U.S. patent application number 10/757832 was filed with the patent office on 2006-02-02 for murine calicivirus.
This patent application is currently assigned to Washington University. Invention is credited to Herbert W. Virgin.
Application Number | 20060024319 10/757832 |
Document ID | / |
Family ID | 34794769 |
Filed Date | 2006-02-02 |
United States Patent
Application |
20060024319 |
Kind Code |
A2 |
Virgin; Herbert W. |
February 2, 2006 |
Murine Calicivirus
Abstract
Abstract of the Disclosure The invention disclosed herein
relates to a newly discovered murine norovirus, and compositions
and methods related thereto.
Inventors: |
Virgin; Herbert W.; (St.
Louis, MO) |
Correspondence
Address: |
SONNENSCHEIN NATH & ROSENTHAL LLP
P.O. BOX 061080
WACKER DRIVE STATION, SEARS TOWER
CHICAGO
IL
60606-1080
US
|
Assignee: |
Washington University
One Brookings Drive
St. Louis
MO
63130
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20050037016 A1 |
February 17, 2005 |
|
|
Family ID: |
34794769 |
Appl. No.: |
10/757832 |
Filed: |
January 14, 2004 |
Current U.S.
Class: |
424/186.1;
435/235.1; 435/320.1; 435/325; 435/456; 435/69.3; 530/350;
536/23.72 |
Current CPC
Class: |
C12N 7/00 20130101; C07K
14/005 20130101; A61K 39/00 20130101; C12N 2770/16022 20130101;
C12N 2770/16021 20130101; C12N 2770/16023 20130101; A61K 2039/5258
20130101 |
Class at
Publication: |
424/186.1;
435/069.3; 435/320.1; 435/325; 435/456; 435/235.1; 530/350;
536/023.72 |
International
Class: |
A61K 39/12 20060101
A61K039/12; C07H 21/04 20060101 C07H021/04; C07K 14/005 20060101
C07K014/005; C12N 15/86 20060101 C12N015/86 |
Claims
1. (canceled).
2. (canceled).
3. (canceled).
4. (canceled).
5. (canceled).
6. (canceled).
7. (canceled).
8. (canceled).
9. (canceled).
10. (canceled).
11. (canceled).
12. (amended) An isolated polypeptide comprising an amino acid
sequence at least 80% identical to a sequence selected from the
group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, and
wherein said amino acid sequence is a murine norovirus
sequence.
13. (amended) The isolated polypeptide of claim 12, wherein the
sequence is at least 95% identical to a sequence selected from the
group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.
14. (amended) The isolated polypeptide of claim 12 wherein the
sequence consists of a sequence selected from the group consisting
of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.
15. (canceled).
16. (canceled).
17. (canceled).
18. (canceled).
19. (canceled).
20. (canceled).
21. (canceled).
22. (canceled).
23. (canceled).
24. (canceled).
25. (canceled).
26. (canceled).
27. (canceled).
28. (canceled).
29. (canceled).
30. (canceled).
31. (canceled).
32. (canceled).
33. (canceled).
34. (canceled).
35. (canceled).
36. (new) A method for determining presence, absence or quantity of
antibody against MNV-1 in a fluid or tissue sample of a mouse, the
method comprising: a) contacting the fluid or tissue sample with at
least one MNV-1 polypeptide; and b) detecting binding of the at
least one MNV-1 polypeptide to antibody against MNV-1 if present in
the sample.
37. (new) A method in accordance with claim 36, wherein detecting
binding comprises detecting MNV-1 antibody bound to the at least
one MNV-1 polypeptide with a labeled antibody that detects presence
of mouse antibody.
38. (new) A method in accordance with claim 36, wherein the at
least one MNV-1 polypeptide is immobilized on a solid immunosorbent
surface.
39. (new) A method in accordance with claim 36, wherein the solid
immunosorbent surface is an ELISA plate.
40. (new) A method in accordance with claim 36, wherein the fluid
or tissue sample of the mouse is selected from the group consisting
of a serum sample, a saliva sample, a feces sample and a tissue
sample of the mouse.
41. (new) A method in accordance with claim 36, wherein the fluid
or tissue sample of the mouse is a serum sample of the mouse.
42. (new) A method in accordance with claim 36, wherein the at
least one MNV-1 polypeptide comprises at least 20 contiguous amino
acids of the at least one MNV-1 polypeptide.
43. (new) A method in accordance with claim 36, wherein the at
least one MNV-1 polypeptide is an MNV-1 capsid protein.
44. (new) A method in accordance with claim 36, wherein the at
least one MNV-1 polypeptide comprises at least one epitope of an
MNV-1 protein.
45. (new) A method in accordance with claim 36, wherein detecting
antibodies against MNV-1 in a fluid or tissue sample of a mouse
comprises detecting seroconversion for MNV-1 in the mouse.
46. (new) An assay surface for detecting antibody against MNV-1,
comprising at least one MNV-1 polypeptide immobilized on an
immunosorbent surface.
47. (new) The assay surface in accordance with claim 46, wherein
the at least one MNV-1 polypeptide has a sequence selected from the
group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:
4.
48. (new) The assay surface in accordance with claim 46, wherein
the immunosorbent surface is an ELISA plate.
49. (new) A method of making an assay surface for detecting
antibody against MNV-1, the method comprising immobilizing at least
one MNV-1 polypeptide on an immunosorbent surface.
50. (new) A method of making an assay surface in accordance with
claim 49, wherein the immunosorbent surface is an ELISA plate.
51. (new) A method of making an assay surface in accordance with
claim 49, further comprising expressing the at least one MNV-1
polypeptide in cells.
52. (new) A method of making an assay surface in accordance with
claim 48, further comprising transforming or transfecting the cells
with at least one MNV-1 polynucleotide encoding the at least one
MNV-1 polypeptide.
53. (new) A method of making an assay surface in accordance with
claim 49, further comprising cloning at least one of the
transformed or transfected cells.
54. (new) A method of making an assay surface in accordance with
claim 49, wherein the MNV-1 polypeptide comprises at least 20
contiguous amino acids of an MNV-1 protein having an amino acid
sequence selected from the group consisting of SEQ ID NO:2, SEQ ID
NO: 3 and SEQ ID NO: 4.
55. (new) A method of making an assay surface in accordance with
claim 49, wherein the MNV-1 polypeptide is an MNV-1 capsid
protein.
56. (new) A method of making an assay surface in accordance with
claim 55, wherein the MNV-1 polypeptide comprises at least one
epitope of the MNV-1 capsid protein.
57. (new) A kit for detecting seroconversion comprising an MNV-1
polypeptide immobilized on a solid surface.
58. (new) A kit for detecting seroconversion in accordance with
claim 57, further comprising reagents for detecting binding of the
MNV-polypeptide with MNV-1 antibody if present in a sample.
59. (new) A kit for detecting seroconversion in accordance with
claim 57, wherein the solid surface is an ELISA plate.
60. (new) A method for determining presence, absence or quantity of
MNV-1 in a fluid or organ sample of a mouse, the method comprising:
a) synthesizing cDNA from RNA comprised by the fluid or organ
sample; and b) detecting MNV-1 cDNA by a PCR assay if MNV-1 is
present in the sample.
61. (new) A method in accordance with claim 60, wherein the PCR
assay is selected from the group consisting of a real time PCR
assay and a nested PCR assay.
62. (new) A method in accordance with claim 60, wherein the PCR
assay uses at least one sense primer and at least one antisense
primer, wherein the sequence of the sense primer is selected from
the group consisting of SEQ ID NO:15, SEQ ID NO:17 and SEQ ID
NO:19, and the sequence of the antisense primer is selected from
the group consisting of SEQ ID NO:16, SEQ ID NO:18 and SEQ ID
NO:20.
Description
Detailed Description of the Invention
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of priority to Provisional
U.S. Patent Application Ser. No. 60/440,016, filed Jan. 14, 2003,
which application is hereby incorporated herein by reference in its
entirety.
