U.S. patent application number 11/174592 was filed with the patent office on 2006-01-12 for cyclic progestin regimens and kits.
This patent application is currently assigned to Wyeth. Invention is credited to Ginger Dale Constantine, Gary Sondermann Grubb.
Application Number | 20060009428 11/174592 |
Document ID | / |
Family ID | 35064935 |
Filed Date | 2006-01-12 |
United States Patent
Application |
20060009428 |
Kind Code |
A1 |
Grubb; Gary Sondermann ; et
al. |
January 12, 2006 |
Cyclic progestin regimens and kits
Abstract
A method of contraception is provided which involves delivery of
21 to 27 consecutive days of a progestin in the absence of an
estrogen or other steroidal compound, followed by 1 to 7 days
without an effective amount of an active agent. Also described is a
pharmaceutically useful kit to facilitate delivery of this
regimen.
Inventors: |
Grubb; Gary Sondermann;
(Newtown Square, PA) ; Constantine; Ginger Dale;
(Malvern, PA) |
Correspondence
Address: |
HOWSON AND HOWSON;CATHY A. KODROFF
ONE SPRING HOUSE CORPORATE CENTER
BOX 457
SPRING HOUSE
PA
19477
US
|
Assignee: |
Wyeth
Madison
NJ
|
Family ID: |
35064935 |
Appl. No.: |
11/174592 |
Filed: |
July 6, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60586045 |
Jul 7, 2004 |
|
|
|
Current U.S.
Class: |
514/170 |
Current CPC
Class: |
A61K 31/5355 20130101;
A61K 31/57 20130101; A61K 31/56 20130101; A61P 15/18 20180101; A61K
31/536 20130101; A61P 5/34 20180101 |
Class at
Publication: |
514/170 |
International
Class: |
A61K 31/57 20060101
A61K031/57; A61K 31/56 20060101 A61K031/56 |
Claims
1. A method of contraception in a female of child bearing age which
comprises administering over a period of 28 consecutive days: (a) a
first phase in which from 21 to 27 daily dosage units of an active
agent are administered, each daily dosage unit containing an
effective amount of an active agent consisting of at least one
progestin; and (b) a second phase of from 1 to 7 days wherein no
effective amount of an active agent is administered.
2. The method according to claim 1, wherein the progestin is
selected from the group consisting of 17-hydroxy progesterone
esters, 19-nor-17-hydroxy progesterone esters,
17.alpha.-ethinyltestosterone and derivatives thereof,
17.alpha.-ethinyl-19-nor-testosterone and derivatives thereof,
norethindrone, norethindrone acetate, ethynodiol diacetate,
dydrogesterone, medroxy-progesterone acetate, norethynodrel,
allylestrenol, lynoestrenol, fuingestanol acetate, medrogestone,
norgestrienone, dimethiderome, ethisterone, cyproterone acetate,
levonorgestrel, dl-norgestrel,
d-17.alpha.-acetoxy-13.beta.-ethyl-17.alpha.-a-ethinyl-gon-4-en-3-one
oxime, cyproterone acetate, gestodene, desogestrel, etonorgestrel,
norgestimate, norelgestromin, chlormadione, dienogest, and
drospirenone.
3. The method according to claim 1, wherein from 1 to 7 daily
dosage units of a pharmaceutically acceptable placebo are delivered
in the second phase.
4. The method according to claim 1, which comprises: a) a first
phase of 21 daily dosage units; and b) a second phase of 7 daily
dosage units of an orally and pharmaceutically acceptable
placebo.
5. The method according to claim 1, which comprises: a) a first
phase of 23 daily dosage units; and b) a second phase of 5 daily
dosage units of an orally and pharmaceutically acceptable
placebo.
6. The method according to claim 1, which comprises: a) a first
phase of 25 daily dosage units; and b) a second phase of 3 daily
dosage units of an orally and pharmaceutically acceptable
placebo.
7. The method according to claim 1, which comprises: a) a first
phase of 27 daily dosage units; and b) a second phase of 1 daily
dosage units of an orally and pharmaceutically acceptable
placebo.
8. The method according to claim 1, wherein the progestin is
5-(4,4-Dimethyl-2-thioxo-1,4-dihydro-2H-benzo[d]
[1,3]oxazin-6-yl)-1-methyl-1H-pyrrole-2-carbonitrile.
9. A method of contraception in a female of child bearing age which
comprises administering over a period of 28 consecutive days: (a) a
first phase in which from 21 to 27 daily dosage units of an active
agent are administered, each daily dosage unit containing an
effective amount of an active agent consisting of a progestin of
the formula: ##STR2## (b) a second phase of from 1 to 7 days
wherein no effective amount of an active agent is administered.
