukaryotic cell
with at least one vector comprising at least one polynucleotide
sequence of interest operably linked to a RNA pol III dependent
promoter sequence, wherein said promoter sequence comprises a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and which forms a portion of the PSE or TATA element and a
second tetracycline operator located between the TATA element and
the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is identical to a polynucleotide
sequence of the second tetracycline operator; and c. contacting the
cell with an inducing agent that binds to a tet repressor and
causes the promoter to transcribe the polynucleotide sequence of
interest, and the transcription of said polynucleotide sequence of
interest produces an RNA molecule that modulates the expression of
at least one target gene in said cell.
67. The method of claim 66 wherein the at least one polynucleotide
sequence of interest is DNA or cDNA.
68. The method of claim 66 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
69. The method of claim 66 wherein the at least one vector further
comprises a second polynucleotide sequence operable linked to a
second promoter, wherein said second polynucleotide sequence
encodes a tet repressor that binds to at least one of the tet
operators of the promoter.
70. The method of claim 66 the at least one vector further
comprises a first polynucleotide sequence of interest and a second
polynucleotide sequence of interest each of which are linked in
tandem and each of which encode a different RNA molecule.
71. The method of claim 70 wherein the at least one vector further
comprises a third polynucleotide sequence operable linked to a
second promoter, wherein said third polynucleotide sequence encodes
a tet repressor that binds to at least one of the tet operators of
the promoter.
72. The method of claim 70 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest and the transcription
of the first polynucleotide sequence of interest produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence of
interest produces a second RNA molecule that modulates the
expression of a second target gene.
73. The method of claim 66 wherein step b further comprises the
step of transforming the eukaryotic cell with a second vector
comprising a polynucleotide sequence operably linked to a promoter,
wherein said polynucleotide sequence encodes a tet repressor that
binds to at least one tet operator of the promoter.
74. The method of claim 73 wherein the at least one vector further
comprises first polynucleotide sequence of interest and a second
polynucleotide sequence of interest each of which are linked in
tandem.
75. The method of claim 73 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest and the transcription
of the first polynucleotide sequence of interest produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence of
interest produces a second RNA molecule that modulates the
expression of a second target gene.
76. The method of claim 66 wherein the inducing agent is
doxycycline or tetracycline.
77. The promoter sequence of claim 66 wherein the at least one
first tetracycline operator and the at least one second
tetracycline operator each have a polynucleotide sequence selected
from the group consisting of: actctatcattgatagagttat (SEQ ID NO:1),
tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ ID
NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4).
78. The promoter sequence of claim 66 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
79. A method for inducing transcription of at least one
polynucleotide sequence of interest in an eukaryotic cell, wherein
transcription of said polynucleotide sequence of interest produces
an RNA molecule that modulates the expression of at least one
target gene in said cell, the method comprising the steps of: a.
providing an eukaryotic cell; b. transforming said eukaryotic cell
with at least one vector comprising at least one polynucleotide
sequence of interest operably linked to a RNA pol III dependent
promoter sequence, wherein said promoter sequence comprises a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and a second tetracycline operator located between the TATA
element and the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is different than a polynucleotide
sequence of the a second tetracycline operator, provided that when
the first tetracycline operator has the polynucleotide sequence of:
actctatcattgatagagttat (SEQ ID NO:1), the second tetracycline
operator does not have a polynucleotide sequence of:
ctccctatcagtgatagagaaa (SEQ ID NO:5); and c. contacting the cell
with an inducing agent that binds to a tet repressor and causes the
promoter to transcribe the polynucleotide sequence of interest, and
the transcription of said polynucleotide sequence of interest
produces an RNA molecule that modulates the expression of at least
one target gene in said cell.
80. The method of claim 79 wherein the at least one polynucleotide
sequence of interest is DNA or cDNA.
81. The method of claim 79 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
82. The method of claim 79 wherein the at least one vector further
comprises a second polynucleotide sequence operable linked to a
second promoter, wherein said second polynucleotide sequence
encodes a tet repressor that binds to at least one of the tet
operators of the promoter.
83. The method of claim 79 the at least one vector further
comprises a first polynucleotide sequence of interest and a second
polynucleotide sequence of interest each of which are linked in
tandem.
84. The method of claim 83 wherein the at least one vector further
comprises a third polynucleotide sequence operable linked to a
second promoter, wherein said third polynucleotide sequence encodes
a tet repressor that binds to at least one of the tet operators of
the promoter.
85. The method of claim 83 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest and the transcription
of the first polynucleotide sequence of interest produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence of
interest produces a second RNA molecule that modulates the
expression of a second target gene.
86. The method of claim 79 wherein step b further comprises the
step of transforming the eukaryotic cell with a second vector
comprising a polynucleotide sequence operably linked to a promoter,
wherein said polynucleotide sequence encodes a tet repressor that
binds to at least one tet operator of the promoter.
87. The method of claim 86 wherein the at least one vector further
comprises first polynucleotide sequence of interest and a second
polynucleotide sequence of interest each of which are linked in
tandem.
88. The method of claim 87 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest and the transcription
of the first polynucleotide sequence of interest produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence of
interest produces a second RNA molecule that modulates the
expression of a second target gene.
89. The method of claim 79 wherein the inducing agent is
doxycycline or tetracycline.
90. The method of claim 79 wherein the second tetracycline operator
has a polynucleotide sequence selected from the group consisting
of: tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ
ID NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4).
91. The method of claim 79 wherein the first tetracycline operator
has the polynucleotide sequence of: tccctatcagtgatagagacc (SEQ ID
NO:2) and the second tetracycline operator has the polynucleotide
sequence of: actctatcattgatagagttat (SEQ ID NO:1).
92. The promoter sequence of claim 79 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
93. A method for inducing transcription of at least one
polynucleotide sequence of interest in an eukaryotic cell, wherein
transcription of said polynucleotide sequence of interest produces
an RNA molecule that modulates the expression of at least one
target gene in said cell, the method comprising the steps of: a.
providing an eukaryotic cell; b. transforming said eukaryotic cell
with at least one vector comprising at least one polynucleotide
sequence of interest operably linked to a RNA pol III dependent
promoter sequence, wherein said promoter sequence comprises a TATA
element, a proximal sequence element (PSE) 5' to the TATA element,
and a transcriptional start site (TSS) 3' to the TATA element, a
first tetracycline operator located between the PSE and TATA
element and which forms a portion of the PSE or TATA element and a
second tetracycline operator located between the TATA element and
the TSS, wherein the first tetracycline operator has a
polynucleotide sequence that is different than a polynucleotide
sequence of the a second tetracycline operator, provided that when
the first tetracycline operator has the polynucleotide sequence of:
actctatcattgatagagttat (SEQ ID NO:1), the second tetracycline
operator does not have a polynucleotide sequence of:
ctccctatcagtgatagagaaa (SEQ ID NO:5); and c. contacting the cell
with an inducing agent that binds to a tet repressor and causes the
promoter to transcribe the polynucleotide sequence of interest, and
the transcription of said polynucleotide sequence of interest
produces an RNA molecule that modulates the expression of at least
one target gene in said cell.
94. The method of claim 93 wherein the at least one polynucleotide
sequence of interest is DNA or cDNA.
95. The method of claim 93 wherein the RNA molecule is small
interferring RNA or short hairpin RNA.
96. The method of claim 93 wherein the at least one vector further
comprises a second polynucleotide sequence operable linked to a
second promoter, wherein said second polynucleotide sequence
encodes a tet repressor that binds to at least one of the tet
operators of the promoter.
97. The method of claim 93 the at least one vector further
comprises a first polynucleotide sequence of interest and a second
polynucleotide sequence of interest each of which are linked in
tandem.
98. The method of claim 97 wherein the at least one vector further
comprises a third polynucleotide sequence operable linked to a
second promoter, wherein said third polynucleotide sequence encodes
a tet repressor that binds to at least one of the tet operators of
the promoter.
99. The method of claim 97 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest and the transcription
of the first polynucleotide sequence of interest produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence of
interest produces a second RNA molecule that modulates the
expression of a second target gene.
100. The method of claim 93 wherein step b further comprises the
step of transforming the eukaryotic cell with a second vector
comprising a polynucleotide sequence operably linked to a promoter,
wherein said polynucleotide sequence encodes a tet repressor that
binds to at least one tet operator of the promoter.
101. The method of claim 100 wherein the at least one vector
further comprises a first polynucleotide sequence of interest and a
second polynucleotide sequence of interest each of which are linked
in tandem.
102. The method of claim 101 wherein in step c, when the cell is
contacted with an inducing agent that binds to a tet repressor and
the promoter causes the transcription of each of first and second
polynucleotide sequence of interests and the transcription of the
first polynucleotide sequence of interest produces a first RNA
molecule that modulates the expression of a first target gene and
the transcription of the second polynucleotide sequence of interest
produces a second RNA molecule that modulates the expression of a
second target gene.
103. The method of claim 93 wherein the inducing agent is
doxycycline or tetracycline.
104. The method of claim 93 wherein the second tetracycline
operator has a polynucleotide sequence selected from the group
consisting of: tccctatcagtgatagaga (SEQ ID NO:2),
tccctatcagtgatagagacc (SEQ ID NO:3) and tccctatcagtgatagagagg (SEQ
ID NO:4).
105. The method of claim 93 wherein the first tetracycline operator
has the polynucleotide sequence of: tccctatcagtgatagagacc (SEQ ID
NO:2) and the second tetracycline operator has the polynucleotide
sequence of: actctatcattgatagagttat (SEQ ID NO:1).
106. The promoter sequence of claim 93 wherein the promoter is a U6
promoter, H1 promoter or a 7SK promoter.
Description
FIELD OF THE INVENTION
[0001] The present invention relates generally to the field of
molecular biology. More specifically, the present invention relates
to inducible expression systems for use in modulating the
expression of target genes in eukaryotic cells and non-human
animals.
BACKGROUND OF THE INVENTION
[0002] RNA interference (RNAi) is a process for silencing gene
expression using double-stranded RNA. The RNAi mechanism is
conserved in plants, invertebrates and vertebrates. Because of its
simplicity and specificity, RNAi is becoming the method of choice
for studying gene function in a variety of model organisms (See,
for example, Hannon, G. J., Nature, 418:244-251 (2002), Paddison,
et al., Cancer Cell, 2:17-23 (2002), Sharp, P. A., Genes Dev.,
15:485-490 (2001), Tuschl, T., Chembiochem., 2:239-245 (2001) and
Zamore, P. D., Nat. Struct. Biol., 8:746-750 (2001)). Although
chemically synthesized small interfering RNA (siRNA) can
effectively silence genes of interest when transfected into cells,
the use of siRNA has been limited to short term experiments because
siRNA is degraded over time or diluted after cell division. To
overcome this limitation, a vector-based system was developed that
expressed short hairpin RNAs (shRNAs) that comprise a 19-29 bp stem
with a loop size of 4-9 nucleotides. shRNAs are processed into
siRNAs by an enzyme known as a "dicer" and exhibit specific gene
silencing when expressed in human cells (See, for example,
Brummelkamp, T. R., et al., Science, 296:550-553 (2002), Miyagishi,
M., et al., Nat. Biotechnol., 20:497-500 (2002), Paddision, P. J.,
et al., Genes Dev., 16:948-958 (2002), Paul, C. P., et al., Nat.
Biotechnol., 20:505-508 (2002) and Sui, G., et al., Proc. Natl.
