U.S. patent application number 11/193526 was filed with the patent office on 2006-02-02 for assay and kit for analyzing gene expression.
Invention is credited to Morten Lorentz Pedersen.
Application Number | 20060024721 11/193526 |
Document ID | / |
Family ID | 46150060 |
Filed Date | 2006-02-02 |
United States Patent
Application |
20060024721 |
Kind Code |
A1 |
Pedersen; Morten Lorentz |
February 2, 2006 |
Assay and kit for analyzing gene expression
Abstract
It is one objective of the present invention to obtain
reproducible representations of expressed mRNA molecules by
exploiting a novel technique that relies on short, single stranded
polynucleotide tags. In one preferred embodiment, only one
polynucleotide tag is obtained from each mRNA molecule, and
relatively simple counting statistics can thus be applied after
identification and sampling of the different tags, or a subset of
tags being present in the population of representative tags. The
tags according to the present invention are preferably single
stranded polynucleotide tags obtained by subjecting genetic
material derived from a biological sample to at least one
site-specific nicking endonuclease capable of i) recognizing a
predetermined nucleotide motif comprising complementary nucleotide
strands and ii) cleaving only one of said complementary strands in
the process of generating the at least one single stranded
polynucleotide tag. Accordingly, the present invention demonstrates
that nicking endonucleases may advantageously be used for obtaining
and isolating ssDNA tags. This novel approach in one embodiment
eliminates the occurrence of any linker sequence in the ssDNA tag,
and it eliminates the presence of a complementary strand in the
isolated polynucleotide tag. The lack of linker sequence in the tag
and the lack of any complementary strand serves to reduce the huge
complexities associated with the analysis of expressed molecules in
a biological sample.
Inventors: |
Pedersen; Morten Lorentz;
(Taastrup, DK) |
Correspondence
Address: |
BROWDY AND NEIMARK, P.L.L.C.
624 Ninth Street, N.W.
Washington
DC
20001
US
|
Family ID: |
46150060 |
Appl. No.: |
11/193526 |
Filed: |
August 1, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10053883 |
Jan 24, 2002 |
6958217 |
|
|
11193526 |
Aug 1, 2005 |
|
|
|
60267704 |
Feb 12, 2001 |
|
|
|
Current U.S.
Class: |
435/6.14 |
Current CPC
Class: |
C12Q 1/6809 20130101;
C12Q 2521/301 20130101; C12Q 2525/191 20130101; C12Q 1/6809
20130101; C12N 15/1093 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 24, 2001 |
DK |
PA 2001 00126 |
Claims
1. A kit for performing or assaying expression profiling of
polynucleotides by determining the presence or sequence of a single
stranded polynucleotide tag, said kit comprising a) at least one
site-specific nicking endonuclease capable of i) recognizing a
predetermined nucleotide motif comprising complementary nucleotide
strands and ii) cleaving only one of said complementary strands,
said cleavage generating at least one single stranded
polynucleotide tag, b) at least one adapter oligonucleotide
comprising a recognition motif for said site-specific nicking
endonuclease, and c) at least one identifying linker
oligonucleotide for identifying said at least one single stranded
polynucleotide tag.
2. A kit for performing or assaying expression profiling of
polynucleotides by determining the presence or sequence of a single
stranded polynucleotide tag, said kit comprising a) a first
identifying linker oligonucleotide for identifying said at least
one single stranded polynucleotide tag, said first identifying
linker oligonucleotide comprising a single stranded part forming a
5' overhang, and b) a second identifying linker oligonucleotide for
identifying said at least one single stranded polynucleotide tag,
said second identifying linker oligonucleotide comprising a single
stranded part forming a 3' overhang.
3. The kit according to claim 2 and further comprising at least one
adapter oligonucleotide comprising at least one recognition motif
for a site-specific nicking endonuclease.
4. A kit for performing or assaying expression profiling of
polynucleotides by determining the presence or sequence of a single
stranded polynucleotide tag, said kit comprising a) at least one
site-specific nicking endonuclease capable of i) recognizing a
predetermined nucleotide motif comprising complementary nucleotide
strands and ii) cleaving only one of said complementary strands,
said cleavage generating at least one single stranded
polynucleotide tag, b) at least one adapter oligonucleotide
comprising a recognition motif for said site-specific nicking
endonuclease, and c) at least one molecular identifier facilitating
sorting and/or detection of a single stranded polynucleotide tag
attached to an identifying linker oligonucleotide for identifying
said at least one single stranded polynucleotide tag, wherein the
molecular identifier is selected from the group consisting of i) an
epitope, ii) a molecule comprised of a predetermined number of
subunits having essentially the same charge, mass, hydrophobic
properties, three dimensional structure, wherein different
molecular identifiers each comprise a different number of subunits,
and wherein said difference in the number of subunits makes it
possible to separate or identify individual molecular identifiers
when subjecting these to a separation or identification process,
iii) a dsDNA or ssDNA oligonucleotide of predetermined length or
sequence, iv) a peptide of predetermined length or sequence, v) a
first molecule capable of binding a second molecule, vi) a
linarized plasmid, vii) a molecule comprising an electromagnetic
property or a paramagnetic property, and viii) a moiety capable of
emitting an electromagnetic radiation after excitation.
5. The kit according to claim 4, wherein said one or more molecular
identifiers are attached to said adapter oligonucleotide.
6. The kit according to claim 1, wherein the site-specific nicking
endonuclease is of the N.BstNB I type.
7. The kit according to claim 1, wherein the adapter
oligonucleotide further comprises one or more recognition motifs,
or part thereof, for one or more site-specific restriction
endonucleases.
8. The kit according to claim 3, wherein the adapter
oligonucleotide further comprises one or more recognition motifs,
or part thereof, for one or more site-specific restriction
endonucleases.
9. The kit according to claim 4, wherein the adapter
oligonucleotide further comprises one or more recognition motifs,
or part thereof, for one or more site-specific restriction
endonucleases.
10. The kit according to claim 7, wherein the site-specific
restriction endonucleases are selected from the group consisting of
site-specific restriction endonucleases of type II and
site-specific restriction endonucleases of type IIs.
11. The kit according to claim 1, wherein the recognition motif in
the adapter oligonucleotide is recognized by different cleavage
agents selected from the group consisting of site-specific nicking
endonucleases and site-specific restriction endonucleases.
12. The kit according to claim 1, wherein the adapter is in single
stranded form and comprises one nucleotide strand, which, together
with the complementary strand, generates said one or more
recognition motifs.
13. The kit according to claim 1, wherein the adapter is single
stranded and comprises one strand of said one or more recognition
motifs.
14. The kit according to claim 1, wherein the adapter is double
stranded.
15. The kit according to claim 1, wherein the identifying linker
oligonucleotide comprises a double stranded part comprising
complementary nucleotide strands and/or at least one single
stranded part.
16. The kit according to claim 2, wherein the first and second
identifying linker oligonucleotides comprise a double stranded part
comprising complementary nucleotide strands and/or at least one
single stranded part.
17. The kit according to claim 15, wherein the identifying linker
oligonucleotide(s) comprises a double stranded part comprising
complementary nucleotide strands and/or at least two single
stranded parts.
18. The kit according to claim 1, wherein the identifying linker
oligonucleotide(s) is exclusively single stranded.
19. The kit according to claim 1, wherein the identifying linker
oligonucleotide(s) is a double stranded linker oligonucleotide
having a 3' or 5' overhang comprising a predetermined sequence
capable of hybridizing under suitable conditions to a single
stranded polynucleotide tag comprising a sequence that is
complementary to the predetermined sequence of the overhang of the
identifying linker oligonucleotide.
20. The kit according to claim 1, wherein the identifying linker
oligonucleotide(s) is linked to a solid support.
21. The kit according to claim 20, wherein the solid support
includes a hybridization array.
22. The kit according to claim 1, wherein said adapter
oligonucleotide comprises one or more of i) a molecular identifier
facilitating sorting and/or detection of a single stranded
polynucleotide tag attached to the identifying linker
oligonucleotide, ii) a selectively identifiable label, and iii) a
recognition motif for a site-specific nicking endonuclease capable
of i) recognizing a predetermined nucleotide motif comprising
complementary nucleotide strands and ii) cleaving only one of said
complementary strands, said cleavage generating at least one single
stranded polynucleotide tag.
23. The kit according to claim 1, wherein said adapter
oligonucleotide comprises a molecular identifier facilitating
sorting and/or detection of a single stranded polynucleotide tag
attached to the identifying linker oligonucleotide,
24. The kit according to claim 1, wherein said adapter
oligonucleotide comprises a selectively identifiable label.
25. The kit according to claim 1, wherein said adapter
oligonucleotide comprises a recognition-motif for a site-specific
nicking endonuclease capable of i) recognizing a predetermined
nucleotide motif comprising complementary nucleotide strands and
ii) cleaving only one of said complementary strands, said cleavage
generating at least one single stranded polynucleotide tag.
26. The kit according to claim 4, wherein said adapter
oligonucleotide further comprises a selectively identifiable
label.
27. The kit according to claim 4, wherein said adapter
oligonucleotide further comprises a recognition motif for a
site-specific nicking endonuclease capable of i) recognizing a
predetermined nucleotide motif comprising complementary nucleotide
strands and ii) cleaving only one of said complementary strands,
said cleavage generating at least one single stranded
polynucleotide tag.
28. The kit according to claim 2, wherein said first and/or said
second identifying linker oligonucleotide(s) comprises one or more
of i) a molecular identifier facilitating sorting and/or detection
of a single stranded polynucleotide tag attached to the identifying
linker oligonucleotide, ii) a selectively identifiable label, and
ii) a recognition motif for a site-specific nicking endonuclease
capable of i) recognizing a predetermined nucleotide motif
comprising complementary nucleotide strands and ii) cleaving only
one of said complementary strands, said cleavage generating at
least one single stranded polynucleotide tag.
29. The kit according to claim 2, wherein said first and/or said
second identifying linker oligonucleotide(s) comprises a molecular
identifier facilitating sorting and/or detection of a single
stranded polynucleotide tag attached to the identifying linker
oligonucleotide.
30. The kit according to claim 2, wherein said first and/or said
second identifying linker oligonucleotide(s) comprises a
selectively identifiable label.
31. The kit according to claim 2, wherein said first and/or said
second identifying linker oligonucleotide(s) comprises a
recognition motif for a site-specific nicking endonuclease capable
of i) recognizing a predetermined nucleotide motif comprising
complementary nucleotide strands and ii) cleaving only one of said
complementary strands, said cleavage generating at least one single
stranded polynucleotide tag.
32. The kit according to claim 2, wherein said first and/or second
identifying linker oligonucleotide(s) comprises one or more
molecular identifiers facilitating sorting and/or detection of the
single stranded polynucleotide tag attached to said identifying
linker oligonucleotide(s), wherein the molecular identifier is
selected from the group consisting of i) an epitope, ii) a molecule
comprised of a predetermined number of subunits having essentially
the same charge, mass, hydrophobic properties, three dimensional
structure, wherein different molecular identifiers each comprise a
different number of subunits, and wherein said difference in the
number of subunits makes it possible to separate or identify
individual molecular identifiers when subjecting these to a
separation or identification process, iii) a dsDNA or ssDNA
oligonucleotide of predetermined length or sequence, iv) a peptide
of predetermined length or sequence, v) a first molecule capable of
binding a second molecule, vi) a linarized plasmid, vii) a molecule
comprising an electromagnetic property or a paramagnetic property,
and viii) a moiety capable of emitting an electromagnetic radiation
after excitation.
33. The kit according to claim 32, wherein said one or more
molecular identifiers are attached to said first and/or said second
identifying linker oligonucleotide(s).
34. The kit according to claim 3, wherein said adapter
oligonucleotide comprises one or more molecular identifiers
facilitating sorting and/or detection of a single stranded
polynucleotide tag attached to an identifying linker
oligonucleotide, wherein the molecular identifier is selected from
the group consisting of i) an epitope, ii) a molecule comprised of
a predetermined number of subunits having essentially the same
charge, mass, hydrophobic properties, three dimensional structure,
wherein different molecular identifiers each comprise a different
number of subunits, and wherein said difference in the number of
subunits makes it possible to separate or identify individual
molecular identifiers when subjecting these to a separation or
identification process, iii) a dsDNA or ssDNA oligonucleotide of
predetermined length or sequence, iv) a peptide of predetermined
length or sequence, v) a first molecule capable of binding a second
molecule, vi) a linarized plasmid, vii) a molecule comprising an
electromagnetic property or a paramagnetic property, and viii) a
moiety capable of emitting an electromagnetic radiation after
excitation.
35. A solid support comprising a hybridization array comprising a
plurality of ordered first identifying linker oligonucleotides,
wherein at least one of said first identifying linker
oligonucleotides comprises a single stranded nucleotide sequence
hybridized to at least one single stranded polynucleotide tag
comprising a sequence complementary thereto.
36. The solid support according to claim 35, wherein the single
stranded poly-nucleotide tag is obtained by the method comprising
the steps of i) providing at least one ribonucleic acid from the
biological sample, ii) obtaining at least one double stranded
polynucleotide comprising two complementary strands by using the at
least one ribonucleic acid provided in step i) as a template for
the synthesis of a polynucleotide strand complementary to the at
least one ribonucleic acid, iii) providing at least one
site-specific restriction endonuclease capable of recognizing a
recognition motif comprised in the double stranded polynucleotide
comprising complementary strands and cleaving the double stranded
polynucleotide obtained in step ii) into at least two fragments,
iv) contacting and cleaving the at least one double stranded
polynucleotide obtained in step ii) with the at least one
site-specific restriction endonuclease provided in step iii), v)
obtaining at least one double stranded polynucleotide fragment by
cleaving the at least one double stranded polynucleotide contacted
with the at least one site-specific restriction endonuclease in
step iv), vi) providing at least one adapter oligonucleotide
comprising at least one recognition motif for at least one
site-specific nicking endonuclease, wherein said motif comprises a
double stranded oligonucleotide comprising complementary strands,
wherein the adapter is capable of being linked together with the at
least one double stranded polynucleotide fragment obtained in step
v), vii) obtaining at least one chimeric polynucleotide by linking
together the at least one double stranded polynucleotide fragment
obtained in step v) and the at least one adapter oligonucleotide
provided in step vi), viii) providing at least one site-specific
nicking endonuclease capable of recognizing a recognition motif
comprised in the double stranded chimeric polynucleotide comprising
complementary strands and cleaving only one of the complementary
strands of the chimeric polynucleotide obtained in step vii), ix)
contacting and cleaving the at least one chimeric polynucleotide
obtained in step vii) with the at least one site-specific nicking
endonuclease provided in step viii), and x) obtaining at least one
single stranded polynucleotide tag.
37. The solid support according to claim 35, wherein the single
stranded poly-nucleotide tag is obtained by the method comprising
the steps of i) providing at least one ribonucleic acid from the
biological sample, ii) obtaining at least one double stranded
polynucleotide comprising two complementary strands by using the at
least one ribonucleic acid provided in step i) as a template for
the synthesis of a polynucleotide strand complementary to the at
least one ribonucleic acid, iii) providing at least one
site-specific restriction endonuclease capable of recognizing a
recognition motif comprised in the double stranded polynucleotide
comprising complementary strands and cleaving the double stranded
polynucleotide obtained in step ii) into at least two fragments,
iv) contacting and cleaving the at least one double stranded
polynucleotide obtained in step ii) with the at least one
site-specific restriction endonuclease provided in step iii), v)
obtaining at least one double stranded polynucleotide fragment by
cleaving the at least one double stranded polynucleotide contacted
with the at least one site-specific restriction endonuclease in
step iv), vi) providing at least one adapter oligonucleotide
comprising at least one recognition motif for at least one
site-specific nicking endonuclease, wherein said motif comprises a
double stranded oligonucleotide comprising complementary strands,
wherein the adapter is capable of being linked together with the at
least one double stranded polynucleotide fragment obtained in step
v), vii) obtaining at least one double stranded chimeric
polynucleotide by linking together the at least one double stranded
polynucleotide fragment obtained in step v) and the at least one
adapter oligonucleotide provided in step vi), viii) providing at
least one further site-specific restriction endonuclease capable of
recognizing a recognition motif comprised in the double stranded
chimeric polynucleotide comprising complementary strands and
cleaving both of the complementary strands of the chimeric
polynucleotide provided in step vii), ix) contacting and cleaving
the at least one chimeric polynucleotide obtained in step vii) with
the at least one further site-specific restriction endonuclease
provided in step viii), x) obtaining at least one chimeric
polynucleotide fragment by cleaving the at least one chimeric
polynucleotide contacted with the at least one further
site-specific restriction endonuclease in step ix), xi) providing
at least one site-specific nicking endonuclease capable of
recognizing a recognition motif comprised in the double stranded
chimeric polynucleotide fragment comprising complementary strands
and cleaving only one of the complementary strands of the chimeric
polynucleotide fragment obtained in step x), xii) contacting and
cleaving the at least one chimeric polynucleotide fragment obtained
in step x) with the at least one site-specific nicking endonuclease
provided in step xi), and xiii) obtaining at least one single
stranded polynucleotide tag.
38. The solid support according to claim 35, wherein the single
stranded poly-nucleotide tag is obtained by the method comprising
the steps of i) providing at least one ribonucleic acid from the
biological sample ii) providing at least one adapter
oligonucleotide comprising a part of a recognition motif for at
least one site-specific nicking endonuclease, wherein said part
comprises a single oligonucleotide strand which, together with a
complementary strand, forms a recognition motif for at least one
site-specific nicking endonuclease, iii) obtaining at least one
chimeric polynucleotide by linking together the at least one
ribonucleic acid of step i) with the at least one adapter
oligonucleotide of step ii), iv) obtaining at least one double
stranded chimeric polynucleotide comprising an adapter
oligonucleotide part by using the chimeric polynucleotide of step
iii) as a template for the synthesis of a polynucleotide strand
complementary to said chimeric polynucleotide, v) providing at
least one site-specific restriction endonuclease capable of
recognizing a recognition motif comprised in the double stranded
polynucleotide comprising complementary strands and cleaving the
double stranded polynucleotide obtained in step iv) into at least
two fragments, vi) contacting and cleaving the at least one double
stranded chimeric polynucleotide obtained in step iv) with the at
least one site-specific restriction endonuclease provided in step
v), vii) obtaining at least one double stranded chimeric
polynucleotide fragment by cleaving the at least one double
stranded chimeric polynucleotide contacted with the at least one
site-specific restriction endonuclease in step vi), viii) providing
at least one site-specific nicking endonuclease capable of
recognizing a recognition motif comprised in the double stranded
chimeric polynucleotide fragment comprising complementary strands
and cleaving only one of the complementary strands of the chimeric
polynucleotide fragment obtained in step vii), ix) contacting and
cleaving the at least one chimeric polynucleotide fragment obtained
in step vii) with the at least one site-specific nicking
endonuclease provided in step viii), and x) obtaining at least one
single stranded polynucleotide tag.
39. The solid support according to claim 35, wherein the single
stranded poly-nucleotide tag is obtained by the method comprising
the steps of i) providing at least one ribonucleic acid from the
biological sample, ii) providing at least one adapter
oligonucleotide comprising a part of a recognition motif for at
least one site-specific nicking endonuclease, wherein said part
comprises a single oligonucleotide strand which, together with a
complementary strand, forms a recognition motif for at least one
site-specific nicking endonuclease, iii) obtaining at least one
chimeric polynucleotide by linking together the at least one
ribonucleic acid of step i) with the at least one adapter
oligonucleotide of step ii), iv) obtaining at least one double
stranded chimeric polynucleotide comprising an adapter
oligonucleotide part by using the chimeric polynucleotide of step
iii) as a template for the synthesis of a polynucleotide strand
complementary to said chimeric polynucleotide, v) providing at
least one site-specific nicking endonuclease capable of recognizing
a recognition motif comprised in the double stranded chimeric
polynucleotide comprising complementary strands and cleaving only
one of the complementary strands of the chimeric polynucleotide
obtained in step iv), vi) contacting and cleaving the at least one
chimeric polynucleotide obtained in step iv) with the at least one
site-specific nicking endonuclease provided in step v), and vii)
obtaining at least one single stranded polynucleotide tag.
Description
[0001] This application is a nonprovisional of U.S. provisional
application Ser. No. 60/267,704 filed on 12 Feb. 2001, which is
hereby incorporated by reference in its entirety. All patent and
nonpatent references cited in the application, or in the present
application, are also hereby incorporated by reference in their
entirety.
TECHNICAL FIELD OF THE INVENTION
[0002] The present invention relates to methods and tools for
analyzing gene expression at large. A process also known as
expression profiling. In a basic scientific context, information
about gene expression from one biological sample is normally
correlated to the gene expression information obtained from another
biological sample. This can be done in a variety of ways generally
referred to as differential gene expression.
[0003] The objective of differential gene expression is to perform
an analysis by determining the genes, which are expressed in a
first predetermined cell, but not expressed, or expressed at a
different level, in a second predetermined cell. The analysis thus
facilitates a characterization of the selected cell type and
differentiates said cell type from other cell types, or essentially
identical cell types having a different history. The analysis also
facilitates target identification, when correlating the expression
from an "altered" or "aberrant" cell with the expected expression
from that type of cell.
[0004] Clustering software can be used to group genes that are
regulated in a similar fashion. Some of these clusters will be
mutually exclusive. For example a group of the genes that prevent
cell proliferation may do so by encoding proteins or non-translated
RNA species capable of blocking the expression of genes necessary
for DNA replication and cell division. If genes belonging to
clusters that are mutually exclusive are expressed at the same time
in a cell sample that normally would not express genes from
mutually exclusive genes, then this is a strong indication that the
cell in this sample exhibit an aberrant behaviour. In this case no
direct correlation with a normal control is necessary.
[0005] As many examples of mutually exclusive gene clusters are
described in the literature, it may not be necessary or convenient
to do a classical differential gene expression analysis when using
gene expression for diagnostic or genotyping purposes. Instead it
may be more relevant just to refer to present knowledge about the
behavior of the marker genes used or to refer to a database
comprising the relevant data for the analysis of the sample.
BACKGROUND OF THE INVENTION
[0006] Analysis of complex nucleic acid populations is a common
problem in many areas of molecular biology, nowhere more so than in
the analysis of patterns of gene expression. Various methods have
been developed to allow simultaneous analysis of entire mRNA
populations, or their corresponding cDNA populations, in order to
understand the observed patterns of gene expression.
[0007] The method of "subtractive cloning" (Lee et al, Proc. Nat.
Acad. Sci. USA 88, 2825-2829) allows identification of mRNAs, or
rather, their corresponding cDNAs, that are differentially
expressed in two related cell types. One can selectively eliminate
cDNAs common to two related cell types by hybridizing cDNAs from a
library derived from one cell type to a large excess of mRNA from a
related, but distinct cell type. mRNAs in the second cell type
complementary to cDNAs from the first type will form
double-stranded hybrids. Various enzymes exist which degrade such
double-stranded hybrids allowing these to be eliminated thus
enriching the remaining population in cDNAs unique to the first
cell type. This method allows highly specific comparative
information about differences in gene expression between related
cell types to be derived and has had moderate success in isolating
rare cDNAs.
[0008] The methods of "differential display" (Science 257, 967-971,
1992) sorts mRNAs using PCR primers to selectively amplify specific
subsets of an mRNA population. An mRNA population is primed with a
general oligo(dT) primer to amplify one strand and a specific
primer, of perhaps 10 nucleotides or so to amplify the reverse
strand with greater specificity. In this way only mRNAs bearing the
second primer sequence are amplified; the longer the second primer
the smaller a proportion of the total cDNA population is amplified
or any given sequence of that length used. The resultant amplified
sub-population can then be cloned for screening or sequencing or
the fragments can simply be separated on a sequencing gel. Low copy
number mRNAs are less likely to get lost in this sort of scheme in
comparison with subtractive cloning, and it is probably more
reproducible. Whilst this method is more general than subtractive
cloning, time-consuming analysis is required.
[0009] The method of "molecular indexing" (PCT/GB93/01452) uses
populations of adapter molecules to hybridize to the ambiguous
sticky-ends generated by cleavage of a nucleic acid with a type IIs
restriction endonuclease to categorize the cleavage fragments.
Using specifically engineered adapters one can specifically
immobilize or amplify or clone specific subsets of fragments in a
manner similar to differential display but achieving a greater
degree of control. Again, time-consuming analysis is required.
[0010] The method of Kato (Nucleic Acids Research 12, 3685-3690,
1995) exemplifies the above molecular indexing approach and effects
cDNA population analysis by sorting terminal cDNA fragments into
sub-populations followed by selective amplification of specific
subsets of cDNA fragments. Sorting is effected by using type IIs
restriction endonucleases and adapters. The adapters also carry
primer sites, which in conjunction with general oligo(dT) primers
allows selective amplification of terminal cDNA fragments as in
differential display. It is possibly more precise than differential
display in that it effects greater sorting: only about 100 cDNAs
will be present in a given subset and sorting can be related to
specific sequence features rather than using primers chosen by
trial and error.
[0011] The method of "Serial Analysis of Gene Expression" or "SAGE"
(Science 270, 484-487, 1995) allows identification of mRNAs, or
rather, their corresponding cDNAs, that are expressed in a given
cell type. The method involved a process for isolating a "tag" from
every cDNA in a population using adapters and type IIs restriction
endonucleases. A tag is a sample of a cDNA sequence of a fixed
number of nucleotides sufficient to identify uniquely that cDNA in
the population. Tags are then ligated together to create so-called
di-tags consisting of two decamers from the pool of cDNA molecules
under investigation ligated head-to-head and flanked by two
linkers. These di-tags are then amplified using PCR, concatemerized
into longer fragments, cloned and sequenced. The method gives
quantitative data on gene expression and will readily identify
novel cDNAs. This method was invented in 1995, but trials have
since then showed that the amplification efficiency of different
di-tags depends very much upon the sequence of the individual
di-tags. In one trial a seven fold difference between two di-tag
sequences after 20 cycles of PCR was detected even though there was
no difference in abundance between these two di-tags in the
starting material (NAR 27(18), e22, 1999). This makes SAGE a very
bad choice if reliable quantitative data are required. The method
is also extremely time-consuming in view of the large amount of
sequencing required.
[0012] The method of "Tandem Arrayed Ligation of Expressed Sequence
Tags" or "TAL-EST" (NAR 27(18), e22, 1999) is a modification of
SAGE, where the PCR amplification step gives way to a cloning step.
Each analysis then involves two cloning steps. The method is very
quantitative and reproducible (P=0.99), but on the other hand
approx. 15% of all genes are invisible in this assay. This means
that the expression of 15% of all genes is not detected regardless
how abundant their mRNA is. Thus TALEST is a very labor and time
intensive technique to work with and the coverage is only 85% of
all genes.
[0013] The method of "Total Gene Expression Analysis" or "TOGA"
(PNAS 97(5), p. 1976-1981, 2000) makes use of a technique where the
poly(T) tail of the cDNA along with the sequence 5' of the poly(T)
tail is ligated into an RNA expression vector. This vector is then
linarized and RNA in vitro synthesized. Then gene specific
sequences are detected and quantified in approximately the same
manner as with AFLP. Thus in TOGA, PCR is also used to amplify the
products that are analyzed. As for SAGE, the use of PCR before the
analysis step jeopardizes the quantitative aspect of the
method.
[0014] The method of "Massively Parallel Signature Sequencing" or
"MPSS" (Nature Bio-tech. 18, 630-634, 2000) uses a FACS sorting
device in the data acquisition process. Like many of the other
techniques MPSS depends heavily upon PCR for amplification of the
tags, and hence MPSS is inflicted with all the problems that comes
from using PCR.
[0015] Methods involving hybridization grids, chips and arrays are
advantageous in that they avoid gel methods for sequencing and are
relatively quantitative. They can be performed entirely in
solution, and are thus readily automatable. These methods come in
two forms.
[0016] The first involves immobilization of target nucleic aids to
an array of oligonucleotides complementary to the terminal
sequences of the target nucleic acid. Immobilization is followed by
partial sequencing of those fragments by a single base method, e.g.
using type IIs restriction endonucleases and adapters. This
particular approach is advocated by Brenner in PCT/US95/12678.
[0017] The second form involves arrays of oligonucleotides. Nucleic
acids are hybridized as single strands to the array. Detection of
hybridization is achieved by fluorescently labeling each nucleic
acid and determining from where on the grid the fluorescence
arises, which determines the oligonucleotide to which the nucleic
acid has bound. The fluorescent labels also give quantitative
information about how much nucleic acid has hybridized to a given
oligonucleotide. This information and knowledge of the relative
quantities of individual nucleic acids should be sufficient to
reconstruct the sequences and quantities of the hybridizing
population. This approach is advocated by Lehrach in numerous
papers and Nucleic Acids Research 22, 3423 contains a recent
discussion. A disadvantage of this approach is that the
construction of large arrays of oligonucleotides is extremely
technically demanding and expensive. It is also still a very big
technological challenge to hybridize between 10,000 and 20,000
different cDNA products quantitatively to a gene-chip containing
between 25,000 and 100,000 different cDNA probes without getting a
significant amount of mismatch hybridization. Another drawback with
DNA array technology is that high quality sequence information is
necessary for all the genes used on the array. Still the technology
is relatively easy to use once the arrays have been designed and
manufactured.
[0018] Additional methods for analyzing and demonstrating
differential gene expression have been disclosed in e.g. WO
94/01582; WO 97/10363; WO 97/13877; WO 98/10095; WO 98/15652; WO
98/31380; WO 98/44152; WO 98/48047; WO 99/02725; WO 99/02726; WO
99/02727; WO 99/02728; WO 99/39001; WO 00/53806; U.S. Pat. No.
5,508,169; U.S. Pat. No. 5,658,736; U.S. Pat. No. 6,090,553; and EP
735 144 A1.
[0019] Reference is also made to Cowan et al. (J. Theor. Biol.,
1987, vol. 127, p. 229-245), who disclose breakage of
double-stranded DNA due to single-stranded nicking. The nicking
activity is not site-specific. Morgan et al. (Biol. Chem., 2000,
vol. 361, p. 1123-1125) disclose a characterization of the specific
DNA nicking activity of restriction endonuclease N.BstNBI.
[0020] None of the above methods are related to a method for
obtaining--and optionally analyzing the sequence of--at least one
single stranded polynucleotide tag originating at least partly from
a biological sample and comprising a consecutive sequence of bases,
wherein--prior to sequence analysis or other characterization--no
part of the single stranded polynucleotide tag comprises a
complementary polynucleotide strand, and wherein preferably all of
the bases originate from the biological sample, such as more than
95% of the bases, for example more than 90% of the bases, such as
more than 85% of the bases, for example more than 80% of the bases,
such as more than 75% of the bases originating from the biological
sample.
[0021] Furthermore, none the above methods exploit a cleavage
agent, preferably in the form of a site-specific nicking
endonuclease capable of i) recognizing a predetermined nucleotide
motif comprising complementary nucleotide strands and ii) cleaving
only one of said complementary strands in the process of generating
at least one single stranded polynucleotide tag.
SUMMARY OF THE INVENTION
[0022] It is an objective of the present invention to obtain
reproducible representations of expressed mRNA molecules by
exploiting a novel technique that relies on short polynucleotide
tags comprising nucleotide sequence information. In one preferred
embodiment, only one polynucleotide tag is obtained from each mRNA
molecule, and relatively simple counting statistics can thus be
applied after identification and sampling of the different tags, or
a subset of tags being present in the population of representative
tags. The present invention thus provides signal-to-noise ratios
sufficient for utilizing very simple counting statistics.
[0023] The information carried by the different types of
polynucleotide tags lies not only in the unique sequence of each
tag originating from one mRNA molecule. Other types of information
includes the orientation of the tag (sense or anti-sense) and the
location of the tag relative to the 3' or 5' ends or relative to
internal restriction sites in the cDNA molecule. Having preferably
gathered all this information in addition to the sequence of at
least one specific polynucleotide tag according to the present
invention, specific expressed sequence tags (ESTs) that are
represented by the specific tag can readily be identified. The
identification may preferably be performed by searching a database
of EST sequences. Subsequently, the ESTs comprising the sequence of
the tag can readily be obtained or isolated from a biological
sample. It is also possible to use one identified ssDNA tag
sequence directly as a primer, or a part thereof, in a
gene-specific PCR reaction in order to isolate gene-specific
sequences.
[0024] The tags according to the present invention are preferably
single stranded polynucleotide tags obtained by subjecting genetic
material derived from a biological sample to at least one
site-specific nicking endonuclease capable of i) recognizing a
predetermined nucleotide motif comprising complementary nucleotide
strands and ii) cleaving only one of said complementary strands in
the process of generating the at least one single stranded
polynucleotide tag. The tag may subsequently be identified and/or
amplified as described herein further below.
[0025] As explained in detail herein below, the present invention
provides novel and innovative solutions to the problem of how to
obtain reproducible representations of molecules expressed in a
biological sample.
[0026] The present invention for the first time demonstrates that
nicking endonucleases may advantageously be used for obtaining and
isolating ssDNA tags. This novel approach in one embodiment
eliminates the occurrence of any linker sequence in the ssDNA tag
and it eliminates the presence of a complementary strand in the
isolated polynucleotide tag. The lack of linker sequence in the tag
and the lack of any complementary strand serves to reduce the huge
complexities associated with the analysis of expressed molecules in
a biological sample.
[0027] It is not necessary according to the present invention to
use full length cDNA for expression profiling--truncated cDNAs may
also be exploited, and tags arising from the 3' end or from the 5'
end of the mRNA can be analyzed at will.
[0028] In one preferred embodiment, only one ssDNA tag is isolated
from each mRNA molecule. This facilitates and ensures a direct
correlation between i) the abundance, i.e. relative amount, of any
one ssDNA tag and ii) the expression of the corresponding mRNA
molecule in a biological sample. The increased correlation between
the ssDNA tag and the mRNA as well as the decreased complexity
serves to achieve a higher success rate when tracking changes in
gene expression.
[0029] It is possible to automate the isolation of the ssDNA tags
from a biological sample by using e.g. robot technology or a
microfluid device. The signal generated by a label can easily be
amplified using e.g. asymmetric ligase chain reaction (LCR),
thereby preserving the tight correlation between the abundance of
one ssDNA tag and the expression of the corresponding mRNA
molecule.
[0030] As an alternative solution, the signal can be amplified by
cloning ssDNA tags into extrachromosomal replicons, including
plasmids and phages, and subsequently releasing the tags after in
vivo amplification, thereby preserving the tight correlation
between the abundance of one ssDNA tag sequence and the expression
of the corresponding mRNA molecule.
[0031] As another alternative, the signal can be amplified by using
PCR. As with every other technique that uses PCR, the tight
correlation between the abundance of one ssDNA tag and the
expression of the corresponding mRNA molecule is likely to be
jeopardized to some extent due to different amplification
efficiencies of sequences having different C/G content. It is also
possible to use one identified ssDNA tag sequence directly as a
primer, or a part thereof, in a gene-specific PCR reaction in order
to isolate genespecific sequences.
[0032] It is also possible to automate the amplification of the
signal regardless of asymmetric LCR, in vivo amplification or PCR
are used for the signal amplification. This may be achieved e.g. by
using a robot or a microfluid device in combination with a peltier
element.
[0033] The present invention used in combination with any state of
the art array technology makes expression profiling experiments
more cost effective to conduct. In particular, more than one
display technology can be used at will or in combination. Cost
effectiveness is also associated with an automated analysis of the
ssDNA tags, e.g. by using a robot or a microfluid device in
combination with a mass spectrometer, an array, an UV/VIS
spectrometer or a fluorometer, including any combination
thereof.
[0034] In one embodiment, the present invention makes it possible
to concatenate the ssDNA tags by using dsDNA linkers. After cloning
and sequencing, a more accurate picture of the expression profile
as compared to SAGE is obtained in this way as the use of PCR can
be avoided. The present invention thus provides signal-to-noise
ratios sufficient for utilizing very simple counting
statistics.
[0035] The invention can also be used to analyze genomic DNA,
thereby moving into areas such as methylation profiling and SNP
profiling (single nucleotide polymorphism). Consequently, the
present invention covers such diverse areas as expression
profiling, genotyping, epigenotyping, and diagnostics.
[0036] The present invention can also be used to elucidate new
etiologies of disease related phenotypes and discover new modes of
disease.
[0037] The present invention can also be used to discover new uses
of known drugs, to pinpoint new drug targets, to monitor specific
diagnostic markers, and to make diagnostic kits.
[0038] In one embodiment, the tags according to the present
invention are used for expression profiling. The tags can either be
concatemerized, sequenced and counted; or just used in a
conventional array expression profiling experiment instead of full
length mRNA or cDNA molecules. In the latter case, one significant
advantage is that any background originating from a
cross-hybridization between different sequences with one or more
mismatches can be significantly reduced due to the more simple
hybridization dynamics of shorter nucleotides compared with longer
nucleotides. The dynamics is even more favorable if the tag is
ligated onto the oligo probe in the array. The identity and
abundance of each tag sequence can also be displayed by means of
gel electrophoresis following ligation to a set of identifying
linker oligonucleotides with overhang sequences that correspond to
their length. In a similar fashion, mass spectroscopy or a
micro-fluid device can also be employed in the process of sorting
the tags and/or displaying the identity and abundance of each tag
sequence. The tags are preferably linked to a suitable label that
enables identification of the tag. The label may form part of the
identifying linker oligonucleotide. Alternatively, the label may
form part of a molecular identifier comprised by the identifying
linker oligonucleotide. Accordingly, the molecular identifier may
facilitate both sorting and/or detection of the tag in question.
The sorting may be performed e.g. when a plurality of tags are
attached to a plurality of identifying linker oligonucleotides
comprising a molecular identifier. Separation preferably occurs by
means of differences among molecular identifiers in terms of
molecular weight, size, charge electromagnetic properties, or
affinity among predetermined specific binding partners. The latter
shall comprise antigens and antibodies, or binding fragments
thereof, including epitopes and monoclonal antibodies, including
binding fragments thereof. A further example of specific binding
partners is biotin, and avidin or streptavidin, respectively.
[0039] When doing expression profiling experiments, it is not
necessary to incorporate a procedure to enrich for different
behavior of genes between to types of cells (commonly known as the
"normal" and the "aberrant" cell) if relatively simple counting
statistics (as modeled e.g. by the Poisson distribution) can be
applied in the sampling procedure. If that is the case the
comparison between the "normal" and the "aberrant" cells can be
carried out in a database containing the expression profiles of the
"normal" and the "aberrant" cells, respectively. If relatively
simple counting statistics cannot be applied it may be necessary to
either incorporate a procedure to enrich for differential behavior
of genes or to use a large number of test samples to equal out
random noise. The number of samples necessary in the latter case
depends upon the signal-to-noise ratio of the method used in the
expression profiling experiments.
[0040] When the present invention relates to methods for making
expression profiling, the profiling is used to compare the
expression of genes, or a subset of genes, in samples comprising a
biological cell or a plurality of such cells, either directly or
through a database comprising expression profiles.
[0041] The objective of the analysis is to elucidate which genes
are expressed in a first type of cell, but not expressed, or
expressed at a different level, in a second type of cell. Each
expressed gene is initially identified by obtaining and identifying
a unique polynucleotide tag that can be correlated to an expressed
gene. The correlation enables a positive identification of each
expressed gene and a very accurate assertion of the abundance of
each expressed gene.
[0042] The analysis according to the present invention facilitates
a characterization of the selected cell type and differentiates
said cell type from other cell types, or essentially identical cell
types having different histories.
[0043] The invention in further aspects relates to methods for
identifying the polynucleotide tag, methods for identifying the
nucleotide sequence of the tag, and methods for displaying an
expression profile. The invention in further aspects also relates
to using said expression profile, or a part thereof, obtained from
a predetermined first cell and comparing said profile with that of
a predetermined second cell.
[0044] In even further aspects the present invention relates to
methods for treatment of a clinical condition or a genetic disorder
in an individual, and methods for performing a diagnosis of a
clinical condition or a genetic disorder in an individual, wherein
said methods for treatment and/or diagnosis exploit either the
method for displaying the results obtained from the analysis of the
differential gene expression, or the method for analyzing an
expression profile through a database comprising expression
profiles.
[0045] There is also provided a kit of parts for performing the
methods pertaining to the invention as described herein immediately
above.
[0046] In a preferred aspect the present invention relates to a
method for obtaining at least one single stranded polynucleotide
tag from a biological sample, said method comprising the steps of
[0047] i) providing at least one double stranded polynucleotide,
wherein the polynucleotide is selected from the group of
polynucleotides consisting of polynucleotides comprising
complementary DNA (cDNA), polynucleotides comprising genomic DNA,
and polynucleotides comprising extra-genomic DNA, [0048] ii)
contacting and cleaving at least one of the complementary strands
of the double stranded polynucleotide provided in step i) with at
least one cleavage agent capable of recognizing a double stranded
polynucleotide comprising complementary polynucleotide strands and
cleaving only one of the strands of the polynucleotide provided in
step i), and [0049] iii) obtaining at least one single stranded
polynucleotide tag.
[0050] In preferred embodiments the method comprises the further
step(s) of i) isolating the tag and/or ii) determining the sequence
of the tag and/or iii) quantifying the tag against a predetermined
standard.
BRIEF DESCRIPTION OF THE DRAWINGS
[0051] FIG. 1: Common features of type IIs restriction
endonucleases and nicking endonucleases. A) Recognition/binding
site. B) Cleavage site. 5' PO.sub.4 and 3' OH groups are not
shown,
[0052] FIG. 2: dsDNA after treatment with type IIs restriction
endonuclease producing 3' overhangs. A) Recognition/binding site.
B) Cleavage site. I) Just after cleavage. II) Fragments after
separation. 5' PO.sub.4 and 3' OH groups are not shown.
[0053] FIG. 3: dsDNA after treatment with type IIs restriction
endonuclease producing 5' overhangs. A) Recognition/binding site.
B) Cleavage site. I) Just after cleavage. II) Fragments after
separation. 5' PO.sub.4 and 3' OH groups are not shown.
[0054] FIG. 4: dsDNA after treatment with nicking endonuclease
cleaving the sense string downstream from recognition/binding site.
A) Recognition/binding site. B) Cleavage site. I) Just after
cleavage. II) Fragments after separation. 5' PO.sub.4 and 3' OH
groups are not shown.
[0055] FIG. 5: dsDNA after treatment with nicking endonuclease
cleaving the anti-sense string downstream from recognition/binding
site. A) Recognition/binding site. B) Cleavage site. I) Just after
cleavage. II) Fragments after separation. 5' PO.sub.4 and 3' OH
groups are not shown.
[0056] FIG. 6: Creation of an ssDNA tag from dsDNA comprising a
nicking endonuclease recognition/binding site between a type IIs
restriction endonuclease recognition/binding site and the cleavage
site for said type IIs restriction endonuclease, when said type IIs
restriction endonuclease produces 5' overhangs. A)
Recognition/binding site for type IIs restriction endonuclease. B)
Recognition/binding site for nicking endonuclease. C) Cleavage site
for nicking endonuclease. D) Cleavage site for type IIs restriction
endonuclease. I) The dsDNA after cleavage with type IIs restriction
endonuclease producing 5' overhangs. II) Downstream fragments are
discarded and the remaining fragment is cleaved with nicking
endonuclease. III) The ssDNA tag is separated from the remaining
dsDNA fragment. 5' PO.sub.4 and 3' OH groups are not shown.
[0057] FIG. 7: Creation of an ssDNA tag from dsDNA comprising a
nicking endonuclease recognition/binding site between a type IIs
restriction endonuclease recognition/binding site and the cleavage
site for said type IIs restriction endonuclease, when said type IIs
restriction endonuclease produces 3' overhangs. A)
Recognition/binding site for type IIs restriction endonuclease. B)
Recognition/binding site for nicking endonuclease. C) Cleavage site
for nicking endonuclease. D) Cleavage site for type IIs restriction
endonuclease. I) The dsDNA after cleavage with type IIs restriction
endonuclease producing 3' overhangs. II) Downstream fragments are
discarded and the remaining fragment is cleaved with nicking
endonuclease. III) The ssDNA tag is separated from the remaining
dsDNA fragment. 5' P and 3' OH groups are not shown.
[0058] FIG. 8: Creation of an ssDNA tag from dsDNA comprising a
nicking endonuclease recognition/binding site, that is situated
proximal to a type IIs restriction endonuclease recognition/binding
site as the cleavage site for said type IIs restriction
endonuclease is distal to said type IIs restriction endonuclease
recognition/binding site. This is illustrated with hatched boxes
having different shadings. Some of the sites are drawn as if they
were overlapping each other. In fact for as long as the general
order of the recognition/binding sites and the corresponding
cleavage sites is maintained, any number of depicted
recognition/binding sites may overlap with neighbouring sites. The
situation depicted is when said type IIs restriction endonuclease
produces 5' overhangs. A) Recognition/binding site for nicking
endonuclease. B) Recognition/binding site for type IIs restriction
endonuclease. C) Cleavage site for nicking endonuclease. D)
Cleavage site for type IIs restriction endonuclease. I) The dsDNA
is cleaved with type IIs restriction endonuclease producing 5'
overhangs. II) Down-stream fragments are discarded and the
remaining fragment is cleaved with nicking endonuclease. III) The
ssDNA tag is separated from the remaining dsDNA fragment. 5'
PO.sub.4 and 3' OH groups are not shown.
