Antisense modulation of c/ebp beta expression

Abstract

Antisense compounds, compositions and methods are provided for modulating the expression of C/EBP beta. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding C/EBP beta. Methods of using these compounds for modulation of C/EBP beta expression and for treatment of diseases associated with expression of C/EBP beta are provided.

Description

FIELD OF THE INVENTION

[0001] The present invention provides compositions and methods for modulating the expression of C/EBP beta. In particular, this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding C/EBP beta. Such oligonucleotides have been shown to modulate the expression of C/EBP beta.

BACKGROUND OF THE INVENTION

[0002] Transcription factors represent a group of molecules within the cell that function to connect the pathways from extracellular signals to intracellular responses. Immediately after an environmental stimulus, these proteins which reside predominantly in the cytosol are translocated to the nucleus where they bind to specific DNA sequences in the promoter elements of target genes and activate the transcription of these target genes. One family of transcription factors, CCAAT/Enhancer-binding proteins (C/EBPs), regulates the expression of an extensive panel of genes that control normal tissue development and cellular function, cellular proliferation and functional differentiation. Six members of this family have been identified to date all of which form both homo- and heterodimers with other C/EBP family members as well as with members of the NFkB and Fos/Jun families of transcription factors (Lekstrom-Himes and Xanthopoulos, J. Biol. Chem., 1998, 273, 28545-28548). While all of the members of the C/EBP family have a similar modular protein structure, expression levels and tissue distributions vary widely leading to a diversity of roles (Lekstrom-Himes and Xanthopoulos, J. Biol. Chem., 1998, 273, 28545-28548).

[0003] C/EBP beta (also known as C/EBP2, LAP, TCF5, CRP2, NFIL6, IL6DBP, NF-M, AGP/EBP and Apc/EPB) was originally identified as a mediator of IL-6 signaling, binding to IL-6 responsive agents in acute phase response genes such as TNF, IL-8 and G-CSF (Akira et al., Embo J., 1990, 9, 1897-1906; Descombes et al., Genes Dev., 1990, 4, 1541-1551) isolated from the liver and primarily regulates hormone responsiveness and oxidative stress responses (Descombes et al., Genes Dev., 1990, 4, 1541-1551). Studies of tissue distribution and developmental expression patterns showed that C/EBP beta is found the liver, lung, spleen, kidney, brain and testis with the highest expression found in the lung (Descombes et al., Genes Dev., 1990, 4, 1541-1551). Disclosed in U.S. Pat. Nos. 5,215,892 and 5,360,894 are the nucleic acid sequence of C/EBP beta as well as plasmids and host cells for the expression of the recombinant protein (Kishimoto et al., 1994; Kishimoto et al., 1993).

[0004] C/EBP-deficient mice have been generated for five of the six members of the C/EBP family and these have been characterized for system-specific phenotypic abnormalities. Mice lacking C/EBP beta demonstrate defective carbohydrate metabolism, immunodeficiency, defective Th1 response and female sterility. They also have a low level of expression of phosphoenolpyruvate carboxykinase (Park et al., J. Biol. Chem., 1999, 274, 211-217; Yamada et al., J. Biol. Chem., 1999, 274, 5880-5887) and demonstrate perinatal lethality suggesting involvement of C/EBP beta in gluconeogenic pathways (Arizmendi et al., J. Biol. Chem., 1999, 274, 13033-13040; Greenbaum et al., J. Clin. Invest., 1998, 102, 996-1007). These mice are highly susceptible to infection by a wide range of pathogens indicating a critical role for C/EBP beta in bactericidal responses (Tanaka et al., Cell, 1995, 80, 353-361). In studies of the cAMP responsiveness of the phosphoenolpyruvate carboxykinase (PEPCK) gene, Crosson and Roesler designed plasmids that stably express antisense RNA to rat C/EBP alpha or rat C/EBP beta in hepatoma cells (J. Biol. Chem., 2000, 275(8): 5804-5809). Antisense directed against C/EBP alpha mRNA reduced C/EBP alpha proteins levels and CAMP responsiveness, while antisense directed against C/EBP beta was without effect.

[0005] In addition to stage-specific expression level variations, the C/EBP members also undergo multiple isoform expression arising from alternative start positions, for the alpha and beta isoforms, in 5' upstream open reading frames (Geballe and Morris, Trends Biochem. Sci., 1994, 19, 159-164; Lincoln et al., J. Biol. Chem., 1998, 273, 9552-9560). The steady-state level of the various pools of transcripts also changes as a function of age and stress challenges (Hsieh et al., Mol. Biol. Cell, 1998, 9, 1479-1494). In mice the expression of certain transcripts of one isoform has also been shown to regulate the expression of other C/EBP isoforms (Burgess-Beusse et al., Hepatology, 1999, 29, 597-601).

[0006] C/EBP beta occurs as two isoforms in the cell, a full-length 32-kDa form, known as LAP and a shorter form known as LIP. The dimerization of these two forms attenuates transcription of the C/EBP beta gene and therefore represents an autoregulatory mechanism of expression (Descombes et al., Genes Dev., 1990, 4, 1541-1551).

[0007] In disease states, C/EBP beta has been implicated in the development of diabetes and cancer. Studies comparing normal and tumorigenic tissue from human ovaries demonstrated a higher level of expression of C/EBP alpha and beta in the tumor tissues, irrespective of stage or grade of tumor (Sundfeldt et al., Br. J. Cancer, 1999, 79, 1240-1248). In the rat pancreas, it was shown that C/EBP beta expression is upregulated upon chronically elevated levels of glucose, possibly contributing to impaired insulin secretion in severe type II diabetes (Lu et al., J. Biol. Chem., 1997, 272, 28349-28359; Seufert et al., J. Clin. Invest., 1998, 101, 2528-2539).

[0008] The pharmacological modulation of C/EBP beta activity and/or expression may therefore be an appropriate point of therapeutic intervention in pathological conditions.

[0009] Currently, there are no known therapeutic agents which effectively inhibit the synthesis of C/EBP beta and to date, investigative strategies aimed at modulating C/EBP beta function have involved the use of antibodies and gene knock-outs in mice. However, these strategies are untested as therapeutic protocols and consequently there remains a long felt need for agents capable of effectively inhibiting C/EBP beta function.

[0010] Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of C/EBP beta expression.

[0011] The present invention provides compositions and methods for modulating C/EBP beta expression, including modulation of both the long and short isoforms of C/EBP beta.

SUMMARY OF THE INVENTION

[0012] The present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding C/EBP beta, and which modulate the expression of C/EBP beta. Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of C/EBP beta in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention. Further provided are methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of C/EBP beta by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.

DETAILED DESCRIPTION OF THE INVENTION

[0013] The present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding C/EBP beta, ultimately modulating the amount of C/EBP beta produced. This is accomplished by providing antisense compounds which specifically hybridize with one or more nucleic acids encoding C/EBP beta. As used herein, the terms "target nucleic acid" and "nucleic acid encoding C/EBP beta" encompass DNA encoding C/EBP beta, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds which specifically hybridize to it is generally referred to as "antisense". The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the expression of C/EBP beta. In the context of the present invention, "modulation" means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation of gene expression and mRNA is a preferred target.

[0014] It is preferred to target specific nucleic acids for antisense. "Targeting" an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding C/EBP beta. The targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result. Within the context of the present invention, a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon". A minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding C/EBP beta, regardless of the sequence(s) of such codons.

[0015] It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 540 -TGA, respectively). The terms "start codon region" and "translation initiation codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon. Similarly, the terms "stop codon region" and "translation termination codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon.

[0016] The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene. The 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap. The 5' cap region may also be a preferred target region.

[0017] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. mRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA.

[0018] Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.

[0019] In the context of this invention, "hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. "Complementary," as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.

[0020] Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.

[0021] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.

[0022] In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.

[0023] While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleosides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 25 nucleobases. As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

[0024] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

[0025] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

[0026] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

[0027] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

[0028] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

[0029] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0030] Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH.sub.2--NH--O--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene (methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and --O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

[0031] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Particularly preferred are O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in examples hereinbelow.

[0032] Other preferred modifications include 2'-methoxy (2'-O--CH.sub.3), 2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0033] Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. , ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0034] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.

[0035] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937.

[0036] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.

[0037] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds which are chimeric compounds. "Chimeric" antisense compounds or "chimeras," in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0038] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0039] The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.

[0040] The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.

[0041] The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.

[0042] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

[0043] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 to Imbach et al.

[0044] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0045] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in nature, for example glutamic acid or aspartic acid, and also with phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfoic acid, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acid organic compounds, such as ascorbic acid. Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.

[0046] For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

[0047] The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of C/EBP beta is treated by administering antisense compounds in accordance with this invention. The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.

[0048] The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding C/EBP beta, enabling sandwich and other assays to easily be constructed to exploit this fact. Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding C/EBP beta can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of C/EBP beta in a sample may also be prepared.

[0049] The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.

[0050] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

[0051] Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.

[0052] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0053] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.

[0054] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0055] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0056] In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.

Emulsions

[0057] The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 .mu.m in diameter. (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.

[0058] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0059] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

[0060] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

[0061] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0062] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

[0063] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0064] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

[0065] In one embodiment of the present invention, the compositions of oligonucleotides and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0066] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

[0067] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

[0068] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.

[0069] Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories--surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

Liposomes

[0070] There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.

[0071] Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.

[0072] In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.

[0073] Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0074] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.

[0075] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.

[0076] Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.

[0077] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0078] Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0079] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

[0080] Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

[0081] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome.TM. I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome.TM. II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).

[0082] Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765). Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1, or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.).

[0083] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.

[0084] A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising antisense oligonucleotides targeted to the raf gene.

[0085] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0086] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0087] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0088] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0089] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0090] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

[0091] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

Penetration Enhancers

[0092] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

[0093] Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

[0094] Surfactants:

[0095] In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0096] Fatty Acids:

[0097] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0098] Bile Salts:

[0099] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

[0100] Chelating Agents:

[0101] Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0102] Non-Chelating Non-Surfactants:

[0103] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0104] Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.

[0105] Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

Carriers

[0106] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).

Excipients

[0107] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).

[0108] Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0109] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

[0110] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

Other Components

[0111] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0112] Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0113] Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 1206-1228). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively). Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

[0114] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.

[0115] The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC.sub.50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.

[0116] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.

EXAMPLES

Example 1

Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and 2'-alkoxy Amidites

[0117] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial sources (e.g. Chemgenes, Needham Mass. or Glen Research, Inc. Sterling Va.). Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Pat. No. 5,506,351, herein incorporated by reference. For oligonucleotides synthesized using 2'-alkoxy amidites, the standard cycle for unmodified oligonucleotides was utilized, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds.

[0118] Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) nucleotides were synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling Va. or ChemGenes, Needham Mass.).

2'-Fluoro Amidites

[0119] 2'-Fluorodeoxyadenosine Amidites

[0120] 2'-fluoro oligonucleotides were synthesized as described previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and U.S. Pat. No. 5,670,633, herein incorporated by reference. Briefly, the protected nucleoside N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized utilizing commercially available 9-beta-D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha-fluoro atom is introduced by a S.sub.N2-displacement of a 2'-beta-trityl group. Thus N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N6-benzoyl groups was accomplished using standard methodologies and standard methods were used to obtain the 5'-dimethoxytrityl-(DMT) and 5'-DMT-3'-phosphoramidite intermediates.

[0121] 2'-Fluorodeoxyguanosine

[0122] The synthesis of 2'-deoxy-2'-fluoroguanosine was accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-beta-D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS group was followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosylguanine. Selective O-deacylation and triflation was followed by treatment of the crude product with fluoride, then deprotection of the THP groups. Standard methodologies were used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites.

