U.S. patent application number 11/099687 was filed with the patent office on 2006-02-02 for attenuated pestiviruses.
Invention is credited to Gregor Meyers.
Application Number | 20060024320 11/099687 |
Document ID | / |
Family ID | 27239083 |
Filed Date | 2006-02-02 |
United States Patent
Application |
20060024320 |
Kind Code |
A1 |
Meyers; Gregor |
February 2, 2006 |
Attenuated pestiviruses
Abstract
This invention relates to attenuated pestiviruses characterised
in that their enzymatic activity residing in glycoprotein E.sup.RNS
is inactivated, methods of preparing, using and detecting
these.
Inventors: |
Meyers; Gregor;
(Walddorfhaeslach, DE) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Family ID: |
27239083 |
Appl. No.: |
11/099687 |
Filed: |
April 6, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10717615 |
Nov 21, 2003 |
|
|
|
11099687 |
Apr 6, 2005 |
|
|
|
09325542 |
Jun 4, 1999 |
|
|
|
10717615 |
Nov 21, 2003 |
|
|
|
60092027 |
Jul 7, 1998 |
|
|
|
Current U.S.
Class: |
424/186.1 ;
435/235.1; 435/325; 435/456; 435/5; 530/395; 536/23.72 |
Current CPC
Class: |
A61K 2039/51 20130101;
C12N 7/00 20130101; A61K 2039/5254 20130101; C12N 2770/24361
20130101; G01N 2333/18 20130101; C07K 14/005 20130101; A61P 31/00
20180101; A61K 39/00 20130101; A61K 38/00 20130101; C12N 2770/24322
20130101; A61K 2039/53 20130101 |
Class at
Publication: |
424/186.1 ;
435/005; 435/235.1; 435/325; 435/456; 530/395; 536/023.72 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70; C07H 21/04 20060101 C07H021/04; A61K 39/12 20060101
A61K039/12; C12N 7/00 20060101 C12N007/00; C12N 15/86 20060101
C12N015/86; C07K 14/18 20060101 C07K014/18 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 5, 1998 |
EP |
98110356.7 |
Claims
1-11. (canceled)
12. A nucleic acid coding for a glycoprotein E.sup.RNS, wherein the
RNase activity residing in said glycoprotein is inactivated by
deletions and/or mutations of at least one amino acid of said
glycoprotein with the proviso that the amino acids at position 297
and/or 346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein are not lysine.
13. The nucleic acid of claim 12, wherein said RNase activity is
inactivated by deletions and/or mutations that are located at the
amino acids at position 295 to 307 and/or position 338 to 357, as
described in FIG. 1 for the CSFV Alfort strain in an exemplary
manner or corresponding thereto in other strains, of said
glycoprotein.
14. The nucleic acid of claim 13, wherein said RNase activity is
inactivated by deletion or mutation of the amino acid at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein.
15. The nucleic acid according to claim 14, wherein said RNase
activity is inactivated by the deletion of the histidine residue at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
16. A BVDV nucleic acid according to claim 15, wherein said RNase
activity is inactivated by the deletion of the histidine residue at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other BVDV strains,
of said glycoprotein.
17-18. (canceled)
19. A method for attenuating pestiviruses wherein the RNase
activity residing in glycoprotein E.sup.RNS is inactivated.
20. The method of claim 19, wherein said RNase activity is
inactivated by deletions and/or mutations of at least one amino
acid of said glycoprotein.
21. The method of claim 20, wherein said deletions and/or mutations
are located at the amino acids at position 295 to 307 and/or
position 338 to 357, as described in FIG. 1 for the CSFV Alfort
strain in an exemplary manner or corresponding thereto in other
strains, of said glycoprotein.
22. The method according to claim 21, wherein said RNase activity
is inactivated by deletion or mutation of the amino acid at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
23. The method according to claim 22, wherein said RNase activity
is inactivated by the deletion of the histidine residue at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein.
24. A method for producing a specifically attenuated vaccine
characterized in that wherein the RNase activity residing in
glycoprotein E.sup.RNS is inactivated.
25. The method of claim 24, wherein said RNase activity is
inactivated by deletions and/or mutations of at least one amino
acid of said glycoprotein.
26. The method of claim 25, wherein said deletions and/or mutations
are located at the amino acids at position 295 to 307 and/or
position 338 to 357, as described in FIG. 1 for the CSFV Alfort
strain in an exemplary manner or corresponding thereto in other
strains, of said glycoprotein.
27. The method according to claim 26, wherein said RNase activity
is inactivated by deletion or mutation of the amino acid at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
28. The method according to claim 27, wherein said RNase activity
is inactivated by the deletion of the histidine residue at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein.
29. A method for detectably labeling pestiviruses wherein the RNase
activity residing in glycoprotein E.sup.RNS is inactivated.
30. The method of claim 29, wherein said RNase activity is
inactivated by deletions and/or mutations of at least one amino
acid of said glycoprotein.
31. The method of claim 30, wherein said deletions and/or mutations
are located at the amino acids at position 295 to 307 and/or
position 338 to 357, as described in FIG. 1 for the CSFV Alfort
strain in an exemplary manner or corresponding thereto in other
strains, of said glycoprotein.
32. The method according to claim 31, wherein said RNase activity
is inactivated by deletion or mutation of the amino acid at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
33. The method according to claim 32, wherein said RNase activity
is inactivated by the deletion of the histidine residue at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein.
34. (canceled)
35. A process for the preparation of specifically attenuated
pestiviruses characterized in that wherein the RNase activity
residing in glycoprotein E.sup.RNS is inactivated.
36. The process according to claim 35, wherein said RNase activity
is inactivated by deletions and/or mutations of at least one amino
acid of said glycoprotein.
37. The process according to claim 36, wherein said deletions
and/or mutations are located at the amino acids at position 295 to
307 and/or position 338 to 357, as described in FIG. 1 for the CSFV
Alfort strain in an exemplary manner or corresponding thereto in
other strains, of said glycoprotein.
38. The process according to claim 37, wherein said RNase activity
is inactivated by deletion or mutation of the amino acid at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
39. The process according to claim 38, wherein said RNase activity
is inactivated by the deletion of the histidine residue at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein.
40. A process for the preparation of specifically labeled
pestiviruses characterized in that wherein the RNase activity
residing in glycoprotein E.sup.RNS is inactivated.
41. The process according to claim 40, wherein said RNase activity
is inactivated by deletions and/or mutations of at least one amino
acid of said glycoprotein.
42. The process according to claim 41, wherein said deletions
and/or mutations are located at the amino acids at position 295 to
307 and/or position 338 to 357, as described in FIG. 1 for the CSFV
Alfort strain in an exemplary manner or corresponding thereto in
other strains, of said glycoprotein.
43. The process according to claim 42, wherein said RNase activity
is inactivated by deletion or mutation of the amino acid at
position 346. as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
44. The process according to claim 43, wherein said RNase activity
is inactivated by the deletion of the histidine residue at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein.
45-52. (canceled)
53. A vaccine comprising the nucleic acid according to claim
12.
54. A method for the prophylaxis or treatment of a pestivirus
infection in an animal comprising administering a vaccine of claim
1 to an animal in need of such prophylaxis or treatment.
55. A method for the prophylaxis or treatment of a pestivirus
infection in an animal comprising administering the pharmaceutical
composition of claim 18 to an animal in need of such prophylaxis or
treatment.
56. A method for distinguishing pestivirus-infected animals from
animals vaccinated with a specifically attenuated pestivirus,
wherein said specifically attenuated pestivirus is attenuated
according to the method of claim 19, comprising: (a) obtaining a
sample from an animal suspected of pestivirus infection or from an
animal vaccinated with a specifically attenuated pestivirus; (b)
identifying the nucleotide sequence of a pestivirus within said
sample; and (c) correlating the presence of deletions and/or
mutations of the E.sup.RNS nucleotide sequence with a vaccinated
animal and correlating the absence of said deletions and/or
mutations with a pestivirus infection of said animal.
57. A method for distinguishing pestivirus-infected animals from
animals vaccinated with a specifically attenuated pestivirus,
wherein said specifically attenuated pestivirus is attenuated
according to the method of claim 19, comprising: (a) obtaining a
sample from an animal suspected of pestivirus infection or from an
animal vaccinated with a specifically attenuated pestivirus; (b)
identifying a modified E.sup.RNS glycoprotein of an attenuated
pestivirus by the specific binding of monoclonal or polyclonal
antibodies to E.sup.RNS glycoproteins present in said sample, said
glycoproteins being modified by deletions and/or mutations of at
least one amino acid, whereby said monoclonal or polyclonal
antibodies do not bind to unmodified E.sup.RNS glycoproteins; and
(c) correlating the specific binding of said monoclonal or
polyclonal antibodies with a vaccinated animal and correlating the
absence of antibody binding to a pestivirus infection of said
animal with the proviso that the presence of pestiviral material in
said animal and/or said sample is established otherwise.
58. A method for distinguishing pestivirus-infected animals from
animals vaccinated with a specifically attenuated pestivirus,
wherein said specifically attenuated pestivirus is attenuated
according to the method of claim 19, comprising: (a) obtaining a
sample from an animal suspected of pestivirus infection or from an
animal vaccinated with a specifically attenuated pestivirus; (b)
identifying an unmodified E.sup.RNS glycoprotein of a pestivirus by
the specific binding of monoclonal or polyclonal antibodies to
E.sup.RNS glycoproteins present in said sample, said glycoproteins
not being modified by deletions and/or mutations of at least one
amino acid, whereby said monoclonal or polyclonal antibodies do not
bind to modified E.sup.RNS glycoproteins; and (c) correlating the
specific binding of said monoclonal or polyclonal antibodies with a
pestivirus infection in said animal and correlating the absence of
antibody binding to a vaccinated animal with the proviso that the
presence of pestiviral material in said animal and/or said sample
is established otherwise.
59. A method for distinguishing pestivirus-infected animals from
animals vaccinated with a specifically attenuated pestivirus,
wherein said specifically attenuated pestivirus is attenuated
according to the method of claim 19, comprising: (a) obtaining a
sample from an animal suspected of pestivirus infection or from an
animal vaccinated with a specifically attenuated pestivirus; (b)
determining the absence or presence of RNase activity of a
glycoprotein E.sup.RNS within said sample; and (c) correlating the
absence of RNase activity of glycoprotein E.sup.RNS with a
vaccinated animal and correlating the presence of said activity
with a pestivirus infection of said animal.
60. A method for distinguishing pestivirus-infected animals from
animals vaccinated with a specifically attenuated pestivirus,
wherein said specifically attenuated pestivirus is attenuated
according to the method of claim 19, comprising: (a) obtaining a
sample of polyclonal antibodies from an animal suspected of
pestivirus infection or from an animal vaccinated with a
specifically attenuated pestivirus; (b) identifying any specific
binding of said polyclonal antibodies to unmodified glycoprotein
E.sup.RNS or glycoprotein E.sup.RNS as modified by deletions and/or
mutations of at least one amino acid; and (c) correlating the
binding of said polyclonal antibodies to unmodified glycoprotein
E.sup.RNS with a pestivirus infection and correlating the binding
of said polyclonal antibodies to glycoprotein E.sup.RNS as modified
by deletions and/or mutations of at least one amino acid with a
vaccinated animal.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a method for attenuating
pestiviruses by inactivating the ribonuclease activity (RNase
activity) residing in glycoprotein E.sup.RNS. The invention also
relates to pestiviruses attenuated according to the invention,
nucleic acids for preparing such pestiviruses, vaccines and
pharmaceutical compositions comprising the attenuated pestiviruses
of the invention. The invention further relates to methods for
distinguishing between the attenuated viruses of the invention and
pathogenic viruses.
BACKGROUND OF THE INVENTION
[0002] Pestiviruses are causative agents of economically important
diseases of animals in many countries worldwide. Presently known
virus isolates have been grouped into three different species which
together form one genus within the family Flaviviridae. [0003] I
Bovine viral diarrhea virus (BVDV) causes bovine viral diarrhea
(BVD) and mucosal disease (MD) in cattle (Baker, 1987; Moennig and
Plagemann, 1992; Thiel et al., 1996). [0004] II Classical swine
fever virus (CSFV), formerly named hog cholera virus, is
responsible for classical swine fever (CSF) or hog cholera (HC)
(Moennig and Plagemann, 1992; Thiel et al., 1996). [0005] III
Border disease virus (BDV) is typically found in sheep and causes
border disease (BD). Symptoms similar to MD in cattle have also
been described to occur after intrauterine infection of lambs with
BDV (Moennig and Plagemann, 1992; Thiel et al., 1996).