[0059] FIG. 9: Creation of a ssDNA tag from dsDNA comprising a
nicking endonuclease recognition/binding site, that is situated
proximal to a type IIs restriction endonuclease recognition/binding
site as the cleavage site for said type IIs restriction
endonuclease is distal to said type IIs restriction endonuclease
recognition/binding site. This is illustrated with hatched boxes
having different shadings. Some of the sites are drawn as if they
were overlapping each other. In fact for as long as the general
order of the recognition/binding sites and the corresponding
cleavage sites is maintained, any number of depicted
recognition/binding sites may overlap with neighbouring sites. The
situation depicted is when said type IIs restriction endonuclease
produces 3' overhangs. A) Recognition/binding site for nicking
endonuclease. B) Recognition/binding site for type IIs restriction
endonuclease. C) Cleavage site for nicking endonuclease. D)
Cleavage site for type IIs restriction endonuclease. I) The dsDNA
is cleaved with type IIs restriction endonuclease producing 3'
overhangs. II) Down-stream fragments are discarded and the
remaining fragment is cleaved with nicking endonuclease. III) The
ssDNA tag is separated from the remaining dsDNA fragment. 5'
PO.sub.4 and 3' OH groups are not shown.
[0060] FIG. 10: Creation of chimeric dsDNA using either a blunt
ended adapter or an adapter with 3' or 5' overhangs respectively.
The adapter comprises a nicking endonuclease recognition/binding
site, that is situated proximal to a type IIs restriction
endonuclease recognition/binding site as the cleavage site for said
type IIs restriction endonuclease is distal to the cleavage site
for said nicking endonuclease. This is illustrated with hatched
boxes having different shadings. Some of the sites are drawn as if
they were overlapping each other. In fact for as long as the
general order of the recognition/binding sites and the
corresponding cleavage sites is maintained, any number of depicted
recognition/binding sites may overlap with neighbouring sites. A)
Recognition/binding site for nicking endonuclease. B)
Recognition/binding site for type IIs restriction endonuclease. C)
Cleavage site for nicking endonuclease. D) Overhang or blunt end of
adapter corresponding to the specific cleavage over-hang of the
type II restriction endonuclease used for cleavage of the dsDNA
that is used in the creation of the chimeric dsDNA. E)
Recognition/binding and cleavage site for type II restriction
endonuclease after cleavage of dsDNA F) Cleavage site for type IIs
restriction endonuclease. I) Ligation of blunt ended adapter to
dsDNA after cleavage of dsDNA with type II restriction
endonuclease. II) Ligation of adapter to dsDNA with 3' overhangs
after cleavage of dsDNA with type II restriction endonuclease. III)
Ligation of adapter to dsDNA with 5' overhangs after cleavage of
dsDNA with type II restriction endonuclease. IV) After ligation
using either I) blunt end II) 3', or III) 5' overhangs the
resulting chimeric dsDNA has a cleavage site for a nicking
endonuclease immediately 3' of a type IIs restriction endonuclease
recognition/binding site and a cleavage site for said type IIs
restriction endonuclease 3' of the cleavage site for said nicking
endonuclease. 5' PO.sub.4 and 3' OH groups are not shown.
[0061] FIG. 11: Creation of chimeric dsDNA using either a blunt
ended adapter or an adapter with 3' or 5' overhangs respectively.
The adapter has a type IIs restriction endonuclease
recognition/binding site that is situated proximal to a nicking
endonuclease recognition/binding site as the cleavage site for said
type IIs restriction endonuclease is distal to said type IIs
restriction endonuclease recognition/binding site. This is
illustrated with hatched boxes having different shadings. Some of
the sites are drawn as if they were overlapping each other. In fact
for as long as the general order of the recognition/binding sites
and the corresponding cleavage sites is maintained, any number of
depicted recognition/binding sites may overlap with neighbouring
sites. A) Recognition/binding site for type IIs restriction
endonuclease. B) Recognition/binding site for nicking endonuclease.
C) Overhang or blunt end of adapter corresponding to the specific
cleavage overhang of the type II restriction endonuclease used for
cleavage of the dsDNA that is used in the creation of the chimeric
dsDNA. D) Recognition/binding and cleavage site for type II
restriction endonuclease after cleavage of dsDNA. E) Cleavage site
for nicking endonuclease. F) Cleavage site for type IIs restriction
endonuclease. I) Ligation of blunt ended adapter to dsDNA after
cleavage of dsDNA with type II restriction endonuclease. II)
Ligation of adapter with 3' overhang to dsDNA with 3' overhangs
after cleavage of dsDNA with type II restriction endonuclease. III)
Ligation of adapter with 5' overhang to dsDNA with 5' overhangs
after cleavage of dsDNA with type II restriction endonuclease. IV)
After ligation using either I) blunt end II) 3', or III) 5'
overhangs the resulting chimeric dsDNA has a recognition/binding
site for a nicking endonuclease immediately 3' of a type IIs
restriction endonuclease recognition/binding site and a cleavage
site for said type IIs restriction endonuclease 3' of the cleavage
site for said nicking endonuclease. 5' PO.sub.4 and 3' OH groups
are not shown.
[0062] FIG. 12: Creation of chimeric dsDNA using ligation of an
adapter to mRNA before reverse transcription. Said adapter
harboring part of a nicking endonuclease recognition/binding site,
that is situated proximal to a type II is restriction endonuclease
recognition/binding site as the cleavage site for said type IIs
restriction endonuclease is distal to the cleavage site of said
nicking endonuclease. This is illustrated with hatched boxes having
different shadings. Some of the sites are drawn as if they were
overlapping each other. In fact for as long as the general order of
the recognition/binding sites and the corresponding cleavage sites
is maintained, any number of depicted recognition/binding sites may
overlap with neighbouring sites. A) Recognition/binding site for
nicking endonuclease. B) Recognition/binding site for type IIs
restriction endonuclease. C) Cleavage site for nicking
endonuclease. D) Cleavage site for type IIs restriction
endonuclease. I) mRNA contains a 5' cap. Contamination from
degrated mRNA, tRNA, rRNA and DNA is eliminated by treating the RNA
sample with phosphatase. II) A pyrophosphatase is used to remove
the 5' cap on the mRNA and the adapter is mixed with the decapped
mRNA III) The adapter is ligated to the 5' end of the mRNA. IV)
Reverse transcription is carried out using random decamers. V)
After second strand synthesis is carried out using a primer with
the sequence of the adapter the resulting chimeric dsDNA has a
cleavage site for a nicking endonuclease immediately 3' of a type
IIs restriction endonuclease recognition/binding site and a
cleavage site for said type IIs restriction endonuclease 3' of the
cleavage site for said nicking endonuclease. Selected 5' PO.sub.4
and 3' OH groups are indicated.
[0063] FIG. 13: Creation of chimeric dsDNA using ligation of an
adapter to mRNA before reverse transcription. Said adapter
harboring part of a type IIs restriction endonuclease
recognition/binding site, that is situated proximal to a nicking
endonuclease recognition/binding site as the cleavage site for said
type IIs restriction endonuclease is distal to the cleavage site of
said nicking endonuclease. This is illustrated with hatched boxes
having different shadings. Some of the sites are drawn as if they
were overlapping each other. In fact for as long as the general
order of the recognition/binding sites and the corresponding
cleavage sites is maintained, any number of depicted
recognition/binding sites may overlap with neighbouring sites. A)
Recognition/binding site for type IIs restriction endonuclease. B)
Recognition/binding site for nicking endonuclease. C) Cleavage site
for nicking endonuclease. D) Cleavage site for type IIs restriction
endonuclease. I) mRNA contains a 5' cap. Contamination from
degrated mRNA, tRNA, rRNA and DNA is eliminated by treating the RNA
sample with phosphatase. II) A pyrophosphatase is used to remove
the 5' cap on the mRNA and the adapter is mixed with the decapped
mRNA III) The adapter is ligated to the 5' end of the mRNA IV)
Reverse transcription is carried out using random decamers. V)
After second strand synthesis is carried out using a primer with
the sequence of the adapter the resulting chimeric dsDNA has a
recognition/binding site for a nicking endonuclease immediately 3'
of a type IIs restriction endonuclease recognition/binding site and
a cleavage site for said type IIs restriction endonuclease 3' of
the cleavage site for said nicking endonuclease. Selected 5'
PO.sub.4 and 3' OH groups are indicated.
[0064] FIG. 14: Every ssDNA tag in the population of ssDNA tags is
analyzed as illustrated with only one ssDNA tag in this figure.
Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. I) A first
identifying linker oligonucleotide A) is in this example comprising
a 5' over-hang with a sequence complementary to the 5' end of an
ssDNA tag. The identifying linker is either attached to a
predetermined position in an array or it is optionally comprising
one or more molecular identifiers or labels, or any combination
thereof that are used in the identification and quantification
steps. The ssDNA tag B) illustrated here has a 5' end complementary
to the 5' overhang of the first identifying linker oligonucleotide
and a 3' end complementary to the 3' overhang of the second
identifying linker oligonucleotide C). The second identifying
linker oligonucleotide is either attached to a predetermined
position in an array or it is optionally comprising one or more
molecules or labels or any combination thereof, that are used in
the identification and quantification steps. Both the first and the
second identifying linker oligonucleotide can optionally comprise a
recognition/binding site for one or more site-specific
endonucleases including restriction endonucleases and/or nicking
endonucleases. The X in the circle can either be a solid support or
a molecule that is used to identify and/or quantify the ssDNA tag
linked to a first identifying linker oligonucleotide; optionally in
combination with the X on a second identifying linker
oligonucleotide attached to the same ssDNA tag. Attached shall in
this respect denote attached by means of ligation or hybridization.
X can be linked to the 3' or to the 5' end of one or both of the
two DNA strands in an identifying linker oligonucleotide or it can
be linked to any of the bases or to the backbone structure at any
position(s) serving the purpose, including any combination thereof.
See the definition of identifying linker oligonucleotide for
further examples of X. II) The steps involved includes providing at
least one identifying linker oligonucleotide A) having a 3' or 5'
overhang complementary to an ssDNA tag or a part of an ssDNA tag
(in this example an identifying linker oligonucleotide having a 5'
overhang is used and only one identifying linker oligonucleotide is
shown, but 3' overhangs may also be used along with any suitable
plurality of identifying linker oligonucleotides); B) exposing the
ssDNA tags to the linker. III) After contacting and hybridizing
said identifying linker to an ssDNA tag forming a hybrid
oligonucleotide tag, the ssDNA tag is preferably ligated to the
identifying linker thereby producing a chimeric polynucleotide tag
A) comprising an ssDNA tag derived from a biological sample and a
synthetic, identifying linker oligonucleotide. This chimeric
polynucleotide is capable of being linked to the second identifying
linker B) having a complementary overhang opposite to that of the
first identifying linker oligonucleotide (e.g. when the first
identifying linker oligonucleotide has a 5' overhang, the second
identifying linker oligonucleotide has a 3' overhang, and vice
versa). IV) After a second ligation step the chimeric
polynucleotide tag A) becomes double stranded along the entire
length of the original ssDNA tag. It is possible to quantify each
double stranded chimeric tag by employing a combination of a solid
support and/or a molecule attached to one or both of the two
identifying linker oligonucleotides. Such molecules are termed
"molecular identifiers" and it will be understood that any unique
identifying linker oligonucleotide may comprise at least one unique
molecular identifier. The molecular identifier makes it possible to
identify the identifying linker oligonucleotide capable of
identifying the single stranded nucleotide tag according to the
invention. Examples of molecular identifiers are listed under
"Definitions" herein. The identifying linker oligonucleotides
themselves can be blocked in any end of the two DNA strands. For
example by not having a 5' PO.sub.4 group or a 3' OH group or any
combination thereof. Furthermore the two DNA strands in one linker
can be covalently linked together in one end or at any point along
the length of the linker. For example by making the linker out of
one palindromic DNA strand looping back onto itself. The combined
length of the two overhangs can either be equal to or shorter than
the ssDNA tag that is being identified by the combination of the
two overhangs of the first and second identifying linker. The two
overhangs of the first and the second identifying linker
oligonucleotide do not have to be of equal length. Furthermore,
double stranded linkers are only required if they are to be ligated
to the ssDNA tag or if a fixed offset is required. In other
instances single stranded linkers can be used as well. Selected 5'
PO.sub.4 and 3' OH groups are indicated.
[0065] FIG. 15: As illustrated in FIGS. 15 through 18, a subset of
ssDNA tags can be identified and quantified using an array. A
population of ssDNA tags A) is exposed to identifying linker
oligonucleotides B) attached to a solid support in an array. The
identifying linker oligonucleotides are ordered in the array
according to the sequence of their overhangs. 5' overhangs are
indicated, but 3' overhangs may also be used, along with any
suitable plurality of identifying linker oligonucleotides.
Accordingly, although only three different identifying linker
oligonucleotides are shown, and only in duplicates (i.e. two of
each), any number of different identifying linker oligonucleotides
can be used, and a comparatively large number of each identifying
linker oligonucleotide may be attached closely together within the
confined area defining that particular identifying linker
oligonucleotide in the array. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0066] FIG. 16: The ssDNA tags are ligated to the identifying
linker oligonucleotides in the array. This way a part of the
sequence in the ssDNA tags is used to sort the ssDNA tags. In this
case this part is at the 5' end of the ssDNA tags, but the sequence
in the 3' end of the ssDNA tag may also be used as well. Different
shading of strands illustrates different sequences. Complementary
sequences are shown with the same shading. Selected 5' PO.sub.4 and
3' OH groups are indicated.
[0067] FIG. 17: A) A specific identifying linker oligonucleotide in
solution with a predetermined sequence in the overhang and
comprising a label A) is exposed to the population of chimeric tags
B) made from ssDNA tags ligated to the identifying linker
oligonucleotides in the array. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0068] FIG. 18: A specific identifying linker oligonucleotide
comprising a predetermined sequence in the overhang and comprising
a label is contacted and ligated to the population of ssDNA tags
ligated to the identifying linker oligonucleotide in the array.
Then the individual intensities of all the positions in the array
are recorded to determine the relative amount of the individual
ssDNA tags in the subset. This completes the analysis of a panel of
ssDNA tags sharing the same sequence in their 3' end. Different
shading of strands illustrates different sequences. Complementary
sequences are shown with the same shading. Selected 5' PO.sub.4 and
3' OH groups are indicated.
[0069] FIG. 19: As illustrated in FIG. 15 through 22 a whole
population of ssDNA tags can be identified and quantified using an
array. Starting from FIG. 18 a specific identifying linker
oligonucleotide in solution with a predetermined sequence in the
overhang that is different from the sequence used in FIG. 17 and
comprising a label A) is exposed to the population of chimeric tags
B) made from ssDNA tags ligated to the identifying linker
oligonucleotides in the array. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0070] FIG. 20: A specific identifying linker oligonucleotide
comprising a predetermined sequence in the overhang that is
different from the sequence used in FIG. 17 and comprising a label
is ligated to the population of chimeric tags made from ssDNA tags
ligated to the identifying linker oligonucleotides in the array.
Then the individual intensities of all the positions in the array
are recorded. To determine the relative amount of the individual
ssDNA tags in this second panel of ssDNA tags that share a common
sequence in their 3' end the recordings from the previous panel
(See FIG. 18) is subtracted. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0071] FIG. 21: The process described in FIG. 19 through 20 is
iterated until all possible sequences in the overhang of the
specific identifying linker oligonucleotide in solution with a
predetermined sequence in the overhang and comprising a label have
been used. Ultimately, a last specific identifying linker
oligonucleotide in solution comprising a predetermined sequence in
the overhang that is different from all the sequence previously
used in the steps described in FIG. 17 through 20 and comprising a
label A) is exposed to the population of chimeric tags B) made from
ssDNA tags ligated to the identifying linker oligonucleotide in the
array. Different shading of strands illustrates different
sequences. Complementary sequences are shown with the same shading.
Selected 5' PO.sub.4 and 3' OH groups are indicated.
[0072] FIG. 22: The last specific identifying linker
oligonucleotide comprising a predetermined sequence in the overhang
that is different from all the sequences previously used in the
steps described in FIG. 17 through 20 and comprising a label is
ligated to the population of chimeric tags made from ssDNA tags
ligated to the identifying linker oligonucleotides in the array.
Then the individual intensities of all the positions in the array
are recorded. To determine the relative amount of the individual
ssDNA tags in this last panel of ssDNA tags that share a common
sequence in their 3' end all the recordings from the previous
panels are subtracted. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. If the identifying linker oligonucleotides in
solution are comprising labels of a different color for each
different sequence of their overhang, then a plurality of different
identifying linker oligonucleotides in solution may be exposed,
hybridized and ligated simultaneously. An optical separation can
then give data for each subset. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0073] FIG. 23: As illustrated in FIG. 23 through 30 a whole
population of ssDNA tags can be identified and quantified using an
array in another preferred embodiment. In this embodiment both the
variable end of the identifying linker oligonucleotide and the
ssDNA tag is protected against cleavage with methylated bases. A
specific identifying linker oligonucleotide in solution A)
comprising a predetermined sequence in the overhang and comprising
a label and a cleavage site for a site-specific restriction
endonuclease (hatched box) is exposed to the population of chimeric
tags B) made from ssDNA tags ligated to the identifying linker
oligonucleotides in the array (See FIG. 16). Different shading of
strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0074] FIG. 24: A specific identifying linker oligonucleotide
comprising a predetermined sequence in the overhang and comprising
a label and a cleavage site for a site-specific restriction
endonuclease (hatched box) is contacted and ligated to the
population of chimeric tags made from ssDNA tags ligated to the
identifying linker oligonucleotides in the array. Then the
individual intensities of all the positions in the array are
recorded to determine the relative amount of the individual ssDNA
tags in the subset. This completes the analysis of a panel of ssDNA
tags sharing the same sequence in their 3' end. Different shading
of strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0075] FIG. 25: The array is subsequently exposed to a restriction
endonuclease recognizing and cleaving the unmethylated cleavage
site introduced with the identifying linker oligonucleotide
previously ligated to a subset of the chimeric tags and all the
labels are cleaved from the chimeric tags and subsequently washed
off of the array. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0076] FIG. 26: A specific identifying linker oligonucleotide in
solution A) comprising a predetermined sequence in the overhang
that is different from the sequence used in FIGS. 23 and 25 and
comprising a label and a cleavage site for a site-specific
restriction endonuclease (hatched box) is exposed to the population
of chimeric tags B) made from ssDNA tags ligated to the identifying
linker oligonucleotides in the array. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' P and 3' OH groups are
indicated.
[0077] FIG. 27: A specific identifying linker oligonucleotide
comprising a predetermined sequence in the overhang that is
different from the sequence used in FIGS. 23 and 25 and comprising
a label and a cleavage site for a site-specific restriction
endonuclease (hatched box) A) is ligated to the population of
chimeric tags made from ssDNA tags ligated to the identifying
linker oligonucleotides in the array. Then the individual
intensities of all the positions in the array are recorded.
Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. Selected
5' PO.sub.4 and 3' OH groups are indicated.
[0078] FIG. 28: The array is subsequently exposed to a restriction
endonuclease recognizing and cleaving the unmethylated cleavage
site introduced with the identifying linker oligonucleotide
previously ligated to a subset of the chimeric tags in FIG. 27 and
all the labels are cleaved from the chimeric tags and subsequently
washed off of the array. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0079] FIG. 29: The process described in FIG. 26 through 28 is
iterated until all possible sequences in the overhang of the
specific identifying linker oligonucleotide in solution comprising
a predetermined sequence in the overhang and comprising a label and
a cleavage site for a site-specific restriction endonuclease have
been used. Ultimately, a last specific identifying linker
oligonucleotide in solution A) comprising a predetermined sequence
in the overhang that is different from all the sequence previously
used in the steps described in FIG. 23 through 28 and comprising a
label and a cleavage site for a site-specific restriction
endonuclease (hatched box) is exposed to the population of chimeric
tags B) made from ssDNA tags ligated to the identifying linker
oligonucleotides in the array. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0080] FIG. 30: The last specific identifying linker
oligonucleotide comprising a predetermined sequence in the overhang
that is different from all the sequence previously used in the
steps described in FIG. 23 through 28 and comprising a label and a
cleavage site for a site-specific restriction endonuclease (hatched
box) is ligated to the population of chimeric tags made from ssDNA
tags ligated to the identifying linker oligonucleotides in the
array. Then the individual intensifies of all the positions in the
array are recorded to complete the profiling experiment. Different
shading of strands illustrates different sequences. Complementary
sequences are shown with the same shading. Selected 5' PO.sub.4 and
3' OH groups are indicated.
[0081] FIG. 31: In one preferred embodiment asymmetric LCR
amplification of the signal from each ssDNA tag can be carried out
as illustrated in FIG. 31 through 37. As a first step the ssDNA
tags are blocked in one end, for example by removing the 5'
phosphate group. These blocked ssDNA tags are then used in an
asymmetric ligase chain reaction (LCR) directly on an array to
amplify the signal derived from each ssDNA tag. An array similar to
that used in FIG. 15 A) and a linker in solution B) comprising a
predetermined sequence in the overhang and comprising a label and
having the 5' end next to the 3' end overhang blocked; for example
by removing the 5' phosphate group; is exposed to the ssDNA tags C)
having a blocked 5' end. In this case 5' overhangs are used on the
array, but 3' overhangs may also be used, in both cases along with
any suitable plurality of identifying linker oligonucleotides.
Accordingly, although only three different identifying linker
oligonucleotides are shown, and only in duplicates (i.e. two of
each), any number of different identifying linker oligonucleotides
can be used, and a comparatively large number of each identifying
linker oligonucleotide may be attached closely together within the
confined area defining that particular identifying linker
oligonucleotide in the array. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0082] FIG. 32: The conditions are manipulated so that the ssDNA
tags hybridize to the 5' overhangs of the linkers in the array A).
After hybridization the ssDNA tags together with the identifying
linker oligonucleotides in the array exposes a 3' overhang that the
identifying linker oligonucleotides in solution B) can hybridize
to. Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. Selected
5' PO.sub.4 and 3' OH groups are indicated.
[0083] FIG. 33: Concurrently the identifying linker
oligonucleotides comprising a label hybridizes to the exposed 3'
end of the ssDNA tags hybridized to the identifying linker
oligonucleotides in the array A). This complex is a substrate for
ligase, but because the ssDNA tags and the identifying linker
oligonucleotides in solution had their 5' end blocked only the two
identifying linker oligonucleotides can be ligated together.
Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. Selected
5' PO.sub.4 and 3' OH groups are indicated.
[0084] FIG. 34: The conditions are changed again; for example by
heating; leaving a number of identifying linker oligonucleotides
covalently attached to some of the linkers in the array A). If
necessary the concentration of the identifying linker
oligonucleotides in solution B) is adjusted to restore the initial
concentration. The ssDNA tags C) are restored in solution by the
changing of the conditions. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0085] FIG. 35: Again the conditions are changed; for example by
cooling down the array; making the ssDNA tags hybridize to the
identifying linker oligonucleotides in the array again A). Because
the number of identifying linker oligonucleotides in each spot in
the array exceeds the number of ssDNA tags having the same
complementary 5' end, the chances a tag hybridizes to an
identifying linker oligonucleotide that is already ligated to one
of the identifying linker oligonucleotides in solution is very
small. After hybridization the ssDNA tags together with the
identifying linker oligonucleotides in the array exposes a 3'
overhang that the identifying linker oligonucleotides in solution
B) can hybridize to. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0086] FIG. 36: Concurrently the identifying linker
oligonucleotides comprising a label hybridizes to the exposed 3'
end of the ssDNA tags hybridized to the identifying linker
oligonucleotides in the array. This complex is a substrate for
ligase, but because the ssDNA tags and the linker in solution had
their 5' end blocked only the two linkers can be ligated together.
Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. Selected
5' PO.sub.4 and 3' OH groups are indicated.
[0087] FIG. 37: After a number of cycles of the steps in FIG. 34
through 36 the signal from a subset of the ssDNA tags have been
amplified without consuming the ssDNA tags in the process. The
amplification products from the asymmetric LCR A) can now be
recorded after removal of the remaining linkers B) in solution. The
ssDNA tags C) can be separated from the linkers in solution and
used in a similar LCR with the next linker in solution with a
predetermined sequence in the overhang and comprising a label.
Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. Selected
5' PO.sub.4 and 3' OH groups are indicated.
[0088] FIG. 38: In one embodiment labels from the first LCR are
removed by cleaving the unmethylated recognition/binding site for a
type II restriction endonuclease on the second identifying linker
oligonucleotide with a methylation sensitive type II restriction
endonuclease, thereby eliminating the label that is subsequently
washed away A). A new identifying linker oligonucleotide in
solution B) comprising a predetermined sequence in the overhang and
comprising a label is introduced with the ssDNA tags C) that is
regenerated from the previous LCR. This whole process is repeated
with all the possible 4.sup.n sequence combinations of the
identifying linker oligonucleotide in solution. However, the
process may also be repeated using only a predetermined subset of
such combinations. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0089] FIG. 39: As illustrated in FIG. 39 through 43 in one
embodiment a subset of ssDNA tags can be identified and quantified
using two arrays. In this embodiment both the variable end of the
identifying linker oligonucleotide and the ssDNA tag is protected
against cleavage with methylated bases. In one embodiment an array
of identifying linker oligonucleotides comprising a label and a
recognition/binding site for a site-specific cleavage agent A) is
exposed to the ssDNA tags in solution B). Different shading of
strands illustrates different sequences. Likewise-different
restriction sites are depicted with different shading.
Complementary sequences are shown with the same shading. Different
restriction endonuclease recognition/binding sites are illustrated
with boxes of different shadings. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0090] FIG. 40: The ssDNA tags are ligated to the identifying
linker oligonucleotides in the array. This way a part of the
sequence in the ssDNA tags is used to sort the ssDNA tags. In this
illustration this part is at the 5' end of the ssDNA tags but the
3' end could have been used instead. Different shading of strands
illustrates different sequences. Likewise different restriction
sites are depicted with different shading. Complementary sequences
are shown with the same shading. Different restriction endonuclease
recognition/binding sites are illustrated with boxes of different
shadings. Selected 5' PO.sub.4 and 3' OH groups are indicated.
[0091] FIG. 41: A site-specific cleavage agent is used to free a
predetermined subset of chimeric tags from the array A). This
releases a subset of chimeric tags B) comprised of the ssDNA tags
and the identifying linker oligonucleotides in the array that was
cleaved. The label is released together with the chimeric tags.
Different shading of strands illustrates different sequences.
Likewise different restriction sites are depicted with different
shading. Complementary sequences are shown with the same shading.
Different restriction endonuclease recognition/binding sites are
illustrated with boxes of different shadings. Selected 5' PO.sub.4
and 3' OH groups are indicated.
[0092] FIG. 42: Another array A) is exposed to the released
chimeric tags B). Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0093] FIG. 43: After ligation the second array is now ready for
recording of the data. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0094] FIG. 44: As illustrated in FIG. 44 through 51 in one
embodiment a whole population of ssDNA tags can be identified and
quantified using e.g. a microfluid device. In one such embodiment,
both the variable end of the identifying linker oligonucleotide and
the ssDNA tag is protected against cleavage with methylated bases.
In a microfluid device a complete set of first identifying linker
oligonucleotides in solution A) comprising every combination of
sequence in the overhang, or a predetermined subset thereof, and
comprising a label and a predetermined molecular identifier capable
of identifying each predetermined overhang of the identifying
linker oligonucleotides and comprising a recognition/binding site
for a type if restriction endonuclease is exposed to a sample of
ssDNA tags B). Unique molecular identifiers are illustrated as M1,
M2, M3, and any suitable plurality of molecular identifiers can be
applied. The molecular identifier that makes it possible to
identify each identifying linker oligonucleotide comprising a
predetermined nucleotide sequence overhang can be i) a
predetermined epitope, or ii) a molecule comprised of a
predetermined number of subunits having the same, or almost the
same charge, mass, hydrophobic properties, three dimensional
structure, or any other physical or chemical property, or any
combination thereof, wherein the different molecular identifiers
comprise a different number of subunits, and wherein said
difference in the number of subunits makes it possible to separate
or identify individual molecular identifiers when subjecting these
to separation or identification techniques such as e.g. gel
electrophoresis or mass spectroscopy, or iii) a predetermined dsDNA
or ssDNA oligonucleotide having either a different predetermined
length, or a different predetermined sequence, optionally chosen
from a minimal cross hybridization set, or iv) a peptide of a
predetermined length or sequence, or v) a predetermined first
(small) molecule capable of binding to a second (larger) molecule,
e.g. biotin, or vi) any combination of i)-v). In this case 5'
overhangs are used, but 3' overhangs may also be used, in both
cases along with any suitable plurality of identifying linker
oligonucleotides. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0095] FIG. 45: Following ligation the chimeric dsDNA tags are
separated in the microfluid device by using molecular identifiers
that makes it possible to identify each predetermined overhang of
the first identifying linker oligonucleotides. Different shading of
strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0096] FIG. 46: After separation each pool of separated chimeric
dsDNA tags is comprised of chimeric dsDNA tags having a variety of
3' overhangs. Different shading of strands illustrates different
sequences. Complementary sequences are shown with the same shading.
Selected 5' PO.sub.4 and 3' OH groups are indicated.
[0097] FIG. 47: A site-specific cleavage agent is used to remove
the part of the chimeric dsDNA comprising a molecular identifier
that makes it possible to identify each predetermined overhang of
the first identifying linker oligonucleotides. Different shading of
strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0098] FIG. 48: The chimeric dsDNA tags A) are exposed to complete
set of second identifying linker oligonucleotides in solution B)
comprising every combination of sequence in the overhang or a
preselected subset thereof and comprising a molecular identifier
that makes it possible to identify each predetermined overhang of
the identifying linker oligonucleotides. If 5' overhangs are used
for the first set of identifying linker oligonucleotides in
solution, then 3' overhangs are used for the second set of
identifying linker oligonucleotides in solution and vice versa.
Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. Selected
5' PO.sub.4 and 3' OH groups are indicated.
[0099] FIG. 49: After ligation a set of chimeric dsDNA tags each
comprising a label and a molecular identifier that makes it
possible to identify each predetermined overhang of the second
identifying linker oligonucleotides is obtained. Different shading
of strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0100] FIG. 50: Using a microfluid device the chimeric dsDNA tags
are separated. Different shading of strands illustrates different
sequences. Complementary sequences are shown with the same shading.
Selected 5' PO.sub.4 and 3' OH groups are indicated.
[0101] FIG. 51: Before quantification of each chimeric dsDNA tag
the molecular identifier that makes it possible to identify each
predetermined overhang of the identifying linker oligonucleotides
is optionally removed by cleaving with a site-specific cleavage
agent. Different shading of strands illustrates different
sequences. Complementary sequences are shown with the same shading.
Selected 5' PO.sub.4 and 3' OH groups are indicated.
[0102] FIG. 52: In one embodiment asymmetric LCR amplification of
the signal from each ssDNA tag can be carried out in a microfluid
device as illustrated in FIG. 52 through 63. A complete set of
first identifying linker oligonucleotides in solution A) comprising
every combination of sequence in the overhang, or a predetermined
subset thereof, as illustrated by the different shading of the
strands, and comprising a label (L) and a molecular identifier (M)
capable of identifying each predetermined overhang of the
identifying linker oligonucleotides and also comprising a
recognition/binding site for a site-specific nicking endonuclease
(hatched box) is provided.
[0103] Said identifying linker oligonucleotides are exposed to a
sample of ssDNA tags B). The molecular identifier capable of
identifying each predetermined overhang of the identifying linker
oligonucleotides can be i) a predetermined epitope, or ii) a
molecule comprised of a predetermined number of subunits having the
same, or almost the same charge, mass, hydrophobic properties,
three dimensional structure, or any other physical or chemical
property, or any combination thereof, wherein the different
molecular identifiers comprise a different number of subunits, and
wherein said difference in the number of subunits makes it possible
to separate or identify individual molecular identifiers when
subjecting these to separation or identification techniques such as
e.g. gel electrophoresis or mass spectroscopy, or iii) a
predetermined dsDNA or ssDNA oligonucleotide having either a
different predetermined length, or a different predetermined
sequence, optionally chosen from a minimal cross hybridization set,
or iv) a peptide of a predetermined length or sequence, or v) a
predetermined first (small) molecule capable of binding to a second
(larger) molecule, e.g. biotin, or vi) any combination of i)-v). In
this case 5' overhangs are used, but 3' overhangs may also be used,
in both cases along with any suitable plurality of identifying
linker oligonucleotides. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0104] FIG. 53: Following ligation the chimeric dsDNA tags are
separated in the microfluid device by using the molecular
identifiers capable of identifying each predetermined overhang of
the identifying linker oligonucleotides. Different shading of
strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0105] FIG. 54: After separation each pool of separated chimeric
dsDNA tags are comprised of chimeric dsDNA tags having a variety of
3' overhangs. The first identifying linker oligonucleotide part of
the chimeric dsDNA tags of each pool all had the same sequence in
their overhang complementary to one end of the subset of ssDNA tags
attached to them before the ligation step. Different shading of
strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0106] FIG. 55: A site-specific nicking endonuclease is used to
separate the first identifying linker oligonucleotides A) from the
ssDNA tags B). Different shading of strands illustrates different
sequences. Complementary sequences are shown with the same shading.
Selected 5' PO.sub.4 and 3' OH groups are indicated.
[0107] FIG. 56: After cleavage with a site-specific nicking
endonuclease a phosphatase enzyme is employed in order to remove
the 5' phosphate from the ssDNA tags. If the first identifying
linker oligonucleotides are still in the reaction mixture at this
stage they will also have their 5' phosphate groups removed. This,
however, does not have any impact on the following steps.
Alternatively the 3' end could have been blocked instead if the
steps following this step are adapted accordingly. Different
shading of strands illustrates different sequences. Complementary
sequences are shown with the same shading. Selected 5' PO.sub.4 and
3' OH groups are indicated.
[0108] FIG. 57: A new set of first identifying linker
oligonucleotides A) comprising a 5' overhang complementary to the
5' end of the specific pool of ssDNA tags having been separated in
the previous steps described in FIG. 52 through 56 and comprising a
label are exposed to said pool of ssDNA tags B). A set of second
identifying linker oligonucleotides C) with 3' overhangs comprising
every combination of sequence in the overhang and comprising a
molecular identifier capable of identifying each predetermined
overhang of the identifying linker oligonucleotides and lacking the
5' phosphate group next to the overhang are exposed along with A)
and B). The molecular identifier capable of identifying each
predetermined overhang of the identifying linker oligonucleotides
can be i) a predetermined epitope, or ii) a molecule comprised of a
predetermined number of subunits having the same, or almost the
same charge, mass, hydrophobic properties, three dimensional
structure, or any other physical or chemical property, or any
combination thereof, wherein the different molecular identifiers
comprise a different number of subunits, and wherein said
difference in the number of subunits makes it possible to separate
or identify individual molecular identifiers when subjecting these
to separation or identification techniques such as e.g. gel
electrophoresis or mass spectroscopy, or iii) a predetermined dsDNA
or ssDNA oligonucleotide having either a different predetermined
length, or a different predetermined sequence, optionally chosen
from a minimal cross hybridization set, or iv) a peptide of a
predetermined length or sequence, or v) a predetermined first
(small) molecule capable of binding to a second (larger) molecule,
e.g. biotin, or vi) any combination of i)-v). Different shading of
strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0109] FIG. 58: The conditions are manipulated so that the ssDNA
tags hybridizes to the 5' overhangs of the first identifying linker
nucleotides comprising a label A). After hybridization the ssDNA
tags together with the first identifying linker oligonucleotides
comprising a label exposes a 3' overhang that the second
identifying linker oligonucleotides comprising a molecular
identifier B) can hybridize to. Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0110] FIG. 59: Concurrently the second identifying linker
oligonucleotides comprising a molecular identifier hybridize to the
exposed 3' end of the ssDNA tags hybridized to the first
identifying linker oligonucleotides comprising a label. This
complex is a substrate for ligase, but because the ssDNA tags and
the second identifying linker oligonucleotides in solution had
their 5' end blocked, only the two identifying linker
oligonucleotides can be ligated together. Different shading of
strands illustrates different sequences. Complementary sequences
are shown with the same shading. Selected 5' PO.sub.4 and 3' OH
groups are indicated.
[0111] FIG. 60: The conditions are changed again; for example by
heating; leaving a number of first and second identifying linker
oligonucleotides covalently bound together A). If necessary the
concentration of the first and second identifying linker
oligonucleotides in solution is adjusted to restore the initial
concentration C). The ssDNA tags are restored in solution by the
changing of the conditions B). Different shading of strands
illustrates different sequences. Complementary sequences are shown
with the same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0112] FIG. 61: Again the conditions are changed; for example by
cooling down; making the ssDNA tags hybridize to the first
identifying linker oligonucleotides again A). Because the
concentration of the first identifying linker oligonucleotides in
solution exceeds the number of ssDNA tags having the same
complementary 5' end, the chances a tag hybridizes to a first
identifying linker oligonucleotide that is already ligated to one
of the second identifying linker oligonucleotides in solution is
very small. After hybridization the ssDNA tags together with the
first identifying linker oligonucleotides comprising a label
exposes a 3' overhang that the second identifying linker
oligonucleotides comprising a molecular identifier B) can hybridize
to. Different shading of strands illustrates different sequences.
Complementary sequences are shown with the same shading. Selected
5' PO.sub.4 and 3' OH groups are indicated.
[0113] FIG. 62: Concurrently the second identifying linker
oligonucleotides comprising a molecular identifier hybridizes to
the exposed 3' end of the ssDNA tags hybridized to the first
identifying linker oligonucleotides comprising a label. This
complex is a substrate for ligase, but because the ssDNA tags and
the second identifying linker oligonucleotide in solution had their
5' end blocked only the two identifying linker oligonucleotides can
be ligated together. Different shading of strands illustrates
different sequences. Complementary sequences are shown with the
same shading. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0114] FIG. 63: After a number of cycles of the steps in FIG. 60
through 62 the signal from a subset of the ssDNA tags have been
amplified without consuming the ssDNA tags in the process. Due to
the molecular identifier on the second identifying linker
oligonucleotide a separation can be carried out so that each subset
of amplification products from the asymmetric LCR can be quantified
without interference from the other subsets of amplification
products. In this case two subset of amplification products are
shown in A) and B). Different shading of strands illustrates
different sequences. Selected 5' PO.sub.4 and 3' OH groups are
indicated.
[0115] FIG. 64: Concomitant creation and labelling of ssDNA tag.
The adapter comprises a nicking endonuclease recognition/binding
site, that is situated proximal to a type IIs restriction
endonuclease recognition/binding site as the cleavage site for said
type IIs restriction endonuclease is distal to the cleavage site
for said nicking endonuclease. This is illustrated in FIG. 64 with
hatched boxes having different shadings. However, concomitant
creation and labelling of the ssDNA tag is also possible when the
adapter has a type IIs restriction endonuclease recognition/binding
site that is situated proximal to a nicking endonuclease
recognition/binding site as the cleavage site for said type IIs
restriction endonuclease is distal to said type IIs restriction
endonuclease recognition/binding site (not shown). Some of the
sites are drawn as if they were overlapping each other. In fact for
as long as the general order of the recognition/binding sites and
the corresponding cleavage sites is maintained, any number of
depicted recognition/binding sites may overlap with neighbouring
sites. A) Recognition/binding site for nicking endonuclease. B)
Recognition/binding site for type IIs restriction endonuclease. C)
Cleavage site for nicking endonuclease. D) Overhang or blunt end of
adapter corresponding to the specific cleavage overhang of the type
II restriction endonuclease used for cleavage of the dsDNA that is
used in the creation of the chimeric dsDNA (only the 5' overhang
situation is shown). E) Recognition/binding and cleavage site for
type II restriction endonuclease after cleavage of dsDNA. F)
Cleavage site for type IIs restriction endonuclease. I) Ligation of
adapter carrying a label attached to the non-overhanging 3' end
that is to be ligated to the to dsDNA after cleavage of dsDNA with
type II restriction endonuclease. The label is attached to one of
the nucleotides that are transferred to the end of the ssDNA tag in
this process. Therefore the nicking endonuclease and the type IIs
restriction endonuclease and their sites in the adaptor are chosen
so that at least one nucleotide from the adaptor ends up in one end
of the ssDNA tag. The ends of the adaptor and the dsDNA could also
have compatible 3' overhangs or blunt ends as long as the resulting
chimeric dsDNA has a cleavage site for a nicking endonuclease
immediately 3' of a type IIs restriction endonuclease
recognition/binding site and a cleavage site for said type IIs
restriction endonuclease 3' of the cleavage site for said nicking
endonuclease. II) After ligation the chimeric molecule comprises a
label inside the sequence. III) After digestion with a type IIs
restriction endonuclease down stream fragments are discarded. IV)
The remaining fragment is digested with a nicking endonuclease
capable of nicking the DNA upstream from the label, so that a ssDNA
tag carrying a label in one and can be isolated. 5' PO.sub.4 and 3'
OH groups are not shown.
[0116] FIG. 65: In a pool of different ssDNA tags created in the
process described in FIG. 64, each ssDNA tag will be carrying a
label in the same end (here ssDNA tags carrying a label in the 3'
end is shown). These tags are ideal for hybridizing to an array.
Here an array comprising identifying linker oligonucleotides with
5' overhangs is shown, but 3' overhangs could also work fine.
[0117] FIG. 66: After hybridizing the ssDNA tags to the overhangs
of the identifying linker oligonucleotides in the array the ssDNA
tags are optionally ligated to the identifying linker
oligonucleotides. The non-hybridized ssDNA tags are washed away
before scanning the array.
[0118] FIG. 67: When using two identifying linker oligonucleotides
in solution that are blocked from being ligated together in their
overhangs it is possible to create a looped ssDNA string comprising
the two identifying linker oligonucleotides and an ssDNA tag. A
prerequisite for getting hybridization--and after that,
ligation--between the ssDNA tag and the identifying linker
oligonucleotides is, of cause, that the sequences of the overhangs
of the identifying linker oligonucleotides are complementary to the
sequences in the ends of the ssDNA tag.
[0119] FIG. 68: After creating a looped ssDNA string comprising two
identifying linker oligonucleotides and an ssDNA tag as described
in FIG. 67 it is possible to detect said molecule in a traditional
PCR reaction. I) After ligating together two identifying linker
oligonucleotides and an ssDNA tag a looped ssDNA string is created.
II) this looped ssDNA string can be melted into an ssDNA string
with no loops. III) A second string can be synthesized using a
primer complementary to the 3' end of the ssDNA string. IV) Form
here on this is equivalent to a traditional PCR reaction. The
curved part of the otherwise linear molecule depicts the part of
the molecule that ends up in the two loops when the ssDNA molecule
folds into its looped configuration.
[0120] FIG. 69: Both the primers for the second string and for the
traditional PCR step can be chosen to be complementary to different
sites in the part of the molecule that was the identifying linker
oligonucleotides before they were ligated to the ssDNA tag in the
middle. I) A number of the different primers that is possible for
the second-string synthesis. It is also possible to have primers
that are overlapping with the ssDNA tag sequence in the middle of
the molecule. II) A number of the different primers that is
possible for the traditional PCR reaction. It is also possible to
have primers that are overlapping with the ssDNA tag sequence in
the middle of the molecule. The curved part of the otherwise linear
molecule depicts the part of the molecule that ends up in the two
loops when the ssDNA molecule folds into its looped
configuration.
DEFINITIONS
[0121] Adapter oligonucleotide: Generally speaking an adapter
oligonucleotide is an oligonucleotide, either double stranded or
single stranded, that is capable of being linked to a
polynucleotide, preferably by means of ligation or PCR, for a
specific purpose. In the present context an adapter oligonucleotide
is an oligonucleotide comprising a recognition/binding motif or a
part thereof, wherein the recognition/binding motif is capable of
being recognized by a cleavage agent. Unless otherwise stated, the
adapter oligonucleotide comprises a recognition motif for a
cleavage agent capable of recognizing a predetermined motif of a
double stranded polynucleotide and cleaving only one strand of the
double stranded nucleotide. Optionally the adapter oligonucleotide
also comprises one or more recognition motifs for one or more
cleavage agents capable of cleaving both strands of a double
stranded polynucleotide. Such cleavage agents are known in the art
and described herein as site-specific nicking endonucleases and
site-specific restriction endonucleases respectively. Examples are
site-specific nicking endonucleases of the N. BstNB I type, and
site-specific restriction endonucleases of type II and of type IIs.