10. A pharmaceutically useful kit adapted for daily oral
administration, which comprises: (a) 21 to 27 daily dosage units of
an active agent, each daily dosage unit containing an effective
amount of an active agent consisting of at least one progestin; and
(b) one or more packages for said daily dosage units.
11. The pharmaceutically useful kit according to claim 10, wherein
the progestin is selected from the group consisting of 17-hydroxy
progesterone esters, 19-nor-17-hydroxy progesterone esters,
17.alpha.-ethinyltestosterone and derivatives thereof,
17.alpha.-ethinyl-19-nor-testosterone and derivatives thereof,
norethindrone, norethindrone acetate, ethynodiol diacetate,
dydrogesterone, medroxy-progesterone acetate, norethynodrel,
allylestrenol, lynoestrenol, fuingestanol acetate, medrogestone,
norgestrienone, dimethiderome, ethisterone, cyproterone acetate,
levonorgestrel, dl-norgestrel,
d-17.alpha.-acetoxy-13.beta.-ethyl-17.alpha.-a-ethinyl-gon-4-en-3-one
oxime, cyproterone acetate, gestodene, desogestrel, etonorgestrel,
norgestimate, norelgestromin, chlormadione, dienogest, and
drospirenone.
12. The pharmaceutically useful kit according to claim 10, further
comprising from 1 to 7 daily dosage units of a pharmaceutically
acceptable placebo.
13. The pharmaceutically useful kit adapted for daily oral
administration according to claim 10, which comprises: a) 21 daily
dosage units of an active agent; and b) 7 daily dosage units of an
orally and pharmaceutically acceptable placebo.
14. The pharmaceutically useful kit adapted for daily oral
administration according to claim 10, which comprises: a) 23 daily
dosage units of an active agent; and b) 5 daily dosage units of an
orally and pharmaceutically acceptable placebo.
15. The pharmaceutically useful kit adapted for daily oral
administration according to claim 10, which comprises: a) 25 daily
dosage units of an active agent; and b) 3 daily dosage units of an
orally and pharmaceutically acceptable placebo.
16. The pharmaceutically useful kit adapted for daily oral
administration according to claim 10, which comprises: a) 27 daily
dosage units of an active agent; and b) 1 daily dosage units of an
orally and pharmaceutically acceptable placebo.
17. The pharmaceutically useful kit according to claim 10, wherein
said daily dosage units are in the form of tablets.
18. The pharmaceutically useful kit according to claim 10, wherein
said daily dosage units are in the form of a topical cream or
gel.
19. The pharmaceutically useful kit according to claim 10, wherein
said daily dosage units are delivered via a sustained release
delivery system selected from among a transdermal, transmucosal or
transvaginal drug delivery system.
20. The kit according to claim 10, wherein the progestin is
5-(4,4-Dimethyl-2-thioxo-1,4-dihydro-2H-benzo[d]
[1,3]oxazin-6-yl)-1-methyl-1H-pyrrole-2-carbonitrile.
21. A pharmaceutically useful kit adapted for daily oral
administration, which comprises: (a) 21 to 27 daily dosage units of
an active agent, each daily dosage unit containing an effective
amount of an active agent consisting of at least one progestin of
the formula: ##STR3## (b) one or more packages for said daily
dosage units.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 USC 119(e) of
prior U.S. Provisional Patent Application No. 60/586,045, filed
Jul. 7, 2004.
BACKGROUND OF THE INVENTION
[0002] Soon after the introduction of progestin/estrogen
combination oral contraceptives (OCs) pills in 1960, several
progestin-only pills (POPs) were introduced. The dose of the
progestin in the POPs was made lower than in the combined OCs to
minimize the occurrence of amenorrhea resulting from complete
ovarian suppression. Consequently, ovulation was inhibited in about
half the users of POPs. (The standard POPs primarily depend upon
cervical mucus thickening to provide contraceptive protection for
those who ovulate). Partly because of the lower progestin dose, the
absence of exogenous estrogen and the absence of regular withdrawal
bleed, POP users have a much higher rate of unscheduled
breakthrough bleeding and spotting than combination OC users.
Primarily because of the bleeding problems, POPs are used by only
about 1-2% of contracepting women, compared to about 30% using
combination OCs.
[0003] What is needed is a progestin-containing contraceptive which
avoids breakthrough bleeding and spotting problems.
SUMMARY OF THE INVENTION
[0004] The present invention provides a contraceptive regimen which
involves delivery of an effective amount of a progestin for 21 to
27 consecutive days followed by 1 to 7 consecutive days without
delivery of same. In one embodiment, the progestin is
5-(4,4-Dimethyl-2-thioxo-1,4-dihydro-2H-benzo[d]
[1,3]oxazin-6-yl)-1-methyl-1H-pyrrole-2-carbonitrile, also termed
tanaproget.
[0005] The invention further provides a pharmaceutical kit for use
in delivery of the regimen.