REFERENCE TO GOVERNMENT GRANT
[0002] This invention was made with government support under Grant
No. RO1 A149286. The United States government may have certain
rights in the invention.
BACKGROUND
[0003] The Caliciviridae are a family of positive-sense,
single-stranded RNA viruses with a 7-8 kb genome that are divided
into 4 distinct genera and further subdivided into genogroups. The
genera Norwalk-like viruses, together with the closely related
Sapporo-like viruses, recently renamed Noroviruses and Sapoviruses
(Mayo, M. A., Arch. Virol. 147:1655-1656, 2002), make up human
caliciviruses (Kapikian, A. Z. et al., J. Virol. 10: 1075-1081,
1972; Jiang, X. et al., Science 250:1580-1583, 1990; Jiang, X. et
al., Virol. 195:51-61, 1993; Hardy, M. E. et al., Virus Genes
12:287-290, 1996). Noroviruses are responsible for more than 90% of
all cases of non-bacterial epidemic gastroenteritis (Kapikian et
al., 1972; Kapikian, A. Z. et al., Chapter 25 in Fields Virology,
Fields, B. N. et al., Eds., 1996; Pang, X. L. et al., Pediatr.
Infect. Dis. J. 18:420-426, 1999; Pang, X. L. et al., J. Infect.
Dis. 181 (Supp. 2): S288-S294, 2000; Fankhauser, R. L. et al., J.
Infect. Dis. 178:1571-1578, 1998; Glass, R. I. et al., J. Infect.
Dis. 181(Supp. 2): S254-S261, 2000; Hedlund, K. O. et al., J.
Infect. Dis. 181(Supp. 2): S275-S280, 2000; Koopmans, M. et al., J.
Infect. Dis. 181(Supp. 2): S262-S269, 2000; Inouye, S. et al., J.
Infect. Dis. 181(Supp. 2): S270-S274, 2000). There are no current
therapeutic drugs or vaccines for these important human pathogens.
Sapoviruses are typically associated with sporadic cases of
pediatric gastroenteritis (Pang et al., 1999; Pang et al., 2000).
Two other calicivirus genera, Vesiviruses and Lagoviruses, contain
animal viruses exclusively. Calicivirus genomes typically contain a
large 5' open reading frame (ORF1) encoding a nonstructural
polyprotein, followed by ORF2 encoding a single capsid protein.
ORF2 is either in frame with ORF1 or present as an independent ORF.
While the 5' end of ORF1 shows extensive sequence diversity, the
remainder of ORF1 contains motifs arranged in a specific order
conserved between caliciviruses and picornaviruses. ORF3, encoding
a basic protein, is present at the 3' end of the genome preceding a
poly-A tract (Clarke, I. N. et al., J. Infect. Dis. 181(Supp. 2):
S309-S316, 2000).
DESCRIPTION OF THE FIGURES
[0004] FIG. 1: Passage of a new pathogen by intracranial
inoculation in RAG/STAT-/- and IFN.alpha..beta..gamma.R-/-
mice.
[0005] The unknown pathogen was passaged into RAG/STAT-/- and
IFN.alpha..beta..gamma.R-/- mice and caused lethal disease within
30 days of inoculation (A), characterized histologically by
meningitis (C), vasculitis of the cerebral vessel (D), and
encephalitis (E) compared to mock-infected brain (B). (B,
C)RAG/STAT-/- mice; (D, E) IFN.alpha..beta..gamma.R-/- mice. Brain
homogenate from an infected RAG/STAT-/- mouse was passed into 129
wild-type mice (A) and sera of these mice harvested 35 days later
tested negative for mycoplasma, Sendai virus, reovirus type 3,
Theiler's mouse encephalomyelitis virus (GDVII strain), lymphocytic
choriomeningitis virus, pneumonia virus of mice, minute virus of
mice, mouse hepatitis virus, ectromelia virus, epizootic diarrhea
of infant mice, mouse cytomegalovirus, polyoma virus, K virus,
orphan parvovirus, and mouse adenovirus.
[0006] FIG. 2: Sequencing and phylogenetic analysis of the MNV-1
genome.
[0007] A) Double-stranded cDNA (dsDNA) from the brain of an
infected IFN.alpha..beta..gamma.R-/- mouse at passage 2 (FIG. 1)
was prepared, digested with restriction enzymes, and ligated to
adaptors containing PCR primer sequences to generate "tester"
nucleic acids. dsDNA lacking linkers was prepared concurrently from
a control brain to generate "driver" nucleic acids. Serial rounds
of subtractive hybridization of tester in the presence of excess
driver followed by PCR amplification of tester-specific sequences
were performed to generate difference products (DP) one through
four (DP1-DP4). DP3 and DP4 were cloned into pGEMT (Promega,
Madison, Wis.), sequenced, analyzed using BLAST, and clones (1-8,
FIG. 2A) homologous, but not identical, to calicivirus sequences
were identified that spanned the Norwalk virus genome. Sequences
within RDA clones (indicated by asterisks) were used to clone and
sequence five fragments (a', b', c', d', e', FIG. 2A) of the MNV-1
genome after PCR or 5' and 3' RACE (Marathon cDNA amplification
kit, Clontech, Palo Alto, Calif.). The 5' end of the genome was
difficult to clone and consequently the first 15 nucleotides are
based on a single sequence, while the remaining sequence has at
least a 10-fold redundancy. This may explain why there is no start
codon close to the 5' end as is expected based on comparison with
other Noroviruses. B) Schematic of the final 7726 bp MNV-1 genome
sequence with predicted open reading frames (ORFs). The locations
of amino acid motifs in ORF1 are indicated: 2C helicase: GXXGXGKT
(SEQ ID NO: 50); 3C protease: GDCG (SEQ ID NO: 51); 3D polymerase:
KDEL (SEQ ID NO: 52), GLPS(SEQ ID NO: 53), YGDD (SEQ ID NO: 54).
The putative S and P domains of the ORF2 encoded capsid protein
were identified based on sequence alignments with Norwalk virus.
AAA: 3' poly-A tail. C) Alignment of the complete MNV-1 genome with
complete genomes of representative members of the four
Caliciviridae genera and members of the most closely related virus
family, the Picornaviridae. Specific members were chosen based on
the 2000 taxonomy study by Green et al. (J Infect Dis '00 v. 81 p.
S322). D) Alignment of the capsid protein sequence of MNV-1, done
as in C. Note that the alignments in C and D were confirmed using
other algorithms (data not presented).
[0008] FIG. 3: Sequence variability of MNV-1. A) All variable
nucleotides within ORF1 and ORF2, based on sequence analysis of
multiple clones of the entire MNV-1 genome, are depicted. These
nucleotides had 20% or less variability between clones. B)
Sequences of individual clones spanning nucleotides 1767 to 1893
(solid box on ORF1 in panel A), with variable positions highlighted
with arrowheads SEQ ID Nos: 21-48). The consensus sequence of MNV-1
is shown at the bottom (bold type) (SEQ ID NO:49), with variable
nucleotides highlighted by arrowheads.
[0009] FIG. 4: Purification and pathogenicity of MNV-1.
[0010] MNV-1 was purified from an infected
IFN.alpha..beta..gamma.R-/- mouse brain homogenate by CsCl density
gradient centrifugation. As a control, mock-infected mouse brain
homogenates were processed similarly. (A) Determination of the
average buoyant density of genome-containing MNV-1 particles.