The recognition motif may be a hybrid motif, wherein part of the
motif is recognized by more than one cleavage agent. See FIG. 10-13
for a number of examples of an adapter. When present in single
stranded form the adapter comprises one nucleotide strand, which,
together with the complementary strand, comprises the motif. Single
stranded adapters are preferably ligated to single stranded
polynucleotides, such as RNA species. The resulting single stranded
chimeric polynucleotide is subsequently converted into a double
stranded polynucleotide. Double stranded adapters are capable of
being ligated directly to a double stranded polynucleotide with
compatible sticky ends or optionally a blunt end, if the adapter is
blunt ended.
[0122] Amplification: Process whereby more copies are generated of
a tag sequence or a sequence complementary thereto, or both. The
product of an amplification may also include flanking sequences not
included in the tag sequence.
[0123] Array: In the present context an array means an ordered
plurality of molecules. Mostly consisting of a plurality of dsDNA
or ssDNA fragments covalently attached to a slide or a similar
solid support, said DNA fragments being identified by their two
dimensional position in the array. See FIG. 15 for an example of an
array.
[0124] Asymmetric LCR: LCR using only two oligonucleotides instead
of four. Asymmetric LCR can be carried out on ssDNA. As with
asymmetric PCR the amplification in LCR is linear instead of
exponential. See FIG. 31-38 for an example of asymmetric LCR.
[0125] Base: In this context a base refers to one of the bases in
nucleic acid or modified nucleic acid unless otherwise noted. The
bases of DNA, for example are adenosine, cytidine, guanosine, and
thymidine.
[0126] Biological sample: Any sample comprising genetic material in
the form of DNA or RNA.
[0127] cDNA: See "complementary DNA"
[0128] Chimeric polynucleotide: Polynucleotide comprising an
adapter oligonucleotide part that is ligated to a polynucleotide
derived from a biological sample. A chimeric polynucleotide can
also be a single stranded polynucleotide. The polynucleotide
derived from a biological sample can also be a truncated part of a
polynucleotide obtained from a biological sample. Chimeric
polynucleotide also denotes any cDNA copy of a chimeric RNA
polynucleotide. See FIG. 10-13 for a number of examples of a
chimeric polynucleotide.
[0129] Chimeric tag: Double stranded oligonucleotide linker
comprising a single stranded oligonucleotide overhang that is
ligated to a complementary single stranded oligonucleotide tag
following hybridization between the overhang of the oligonucleotide
linker and the single stranded oligonucleotide tag. See also FIG.
14.
[0130] Cleavage agent: Agent capable of recognizing a predetermined
motif of a double stranded polynucleotide and cleaving only one
strand of the double stranded polynucleotide, or capable of
cleaving both strands of the double stranded polynucleotide.
Examples of cleavage agents in the present context is type II
restriction endonucleases, type IIs restriction endonucleases, and
nicking endonucleases having activities as outlined e.g. in New
England BioLabs' catalog for 2000-01.
[0131] Complementary DNA: Any DNA obtained by means of reverse
transcriptase acting on RNA as a substrate. Complementary DNA is
also termed copy DNA.
[0132] Complementary strand: Double stranded polynucleotide
contains two strands that are complementary in sequence and capable
of hybridizing to one another.
[0133] Complementary or substantially complementary: Refers to the
hybridization or base pairing between nucleotides or nucleic acids,
such as, for instance, between the two strands of a double stranded
DNA molecule or between an oligonucleotide primer and a primer
binding site on a single stranded nucleic acid to be sequenced or
amplified. Complementary nucleotides are, generally, A and T (or A
and U), or C and G. Two single stranded RNA or DNA molecules are
said to be substantially complementary when the nucleotides of one
strand, optimally aligned and with appropriate nucleotide
insertions or deletions, pair with at least about 80% of the
nucleotides of the other strand, usually at least about 90% to 95%,
and more preferably from about 98 to 100%. Alternatively,
substantial complementarity exists when an RNA or DNA strand will
hybridize under selective hybridization conditions to its
complement. Selective hybridization conditions include, but is not
limited to, stringent hybridization conditions. Selective
hybridization occurs in one embodiment when there is at least about
65% complementarity over a stretch of at least 14 to 25
nucleotides, preferably at least about 75%, more preferably at
least about 90% complementarity. See, M. Kanehisa (Nucleic Acids
Res. 12, 203, 1984), incorporated herein by reference. For shorter
nucleotide sequences selective hybridization occurs when there is
at least about 65% complementarity over a stretch of at least 8 to
12 nucleotides, preferably at least about 75%, more preferably at
least about 90% complementarity. Stringent hybridization conditions
will typically include salt concentrations of less than about 1 M,
more usually less than about 500 mM and preferably less than about
200 mM. Hybridization temperatures can be as low as 5.degree. C.
and are preferably lower than about 30.degree. C. However, longer
fragments may require higher hybridization temperatures for
specific hybridization. Hybridization temperatures are generally
about 2.degree. C. to 6.degree. C. lower than melting temperatures
(T.sub.m), which for polynucleotides comprising less than about 20
nucleotides can be calculated as T.sub.m=4.times.(G+C
content)+2.times.(A+T content). As other factors may affect the
stringency of hybridization, including base composition and length
of the complementary strands, presence of organic solvents and
extent of base mismatching, the combination of parameters is more
important than the absolute measure of any one alone.
[0134] DNA: deoxyribonucleic acid.
[0135] Double stranded polynucleotide: Polynucleotide comprising
complementary strands.
[0136] Double stranded tag source: Sources selected from cDNA,
genomic DNA and extra-genomic DNA, including plasmids and other
extra-chromosomal replicons.
[0137] dsDNA: Double stranded DNA.
[0138] Epitope: Epitope in this context covers any epitope capable
of being recognised by an antibody or a binding fragment thereof.
Therefore a unique epitope can identify a unique identifying
linker.
[0139] Hybrid motif: In the present context a hybrid motif is one
binding/recognition motif for a site-specific endonuclease that is
overlapping with another binding/recognition motif for another
site-specific endonuclease so that some of the bases in the hybrid
motif is used by both site-specific endonuclease. A hybrid motif
can also comprise binding/recognition motifs for more than two
site-specific endonucleases.
[0140] Hybrid oligonucleotide tag: Single stranded or double
stranded oligonucleotide linker comprising a single stranded
oligonucleotide overhang that is hybridized to a complementary
single stranded oligonucleotide tag. A hybrid oligonucleotide tag
can be a substrate for ligase if a 3' and a 5' end of two
polynucleotides are adjacent to each other. See FIG. 32 for an
example.
[0141] Identifying linker of oligonucleotide: An oligonucleotide,
preferably comprising either a double stranded part comprising
complementary nucleotide strands and/or comprising at least one
single stranded part such as two single stranded parts. The
identifying linker oligonucleotide may thus in one preferred
embodiment be exclusively single stranded. Identifying linker
nucleotides are used in the process of identifying at least one
single stranded polynucleotide tag. The double stranded part may be
obtained by hybridization of a first nucleotide strand to a second,
complementary nucleotide strand, or by a "hairpin" structure
obtained by folding a first single stranded nucleotide strand to a
part of itself. In one embodiment a double stranded linker
oligonucleotide is used having a 3' or 5' overhang comprising or
essentially consisting of a predetermined sequence capable of
hybridizing under suitable conditions to a single stranded
polynucleotide tag comprising a sequence that is complementary to
the predetermined sequence of the overhang of the identifying
linker oligonucleotide. The identifying linker oligonucleotide may
be linked to a solid support, or it may, in another embodiment,
comprise one or more molecules, that makes it possible to link an
ssDNA tag; or any other polynucleotide comprising a part that is
complementary to the overhang of the identifying oligonucleotide;
to for example [0142] i) one predetermined position out of a
plurality of predetermined positions in an array, or [0143] ii) one
predetermined epitope out of a plurality of predetermined epitopes,
or [0144] iii) one predetermined label out of a plurality of
predetermined labels, that can be either a fluorochrome, an
epitope, an enzyme, a DNA tag, or a first (small) molecule that can
bind to a second (larger) molecule for example, but not limited to,
biotin, wherein said first molecule does not interfere with the
function of the identifying oligonucleotide, or [0145] iv) one
predetermined molecule out of a plurality of predetermined
molecules comprised of a predetermined number of subunits having
the same, or almost the same charge, mass, hydrophobic properties,
three dimensional structure, or any other physical or chemical
property, or any combination thereof, wherein the different
molecular identifiers comprise a different number of subunits, and
wherein said difference in the number of subunits makes it possible
to separate or identify individual molecular identifiers when
subjecting these to separation or identification techniques such as
e.g. gel electrophoresis or mass spectroscopy, or [0146] v) one
predetermined dsDNA or ssDNA oligonucleotide out of a plurality of
predetermined dsDNA or ssDNA oligonucleotides each having either a
different predetermined length, or a different predetermined
sequence, optionally chosen from a minimal cross hybridization set,
or [0147] vi) one predetermined peptide out of a plurality of
predetermined peptides of a predetermined length or sequence, or
[0148] vii) one predetermined end of a linarized plasmid out of a
plurality of predetermined ends of a linarized plasmids. The other
end can either be 3' or 5' overhang or a blunt end, or the
linarized plasmid can comprise a set of two overhangs complimentary
to each end of an ssDNA tag, that is being cloned into the plasmid,
or [0149] viii) a molecule comprising one predetermined
electromagnetic property out of a plurality of predetermined
electromagnetic properties including a para-magnetic property
capable of being subjected to magnetic separation, [0150] ix) a
moiety capable of emitting an one predetermined electromagnetic
radiation out of a plurality of predetermined electromagnetic
radiations after excitation, including any fluorescent moiety,
including [0151] x) any combination of i)-ix), thus making it
possible for the skilled person to [0152] i) separate, or [0153]
ii) manipulate, or [0154] iii) visualize, or [0155] iv) display, or
[0156] v) amplify, or [0157] vi) identify, including [0158] vii)
any combination thereof the hybrid polynucleotide tag or the
chimeric polynucleotide tag formed by said identifying linker
oligonucleotide in combination with the ssDNA tag in order to
identify the ssDNA tag that is linked to the identifying linker,
and optionally quantify said ssDNA tag using the properties of the
molecules linked to the identifying linker oligonucleotide. One
category of such molecules is "molecular identifiers". Another
category is defined as "labels". However, these definitions do not
exclude a molecule from belonging to both categories. A label can
be separated from the plurality of other labels by using e.g. an
optical filter. Manipulation using a molecular identifier can occur
without detection, if a downstream detection step is included. A
set of two identifying linkers having 3' and 5' overhangs
respectively can be a substrate in a ligase chain reaction provided
an ssDNA tag is present that is able to hold them in close
proximity during the ligation step. In order for the ssDNA tag to
function as a catalyzer/modifier in a ligase chain reaction, either
the identifying linkers or the ssDNA tag, or both, have to be
blocked in the ends that would otherwise link the ssDNA tag to the
identifying linkers during the LCR. See e.g. FIG. 31 through 38 for
an example. See also FIG. 14.
[0159] Label: Any recognizable feature which is, for example:
microscopically distinguishable in shape, size, color, optical
density, electromagnetic properties, etc.; differently absorbing or
emitting light; chemically reactive; magnetically or electronically
encoded; or in some other way distinctively marked with the
required information. Examples include, but are not limited to: a
fluorochrome/fluorophor, an epitope, an enzyme, a DNA tag, any
molecule that is detectable in a mass spectrometer, and a first
(small) molecule that can bind to a second (larger) molecule for
example, but not limited to, biotin, wherein said first molecule
does not interfere with the function of the nucleotide to which the
label is attached.
[0160] LCR: See Ligase Chain Reaction.
[0161] Ligation: Enzymatic reaction carried out by the enzyme
ligase. Ligase catalysis the covalent bonding between two
nucleotides adjacent to each other. The reaction of ligase is
facilitated by a complementary strand holding the two nucleotides
in close proximity. The reaction is further facilitated if the two
nucleotides comprises the 3' and 5' ends of two polynucleotides
that is hold in close proximity to each other by a complementary
strand leaving no gaps between the two ends. See "Hybrid
oligonucleotide tag". Even if that is the situation the reaction
cannot occur if there is no phosphate group on the 5' end or no OH
group on the 3' end or if either of the ends are blocked in any
other way. Ligation can be carried out using any enzyme capable of
ligating nucleotides.
[0162] Ligase Chain Reaction: In LCR, four oligonucleotides, two
adjacent oligonucleotides which uniquely hybridize to one strand of
target DNA, and a complementary set of adjacent oligonucleotides,
which hybridize to the opposite strand are mixed and DNA ligase is
added to the mixture. Provided that there is complete
complementarity at the junction, ligase will covalently link each
set of hybridized molecules. Importantly, in LCR, two probes are
ligated together only when they base-pair with sequences in the
target sample, without gaps or mismatches. Repeated cycles of
denaturation, hybridization and ligation amplify a short segment of
DNA.
[0163] Linker: An oligonucleotide, either double stranded or single
stranded or comprising both a double stranded and a single stranded
part, that link two polynucleotides or a polynucleotide and an
oligonucleotide together. An adapter can also function as a linker
on top of other functions comprised by the adapter. See also FIG.
14.
[0164] Linking: Linking two polynucleotides together means any kind
of linking e.g. hydrogen bonding of "sticky ends"; hybridization of
a larger overlap between two polynucleotides; covalent bonding
after ligation and more.
[0165] Methylase: Enzyme capable of performing a site-specific
methylation of a nucleotide. Preferred methylases are M.AIwI;
M.BbvI; M.BmrIA; M.BpmI; M.BseRI; M.BsgI; M.BsmFI; M.BspMIA;
M.BspMIB; M.EciI; M.FauI; M.FokI; M.HgaIA; M.HgaIB; M.HphIA;
M.HphIB; M.MboIIA; M.MboIIB; M.MIyI; M.MnII; M.PIeI; M.SfaNI.
[0166] Methyl-transferase: Enzyme capable of copying the
methylation pattern from the old DNA strand to the newly
synthesized DNA strand.
[0167] Microfluid device: Device manufactured by microfabrication
techniques and exploiting a miniaturization of processes involved
e.g. in genetic analysis. A representative example of a microfluid
device is described in e.g. U.S. Pat. No. 6,168,948.
[0168] Molecular identifier: The single stranded polynucleotide
tags according to the invention are preferably linked to a suitable
label that enables identification of the tag. The linkage may be
direct or indirect. When being an indirect linkage, the detectable
label may be linked to an identifying linker oligonucleotide to
which the single stranded polynucleotide tag is attached by means
of e.g. hybridization or ligation. The molecular identifier may
facilitate both sorting and/or detection of the tag in question.
The sorting may be performed e.g. when a plurality of tags are
attached to a plurality of identifying linker oligonucleotides
comprising a molecular identifier. Separation preferably occurs by
means of differences among molecular identifiers in terms of
molecular weight, size, charge, or affinity among predetermined
specific binding partners. Accordingly, a molecular identifier is a
molecule that a skilled person can use to separate, or manipulate,
any molecule attached to said molecular identifier. Normally a
molecular identifier has to be linked directly or indirectly to a
label in order for a skilled person to track any separation and/or
manipulation. Examples of molecular identifiers include, but are
not limited to: [0169] i) a predetermined epitope, or [0170] ii) a
molecule comprised of a predetermined number of subunits having the
same, or almost the same charge, mass, hydrophobic properties,
three dimensional structure, or any other physical or chemical
property, or any combination thereof, wherein the different
molecular identifiers comprise a different number of subunits, and
wherein said difference in the number of subunits makes it possible
to separate or identify individual molecular identifiers when
subjecting these to separation or identification techniques such as
e.g. gel electrophoresis or mass spectroscopy, or [0171] iii) a
predetermined dsDNA or ssDNA oligonucleotide having either a
predetermined length, or a predetermined sequence, optionally
chosen from a minimal cross hybridization set, or [0172] iv) a
peptide of a predetermined length or sequence, or [0173] v) a
predetermined first (small) molecule that can bind to a second
(larger) molecule for example, but not limited to, biotin, wherein
said first molecule does not interfere with the function of the
molecular identifier, or [0174] vi) a predetermined end of a
linarized plasmid out of a plurality of predetermined ends of a
linarized plasmids. The other end can either be 3' or 5' overhang
or a blunt end, or the linarized plasmid can comprise a set of two
overhangs complimentary to each end of an ssDNA tag, that is being
cloned into the plasmid, or [0175] vii) a molecule comprising an
electromagnetic property including a paramagnetic property capable
of being subjected to magnetic separation, [0176] viii) a moiety
capable of emitting an electromagnetic radiation after excitation,
including any fluorescent moiety, including [0177] ix) any
combination of i)-viii)
[0178] The separation and/or manipulation using a molecular
identifier can be carried out using antibodies attached to any kind
of solid support; for example antibodies attached using a
state-of-the-art contacting group to magnetic beads. The separation
and/or manipulation using a molecular identifier can also be
carried out using a gel like matrix that allows separation
according to size; for example when the molecular identifier is
dsDNA of a predetermined length that is separated from the
plurality of similar molecular identifiers, i.e. dsDNA, by using a
polyacrylamide gel. The separation and/or manipulation using a
molecular identifier can also be carried out using molecules with
paramagnetic properties; for example by passing said molecules with
paramagnetic properties through a microfluid device engineered to
manipulate such molecules through their paramagnetic properties. In
some cases the separation and detection is done in virtually one
step. For example, but not limited to, methods outlined in PCT/US
99/02727 and PCT/US 99/02728. In such cases the molecular
identifier also functions as a label. The objective of using a
molecular identifier in the present context is to use a plurality
of molecular identifiers attached using a state-of-the-art
contacting group to a plurality of identifying linker
oligonucleotides all having a correlation between the sequence of
the overhang and the specific molecular identifier attached to the
identifying linker oligonucleotide. In other words in this context
there is a convergence between the plurality of sequences in the
overhang of identifying linker oligonucleotides and the plurality
of molecular identifiers attached to said identifying linker
oligonucleotides. That way, after forming a chimeric tag out of two
identifying linker oligonucleotides and an ssDNA tag, a label
originally attached to one of the identifying linker
oligonucleotides is now attached to a predetermined molecular
identifier originally attached to the other identifying linker
oligonucleotide through the ssDNA tag being identified. After
separation a quantification of the individual chimeric tags can be
carried out. Attaching a plurality of identifying linker
oligonucleotides to a grid according to the specific sequence of
the overhang will also uniquely identify the linker
oligonucleotides according to the sequence of the overhang. It is
possible to use as a molecular identifier one end of an
extrachromosomal replicon including a plasmid. The other end can
either be 3' or 5' overhang or a blunt end. Optionally, the
linarized plasmid can comprise a set of two overhangs complimentary
to each end of an ssDNA tag that is being cloned into the
plasmid.
[0179] Monomer: Any member of the set of molecules which can be
joined together to form an oligomer or polymer. The set of monomers
useful in the present invention includes, but is not restricted to,
for the example of oligonucleotide synthesis, the set of
nucleotides consisting of adenine, thymine, cytosine, guanine, and
uridine (A, T, C, G, and U, respectively) and synthetic analogs
thereof. As used herein, monomers refers to any member of a basis
set for synthesis of an oligomer. Different basis sets of monomers
may be used at successive steps in the synthesis of a polymer.
[0180] Messenger RNA: mRNA, a polynucleotide being transcribed only
from genes that are actively expressed, where the expressed mRNA
codes for a protein.
[0181] mRNA: See "messenger RNA".
[0182] Nuclear RNA: The group of nRNA consists of both small
nuclear RNA and large nuclear RNA transcripts. Different nRNAs can
have a variety of functions far beyond the scope of this list.
[0183] Nucleoside: A base attached to a ribose ring, as in RNA
nucleosides, or a deoxyribose ring, as in DNA nucleosides. See
also: "Base".
[0184] Nucleotide: Monomer of RNA or DNA. A nucleotide is a ribose
or a deoxyribose ring attached to both a base and a phosphate
group. Both mono-, di-, and tri-phosphate nucleosides are referred
to as nucleotides.
[0185] nRNA: See "nuclear RNA".
[0186] Oligonucleotide: The oligomer or polymer sequences of the
present invention are formed from the chemical or enzymatic
addition of monomer subunits. The term "oligonucleotide" as used
herein includes linear oligomers of natural or modified monomers or
linkages, including deoxyribonucleotides, ribonucleotides, anomeric
forms thereof, peptide nucleic acid monomers (PNAs), locked
nucleotide acid monomers (LNA), and the like, capable of
specifically binding to a single stranded polynucleotide tag by way
of a regular pattern of monomer-to-monomer interactions, such as
Watson-Crick type of base pairing, base stacking, Hoogsteen or
reverse Hoogsteen types of base pairing, or the like. Usually
monomers are linked by phosphodiester bonds or analogs thereof to
form oligonucleotides ranging in size from a few monomeric units,
e.g. 3-4, to several tens of monomeric units, e.g. 40-60. Whenever
an oligonucleotide is represented by a sequence of letters, such as
"ATGCCTG," it will be understood that the nucleotides are in
5'.fwdarw.3' order from left to right and the "A" denotes
deoxyadenosine, "C" denotes deoxycytidine, "G" denotes
deoxyguanosine, and "T" denotes thymidine, unless otherwise noted.
Usually oligonucleotides of the invention comprise the four natural
nucleotides; however, they may also comprise methylated or
non-natural nucleotide analogs. Suitable oligonucleotides may be
prepared by the phosphoramidite method described by Beaucage and
Carruthers (Tetrahedron Lett., 22, 1859-1862, 1981), or by the
triester method according to Matteucci, et al. (J. Am. Chem. Soc.,
103, 3185, 1981), both incorporated herein by reference, or by
other chemical methods using either a commercial automated
oligonucleotide synthesizer or VLSIPS.TM. technology. When
oligonucleotides are referred to as "double-stranded," it is
understood by those of skill in the art that a pair of
oligonucleotides exist in a hydrogen-bonded, helical configuration
typically associated with, for example, DNA. In addition to the
100% complementary form of double-stranded oligonucleotides, the
term "double-stranded" as used herein is also meant to refer to
those forms which include such structural features as bulges and
loops. For example as described in U.S. Pat. No. 5,770,722 for a
unimolecular double-stranded DNA. It is clear to those skilled in
the art when oligonucleotides having natural or non-natural
nucleotides may be employed, e.g. where processing by enzymes is
called for, usually oligonucleotides consisting of natural
nucleotides are required. When nucleotides are conjugated together
in a string using synthetic procedures, they are always referred to
as oligonucleotides.
[0187] Polynucleotide: A plurality of individual nucleotides linked
together in a single molecule. Polynucleotide covers any
derivatized nucleotides such as DNA, RNA, PNA, LNA etc. Any
oligonucleotide is also a polynucleotide, but every polynucleotide
is not an oligonucleotide.
[0188] Predetermined position: The position in a hybridization
array occupied by a predetermined, single stranded nucleotide
sequence of a first and/or second identifying linker
oligonucleotide, or the position in a capilary tube, or any other
compartment of a microfluid device, occupied by a predetermined,
single stranded nucleotide sequence of a first and/or second
identifying linker oligonucleotide. In both cases the identifying
linker oligonucleotide may further comprise a molecular identifier.
When this is the case, the single stranded nucleotide sequence of a
first and/or second identifying linker oligonucleotide may occupy
the predetermined position in the hybridization array or in the
capilary tube or in the microfluid device compartment due to the
manipulation of the molecular identifier under predetermined
conditions.
[0189] Ribosomal RNA: rRNA is an integral part of ribozymes. rRNA
is also the most abundant RNA species in a living cell.
[0190] RNA: ribonucleic acid. Different groups of ribonucleic acids
exists: mRNA, tRNA, rRNA and nRNA.
[0191] rRNA: See "ribosomal RNA".
[0192] Sequence determination: Used interchangeably with
"determining a nucleotide sequence" in reference to polynucleotides
and includes determination of partial as well as full sequence
information of the polynucleotide. That is, the term includes
sequence comparisons, fingerprinting, and like levels of
information about a target polynucleotide, as well as the express
identification and ordering of bases, usually each base, in a
target polynucleotide. The term also includes the determination of
the identification, ordering, and locations of one, two, or three
of the four types of nucleotides within a target polynucleotide.
For example, in some embodiments sequence determination may be
effected by identifying the ordering and locations of a single type
of nucleotide, e.g. cytosines, within the target polynucleotide
"CATCGC . . . " so that its sequence is represented as a binary
code, e.g. "100101 . . . " for "C-(not C)-(not C)-C-(not C)-C . . .
" and the like.
[0193] Single nucleotide polymorphism: A single nucleotide position
in an ordered context, that not constant throughout the
population.
[0194] Single stranded polynucleotide tag: Consecutive nucleotides
linked together and forming a single strand. The number of
nucleotides may range from about 6, such as 8, for example 10, such
as 12, for example 14 nucleotides, to more than 20 nucleotides,
including tags of more than e.g. 200 nucleotides. In this context a
single stranded polynucleotide tag is obtainable from genetic
material present in a biological sample.
[0195] Single stranded tag source: Ribonucleic acid, including
mRNA, which is subsequently converted into a double stranded tag
source.
[0196] Site-specific cleavage agent: Any agent capable of
recognising a predetermined nucleotide motif and cleaving a single
stranded nucleotide and/or a double stranded nucleotide. The
cleavage may occur within the nucleotide motif or at a location
either 5' or 3' to the nucleotide motif being recognised.
[0197] Site-specific endonuclease: Enzyme capable of recognizing a
double stranded polynucleotide and cleaving only one strand of the
double stranded polynucleotide, or capable of recognizing a double
stranded polynucleotide and cleaving both strands of the double
stranded polynucleotide. One group of site-specific endonucleases
is blocked in their activity by the presence of methylated bases in
specific position in their recognition sequence. Another group of
site-specific endonucleases is dependant upon methylated bases in
specific position in their recognition sequence. A third group of
site-specific endonucleases are oblivious to methylated bases in
specific positions in their recognition sequence.
[0198] Site-specific Restriction Endonuclease: Enzyme capable of
recognizing a double stranded polynucleotide and cleaving both
strands of the double stranded polynucleotide. Examples of
site-specific restriction endonucleases are shown in New England
BioLabs' catalog for 2000-01.
[0199] Site-specific Nicking Endonuclease: Enzyme capable of
recognizing a double stranded polynucleotide and cleaving only one
strand of the double stranded polynucleotide. An example of
site-specific nicking endonucleases is shown in New England
BioLabs' catalog for 2000-01.
[0200] SNP: See: Single nucleotide polymorphism.
[0201] Solid support: A material having a rigid or semi-rigid
surface. Such materials will preferably take the form of plates or
slides, small beads; pellets, disks, capillary tubes or other
convenient forms, although other forms may be used. In some
embodiments, at least one surface of the solid support will be
substantially flat. In other embodiments, a roughly spherical shape
is preferred. The solid support may be biological, non-biological,
organic, inorganic, or a combination of any of these, existing as
particles, strands, precipitates, gels, sheets, tubing, spheres,
containers, capillaries, pads, slices, films, plates, slides, etc.
The solid support is preferably flat but may take on alternative
surface configurations. For example, the solid support may contain
raised or depressed regions on which reactions including, but not
limited to, hybridization, ligation, and cleavage takes place. In
some embodiments, the solid support will be chosen to provide
appropriate light-absorbing characteristics. For example, the
support may be a polymerized Langmuir Blodgett film, functionalized
glass, Si, Ge, GaAs, GaP, SiO.sub.2, SiN.sub.4, modified silicon,
or any one of a variety of gels or polymers such as
(poly)tetrafluoroethylene, (poly)vinyliden-difluoride, polystyrene,
polycarbonate, or combinations thereof. Other suitable solid
support materials will be readily apparent to those of skill in the
art. Preferably, the surface of the solid support will contain
reactive groups, which could be carboxyl, amino, hydroxyl, thiol,
or the like. More preferably, the surface will be optically
transparent and will have surface Si--H functionalities, such as
are found on silica surfaces. The solid support is preferably
contacted by an array of ordered sets of molecules comprising or
essentially consisting of dsDNA and/or ssDNA fragments that are
preferably covalently attached to the solid support. In this way
the DNA fragments are identified by their two dimensional position
in the array.
[0202] ssDNA: Single stranded DNA.
[0203] ssDNA tag: Single-stranded polynucleotide tag comprising, or
essentially consisting of, or consisting exclusively of a single
strand of consecutive deoxyribonucleic acids.
[0204] Sticky ends: Polynucleotides having complementary 3' and 5'
ends that are capable of holding the two polynucleotides linked
together by the force of the hydrogen bonds between the
complementary overhangs are said to have sticky ends. See FIGS. 10
and 11 for an example of sticky ends.
[0205] Strand: Stretch of individual nucleotides linked together
and forming an oligonucleotide or a polynucleotide. Normally a
strand denotes a single stranded polynucleotide such as ssDNA or
RNA. See "Double stranded polynucleotide".
[0206] Substantially: Used herein to indicate that numbers or
process parameters may deviate from an absolute number or a maximal
number under practical circumstances without this deviation being
relevant for the technical effect achieved under such
circumstances. When used in the context of substantially all of a
plurality, it is generally to be understood that the term signifies
at least 95% of individual members of such a plurality, such as at
least 99% of individual members. Substantially individual linker
oligonucleotides refer to any number of one kind of detectable
linker oligonucleotides identifiable by their single stranded
nucleotide sequence and present among a plurality of different
kinds of linker oligonucleotides harbouring different single
stranded sequences.
[0207] Transfer RNA: tRNA are linked to specific amino acids and
subsequently used by the cell as a substrate for the synthesis of
protein.
[0208] tRNA: See "transfer RNA".
DETAILED DESCRIPTION OF THE INVENTION
[0209] The present invention in one preferred embodiment relates to
methods for separating, analyzing and optionally quantifying single
stranded polynucleotides comprising tags originating at least
partly and preferably wholly from a source of DNA and/or RNA
including a sample comprising biological cells.
[0210] Using at least one cleavage agent capable of recognizing and
cleaving at least one strand of double stranded DNA (dsDNA) makes
it possible to isolate a single stranded DNA (ssDNA) tag from
dsDNA. The dsDNA can either be at least one cDNA molecule as in a
number of preferred embodiments of the invention or it can be
genomic DNA, extra genomic DNA or amplification product arising
from a PCR or an LCR reaction.
Identifying Linker Oligonucleotides
[0211] In one preferred embodiment, the population of ssDNA tags
are analyzed by annealing and ligating the tags to a set of
identifying linker oligonucleotides each having specific 3' and 5'
overhangs corresponding to the 3' and 5' end sequences,
respectively, of subsets of the ssDNA tag population. The set will
be denoted first identifying linker oligonucleotide and second
identifying linker oligonucleotide respectively. Both the first and
the second identifying linker oligonucleotide can be linked to a
solid support in an array in a predetermined position or to a
molecular identifier capable of identifying each identifying linker
oligonucleotide according to its predetermined overhang. In the
former case no separation is necessary after ligation of the ssDNA
tag to the first identifying linker oligonucleotide in an array and
before the ligation of this chimeric tag to the second identifying
linker oligonucleotide. In the latter case a separation of the
different identifying linker oligonucleotides is preferably carried
out after ligation to the ssDNA tag and before the ligation of this
chimeric tag to the second identifying linker oligonucleotide.
[0212] The label attached to the identifying linker oligonucleotide
for detection of the identified chimeric tag, after ligation
between the identifying linker oligonucleotide and one of the ssDNA
tags, can be linked to the first or to the second identifying
linker oligonucleotide or to both. See FIGS. 15 through 30 and 52
through 63.
[0213] Further steps may preferably include, in addition to
providing at least one identifying linker oligonucleotide having a
3' or 5' overhang complementary to an ssDNA tag, or a part of an
ssDNA tag, the steps of exposing the pool of ssDNA tags being
analyzed to the at least one identifying linker oligonucleotide.
The contacting and hybridizing of said identifying linker
oligonucleotide to an ssDNA tag generates a hybrid oligonucleotide
tag.
[0214] In yet further steps, the ssDNA tag is preferably ligated to
the identifying linker oligonucleotide thereby producing a chimeric
polynucleotide tag comprising i) the ssDNA tag derived from a
biological sample and ii) the synthetic, partly double stranded
identifying linker oligonucleotide. This chimeric polynucleotide
will, in one embodiment of the invention, comprise an overhang
derived from the ssDNA tag. Such an overhang is capable of being
linked to a second identifying linker oligonucleotide having a
complementary overhang opposite to that of the overhang of the
first identifying linker oligonucleotide, e.g. a 3' overhang when
the first identifying linker oligonucleotide has a 5' overhang, and
vice versa. See FIGS. 15 and 16.
[0215] After contacting, hybridizing and ligating the second
identifying linker oligonucleotide to the overhang of the chimeric
tag resulting from ligation of the ssDNA tag to the first
identifying linker oligonucleotide, the chimeric polynucleotide tag
in one preferred embodiment becomes double stranded along the
entire length of the original ssDNA tag. See FIGS. 17 and 18.
[0216] It is possible to quantify each unique double stranded
chimeric tag comprising a unique ssDNA tag by exploiting the
physical and/or chemical properties of certain molecules associated
with the identifying linker oligonucleotide, including molecules
such as e.g. molecular identifiers comprised by the identifying
linker oligonucleotides; optionally in combination with the
identifying linker oligonucleotide being attached directly or
indirectly to a predetermined position in an array.
[0217] Furthermore, any identifying linker oligonucleotide may
comprise binding/recognition sites for type II or type IIs
restriction endonucleases or nicking endonucleases or any
combination thereof. The identifying linkers themselves can be
blocked in any or both ends of the two DNA strands. For example by
not having a 5' PO.sub.4 group or a 3' OH group or any combination
thereof. If the identifying linker oligonucleotides are blocked in
such a way, that they cannot ligate to an ssDNA tag, but, given an
ssDNA tag holds them in close proximity, the first identifying
linker oligonucleotide and the second identifying linker
oligonucleotide can be linked together, and thus undergo any from
of LCR, including asymmetric LCR with the ssDNA tag as template.
Furthermore the two DNA strands in one linker can be covalently
linked together in one end or at any point along the length of the
linker. For example by making the linker out of one palindromic DNA
strand looping back onto itself. The combined length of the two
overhangs can either be equal to or shorter than the ssDNA tag that
is being identified by the combination of the two overhangs of the
first and second identifying linker oligonucleotide. In some
preferred embodiments, the length of the overhang of the first and
second identifying linker oligonucleotides is different from each
other. See FIGS. 39 through 43 and 52 through 63.
[0218] In summary, the identifying linker oligonucleotide is
capable of linking the ssDNA tag to a predetermined position in an
array and/or to a molecular identifier both capable of identifying
the predetermined sequence in the overhang of the linker. The
identifying linker oligonucleotide is also capable of linking the
ssDNA tag to a label that in some situations are capable of
quantifying the relative amount of ssDNA tags linked to that
identifying linker. E.g. when the chimeric tag is comprised of a
first identifying linker oligonucleotide linked to a predetermined
position in an array, an ssDNA tag, and a second identifying linker
oligonucleotide linked to a label.
Hybridization Arrays
[0219] In one preferred embodiment, the first identifying linker
oligonucleotides of the invention are arranged in an array on a
solid support and/or they can comprise any combination of
molecules, including molecular identifiers, linked to the 3' or to
the 5' end of one or both of the two DNA strands in the identifying
linker oligonucleotide or linked to any of the bases or to the
backbone structure at any position(s) serving the purpose, or any
combination thereof. See FIGS. 15 and 44.
[0220] The identifying linker oligonucleotide and/or the molecular
identifier may further comprise a label capable of being
selectively detected. When detected by any state of the art
detection technology, the label provides information of the
position and/or presence of a particular identifying linker
oligonucleotide and/or a particular molecular identifier. It will
be understood that the molecular identifier comprising the label
will also provide such information for any identifying linker
oligonucleotide when the identifying linker oligonucleotide
comprises the molecular identifier comprising the label.
[0221] The label thus provides valuable information about the
presence and/or position of any identifying linker oligonucleotide.
It is possible to correlate a particular selectively detectable
label with a particular identifying linker oligonucleotide
comprising an overhang comprising a predetermined nucleotide
sequence. Accordingly, it is also possible to correlate a
particular selectively detectable label with a particular
identifying linker oligonucleotide to which a single stranded
polynucleotide tag is hybridized. It will be understood that such
hybridization occurs at least when the single stranded
polynucleotide tag comprises a nucleotide sequence that is
complementary to the nucleotide sequence of the overhang of the
identifying linker oligonucleotide. As the correlation between the
selectively detectable label and the corresponding nucleotide
sequence of the overhang of the identifying linker oligonucleotide
is known, the label thus also confers information of the sequence
of at least part of the single stranded polynucleotide tag that is
complementary to the nucleotide sequence of the overhang of the
identifying linker oligonucleotide.
[0222] When a predetermined first identifying linker
oligonucleotide comprising an overhang comprising a predetermined
nucleotide sequence is contacting a solid support and is attached
thereto in a fixed position by means of a covalent bond or
otherwise, a single stranded polynucleotide tag of a predetermined
length and comprising a nucleotide sequence complementary to the
nucleotide sequence of the overhang of the first identifying linker
oligonucleotide may hybridize to the overhang of the first
identifying linker oligonucleotide.
[0223] The length of the overhang may comprise or essentially
consist of e.g. 5 nucleotides, and the length of the single
stranded polynucleotide tag may comprise or essentially consist of
e.g. 10 nucleotides. It will be understood that all possible
sequence permutations, or a subset thereof, may be used in
accordance with the present invention. Other lengths of overhangs
and tags, respectively, than those exemplified herein above may
also be used in accordance with the present invention, such as e.g.
an overhang of only 4 nucleotides and a single stranded
polynucleotide tag according to the present invention comprising or
essentially consisting of 8 nucleotides. In some embodiments, the
length of the overhang of the first and second identifying linker
oligonucleotides is different from each other.
[0224] Once hybridized to the overhang of the first identifying
linker oligonucleotide, the remaining e.g. 5 nucleotides of the
single stranded polynucleotide tag, i.e. the 5 nucleotides not
hybridized, and optionally ligated, to the overhang of the first
linker oligonucleotide, may subsequently be identified by
introducing at least one or a plurality a second identifying linker
oligonucleotides, wherein at least one of said second identifying
linker oligonucleotides comprises an overhang of e.g. 5 nucleotides
comprising a nucleotide sequence complementary to the part of the
single stranded polynucleotide sequence not hybridized, and
optionally ligated, to the overhang of the first identifying linker
oligonucleotide. See FIGS. 17, 18, 48, and 49.
[0225] The at least one second identifying linker oligonucleotide
preferably comprises a label capable of being selectively detected
at least when the part of the single stranded polynucleotide tag
not hybridized to the first identifying linker oligonucleotide is
hybridized to the at least one second identifying linker
oligonucleotides comprising an overhang of e.g. 5 nucleotides
complementary to the part of the single stranded polynucleotide
sequence not hybridized to the first identifying linker
oligonucleotide.
[0226] In one embodiment, the hybridization array comprising a
plurality of ordered first and/or second identifying linker
oligonucleotides is preferably attached to a substrate, preferably
a solid support, said attachment resulting in a large number of
positionally distinct identifying linker oligonucleotides attached
thereto.
[0227] Such hybridization arrays comprising a plurality of ordered
first and/or second identifying linker oligonucleotides may, in one
embodiment, be "Genechip.RTM. arrays," which are well known in the
art. Examples are disclosed e.g. in U.S. Pat. No. 5,143,854 and PCT
patent publication Nos. WO 90/15070 and 92/10092, all of which are
incorporated herein by reference. However, any other suitable
commercial hybridization array may also be employed in connection
with the present invention.
[0228] Such arrays may be produced using mechanical or light
directed synthesis methods which incorporate a combination of
photolithographic methods and solid phase oligonucleotide synthesis
methods. See Fodor et al., Science, 251:767-777 (1991), Pirrung et
al., U.S. Pat. No. 5,143,854 (see also PCT Application No. WO
90/15070) and Fodor et al., PCT Publication No. WO 92/10092, all
incorporated herein by reference. These references disclose methods
of forming vast arrays of peptides, oligonucleotides and other
polymer sequences using, for example, light-directed synthesis
techniques. Techniques for the synthesis of these arrays using
mechanical synthesis strategies are described in, e.g., PCT
Publication No. 93/09668 and U.S. Pat. No. 5,384,261, each of which
is incorporated herein by reference in its entirety for all
purposes. Incorporation of such arrays in injection molded
polymeric casings has been described in Published PCT Application
No. 95/33846.
[0229] In one preferred embodiment, the basic strategy for light
directed synthesis of hybridization arrays comprising a plurality
of ordered first and/or second identifying linker oligonucleotides
is as follows. In a first step, the surface of a solid support,
modified with photosensitive protecting groups is illuminated
through a photolithographic mask, yielding reactive hydroxyl groups
in the illuminated regions.
[0230] A selected nucleotide, typically in the form of a
3'-O-phosphoramidite-activated deoxynucleoside (protected at the 5'
hydroxyl with a photosensitive protecting group), is then presented
to the surface and coupling occurs at the sites that were exposed
to light.
[0231] Following capping and oxidation, the substrate is rinsed and
the surface is illuminated through a second mask, to expose
additional hydroxyl groups for coupling.
[0232] A second selected nucleotide (e.g., 5'-protected,
3'-O-phosphoramidite-activated deoxynucleoside) is then presented
to the surface. The selective deprotection and coupling cycles are
repeated until the desired set of products is obtained. Since
photolithography is used, the process can be readily miniaturized
to generate high density arrays of oligonucleotide probes.
Furthermore, the sequence of the oligonucleotides at each site is
known. See, e.g., Pease, et al.: Mechanical synthesis methods are
similar to the light directed methods except involving mechanical
direction of fluids for deprotection and addition in the synthesis
steps.
[0233] Typically, the arrays used in the present invention will
have a site density of greater than 100 different first and/or
second identifying linker oligonucleotides per cm.sup.2.
Preferably, the arrays will have a site density of greater than
500/cm.sup.2, more preferably greater than about 1000/cm.sup.2, and
most preferably, greater than about 10,000/cm.sup.2. Preferably,
the arrays will have more than 100 different first and/or second
identifying linker oligonucleotides on a single substrate, more
preferably greater than about 1000 different first and/or second
identifying linker oligonucleotides still more preferably, greater
than about 10,000 different first and/or second identifying linker
oligonucleotides and most preferably, greater than 100,000
different first and/or second identifying linker oligonucleotides
on a single substrate.
[0234] For some embodiments, a hybridization array comprising a
plurality of ordered first and/or second identifying linker
oligonucleotides may be prepared having all possible single
stranded first and/or second nucleotide sequences, respectively, of
a given length, such as a length of 3 nucleotides, for example 4
nucleotide, such as 5 nucleotides, for example 6 nucleotides, such
as 7 nucleotides, for example 8 nucleotides, such as 9 nucleotides,
for example 10 nucleotides, such as 12 nucleotides, for example 14
nucleotides, such as 16 nucleotides, for example 18 nucleotides,
such as for example 20 nucleotides.
[0235] The length of the single stranded first and/or second
nucleotide sequence employed correspond in one embodiment to the
expected length of the single stranded polynucleotide tag which
may, in preferred embodiments, have a length of for example 4
nucleotide, such as 5 nucleotides, for example 6 nucleotides, such
as 7 nucleotides, for example 8 nucleotides, such as 9 nucleotides,
for example 10 nucleotides, such as 12 nucleotides, for example 14
nucleotides, such as 16 nucleotides, for example 18 nucleotides,
such as for example 20 nucleotides. A length of 10 nucleotides is
preferred in one particularly preferred embodiment of the
invention.
[0236] Hybridization arrays comprising a plurality of ordered first
and/or second identifying linker oligonucleotides may be used in
such areas as single stranded polynucleotide tag characterization
and analysis, including single stranded polynucleotide tag
sequencing or sequence checking applications, including any
diagnostic application, and the identification in this way of the
sequence of a single stranded polynucleotide tag offers substantial
benefits over traditional methods.
[0237] The use of hybridization arrays in general is described in,
e.g., U.S. patent application Ser. No. 08/505,919, filed Jul. 24,
1995, now abandoned, and U.S. patent application Ser. No.
08/284,064, filed Aug. 2, 1994, now abandoned, each of which is
incorporated herein by reference in its entirety for all
purposes.
Determination of Single Stranded Polynucleotide Tags
[0238] In one preferred embodiment of the invention it is possible
to determine conclusively both i) the position on a solid support
of the first identifying linker oligonucleotide comprising an
overhang comprising a predetermined, known nucleotide sequence, and
ii) the second identifying linker oligonucleotide capable of being
selectively detected by detection of the label and/or a molecular
identifier attached thereto, wherein the selectively detectable
label and/or molecular identifier is correlated to an overhang
comprising a predetermined, known nucleotide sequence hybridising
to the part of the single stranded polynucleotide tag that is not
hybridized, and optionally ligated, to the overhang of the first
identifying linker oligonucleotide.
[0239] Both the first and the second identifying linker
oligonucleotides will thus be present in the same position in the
solid support. This makes it possible to conclusively identify the
nucleotide sequences of both of the overhangs of said first and
second identifying linker oligonucleotides, and the complementary
sequence will thus in one preferred embodiment be identical to the
nucleotide sequence of the single stranded polynucleotide tag
hybridized to the overhangs.