[0006] Other aspects of the invention will be readily apparent from
the following detailed description of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0007] In one aspect, the present invention provides a method of
contraception in a female of child-bearing age. In this method, a
progestin, or combination of progestins, is delivered for a period
of consecutive days as the sole active (i.e., anti-contraceptive)
agent in order to prevent conception.
[0008] In another aspect, the present invention provides for the
use of a progestin, or combination of progestins, in preparing a
medicament useful for contraception in a female of child-bearing
age. In one embodiment, the medicament comprises one phase in
which, from 21 to 27 daily dosage units are consecutively
administered, each containing an active agent comprising a
progestin. In a further embodiment, the medicament also comprises
from 1 to 7 daily dosage units of a pharmaceutically acceptable
placebo for administration in a second phase. In other embodiments,
progestins are useful in preparing medicaments useful in any of the
methods of contraception described herein.
[0009] Without wishing to be bound by theory, it is believed that
this invention will reduce the bleeding problems of conventional
progestin-only contraceptives in two ways. First, due to the
incorporation of 1 to 7 days in each cycle with no effective amount
of a progestin, a regular withdrawal bleed will occur approximately
every 28 days. Second, increasing the progestin dose above standard
progestin-only contraceptives, produces almost complete ovulation
inhibition and the composition of the invention does not depend on
cervical mucus thickening to maintain the contraceptive
effectiveness as do conventional progestin-only regimens.
[0010] The term "progestin," as used herein, refers to any
progestationally active compound, i.e., any compound that binds to
and activates the progesterone receptor. Representative progestins
include progesterone synthetic derivatives such as, for example,
17-hydroxy progesterone esters, 19-nor-17-hydroxy progesterone
esters, 17.alpha.-ethinyltestosterone and derivatives thereof,
17.alpha.-ethinyl-19-nor-testosterone and derivatives thereof,
norethindrone, norethindrone acetate, ethynodiol diacetate,
dydrogesterone, medroxy-progesterone acetate, norethynodrel,
allylestrenol, lynoestrenol, fuingestanol acetate, medrogestone,
norgestrienone, dimethiderome, ethisterone, cyproterone acetate,
levonorgestrel, dl-norgestrel,
d-17.alpha.-acetoxy-13.beta.-ethyl-17.alpha.-a-ethinyl-gon-4-en-3-one
oxime, cyproterone acetate, gestodene, desogestrel, etonorgestrel,
norgestimate and norelgestromin. Other compounds with
progestational activity used in oral contraceptives include
chlormadione, dienogest, and drospirenone.
[0011] In one embodiment, the progestin is
5-(4,4-Dimethyl-2-thioxo-1,4-dihydro-2H-benzo[d]
[1,3]oxazin-6-yl)-1-methyl-1H-pyrrole-2-carbonitrile, also termed
tanaproget and NSP-989. This compound can have the formula:
##STR1## and encompasses pharmaceutically acceptable salts, esters
or other prodrug forms thereof. This compound and methods of making
same are described in U.S. Pat. No. 6,436,929, U.S. patent
application Ser. No. 11/113,794 (filed Apr. 25, 2005), and U.S.
Provisional Patent Application No. 60/675,550 (filed Apr. 28,
2005); No. 60/675,551 (filed Apr. 28, 2005); No. 60/675,559 (filed
Apr. 28, 2005); No. 60/675,737 (filed Apr. 28, 2005); and No.
60/675,738 (filed Apr. 28, 2005).
[0012] In addition, other progestins described in U.S. Pat. Nos.
6,436,929; 6,355,648; 6,521,657; 6,407,101; 6,562,857; and
6,358,947, U.S. Patent Publication No. 2003-0158182-A1, and U.S.
Provisional Patent Application No. 60/601,254 (filed Aug. 13, 2004)
may be useful in the methods and kits of the invention.
[0013] The progestin compounds useful in the present invention can
be used in the form of salts derived from pharmaceutically or
physiologically acceptable acids or bases. These salts include, but
are not limited to, the following salts with inorganic acids such
as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid
and, as the case may be, such organic acids as acetic acid, oxalic
acid, succinic acid, and maleic acid. Other salts include salts
with alkali metals or alkaline earth metals, such as sodium,
potassium, calcium or magnesium in the form of esters, carbamates
and other conventional "pro-drug" forms, which, when administered
in such form, convert to the active moiety in vivo.
[0014] The method of the invention is performed for a period of
time corresponding to the length of a menstrual cycle, i.e., in the
range of 23 to 35 days, with 28 days being the average. Thus, the
method of the invention involves delivering a daily dosage unit
containing an effective amount of an active agent consisting of a
progestin to a female of child bearing age over a period of 18 to
28 consecutive days followed by 1 to 7 consecutive days in which no
effective amount of an active agent is delivered to the
subject.