Dialyzed gradient fractions were analyzed by MNV-1 specific RT-PCR
(Titanium one-step RT-PCR kit, Clontech, Palo Alto, Calif.) and
products were separated on a 1% agarose gel. Primers were chosen in
ORF1 to yield an expected product of 184 bp (indicated by the
asterisk). (B) MNV-1 virions visualized by EM. Samples were
absorbed onto formvar/carbon-coated grids for 1 min. The grids were
washed in dH2O, stained with 2% aqueous uranyl acetate (Ted Pella
Inc., Redding, Calif.) for 1 min, and air dried prior to viewing on
a JEOL 1200EX transmission electron microscope (JEOL USA, Peabody,
Mass.). (C) Survival of RAG/STAT-/- mice infected i.c. with
unpurified, or purified MNV-1, as well as gradient fractions from
mock-infected brain. The P values for mock versus infected mice are
indicated. Statistical analyses were performed using GraphPad Prism
software.
[0011] FIG. 5: IFN.alpha..beta. or IFN.gamma. receptors and STAT1
are required to protect from lethal MNV-1 challenge.
[0012] A MNV-1 stock was prepared as a brain homogenate from 17
IFN.alpha..beta..gamma.R-/- mice inoculated i.c. three days
previously with brain homogenate from a passage 2 (FIG. 1) mouse.
Infected brains were homogenized in sterile PBS and filtered
through a 0.2 .mu.m filter. Brains from five
IFN.alpha..beta..gamma.R-/- mice inoculated i.c. with uninfected
brain tissue were used to generate a mock virus stock. Mice of
various strains were inoculated with MNV-1 or mock-inoculated using
10 .mu.l intracerebrally (ic), 25 .mu.l intranasally (in), or 25
.mu.l perorally (po). A number of mouse strains did not show
increased mortality compared to wild-type 129 controls (A). The
survival after inoculation with MNV-1 or mock virus is shown for
IFN.alpha..beta..gamma.- R-/- mice (B), STAT1-/- mice (C),
RAG/STAT-/- mice (D), and STAT1/PKR-/- mice (E). All p values for
mock versus infected groups were .ltoreq.0.0001 except:
IFN.alpha..beta..gamma.R-/- i.n.: p=0.002; STAT1-/- i.n.: p=0.097;
and STAT1-/- p.o.: p=0.034. Statistical analyses were performed
with GraphPad Prism software.
[0013] FIG. 6: Generation of MNV-1 virus-like particles.
[0014] A) Western blot analysis of cell lysates from High-Five
cells infected with recombinant baculovirus expressing the MNV-1
capsid protein (see Example 9) or a control baculovirus expressing
the LacZ cassette (negative control). Proteins were detected by ECL
Plus after incubation with serum from a MNV-1 infected mouse
followed by a HRP-labeled secondary antibody. The size of the
molecular weight marker is indicated on the right. B)-D) Electron
microscopy of negatively stained VLPs. Supernatants of High-Five
cells infected with a control baculovirus expressing LacZ (B),
recombinant baculovirus expressing the MNV-1 capsid protein (C), or
VLPs purified from these supernatants (D) were stained with uranyl
acetate and photographed at a magnification of 50,000.times.
[0015] FIG. 7: Reactivity of mouse serum against MNV-1 VLP
supernatants or cell lysates by ELISA.
[0016] Supernatants of High-Five cells infected with recombinant
baculovirus expressing the MNV-1 capsid protein or LacZ expressing
control were coated on ELISA plates. A) Analysis of half-log serial
dilutions of serum from MNV-1 infected mice or 129 wild type mice.
B) Analysis of 1:10 dilution of several cages of STAT-/- mice. Each
dot represents one mouse. Reactivity was assessed after incubation
with a HRP-coupled secondary antibody and colorimetric detection at
405 nm. Cages 1, 3, 4, 5 and 6 contained seronegative mice. Cages
2, 7, 8, and 9 contained seropositive mice.
[0017] FIG. 8: Tissue MNV-1 RNA levels after infection via
different routes.
[0018] Four IFN.alpha..beta..gamma.R-/- mice were inoculated with
MNV-1 i.c. (10 .mu.l), p.o. (25 .mu.l), or i.n. (25 .mu.l). Two
mice were sacrificed at both 2 and 7 dpi and lung (Lu), intestine
(Int), brain (Br) and feces were collected. RNA was extracted from
each organ, and cDNA was synthesized and used (5 ng) in triplicate
real time PCR reactions. Primers specific to a 131 nucleotide
region of ORF1 were used (sense=cagtgccagccctcttat (SEQ ID NO:19);
antisense=gtcccttgatgaggagga (SEQ ID NO:20)). Signal was compared
to a standard curve generated using a plasmid containing target
sequences. Triplicate reactions were performed using GAPDH primers
to verify equivalent amounts of starting template (not shown). The
levels of virus RNA as log10 MNV-1 genome copies are shown (open
bars=2 dpi, solid bars=7 dpi, *=undetectable levels).
[0019] FIG. 9: Immunohistochemical staining of spleen secti ns from
MNV-1 infected mouse. Formalin-fixed spleen sections from a
STAT1-/- animal 3 days after p.o. inoculation with MNV-1 were
stained with either immune polyclonal rabbit serum inoculated with
bacterially expressed MNV-1 capsid protein (left panel), or with
the preimmune serum from the same rabbit (right panel).
Immunohistochemistry was performed with the PerkinElmer.TM.
TSA.TM.-Plus DNP (HRP) System, according to the supplied protocol.
Primary antibodies were used at a 1:25 dilution. Positive cells are
indicated by arrows.
[0020] FIG. 10: Single copy sensitivity of MNV-1 cDNA detection by
nested PCR assay. Nested PCR primers specific to a region of MNV-1
ORF2 were designed (outer-sense=gcgcagcgccaaaagccaat (SEQ ID NO:
15); outer-antisense=gagtcctttggcatgctacccagg (SEQ ID NO: 16);
inner-sense=gccgccgggcaaattaacca (SEQ ID NO: 17); and
inner-antisense=ggcttaacccctaccttgccca (SEQ ID NO: 18)). A)
Multiple PCR reactions with either 1 or 10 copies of a plasmid
containing the appropriate region of MNV-1 were performed. 3/4 and
4/4 reactions were positive for 1 and 10 copies, respectively. The
expected size of the PCR product is 153 bp. B) cDNA was generated
from spleen tissue of 10 IFN.alpha..beta..gamma.R-/- mice and 1
.mu.g of each was used in nested PCR reactions (7/10 samples were
positive). All water controls are negative.
DESCRIPTION
[0021] It has been discovered that mice doubly deficient in STAT1
and RAG2 (RAG/STAT) contained an infectious pathogen that caused
severe encephalitis and could be serially passaged by intracerebral
(i.c.) inoculation (FIG. 1). Lethal infection was associated with
encephalitis, vasculitis of the cerebral vessels, meningitis,
hepatitis, and pneumonia (FIG. 1 and data not shown). Disease was
passed by filtered samples, suggesting the presence of a virus
(FIG. 1A). Sera of 129 mice infected with the putative virus tested
negative for an extensive panel of mouse pathogens (see legend of
FIG. 1). Brain homogenate from an infected RAG/STAT-/- mouse was
passed into 129 wild-type or IFN.alpha..beta..gamma.R-/- mice
before and after filtration. A full work-up was performed on mice
from passages 1 and 2, including histopathology, electron
microscopy, standard clinical virology and microbiology work-ups,
as well as special stains of histology sections (GMS, AFB
[acid-fast bacilli], Gram stain). All of these failed to reveal the
nature of the pathogen.
[0022] The pathogen is more virulent in mice lacking both the
interferon .alpha..beta.(IFN.alpha..beta.) and the interferon
.gamma. (IFN.gamma.) receptors (IFN.alpha..beta..gamma.R-/-, 2)
than in wild-type mice (see below) and it passes through a 0.2
.mu.m filter (see above and FIG. 1A). The pathogen does not appear
to cause cytopathic effect on HeLa cells, Vero cells or murine
embryonic fibroblasts (including those lacking IFN receptors or
STAT1). These data suggest that a previously unknown IFN- sensitive
but non-cultivatable pathogen that was <0.2 .mu.m in size was
present in diseased mice.