[0123] 2'-Fluorouridine

[0124] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by the modification of a literature procedure in which 2,2'-anhydro-1-beta-D-arabinofuranosyluracil was treated with 70% hydrogen fluoride-pyridine. Standard procedures were used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.

[0125] 2'-Fluorodeoxycytidine

[0126] 2'-deoxy-2'-fluorocytidine was synthesized via amination of 2'-deoxy-2'-fluorouridine, followed by selective protection to give N4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.

[0127] 2'-O-(2-Methoxyethyl) Modified Amidites

[0128] 2'-O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.

[0129] 2,2'-Anhydro[1-(beta-D-arabinofuranosyl)-5-methyluridine]

[0130] 5-Methyluridine (ribosylthymine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were added to DMF (300 mL). The mixture was heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethylether (2.5 L), with stirring. The product formed a gum. The ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL). The solution was poured into fresh ether (2.5 L) to yield a stiff gum. The ether was decanted and the gum was dried in a vacuum oven (60.degree. C. at 1 mm Hg for 24 h) to give a solid that was crushed to a light tan powder (57 g, 85% crude yield). The NMR spectrum was consistent with the structure, contaminated with phenol as its sodium salt (ca. 5%). The material was used as is for further reactions (or it can be purified further by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid, mp 222-4.degree. C.).

[0131] 2'-O-Methoxyethyl-5-methyluridine

[0132] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M), tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) were added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160.degree. C. After heating for 48 hours at 155-160.degree. C., the vessel was opened and the solution evaporated to dryness and triturated with MeOH (200 mL). The residue was suspended in hot acetone (1 L). The insoluble salts were filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600 mL) and evaporated. A silica gel column (3 kg) was packed in CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH. The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product was eluted with the packing solvent to give 160 g (63%) of product. Additional material was obtained by reworking impure fractions.

[0133] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine

[0134] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was co-evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the reaction stirred for an additional one hour. Methanol (170 mL) was then added to stop the reaction. HPLC showed the presence of approximately 70% product. The solvent was evaporated and triturated with CH.sub.3CN (200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and extracted with 2.times.500 mL of saturated NaHCO.sub.3 and 2.times.500 mL of saturated NaCl. The organic phase was dried over Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was obtained. The residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/hexane/acetone (5:5:1) containing 0.5% Et.sub.3NH. The pure fractions were evaporated to give 164 g of product. Approximately 20 g additional was obtained from the impure fractions to give a total yield of 183 g (57%).

[0135] 3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine

[0136] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from 562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL, 0.258 M) were combined and stirred at room temperature for 24 hours. The reaction was monitored by TLC by first quenching the TLC sample with the addition of MeOH. Upon completion of the reaction, as judged by TLC, MeOH (50 mL) was added and the mixture evaporated at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL) and extracted with 2.times.200 mL of saturated sodium bicarbonate and 2.times.200 mL of saturated NaCl. The water layers were back extracted with 200 mL of CHCl.sub.3. The combined organics were dried with sodium sulfate and evaporated to give 122 g of residue (approx. 90% product). The residue was purified on a 3.5 kg silica gel column and eluted using EtOAc/hexane(4:1). Pure product fractions were evaporated to yield 96 g (84%). An additional 1.5 g was recovered from later fractions.

[0137] 3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-tria- zoleuridine

[0138] A first solution was prepared by dissolving 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1 L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10.degree. C., and the resulting mixture stirred for an additional 2 hours. The first solution was added dropwise, over a 45 minute period, to the latter solution. The resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were removed by filtration. The filtrate was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.

[0139] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine

[0140] A solution of 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleuri- dine (103 g, 0.141 M) in dioxane (500 mL) and NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The dioxane solution was evaporated and the residue azeotroped with MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH.sub.3 gas was added and the vessel heated to 100.degree. C. for 2 hours (TLC showed complete conversion). The vessel contents were evaporated to dryness and the residue was dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics were dried over sodium sulfate and the solvent was evaporated to give 85 g (95%) of the title compound.

[0141] N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine

[0142] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) was added with stirring. After stirring for 3 hours, TLC showed the reaction to be approximately 95% complete. The solvent was evaporated and the residue azeotroped with MeOH (200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give a residue (96 g). The residue was chromatographed on a 1.5 kg silica column using EtOAc/hexane (1:1) containing 0.5% Et.sub.3NH as the eluting solvent. The pure product fractions were evaporated to give 90 g (90%) of the title compound.

[0143] N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine- -3'-amidite

[0144] N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L). Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete). The reaction mixture was extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated NaCl (3.times.300 mL). The aqueous washes were back-extracted with CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried over MgSO.sub.4 and concentrated. The residue obtained was chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1) as the eluting solvent. The pure fractions were combined to give 90.6 g (87%) of the title compound.

2'-O-(Aminooxyethyl) Nucleoside Amidites and 2'-O-(dimethylaminooxyethyl) Nucleoside Amidites

[0145] 2'-(Dimethylaminooxyethoxy) Nucleoside Amidites

[0146] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.

[0147] 5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine

[0148] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese, Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013 eq, 0.0054 mmol) were dissolved in dry pyridine (500 ml) at ambient temperature under an argon atmosphere and with mechanical stirring. tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458 mmol) was added in one portion. The reaction was stirred for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a complete reaction. The solution was concentrated under reduced pressure to a thick oil. This was partitioned between dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1 L) and brine (1 L). The organic layer was dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil was dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600 mL) and the solution was cooled to -10.degree. C. The resulting crystalline product was collected by filtration, washed with ethyl ether (3.times.200 mL) and dried (40.degree. C., 1 mm Hg, 24 h) to 149 g (74.8%) of white solid. TLC and NMR were consistent with pure product.

[0149] 5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine

[0150] In a 2 L stainless steel, unstirred pressure reactor was added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the fume hood and with manual stirring, ethylene glycol (350 mL, excess) was added cautiously at first until the evolution of hydrogen gas subsided. 5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine (149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) were added with manual stirring. The reactor was sealed and heated in an oil bath until an internal temperature of 160.degree. C. was reached and then maintained for 16 h (pressure <100 psig). The reaction vessel was cooled to ambient and opened. TLC (Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate) indicated about 70% conversion to the product. In order to avoid additional side product formation, the reaction was stopped, concentrated under reduced pressure (10 to 1 mm Hg) in a warm water bath (40-100.degree. C.) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase.] The residue was purified by column chromatography (2 kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate fractions were combined, stripped and dried to product as a white crisp foam (84 g, 50%), contaminated starting material (17.4 g) and pure reusable starting material 20 g. The yield based on starting material less pure recovered starting material was 58%. TLC and NMR were consistent with 99% pure product.

[0151] 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methylurid- ine

[0152] 5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-S-methyluridine (20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g, 44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was then dried over P.sub.2O.sub.5 under high vacuum for two days at 40.degree. C. The reaction mixture was flushed with argon and dry THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop. After the addition was complete, the reaction was stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate:hexane, 60:40). The solvent was evaporated in vacuum. Residue obtained was placed on a flash column and eluted with ethyl acetate:hexane (60:40), to get 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine as white foam (21.819 g, 86%).

5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methylur- idine

[0153] 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methylurid- ine (3.1 g, 4.5 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL) and methylhydrazine (300 mL, 4.64 mmol) was added dropwise at -10.degree. C. to 0.degree. C. After 1 h the mixture was filtered, the filtrate was washed with ice cold CH.sub.2Cl.sub.2 and the combined organic phase was washed with water, brine and dried over anhydrous Na.sub.2SO.sub.4. The solution was concentrated to get 2'-O-(aminooxyethyl) thymidine, which was then dissolved in MeOH (67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1 eq.) was added and the resulting mixture was strirred for 1 h. Solvent was removed under vacuum; residue chromatographed to get 5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methyluri- dine as white foam (1.95 g, 78%).

[0154] 5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-me- thyluridine

[0155] 5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-me- thyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1M pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at 10.degree. C. under inert atmosphere. The reaction mixture was stirred for 10 minutes at 10.degree. C. After that the reaction vessel was removed from the ice bath and stirred at room temperature for 2 h, the reaction monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) was added and extracted with ethyl acetate (2.times.20 mL). Ethyl acetate phase was dried over anhydrous Na.sub.2SO.sub.4, evaporated to dryness. Residue was dissolved in a solution of 1M PPTS in MeOH (30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) was added and the reaction mixture was stirred at room temperature for 10 minutes. Reaction mixture cooled to 10.degree. C. in an ice bath, sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and reaction mixture stirred at 10.degree. C. for 10 minutes. After 10 minutes, the reaction mixture was removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3 (25 mL) solution was added and extracted with ethyl acetate (2.times.25 mL). Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and evaporated to dryness. The residue obtained was purified by flash column chromatography and eluted with 5% MeOH in CH.sub.2Cl.sub.2 to get 5'-O-tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluri- dine as a white foam (14.6 g, 80%).

[0156] 2'-O-(dimethylaminooxyethyl)-5-methyluridine

[0157] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept over KOH). This mixture of triethylamine-2HF was then added to 5'-O-tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluri- dine (1.40 g, 2.4 mmol) and stirred at room temperature for 24 hrs. Reaction was monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Solvent was removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH.sub.2Cl.sub.2 to get 2'-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg, 92.5%).

[0158] 5'-O-DMT-2'-O-(dimethylaminooxyethyl) -5-methyluridine

[0159] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17 mmol) was dried over P.sub.2O.sub.5, under high vacuum overnight at 40.degree. C. It was then co-evaporated with anhydrous pyridine (20 mL). The residue obtained was dissolved in pyridine (11 mL) under argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol), 4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the mixture and the reaction mixture was stirred at room temperature until all of the starting material disappeared. Pyridine was removed under vacuum and the residue chromatographed and eluted with 10% MeOH in CH.sub.2Cl.sub.2 (containing a few drops of pyridine) to get 5'-O-DMT-2'-O-(dimethylamino-oxyethyl)-5-methyluridine (1.13 g, 80%).

[0160] 5'-O-DMT-2'-o-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2- -cyanoethyl)-N,N-diisopropylphosphoramidite]

[0161] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08 g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) was added and dried over P.sub.2O.sub.5 under high vacuum overnight at 40.degree. C. Then the reaction mixture was dissolved in anhydrous acetonitrile (8.4 mL) and 2-cyanoethyl-N,N,N.sup.1,N.sup.1-tetraisopropylphosphoramidite (2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction was monitored by TLC (hexane:ethyl acetate 1:1). The solvent was evaporated, then the residue was dissolved in ethyl acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL). Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated. Residue obtained was chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoe- thyl)-N,N-diisopropylphosphoramidite] as a foam (1.04 g, 74.9%).

[0162] 2'-(Aminooxyethoxy) Nucleoside Amidites

[0163] 2'-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.

[0164] N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4- '-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramid- ite]

[0165] The 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-O-alkylation of diaminopurine riboside. Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer. 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2'-O-(2-ethylacetyl)guanosine by treatment with adenosine deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C. J., WO 94/02501 A1 1994 Feb. 3.) Standard protection procedures should afford 2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime- thoxytrityl)guanosine which may be reduced to provide 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime- thoxytrityl)guanosine. As before the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime- thoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite].

2'-dimethylaminoethoxyethoxy (2'-DMAOE) Nucleoside Amidites

[0166] 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, or 2'-DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.