Acad. Sci. USA, 99:5515-5520 (2002)). Furthermore, it has been
demonstrated that shRNA expression systems can be incorporated into
chromosomes to establish stable cell lines or to create knockdown
animals for studying gene function in vivo (See, Paddision, P. J.,
et al., Genes Dev., 16:948-958 (2002), Brummelkamp, T. R., et al.,
Cancer Cell, 2:243-247 (2002), Hemann, M. T., et al., Nat. Genet.,
33:396-400 (2003), Tiscornia, G., et al., Proc. Natl. Acad. Sci.,
USA, 100:1844-1848 (2003), Barton, G. M., et al., Proc. Natl. Acad.
Sci. USA, 99:14943-14945 (2002), Hasuwa, H., et al., FEBS Lett.,
532:227-230 (2002), Kunath, T., Nat. Biotechnol., 21:559-561 (2003)
and Rubinson, D. A, et al., Nat. Genet., 33:401-406 (2003)).
[0003] RNA polymerase III dependent promoter sequences are often
chosen for expression of shRNAs. Unlike mRNAs produced by RNA pol
II, transcripts produced by pol III do not have the 5' cap and 3'
poly A tail, thereby allowing efficient processing of shRNA into
siRNA by the dicer enzyme. Although the development of shRNA
expression systems enables stable target knockdown in cells or
animals, the constitutive activity of pol III dependent promoter
sequences impose various restrictions on the use of shRNA
expression systems. For example, constitutive expression of shRNAs
that target genes with critical developmental functions result in
embryonic lethality, which prevents the study of loss of function
phenotypes in adult animals. In addition, the constitutive
knockdown of a target with critical functions in cells or animals
often trigger a compensatory response, which could alter the true
consequence of gene silencing. Therefore, there is a need in the
art for the controlled expression of shRNA that is useful for an
unbiased analysis of the loss of function phenotype of essential
genes in cells and animals.
[0004] Attempts have been made to develop tetracycline responsive
pol III dependent promoter sequences. Two types of
tetracycline-responsive derivatives of the human U6 snRNA promoter
sequence are known in the art (See, Ohkawa, J., et al., Human Gene
Therapy, 11:577-585 (2000)). In the tetracycline O1 (tetO1) type U6
promoter sequences, a type 1 tetracycline operator (tet operator)
having the polynucleotide sequence of: actctatcattgatagagttat (SEQ
ID NO:1), was engineered between the proximal sequence element
(PSE) and the TATA box. In the tetracycline O2 (tetO2) type U6
promoter, a type 2 tet operator having the polynucleotide sequence
of ctccctatcagtgatagagaaa (SEQ ID NO:5), was engineered between the
TATA box and the transcriptional start site (TSS). Both the TATA
box and PSE play essential roles in the transcription initiation by
RNA polymerase III. It was reasoned that binding of the
tetracycline repressor (tetR) to these modified U6 promoter
sequences at positions adjacent to the TATA box or the PSE would
interfere with small nuclear RNA (snRNA) activating protein complex
(SNAPc) binding to the PSE and subsequently prevent transcription
initiation. Both the tetO1 and tetO2 type promoter sequences have
been shown to exhibit tetracycline-dependent transcriptional
activity in a cell line that constitutively expresses tetR.
However, the tetO1 appeared to have a better response to
tetracycline treatment compared with the tetO2 type promoter in a
transient transfection experiment (See, Ohkawa, J., et al., Human
Gene Therapy, 11:577-585 (2000)). Controlled expression of shRNA
using the tetO1 or the tetO2 type U6 promoters or using a human H1
snRNA promoter derivative with a design similar to that of the
tetO2 type U6 promoter is also known in the art (See, Matsukura,
S., et al., Nucleic Acid Res., 31:e77 (2003) and Czaudema, F., et
al., Nucleic Acids Res., 31:e127 (2003)). Inducible knockdown of
DNA methyltransferase (DNMT), beta catenin and PI3 kinase was
achieved in stable cell lines using these systems. Although these
pol III dependent promoter derivatives appeared to be tightly
regulated in the literature, severe leakiness of these expression
systems have been observed by the inventors of the present
invention when the tetO1 promoter sequence was used to express a
shRNA targeting a polynucleotide sequence of interest, such as
luciferase. While not wishing to be bound by any theory, the
inventors believe that it is likely that the binding of tetR to a
single site on the U6 promoter is not sufficient to completely
block the basal transcriptional activity of the promoter. When a
potent shRNA is used, a slight leakiness of the system could lead
to a significant reduction of the target protein. Tight regulation
is one of the most critical and challenging requirements for all
controlled expression systems. Depending on the target of interest,
slight perturbation of the target level could be sufficient to
cause phenotypic changes.
[0005] A third type of tetracycline responsive derivative of the
human U6 snRNA promoter sequence is also known in the art. In this
promoter sequence, both the tetO1 and tetO2 type promoters were
engineered into the U6 promoter (See, Ohkawa, J., et al., Human
Gene Therapy, 11:577-585 (2000)). The tetO1 operator was engineered
between the PSE and the TATA box and the tetO2 operator engineered
between the TATA box and TSS. However, Ohkawa et al. reported that
the inclusion of both the tetO1 and tetO2 resulted in a complete
loss of transcriptional activity for the U6 promoter sequence.
[0006] Thereupon, due to the potential limitations associated with
the currently known inducible shRNA expression systems, there is a
need in the art for a controlled shRNA expression system with
minimal basal transcriptional activity. Specifically, there is a
need for a tightly regulated promoter that can be used in such
expression systems so as to improve the success rate in making
inducible knockdown cell lines and non-human animals.
SUMMARY OF THE INVENTION
[0007] In one embodiment, the present invention relates to a RNA
pol III dependent promoter sequence. The promoter sequence can be a
U6 promoter, a H1 promoter or a 7SK promoter. The promoter sequence
of the present invention comprises a TATA element, a proximal
sequence element (PSE) 5' to the TATA element, a transcriptional
start site (TSS) 3' to the TATA element, a first tetracycline
operator (first tet operator) located between the PSE and TATA
element and a second tetracycline operator (second tet operator)
located between the TATA element and TSS. In one aspect, the first
tet operator is located between the TATA element and the PSE and
does not form a portion of either the PSE or TATA element. In
another aspect, the first tet operator is located between the TATA
element and the PSE and forms of portion of one or both of the PSE
or TATA element. The second tet operator is located between the
TATA element and the TSS. In one aspect, the second tet operator is
located between the TATA element and the TSS and does not form a
portion of either the TSS or TATA element. In another aspect, the
second tet operator is located between the TATA element and the TSS
and forms of portion of one or both of the TSS or TATA element.
[0008] The polynucleotide sequence of the first tet operator and
second tet operator can be the identical or can be different. If
the polynucleotide sequence of the first tet operator and the
second tet operator are identical, the polynucleotide sequence can
be selected from the group consisting of: actctatcattgatagagttat
(SEQ ID NO:1), tccctatcagtgatagaga (SEQ ID NO:2),
tccctatcagtgatagagacc (SEQ ID NO:3) and tccctatcagtgatagagagg (SEQ
ID NO:4).
[0009] The polynucleotide sequence of the first tet operator and
the second tet operator can be different from one another provided
that when the first tet operator has the polynucleotide sequence of
actctatcattgatagagttat (SEQ ID NO:1), that the second tet operator
does not have a polynucleotide sequence of ctccctatcagtgatagagaaa
(SEQ ID NO:5). The polynucleotide sequence of the first tet
operator can be selected from the group consisting of:
actctatcattgatagagttat (SEQ ID NO:1), tccctatcagtgatagaga (SEQ ID
NO:2), tccctatcagtgatagagacc (SEQ ID NO:3) and
tccctatcagtgatagagagg (SEQ ID NO:4). The polynucleotide sequence of
the second tet operator can be selected independently from the
group consisting of: actctatcattgatagagttat (SEQ ID NO:1),
tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ ID
NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4). Preferably, if the
first tet operator has a polynucleotide sequence of
tccctatcagtgatagagacc (SEQ ID NO:2) the second tetracycline
operator has the polynucleotide sequence of: actctatcattgatagagttat
(SEQ ID NO:1).
[0010] In another embodiment, the present invention relates to
vectors comprising the herein described promoters. More
specifically, the vectors of the present invention comprise at
least one of the RNA pol III dependent promoter sequences described
above that are operably linked to at least one polynucleotide
sequence of interest. The at least one polynucleotide sequence of
interest can be DNA or cDNA.
[0011] In another embodiment, the present invention relates to a
eukaryotic cell that comprises at least one of the vectors
described above.
[0012] In another embodiment, the present invention relates to
transgenic non-human animals. Examples of transgenic non-human
animals are mice, rats, dogs, cats, pigs, cows, goats, sheep,
primates (other than humans) and guinea pigs. The transgenic
non-human animals of the present invention comprise a transgene
that comprises at least one polynucleotide sequence of interest
that is operably linked to at least one of the RNA pol III
dependent promoter sequences described herein. Transcription of the
at least one polynucleotide sequence of interest produces an RNA
molecule that modulates the expression of at least one target gene
in said transgenic animal. The RNA molecule that is produced can be
a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).
[0013] In another embodiment, the present invention relates to
methods of producing a transgenic non-human animal. In one aspect,
a transgenic non-human animal can be produced pursuant to the
following method. The first step of the method involves introducing
a transgene into a fertilized oocyte of a non-human animal. This
transgene comprises at least one polynucleotide sequence of
interest that is operably linked to at least one of the RNA pol III
dependent promoter sequences described herein. Transcription of the
at least one polynucleotide sequence of interest produces an RNA
molecule that modulates the expression of at least one target gene
in said transgenic animal. The RNA molecule that is produced can be
siRNA or shRNA. The next step in the method involves allowing the
fertilized oocyte to develop into an embryo. The next step involves
transferring the embryo into a pseudopregnant female non-human
animal. The next step involves allowing the embryo to develop to
term. The next step involves identifying the transgenic non-human
animal containing the polynucleotide sequence of interest.
[0014] In another aspect, the transgenic non-human animal can be
produced pursuant to the following method. The first step of the
method involves introducing a transgene into an embryonic stem cell
of a non-human animal. This transgene comprises at least one
polynucleotide sequence of interest that is operably linked to at
least one of the RNA pol III dependent promoter sequences described
herein. Transcription of the at least one polynucleotide sequence
of interest produces an RNA molecule that modulates the expression
of at least one target gene in said transgenic animal. The RNA
molecule that is produced can be a siRNA or shRNA. The next step in
the method involves introducing said non-human embryonic stem cell
into a blastocyst. The next step in the method involves implanting
the resulting blastocyst into a pseudopregnant female non-human
animal. The next step in the method involves allowing the non-human
animal to give birth to a chimeric non-human animal. The next step
involves breeding the chimeric non-human animal to produce a
transgenic non-human animal containing said transgene.
[0015] In another embodiment, the present invention relates to a
method for inducing transcription of at least one polynucleotide
sequence of interest in an eukaryotic cell. In this method, when
transcription is induced, the at least one polynucleotide sequence
of interest produces at least one RNA molecule that modulates the
expression of at least one target gene in the eukaryotic cell. The
first step of the method involves providing an eukaryotic cell
expressing the tetR protein. Once an eukaryotic cell has been
provided, the next step is transforming or transfecting this cell
with at least one vector, such as one of the vectors previously
described herein. For example, the vector may contain at least one
polynucleotide sequence of interest that is operably linked to at
least one RNA pol III dependent promoter sequence described herein.
The next step in the method involves contacting the cell with an
inducing agent. The inducing agent binds to a tet repressor protein
and causes the promoter sequence to transcribe the polynucleotide
sequence of interest. Transcription of the polynucleotide sequence
produces at least one RNA molecule that modulates the expression of
at least one target gene in the cell. The inducing agent used in
the above described method can be doxycycline, tetracycline or a
tetracycline analogue. Additionally, the RNA molecule produced in
the above described method can be siRNA or shRNA.