[0240] A label can be any recognizable feature which is, for
example: microscopically distinguishable in shape, size, color,
optical density, etc.; differently absorbing or emitting of light;
chemically reactive; magnetically or electronically encoded; or in
some other way distinctively marked with the required information.
Examples include, but are not limited to: a
fluorochrome/fluorophor, an epitope, an enzyme, a DNA tag, any
molecule that is detectable in a mass spectrometer, and a first
(small) molecule that can bind to a second (larger) molecule for
example, but not limited to, biotin, wherein said first molecule
does not interfere with the function of the nucleotide to which the
label is attached.
[0241] Molecular identifiers can be used for separating and/or
manipulating identifying linker oligonucleotides and any ssDNA tag
and optionally any additional identifying linker oligonucleotides
attached to said ssDNA tag.
[0242] Accordingly, a molecular identifier sometimes have a dual
role in visualizing and separating the identifying linker
oligonucleotides or the chimeric tags. E.g. an epitope has the
ability to bind to a specific antigen on a solid support in a
separation or manipulation step. The same epitope can also bind to
a specific antigen comprising a label with optic properties in the
process of quantifying the chimeric tag.
[0243] Examples of a molecular identifier are i) a predetermined
epitope, or ii) a molecule comprised of a predetermined number of
subunits having the same, or substantially the same charge, mass,
hydrophobic properties, or any other physical or chemical property,
or any combination thereof, or iii) a predetermined dsDNA or ssDNA
oligonucleotide having a different predetermined length or a
different predetermined sequence, optionally chosen from a minimal
cross hybridization set, or iv) a peptide of a predetermined length
or sequence, or v) a first (small) molecule that can bind to a
second (larger) molecule for example, but not limited to, biotin,
wherein said first molecule does not interfere with the function of
the molecular identifier, or vi) any combination of i)-v).
[0244] It is possible to use as a molecular identifier one end of
an extrachromosomal replicon including a plasmid. The other end can
either be 3' or 5' overhang or a blunt end. Optionally, the
linarized plasmid can comprise a set of two overhangs complimentary
to each end of an ssDNA tag that is being cloned into the
plasmid.
Cleavage Agents
[0245] Cleavage agents used in connection with the present
invention are preferably selected from site-specific endonucleases
including site-specific restriction endonucleases of type II and/or
site-specific restriction endonucleases of type IIs, and nicking
endonucleases. The cleavage agent in question can optionally be
sensitive to methylation of the target, or dependant upon
methylation of the target.
[0246] In a number of preferred embodiments the double stranded DNA
carries at least one methylated nucleotide that can either be
introduced into the DNA by a cell as is common for genomic DNA or
during the cDNA synthesis process by using methylated
deoxyribonucleotides in the synthesis reaction. Methylation can
also be introduced into double-stranded DNA by applying at least
one methylase and/or methyl-transferase or any combination thereof.
In case extra genomic DNA is being used, the host cell can be
engineered to supply the necessary methylase and/or
methyl-transferase. Methylaton of double stranded DNA is used in a
number of preferred embodiments of the invention.
[0247] Either one of the two identifying linker oligonucleotides,
or both of them, may comprise any number of binding/recognition
motifs for type II or type IIs restriction endonucleases or nicking
endonucleases or any combination thereof. For example a
site-specific nicking endonuclease; or a site-specific nicking
endonuclease in combination with a site-specific restriction
endonuclease of type II; or a site-specific nicking endonuclease in
combination with a site-specific restriction endonuclease of type
IIs; or a site-specific nicking endonuclease in combination with a
site-specific restriction endonuclease of type II and a
site-specific restriction endonuclease of type IIs. See FIGS. 39
and 52.
Adapter Oligonucleotides
[0248] In one preferred embodiment of the invention the
recognition/binding motif or motifs for the cleavage agent or
agents are introduced into the double stranded DNA by generating at
least one double-stranded DNA fragment by cleaving double-stranded
DNA with a cleavage agent and ligating an adapter oligonucleotide
onto the end of the double stranded DNA fragment. The adapter
comprises a recognition motif for a cleavage agent capable of
recognizing a predetermined motif of a double stranded
polynucleotide and cleaving only one strand of the double stranded
nucleotide. Optionally the adapter oligonucleotide also comprises
one or more recognition motifs for one or more cleavage agents
capable of cleaving both strands of a double stranded
polynucleotide.
[0249] The adapter oligonucleotide and the double stranded DNA may
be manipulated so that the adapter is preferably ligated to either
one of the two ends or to both ends of the double stranded DNA
fragment originating from e.g. either cDNA, genomic DNA or
extra-genomic DNA. Fragments comprising both an adapter and e.g.
cDNA or genomic DNA or extra-genomic DNA are termed chimeric
polynucleotide fragments, as only part of the nucleotides originate
from the source being subsequently characterized by the single
stranded polynucleotide tag of this invention.
[0250] Any suitable kind of ligase enzyme can be used for ligating
the adapter oligonucleotide and the dsDNA fragment together. The
cleavage agent used for cleaving the double stranded DNA in this
step can be either a type II or a type IIs restriction
endonuclease, and it can optionally be oblivious to methylation,
sensitive to methylation or dependant upon methylation.
[0251] The adapter oligonucleotide comprises at least one
recognition/binding motif for the at least one cleavage agent used
in the generation of the ssDNA tag. The cleavage agent or agents
includes at least one site-specific nicking endonuclease and
optionally one or more site-specific restriction endonuclease of
type II or type IIs.
[0252] The adapter oligonucleotide may also comprise a solid
support or a first (small) molecule that can bind to a second
(larger) molecule for example, but not limited to, biotin, wherein
said first molecule does not interfere with the function of the
adapter oligonucleotide, and the adapter oligonucleotide may
independently thereof further comprise a label for detection of the
adapter and/or any tag associated therewith by means of
hybridization or otherwise.
[0253] The adapter oligonucleotide may further comprise a molecular
identifier that is correlated to the overhang of the adapter
oligonucleotide. This molecular identifier makes it possible for
the skilled person to manipulate with the adapter and anything
linked to the adapter. The molecular identifier can either be a
predetermined epitope; a molecule comprised of a predetermined
number of subunits having the same, or almost the same charge,
mass, hydrophobic properties, three dimensional structure, or any
other physical or chemical property, or any combination thereof,
wherein different molecular identifiers comprise a different number
of subunits, and wherein said difference in the number of subunits
makes it possible to separate or identify individual molecular
identifiers when subjecting these to separation or identification
techniques such as e.g. gel electrophoresis or mass spectroscopy;
dsDNA of a predetermined length; or ssDNA of a predetermined
sequence, optionally chosen from a minimal cross hybridization set;
or a peptide of a predetermined length or sequence; including any
combination thereof. In one embodiment the adapter is introduced by
use of PCR with at least one primer comprising the adapter.
Single Stranded Adapter Oligonucleotides
[0254] In one preferred embodiment of the invention the adapter
oligonucleotide comprising the at least one recognition motif(s)
for the cleavage agent or agents are introduced Into the double
stranded DNA by initially ligating an adapter, preferably a single
stranded adapter, to at least one decapped mRNA molecule, reverse
transcribing this chimeric mRNA molecule into single stranded cDNA,
and then using a polymerase to synthesize the second strand of the
cDNA. The cleavage agent or agents includes at least one
site-specific nicking endonuclease and optionally one or more
site-specific restriction endonuclease of type II or type IIs.
[0255] When the chimera is obtained by ligating an adapter to the
5' end of at least one decapped mRNA molecule, a solid support or a
molecular identifier that makes it possible for the skilled person
to manipulate with the adapter and anything linked to the adapter
is preferably introduced into the chimera with the primer used to
synthesize the second strand of the cDNA. It is also possible to
put discriminating bases at the 3' end of this primer in order to
simplify the analysis by breaking it down into a number of panels.
Furthermore it is possible to make sets of ssDNA originating with
different offset from the 5' end of the mRNA molecule. In this way
it is possible to circumvent any errors introduced due to the
specific sequence of a specific ssDNA tag. For example it is
possible for palindromic sequences to fold up in a hairpin
structure and such a structure will be less likely to hybridize to
an identifier linker oligonucleotide. See also FIGS. 12 and 13.
Double Stranded Adapter Oligonucleotides
[0256] In another preferred embodiment of the invention, at least
one double stranded chimeric polynucleotide is obtained either by
ligating an adapter oligonucleotide to dsDNA or by ligating an
adapter to the 5' end of at least one decapped mRNA molecule,
reverse transcribing this chimeric mRNA molecule or molecules into
single stranded cDNA, and using a DNA dependent polymerase to
synthesize the second strand of the cDNA.
[0257] The chimeric dsDNA is preferably attached to a solid
support, or a first (small) molecule that can bind to a second
(larger) molecule for example, but not limited to, biotin, wherein
said first molecule does not interfere with the function of the
chimer, through the adapter oligonucleotide or, in case the chimera
is obtained by ligating an adapter to the 5' end of at least one
decapped mRNA molecule, the solid support, or the first (small)
molecule capable of binding to the second (larger) molecule e.g.
biotin, is introduced with the primer used to synthesize the second
strand of the cDNA. In one preferred embodiment of the invention,
the adapter oligonucleotide further comprises at least one
recognition motif for a type IIs restriction endonuclease that
cleaves from 2 to about 25 bases, preferably about 20 bases, from
its recognition/binding motif. At least one set of identifying
linker oligonucleotides is used to identify and optionally quantify
the generated ssDNA tags.
[0258] Initially, the chimeric dsDNA is preferably obtained and
cleaved by the type IIs restriction endonuclease. The solid
support, or the first (small) molecule capable of binding to a
second (larger) molecule, e.g. biotin, on the adapter
oligonucleotide is then used to separate the distal fragment or
fragments from the proximal fragment. The same solid support, or
the first (small) molecule capable of binding to a second (larger)
molecule, e.g. biotin, is then used to separate the two strands of
the dsDNA tag after melting of the two strands. This provides at
least one ssDNA tag in solution. The at least one ssDNA tag is then
ligated to the first identifying linker oligonucleotide, having a
sequence in its overhang that correlates to a position in an array
whereto it is attached.
[0259] A second identifying linker oligonucleotide comprising a
label is subsequently ligated to the single stranded overhang
produced by forming a chimeric polynucleotide tag comprising the
ssDNA tag and the first identifying linker oligonucleotide. The
label on the second identifying linker oligonucleotide can
optionally be correlated to the sequence of the overhang in this
identifying linker oligonucleotide or a panel of identifying linker
oligonucleotides with different overhangs can be probed one at the
time.
[0260] The above-described preferred embodiment of the invention
provides at least one ssDNA tag from every chimeric dsDNA used as
starting material. The identity and quantity of this at least one
ssDNA tag is then assessed. This preferred embodiment can be used
e.g. to make expression profiling. It can also be used to track the
expression of a selected subset of genes, a commonly used approach
in diagnostics. It can also be used to asses the extent of
methylation in genomic DNA, provided that the chimeric dsDNA is
obtained by cleaving genomic DNA with a methylation sensitive or
methylation dependant restriction endonuclease before ligating the
fragments onto the adapter oligonucleotide, thereby providing
chimeric dsDNA fragments suitable for generating the ssDNA tags
according to this invention.
[0261] In yet another preferred embodiment of the invention, at
least one double stranded chimeric dsDNA is obtained either by
ligating an adapter oligonucleotide to dsDNA or by ligating an
adapter to the 5' end of at least one decapped mRNA molecule,
reverse transcribing this chimeric mRNA molecule or molecules into
single stranded cDNA and then using a polymerase to synthesize the
second strand of the cDNA, or by introducing an adapter by use of
PCR with at leaset one primer comprising the adapter.
[0262] The chimeric dsDNA may be attached to a solid support, or
the first (small) molecule capable of binding to a second (larger)
molecule, e.g biotin, through the adapter oligonucleotide or, in
case the chimera is obtained by ligating an adapter to the 5' end
of at least one decapped mRNA molecule, the solid support, or the
first (small) molecule capable of binding to a second (larger)
molecule, e.g biotin, is introduced with the primer used to
synthesize the second strand of the cDNA. In this preferred
embodiment of the invention, the adapter oligonucleotide comprises
one recognition/binding motif for a type IIs restriction
endonuclease that cleaves preferably from about 4 to 20 bases from
its recognition/binding motif. The adapter oligonucleotide also
comprises one recognition/binding motif for a nicking endonuclease
that preferably cleaves one of the strands from 0 to 16 bases form
its recognition/binding motif. At least one set of identifying
linker oligonucleotides is used to identify and optionally quantify
the generated ssDNA tag. See also FIGS. 10 and 11.
[0263] First the chimeric dsDNA is obtained and then it is cleaved
by a type IIs restriction endonuclease. The solid support, or the
first (small) molecule capable of binding to a second (larger)
molecule, e.g biotin, on the adapter oligonucleotide is then used
to separate the distal fragment or fragments from the proximal
fragment or fragments. A nicking endonuclease is then used to
introduce a single strand break so that a single strand of a fixed
length can be melted off and isolated from the rest of the chimeric
fragment still attached to the solid support. This gives at least
one ssDNA tag in solution. This at least one ssDNA tag is then
identified by ligating it to the first identifying linker
oligonucleotide, having a sequence in its overhang that correlates
to a position in an array whereto it is attached.
[0264] The second identifying linker oligonucleotide comprising a
label is subsequently ligated to the overhang produced by ligating
the ssDNA tag to the first identifying linker oligonucleotide. The
label on the second identifying linker oligonucleotide can
optionally be correlated to the sequence of the overhang in this
identifying linker oligonucleotide or a panel of identifying linker
oligonucleotides with different overhangs can be probed one at the
time.
[0265] This preferred embodiment of the invention provide an ssDNA
tag from every chimeric dsDNA used as starting material. The
identity and quantity of this at least one ssDNA tag is then
assessed. This preferred embodiment can be used to make expression
profiling. It can also be used to track the expression of a
selected subset of genes, as is commonly the case in diagnostics.
It can also be used to asses the extent of methylation in genomic
DNA if the chimeric dsDNA is obtained by cleaving genomic DNA with
a methylation sensitive or methylation dependant restriction
endonuclease before ligating the fragments onto the adapter
oligonucleotide giving the chimeric dsDNA fragments suitable for
production of the ssDNA tags according to this invention.
Further Processing Steps in ssDNA Tag Characterization and
Identification
[0266] Once the at least one ssDNA tag is isolated, its identity
and abundance can be assessed. The first step in this process can
be, but does not have to be, a blocking of one or both ends of the
ssDNA tag. For example by substituting the 5' PO.sub.4 group or the
3' OH group, or both of said groups, with a blocking agent that
prevents the ligation of the group to another nucleotide.
[0267] The combination of at least two identifying linker
nucleotides, one having a 5' overhang and the other having a 3'
overhang, may be used in the combined processes of identifying and
quantifying the at least one ssDNA tag.
[0268] The identifying linker nucleotides themselves can be blocked
in any end of the two DNA strands, for example by substituting the
5' PO.sub.4 group or the 3' OH group, or both of said groups, with
a blocking agent that prevents the ligation of the group to another
nucleotide. Furthermore the two DNA strands in any one identifying
linker oligonucleotide can be covalently linked together in one
end, or at any position along the length of the identifying linker
nucleotide. For example by making the identifying linker nucleotide
out of one palindromic DNA strand looping back onto itself.
[0269] The combined length of the two overhangs can either be equal
to or shorter than the ssDNA tag that is being identified by the
combination of the overhangs from the two identifying linker
oligonucleotides. Optionally the identifying linker
oligonucleotides can be methylated in any combination of positions.
A solid support, a label, a molecular identifier, or any
combination thereof, can be linked to the 3' or to the 5' end of
one or both of the two DNA strands in one identifying linker
oligonucleotide. Or it can be linked to any of the bases, or to the
backbone structure at any position(s) serving the purpose or any
combination thereof.
[0270] The solid support can be either a particle or a
predetermined position in an array. It can optionally be correlated
to the sequence in the overhang of the identifying linker
oligonucleotide.
[0271] The label can be any recognizable feature which is, for
example: microscopically distinguishable in shape, size, color,
optical density, etc.; differently absorbing or emitting of light;
chemically reactive; magnetically or electronically encoded; or in
some other way distinctively marked with the required information.
Examples include, but are not limited to: a
fluorochrome/fluorophor, an epitope, an enzyme, a DNA tag, any
molecule that is detectable in a mass spectrometer, or a first
(small) molecule capable of binding to a second (larger) molecule,
e.g biotin. The label can optionally be correlated to the
predetermined sequence in the overhang of the identifying linker
oligonucleotide.
[0272] The molecular identifier correlated to the sequence in the
overhang of the identifying linker oligonucleotide can be i) a
predetermined epitope, or ii) a molecule comprised of a
predetermined number of subunits having the same, or substantially
the same charge, mass, hydrophobic properties, or any other
physical or chemical property, or any combination thereof, or iii)
a predetermined dsDNA or ssDNA oligonucleotide having a different
predetermined length or a different predetermined sequence,
optionally chosen from a minimal cross hybridization set, or iv) a
peptide of a predetermined length or sequence, or v) a
predetermined or a first (small) molecule capable of binding to a
second (larger) molecule, e.g biotin, including vi) any combination
of i)-v).
[0273] The identifying linker oligonucleotide may also be a part of
a linarized plasmid or an end part thereof. The other end of the
linarized plasmid can either be 3' or 5' overhang or a blunt end.
Optionally, the linarized plasmid can comprise a set of two
identifying overhangs complimentary to the at least one ssDNA tag
that is being cloned into the plasmid. Even if the identifying
linker oligonucleotide is one end of a linarized plasmid, this
embodiment may be combined with using a solid support, a label or a
molecular identifier.
[0274] In one preferred embodiment, the plasmid comprises an
identifier, that is correlated to the sequence of the tag being
cloned into that specific plasmid. Said identifier can be a
variable stretch of DNA; a gene coding for a specific factor; or a
gene coding for a small peptide of variable length, charge or
composition, all of which is correlated to the specific sequence of
the tag being cloned.
Enhancing the Plurality of ssDNA Tags
[0275] In a further preferred embodiment of the invention at least
one double stranded chimera is obtained by ligating an adapter
oligonucleotide to dsDNA. This time the double stranded DNA is
cleaved with a type IIs restriction endonuclease leaving 2 to 6
bases of overhang. This gives between 16 and 4096 different
sequences of the overhang depending on the number of bases in the
overhang. The adapter oligonucleotides that are utilized to obtain
the chimeric dsDNA is then identified based upon the sequence of
their overhang. This is done by taking one at a time or by applying
a label or a molecular identifier or both, that is correlated to
the sequence of the overhang of the adapter oligonucleotide. The
chimeric dsDNA is then attached to a solid support through the
adapter oligonucleotide.
[0276] This solid support is engineered so that it can easily be
cleaved from the rest of the adapter oligonucleotide if all the 16
to 4096 different chimeric dsDNA fragments are to be separated
according to their molecular identifier. In this preferred
embodiment of the invention the adapter oligonucleotide comprises
one recognition/binding motif for a type IIs restriction
endonuclease that cleaves from 4 to 20 bases from its
recognition/binding motif. The adapter oligonucleotide also
comprises one recognition/binding motif for a nicking endonuclease
that cleaves one of the strands from 0 to 16 bases form its
recognition/binding motif. At least one set of identifying linker
oligonucleotides is used to identify and optionally quantify the
generated ssDNA tag.
[0277] First the chimeric dsDNA is obtained and then it is cleaved
by the type IIs restriction endonuclease. The solid support on the
adapter oligonucleotide is then preferably used to separate the
distal fragment or fragments from the proximal fragment. A nicking
endonuclease is then used to introduce a single strand break so
that a single strand of a fixed length can be melted off and
isolated from the rest of the chimeric fragment still attached to
the solid support. This gives at least one ssDNA tag in solution.
This at least one ssDNA tag is then identified by ligating it to
the first identifying linker oligonucleotide, having a sequence in
its overhang that correlates to a position in an array whereto it
is attached.
[0278] The second identifying linker oligonucleotide comprising a
label is subsequently ligated to the overhang produced by ligating
the ssDNA tag to the first identifying linker oligonucleotide. The
label on the second identifying linker oligonucleotide can
optionally be correlated to the sequence of the overhang in this
identifying linker oligonucleotide or a panel of identifying linker
oligonucleotides with different overhangs can be probed one at the
time.
[0279] This preferred embodiment of the invention provide all ssDNA
tags from a predetermined subset or panel of chimeric dsDNA used as
starting material. The identity and quantity of the ssDNA tags in
the panel is then assessed.
[0280] This preferred embodiment can be used e.g. to make
expression profiling. It can also be used to track the expression
of a selected subset of genes, as is commonly the case in
diagnostics. It can also be used to asses the extent of methylation
in genomic DNA if the chimeric dsDNA is obtained by cleaving
genomic DNA with a methylation sensitive or methylation dependant
restriction endonuclease before ligating the fragments onto the
adapter oligonucleotide giving the chimeric dsDNA fragments used
for producing the ssDNA tags. This preferred embodiment is
especially useful for identifying a large number of tags because
there are up to 4096 panels each giving up to 4.sup.20 or 10.sup.12
different combinations in the sequence of the tags or a total of
4.sup.26 or 4.5.times.10.sup.15 different combinations.
Generation of cDNA Libraries
[0281] The gold standard when doing expression profiling has always
been to sequence every clone in a cDNA library. This tedious and
laborious task, mainly due to it's complexity, also incorporates
some systematic errors. Especially in the process of generating the
cDNA libraries. Therefore the status of cDNA library sequencing as
a gold standard for expression profiling may not be thoroughly
justified. In the following section the whole process of generating
these cDNA libraries using different methods are discussed,
including the pros and cons involved. Any state of the art method
for generating cDNA can be used in accordance with the present
invention.
[0282] Only a small fraction of the genetic information of an
organism is actually used in an individual cell or tissue at any
particular point in time. A cDNA library is a type of gene library
in which only DNA coding for actively expressed genes is cloned.
These active genes can be selectively cloned over silent genes
because the DNA of active genes is transcribed into messenger RNA
(mRNA) as part of the pathway by which proteins are made. Therefore
the expression of mRNA molecules is a bottleneck in the flow of
information in a cell, said flow of information going in very
general terms from DNA through mRNA to protein and back again to
DNA.
[0283] RNA molecules are polar by nature; i.e. the constituent
nucleoside bases are linked via phosphodiester bonds between the 3'
ribosyl position of one nucleoside and the 5' ribosyl position on
the following nucleoside. RNA is synthesized in the 5'.fwdarw.3'
direction, and mRNAs are translated by ribosomes in the same
direction, such that proteins are synthesized from N-terminus to
C-terminus.
[0284] cDNA libraries have become the standard source from which
thousands of genes have been isolated for further study.
Accordingly, any conventional method known to the skilled person
for converting single stranded messenger RNA (mRNA) into
complementary DNA (cDNA) by means of an enzyme comprising reverse
transcriptase activity can be employed in accordance with the
present invention.
[0285] The first step in preparing a cDNA library is to obtain an
mRNA fraction by e.g. purifying the mRNA, which usually represents
about 1-3% of the total RNA of the cell. The remainder is ribosomal
RNA, transfer RNA, and several other RNA species.
[0286] Many mRNAs from eukaryotic organisms have a poly(A) "tail".
This is a tract of about 50-150 adenosine residues at their 3'
ends. A general practice for purifying mRNA from total cellular RNA
involves specifically annealing, or binding, the poly(A) tail to
oligo(dT), a single stranded DNA molecule of between about 12 and
30 consecutive dT residues. See e.g. Jacobson, A. (Meth. Enzymol.
152, 254, 1987). Total cellular RNA can be incubated with a solid
support to which oligo(dT) has been immobilized. Only RNA molecules
containing poly(A) tails selectively anneal to the matrix.
[0287] Upon purification of poly(A) containing mRNA, a
double-stranded complementary DNA (cDNA) copy of this active RNA
can be synthesized in vitro by two sequential enzymatic steps. An
RNA-dependent DNA polymerase, known as a reverse transcriptase, is
used to synthesize the first strand cDNA (complementary DNA), using
the RNA as a template. Then, a DNA-dependent DNA polymerase,
typically E. coli DNA polymerase I or Taq polymerase, copies the
newly synthesized first cDNA strand to form a complementary second
cDNA strand. A popular method of second strand synthesis utilizes
the enzyme RNaseH to create "nicks" in the mRNA strand.
[0288] The resulting short mRNA fragments serve as primers for
second strand synthesis by the DNA polymerase. See e.g. Gubler, U.
(Meth. Enzymol. 152, 330, 1987). Both polymerases synthesize DNA in
the 5'.fwdarw.3' direction, reading the template strand from the
3'.fwdarw.5' direction. Double-stranded cDNA thus prepared may be
inserted into a prepared cloning vector, or they may be subjected
to a series of processing steps according to the invention.
[0289] To efficiently process the cDNA or insert the cDNA into a
cloning vector, the ends of the insert cDNA, and optionally also
the vector DNA molecules, must be prepared in such a way that they
are compatible or suitable for processing. Specialized adapter
oligonucleotides can be added to the cDNA ends, followed by
digestion with a pre-determined site-specific restriction
endonuclease to cleave the cDNA and optionally also to create
single stranded protrusions that will anneal to corresponding ends
in the vector. The insert and vector molecules are subsequently
ligated together with T4 DNA ligase. The ligated vectors carrying
their cDNA molecule inserts are capable of being introduced into
any suitable host organism, including e.g. yeast and E. coli.
[0290] One way of generating a cDNA library is by using a cDNA
primer known as a random primer to produce so-called "random primed
libraries." Rather than being a single species, a random primer is,
in actuality, a collection or set of primers of a certain length,
usually hexameric, wherein the set includes all possible
arrangements of the 4 DNA nucleoside bases over the length of the
primer. Thus, a random hexamer is actually a collection of 4.sup.6,
or 4096, different primer sequences each of which is capable of
annealing specifically with its complementary sequence in mRNA.
[0291] Since every possible 6-base long portion of the mRNA has a
complement in the set of random hexamer primers, the population of
cDNA first strands generated using random primers shares neither a
common origin on the mRNA nor a common 3' sequence. The bias for 3'
ends is not a problem in random primed libraries because the primer
mix of all possible hexamers promotes initiation of cDNA synthesis
at any point on the mRNA. No portion of the mRNA molecule is better
represented than any other portion in the population of cDNA first
strands.
[0292] A common practice in the field is to supplement screening of
oligo(dT)-primed libraries with random primed libraries to obtain
full-length clones. Random-primed libraries have also been used for
intentionally cloning cDNA fragments as a means to obtain gene
regions encoding DNA binding proteins. See Singh et al., (Cell 52,
415, 1988); Vinson et al., (Genes Dev. 2, 801, 1988). The inability
of some mRNAs to be primed with oligo(dT) makes it essential to
construct random primed libraries when the mRNA is
non-polyadenylated.
[0293] One modification of the standard oligo(dT) priming strategy
takes advantage of the common 3' ends of the resulting cDNA to
allow the cloning of cDNA molecules in a defined orientation
(directional cloning) (Ausubel, et al. (eds) in Current Protocols
in Molecular Biology, John Wiley & Sons (1995) Supplement 29).
Directional cDNA cloning has two major benefits. First, it reduces
the amount of work required to retrieve a clone of interest when
using any detection scheme based on protein or peptide expression,
such as antibody screening. Expression of the desired protein or
peptide requires not only that the DNA fragment containing the gene
of interest be present, but also that the fragment is provided in
the proper orientation and in the correct reading frame to direct
the synthesis of that protein. In a non-directional library,
statistically only 1 clone in 6 will meet this requirement, since
there are two possible orientations and three possible reading
frames for every clone. In contrast, directionally cloned cDNA
libraries eliminate the orientation variable, thereby doubling the
likelihood of successfully expressing a protein from a given clone
and effectively reducing by a factor of two the number of clones
that must be screened.
[0294] The immediate result is diminished labor costs.
[0295] The second, and perhaps more important, advantage of
directional cloning arises in connection with the construction of
subtractive cDNA libraries. Subtractive cDNA libraries are
collections of cDNA clones from genes expressed in one tissue or
during one developmental state, but not in another. Subtractive
cDNA libraries are used to rapidly identify genes important in
development or progression of a disease, even in the absence of
prior information about the genes. For example, a subtractive cDNA
library can identify genes that are specifically active in cancer
cells. See Scott et al., (Cell 34, 557-567, 1983); Krady et al.,
(Mol. Brain Res. 7, 287-297, 1990).
[0296] Whereas many strategies have been used to create subtractive
libraries, one of the most successful is based on the use of
directionally cloned cDNA libraries as starting material. See
Palazzolo and Meyerowitz, (Gene 52, 197, 1987); Palazzolo et al.
(Neuron 3, 527, 1989); Palazzolo et al. (Gene 88, 25, 1990). In
this approach, cDNAs prepared from a first source tissue are
directionally inserted immediately downstream of a bacteriophage T7
promoter in the vector. Total library DNA is prepared and
transcribed in vitro with T7 RNA polymerase to produce large
amounts of RNA that correspond to the original mRNA from the first
source tissue. Sequences present in both the source tissue and
another tissue are subtracted as follows. The in vitro transcribed
RNA prepared from the first source is allowed to hybridize with
cDNA prepared from either native mRNA or library RNA from the
second source tissue.
[0297] The complementarity of the cDNA to the RNA makes it possible
to remove common sequences as they anneal to each other, allowing
the subsequent isolation of unhybridized presumably tissue-specific
cDNA. This approach is only possible using directional cDNA
libraries, since any cDNA sequence in a non-directional library is
as likely to be in the "sense" orientation as the "antisense"
direction (sense and antisense are complementary to each other). A
cDNA sequence unique to a tissue would not be identifiable during
the hybridization procedure due to a low signal to noise ratio if
both sense and antisense copies were present.
[0298] In one directional cloning strategy, a DNA sequence encoding
a specific restriction endonuclease recognition motif (usually 6-10
bases) is provided at the 5' end of the oligo(dT) primer. See
Palazzolo and Meyerowitz, (Gene 52, 197, 1987). This relatively
short recognition sequence does not affect the annealing of the
12-20 base oligo(dT) primer to the mRNA, so the cDNA second strand
synthesized from the first strand template includes the new
recognition motif added to the original 3' end of the coding
sequence. After second strand cDNA synthesis, a blunt ended adapter
oligonucleotide molecule containing a second restriction motif (or
a partially double stranded adapter containing a protruding end
compatible with a second restriction site) is ligated to both ends
of the cDNA. The site encoded by the linker is now on both ends of
the cDNA molecule, but only the 3' end of the cDNA has the site
introduced by the modified primer. Following the linker ligation
step, the product is digested with both restriction enzymes (or, if
a partially double stranded linker adapter was ligated onto the
cDNA, with only the enzyme that recognizes the modified primer
sequence). A population of cDNA molecules results which all have
one defined sequence on their 5' end and a different defined
sequence on their 3' end.
[0299] A related directional cloning strategy developed by Meissner
et al. (PNAS USA 84, 4171, 1987), requires no sequence-specific
modified primer. Meissner et al. describe a double stranded
palindromic BamHI/HindIII directional linker having the sequence
d(GCTTGGATCCAAGC) (SEQ: ID NO:1), which is ligated to a population
of oligo(dT)-primed cDNAs, followed by digestion of the ligation
products with BamHI and HindIII. This palindromic linker, when
annealed to double stranded form, includes an internal BamHI site
(GGATCC) flanked by 4 of the 6 bases that define a HindIII site
(AAGCTT). The missing bases needed to complete a HindIII site are
d(AA) on the 5' end or d(TT) on the 3' end. Regardless of the
sequence to which this directional linker ligates, the internal
BamHI site will be present. However, HindIII can only cut the
linker if it ligates next to an d(AA):d(TT) dinucleotide base pair.
In an oligo(dT)-primed strategy, a HindIII site is always generated
at the 3' end of the cDNA after ligation to this directional
linker. For cDNAs having the sequence d(TT) at their 5' ends
(statistically 1 in 16 molecules), linker addition will also yield
a HindIII site at the 5' end. However, because the 5' ends of cDNA
are heterogeneous due to the lack of processivity of reverse
transcriptases, cDNA products from every gene segment will be
represented in the library.
[0300] As described above, a major limitation on cDNA cloning
technology is imposed by the available priming strategies.
Oligo(dT)-primed libraries require poly(A) containing mRNA and
generally are deficient in 5' sequences. Random primed cDNA
libraries have not found general embodiment, partly due to
technical difficulties in their construction, and more recently due
to the increasing use of incompatible directional cloning
strategies.
[0301] A "5' stretch" technique used in some laboratories employs
both an oligo(dT) primer and random hexamers for priming two
separate first strand cDNA reactions. The discontinuous cDNA
fragments are spliced together during second strand synthesis when
the two reactions are combined. After second strand synthesis,
linkers of the type described above are added, to facilitate
directional cloning. The shortcoming of this strategy is that any
spliced cDNA molecule that fails to incorporate oligo(dT) at its 3'
end is lost from the library because it cannot regenerate the 3'
enzyme recognition sequence that must be present to generate a
proper end for ligation. This strategy also does not address the
inherent problems attributable to the secondary structure of
RNA.
[0302] Still other techniques involve the use a set of random
hexameric primers engineered to also include a common restriction
site of six or more bases at one end of each primer. These primers
have not been successfully used to prime first strand synthesis.
The failure has been attributed to the formation of unstable
RNA-primer hybrids. Because the length of the engineered
restriction site equals or exceeds the length of the random
hexamers, proper hybridization of the random portion of the primers
may be energetically unfavorable. Moreover, the presence of six
defined bases as part of every primer might bias hybridization
toward corresponding complementary portions of the RNA
templates.
[0303] In spite of the success of cDNA libraries as a resource for
studying differential gene expression, several technical
difficulties have limited their wider application or have
necessitated a large amount of effort to obtain complete gene
sequences. One such difficulty concerns the under-representation of
the 5' ends of gene sequences obtained from cDNA libraries.
[0304] First strand synthesis uses an RNA-dependent DNA polymerase,
and no DNA polymerase can start cDNA synthesis de novo. DNA
polymerases require a short primer as a starting material upon
which to add bases to the 3' end of a nascent cDNA first strand.
The simplest primer is an oligo(dT) primer that can anneal
specifically to the 3' poly(A) tail found in most mRNA molecules.
All cDNAs synthesized with an oligo(dT) primer thus start at the 3'
end of the mRNA and share a common 3' sequence (i.e. the
d(A.sub.n:T.sub.n) tail).
[0305] The major pitfall of oligo(dT)-primed synthesis is that
RNA-dependent DNA polymerases tend to become disengaged from the
mRNA template before traversing its entire length. It is thought
that this is primarily due to random failure in the elongation
process and to specific areas of RNA secondary structure at which
the enzyme may pause or stop altogether.
[0306] Accordingly, in oligo(dT)-primed libraries, the 3' ends of
mRNAs are therefore statistically more likely to be copied than the
sequences closer to the 5' end because reverse transcription always
commences from the point at which the primer anneals. The resulting
cDNA population is therefore biased toward the 3' ends of RNA
strands. As might be expected, the effect is particularly
noticeable with long mRNAs and results in few or no complete cDNA
clones for certain genes in the library. Good quality
oligo(dT)-primed cDNA libraries contain some inserts from 4 to 8
kb, but even inserts of this length may not cover the 5' end of a
desired gene.
[0307] In addition, some mRNAs have a poly(A) tail that is too
short to anneal to the oligo(dT) primer, or they have no poly(A)
tail at all. See Greenberg, (Biochemistry 15, 3516-3522, 1976);
Adesnik and Darnell, (J. Mol. Biol. 67, 397-406, 1982); Houdebine,
(FEBS Lett. 66, 110-118, 1976).
[0308] Estimates of the percent of non-polyadenylated mRNA in
different species ranges from 30% Milcarek et al., (Cell 3, 1-10,
1974) to 80% Miller, (Dev. Biol. 64, 118-129, 1978) of mRNA. In a
comparison of poly(A) containing mRNA and poly(A) devoid mRNA
isolated from mouse brain, Van Ness et al. (Cell 18, 1341-1349,
1979) found that a substantial proportion of non-polyadenylated
mRNA contains unique protein-encoding sequences. Therefore, many
potentially important genes might be absent in oligo(dT)-primed
cDNA libraries.
[0309] One preferred method for obtaining randomly primed cDNA is
disclosed in U.S. Pat. No. 5,629,179 incorporated herein by
reference. U.S. Pat. No. 5,629,179 provide a method for forming
cDNA libraries by directional cloning of cDNA molecules formed by
random priming. The method differs from other random priming and
directional cDNA cloning methods by using a set of oligonucleotides
in the form of primers having the sequence of 5'-XXNNNNNN-3' and
annealing the primers to a RNA template.
[0310] The members of the set of primers are constant in one regard
and variable in a second regard. The primers in the set vary in the
3'-most six nucleotides, depicted as NNNNNN. This representation is
intended to indicate that A, G, C, or T can appear at any position.
Thus, the 3'-most six nucleotides of the primers in the set
represent all 4096 (4.sup.6) possible hexamers.
[0311] All primers in the set contain the same two 5'-most
nucleotides, depicted as XX. XX can be any dinucleotide that, when
ligated to the 3' terminus of another polynucleotide molecule,
forms an endonuclease recognition sequence. The use of a
dinucleotide is sterically and energetically acceptable for
facilitating primer binding, yet short enough to not bias priming
toward any particular sequence on the mRNA templates.
[0312] After binding the set of primers to the RNA strand, first
and second strand cDNA syntheses are carried out according to any
known method. The RNA used as template can be cellular RNA obtained
from any biological sample including any organism, such as an
animal, including a human being. The RNA can be isolated using
known method. One preferred method is that of Chomczynski and
Sacchl, (Anal. Biochem, 162, 156-159, 1987). The RNA may, but need
not be, poly(A)-enriched. If poly(A) containing RNA is desired, it
may be obtained using any method that yields poly(A)-selected
RNA.
[0313] One preferred method for purifying poly(A)-selected RNA is
to pass the total RNA over an oligo(dT)-cellulose matrix, washing
unbound RNA from the matrix, and then releasing the poly(A)
containing RNA from the oligo(dT)-cellulose under low ionic
strength with low salt. More recently developed methods for direct
isolation of poly(A) containing RNA from tissues and cells
utilizing oligo(dT)-coupled magnetic particles may also be
employed.
[0314] During copying of the first strand to form the complementary
second strand the primer-derived 5'-terminal dinucleotide on the
first strand is also copied. Thus, the result of cDNA first and
second strand synthesis is a population of fully double-stranded
cDNA molecules, each having the same defined dinucleotide at the
end corresponding to the 3' (carboxyl-terminal) side of a coding
region thus facilitating discrimination between the two ends of the
cDNA. In combination with the present invention this enables the
isolation of an ssDNA tag from any of the two strands at will.
[0315] Another preferred method for obtaining cDNA from the 5'
region of RNA is described in Technotes Newsletter 7(3), 1-2, 2000
(published by Ambion) and exploits rapid amplification of cDNA ends
(RACE). Common shortcomings of cDNA library synthesis have been
discussed earlier. PCR can facilitate isolation of 5'-ends of mRNA
by several similar methods collectively termed Rapid Amplification
of cDNA Ends, or RACE. RACE involves performing a random-primed
reverse transcription (RT) reaction, adding an adapter to the
3'-end of the synthesized cDNA (corresponding to the 5'-end of the
gene sequence) by ligation or PCR, and amplifying by PCR with a
gene specific primer and a primer that recognizes the adapter
sequence.
[0316] While RACE can produce results in a relatively short time,
the procedure frequently yields sequences exclusively from
truncated RT products. This is so partly because it is not a
trivial task to prevent premature termination of cDNA synthesis and
because PCR will selectively amplify the shortest targets in a
mixed population. In order to add selectivity to RACE, several
variations to the basic procedure have been developed. The most
promising is a method of positive selection for amplification
products that contain the true 5'-end of the mRNA. One preferred
second-generation RACE-technique is RNA-ligase-mediated RACE, or
RLM-RACE (Nucl. Acid Res. 21, 4954-4960, 1993). In RLM-RACE, an RNA
sample is first treated with phosphatase, for example Calf
Intestine Phosphatase (CIP), to remove the 5'-phosphate from all
RNA species except those that have a cap structure.
[0317] A cap structure is present on all Pol II transcripts i.e.
full-length mRNAs. Molecules that are dephosphorylated by CIP
include rRNA, tRNA, DNA, and fragmented mRNA that does not contain
the 5'-end. Pyrophosphatase, for example Tobacco Acid
Pyrophosphatase (TAP), is then used to remove the cap structure
from mRNA. Next a synthetic adapter is ligated to the CIP/TAP
treated RNA. The RNA oligonucleotide ligates only to the decapped
mRNA--no ligation occurs to dephosphorylated molecules.
[0318] The chimeric RNA is then reverse transcribed using random
decamers as primers. If the RT extends to the natural 5'-end of an
RNA, it will incorporate the adapter sequence into the first-strand
cDNA. Next nested PCR using gene specific primers together with
adapter primers can be carried out. If using RLM-RACE for preparing
cDNA for an expression profiling experiment, second-strand cDNA
synthesis can be carried out with an adapter primer conjugated to a
solid support or a magnetic bead.
[0319] Once a cDNA has been generated it may be subjected to the
below described processing steps in order to obtain at least one
single stranded polynucleotide tag. In principle, the cDNA can
either be subjected to cleavage by at least one cleavage agent,
preferably a site-specific nicking endonuclease capable of
recognizing a predetermined motif of a double stranded
polynucleotide and cleaving only one of said strands, or cloned in
a suitable vector prior to such cleavage and generation of a single
stranded polynucleotide.
Cloning of cDNA in Suitable Vectors
[0320] Various approaches have been used to prepare the cDNA ends
for vector insertion. See Kimmel, A. R. and Berger, S. L. (Meth.
Enzymol. 152, 307, 1987). Most have used methods known as "linker"
or "adapter" methods. All methods using linkers require an
additional step to protect the cDNA from being cleaved at
adventitious restriction sites during digestion to create the
cohesive ends. See Wu, R., Wu, T. and Ray, A. (Meth. Enzymol. 152,
343, 1987). This protection is accomplished either by treating the
cDNA with on site-specific methylases or by substituting a
methylated dCTP analog for unmodified dCTP in the synthesis
reactions.
[0321] The double-stranded cDNA molecules generated as described
herein above and in U.S. Pat. No. 5,629,179 may subsequently be
joined by ligation to a double-stranded, palindromic linker.
Internal to the linker is a palindromic second endonuclease
recognition sequence different from the first recognition sequence.
At the 3' terminus of each strand of the palindromic linker are at
least two nucleotides that form the 5' portion of the first
endonuclease recognition sequence, the 3' portion of which is
encoded by the dinucleotide that is the constant portion shared by
each of the primers in the set. Upon ligation of the mixed
population of cDNA molecules to copies of the palindromic linker,
the second recognition sequence is formed at the junction in each
cDNA molecule.
[0322] To obtain a cDNA fragment for directional cloning, the
ligated products are cleaved using the first and second
endonucleases, thereby generating a first cleavage in the linker 5'
to the cDNA and a second cleavage at the 3' end of the cDNA in the
site formed at the cDNA-linker junction. As normally practiced, the
cDNA can be methylated after synthesis using site-specific enzymes
(e.g. EcoRI methylase, AluI methylase, etc.) to protect against
digestion at adventitious sites. Alternatively, 5-methyl dCTP can
be incorporated during cDNA synthesis to accomplish protection. The
directional cDNA fragment thus generated can be ligated
directionally into a vector and subsequently prepared as a cDNA
library.
[0323] It will be understood that "adapter oligonucleotides"
according to the present invention may be used either i) for
preparing a cDNA for cloning in a suitable vector, or ii) for
introducing a predetermined restriction endonuclease recognition
motif in conjunction to the cDNA for other purposes than direct
cloning into a vector. Examples of such other purposes include the
provision of polynucleotide tags obtainable by the methods of the
present invention.
Characterizing Single Stranded Polynucleotide Tags from dsDNA
[0324] The invention in preferred embodiments relates to methods
for obtaining single stranded polynucleotide tags including ssDNA
tags from either end of a cDNA, from genomic DNA, or from
extra-genomic DNA. The tag may have any desired length ranging from
only about 4 or 18 nucleotides to much longer tags containing up to
more than several hundred nucleotides.
[0325] Accordingly, in preferred embodiments of the present
invention there are provided methods for generating short or long
tags from either the 5' end or the 3' end of either at least one
cDNA or at least one fragment of genomic DNA or at least one
fragment of extra-genomic DNA.