[0015] The term "effective amount" of a progestin(s) is a dosage
that provides contraception. Without being bound by theory, this is
achieved primarily by preventing ovulation. The term "no effective
amount" of a progestin(s) is used to refer to the 1 to 7 days
following delivery of an effective amount of the progestin(s).
During this period, preferably, no amount of a progestin(s) is
delivered to the animal. However, it is possible, that a sustained
release formulation or other delivery method may be "leaky" and
continue to deliver low amounts of a progestin which are not
effective at contraception during this period. The phrase "no
effective amount" encompasses delivery of no amount of
progestin(s).
[0016] According to the present invention, a female is preferably a
human. However, as used herein, a female can include non-human
mammals, e.g., cattle or livestock, horses, pigs, domestic animals,
etc.
[0017] In one aspect, the method of invention involves delivering a
daily dosage unit containing an active agent consecutively for at
least 21 of 28 consecutive days. In the embodiment, the regimen
consists of delivering a progestin to a female of child bearing age
over a period of 21 to 27 consecutive days followed by 1 to 7
consecutive days in which no effective amount or no amount of
active agent is delivered to the subject. Optionally, the period of
1 to 7 days in which no effective amount of an active agent is
delivered to the subject can involve delivery of a second phase of
daily dosage units of 1 to 7 days of a pharmaceutically acceptable
placebo. Alternatively, during this "placebo period", no placebo is
administered.
[0018] In one embodiment, the method of the invention involves
delivering a progestin as the sole active agent for 21 consecutive
days followed by 7 days in which no effective amount of an active
agent is delivered. Optionally, during these 7 days, a second phase
of 7 daily dosage units of an orally and pharmaceutically
acceptable placebo can be delivered.
[0019] In another embodiment, the method of the invention involves
delivering a progestin as the sole active agent for 23 consecutive
days followed by 5 days in which no effective amount of an active
agent is delivered. Optionally, during these 5 days, a second phase
of 5 daily dosage units of an orally and pharmaceutically
acceptable placebo can be delivered.
[0020] In still another embodiment, the method of the invention
involves delivering a progestin as the sole active agent for 25
consecutive days followed by 3 days in which no effective amount of
an active agent is delivered. Optionally, during these 3 days, a
second phase of 3 daily dosage units of an orally and
pharmaceutically acceptable placebo can be delivered.
[0021] In still another embodiment, the method of the invention
involves delivering a progestin as the sole active agent for 27
consecutive days followed by 1 day in which no effective amount of
an active agent is delivered. Optionally, a second phase of 1 daily
dosage unit of an orally and pharmaceutically acceptable placebo
can be delivered.
[0022] This invention includes the use of pharmaceutical
compositions containing one or more progestin compound(s) as the
sole active ingredient in the formulation and regimen. The
progestin compounds are formulated with a pharmaceutically
acceptable carrier or excipient.
[0023] Suitably, the progestins used in the invention are
formulated for delivery by any suitable route including, e.g.,
transdermal, mucosal (intranasal, buccal, vaginal), oral,
parenteral, etc, by any suitable delivery device including, e.g.,
transdermal patches, topical creams or gels, a vaginal ring, among
others. In a further embodiment, the progestins are delivered by
any suitable route in a sustained release formulation. Such
sustained release formulations are known to those of skill in the
art.
[0024] When the compounds are employed for the above utilities,
they may be combined with one or more pharmaceutically acceptable
carriers or excipients, for example, solvents, diluents and the
like. When formulated for oral delivery, the progestin compound can
be in the form of a tablet, capsule, caplet, gel tab, dispersible
powders, granules, or suspensions containing, for example, from
about 0.05 to 5% of suspending agent, syrups containing, for
example, from about 10 to 50% of sugar, and elixirs containing, for
example, from about 20 to 50% ethanol, and the like. When
formulated for parenteral delivery, the compositions can be
delivered in the form of sterile injectable solutions or
suspensions containing from about 0.05 to 5% suspending agent in an
isotonic medium. Such pharmaceutical preparations may contain, for
example, from about 25 to about 90% of the active ingredient in
combination with the carrier, more usually between about 5% and 60%
by weight.
[0025] The effective dosage of active ingredient employed may vary
depending on the particular compound employed, the mode of
administration and the degree of ovarian suppression desired.
However, in general, satisfactory results are obtained when the
compounds of the invention are administered at a daily dosage of
from about 0.03 to 0.6 mg, or about 0.1 to about 0.5 mg, preferably
given daily or in a sustained release form. This dosage regimen may
be adjusted to provide the optimal therapeutic response. For
example, several divided doses may be administered daily or the
dose may be proportionally reduced as indicated by the exigencies
of the therapeutic situation.