[0023] Identification and Sequencing
[0024] To identify the new pathogen a previously published
representational difference analysis protocol (RDA) was used (See
Pastorian et al., Anal. Bicochem. 283:89-98 (2000), which is hereby
incorporated in its entirety). Double-stranded cDNA (dsDNA) from
the brain of an infected IFN.alpha..beta..gamma.R-/- mouse at
passage 2 (FIG. 1) was prepared, digested with restriction enzymes,
and ligated to adaptors containing PCR primer sequences (tester)
(see Pastorian protocol for sequences of RDA primers). Control
dsDNA lacking linkers was prepared concurrently from a control
brain (driver). Serial rounds of subtractive hybridization of
tester in the presence of excess driver followed by PCR
amplification of tester-specific sequences were performed to
generate difference products (DP) one through four (DP1-DP4). DP3
and DP4 were cloned and sequenced. Three of 24 clones from DP3 and
ten of 48 clones derived from DP4 had significant homology to
multiple caliciviruses (data not shown). These RDA clones spanned
the Norwalk virus genome (FIG. 2A), but were not identical to any
known full or partial calicivirus sequence, demonstrating that we
had identified a novel calicivirus. This new virus is referred to
herein as murine Norovirus-1 (MNV-1).
[0025] To determine the relationship of MNV-1 to other
caliciviruses, the MNV-1 genome was cloned and sequenced from cDNA
of an infected mouse brain using a combination of 5' and 3' RACE
and PCR (FIG. 2A). Sequencing was performed in both directions with
10-fold redundancy to obtain a consensus sequence with the
exception that the 5' 15 nucleotides were obtained from a single
clone. The assembled genome included 7726 bp of unique sequence
plus a 3' polyA tail, and contained the expected three ORFs
conserved across the Caliciviridae (FIG. 2B). Phylogenetic analysis
using the CLUSTAL W algorithm, and other algorithms including PAUP,
aligning either the complete genome sequence (FIG. 2C) or the
capsid protein sequence (FIG. 2D) of MNV-1 with corresponding
sequences from members of the four calicivirus genera and several
members of the Picornaviridae family revealed that MNV-1 is a
Norovirus that does not cluster within previously identified
genogroups (FIGS. 2C, D)(Green KY JID 181 S322-330). Therefore, it
is proposed that MNV-1 is exemplary of a new Norovirus
genogroup.
[0026] Thus, disclosed herein is a pathogen that infects mice,
referred to herein as Murine Norovirus-1 (MNV-1). MNV-1 is both a
unique norovirus, and is the first member of a new genogroup of
Noroviruses. An exemplary sequence for the MNV-1 virus and
genogroup is provided as SEQ ID NO: 1, which is a consensus
sequence representative of the full length MNV-1 genome as
determined from a series of clones derived by PCR or RACE analysis
from RNA derived from the brain of an infected mouse. Thus, one
embodiment comprises an isolated RNA sequence as shown in SEQ ID
NO: 1. An additional embodiment comprises sequences of MNV-1
isolates that vary from the sequence in SEQ ID NO: 1 by an amount
determined by both sequence analysis and current understanding of
the relatedness of different caliciviruses (see below). One
embodiment comprises the viruses related directly to MNV-1 as viral
quasispecies. Another embodiment comprises other members of the
MNV-1 genogroup of which MNV-1 is the defining member. The criteria
for viral quasispecies and viral genogroup are defined below, and
serve to specifically set criteria for the MNV-1 embodiments
described herein.
[0027] RNA viruses vary during infection due to errors made by the
viral RNA-dependent RNA polymerase. Thus, MNV-1 (a positive-strand
RNA virus) may be expected to vary during replication into a
quasispecies comprising multiple viruses with sequences closely
related to, but not identical to, the sequence of the original
infecting virus. Thus, some embodiments of MNV-1 include viruses
with sequences that vary from the sequence provided in SEQ ID NO: 1
by an amount consistent with variation within a calicivirus
quasispecies. The level of variation from the MNV-1 consensus SEQ
ID NO: 1 that still is considered by those skilled in the art to be
the same virus (since these viruses always exist as quasispecies)
is 5-7% (Radford et. Al. Veterinary rewcord Jan. 29, 2000 pp 117
on, Radford et al Vet Record Oct. 20, 2001 pp 477 on). Thus, an
embodiment comprises the MNV-1 viral quasispecies of sequences that
vary from our initial consensus sequence (SEQ ID NO: 1) by no more
than 5%. It has been confirmed that there is significant variance
in MNV-1 nucleotide sequence even within a single infected animal
(FIG. 3). To show this, a portion of the primary data from which
the 10-fold redundant consensus sequence SEQ ID NO: 1 was derived
is presented. It was found that over the highly conserved ORF2
region, there are multiple sites at which there is sequence
variation (FIG. 3A). A portion of the sequence data is presented in
FIG. 3B for a region within which sequence variation was found. The
frequency of variation at the sites shown in boxes is greater than
that observed at multiple other sites (e.g. the remainder of the
sequence in FIG. 3B), showing that these variations represent true
biological variation rather than PCR artifacts or sequencing
errors. Thus, MNV-1 does exist as a quasispecies.
[0028] Further embodiments comprise viruses with an amount of
variance from SEQ ID NO: 1 that is consistent with variation within
a genogroup, and less than the variation observed between
genogroups. For caliciviruses, genogroup and genus definition has
been developed and officially set by the International Committee on
the Taxonomy of viruses (ICTV) and research in the field has led to
definitions of the amount of variation in sequence that is expected
within a single genogroup as opposed to between viruses of
different genogroups (K. Y. Green et al JID 2000 S322-330). Because
nucleotide sequences can vary without causing variation in amino
acid sequence, relatedness at the nucleotide level is a preferred
method for distinguishing between genogroups or within a
quasispecies (see above). Nucleotide identity within a genogroup of
Noroviruses has been established as greater than 80% within the
highly conserved capsid protein (ORF 2) gene (J. Vinje et al Arch
Virol (2000) 145:223-241). Thus, viruses that differ by more than
20% at the nucleotide level from a member of a genogroup (in this
case from the MNV-1 sequence in SEQ ID NO:1) are not members of the
genogroup. Nucleotide identity between genogroups is 64%-78% or
less. Therefore, the genogroup to which MNV-1 belongs comprises
viruses that vary by no more than 20% from the MNV-1 sequence
within the capsid region. Similar reasoning applies to other
conserved regions of the genome including the RNA dependent RNA
polymerase gene. Therefore, our use of the capsid sequence for the
definition of genogroup is standard.
[0029] Further embodiments include RNA sequences that are at least
about 80% identical to SEQ ID NO: 1, where the % identity is
determined using Vector NTI AlignX program. Other embodiments
include an isolated DNA sequence, or fragments thereof, identical
to or complementary to SEQ ID NO: 1, and isolated DNA sequences at
least about 80% identical to or complementary to SEQ ID NO: 1.
Further embodiments comprise sequences between 80% and 100%
identical to SEQ ID NO: 1, and sequences complementary thereto.