2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl Uridine

[0167] 2[2-(Dimethylamino)ethoxy]ethanol (Aldrich, 6.66 g, 50 mmol) is slowly added to a solution of borane in tetra-hydrofuran (1 M, 10 mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas evolves as the solid dissolves. O.sup.2-,2'-anhydro-5-methyluridine (1.2 g, 5 mmol), and sodium bicarbonate (2.5 mg) are added and the bomb is sealed, placed in an oil bath and heated to 155.degree. C. for 26 hours. The bomb is cooled to room temperature and opened. The crude solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL). The excess phenol is extracted into the hexane layer. The aqueous layer is extracted with ethyl acetate (3.times.200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue is columned on silica gel using methanol/methylene chloride 1:20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.

5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methyl Uridine

[0168] To 0.5 g (1.3 mmol) of 2'-O-[2(2-N,N-dimethylamino-ethoxy)ethyl)]-5-methyl uridine in anhydrous pyridine (8 mL), triethylamine (0.36 mL) and dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 eq.) are added and stirred for 1 hour. The reaction mixture is poured into water (200 mL) and extracted with CH.sub.2Cl.sub.2 (2.times.200 mL). The combined CH.sub.2Cl.sub.2 layers are washed with saturated NaHCO.sub.3 solution, followed by saturated NaCl solution and dried over anhydrous sodium sulfate. Evaporation of the solvent followed by silica gel chromatography using MeOH:CH.sub.2Cl.sub.2:Et.sub.3N (20:1, v/v, with 1% triethylamine) gives the title compound.

[0169] 5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-m- ethyl Uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite

[0170] Diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxy-N,N-diisopropyl phosphoramidite (1.1 mL, 2 eq.) are added to a solution of 5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methylur- idine (2.17 g, 3 mmol) dissolved in CH.sub.2Cl.sub.2 (20 mL) under an atmosphere of argon. The reaction mixture is stirred overnight and the solvent evaporated. The resulting residue is purified by silica gel flash column chromatography with ethyl acetate as the eluent to give the title compound.

Example 2

Oligonucleotide Synthesis

[0171] Unsubstituted and substituted phosphodiester (P.dbd.O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine.

[0172] Phosphorothioates (P.dbd.S) are synthesized as for the phosphodiester oligonucleotides except the standard oxidation bottle was replaced by 0.2 M solution of 3H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the stepwise thiation of the phosphite linkages. The thiation wait step was increased to 68 sec and was followed by the capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55.degree. C. (18 h), the oligonucleotides were purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.

[0173] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863, herein incorporated by reference.

[0174] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050, herein incorporated by reference.

[0175] Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein incorporated by reference.

[0176] Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.

[0177] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925, herein incorporated by reference.

[0178] Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243, herein incorporated by reference.

[0179] Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated by reference.

Example 3

Oligonucleoside Synthesis

[0180] Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedi-methylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P.dbd.O or P.dbd.S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by reference.

[0181] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564, herein incorporated by reference.

[0182] Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618, herein incorporated by reference.

Example 4

PNA Synthesis

[0183] Peptide nucleic acids (PNAs) are prepared in accordance with any of the various procedures referred to in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and 5,719,262, herein incorporated by reference.

Example 5

Synthesis of Chimeric Oligonucleotides

[0184] Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end" type wherein the "gap" segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers".

[0185] [2'-O-Me]--[2'-deoxy]--[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides

[0186] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2'-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 380B, as above. Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for 5' and 3' wings. The standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3:1 ammonia/ethanol at room temperature overnight then lyophilized to dryness. Treatment in methanolic ammonia for 24 hrs at room temperature is then done to deprotect all bases and sample was again lyophilized to dryness. The pellet is resuspended in 1M TBAF in THF for 24 hrs at room temperature to deprotect the 2' positions. The reaction is then quenched with 1M TEAA and the sample is then reduced to 1/2 volume by rotovac before being desalted on a G25 size exclusion column. The oligo recovered is then analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.

[0187] [2'-O-(2-Methoxyethyl)]--[2'-deoxy]--[2'-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides

[0188] [2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites.

[0189] [2'-O-(2-Methoxyethyl)Phosphodiester]--[2'-deoxy Phosphorothioate]--[2'-O-(2-Methoxyethyl) Phosphodiester] Chimeric Oligonucleotides

[0190] [2'-O-(2-methoxyethyl phosphodiester]--[2'-deoxy phosphorothioate]--[2'-O-(methoxyethyl)phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites, oxidization with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.

[0191] Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.

Example 6

Oligonucleotide Isolation

[0192] After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55.degree. C. for 18 hours, the oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis were periodically checked by .sup.31P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.

Example 7

Oligonucleotide Synthesis--96 Well Plate Format

[0193] Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format. Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.

[0194] Oligonucleotides were cleaved from support and deprotected with concentrated NH.sub.4OH at elevated temperature (55-60.degree. C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.

Example 8

Oligonucleotide Analysis--96 Well Plate Format

[0195] The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.

Example 9

Cell Culture and Oligonucleotide Treatment

[0196] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 5 cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR.

T-24 Cells:

[0197] The human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.

[0198] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.

A549 Cells:

[0199] The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells were routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.

NHDF Cells:

[0200] Human neonatal dermal fibroblast (NHDF) were obtained from the Clonetics Corporation (Walkersville Md.). NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville Md.) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.

HEK Cells:

[0201] Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville Md.). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville Md.) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier.

3T3-L1 Cells:

[0202] The mouse embryonic adipocyte-like cell line 3T3-L1 was obtained from the American Type Culure Collection (Manassas, Va.). 3T3-L1 cells were routinely cultured in DMEM, high glucose (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 80% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 4000 cells/well for use in RT-PCR analysis.

[0203] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.

Treatment with Antisense Compounds:

[0204] When cells reached 80% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 200 .mu.L OPTI-MEM.TM.-1 reduced-serum medium (Gibco BRL) and then treated with 130 .mu.L of OPTI-MEM.TM.-1 containing 3.75 .mu.g/mL LIPOFECTIN.TM. (Gibco BRL) and the desired concentration of oligonucleotide. After 4-7 hours of treatment, the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.

[0205] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1, a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to human H-ras. For mouse or rat cells the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf. The concentration of positive control oligonucleotide that results in 80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of H-ras or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments.

Example 10

Analysis of Oligonucleotide Inhibition of C/EBP Beta Expression

[0206] Antisense modulation of C/EBP beta expression can be assayed in a variety of ways known in the art. For example, C/EBP beta mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM.TM. 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions. Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed as multiplexable. Other methods of PCR are also known in the art.

[0207] Protein levels of C/EBP beta can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to C/EBP beta can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.

[0208] Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.

Example 11

Poly(A)+ mRNA Isolation

[0209] Poly(A)+ mRNA was isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 .mu.L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70.degree. C. was added to each well, the plate was incubated on a 90.degree. C. hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.

[0210] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.

Example 12

Total RNA Isolation

[0211] Total mRNA was isolated using an RNEASY 96.TM. kit and buffers purchased from Qiagen Inc. (Valencia Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 .mu.L cold PBS. 100 .mu.L Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 100 .mu.L of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY 96.TM. well plate attached to a QIAVAC.TM. manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 15 seconds. 1 mL of Buffer RW1 was added to each well of the RNEASY 96.TM. plate and the vacuum again applied for 15 seconds. 1 mL of Buffer RPE was then added to each well of the RNEASY 96.TM. plate and the vacuum applied for a period of 15 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 10 minutes. The plate was then removed from the QIAVAC.TM. manifold and blotted dry on paper towels. The plate was then re-attached to the QIAVAC.TM. manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 60 .mu.L water into each well, incubating 1 minute, and then applying the vacuum for 30 seconds. The elution step was repeated with an additional 60 .mu.L water.

[0212] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.

Example 13

Real-Time Quantitative PCR Analysis of C/EBP Beta mRNA Levels

[0213] Quantitation of C/EBP beta mRNA levels was determined by real-time quantitative PCR using the ABI PRISM.TM. 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., JOE, FAM, or VIC, obtained from either Operon Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM.TM. 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.

[0214] PCR reagents were obtained from PE-Applied Biosystems, Foster City, Calif. RT-PCR reactions were carried out by adding 25 .mu.L PCR cocktail (1.times. TAQMAN.TM. buffer A, 5.5 mM MgCl.sub.2, 300 .mu.M each of dATP, dCTP and dGTP, 600 .mu.M of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD.TM., and 12.5 Units MuLV reverse transcriptase) to 96 well plates containing 25 .mu.L poly(A) mRNA solution. The RT reaction was carried out by incubation for 30 minutes at 48.degree. C. Following a 10 minute incubation at 95.degree. C. to activate the AMPLITAQ GOLD.TM., 40 cycles of a two-step PCR protocol were carried out: 95.degree. C. for 15 seconds (denaturation) followed by 60.degree. C. for 1.5 minutes (annealing/extension).

[0215] Probes and primers to human C/EBP beta were designed to hybridize to a human C/EBP beta sequence, using published sequence information (GenBank accession number X52560, incorporated herein as SEQ ID NO:3). For human C/EBP beta the PCR primers were: TABLE-US-00001 (SEQ ID NO: 4) forward primer: GCAACCCACGTGTAACTGTCA (SEQ ID NO: 5) reverse primer: TCAACAGCAACAAGCCCTAGAA and

the PCR probe was: FAM-CCGGGCCCTGAGTAATCGCTTAAAGAT-TAMRA (SEQ ID NO: 6) where FAM (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye. For human GAPDH the PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9) where JOE (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.

[0216] Probes and primers to mouse C/EBP beta were designed to hybridize to a mouse C/EBP beta sequence, using published sequence information (GenBank accession number X62600, incorporated herein as SEQ ID NO:10). For mouse C/EBP beta the PCR primers were: TABLE-US-00002 (SEQ ID NO:11) forward primer: CGGATCAAACGTGGCTGA (SEQ ID NO:12) reverse primer: CGCAGGAACATCTTTAAGGTGATT

[0217] and the PCR probe was: FAM-ACGTGTAACTGTCTAGCCGGGCCCTG-TAMRA (SEQ ID NO: 13) where FAM (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye. For mouse GAPDH the PCR primers were: TABLE-US-00003 (SEQ ID NO: 14) forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 15) reverse primer: GGGTCTCGCTCCTGGAAGCT and

the PCR probe was: 5'JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3' (SEQ ID NO: 16) where JOE (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.

Example 14

Northern Blot Analysis of C/EBP Beta mRNA Levels

[0218] Eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM. (TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST "B" Inc., Friendswood, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER.TM. UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then robed using QUICKHYB.TM. hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions.

[0219] To detect human C/EBP beta, a human C/EBP beta specific probe was prepared by PCR using the forward primer GCAACCCACGTGTAACTGTCA (SEQ ID NO: 4) and the reverse primer TCAACAGCAACAAGCCCTAGAA (SEQ ID NO: 5). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).

[0220] To detect mouse C/EBP beta, a mouse C/EBP beta specific probe was prepared by PCR using the forward primer CGGATCAAACGTGGCTGA (SEQ ID NO:11) and the reverse primer CGCAGGAACATCTTTAAGGTGATT (SEQ ID NO: 12). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).

[0221] Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.