[0326] In particular, there is provided in one preferred embodiment
of the invention a method for obtaining at least one single
stranded polynucleotide tag from a biological sample, wherein the
method comprises the steps of [0327] i) providing at least one
double stranded polynucleotide, wherein the polynucleotide is
selected from the group of polynucleotides consisting of
polynucleotides comprising complementary DNA (cDNA),
polynucleotides comprising genomic DNA, and polynucleotides
comprising extra-genomic DNA, [0328] ii) contacting and cleaving at
least one of the complementary strands of the double stranded
polynucleotide provided in step i) with at least one cleavage agent
capable of recognizing a double stranded polynucleotide comprising
complementary polynucleotide strands and cleaving only one of the
strands of the polynucleotide provided in step i), and the further
step of [0329] iii) contacting and cleaving--prior to obtaining at
least one single stranded polynucleotide tag--either [0330] a) the
double stranded polynucleotide provided in step i), or [0331] b)
the double stranded polynucleotide of step ii) contacted and
cleaved in one strand by the at least one cleavage agent,
preferably a site-specific nicking endonuclease, capable of
recognizing a double stranded polynucleotide comprising
complementary polynucleotide strands and cleaving only one of the
strands of the polynucleotide with at least one cleavage agent,
preferably a site-specific restriction endonuclease, capable of
recognizing a double stranded polynucleotide comprising
complementary polynucleotide strands and cleaving both of the
strands of the polynucleotide, wherein the cleavage with the
cleavage agent capable of cleaving only one strand, and the
cleavage with the cleavage agent capable of cleaving both strands,
of the double stranded polynucleotide occurs simultaneously, or
sequentially in any order, and [0332] iv) obtaining at least one
single stranded polynucleotide tag.
[0333] The single stranded polynucleotide tag preferably comprises
or essentially consists of deoxyribonucleic acid, and the
biological sample is preferably obtained from an animal, including
a human being; or a plant; or a fungus; or a single cellular
organism, including bacteria, protozooans; or a virus.
[0334] The single stranded polynucleotide tag preferably comprises
only a single polynucleotide strand and no complementary strand, or
a part thereof, capable of forming with the single stranded
polynucleotide tag a double stranded polynucleotide comprising
complementary polynucleotides, including any double stranded
polynucleotide wherein at least a part of the double stranded
polynucleotide consists of single, complementary
polynucleotides.
[0335] The single stranded polynucleotide tag preferably comprises
less than 5000 nucleotides, such as 1000 nucleotides, for example
less than 500 nucleotides, such as 100 nucleotides, for example
less than 50 nucleotides, such as 40 nucleotides, for example less
than 30 nucleotides, such as 25 nucleotides, for example less than
20 nucleotide, such as 19 nucleotides, for example less than 18
nucleotides, such as 17 nucleotides, for example less than 16
nucleotides, such as 15 nucleotides, for example less than 14
nucleotides, such as 13 nucleotides, for example less than 12
nucleotides, such as 11 nucleotides, for example 10 nucleotides, or
less than 10 nucleotides, such as 9 nucleotides, for example less
than 8 nucleotides, such as 7 nucleotides, for example less than 6
nucleotides, such as 5 nucleotides, for example 4 nucleotides. In
one embodiment, tags of less than 20 nucleotides, including tags of
10 nucleotides, is preferred.
[0336] It is preferred that all of the nucleotides of the single
stranded polynucleotide tag originate from a cDNA obtained from the
biological sample, or from genomic DNA obtained from the biological
sample, or from extra-genomic DNA obtained from the biological
sample.
[0337] The cleavage agent capable of recognizing a double stranded
polynucleotide comprising complementary polynucleotide strands and
cleaving only one of the strands is preferably a site-specific
nicking endonuclease, including a site-specific nicking
endonuclease catalyzing a single strand cleavage either within the
location of the recognition motif recognized by the endonuclease,
or at a location beyond the most 5' nucleotide of the recognition
motif, such as at least one nucleotide beyond the most 5'
nucleotide of the recognition motif, or at a location beyond the
most 3' nucleotide of the recognition motif, such as at least one
nucleotide beyond the most 3' nucleotide of the recognition
motif.
[0338] The distance between the location of the site for the single
strand cleavage and the nearest nucleotide of the recognition motif
is preferably less than about 500 nucleotides, such as about 400
nucleotides, for example less than about 300 nucleotides, such as
about 200 nucleotides, for example about 150 nucleotides, such as
less than about 100 nucleotides, for example less than about 80
nucleotides, such as about 60 nucleotides, for example less than
about 50 nucleotides, such as about 40 nucleotides, for example
less than about 30 nucleotides, such as about 25 nucleotides, for
example less than 20 nucleotides, such as 19 nucleotides, for
example less than 18 nucleotides, such as 17 nucleotides, for
example less than 16 nucleotides, such as 15 nucleotides, for
example less than 14 nucleotides, such as 13 nucleotides, for
example less than 12 nucleotides, such as 11 nucleotides, for
example less than 10 nucleotides, such as 9 nucleotides, for
example less than 8 nucleotides, such as 7 nucleotides, for example
less than 6 nucleotides, such as 5 nucleotides or less, for example
4 nucleotides, or less than 4 nucleotides, such as 3 nucleotides,
for example less than 2 nucleotides, such as 1 nucleotide. In one
embodiment a distance of 4 nucleotides is preferred.
[0339] The site-specific nicking endonuclease preferably recognizes
a recognition motif comprising the complementary polynucleotide
strands TABLE-US-00001 5'- GAGTC -3' 3'- CTCAG -5'
[0340] In one embodiment the site-specific nicking endonuclease is
isolated from a strain of Bacillus stearothermophilus, including
the strain of Bacillus stearothermophilus 33M as described by New
England Biolabs as a source of N.BstNB I as listed in Catalogue
dated 2000-01 under no. R0607S (200 units) or no. R0607L (1000
units), or an isoschizomer thereof.
[0341] The cleavage agent capable of recognizing a double stranded
polynucleotide comprising complementary polynucleotide strands and
cleaving both of the strands of the polynucleotide is preferably a
site-specific restriction endonuclease, preferably a site-specific
restriction endonuclease selected from the group consisting of
site-specific restriction endonucleases of type II recognizing and
cleaving a double stranded polynucleotide within the location of a
recognition motif producing either 3' or 5' overhangs or blunt
ends, and site-specific restriction endonucleases of type IIs
recognizing and cleaving a double stranded polynucleotide beyond
the location of a recognition motif producing either 3' or 5'
overhangs or blunt ends.
[0342] The method in one preferred embodiment comprises the further
step of providing at least one adapter oligonucleotide comprising
at least one recognition motif, or a part thereof, for at least one
cleavage agent capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving a)
only one complementary strand, or b) both of the complementary
stands of the double stranded polynucleotide.
[0343] The adapter oligonucleotide comprises or essentially
consists of either complementary strands comprising at least one
recognition motif for at least one cleavage agent, wherein said
motif comprises complementary polynucleotide strands, or a part of
a recognition motif for at least one cleavage agent, wherein said
part comprises a single oligonucleotide strand which, together with
a complementary strand, forms a recognition motif for at least one
cleavage agent.
[0344] The adapter oligonucleotide may comprise at least two
recognition motifs, or a single stranded part thereof, wherein at
least one of said motifs are capable of binding a site-specific
nicking endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving only
one complementary strand thereof.
[0345] The adapter oligonucleotide may further comprise a
recognition motif capable of binding a site-specific restriction
endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving both
of the complementary stands of the double stranded polynucleotide.
The recognition motif for the site-specific nicking endonuclease
capable of recognizing a double stranded polynucleotide comprising
complementary strands and cleaving only one complementary strand
thereof may in one embodiment form part of the recognition motif
for the site-specific restriction endonuclease capable of
recognizing a double stranded polynucleotide comprising
complementary strands and cleaving both of the complementary stands
of the double stranded polynucleotide.
Preferred Recognition Motifs in Adapter Oligonucleotides
[0346] Described herein below are examples of cleavage agents
capable of being exploited in connection with the present
invention. One preferred site-specific nicking endonuclease is
N.BstNB I recognising the illustrated dsDNA sequence and nicking
one of the strands at the indicated position ({hacek over (
)}).
[0347] When used in combination with the recognition motif for at
least one additional cleavage agent as illustrated herein below, a
number of sequences introduced into the chimeric dsDNA by the
adapter oligonucleotide can be generated, as illustrated herein
below, wherein each sequence introduced into the chimeric dsDNA by
the adapter oligonucleotide comprises the recognition motif for a
preferred site-specific nicking endonuclease, including the
recognition motif for N.BstNB I, and the recognition motif for a
preferred site-specific restriction endonuclease, including the
site-specific restriction endonuclease mentioned herein below.
[0348] When subjected to both the site-specific nicking
endonuclease, including N.BstNB I, and the illustrated
site-specific restriction endonucleases listed herein below, an
ssDNA tag is generated in each case as illustrated herein below for
the respective combination of site-specific nicking endonuclease,
including N.BstNB I, and site-specific restriction endonuclease.
TABLE-US-00002 N.BStNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Alw I:
5'-GGATCNNNNNN-3' 3'-CCTAGNNNNNN-5'
[0349] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (except for any N): TABLE-US-00003
5'-GAGTCGGATCNNNNNN-3' (SEQ ID NO: 2) 3'-CTCAGCCTAGNNNNNN-5' (SEQ
ID NO: 3) ssDNA tag: 5'-CNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3'
3'-CTCAGNNNNN-5' Bbv I: 5'-GCAGCNNNNNNNNNNNNN-3'
3'-CGTCGNNNNNNNNNNNNN-5'
[0350] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00004
5'-GAGTCGCAGCNNNNNNNNNNNNN-3' (SEQ ID NO: 4)
3'-CTCAGCGTCGNNNNNNNNNNNNN-5' (SEQ ID NO: 5) ssDNA tag:
5'-CNNNNNNNN-3' N.BStNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Bci
VI: 5'-GTATCCNNNNNNN-3' 3'-CATAGGNNNNNNN-5'
[0351] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00005
5'-GAGTCGTATCCNNNNNNN-3' (SEQ ID. NO: 6) 3'-CTCAGCATAGGNNNNNNN-5'
(SEQ ID NO: 7) ssDNA tag: 5'-CCNNNNNN-3' N.BstNB I:
5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Bmr I: 5'-ACTGGGNNNNNN-3'
3'-TGACCCNNNNNN-5'
[0352] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00006
5'-GAGTCACTGGGNNNNNN-3' (SEQ ID NO: 8) 3'-CTCAGTGACCCNNNNNN-5' (SEQ
ID NO: 9) ssDNA tag: 5'-GGNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3'
3'-CTCAGNNNNN-5' Bpm I: 5'-CTGGAGNNNNNNNNNNNNNNNNN-3'
3'-GACCTCNNNNNNNNNNNNNNNNN-5'
[0353] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 1: TABLE-US-00007 (SEQ ID NO:
10) 5'-GAGTCCTGGAGNNNNNNNNNNNNNNNNNN-3' (SEQ ID NO: 11)
3'-CTCAGGACCTCNNNNNNNNNNNNNNNNNN-5' ssDNA tag 1:
5'-AGNNNNNNNNNNNNNNNN-3'
[0354] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 2: TABLE-US-00008
5'-GAGTCTGGAGNNNNNNNNNNNNNNNNN-3' (SEQ ID NO: 12)
3'-CTCAGACCTCNNNNNNNNNNNNNNNNN-5' (SEQ ID NO: 13) ssDNA tag 2:
5'-GNNNNNNNNNNNNNNNN-3'
[0355] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 3: TABLE-US-00009
5'-CTGGAGTCNNNNNNNNNNNNNNN-3' 3'-GACCTCAGNNNNNNNNNNNNNNN-5' ssDNA
tag 3: 5'-NNNNNNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3'
3'-CTCAGNNNNN-5' Bse RI: 5'-GAGGAGNNNNNNNNNNNN-3'
3'-CTCCTCNNNNNNNNNNNN-5'
[0356] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 1: TABLE-US-00010
5'-GAGTCGAGGAGNNNNNNNNNNN-3' (SEQ ID NO: 14)
3'-CTCAGCTCCTCNNNNNNNNNNN-5' (SEQ ID NO: 15) ssDNA tag 1:
5'-AGNNNNNNNNNN-3'
[0357] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 2: TABLE-US-00011
5'-GAGGAGTCNNNNNNNNN-3' 3'-CTCCTCAGNNNNNNNNN-3' ssDNA tag 2:
5'-NNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Bsg I:
5'-GTGCAGNNNNNNNNNNNNNNNNN-3' 3'-CACGTCNNNNNNNNNNNNNNNNN-5'
[0358] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 1: TABLE-US-00012
5'-GAGTCGTGCAGNNNNNNNNNNNNNNNNN-3' (SEQ ID NO: 16)
3'-CTCAGCACGTCNNNNNNNNNNNNNNNNN-5' (SEQ ID NO: 17) ssDNA tag 1:
5'-AGNNNNNNNNNNNNNNNN-3'
[0359] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 2: TABLE-US-00013
5'-GTGCAGGAGTCNNNNNNNNNNNN-3' (SEQ ID NO: 18)
3'-CACGTCCTCAGNNNNNNNNNNNN-5' (SEQ ID NO: 19) ssDNA tag 2:
5'-NNNNNNN-3'
[0360] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 3: TABLE-US-00014
5'-GTGCAGAGTCNNNNNNNNNNNNN-3' (SEQ ID NO: 20)
3'-CACGTCTCAGNNNNNNNNNNNNN-5' (SEQ ID NO: 21) ssDNA tag 3:
5'-NNNNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Bsm FI:
5'-GGGACNNNNNNNNNNNNNNN-3' 3'-CCCTGNNNNNNNNNNNNNNN-5'
[0361] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00015
5'-GAGTCGGGACNNNNNNNNNNNNNNN-3' (SEQ ID NO: 22)
3'-CTCAGCCCTGNNNNNNNNNNNNNNN-5' (SEQ ID NO: 23) ssDNA tag:
5'-CNNNNNNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Bsp
MI: 5'-ACCTGCNNNNNNNNN-3' 3'-TGGACGNNNNNNNNN-5'
[0362] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00016
5'-GAGTCACCTGCNNNNNNNNN-3' (SEQ ID NO: 24)
3'-CTCAGTGGACGNNNNNNNNN-5' (SEQ ID NO: 25) ssDNA tag: 5'-GCNNNN-3'
N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Eci I:
5'-GGCGGANNNNNNNNNNNN-3' 3'-CCGCCTNNNNNNNNNNNN-5'
[0363] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00017
5'-GAGTCGGCGGANNNNNNNNNNNN-3' (SEQ ID NO: 26)
3'-CTCAGCCGCCTNNNNNNNNNNNN-5' (SEQ ID NO: 27) ssDNA tag:
5'-GANNNNNNNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5'
Fau I: 5'-CCCGCNNNNNNN-3' 3'-GGGCGNNNNNNN-3'
[0364] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 1: TABLE-US-00018
5'-GAGTCCCCGCNNNNNNN-3' (SEQ ID NO: 28) 3'-CTCAGGGGCGNNNNNNN-5'
(SEQ ID NO: 29) ssDNA tag 1: 5'-CNNNN-3'
[0365] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 2: TABLE-US-00019
5'-GAGTCCCGCNNNNNNNN-3' 3'-CTCAGGGCGNNNNNNNN-5' ssDNA tag 2:
5'-NNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Fok I:
5'-GGATGNNNNNNNNNNNNNN-3' 3'-CCTACNNNNNNNNNNNNNN-5'
[0366] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00020
5'-GAGTCGGATGNNNNNNNNNNNNNN-3' (SEQ ID NO: 30)
3'-CTCAGCCTACNNNNNNNNNNNNNN-5' (SEQ ID NO: 31) ssDNA tag:
5'-GNNNNNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Hga
I: 5'-GACGCNNNNNNNNNNN-3' 3'-CTGCGNNNNNNNNNNN-5'
[0367] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00021
5'-GAGTCGACGCNNNNNNNNNNN-3' (SEQ ID NO: 32)
3'-CTCAGCTGCGNNNNNNNNNNN-5' (SEQ ID NO: 33) ssDNA tag: 5'-CNNNNN-3'
N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Hph I:
5'-GGTGANNNNNNNNN-3' 3'-CCACTNNNNNNNNN-5'
[0368] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00022
5'-GAGTCGGTGANNNNNNNNN-3' (SEQ ID NO: 34) 3'-CTCAGCCACTNNNNNNNNN-5'
(SEQ ID NO: 35) sSDNA tag: 5'-ANNNNNNNN-3' N.BstNB I:
5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Mbo II: 5'-GAAGANNNNNNNNN-3'
3'-CTTCTNNNNNNNNN-5'
[0369] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00023
5'-GAGTCGAAGANNNNNNNNN-3' (SEQ ID NO: 36) 3'-CTCAGCTTCTNNNNNNNNN-5'
(SEQ ID NO: 37) ssDNA tag: 5'-ANNNNNNNN-3' N.BstNB I:
5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Mly I: 5'-GAGTCNNNNNN-3'
3'-CTCAGNNNNNN-5'
[0370] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00024
5'-GAGTCGAGTCNNNNNN-3' (SEQ ID NO: 38) 3'-CTCAGCTCAGNNNNNN-5' (SEQ
ID NO: 39) ssDNA tag: 5'-CNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3'
3'-CTCAGNNNNN-5' Mnl I: 5'-CCTCNNNNNNNN-3' 3'-GGAGNNNNNNNN-5'
[0371] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 1: TABLE-US-00025
5'-GAGTCCCTCNNNNNNNN-3' 3'-CTCAGGGAGNNNNNNNN-5' sSDNA tag 1:
5'-NNNNNNN-3'
[0372] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N) 2: TABLE-US-00026
5'-GAGTCCTCNNNNNNNNN-3' 3'-CTCAGGAGNNNNNNNNN-5' ssDNA tag 2:
5'-NNNNNNN-3' N.BstNB I: 5'-GAGTCNNNNN-3' 3'-CTCAGNNNNN-5' Ple I:
5'-GAGTCNNNNNN-3' 3'-CTCAGNNNNNN-5'
[0373] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00027
5'-GAGTCGAGTCNNNNNN-3' (SEQ ID NO: 40) 3'-CTCAGCTCAGNNNNNN-5' (SEQ
ID NO: 41) ssDNA tag: 5'-CNNNN-3' N.BStNB I: 5'-GAGTCNNNNN-3'
3'-CTCAGNNNNN-5' Sfa NI: 5'-GCATCNNNNNNNNNN-3'
3'-CGTAGNNNNNNNNNN-5'
[0374] Sequence Introduced into the Chimeric dsDNA by the Adapter
Oligonucleotide (Except for any N): TABLE-US-00028
5'-GAGTCGCATCNNNNNNNNNN-3' (SEQ ID NO: 42)
3'-CTCAGCGTAGNNNNNNNNNN-5' (SEQ ID NO: 43) ssDNA tag:
5'-CNNNNN-3'
Methods Exploiting Adapter Oligonucleotides for Obtaining a Single
Stranded Polynucleotide Tag
[0375] Adapter oligonucleotides can be exploited in a variety of
ways in methods for obtaining single stranded polynucleotide tags.
The adapters can thus be used for obtaining tags from a
predetermined source. A different class of molecules termed
identifying linker oligonucleotides can subsequently be used for
isolation and/or sequence determination and/or quantification of
such tags.
[0376] The tag sources can be e.g. single stranded RNA, or double
stranded cDNA synthesized on the basis thereof. The tag source can
also be genomic DNA or extra-genomic DNA, in which case the tag
source is preferably also double stranded. It is generally
preferred that the tag consists exclusively of a sequence of
nucleotides originating from the tag source, although an exemption
from this principle is illustrated in FIG. 64. One advantage of
obtaining tags consisting exclusively of a sequence of nucleotides
originating from the tag source itself is that artificial, non-tag
source sequences, such as e.g. sequences originating from adapters,
linkers, primers and the like, but not associated with the tag
source, do not interfere with the sorting and/or isolation and/or
sequence determination and/or quantification of the tag.
[0377] When being ligated to single stranded RNA the adapter is
preferably in single stranded form. When being ligated to double
stranded cDNA or double stranded genomic DNA, or double stranded
extra-genomic DNA, the adapter is preferably in double stranded
form. The adapter can in principle be ligated to either the 5' end
or the 3' end of the tag source.
[0378] Prior to ligation of adapter and double stranded tag source
it may be preferred to obtain a fragment of such a tag source. This
fragment can be obtained by digesting said double stranded tag
source with a cleavage agent capable of providing a fragment
thereof. The cleavage agent can be a site specific endonuclease,
including a site specific restriction endonuclease of type II or
IIs.
[0379] The ligation of adapter and tag source can be carried out by
using any method known to the skilled person, including methods
involving state-of-the-art molecular biology modifications in order
to facilitate or optimize ligation of nucleotides.
[0380] Ligation of a double stranded adapter and double stranded
tag source, or a fragment thereof, results in the formation of a
double stranded chimer as defined herein. Likewise, ligation of a
single stranded adapter and a single stranded tag source, or a part
thereof, results in a single stranded chimer capable of being
converted into a double stranded chimer by second strand synthesis
using the single stranded chimer as a template.
[0381] Accordingly, there is provided in one preferred embodiment
of the invention a method for obtaining at least one single
stranded polynucleotide tag from a biological sample, said method
comprising the steps of [0382] i) providing at least one adapter
oligonucleotide comprising [0383] a) at least one recognition motif
for at least one site-specific nicking endonuclease, wherein said
motif comprises a double stranded oligonucleotide comprising
complementary strands, or [0384] b) a part of a recognition motif
for at least one site-specific nicking endonuclease, wherein said
part comprises a single oligonucleotide strand which, together with
a complementary strand, forms a recognition motif for at least one
site-specific nicking endonuclease, [0385] ii) further providing
[0386] c) at least one ribonucleic acid obtained from the
biological sample, or [0387] d) at least one double stranded
polynucleotide fragment comprising complementary polynucleotide
strands, wherein said double stranded polynucleotide is obtained by
a method comprising the step of using the at least one ribonucleic
acid provided in step iic) as a template for the synthesis of a
polynucleotide strand complementary to the at least one ribonucleic
acid, or [0388] e) at least one double stranded genomic
polynucleotide fragment, or at least one double stranded
extra-genomic polynucleotide fragment, wherein said genomic
polynucleotide fragment or extra-genomic polynucleotide fragment is
obtained by cleaving a genomic polynucleotide or an extra-genomic
polynucleotide with at least one site-specific restriction
endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving both
of said strands, [0389] iii) obtaining a double stranded chimeric
polynucleotide comprising an adapter oligonucleotide part by [0390]
iiia) linking together [0391] f) the at least one adapter
oligonucleotide of step ia) comprising the at least one recognition
motif for the at least one site-specific nicking endonuclease,
wherein said motif comprises complementary strands, [0392] with
either [0393] g) the at least one double stranded polynucleotide
comprising complementary polynucleotide strands, wherein said
double stranded polynucleotide is obtained by a method comprising
the step of using the at least one ribonucleic acid provided in
step iic), as a template for the synthesis of a polynucleotide
strand complementary to the at least one ribonucleic acid, or
[0394] h) the at least one double stranded genomic polynucleotide
or the at least one double stranded extra-genomic polynucleotide of
step iie), [0395] or [0396] iiib) obtaining a double stranded
chimeric polynucleotide comprising an adapter oligonucleotide part
by linking together [0397] i) at least one adapter oligonucleotide
comprising a part of a recognition motif for at least one
site-specific nicking endonuclease, wherein said part comprises a
single oligonucleotide strand which, together with a complementary
strand, forms a recognition motif for at least one site-specific
nicking endonuclease, [0398] with [0399] j) the at least one
ribonucleic acid obtained from the biological sample, and [0400] k)
obtaining at least one double stranded chimeric polynucleotide
comprising an adapter oligonucleotide part by using the chimeric
polynucleotide obtained by linking together the adapter
oligonucleotide of step iiibi) with the ribonucleic acid of step
iiibj) as a template for the synthesis of a polynucleotide strand
complementary to said chimeric polynucleotide, [0401] iv)
contacting and cleaving the double stranded chimeric polynucleotide
obtained in step iiia) or step iiib) with either [0402] iva) at
least one site-specific nicking endonuclease capable of recognizing
a double stranded polynucleotide comprising complementary
polynucleotide strands and cleaving only one of said strands,
[0403] or contacting and cleaving the double stranded chimeric
polynucleotide obtained in step iiia) or step iiib) with [0404]
ivb) a combination of [0405] a) at least one sites-specific
restriction endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving both
of said strands, and [0406] b) at least one site-specific nicking
endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary polynucleotide strands and
cleaving only one of said strands, wherein the contacting and
cleaving of the double stranded chimeric polynucleotide performed
with the combination of step ivb) occurs either simultaneously, or
sequentially in any order, and [0407] v) obtaining at least one
single stranded polynucleotide tag.
[0408] In the above methods, the fragment of step iid) is
preferably obtained by using a site specific restriction
endonuclease of type II and/or type IIs. The fragment of step iie)
is preferably obtained by using a site specific restriction
endonuclease of type II and/or type IIs. The site-specific
restriction endonuclease of step ivb) is preferably of type II.
[0409] In further preferred embodiments there are provided a series
of methods comprising some, but not all, of the above method steps.
The methods of such embodiments comprise steps: [0410] ia); iid);
iiiaf; iiiag); iva); and v), [0411] ia); iid); iiiaf); iiiag);
ivb); and v), [0412] ia); iie); iiiaf); iiiah); iva); and v),
[0413] ia); iie); iiiaf); iiiah); ivb); and v), [0414] ib); iic);
iiibi); iiibj); iiibk); iva); and v), and [0415] ib); iic); iiibi);
iiibj); iiibk); ivb); and v), respectively, as described in detail
below. Steps ia); iid); iiiaf); iiiag); iva); and v)
[0416] Method for obtaining at least one single stranded
polynucleotide tag from a biological sample, said method comprising
the steps of [0417] i) providing at least one adapter
oligonucleotide comprising at least one recognition motif for at
least one site-specific nicking endonuclease, wherein said motif
comprises a double stranded oligonucleotide comprising
complementary strands, [0418] ii) further providing at least one
ribonucleic acid obtained from a biological sample and at least one
double stranded polynucleotide fragment comprising complementary
polynucleotide strands, wherein said double stranded polynucleotide
is obtained by a method comprising the step of using the at least
one ribonucleic acid as a template for the synthesis of a
polynucleotide strand complementary to the at least one ribonucleic
acid, [0419] iii) obtaining a double stranded chimeric
polynucleotide comprising an adapter oligonucleotide part by
linking together the at least one adapter oligonucleotide of step
i) comprising the at least one recognition motif for the at least
one site-specific nicking endonuclease, wherein said motif
comprises complementary strands, with the at least one double
stranded polynucleotide comprising complementary polynucleotide
strands, wherein said double stranded polynucleotide is obtained by
a method comprising the step of using the at least one ribonucleic
acid provided in step ii) as a template for the synthesis of a
polynucleotide strand complementary to the at least one ribonucleic
acid, [0420] iv) contacting and cleaving the double stranded
chimeric polynucleotide obtained in step iii) with at least one
site-specific nicking endonuclease capable of recognizing a double
stranded polynucleotide comprising complementary polynucleotide
strands and cleaving only one of said strands, and [0421] v)
obtaining at least one single stranded polynucleotide tag. Steps
ia); iid); iiiaf); iiiag); ivb); and v)
[0422] Method for obtaining at least one single stranded
polynucleotide tag from a biological sample, said method comprising
the steps of [0423] i) providing at least one adapter
oligonucleotide comprising at least one recognition motif for at,
least one site-specific nicking endonuclease, wherein said motif
comprises a double stranded oligonucleotide comprising
complementary strands, [0424] ii) further providing at least one
ribonucleic acid obtained from a biological sample and at least one
double stranded polynucleotide fragment comprising complementary
polynucleotide strands, wherein said double stranded polynucleotide
is obtained by a method comprising the step of using the at least
one ribonucleic acid as a template for the synthesis of a
polynucleotide strand complementary to the at least one ribonucleic
acid, [0425] iii) obtaining a double stranded chimeric
polynucleotide comprising an adapter oligonucleotide part by
linking together the at least one adapter oligonucleotide of step
i) comprising the at least one recognition motif for the at least
one site-specific nicking endonuclease, wherein said motif
comprises complementary strands, with the at least one double
stranded polynucleotide comprising complementary polynucleotide
strands, wherein said double stranded polynucleotide is obtained by
a method comprising the step of using the at least one ribonucleic
acid provided in step ii) as a template for the synthesis of a
polynucleotide strand complementary to the at least one ribonucleic
acid, [0426] iv) contacting and cleaving the double stranded
chimeric polynucleotide obtained in step iii) with a combination of
a) at least one site-specific restriction endonuclease capable of
recognizing a double stranded polynucleotide comprising
complementary strands and cleaving both of said strands, and b) at
least one site-specific nicking endonuclease capable of recognizing
a double stranded polynucleotide comprising complementary
polynucleotide strands and cleaving only one of said strands,
wherein the contacting and cleaving of the double stranded chimeric
polynucleotide performed with said combination occurs either
simultaneously, or sequentially in any order, and [0427] v)
obtaining at least one single stranded polynucleotide tag. Steps
ia); iie); iiiaf); iiiah); iva); and v) [0428] i) providing at
least one adapter oligonucleotide comprising at least one
recognition motif for at least one site-specific nicking
endonuclease, wherein said motif comprises a double stranded
oligonucleotide comprising complementary strands, [0429] ii)
further providing at least one double stranded genomic
polynucleotide fragment, or at least one double stranded
extra-genomic polynucleotide fragment wherein said genomic
polynucleotide fragment or extra-genomic polynucleotide fragment is
obtained by cleaving a genomic polynucleotide or an extra-genomic
polynucleotide with at least one site-specific restriction
endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving both
of said strands, [0430] iii) obtaining a double stranded chimeric
polynucleotide comprising an adapter oligonucleotide part by
linking together the at least one adapter oligonucleotide of step
i) comprising the at least one recognition motif for the at least
one site-specific nicking endonuclease, wherein said motif
comprises complementary strands, with the the at least one double
stranded genomic polynucleotide or the at least one double stranded
extra-genomic polynucleotide of step ii), [0431] v) contacting and
cleaving the double stranded chimeric polynucleotide obtained in
step iii) with at least one site-specific nicking endonuclease
capable of recognizing a double stranded polynucleotide comprising
complementary polynucleotide strands and cleaving only one of said
strands, and [0432] v) obtaining at least one single stranded
polynucleotide tag. Steps ia); iie); iiiaf) iiiah); ivb); and v)
[0433] i) providing at least one adapter oligonucleotide comprising
at least one recognition motif for at least one site-specific
nicking endonuclease, wherein said motif comprises a double
stranded oligonucleotide comprising complementary strands, [0434]
ii) further providing at least one double stranded genomic
polynucleotide fragment, or at least one double stranded
extra-genomic polynucleotide fragment, wherein said genomic
polynucleotide fragment or extra-genomic polynucleotide fragment is
obtained by cleaving a genomic polynucleotide or an extra-genomic
polynucleotide with at least one site-specific restriction
endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving both
of said strands, [0435] iii) obtaining a double stranded chimeric
polynucleotide comprising an adapter oligonucleotide part by
linking together the at least one adapter oligonucleotide of step
i) comprising the at least one recognition motif for the at least
one site-specific nicking endonuclease, wherein said motif
comprises complementary strands, with the the at least one double
stranded genomic polynucleotide or the at least one double stranded
extra-genomic polynucleotide of step ii), [0436] iv) contacting and
cleaving the double stranded chimeric polynucleotide obtained in
step iii) with a combination of a) at least one site-specific
restriction endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving both
of said strands, and b) at least one site-specific nicking
endonuclease capable of recognizing a double stranded
polynucleotide comprising complementary polynucleotide strands and
cleaving only one of said strands, wherein the contacting and
cleaving of the double stranded chimeric polynucleotide performed
with said combination occurs either simultaneously, or sequentially
in any order, and [0437] v) obtaining at least one single stranded
polynucleotide tag. Steps ib): iic): iiibi): iiibj): iiibk): iva):
and v)
[0438] Method for obtaining at least one single stranded
polynucleotide tag from a biological sample, said method comprising
the steps of [0439] i) providing at least one adapter
oligonucleotide comprising a part of a recognition motif for at
least one site-specific nicking endonuclease, wherein said part
comprises a single oligonucleotide strand which, together with a
complementary strand, forms a recognition motif for at least one
site-specific nicking endonuclease, [0440] ii) further providing at
least one ribonucleic acid obtained from the biological sample,
[0441] iii) obtaining a double stranded chimeric polynucleotide
comprising an adapter oligonucleotide part by linking together A)
at least one adapter oligonucleotide comprising a part of a
recognition motif for at least one site-specific nicking
endonuclease, wherein said part comprises a single oligonucleotide
strand which, together with a complementary strand, forms a
recognition motif for at least one site-specific nicking
endonuclease, with B) the at least one ribonucleic acid obtained
from the biological sample, and C) obtaining at least one double
stranded chimeric polynucleotide comprising an adapter
oligonucleotide part by using the chimeric polynucleotide obtained
by linking together the adapter oligonucleotide of step iiiA) with
the ribonucleic acid of step iiiB) as a template for the synthesis
of a polynucleotide strand complementary to said chimeric
polynucleotide, [0442] iv) contacting and cleaving the double
stranded chimeric polynucleotide obtained in step iii) with at
least one site-specific nicking endonuclease capable of recognizing
a double stranded polynucleotide comprising complementary
polynucleotide strands and cleaving only one of said strands, and
[0443] v) obtaining at least one single stranded polynucleotide
tag. Steps ib); iic); iiibi); iiibj); iiibk); ivb); and v)
[0444] Method for obtaining at least one single stranded
polynucleotide tag from a biological sample, said method comprising
the steps of [0445] i) providing at least one adapter
oligonucleotide comprising a part of a recognition motif for at
least one site-specific nicking endonuclease, wherein said part
comprises a single oligonucleotide strand which, together with a
complementary strand, forms a recognition motif for at least one
site-specific nicking endonuclease, [0446] ii) further providing at
least one ribonucleic acid obtained from the biological sample,
[0447] iii) obtaining a double stranded chimeric polynucleotide
comprising an adapter oligonucleotide part by linking together A)
at least one adapter oligonucleotide comprising a part of a
recognition motif for at least one site-specific nicking
endonuclease, wherein said part comprises a single oligonucleotide
strand which, together with a complementary strand, forms a
recognition motif for at least one site-specific nicking
endonuclease, with B) the at least one ribonucleic acid obtained
from the biological sample, and C) obtaining at least one double
stranded chimeric polynucleotide comprising an adapter
oligonucleotide part by using the chimeric polynucleotide obtained
by linking together the adapter oligonucleotide of step iiiA) with
the ribonucleic acid of step iiiB) as a template for the synthesis
of a polynucleotide strand complementary to said chimeric
polynucleotide, [0448] iv) contacting and cleaving the double
stranded chimeric polynucleotide obtained in step iii) with a
combination of at least one site-specific restriction endonuclease
capable of recognizing a double stranded polynucleotide comprising
complementary strands and cleaving both of said strands, and at
least one site-specific nicking endonuclease capable of recognizing
a double stranded polynucleotide comprising complementary
polynucleotide strands and cleaving only one of said strands,
wherein the contacting and cleaving of the double stranded chimeric
polynucleotide performed with said combination occurs either
simultaneously, or sequentially in any order, and [0449] v)
obtaining at least one single stranded polynucleotide tag.
[0450] It will be clear from the above considerations that the tags
provided by the present invention may originate from different
parts of a cDNA or a genomic DNA fragment, and that the tag in
question will be of different length depending on whether the cDNA
or the genomic DNA is cleaved by a nicking endonuclease cleaving
one complementary strand only, or cleaved by a nicking endonuclease
in combination with a site-specific restriction endonuclease
cleaving both of the complementary strands.
Short Tags Obtained from the 5' End of cDNA
[0451] There is provided a method for obtaining at least one single
stranded polynucleotide tag from a biological sample, said method
comprising the steps of [0452] i) providing at least one
ribonucleic acid from the biological sample [0453] ii) providing at
least one adapter oligonucleotide comprising a part of a
recognition motif for at least one site-specific nicking
endonuclease, wherein said part comprises a single oligonucleotide
strand which, together with a complementary strand, forms a
recognition motif for at least one site-specific nicking
endonuclease, [0454] iii) obtaining at least one chimeric
polynucleotide by linking together the at least one ribonucleic
acid of step i) with the at least one adapter oligonucleotide of
step ii), [0455] iv) obtaining at least one double stranded
chimeric polynucleotide comprising an adapter oligonucleotide part
by using the chimeric polynucleotide of step iii) as a template for
the synthesis of a polynucleotide strand complementary to said
chimeric polynucleotide, [0456] v) providing at least one
site-specific restriction endonuclease capable of recognizing a
recognition motif comprised in the double stranded polynucleotide
comprising complementary strands and cleaving the double stranded
polynucleotide obtained in step iv) into at least two fragments,
[0457] vi) contacting and cleaving the at least one double stranded
chimeric polynucleotide obtained in step iv) with the at least one
site-specific restriction endonuclease provided in step v), [0458]
vii) obtaining at least one double stranded chimeric polynucleotide
fragment by cleaving the at least one double stranded chimeric
polynucleotide contacted with the at least one site-specific
restriction endonuclease in step vi), [0459] viii) providing at
least one site-specific nicking endonuclease capable of recognizing
a recognition motif comprised in the double stranded
chimeric-polynucleotide fragment comprising complementary strands
and cleaving only one of the complementary strands of the chimeric
polynucleotide fragment obtained in step vii), [0460] ix)
contacting and cleaving the at least one chimeric polynucleotide
fragment obtained in step vii) with the at least one site-specific
nicking endonuclease provided in step viii), and [0461] x)
obtaining at least one single stranded polynucleotide tag.
[0462] The site-specific restriction endonuclease of step v) is
preferably of type IIs.
[0463] The tag preferably comprises less than 30 nucleotides, such
as less than 20 nucleotides, for example less than 15 nucleotides,
such as 10 nucleotides or less than 10 nucleotides. The above
method preferably comprises the further steps of isolating the tag
and/or determining the sequence of the tag and/or quantifying the
tag as compared to the quantification of a predetermined
standard.
[0464] In one embodiment the ribonucleic acid is mRNA that may be
polyadenylated or present in mixture with non-polyadenylated
ribonucleic acid. The site-specific endonucleases capable of
recognizing complementary strands of a double stranded
polynucleotide preferably recognize a motif comprising 8
nucleotides, or less than 8 nucleotides, such as 7 nucleotides, or
less than 7 nucleotides, such as 6 nucleotides, or less than 6
nucleotides, such as 5 nucleotides, or less than 5 nucleotides,
such as 4 nucleotides.
[0465] It is much preferred that the chimeric polynucleotide is
obtained by means of ligation, and in various embodiments,
recognition motifs are either recreated or not recreated upon
ligation.
[0466] In one embodiment there is provided the further step of
contacting the double stranded polynucleotide with a site-specific
methylase or methyltransferase. The site-specific methylase or
methyltransferase preferably methylates a recognition motif capable
of being recognized by at least one of the site-specific
endonucleases capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving either
one or both of said strands. In one such embodiment, a methylated
dCTP analog is substituted for an unmodified dCTP in the synthesis
reaction resulting in the synthesis of a complementary strand to
the template. In another embodiment, M.BpmI is used to methylate
the target DNA in the motif that BpmI recognizes and binds to.
Long Tags Obtained from the 5' End of cDNA
[0467] There is provided a method for obtaining at least one single
stranded polynucleotide tag from a biological sample, said method
comprising the steps of [0468] i) providing at least one
ribonucleic acid from the biological sample, [0469] ii) providing
at least one adapter oligonucleotide comprising a part of a
recognition motif for at least one site-specific nicking
endonuclease, wherein said par comprises a single oligonucleotide
strand which, together with a complementary strand, forms a
recognition motif for at least one site-specific nicking
endonuclease, [0470] iii) obtaining at least one chimeric
polynucleotide by linking together the at least one ribonucleic
acid of step i) with the at least one adapter oligonucleotide of
step ii), [0471] iv) obtaining at least one double stranded
chimeric polynucleotide comprising an adapter oligonucleotide part
by using the chimeric polynucleotide of step iii) as a template for
the synthesis of a polynucleotide strand complementary to said
chimeric polynucleotide, [0472] v) providing at least one
site-specific nicking endonuclease capable of recognizing a
recognition motif comprised in the double stranded chimeric
polynucleotide comprising complementary strands and cleaving only
one of the complementary strands of the chimeric polynucleotide
obtained in step iv), [0473] vi) contacting and cleaving the at
least one chimeric polynucleotide obtained in step iv) with the at
least one site-specific nicking endonuclease provided in step v),
and [0474] vii) obtaining at least one single stranded
polynucleotide tag.
[0475] The tag preferably comprises less than 30 nucleotides, such
as less than 20 nucleotides, for example less than 15 nucleotides,
such as 10 nucleotides or less than 10 nucleotides. The above
method preferably comprises the further steps of isolating the tag
and/or determining the sequence of the tag and/or quantifying the
tag as compared to the quantification of a predetermined
standard.
[0476] In one embodiment the ribonucleic acid is mRNA that may be
polyadenylated or present in mixture with non-polyadenylarted
ribonucleic acid. The site-specific nicking endonuclease capable of
recognizing complementary strands of a double stranded
polynucleotide preferably recognizes a motif comprising 8
nucleotides, or less than 8 nucleotides, such as 7 nucleotides, or
less than 7 nucleotides, such as 6 nucleotides, or less than 6
nucleotides, such as 5 nucleotides, or less than 5 nucleotides,
such as 4 nucleotides.
[0477] It is much preferred that the chimeric polynucleotide is
obtained by means of ligation, and in various embodiments,
recognition motifs are either recreated or not recreated upon
ligation.
[0478] In one embodiment there is provided the further step of
contacting the double stranded polynucleotide with a site-specific
methylase or methyltransferase. The site-specific methylase or
methyltransferase preferably methylates a recognition motif capable
of being recognized by at least one of the site-specific
endonucleases capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving either
one or both of said strands. In one such embodiment, a methylated
dCTP analog is substituted for an unmodified dCTP in the synthesis
reaction resulting in the synthesis of a complementary strand to
the template. In another embodiment, M.BpmI is used to methylate
the target DNA in the motif that BpmI recognizes and binds to.
Short Tags Obtained from the 3' End of cDNA
[0479] There is provided a method for obtaining at least one single
stranded polynucleotide tag from a biological sample, said method
comprising the steps of [0480] i) providing at least one
ribonucleic acid from the biological sample, [0481] ii) obtaining
at least one double stranded polynucleotide comprising two
complementary strands by using the at least one ribonucleic acid
provided in step i) as a template for the synthesis of a
polynucleotide strand complementary to the at least one ribonucleic
acid, [0482] iii) providing at least one site-specific restriction
endonuclease capable of recognizing a recognition motif comprised
in the double stranded polynucleotide comprising complementary
strands and cleaving the double stranded polynucleotide obtained in
step ii) into at least two fragments, [0483] iv) contacting and
cleaving the at least one double stranded polynucleotide obtained
in step ii) with the at least one site-specific restriction
endonuclease provided in step iii), [0484] v) obtaining at least
one double stranded polynucleotide fragment by cleaving the at
least one double stranded polynucleotide contacted with the at
least one site-specific restriction endonuclease in step iv),
[0485] vi) providing at least one adapter oligonucleotide
comprising at least one recognition motif for at least one
sit-specific nicking endonuclease, wherein said motif comprises a
double stranded oligonucleotide comprising complementary strands,
wherein the adapter is capable of being linked together with the at
least one double stranded polynucleotide fragment obtained in step
v), [0486] vii) obtaining at least one double stranded chimeric
polynucleotide by linking together the at least one double stranded
polynucleotide fragment obtained in step v) and the at least one
adapter oligonucleotide provided in step vi), [0487] viii)
providing at least one further site-specific restriction
endonuclease capable of recognizing a recognition motif comprised
in the double stranded chimeric polynucleotide comprising
complementary strands and cleaving both of the complementary
strands of the chimeric polynucleotide provided in step vii),
[0488] ix) contacting and cleaving the at least one chimeric
polynucleotide obtained in step vii) with the at least one further
site-specific restriction endonuclease provided in step viii),
[0489] x) obtaining at least one chimeric polynucleotide fragment
by cleaving the at least one chimeric polynucleotide contacted with
the at least one further site-specific restriction endonuclease in
step ix), [0490] xi) providing at least one site-specific nicking
endonuclease capable of recognizing a recognition motif comprised
in the double stranded chimeric polynucleotide fragment comprising
complementary strands and cleaving only one of the complementary
strands of the chimeric polynucleotide fragment obtained in step
x), [0491] xii) contacting and cleaving the at least one chimeric
polynucleotide fragment obtained in step x) with the at least one
site-specific nicking endonuclease provided in step xi), and [0492]
xiii) obtaining at least one single stranded polynucleotide
tag.
[0493] The site-specific restriction endonuclease of step iii) is
preferably of type II or type IIs. The further site-specific
restriction endonuclease of step viii) is preferably of type IIs.