[0030] Additional embodiments comprise fragments of any of the
above mentioned sequences, such as may be used, for example, as
primers or probes. Examples of such sequences include the primers
listed in legends to FIGS. 8 and 10 that were used to detect virus
infection in animals by nested PCR (FIG. 10) or to determine the
amount of MNV-1 genome in a tissue by the use of real time PCR
(FIG. 8). These primers will be useful for detection of MNV-1
infection in commercially bred mice and for quantitation of MNV-1
in tissues after trials of antiviral agents or vaccines. Such
primers and probes are selected such that they are substantially
complementary to a target sequence, wherein the target sequence
consists of coding sequence of MNV-1. Here, substantially
complementary means that the primer or probe is sufficiently
complementary to the target sequence that it will hybridize to the
target sequence under highly stringent conditions. As used herein,
highly stringent conditions are as defined in the nested and real
time PCR protocols exemplified in FIGS. 8 and 10. For hybridization
in blots as opposed to PCR reactions, stringent refers to:
hybridization at 68 degrees C in 5x SSC/5x Denhardt's solution/1.0%
SDS, and washing in 0.2x SSC/1.0% SDS at room temperature. Such
probes and primers are useful, for example in various assays for
detecting the presence of MNV-1 (FIG. 10) and determining how much
MNV-1 is in a particular sample (FIG. 8). Other assays for which
such primers or portions of MNV-1 sequence would be useful include
Northern and Southern hybridization blot assays, additional PCR
assays (e.g. degenerate PCR using primers with degenerate
nucleotides at specific sites within the PCR primer to detect
viruses within the MNV-1 genogroup but not identical to the MNV-1
sequence in SEQ ID NO: 1), transcription-mediated amplification
assays and the like, and as positive controls and internal
standards for commercial assays to detect the presence of MNV-1 in
mice or after treatment with anti-viral agents or vaccines.
[0031] A feature that distinguishes the human Noroviruses from the
Sapoviruses are the cup-shaped depressions on the virion surface
that gave the calicivirus family its name (calyx=cup in Latin).
Sapovirus capsids show these characteristic cup-shaped depressions
by electron microscopy (EM), while Norovirus capsids have a
feathery appearance. To visualize MNV-1 virions, MNV-1 was purified
from the brain of an infected IFN.alpha..beta..gamma.R-/- mouse on
CsCl gradients (FIG. 4). Gradient fractions containing MNV-1 genome
were identified by RT-PCR (FIG. 4A), revealing a buoyant density of
MNV-1 of 1.36 g/cm3+/-0.04 g/cm3 (n=3 experiments), in close
agreement with the published buoyant densities of Noroviruses
(1.33-1.41 g/cm3). Analysis of these gradient fractions by EM
revealed particles with a diameter of 28-35 nm (FIG. 4B), similar
to the known size (26-32 nm) of Norovirus particles in negatively
stained preparations. The particles were icosahedral and had the
same feathery surface morphology as Noroviruses but lacked the
cup-like depressions characteristic of Sapoviruses. Gradient
fractions prepared from mock-infected brain did not contain these
particles (data not shown).
[0032] To test the pathogenicity of MNV-1, mice were infected i.c.
with CsCl gradient purified MNV-1. These virions were infectious
since 18/18 RAG/STAT mice inoculated with them died, while 18 of 18
mice inoculated with gradient fractions prepared from a
mock-infected brain survived (FIG. 4C). Mice inoculated with
gradient-purified virions showed encephalitis, meningitis, cerebral
vasculitis, pneumonia, and hepatitis (data not shown). This
mortality rate and pathology was similar to that observed
previously in mice inoculated with unpurified brain homogenate
(FIG. 4C and data not shown). The presence of disease in mice
inoculated with CsCl-purified MNV-1 demonstrates that MNV-1 is the
causative agent of the disease initially detected and passed (FIG.
1).
[0033] The MNV-1 genome comprises three open reading frames (ORFs).
Analysis of the predicted coding sequence of ORF1 indicated a
polyprotein with a molecular weight (MW) of 180.7 kDa and revealed
the presence of multiple conserved motifs shared by caliciviruses
and picornaviruses (FIG. 2B). ORF2 is separated from ORF1 by 32 nt
and starts in the -1 frame relative to ORF1. It encodes a 542 aa
protein with a calculated MW of 58.9 kDa and an isoelectric point
of 5.19. When this gene was expressed in a recombinant baculovirus,
virus-like particles (VLPs) were found in the supernatant of
infected cells, demonstrating ORF2 encodes the capsid protein (FIG.
6). These VLPs provide a reagent for analysis of MNV-1 infection
(see below). The predicted ORF3 encodes a basic protein (pI of
10.22) with a calculated MW of 22.1 kDa that overlaps by 2 nt with
ORF2 and is expressed in the +1 frame relative to ORF1 but the -2
frame relative to ORF2.
[0034] Thus, further embodiments comprise the amino acid sequences
encoded by ORF1, ORF2 and ORF3. These amino acid sequences are
shown in SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, respectfully.
Additional embodiments comprise amino acid sequences that are
encoded by viruses that vary from SEQ ID NO: 1 by no more than 20%
at the nucleotide level as defined above. The protein translation
of such sequences will vary on a percentage basis depending on the
placement of nucleotides within codons and the frequency of amino
acids coded for by single versus multiple three base pair codons
used by the translational machinery. Therefore the extent of
variation of these embodiments is properly determined by defining
the extent of total nucleotide variation accepted as defining the
MNV-1 genogroup. Some embodiments comprise the nucleotide sequences
that encode each of the amino acid sequences of SEQ ID NO:2, SEQ ID
NO:3 and SEQ ID NO:4, including degenerate variants that encode
those amino acid sequences. Additional embodiments comprise the
nucleotide sequences of ORF1, ORF2 and ORF3 of MNV-1.
[0035] Additional embodiments include vectors capable of expression
of any of the proteins encoded by MNV-1 or their variants as
defined above. Examples of suitable vectors include baculovirus
vectors, alphavirus vectors (e.g. Sindbis virus vectors, VEEV
replicons), retroviral vectors, plasmids within which expression is
driven from eukaryotic promoters, plasmids that generate short RNA
sequences suitable for gene inactivation by RNAi technology,
plasmids in which the presence of an RNA polymerase transcribes
MNV-1 sequences (including the entire sequence) in order to provide
RNA (including up to full length infectious RNA) for analysis or
transfection into cells. Infectious RNA is defined as RNA, which,
on transfection into eukaryotic cells, gives rise to intact
infectious virus. Portions of the genome may also be expressed in
this fashion for the generation of viral proteins or for analysis
of the processing of MNV-1 viral proteins for the purpose of
developing assays for identification of steps in viral replication
that may serve as drug targets. Additional uses of expression
vectors include generation of cells expressing viral proteins in a
stable fashion for the purpose of screening anti-viral antibodies
or for providing positive controls for assay for detection of
anti-viral antibody in the serum.
[0036] As discussed above, expression of the capsid protein, i.e.,
the protein encoded by the sequence of ORF2, results in the
formation of virus-like particles (VLPs). Thus, some embodiments
comprise methods of producing VLPs. Such methods comprise
transfecting a cell or animal with a vector that encodes the MNV-1
capsid protein, and recovering VLPs, or expression of the capsid
protein from within the baculovirus genome such that the capsid
protein is produced in insect cells infected with the baculovirus
expressing the capsid protein. Further embodiments comprise MNV-1
VLPs. VLPs are useful, for example, for isolation of antibodies,
analysis of the epitopes that antibodies recognize, and for cryo-EM
and X-ray crystallography and other methods for determining the
three dimensional structure of the MNV-1 capsid. VLPs may also be
studied for potential use as a vaccine. In this setting they may be
useful for mapping the specific conformational epitopes recognized
by anti-viral antibodies and the specific peptides recognized by
antiviral CD4 and CD8 T cells.
[0037] Antibodies
[0038] Some embodiments comprise antibodies that bind specifically
to any of the various proteins encoded by the MNV-1 genome. Methods
for producing antibodies are known in the art. Such antibodies may
be either monoclonal or polyclonal. Antibodies can be used in
various assays, such as for example ELISA assays, to detect the
presence of MNV-1 in a sample. Samples include for example serum,
saliva, feces, and tissues. In addition, antibodies may be utilized
in methods for preventing lethal MNV-1 infection and studied for
potential use as vaccines or anti-viral therapeutics.