[0026] These active compounds (one or more progestins) may be
administered orally. Solid carriers include starch, lactose,
dicalcium phosphate, microcrystalline cellulose, sucrose and
kaolin, while liquid carriers include sterile water, non-ionic
surfactants, ethanol (e.g., glycerol, propylene glycol and liquid
polyethylene glycols), suitable mixtures thereof, and vegetable or
edible oils such as corn, peanut and sesame oils, as are
appropriate to the nature of the active ingredient and the
particular form of administration desired. Adjuvants customarily
employed in the preparation of pharmaceutical compositions may be
advantageously included, such as flavoring agents, coloring agents,
preserving agents, and antioxidants, for example, vitamin E,
ascorbic acid, BHT and BHA.
[0027] The preferred pharmaceutical compositions from the
standpoint of ease of preparation and administration are solid
compositions, particularly tablets and hard-filled or liquid-filled
capsules. Oral administration of the compounds is preferred.
[0028] These active compounds may also be administered via a
vaginal ring. Suitably, use of the vaginal ring is timed to the 28
day cycle. In one embodiment, the ring is inserted into the vagina,
and it remains in place for 3 weeks. During the fourth week, the
vaginal ring is removed and menses occurs. The following week a new
ring is inserted to be worn another 3 weeks until it is time for
the next period. In another embodiment, the vaginal ring is
inserted weekly, and is replaced for three consecutive weeks. Then,
following one week without the ring, a new ring is inserted to
begin a new regimen. In yet another embodiment, the vaginal ring is
inserted for longer, or shorter periods of time.
[0029] For use in the vaginal ring, a progestin compound is
formulated in a manner similar to that described for contraceptive
compounds previously described for delivery via a vaginal ring.
See, e.g., U.S. Pat. Nos. 5,972,372; 6,126,958; and 6,125,850.
[0030] Optionally, a progestin composition can be formulated for
parenteral delivery in a sustained release formulation and
administered by injection, e.g., monthly or quarterly.
[0031] In another aspect of the invention, a progestin compound is
formulated for delivery via a cream or a gel, by a suitable route.
Suitably, carriers for such routes are known to those of skill in
the art.
[0032] In still another aspect of the invention, the progestin
compound(s) are delivered via a transdermal patch. Suitably, use of
the patch is timed to the 28 day cycle. In one embodiment, the
patch is applied via a suitable adhesive on the skin, where it
remains in place for 1 week and is replaced weekly for a total
period of three weeks. During the fourth week, no patch is applied
and menses occurs. The following week a new patch is applied to be
worn to begin a new regimen. In yet another embodiment, the patch
remains in place for longer, or shorter periods of time.
[0033] This invention also includes kits or packages of
pharmaceutical formulations designed for use in the regimens
described herein. Suitably, the kits contain one or more progestin
compounds as described herein. In one embodiment, the progestin is
selected from among 17-hydroxy progesterone esters,
19-nor-17-hydroxy progesterone esters,
17.alpha.-ethinyltestosterone and derivatives thereof,
17.alpha.-ethinyl-19-nor-testosterone and derivatives thereof,
norethindrone, norethindrone acetate, ethynodiol diacetate,
dydrogesterone, medroxy-progesterone acetate, norethynodrel,
allylestrenol, lynoestrenol, fuingestanol acetate, medrogestone,
norgestrienone, dimethiderome, ethisterone, cyproterone acetate,
levonorgestrel, dl-norgestrel,
d-17.alpha.-acetoxy-13.beta.-ethyl-17.alpha.-a-ethinyl-gon-4-en-3-one
oxime, cyproterone acetate, gestodene, desogestrel, etonorgestrel,
norgestimate, norelgestromin, chlormadione, dienogest, and
drospirenone. In addition, other progestins described in U.S. Pat.
Nos. 6,436,929; 6,355,648; 6,521,657; 6,407,101; and 6,562,857, may
be useful in the methods and kits of the invention.
[0034] In one desirable embodiment, the progestin is NSP-989, also
termed tanaproget, or a pharmaceutically acceptable salt or prodrug
thereof.
[0035] Advantageously, for use in the kits of the invention, the
progestin is formulated for the desired delivery vehicle and route.
For example, a progestin can be formulated for oral delivery,
parenteral delivery, vaginal ring, transdermal delivery, or mucosal
delivery.
[0036] In one embodiment, the kit of the invention is designed for
daily oral administration over a 28-day cycle, preferably for one
oral administration per day, and organized so as to indicate a
single oral formulation or combination of oral formulations to be
taken on each day of the 28-day cycle. Preferably each kit will
include oral tablets to be taken on each the days specified;
preferably one oral tablet will contain each of the combined daily
dosages indicated. For example, a kit of the invention can contain
21 to 27 daily dosage units of an effective amount of an active
agent and, optionally, 1 to 7 daily dosage units of a placebo and
other appropriate components including, e.g., instructions for
use.
[0037] The kit of the invention is preferably a pack (e.g. a
blister pack) containing daily doses arranged in the order in which
they are to be taken.