[0016] Optionally, the method described above can further comprise
the step of transforming the eukaryotic cell with a second vector
that contains a polynucleotide sequence operably linked to a
promoter, wherein said polynucleotide sequence encodes a tet
repressor that binds to at least one tet operator of the
promoter.
[0017] Optionally, the at least one vector used in the above method
can further contain a second polynucleotide sequence of interest.
In one aspect, this second polynucleotide sequence can be operably
linked to a second promoter sequence and can encode a tet repressor
protein that binds to at least one of the tet operators of the
promoter.
[0018] In a second aspect, this second polynucleotide sequence can
be linked in tandem with the first polynucleotide sequence of
interest. In this second aspect, when the cell is contacted with an
inducing agent, the inducing agent binds to a tet repressor protein
and the promoter causes the transcription of each of the first and
second polynucleotide sequences of interest. Specifically, the
transcription of the first polynucleotide sequence produces a first
RNA molecule that modulates the expression of a first target gene
and the transcription of the second polynucleotide sequence
produces a second RNA molecule that modulates the expression of a
second target gene.
[0019] In a third aspect, the at least one vector not only contains
a second polynucleotide sequence of interest that is linked in
tandem with the first polynucleotide sequence of interest, but also
a third polynucleotide sequence that is operably linked to a second
promoter sequence. This third polynucleotide sequence encodes a tet
repressor protein that binds to at least one of the tet operators
of the promoter. In this third aspect, when the cell is contacted
with an inducing agent, the inducing agent binds to a tet repressor
protein and the promoter sequence causes the transcription of each
of the first and second polynucleotide sequences of interest.
Specifically, the transcription of the first polynucleotide
sequence produces a first RNA molecule that modulates the
expression of a first target gene and the transcription of the
second polynucleotide sequence produces a second RNA molecule that
modulates the expression of a second target gene.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1 shows the sequence alignment of U6 promoter variants.
U6 is the wildtype human U6 promoter (SEQ ID NO:6). O1 (SEQ ID
NO:7) or O2 (SEQ ID NO:8) is the O1 and O2 type human U6 promoter.
O1O2.sub.--1 (SEQ ID NO:9), O1O2.sub.--2 (SEQ ID NO:10),
O1O2.sub.--3 (SEQ ID NO:11), O1O2.sub.--4 (SEQ ID NO:12),
O1O2.sub.--5 (SEQ ID NO:13), and O1O2.sub.--6 (SEQ ID NO:14) are U6
promoter variants with both O1 and O2 type tet operators. 2O2 (SEQ
ID NO:15) is the U6 promoter variant with two O2 type tet
operators. The underscored italic sequence represents the O2 type
tet operator. The underscored non-italic sequence represents the O1
type tet operator.
[0021] FIGS. 2A, 2B and 2C show the transcriptional activity and
tetracycline response of U6 promoter variants.
[0022] FIGS. 3A, 3B and 3C show tetracycline dependent knockdown of
an endogenous gene in stable cell lines using the 2O2 expression
system.
[0023] FIGS. 4A, 4B and 4C show a comparison of the O1 and 2O2
expression system in making stable cell lines.
DETAILED DESCRIPTION OF THE INVENTION
[0024] Definitions and Other Terms
[0025] As used herein, the term "gene" refers to a polynucleotide
sequence that undergoes transcription as a result of promoter
activity. A gene may encode for a particular polypeptide, or
alternatively, code for a RNA molecule. A gene can include one or
more introns and/or exons and/or one or more regulatory and/or
control sequences.
[0026] As used herein, the term "inducing agent" refers to an any
compound that binds with specificity to a tet repressor protein,
including, but not limited to, tetracycline, doxycycline or a
tetracycline analogue.
[0027] As used herein, the terms "modulation" or "modulating" as
used interchangeably herein, refer to both upregulation (i.e.,
activation or stimulation (e.g., by agonizing or potentiating)) and
downregulation (i.e. inhibition or suppression (e.g., by
antagonizing, decreasing or inhibiting)).
[0028] As used herein, the term "non-human animal" includes all
vertebrate animals, except humans. It also includes an individual
animal in all stages of development, including embryonic and fetal
stages. A "transgenic animal" is any animal containing one or more
cells bearing genetic information altered or received, directly or
indirectly, by deliberate genetic manipulation at a subcellular
level, such as by targeted recombination or microinjection or
infection with recombinant virus.
[0029] Mice are often used for transgenic animal models because
they are easy to house, relatively inexpensive, and easy to breed.
However, other non-human transgenic mammals may also be made in
accordance with the present invention such as, but not limited to,
primates, mice, goat, sheep, rabbits, dogs, cows, cats, guinea pigs
and rats. Transgenic animals are those which carry a transgene,
that is, a cloned gene introduced and stably incorporated which is
passed on to successive generations.
[0030] As used herein, the term "operably linked" refers to a
juxtaposition wherein the components so described are in a
relationship permitting them to function in their intended manner.
For example, a polynucleotide sequence of interest may be
positioned adjacent another polynucleotide sequence that directs
transcription or transcription and translation of the introduced
polynucleotide sequence of interest (i.e., facilitates the
production of, e.g., a polypeptide or a polynucleotide encoded by
the introduced sequence of interest). A promoter is considered
operably linked to a coding sequence if the promoter effects the
transcription or expression of the coding sequence.
[0031] As used herein, the term "polynucleotide" means a polymeric
form of nucleotides of any length, either ribonucleotides or
deoxyribonucleotides. This term refers only to the primary
structure of the molecule. Thus, the term includes double- and
single-stranded DNA, as well as double- and single-stranded RNA. It
also includes modifications, such as methylation or capping and
unmodified forms of the polynucleotide. The terms "polynucleotide,"
"oligomer," "oligonucleotide," and "oligo" are used interchangeably
herein.
[0032] As used herein, the term "polynucleotide sequence of
interest" refers to any DNA cDNA, genomic DNA, nucleic acid analogs
and synthetic DNA that is capable of expressing a RNA molecule,
such as, but not limited to, short interfering RNA (siRNA) or short
hairpin RNA (shRNA), or a protein or other molecule in a target
cell (i.e., that is capable of the production of the protein or
other biological molecule in a target cell). The DNA may be
double-stranded or single-stranded, and if single stranded, may be
the coding (sense) strand or non-coding (anti-sense) strand. The
polynucleotide sequence of interest is generally operably linked to
other polynucleotide sequences needed for expression, such as at
least one promoter sequence. Any polynucleotide sequence of
interest can be used in the present invention. Examples of
polynucleotide sequences that can be used in the present invention
include, but are not limited to, polynucleotide sequences to
knock-out the mouse IRAK4 gene, such as, ggaagaaauuagcaguagc
ucucuugaa gcuacugcuaauuucuuccuu (SEQ ID NO:16), which can be used
in shRNA methods, polynucleotide sequences to knock-out the human
STK33 gene, such as, gggcauuucucagagaaugtt (SEQ ID NO:17) and
ttcccguaaagagucucuuac (SEQ ID NO:18), each of which can be used in
siRNA methods, polynucleotide sequences that encode a NFKB
inhibitor Ras-like 1 (also known as "NKIRAS1") protein or knock-out
a NKIRAS1 gene (cDNA encoding a human NKIRAS1 protein can be found
in GenBank as Accession No. NM-020345), polynucleotide sequences
that encode a hypoxia-inducible factor 1, alpha subunit (a basic
helix-loop-helix transcription factor and also known as "HIF1A")
protein or knock-out a HIF1A gene (cDNA encoding a human HIF1A
protein can be found in GenBank as Accession No. NM.sub.--001530),
polynucleotide sequences that encode genomic chromosomes or
knock-out a genomic chromosome, such as, but not limited to a
chromosome 8 genomic contig (genomic DNA encoding a human
chromosome 8 genomic contig can be found in GenBank as Accession
No. NT.sub.--023736.16), polynucleotide sequences that encode a
member of the kinase family or that knock-out a gene that encodes a
member of a kinase family (examples of members of a kinase family,
include, activin A receptor type II-like proteins (also known as
"ACVRL1") (DNA encoding a human ACVRL1 protein can be found in
GenBank as Accession No. NM.sub.--000020) or ATM proteins (DNA
encoding a human ATM protein can be found in GenBank as Accession
No. NM.sub.--000051)), polynucleotide sequences that encode tumor
suppressor proteins or knock-out a gene that encodes a tumor
suppressor protein (examples of tumor suppressor proteins include,
the p53 protein (DNA encoding a human p53 protein can be found in
GenBank as Accession No. NM.sub.--000546) or a human retinoblastoma
protein (DNA encoding a human retinoblastoma protein can be found
in GenBank as Accession No. M15400)), polynucleotide sequences that
encode transcriptional factors or that knock-out a gene that
encodes a transcriptional factor (an example of a transcriptional
factor, includes, the myc protein (DNA encoding a human myc protein
can be found in GenBank as Accession No. M13228)), polynucleotide
sequences that encode Sam11 GTPases or that knock-out a Sam11
GTPase gene (an example of Sam11 GTPases includes the Ras protein
(DNA encoding a human Ras protein can be found in GenBank as
Accession No. NM.sub.--033360)), polynucleotide sequences that
encode E3 ligases or that knock-out a gene encoding a E3 ligase (an
example of a E3 ligase includes, the SKP2 protein (DNA encoding a
human SKP2 protein can be found in GenBank as Accession No.
NM.sub.--032637)), etc.
[0033] As used herein, the term "polypeptide" and "protein" are
used interchangeably herein and indicate at least one molecular
chain of amino acids linked through covalent and/or non-covalent
bonds. The terms do not refer to a specific length of the product.
Thus peptides, oligopeptides and proteins are included within the
definition of polypeptide. The terms include post-translational
modifications of the polypeptide, for example, glycosylations,
acetylations, phosphorylations and the like. In addition, protein
fragments, analogs, mutated or variant proteins, fusion proteins
and the like are included within the meaning of polypeptide.
[0034] As used herein, the term "target gene" refers to a
polynucleotide sequence, such as, but not limited to, a
polynucleotide sequence of interest that encodes a polypeptide of
interest or alternatively, a RNA molecule of interest, such as, but
not limited to siRNA or shRNA. The target gene can be an
"essential" gene required for continued cell viability whose
function is to be shut-off by the methods of the present invention.
The term "target gene" can also refer to a gene to be knocked-out
according to the methods described herein.
[0035] As used herein, the term "tetracycline analogue" refers to
any compound that is related to tetracycline or doxycycline and
that binds with specificity to a tet repressor protein. The
dissociation constant of such analogues should be at least
1.times.10.sup.-6 M, preferably greater than 1.times.10.sup.-9 M.
Examples of tetracycline analogues are discussed in Hlavka et al.,
"The Tetracyclines," in Handbook of Experimental Pharmacology 78,
Blackwood et al. (eds), New York (1985) and Mitschef ("The
Chemistry of Tetracycline Antibiotics," Medicinal Res. 9, New York
(1978), which is herein incorporated by reference.
[0036] As used herein, the terms "tetracycline repressor protein,",
"tet repressor protein", and "tetR", which are all used
interchangeably herein, refer to a polypeptide that (1) exhibits
specific binding to an inducing agent; 2) exhibits specific binding
to at least one tet operator sequence when the tetracycline
repressor protein is not bound by an inducing agent; and/or 3) is
capable of being displaced or competed off from a tetracycline
operator by an inducing agent. The term "tetracycline repressor
protein" includes naturally-occurring (i.e., native) tetracycline
repressor protein polypeptide sequences and functional derivatives
thereof.
[0037] As used herein, the term "regulatory sequences" refer to
those sequences normally associated with (for example, within 50 kb
of) the coding region of a locus which affect the expression of a
polynucleotide (including transcription of a gene, and translation,
splicing, stability, or the like of a messenger RNA). Regulatory
sequences include, for example, promoters, enhancers, splice sites
and polyadenylation sites.