Example 15

Antisense Inhibition of Human C/EBP Beta Eexpression by Chimeric Phosphorothioate Oligonucleotides having 2'-MOE Wings and a Deoxy Gap

[0222] In accordance with the present invention, a series of oligonucleotides were designed to target different regions of the human C/EBP beta RNA, using published sequences (GenBank accession number X52560, incorporated herein as SEQ ID NO: 3, and GenBank accession number AI567596, the complement of which is incorporated herein as SEQ ID NO: 17). The oligonucleotides are shown in Table 1. "Target site" indicates the first (5'-most) nucleotide number on the particular target sequence to which the oligonucleotide binds. All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-methoxyethyl (2'-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P.dbd.S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on human C/EBP beta mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from two experiments. If present, "N.D." indicates "no data". TABLE-US-00004 TABLE 1 Inhibition of human C/EBP beta mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap TARGET TARGET % SEQ ID ISIS # REGION SEQ ID NO SITE SEQUENCE INHIB NO 116442 5'UTR 3 178 ctgctgccgccgctgccggg 63 18 116443 5'UTR 3 203 agctgtcgccgctgcgtcgc 0 19 116444 5'UTR 3 234 cggcccgcaggtgcgcggcc 16 20 116445 Start 3 290 aggcgttgcatgaacgcggg 0 21 Codon 116446 Coding 3 366 gaagttggccacttccatgg 0 22 116447 Coding 3 370 agtagaagttggccacttcc 0 23 116448 Coding 3 375 ctcgtagtagaagttggcca 11 24 116449 Coding 3 394 cagcagccaagcagtccgcc 40 25 116450 Coding 3 399 gtacgcagcagccaagcagt 0 26 116451 Coding 3 488 tcgtggtcgccgatgctgcc 8 27 116452 Coding 3 626 tcgtggtgctgcccggagga 49 28 116453 Coding 3 637 cggagaggaagtcgtggtgc 17 29 116454 Coding 3 642 gaggtcggagaggaagtcgt 0 30 116455 Coding 3 664 tgcccccgtagtcgtcggag 50 31 116456 Coding 3 680 ggcttcttgcagttcttgcc 0 32 116457 Coding 3 681 cggcttcttgcagttcttgc 23 33 116458 Coding 3 685 cggccggcttcttgcagttc 50 34 116459 Coding 3 698 acgtagccgtactcggccgg 0 35 116460 Coding 3 708 ccccaggctcacgtagccgt 59 36 116461 Coding 3 791 gcgggcggcggcggcggcgg 0 37 116462 Coding 3 805 ccgccttgagctcggcgggc 18 38 116463 Coding 3 814 agcccggctccgccttgagc 15 39 116464 Coding 3 818 tcgaagcccggctccgcctt 31 40 116465 Coding 3 867 gccgccgcccggcgccccgg 34 41 116466 Coding 3 878 gccatgcctgcgccgccgcc 60 42 116467 Coding 3 890 gggaagcccgccgccatgcc 4 43 116468 Coding 3 900 cagcgcgtacgggaagcccg 0 44 116469 Coding 3 910 ggtaagcgcgcagcgcgtac 45 45 116470 Coding 3 912 gaggtaagcgcgcagcgcgt 27 46 116471 Coding 3 920 tggtagccgaggtaagcgcg 0 47 116472 Coding 3 922 cctggtagccgaggtaagcg 0 48 116473 Coding 3 924 cgcctggtagccgaggtaag 0 49 116474 Coding 3 925 ccgcctggtagccgaggtaa 64 50 116475 Coding 3 937 tgccgctcggcaccgcctgg 10 51 116476 Coding 3 960 ggacgtggagaggctcccgc 24 52 116477 Coding 3 976 gcgggctggacgaggaggac 0 53 116478 Coding 3 1053 ctgcgagggcgccggcccgg 40 54 116479 Coding 3 1127 atgttgttgcgctcgcgccg 52 55 116480 Coding 3 1169 aggttgcgcatcttggcctt 0 56 116481 Coding 3 1174 tctccaggttgcgcatcttg 49 57 116482 Coding 3 1187 accttgtgctgcgtctccag 43 58 116483 Coding 3 1223 ttctgcagccgctcgttctc 39 59 116484 Coding 3 1228 ccttcttctgcagccgctcg 47 60 116485 Coding 3 1233 ctccaccttcttctgcagcc 32 61 116486 Coding 3 1238 agctgctccaccttcttctg 49 62 116487 Coding 3 1243 gcgacagctgctccaccttc 57 63 116488 Coding 3 1253 ctgagctcgcgcgacagctg 63 64 116489 Coding 3 1265 ttccgcagggtgctgagctc 27 65 116490 Coding 3 1270 acaagttccgcagggtgctg 54 66 116491 Coding 3 1275 cttgaacaagttccgcaggg 12 67 116492 Coding 3 1280 agctgcttgaacaagttccg 26 68 116493 Coding 3 1285 cgggcagctgcttgaacaag 42 69 116494 Stop 3 1321 cgcgctagcagtggccggag 59 70 codon 116495 Stop 3 1325 gggccgcgctagcagtggcc 56 71 codon 116496 3'UTR 3 1366 ccggagtctcagccccggcc 57 72 116497 3'UTR 3 1367 cccggagtctcagccccggc 43 73 116498 3'UTR 3 1375 gggcgctccccggagtctca 0 74 116499 3'UTR 3 1470 ataaaatattaaaattaccg 23 75 116500 3'UTR 3 1499 ggttggcaaaatatagatat 0 76 116501 3'UTR 3 1509 atgtacggttggttggcaaa 0 77 116502 3'UTR 3 1544 ttcttctttatacaccacgg 19 78 116503 3'UTR 3 1570 tatcattcatctgtacacat 47 79 116504 3'UTR 3 1624 gaaaccggccccgcccgccg 0 80 116505 3'UTR 3 1642 accgattgcatcaacttcga 71 81 116506 3'UTR 3 1662 acgcgttcagccatgtttaa 50 82 116507 3'UTR 3 1685 ggttgcgtcagtcccgtgta 77 83 116508 3'UTR 3 1711 cagggcccggctgacagtta 82 84 116509 3'UTR 3 1727 tctttaagcgattactcagg 51 85 116510 3'UTR 3 1749 aacagcaacaagccctagaa 57 86 116511 3'UTR 3 1758 caaaacatcaacagcaacaa 37 87 116512 3'UTR 3 1821 tcttttctcatagaaataga 42 88 116513 3'UTR 3 1826 acgcctcttttctcatagaa 58 89 116514 3'UTR 3 1827 gacgcctcttttctcataga 52 90 116515 3'UTR 3 1854 aaacggaaaagattcccaaa 35 91 116516 3'UTR 3 1869 gttcttaattgcttgaaacg 19 92 116517 3'UTR 3 1887 aaaaagtttattaaaagtgt 8 93 116518 3'UTR 17 143 cccaaaaggctttgtaacca 13 94 116519 3'UTR 17 148 ctgcccccaaaaggctttgt 14 95

[0223] As shown in Table 1, SEQ ID NOs 18, 25, 28, 31, 33, 34, 36, 40, 41, 42, 45, 46, 50, 52, 54, 55, 57, 58, 59, 60, 61, 62, 63, 63, 64, 65, 66, 68, 69, 70, 71, 72, 73, 75, 79, 81, 82, 83, 84, 85, 86, 87, 88, 89, 89, 90 and 91 demonstrated at least 20% inhibition of human C/EBP beta expression in this assay and are therefore preferred.

Example 17

Antisense Inhibition of Mouse C/EBP Beta Expression by Chimeric Phosphorothioate Oligonucleotides having 2'-MOE Wings and a Deoxy Gap