[0006] An alternative classification of pestiviruses is provided by
Becher et al. (1995) or others.
[0007] Pestiviruses are small enveloped viruses with a single
stranded RNA genome of positive polarity lacking both 5' cap and 3'
poly(A) sequences. The viral genome codes for a polyprotein of
about 4000 amino acids giving rise to final cleavage products by
co- and posttranslational processing involving cellular and viral
proteases. The viral proteins are arranged in the polyprotein in
the order
NH.sub.2-N.sup.pro-C-E.sup.RNS-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B--COOH
(Rice, 1996). Protein C and the glycoproteins E.sup.RNS, E1 and E2
represent structural components of the pestivirus virion (Thiel et
al., 1991). E2 and to a lesser extent E.sup.RNS were found to be
targets for antibody neutralization (Donis et al., 1988; Paton et
al., 1992; van Rijn et al., 1993; Weiland et al., 1990, 1992).
E.sup.RNS lacks a membrane anchor and is secreted in considerable
amounts from the infected cells; this protein has been reported to
exhibit RNase activity (Hulst et al., 1994; Schneider et al., 1993;
Windisch et al., 1996). The function of this enzymatic activity for
the viral life cycle is presently unknown. In the case of a CSFV
vaccine strain experimental destruction of the RNase by site
directed mutagenesis has been reported to result in a
cytopathogenic virus that has growth characteristics in cell
culture equivalent to wild type virus (Hulst et al., 1998). The
enzymatic activity depends on the presence of two stretches of
amino acids conserved between the pestivirus E.sup.RNS and
different known RNases of plant and fungal origin. Both of these
conserved sequences contain a histidine residue (Schneider et al.,
1993). Exchange of each of these residues against lysine in the
E.sup.RNS protein of a CSFV vaccine strain resulted in the
destruction of RNase activity (Hulst et al., 1998). Introduction of
these mutations into the genome of the CSFV vaccine strain did not
influence viral viability or growth properties but led to a virus
exhibiting a slightly cytopathogenic phenotype (Hulst et al.,
1998).
[0008] Vaccines comprising attenuated or killed viruses or viral
proteins expressed in heterologous expression systems have been
generated for CSFV and BVDV and are presently used. The structural
basis of the attenuation of these viruses used as life vaccines is
not known. This leads to the risk of unpredictable revertants by
backmutation or recombination subsequent to vaccination. On the
other hand, the efficacy of inactivated vaccines or heterologously
expressed viral proteins (subunit vaccines) in the induction of
immunity is rather low.
[0009] In general, live vaccines with defined mutations as a basis
for attenuation would allow to avoid the disadvantages of the
present generation of vaccines. Potential targets for attenuating
mutations in pestiviruses are not available at present.
[0010] A further advantage of said attenuating mutations lies in
their molecular uniqueness which allows to use them as distinctive
labels for an attenuated pestiviruses and to distinguish them from
pestiviruses from the field.
[0011] Because of the importance of an effective and safe as well
as detectable prophylaxis and treatment of pestiviral infections,
there is a strong need for live and specifically attenuated
vaccines with a high potential for induction of immunity as well as
a defined basis of attenuation which can also be distinguished from
pathogenic pestiviruses.
[0012] Therefore, the technical problem underlying the present
invention is to provide specifically attenuated and detectably
labeled pestiviruses for use as live attenuated vaccines with a
high efficiency for the induction of immunity which, as a result of
this method, can also be distinguished from pathogenic pestiviruses
from the field.
DISCLOSURE OF THE INVENTION
[0013] The solution to the above technical problem is achieved by
the description and the embodiments characterized in the
claims.
[0014] It has surprisingly been found that pestiviruses can be
specifically attenuated by the inactivation of the RNase activity
residing in glycoprotein E.sup.RNS.
[0015] The attenuated pestiviruses now provide live vaccines of
high immunogenicity. Therefore, in one aspect the present invention
provides a live vaccine comprising a pestivirus, wherein the RNase
activity residing in glycoprotein E.sup.RNS is inactivated.
[0016] The term "vaccine" as used herein refers to a pharmaceutical
composition comprising at least one immunologically active
component that induces an immunological response in an animal and
possibly but not necessarily one or more additional components that
enhance the immunological activity of said active component. A
vaccine may additionally comprise further components typical to
pharmaceutical compostions. The immunologically active component of
a vaccine may comprise complete live organisms in either its
original form or as attenuated organisms in a so called modified
live vaccine (MLV) or organisms inactivated by appropriate methods
in a so called killed vaccine (KV). In another form the
immunologically active component of a vaccine may comprise
appropriate elements of said organisms (subunit vaccines) whereby
these elements are generated either by destroying the whole
organism or the growth cultures of such organisms and subsequent
purification steps yielding in the desired structure(s), or by
synthetic processes induced by an appropriate manipulation of a
suitable system like, but not restricted to bacteria, insects,
mammalian or other species plus subsequent isolation and
purification procedures or by induction of said synthetic processes
in the animal needing a vaccine by direct incorporation of genetic
material using suitable pharmaceutical compositions (polynucleotide
vaccination). A vaccine may comprise one or simultaneously more
than one of the elements described above.
[0017] Additional components to enhance the immune response are
constituents commonly referred to as adjuvants, like e.g.
aluminiumhydroxide, mineral or other oils or ancillary molecules
added to the vaccine or generated by the body after the respective
induction by such additional components, like but not restricted to
interferons, interleukins or growth factors.
[0018] A "pharmaceutical composition" essentially consists of one
or more ingredients capable of modifying physiological e.g.
immunological functions of the organism it is administered to, or
of organisms living in or on its surface like but not restricted to
antibiotics or antiparasitics, as well as other constituents added
to it in order to achieve certain other objectives like, but not
limited to, processing traits, sterility, stability, feasibility to
administer the composition via enteral or parenteral routes such as
oral, intranasal, intravenous, intramuscular, subcutaneous,
intradermal or other suitable route, tolerance after
administration, controlled release properties. A vaccine of the
invention refers to a vaccine as defined above, wherein one
immunologically active component is a pestivirus or of pestiviral
origin.
[0019] The term "live vaccine" refers to a vaccine comprising a
living, in particular, a living viral active component.
[0020] The term "pestivirus" as used herein refers to all
pestiviruses, characterized by belonging to the same genus as BVDV,
CSFV and BDV within the family Flaviviridae and by their expression
of glycoprotein E.sup.RNS. Of course, said term also refers to all
pestiviruses as characterized by Becher et al. (1995) or others
that express glycoprotein E.sup.RNS. "RNase activity" as used
herein refers to the ability of the glycoprotein E.sup.RNS to
hydrolyze RNA.
[0021] It should be noted that the term glycoprotein EO is often
used synonymously to glycoprotein E.sup.RNS in publications.
[0022] The term "inactivation of the RNase activity residing in
said glycoprotein" refers to the inability or reduced capability of
a modified glycoprotein E.sup.RNS to hydrolyze RNA as compared to
the unmodified wild type of said glycoprotein E.sup.RNS.
[0023] Inactivation of the RNase activity residing in glycoprotein
E.sup.RNS can be achieved by deletions and/or mutations of at least
one amino acid of said glycoprotein as demonstrated herein and by
Hulst et al. (1998). Therefore, in a preferred embodiment the
present invention relates to live vaccines, wherein said RNase
activity is inactivated by deletions and/or mutations of at least
one amino acid of said glycoprotein.
[0024] It has been shown that the glycoprotein E.sup.RNS forms a
disulfide-bonded homodimer of about 97 kD, wherein each monomer
consists of 227 amino acids corresponding to the amino acids 268 to
494 of the CSFV polyprotein as described by Rumenapf et al. (1993).
The first 495 amino acids as expressed by the Alfort strain of CSFV
are shown in FIG. 1 for reference purpose only. The genome sequence
of the Alfort strain of CSFV is available in the GenBank/EMBL data
library under accession number J04358; alternatively, the amino
acid sequence for the BVDV strain CP7 can be accessed in the
GenBank/EMBL data library (accession number U63479). Two regions of
amino acids are highly conserved in glycoprotein E.sup.RNS as well
as in some plant and fungal RNase-active proteins (Schneider et
al., 1993). These two regions are of particular importance to the
RNase enzymatic activity. The first region consists of the region
at the amino acids at position 295 to 307 and the second region
consists of the amino acids at position 338 to 357 of said viral
polyprotein as exemplified by FIG. 1 for the Alfort strain of CSFV
(numbering according to the published deduced amino acid sequence
of CSFV strain Alfort (Meyers et al., 1989). The amino acids of
particular importance to the RNase activity as mentioned above are
by no means limited to the exact position as defined for the Alfort
strain of CSFV but are simply used in an exemplary manner to point
out the preferred amino acids being at that position or
corresponding to that position in other strains such as found in
BVDV, BDV and pestiviruses in general since they are highly
conserved. For pestiviruses other than the CSFV Alfort strain the
numbering of the positions of the preferred amino acids is often
different but an expert in the field of the molecular biology of
pestiviruses will easily identify these preferred amino acids by
their position relative to the highly conserved amino acids of said
glycoprotein. In one particular non-limiting example, the position
of CSFV Alfort 346 is identical to position 349 of BVDV strain
cp7.
[0025] As a consequence, the present invention relates in a more
preferred embodiment to a vaccine of the invention, wherein said
inactivating deletions and/or mutations are located at the amino
acids at position 295 to 307 and/or position 338 to 357, as
described in FIG. 1 for the CSFV Alfort strain in an exemplary
manner or corresponding thereto in other strains, of said
glycoprotein.
[0026] In a very preferred embodiment the present invention
discloses that the inactivation of said RNase activity by deletion
or mutation of the amino acid at position 346 of said glycoprotein
leads to particularly useful live vaccines. Therefore, the present
invention relates to vaccines according to the invention, wherein
said Rnase activity is inactivated by deletion or mutation of the
amino acid at position 346, as described in FIG. 1 for the CSFV
Alfort strain in an exemplary manner or corresponding thereto in
other strains, of said glycoprotein.
[0027] The present invention demonstrates that pestiviruses are
viable and code for an E.sup.RNS protein without RNase activity
when the histidine residue at position 346 of the viral polyprotein
(numbering according to the published sequence of CSFV
Alfort/Tubingen (Meyers et al., 1989)), which represents one of the
conserved putative active site residues of the E.sup.RNS RNase, is
deleted. It has also been demonstrated for this invention that the
deletion of the respective histidine in the E.sup.RNS of a BVD
pestivirus (position 349, numbered according to the sequence of
BVDV CP7 GenBank/EMBL data library (accession number U63479))
results in a viable virus in which the E.sup.RNS glycoprotein has
lost the RNase activity. In contrast to point mutations changing
one amino acid into another, a deletion mutant is generally much
more stable with respect to revertants. Infection of pigs with a
mutant of the pathogenic CSFV Alfort/Tubingen expressing E.sup.RNS
with this deletion did not lead to fever or other typical clinical
signs of CSFV infections whereas the infection with wild type virus
resulted in fever, diarrhea, anorexia, apathy, depletion of B-cells
and central nervous disorders. These pigs were killed in a moribund
stage showing severe hemorrhages in the skin and internal organs 14
days post inoculation. The pigs infected with the mutant did
neither show viremia nor B-cell depletion as tested on days 3, 5,
7, 10, 14 post infection while CSFV was easily isolated from blood
samples derived from the pigs inoculated with wild type virus. The
deletion mutant apparently replicated in the animals as indicated
by the induction of neutralizing antibodies (see Example 3, Table
3c). The immune response to the mutant virus was sufficient to
permit to survive a lethal challenge with 2.times.10.sup.5
TCID.sub.50 of the highly pathogenic infection with the CSFV strain
Eystrup (Konig, 1994) which is heterologous to the Alfort strain.
Moreover, the tested animals displayed no typical clinical signs
for CSFV infection like fever, diarrhea, hemorrhages, B-cell
depletion or anorexia after the challenge infection. This data
demonstrates that infection of pigs with the deletion mutant
induces an immune response sufficient for protection against a
stringent challenge.
[0028] Therefore, in a most preferred embodiment, the invention
relates to vaccines according to the invention, wherein said RNase
activity is inactivated by the deletion of the histidine residue at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
[0029] In a further most preferred embodiment, the invention
relates to BVDV vaccines according to the invention, wherein said
RNase activity is inactivated by the deletion of the histidine
residue at position 346, as described in FIG. 1 for the CSFV Alfort
strain in an exemplary manner or corresponding thereto in other
BVDV strains, of said glycoprotein.