[0038] As used herein, the term "control sequence" refers to
polynucleotide sequences which are necessary to effect the
expression of coding sequences to which they are ligated. The
nature of such control sequences differs depending upon the host
organism; in prokaryotes, such control sequences generally include
promoter, ribosomal binding site, and transcription termination
sequence; in eukaryotes, generally, such control sequences include
promoters and transcription termination sequence. The term "control
sequences" is intended to include, at a minimum, all components
whose presence is necessary for expression, and may also include
additional components whose presence is advantageous, for example,
leader sequences and fusion partner sequences.
[0039] As used herein, the term "transgene" refers to a
polynucleotide sequence (encoding, e.g., one of the polypeptides,
or an antisense transcript thereto) which has been introduced into
a cell. A transgene could be partly or entirely heterologous, i.e.,
foreign, to the transgenic animal or cell into which it is
introduced, or, homologous to an endogenous gene of the transgenic
animal or cell into which it is introduced, but which is designed
to be inserted, or is inserted, into the animal's genome in such a
way as to alter the genome of the cell into which it is inserted
(e.g., it is inserted at a location which differs from that of the
natural gene or its insertion results in a knockout). A transgene
can also be present in a cell in the form of an episome. A
transgene can include one or more transcriptional regulatory
sequences and any other nucleic acid, such as introns, that may be
necessary for optimal expression of a selected polynucleotide
sequence.
[0040] As used herein, the term "vector" refers to a vehicle by
which a polynucleotide or DNA sequence is introduced into the cell.
It is not intended to be limited to any specific sequence. The
vector could itself be the polynucleotide or DNA sequence that
modulates the endogenous gene or could contain the polynucleotide
sequence that modulates the endogenous gene. Thus, the vector could
be simply a linear or circular polynucleotide containing
essentially only those sequences necessary formodulation, or could
be these sequences in a larger polynucleotide or other construct
such as a DNA or RNA viral genome, a whole viron, or other
biological construct used to introduce the critical nucleotide
sequences into a cell. It is also understood that the phrase
"vector construct", "recombinant vector" or "construct" may be used
interchangeably with the term "vector" herein.
[0041] As used herein, the singular forms "a," "an" and "the"
include plural reference unless the context clearly dictates
otherwise. Unless defined otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood to
one those of skill in the art to which this invention belongs.
[0042] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range, and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges, and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0043] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to those
of skill in the art to which this invention belongs. Although any
methods, devices and materials similar or equivalent to those
described herein can be used in the practice or testing of the
invention, representative methods, devices and materials are now
described.
[0044] Tetracycline Resistance Operons
[0045] Although not critical, information relating to tetracycline
resistance (tet) operons in bacteria is briefly provided herein to
help facilitate the understanding of the present invention.
[0046] In a tet operon, a polynucleotide sequence of interest and a
gene encoding the tet repressor protein (tetR) are both under the
control of the same operator elements. In the absence of an
inducing agent, the tet repressor protein binds to the operator
sequence, thereby sterically preventing the adjacent promoter
sequence from interacting with transcription activators, such as
RNA polymerase. Thus, transcription of the polynucleotide sequence
of interest is blocked. When the level of the inducing agent within
the bacterium increases, the agent binds to the tet repressor
protein preventing it from binding to the operator sequence. As a
result, the polymerase is able to bind to the promoter sequence and
the polynucleotide sequence is transcribed.
[0047] Promoters of the Present Invention
[0048] In one embodiment, the present invention relates to RNA pol
III dependent promoter sequences. Preferably, the RNA pol III
dependent promoter sequences of the present invention are
inducible, meaning that such promoters are inducible promoters. As
used herein, the term "inducible" or "inducible promoter(s)", both
of which are used interchangeably herein, refers to the fact that
the promoter sequences of the present invention are activated under
a specific set of chemical conditions. These specific conditions
are the presence of an inducing agent that binds to the tet
repressor protein. For example, in the present invention, when an
inducing agent is present, the promoter sequence of the present
invention is activated and transcription of a polynucleotide
sequence of interest, which is operably linked to said promoter
sequence, occurs. The present invention contemplates that any RNA
pol III dependent promoter sequence can be used herein, including,
but not limited to the U6 promoter sequence, H1 promoter sequence
or 7SK promoter sequence.
[0049] The promoter sequences of the present invention comprise a
TATA element, a proximal sequence element (PSE) that is located 5'
to the TATA element, a transcriptional state site (TSS) that is
located 3' to the TATA element, at least one first tetracycline
operator (first tet operator) and at least one second tetracycline
operator (second tet operator). The promoter sequences of the
present invention contain at least two tetracycline operators but
promoter sequences containing more than two tetracycline operators
are also contemplated as being within the scope of the present
invention.
[0050] In the promoter sequences of the present invention, the
first tet operator is located between the TATA element and the PSE
(See FIG. 1). In one aspect, the first tet operator is located
between the TATA element and the PSE and does not form a portion of
either the PSE or TATA element. In another aspect, the first tet
operator is located between the TATA element and the PSE and forms
of portion of one or both of the PSE or TATA element. The second
tet operator is located between the TATA element and the TSS (See
FIG. 1). In one aspect, the second tet operator is located between
the TATA element and the TSS and does not form a portion of either
the TSS or TATA element. In another aspect, the second tet operator
is located between the TATA element and the TSS and forms of
portion of one or both of the TSS or TATA element. The arrangement
of these elements must not substantially interfere with the ability
of the promoter sequence to direct the transcription of a
downstream polynucleotide sequence of interest or the translation
of the gene product, if so desired. Moreover, procedures for
synthesizing or purifying promoter sequences, operators and other
polynucleotide sequences are well known to those of skill in the
art and can be employed for constructing vectors (which will be
described in more detail herein) with appropriately arranged
elements as described in Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor Press
(1989).
[0051] By engineering the at least two tetracycline operators
within the specific locations of the promoter sequences described
herein, the inventors of the present invention have found that when
the promoter sequences of the present invention are operably linked
to at least one polynucleotide sequence of interest, that the
promoter sequences exhibit lower basal transcriptional activity
compared to other inducible pol III dependent promoters known in
the art. Consequently, as a result of the promoters of the present
invention exhibiting tighter regulation, these promoter sequences
greatly improve the success rate in making inducible knockdown cell
lines.
[0052] The polynucleotide sequences of the first tet operator and
second tet operator can be the same (i.e., identical) or can be
different. The first tet operator and second tet operator can have
any polynucleotide sequence provided that said polynucleotide
sequence is such that it allows for the binding of a tet repressor
protein to one and/or both of said operators in the absence of an
inducing agent. For example, if the polynucleotide sequence of the
first tet operator and the second tet operator are identical, the
polynucleotide sequences of said operators can be selected from the
group consisting of: actctatcattgatagagttat (SEQ ID NO:1),
tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ ID
NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4).
[0053] As mentioned previously, the polynucleotide sequence of the
first tet operator and second tet operator do not have to be
identical and can be different from one another. Again, as
mentioned previously, the first tet operator and second tet
operator can have any polynucleotide sequence provided that said
polynucleotide sequence is such that it allows for the binding of a
tet repressor protein to one and/or both of said operators in the
absence of an inducing agent. For example, the polynucleotide
sequence of the first tet operator can be selected from the group
consisting of: actctatcattgatagagttat (SEQ ID NO:1),
tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ ID
NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4). The polynucleotide
sequence of the second tet operator can be selected independently
from the group consisting of: actctatcattgatagagttat (SEQ ID NO:1),
tccctatcagtgatagaga (SEQ ID NO:2), tccctatcagtgatagagacc (SEQ ID
NO:3) and tccctatcagtgatagagagg (SEQ ID NO:4). However, if the
first tet operator has a polynucleotide sequence of
actctatcattgatagagttat (SEQ ID NO:1), then the second tet operator
must not have a polynucleotide sequence of ctccctatcagtgatagagaaa
(SEQ ID NO:5). Nonetheless, it is preferred that the first tet
operator have a polynucleotide sequence of tccctatcagtgatagagacc
(SEQ ID NO:2) and that the second tetracycline operator has the
polynucleotide sequence of: actctatcattgatagagttat (SEQ ID
NO:1).
[0054] Vectors of the Present Invention
[0055] The promoter sequences of the present invention will
typically be incorporated into at least one expression vector (such
as, but not limited to, a plasmid, virus or phage). Large numbers
of suitable vectors are known to those of skill in the art and are
commercially available and can be used in the present invention.
The following vectors are provided by way of example. Bacterial:
pINCY (Incyte Pharmaceuticals Inc., Palo Alto, Calif.), pSPORT1
(Life Technologies, Gaithersburg, Md.), pQE70, pQE60, pQE-9
(Qiagen) pBs, phagescript, psiX174, pBluescript SK, pBsKS, pNH8a,
pNH16a, pNH18a, pNH46a (Stratagene); pTrc99A, pKK223-3, pKK233-3,
pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLneo, pSV2cat, pOG44,
pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
However, any other vector may be used as long as it is replicable
and viable in a host. If desired, large amounts of vector DNA can
be generated (for example, by transferring the vector into bacteria
that make the repressor protein).
[0056] The expression vector will also contain at least one
polynucleotide sequence of interest. This polynucleotide sequence
of interest can be derived from any source and may be inserted into
the vector by a variety of procedures that are known to those of
skill in the art. Generally, the polynucleotide sequence of
interest can be inserted into appropriate restriction endonuclease
sites. Such procedures and others are deemed to be within the scope
of those of skill in the art. The expression vector can also
contain an origin of replication, a ribosome binding site for
translation initiation and a transcription terminator. The vector
may also include appropriate sequences for amplifying expression.
In addition, the vector can contain one or more selectable marker
sequences, such as antibiotic resistance genes (e.g., ampicillin,
hygromycin, G418), .beta.-galactosidase, or other gene products
that can be used for the selection of cells containing the
vector.
[0057] As mentioned briefly above, the vector can contain at least
one polynucleotide sequence of interest. The vector can contain two
or more polynucleotide sequences of interest wherein each
polynucleotide sequence is operably linked to its own promoter
sequence. The promoter sequence for each polynucleotide sequence
can be the same or different provided that at least one
polynucleotide sequence is operably linked to at least one promoter
sequence of the present invention. For example, the vector may
contain a first promoter sequence operably linked to a first
polynucleotide sequence of interest and a second promoter sequence
operably linked to a second polynucleotide sequence. The first and
second promoter sequences can each be the promoter sequences of the
present invention or can be different promoter sequences provided
that at least one of the first or second promoter sequences is the
promoter sequence of the present invention. Examples of suitable
promoter sequences that are not the promoter sequences of the
present invention and can be operably linked to either the first or
second polynucleotide sequences of interest include, but are not
limited to, LTR or the SV40 promoter, the E. coli lac or trp, the
phage lambda P sub L promoter and other promoters known to those of
skill in the art. Other regulatory and/or control sequences can be
included with said promoter as well. Alternatively, the first and
second polynucleotide sequences of interest can be linked in tandem
and operably linked in an appropriate fashion to the promoter
sequence of the present invention.
[0058] The vectors described herein can be introduced (i.e.
transformed or transfected) into host cells, such as mammalian
(such as, but not limited to, simian, canine, feline, bovine,
equine, rodent, murine, etc.) or non-mammalian (such as, but not
limited to, insect, reptile, fish, avian, etc.) cells, using any
method known to those of skill in the art including, but not
limited to, electroporation, calcium phosphate precipitation, DEAE
dextran, lipofection, and receptor mediated endocytosis, polybrene,
particle bombardment, and microinjection. Alternatively, the vector
can be delivered to the cell as a viral particle (either
replication competent or deficient). Examples of viruses useful for
the delivery of nucleic acid include, but are not limited to,
lentivirus, adenoviruses, adeno-associated viruses, retroviruses,
Herpesviruseses, and vaccinia viruses. Other viruses suitable for
delivery of polynucleotide sequences into cells that are known to
those of skill in the art may be equivalently used in the present
invention.