The site-specific restriction endonuclease and the further
site-specific restriction endonuclease can be the same or different
endonucleases.
[0494] The tag preferably comprises less than 30 nucleotides, such
as less than 20 nucleotides, for example less than 15 nucleotides,
such as 10 nucleotides or less than 10 nucleotides. The above
method preferably comprises the further steps of isolating the tag
and/or determining the sequence of the tag and/or quantifying the
tag as compared to the quantification of a predetermined
standard.
[0495] In one embodiment the ribonucleic acid is mRNA that may be
polyadenylated or present in mixture with non-polyadenylated
ribonucleic acid. The site-specific endonucleases capable of
recognizing complementary strands of a double stranded
polynucleotide preferably recognizes a motif comprising 8
nucleotides, or less than 8 nucleotides, such as 7 nucleotides, or
less than 7 nucleotides, such as 6 nucleotides, or less than 6
nucleotides, such as 5 nucleotides, or less than 5 nucleotides,
such as 4 nucleotides.
[0496] It is much preferred that the chimeric polynucleotide is
obtained by means of ligation, and in various embodiments,
recognition motifs are either recreated or not recreated upon
ligation. In one preferred embodiment the cleavage of step iv) and
the ligation of step vii) is carried out simultaneously.
[0497] In one embodiment there is provided the further step of
contacting the double stranded polynucleotide with a site-specific
methylase or methyltransferase. The site-specific methylase or
methyltransferase preferably methylates a recognition motif capable
of being recognized by at least one of the site-specific
endonucleases capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving either
one or both of said strands. In one such embodiment, a methylated
dCTP analog is substituted for an unmodified dCTP in the synthesis
reaction resulting in the synthesis of a complementary strand to
the template. In another embodiment, M.BpmI is used to methylate
the target DNA in the motif that BpmI recognizes and binds to.
Long Taps Obtained from the 3' End of cDNA
[0498] There is provided ac method for obtaining at least one
single stranded polynucleotide tag from a biological sample, said
method comprising the steps of [0499] i) providing at least one
ribonucleic acid from the biological sample, [0500] ii) obtaining
at least one double stranded polynucleotide comprising two
complementary strands by using the at least one ribonucleic acid
provided in step i) as a template for the synthesis of a
polynucleotide strand complementary to the at least one ribonucleic
acid, [0501] iii) providing at least one site-specific restriction
endonuclease capable of recognizing a recognition motif comprised
in the double stranded polynucleotide comprising complementary
strands and cleaving the double stranded polynucleotide obtained in
step ii) into at least two fragments, [0502] iv) contacting and
cleaving the at least one double stranded polynucleotide obtained
in step ii) with the at least one site-specific restriction
endonuclease provided in step iii), [0503] v) obtaining at least
one double stranded polynucleotide fragment by cleaving the at
least one double stranded polynucleotide contacted with the at
least one site-specific restriction endonuclease in step iv),
[0504] vi) providing at least one adapter oligonucleotide
comprising at least one recognition motif for at least one
site-specific nicking endonuclease, wherein said motif comprises a
double stranded oligonucleotide comprising complementary strands,
wherein the adapter is capable of being linked together with the at
least one double stranded polynucleotide fragment obtained in step
v), [0505] vii) obtaining at least one chimeric polynucleotide by
linking together the at least one double stranded polynucleotide
fragment obtained in step v) and the at least one adapter
oligonucleotide provided in step vi), [0506] viii) providing at
least one site-specific nicking endonuclease capable of recognizing
a recognition motif comprised in the double stranded chimeric
polynucleotide comprising complementary strands and cleaving only
one of the complementary strands of the chimeric polynucleotide
obtained in step vii), [0507] ix) contacting and cleaving the at
least one chimeric polynucleotide obtained in step vii) with the at
least one site-specific nicking endonuclease provided in step
viii), and [0508] x) obtaining at least one single stranded
polynucleotide tag.
[0509] The site-specific restriction endonuclease of step iii) is
preferably of type II or type IIs.
[0510] The tag preferably comprises less than 30 nucleotides, such
as less than 20 nucleotides, for example less than 15 nucleotides,
such as 10 nucleotides or less than 10 nucleotides. The above
method preferably comprises the further steps of isolating the tag
and/or determining the sequence of the tag and/or quantifying the
tag as compared to the quantification of a predetermined
standard.
[0511] In one embodiment the ribonucleic acid is mRNA that may be
polyadenylated or present in mixture with non-polyadenylarted
ribonucleic acid. The site-specific endonucleases capable of
recognizing complementary strands of a double stranded
polynucleotide preferably recognize a motif comprising 8
nucleotides, or less than 8 nucleotides, such as 7 nucleotides, or
less than 7 nucleotides, such as 6 nucleotides, or less than 6
nucleotides, such as 5 nucleotides, or less than 5 nucleotides,
such as 4 nucleotides.
[0512] It is much preferred that the chimeric polynucleotide is
obtained by means of ligation, and in various embodiments,
recognition motifs are either recreated or not recreated upon
ligation. In one preferred embodiment the cleavage of step iv) and
the ligation of step vii) is carried out simultaneously.
[0513] In one embodiment there is provided the further step of
contacting the double stranded polynucleotide with a site-specific
methylase or methyltransferase. The site-specific methylase or
methyltransferase preferably methylates a recognition motif capable
of being recognized by at least one of the site-specific
endonucleases capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving either
one or both of said strands. In one such embodiment, a methylated
dCTP analog is substituted for an unmodified dCTP in the synthesis
reaction resulting in the synthesis of a complementary strand to
the template. In another embodiment, M.BpmI is used to methylate
the target DNA in the motif that BpmI recognizes and binds to.
Short Tags Obtained from Genomic DNA or Extra-Genomic DNA
[0514] There is provided a method for obtaining at least one single
stranded polynucleotide tag from a biological sample, said method
comprising the steps of [0515] i) providing at least one double
stranded genomic polynucleotide fragment, or at least one double
stranded extra-genomic polynucleotide fragment, wherein said
genomic polynucleotide fragment or extra-genomic polynucleotide
fragment is obtained by cleaving a genomic polynucleotide or an
extra-genomic polynucleotide, respectively, with at least one
site-specific restriction endonuclease capable of recognizing a
double stranded polynucleotide comprising complementary strands and
cleaving both of said strands, [0516] ii) providing at least one
adapter oligonucleotide comprising at least one recognition motif
for at least one site-specific nicking endonuclease, wherein said
motif comprises a double stranded oligonucleotide comprising
complementary strands, wherein the adapter is capable of being
linked together with the at least one double stranded genomic
polynucleotide fragment, or the at least one double stranded
extra-genomic polynucleotide fragment, provided in step i), [0517]
iii) obtaining at least one chimeric polynucleotide by linking
together the at least one double stranded genomic polynucleotide
fragment, or the at least one double stranded extra-genomic
polynucleotide fragment obtained in step i) and the at least one
adapter oligonucleotide provided in step ii), [0518] iv) providing
at least one further site-specific restriction endonuclease capable
of recognizing a double stranded polynucleotide comprising
complementary strands and cleaving both of the complementary
strands of the at least one chimeric polynucleotide of step iii)
obtained by linking together the at least one double stranded
genomic polynucleotide fragment or the at least one double stranded
extra-genomic polynucleotide fragment, and the at least one adapter
oligonucleotide provided in step ii), [0519] v) contacting and
cleaving the at least one chimeric polynucleotide obtained in step
iii) with the at least one further site-specific restriction
endonuclease provided in step iv), [0520] vi) obtaining at least
one chimeric polynucleotide fragment by cleaving the at least one
chimeric polynucleotide contacted with the at least one further
site-specific restriction endonuclease in step v), [0521] vii)
providing at least one site-specific nicking endonuclease capable
of recognizing a recognition motif comprised in the double stranded
chimeric polynucleotide fragment comprising complementary strands
and cleaving only one of the complementary strands of the at least
one chimeric polynucleotide fragment obtained in step vi), [0522]
viii) contacting and cleaving the at least one chimeric
polynucleotide fragment obtained in step vi) with the at least one
site-specific nicking endonuclease provided in step vii), and
[0523] ix) obtaining at least one single stranded polynucleotide
tag.
[0524] The site-specific restriction endonuclease of step i) is
preferably of type II or type IIs. The further site-specific
restriction endonuclease of step iv) is preferably of type IIs. The
site-specific restriction endonuclease and the further
site-specific restriction endonuclease can be the same or different
endonucleases.
[0525] The tag preferably comprises less than 30 nucleotides, such
as less than 20 nucleotides, for example less than 15 nucleotides,
such as 10 nucleotides or less than 10 nucleotides. The above
method preferably comprises the further steps of isolating the tag
and/or determining the sequence of the tag and/or quantifying the
tag as compared to the quantification of a predetermined
standard.
[0526] The site-specific restriction endonuclease capable of
recognizing complementary strands of a double stranded
polynucleotide preferably recognizes a motif comprising 8
nucleotides, or less than 8 nucleotides, such as 7 nucleotides, or
less than 7 nucleotides, such as 6 nucleotides, or less than 6
nucleotides, such as 5 nucleotides, or less than 5 nucleotides,
such as 4 nucleotides.
[0527] It is much preferred that the chimeric polynucleotide is
obtained by means of ligation, and in various embodiments,
recognition motifs are either recreated or not recreated upon
ligation. In one preferred embodiment the cleavage of step i) and
the ligation of step iii) is carried out simultaneously.
[0528] In one embodiment there is provided the further step of
contacting the double stranded polynucleotide with a site-specific
methylase or methyltransferase. The site-specific methylase or
methyltransferase preferably methylates a recognition motif capable
of being recognized by at least one of the site-specific
endonucleases capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving either
one or both of said strands. In one such embodiment, a methylated
dCTP analog is substituted for an unmodified dCTP in the synthesis
reaction resulting in the synthesis of a complementary strand to
the template. In another embodiment, M.BpmI is used to methylate
the target DNA in the motif that BpmI recognizes and binds to.
Long Tags Obtained from Genomic DNA or Extra-Genomic DNA
[0529] There is provided a method for obtaining at least one single
stranded polynucleotide tag from a biological sample, said method
comprising the steps of [0530] i) providing at least one double
stranded genomic polynucleotide fragment, or at least one double
stranded extra-genomic polynucleotide fragment, wherein said
genomic polynucleotide fragment or extra-genomic polynucleotide
fragment is obtained by cleaving a genomic polynucleotide or an
extra-genomic polynucleotide, respectively, with at least one
site-specific restriction endonuclease capable of recognizing a
double stranded polynucleotide comprising complementary strands and
cleaving both of said strands, [0531] ii) providing at least one
adapter oligonucleotide comprising at least one recognition motif
for at least one site-specific nicking endonuclease, wherein said
motif comprises a double stranded oligonucleotide comprising
complementary strands, wherein the adapter is capable of being
linked together with the at least one double stranded genomic
polynucleotide fragment, or the at least one double stranded
extra-genomic polynucleotide fragment, provided in step i), [0532]
iii) obtaining at least one chimeric polynucleotide by linking
together the at least one double stranded genomic polynucleotide
fragment, or the at least one double stranded extra-genomic
polynucleotide fragment obtained in step i) and the at least one
adapter oligonucleotide provided in step ii), [0533] iv) providing
at least one site-specific nicking endonuclease capable of
recognizing a recognition motif comprised in the double stranded
polynucleotide comprising complementary strands and cleaving only
one of the complementary strands of the at least one chimeric
polynucleotide obtained in step iii), [0534] v) contacting and
cleaving the at least one chimeric polynucleotide obtained in step
iii) with the at least one site-specific nicking endonuclease
provided in step iv), and [0535] vi) obtaining at least one single
stranded polynucleotide tag.
[0536] The site-specific restriction endonuclease of step iii) is
preferably of type II or type IIs.
[0537] The tag preferably comprises less than 30 nucleotides, such
as less than 20 nucleotides, for example less than 15 nucleotides,
such as 10 nucleotides or less than 10 nucleotides. The above
method preferably comprises the further steps of isolating the tag
and/or determining the sequence of the tag and/or quantifying the
tag as compared to the quantification of a predetermined
standard.
[0538] The site-specific endonucleases capable of recognizing
complementary strands of a double stranded polynucleotide
preferably recognizes a motif comprising 8 nucleotides, or less
than 8 nucleotides, such as 7 nucleotides, or less than 7
nucleotides, such as 6 nucleotides, or less than 6 nucleotides,
such as 5 nucleotides, or less than 5 nucleotides, such as 4
nucleotides.
[0539] It is much preferred that the chimeric polynucleotide is
obtained by means of ligation, and in various embodiments, the
recognition motifs are either recreated or not recreated upon
ligation. In one preferred embodiment the cleavage of step i) and
the ligation of step iii) is carried out simultaneously.
[0540] In one embodiment there is provided the further step of
contacting the double stranded polynucleotide with a site-specific
methylase or methyltransferase. The site-specific methylase or
methyltransferase preferably methylates a recognition motif capable
of being recognized by at least one of the site-specific
endonucleases capable of recognizing a double stranded
polynucleotide comprising complementary strands and cleaving either
one or both of said strands. In one such embodiment, a methylated
dCTP analog is substituted for an unmodified dCTP in the synthesis
reaction resulting in the synthesis of a complementary strand to
the template. In another embodiment, M.BpmI is used to methylate
the target DNA in the motif that BpmI recognizes and binds to.
Methods for Amplification of Isolated Single Stranded
Polynucleotide Tags
[0541] Various methods are known to the art which may be used to
detect and characterize specific polynucleotide tags. Examples
include the below-mentioned "signal" amplification methods
including the polymerase chain reaction and the ligase chain
reaction. In one embodiment of the invention, the amplification
step is carried out using PCR techniques that are well known in the
art.
[0542] The polymerase chain reaction (PCR), as described in U.S.
Pat. Nos. 4,683,195 and 4,683,202 to Mullis and Mullis et al. (the
disclosures of which are hereby incorporated by reference), is a
method for increasing the concentration of a segment of target
sequence in a mixture of genomic DNA without cloning or
purification. An additional reference guide on PCR is: A Guide to
Methods and Applications (Innis, M., Gelfand, D., Sninsky, J. and
White, T., eds.) Academic Press (1990), incorporated herein by
reference in its entirety for all purposes.
[0543] PCR amplification generally involves the use of one strand
of the target nucleic acid sequence as a template for producing a
large number of complements to that sequence. Generally, two primer
sequences complementary to different ends of a segment of the
complementary strands of the target sequence hybridize with their
respective strands of the target sequence, and in the presence of
polymerase enzymes and deoxy-nucleoside triphosphates, the primers
are extended along the target sequence. The extensions are melted
from the target sequence and the process is repeated, this time
with the additional copies of the target sequence synthesized in
the preceding steps. PCR amplification typically involves repeated
cycles of denaturation, hybridization and extension reactions to
produce sufficient amounts of the target nucleic acid. The first
step of each cycle of the PCR involves the separation of the
nucleic acid duplex formed by the primer extension. Once the
strands are separated, the next step in PCR involves hybridizing
the separated strands with primers that flank the target sequence.
The primers are then extended to form complementary copies of the
target strands. For successful PCR amplification, the primers are
designed so that the position at which each primer hybridizes along
a duplex sequence is such that an extension product synthesized
from one primer, when separated from the template (complement),
serves as a template for the extension of the other primer. The
cycle of denaturation, hybridization, and extension is repeated as
many times as is necessary to obtain the desired amount of
amplified nucleic acid.
[0544] In PCR methods, strand separation is normally achieved by
heating the reaction to a sufficiently high temperature for a
sufficient time to cause the denaturation of the duplex but not to
cause an irreversible denaturation of the polymerase enzyme (see
U.S. Pat. No. 4,965,188, incorporated herein by reference). Typical
heat denaturation involves temperatures ranging from about
80.degree. C. to 105.degree. C. for times ranging from seconds to
minutes. Strand separation, however, can be accomplished by any
suitable denaturing method including physical, chemical, or
enzymatic means. Strand separation may be induced by a helicase,
for example, or an enzyme capable of exhibiting helicase activity.
For example, the enzyme RecA has helicase activity in the presence
of ATP. The reaction conditions suitable for strand separation by
helicases are known in the art (see Kuhn Hoffman-Berling, 1978,
CSH-Quantitative Biology, 43:63-67; and Radding, 1982, Ann. Rev.
Genetics 16:405-436, each of which is incorporated herein by
reference). Other embodiments may achieve strand separation by
application of electric fields across the sample. For example,
Published PCT Application Nos. WO 92/04470 and WO 95/25177,
incorporated herein by reference, describe electrochemical methods
of denaturing double stranded DNA by application of an electric
field to a sample containing the DNA. Structures for carrying out
this electrochemical denaturation include a working electrode,
counter electrode and reference electrode arranged in a
potentiostat arrangement across a reaction chamber (See, Published
PCT Application Nos. WO 92/04470 and WO 95/25177, each of which is
incorporated herein by reference). Such devices may be readily
miniaturized for incorporation into the devices of the present
invention utilizing the microfabrication techniques described
herein.
[0545] Template-dependent extension of primers in PCR is catalyzed
by a polymerizing agent in the presence of adequate amounts of at
least 4 deoxyribonucleoside tri-phosphates (typically selected from
dATP, dGTP, dCTP, dUTP and dTTP) in a reaction medium which
comprises the appropriate salts, metal cations, and pH buffering
system. Reaction components and conditions are well known in the
art (See PCR Protocols: A Guide to Methods and Applications (Innis,
M., Gelfand, D., Sninsky, J. and White, T., eds.) Academic Press
(1990), previously incorporated by reference). Suitable
polymerizing agents are enzymes known to catalyze
template-dependent DNA synthesis.
[0546] In one embodiment, the amplification step is carried out
using methods and devices described in published PCT Application
No. WO 94/05414, to Northrup and White, and directed to the use of
a microPCR chamber which incorporates microheaters and micropumps
in the thermal cycling and mixing during the PCR reactions.
[0547] Accordingly, PCR technology provides one approach for
solving problems of low target sequence concentration, i.e. a low
concentration of the source of a single stranded polynucleotide tag
to be analysed and/or detected in accordance with the present
invention. PCR may thus be used to directly increase the
concentration of the target to an easily detectable level.
[0548] The length of the segment of the desired target sequence is
determined by the relative positions of the primers with respect to
each other, and, therefore, this length is a controllable
parameter. Because the desired segments of the target sequence
become the dominant sequences (in terms of concentration) in the
mixture, they are said to be "PCR-amplified."
[0549] The ligase chain reaction (LCR; sometimes referred to as
"Ligase Amplification Reaction" (LAR) described by Barany, (PNAS,
88, 189, 1991); (PCR Methods and Applic., 1, 5, 1991); and
(Genomics 4, 560, 1989) (all of which are hereby incorporated by
reference) has developed into a well-recognized alternative method
for amplifying nucleic acids. In LCR, four oligonucleotides, two
adjacent oligonucleotides which uniquely hybridize to one strand of
target DNA, and a complementary set of adjacent oligonucleotides,
which hybridize to the opposite strand are mixed and DNA ligase is
added to the mixture. Provided that there is complete
complementarity at the junction, ligase will covalently link each
set of hybridized molecules. Importantly, in LCR, two probes are
ligated together only when they base-pair with sequences in the
target sample, without gaps or mismatches. Repeated cycles of
denaturation, hybridization and ligation amplify a short segment of
DNA.
[0550] LCR has also been used in combination with PCR to achieve
enhanced detection of single-base changes. Segev, PCT Public. No.
WO9001069 A1 (1990). However, because the four oligonucleotides
used in this assay can pair to form two short ligatable fragments,
there is the potential for the generation of target-independent
background signal. The use of LCR for mutant screening is limited
to the examination of specific nucleic acid positions.
Analysis of ssDNA Tags Obtained According to One Preferred Method
of the Present Invention
[0551] It is possible to divide a sample into a number of panels
during the first strand or the second strand synthesis, when making
cDNA from RNA. It is preferred to have one or more discriminating
bases in the 3' end of the primer used for either the first strand
or the second strand synthesis.
[0552] When doing RLM-RACE, it is most convenient have any
discriminating bases at the 3' end of the primer, that binds to the
first strand complementary part of the adapter of the chimeric mRNA
molecule. In other instances it might be more convenient to put
discriminating bases in the 3' end of the oligo(dT) primer used in
the RT-reaction.
[0553] Depending on the number of discriminating bases in the 3'
end of the oligo(dT) primer, the resulting number of panels is
3.times.4.sup.(n-1), where n is the number of discriminating bases.
If there is only one discriminating base in the 3' end of an
oligo(dT) primer, that base can either be A, G or C--but not T.
Hence a degeneracy of 3 in stead of 4 for the first base. When
using such panels in the RT reaction, it is possible to create
pools of cDNA in a reproducible way. When such pools is combined
with extracting an ssDNA tag from the cDNA, then the degeneracy of
the ssDNA tag can be combined with the degeneracy of panels from
the RT reaction.
[0554] An ssDNA tag that is six bases long has a degeneracy of
4.sup.6, or 4096. If the oligo(dT) primer has three discriminating
bases it will divide the cDNA pool into 3.times.4.sup.2 or 48
pools. If isolating ssDNA tags form each of the 48 pools, the
combined degeneracy is 3.times.4.sup.2.times.4.sup.6 or
48.times.4096, or 196,608. In other terms it is possible to
identify and quantify 196,608 different transcripts by combining
the degeneracy of an oligo(dT) with three discriminating bases in
its 3' end and a hexamer ssDNA tag from each cDNA.
[0555] In a preferred embodiment of the invention as described
herein above, the double stranded DNA is cleaved with a type IIs
restriction endonuclease that leads to over-hangs of from 2 to 6
bases. This gives between 16 and 4096 different sequences of the
overhang depending on the number of bases in the overhang. This
approach can naturally also be combined with an oligo(dT) with a
number of discriminating bases in its 3' end. If combined with the
example above, a type IIs restriction endonuclease leaving 4
overhanging bases will increase the degeneracy with a factor of
4.sup.4 or 256 so the total degeneracy in the example reaches
50,331,648--far more than is needed to track the approximately
100,000 transcripts in the human genome.
[0556] When using two linkers with 3' and 5' overhangs respectively
to analyze the ssDNA tag, the total degeneracy according to
preferred embodiments of the invention is selected so that they
satisfy the criteria below depending upon the purpose of the
analysis:
[0557] Every combination of degeneracy where the sum of
opportunities satisfies the equation:
100<.sub.4L1.times.4.sup.L2<200,000, where L1 is the number
of degenerated bases in linker 1 and where L2 is the number of
degenerated bases in linker 2, both L1 and L2 and the sum of the
two being shorter than 10 bases long, can be used to make
diagnostic tools.
[0558] Every combination of degeneracy where the sum of
opportunities satisfies the equation:
1000<4.sup.L1.times.4.sup.L2<17,000,000, where L1 is the
number of degenerated bases in linker 1 and where L2 is the number
of degenerated bases in linker 2, both L1 and L2 and the sum of the
two being shorter than 13 bases long, can be used to make
expression profiling tools.
[0559] Every combination of degeneracy where the sum of
opportunities satisfies the equation:
10,000<4.sup.L1.times.4.sup.L2<4,500,000,000, where L1 is the
number of degenerated bases in linker 1 and where L2 is the number
of degenerated bases in linker 2, both L1 and L2 and the sum of the
two being shorter than 17 bases long, can be used to make SNP-,
methylation-, and expression profiling tools.
[0560] Every combination of degeneracy where the sum of
opportunities satisfies the equation:
10,000<4.sup.L1.times.4.sup.L2<1.2.times.10.sup.12, where L1
is the number of degenerated bases in linker 1 and where L2 is the
number of degenerated bases in linker 2, both L1 and L2 and the sum
of the two being shorter than 21 bases long, can be used to make
SNP and methylation profiling tools.
[0561] Accordingly, there is provided a method of the invention as
described herein above and comprising the further step of
separating and/or identifying and/or determining the amount of the
at least one single stranded polynucleotide tag from other single
stranded polynucleotides and/or double stranded
polynucleotides.
[0562] The method may employ a solid support comprising a
hybridization array comprising a plurality of ordered identifying
linker oligonucleotides to which at least one single stranded
polynucleotide strand may hybridize. In one embodiment, the
identifying linker oligonucleotides are identifiable based on their
position in the hybridization array.
[0563] In another preferred embodiment, the present invention
employs a microfluid device for separating and/or identifying
and/or determining the amount of the at least one single stranded
polynucleotide tag derived from a biological sample. The separation
and/or identification and/or determination preferably occurs by
separating and/or identifying and/or determining, respectively, a
hybrid polynucleotide tag or a chimeric polynucleotide further
comprising a molecular identifier and/or a selectively detectable
label.
[0564] The molecular identifier and/or the selectively detectable
label makes it possible to manipulate and/or identify the hybrid
polynucleotide tag or a chimeric polynucleotide present within one
compartment or present in a plurality of compartments of the
microfluid device, wherein the compartments are preferably
interconnected.
[0565] The manipulation and/or identification is made possible by
the ability of individual molecular identifiers and/or selectively
detectable labels to be manipulated and/or identified according to
their molecular weight and/or charge and/or a paramagnetic property
and/or a fluorescent property or any other capability of emitting
electromagnetic radiation when desirably excited by any suitable
source of radiation.
Microfluid Device
[0566] It is preferred in accordance with one preferred embodiment
of the invention to analyse the at least one single stranded
polynucleotide tag derived from a biological sample by means of
miniaturized, integrated microfluid devices and systems
incorporating such devices. The devices of the invention are
generally capable of performing one or more sample acquisition and
preparation operations, as may be integrated with one or more
sample analysis operations. A sample as used herein below shall
denote any sample comprising at least one single stranded
polynucleotide sample obtained by any method pertaining to the
present invention.
[0567] For example, the devices can integrate several or all of the
operations involved in sample acquisition and storage, sample
preparation and sample analysis, within a single, miniaturized,
integrated unit. The devices are useful in a variety of
applications including single stranded polynucleotide tag
manipulation and/or identification, as well as single stranded
polynucleotide tag based diagnostic applications.
[0568] The devices of the invention will typically be one component
of a larger diagnostic system which further preferably includes a
reader device for scanning and obtaining data from the device, and
a computer based interface for controlling the device and/or
interpretation of the data derived from the device.
[0569] To carry out their primary functions, one embodiment of the
devices of the invention will typically incorporate a plurality of
distinct reaction chambers for carrying out the sample acquisition,
preparation and analysis operations. In particular, a sample
comprising a single stranded polynucleotide tag to be analyzed,
including any step involving that the tag is being manipulated
and/or separated and/or determined, is preferably introduced into
the device whereupon it will be manipulated and delivered to one of
the distinct reaction chambers which may, in one embodiment, be
designed for carrying out a variety of reactions as a prelude to
analysis of the sample. These preparative reactions generally
include, e.g., sample extraction, sample processing, including
endonuclease digestion, including digestion with a nicking
endonuclease and optionally also with a restriction endonuclease,
single stranded polynucleotide tag generation, hybrid
polynucleotide tag formation, chimeric polynucleotide tag
formation, release from the chimeric tag of the singlestranded
polynucleotide tag, tag amplification, including PCR amplification
and/or LCR amplification, second identifying linker oligonucleotide
hybridization to a hybrid polynucleotide tag and/or a chimeric
polynucleotide tag.
[0570] In one particularly preferred embodiment of this aspect of
the invention, there is provided at least one compartment chamber
comprising at least one cleavage agent Including at least one
single stranded nicking endonuclease, wherein the at least one
cleavage agent including at least one site-specific nicking
endonuclease is preferably bound to a solid support forming part of
said chamber.
[0571] The chamber comprising the at least one cleavage agent
including at least one single stranded nicking endonuclease, or
another chamber, may preferably comprise at least one site-specific
restriction endonuclease and/or at least one single stranded
adapter oligonucleotide and/or at least one double stranded adapter
oligonucleotide and/or at least one first and/or second identifying
linker oligonucleotide. The at least one adapter oligonucleotide
preferably comprises at least one recognition site for a
site-specific nicking endonuclease.
[0572] In the same or another preferred embodiment as the one
described above, there is provided at least one compartment chamber
comprising i) at least one or a plurality of first identifying
linker oligonucleotides, wherein each or a plurality of first
identifying linker oligonucleotides, or a subset thereof, comprise
a single stranded, first unique nucleotide sequence forming a 5'
overhang, and/or ii) at least one or a plurality of second
identifying linker oligonucleotides, wherein each or a plurality of
second identifying linker oligonucleotides, or a subset thereof,
comprise a single stranded, second unique nucleotide sequence
forming a 3' overhang.
[0573] At least one or a plurality of said adapter oligonucleotides
and/or said first and/or said second identifying linker
oligonucleotides, or a subset thereof, preferably comprises one or
more of i) a molecular identifier, ii) a selectively identifiable
label, and a iii) recognition motif for one or more of a
site-specific nicking endonuclease and/or a site-specific
restriction endonuclease.
[0574] The molecular identifier and/or the selectively identifiable
label is in one embodiment preferably attached to a solid support
including a hybridization array forming part of a compartment of
the microfluid device. Both the molecular identifier and the label
may be detachable from the solid support by e.g. cleavage with a
cleavage agent including a site-specific restriction
endonuclease.
[0575] In another preferred embodiment there is provided a
microfluid device comprising a solid support comprising at least
one hybridization array comprising a plurality of ordered first
and/or second identifying linker oligonucleotides, preferably at
least one hybridization array comprising a plurality of ordered
first identifying linker oligonucleotides, or a subset of such
oligonucleotides, and/or at least one hybridization array
comprising a plurality of ordered second identifying linker
oligonucleotides, or a subset of such oligonucleotides.
[0576] Preferably, at least one of said first and/or second
identifying linker oligonucleotides comprises a single stranded
nucleotide sequence hybridized to at least one single stranded
polynucleotide tag comprising a sequence complementary thereto. The
single stranded polynucleotide tag is preferably obtained by a
method of the invention as described herein. Alternatively, the
single stranded polynucleotide tag is obtained by displacement of a
double stranded polynucleotide tag comprising polynucleotide
strands which are at least partly complementary to one another.
[0577] In will be understood that following sample entry into the
microfluid device, the sample can be subjected to one or more
different analysis operations. A variety of analysis operations may
generally be performed, including size or molecular weight based
analysis using, e.g., microcapillary electrophoresis, and/or
sequence based analysis using first and/or second identifying
linker oligonucleotides, hybridization of hybrid polynucleotide
tags and/or chimeric polynucleotide tags to e.g. a solid support
comprising e.g. a hybridization array including an array comprising
first and/or second identifying linker oligonucleotides.
[0578] In addition to the various reaction chambers, the device
will generally comprise a series of fluid channels which allow for
the transportation of the sample, or a portion thereof, among the
various reaction chambers. Further chambers and components may also
be included to provide reagents, buffers, sample manipulation,
e.g., mixing, pumping, fluid direction (i.e., valves) heating and
the like.
[0579] The below sections describe in more detail preferred
integratable operations of a microfluid device according to the
present invention.
Sample Acquisition
[0580] The sample collection portion of the device of the present
invention preferably provides for the identification or nummeration
of individual samples, while preventing contamination of the sample
by external elements, or contamination of a working environment or
an external environment by the sample.
[0581] Generally, this is carried out by introducing a sample for
analysis, e.g., a biological sample putatively comprising the
single stranded polynucleotide tag to be displayed, determined, or
identified. The sample may be a preamplified sample, a tissue
sample, a blood sample, a saliva sample, etc., directly into a
sample collection chamber within the device.
[0582] Typically, the prevention of cross-contamination of the
sample may be accomplished by directly injecting the sample into
the sample collection chamber through a sealable opening, e.g., an
injection valve, or a septum. Generally, sealable valves are
preferred to reduce any potential threat of leakage during or after
sample injection. Alternatively, the device may be provided with a
hypodermic needle integrated within the device and connected to the
sample collection chamber, for direct acquisition of the sample
into the sample chamber. This can substantially reduce the
opportunity for contamination of the sample.
[0583] In addition to the foregoing, the sample collection portion
of the device may also include reagents and/or treatments for
neutralization of infectious agents, stabilization of the specimen
or sample, pH adjustments, and the like. Stabilization and pH
adjustment treatments may include, e.g., introduction of heparin to
prevent clotting of blood samples, addition of buffering agents,
addition of protease or nuclease inhibitors, preservatives and the
like.
[0584] Such reagents may generally be stored within the sample
collection chamber of the device or may be stored within a
separately accessible chamber, wherein the reagents may be added to
or mixed with the sample upon introduction of the sample into the
device. These reagents may be incorporated within the device in
either liquid or lyophilized form, depending upon the nature and
stability of the particular reagent used.
Sample Manipulation
[0585] In between introducing the sample to be analyzed into the
device, and analyzing that sample, e.g., on a hybridization array
comprising a plurality of ordered first and/or second identifying
linker oligonucleotides such as e.g. a hybridization array
comprising an ordered plurality of first and/or second identifying
linker oligonucleotides, it will often be desirable to perform one
or more initial sample preparation operations upon the sample.
[0586] Typically, these sample preparation operations will include
such manipulations as extraction of intracellular material, e.g.,
polynucleotides including nucleic acids from whole cell samples,
viruses and the like, and optionally one or more steps preferably
including amplification of the extracted nucleic acids,
fragmentation by treatment with at least one site-specific
endonuclease including at least one site-specific nicking
endonuclease, and optionally also a site-specific restriction
endonuclease, transcription, including reverse transcription in
connection with cDNA synthesis, labeling and/or extension
reactions. One or more of these various operations may be readily
incorporated into the microfluid device of the present
invention.
Nucleic Acid Extraction from the Biological Sample
[0587] For those embodiments where whole cells, viruses or other
tissue samples are being analyzed, it will typically be necessary
to extract the nucleic acids from the cells or viruses, prior to
continuing with the various sample preparation operations.
Accordingly, following sample collection, polynucleotides may be
liberated from the collected cells, viral coat, etc., into a crude
extract, followed by additional treatments to prepare the sample
for subsequent operations, e.g., denaturation of contaminating (DNA
binding) proteins, purification, filtration, desalting, and the
like.
[0588] Liberation of nucleic acids from the sample cells or
viruses, and denaturation of DNA binding proteins may generally be
performed by chemical, physical, or electrolytic lysis methods. For
example, chemical methods generally employ lysing agents to disrupt
the cells and extract the nucleic acids from the cells, followed by
treatment of the extract with chaotropic salts such as guanidinium
isothiocyanate or urea to denature any contaminating and
potentially interfering proteins. Generally, where chemical
extraction and/or denaturation methods are used, the appropriate
reagents may be incorporated within the extraction chamber, a
separate accessible chamber or externally introduced.
[0589] Alternatively, physical methods may be used to extract the
polynucleotides and denature DNA binding proteins. U.S. Pat. No.
5,304,487, incorporated herein by reference in its entirety for all
purposes, discusses the use of physical protrusions within
microchannels or sharp edged particles within a chamber or channel
to pierce cell membranes and extract their contents. Combinations
of such structures with piezoelectric elements for agitation can
provide suitable shear forces for lysis. Such elements are
described in greater detail with respect to nucleic acid
fragmentation, below. More traditional methods of cell extraction
may also be used, e.g., employing a channel with restricted
cross-sectional dimension which causes cell lysis when the sample
is passed through the channel with sufficient flow pressure.
[0590] Alternatively, cell extraction and denaturing of
contaminating proteins may be carried out by applying an
alternating electrical current to the sample. More specifically,
the sample of cells is flowed through a microtubular array while an
alternating electric current is applied across the fluid flow. A
variety of other methods may be utilized within the device of the
present invention to effect cell lysis/extraction, including, e.g.,
subjecting cells to ultrasonic agitation, or forcing cells through
microgeometry apertures, thereby subjecting the cells to high shear
stress resulting in rupture.
[0591] Following extraction, it will often be desirable to separate
the nucleic acids from other elements of the crude extract, e.g.,
denatured proteins, cell membrane particles, salts, and the like.
Removal of particulate matter is generally accomplished by
filtration, flocculation or the like. A variety of filter types may
be readily incorporated into the device. Further, where chemical
denaturing methods are used, it may be desirable to desalt the
sample prior to proceeding to the next step. Desalting of the
sample, and isolation of the nucleic acid may generally be carried
out in a single step, e.g., by binding the nucleic acids to a solid
phase and washing away the contaminating salts or performing gel
filtration chromatography on the sample, passing salts through
dialysis membranes, and the like. Suitable solid supports for
nucleic acid binding include, e.g., diatomaceous earth, silica
(i.e., glass wool), or the like. Suitable gel exclusion media, also
well known in the art, may also be readily incorporated into the
devices of the present invention, and is commercially available
from, e.g., Pharmacia and Sigma Chemical.
[0592] The isolation and/or gel filtration/desalting may be carried
out in an additional chamber, or alternatively, the particular
chromatographic media may be incorporated in a channel or fluid
passage leading to a subsequent reaction chamber. Alternatively,
the interior surfaces of one or more fluid passages or chambers may
themselves be derivatized to provide functional groups appropriate
for the desired purification, e.g., charged groups, affinity
binding groups and the like, i.e., poly-T oligonucleotides for mRNA
purification. This is also preferred when isolating single stranded
polynucleotide tags from cDNA synthesised from poly-A containing
mRNA.
[0593] Alternatively, desalting methods may generally take
advantage of the high electrophoretic mobility and negative charge
of DNA compared to other elements. Electrophoretic methods may also
be utilized in the purification of nucleic acids from other cell
contaminants and debris.
[0594] In one example, a separation channel or chamber of the
device is fluidly connected to two separate "field" channels or
chambers having electrodes, e.g., platinum electrodes, disposed
therein. The two field channels are separated from the separation
channel using an appropriate barrier or "capture membrane" which
allows for passage of current without allowing passage of nucleic
acids or other large molecules.
[0595] The barrier generally serves two basic functions: first, the
barrier acts to retain the nucleic acids which migrate toward the
positive electrode within the separation chamber; and second, the
barriers prevent the adverse effects associated with electrolysis
at the electrode from entering into the reaction chamber (e.g.,
acting as a salt junction). Such barriers may include, e.g.,
dialysis membranes, dense gels, PEI filters, or other suitable
materials. Upon application of an appropriate electric field, the
nucleic acids present in the sample will migrate toward the
positive electrode and become trapped on the capture membrane.
Sample impurities remaining free of the membrane are then washed
from the chamber by applying an appropriate fluid flow.
[0596] Upon reversal of the voltage, the nucleic acids are released
from the membrane in a substantially purer form. The field channels
may be disposed on the same or opposite sides or ends of a
separation chamber or channel, and may be used in conjunction with
mixing elements described herein, to ensure maximal efficiency of
operation. Further, coarse filters may also be overlaid on the
barriers to avoid any fouling of the barriers by particulate
matter, proteins or nucleic acids, thereby permitting repeated
use.
[0597] In a similar aspect, the high electrophoretic mobility of
nucleic acids with their negative charges, may be utilized to
separate nucleic acids from contaminants by utilizing a short
column of a gel or other appropriate matrix or gel which will slow
or retard the flow of other contaminants while allowing the faster
nucleic acids to pass.
[0598] For a number of applications, it may be desirable to extract
and separate messenger RNA from cells, cellular debris, and other
contaminants. In some applications, poly-A containing mRNA may be
extracted. In other applications, both poly-A containing mRNA and
mRNA devoid of a poly-A tail may be extracted.
[0599] As such, the device of the present invention may, in some
cases, include an mRNA purification chamber or channel. In general,
such purification takes advantage of the poly-A tails on mRNA in
particular and as noted above, poly-T oligonucleotides may be
immobilized within a chamber or channel of the device to serve as
affinity ligands for mRNA. Poly-T oligonucleotides may be
immobilized upon a solid support incorporated within the chamber or
channel, or alternatively, may be immobilized upon the surface(s)
of the chamber or channel itself. Immobilization of
oligonucleotides on the surface of the chambers or channels may be
carried out by methods described herein including, e.g., oxidation
and silanation of the surface followed by standard DMT synthesis of
the oligonucleotides.
[0600] In operation, the lysed sample is introduced into this
chamber or channel in an appropriate salt solution for
hybridization, whereupon the mRNA will hybridize to the immobilized
poly-T. Hybridization may also be enhanced through incorporation of
mixing elements, also as described herein. After enough time has
elapsed for hybridization, the chamber or channel is washed with
clean salt solution.
[0601] The mRNA bound to the immobilized poly-T oligonucleotides is
then washed free in a low ionic strength buffer. The surface area
upon which the poly-T oligonucleotides are immobilized may be
increased through the use of etched structures within the chamber
or channel, e.g., ridges, grooves or the like. Such structures also
aid in the agitation of the contents of the chamber or channel, as
described herein. Alternatively, the poly-T oligonucleotides may be
immobilized upon porous surfaces, e.g., porous silicon, zeolites,
silica xerogels, cellulose, sintered particles, or other solid
supports.
Polynucleotide Amplification and in Vitro Transcription
[0602] Following sample collection and nucleic acid extraction, the
nucleic acid portion of the sample may be subjected to one or more
preparative reactions. These preparative reactions can include in
vitro transcription, labeling, fragmentation, amplification and
other reactions.
[0603] Nucleic acid amplification increases the number of copies of
the target nucleic acid sequence of interest. A variety of
amplification methods are suitable for use in the methods and
device of the present invention, including for example, the
polymerase chain reaction method or (PCR), the ligase chain
reaction (LCR), self sustained sequence replication (3SR), and
nucleic acid based sequence amplification (NASBA).
[0604] The latter two amplification methods involve isothermal
reactions based on isothermal transcription, which produce both
single stranded RNA (ssRNA) and double stranded DNA (dsDNA) as the
amplification products in a ratio of approximately or 100 to 1,
respectively. As a result, where these latter methods are employed,
sequence analysis may be carried out using either type of
substrate, i.e., complementary to either DNA or RNA.
[0605] In one embodiment, the microfluid device according to the
present invention comprises an amplification reaction chamber. The
microfluid device preferably comprises a sealable opening for the
addition of the various amplification reagents. However, in
preferred aspects, the amplification chamber will have an effective
amount of the various amplification reagents described above,
predisposed within the amplification chamber, or within an
associated reagent chamber whereby the reagents can be readily
transported to the amplification chamber upon initiation of the
amplification operation. By "effective amount" is meant a quantity
and/or concentration of reagents required to carry out
amplification of a targeted nucleic acid sequence. These amounts
are readily determined from known PCR protocols. See, e.g.,
Sambrook, et al. Molecular Cloning: A Laboratory Manual, (2nd ed.)
Vols. 1-3, Cold Spring Harbor Laboratory, (1989) and PCR Protocols:
A Guide to Methods and Applications (Innis, M., Gelfand, D.,
Sninsky, J. and White, T., eds.) Academic Press (1990), both of
which are incorporated herein by reference for all purposes in
their entirety.
[0606] For those embodiments where the various reagents are
predisposed within the amplification or adjacent chamber, it will
often be desirable for these reagents to be in lyophilized forms,
to provide maximum shelf life of the overall device. Introduction
of the liquid sample to the chamber then reconstitutes the reagents
in active form, and the particular reactions may be carried
out.
[0607] In some aspects, the polymerase enzyme may be present within
the amplification chamber, coupled to a suitable solid support, or
to the walls and surfaces of the amplification chamber. Suitable
solid supports include those that are well known in the art, e.g.,
agarose, cellulose, silica, divinylbenzene, polystyrene, etc.
[0608] Coupling of enzymes to solid supports has been reported to
impart stability to the enzyme in question, which allows for
storage of days, weeks or even months without a substantial loss in
enzyme activity, and without the necessity of lyophilizing the
enzyme. The 94 kd, single subunit DNA polymerase from Thermus
aquaticus (or taq polymerase) is particularly suited for the PCR
based amplification methods used in the present invention, and is
generally commercially available from, e.g., Promega, Inc.,
Madison, Wis. In particular, monoclonal antibodies are available
which bind the enzyme without affecting its polymerase activity.
Consequently, covalent attachment of the active polymerase enzyme
to a solid support, or the walls of the amplification chamber can
be carried out by using the antibody as a linker between the enzyme
and the support.
[0609] In addition to PCR and IVT reactions, the methods and
devices of the present invention are also applicable to a number of
other reaction types, e.g., reverse transcription, nick
translation, cDNA generation, and the like.
[0610] In one embodiment, acoustic microstructures may be used for
hybridization mixing. A description of an acoustic mixer may be
found in X. Zhu and E. S. Kim "Microfluidic Motion Generation With
Loosely-Focused Acoustic Waves", 1997 Int'l. Conference on
Solid-State Sensors and Actuators, Jun. 16-19, 1997, Chicago,
Ill.
Labeling and Fragmentation
[0611] Nucleic acids comprising or essentially consisting of the
single stranded polynucleotide tag to be analysed and/or determined
in the biological sample may, in one embodiment of the present
invention, be labeled to facilitate detection in subsequent
steps.
