U.S. patent application number 11/122944 was filed with the patent office on 2006-01-05 for rna virus expression and replication, methods and uses therefor.
This patent application is currently assigned to Washington University in St. Louis. Invention is credited to Stephanie Karst, Herbert W. Virgin, Christiane Wobus.
Application Number | 20060003957 11/122944 |
Document ID | / |
Family ID | 35514777 |
Filed Date | 2006-01-05 |
United States Patent
Application |
20060003957 |
Kind Code |
A1 |
Virgin; Herbert W. ; et
al. |
January 5, 2006 |
RNA virus expression and replication, methods and uses therefor
Abstract
A norovirus-permissive cell culture infected with a norovirus,
and methods of culturing a norovirus, are disclosed.
Norovirus-permissive cells include dendritic cell-lineage cells,
and macrophage-lineage cells, such as dendritic cells, and
macrophages having a deficiency in a cellular anti-viral pathway
such as a STAT-1-dependent pathway, an interferon
receptor-dependent pathway, or a PKR-dependent pathway. Also
disclosed are methods of screening anti-viral compounds against
norovirus-permissive cells infected with norovirus, and norovirus
adapted to grow in fibroblasts as well as macrophages that are not
deficient in a cellular anti-viral pathway. Methods of making a
norovirus vaccine are also disclosed. A replicative form of
norovirus as well as its use in the development of an anti-viral
agent and a polypeptide expression system are also described.
Inventors: |
Virgin; Herbert W.;
(Clayton, MO) ; Wobus; Christiane; (Kirkwood,
MO) ; Karst; Stephanie; (Shreveport, LA) |
Correspondence
Address: |
SONNENSCHEIN NATH & ROSENTHAL LLP
P.O. BOX 061080
WACKER DRIVE STATION, SEARS TOWER
CHICAGO
IL
60606-1080
US
|
Assignee: |
Washington University in St.
Louis
|
Family ID: |
35514777 |
Appl. No.: |
11/122944 |
Filed: |
May 5, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60568301 |
May 5, 2004 |
|
|
|
Current U.S.
Class: |
514/44R ;
536/23.72 |
Current CPC
Class: |
C07K 14/005 20130101;
C07K 2317/76 20130101; C12N 2310/32 20130101; C12N 2310/52
20130101; C07K 16/10 20130101; C12N 2770/16051 20130101; C12N
15/1131 20130101; C12N 2310/321 20130101; C12N 2770/16022 20130101;
C12N 2310/3521 20130101; C12N 7/00 20130101; C12N 2310/321
20130101 |
Class at
Publication: |
514/044 ;
536/023.72 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07H 21/02 20060101 C07H021/02 |
Goverment Interests
GOVERNMENT INTERESTS
[0002] This work was supported at least in part with funds from the
federal government under U.S.P.H.S. Grant RO1 A154483, awarded by
the National Institutes of Health. The U.S. Government may have
certain rights in the invention.
Claims
1. A method of inhibiting RNA virus replication, the method
comprising contacting an RNA virus-infected cell with an inhibitor
of lariat formation, wherein the RNA virus nucleic acid comprises a
replicative form comprising at least one lariat comprising at least
one 5'-2' phosphodiester bond.
2. The method of claim 1, wherein the inhibitor is a nucleobase
polymer comprising a sequence selected from the group consisting of
GTGAAATGA (SEQ ID NO: 10), GTGAAATGAGG (SEQ ID NO: 11), TACCGATCT
(SEQ ID NO: 12), CTACCGATCTCGGG (SEQ ID NO: 13), GTGAAATGAGGTACCGAT
(SEQ ID NO: 14) and a complement thereof.
3. The method of claim 1, wherein the nucleobase polymer is a
Y-shaped nucleobase polymer.
4. The method of claim 3, wherein the nucleobase polymer comprises
at least one internal L-2'-O-methyl ribopyrimidine subunit.
5. The method of claim 3, wherein the nucleobase polymer comprises
a 3'-terminal L-2'-deoxycytidine subunit.