[0059] The engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating the promoter
sequences, selecting transfected cells, etc. The culture
conditions, such as temperature, pH and the like, are those
previously used with the host cell selected for expression, and
will be apparent to those of skill in the art.
[0060] Preferably, the recombinant vector is transferred,
transformed or transfected into a host cell that has been
engineered to express the tet repressor protein. There are a number
of ways to engineer host cells to express the tet repressor
protein. For example, one way is to operably link the tet repressor
gene sequence to a promoter sequence and then to incorporate this
into the vector containing the promoter sequence of the present
invention operably linked to the polynucleotide sequence of
interest in tandem and then transfer, transform or transfect the
vector into the host cells. In such an expression vector, the tet
repressor sequence will be operably linked to a second promoter
sequence (the first promoter sequence being the promoter sequence
containing the at least two tet operators and operably linked to
the polynucleotide sequence of interest). If the recombinant vector
contains at least two polynucleotide sequences of interest, then
the tet repressor sequence will be operably linked to a "second" or
"third" promoter sequence depending upon whether the polynucleotide
sequences of interest are each operably linked to a single promoter
or operably linked to separate promoters. Alternatively, cells may
be transformed or transfected with a separate recombinant vector
containing the tet repressor sequence operable linked to a promoter
sequence prior to the transfer of the vector containing the
promoter sequence of the present invention operably linked to the
polynucleotide sequence of interest. Examples of suitable "a
promoter sequence" or "second" or "third" promoter sequences that
can be operably linked to the tet repressor sequence include, but
are not limited to, LTR or the SV40 promoter, the E. Coli lac or
trp, the phage lambda P sub L promoter and other promoters known to
control expression of tet repressor sequences. Other regulatory
and/or control sequences can be included with said promoter as
well.
[0061] The engineered host cells containing the incorporated
vector(s) can be identified using hybridization techniques that are
well known to those of skill in the art or by using the polymerase
chain reaction (PCR) to amplify specific polynucleotide sequences.
If the polynucleotide sequence transferred to the cells produces a
protein that can be detected, for example, by means of an
immunological or enzymatic assay, then the presence of recombinant
protein can be confirmed by introducing tetracycline into cells and
then performing the assays either on the medium surrounding the
cells or on cellular lysates.
[0062] As discussed previously herein, in the absence of any
inducing agent, host cells transformed or transfected with the
recombinant vectors containing the promoter sequences described
herein exhibit lower basal transcriptional activity compared to
other inducible pol III dependent promoter sequences known in the
art. Nonetheless, transcription of the at least one polynucleotide
sequence of interest incorporated into the host cells can be
achieved by using an inducing agent. The amount of inducing agent
to be added to the host cells to achieve the transcription of the
at least one polynucleotide sequence of interest can be readily
determined by those of skill in the art. Once induced,
transcription of at least one polynucleotide sequence produces a
RNA molecule. Preferably, this RNA molecule modulates the
expression of a target gene in the host cell. If the host cell has
been transformed or transfected with a recombinant vector
containing more than one polynucleotide sequence of interest, each
polynucleotide sequence will produce a RNA molecule. Preferably,
these RNA molecules will modulate the expression of more than one
target gene in a host cell. For example, if said host cells are
transformed or transfected with two polynucleotide sequences of
interest, the first polynucleotide sequence of interest can, as a
result of transcription, produce a first RNA molecule that
modulates the expression of a first target gene in said cell. The
second polynucleotide sequence of interest can also, as a result of
transcription, produce a second RNA molecule that modulates a
second target gene in said cell. Preferably, said second target
gene is different than the first target gene. Also, preferably, the
modulation accomplished by the first and/or second RNA molecule is
an inhibition or suppression of the first and/or second target
gene. However, the present invention does contemplate that one RNA
molecule might inhibit or suppress a first target gene while the
second RNA molecule might activate or stimulate a second target
gene.
[0063] Short Interfering RNA and Short Hairpin RNA
[0064] A brief description of siRNA and shRNA is provided to help
facilitate the understanding of the present invention. Several U.S.
and P.C.T. patent application Publications teach preferred methods
for designing, synthesizing, purifying, and delivering siRNAs and
shRNAs into cells. In particular, U.S. Patent Application
Publication U.S. 2003/0148519, which is incorporated by reference
herein in its entirety, provides compositions and methods for
intracellular expression and delivery of siRNAs and shRNAs in
mammalian cells; and U.S. Patent Application Publication U.S.
2002/0132788, which is incorporated by reference herein in its
entirety, provides a process for delivering siRNAs into cells in
vivo for the purpose of inhibiting gene expression in those
cells.
[0065] Short interfering RNAs (siRNAs) are short intermolecular
duplexes, generally composed of two distinct (sense and antisense)
strands of RNA, each of approximately 21 nucleotides, that form
approximately 19 basepairs, with single stranded 3' overhands of
1-3, preferably 2 nucleotides. The base-paired regions of siRNAs
generally substantially correspond, but are preferably exact to a
"target gene" and its complement, in the RNA transcript to be
targeted for degradation or translational inhibition.
[0066] The specific and necessary features of siRNAs required for
inducing the efficient degradation or silencing of corresponding
RNA transcripts have been investigated along with the features of
the target gene within the targeted transcript. Methods for the
design of effective siRNA's are described in Tuschl et al., Genes
& Dev., 13:3191-3197 (1999) and Elbashir et al., EMBO J,
20:6877-6888 (2001), each of which are herein incorporated by
reference.
[0067] For purposes of the present invention, the individual
single-stranded RNAs comprising siRNAs are synthesized endogenously
(within cells). The two complementary single strands must then
anneal to form an RNA duplex-the siRNA. The annealing step also
occurs endogenously. Endogenously synthesized single-stranded RNAs
are synthesized by cellular RNA polymerases using the vectors
described herein that contain the promoters of the present
invention.
[0068] Small hairpin RNAs (shRNAs), are single-stranded RNAs with
regions of self-complementarity that can pair with one another,
allowing the single strand to fold into an intramolecular duplex
with a stem-loop type structure. Although the unpaired loop region
can theoretically be any size, it is advantageous for the loop to
be small enough to readily allow the self-complementary sequences
within the same single-stranded RNA to find each other and
basepair. Preferred loop sizes are from 4 to 9 nucleotides, and
larger, with loops of 5-8 nucleotides being most preferred.
Generally the sequence of the loop is not important, however, it
should not contain a palindromic sequence. Within the cell the loop
of an shRNAs is cleaved and an intermolecular duplex, not unlike an
siRNA, is formed. The stem region of the shRNA should generally
contain approximately 19-29 base pairs, and generally 3' end of the
shRNA extending beyond the paired region is composed of multiple
thymidylate residues. The base-paired regions of shRNAs generally
correspond substantially, preferably exactly, to a target gene and
its complement in the RNA transcript to be targeted for
degradation, just as the base-paired region in siRNAs does.
[0069] Like the single strands of siRNAs, shRNAs can be can be
synthesized either endogenously, or exogenously. Endogenously
synthesized shRNAs are generally synthesized by cellular RNA
polymerases using the vectors described herein that contain the
promoters of the present invention.
[0070] Methods for Modulating Gene Expression in Non-Human
Mammals
[0071] In another embodiment, the present invention relates to
methods of modulating the expression of at least one target gene in
at least one eukaryotic cell in a non-human animal. These methods
involve inducing the transcription of a polynucleotide sequence of
interest using the promoter sequences and recombinant vectors
described herein. As discussed previously herein, the transcription
of said polynucleotide sequence of interest produces at least one
RNA molecule. Examples of RNA molecules that can be produced
include, but are not limited to, siRNA or shRNA. These RNA
molecules are then used to modulate the expression of at least one
target gene in such cells.
[0072] The promoter sequences and vectors of the present invention
described herein can be used in a variety of methods for modulating
the expression of at least one target gene in a eukaryotic cell.
More specifically, the method involves providing at least one
eukaryotic cell and then transforming or transfecting said
eukaryotic cell with at least one of the recombinant vectors
described herein. The at least one polynucleotide sequence of
interest contained within the recombinant vectors described herein,
upon transcription preferably produces at least one RNA molecule
that modulates the expression of at least one target gene in said
cell. Depending upon the purpose intended, the at least one RNA
molecule can either 1) activate or stimulate the target gene or 2)
inhibit or suppress the target gene. For example, if a target gene
in a eukaryotic cell is to be "knocked out", then the RNA molecule
produced may be siRNA or shRNA. It is known to those of skill in
the art that siRNA or shRNA can be used to "knock-out" target
genes. Therefore, the result of this modulation would be to inhibit
or suppress the target gene. Methods for making polynucleotide
sequences of interest that encode siRNA or shRNA are described
herein.
[0073] Transgenic Non-Human Animals
[0074] In another embodiment, the present invention relates to
transgenic non-human animals that contain the promoter sequences
and vectors described herein as well as methods of making said
animals. A variety of methods can be used to create the transgenic
non-human animals of the present invention. For example, the
generation of a specific alteration of a polynucleotide sequence of
a target gene is one approach that can be used. Alterations can be
accomplished by a variety of enzymatic and chemical methods used in
vitro. One of the most common methods uses a specific
oligonucleotide as a mutagen to generate precisely designed
deletions, insertions and point mutations in a target gene.
Secondly, a wildtype human gene and/or humanized non-human animal
gene could be inserted by homologous recombination. It is also
possible to insert an altered or mutant (single or multiple) human
gene as genomic or minigene constructs using the promoter of the
present invention.
[0075] Additionally, transgenic non-human animals can also be made
wherein at least one endogenous target gene is "knocked-out". The
creation of knockdown animals allows those of skill in the art to
assess in vivo function of the gene that has been "knocked-out".
The knock-out of at least one target gene may be accomplished in a
variety of ways. One strategy that can be used to "knock-out" a
target gene is by the insertion of artificially modified fragments
of the endogenous gene by homologous recombination. In this
technique, mutant alleles are introduced by homologous
recombination into embryonic stem (ES) cells. The embryonic stem
cells containing a knock out mutation in one allele of the gene
being studied are introduced into a blastocyst. The resultant
animals are chimeras containing tissues derived from both the
transplanted ES cells and host cells. The chimeric animals are
mated to assess whether the mutation is incorporated into the germ
line. Those chimeric animals each heterozygous for the knock-out
mutation are mated to produce homozygous knock-out mice. A second
strategy that can be used to "knock-out" at least one gene involves
using siRNA and shRNA and oocyte microinjection or transfection or
microinjection into embryonic stem cells as described further
herein. As mentioned previously herein, because the promoter
sequences of the present invention exhibit tighter regulation,
these promoter sequences greatly improve the success rate in making
inducible knockdown cell lines and animals when compared to other
promoter sequences known in the art.
[0076] To create a transgenic non-human animal having an altered
version of a human target gene, a polynucleotide sequence of
interest can be inserted into a non-human animal germ line using
standard techniques of oocyte microinjection or transfection or
microinjection into embryonic stem cells. Alternatively, if it is
desired to knock-out or replace a endogenous gene, homologous
recombination using embryonic stem cells or siRNA or shRNA using
oocyte microinjection or transfection or microinjection of
embryonic stem cells can be used as described herein.