[0038] In another embodiment, the kit of the invention is designed
for weekly or monthly administration via a vaginal ring over a
28-day cycle. Suitably, such a kit contains individual packaging
for each of the vaginal rings, i.e. one to three, required for a
monthly cycle and other appropriate components, including, e.g.,
instructions for use.
[0039] In another embodiment, the kit of the invention is designed
for weekly or monthly administration via a transdermal patch over a
28-day cycle. Suitably, such a kit contains individual packaging
for each of the patches, i.e. one to three, required for a monthly
cycle and other appropriate components including, e.g.,
instructions for use.
[0040] In still another embodiment, the kit of the invention is
designed for parenteral delivery of the progestin. Such a kit is
typically designed for delivery at home and may include needles,
syringes, and other appropriate packaging and instructions for
use.
[0041] In yet another embodiment, the kit of the invention contains
a progestin compound in a gel or cream formulation. Optionally, the
kit can include appropriate packaging such as a tube or other
container, an applicator, and/or instructions for use.
[0042] In each of the regimens and kits described herein, it is
preferred that the daily dosage of each pharmaceutically active
component of the regimen remain fixed in each particular phase in
which it is administered. It is also understood that the daily dose
units described are to be administered in the order described, with
the first phase followed in order by the optional second phase. To
help facilitate compliance with each regimen, it is also preferred
that the kits contain the placebo described for the final days of
the cycle. It is further preferred that each package or kit
comprise a pharmaceutically acceptable package having indicators
for each day of the 28-day cycle, such as a labeled blister
package, dial dispenser, or other packages known in the art.
[0043] These dosage regimens may be adjusted to provide the optimal
contraceptive effect. For example, several divided doses of each
component may be administered daily or the dose may be
proportionally increased or reduced as indicated by the
contraceptive effectiveness. In the descriptions herein, reference
to a daily dosage unit may also include divided units which are
administered over the course of each day of the cycle
contemplated.
[0044] The following examples are illustrative only and are not
intended to be a limitation on the present invention.
EXAMPLE 1
Ovulation Inhibition by the Progestin Compound NSP-989
[0045] The activity of NSP-989 was evaluated orally in three 3
different rat models for progestin activity along with reference
progestins medroxyprogesterone acetate (MPA) and trimegestone (TMG)
in 2% Tween 80/0.5% methylcellulose vehicle. These models are
described in Parts A, B and C of this example.
[0046] A. Effect of NSP-989 in the Rat Ovulation Inhibition
Model
[0047] The ovulation inhibition assay measures a compound's ability
to inhibit ovulation in adult female rats. This activity is
essential for contraceptive efficacy. In this assay, NSP-989 had a
mean ED.sub.100 value of 0.03 mg/kg, whereas both TMG and MPA had
ED.sub.100 values of 1 mg/kg (n=2- to 3).
[0048] Random cycling mature female Sprague-Dawley rats (.about.200
g) were obtained from Charles River Laboratory (Boston, Mass.).
Rats were synchronized for estrus with 2 .mu.g of LHRH (in
phosphate buffered saline containing 0.1% bovine serum albumin)
administered subcutaneously (sc) per rat at 0900 h and again at
1600 h. Animals were allowed to rest for 8 days before the
administration of test compounds. Animals were then grouped, with 7
to 9 rats per treatment group. The morning of the ninth day
following LHRH treatment, the rats were treated with test compounds
once daily, by gavage. This continued for 4 consecutive days. The
animals were euthanized the morning following the last treatment.
Oviducts were removed, placed between 2 glass slides, and viewed
through a dissecting microscope to count ova. The number of animals
presenting ova in the oviduct from each treatment group and the
number of ova in the oviduct of each animal were recorded.
[0049] B. Rat decidualization Decidualization Model
[0050] The second rat model to determine progestational activity is
the uterine decidualization assay in adult ovariectomized rats.
Only compounds that are progesterone receptor agonists will be
active in this model, as a progestin is absolutely required to
transform uterine stromal cells to differentiated decidual
cells.
[0051] Rat decidualization assay was run as described previously
[Lundeen SG, et al., "Rat uterine complement C3 expression as a
model for progesterone receptor modulators: characterization of the
new progestin trimegestone", J Steroid Biol Mol. Biol. 2001; 78:
137-143.]
[0052] Briefly, mature female Sprague-Dawley rats (.about.220 g)
were ovariectomized at least 10 days prior to treatment to reduce
circulating sex steroids. NSP-989 was administered once daily for
seven 7 days orally by gavage (0.5 ml) in 2% Tween 80/0.5%
methyl-cellulose vehicle. Approximately 24 hours after the third
daily treatment, decidualization was induced in onel uterine horn
of each anesthetized rat by scratching the antimesometrial luminal
epithelium with a blunt 21-gauge needle. The contralateral horn was
not scratched and served as a non-stimulated control. Animals were
euthanized by CO.sub.2 asphyxiation 24 hoursr following the final
treatment. The uteri were removed, and trimmed of fat, and the
decidualized (D) and control (C) horns were weighed separately. The
decidual response is expressed as D/C.