6. The method of claim 3, wherein the nucleobase polymer comprises
an arabino-adenosine branch point.
7. The method of claim 1, wherein the inhibitor comprises a
nucleobase polymer comprising a sequence of at least about 10
contiguous nucleobases of a lariat branch point of the RNA virus
nucleic acid replicative form or the complement thereof.
8. The method of claim 1, wherein the inhibitor comprises a
nucleobase polymer comprising a sequence of at least about 10
contiguous nucleobases of a sequence 5' to a lariat branch point of
the RNA virus nucleic acid replicative form or the complement
thereof.
9. The method of claim 1, wherein the inhibitor comprises a
nucleobase polymer comprising a sequence of at least about 10
nucleobases of a sequence 3' to a lariat branch point of the RNA
virus nucleic acid replicative form or the complement thereof.
10. The method of claim 1, wherein the RNA virus is a
single-stranded RNA virus.
11. The method of claim 10, wherein the RNA virus is a
calicivirus.
12. A method of translating a nucleic acid encoding a polypeptide,
the method comprising: inoculating an RNA virus-permissive cell
with a viral nucleic acid which forms a lariat structure
operatively linked to a sequence encoding the polypeptide; and
incubating the cell.
13. The method of claim 12, wherein the RNA virus translation
initiation sequence comprises a lariat branch point sequence.
14. The method of claim 12, wherein the RNA virus translation
initiation sequence is an RNA virus ribosome binding site.
15. The method of claim 14, wherein the RNA virus ribosome binding
site is an RNA virus internal ribosome entry site.
16. The method of claim 12, wherein the RNA virus translation
initiation sequence is a calicivirus translation initiation
sequence and wherein the RNA virus-permissive cell is a
calicivirus-permissive cell.
17. A replicon comprising an RNA virus branch point and a sequence
encoding a heterologous polypeptide.
18. The replicon of claim 17, further comprising an RNA virus
promoter.
19. The replicon of claim 18, wherein the RNA virus branch point is
a calicivirus branch point.
20. The replicon of claim 17, wherein the RNA virus branch point
comprises a sequence comprising at least 20 contiguous nucleotides
having at least about 70% sequence identity with a sequence
selected from the group consisting of SEQ ID NO:11, SEQ ID NO:12,
SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:161, SEQ ID
NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ED NO:20, SEQ ID NO:21, SEQ
ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26,
SEQ ID NO:27, SEQ ID NO:28 and portions thereof.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application Ser. No. 60/568,300, filed May 5, 2004. This
application is incorporated in its entirety by reference.
FIELD
[0003] This invention relates generally to the field of virology,
and, more particularly, to methods and uses for norovirus culture
and norovirus replicative forms.
BACKGROUND
[0004] Norovirus, which is a single-stranded, positive strand RNA
virus belonging to the family calciviridae, causes over 90% of
non-bacterial epidemic gastroenteritis worldwide. However,
norovirus has been poorly understood because of a lack of a cell
culture system supporting norovirus replication (Atmar, R. L. and
Estes, M. K., Clinical Microbiology Reviews 14: 15-37, 2001).
Norovirus, including human forms of norovirus (i.e., Norwalk
virus), can be detected in stool specimens, sputum, blood or
vomitus of diseased individuals. Norovirus can also be present in
body tissues, such as brain tissue, in an infected mammalian
organism. Previous attempts to culture norovirus have been
unsuccessful (Duizer E, et al. J Gen Virol. 85(Pt 1): 79-87, 2004).
There is thus a need to establish a norovirus culture system and to
use such a system to identify the mechanisms of replication and
translation of these important human viruses.
SUMMARY
[0005] Accordingly, the present inventors have succeeded in
discovering methods for culturing norovirus and in developing
norovirus-permissive host cells. The culture methods can be used
for a variety of purposes, such as diagnostic methods, development
of assays for viral replication, selection of mutant viruses with
desirable properties, screening of potential anti-viral compounds,
and development of vaccines.