[0030] In another aspect the present invention relates to
attenuated pestiviruses, wherein the RNase activity residing in
glycoprotein E.sup.RNS is inactivated by deletions and/or mutations
of at least one amino acid of said glycoprotein with the proviso
that the amino acids at position 297 and/or 346 of said
glycoprotein as described in FIG. 1 for CSFV are not lysine. A
recombinant pestivirus, wherein amino acids at position 297 and/or
346 of said glycoprotein are lysine has been described by Hulst et
al. in 1998. These particular pestiviruses demonstrated cytopathic
effects in swine kidney cells. Up to now, there has been total
unawareness of the surprising and innovative attenuating feature
due to the inactivation of the E.sup.RNS enzymatic activity.
[0031] In a preferred embodiment for the reasons stated above for
vaccines the present invention also relates to pestiviruses
according to the invention, wherein said RNase activity is
inactivated by deletions and/or mutations located at the amino
acids at position 295 to 307 and/or position 338 to 357, as
described in FIG. 1 for the CSFV Alfort strain in an exemplary
manner or corresponding thereto in other strains, of said
glycoprotein.
[0032] In a more preferred embodiment for the reasons stated above
for vaccines the present invention also relates to pestiviruses of
the invention, wherein said RNase activity is inactivated by
deletion or mutation of the amino acid at position 346, as
described in FIG. 1 for the CSFV Alfort strain in an exemplary
manner or corresponding thereto in other strains, of said
glycoprotein.
[0033] In a most preferred embodiment for the reasons stated above
for vaccines the present invention also relates to pestiviruses,
wherein said RNase activity is inactivated by the deletion of the
histidine residue at position 346, as described in FIG. 1 for the
CSFV Alfort strain in an exemplary manner or corresponding thereto
in other strains, of said glycoprotein.
[0034] In a further most preferred embodiment, the present
invention relates to BVDV pestiviruses, wherein said RNase activity
is inactivated by the deletion of the histidine residue at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other BVDV strains, of
said glycoprotein.
[0035] The attenuated pestiviruses and active components of the
vaccines of the present invention can easily be prepared by nucleic
acid-modifying recombinant techniques resulting in the expression
of a mutant amino acid sequence in glycoprotein E.sup.RNS
Therefore, a further aspect of the present invention relates to
nucleic acids coding for a glycoprotein E.sup.RNS, wherein the
RNase activity residing in said glycoprotein is inactivated by
deletions and/or mutations of at least one amino acid of said
glycoprotein with the proviso that the amino acids at position 297
and/or 346 of the glycoprotein as described in FIG. 1 for the CSFV
Alfort strain are not lysine. In a preferred embodiment the present
invention relates, for reasons as mentioned above, to nucleic acids
according to the invention, wherein said RNase activity is
inactivated by deletions and/or mutations that are located at the
amino acids at position 295 to 307 and/or position 338 to 357, as
described in FIG. 1 for the CSFV Alfort strain in an exemplary
manner or corresponding thereto in other strains, of said
glycoprotein.
[0036] In a more preferred embodiment the present invention
relates, for reasons as mentioned for vaccines, to nucleic acids
according to the invention, wherein said RNase activity is
inactivated by deletion or mutation of the amino acid at position
346, as described in FIG. 1 for the CSFV Alfort strain in an
exemplary manner or corresponding thereto in other strains, of said
glycoprotein.
[0037] In a most preferred embodiment the present invention relates
to nucleic acids according to the invention, wherein said RNase
activity is inactivated by the deletion of the histidine residue at
position 346, as described in FIG. 1 for the CSFV Alfort strain in
an exemplary manner or corresponding thereto in other strains, of
said glycoprotein.
[0038] In a further most preferred embodiment the present invention
relates to BVDV nucleic acids according to the invention, wherein
said RNase activity is inactivated by the deletion of the histidine
residue at position 346, as described in FIG. 1 for the CSFV Alfort
strain in an exemplary manner or corresponding thereto in other
BVDV strains, of said glycoprotein.
[0039] Nucleotides, e.g. DNA or RNA, are also useful for preparing
DNA-, RNA- and/or vector-vaccines. In these vaccines, the
nucleotides are applied directly to the animal or indirectly via
vectors other than the original virus. Nucleotide vaccines and
vector vaccines are well known from the present state of the art
and will not be elaborated further.
[0040] In a further aspect, the present invention relates to the
use of nucleic acids of the present invention for preparing
nucleotide- and/or vector-vaccines.
[0041] The vaccines, attenuated pestiviruses, and/or nucleic acids
according to the invention are particularly useful for the
preparation of a pharmaceutical composition.
[0042] In consequence, a further aspect of the present invention
relates to pharmaceutical compositions comprising a vaccine
according to the invention, and/or a pestivirus according to the
invention, and/or a nucleotide sequence according to the invention.
One non-limiting example of such a pharmaceutical composition,
solely given for demonstration purposes, could be prepared as
follows: Cell culture supernatant of an infected cell culture is
mixed with a stabilizer (e.g. spermidine and/or BSA (bovine serum
albumin)) and the mixture is subsequently lyophilized or dehydrated
by other methods. Prior to vaccination, said mixture is then
rehydrated in aquous (e.g. saline, PBS (phosphate buffered saline))
or non-aquous solutions (e.g. oil emulsion, aluminum-based
adjuvant).
[0043] An additional aspect of the present invention relates to a
method of attenuation for pestiviruses. The invention provides a
unique and unexpected method for attenuating pestiviruses
characterized in that the RNase activity residing in glycoprotein
E.sup.RNS is inactivated.
[0044] The specifically attenuated pestiviruses are especially
useful for the preparation of vaccines. Therefore, in a further
additional aspect the present invention relates to methods for
producing a specifically attenuated pestivirus vaccine
characterized in that the Rnase activity residing in glycoprotein
E.sup.RNS is inactivated.
[0045] The inactivation of the RNase activity residing in
glycoprotein E.sup.RNS provides a surprising and new method for
detectably labeling pestiviruses. In a further aspect the present
invention provides a method for detectably labeling pestiviruses
characterized in that the RNase activity residing in glycoprotein
E.sup.RNS is inactivated. The feature of absence of RNase activity
residing in the glycoprotein E.sup.RNS of pestiviruses of the
invention now enables for detectably labeling these pestiviruses.
Labeled and unlabeled pestiviruses or the E.sup.RNS secreted from
pestivirus infected cells in body fluids can clearly be
distinguished by the absence or presence of RNase activity of the
glycoproteins E.sup.RNS upon isolation and assaying such enzymatic
activity.
[0046] For pestiviruses inactivated in their RNase activity
residing in glycoprotein E.sup.RNS by deletion and/or mutation, a
number of other techniques can be used. Such pestiviruses can
easily be detected because of the structural consequences resulting
from such deletions and/or mutations. For example, the sequence
difference of the nucleic acid sequence of altered glycoprotein
E.sup.RNS is detectable by nucleic acid sequencing techniques or
PCR-techniques (polymerase-chain reaction) as demonstrated in
example 8; the altered protein sequence can be detected by specific
monoclonal antibodies, that do not recognize unaltered proteins.
Vice versa, it is also possible to detect the altered and thereby
structurally labeled proteins by the absence of binding to specific
monoclonal antibodies that recognize unaltered glycoproteins
E.sup.RNS under the proviso that the presence of pestiviruses can
be established otherwise. And, of course, the deletions and/or
mutations abrogating the RNase activity in the labeled viruses will
result in different immune responses in animals when compared to
the responses resulting from unlabeled pestivirus infections.
[0047] A preferred embodiment for all aspects referring to methods
for attenuating pestiviruses, methods for producing a specifically
attenuated pestivirus vaccine and methods for detectably labeling
pestiviruses according to the invention are those methods relating
to the inactivation of the glycoprotein E.sup.RNS, wherein said
RNase activity is inactivated by deletions and/or mutations of at
least one amino acid of said glycoprotein.
[0048] A more preferred embodiment for all aspects referring to
methods for attenuating pestiviruses, methods for producing a
specifically attenuated pestivirus vaccine and methods for
detectably labeling pestiviruses according to the invention are
those methods relating to the inactivation of the glycoprotein
E.sup.RNS, wherein said deletions and/or mutations are located at
the amino acids at position 295 to 307 and/or position 338 to 357,
as described in FIG. 1 for the CSFV Alfort strain in an exemplary
manner or corresponding thereto in other strains, of said
glycoprotein. A very preferred embodiment for all aspects referring
to methods for attenuating pestiviruses, methods for producing a
specifically attenuated pestivirus vaccine and methods for
detectably labeling pestiviruses according to the invention are
those methods relating to the inactivation of the glycoprotein
E.sup.RNS, wherein said RNase activity is inactivated by deletion
or mutation of the amino acid at position 346, as described in FIG.
1 for the CSFV Alfort strain in an exemplary manner or
corresponding thereto in other strains, of said glycoprotein.
[0049] A most preferred embodiment for all aspects referring to
methods for attenuating pestiviruses, methods for producing a
specifically attenuated pestivirus vaccine and methods for
detectably labeling pestiviruses according to the invention are
those methods relating to the inactivation of the glycoprotein
E.sup.RNS, wherein said RNase activity is inactivated by the
deletion of the histidine residue at position 346, as described in
FIG. 1 for the CSFV Alfort strain in an exemplary manner or
corresponding thereto in other strains, of said glycoprotein.
[0050] The present invention provides vaccines and or other
pharmaceutical compositions which are particularly useful for the
prophylaxis and treatment of pestivirus infections in animals.
Therefore, a further aspect of the present invention relates to
methods for the prophylaxis and treatment of pestivirus infections
in animals characterized in that a vaccine according to the
invention or another pharmaceutical composition according to the
invention is applied to an animal in need of such prophylaxis or
treatment.
[0051] In a further aspect the present invention provides a process
for the preparation of specifically attenuated pestiviruses
characterized in that the RNase activity residing in glycoprotein
E.sup.RNS is inactivated.
[0052] In one aspect the present invention provides a process for
the preparation of specifically labeled pestiviruses characterized
in that the RNase activity residing in glycoprotein E.sup.RNS is
inactivated.
[0053] A preferred embodiment for all aspects referring to a
process for the preparation of specifically attenuated
pestiviruses, a process for the preparation of specifically labeled
pestiviruses according to the invention are those processes
relating to the inactivation of the glycoprotein E.sup.RNS, wherein
said RNase activity is inactivated by deletions and/or mutations of
at least one amino acid of said glycoprotein.
[0054] A more preferred embodiment for all aspects referring to a
process for the preparation of specifically attenuated
pestiviruses, a process for the preparation of specifically labeled
pestiviruses according to the invention are those processes
relating to the inactivation of the glycoprotein E.sup.RNS, wherein
said deletions and/or mutations are located at the amino acids at
position 295 to 307 and/or position 338 to 357, as described in
FIG. 1 for the CSFV Alfort strain in an exemplary manner or
corresponding thereto in other strains, of said glycoprotein.
[0055] A very preferred embodiment for all aspects referring to a
process for the preparation of specifically attenuated
pestiviruses, a process for the preparation of specifically labeled
pestiviruses according to the invention are those processes
relating to the inactivation of the glycoprotein E.sup.RNS, wherein
said Rnase activity is inactivated by deletion or mutation of the
amino acid at position 346, as described in FIG. 1 for the CSFV
Alfort strain in an exemplary manner or corresponding thereto in
other strains, of said glycoprotein.
[0056] A most preferred embodiment for all aspects referring to a
process for the preparation of specifically attenuated
pestiviruses, a process for the preparation of specifically labeled
pestiviruses according to the invention are those processes
relating to the inactivation of the glycoprotein E.sup.RNS, wherein
said RNase activity is inactivated by the deletion of the histidine
residue at position 346, as described in FIG. 1 for the CSFV Alfort
strain in an exemplary manner or corresponding thereto in other
strains, of said glycoprotein.
[0057] The vaccines or other pharmaceutical compositions of the
present invention are useful for the prophylaxis and treatment of
pestivirus infections in animals.
[0058] Therefore, in one aspect the present invention relates to
the use of a vaccine according to the invention for the prophylaxis
and treatment of pestivirus infections in animals. In a further
aspect the present invention relates to the use of a pharmaceutical
composition according to the invention for the prophylaxis and
treatment of pestivirus infections in animals.
[0059] Pestiviruses and/or nucleic acids according to the invention
are useful active components of a pharmaceutical composition or a
vaccine. Therefore, the present invention relates in a further
aspect to the use of a pestivirus of the invention and/or a nucleic
acid of the invention for the preparation of a vaccine or a
pharmaceutical composition.