[0612] The labeling may also comprise labeling of an adapter
oligonucleotide, of a first and/or second identifying linker
oligonucleotide, of a hybrid or chimeric oligonucleotide tag, of a
molecular identifier, or any other molecule used for manipulating
and/or identifying the single stranded polynucleotide tag according
to the present invention. Labeling reactions are thus not confined
to labeling of nucleic acids natively occurring in a biological
sample of interest.
[0613] Labeling may be carried out prior to, during, and after any
amplification step. In particular, amplification, in vitro
transcription or nick translation may incorporate a label into the
amplified or transcribed sequence, either through the use of
labeled primers or the incorporation of labeled dNTPs or NTPs into
the amplified sequence. An amplification step, an in vitro
transcription step, and/or a nick translation step may thus be
employed for generating one or more of e.g. i) an adapter
oligonucleotide, ii) an identifying linker oligonucleotide
comprising a predetermined single stranded nucleotide sequence, and
iii) a chimeric polynucleotide comprising an adapter part.
[0614] Labeling may also be carried out by attaching an
appropriately labeled (e.g. FICT, or biotin), dNTP to the 3'-end of
DNAase fragmented PCR product using terminal deoxy-transferase
(TdT).
[0615] In an alternative embodiment, Poly(A) polymerase will "tail"
any RNA molecule with polyA and therefore be used for radiolabeling
RNA. Used in conjunction with a biotin-, fluorophore-, gold
particle- (or any other detectable moiety)-ATP conjugate, poly (A)
polymerase can be used for direct 3'-end labelling of RNA targets
for detecting hybridization to DNA probe arrays. The nucleotide
conjugate may carry the detectable moiety attached, through a
linker (or not) to positions on either the nucleotide base or
sugar.
[0616] With regard to relative incorporation efficiency, the enzyme
may exhibit a preference for one or more of these positions. The
nucleotide may be a 2', 3'-dideoxynucleotide, in which case only a
single label will be added to the 3'-end of the RNA. A preferred
format is to tail the RNA with 5-Bromo-UTP, and then detect
hybridization indirectly using a labeled anti-bromouridine. This
would closely parallel a currently favored assay format used for
expression monitoring applications using biotinylated RNA and
phycoerythrin-streptavidin "staining".
[0617] Alternatively, a polynucleotide and/or any one or more of
e.g. i) an adapter oligonucleotide, ii) an identifying linker
oligonucleotide comprising a predetermined single stranded
nucleotide sequence, and iii) a chimeric polynucleotide comprising
an adapter part, may be labeled without any amplification taking
place, or following an amplification step involving amplification
of natively occurring polynucleotides in the biological sample.
[0618] In one such embodiment, the labeling typically involves the
covalent attachment of a particular detectable group upon an
amplified sequences. Suitable labels or detectable groups include a
variety of fluorescent or radioactive labeling groups well known in
the art. These labels may also be coupled to the sequences using
methods that are well known in the art. See, e.g., Sambrook, et
al.
[0619] Any one or more of a single stranded polynucleotide tag, an
adapter oligonucleotide, an identifying linker oligonucleotide
comprising a predetermined single stranded nucleotide sequence, and
a chimeric polynucleotide comprising an adapter part may be
subjected to one or more further processing steps. For example, in
some cases, it may be desirable to further fragment a chimeric
polynucleotide or a hybrid polynucleotide tag or a chimeric
polynucleotide tag prior to hybridization with a hybridization
array, in order to provide segments which are more readily
accessible to the identifying linker oligonucleotides comprised in
the array. In one embodiment, a further processing step is e.g. a
ligation of a single stranded or double stranded adapter
oligonucleotide to a single stranded or double stranded
polynucleotide, respectively, comprising a single stranded
polynucleotide tag, or e.g. complementary part thereof, as the case
may be for some single stranded polynucleotides, wherein said
single stranded polynucleotide tag is to be analysed and/or
determined according to a method of the present invention, wherein
said ligation, preferably a ligation catalysed by an enzyme,
generates a chimeric polynucleotide.
[0620] Another example of a further processing step is
fragmentation of the chimeric polynucleotide by at least one
site-specific nicking endonuclease; optionally in combination with
a further fragmentation resulting from cleavage of the chimeric
polynucleotide by a site-specific restriction endonuclease. The
fragmentation generated by the action of the specific nicking
endonuclease, and optionally also by the site-specific restriction
endonuclease may occur simultaneously, or sequentially, in any
order.
[0621] Yet further processing steps are steps leading to the
formation of hybrid polynucleotide tags and/or chimeric
polynucleotide tags. Even further processing steps involve the
manipulation or detection of the tags by using e.g. molecular
identifiers and/or selectively detectable labels.
[0622] In addition to fragmentation of polynucleotides arising from
enzymatic treatment, Including treatment with site-specific
endonucleases, including site-specific nicking endonucleases and
optionally also site-specific restriction endonucleases,
fragmentation of polynucleotides may also arise from any physical
or chemical or enzymatic methods that are known in the art. These
additional treatments may be performed within an amplification
chamber, or alternatively, they may be carried out in a separate
chamber.
[0623] For example, physical fragmentation methods may involve
moving the sample containing the nucleic acid over pits or spikes
in the surface of a reaction chamber or fluid channel. The motion
of the fluid sample, in combination with the surface irregularities
produces a high shear rate, resulting in fragmentation of the
nucleic acids. In one aspect, this may be accomplished in a
miniature device by placing a piezoelectric element, e.g., a PZT
ceramic element adjacent to a substrate layer that covers a
reaction chamber or flow channel, either directly, or through a
liquid layer, as described herein. The substrate layer has pits,
spikes or apertures manufactured in the surface which are within
the chamber or flow channel. By driving the PZT element in the
thickness mode, a standing wave is set up within the chamber.
Cavitation and/or streaming within the chamber results in
substantial shear. Similar shear rates may be achieved by forcing
the nucleic acid containing fluid sample through restricted size
flow passages, e.g., apertures having a cross-sectional dimension
in the micron or submicron scale, thereby producing a high shear
rate and fragmenting the nucleic acid.
[0624] A number of sample preparation operations may be carried out
by adjusting the pH of the sample, such as cell lysis, nucleic acid
fragmentation, enzyme denaturation and the like. Similarly, pH
control may also play a role in a wide variety of other reactions
to be carried out in the device, i.e., for optimizing reaction
conditions, neutralizing acid or base additions, denaturing
exogenously introduced enzymes, quenching reactions, and the like.
Such pH monitoring and control may be readily accomplished using
well known methods. For example, pH may be monitored by
incorporation of a pH sensor or indicator within a particular
chamber. Control may then be carried out by titration of the
chamber contents with an appropriate acid or base.
Single Stranded Polynucleotide Tag Analysis
[0625] Following the various sample preparation operations, the
sample comprising the single stranded polynucleotide tag may in one
embodiment be subjected to one or more analysis and/or manipulation
operations. Particularly preferred analysis operations include,
e.g., sequence based analyses using a hybridization array
comprising an ordered plurality of first and/or second identifying
linker oligonucleotides and/or an analysis based on separation of
single stranded polynucleotide tags comprised in a hybrid
polynucleotide tag further comprising a molecular identifier and/or
a selectively detectable label or a chimeric polynucleotide tag
further comprising a molecular identifier and/or a selectively
detectable label, i.e. analyses using, e.g., microcapillary array
electrophoresis.
Single Stranded Polynucleotide Tag Analysis Using a Microfluid
Device Comprising a Hybridization Array
[0626] In one embodiment, following sample preparation, the
biological sample comprising the single stranded polynucleotide
probe is processed and the single stranded polynucleotide tag thus
obtained is analysed using a hybridization array comprising a
plurality of identifying linker oligonucleotides.
[0627] Accordingly, it shall be understood that the below
description of single stranded polynucleotide tag characterization
using a hybridization array comprising a plurality of ordered first
and/or second identifying linker oligonucleotides may take place
with or without the use of a microfluid device comprising the
array. Furthermore, when sample processing occurs in one microfluid
device, the processed sample comprising the at least one single
stranded polynucleotide tag may be analysed in said device with or
without using a hybridization array comprising an ordered plurality
of first and/or second identifying linker oligonucleotides, or the
sample may be transferred to another microfluid device comprising a
hybridization array comprising an ordered plurality of first and/or
second identifying linker oligonucleotides, or the sample may be
transferred to a hybridization array that does not form part of a
microfluid device. However, in one preferred embodiment of the
present invention, a microfluid device, optionally comprising a
hybridization array comprising an ordered plurality of first and/or
second identifying linker oligonucleotides, is used for sample
handling and single stranded polynucleotide tag analysis and
characterization.
[0628] The method of the present invention for characterizing a
single stranded polynucleotide tag employs, in one preferred
embodiment, a set of relatively short first and/or second
identifying linker oligonucleotides comprising a predetermined,
single stranded first and/or second nucleotide sequence,
respectively, to search for and identify complementary sequences
comprised in a single stranded polynucleotide strand.
[0629] The ratio of first and/or second identifying linker
oligonucleotides to single stranded polynucleotide tags may differ
in various preferred embodiments. When analysing tags of unknown
sequence, all possible combinations of single stranded nucleotides
sequences comprised in a first and/or second identifying linker
oligonucleotide may be employed. The maximum number of possible
combinations is in one preferred embodiment given by 4.sup.n,
wherein n denotes the number of nucleotides in the single stranded
part of the first and/or second identifying linker oligonucleotide.
For other purposes including e.g. diagnostic purposes, the number
of first and/or second identifying linker oligonucleotides may be
significantly less. This is indicated by stating that a subset of
first and/or second identifying linker oligonucleotides are present
in the hybridization array. Such a subset may vary in numbers, and
it may comprise e.g. numbers corresponding to about 90% of all
possible combinations of single stranded nucleotide sequence, such
as 80% of such combinations, for example 75% of such combinations,
such as 70% of such combinations, for example 65% of such
combinations, such as 60% of such combinations, for example 55% of
such combinations, such as 50% of such combinations, for example
40% of such combinations, such as 35% of such combinations, for
example 30% of such combinations, such as 25% of such combinations,
for example 20% of such combinations, or less than about 20% of
such combinations.
[0630] One strategy of single stranded polynucleotide tag
identification can be illustrated by the following example. An
ssDNA tag comprising e.g. 10 or more nucleotides is contacted with
a hybridization array comprising a complete set of first and/or
second identifying linker oligonucleotides, or a subset thereof.
Preferably, at least one of the first and/or second identifying
linker oligonucleotides will perfectly hybridize to the ssDNAtag
sequence. The identity of the first and/or second identifying
linker oligonucleotides at each site is known. Thus, by determining
the locations at which the tag hybridizes on the array, or the
hybridization pattern, one can determine the sequence of the tag
sequence.
[0631] While first and/or second identifying linker
oligonucleotides may be prepared comprising every possible first
and/or second single stranded sequence of length n, respectively,
it may be desirable, when practicing the present invention, to
provide a hybridization array comprising a plurality of ordered
first and/or second identifying linker oligonucleotides which is
specific and complementary to a particular nucleotide sequence
comprised in a predetermined subset of single stranded
polynucleotide tags.
[0632] For example, in particularly preferred aspects including
diagnostic applications, the hybridization array will comprise
first and/or second identifying linker oligonucleotides comprising
single stranded nucleotide sequences which are complementary to
specific, predetermined ssDNA tag sequences, and/or any number or
plurality of individual or multiple mutations of these.
[0633] Such arrays are particularly useful in the diagnosis of
specific disorders which are characterized by the presence of a
particular nucleic acid sequence. For example, the tag sequence may
be that of a particular exogenous disease causing agent, e.g.,
human immunodeficiency virus (see, U.S. application Ser. No.
08/284,064, now abandoned, previously incorporated herein by
reference), or alternatively, the tag sequence may be that portion
of the human genome which is known to be mutated in instances of a
particular disorder, i.e., sickle cell anemia (see, e.g., U.S.
application Ser. No. 08/082,937, now abandoned, previously
incorporated herein by reference) or cystic fibrosis.
[0634] For such applications, the array may comprise a plurality of
hybridization arrays comprising a plurality of ordered first and/or
second identifying linker oligonucleotides, such as two, three, or
at least four sets of first and/or second identifying linker
oligonucleotides.
[0635] A first hybridization array preferably comprises a first
and/or second identifying linker oligonucleotide set comprising a
single stranded nucleotide sequence complementary to the nucleotide
sequence of the ssDNA tag. Any first and/or second identifying
linker oligonucleotide is related to an ssDNA tag comprising a
nucleotide sequence complementary to the single stranded part of
each first and/or second identifying linker oligonucleotide. Thus,
each first and/or second identifying linker oligonucleotide has a
position, designated a predetermined position, that is occupied by
a nucleotide sequence complementary to the corresponding nucleotide
sequence comprised in a single stranded polynucleotide tag capable
of hybridizing thereto.
[0636] The sample comprising at least one single stranded
polynucleotide tag is preferably incubated with the hybridization
array comprising a plurality of ordered first and/or second
identifying linker oligonucleotides in a hybridization chamber of a
microfluid device. Hybridization between the single stranded
polynucleotide tag and the first and/or second identifying linker
oligonucleotides in the hybridization array is suitably detected,
using, e.g., epifluorescence confocal microscopy.
[0637] In one embodiment, the sample comprising at least one single
stranded polynucleotide tag is subjected to mixing, e.g. stirring
or shaking, when the hybridization is performed. This is to enhance
hybridization of ssDNA tag in the sample to first and/or second
identifying linker oligonucleotides comprised in the array. Mixing
may be carried out by any method described herein, e.g., through
the use of piezoelectric elements, electrophoretic methods, or
physical mixing by pumping fluids into and out of the hybridization
chamber, i.e., into an adjoining chamber.
[0638] In one embodiment, the detection operation will be performed
using a reader device external to the diagnostic device. However,
it may be desirable in some cases, to incorporate the data
gathering operation into the diagnostic device itself. Novel
systems for direct electronic detection of hybridization/ligation
locations on the array will be set forth herein.
[0639] The hybridization/ligation data is next analyzed to
determine the presence or absence of a particular ssDNA tag
sequence within the sample.
[0640] In some cases, hybridized oligonucleotides may be labeled
following hybridization. For example, where biotin labeled dNTPs
are used in, e.g., amplification or transcription, streptavidin
linked reporter groups may be used to label hybridized complexes.
Such operations are readily integratable into the systems of the
present invention, requiring the use of various mixing methods as
is necessary.
Capillary Electrophoresis
[0641] In some embodiments, it may be desirable to provide an
additional, or alternative means for analyzing the nucleic acids
from the sample. Accordingly, in one embodiment, the device of the
invention will optionally or additionally comprise a micro
capillary array for analysis of the nucleic acids obtained from the
sample. In this embodiment, the first and/or second identifying
linker oligonucleotides preferably further comprises a molecular
identifier capable of being manipulated according to size and/or
molecular weight and/or charge.
[0642] Microcapillary array electrophoresis generally involves the
use of a thin capillary or channel which may or may not be filled
with a particular separation medium. Electrophoresis of a sample
through the capillary provides a size based separation profile for
the sample. The use of microcapillary electrophoresis in size
separation of nucleic acids has been reported in, e.g., Woolley and
Mathies, Proc. Nat'l Acad. Sci. USA (1994) 91:11348-11352.
Microcapillary array electrophoresis generally provides a rapid
method for size based sequencing, PCR product analysis and
restriction fragment-sizing. The high surface to volume ratio of
these capillaries allows for the application of higher electric
fields across the capillary without substantial thermal variation
across the capillary, consequently allowing for more rapid
separations.
[0643] Furthermore, when combined with confocal imaging methods,
these methods provide sensitivity in the range of attomoles, which
is comparable to the sensitivity of radioactive sequencing
methods.
[0644] Microfabrication of microfluidic devices including
microcapillary electrophoretic devices has been discussed in detail
in, e.g., Jacobsen, et al., Anal. Chem. (1994) 66:1114-1118,
Effenhauser, et al., Anal. Chem. (1994) 66:2949-2953, Harrison, et
al., Science (1993) 261:895-897, Effenhauser, et al. Anal. Chem.
(1993) 65:2637-2642, and Manz, et al., J. Chromatog. (1992)
593:253-258.
[0645] Typically, these methods comprise photolithographic etching
of micron scale channels on a silica, silicon or other rigid
substrate or chip, and can be readily adapted for use in the
miniaturized devices of the present invention. In some embodiments,
the capillary arrays may be fabricated from the same polymeric
materials described for the fabrication of the body of the device,
using the injection molding techniques described herein. In such
cases, the capillary and other fluid channels may be molded into a
first planar element. A second thin polymeric member having ports
corresponding to the termini of the capillary channels disposed
therethrough, is laminated or sonically welded onto the first to
provide the top surface of these channels. Electrodes for
electrophoretic control are disposed within these ports/wells for
application of the electrical current to the capillary channels.
Through use of a relatively thin sheet as the covering member of
the capillary channels, heat generated during electrophoresis can
be rapidly dissipated. Additionally, the capillary channels may be
coated with more thermally conductive material, e.g., glass or
ceramic, to enhance heat dissipation.
[0646] In many capillary electrophoresis methods, the capillaries,
e.g., fused silica capillaries or channels etched, machined or
molded into planar substrates, are filled with an appropriate
separation/sieving matrix. Typically, a variety of sieving matrices
are known in the art may be used in the microcapillary arrays.
Examples of such matrices include, e.g., hydroxyethyl cellulose,
polyacrylamide, agarose and the like. Gel matrices may be
introduced and polymerized within the capillary channel. However,
in some cases, this may result in entrapment of bubbles within the
channels which can interfere with sample separations. Accordingly,
it is often desirable to place a preformed separation matrix within
the capillary channel(s), prior to mating the planar elements of
the capillary portion. Fixing the two parts, e.g., through sonic
welding, permanently fixes the matrix within the channel.
Polymerization outside of the channels helps to ensure that no
bubbles are formed. Further, the pressure of the welding process
helps to ensure a void-free system. Generally, the specific gel
matrix, running buffers and running conditions are selected to
maximize the separation characteristics of the particular
application, e.g., the size of the nucleic acid fragments, the
required resolution, and the presence of native or undenatured
nucleic acid molecules. For example, running buffers may include
denaturants, chaotropic agents such as urea or the like, to
denature nucleic acids in the sample.
Data Gathering and Single Stranded Polynucleotide Tag Analysis
[0647] Gathering data from the various analysis operations, e.g.,
hybridization arrays and/or microcapillary arrays, is carried out
using any method known in the art. For example, the arrays may be
scanned using lasers to excite fluorescently labeled tags that have
hybridized to regions of probe arrays, which can then be imaged
using charged coupled devices. ("CCDs") for a wide field scanning
of the array. Alternatively, another particularly useful method for
gathering data from the arrays is through the use of laser confocal
microscopy which combines the ease and speed of a readily automated
process with high resolution detection. Particularly preferred
scanning devices are generally described in, e.g., U.S. Pat. Nos.
5,143,854 and 5,424,186.
[0648] Following the data gathering operation, the data will
typically be reported to a data analysis operation. To facilitate
the sample analysis operation, the data obtained by the reader from
the device will typically be analyzed using a digital computer.
Typically, the computer will be appropriately programmed for
receipt and storage of the data from the device, as well as for
analysis and reporting of the data gathered, i.e., interpreting
fluorescence data to determine the sequence of the single stranded
part of first and/or second identifying linker oligonucleotides
hybridized to a single stranded polynucleotide tag; normalization
of background.
Single Stranded Polynucleotide Tag Characterization for Diagnostic
Purposes
[0649] When used for diagnostic purposes, the present invention may
in one preferred embodiment exploit a microfluid device comprising
a part used primarily for sample processing purposes and/or
analytical purposes, as well as a part used primarily for
diagnostic purposes.
[0650] A schematic presentation of a representative microfluid
device is disclosed e.g. in U.S. Pat. No. 6,168,948, incorporated
herein by reference, wherein the analytical part comprises one or
more compartments for sample collection, one or more compartments
for sample preparation or sample processing, and one or more
compartments for sample analysis, as well as suitable systems for
data acquisition, data analysis, and data interpretation. The
microfluid device may further comprise a diagnostic part for
performing one or more of the operations of sample collection,
preparation and/or analysis using, e.g., hybridization and/or
separation according to size, molecular weight, or charge, of a
molecular identifier.
[0651] The diagnostic part of the device can be connected to a
reader device in order to detect the hybridization and/or
separation information contained in the device. The hybridization
and/or separation data is reported from the reader device to a
computer which is programmed with appropriate software for
interpreting the data obtained by the reader device from the
diagnostic device.
[0652] Interpretation of the data from the diagnostic device may be
used in a variety of ways, including single stranded polynucleotide
tag identification and/or nucleic acid sequencing directed towards
a particular disease or a particular disease causing agent, such as
viral or bacterial infections, e.g., AIDS, malaria, etc., or
genetic disorders, e.g., sickle cell anemia, cystic fibrosis,
Fragile X syndrome, Duchenne muscular dystrophy, gene expression
and the like.
[0653] When used for diagnostic and/or analytical purposes,
including single stranded polynucleotide tag characterization
and/or sequence determination, the device generally comprises a
number of discrete reaction, storage and/or analytical chambers
disposed within a single unit or body. While referred to herein as
a "diagnostic device," those of skill in the art will appreciate
that the device of the invention will have a variety of
applications outside the scope of diagnostics, alone. Such
applications include sample identification and characterization
applications (for, e.g., taxonomic studies, forensic applications,
i.e., criminal investigations, and the like).
[0654] Typically, the body of the device defines the various
reaction chambers and fluid passages in which the above described
operations are carried out. Fabrication of the body, and thus the
various chambers and channels disposed within the body may
generally be carried out using one or a combination of a variety of
well known manufacturing techniques and materials. Generally, the
material from which the body is fabricated will be selected so as
to provide maximum resistance to the full range of conditions to
which the device will be exposed, e.g., extremes of temperature,
salt, pH, application of electric fields and the like, and will
also be selected for compatibility with other materials used in the
device. Additional components may be later introduced, as
necessary, into the body. Alternatively, the device may be formed
from a plurality of distinct parts that are later assembled or
mated. For example, separate and individual chambers and fluid
passages may be assembled to provide the various chambers of the
device.
[0655] As a miniaturized device, the body of the microfluid device
as described herein will typically be approximately 1 to 20 cm in
length by about 1 to 10 cm in width by about 0.1 cm to about 2 cm
thick. Although indicative of a rectangular shape, it will be
readily appreciated that the devices of the invention may be
embodied in any number of shapes depending upon the particular
need. Additionally, these dimensions will typically vary depending
upon the number of operations to be performed by the device, the
complexity of these operations and the like. As a result, these
dimensions are provided as a general indication of the size of the
device.
[0656] The number and size of the reaction chambers included within
the device will also vary depending upon the specific application
for which the device is to be used. Generally, the device will
include at least two distinct reaction chambers, and preferably, at
least three, four or five distinct reaction chambers, all
integrated within a single body. Individual reaction chambers will
also vary in size and shape according to the specific function of
the reaction chamber.
[0657] For example, in some cases, circular reaction chambers may
be employed. Alternatively, elongate reaction chambers may be used.
In general however, the reaction chambers will be from about 0.05
mm to about 20 mm in width or diameter, preferably from about 0.1
mm to about 2.0 mm in width or diameter and about 0.05 mm to about
5 mm deep, and preferably 0.05 mm to about 1 mm deep. For elongate
chambers, length will also typically vary along these same
ranges.
[0658] Microfluid channels, on the other hand, are typically
distinguished from chambers in having smaller dimensions relative
to the chambers, and will typically range from about 10 .mu.m to
about 1000 .mu.m wide, preferably, 100 .mu.m to 500 .mu.m wide and
about 1 .mu.m to 500 .mu.m deep. Although described in terms of
reaction chambers, it will be appreciated that these chambers may
perform a number of varied functions, e.g., as storage chambers,
incubation chambers, mixing chambers and the like.
[0659] In some cases, a separate chamber or chambers may be used as
volumetric chambers, e.g., to precisely measure fluid volumes for
introduction into a subsequent reaction chamber. In such cases, the
volume of the chamber will be dictated by volumetric needs of a
given reaction. Further, the device may be fabricated to include a
range of volumetric chambers having varied, but known volumes or
volume ratios (e.g., in comparison to a reaction chamber or other
volumetric chambers).
[0660] As described above, the body of the device is generally
fabricated using one or more of a variety of methods and materials
suitable for microfabrication techniques. For example, in preferred
aspects, the body of the device may comprise a number of planar
members that may individually be injection molded parts fabricated
from a variety of polymeric materials, or may be silicon, glass, or
the like. In the case of substrates like silica, glass or silicon,
methods for etching, milling, drilling, etc., may be used to
produce wells and depressions which make up the various reaction
chambers and fluid channels within the device.
[0661] Microfabrication techniques, such as those regularly used in
the semiconductor and microelectronics industries are particularly
suited to these materials and methods. These techniques include,
e.g., electrodeposition, low-pressure vapor deposition,
photolithography, wet chemical etching, reactive ion etching (RIE),
laser drilling, and the like. Where these methods are used, it will
generally be desirable to fabricate the planar members of the
device from materials similar to those used in the semiconductor
industry, i.e., silica, silicon, gallium arsenide, polyimide
substrates. U.S. Pat. No. 5,252,294, to Kroy, et al., incorporated
herein by reference in its entirety for all purposes, reports the
fabrication of a silicon based multiwell apparatus for sample
handling in biotechnology applications.
[0662] Photolithographic methods of etching substrates are
particularly well suited for the microfabrication of these
substrates and are well known in the art. For example, the first
sheet of a substrate may be overlaid with a photoresist. An
electromagnetic radiation source may then be shone through a
photolithographic mask to expose the photoresist in a pattern which
reflects the pattern of chambers and/or channels on the surface of
the sheet. After removing the exposed photoresist, the exposed
substrate may be etched to produce the desired wells and channels.
Generally preferred photoresists include those used extensively in
the semiconductor industry. Such materials include polymethyl
methacrylate (PMMA) and its derivatives, and electron beam resists
such as poly(olefin sulfones) and the like (more fully discussed
in, e.g., Ghandi, "VLSI Fabrication Principles," Wiley (1983)
Chapter 10, incorporated herein by reference in its entirety for
all purposes).
[0663] As an example, the wells manufactured into the surface of
one planar member make up the various reaction chambers of the
device. Channels manufactured into the surface of this or another
planar member make up fluid channels which are used to fluidly
connect the various reaction chambers. Another planar member is
then placed over and bonded to the first, whereby the wells in the
first planar member define cavities within the body of the device
which cavities are the various reaction chambers of the device.
Similarly, fluid channels manufactured in the surface of one planar
member, when covered with a second planar member define fluid
passages through the body of the device. These planar members are
bonded together or laminated to produce a fluid tight body of the
device.
[0664] Bonding of the planar members of the device may generally be
carried out using a variety of methods known in the art and which
may vary depending upon the materials used. For example, adhesives
may generally be used to bond the planar members together. Where
the planar members are, e.g., glass, silicon or combinations
thereof, thermal bonding, anodic/electrostatic or silicon fusion
bonding methods may be applied. For polymeric parts, a similar
variety of methods may be employed in coupling substrate parts
together, e.g., heat with pressure, solvent based bonding.
Generally, acoustic welding techniques are generally preferred. In
a related aspect, adhesive tapes may be employed as one portion of
the device forming a thin wall of the reaction chamber/channel
structures.
[0665] Although primarily described in terms of producing a fully
integrated body of the device, the above described methods can also
be used to fabricate individual discrete components of the device
which are later assembled into the body of the device.
[0666] In additional embodiments, the body may comprise a
combination of materials and manufacturing techniques described
above in some cases, the body may include some parts of injection
molded plastics, and the like, while other portions of the body may
comprise etched silica or silicon planar members, and the like. For
example, injection molding techniques may be used to form a number
of discrete cavities in a planar surface which define the various
reaction chambers, whereas additional components, e.g., fluid
channels, arrays, etc, may be fabricated on a planar glass, silica
or silicon chip or substrate. Lamination of one set of parts to the
other will then result in the formation of the various reaction
chambers, interconnected by the appropriate fluid channels.
[0667] In particularly preferred embodiments, the body of the
device is made from at least one injection molded, press molded or
machined polymeric part that has one or more wells or depressions
manufactured into its surface to define several of the walls of the
reaction chamber or chambers. Molds or mold faces for producing
these injection molded parts may generally be fabricated using the
methods described herein for, e.g., conventional machining or
silicon molds. Examples of suitable polymers for injection molding
or machining include, e.g., polycarbonate, polystyrene,
polypropylene, polyethylene, acrylic, and commercial polymers such
as Kapton, Valox, Teflon, ABS, Delrin and the like. A second part
that is similarly planar in shape is mated to the surface of the
polymeric part to define the remaining wall of the reaction
chamber(s). Published PCT Application No. 95/33846, incorporated
herein by reference, describes a device that is used to package
individual hybridization array comprising a plurality of ordered
first and/or second identifying linker oligonucleotidess. The
device includes a hybridization chamber disposed within a planar
body. The chamber is fluidly connected to an inlet port and an
outlet port via flow channels in the body of the device. The body
includes a plurality of injection molded planar parts that are
mated to form the body of the device, and which define the flow
channels and hybridization chamber.
[0668] The surfaces of the fluid channels and reaction chambers
which contact the samples and reagents may also be modified to
better accommodate a desired reaction. Surfaces may be made more
hydrophobic or more hydrophilic depending upon the particular
application. Alternatively, surfaces may be coated with any number
of materials in order to make the overall system more compatible to
the reactions being carried out For example, in the case of nucleic
acid analyses, it may be desirable to coat the surfaces with a
non-stick coating, e.g., a Teflon, parylene or silicon, to prevent
adhesion of nucleic acids to the surface. Additionally, insulator
coatings may also be desirable in those instances where electrical
leads are placed in contact with fluids, to prevent shorting out,
or excess gas formation from electrolysis. Such insulators may
include those well known in the art, e.g., silicon oxide, ceramics
or the like.
[0669] Below is illustrated preferred embodiments of the present
invention related to single stranded polynucleotide tag analysis
and characterization. The analysis and characterization, including
characterizations for diagnostic purposes, includes in preferred
embodiment of using microfluid devices and hybridization arrays as
described herein above.
Method for Generating a Hybrid Polynucleotide Tag
[0670] When it is desirable to i) characterise and/or ii) separate
and/or identify a single stranded polynucleotide tag according to
the present invention, or desirable to determine the amount of the
at least one single stranded polynucleotide tag, the present
invention in one preferred embodiment provides a method for
generating a hybrid polynucleotide tag by hybridizing a single
stranded polynucleotide tag to a first and/or second identifying
linker oligonucleotide. The hybrid polynucleotide tag may
subsequently be subjected to a ligation, preferably an enzymatic
ligation, resulting in the ligation of the single stranded
polynucleotide tag to the first and/or second identifying linker
oligonucleotide in the form of a chimeric polynucleotide tag.
[0671] Accordingly, the method comprises the step of forming a
hybrid polynucleotide tag and/or a chimeric polynucleotide tag
between at least one single stranded polynucleotide tag and a
complementary, single stranded first unique nucleotide sequence of
a first identifying linker oligonucleotide, said method comprising
the steps of [0672] i) providing a sample preferably comprising at
least one single stranded polynucleotide tag, or a plurality of
samples obtained by dividing a composition comprising a plurality
of single stranded polynucleotide tags into at least about 4
samples, for example at least about 16 samples, such as at least
about 256 samples, for example at least about 1024 samples, such as
at least about 4096 samples, [0673] ii) contacting each of the
plurality of samples, or a subset thereof, provided in step i) with
at least one first identifying linker oligonucleotide, or a
plurality of first identifying linker oligonucleotides, [0674]
wherein each first identifying linker oligonucleotide comprises a
single stranded first unique nucleotide sequence, [0675] wherein
the at least one single stranded polynucleotide tag, or each of the
plurality of single stranded polynucleotide tags, or a subset
thereof, in each of the samples is contacted with essentially only
one first identifying linker oligonucleotide comprising a single
stranded first unique nucleotide sequence, [0676] wherein
preferably each sample is contacted with essentially all possible
combinations of single stranded first unique nucleotide sequences
of the first identifying linker oligonucleotide, or a predetermined
subset of such combinations, [0677] wherein at least one single
stranded polynucleotide tag in each sample comprises a
polynucleotide sequence, or a part thereof, complementary to a
single stranded first unique nucleotide sequence of at least one
first identifying linker oligonucleotide contacting the sample,
[0678] wherein the contacting of each of the plurality of samples,
or a subset thereof provided in step i), with at least one or a
plurality of first identifying linker oligonucleotides, occurs
under conditions allowing a hybridization to occur between [0679]
a) at least one first identifying linker oligonucleotide comprising
a single stranded first unique nucleotide sequence, and [0680] b)
at least one single stranded polynucleotide tag complementary to
the single stranded first unique nucleotide sequence, and
optionally [0681] iii) removing by means of one or more washing
steps any unhybridized material from the hybrid polynucleotide tags
and/or the chimeric polynucleotide tags formed between the single
stranded polynucleotide tag and the complementary, single stranded
first unique nucleotide sequence of the first identifying linker
oligonucleotide.
[0682] The plurality or subset of first identifying linker
oligonucleotides will typically comprise a molecular identifier
and/or be attached to a solid support, preferably a solid support
comprising a hybridization array in the form of an ordered
plurality of first identifying linker oligonucleotides.
[0683] Accordingly, substantially each of the plurality or subset
of first identifying linker oligonucleotides may further comprise a
molecular identifier capable of characterizing and/or separating
the linker oligonucleotides and/or hybrid oligonucleotide tags
according to i) the molecular weight and/or ii) charge and/or iii)
an electromagnetic property and/or iv) an ability to emit
electromagnetic radiation after excitation of individual linker
oligonucleotides comprising individual molecular identifiers.
[0684] Substantially each of the plurality or subset of first
identifying linker oligonucleotides may also comprise, or comprise
in addition to a molecular identifier, a selectively detectable
label capable of identifying substantially individual identifying
linker oligonucleotides and/or hybrid oligonucleotide tags forming
part of a plurality of such oligonucleotides, or a subset
thereof.
[0685] In one embodiment, the maximum number of combinations of
single stranded first unique nucleotide sequences is 4.sup.n,
wherein n denotes the number of nucleotides in the unique, single
stranded nucleotide sequence comprised in the identifying linker
oligonucleotides.
[0686] In one embodiment, substantially each single stranded
polynucleotide tag is ligated to a first identifying linker
oligonucleotide hybridized thereto, preferably by means of an
enzyme catalysed ligation.
[0687] Each sample comprising the at least one single stranded
polynucleotide tag may be located in the same compartment, or
located in separate containers.
[0688] The at least one or a plurality of first identifying linker
oligonucleotides may preferably comprise a recognition motif for a
site-specific restriction endonuclease, wherein the recognition
motif is correlated to the sequence of nucleotides in the single
stranded first, unique nucleotide sequence. For such identifying
linker oligonucleotides, there is provided the embodiment of [0689]
i) obtaining at least one or a plurality of chimeric polynucleotide
tags comprising a first identifying linker oligonucleotide, [0690]
ii) contacting and cleaving the at least one or a plurality of
chimeric polynucleotide tags comprising [0691] a) a single stranded
polynucleotide tag and [0692] b) a complementary, single stranded
first unique nucleotide sequence of a first identifying linker
oligonucleotide [0693] with a site-specific restriction
endonuclease capable of recognising the recognition motif, and
[0694] iii) obtaining at least one or a plurality of chimeric
polynucleotide tag fragments, and optionally [0695] iv)
substituting a phosphate group and/or an OH-group at one or both
ends of the single stranded polynucleotide tag with a molecular
moiety preventing the substituted, single stranded polynucleotide
tag from participating in a ligase reaction including a ligase
chain reaction, and further optionally, [0696] v) contacting at
least one or a plurality of second identifying linker
oligonucleotides each comprising a single stranded, unique second
nucleotide sequence with the at least one or a plurality of
chimeric polynucleotide tag fragments obtained in step iii).
[0697] Each recognition motif may be recognised by a different
site-specific restriction endonuclease or by the same site-specific
restriction endonuclease. In a further step the method involves
contacting the at least one or a plurality of chimeric
polynucleotide tags with a site-specific nicking endonuclease
capable of recognising a recognition motif of the chimeric
polynucleotide tag fragment and cleaving a single strand of said
fragment and providing a single stranded polynucleotide tag.
[0698] In another embodiment, there is provided a method wherein
the at least one or a plurality of first identifying linker
oligonucleotides comprises a recognition motif for a site-specific
nicking endonuclease, wherein the recognition motif is correlated
to the sequence of nucleotides in the single stranded first, unique
nucleotide sequence. In this embodiment the method comprises the
further steps of [0699] i) obtaining at least one or a plurality of
chimeric polynucleotide tags comprising a first identifying linker
oligonucleotide, [0700] ii) contacting and cleaving the at least
one or a plurality of chimeric polynucleotide tags comprising
[0701] a) a single stranded polynucleotide tag and [0702] b) a
complementary, single stranded first unique nucleotide sequence of
a first identifying linker oligonucleotide with a site-specific
nicking endonuclease capable of recognising the recognition motif,
and [0703] iii) obtaining at least one or a plurality of single
stranded polynucleotide tags, and optionally [0704] iv)
substituting a phosphate group and/or an OH-group at one or both
ends of the single stranded polynucleotide tag with a molecular
moiety preventing the substituted, single stranded polynucleotide
tag from participating in a ligase reaction including a ligase
chain reaction, and further optionally, [0705] v) contacting at
least one or a plurality of second identifying linker
oligonucleotides each comprising a single stranded, unique second
nucleotide sequence with the at least one or a plurality of single
stranded polynucleotide tags obtained in step iii).
[0706] Each recognition motif may be recognised by a different
site-specific nicking endonuclease or by the same site-specific
nicking endonuclease. The method pertaining to this embodiment may
comprise the further step of contacting the at least one or a
plurality of chimeric polynucleotide tags with a site-specific
restriction endonuclease capable of recognising a recognition motif
of the chimeric polynucleotide tag fragment and cleaving said
fragment
[0707] When involving the step of contacting second identifying
linker oligonucleotides, the plurality or subset of second
identifying linker oligonucleotides may comprise a molecular
identifier or be attached to a solid support including a
hybridization array in the form of an ordered plurality of second
identifying linker oligonucleotides.
[0708] In one preferred embodiment, substantially each chimeric
polynucleotide tag fragment is subsequently ligated to a second
identifying linker oligonucleotide hybridized thereto, preferably
by means of an enzyme catalysed ligation.
[0709] In one embodiment, it is preferred that substantially each
of the plurality or subset of second identifying linker
oligonucleotides further comprises a molecular identifier capable
of characterizing and/or separating the linker oligonucleotides
and/or hybrid oligonucleotide tags and/or chimeric polynucleotide
tags according to individual linker oligonucleotides properties
such as e.g. i) the molecular weight and/or ii) charge and/or iii)
an electromagnetic property and/or iv) an ability to emit
electromagnetic radiation after excitation of individual linker
oligonucleotides comprising individual molecular identifiers.
[0710] In the same embodiment, or in another embodiment,
substantially each of the plurality or subset of second identifying
linker oligonucleotides further comprises a selectively detectable
label capable of identifying substantially individual identifying
linker oligonucleotides and/or hybrid oligonucleotide tags and/or
chimeric oligonucleotide tags forming part of a plurality of such
oligonucleotides, or a subset thereof.
[0711] In one embodiment, the maximum number of combinations of
single stranded second unique nucleotide sequences is 4.sup.n,
wherein n denotes the number of nucleotides in the unique
nucleotide sequence comprised in a first and/or second identifying
linker oligonucleotide. Each sample comprising the at least one
single stranded polynucleotide tag is preferably located in the
same container or in separate containers.
Method for Sequence Determination of at Least a Part of a Single
Stranded Polynucleotide Tag
[0712] In another preferred embodiment of the present invention
there is provided a method for determining at least part of the
sequence of a single stranded polynucleotide tag hybridized or
ligated to an identifying linker oligonucleotide, said method
comprising the further steps of [0713] i) contacting [0714] a) a
solid support comprising a hybridization array comprising an
ordered plurality of first identifying linker oligonucleotides
comprising a single stranded first unique oligonucleotide sequence,
with [0715] b) a sample comprising at least one single stranded
polynucleotide tag, or a plurality of samples obtained by dividing
a composition comprising a plurality of single stranded
polynucleotide tags into at least about 4 samples, for example at
least about 16 samples, such as at least about 256 samples, for
example at least about 1024 samples, such as at least about 4096
samples, [0716] wherein each set of first identifying linker
oligonucleotides comprising a single stranded first unique
oligonucleotide sequence is identifiable by their location in the
hybridization array, [0717] wherein essentially all possible
combinations of single stranded first unique nucleotide sequences
of first identifying linker oligonucleotides, or a subset of such
combinations, are represented in the array, [0718] wherein at least
one single stranded polynucleotide tag comprised in the sample is
hybridized to a complementary single stranded first unique
nucleotide sequences of a first identifying linker oligonucleotide,
[0719] wherein the hybridization of the at least one single
stranded polynucleotide tag to a complementary single stranded
first unique nucleotide sequence occurs at an identifiable position
in the hybridization array, [0720] wherein said hybridization
generates a hybrid nucleotide tag comprising the at least one
single stranded polynucleotide tag hybridized to a complementary
single stranded first unique nucleotide sequence of a first
identifying linker oligonucleotide, and optionally [0721] ii)
determining the position in the hybridization array of the hybrid
polynucleotide tag, by [0722] iii) correlating the position in the
hybridization array of the hybrid polynucleotide tag with the
corresponding single stranded first unique nucleotide sequence, and
[0723] iv) determining the sequence of the part of the single
stranded polynucleotide tag that is hybridized to the complementary
single stranded first unique nucleotide sequence at the determined
position in the hybridization array.
[0724] In one preferred embodiment, substantially each tag is
ligated to the first identifying linker oligonucleotide hybridized
thereto, preferably by means of an enzyme catalysed ligation.
[0725] Substantially each of the plurality or subset of first
identifying linker oligonucleotides may preferably further comprise
a molecular identifier capable of characterizing and/or separating
the linker oligonucleotides and/or hybrid oligonucleotide tags
and/or chimeric oligonucleotide tags according to properties of
individual molecular identifiers such as e.g. i) the molecular
weight and/or ii) charge and/or iii) an electromagnetic property
and/or iv) an ability to emit electromagnetic radiation after
excitation of individual linker oligonucleotides comprising
individual molecular identifiers.
[0726] In the same or in another embodiment, substantially each of
the plurality or subset of first identifying linker
oligonucleotides may further comprise a selectively detectable
label capable of identifying substantially individual identifying
linker oligonucleotides and/or hybrid oligonucleotide tags and/or
chimeric oligonucleotides forming part of a plurality of such
oligonucleotides, or a subset thereof.
[0727] The maximum number of combinations of single stranded first
unique nucleotide sequences is preferably 4.sup.n, wherein n
denotes the number of nucleotides in the unique nucleotide
sequence, and each sample comprising the at least one single
stranded polynucleotide tag is located in the same or separate
containers.
Method for Determining the Sequence of a Single Stranded
Polynucleotide Tag
[0728] Having determined at least a part of the nucleotide sequence
of a single stranded polynucleotide tag as described herein
immediately above, the present invention further relates to a
method comprising the further steps of determining at least part.
of the sequence of the tag not hybridized to the single stranded,
first unique nucleotide sequence of a first identifying linker
oligonucleotide, said method comprising the further steps of [0729]
i) contacting at least one or a plurality of hybrid or chimeric
polynucleotide tags, each comprising a single stranded
polynucleotide tag, with at least one or a plurality of second
identifying linker oligonucleotides, [0730] wherein each second
identifying linker oligonucleotide comprises a single stranded,
second unique oligonucleotide sequence, [0731] wherein the single
stranded, unique second nucleotide sequence of each second
identifying linker oligonucleotide comprises essentially all
possible combinations of second oligonucleotide sequences, or a
subset of such sequences, [0732] wherein each second identifying
linker oligonucleotide further comprises at least one molecular
identifier and/or at least one selectively detectable label capable
of identifying the second identifying linker oligonucleotide,
[0733] wherein the contacting of step i) occurs under conditions
allowing a hybridization to occur between at least one of second
identifying linker oligonucleotide and at least one hybrid
polynucleotide tag, and optionally removing any unhybridized second
identifying linker oligonucleotide, [0734] ii) determining the
presence and/or amount of any hybridized second identifying linker
oligonucleotide comprising a second unique oligonucleotide sequence
by means of detection of the label and/or the molecular identifier,
and optionally [0735] iii) repeating steps i) and/or ii) until
substantially all of the second identifying linker oligonucleotides
in the hybridization array, or a predetermined subset thereof, have
been tested.
[0736] In the above described methods, any hybridization step is
preferably followed by or performed simultaneously with a ligation
step, including any ligation step catalysed by a ligase enzyme.