[0006] The present inventors have also succeeded in identifying a
replicative form of an RNA virus genome, such as a norovirus
genome. The identification of this replicative form provides the
basis for the development of new methods and agents for treating
viral infection, as well as the development of new methods for
expressing polypeptides. This replicative form has a close
resemblance to RNA forms involved in the mammalian cell splicing
machinery and as such provides insight into fundamental host cell
processes emulated by a virus. In the lariat configuration, the 5'
end of the genome is adjacent to, and downstream of, the highly
active subgenomic RNA promoter of the virus. Hence, the virus can
use the subgenomic RNA promoter to make both at least one single
stranded subgenomic RNA and a full length genome. It therefore can
comprise a eukaryotic expression system, wherein a heterologous
gene is expressed under the control of a subgenomic RNA
promtoter.
[0007] The subgenomic RNA of the virus also has the potential to
form a lariat. This is because the 5' end of the genome is highly
conserved with the 5' end of the subgenomic RNA. That is, the
sequences at the 5' end that are similar to splicing intermediates
are highly related to the 5' end of the subgenomic RNA. Thus, an
infected cell can comprise more than one viral-derived lariat.
[0008] In various embodiments, the present invention can comprise a
norovirus-permissive cell culture infected with a norovirus. Such
norovirus-permissive cell cultures can be comprised of vertebrate
cells, in particular haematopoietic cells such as
macrophage-lineage cells and dendritic cell-lineage cells
(dendritic cell-lineage cells). The macrophage-lineage cells can
be, for example, bone marrow macrophages, umbilical cord
macrophages, peripheral blood mononuclear cells, human
leukocyte/mouse macrophage hybrid cells and embryonic stem cell
macrophages.
[0009] In certain embodiments, the macrophages that can support
norovirus replication can be macrophages deficient in one or more
anti-viral pathways. The deficiency in a cellular anti-viral
pathway can be a deficiency in a STAT-1-dependent anti-viral
pathway (Damell, J. E. et al., Science 264: 1415-1421, 1994) a
deficiency in an interferon receptor-dependent anti-viral pathway,
a deficiency in a double-stranded RNA-dependent serine/threonine
protein kinase (PKR)-dependent anti-viral pathway (Hovanessian, A.
G. Semin. Virol. 4, 237-245, 1993), or combinations thereof.
Accordingly, macrophages which can support norovirus replication
can be STAT-1-deficient macrophages, PKR-deficient macrophages,
interferon receptor-deficient macrophages, or a combination
thereof. The interferon receptor deficient macrophages can be
deficient in an interferon-.alpha..beta. receptor, deficient in an
interferon-.gamma. receptor, deficient in an interferon .lamda.
receptor, or a combination thereof. Macrophages deficient in the
PKR-dependent anti-viral pathway can be macrophages deficient in
PKR.
[0010] In certain configurations, the macrophage lineage cells can
be transformed macrophages. In some aspects, transformed
macrophages can be established macrophage cell lines such as RAW
264.7 cells, J774A.1 cells or WBC264-9C cells (a human
leukocyte/mouse macrophage hybrid cell line).
[0011] In certain configurations, the dendritic cell lineage cells
can be bone marrow dendritic cells, peripheral blood dendritic
cells, or transformed dendritic cells.
[0012] In some embodiments, the vertebrate cells can be murine
cells, while in other embodiments, the vertebrate cells can be
human cells or hybrid cells such as human-mouse fusion cells. In
some configurations, a norovirus can be a murine norovirus, while
in other configurations, a norovirus can be a human norovirus.