[0060] As mentioned above the inactivation of the RNase activity
residing in glycoprotein E.sup.RNS provides a surprising and new
method for labeling pestiviruses. As a consequence one aspect of
the present invention relates to methods for distinguishing the
detectably labeled pestiviruses according to the invention from
unlabeled and possibly pathogenic pestiviruses. Such methods are
especially useful for tracing the efficacy of labeled pestiviruses
in animals. A vaccine treated animal will prove label-positive
after obtaining a sample of such animal and assaying for said
label. Unlabeled animals and especially unlabeled animals that
prove pestivirus positive can be immediately separated, isolated or
slaughtered to remove the imminent danger of spreading the
pathogenic infection to other animals.
[0061] The present invention provides a method for detectably
labeling pestiviruses characterized in that the RNase activity
residing in glycoprotein E.sup.RNS is inactivated. This feature of
absence of RNase activity residing in the glycoprotein E.sup.RNS of
pestiviruses of the invention now enables for detectably labeling
these pestiviruses. As a result labeled and unlabeled pestiviruses
can clearly be distinguished by the absence or presence of RNase
activity of the glycoprotein E.sup.RNS upon isolation and assaying
such enzymatic activity. The determination of presence or absence
of this enzymatic activity upon obtaining a sample containing a
pestivirus of interest or material thereof can be performed
according to standard methods as, for example, described in Example
2 or in Hulst et al. (1994).
[0062] Therefore, in a preferred embodiment the present invention
relates to a method for distinguishing pestivirus-infected animals
from animals vaccinated with a specifically attenuated pestivirus
according to the invention, comprising the following steps: [0063]
(1) Obtaining a sample from an animal of interest suspected of
pestivirus infection or a vaccinated animal; [0064] (2) Determining
the absence or presence of RNase activity of a glycoprotein
E.sup.RNS within said sample; [0065] (3) Correlating the absence of
RNase activity of glycoprotein E.sup.RNS with a vaccinated animal
and correlating the presence of said activity with a pestivirus
infection of said animal.
[0066] The present invention provides pestiviruses inactivated in
their RNase activity residing in glycoprotein E.sup.RNS by deletion
and/or mutation. Such pestiviruses are easily detected because of
the structural consequences resulting from such deletions and/or
mutations. The sequence difference of the E.sup.RNS gene coding for
the altered glycoprotein E.sup.RNS is detectable by sequencing
techniques or PCR-techniques. As a result, the present invention
provides in a preferred embodiment a method for distinguishing
pestivirus-infected animals from animals vaccinated with a
specifically attenuated pestivirus according to the invention,
comprising the following steps: [0067] (1) Obtaining a sample from
an animal of interest suspected of pestivirus infection or a
vaccinated animal; [0068] (2) Identifying the nucleotide sequence
of a pestivirus genome or protein within said sample; [0069] (3)
Correlating the deletions and/or mutations of the E.sup.RNS
nucleotide sequence as present in the vaccine with a vaccinated
animal and correlating the absence of said deletions and/or
mutations with a pestivirus infection of said animal.
[0070] Furthermore, the structural changes resulting from the
altered protein sequence of the glycoprotein E.sup.RNS of
pestiviruses of the invention can be detected by specific
monoclonal or polyclonal antibodies, that do not recognize
unaltered proteins.
[0071] Therefore, in a further embodiment, the present invention
relates to a method for distinguishing pestivirus-infected animals
from animals vaccinated with an attenuated pestivirus according to
the invention, comprising the following steps: [0072] (1) Obtaining
a sample from an animal of interest suspected of pestivirus
infection or a vaccinated animal; [0073] (2) Identifying a modified
E.sup.RNS glycoprotein of an attenuated pestivirus by the specific
binding of monoclonal or polyclonal antibodies to E.sup.RNS
glycoproteins present in said sample, said glycoproteins being
modified by a method according to the invention, whereby said
monoclonal or polyclonal antibodies do not bind to unmodified
E.sup.RNS glycoproteins; [0074] (3) Correlating the specific
binding of said monoclonal or polyclonal antibodies with a
vaccinated animal and correlating the absence of antibody binding
to a pestivirus infection of said animal under the proviso that the
presence of pestiviral material in said animal and/or said sample
is established otherwise.
[0075] Vice versa, it is also possible to detect the altered and
thereby structurally labeled proteins by the absence of binding to
specific monoclonal or polyclonal antibodies that recognize
unaltered glycoproteins E.sup.RNS only, if the presence of
pestiviruses can be established otherwise. In a preferred
embodiment the present invention relates to a method for
distinguishing pestivirus-infected animals from animals vaccinated
with an attenuated pestivirus according to the invention,
comprising the following steps: [0076] (1) Obtaining a sample from
an animal of interest suspected of pestivirus infection or a
vaccinated animal; [0077] (2) Identifying an unmodified E.sup.RNS
glycoprotein of a pestivirus by the specific binding of monoclonal
or polyclonal antibodies to E.sup.RNS glycoproteins present in said
sample, said glycoproteins not being modified by a method according
to the invention, whereby said monoclonal or polyclonal antibodies
do not bind to modified E.sup.RNS glycoproteins; [0078] (3)
Correlating the specific binding of said monoclonal or polyclonal
antibodies with a pestivirus infection in said animal and
correlating the absence of antibody binding to an vaccinated animal
under the proviso that the presence of pestiviral material in said
animal and/or said sample is established otherwise.
[0079] Of course, the structural modification and absence of the
RNase activity in the labeled viruses of the invention will result
in different immune responses in animals when compared to the
responses resulting from unlabeled pestivirus infections. The
pestiviruses of the invention elicit a different and distinct
immune response, cellular as well as humoral, that differs from
unmodified and possibly pathogenic immune responses. For example,
glycoproteins E.sup.RNS according to the invention will result in
polyclonal antibodies that are different in their binding
specificity when compared to polyclonal antibodies resulting from
unmodified glycoproteins. This difference in binding specificity
provides a label for distinguishing animals vaccinated with
pestiviruses from the invention from pestivirus field infected
animals. Tests for screening sera for specific polyclonal
antibodies that either bind to a wildtype epitope or a marker
deletion mutation of that epitope for the purpose of
differentiating infected and vaccinated animals have been
described, for example for pseudorabies-infected and vaccinated
pigs (Kit et al., 1991).
[0080] In a preferred embodiment the present invention relates to a
method for distinguishing pestivirus-infected animals from animals
vaccinated with an attenuated pestivirus according to the
invention, comprising the following steps: [0081] (1) Obtaining a
sample of polyclonal antibodies from an animal of interest
suspected of pestivirus infection or a vaccinated animal; [0082]
(2) Identifying any specific binding of said polyclonal antibodies
to unmodified glycoprotein E.sup.RNS or glycoprotein E.sup.RNS as
modified according to the invention. [0083] (3) Correlating the
binding of said polyclonal antibodies to unmodified glycoprotein
E.sup.RNS with a pestivirus infection and correlating the binding
of said polyclonal antibodies to glycoprotein E.sup.RNS as modified
according to the invention with a vaccinated.
REFERENCES
[0083] [0084] 1. Baker, J. C. 1987. Bovine viral diarrhea virus: a
review. J. Am. Vet. Med.Assoc. 190: 1449-1458. [0085] 2. Becher,
P., Konig, M., Paton, D. J., Thiel, H. J., 1995, Further
characterization of border disease virus isolates: evidence for the
presence of more than three species within the genus pesivirus.
Virology 209 (1), 200-206. [0086] 3. Donis, R. O., Corapi, W., and
Dubovi, E. J. 1988. Neutralizing monoclonal antibodies to bovine
viral diarrhea virus bind to the 56K to 58K glycoprotein. J. Gen.
Virol. 69: 77-86. [0087] 4. Fuerst T. R. et al. 1986. Eukaryotic
transient expression system based on recombinant vaccinia virus
that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad.
Sci. 83: 8122-8126. [0088] 5. Hulst, M. M., Himes, G., Newbigin,
E., Moormann, R. J. M. 1994. Glycoprotein E2 of classical swine
fever virus: expression in insect cells and identification as a
ribonuclease. Virology200: 558-565. [0089] 6. Hulst, M. M., F. E.
Panoto, A. Hooekmann, H. G. P. van Gennip., and Moormann, R. J. M.
1998. Inactivation of the RNase activity of glycoprotein E.sup.ms
of classical swine fever virus results in a cytopathogenic virus.
J. Virol. 72: 151-157. [0090] 7. Kit, M. and S. Kit. 1991.
Sensitive glycoprotein gIII blocking ELISA to distinguish between
pseudorabies (Aujeszky's disease)--infected and vaccinated pigs.
Veternary Microbiology 28:141-155. [0091] 8. Kunkel, T. A., J. D.
Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific
mutagenesis without phenotypic selection. Methods Enzymol.
154:367-392. [0092] 9. Konig, Matthias, 1994, Virus der klassischen
Schweinepest: Untersuchungen zur Pathogenese und zur lnduktion
einer protektiven Immunantwort. Dissertation, Tierarztliche
Hochschule Hannover, Germany. [0093] 10. Meyers, G., Rumenapf, T.
and Thiel, H.-J. 1989. Molecular cloning and nucleotide sequence of
the genome of hog cholera virus.Virology 171: 555-567. [0094] 11.
Meyers, G., Tautz, N., Becher, P., Thiel, H.-J., & Kummerer, B.
M. 1996b. Recovery of cytopathogenic and noncytopathogenic bovine
viral diarrhea viruses from cDNA constructs. J. Virol., 70:
8606-8613. [0095] 12. Meyers, G., Thiel, H.-J., and Rumenapf, T.
1996a. Classical swine fever virus: Recovery of infectious viruses
from cDNA constructs and generation of recombinant cytopathogenic
swine fever virus. J. Virol. 67:7088-709526. [0096] 13. Moennig, V.
and Plagemann, J. 1992. The pestiviruses. Adv. Virus Res. 41:
53-91. [0097] 14. Paton, D. J., Lowings, J. P., Barrett, A. D.
1992. Epitope mapping of the gp53 envelope protein of bovine viral
diarrhea virus. Virology 190: 763-772. [0098] 15. Pellerin, C. et.
al. Identification of a new group of bovine viral diarrhea virus
strains associated. with severe outbreaks and high mortalities,
Virology 203, 1994:260-268. [0099] 16. Rice, C. M. 1996.The
pestiviruses. In Fields Virology, eds. Fields, B. N., Knipe, D. M.,
& Howley, P. M. (Lippincott-Raven, Philadelphia), pp. 931-959.
[0100] 17. Rumenapf, T., Unger, G., Strauss, J. H., and Thiel,
H.-J. 1993. Processing of the evelope glycoproteins of
pestiviruses. J. Virol. 67: 3288-3294 [0101] 18. Schneider, R., G.
Unger, R. Stark, E. Schneider-Scherzer, and H.-J. Thiel. 1993.
Identification of a structural glycoprotein of an RNA virus as a
ribonuclease. Science 261: 1169-1171. [0102] 19. Thiel, H.-J.,
Plagemann, G. W., & Moennig, V. 1996. The pestiviruses. In
Fields Virology, eds. Fields, B. N., Knipe, D. M., & Howley, P.
M. (Lippincott-Raven, Philadelphia), pp.1059-1073. [0103] 20.
Thiel, H.-J., Stark, R., Weiland, E., Rumenapf, T. & Meyers, G.
1991. Hog cholera virus: molecular. .composition of virions from a
pestivirus. J. Virol. 65: 4705-4712.31. [0104] 21. van Rijn, P. A.,
van Gennip, H. G., de Meijer, E. J., Moormann, R. J. 1993. Epitope
mapping of envelope glycoprotein E1 of hog cholera virus strain
Brescia. J. Gen. Virol. 74: 2053-2060. [0105] 22. Weiland, E.,
Thiel, H.-J., Hess, G., and Weiland, F. (1989). Development of
monoclonal neutralizing antibodies agaist bovine viral diarrhea
virus after pretreatment of mice with normal bovine cells and
cyclophosphamide. J. Virol. Methods 24: 237-244. [0106] 23.
Weiland, E., Stark, R., Haas, B., Rumenapf, T., Meyers, G. and
Thiel, H.-J. (1990). Pestivirus glycoprotein which induces
neutralizing antibodies forms part of a disulfide-linked
heterodimer. J. Virology 64, 3563-3569. [0107] 24. Weiland, E.,
Ahl, R., Stark, R., Weiland, F. and Thiel, H.-J. (1992). A second
envelope glycoprotein mediates neutralization of a pestivirus, hog
cholera virus. J. Virology 66, 3677-3682. [0108] 25. Windisch, J.