Method for Amplification of a Hybrid Polynucleotide Tag or a
Chimeric Polynucleotide
[0737] In one embodiment it may be desirable to amplify a hybrid or
chimeric polynucleotide tag. Accordingly, there is provided method
for amplification of a hybrid polynucleotide tag or a chimeric
polynucleotide tag obtainable by any of the method according to the
present invention claims, said method comprising the steps of
[0738] i) obtaining at least one hybrid polynucleotide tag or at
least one chimeric polynucleotide tag comprising [0739] a) a single
stranded polynucleotide tag hybridized or ligated to one or both of
[0740] b) a first identifying linker oligonucleotide comprising a
single stranded, first unique oligonucleotide sequence, and [0741]
c) a second identifying linker oligonucleotide comprising a single
stranded, second unique oligonucleotide sequence [0742] wherein
said first identifying linker oligonucleotide and said second
identifying linker oligonucleotide comprises single stranded
nucleotide sequences complementary to at least a part of the
nucleotide sequence of the single stranded polynucleotide tag, and
[0743] ii) amplifying the at least one hybrid or chimeric
polynucleotide tag.
[0744] The amplification preferably comprises an amplification step
comprising a polymerase chain reaction (PCR) step, including an
asymmetric PCR step, and/or a ligase chain reaction (LCR) step,
including an asymmetric LCR step.
Method for Identifying a cDNA in a Biological Sample
[0745] In a further preferred preferred embodiment there is
provided a method for identifying a cDNA in a biological sample,
said method comprising the steps of any of the methods for
obtaining and characterizing a single stranded polynucleotide tag
as described herein above, as well as the further steps of [0746]
i) comparing for at least one of a plurality of predetermined
positions in a hybridization array, or for at least one of a
plurality of predetermined positions in a capilary tube of a
microfluid device, [0747] a) the sequence of the at least one
single stranded polynucleotide tag and/or the amount of the at
least one single stranded polynucleotide tag with [0748] b) the
sequence and/or amount of a predetermined polynucleotide tag
obtained from a predetermined cDNA, and [0749] ii) identifying a
cDNA present in the biological sample. Method for Diagnosing a
Clinical Condition
[0750] In a yet further preferred embodiment of the present
invention, there is provided a method for diagnosing a clinical
condition in an individual, preferably a human being, said method
comprising the steps of [0751] i) determining for at least one of a
plurality of predetermined positions in a hybridization array, or
for at least one of a plurality of predetermined positions in a
capilary tube of a microfluid device, at least one predetermined
cDNA in a biological sample by performing a method of the present
invention as described herein above, [0752] wherein each of the
first identifying linker oligonucleotides comprises a predetermined
single stranded, first unique oligonucleotide sequence, [0753]
wherein each of the second identifying linker oligonucleotides
comprises a predetermined single stranded, second unique
oligonucleotide sequence, [0754] wherein at least one of said first
and second identifying linker oligonucleotides comprises at least
one selectively detectable molecular identifier and/or at least one
selectively detectable label, [0755] wherein the predetermined cDNA
is determined by assaying for a predetermined polynucleotide tag
originating from said predetermined cDNA, [0756] wherein the
predetermined polynucleotide tag originating from said
predetermined cDNA comprises a nucleotide sequence complementary to
the sequence of the first and second identifying linker
oligonucleotides, [0757] wherein the at least one predetermined
position in the hybridization array, or the at least one
predetermined position in the capilary tube of a microfluid device,
in combination with the determination of the at least one
selectively detectable molecular identifier and/or the at least one
selectively detectable label comprised by at least one of said
first and second identifying linker oligonucleotides, is positively
correlated with the presence in the biological sample of the at
least one predetermined cDNA, and [0758] ii) diagnosing the
clinical condition.
[0759] Preferably, in any one of the above methods, at least one
cleavage agent including at least one site-specific nicking
endonuclease is attached to a solid support. The solid support may
be a compartment of a microfluid device, including a capilary tube.
The ligation steps are also preferably carried out by a ligase
attached to a solid support, including be a compartment of a
microfluid device, including a capilary tube. When the solid
support is a capilary tube the diameter of said tube is preferably
less than 1 mm, such as less than 0.1 mm.
[0760] In yet another preferred embodiment there is provided the
method of using a single stranded polynucleotide tag obtained
according to the present invention in the preparative steps of the
method of U.S. Pat. No. 6,013,445 pertaining to a method of nucleic
acid sequence analysis based on the ligation of one or more sets of
encoded adapters to at least the terminus of a single stranded
polynucleotide tag according to the present invention. Encoded
adapters whose protruding strands form perfectly matched duplexes
with at least the complementary protruding strands of the single
stranded polynucleotide tag are ligated, and the identity of the
nucleotides in the protruding strands is determined by an
oligonucleotide tag carried by the encoded adapter. Such
determination, or "decoding" is carried out by specifically
hybridizing a labeled tag complement to its corresponding tag on
the ligated adapter.
[0761] Accordingly, there is provided a method of nucleic acid
sequence analysis based on the ligation of one or more sets of
encoded adapters to a single stranded polynucleotide tag according
to the present invention (or to multiple single stranded
polynucleotide tags according to the present inventions when used
in a parallel sequencing operation). Each encoded adapter comprises
a protruding strand and an oligonucleotide tag selected from a
minimally cross-hybridizing set of oligonucleotides. Encoded
adapters whose protruding stands form perfectly matched duplexes
with the single stranded polynucleotide tag according to the
present invention, or a part thereof, are ligated. After ligation,
the identity and ordering of the nucleotides in he protruding
strands are determined, or "decoded," by specifically hybridizing a
labeled tag complement to its corresponding tag on the ligated
adapter.
[0762] For example, if an encoded adapter with a protruding strand
of four nucleotides, say 5'-AGGT, form a perfectly matched duplex
with the complementary protruding strand of a single stranded
polynucleotide tag according to the present invention and is
ligated, the four complementary nucleotides, 3'-TCCA, on the
polynucleotide may be identified by a unique oligonucleotide tag
selected form a set of 256 such tags, one for every possible four
nucleotide sequence of the protruding strands. Tag complements are
applied to the ligated adapters under conditions which allow
specific hybridization of only those tag complements that form
perfectly matched duplexes (or triplexes) with the oligonucleotide
tags of the ligated adapters. The tag complements may be applied
individually or as one or more mixtures to determine the identity
of the oligonucleotide tags, and therefore, the sequences of the
protruding strands.
[0763] The encoded adapters may be used in sequence analysis either
i) to identify one or more nucleotides as a step of a process that
involves repeated cycles of ligation, identification, and cleavage,
as described in Brenner U.S. Pat. No. 5,599,675, or ii) as a "stand
alone" identification method, wherein sets of encoded adapters are
applied to single stranded polynucleotide tags according to the
present inventions such that each set is capable of identifying the
nucleotide sequence of a different portion of a single stranded
polynucleotide tag according to the present invention; that is, in
the latter embodiment, sequence analysis is carried out with a
single ligation for each set followed by identification.
[0764] An important feature of the encoded adapters is the use of
oligonucleotide tags that are members of a minimally
cross-hybridizing set of oligonucleotides, e.g., as described in
International patent applications PCT/US95/12791 and
PCT/US96/09513. The sequences of oligonucleotides of such a set
differ from the sequences of every other member of the same set by
at least two nucleotides. Thus, each member of such a set cannot
form a duplex (or triplex) with the complement of any other member
with less than two mismatches. Preferably, each member of a
minimally cross-hybridizing set differs from every other member by
as much nucleotides as possible consistent with the size of set
required for a particular application. For example, where longer
oligonucleotide tags are used, such as 12- to 20-mers for
delivering labels to encoded adapters, then the difference between
members of a minimally cross-hybridizing set is preferably
significantly greater than two. Preferably, each member of such a
set differs from every other member by at least four nucleotides.
More preferably, each member of such a set differs from every other
member by at least six nucleotides. Complements of oligonucleotide
tags of the invention are referred to herein as "tag
complements."
[0765] Oligonucleotide tags may be single stranded and be designed
for specific hybridization to single stranded tag complements by
duplex formation. Oligonucleotide tags may also be double stranded
and be designed for specific hybridization to single stranded tag
complements by triplex formation. Preferably, the oligonucleotide
tags of the encoded adapters are double stranded and their tag
complements are single stranded, such that specific hybridization
of a tag with its complements occurs through the formation of a
triplex structure.
[0766] Preferably, the method of the invention comprises the
following steps: (a) ligating an encoded adapter to an end of a
polynucleotide, the adapter having an oligonucleotide tag selected
from a minimally cross-hybridizing set of oligonucleotides and a
protruding strand complementary to a protruding strand of the
polynucleotide; and (b) identifying one or more nucleotides in the
protruding strand of the polynucleotide by specifically hybridizing
a tag complement to the oligonucleotide tag of the encoded
adapter.
Kit for Performing or Assaying Expression Profiling
[0767] There is also provided a kit for performing or assaying
expression profiling and comprising at least one cleavage agent
including at least one site-specific nicking endonuclease, at least
one adapter oligonucleotide, and at least one identifying linker
oligonucleotide.
[0768] In another embodiment, there is provided a kit for
performing or assaying expression profiling and comprising a first
identifying linker oligonucleotide comprising a single stranded
part forming a 5' overhang, and a second identifying linker
oligonucleotide comprising a single stranded part forming a 3'
overhang. This kit may further comprise an adapter
oligonucleotide.
[0769] When comprising an adapter oligonucleotide, such an adapter
oligonucleotide preferably comprises at least one recognition motif
for a site-specific nicking endonuclease.
[0770] The kits may further comprise at least one adapter
oligonucleotide and/or at least one first and/or said second
identifying linker oligonucleotide comprising one or more of i) a
molecular identifier, ii) a selectively identifiable label, and a
iii) recognition motif for a site-specific nicking endonuclease.
One or more of said molecular identifier and said selectively
identifiable label are preferably attached to a solid support
including a hybridization array.
Solid Support Comprising a Hybridization Array
[0771] In a still further embodiment of the present invention there
is provided a solid support, preferably a solid support comprising
an array in the form of an ordered set of molecules comprising or
essentially consisting of dsDNA and/or ssDNA fragments comprising
permutated nucleotide sequences, wherein the solid support further
comprises at least one single stranded polynucleotide tag according
to the present invention.
[0772] The dsDNA and/or ssDNA fragments are preferably covalently
attached to the solid support so that the DNA fragments are
identified by their two dimensional position in the array. The
array may also comprise an ordered set of e.g. identifying linkers
covalently attached to an ordered set of molecular identifiers.
[0773] In one particularly preferred embodiment, there is provided
a solid support comprising a hybridization array comprising a
plurality of ordered first identifying linker oligonucleotides, or
a subset of such oligonucleotides, wherein at least one of said
first identifying linker oligonucleotides comprises a single
stranded nucleotide sequence hybridized to at least one single
stranded polynucleotide tag, and preferably only one such tag,
comprising a sequence complementary thereto.
[0774] The single stranded polynucleotide tag is preferably
obtained by any method of the invention as described herein.
Alternatively, the single stranded polynucleotide tag is obtained
by displacement of a double stranded polynucleotide tag comprising
at least partly complementary nucleotide strands.
[0775] The solid support may be biological, non-biological,
organic, inorganic, or a combination of any of these, existing as
particles, strands, precipitates, gels, sheets, tubing, spheres,
containers, capillaries, pads, slices, films, plates, slides, etc.
The solid support is preferably flat but may take on alternative
surface configurations.
[0776] The support may be a polymerized Langmuir Blodgett film,
functionalized glass, Si, Ge, GaAs, GaP, SiO.sub.2, SiN.sub.4,
modified silicon, or any one of a variety of gels or polymers such
as (poly)tetrafluoroethylene, (poly)vinylidendifluoride,
polystyrene, polycarbonate, or combinations thereof. Other suitable
solid support materials will be readily apparent to those of skill
in the art. Preferably, the surface of the solid support will
contain reactive groups, which could be carboxyl, amino, hydroxyl,
thiol, or the like. More preferably, the surface will be optically
transparent and will have surface Si--H functionalities, such as
are found on silica surfaces.
[0777] In yet another preferred embodiment there is provided a kit
comprising cleavage agents, adapter oligonucleotides, and molecular
"identifiers" according to the invention for performing expression
profiling.
EXAMPLE
[0778] The present example illustrates how three different plasmids
can be used to simulate tag analysis in more complex biological
systems. The example demonstrates the principles of how one would
obtain and detect a single stranded polynucleotide tag. In a first
step specific test RNA molecules are produced. A second step is
concerned with the synthesis of custom oligos on magnetic beads. In
step three, the test RNA molecules are used as templates for second
strand synthesis. A single stranded tag comprising a sequence of 10
nucleotides is isolated in step four, and the single stranded tags
are detected as described in step five.
[0779] ". . . " as used herein below denotes an intervening
sequence of varying length. "I" as used herein below indicates a
5'-3' bond in a hair-pin type structure, when connecting two
nucleotides in a sequence printed over two lines.
Step 1: Production of Specific Test RNA Molecules:
[0780] PCR fragments from CTR1 (GenEMBL acc #U83460), CTR2 (GenEMBL
acc # U83461), and HAH1 (GenEMBL acc # U70660), were amplified from
human genomic DNA using the primers: TABLE-US-00029 CTR1, BamHI,
5'- KOZAK CGCGGATCCGCCGCCATGGATCATTCCCACCATAT- 3' CTR1, Xba I
5'-GCTCTAGAACTGCAATCGATAAGGCCACGC-3' (SEQ ID NO: 44) (SEQ ID NO:
45) CTR2, BamHI, 5'- KOZAK CGCGGATCCGCCGCCATGGCGATGCATTTCATCT- 3'
CTR2, Xba I 5'-GCTCTAGAGCTTCAGCTCAAAGTTTCCAGG-3' (SEQ ID NO: 46)
(SEQ ID NO: 47) HAH1, BamHI, 5'- KOZAK
CGCGGATCCGCCGCCATGCCGAAGCACGAGTTC-3' HAH1 Xba I
5'-GCTCTAGAACTGCCAAGTCCCAGGTCTGTC-3' (SEQ ID NO: 48) (SEQ ID NO:
49)
Respectively, and cloned into the Bam HI and Xba I sites of the
vector pcDNA3.1+ from Invitrogen. The three plasmids were named
pCTR1, pCTR2, and pHAH respectively.
[0781] Using the ampicillin resistance marker on the plasmids, they
were amplified in E. coli using standard procedures.
[0782] Using the two primers: TABLE-US-00030 pcDNA3s 5'- (SEQ ID
NO: 50) ACCCACTGTTTACTGGCTTATC-3' pcDNA3c 5'-GAGGGGCAAACAGATGGC-3'
(SEQ ID NO: 51)
PCR and cycle sequencing was carried out on each of the plasmids in
order to verify and compare the sequence with the public
database.
[0783] In separate tubes the three plasmids were digested with Dra
III and the linearized plasmids were purified on a 0.7% agarose
gel.
[0784] The purified linearized plasmids were used as templates in
PCR reactions using as primes pcDNA3s and pcDNA3c.
[0785] The resulting PCR products were used as templates in a
MAXI-script RNA transcription reaction using the T7 RNA
polymerase.
Step 2: Production of Sera-Mag Beads with Custom Oligos
[0786] Outlined below is the production of magnetic beads carrying
the RT-primer. Steps involved in creating specific RT primer
attached to bead or solid support (-[1): TABLE-US-00031 (SEQ ID
NO:52; SEQ ID NO:53) A:
5'-CCATCTGTTGTTTGCCCCTCAAAAAAAAAAAAAAAAAAAAAAAAAA-3'
3'-TTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1
[0787] A: Primer comprising a 5' end complementary to desired
sequence and a 3' poly d(A) tall is annealed to a poly d(T) primer
already attached to a bead or a solid support (-[1). TABLE-US-00032
(SEQ ID NO:52; SEQ ID NO:54) B:
5'-CCATCTGTTGTTTGCCCCTCAAAAAAAAAAAAAAAAAAAAAAAAAA-3'
3'-GGTAGACAACAACGGGGAGTTTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1
[0788] B: A DNA polymerase elongates the poly d(T) primer.
TABLE-US-00033 (SEQ ID NO:54) C:
3'-GGTAGACAACAAACGGGGAGTTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1.
[0789] C: The two strands are separated and isolated.
Step 3: Reverse Transcriptase, and 2 Strand Synthesis.
[0790] Using the test RNA molecules described in step 1 as
templates a reverse transcriptase reaction was carried out using
the RT-primer on Sera-Mag beads described in step 2. After melting
the template RNA off the newly formed 1, strand, the second strand
was synthesized using one of the following primes according to the
origin of the test RNA (pCTR1, pCTR2, or pHAH). TABLE-US-00034
CTR1, BamHI, KOZAK 5'-CGCCGATCCGCCGCCATGGATCATTCCCACCATAT-3' (SEQ
ID NO:44) CTR2, BamHI, KOZAK
5'-CGCGGATCCGCCGCCATGGCGATGCATTTCATCT-3' (SEQ ID NO:46) HAH1,
BamHI, KOZAK 5'-CGCGGATCCGCCGCCATGCCGAAGCACGAGTTC-3' (SEQ ID
NO:48)
Step 4: Isolation of a 10-mer ssDNA Tag from cDNA Tracing Back to
CTR1.
[0791] The dsDNA on the beads from step 3 was digested with Dde I
followed by the ligation of the first adapter. The first adapter
comprises two oligos hybridised together. One of them, 1, adap. B,
has a biotin in the 5'-end. The first adapter comprises sites for
Bpm I and N.Bst NB I and has a 5' overhang compatible with Dde I,
and a biotin moiety (B) in the opposite end. TABLE-US-00035 1st
adap A 5'-TCAGACTCCAGACACCCACACAACCACAA-3' (SEQ ID NO:55) 1st adap
B (B)-5'-TTTTTTTTGTGGTTGTGTGGGTGTCTGGAGTC-3' (SEQ ID NO:56)
[0792] In the following example the steps involved in isolation of
a 10-mer ssDNA tag from CTR1 in vitro transcribed and reverse
transcribed ds cDNA is illustrated: TABLE-US-00036 D:
5'-TGAGCTTTCCTCACCTCCTGCAAACAGTGCTGCACATCATC . . . TAGTTG-
3'-CGAAAGGAGTGGAGGACGTTTGTCACGACGTGTAGTAG . . . ATCAAC-
CCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTT-3'
GGTCGGTAGACAACAAACGGGGAGTTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1
(SEQ ID NO:57; SEQ ID NO:58; SEQ ID NO:59; SEQ ID NO:60)
[0793] D: After 1, and 2, strand synthesis the cDNA is digested
with Dde I. TABLE-US-00037 E:
(B)-5'-TTTTTTTTGTGGTTGTGTGGGTGTCTGGAGTC-3' (SEQ ID NO: 89)
3'-AACACCAACACACCCACACACCTCAGACT-5' (SEQ ID NO: 90)
[0794] E: The first adapter. TABLE-US-00038 (SEQ ID NO:61; SEQ ID
NO:62; SEQ ID NO:63; SEQ ID NO:64) F: (B) -5
'-TTTTTTTTGTGGTTGTGTGGGTGTCTGGAGTCTGAGCTTTCCTCACCTCCTGCA . . .
3'-AACACCAACACACCCACACACCTCAGACTCGAAAGGAGTGGAGGACGT . . . . . .
ACAGTGCTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTT-3' . . .
TTGTCACGACGGTCGGTAGACAACAAACGGGGAGTTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1
[0795] F: The adapter from E is ligated to digested cDNA from D.
TABLE-US-00039 (SEQ ID NO:65; SEQ ID NO:66) H:
(B)-5'-TTTTTTTTGTGGTTGTGTGGGTGTCTGGAGTCTGAGCTTTCCTCAC-3' +TL,37
3'-AACACCAACACACCCACACACCTCAGACTCGAAAGGAG-5'
[0796] H: The resulting molecule is digested with Bpm I and the
free fragment is isolated on a solid support coated with
streptavidine. TABLE-US-00040 (SEQ ID NO:66; SEQ ID NO:67; SEQ ID
NO:68) I: (B) -5'-TTTTTTTTGTGGTTGTGTGGGTGTCTGGAGTCTGAG-3'
5'-CTTTCCTCAC-3' 3'-AACACCAACACACCCACACACCTCAGACTCGAAAGGAG-5'
[0797] I: The molecule is now digested with N.BstNB I and the
resulting ssDNA 10-mer is isolated. TABLE-US-00041 Using the same
approach the ssDNA 10-mer 5'-GCTGGAGGGA-3' ((SEQ ID NO: 69) is
isolated when RNA tracing back to pCTR2 is used, and the ssDNA
10-mer 5'-CACAGCATGG-3' (SEQ ID. NO: 70) is isolated when RNA
tracing back to pHAH is used.
Step 5: Detection of ssDNA Tags.
[0798] Steps involved in creation of the immobilized discriminating
adapters. TABLE-US-00042 J: CTR1 ID B
5'-CTCACTAAGGTTCAAAGGTTCAAACGGATCCAAAAAAAAAAAAAAAAAAAAAAAAA-3' CTR2
1D B 5'-AGGGATAAGGTTCAAAGGTTCAAACGGATCCAAAAAAAAAAAAAAAAAAAAAAAAA-3'
HAH ID B
5'-CATGGTAAGGTTCAAAGGTTCAAACGGATCCAAAAAAAAAAAAAAAAAAAAAAAAA-3' (SEQ
ID NO: 71; SEQ ID NO: 72; SEQ ID NO: 73)
[0799] J: Just as when producing RT-primer on Sera-Mag beads in A,
B, and C, primers comprising a 5' end complementary to desired
sequence and a 3' poly d(A) tail is annealed to a poly d(T) primer
already attached to a bead or a solid support. A DNA polymerase
elongates the poly d(T) primer, and the two strands are separated
and isolated. Individual 5' ends are selected that are identical to
the 5' ends of the 10-mers isolated from CTR1, CTR2, and HAH1. A
sequence separates the poly d(A) tail from the said 5' sequence.
The only function of this middle sequence is to provide a spacer
and a digestion site for Bam HI. TABLE-US-00043 (SEQ ID NO: 74) K:
5'-TAAGGTTCAAAGGTTCAAACGGATCCAAAAAAA-3'
[0800] K: A common sequence only covering the common sequence of
the three different 3' ends provided in J is annealed to the single
stranded DNA molecules on Sera-Mag beads provided in J. But first
this oligo is radiolabled for later detection using standard
procedures. TABLE-US-00044 L: CTR1
5'-TAAGGTTCAAAGGTTCAAACGGATCCAAAAAAA-3'
3'-GAGTGATTCCAAGTTTCCAAGTTTGCCTAGGTTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1
(SEQ ID NO: 75; SEQ ID NO: 76) CTR2
5'-TAAGGTTCAAAGGTTCAAACGGATCCAAAAAAA-3'
3'-TCCCTATTCCAAGTTTCCAAGTTTGCCTAGGTTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1
(SEQ ID NO: 77; SEQ ID NO: 78) HAH1
5'-TAAGGTTCAAAGGTTCAAACGGATCCAAAAAAA-3'
3'-GTACCATTCCAAGTTTCCAAGTTTGCCTAGGTTTTTTTTTTTTTTTTTTTTTTTTTT-5'-[1
(SEQ ID NO: 79; SEQ ID NO: 80)
[0801] L: The resulting adapters provide 3' overhangs capable of
hybridising to a specific 10-mer and compatible for ligation of
that 10-mer.
[0802] Steps involved in creation of the discriminating adapters in
solution. TABLE-US-00045 M: CTR1
5'-GAAAGTCCCTGGAATGCCGGTTTCGTTTTTTTCGAAACCTTCATTCCAGGGA-3' (SEQ ID
NO: 81) TTTT-CGAAACCTTCATTCCAGGGA-3' (SEQ ID NO: 91)
|TTT-GCTTTGGAAGTAAGGTCCCT GAAAG-5' (SEQ ID NO: 92) CTR2
5'-CCAGCGGAAGGTTTGGTCCCAATTTCGTGTTTTTTTTACACGAAATTGGGACCAAACCTTCC-3'
(SEQ ID NO: 82) TTTT-ACACGAAATTGGGACCAAACCTTCC-3' (SEQ ID NO: 93)
|TTT-TGTGCTTTAACCCTGGTTTGGAAGG-CGACC-5' (SEQ ID NO: 94) HAH
5'-CTGTGGGTGTTGTGTGGAATTTCGTGTAAGGTCCCTTTTTTTGGGACCTTACACGAAAT-
(SEQ ID NO: 83) TCCACACAACACC-3'
TTTT-GGGACCTTACACGAAATTCCACACAACACC-3' (SEQ ID NO: 95)
|TTT-CCCTGGAATGTGCTTTAAGGTGTGTTGTGG-GTGTC-5' (SEQ ID NO: 96)
[0803] M: Three adapters of different length and capable of forming
a hair-pin structure and having 5' ends complementary to the 3'
ends of the 10-mers isolated from CTR.sub.1, CTR2, and HAH1 are
synthesized with a 5' phosphate group.
[0804] The actual detection (illustrated with CTR1): TABLE-US-00046
N: 5'-CTTTCCTCAC-3' 5'-TAAGGTTCAAAGGTTCAAACGGATCCAAAAAAA-3'
3'-GAGTGATTCCAAGTTTCCAAGTTTGCCTAGGTTTTTTTTTTTTTTTTTTTTT-
TTTTT-5'-[1 (SEQ ID NO: 76; SEQ ID NO: 97; SEQ ID NO: 98)
[0805] N: The ssDNA 10-mer and the immobilized discriminating
adapter are ligated together. TABLE-US-00047 O:
5'-CTTTCCTCACTAAGGTTCAAAGGTTCAAACGGATCCAAAAAAA-3'
3'-GAGTGATTCCAAGTTTCCAAGTTTGCCTAGGTTTTTTTTTTTTTTTTTTTTTTTTTT- 5'-[1
(SEQ ID NO: 76; SEQ ID NO: 84)
[0806] O: The molecule resulting from ligating the ssDNA 10-mer and
the immobilized discriminating adapter together.
[0807] P: TABLE-US-00048 TTTT-CGAAACCTTCATTCCAGGGA-3'
|TTT-GCTTTGGAAGTAAGGTCCCT-GAAAG-5' (SEQ ID NO: 91; SEQ ID NO: 92)
5'-CTTTCCTCACTAAGGTTCAAAGGTTCAAACGGATCCAAAAAAA-3'
3'-GAGTGATTCCAAGTTTCCAAGTTTGCCTAGGTTTTTTTTTTTTTTTTTTTTTTTTTT- 5'-[1
(SEQ ID NO: 76; SEQ ID NO: 84)
[0808] P: The discriminating adapter in solution is ligated to the
molecule from O. TABLE-US-00049 Q: 3'
TTTT-CGAAACCTTCATTCCAGGGACTTTCCTCACTAAGGTTCAAAGGTTCAAACGGATCAAAAAAA-
|TTT-GCTTTGGAAGTAAGGTCCCTGAAAGGAGTGATTCCAAGTTTCCAAGTTTGCCTAGGTTTTTT.sub.--
TTTTT-5'-[1 (SEQ ID NO: 99; SEQ ID NO: 100)
[0809] Q: The molecule resulting from ligating the discriminating
adapter in solution to the molecule from O. This molecule is
digested with Bam HI. TABLE-US-00050 R:
TTTT-CGAAACCTTCATTCCAGGGACTTTCCTCACTAAGGTTCAAAGGTTCAAACG-3'
|TTT-GCTTTGGAAGTAAGGTCCCTGAAAGGAGTGATTCCAAGTTTCCAAGTTTGCCTAG 5'
(SEQ ID NO: 101; SEQ ID NO: 102) 5'-GATCCGTTTG AACCTTTGAA
CCTTAGTGAG GAAAGTCCCT GGAATGAAGG TTTCGTTTTT TTCGAAACC TTCATTCCAG
GGACTTTCCT CACTAAGGTT CAAAGGTTCA AACG-3' (SEQ ID NO: 88)
[0810] R: After digestion with Bam HI a 114 bp molecule can be
separated for polyacrylamide gel detection and quantification. When
using identifying linkers with overhangs complementary to the ssDNA
10-mer tags tracing back to CTR2 and HAH the length of the
molecules after this last digestion with Bam HI is 124, and 134
respectively.
Sequence CWU 1
1
148 1 14 DNA Artificial Sequence synthetic 1 gcttggatcc aagc 14 2
16 DNA Artificial Sequence synthetic 2 gagtcggatc nnnnnn 16 3 16
DNA Artificial Sequence synthetic 3 nnnnnngatc cgactc 16 4 23 DNA
Artificial Sequence synthetic 4 gagtcgcagc nnnnnnnnnn nnn 23 5 23
DNA Artificial Sequence synthetic 5 nnnnnnnnnn nnngctgcga ctc 23 6
18 DNA Artificial Sequence synthetic 6 gagtcgtatc cnnnnnnn 18 7 18
DNA Artificial Sequence synthetic 7 nnnnnnngga tacgactc 18 8 17 DNA
Artificial Sequence synthetic 8 gagtcactgg gnnnnnn 17 9 17 DNA
Artificial Sequence synthetic 9 nnnnnnccca gtgactc 17 10 29 DNA
Artificial Sequence synthetic 10 gagtcctgga gnnnnnnnnn nnnnnnnnn 29
11 29 DNA Artificial Sequence synthetic 11 nnnnnnnnnn nnnnnnnnct
ccaggactc 29 12 27 DNA Artificial Sequence synthetic 12 gagtctggag
nnnnnnnnnn nnnnnnn 27 13 27 DNA Artificial Sequence synthetic 13
nnnnnnnnnn nnnnnnnctc cagactc 27 14 22 DNA Artificial Sequence
synthetic 14 gagtcgagga gnnnnnnnnn nn 22 15 22 DNA Artificial
Sequence synthetic 15 nnnnnnnnnn nctcctcgac tc 22 16 28 DNA
Artificial Sequence synthetic 16 gagtcgtgca gnnnnnnnnn nnnnnnnn 28
17 28 DNA Artificial Sequence synthetic 17 nnnnnnnnnn nnnnnnnctg
cacgactc 28 18 23 DNA Artificial Sequence synthetic 18 gtgcaggagt
cnnnnnnnnn nnn 23 19 23 DNA Artificial Sequence synthetic 19
nnnnnnnnnn nngactcctg cac 23 20 23 DNA Artificial Sequence
synthetic 20 gtgcagagtc nnnnnnnnnn nnn 23 21 23 DNA Artificial
Sequence synthetic 21 nnnnnnnnnn nnngactctg cac 23 22 25 DNA
Artificial Sequence synthetic 22 gagtcgggac nnnnnnnnnn nnnnn 25 23
25 DNA Artificial Sequence synthetic 23 nnnnnnnnnn nnnnngtccc gactc
25 24 20 DNA Artificial Sequence synthetic 24 gagtcacctg cnnnnnnnnn
20 25 20 DNA Artificial Sequence synthetic 25 nnnnnnnnng caggtgactc
20 26 23 DNA Artificial Sequence synthetic 26 gagtcggcgg annnnnnnnn
nnn 23 27 23 DNA Artificial Sequence synthetic 27 nnnnnnnnnn
nntccgccga ctc 23 28 17 DNA Artificial Sequence synthetic 28
gagtccccgc nnnnnnn 17 29 17 DNA Artificial Sequence synthetic 29
nnnnnnngcg gggactc 17 30 24 DNA Artificial Sequence synthetic 30
gagtcggatg nnnnnnnnnn nnnn 24 31 24 DNA Artificial Sequence
synthetic 31 nnnnnnnnnn nnnncatccg actc 24 32 21 DNA Artificial
Sequence synthetic 32 gagtcgacgc nnnnnnnnnn n 21 33 21 DNA
Artificial Sequence synthetic 33 nnnnnnnnnn ngcgtcgact c 21 34 19
DNA Artificial Sequence synthetic 34 gagtcggtga nnnnnnnnn 19 35 19
DNA Artificial Sequence synthetic 35 nnnnnnnnnt caccgactc 19 36 19
DNA Artificial Sequence synthetic 36 gagtcgaaga nnnnnnnnn 19 37 19
DNA Artificial Sequence synthetic 37 nnnnnnnnnt cttcgactc 19 38 16
DNA Artificial Sequence synthetic 38 gagtcgagtc nnnnnn 16 39 16 DNA
Artificial Sequence synthetic 39 nnnnnngact cgactc 16 40 16 DNA
Artificial Sequence synthetic 40 gagtcgagtc nnnnnn 16 41 16 DNA
Artificial Sequence synthetic 41 nnnnnngact cgactc 16 42 20 DNA
Artificial Sequence synthetic 42 gagtcgcatc nnnnnnnnnn 20 43 20 DNA
Artificial Sequence synthetic 43 nnnnnnnnnn gatgcgactc 20 44 35 DNA
Artificial Sequence synthetic 44 cgcggatccg ccgccatgga tcattcccac
catat 35 45 30 DNA Artificial Sequence synthetic 45 gctctagaac
tgcaatcgat aaggccacgc 30 46 34 DNA Artificial Sequence synthetic 46
cgcggatccg ccgccatggc gatgcatttc atct 34 47 30 DNA Artificial
Sequence synthetic 47 gctctagagc ttcagctcaa agtttccagg 30 48 33 DNA
Artificial Sequence synthetic 48 cgcggatccg ccgccatgcc gaagcacgag
ttc 33 49 30 DNA Artificial Sequence synthetic 49 gctctagaac
tgccaagtcc caggtctgtc 30 50 22 DNA Artificial Sequence synthetic 50
acccactgtt tactggctta tc 22 51 18 DNA Artificial Sequence synthetic
51 gaggggcaaa cagatggc 18 52 46 DNA Artificial Sequence synthetic
52 ccatctgttg tttgcccctc aaaaaaaaaa aaaaaaaaaa aaaaaa 46 53 26 DNA
Artificial Sequence synthetic 53 tttttttttt tttttttttt tttttt 26 54
46 DNA Artificial Sequence synthetic 54 tttttttttt tttttttttt
ttttttgagg ggcaaacaac agatgg 46 55 29 DNA Artificial Sequence
synthetic 55 tcagactcca gacacccaca caaccacaa 29 56 32 DNA
Artificial Sequence synthetic 56 ttttttttgt ggttgtgtgg gtgtctggag
tc 32 57 41 DNA Artificial Sequence synthetic 57 tgagctttcc
tcacctcctg caaacagtgc tgcacatcat c 41 58 41 DNA Artificial Sequence
synthetic 58 tagttgccag ccatctgttg tttgcccctc ccccgtgcct t 41 59 56
DNA Artificial Sequence synthetic 59 tttttttttt tttttttttt
ttttttgagg ggcaaacaac agatggctgg caacta 56 60 38 DNA Artificial
Sequence synthetic 60 gatgatgtgc agcactgttt ggacgaggtg ggaaaagc 38
61 64 DNA Artificial Sequence synthetic 61 ttttttttgt ggttgtgtgg
gtgtctggag tctgagcttt cctcacctcc tgcaaacagt 60 gctg 64 62 35 DNA
Artificial Sequence synthetic 62 ccagccatct gttgtttgcc cctcccccgt
gcctt 35 63 50 DNA Artificial Sequence synthetic 63 tttttttttt
tttttttttt ttttttgagg ggcaaacaac agatggctgg 50 64 58 DNA Artificial
Sequence synthetic 64 cagcactgtt tgcaggaggt gaggaaagct cagactccac
acacccacac aaccacaa 58 65 46 DNA Artificial Sequence synthetic 65
ttttttttgt ggttgtgtgg gtgtctggag tctgagcttt cctcac 46 66 38 DNA
Artificial Sequence synthetic 66 gaggaaagct cagactccac acacccacac
aaccacaa 38 67 36 DNA Artificial Sequence synthetic 67 ttttttttgt
ggttgtgtgg gtgtctggag tctgag 36 68 10 DNA Artificial Sequence
synthetic 68 ctttcctcac 10 69 10 DNA Artificial Sequence synthetic
69 gctggaggga 10 70 10 DNA Artificial Sequence synthetic 70
cacagcatgg 10 71 56 DNA Artificial Sequence synthetic 71 ctcactaagg
ttcaaaggtt caaacggatc caaaaaaaaa aaaaaaaaaa aaaaaa 56 72 56 DNA
Artificial Sequence synthetic 72 agggataagg ttcaaaggtt caaacggatc
caaaaaaaaa aaaaaaaaaa aaaaaa 56 73 56 DNA Artificial Sequence
synthetic 73 catggtaagg ttcaaaggtt caaacggatc caaaaaaaaa aaaaaaaaaa
aaaaaa 56 74 33 DNA Artificial Sequence synthetic 74 taaggttcaa
aggttcaaac ggatccaaaa aaa 33 75 33 DNA Artificial Sequence
synthetic 75 taaggttcaa aggttcaaac ggatccaaaa aaa 33 76 57 DNA
Artificial Sequence synthetic 76 tttttttttt tttttttttt ttttttggat
ccgtttgaac ctttgaacct tagtgag 57 77 33 DNA Artificial Sequence
synthetic 77 taaggttcaa aggttcaaac ggatccaaaa aaa 33 78 57 DNA
Artificial Sequence synthetic 78 tttttttttt tttttttttt ttttttggat
ccgtttgaac ctttgaacct tatccct 57 79 33 DNA Artificial Sequence
synthetic 79 taaggttcaa aggttcaaac ggatccaaaa aaa 33 80 57 DNA
Artificial Sequence synthetic 80 tttttttttt tttttttttt ttttttggat
ccgtttgaac ctttgaacct taccatg 57 81 52 DNA Artificial Sequence
synthetic 81 gaaagtccct ggaatgccgg tttcgttttt ttcgaaacct tcattccagg
ga 52 82 62 DNA Artificial Sequence synthetic 82 ccagcggaag
gtttggtccc aatttcgtgt tttttttaca cgaaattggg accaaacctt 60 cc 62 83
72 DNA Artificial Sequence synthetic 83 ctgtgggtgt tgtgtggaat
ttcgtgtaag gtcccttttt ttgggacctt acacgaaatt 60 ccacacaaca cc 72 84
43 DNA Artificial Sequence synthetic 84 ctttcctcac taaggttcaa
aggttcaaac ggatccaaaa aaa 43 85 10 DNA Artificial Sequence
synthetic 85 gagtcnnnnn 10 86 10 DNA Artificial Sequence synthetic
86 nnnnngactc 10 87 131 DNA Artificial Sequence synthetic 87
ttttttggat ccgtttgaac ctttgaacct tagtgaggaa agtccctgga atgaaggttt
60 cgtttttttc gaaaccttca ttccagggac tttcctcact aaggttcaaa
ggttcaaacg 120 gatccaaaaa a 131 88 113 DNA Artificial Sequence
synthetic 88 gatccgtttg aacctttgaa ccttagtgag gaaagtccct ggaatgaagg
tttcgttttt 60 ttcgaaacct tcattccagg gactttcctc actaaggttc
aaaggttcaa acg 113 89 32 DNA Artificial Sequence synthetic 89
ttttttttgt ggttgtgtgg gtgtctggag tc 32 90 29 DNA Artificial
Sequence synthetic 90 tcagactcca cacacccaca caaccacaa 29 91 24 DNA
Artificial Sequence synthetic 91 ttttcgaaac cttcattcca ggga 24 92
28 DNA Artificial Sequence synthetic 92 gaaagtccct ggaatgaagg
tttcgttt 28 93 29 DNA Artificial Sequence synthetic 93 ttttacacga
aattgggacc aaaccttcc 29 94 33 DNA Artificial Sequence synthetic 94
ccagcggaag gtttggtccc aatttcgtgt ttt 33 95 34 DNA Artificial
Sequence synthetic 95 ttttgggacc ttacacgaaa ttccacacaa cacc 34 96
38 DNA Artificial Sequence synthetic 96 ctgtgggtgt tgtgtggaat
ttcgtgtaag gtcccttt 38 97 10 DNA Artificial Sequence synthetic 97
ctttcctcac 10 98 33 DNA Artificial Sequence synthetic 98 taaggttcaa
aggttcaaac ggatccaaaa aaa 33 99 66 DNA Artificial Sequence
synthetic 99 ttttcgaaac cttcattcca gggactttcc tcactaaggt tcaaaggttc
aaacggatcc 60 aaaaaa 66 100 65 DNA Artificial Sequence synthetic
100 ttttttggat ccgtttgaac ctttgaacct tagtgaggaa agtccctgga
atgaaggttt 60 cgttt 65 101 55 DNA Artificial Sequence synthetic 101
ttttcgaaac cttcattcca gggactttcc tcactaaggt tcaaaggttc aaacg 55 102
58 DNA Artificial Sequence synthetic 102 gatccgtttg aacctttgaa
ccttagtgag gaaagtccct ggaatgaagg tttcgttt 58 103 11 DNA Artificial
Sequence synthetic 103 ggatcnnnnn n 11 104 11 DNA Artificial
Sequence synthetic 104 nnnnnngatc c 11 105 18 DNA Artificial
Sequence synthetic 105 gcagcnnnnn nnnnnnnn 18 106 18 DNA Artificial
Sequence synthetic 106 nnnnnnnnnn nnngctgc 18 107 13 DNA Artificial
Sequence synthetic 107 gtatccnnnn nnn 13 108 13 DNA Artificial
Sequence synthetic 108 nnnnnnngga tac 13 109 12 DNA Artificial
Sequence synthetic 109 actgggnnnn nn 12 110 12 DNA Artificial
Sequence synthetic 110 nnnnnnccca gt 12 111 23 DNA Artificial
Sequence synthetic 111 ctggagnnnn nnnnnnnnnn nnn 23 112 23 DNA
Artificial Sequence synthetic 112 nnnnnnnnnn nnnnnnnctc cag 23 113
23 DNA Artificial Sequence synthetic 113 ctggagtcnn nnnnnnnnnn nnn
23 114 23 DNA Artificial Sequence synthetic 114 nnnnnnnnnn
nnnnngactc cag 23 115 18 DNA Artificial Sequence synthetic 115
gaggagnnnn nnnnnnnn 18 116 18 DNA Artificial Sequence synthetic 116
nnnnnnnnnn nnctcctc 18 117 17 DNA Artificial Sequence synthetic 117
gaggagtcnn nnnnnnn 17 118 17 DNA Artificial Sequence synthetic 118
nnnnnnnnng actcctc 17 119 23 DNA Artificial Sequence synthetic 119
gtgcagnnnn nnnnnnnnnn nnn 23 120 23 DNA Artificial Sequence
synthetic 120 nnnnnnnnnn nnnnnnnctg cac 23 121 20 DNA Artificial
Sequence synthetic 121 gggacnnnnn nnnnnnnnnn 20 122 20 DNA
Artificial Sequence synthetic 122 nnnnnnnnnn nnnnngtccc 20 123 15
DNA Artificial Sequence synthetic 123 acctgcnnnn nnnnn 15 124 15
DNA Artificial Sequence synthetic 124 nnnnnnnnng caggt 15 125 18
DNA Artificial Sequence synthetic 125 ggcggannnn nnnnnnnn 18 126 18
DNA Artificial Sequence synthetic 126 nnnnnnnnnn nntccgcc 18 127 12
DNA Artificial Sequence synthetic 127 cccgcnnnnn nn 12 128 12 DNA
Artificial Sequence synthetic 128 nnnnnnngcg gg 12 129 17 DNA
Artificial Sequence synthetic 129 gagtcccgcn nnnnnnn 17 130 17 DNA
Artificial Sequence synthetic 130 nnnnnnnngc gggactc 17 131 19 DNA
Artificial Sequence synthetic 131 ggatgnnnnn nnnnnnnnn 19 132 19
DNA Artificial Sequence synthetic 132 nnnnnnnnnn nnnncatcc 19 133
16 DNA Artificial Sequence synthetic 133 gacgcnnnnn nnnnnn 16 134
16 DNA Artificial Sequence synthetic 134 nnnnnnnnnn ngcgtc 16 135
14 DNA Artificial Sequence synthetic 135 ggtgannnnn nnnn 14 136 14
DNA Artificial Sequence synthetic 136 nnnnnnnnnt cacc 14 137 14 DNA
Artificial Sequence synthetic 137 gaagannnnn nnnn 14 138 14 DNA
Artificial Sequence synthetic 138 nnnnnnnnnt cttc 14 139 11 DNA
Artificial Sequence synthetic 139 gagtcnnnnn n 11 140 11 DNA
Artificial Sequence synthetic 140 nnnnnngact c 11 141 12 DNA
Artificial Sequence synthetic 141 cctcnnnnnn nn 12 142 12 DNA
Artificial Sequence synthetic 142 nnnnnnnnga gg 12 143 17 DNA
Artificial Sequence synthetic 143 gagtccctcn nnnnnnn 17 144 17 DNA
Artificial Sequence synthetic 144 nnnnnnnnga gggactc 17 145 17 DNA
Artificial Sequence synthetic 145 gagtcctcnn nnnnnnn 17 146 17 DNA
Artificial Sequence synthetic 146 nnnnnnnnng aggactc 17 147 15 DNA
Artificial Sequence synthetic 147 gcatcnnnnn nnnnn 15 148 15 DNA
Artificial Sequence synthetic 148 nnnnnnnnnn gatgc
15
* * * * *