[0013] In various embodiments, the present invention can involve
methods of replicating a norovirus in vitro. The methods can
comprise inoculating norovirus-permissive cells with a norovirus,
and culturing the cells. In these embodiments, inoculating
norovirus-permissive cells can comprise infecting the cells with
the norovirus, or transfecting the norovirus-permissive cells with
a nucleic acid comprising a norovirus genome or a portion thereof
comprising at least 25 nucleotides. In various configurations, the
methods can comprise inoculating vertebrate cells which can be
macrophage-lineage cells or dendritic cell-lineage cells. The
macrophage-lineage cells which can be inoculated can be
macrophage-lineage cells deficient in a cellular anti-viral pathway
such as a STAT-1-dependent anti-viral pathway, an interferon
receptor-dependent anti-viral pathway, a PKR-dependent anti-viral
pathway, or a combination thereof. The macrophages deficient in an
interferon-dependent pathway which can be inoculated can be
deficient in an interferon-.alpha..beta. receptor, an
interferon-.gamma. receptor, an interferon .lamda. receptor or a
combination thereof. The macrophages deficient in the PKR-dependent
pathway which can be inoculated can be PKR-deficient macrophages.
In some configurations, the macrophage-lineage cells which can be
inoculated can be transformed macrophages such as RAW 264.7 cells,
J774A.1 cells or WBC264-9C cells. In certain configurations, the
norovirus-permissive cells which can be inoculated with norovirus
can be dendritic cells such as bone marrow dendritic cells,
peripheral blood dendritic cells, and transformed dendritic cells.
In various embodiments of the invention, the cells that can be
inoculated with norovirus can be vertebrate cells such as human
cells, murine cells, or human-murine fusion cells, and the
norovirus can be a murine norovirus or a human norovirus such as a
Norwalk virus.
[0014] In various embodiments, the invention comprises methods of
detecting norovirus in a biological sample. In one aspect, such
methods can involve contacting a cell culture comprising
norovirus-permissive cells with the sample, and detecting norovirus
viral replication in the cell culture. The sample in some
configurations can be a diagnostic sample, such as a diagnostic
sample from a mammal suspected of infection with the norovirus. The
mammal can be a human, a laboratory animal such as a rodent, a farm
animal, or a companion animal. The diagnostic sample can be a
tissue sample, a blood sample, a vomitus sample, a sputum sample or
a stool sample. The norovirus-permissive cells in these embodiments
can be dendritic cell-lineage cells or macrophage-lineage cells.
The macrophage-lineage cells can be macrophages deficient in a
cellular anti-viral pathway such a STAT-1-dependent anti-viral
pathway, an interferon receptor-dependent anti-viral pathway, a
PKR-dependent anti-viral pathway, or combinations thereof. In some
configurations, the norovirus-permissive cells can be transformed
macrophages selected from the group consisting of RAW 264.7 cells,
J774A.1 cells and WBC264-9C cells.
[0015] In various configurations, methods of detecting norovirus in
a biological sample can also involve performing a cytopathic assay,
an antibody assay, a nucleic acid detection assay, or a protein
detection assay. A cytopathic assay can be, in some configurations,
a dye exclusion assay, an enzyme release assay, a necrosis assay or
an apoptosis assay. In some configurations, an antibody assay can
use a monoclonal or a polyclonal antibody, such as an antibody
directed against a norovirus polypeptide and any antigen detection
system known in the art, such as a Western blot assay, an ELISA
assay, an immunofluorescence assay, an immunoprecipitation assay or
a radioimmunoassay. In yet other configurations, a nucleic acid
detection assay can be an assay such as a polymerase chain reaction
assay, an RNase protection assay or a hybridization assay such as a
Northern blot assay. In yet other configurations, a nucleic acid
detection assay can be an assay such as a polymerase chain reaction
assay, a Northern blot assay or an RNase protection assay that
detects a lariat form of a viral genome.