M., Schneider, R., Stark, R., Weiland, E., Meyers, G., and Thiel,
H.-J. 1996. RNase of classical swine fever virus: biochemical
characterization and inhibition by virus-neutralizing monoclonal
antibodies. J. Virol. 70: 352-358
EXAMPLES
Example I
Generation of RNase-Negative Pestivirus Mutants
[0109] Starting with the full length cDNA clones pA/CSFV (Meyers et
al., 1996a) or pA/BVDV (Meyers et al., 1996b), from which
infectious cRNA can be obtained by in vitro transcription,
subclones were generated. For CSFV, a XhoI/SspI fragment of pA/CSFV
was cloned into pBluescript SK+, cut with XhoI and SmaI. For BVDV,
a XhoI/BglII fragment from pA/BVDV was cloned into plasmid
pCITE-2C, cut with the same enzymes. Single stranded plasmid DNA
was produced from these constructs according to the method of
Kunkel (Kunkel et al., 1987) using E. coli CJ 236 cells (BioRad)
and the VCMS single strand phage (Stratagene). The single stranded
DNA was converted to double strands using the `Phagemid in vitro
Mutagenesis Kit` (BioRad). Some of the synthetic oligonucleotides
which were used as primers for generating the desired pestivirus
mutants are listed below in an exemplary fashion: TABLE-US-00001
C-297-L: AGGAGCTTACTTGGGATCTG C-346-L: GGAACAAACTTGGATGGTGT
C-297-K: ACAGGAGCTTAAAAGGGATCTGGC C-346-K: ATGGAACAAAAAGGGATGGTGTAA
C-346-d: GAATGGAACAAAGGATGGTGTAAC B-346-d:
CATGAATGGAACAAAGGTTGGTGCAACTGG
[0110] The double stranded plasmid DNA was used for transformation
of E. coli XL1-Blue cells (Stratagene). Bacterial colonies
harboring plasmids were isolated via ampicillin selection. Plasmid
DNA was prepared and further analyzed by nucleotide sequencing
using the T7 polymerase sequencing kit (Pharmacia). Plasmids
containing the desired mutations and no second site changes were
used for the construction of full length cDNA clones. In the case
of CSFV, a XhoI/NdeI fragment from the mutagenized plasmid was
inserted together with a NdeI/BglII fragment derived from plasmid
578 (pCITE 2A, containing the XhoI/BglII fragment form pA/CSFV)
into pA/CSFV cut with XhoI and BglII. To obtain the BVDV CP7
mutant, a XhoI/BglII fragment containing the deletion was inserted
into pA/BVDV cut with XhoI and NcoI together with a BglII/NcoI
fragment isolated from pA/BVDV/Ins-. From construct pA/BVDV/Ins- a
cRNA was transcribed that gives rise to a noncytopathogenic BVDV
upon transfection in suitable cells (Meyers et al., 1996b).
[0111] The different full length clones were amplified, and the
plasmids isolated. The presence of the desired mutations was proven
by DNA sequencing. After linearization with SrfI (CSFV full length
clones) or SmaI (BVDV full length clones) cRNA was transcribed as
described previously (Meyers et al., 1996ab). RNA was purified by
gel filtration and phenol/chloroform extraction and used for
transfection of porcine kidney (PK15) cells or bovine kidney (MDBK
clone B2) cells (CSFV or BVDV constructs, respectively). The
transfections were analyzed by immunofluorescence with virus
specific antisera. In cases where the desired mutants could be
recovered (immunofluorescence positive) the viruses were amplified
by passage on the same cell lines used for the transfection
experiments. Further analysis of the CSFV mutants included
determination of one step growth curves and characterization of
viral RNA by Northern blot with virus specific cDNA probes as well
as reverse transcription polymerase chain reaction (RT-PCR) and
subsequent sequencing of the PCR fragments to verify the presence
of the desired mutations in the viral genome. In all cases the
presence of the desired mutation was proven. All of the recovered
viruses grew equally well and produced similar amounts of RNA just
as the virus resulting from the plasmid displaying the wild type
sequence.
[0112] The viability of the BVDV mutant was shown by transfection
of the respective cRNA and splitting of the cells 3 days
thereafter. Part of the cells was seeded into a 3.5 cm diameter
dish, fixed with acetone/methanol at the day thereafter and
analyzed by immunofluorescence with a mixture of BVDV-specific
monoclonal antibodies (Weiland et al., 1989). All cells were found
positive whereas a control of cells transfected with noninfectious
RNA showed no signal. From a part of the cells transfected with the
respective cRNA, an extract was produced by one cycle of freezing
and thawing. Fresh cells were infected with this cell extract and
proved to be BVDV positive by BVDV specific immunofluorescence 3
days post infection. Table I summarizes the different changes
introduced into the conserved sequences of E.sup.RNS representing
the putative active site of the RNase which are encoded by the
indicated virus mutants TABLE-US-00002 TABLE 1 RNase Viability Name
Sequence in RNase motif activity of mutant pA/CSFV . . .
SLHGIWPEKIC . . . . . . RHEWNKHGWCNW . . . + + C-297-L . . .
SLLGIWPEKIC . . . . . . RHEWNKHGWCNW . . . - + C-346-L . . .
SLHGIWPEKIC . . . . . . RHEWNKLGWCNW . . . - + C-297-L/346-L . . .
SLLGIWPEKIC . . . . . . RHEWNKLGWCNW . . . - + C-297-K . . .
SLKGIWPEKIC . . . . . . RHEWNKHGWCNW . . . - + C-346-K . . .
SLHGIWPEKIC . . . . . . RHEWNKKGWCNW . . . - + C-297-d . . .
SL_GIWPEKIC . . . . . . RHEWNKHGWCNW . . . - - C-346-d . . .
SLHGIWPEKIC . . . . . . RHEWNK_GWCNW . . . - + C-296/7/8-d . . .
S___IWPEKIC . . . . . . RHEWNKHGWCNW . . . - - C-345/6/7-d . . .
SLHGIWPEKIC . . . . . . RHEWN___WCNW . . . - - C-345/6-d . . .
SLHGIWPEKIC . . . . . . RHEWN__GWCNW . . . - - C-346/7-d . . .
SLHGIWPEKIC . . . . . . RHEWNK__WCNW . . . - - C-342-d . . .
SLHGIWPEKIC . . . . . . RH_WNKHGWCNW . . . - - C-342/6-d . . .
SLHGIWPEKIC . . . . . . RH_WNK_GWCNW . . . - - C-301-d . . .
SLHGIW_EKIC . . . . . . RHEWNKHGWCNW . . . - - C-295-S/G . . .
GLHGIWPEKIC . . . . . . RHEWNKHGWCNW . . . - + C-300-W/G . . .
SLHGIGPEKIC . . . . . . RHEWNKHGWCNW . . . - + C-302-E/A . . .
SLHGIWPAKIC . . . . . . RHEWNKHGWCNW . . . - - C-305-C/G . . .
SLHGIWPEKIG . . . . . . RHEWNKHGWCNW . . . - - C-300-W/G-302-E/A .
. . SLHGIGPAKIC . . . . . . RHEWNKHGWCNW . . . - - C-340-R/G . . .
SLHGIWPEKIC . . . . . . GHEWNKHGWCNW . . . - - C-343-W/G . . .
SLHGIWPEKIC . . . . . . RHEGNKHGWCNW . . . - - C-345-K/A . . .
SLHGIWPEKIC . . . . . . RHEWNAHGWCNW . . . - - C-297-K/346-K . . .
SLKGIWPEKIC . . . . . . RHEWNKKGWCNW . . . - + C-297-K/346-L . . .
SLKGIWPEKIC . . . . . . RHEWNKKGWCNW . . . - + pA/BVDV . . .
SLHGIWPEKIC . . . . . . RHEWNKHGWCNW . . . + + B-346-d . . .
SLHGIWPEKIC . . . . . . RHEWNK_GWCNW . . . - +
[0113] Legend to Table 1: Test for RNase activity was done in a
transient assay. BHK21 cells were infected with Vaccina virus
vTF7-3 (Fuerst et al, 1986) and then transfected with the
respective cDNA construct (5 pg of plasmid DNA, transfection using
Superfect as recommended by the supplier (Qiagen)). After 10 hours
incubation at 37.degree. C. in a CO.sub.2 incubator, the
transfected cells were lysed and processed for determination of
RNase activity as described below). Viability was determined as
described below.
Example 2
Effect of Different Mutations on RNase Activity of E.sup.RNS
[0114] To test the effect of the different mutations on the RNase
activity of E.sup.RNS appropriate cells were infected with the
mutant viruses. For CSFV, the infection was carried out with a
multiplicity of infection (m.o.i.) of 0.01. Infection with wild
type virus served as a positive control whereas noninfected cells
were used as a negative control. At 48 h post infection, cells were
washed twice with phosphate buffered saline and lysed in 0.4 ml of
lysis buffer (20 mM Tris/HCl; 100 mM NaCl, 1 mM EDTA, 2 mg/ml
bovine serum albumin; 1% Triton X100; 0.1% deoxycholic acid; 0.1%
sodium dodecyl sulfate). The lysate was given into 1.5 ml reaction
tubes, sonified (Branson sonifier B12, 120 Watt, 20 s in a cup hom
water bath), cleared by centrifugation (5 min, 14,000 rpm,
Eppendorf Centrifuge, 4.degree. C.) and the supernatant subjected
to ultracentrifugation (Beckmann table top ultracentifuge, 60 min
at 4.degree. C. and 45,000 rpm in a TLA 45 rotor). Determination of
RNase activity was done in a total volume of 200 .mu.l containing 5
or 50 .mu.l of supernatant of the second centrifugation step and 80
.mu.g of Poly(rU)(Pharmacia) in RNase-assay buffer (40 mM
Tris-acetate (pH 6.5), 0.5 mM EDTA, 5 mM dithiothreitol (DTT)).
After incubation of the reaction mixture at 37.degree. C. for 1
hour 200 .mu.l of 1.2 M perchloric acid, 20 mM LaSO.sub.4 was
added. After 15 min incubation on ice the mixture was centrifugated
for 15 min at 4.degree. C. and 14,000 rpm in an Eppendorf
centrifuge. To the supernatant 3 volumes of water were added and an
aliquot of the mixture was analyzed by measuring the optical
density at 260 nm using an Ultrospec 3000 spectrophotometer
(Pharmacia). In all cases, the mutations introduced into the
E.sup.ms gene completely abrogated RNase activity (Table 1).
[0115]
[0116] For the BVDV mutant RNase activity was tested with material
obtained after RNA transfection without passage of the recovered
viruses. Cells transfected with the appropriate RNA were split 72 h
post transfection and seeded in two dishes. 24 h later, from one
dish, cell extracts were prepared and analyzed for RNase activity
as described above. To prove infection, the cells of the second
dish were analyzed by immunofluorescence with BVDV specific
monoclonal antibodies (Weiland et al., 1989) and found 100%
positive. Transfection was carried out with RNA transcribed from
pA/BVDV/Ins- and from pA/B-346-d, the plasmid equivalent to
pA/BVDV/Ins- but containing the deletion of the codon equivalent to
the codon 346 in the CSFV Alfort genome. Nontransfected MDBK cells
served as a negative control. TABLE-US-00003 TABLE 2A Determination
of RNase activity of different viruses Alfort C-WT C-297-L C-346-L
C-346-d C-346-d/Rs control OD.sub.260 2.4 2.3 1.1 1.1 1.1 2.3 1.1
Alfort C-WT C-297-L C-346-L C-297-K C-297-K C-297-L/346-L
OD.sub.260 2.09 2.16 0.715 0.77 0.79 0.766 0.77 C-297-K/346-L
C-297-K/346-K C-346-d Control OD.sub.260 0.725 0.835 0.8 0.84
[0117] Description of Table 2A:
[0118] PK15 cells were infected with the indicated viruses at an
m.o.i. (multiplicity of infection) of 0.01, incubated at 37.degree.
C. for 48 h in a CO.sub.2 incubator, and then lysed and subjected
to RNase test. The acid soluble RNA resulting from incubation with
the different cell extracts was quantified by measuring the optical
density at 260 nm. The observed differences in RNase activity were
not due to different amounts of E.sup.RNS protein in the samples
since similar values were obtained after quantification of
E.sup.RNS by radioactive labeling, immunoprecipitation and analysis
of radioactivity with a phosphorimager. Moreover, reduction of the
E.sup.ms concentration in the assay down to only one tenth of the
usual amount did not change the resulting OD values considerably,
indicating that with the chosen conditions the assay was saturated
with E.sup.ms.