[0039] An example of the use of antibodies and antibody detection
assays is the demonstration that seroconversion can be detected by
ELISA of serum using MNV-1 VLPs as the target antigen bound to the
ELISA plate (FIG. 7). A further example is the demonstration that
MNV-1 infection can be detected in specific cells by using
immunohistochemistry to detect the binding of MNV-1 specific
antibodies to infected cells (FIG. 9). This type of use may also be
employed for detecting binding of virus to cells by FACS analysis.
This in turn will provide an opportunity to identify the receptor
for MNV-1. Identification of the MNV-1 receptor on the cell surface
may provide important targets for anti-viral drug development. In
addition, antibodies will be used for immunofluorescence and
in-situ detection of virus infected cells.
[0040] Small Animal Model
[0041] The discovery of the first murine Norovirus provides the
first small animal model for development and testing of
pharmaceuticals and vaccines for treatment and prevention of a
major human disease. This presents an opportunity to answer
important questions regarding the pathogenesis of Norovirus
infections, to determine the role and mechanisms of immunity in
either protection against infection or immunopathology, to identify
novel therapeutic targets for treatment of human calicivirus
disease, and to better understand how innate immunity can control
enteric virus infection. The mouse model can also be used in
methods to identify agents that alter calicivirus infection and
disease.
[0042] The course of human Norovirus infection strongly suggests
that symptoms are caused by acute infection. Prominent amongst the
clinical manifestations are vomiting and diarrhea with a mean
incubation period of 24 hours and duration of 24-48 hours.
Understanding of the viral and host mechanisms involved in the
induction and clearance of human Norovirus disease is rudimentary.
Acquired immunity can play a role in Norovirus resistance, but may
not explain why certain individuals get severe disease while others
do not. It may be that long-term immunity can be achieved, and the
use of the MNV-1 virus in a small animal model provides the first
opportunity to define such possible mechanisms. Infected
individuals can develop short-term immunity to homologous virus,
but the development of long-term immunity is questionable. An
unexpected inverse relationship between pre-challenge antibody
levels and susceptibility to infection has been reported in some
studies (Parrino, T. S., et al., N. Engl. J. Med. 297:86-89, 1977;
Johnson, P. C. et al., J. Infect. Dis. 161:18-21, 1990; Okhuysen,
P. C. et al., J. Infect. Dis. 171:566-569, 1995), while others have
reported that circulating antibody does correlate with resistance
to calicivirus infection (Lew, J. F. et al., J. Infect. Dis.
169:1364-1367, 1994; Ryder, R. W. et al., J. Infect. Dis.
151:99-105, 1985; Nakata, S. et al., J. Infect. Dis. 152:274-279,
1985). This controversy has led to studies showing that non-immune
host factors, such as blood groups, influence susceptibility to
infection (Hutson, A. M. et al., J. Infect. Dis. 185:1335-1337,
2002). The discovery of MNV-1 provides a small animal model for the
study of Noroviruses.
[0043] One embodiment is therefore the use of mice infected with
MNV-1 as an approach to identifying the efficacy of vaccines or
therapeutic agents. Mice would be infected with the newly
discovered virus, and then treated with candidate agents and the
outcome of the infection monitored using ELISA (FIG. 7),
quantitative real time PCR for the viral RNA (FIG. 8),
immunohistochemistry (FIG. 9), lethality (FIG. 5), or in situ
hybridization to monitor the course of infection. Similarly,
another embodiment is the use of mice infected with MNV-1 to test
the efficacy of vaccination protocols against the virus. In this
case, different vaccine preparations (including vectors expressing
portions of the new virus genome or proteins from the virus or from
human noroviruses that cross react with proteins from the mouse
virus) would be administered to infected mice and the effect of
vaccination on the course of the infection monitored using ELISA
(FIG. 7), quantitative real time PCR for the viral RNA (FIG. 8),
immunohistochemistry (FIG. 9), lethality (FIG. 5), or in situ
hybridization. As it is not practical to perform such experiments
in humans, the capacity to perform these types of screens for in
vivo efficacy of therapeutics or vaccines is not possible without
the use of this newly described virus.
[0044] In addition, the discovery of MNV-1 and the generation of a
consensus sequence will enable construction of an infectious clone
for MNV-1. One embodiment is therefore generation of such an
infectious clone from the current cloned and sequenced genome or
from sequences that vary within the limits described above for the
MNV-1 quasispecies or MNV-1 genogroup. Such a clone can be used to
develop various screening assays for MNV-1 antiviral agents and
targets for antiviral drug development and vaccines for prevention
of infection or antibodies for therapy of disease, and also may be
used to study certain aspects of the viruses infection cycle
including binding, entry, uncoating, negative strand RNA synthesis,
positive strand RNA synthesis, subgenomic RNA synthesis, synthesis
of structural and non-structural proteins, viral assembly and viral
egress to be studied and used to develop screens for antiviral
drugs that might have uses in preventing or treating Norovirus
induced disease. In addition, placement of portions of human
Noroviruses into an infectious clone for MCV-1 (e.g. substituting
proteins such as the capsid of RNA polymerase of the human virus
into the mouse virus infectious clone) will allow the murine virus
to be humanized and potentially still used in mice. This will allow
screening of therapeutic agents that target the functions of human
norovirus proteins in an animal model. This is possible only
through the combined use of an infectious MNV-1 clone as a vector
for expressing functional proteins and a small animal model which
allows assessment of the effects of therapeutic agents or vaccines
on the course of infection with such "humanized" forms of the mouse
calicivirus MNV-1.
[0045] In addition, the use of the newly discovered MCV-1 virus in
mice with different immune deficiencies will allow identification
of host proteins that play a role in control of Norovirus
infection. An example of this is the detection of the critical role
of STAT-1 in resistance to MNV-1 infection (Working Example 14,
FIG. 5). Identification of such host proteins could allow
development of targeted therapeutic agents that enhance specific
parts of the host immune response as a way to treat or prevent
Norovirus disease. Such embodiments include, for example, use of
the virus in mice with deficiencies in specific parts of the immune
system in order to identify mice that have increased susceptibility
or increased resistance to infection by MCV-1. Such embodiments
would be useful for identifying immune protective or
immunopathologic aspects of the host response and thereby inform
searches for vaccines or therapeutic agents that could prevent or
treat Norovirus infection. An example would be targeting enhanced
STAT-1 function, based on the experiments in FIG. 5, for prevention
of Norovirus disease in humans.
WORKING EXAMPLES: Example 1, Generation of MNV-1 Stock
[0046] After identification of MNV-1 in RAG/STAT and
IFN.alpha..beta..gamma.R-deficient mice, a brain homogenate from an
IFN.alpha..beta..gamma.R-deficient mouse at passage 3 was used for
i.c. inoculations of 17 additional
IFN.alpha..beta..gamma.R-deficient mice. Brains of infected mice
were harvested 3 days post-infection and homogenized in PBS.
Homogenates were centrifuged at low speed and filtered through a
0.2 .mu.m filter and the resulting supernatant was used in
subsequent infections. For control experiments, brain homogenates
of mock-infected mice were prepared similarly after injection of
mice with uninfected mouse brain homogenate. (See FIG. 5).
WORKING EXAMPLES: Example 2: Purification of MNV-1 Virions
[0047] Homogenate from one MNV-1 infected brain was used for
purification of MNV-1 virions while a mock-infected mouse brain was
used as a control (FIG. 4). Homogenized brain was subjected to a
cycle of freeze/thaw and two low speed centrifugations before
filtration through 0.22 .mu.m filter. Supernatants were centrifuged
at 90,000.times.g for 2 hrs and the resulting pellets were
incubated for 30 min at 37 C in 1 ml 1% Na-deoxycholate. The
resulting material was mixed with CsCl to a final density of 1.36
g/cm3 and centrifuged for 40 hrs at 150,000.times.g. Gradients were
fractionated, their density determined with a refractometer, and
dialyzed against a buffer containing 0.01M Tris-HCl, 0.15M NaCl, 1
mM CaCl2, and 0.05M MgCl2. (See FIG. 4).WORKING EXAMPLES: Example
3: RNA Isolation, cDNA Synthesis, and RDA
[0048] Total RNA was isolated from a MNV-1 infected mouse brain
using Trizol (Invitrogen, Carlsbad, Calif.) following the
manufacturer's instructions. Double-stranded cDNA for use in RDA
was synthesized from total RNA using the Superscript Choice System
for cDNA synthesis (Invitrogen, Carlsbad, Calif.) and a combination
of random hexamers and oligo dT primers. Single-stranded cDNA for
quantitative PCR was generated using Supercript II (Invitrogen,
Carlsbad, Calif.) following the manufacturer's recommendations. RDA
was performed as described by Pastorian et al. (Anal. Biochem.