[0224] In accordance with the present invention, a second series of oligonucleotides were designed to target different regions of the mouse C/EBP beta RNA, using published sequences (GenBank accession number X62600, incorporated herein as SEQ ID NO: 10). The oligonucleotides are shown in Table 2. "Target site" indicates the first (5'-most) nucleotide number on the particular target sequence to which the oligonucleotide binds. All compounds in Table 2 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-methoxyethyl (2'-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P.dbd.S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on mouse C/EBP beta mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from two experiments. If present, "N.D." indicates "no data". TABLE-US-00005 TABLE 2 Inhibition of mouse C/EBP beta mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap TARGET TARGET % SEQ ID ISIS # REGION SEQ ID NO SITE SEQUENCE INHIB NO 116487 Coding 10 905 gcgacagctgctccaccttc 46 63 116513 3'UTR 10 1395 acgcctcttttctcatagaa 46 89 120605 5'UTR 10 6 tataaggcggcgcctggcaa 0 96 120606 5'UTR 10 10 ggtttataaggcggcgcctg 2 97 120607 5'UTR 10 18 gagcgggaggtttataaggc 0 98 120608 5'UTR 10 23 cggccgagcgggaggtttat 7 99 120609 5'UTR 10 42 ctcggactcggcgcggcggc 33 100 116520 5'UTR 10 56 ggtcccgtgcgcggctcgga 0 101 120610 5'UTR 10 62 cgtcccggtcccgtgcgcgg 41 102 116521 5'UTR 10 71 gctccgctgcgtcccggtcc 0 103 116522 Start 10 99 aggcggtgcatgaacgcggg 0 104 Codon 120611 Start 10 105 gccagcaggcggtgcatgaa 43 105 Codon 120612 Start 10 109 ccaggccagcaggcggtgca 41 106 Codon 116523 Coding 10 118 tgctgcgtcccaggccagca 0 107 120613 Coding 10 126 gggaggcatgctgcgtccca 11 108 116524 Coding 10 145 aaaggcggcgggcggcggcg 18 109 116525 Coding 10 156 tccatgggtctaaaggcggc 0 110 116526 Coding 10 161 ccacttccatgggtctaaag 13 111 116527 Coding 10 171 tagaagttggccacttccat 13 112 116528 Coding 10 176 cgtagtagaagttggccact 0 113 120614 Coding 10 184 gtcgggctcgtagtagaagt 21 114 116529 Coding 10 194 aggccaggcagtcgggctcg 0 115 116530 Coding 10 210 gccgccttggccccgtaggc 0 116 116531 Coding 10 222 ggcgcggcgcgggccgcctt 0 117 120615 Coding 10 251 caatggccggctcggcggcg 17 118 116532 Coding 10 257 gctcgccaatggccggctcg 0 119 120616 Coding 10 264 cgctcgtgctcgccaatggc 40 120 120617 Coding 10 270 atggcgcgctcgtgctcgcc 31 121 116533 Coding 10 303 ggcgcgagcggctccaggta 1 122 116534 Coding 10 328 cgcgggcgcggcgaagtccg 2 123 116535 Coding 10 355 gtcggagaggaagtcgtggt 3 124 116536 Coding 10 360 aagaggtcggagaggaagtc 9 125 120618 Coding 10 378 gcgccgtagtcgtcggcgaa 14 126 120619 Coding 10 382 cttggcgccgtagtcgtcgg 26 127 120620 Coding 10 386 tcggcttggcgccgtagtcg 25 128 116537 Coding 10 392 tcttgctcggcttggcgccg 0 129 116538 Coding 10 405 tagtcggccggcttcttgct 28 130 120621 Coding 10 412 gtaaccgtagtcggccggct 20 131 120622 Coding 10 417 ctcacgtaaccgtagtcggc 28 132 120623 Coding 10 424 gccgaggctcacgtaaccgt 21 133 116539 Coding 10 430 cgcgcggccgaggctcacgt 0 134 116540 Coding 10 449 gcggcgcggccttggcgccc 0 135 116541 Coding 10 491 ccgccttgagcgccgcggga 0 136 116542 Coding 10 502 gaagcccggctccgccttga 0 137 120624 Coding 10 510 gcgggttcgaagcccggctc 37 138 120625 Coding 10 514 gtccgcgggttcgaagcccg 27 139 120626 Coding 10 517 gcagtccgcgggttcgaagc 4 140 120627 Coding 10 520 cttgcagtccgcgggttcga 18 141 120628 Coding 10 523 gcgcttgcagtccgcgggtt 31 142 120629 Coding 10 531 tcgtccgcgcgcttgcagtc 1 143 120630 Coding 10 532 gtcgtccgcgcgcttgcagt 14 144 120631 Coding 10 545 ccatggcgggcgcgtcgtcc 0 145 120632 Coding 10 555 aaaccggccgccatggcggg 44 146 120633 Coding 10 561 aacgggaaaccggccgccat 32 147 116543 Coding 10 586 gtagcccaggtaggcgcgca 0 148 120634 Coding 10 592 cgcctggtagcccaggtagg 19 149 120635 Coding 10 595 cgtcgcctggtagcccaggt 23 150 116544 Coding 10 604 gccgctcggcgtcgcctggt 0 151 116545 Coding 10 616 gctgccgctgctgccgctcg 0 152 120636 Coding 10 622 ggacaggctgccgctgctgc 25 153 120637 Coding 10 630 gacgacgtggacaggctgcc 36 154 116546 Coding 10 637 ggacgacgacgacgtggaca 0 155 116547 Coding 10 639 ctggacgacgacgacgtgga 0 156 116548 Coding 10 686 cggcgggcgcggccttggcg 0 157 120638 Coding 10 704 gcggccccgcgaagcaggcg 34 158 120639 Coding 10 710 cggccggcggccccgcgaag 0 159 116549 Coding 10 718 ggcgggcgcggccggcggcc 0 160 116550 Coding 10 722 ccttggcgggcgcggccggc 0 161 116551 Coding 10 727 cttggccttggcgggcgcgg 17 162 116552 Coding 10 744 tccaccgtcttcttggcctt 0 163 116553 Coding 10 745 gtccaccgtcttcttggcct 45 164 116554 Coding 10 753 ctcagcttgtccaccgtctt 36 165 120640 Coding 10 762 tactcgtcgctcagcttgtc 43 166 120641 Coding 10 767 tcttgtactcgtcgctcagc 57 167 116555 Coding 10 778 ctcgcgccgcatcttgtact 0 168 116556 Coding 10 802 cttgcgcaccgcgatgttgt 0 169 116557 Coding 10 818 tggccttgtcgcggctcttg 16 170 116558 Coding 10 834 tccaggttgcgcatcttggc 17 171 116559 Coding 10 838 cgtctccaggttgcgcatct 14 172 116560 Coding 10 856 ctccagcaccttgtgctgcg 0 173 116561 Coding 10 864 gccgtcagctccagcacctt 11 174 120642 Coding 10 870 ttctccgccgtcagctccag 39 175 120643 Coding 10 879 agccgctcgttctccgccgt 41 176 116562 Coding 10 887 tcttctgcagccgctcgttc 0 177 116563 Coding 10 893 ccaccttcttctgcagccgc 18 178 116564 Coding 10 897 tgctccaccttcttctgcag 48 179 116565 Coding 10 902 acagctgctccaccttcttc 18 180 120644 Coding 10 912 agctctcgcgacagctgctc 29 182 116566 Coding 10 919 ggtgctgagctctcgcgaca 0 183 116567 Coding 10 929 agttccgcagggtgctgagc 11 184 116568 Coding 10 934 gaacaagttccgcagggtgc 0 185 116569 Coding 10 939 tgcttgaacaagttccgcag 0 186 116570 Coding 10 945 ggcagctgcttgaacaagtt 0 187 116571 Coding 10 950 gctcgggcagctgcttgaac 0 188 120645 Coding 10 956 gcagcggctcgggcagctgc 12 189 116572 Coding 10 963 gaggccagcagcggctcggg 16 190 116573 Coding 10 966 gccgaggccagcagcggctc 0 191 116574 Coding 10 972 tggcccgccgaggccagcag 0 192 116575 Coding 10 977 agcagtggcccgccgaggcc 11 193 116576 Stop 10 980 gctagcagtggcccgccgag 0 194 Codon 116577 Stop 10 988 cgcgccgcgctagcagtggc 0 195 Codon 116578 Stop 10 994 cgccaccgcgccgcgctagc 0 196 Codon 120646 3'UTR 10 1018 gcacggtggccgcggcgccc 0 197 116579 3'UTR 10 1074 agggcacgcacggtggtccg 19 198 116580 3'UTR 10 1083 ggtgcgcgcagggcacgcac 0 199 116581 3'UTR 10 1088 gtgcaggtgcgcgcagggca 0 200 116582 3'UTR 10 1092 gcaggtgcaggtgcgcgcag 0 201 120647 3'UTR 10 1099 cctcggtgcaggtgcaggtg 41 202 120648 3'UTR 10 1103 gtcccctcggtgcaggtgca 37 203 116583 3'UTR 10 1109 cgcggtgtcccctcggtgca 8 204

116584 3'UTR 10 1119 gcggtgtgcccgcggtgtcc 10 205 120649 3'UTR 10 1127 gcgtgcccgcggtgtgcccg 35 206 120650 3'UTR 10 1139 tgcgtgcgccgcgcgtgccc 0 207 120651 3'UTR 10 1149 gctgtgcaggtgcgtgcgcc 17 208 120652 3'UTR 10 1158 acccggtgcgctgtgcaggt 32 209 120653 3'UTR 10 1163 ccgaaacccggtgcgctgtg 51 210 120654 3'UTR 10 1168 aagtcccgaaacccggtgcg 26 211 116585 3'UTR 10 1174 tgcatcaagtcccgaaaccc 6 212 116586 3'UTR 10 1182 atccggattgcatcaagtcc 0 213 120655 3'UTR 10 1188 cgtttgatccggattgcatc 47 214 120656 3'UTR 10 1192 gccacgtttgatccggattg 19 215 120657 3'UTR 10 1197 gctcagccacgtttgatccg 73 216 120658 3'UTR 10 1202 cacgcgctcagccacgtttg 57 217 120659 3'UTR 10 1218 cgtagtcccgtgtccacacg 42 218 120660 3'UTR 10 1223 tgttgcgtagtcccgtgtcc 36 219 116587 3'UTR 10 1232 ttacacgtgtgttgcgtagt 8 220 120661 3'UTR 10 1240 ctagacagttacacgtgtgt 43 221 120662 3'UTR 10 1243 cggctagacagttacacgtg 42 222 116588 3'UTR 10 1257 gattactcagggcccggcta 0 223 116589 3'UTR 10 1264 ttaaggtgattactcagggc 0 224 120663 3'UTR 10 1271 aacatctttaaggtgattac 7 225 116590 3'UTR 10 1278 ccgcaggaacatctttaagg 10 226 116591 3'UTR 10 1292 aaacatcaacaaccccgcag 3 227 116592 3'UTR 10 1309 aacaaaaacaaaaccaaaaa 0 228 120664 3'UTR 10 1369 cttttttatataatacaaaa 7 229 120665 3'UTR 10 1376 aatagaacttttttatataa 8 230 116593 3'UTR 10 1385 tctcatagaaatagaacttt 3 231 116594 3'UTR 10 1393 gcctcttttctcatagaaat 39 232 120666 3'UTR 10 1405 aaatatacatacgcctcttt 3 234 120667 3'UTR 10 1417 gaaaaggttctcaaatatac 0 235 120668 3'UTR 10 1426 ctcgaaacggaaaaggttct 26 236 120669 3'UTR 10 1430 aatgctcgaaacggaaaagg 38 237 120670 3'UTR 10 1434 ctttaatgctcgaaacggaa 33 238 120671 3'UTR 10 1437 tcactttaatgctcgaaacg 46 239 120672 3'UTR 10 1442 tgtcttcactttaatgctcg 48 240 116595 3'UTR 10 1448 ttaaaatgtcttcactttaa 4 241 116596 3'UTR 10 1458 aaaaagtttattaaaatgtc 0 242 120673 3'UTR 10 1465 tctcccaaaaaagtttatta 0 243 116597 3'UTR 10 1476 cttttaaacattctcccaaa 0 244

[0225] As shown in Table 2, SEQ ID NOs 63, 89, 100, 102, 105, 106, 114, 120, 121, 127, 128, 130, 132, 133, 138, 139, 142, 146, 147, 150, 153, 154, 158, 164, 165, 166, 167, 175, 176, 179, 182, 202, 203, 206, 209, 210, 211, 214, 216, 217, 218, 219, 221, 222, 232, 236, 237, 238, 239 and 240 demonstrated at least 20% inhibition of mouse C/EBP beta expression in this experiment and are therefore preferred.

Example 18

Western Blot Analysis of C/EBP Beta Protein Levels

[0226] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to C/EBP beta is used, with a radiolabelled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).