[0077] For oocyte injection, at least one polynucleotide sequence
of interest that is operably linked to the promoter of the present
invention can be inserted into the pronucleus of a just-fertilized
non-human animal oocyte. This oocyte is then reimplanted into a
pseudopregnant foster mother. The liveborn non-human animal can
then be screened for integrants by analyzing the animal's DNA
(using polymerase chain reaction (PCR) for example) such as from
the tail, for the presence of the polynucleotide sequence of
interest. Chimeric non-human animals are then identified. The
transgene can be a complete genomic sequence injected as a YAC or
chromosome fragment, a cDNA, or a minigene containing the entire
coding region and other elements found to be necessary for optimum
expression.
[0078] Retroviral or lentiviral infection (See, Lois C, et al.,
Science, 295:868-872 (2002) (which teaches methods for transgenics
using lentiviral transgenesis)) of early embryos can also be done
to insert an altered gene. In this method, the altered gene is
inserted into a retroviral vector which is used to directly infect
mouse embryos during the early stages of development to generate a
chimera, some of which will lead to germline transmission
(Jaenisch, R., Proc. Natl. Acad. Sci. USA, 73: 1260-1264
(1976)).
[0079] Homologous recombination using embryonic stem cells allows
for the screening of gene transfer cells to identify the rare
homologous recombination events. Once identified, these can be used
to generate chimeras by injection of at least one non-human animal
blastocyst and a proportion of the resulting animals will show
germline transmission from the recombinant line. This gene
targeting methodology is especially useful if inactivation of the
gene is desired. For example, inactivation of the gene can be done
by designing a polynucleotide fragment which contains sequences
from an exon flanking a selectable marker. Homologous recombination
leads to the insertion of the marker sequences in the middle of an
exon, inactivating the gene. DNA analysis of individual clones can
then be used to recognize the homologous recombination events.
[0080] Alternatively, "knock-out" of a target gene can be
accomplished using siRNA or shRNA. In one strategy, oocyte
microinjection can be used as described herein. Specifically, a
transgene comprising at least one polynucleotide sequence of
interest that expresses at least one RNA molecule that is siRNA or
shRNA and that is operably linked to at least one RNA pol III
dependent promoter sequence of the present invention is prepared
using the methods described herein. This transgene is introduced
into a non-human animal fertilized oocyte, preferably, by
injection. The fertilized oocyte is then allowed to develop into an
embryo. The resulting embryo is then transferred into a
pseudopregnant female non-human animal and then allowed to give
birth. Liveborn non-human animals are then screened for chimeric
animals that contain the transgene by obtaining a sample and
analyzing the animal's DNA (using techniques such as PCR) and such
chimeric non-human animals are identified. When these non-human
animals are treated with an inducing agent, transcription is
induced, the siRNA or shRNA expressed, and the target gene is
repressed or "knocked-out". In the absence of the inducing agent,
the gene is not repressed or "knocked-out".
[0081] In a second strategy, microinjection of embryonic stem cells
can be used as described herein. Specifically, a transgene
comprising at least one polynucleotide sequence of interest that
expresses at least one RNA molecule that is siRNA or shRNA is
operably linked to at least one RNA pol III dependent promoter
sequence of the present invention is prepared using the methods
described herein. This transgene is introduced into non-human
animal embryonic stem cells which can be used to generate chimeras
by introducing these embryonic stem cells, preferably by injection,
into at least one non-human animal blastocyst. The resulting
blastocyst is then implanted into a pseudopregnant female non-human
animal and then allowed to give birth to a chimeric non-human
animal. PCR can be used to identify the animals of interest.
Liveborn non-human animals are then screened for chimeric animals
that contain the transgene by obtaining and analyzing a sample of
said animal's DNA (using techniques such as PCR) and such chimeric
non-human animals are identified. This chimeric non-human animal
can then be used in breeding to produce a transgenic non-human
animal that stably contain this transgene within their genome. As
with the previous method, when these non-human animals are treated
with an inducing agent, transcription is induced, the siRNA or
shRNA expressed, and the target gene is repressed or "knocked-out".
In the absence of the inducing agent, the gene is not repressed or
"knocked-out".
[0082] Methods of making transgenic animals are described, e.g., in
Wall et al., J Cell Biochem., June: 49(2), 113-20 (1992); Hogan, et
al., in "Manipulating the mouse embryo", A Laboratory Manual. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1992); in
WO 91/08216 or U.S. Pat. No. 4,736,866 the disclosures of which are
hereby incorporated by reference in their entirety.
[0083] By way of example, and not of limitation, examples of the
present invention shall now be given.
EXAMPLE 1
Development of a Tightly Regulated U6 promoter for shRNA
Expression
a. Luciferase Assay
[0084] Luciferase reporter constructs, pGL-3 (Promega, Madison
Wis.) and pRL-TK (Promega, Wis.) were transfected into cells using
Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.). Luciferase
activity was determined using the Dual-Luciferase Assay System
(Promega, Madison, Wis.).
b. Western Analysis
[0085] Cells were directly lysed on 6-well plates in 1.times.
Laemmli sample buffer. Proteins were separated by SDS-PAGE,
transferred to PVDF membrane, and western blotting was performed
using antibodies against Chk1 (1:200, Santa Crutz Biotechnology,
Santa Crutz, Calif. 95060), HIF-1 alpha (1:500, BD Bioscience, Palo
Alto, Calif. 94303) or tetR (1:2000, Mo Bi Tec, Germany).
c. Cell Culture
[0086] D54-MG (a proprietary cell line owned by Abbott
Laboratories) cells were grown in Dulbecco's modified Eagle's
medium (DMEM) supplemented with 10% fetal bovine serum (FBS).
HeLa-TREx cells (Invitrogen) were grown in minimum essential medium
(MEM) supplemented with 10% FBS. H1299 (a proprietary cell line
owned by Abbott Laboratories) cells were grown in RPMI1640 medium
supplemented with 10% FBS. All cells were maintained at 37.degree.
C. in an environment of 5% CO.sub.2. The D54-MG-tetR cell lines
were established by transfecting the D54-MG parental cell line with
pcDNA6/TR (Invitrogen Corp., Carlsbad, Calif. 92008) and selected
using 10 .mu.g/ml of blasticidin.
d. Molecular Cloning
[0087] The human U6 promoter was synthesized using polymerase chain
reaction (PCR). All PCR reactions were performed pursuant to the
Advantage2 PCR Kit (BD Bioscience Clontech, Palo Alto, Calif.)
using the following primers: TABLE-US-00001 (SEQ ID NO:19) U6_1:
gatcgaattccaggcaaaacgcaccacgtgacggagcgtgaccgcgcgcc
gagcgcgcgccaaggtcgggcagga. (SEQ ID NO:20) U6_2:
aacagccttgtatcgtatatgcaaatatgatggaatcatgggaaataggc
cctcttcctgcccgaccttggcgcg: (SEQ ID NO:21) U6_3:
atatacgatacaaggctgttagagagataattagaattaatttgactgta
aacacaaagatattagtataaaata. (SEQ ID NO:22) U6_4:
aaacataattttaaaactgcaaactacccaagaaattattactttctacg
tcacgtattttatactaatatcttt. (SEQ ID NO:23) U6_5:
gcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaac
ttgaaagtatttcgatttcttggct. (SEQ ID NO:24) U6_6:
tctagaagcttggtgtttcgtcctttccacaagatatataaagccaagaa atcgaaatact.
[0088] After being assembled using primers U6.sub.--1, U6.sub.--2,
U6.sub.--3, U6.sub.--4, U6.sub.--5 and U6.sub.--6, the full length
U6 promoter was amplified using the primer pair U6.sub.--5'PCR
(gatcgaattccaggcaaaacgcaccacgtg) (SEQ ID NO:25) and U6.sub.--3'PCR
(tctagaagcttggtgtttcgtcctttccac) (SEQ ID NO:26). The amplified PCR
fragment was cloned into the EcoRI and HindIII sites of
pBluescriptII (SK+) to create pU6.
[0089] Tetracycline regulated U6 promoter variants pU6.sub.--O1,
pU6.sub.--O2, pU6.sub.--O1O2.sub.--1, pU6.sub.--O1O2.sub.--2,
pU6.sub.--O1O2.sub.--3, pU6.sub.--O1O2.sub.--4,
pU6.sub.--O1O2.sub.--5, pU6.sub.--O1O2.sub.--6 and pU6.sub.--2O2
were all generated by PCR modification of the U6 promoter.
U6.sub.--5'PCR was used as 5' primer and the following primers were
used as 3' primers respectively: TABLE-US-00002 (SEQ ID NO:27) O1
rev: ggtgtttcgtcctttccacaagatatataactctatcaatgatagagtac
tttcaagttacggtaagcatatgata. (SEQ ID NO :28) O2 rev:
tttctctatcactgatagggagatatataaagccaagaaatcgaaatac (SEQ ID NO:29)
O1O2_rev: tctagaagcttggtgtttcgtcctttccacaagatatataactctatcaa
tgataga. (SEQ ID NO :30) O1O21_1:
ggtttctctatcactgatagggatatataactctatcaatgata. (SEQ ID NO:31)
O1O2_2: ggtgtctctatcactgatagggatatataactctatcaatgatagagtac tttcaa.
(SEQ ID NO :32) O1O2_3:
ggtctctatcactgatagggagatatataactctatcaatgataga. (SEQ ID NO :33)
O1O2_4: tctctatcactgatagggagagatatataactctatcaatgatagagt. (SEQ ID
NO:34) O1O2_5: ataactctatcaatgatagagtactttcaagttacggtaagcatctctat
cactgatagggaacataattttaaaactgcaaact. (SEQ ID NO:35) O1O2_6:
ataactctatcaatgatagagtactttcaagttacggtaagcatatgatc
tctatcactgatagggaattttaaaactgcaaactac. (SEQ ID NO:36) 2O2:
ggtctctatcactgatagggagatatataatctctatcactgatagggag
tttcaagttacggtaagcatatgatagtcc.
[0090] Briefly, pU6.sub.--O1 and pU6.sub.--O2 were generated by PCR
using pU6 as template and U6.sub.--5'PCR and O1rev or pU6.sub.--O2
as primers respectively. Tetracycline regulated U6 promoter
variants pU6.sub.--O1O2.sub.--1, pU6.sub.--O1O2.sub.--2,
pU6.sub.--O1O2.sub.--3, and pU6.sub.--O1O2.sub.--4, were all
created by PCR using pU6.sub.--O1 as template, U6.sub.--5'PCR as 5'
primer, and O1O2.sub.--1, O1O2.sub.--2, O1O2.sub.--3, or
O1O2.sub.--4 as 3' primers respectively. pU6.sub.--O1O2.sub.--5 and
pU6.sub.--O1O2.sub.--6 were generated by two PCR steps. In the
first step, pU6.sub.--O1 was used as a template, the primer pairs
U6.sub.--5'PCR and O1O2.sub.--5 or U6.sub.--5'PCR and O1O2.sub.--6
were used as primers respectively. In the second step, the PCR
products from the first step were each used as a template, and
U6.sub.--5'PCR and O1O2_rev were used as primers. The U6 promoter
variant with two O2 type tet operators, pU6.sub.--2O2, was
generated by PCR using pU6 as template and U6.sub.--5'PCR and 2O2
as primers.