[0053] NSP-989 induced endometrial decidualization with an
ED.sub.50 value of 0.01 mg/kg (n=23) and was approximately 40- and
100-fold more potent than MPA and TMG, respectively (Table 1).
TABLE-US-00001 TABLE 1 Summary of Progestational Activity of
NSP-989 in Various Rodent Models Rat Ovulation Rat Decidual Rabbit
Clauberg Inhibition Assay Assay (ED.sub.50, Rat C3 Assay Assay
(AED.sub.50, Compound (ED.sub.100, mg/kg, po) mg/kg, po)
(ED.sub.50, mg/kg, po) mg/kg, po) NSP-989 0.03 0.01 0.0005 0.001
MPA 1.0 0.4 0.03 0.03 TMG 1.0 1.0 0.005 0.001
[0054] C. Rat Uterine C3 Model
[0055] The third model for PR agonist activity was the adult
ovariectomized rat uterine C3 model. This assay evaluates the
ability of a progestin to block estrogen-induced C3 expression in
the uterine epithelium.
[0056] Ovariectomized female, 60 day-old Sprague-Dawley rats were
obtained from Harlan (Indianapolis, Ind.). Ovariectomies were
performed by the supplier a minimum of 8 days prior tobefore
treatment. The rats were randomized and placed in groups of 6. The
animals were treated once daily for (2) two days orally by gavage
(p.o.) in a volume of 0.5 mL. On the second day of treatment, the
animals were also treated with EE (0.08 mg/kg body weight (BW))
orally by gavage. Approximately 24 hours after the final treatment,
the animals were euthanized by CO.sub.2 asphyxiation. The uteri
were then removed, stripped of remaining fat and mesentery,
weighed, and snap-frozen on dry ice. Total RNA was isolated from
the uteri using the Trizol Reagent (GibcoBRL) as described by the
manufacturer. Real-time reverse transcription polymerase chain
reaction (RT-PCR) as previously reported [Sampath D, et al.,
"Aberrant expression of Cyr61, a member of the CCN
(CTGF/Cyr61/Cef10/NOVH) family, and dysregulation by 17b-estradiol
and basic fibroblast growth factor in human uterine leiomyomas" J
Clin Endocrinol Metab. 2001; 86:1707-1715] was used to quantitate
complement C3 expression. Briefly, RNA samples were DNAse-I treated
using a DNA-free kit (Ambion). A total of 50 ng of RNA was analyzed
in triplicate using C3 specific primer pair (5'primer
GGTCGGTCAAGGTCTACTCCTACTA [SEQ ID NO: 1], 3]primer
CACAGCGGCACATTTCATTG [SEQ ID NO: 2]) and customized probe
(6FAM-AGCATTCCATCGTCCTTCTCCGGATG-TAMRA [SEQ ID NO: 3]). C3
messenger RNA (mRNA) levels were normalized to 18s 18S ribosomal
RNA contained within each sample reaction using primers and probe
supplied by PE Applied Biosystems.
[0057] The mean ED.sub.50 value for NSP-989 was 0.0005 mg/kg (n=6).
Both MPA and TMG had mean ED.sub.50 values of 0.03 and 0.005 mg/kg,
respectively in this assay. In summary, in the rats, in several
unrelated models for progestin activity, NSP-989 was 3010- to
10060-fold more potent than the reference progestins used in these
studies.
[0058] D. Rabbit Endometrial Transformation (Clauberg) Assay
[0059] In addition to the rat progestational models described
above, NSP-989 was also evaluated in the Clauberg model, a classic
progestational assay in the rabbit endometrial transformation model
[McPhail MK, "The assay of progestin." J Physiol. 1934;
83:145-1567]. Briefly, immature female New Zealand White rabbits
(.about.1 kg body weight) were injected subcutaneously with 5 .mu.g
17.beta.-estradiol (E.sub.2)/rabbit/day for six consecutive days.
Beginning 24 hours after the final E.sub.2 injection, vehicle alone
or test compounds were given orally for (5) five consecutive days.
Progestational activity was determined by increases in uterine
weight and endometrial glandular arborization (McPhail Index).
[0060] In limited dose response studies, NSP-989 had an estimated
ED.sub.50 (AED.sub.50) of 0.001 mg/kg. Its potency in this assay
was similar to TMG and about 30-fold more potent than MPA.