Sequence CWU 0

0

SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 244 <210> SEQ ID NO 1 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 1 tccgtcatcg ctcctcaggg 20 <210> SEQ ID NO 2 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 2 atgcattctg cccccaagga 20 <210> SEQ ID NO 3 <211> LENGTH: 1910 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <223> OTHER INFORMATION: <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 1415 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 1421 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 1422 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 1423 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 1424 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 1458 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (299)...(1336) <400> SEQUENCE: 3 gtccttcgcg tcccggcggc gcggcggagg ggccggcgtg acgcagcggt tgctacgggc 60 cgcccttata aataaccggg ctcaggagaa actttagcga gtcagagccg cgcacgggac 120 tgggaagggg acccacccga gggtccagcc accagccccc tcactaatag cggccacccc 180 ggcagcggcg gcagcagcag cagcgacgca gcggcgacag ctcagagcag ggaggccgcg 240 cacctgcggg ccggccggag cgggcagccc caggccccct ccccgggcac ccgcgttc 298 atg caa cgc ctg gtg gcc tgg gac cca gca tgt ctc ccc ctg ccg ccg 346 Met Gln Arg Leu Val Ala Trp Asp Pro Ala Cys Leu Pro Leu Pro Pro 1 5 10 15 ccg ccg cct gcc ttt aaa tcc atg gaa gtg gcc aac ttc tac tac gag 394 Pro Pro Pro Ala Phe Lys Ser Met Glu Val Ala Asn Phe Tyr Tyr Glu 20 25 30 gcg gac tgc ttg gct gct gcg tac ggc ggc aag gcg gcc ccc gcg gcg 442 Ala Asp Cys Leu Ala Ala Ala Tyr Gly Gly Lys Ala Ala Pro Ala Ala 35 40 45 ccc ccc gcg gcc aga ccc ggg ccg cgc ccc ccc gcc ggc gag ctg ggc 490 Pro Pro Ala Ala Arg Pro Gly Pro Arg Pro Pro Ala Gly Glu Leu Gly 50 55 60 agc atc ggc gac cac gag cgc gcc atc gac ttc agc ccg tac ctg gag 538 Ser Ile Gly Asp His Glu Arg Ala Ile Asp Phe Ser Pro Tyr Leu Glu 65 70 75 80 ccg ctg ggc gcg ccg cag gcc ccg gcg ccc gcc acg gcc acg gac acc 586 Pro Leu Gly Ala Pro Gln Ala Pro Ala Pro Ala Thr Ala Thr Asp Thr 85 90 95 ttc gag gcg gct ccg ccc gcg ccc gcc ccc gcg ccc gcc tcc tcc ggg 634 Phe Glu Ala Ala Pro Pro Ala Pro Ala Pro Ala Pro Ala Ser Ser Gly 100 105 110 cag cac cac gac ttc ctc tcc gac ctc ttc tcc gac gac tac ggg ggc 682 Gln His His Asp Phe Leu Ser Asp Leu Phe Ser Asp Asp Tyr Gly Gly 115 120 125 aag aac tgc aag aag ccg gcc gag tac ggc tac gtg agc ctg ggg cgc 730 Lys Asn Cys Lys Lys Pro Ala Glu Tyr Gly Tyr Val Ser Leu Gly Arg 130 135 140 ctg ggg gct gcc aag ggc gcg ctg cac ccc ggc tgc ttc gcg ccc ctg 778 Leu Gly Ala Ala Lys Gly Ala Leu His Pro Gly Cys Phe Ala Pro Leu 145 150 155 160 cac cca ccg ccc ccg ccg ccg ccg ccg ccc gcc gag ctc aag gcg gag 826 His Pro Pro Pro Pro Pro Pro Pro Pro Pro Ala Glu Leu Lys Ala Glu 165 170 175 ccg ggc ttc gag ccc gcg gac tgc aag cgg aag gag gag gcc ggg gcg 874 Pro Gly Phe Glu Pro Ala Asp Cys Lys Arg Lys Glu Glu Ala Gly Ala 180 185 190 ccg ggc ggc ggc gca ggc atg gcg gcg ggc ttc ccg tac gcg ctg cgc 922 Pro Gly Gly Gly Ala Gly Met Ala Ala Gly Phe Pro Tyr Ala Leu Arg 195 200 205 gct tac ctc ggc tac cag gcg gtg ccg agc ggc agc agc ggg agc ctc 970 Ala Tyr Leu Gly Tyr Gln Ala Val Pro Ser Gly Ser Ser Gly Ser Leu 210 215 220 tcc acg tcc tcc tcg tcc agc ccg ccc ggc acg ccg agc ccc gct gac 1018 Ser Thr Ser Ser Ser Ser Ser Pro Pro Gly Thr Pro Ser Pro Ala Asp 225 230 235 240 gcc aag gcc ccc ccg acc gcc tgc tac gcg ggg gcc ggg ccg gcg ccc 1066 Ala Lys Ala Pro Pro Thr Ala Cys Tyr Ala Gly Ala Gly Pro Ala Pro 245 250 255 tcg cag gtc aag agc aag gcc aag aag acc gtg gac aag cac agc gac 1114 Ser Gln Val Lys Ser Lys Ala Lys Lys Thr Val Asp Lys His Ser Asp 260 265 270 gag tac aag atc cgg cgc gag cgc aac aac atc gcc gtg cgc aag agc 1162 Glu Tyr Lys Ile Arg Arg Glu Arg Asn Asn Ile Ala Val Arg Lys Ser 275 280 285 cgc gac aag gcc aag atg cgc aac ctg gag acg cag cac aag gtc ctg 1210 Arg Asp Lys Ala Lys Met Arg Asn Leu Glu Thr Gln His Lys Val Leu 290 295 300 gag ctc acg gcc gag aac gag cgg ctg cag aag aag gtg gag cag ctg 1258 Glu Leu Thr Ala Glu Asn Glu Arg Leu Gln Lys Lys Val Glu Gln Leu 305 310 315 320 tcg cgc gag ctc agc acc ctg cgg aac ttg ttc aag cag ctg ccc gag 1306 Ser Arg Glu Leu Ser Thr Leu Arg Asn Leu Phe Lys Gln Leu Pro Glu 325 330 335 ccc ctg ctc gcc tcc tcc ggc cac tgc tag cgcggccccc gcggcgtccc 1356 Pro Leu Leu Ala Ser Ser Gly His Cys 340 345 cctggggccg gccggggctg agactccggg gagcgcccgc gcccgcgccc tcgcccccnc 1416 ccccnnnncc gcaaaacttt ggcactgggg cacttggcag cnggggagcc cgtcggtaat 1476 tttaatattt tattatatat atatatctat attttgccaa ccaaccgtac atgcagatgg 1536 ctcccgcccg tggtgtataa agaagaaatg tctatgtgta cagatgaatg ataaactctc 1596 tgctctccct ctgcccctct ccaggcccgg cgggcggggc cggtttcgaa gttgatgcaa 1656 tcggtttaaa catggctgaa cgcgtgtgta cacgggactg acgcaaccca cgtgtaactg 1716 tcagccgggc cctgagtaat cgcttaaaga tgttctaggg cttgttgctg ttgatgtttt 1776 gttttgtttt gttttttggt ctttttttgt attataaaaa ataatctatt tctatgagaa 1836 aagaggcgtc tgtatatttt gggaatcttt tccgtttcaa gcaattaaga acacttttaa 1896 taaacttttt tttg 1910 <210> SEQ ID NO 4 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 4 gcaacccacg tgtaactgtc a 21 <210> SEQ ID NO 5 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 5 tcaacagcaa caagccctag aa 22 <210> SEQ ID NO 6 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Probe <400> SEQUENCE: 6 ccgggccctg agtaatcgct taaagat 27 <210> SEQ ID NO 7 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 7 gaaggtgaag gtcggagtc 19 <210> SEQ ID NO 8 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 8 gaagatggtg atgggatttc 20 <210> SEQ ID NO 9 <211> LENGTH: 20 <212> TYPE: DNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Probe <400> SEQUENCE: 9 caagcttccc gttctcagcc 20 <210> SEQ ID NO 10 <211> LENGTH: 1500 <212> TYPE: DNA <213> ORGANISM: Mus musculus <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (108)...(998) <400> SEQUENCE: 10 gcccgttgcc aggcgccgcc ttataaacct cccgctcggc cgccgccgcg ccgagtccga 60 gccgcgcacg ggaccgggac gcagcggagc ccgcgggccc cgcgttc atg cac cgc 116 Met His Arg 1 ctg ctg gcc tgg gac gca gca tgc ctc ccg ccg ccg ccc gcc gcc ttt 164 Leu Leu Ala Trp Asp Ala Ala Cys Leu Pro Pro Pro Pro Ala Ala Phe 5 10 15 aga ccc atg gaa gtg gcc aac ttc tac tac gag ccc gac tgc ctg gcc 212 Arg Pro Met Glu Val Ala Asn Phe Tyr Tyr Glu Pro Asp Cys Leu Ala 20 25 30 35 tac ggg gcc aag gcg gcc cgc gcc gcg ccg cgc gcc ccc gcc gcc gag 260 Tyr Gly Ala Lys Ala Ala Arg Ala Ala Pro Arg Ala Pro Ala Ala Glu 40 45 50 ccg gcc att ggc gag cac gag cgc gcc atc gac ttc agc ccc tac ctg 308 Pro Ala Ile Gly Glu His Glu Arg Ala Ile Asp Phe Ser Pro Tyr Leu 55 60 65 gag ccg ctc gcg ccc gcc gcg gac ttc gcc gcg ccc gcg ccc gcg cac 356 Glu Pro Leu Ala Pro Ala Ala Asp Phe Ala Ala Pro Ala Pro Ala His 70 75 80 cac gac ttc ctc tcc gac ctc ttc gcc gac gac tac ggc gcc aag ccg 404 His Asp Phe Leu Ser Asp Leu Phe Ala Asp Asp Tyr Gly Ala Lys Pro 85 90 95 agc aag aag ccg gcc gac tac ggt tac gtg agc ctc ggc cgc gcg ggc 452 Ser Lys Lys Pro Ala Asp Tyr Gly Tyr Val Ser Leu Gly Arg Ala Gly 100 105 110 115 gcc aag gcc gcg ccg ccc gcc tgc ttc ccg ccg ccg cct ccc gcg gcg 500 Ala Lys Ala Ala Pro Pro Ala Cys Phe Pro Pro Pro Pro Pro Ala Ala 120 125 130 ctc aag gcg gag ccg ggc ttc gaa ccc gcg gac tgc aag cgc gcg gac 548 Leu Lys Ala Glu Pro Gly Phe Glu Pro Ala Asp Cys Lys Arg Ala Asp 135 140 145 gac gcg ccc gcc atg gcg gcc ggt ttc ccg ttc gcc ctg cgc gcc tac 596 Asp Ala Pro Ala Met Ala Ala Gly Phe Pro Phe Ala Leu Arg Ala Tyr 150 155 160 ctg ggc tac cag gcg acg ccg agc ggc agc agc ggc agc ctg tcc acg 644 Leu Gly Tyr Gln Ala Thr Pro Ser Gly Ser Ser Gly Ser Leu Ser Thr 165 170 175 tcg tcg tcg tcc agc ccg ccc ggc acg ccg agc ccc gcc gac gcc aag 692 Ser Ser Ser Ser Ser Pro Pro Gly Thr Pro Ser Pro Ala Asp Ala Lys 180 185 190 195 gcc gcg ccc gcc gcc tgc ttc gcg ggg ccg ccg gcc gcg ccc gcc aag 740 Ala Ala Pro Ala Ala Cys Phe Ala Gly Pro Pro Ala Ala Pro Ala Lys 200 205 210 gcc aag gcc aag aag acg gtg gac aag ctg agc gac gag tac aag atg 788 Ala Lys Ala Lys Lys Thr Val Asp Lys Leu Ser Asp Glu Tyr Lys Met 215 220 225 cgg cgc gag cgc aac aac atc gcg gtg cgc aag agc cgc gac aag gcc 836 Arg Arg Glu Arg Asn Asn Ile Ala Val Arg Lys Ser Arg Asp Lys Ala 230 235 240 aag atg cgc aac ctg gag acg cag cac aag gtg ctg gag ctg acg gcg 884 Lys Met Arg Asn Leu Glu Thr Gln His Lys Val Leu Glu Leu Thr Ala 245 250 255 gag aac gag cgg ctg cag aag aag gtg gag cag ctg tcg cga gag ctc 932 Glu Asn Glu Arg Leu Gln Lys Lys Val Glu Gln Leu Ser Arg Glu Leu 260 265 270 275 agc acc ctg cgg aac ttg ttc aag cag ctg ccc gag ccg ctg ctg gcc 980 Ser Thr Leu Arg Asn Leu Phe Lys Gln Leu Pro Glu Pro Leu Leu Ala 280 285 290 tcg gcg ggc cac tgc tag cgcggcgcgg tggcgtgggg ggcgccgcgg ccaccgtgcg 1038 Ser Ala Gly His Cys 295 ccctgccccg cgcgctccgg ccccgcgcgc gcgcccggac caccgtgcgt gccctgcgcg 1098 cacctgcacc tgcaccgagg ggacaccgcg ggcacaccgc gggcacgcgc ggcgcacgca 1158 cctgcacagc gcaccgggtt tcgggacttg atgcaatccg gatcaaacgt ggctgagcgc 1218 gtgtggacac gggactacgc aacacacgtg taactgtcta gccgggccct gagtaatcac 1278 cttaaagatg ttcctgcggg gttgttgatg tttttggttt tgtttttgtt ttttgttttg 1338 ttttgttttt ttttttggtc ttattatttt ttttgtatta tataaaaaag ttctatttct 1398 atgagaaaag aggcgtatgt atatttgaga accttttccg tttcgagcat taaagtgaag 1458 acattttaat aaactttttt gggagaatgt ttaaaagcca aa 1500 <210> SEQ ID NO 11 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 11 cggatcaaac gtggctga 18 <210> SEQ ID NO 12 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 12 cgcaggaaca tctttaaggt gatt 24 <210> SEQ ID NO 13 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Probe <400> SEQUENCE: 13 acgtgtaact gtctagccgg gccctg 26 <210> SEQ ID NO 14 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 14 ggcaaattca acggcacagt 20 <210> SEQ ID NO 15 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Primer <400> SEQUENCE: 15 gggtctcgct cctggaagct 20 <210> SEQ ID NO 16 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PCR Probe <400> SEQUENCE: 16 aaggccgaga atgggaagct tgtcatc 27 <210> SEQ ID NO 17 <211> LENGTH: 192 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 182 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 183 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 184 <223> OTHER INFORMATION: unknown <220> FEATURE: <221> NAME/KEY: unsure <222> LOCATION: 185 <223> OTHER INFORMATION: unknown <400> SEQUENCE: 17 gttttgtttt gttttgtttt ttggtctttt tttggattat aaaaaataat ctatttctat 60 gagaaaaaag gcgtctgtat attttgggaa tcttttccgt ttcaagcatt aagaacactt 120 ttaataaact tttttttgag aatggttaca aagccttttg ggggcagtaa aaaaaaaaaa 180 annnnaaaaa aa 192 <210> SEQ ID NO 18 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 18 ctgctgccgc cgctgccggg 20 <210> SEQ ID NO 19 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 19 agctgtcgcc gctgcgtcgc 20 <210> SEQ ID NO 20 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 20 cggcccgcag gtgcgcggcc 20 <210> SEQ ID NO 21 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 21 aggcgttgca tgaacgcggg 20 <210> SEQ ID NO 22 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 22 gaagttggcc acttccatgg 20 <210> SEQ ID NO 23 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 23 agtagaagtt ggccacttcc 20 <210> SEQ ID NO 24 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 24 ctcgtagtag aagttggcca 20 <210> SEQ ID NO 25 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 25 cagcagccaa gcagtccgcc 20 <210> SEQ ID NO 26 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 26 gtacgcagca gccaagcagt 20 <210> SEQ ID NO 27 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 27 tcgtggtcgc cgatgctgcc 20 <210> SEQ ID NO 28 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 28 tcgtggtgct gcccggagga 20 <210> SEQ ID NO 29 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 29 cggagaggaa gtcgtggtgc 20 <210> SEQ ID NO 30 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 30 gaggtcggag aggaagtcgt 20 <210> SEQ ID NO 31 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 31 tgcccccgta gtcgtcggag 20 <210> SEQ ID NO 32 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 32 ggcttcttgc agttcttgcc 20 <210> SEQ ID NO 33 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 33 cggcttcttg cagttcttgc 20 <210> SEQ ID NO 34 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 34 cggccggctt cttgcagttc 20 <210> SEQ ID NO 35 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 35 acgtagccgt actcggccgg 20 <210> SEQ ID NO 36 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 36 ccccaggctc acgtagccgt 20 <210> SEQ ID NO 37 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 37 gcgggcggcg gcggcggcgg 20 <210> SEQ ID NO 38 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 38 ccgccttgag ctcggcgggc 20 <210> SEQ ID NO 39 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 39 agcccggctc cgccttgagc 20 <210> SEQ ID NO 40 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 40 tcgaagcccg gctccgcctt 20 <210> SEQ ID NO 41 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 41 gccgccgccc ggcgccccgg 20 <210> SEQ ID NO 42 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 42 gccatgcctg cgccgccgcc 20 <210> SEQ ID NO 43 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 43 gggaagcccg ccgccatgcc 20 <210> SEQ ID NO 44 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 44 cagcgcgtac gggaagcccg 20 <210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 45 ggtaagcgcg cagcgcgtac 20 <210> SEQ ID NO 46 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 46 gaggtaagcg cgcagcgcgt 20 <210> SEQ ID NO 47 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 47 tggtagccga ggtaagcgcg 20 <210> SEQ ID NO 48 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 48 cctggtagcc gaggtaagcg 20 <210> SEQ ID NO 49 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 49 cgcctggtag ccgaggtaag 20 <210> SEQ ID NO 50 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 50 ccgcctggta gccgaggtaa 20 <210> SEQ ID NO 51 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 51 tgccgctcgg caccgcctgg 20 <210> SEQ ID NO 52 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 52 ggacgtggag aggctcccgc 20 <210> SEQ ID NO 53 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 53 gcgggctgga cgaggaggac 20 <210> SEQ ID NO 54 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 54 ctgcgagggc gccggcccgg 20 <210> SEQ ID NO 55 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 55 atgttgttgc gctcgcgccg 20 <210> SEQ ID NO 56 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 56 aggttgcgca tcttggcctt 20 <210> SEQ ID NO 57 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 57 tctccaggtt gcgcatcttg 20 <210> SEQ ID NO 58 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 58 accttgtgct gcgtctccag 20 <210> SEQ ID NO 59 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 59 ttctgcagcc gctcgttctc 20 <210> SEQ ID NO 60 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 60 ccttcttctg cagccgctcg 20 <210> SEQ ID NO 61 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 61 ctccaccttc ttctgcagcc 20 <210> SEQ ID NO 62 <211> LENGTH: 20 <212> TYPE: DNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 62 agctgctcca ccttcttctg 20 <210> SEQ ID NO 63 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 63 gcgacagctg ctccaccttc 20 <210> SEQ ID NO 64 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 64 ctgagctcgc gcgacagctg 20 <210> SEQ ID NO 65 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 65 ttccgcaggg tgctgagctc 20 <210> SEQ ID NO 66 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 66 acaagttccg cagggtgctg 20 <210> SEQ ID NO 67 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 67 cttgaacaag ttccgcaggg 20 <210> SEQ ID NO 68 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 68 agctgcttga acaagttccg 20 <210> SEQ ID NO 69 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 69 cgggcagctg cttgaacaag 20 <210> SEQ ID NO 70 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 70 cgcgctagca gtggccggag 20 <210> SEQ ID NO 71 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 71 gggccgcgct agcagtggcc 20 <210> SEQ ID NO 72 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 72 ccggagtctc agccccggcc 20 <210> SEQ ID NO 73 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 73 cccggagtct cagccccggc 20 <210> SEQ ID NO 74 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 74 gggcgctccc cggagtctca 20 <210> SEQ ID NO 75 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 75 ataaaatatt aaaattaccg 20 <210> SEQ ID NO 76 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 76 ggttggcaaa atatagatat 20 <210> SEQ ID NO 77 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 77 atgtacggtt ggttggcaaa 20 <210> SEQ ID NO 78 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 78 ttcttcttta tacaccacgg 20 <210> SEQ ID NO 79 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 79 tatcattcat ctgtacacat 20 <210> SEQ ID NO 80 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 80 gaaaccggcc ccgcccgccg 20 <210> SEQ ID NO 81 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 81 accgattgca tcaacttcga 20 <210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 82 acgcgttcag ccatgtttaa 20 <210> SEQ ID NO 83 <211> LENGTH: 20