283:89-98, 2000) with the following modification. The QIAquick PCR
purification kit (Quiagen, Valencia, Calif.) was used to remove
unincorporated nucleotides and small cDNA species. Difference
products from rounds 3 and 4 were cloned into the pGEM-T vector
system (Promega, Madison, Wis.) following the manufacturer's
instructions. Bacterial colonies were grown up and inserts were PCR
amplified for sequencing. (See FIGS. 2, 3).
WORKING EXAMPLES: Example 4, RT-PCR and Quantitative PCR
[0049] RT-PCR was performed with primers 445/1/AS6
(TCCAGGATGACATAGTCCAGGG- GCG)(SEQ ID NO:5) and 445/1/S6
(TGGGATGATTTCGGCATGGACAACG) (SEQ ID NO:6) using the Titanium
one-step RT-PCR kit (Clontech, Palo Alto, Calif.) following
manufacturer's recommendations. Quantitative PCR (FIG. 8) was
performed with primers ORF1/RT1/S (cagtgccagccctcttat) and
ORF1/RT1/AS2 (tcctcctcatcaagggac) that amplify a 132 bp segment of
ORF1 outside of the predicted subgenomic RNA. This assay has a
sensitivity of 100 viral genomes/.mu.g cellular RNA or about 1
MNLV-1 genome per 1720 cell equivalents of RNA (estimating 1 .mu.g
cellular RNA/I 72,000 cells). The assay linearly quantitates genome
over at least a 6-log range. (See FIG. 8).
WORKING EXAMPLES: Example 5, Cloning of the MNV-1 Genome
[0050] A combination of PCR and RACE was used to clone the MNV-1
genome (FIG. 2A). For internal sequence information, primers were
constructed based on sequence information obtained through RDA and
used to amplify and clone larger pieces of MNV-1 from 1st strand
cDNA from a RAG/STAT mouse brain (passage 3). These PCR products
were cloned into the pGEMT vector (Promega, Madison, Wis.) and
universal M13 forward and reverse primers used for sequencing.
Primer walking was applied when necessary. For the 5' and 3' ends
of MNV-1, RACE was performed with the Marathon cDNA Amplification
Kit (Clontech, Palo Alto, Calif.) using total RNA from the same
RAG/STAT mouse brain (passage 3) as starting template. These
products were cloned and sequenced as outlined above. A consensus
sequence with at least 10-fold redundancy (except for the 5'end,
see below) was constructed using the VectorNTI contig program. The
5' end of the genome was difficult to clone and consequently the
first 15 nucleotides are based on a single sequence, possibly
explaining why there is no start codon close to the 5' end as is
expected based on comparison with other Noroviruses. (See FIG.
2).
WORKING EXAMPLES: Example 6, Cloning and Expression of the MNV-1
Capsid Protein in Bacteria
[0051] The MNV-1 capsid protein was PCR amplified from first strand
cDNA from a RAG/STAT mouse brain (passage 3). The following primers
C-pET1 (GTGGTGCTCGAGTGCGGCCGCAAGCTTTATTATTGTTTGAGCATTCGGCCTG) (SEQ
ID NO:7) and N-pET 1
(ATCCGAATTCTAGATGCACCACCACCACCACCACATGAGGATGAGTGATGGCGCA G) (SEQ ID
NO:8) containing HindIII and EcoRI restriction sites (underlined),
respectively, and a 6 Histidine N-terminal tag (bold) were used in
a 2 step PCR reaction (5 cycles 50 C, 30 cycles 60 C) in the
presence of 5% DMSO. The resulting PCR product was ligated into a
PCR blunt cloning vector (Zero Blunt PCR Cloning kit, Invitrogen,
Carlsbad, Calif.) and transformed into DH5.alpha.CaCl2 competent
cells (Invitrogen, Carlsbad, Calif.). DNA was isolated from the
resulting clones and diagnostic restriction digests followed by DNA
sequencing confirmed the presence and sequence of the insert. The
insert was cloned into the bacterial expression vector pET-30a (+)
(Novagen, Madison, Wis.) using the EcoRI and HindIII restriction
sites. Next, BL21 (DE3) competent cells were transformed and
protein was expressed following the manufacturer's protocol
(Novagen, Madison, Wis.).
WORKING EXAMPLES: Example 7, Purification of Bacterially Expressed
MNV-1 Capsid Protein
[0052] Following a 2 hour expression, protein was purified from
inclusion bodies of bacterial cells using the BugBuster protein
extraction reagent (Novagen, Madison, Wis.). His-tagged capsid
protein was isolated from remaining protein by nickel column
chromatography (Ni--NTA his Bind Resin, Novagen, Madison, Wis.) in
the presence of 8M urea and protease inhibitors (protease inhibitor
cocktail set III, Novagen, Madison, Wis.). Samples were dialyzed
against 25 mM phosphate buffer (pH 6.0) and the purity of each
preparation was assessed by SDS-PAGE and silver staining (Silver
stain Plus kit, Biorad, Hercules, Calif.).
WORKING EXAMPLES: Example 8, Generation of Antisera in Rabbits
[0053] Rabbit sera was produced through Cocalico Biologicals, Inc.
(Reamstown, Pa.). Basically, rabbits were injected with 100 .mu.g
bacterially expressed capsid protein in CFA (complete Freund's
adjuvant) and boosted after a month once every month with 501 g
protein in IFA (incomplete Freund's adjuvant). Production bleeds
were collected a week after each boost and before the start of
injections. The same procedure is being used for generation of
antibodies directed against virus-like MNV-1 particles.
WORKING EXAMPLES: Example 9, Cloning and Expression of the MNV-1
Capsid Protein in Baculovirus
[0054] The MNV-1 capsid protein was cloned into the baculovirus
expression vector in an analogue way to the cloning into the
bacterial expression vector. The following primers were used for
initial 2 step PCR amplification (4 cycles at 50 C, 30 cycles at 64
C) of the MNV-1 capsid protein:
[0055] N-Bac1 (CGGAATTCGGATGAGGATGAGTGATGGCGCA)(SEQ ID NO:9), C-Bac
1 (TCTCGACAAGCTTTTATTGTTTGAGCATTCGGCCT)(SEQ ID NO: 10). The same
restriction sites, EcoRI and HindIII (underlined) were used for
cloning into the pFastBac1 vector (Invitrogen, Carlsbad, Calif.).
Recombinant baculoviruses were made using the Bac-to-Bac Expression
system (Invitrogen, Carlsbad, Calif.) following the manufacturer's
instructions. Briefly, the recombinant vector plasmid containing
the MNV-1 capsid protein was transformed into DH10Bac E. coli cells
allowing for transposition of the gene of interest into the bacmid
genome. Clones containing recombinant bacmids were identified by
antibiotic selection and disruption of the lacZ gene. Recombinant
bacmid DNA was then used for transfection of Sf9 insect cells.