[0119] CSFV strain Alfort; all other viruses were recovered from
RNA transcribed in vitro from plasmids: e.g. C-WT from pA/CSFV;
C-297-L from pA/C-297-L; etc.; C-346-d/Rs virus was recovered from
pA/C-346-d/Rs (generated by reversion of mutation in pA/C-346-d by
exchange of the respective cDNA fragment against the equivalent
fragment derived from pA/CS FV); control: extract of non-infected
PK15 cells. TABLE-US-00004 TABLE 2B B-WT B-346-d control OD.sub.260
2.5 1.1 1.1
[0120] Description of table 2B
[0121] MDBK cells were infected with in vitro transcribed RNA,
split 72 h post transfection and analyzed 24 h later for RNase
activity. Infection of the cells was proven by immunofluorescence
analysis as described in the text.
[0122] B-WT: virus recovered from pA/BVDV/Ins-; B-346-d: virus
recovered from pA/B-346-d; control; extract from noninfected MDBK
cells.
Example 3
Pathogenicity of CSFV after RNase Inactivation
[0123] To test, whether the destruction of the RNase activity
influences the pathogenicity of pestiviruses in their natural host,
animal experiments were conducted with mutant V(pA/C-346-d) (C346-d
in tables). Virus recovered from the CSFV full length clone without
mutation (V(pA/CSFV)) served as a positive control (C-WT in
tables). For each mutant three piglets (breed: German landrace;
about 25 kg body weight) were used. The infection dose was
1.times.10.sup.5 TCID.sub.50 per animal; two thirds of the
inoculate was administered intranasally (one third in each
nostril), one third intramuscularly. The two groups were housed in
separate isolation units. Blood was taken from the animals two
times before infection and on days 3, 5, 7, 10, 12 and 14. In
addition, temperature was recorded daily (FIG. 2). The animals
infected with the wild type virus showed typical symptoms of
classical swine fever like fever, ataxia, anorexia, diarrhea,
central nervous disorders, hemorrhages in the skin (Table 3a).
Virus could be recovered form the blood on days 3 (animal #68) and
on days 5, 7, 10, 14 (animals #68, #78, #121) (Table 3b) The
animals were killed in a moribund stage at day 14 post infection.
At this time, no virus neutralizing antibodies could be
detected.
[0124] In contrast, the animals infected with the mutant did not
develop clinical symptoms (Table 3a). The temperature stayed normal
(FIG. 2) over the whole experimental period and the animals never
stopped taking up food. At no time virus could be recovered from
the blood. Nevertheless, the animals were clearly infected and the
virus most likely replicated since all animals developed
neutralizing antibodies (Table 3c). TABLE-US-00005 TABLE 3a
Clinical signs after test infection: Animal experiment 1 clinical
signs moribund at Hemorrhages Anim. CNS hemorrhages day of in
organs at No.: infected with fever diarrhea disorders anorexia in
skin apathia euthanasia necropsy #68 C-WT + + + + + + + + #78 C-WT
+ + + + + + + + #121 C-WT + + + + + + + + #70 C-346-d - - - - - - -
n.a. #72 C-346-d - - - - - - - n.a. #74 C-346-d - - - - - - -
n.a.
[0125] Description of Table 3a:
[0126] 6 piglets (German land race; about 25 kg body weight) in two
groups (each group was housed separately) were included in the
study. 3 animal were infected with CSFV-WT (110.sup.5 TCID.sub.50)
and 3 animals with C-346-d (110.sup.5 TCID.sub.50). Rectal
temperature and clinical signs were recorded and summarized as
detailed in the table; n.a.: no necropsy was performed.
TABLE-US-00006 TABLE 3b Blood cell viremia after test infection
Animal experiment 1 Animal infected viremia at days post infection
number with 3 5 7 10 14 #68 C-WT + + + + + #78 C-WT - + + + + #121
C-WT - + + + + #70 C-346-d - - - - - #72 C-346-d - - - - - #74
C-346-d - - - - -
[0127] Description of Table 3b:
[0128] Blood cell viremia was detected by cocultivation of blood
with PK15 cells. After. incubation at 37.degree. C. for 72 h cells
were washed with PBS, fixed with ice cold acetone/methanol and
analyzed for infection by immunofluorescence with a monoclonal
antibody specific for glycoprotein E2 (mAb A18, Weiland et al.
1990). TABLE-US-00007 TABLE 3c Development of CSFV specific serum
neutralization titer days p.i. -3 0 17 25 69 76 79 87 pig #70 -- --
1:18 1:162 1:162 1:162 1:486 1:1458 pig #72 -- -- 1:18 1:54 1:486
1:1458 1:1458 1:4374 pig #74 -- -- 1:6 1:54 1:162 1:162 1:486
1:1458
[0129] Description of Table 3c:
[0130] Antibody titers of pigs infected with virus mutant C-346-d
determined at different time points during the animal
experiment:
[0131] 50 .mu.l of the diluted serum were mixed with 50 .mu.l of
medium containing 30 TCID.sub.50 of virus (CSFV Alfort/Tubingen).
After 90 minutes incubation at 37.degree. C., 100 .mu.l of cells
(1.5.times.10.sup.4 cells) were added and the mixture was seeded in
96 well plates. After 72 h the cells were fixed with ice cold
acetone/methanol and analyzed for infection by immunofluorescence
with a monoclonal antibody specific for glycoprotein E2 (mAb A18,
Weiland et al. 1990). On day 69 post infection the animals were
challenged with 2.times.10.sup.5 TCID.sub.50 of CSFV strain
Eystrup. The table gives the highest serum dilution resulting in
complete neutralization of input virus.
Example 4
Induction of Protective Immunity by Infection with RNase Negative
Virus
[0132] To analyze whether the infection with the mutant virus had
led to a protective immunity, a challenge experiment was conducted
about 9 weeks after the infection with the CSFV mutant using a
highly pathogenic heterologous CSFV strain (strain Eystrup,
originated from Behring). 2.times.10.sup.5 TCID.sub.50 of virus was
used for the infection. This amount of virus was found to be
sufficient to induce lethal disease in several preceeding
experiments (Konig, 1994). However, the animals previously infected
with the CSFV RNase mutant did not show symptoms of disease after
challenge infection. Neither fever (FIG. 3) nor viremia could be
detected but an increase in neutralizing antibodies indicated
productive infection and replication of the challenge virus.
Example 5
Confirmation of Attenuation Principle
[0133] To show, that the observed attenuation of the mutant virus
is indeed due to the deletion of the histidine at position 346 of
the polyprotein and not a consequence of an unidentified second
site mutation, the wild type sequence was restored by exchange of a
1.6 kb XhoI/NdeI fragment of the full length clone pA/C-346-d
against the corresponding fragment of pA/CSFV displaying the wild
type sequence. The fragment excised from pA/C-346-d was analyzed by
nucleotide sequencing for mutations. Except for the deletion of the
triplet coding for histidine 346 of the polyprotein, no difference
with regard to the wild type sequence was found. From the cDNA
construct with the rescued mutant, virus V(pA/C-346-d/Rs) could be
recovered that grew equally well as wild type virus and showed
equivalent RNase activity (Table 2A).
[0134] In a second animal experiment, the rescued virus was used
for infection of pigs. As a control, the deletion mutant was used.
Again, two groups consisting of three animals were used. As the
animals were younger (German landrace, about 20 kg) than those in
the first experiment, 5.times.10.sup.4 TCID.sub.50 of virus were
used for infection this time. Again, the animals infected with the
mutant showed no clinical signs (Table 5, FIG. 4). Only one animal
had fever for one day. Nevertheless, these animals developed
neutralizing antibodies and were protected against a lethal CSFV
challenge. Challenge was again performed by infection with
2.times.10.sup.5 TCID.sub.50 of challenge strain Eystrup. The
animals did not show clinical signs after challenge and the
temperature stayed normal (FIG. 5). In contrast to the pigs
infected with the deletion mutant, the animals inoculated with the
rescued wild type virus developed fatal classical swine fever. One
animal had to be killed 11 days after infection, the other two 3
days later. All animals showed typical symptoms of classical swine
fever, i.e. fever, diarrhea, annorexia, and pathological signs like
hemorrhages in different organs including the kidney.
TABLE-US-00008 TABLE 5a Clinical signs after test infection Animal
experiment 2 clinical signs moribund at hemorrhages Anim. CNS
hemorrhages day of in organs at No.: Infected with fever diarrhea
disorders anorexia in skin apathia euthanasia necropsy #43 C-346-d
+* - - - - - - n.a. #47 C-346-d - - - - - - - n.a. #87 C-346-d - -
- - - - - n.a. #27 C-346-d/RS + + + + - + + + #28 C-346-d/RS + + +
+ - + + + #30 C-346-d/RS + + + + - + + + *fever for only 1 day
[0135] Table 5a:
[0136] 6 piglets (German land race; about 20 kg body weight) in two
groups (each group was housed separately under isolation
conditions) were included in the study. 3 animal were infected with
mutant C-346-d (510.sup.4 TCID.sub.50) and 3 animals with
C-346-d/RS (510.sup.4 TCID.sub.50). C-346-d/RS was derived from
mutant C-346-d by restoring the wild type sequence of E.sup.RNS
gene. Rectal temperature and clinical signs were recorded and
summarized; n.a.: no necropsy was performed. TABLE-US-00009 TABLE
5b Diagnostic RNAse test with viruses recovered from infected
animals during viremia animal #3 animal #5 animal #27 animal #28
animal #30 Alfort C-297-K C-297-K C-346-d/RS C-346-d/RS C-346-d/RS
Control OD.sub.260 1.84 0.60 0.56 1.84 1.93 1.94 0.49
[0137] Viruses recovered form the blood of animals 3 and 5 at day 5
post infection and of animals 27, 28 and 30 of animal experiment #2
(described in example 5) at day 7 post infection were propagated in
tissue culture, titrated and tested for RNase activity as described
above. Non-infected PK15 cells and cells (control) infected with
wild type CSFV (Alfort) served as controls. Animals 3 and 5 had
been infected with mutant C-297-K, whereas animals 27, 28 and 30
had been infected with mutant C-346-d/RS, as indicated in the
table.
Example 6
Effects of Double Mutation within E.sup.RNS
[0138] To test the effects of a double mutation within E.sup.RNS on
the ability of the respective virus to replicate in its natural
host and on pathogenicity, an animal experiment was conducted with
mutant V(pA/C-297-L/346-L). Virus recovered from the CSFV full
length clone without mutation (V(pA/CSFV) served as a positive
control. For each mutant three piglets (breed: German land race;
about 25 kg body weight) were used. The infection dose was
1.times.10.sup.5 TCID.sub.50 per animal; two thirds of the
inoculate was administered intra-nasally (one third in each
nostril), one third intramuscularly. Blood was taken from the
animals before infection (day 0) and on days 5, 8, 12 and 20. In
addition, temperature was recorded daily (FIG. 6). The animals
infected with the double mutant did not develop any clinical
symptoms, and the animals never stopped taking up food. The animals
showed no fever over the whole experimental period (animals 45/2
and 45/3) except animal 45/1 on day 8, probably due to bacterial
infection caused by injury of the right hind leg. After treatment
of this animal with an antibiotic on day 10, temperature returned
to normal values within one day (FIG. 6). For all animals virus was
recovered from the blood on day 5 whereas no viremia was detected
at later time points (Table 6a). All animals developed neutralizing
antibodies (Table 6b). For animal 45/1 the neutralization titer was
again determined about 4.5 months p.i. and was found to be 1:4374.
Thus, the infection with the double mutant resulted in long lasting
immunological memory. TABLE-US-00010 TABLE 6a Test for viremia Days
p.i. 5 8 12 Pig 45/I + - - Pig 45/II + - - Pig 45/III + - -
[0139] TABLE-US-00011 TABLE 6b Neutralization titers Animal day 0
day 20 p.i. 45/1 - 1:128 45/2 - 1:256 45/3 - 1:256
Example 7
Immunogenicity and Attenuation Principle of the BVDV Virus
"B-346-d"
[0140] This experiment was designed to investigate the attenuation
principle as well as the immunogenicity of the BVDV virus `B-346-d`
recovered from pA/B-346d by comparing it with the `B-WT` virus
recovered from pA/BVDV/Ins-. The virus `B-346-d` is of course
mutated in original BVDV position 349 but named "B-346" to indicate
the position relative to the CSFV Alfort position 346 of FIG.
1.
[0141] Three groups of BVDV seronegative animals of 3-6 months of
age were selected. Groups 1 and 2 comprised 5 animals each while
group 3 comprised 3 animals. Animals of group 1 and 2 were infected
by administration of 2.times.10.sup.6 TCID.sub.50 of B-346-d (group
1) or B-WT (group 2) in a volume of 5 ml per route. Animals were
infected intra-muscularly (gluteal muscle), intranasally and
subcutaneously (over scapula).