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 83 ggttgcgtca gtcccgtgta 20 <210> SEQ ID NO 84 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 84 cagggcccgg ctgacagtta 20 <210> SEQ ID NO 85 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 85 tctttaagcg attactcagg 20 <210> SEQ ID NO 86 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 86 aacagcaaca agccctagaa 20 <210> SEQ ID NO 87 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 87 caaaacatca acagcaacaa 20 <210> SEQ ID NO 88 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 88 tcttttctca tagaaataga 20 <210> SEQ ID NO 89 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 89 acgcctcttt tctcatagaa 20 <210> SEQ ID NO 90 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 90 gacgcctctt ttctcataga 20 <210> SEQ ID NO 91 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 91 aaacggaaaa gattcccaaa 20 <210> SEQ ID NO 92 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 92 gttcttaatt gcttgaaacg 20 <210> SEQ ID NO 93 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 93 aaaaagttta ttaaaagtgt 20 <210> SEQ ID NO 94 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 94 cccaaaaggc tttgtaacca 20 <210> SEQ ID NO 95 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 95 ctgcccccaa aaggctttgt 20 <210> SEQ ID NO 96 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 96 tataaggcgg cgcctggcaa 20 <210> SEQ ID NO 97 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 97 ggtttataag gcggcgcctg 20 <210> SEQ ID NO 98 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 98 gagcgggagg tttataaggc 20 <210> SEQ ID NO 99 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 99 cggccgagcg ggaggtttat 20 <210> SEQ ID NO 100 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 100 ctcggactcg gcgcggcggc 20 <210> SEQ ID NO 101 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 101 ggtcccgtgc gcggctcgga 20 <210> SEQ ID NO 102 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 102 cgtcccggtc ccgtgcgcgg 20 <210> SEQ ID NO 103 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 103 gctccgctgc gtcccggtcc 20 <210> SEQ ID NO 104

<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 104 aggcggtgca tgaacgcggg 20 <210> SEQ ID NO 105 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 105 gccagcaggc ggtgcatgaa 20 <210> SEQ ID NO 106 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 106 ccaggccagc aggcggtgca 20 <210> SEQ ID NO 107 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 107 tgctgcgtcc caggccagca 20 <210> SEQ ID NO 108 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 108 gggaggcatg ctgcgtccca 20 <210> SEQ ID NO 109 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 109 aaaggcggcg ggcggcggcg 20 <210> SEQ ID NO 110 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 110 tccatgggtc taaaggcggc 20 <210> SEQ ID NO 111 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 111 ccacttccat gggtctaaag 20 <210> SEQ ID NO 112 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 112 tagaagttgg ccacttccat 20 <210> SEQ ID NO 113 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 113 cgtagtagaa gttggccact 20 <210> SEQ ID NO 114 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 114 gtcgggctcg tagtagaagt 20 <210> SEQ ID NO 115 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 115 aggccaggca gtcgggctcg 20 <210> SEQ ID NO 116 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 116 gccgccttgg ccccgtaggc 20 <210> SEQ ID NO 117 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 117 ggcgcggcgc gggccgcctt 20 <210> SEQ ID NO 118 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 118 caatggccgg ctcggcggcg 20 <210> SEQ ID NO 119 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 119 gctcgccaat ggccggctcg 20 <210> SEQ ID NO 120 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 120 cgctcgtgct cgccaatggc 20 <210> SEQ ID NO 121 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 121 atggcgcgct cgtgctcgcc 20 <210> SEQ ID NO 122 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 122 ggcgcgagcg gctccaggta 20 <210> SEQ ID NO 123 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 123 cgcgggcgcg gcgaagtccg 20 <210> SEQ ID NO 124 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 124 gtcggagagg aagtcgtggt 20

<210> SEQ ID NO 125 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 125 aagaggtcgg agaggaagtc 20 <210> SEQ ID NO 126 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 126 gcgccgtagt cgtcggcgaa 20 <210> SEQ ID NO 127 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 127 cttggcgccg tagtcgtcgg 20 <210> SEQ ID NO 128 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 128 tcggcttggc gccgtagtcg 20 <210> SEQ ID NO 129 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 129 tcttgctcgg cttggcgccg 20 <210> SEQ ID NO 130 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 130 tagtcggccg gcttcttgct 20 <210> SEQ ID NO 131 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 131 gtaaccgtag tcggccggct 20 <210> SEQ ID NO 132 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 132 ctcacgtaac cgtagtcggc 20 <210> SEQ ID NO 133 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 133 gccgaggctc acgtaaccgt 20 <210> SEQ ID NO 134 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 134 cgcgcggccg aggctcacgt 20 <210> SEQ ID NO 135 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 135 gcggcgcggc cttggcgccc 20 <210> SEQ ID NO 136 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 136 ccgccttgag cgccgcggga 20 <210> SEQ ID NO 137 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 137 gaagcccggc tccgccttga 20 <210> SEQ ID NO 138 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 138 gcgggttcga agcccggctc 20 <210> SEQ ID NO 139 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 139 gtccgcgggt tcgaagcccg 20 <210> SEQ ID NO 140 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 140 gcagtccgcg ggttcgaagc 20 <210> SEQ ID NO 141 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 141 cttgcagtcc gcgggttcga 20 <210> SEQ ID NO 142 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 142 gcgcttgcag tccgcgggtt 20 <210> SEQ ID NO 143 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 143 tcgtccgcgc gcttgcagtc 20 <210> SEQ ID NO 144 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 144 gtcgtccgcg cgcttgcagt 20 <210> SEQ ID NO 145 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 145 ccatggcggg cgcgtcgtcc 20