[0091] U6 promoter variants that express shRNAs targeting
luciferase, or HIF-1.alpha. were designated as U6_luc, O1_luc,
O2_luc, O1O2_luc 1, O1O2_luc2, O1O2_luc3, O1O2_luc4, O1O2_luc5,
O1O2_luc6, 2O2_luc, and 2O2_Hif1. These constructs were generated
by PCR from each promoter variants using primers U6.sub.--5'PCR and
the following 3' primers respectively with the exception that the
primer O1O2_luc_rev was used to create both O1O2_luc5 and
O1O2_luc6. The PCR fragments were then cloned into the EcoR I and
Hind III site of pBluescript II (SK+). TABLE-US-00003 (SEQ ID
N0:37) O1_luc: gatcaaagcttaaaaaaggacatcacttacgctgagtctcttgaactcag
cgtaagtgatgtccggtgtttcgtcctttccacaa. (SEQ ID N0:38) O2_luc:
tagaagctt aaaaa ggacatcacttacgctgag tctcttgaa ctcagcgtaagtgatgtcc
tttctctatcactgatag. (SEQ ID N0:39) O1O2_luc_rev:
gatcaaagcttaaaaaaggacatcacttacgctgagtctcttgaactcag
cgtaagtgatgtccggtgtttcgtcctttccacaa. (SEQ ID NO:40) O1O2_luc1:
gatcaaagcttaaaaaaggacatcacttacgctgagtctcttgaactcag
cgtaagtgatgtccggtttctctatcactgataggg. (SEQ ID NO:41) O1O2_luc2:
gatcaaagcttaaaaaaggacatcacttacgctgagtctcttgaactcag
cgtaagtgatgtccggtgtctctatcactgataggg. (SEQ ID N0:42) O1O2_luc3:
gatcaaagcttaaaaaaggacatcacttacgctgagtctcttgaactcag
cgtaagtgatgtccggtctctatcactgatagggag. (SEQ ID NO:43) O1O2_luc4:
gatcaaagcttaaaaaaggacatcacttacgctgagtctcttgaactcag
cgtaagtgatgtcctctctatcactgatagggagag. (SEQ ID NO:44) 2O2_luc:
gatcaaagcttaaaaaaggacatcacttacgctgagtctcttgaactcag
cgtaagtgatgtccggtctctatcactgatagggag. (SEQ ID NO:45) 2O2_HIF1A:
gatcaaagcttaaaaaagacagtacaggatgcttgctctcttgaagcaag
catcctgtactgtcggtctctatcactgatagggag.
e. Transcriptional Activity and Tetracycline Response of U6
Promoter Variants
[0092] The plasmids that use each of the U6 promoter variants to
express shRNAs are designated as U6_luc, O1_luc, O1O2_luc1,
O1O2_luc2, O1O2_luc3, O1O2_luc4, O1O2_luc5, and O1O2_luc6. Each of
these plasmids (0.008 .mu.g) or a control vector (the control
vector is identical to the pU6 vector but does not contain a shRNA
against luciferase) was co-transfected with 1 .mu.g pGL3-control
and 0.5 .mu.g pRL-TK (The pGL3-control and pRL-TK plasmids each
express firefly luciferase and renilla luciferase. The shRNA in
each of these constructs are designed to inhibit firefly
luciferase. The renilla luciferase was used to for normalization
purposes.). Transfection was carried out using Lipofectamine2000
(Invitrogen, Carlsbad, Calif.), according to the manufacturer's
suggested protocol.
[0093] Luciferase activity in transfected cells was determined 72
hours post transfection. U6_luc, O1_luc, O1O2.sub.--3,
O1O2.sub.--4, O1O2_luc5, O1O2_luc6 (0.2 .mu.g each) and a control
plasmid also were co-transfected separately with 1 .mu.g
pGL3-control, 0.5 .mu.g pRL-TK and 1 .mu.g of pcDNA6/TR. In
addition, a control plasmid, U6_luc, O1_luc, O2_luc, and 2O2_luc
(0.2 .mu.g each) were co-transfected separately with 1 .mu.g
pGL3-control, 0.5 .mu.g pRL-TK and 1 .mu.g of pcDNA6/TR. For
doxycycline treatment, cells were changed to culture medium
containing 1 .mu.g/ml of doxycycline 24 hours post transfection.
Luciferase activity was determined 48 hours after induction by
doxycycline.
F. Comparison of the tetO1 and 2O2 Expression Systems in Making
Stable Cell Lines Expressing Luciferase shRNA
[0094] D54MG-tetR cells with stably integrated O1_luc (O1_luc1 . .
. . O1_luc4), 2O2-luc (2O2_luc1 . . . 2O2_luc7) or the 2O2 vector
(control) were transfected with 1 .mu.g pGL3-control and 0.5 .mu.g
pRL-TK. For doxycycline treatment, cells were changed into medium
containing 1 .mu.g/ml doxycycline 24 hours post transfection.
Luciferase activities were determined 48 hours after induction by
doxycycline. The cells were lysed after treatment with 1 .mu.g/ml
doxycycline for 48 hours and analyzed by western blotting using an
anti-tetR antibody. The same blot was stripped and immunoblotted
with an anti-actin antibody to show the equal loading of sample in
each lane.
G. Comparison of the tetO1 and 2O2 Expression System in Making
Stable Cell Lines Expressing Hif-1 shRNA
[0095] D54-MG-TetR cell lines with integrated O1_Hif1 cassette or
2O2_Hif1 cassette were treated with 1 .mu.g/ml doxycycline for 48
hours followed by a six-hour treatment with 100 .mu.M
desferrioxamine (DFO). Cells were lysed in 1.times. Laemmli sample
buffer and analyzed by western blotting using an antibody against
Hif-1 alpha (1:500).
h. Results
[0096] The inventors of the present invention first examined
whether two tet operators can be engineered into the U6 promoter
without abolishing the transcriptional activity. An O1 type tet
operator was first engineered between the PSE and the TATA box to
create a O1 type U6 promoter that is identical to that reported in
Ohkawa, J., et al., Human Gene Therapy, 11:577-585 (2000) (See,
FIG. 1, O1). A panel of modified human U6 promoters with two tet
operators were then created by replacing part of the O1 type
promoter with an O2 type tet operator (See FIG. 1). The
transcriptional activities of the modified human U6 promoters were
assessed by the ability of each promoter to express an shRNA
targeting luciferase and inhibit the reporter activity. Based on a
dose-response experiment using U6_luc, which utilizes the wild type
U6 promoter to drive the expression of a luciferase shRNA, an
amount of shRNA plasmid (0.008 .mu.g) that exhibited 80% inhibition
of the reporter activity was chosen for evaluation of the
transcriptional activity exhibited by the modified U6 promoters.
The degree of inhibition varied in cells transfected with U6
derivatives that contain both the O1 and O2 type tet operators. A
similar degree of inhibition on luciferase activity was observed in
cells transfected with O1_luc, O1O2_luc3, O1O2_luc4, O1O2_luc5, and
O1O2_luc6, suggesting that introducing an additional O2 type tet
operator into the O1 type promoter at these positions have only a
marginal effect on the transcriptional activity (FIG. 2A,
O1O2.sub.--3, O1O2.sub.--4, O1O2.sub.--5, and O1O2.sub.--6).
[0097] The active U6 promoter derivatives were then examined for
their response to the inducing agent, doxycycline. Strong
inhibition of luciferase activity was observed in cells transfected
with O1_luc, O1O2_luc5, and O1O2_luc6 regardless of the presence or
absence of doxycycline, suggesting that these promoters are very
leaky under these experimental conditions (See, FIG. 2B, O1,
O1O2_luc5, and O1O2_luc6). In contrast, cells transfected with
O1O2_luc3 and O1O2_luc4 exhibited much lower luciferase activity in
the presence of doxycyclin than in the absence of doxycycline.
However, even in the absence of doxycycline, O1O2_luc3 and
O1O2_luc4 transfected cells exhibited a >50% reduction of
luciferase activity compared with cells transfected with a control
vector (See, FIG. 2B, O1O2.sub.--3, and O1O2.sub.--4), suggesting
that these promoters are still quite leaky despite of improved
regulation compared to the O1 type promoter.
[0098] To further improve the inducible system, the O2 type tet
operator was introduced to replace the O1 type tet operator in
O1O2.sub.--3 to generate a 2O2 type promoter (See, FIG. 1, 2O2).
Because the O2 type tet operator has higher binding affinity for
tetR than the O1 type tet operator (See, Hillen, W., et al., Annu.
Rev. Microbiol., 48:345-69 (1994)), the inventors believed that it
was likely that tetR would bind more tightly to the 2O2 type
promoter than the O1O2.sub.--3 type promoter, resulting in reduced
basal transcriptional activity of the promoter. In the absence of
doxycycline, O1O2_luc3 caused >70% reduction of the luciferase
activity as compared with the control plasmid. Under the same
condition, 2O2_luc caused no more than 30% inhibition of the
luciferase activity (See, FIG. 2C), indicating that the 2O2
promoter indeed has less basal activity compared with the
O1O2.sub.--3 promoter. Meanwhile, O2_luc caused about 85% reduction
of the luciferase activity, suggesting that two O2 type tet
operators are needed at the same time to provide tight control of
shRNA expression in the absence of doxycycline (See, FIG. 2C). In
the presence of doxycycline, both O1O2_luc3 and 2O2_luc exhibited
more than 80% inhibition of the luciferase activity, suggesting
that the 2O2 and O1O2.sub.--3 type promoters have similar
activities upon induction (See, FIG. 2C). These results
demonstrated that it is possible to engineering two tet operators
into the U6 promoter without dramatically sacrificing the
transcriptional activity. Meanwhile, with two O2 type tet operators
flanking the TATA box, the resulting U6 promoter variant, 2O2,
exhibited the best doxycycline response compared with U6 promoter
variants with a single tet operator (O1 or O2) or a combination of
O1 and O2 type tet operators.
[0099] To determine whether the 2O2 promoter retains the ability to
respond to doxycycline after integrating into chromosomes, the
inventors used a commercial tetR expressing cell line, HeLaTREx,
(Invitrogen Corp., Carlsbad, Calif. 92008) to establish stable
clones that carried the 2O2 promoter linked to an shRNA targeting
human Hif1.alpha. (2O2_Hif1). Among the five clones that carried
the 2O2_Hif1 cassette, two clones exhibited a more than 90%
reduction of HIF1.alpha. protein upon induction (See, FIG. 3A,
Hif1-6 and Hif1-7). These results demonstrated that the 2O2
promoter retains its doxycycline responsive property after
integrating into a chromosome.
[0100] Using the best-regulated 2O2_Hif1 clone (Hif1-7), the
inventors further characterized the time and dose dependency of
doxycycline induction of the 2O2 expression system. A significant
reduction of Hif1.alpha. protein was observed as early as 12 hours
after induction, and more than 90% inhibition of Hif-1 protein was
observed 24 hours after doxycycline treatment. Longer induction did
not lead to more complete inhibition of Hif1.alpha. protein (See,
FIG. 3B). The doxycycline concentration that is required for
maximal induction of the 2O2 system was determined in a
dose-response experiment. A more than 90% inhibition of Hif-1
protein was observed in the presence of 0.1 ng/ml of doxycycline
and the maximal inhibition of Hif1.alpha. protein was reached in
the presence of 10 ng/ml of doxycycline (See, FIG. 3C). These
results highlight the fast response and extreme sensitivity of the
2O2 system to doxycycline induction.
[0101] The use of pol III dependent inducible expression systems
for regulated target knockdown is known in the art (See, van de
Wetering, M., et al., EMBO Rep., 4:609-615 (2003), Matskura, S., et
al., Nucleic Acid Res., 31:e77 (2003) and Czauderna, F., et al.,
Nucleic Acids Res., 31:e 127 (2003)). In contrast to these reported
observations, the inventors of the present invention observed
severe leakiness of the O1 and O2 promoter in their initial studies
(See, FIG. 2C, O1 and O2). To determine whether the observed
leakiness of the system in the literature would have a negative
impact on the ability of using these systems to create stable cell
lines, the inventors directly compared the success rate of making
inducible cell lines using both the O1 and the 2O2 systems. A D54MG
cell line with high level of tetR expression was first established,
and plasmids that utilizing the O1 or 2O2 promoters to drive the
expression of shRNAs targeting luciferase (O1_luc and 2O2_luc) or
human Hif1.alpha. (O1_Hif1 and 2O2_Hif1) were transfected with a
hygromycine resistant gene into this cell line. The drug resistant
clones were selected and analyzed by PCR to identify clones that
carry the inducible shRNA expression cassette. The inventors
obtained four clones with stably integrated O1_luc and seven clones
with stably integrated 2O2_luc cassette as analyzed by PCR. All the
clones displayed similar level of tetR expression (See, FIG. 4B).