[0142] Over a period of 14 days after infection, viremia in both
groups was monitored through parameters like blood cell viremia and
virus shedding in nasal swabs. In addition, clinical parameters
like rectal temperatures, white blood cell counts and general
health parameters were monitored.
[0143] The protective immunity against an infection with an
antigenetically heterologous and virulent BVDV-isolate (#13) was
investigated by challenge infection 77 days after infection of the
animals of group 1 with B-346-d. Animals of group 3 served as
challenge control and were infected according to the procedure for
the animals of group 1 with the virulent BVDV-isolate. The BVDV
virus (#13) belongs to a different antigenetic group (type 11),
whereas the B-346-d virus belongs to the antigenetic group (type 1)
according to the classification described by (Pellerin, C. et. al.,
1994). Animals of group 1 and 3 got. infected by administration of
2.times.10.sup.6 TCID.sub.50 of BVDV isolate (#13) in a volume of 5
ml per route. Animals were infected via the intra-muscular (gluteal
muscle), intra-nasal and subcutaneous route (over Scapula). Over a
period of 14 days after infection viremia in both groups was
monitored by parameters like blood cell viremia and virus shedding
in nasal swabs. In addition, clinical parameters like rectal
temperatures, white blood cell counts and general health parameters
were monitored.
[0144] After infection with B-346-d animals did not show any
typical clinical symptoms of a BVDV infection such as rectal
temperature increase (Table 7a), or any respiratory clinical
symptomes (not shown).
[0145] The reduced blood cell viremia (Table 7b) and virus shedding
in nasal swabs (Table 7c) did clearly indicate an attenuation of
B-346-d compared to B-WT.
[0146] The virulent BVDV isolate #13 did induce in the animals of
group 3 a strong viremia with typical signs of a BVDV infection,
like rectal temperature increase over a period of several days
(Table 7d), strong leucopenia (Table 7e), extended blood cell
viremia (Table 7f) and virus shedding in nasal swab fluid (Table
7g). In contrast, animals of group 1, which had been vaccinated by
infection with B-346-d, did show almost no clinical symptoms
typical for a BVDV infection after the challenge infection with the
virulent BVDV isolate #13. There was no significant increase in
rectal temperatures after infection (Table 7d). The observed
leucopenia was very marginal with regard to magnitude and duration
(Table 7e). No BVDV could be isolated from the blood (Table 7f) and
for only one animal virus shedding in nasal swab exudate could be
detected (Table 7g).
[0147] Therefore, infection with B-346-d induces a strong immunity
which clearly reduces clinical signs, virus shedding and blood cell
viremia after challenge infection with a heterologous BVDV isolate.
TABLE-US-00012 TABLE 7a Mean rectal temperatures in group 1
(B-346-d) and 2 (B-WT) Day of study: 0 1 2 3 4 5 6 7 8 9 10 11 12
13 14 Group 1 38.8 39.1 39.0 38.7 38.8 38.7 38.7 38.5 38.7 38.5
38.5 38.5 38.4 38.9 38.7 Group 2 38.8 39.0 38.9 38.6 38.6 38.7 38.6
38.4 39.1 38.4 38.7 38.6 38.7 38.6 38.6 Animals of group 1 were
infected at day 0 with 6 .times. 10.sup.6 TCID.sub.50 B-346-d,
whereas animals of group 2 were infected with 6 .times. 10.sup.6
TCID.sub.50 B-WT.
[0148] TABLE-US-00013 FIG. 7b: Blood cell viremia of groups 1 and 2
First day Final day Recorded nasal nasal duration Mean shedding
shedding of nasal duration of Group Animal recorded recorded
shedding (days) group (days) 1 1 6 6 1 1, 4 2 4 6 2 3 5 5 1 4 -- --
0 5 6 9 3 2 6 4 8 5 4, 4 7 4 7 4 8 4 7 4 9 4 7 4 10 4 8 5
[0149] EDTA blood was sampled daily up to day 10 post infection
with B-346-d and B-WT, respectively. 0.2 ml of blood were added to
each of 3 cultures of calf testis (Cte) cells with medium
containing heparin (1 unit/ml to prevent clotting). After overnight
incubation inoculum/medium was replaced with fresh medium without
heparin. After incubation for 4 to 6 days, BVDV infected cells were
detected by immuneflorescence with a polyclonal serum specific for
BVDV.
[0150] Negative cultures were frozen and subsequently thawed. 0.2
ml thereof were passed to a second passage on Cte cells to confirm
the absence of BVDV. TABLE-US-00014 TABLE 7c Virus shedding in
nasal fluid: First day Final day Number of nasal nasal days virus
Mean number of shedding shedding detected in days detected Group
Animal recorded recorded exudate virus per group 1 1 4 8 4 2, 6 2 6
6 1 3 4 4 1 4 5 7 3 5 3 6 4 2 6 6 8 3 3, 6 7 5 7 3 8 5 8 4 9 5 6 2
10 3 9 6
[0151] Nasal exudate was centrifuged (1000 g) to remove gross
debris and contaminants. Supernatant fluid was removed and 0,2 ml
were seeded to each of three cell cultures. After overnight
incubation the inoculum/medium was replaced with 2 ml of fresh
medium. After incubation for 4-6 days, BVDV infected cells were
detected by immunofluorescence with a polyclonal serum specific for
BVDV. TABLE-US-00015 TABLE 7d Mean rectal temperatures of groups 1
and 3 Day of study: -2 -1 0 1 2 3 4 5 6 7 8 9 10 12 14 Group 1 38.4
38.6 38.5 38.5 38.6 38.4 38.4 38.4 38.3 38.4 38.4 38.4 38.4 38.4
38.5 Group 3 38.8 39.1 38.8 39.1 39.4 39.7 40.2 40.2 40.4 41.3 40.2
40.1 40.2 40.8 40.4
[0152] Rectal temperatures were recorded up to 16 days after
challenge infection. Animals of group 1 and 3 were infected by
6.times.10.sup.6 TCID.sub.50 of the virulent BVDV isolate #13.
TABLE-US-00016 TABLE 7e Mean white blood cell counts Day of study:
-2 -1 0 1 2 3 4 5 6 7 8 9 10 12 14 Group 1 11.9 11.9 11.3 10.8 9.2
8.2 8.9 9.9 11.2 11.6 11.6 10.6 10.8 10.8 9.4 Group 3 11.7 15.8
13.8 11.1 7.7 9.8 7.4 6.8 7.5 8.7 7.0 8.1 6.2 6.4 6.2
[0153] EDTA blood cell sampeles were taken daily from day -2 to 14
post challenge from each animal in both groups. Counts of white
blood cells in EDTA blood samples were determined using a Sysmex
Micro-Cell Counter F800. TABLE-US-00017 TABLE 7f BVDV isolated from
blood samples First Recorded day virus Final day virus duration of
Mean detected in detected in virus in blood duration Group Animal
blood blood (days) (days) 1 1 -- -- 0 0 2 -- -- 0 3 -- -- 0 4 -- --
0 5 -- -- 0 3 11 3 10 8 9.7 12 3 14 12 13 3 9 9
[0154] EDTA blood was sampled daily up to day 10 post challenge.
0.2 ml of blood were added to each of 3 cultures of calf testis
(Cte) cells with medium containing heparin (1unit/ml to prevent
clotting). After overnight incubation inoculum/medium was replaced
with fresh medium without heparin. After incubation for 4 to 6 days
cells BVDV infected cells were detected by immunefluoreszence with
a polyclonal serum specific for BVDV.
[0155] Negative cultures were frozen and subsequently thawed. 0.2
ml thereof were passed to a second passage on Cte cells to confirm
the absence of BVDV. TABLE-US-00018 TABLE 7g Virus shedding in
nasal fluid First Final Mean day nasal day nasal Recorded duration
shedding shedding duration of nasal (days, Group Animal recorded
recorded shedding (days) per group) 1 1 3 4 2 0.8 2 -- -- 0 3 -- --
0 4 -- -- 0 5 4 5 2 3 11 3 14 12 10 12 3 14 12 13 3 8 6
[0156] Nasal exudat was centrifuged (1000 g) to remove gross debris
and contaminants. Supernatant fluid was removed and 0,2 ml thereof
were seeded to each of three cell cultures. After overnight
incubation the inoculum/medium was replaced with 2 ml of fresh
medium. After incubation for 4-6 days BVDV infected cells were
detected by immunofluorescence with a polyclonal serum specific for
BVDV.
Example 8
Discrimination between C-346-d and CSFV without Deletion of the
Histidine Codon 346 by RT-PCR
[0157] The RNA sequence coding for the conserved RNase motif in
CSFV glycoprotein E.sup.RNS is highly conserved. Among all known
CSFV sequences no nucleotide exchanges were found in the region
corresponding to residues 1387 to 1416 of the published sequence of
the CSFV Alfort strain (Meyers et al., 1987). Thus, oligonucleotide
primers derived from this conserved region of the genome can be
used in an RT-PCR assay for detection of all CSFV isolates (see
FIG. 7). In consequence, the absence of the triplet coding for
histidine 346 (nucleotides 1399-1401) could be detected by an
RT-PCR assay with an appropriately designed primer. Different
oligonucleotides covering the conserved region were synthesized
that either contained the histidine codon or not. These
oligonucleotides served as upstream primers in RT-PCR reactions
with oligonucleotide E.sup.RNS-Stop as downstream primer. RNA
purified from tissue culture cells infected with C-346-d, C-WT,
C-346-L or C-346-K, respectively, were used as templates. Reverse
transcription of 2 .mu.g heat denatured RNA (2 min 92.degree. C., 5
min on ice in 11.5 .mu.l of water in the presence of 30 pMol
reverse primer) was done after addition of 8 .mu.l RT mix (125 mM
Tris/HCl pH 8.3, 182.5 mM KCl, 7.5 mM MgCl.sub.2, 25 mM
dithiothreitol, 1.25 mM of each dATP, dTTP, dCTP, dGTP), 15 U of
RNAguard (Pharmacia, Freiburg, Germany) and 50 U of Superscript
(Life Technologies/BRL, Eggenstein, Germany) for 45 min at
37.degree. C. After finishing reverse transcription, the tubes were
placed on ice and 30 .mu.l of PCR mix (8.3 mM Tris/HCl, pH8.3; 33.3
mM KCl; 2.2 mM MgCl.sub.2; 0.42 mM of each dATP, dTTP, dCTP, dGTP;
0.17% TritonX100; 0.03% bovine serum albumine; 5 U of Taq
polymerase (Appligene, Heidelberg, Germany) and 16.7% DMSO) were
added. When primer OI H+3 was used, the reaction mix for
amplification contained no DMSO. Amplification was carried out in
36 cycles (30 sec 94.degree. C.; 30 sec 57.degree. C.; 45 sec
74.degree. C.) 1 .mu.l of amplification reaction was loaded on a 1%
agarose gel, the amplified products were separated by
electrophoresis, and stained with ethidium bromide. As demonstrated
in FIG. 7, primer pair OI H-3/01 E.sup.msStop allowed to
specifically amplify a band derived from RNA containing the
deletion of codon 346 whereas with the other two primer
combinations products containing codon 346 were amplified and no
band was observed when the RNA with the deletion of this codon was
used as a template.
[0158] Primers for RT-PCR: TABLE-US-00019 upstream: Ol H - 3:
TGGAACAAAGGATGGTGT Ol H + 2: TGGAACAAAGATGGATGG Ol H + 3:
GAATGGAACAAACATGGA downstream: Ol E.sup.msStop:
GGAATTCTCAGGCATAGGCACCAAACCAGG
Figure Legends
[0159] FIG. 1: The First 495 Amino Acids as Expressed by the Alfort
Strain of CSFV
[0160] The sequence listing shows the first 495 amino acids as
expressed by the Alfort strain of CSFV (Meyers et al., 1989). One
monomer of the glycoprotein E.sup.RNS of said strain corresponds to
the amino acids 268 to 494 as described by Romenapf et al. (1993).
Residues 295 to 307 and 338 to 357 representing the regions showing
homology to plant and fungal RNases (Schneider et al., 1993) are
underlined.
[0161] FIG. 2: Rectal Temperature Curve of Animals after Test
Infection
[0162] Daily rectal temperature was recorded from day 2 before till
day 18 post infection. Rectal temperature curve is detailed for
each animal of the group infected with the virus V(pA/CSFV)
(continuous line) derived from plasmid pA/CSFV or with the virus
V(pA/C-346-d) derived from plasmid pA/C-346-d (dotted line).