EXAMPLE 2
Cyclic Regimen Using Progestin Compound
[0061] A phase 2, randomized, double-blind, multicenter,
dose-ranging study of 3 doses of NSP-989 in a 21-day regimen
followed by 7 days of placebo pills, and a comparator (the
combination steroidal OC desogestrel (DSG) 150 .mu.g/20 .mu.g
ethinyl estradiol for 21 days followed by 2 days of placebo pills,
followed by 5 days of 10 .mu.g EE, marketed in the United States
under the name Mircette) is planned.
[0062] Approximately 20 sites will participate with approximately
16 subjects per site. However, the enrollment will be competitive,
and additional subjects can be enrolled at any site.
[0063] The study will have 2 parts. Part 1 (days 1-84) of the study
will evaluate the ability of NSP-989 to produce ovarian
suppression, along with evaluating cycle control, side effects, and
metabolic data. Part 2 (days 85-168) will continue to follow the
subjects to collect cycle control, side effects, and metabolic
data. The study will be monitored routinely by the blinded project
medical monitor and study team for efficacy failures and safety
Each subject will participate for up to 9 months, depending on the
length of the subject's screening period. Eight (8) cycles will be
observed. The first cycle will be a baseline observation of
ovulation. Six (6) treatment cycles will be followed by 1
posttreatment observation cycle to assess return to ovulation. The
subjects will be healthy women of .gtoreq.18 years of age who are
younger than 36 years at the time of randomization. Subjects must
have had spontaneous regular (24- to 32-day) menstrual cycles for
the 3-month period preceding entry into the pretreatment
observation cycle, excluding postabortal and nonbreastfeeding
postpartum subjects. Postabortal and nonbreastfeeding postpartum
subjects must have completed at least 1 regular (24- to 32-day)
spontaneous menstrual cycle before entry into the pretreatment
observation cycle. The pretreatment observation cycle for all
subjects will begin on day 1 of the subsequent spontaneous menses
after completion of the prestudy screening (visit 1).
[0064] The pretreatment observation cycle is a control cycle; no
test article will be administered. Each subject will begin test
article on the first day of her menstrual bleeding (first subject
pack only). Each subject pack will contain NSP-989 or the steroid
combination OC comparator. Subjects will take NSP-989 orally, once
daily for 21 days (days 1 through 21), followed by 7 days of
placebo pills (days 22 through 28) for 6 cycles. Subjects assigned
to a steroid combination OC comparator, DSG 150 .mu.g, will take
test article orally, once daily for 21 days (days 1 through 21),
followed by 2 days of placebo pills (days 22 through 23), followed
by 5 days of 10 .mu.g EE (days 24 through 28) for 6 cycles. There
will also be a posttreatment cycle in which no test article will be
administered and return to ovulation will be assessed.
[0065] Each subject will be randomly assigned to receive one of the
following: TABLE-US-00002 Group Treatment A 100 .mu.g of NSP-989
for 21 days followed by 7 days of placebo pills B 200 .mu.g of
NSP-989 for 21 days followed by 7 days of placebo pills C 300 .mu.g
of NSP-989 for 21 days followed by 7 days of placebo pills D
Desogestrel 150 .mu.g for 21 days followed by 2 days of placebo
pills, followed by 5 days of 10 .mu.g EE
[0066] Each subject will begin test article on the first day of her
menstrual bleeding (first subject pack only). Subjects will take
test article orally, once daily for 28 days, at approximately the
same time each day. All subsequent subject packs will begin
following day 28 of the previous pill pack. Subjects will take test
article daily without interruption during the treatment cycles.
[0067] It is anticipated that one or more treatment groups A, B and
C receiving a regimen of the invention will have experience
effective contraception, cessation of ovulation, and all groups
will have a withdrawal bleed during the fourth week of each month
of treatment.
EXAMPLE 3
[0068] A blister pack with 28 blister containers is made with a
cardboard, paperboard, foil or plastic backing and enclosed in a
suitable cover. The blister containers are arranged to house a
sequence of 21 pills each providing a daily dose of 100 .mu.g of
NSP-989 followed by 7 daily doses of placebo pills (or 7 empty
blisters). Each blister container may conveniently be numbered or
otherwise marked, e.g., starting with the first of the 21 dosage
units that contain the active ingredient followed by 7 empty
blisters or by 7 dosage units that contain no active agent.
[0069] All patents, patent publications, and other publications
listed in this specification, and the sequence listing, are
incorporated herein by reference. While the invention has been
described with reference to particular embodiments, it will be
appreciated that modifications can be made without departing from
the spirit of the invention. Such modifications are intended to
fall within the scope of the appended claims.
Sequence CWU 1
1
3 1 25 DNA Artificial Sequence C3 specific primer 1 ggtcggtcaa
ggtctactcc tacta 25 2 20 DNA Artificial Sequence C3 specific primer
2 cacagcggca catttcattg 20 3 26 DNA Artificial Sequence customized
probe 3 agcattccat cgtccttctc cggatg 26
* * * * *