Recombinant baculoviruses were amplified for several rounds on Sf9
or Sf21 cells (Invitrogen, Carlsbad, Calif.) before infection of
High-Five cells (Invitrogen, Carlsbad, Calif.) for protein
expression. High-Five cells were infected for 5-7 days and
supernatant were collected for purification of MNV-1 VLPs. Initial
preparations were screened for the presence of VLPs by negative
staining electron microscopy. VLPs were identified in the
supernatants of several isolates (FIG. 6C). Two isolates with the
highest amount of protein expression were chosen for further
experiments. The amount of protein expression in each preparation
was analyzed by SDS-PAGE and immunoblotting (FIG. 6A).
WORKING EXAMPLES: Example 10, Purification of MNV-1 VLPs
[0056] MNV-1 VLPs are purified from the supernatant of infected
High-Five cells 7 days post-infection (FIG. 6D). The purification
protocol is based on Leite et al. (Arch Virol, 1996, 141:865-875),
which is hereby incorporated by reference. Briefly, protein in the
cell supernatant is being precipitated using PEG 8000, and
particles are purified using CsCl gradients. VLPs are dialyzed
against 25 mM phosphate buffer, pH 6.0. Details of the protocol are
being optimized at this point.
WORKING EXAMPLES: Example 11, Use of VLPs, Potential and Actual
Targets of VLPs
[0057] VLP-containing insect cell supernatants are being used for
ELISA to screen mouse sera (see ELISA below). VLPs will be used to
generate rabbit antisera. Their role as potential vaccine will be
investigated. They will also be used for three-dimensional
structure determination of the MNV-1 capsid.
WORKING EXAMPLES: Example 12, ELISA Assay
[0058] This assay can be used to screen mice capable of eliciting
an antibody response (FIG. 7). The assay was optimized for a
maximal signal-to-background ratio. VLP-containing insect cell
supernatants are used as antigens for coating ELISA plates over
night at 4 C. Plates are blocked for two hours at 37 C with 3% BSA
and washed with 0.15 M NaCl + 0.05% Tween 20. Sera from mice are
diluted 1:100 and incubated for 1 hour at 37 C. after washing,
wells are incubated for two hours at 37 C with a 1:1000 dilution of
peroxidase-conjugated AffiniPure goat anti-mouse IgG (H+L) (Jackson
ImmunoResearch Laboratories, Inc., West Grove, Pa.). Plates are
developed after another round of washing by addition of the
substrate 2,2'-Azinobis 3-ethylbenzthiazoline sulfonic acid (ABTS,
Sigma-Aldrich Corp., St. Louis, Mo.) for 10 min, the reaction is
stopped using 0.2N phosphoric acid, and quantified by reading the
absorbance at 415 nm.
WORKING EXAMPLES: Example 13, Nested PCR Assay
[0059] This assay can be used to screen tissues of
immunocompromised mice with no antibody response (FIG. 10). RNA is
isolated from the tissue(s) of interest and 1st strand cDNA is
being made (see above). To sets of primers were designed with the
following sequences: outer sense primer CCAAAAGCCAATGGCTCTGA (SEQ
ID NO: 11), outer antisense primer AGTTGAATGGGCTCCAGGGT (SEQ ID NO:
12), inner sense primer CCGCCGGGCAAATTAACCAA (SEQ ID NO: 13), inner
antisense primer AGGTGGGCAAGGTAGGGGTTA (SEQ ID NO: 14). Each
reaction contained 2 .mu.l of first strand cDNA and a final
concentration of 1 .mu.M sense and antisense primer, 2.5 mM MgCl2,
0.2 mM dNTPs, and 1.25 unit Taq DNA Polymerase (Promega, Madison,
Wis.) in 1x buffer (Taq DNA Polymerase 10X Reaction Buffer without
MgCl2, Promega, Madison, Wis.). PCR was performed for 45 cycles for
the 1st round, and 30 cycles for the 2nd round with the following
setting: heating 2 min 94 C, cycle for 30 sec 94 C, 30 sec 60 C
(annealing), and 30 sec 72 C (extension), with a final extension
step of 10 min 72 C. Two .mu.l product from the 1st round are used
in the 2nd round using the same overall set-up. Products are
analyzed by agarose gel electrophoresis.
WORKING EXAMPLES: Example 14, Use of MNV-1 Infected Mice as Small
Animal Model of Norovirus Infection
[0060] To determine whether T and B cell mediated immunity is
required for resistance to MNV-1, wild-type and RAG1-/- mice were
infected by the i.c. route and followed for 90 days (data not
shown). Surprisingly, MNV-1 infection does not kill RAG1-/- mice
(n=20) after direct i.c. inoculation even though these mice are
typically highly susceptible to infection with a range of different
viruses. The finding thatRAG-/- mice are resistant to lethal
disease argues that typical adaptive responses are not required for
protection from lethal disease. This finding may explain in part
contradictory conclusions as to the importance of antibody in
resistance to Norovirus disease. While B and T cell responses are
not required for resistance to lethal infection, it may be that
pre-existing immunity influences the pathogenicity of MNV-1.
Alternatively, the presence of immune cells may contribute to
disease induced by MNV-1 as is seen for lymphocytic
choriomeningitis virus.
[0061] Together with a course of clinical illness too brief to
allow typical adaptive responses, these studies in RAG-/- mice beg
the question of whether innate rather than acquired immunity is
critical for resistance to calicivirus infection. We therefore
inoculated a variety of mouse strains lacking components of the
innate immune system with MNV-1. The peroral (p.o.) and intranasal
(i.n.) routes were tested in addition to the i.c. route since the
physiologic routes of infection for human caliciviruses are oral
and respiratory. Mice lacking the IFN.alpha..beta. receptor or the
IFN.gamma. receptor were no more susceptible to lethal infection
than wild-type controls (FIG. 5A). In contrast, mice lacking both
IFN.alpha..beta. and IFN.gamma. receptors were more susceptible to
lethal infection than congenic controls after either i.c. or i.n.
inoculation with MNV-1 (FIG. 5B). These data demonstrate that the
IFN receptors can compensate for each other in resistance to MNV-1
infection such that only deficiency in both receptors leads to
lethality. Mice deficient in inducible nitric oxide synthetase
(iNOS) or in the RNA activated protein kinase PKR, two IFN
regulated proteins with antiviral properties, were also resistant
to lethal MNV-1 infection after i.c. or p.o. inoculation (FIG.
5A).
[0062] Since deficiency in both IFN receptors is required to
predispose to lethal MNV-1 infection, we reasoned that a component
of the innate immune system that can be activated by either the
IFN.alpha..beta. or the IFN.gamma. receptor was critical for MNV-1
survival. We therefore tested the hypothesis that the latent
cytoplasmic transcription factor STAT1, which is shared by both the
IFN.alpha..beta. and IFN.gamma. signaling pathways, was critical
for resistance to calicivirus infection. STAT1 deficiency resulted
in lethal MNV-1 infection in mice with T and B cells (STAT1-/-,
FIG. 5C), mice lacking T and B cells (RAG/STAT, FIG. 5D), and mice
lacking PKR (PKR-/-STAT1-/-, FIG. 5E) by all routes analyzed. Thus
STAT1 is the first host component identified as essential for
resistance to lethal Norovirus infection, and is required for
survival even when T and B cells are present.
[0063] Having identified STAT1 as essential for calicivirus
resistance, we then investigated the relationship between the
interferon receptors and STAT1. No statistically significant
differences were found in the survival of
IFN.alpha..beta..gamma.R-/- and STAT1-/- mice after either i.c. or
i.n. inoculations. However after p.o. inoculation, deficiency of
STAT1, but not deficiency in both IFN.alpha..beta. and IFN.gamma.
receptors, led to lethal infection (see FIGS. 5B and C). This might
suggest that STAT1 has IFN receptor-independent effects that are
critical for Norovirus resistance. Supporting this are findings
that the biological effects of STAT1 do not completely overlap with
those of the IFN receptors during viral infection since there are
both STAT1-independent antiviral effects of the IFN receptors, and
IFN receptor-independent effects of STAT1.
* * * * *