[0163] FIG. 3: Rectal Temperature Curve of Animals after Challenge
Infection
[0164] Daily rectal temperature was recorded at days 1-21 post
challenge virus infection. Animals challenged with a lethal dosis
of the CSFV challenge strain Eystrup had been infected with mutant
C-346-d [V(pA/C-346-d)] 69 days in before as detailed in the text.
Rectal temperature curve is detailed for each animal of the group
challenged with 2.times.10.sup.5 TCID.sub.50 from the CSFV
challenge strain Eystrup
[0165] FIG. 4: Rectal Temperature Curve of Animals after Test
Infection
[0166] Daily rectal temperature was recorded at days 0-18 post
infection. Rectal temperature curve is detailed for each animal of
the two groups infected either with C-346-d [V(pA/C-346-d)] (dotted
line) or with the restored virus C-346-d/RS [V(pA/C-346-d/Rs)]
(continuous line).
[0167] FIG. 5: Rectal Temperature after Challenge Infection Animal
Experiment #2
[0168] Daily rectal temperature was recorded at days 1-10 post
challenge virus infection. Animals challenged with a lethal dose
(2.times.10.sup.5 TCID.sub.50) of the CSFV challenge strain Eystrup
had been infected with mutant C-346-d 37 days in before.
[0169] FIG. 6: Rectal Temperature of Animals Treated with a Double
Mutant According to Example 6
[0170] Daily rectal temperature was recorded prior and post
challenge virus infection with mutant V(pA/C-297-U346-L).
[0171] FIG. 7: Discrimination between C-346-d and CSFV without
Deletion of the Histidine Codon 346 by RT-PCR according to Example
8
[0172] a) Primer pair Ol H-3/01 E.sup.msStop allows to specifically
amplify a band derived from RNA containing the deletion of codon
346 (C-346-d) as described in detail in example 8. In contrast,
RNA, not containing said deletion does not interact with said
primer pair (C-WT, C-346-L, C-346-K).
[0173] b) And c) The other two primer combinations (OI H+2 and OI
H+3) amplify bands derived from RNA that do not contain the
deletion of codon 346 (OI H+2 and OI H+3). No band can be observed
when RNA from the 346-deletion mutant C-346-d is used as a
template.
Sequence CWU 1
1
34 1 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 1 aggagcttac ttgggatctg 20 2 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 2 ggaacaaact tggatggtgt
20 3 24 DNA Artificial Sequence Description of Artificial Sequence
Primer 3 acaggagctt aaaagggatc tggc 24 4 24 DNA Artificial Sequence
Description of Artificial Sequence Primer 4 atggaacaaa aagggatggt
gtaa 24 5 24 DNA Artificial Sequence Description of Artificial
Sequence Primer 5 gaatggaaca aaggatggtg taac 24 6 30 DNA Artificial
Sequence Description of Artificial Sequence Primer 6 catgaatgga
acaaaggttg gtgcaactgg 30 7 11 PRT Artificial Sequence Description
of Artificial Sequence Introduced Sequence in RNase motif 7 Ser Leu
His Gly Ile Trp Pro Glu Lys Ile Cys 1 5 10 8 12 PRT Artificial
Sequence Description of Artificial Sequence Introduced Sequence in
RNase motif 8 Arg His Glu Trp Asn Lys His Gly Trp Cys Asn Trp 1 5
10 9 11 PRT Artificial Sequence Description of Artificial Sequence
Introduced Sequence in RNase motif 9 Ser Leu Leu Gly Ile Trp Pro
Glu Lys Ile Cys 1 5 10 10 12 PRT Artificial Sequence Description of
Artificial Sequence Introduced Sequence in RNase motif 10 Arg His
Glu Trp Asn Lys Leu Gly Trp Cys Asn Trp 1 5 10 11 11 PRT Artificial
Sequence Description of Artificial Sequence Introduced Sequence in
RNase motif 11 Ser Leu Lys Gly Ile Trp Pro Glu Lys Ile Cys 1 5 10
12 12 PRT Artificial Sequence Description of Artificial Sequence
Introduced Sequence in RNase motif 12 Arg His Glu Trp Asn Lys Lys
Gly Trp Cys Asn Trp 1 5 10 13 11 PRT Artificial Sequence UNSURE (3)
Description of Artificial Sequence Introduced Sequence in RNase
motif 13 Ser Leu Xaa Gly Ile Trp Pro Glu Lys Ile Cys 1 5 10 14 12
PRT Artificial Sequence UNSURE (7) Description of Artificial
Sequence Introduced Sequence in RNase motif 14 Arg His Glu Trp Asn
Lys Xaa Gly Trp Cys Asn Trp 1 5 10 15 11 PRT Artificial Sequence
UNSURE (2)..(4) Description of Artificial Sequence Introduced
Sequence in RNase motif 15 Ser Xaa Xaa Xaa Ile Trp Pro Glu Lys Ile
Cys 1 5 10 16 12 PRT Artificial Sequence UNSURE (6)..(8)
Description of Artificial Sequence Introduced Sequence in RNase
motif 16 Arg His Glu Trp Asn Xaa Xaa Xaa Trp Cys Asn Trp 1 5 10 17
12 PRT Artificial Sequence UNSURE (6)..(7) Description of
Artificial Sequence Introduced Sequence in RNase motif 17 Arg His
Glu Trp Asn Xaa Xaa Gly Trp Cys Asn Trp 1 5 10 18 12 PRT Artificial
Sequence UNSURE (7)..(8) Description of Artificial Sequence
Introduced Sequence in RNase motif 18 Arg His Glu Trp Asn Lys Xaa
Xaa Trp Cys Asn Trp 1 5 10 19 12 PRT Artificial Sequence UNSURE (3)
Description of Artificial Sequence Introduced Sequence in RNase
motif 19 Arg His Xaa Trp Asn Lys His Gly Trp Cys Asn Trp 1 5 10 20
12 PRT Artificial Sequence UNSURE (3) UNSURE (7) Description of
Artificial Sequence Introduced Sequence in RNase motif 20 Arg His
Xaa Trp Asn Lys Xaa Gly Trp Cys Asn Trp 1 5 10 21 11 PRT Artificial
Sequence UNSURE (7) Description of Artificial Sequence Introduced
Sequence in RNase motif 21 Ser Leu His Gly Ile Trp Xaa Glu Lys Ile
Cys 1 5 10 22 11 PRT Artificial Sequence Description of Artificial
Sequence Introduced Sequence in RNase motif 22 Gly Leu His Gly Ile
Trp Pro Glu Lys Ile Cys 1 5 10 23 11 PRT Artificial Sequence
Description of Artificial Sequence Introduced Sequence in RNase
motif 23 Ser Leu His Gly Ile Gly Pro Glu Lys Ile Cys 1 5 10 24 11
PRT Artificial Sequence Description of Artificial Sequence
Introduced Sequence in RNase motif 24 Ser Leu His Gly Ile Trp Pro
Ala Lys Ile Cys 1 5 10 25 11 PRT Artificial Sequence Description of
Artificial Sequence Introduced Sequence in RNase motif 25 Ser Leu
His Gly Ile Trp Pro Glu Lys Ile Gly 1 5 10 26 11 PRT Artificial
Sequence Description of Artificial Sequence Introduced Sequence in
RNase motif 26 Ser Leu His Gly Ile Gly Pro Ala Lys Ile Cys 1 5 10
27 12 PRT Artificial Sequence Description of Artificial Sequence
Introduced Sequence in RNase motif 27 Gly His Glu Trp Asn Lys His
Gly Trp Cys Asn Trp 1 5 10 28 12 PRT Artificial Sequence
Description of Artificial Sequence Introduced Sequence in RNase
motif 28 Arg His Glu Gly Asn Lys His Gly Trp Cys Asn Trp 1 5 10 29
12 PRT Artificial Sequence Description of Artificial Sequence
Introduced Sequence in RNase motif 29 Arg His Glu Trp Asn Ala His
Gly Trp Cys Asn Trp 1 5 10 30 18 DNA Artificial Sequence
Description of Artificial Sequence Primer 30 tggaacaaag gatggtgt 18
31 18 DNA Artificial Sequence Description of Artificial Sequence
Primer 31 tggaacaaac atggatgg 18 32 18 DNA Artificial Sequence
Description of Artificial Sequence Primer 32 gaatggaaca aacatgga 18
33 30 DNA Artificial Sequence Description of Artificial Sequence
Primer 33 ggaattctca ggcataggca ccaaaccagg 30 34 495 PRT Classical
swine fever virus (CSFV) 34 Met Glu Leu Asn His Phe Glu Leu Leu Tyr
Lys Thr Ser Lys Gln Lys 1 5 10 15 Pro Val Gly Val Glu Glu Pro Val
Tyr Asp Thr Ala Gly Arg Pro Leu 20 25 30 Phe Gly Asn Pro Ser Glu
Val His Pro Gln Ser Thr Leu Lys Leu Pro 35 40 45 His Asp Arg Gly
Arg Gly Asp Ile Arg Thr Thr Leu Arg Asp Leu Pro 50 55 60 Arg Lys
Gly Asp Cys Arg Ser Gly Asn His Leu Gly Pro Val Ser Gly 65 70 75 80
Ile Tyr Ile Lys Pro Gly Pro Val Tyr Tyr Gln Asp Tyr Thr Gly Pro 85
90 95 Val Tyr His Arg Ala Pro Leu Glu Phe Phe Asp Glu Ala Gln Phe
Cys 100 105 110 Glu Val Thr Lys Arg Ile Gly Arg Val Thr Gly Ser Asp
Gly Lys Leu 115 120 125 Tyr His Ile Tyr Val Cys Val Asp Gly Cys Ile
Leu Leu Lys Leu Ala 130 135 140 Lys Arg Gly Thr Pro Arg Thr Leu Lys
Trp Ile Arg Asn Phe Thr Asn 145 150 155 160 Cys Pro Leu Trp Val Thr
Ser Cys Ser Asp Asp Gly Ala Ser Gly Ser 165 170 175 Lys Asp Lys Lys
Pro Asp Arg Met Asn Lys Gly Lys Leu Lys Ile Ala 180 185 190 Pro Arg
Glu His Glu Lys Asp Ser Lys Thr Lys Pro Pro Asp Ala Thr 195 200 205
Ile Val Val Glu Gly Val Lys Tyr Gln Ile Lys Lys Lys Gly Lys Val 210
215 220 Lys Gly Lys Asn Thr Gln Asp Gly Leu Tyr His Asn Lys Asn Lys
Pro 225 230 235 240 Pro Glu Ser Arg Lys Lys Leu Glu Lys Ala Leu Leu
Ala Trp Ala Val 245 250 255 Ile Thr Ile Leu Leu Tyr Gln Pro Val Ala
Ala Glu Asn Ile Thr Gln 260 265 270 Trp Asn Leu Ser Asp Asn Gly Thr
Asn Gly Ile Gln Arg Ala Met Tyr 275 280 285 Leu Arg Gly Val Asn Arg
Ser Leu His Gly Ile Trp Pro Glu Lys Ile 290 295 300 Cys Lys Gly Val
Pro Thr His Leu Ala Thr Asp Thr Glu Leu Lys Glu 305 310 315 320 Ile
Arg Gly Met Met Asp Ala Ser Glu Arg Thr Asn Tyr Thr Cys Cys 325 330
335 Arg Leu Gln Arg His Glu Trp Asn Lys His Gly Trp Cys Asn Trp Tyr
340 345 350 Asn Ile Asp Pro Trp Ile Gln Leu Met Asn Arg Thr Gln Thr
Asn Leu 355 360 365 Thr Glu Gly Pro Pro Asp Lys Glu Cys Ala Val Thr
Cys Arg Tyr Asp 370 375 380 Lys Asn Thr Asp Val Asn Val Val Thr Gln
Ala Arg Asn Arg Pro Thr 385 390 395 400 Thr Leu Thr Gly Cys Lys Lys
Gly Lys Asn Phe Ser Phe Ala Gly Thr 405 410 415 Val Ile Glu Gly Pro
Cys Asn Phe Asn Val Ser Val Glu Asp Ile Leu 420 425 430 Tyr Gly Asp
His Glu Cys Gly Ser Leu Leu Gln Asp Thr Ala Leu Tyr 435 440 445 Leu
Leu Asp Gly Met Thr Asn Thr Ile Glu Asn Ala Arg Gln Gly Ala 450 455
460 Ala Arg Val Thr Ser Trp Leu Gly Arg Gln Leu Ser Thr Ala Gly Lys
465 470 475 480 Lys Leu Glu Arg Arg Ser Lys Thr Trp Phe Gly Ala Tyr
Ala Leu 485 490 495
* * * * *