These clones were examined for their response to doxycycline
induction. None of the four O1_luc clones exhibited significant
doxycycline dependent reduction of luciferase activity (See, FIG.
4A, O1_luc1 to O1_luc4). Interestingly, three out of the four
O1_luc clones exhibited constitutive inhibition of the luciferase
activity regardless of the presence or absence of doxycycline,
indicating severe leakiness of the O1 system (See, FIG. 4A,
O1_luc1, O1_luc2, and O1_luc4). In contrast, among the seven
2O2_luc clones, two clones exhibited clear doxycycline dependent
inhibition of luciferase activity (See, FIG. 4A, 2O2_luc2,
2O2_luc4), and three clones displayed modest degree of doxycycline
dependent inhibition of luciferase activity (See, FIG. 4A,
2O2_luc1, 2O2_luc5, and 2O2_luc7). The shRNA expression cassette
for clone O1.sub.--3, 2O2.sub.--3 and 2O2.sub.--6 could be inserted
into transcriptional inactive site in a chromosome, resulting no
inhibition of luciferase activity regardless of the presence or
absence of doxycycline.
[0102] Similar results were also obtained from O1_Hif1 clones and
2O2_Hif1 clones. Among the ten O1_Hif1 clones analyzed, none of
them exhibited apparent reduction of Hif1.alpha. protein upon
doxycycline treatment (See, FIG. 4C, top). In contrast, two of the
eleven 2O2_Hif1 clones exhibited significant reduction of
Hif1.alpha. protein upon doxycycline treatment (See, FIG. 4C,
bottom, clone 5 and 11).
[0103] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The molecular complexes and the methods, procedures,
treatments, molecules, specific compounds described herein are
presently representative of preferred embodiments, are exemplary,
and are not intended as limitations on the scope of the invention.
It will be readily apparent to one skilled in the art that varying
substitutions and modifications may be made to the invention
disclosed herein without departing from the scope and spirit of the
invention.
[0104] All patents and publications mentioned in the specification
are indicative of the levels of those skilled in the art to which
the invention pertains. All patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
[0105] The invention illustratively described herein suitably may
be practiced in the absence of any element or elements, limitation
or limitations which is not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising,"
"consisting essentially of" and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed. Thus, it should be understood that although the
present invention has been specifically disclosed by preferred
embodiments and optional features, modification and variation of
the concepts herein disclosed may be resorted to by those skilled
in the art, and that such modifications and variations are
considered to be within the scope of this invention as defined by
the appended claims.
[0106] In addition, where features or aspects of the invention are
described in terms of Markush groups, those skilled in the art will
recognize that the invention is also thereby described in terms of
any individual member or subgroup of members of the Markush group.
For example, if X is described as selected from the group
consisting of bromine, chlorine, and iodine, claims for X being
bromine and claims for X being bromine and chlorine are fully
described.
Sequence CWU 1
1
45 1 22 DNA Artificial Sequence Tetracycline operator 1 actctatcat
tgatagagtt at 22 2 19 DNA Artificial Sequence Polynucleotide 2
tccctatcag tgatagaga 19 3 21 DNA Artificial Sequence Polynucleotide
3 tccctatcag tgatagagac c 21 4 21 DNA Artificial Sequence
Polynucleotide 4 tccctatcag tgatagagag g 21 5 22 DNA Artificial
Sequence Tetracycline O2 type U6 promoter 5 ctccctatca gtgatagaga
aa 22 6 93 DNA Artificial Sequence U6 promoter variants 6
ttaaaatgga ctatcatatg tcatatgctt accgtaactt gaaagtattt cgatttcttg
60 gctttatata tcttgtggaa aggacgaaac acc 93 7 94 DNA Artificial
Sequence U6 promoter variants 7 ttaaaatgga ctatcatatg tcatatgctt
accgtaactt gaaagtactc tatcattgat 60 agagttatat atcttgtgga
aaggacgaaa cacc 94 8 93 DNA Artificial Sequence U6 promoter
variants 8 ttaaaatgga ctatcatatg tcatatgctt accgtaactt gaaagtattt
cgatttcttg 60 gctttatata tctccctatc agtgatagag acc 93 9 94 DNA
Artificial Sequence U6 promoter variants 9 ttaaaatgga ctatcatatg
tcatatgctt accgtaactt gaaagtactc tatcattgat 60 agagttatat
atccctatca gtgatagaga aacc 94 10 94 DNA Artificial Sequence U6
promoter variants 10 ttaaaatgga ctatcatatg tcatatgctt accgtaactt
gaaagtactc tatcattgat 60 agagttatat atccctatca gtgatagaga cacc 94
11 94 DNA Artificial Sequence U6 promoter variants 11 ttaaaatgga
ctatcatatg tcatatgctt accgtaactt gaaagtactc tatcattgat 60
agagttatat atctccctat cagtgataga gacc 94 12 94 DNA Artificial
Sequence U6 promoter variants 12 ttaaaatgga ctatcatatg tcatatgctt
accgtaactt gaaagtactc tatcattgat 60 agagttatat atctctccct
atcagtgata gaga 94 13 94 DNA Artificial Sequence U6 promoter
variants 13 ttaaactccc tatcagtgat agagatgctt accgtaactt gaaagtactc
tatcattgat 60 agagttatat atcttgtgga aaggacgaaa cacc 94 14 94 DNA
Artificial Sequence U6 promoter variants 14 ctccctatca gtgatagaga
tcatatgctt accgtaactt gaaagtactc tatcattgat 60 agagttatat
atcttgtgga aaggacgaaa cacc 94 15 94 DNA Artificial Sequence U6
promoter variants 15 ttaaaatgga ctatcatatg tcatatgctt accgtaactt
gaaactccct atcagtgata 60 gagattatat atctccctat cagtgataga gacc 94
16 49 RNA Artificial Sequence Chemically synthesized short hairpin
RNA 16 ggaagaaauu agcaguagcu cucuugaagc uacugcuaau uucuuccuu 49 17
21 DNA Artificial Sequence variation 20, 21 n = T/U, Combined
DNA/RNA molecule; chemically synthesized small interfering RNA
(siRNA) 17 gggcauuucu cagagaaugn n 21 18 21 DNA Artificial Sequence
variation 1, 2 n = T/U, Combined DNA/RNA molecule; chemically
synthesized small interfering RNA (siRNA) 18 nncccguaaa gagucucuua
c 21 19 75 DNA Artificial Sequence PCR primer 19 gatcgaattc
caggcaaaac gcaccacgtg acggagcgtg accgcgcgcc gagcgcgcgc 60
caaggtcggg cagga 75 20 75 DNA Artificial Sequence PCR primer 20
aacagccttg tatcgtatat gcaaatatga tggaatcatg ggaaataggc cctcttcctg
60 cccgaccttg gcgcg 75 21 75 DNA Artificial Sequence PCR primer 21
atatacgata caaggctgtt agagagataa ttagaattaa tttgactgta aacacaaaga
60 tattagtata aaata 75 22 75 DNA Artificial Sequence PCR primer 22
aaacataatt ttaaaactgc aaactaccca agaaattatt actttctacg tcacgtattt
60 tatactaata tcttt 75 23 75 DNA Artificial Sequence PCR primer 23
gcagttttaa aattatgttt taaaatggac tatcatatgc ttaccgtaac ttgaaagtat
60 ttcgatttct tggct 75 24 61 DNA Artificial Sequence PCR primer 24
tctagaagct tggtgtttcg tcctttccac aagatatata aagccaagaa atcgaaatac
60 t 61 25 30 DNA Artificial Sequence PCR primer 25 gatcgaattc
caggcaaaac gcaccacgtg 30 26 30 DNA Artificial Sequence PCR primer
26 tctagaagct tggtgtttcg tcctttccac 30 27 76 DNA Artificial
Sequence PCR primer 27 ggtgtttcgt cctttccaca agatatataa ctctatcaat
gatagagtac tttcaagtta 60 cggtaagcat atgata 76 28 49 DNA Artificial
Sequence PCR primer 28 ttctctatc actgataggg agatatataa agccaagaaa
tcgaaatac 49 29 57 DNA Artificial Sequence PCR primer 29 tctagaagct
tggtgtttcg tcctttccac aagatatata actctatcaa tgataga 57 30 44 DNA
Artificial Sequence PCR primer 30 ggtttctcta tcactgatag ggatatataa
ctctatcaat gata 44 31 56 DNA Artificial Sequence PCR primer 31
ggtgtctcta tcactgatag ggatatataa ctctatcaat gatagagtac tttcaa 56 32
46 DNA Artificial Sequence PCR primer 32 ggtctctatc actgataggg
agatatataa ctctatcaat gataga 46 33 48 DNA Artificial Sequence PCR
primer 33 tctctatcac tgatagggag agatatataa ctctatcaat gatagagt 48
34 85 DNA Artificial Sequence PCR primer 34 ataactctat caatgataga
gtactttcaa gttacggtaa gcatctctat cactgatagg 60 gaacataatt
ttaaaactgc aaact 85 35 87 DNA Artificial Sequence PCR primer 35
ataactctat caatgataga gtactttcaa gttacggtaa gcatatgatc tctatcactg
60 atagggaatt ttaaaactgc aaactac 87 36 80 DNA Artificial Sequence
PCR primer 36 ggtctctatc actgataggg agatatataa tctctatcac
tgatagggag tttcaagtta 60 cggtaagcat atgatagtcc 80 37 85 DNA
Artificial Sequence PCR primer 37 gatcaaagct taaaaaagga catcacttac
gctgagtctc ttgaactcag cgtaagtgat 60 gtccggtgtt tcgtcctttc cacaa 85
38 79 DNA Artificial Sequence PCR primer 38 tagaagctta aaaaggacat
cacttacgct gagtctcttg aactcagcgt aagtgatgtc 60 ctttctctat cactgatag
79 39 85 DNA Artificial Sequence PCR primer 39 gatcaaagct
taaaaaagga catcacttac gctgagtctc ttgaactcag cgtaagtgat 60
gtccggtgtt tcgtcctttc cacaa 85 40 86 DNA Artificial Sequence PCR
primer 40 gatcaaagct taaaaaagga catcacttac gctgagtctc ttgaactcag
cgtaagtgat 60 gtccggtttc tctatcactg ataggg 86 41 86 DNA Artificial
Sequence PCR primer 41 gatcaaagct taaaaaagga catcacttac gctgagtctc
ttgaactcag cgtaagtgat 60 gtccggtgtc tctatcactg ataggg 86 42 86 DNA
Artificial Sequence PCR primer 42 gatcaaagct taaaaaagga catcacttac
gctgagtctc ttgaactcag cgtaagtgat 60 gtccggtctc tatcactgat agggag 86
43 86 DNA Artificial Sequence PCR primer 43 gatcaaagct taaaaaagga
catcacttac gctgagtctc ttgaactcag cgtaagtgat 60 gtcctctcta
tcactgatag ggagag 86 44 86 DNA Artificial Sequence PCR primer 44
gatcaaagct taaaaaagga catcacttac gctgagtctc ttgaactcag cgtaagtgat
60 gtccggtctc tatcactgat agggag 86 45 86 DNA Artificial Sequence
PCR primer 45 gatcaaagct taaaaaagac agtacaggat gcttgctctc
ttgaagcaag catcctgtac 60 tgtcggtctc tatcactgat agggag 86
* * * * *