<210> SEQ ID NO 146 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 146 aaaccggccg ccatggcggg 20 <210> SEQ ID NO 147 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 147 aacgggaaac cggccgccat 20 <210> SEQ ID NO 148 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 148 gtagcccagg taggcgcgca 20 <210> SEQ ID NO 149 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 149 cgcctggtag cccaggtagg 20 <210> SEQ ID NO 150 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 150 cgtcgcctgg tagcccaggt 20 <210> SEQ ID NO 151 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 151 gccgctcggc gtcgcctggt 20 <210> SEQ ID NO 152 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 152 gctgccgctg ctgccgctcg 20 <210> SEQ ID NO 153 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 153 ggacaggctg ccgctgctgc 20 <210> SEQ ID NO 154 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 154 gacgacgtgg acaggctgcc 20 <210> SEQ ID NO 155 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 155 ggacgacgac gacgtggaca 20 <210> SEQ ID NO 156 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 156 ctggacgacg acgacgtgga 20 <210> SEQ ID NO 157 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 157 cggcgggcgc ggccttggcg 20 <210> SEQ ID NO 158 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 158 gcggccccgc gaagcaggcg 20 <210> SEQ ID NO 159 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 159 cggccggcgg ccccgcgaag 20 <210> SEQ ID NO 160 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 160 ggcgggcgcg gccggcggcc 20 <210> SEQ ID NO 161 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 161 ccttggcggg cgcggccggc 20 <210> SEQ ID NO 162 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 162 cttggccttg gcgggcgcgg 20 <210> SEQ ID NO 163 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 163 tccaccgtct tcttggcctt 20 <210> SEQ ID NO 164 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 164 gtccaccgtc ttcttggcct 20 <210> SEQ ID NO 165 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 165 ctcagcttgt ccaccgtctt 20 <210> SEQ ID NO 166 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 166 tactcgtcgc tcagcttgtc 20

<210> SEQ ID NO 167 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 167 tcttgtactc gtcgctcagc 20 <210> SEQ ID NO 168 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 168 ctcgcgccgc atcttgtact 20 <210> SEQ ID NO 169 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 169 cttgcgcacc gcgatgttgt 20 <210> SEQ ID NO 170 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 170 tggccttgtc gcggctcttg 20 <210> SEQ ID NO 171 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 171 tccaggttgc gcatcttggc 20 <210> SEQ ID NO 172 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 172 cgtctccagg ttgcgcatct 20 <210> SEQ ID NO 173 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 173 ctccagcacc ttgtgctgcg 20 <210> SEQ ID NO 174 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 174 gccgtcagct ccagcacctt 20 <210> SEQ ID NO 175 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 175 ttctccgccg tcagctccag 20 <210> SEQ ID NO 176 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 176 agccgctcgt tctccgccgt 20 <210> SEQ ID NO 177 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 177 tcttctgcag ccgctcgttc 20 <210> SEQ ID NO 178 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 178 ccaccttctt ctgcagccgc 20 <210> SEQ ID NO 179 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 179 tgctccacct tcttctgcag 20 <210> SEQ ID NO 180 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 180 acagctgctc caccttcttc 20 <210> SEQ ID NO 181 <400> SEQUENCE: 181 000 <210> SEQ ID NO 182 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 182 agctctcgcg acagctgctc 20 <210> SEQ ID NO 183 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 183 ggtgctgagc tctcgcgaca 20 <210> SEQ ID NO 184 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 184 agttccgcag ggtgctgagc 20 <210> SEQ ID NO 185 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 185 gaacaagttc cgcagggtgc 20 <210> SEQ ID NO 186 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 186 tgcttgaaca agttccgcag 20 <210> SEQ ID NO 187 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 187 ggcagctgct tgaacaagtt 20 <210> SEQ ID NO 188 <211> LENGTH: 20

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 188 gctcgggcag ctgcttgaac 20 <210> SEQ ID NO 189 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 189 gcagcggctc gggcagctgc 20 <210> SEQ ID NO 190 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 190 gaggccagca gcggctcggg 20 <210> SEQ ID NO 191 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 191 gccgaggcca gcagcggctc 20 <210> SEQ ID NO 192 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 192 tggcccgccg aggccagcag 20 <210> SEQ ID NO 193 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 193 agcagtggcc cgccgaggcc 20 <210> SEQ ID NO 194 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 194 gctagcagtg gcccgccgag 20 <210> SEQ ID NO 195 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 195 cgcgccgcgc tagcagtggc 20 <210> SEQ ID NO 196 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 196 cgccaccgcg ccgcgctagc 20 <210> SEQ ID NO 197 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 197 gcacggtggc cgcggcgccc 20 <210> SEQ ID NO 198 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 198 agggcacgca cggtggtccg 20 <210> SEQ ID NO 199 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 199 ggtgcgcgca gggcacgcac 20 <210> SEQ ID NO 200 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 200 gtgcaggtgc gcgcagggca 20 <210> SEQ ID NO 201 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 201 gcaggtgcag gtgcgcgcag 20 <210> SEQ ID NO 202 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 202 cctcggtgca ggtgcaggtg 20 <210> SEQ ID NO 203 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 203 gtcccctcgg tgcaggtgca 20 <210> SEQ ID NO 204 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 204 cgcggtgtcc cctcggtgca 20 <210> SEQ ID NO 205 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 205 gcggtgtgcc cgcggtgtcc 20 <210> SEQ ID NO 206 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 206 gcgtgcccgc ggtgtgcccg 20 <210> SEQ ID NO 207 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 207 tgcgtgcgcc gcgcgtgccc 20 <210> SEQ ID NO 208 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 208 gctgtgcagg tgcgtgcgcc 20 <210> SEQ ID NO 209

<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 209 acccggtgcg ctgtgcaggt 20 <210> SEQ ID NO 210 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 210 ccgaaacccg gtgcgctgtg 20 <210> SEQ ID NO 211 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 211 aagtcccgaa acccggtgcg 20 <210> SEQ ID NO 212 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 212 tgcatcaagt cccgaaaccc 20 <210> SEQ ID NO 213 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 213 atccggattg catcaagtcc 20 <210> SEQ ID NO 214 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 214 cgtttgatcc ggattgcatc 20 <210> SEQ ID NO 215 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 215 gccacgtttg atccggattg 20 <210> SEQ ID NO 216 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 216 gctcagccac gtttgatccg 20 <210> SEQ ID NO 217 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 217 cacgcgctca gccacgtttg 20 <210> SEQ ID NO 218 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 218 cgtagtcccg tgtccacacg 20 <210> SEQ ID NO 219 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 219 tgttgcgtag tcccgtgtcc 20 <210> SEQ ID NO 220 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 220 ttacacgtgt gttgcgtagt 20 <210> SEQ ID NO 221 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 221 ctagacagtt acacgtgtgt 20 <210> SEQ ID NO 222 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 222 cggctagaca gttacacgtg 20 <210> SEQ ID NO 223 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 223 gattactcag ggcccggcta 20 <210> SEQ ID NO 224 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 224 ttaaggtgat tactcagggc 20 <210> SEQ ID NO 225 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 225 aacatcttta aggtgattac 20 <210> SEQ ID NO 226 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 226 ccgcaggaac atctttaagg 20 <210> SEQ ID NO 227 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 227 aaacatcaac aaccccgcag 20 <210> SEQ ID NO 228 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 228 aacaaaaaca aaaccaaaaa 20 <210> SEQ ID NO 229 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 229 cttttttata taatacaaaa 20

<210> SEQ ID NO 230 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 230 aatagaactt ttttatataa 20 <210> SEQ ID NO 231 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 231 tctcatagaa atagaacttt 20 <210> SEQ ID NO 232 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 232 gcctcttttc tcatagaaat 20 <210> SEQ ID NO 233 <400> SEQUENCE: 233 000 <210> SEQ ID NO 234 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 234 aaatatacat acgcctcttt 20 <210> SEQ ID NO 235 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 235 gaaaaggttc tcaaatatac 20 <210> SEQ ID NO 236 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 236 ctcgaaacgg aaaaggttct 20 <210> SEQ ID NO 237 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 237 aatgctcgaa acggaaaagg 20 <210> SEQ ID NO 238 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 238 ctttaatgct cgaaacggaa 20 <210> SEQ ID NO 239 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 239 tcactttaat gctcgaaacg 20 <210> SEQ ID NO 240 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 240 tgtcttcact ttaatgctcg 20 <210> SEQ ID NO 241 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 241 ttaaaatgtc ttcactttaa 20 <210> SEQ ID NO 242 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 242 aaaaagttta ttaaaatgtc 20 <210> SEQ ID NO 243 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 243 tctcccaaaa aagtttatta 20 <210> SEQ ID NO 244 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <400> SEQUENCE: 244 cttttaaaca ttctcccaaa 20

Claims

1. An antisense compound 8 to 30 nucleobases in length targeted to a nucleic acid molecule encoding C/EBP beta, wherein said antisense compound specifically hybridizes with and inhibits the expression of C/EBP beta.

2. The antisense compound of claim 1 which is an antisense oligonucleotide.

3. The antisense compound of claim 2 wherein the antisense oligonucleotide has a sequence comprising SEQ ID NO: 18, 25, 28, 31, 33, 34, 36, 40, 41, 42, 45, 46, 50, 52, 54, 55, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 68, 69, 70, 71, 72, 73, 75, 79, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 100, 102, 105, 106, 114, 120, 121, 127, 128, 130, 132, 133, 138, 139, 142, 146, 147, 150, 153, 154, 158, 164, 165, 166, 167, 175, 176, 179, 182, 202, 203, 206, 209, 210, 211, 214, 216, 217, 218, 219, 221, 222, 232, 236, 237, 238, 239 or 240.

4. The antisense compound of claim 2 wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage.

5. The antisense compound of claim 4 wherein the modified internucleoside linkage is a phosphorothioate linkage.

6. The antisense compound of claim 2 wherein the antisense oligonucleotide comprises at least one modified sugar moiety.

7. The antisense compound of claim 6 wherein the modified sugar moiety is a 2'-O-methoxyethyl sugar moiety.

8. The antisense compound of claim 2 wherein the antisense oligonucleotide comprises at least one modified nucleobase.

9. The antisense compound of claim 8 wherein the modified nucleobase is a 5-methylcytosine.

10. The antisense compound of claim 2 wherein the antisense oligonucleotide is a chimeric oligonucleotide.

11. A pharmaceutical composition comprising the antisense compound of claim 1 and a pharmaceutically acceptable carrier or diluent.

12. The pharmaceutical composition of claim 11 further comprising a colloidal dispersion system.

13. The pharmaceutical composition of claim 11 wherein the antisense compound is an antisense oligonucleotide.

14. A method of inhibiting the expression of C/EBP beta in cells or tissues comprising contacting said cells or tissues with the antisense compound of claim 1 so that expression of C/EBP beta is inhibited.

15. A method of treating an animal having a disease or condition associated with C/EBP beta comprising administering to said animal a therapeutically or prophylactically effective amount of the antisense compound of claim 1 so that expression of C/EBP beta is inhibited.

16. The method of claim 15 wherein the disease or condition is an inflammatory disorder.

17. The method of claim 15 wherein the disease or condition is diabetes.

18. The method of claim 15 wherein the disease or condition is an immunological disorder.

19. The method of claim 15 wherein the disease or condition is a hyperproliferative disorder.

20. The method of claim 19 wherein the hyperproliferative disorder is cancer.