[0016] In various embodiments, the invention can comprise methods
of identifying a compound having anti-viral activity. In certain
configurations, a method can comprise contacting the compound with
a norovirus-permissive cell culture infected with a norovirus, and
detecting inhibition of norovirus replication. Detecting inhibition
of viral replication in these embodiments can comprise detecting
inhibition of viral nucleic acid synthesis or viral protein
synthesis. In some configurations, detecting inhibition of
norovirus replication can comprise performing a plaque assay on the
norovirus-permissive cell culture. In these configurations, the
assays for identifying anti-viral compounds can be used for
identifying compounds having anti-RNA virus activity,
anti-single-stranded RNA virus activity, anti-positive strand
single-stranded RNA virus activity, anti-positive strand
single-stranded RNA, no DNA stage virus activity, anti-calicivirus
activity, or anti-norovirus activity. A norovirus infecting a
norovirus-permissive cell in these methods can be, in certain
configurations, a norovirus comprising a nucleic acid consisting of
from about 7200 to about 7700 nucleotides and wherein the norovirus
nucleic acid hybridizes under high stringency conditions to a
nucleic acid consisting of the sequence set forth in SEQ ID NO:
1.
[0017] In various embodiments, the invention can comprise a host
range-modified norovirus. In some configurations, a host
range-modified norovirus can be a norovirus adapted for growth in
fibroblasts or macrophage-lineage cells which are not anti-viral
pathway-deficient. In certain aspects, a host range-modified
Norovirus can exhibit reduced virulence compared to non-adapted
norovirus infecting the same host cells. A host range-modified
norovirus of these embodiments can be, in certain aspects, a
norovirus comprising an RNA of at least about 7200 to about 7700
nucleotides, wherein the RNA consists of a nucleotide sequence at
least 80% identical to the RNA of the norovirus deposited on Apr.
27, 2004 with ATCC as Accession Number PTO-5935. A host
range-modified norovirus can have a reduced virulence against a
host organism compared to a non-adapted norovirus. In certain
configurations, a host range-modified norovirus can be used for
vaccination against norovirus infection. Hence, a norovirus vaccine
can comprise a therapeutically effective amount of a host
range-modified norovirus.
[0018] In various embodiments, the invention comprises methods of
adapting norovirus to have a modified host range. The methods can
also comprise serially passaging a norovirus population for three
or more generations in norovirus-permissive cell cultures. The
serially passaging can comprise plaque-purifying a norovirus and
growing the plaque-purified norovirus in norovirus-permissive host
cells for three or more serial passages.
[0019] In some embodiments, the invention includes cDNA of
norovirus genomic RNA. A cDNA in these embodiments can be
single-stranded or double-stranded, and can be comprised by a
vector, such as a plasmid or viral vector. In some configurations,
a cDNA of a norovirus genomic RNA can comprise an infectious clone.
In certain aspects, a cDNA of a norovirus genomic RNA can comprise
a partial cDNA, such as, for example, a subgenomic replicon. A
vector comprising a subgenomic replicon can further comprise a
reporter sequence, for example a reporter sequence encoding an
enzyme or a green fluorescent protein. Such constructs can be used
to test the efficacy of a candidate anti-viral compound. In some
embodiments, a subgenomic portion can comprise, in non-limiting
example, a sequence encoding a viral protein, a sequence involved
in viral assembly, or a sequence involved in viral transcription or
viral genome replication. A subgenomic portion can also be linked
to an indicator sequence such as a sequence encoding a reporter
polypeptide, for example a polypeptide encoding an enzyme or a
fluorescent protein.
[0020] In some embodiments, a replicon can comprise an anti-viral
agent. In some configurations of these embodiments, a replicon can
comprise a viral RNA promoter. In some configurations a plasmid can
comprise a promoter operably linked to a cDNA of viral sequence
encoding an RNA promoter. In these configurations, the RNA promoter
can be transcribed by the host cell to provide a negative sense
copy of the viral RNA promoter. Upon infection or transfection of
the cell with a virus, the negative sense copy of the promoter can
act as a template molecule for a virally-encoded RNA-dependent RNA
polymerase, thereby leading to the cell making RNA copies of
subgenomic plus sense RNA. In some configurations, the amount of
subgenomic RNA can be sufficiently great to compete with the viral
RNA for cell or viral components used in viral replication, and
thereby inhibit viral replication.
[0021] In some embodiments, the invention can comprise a replicon
construct which can be used for viral detection. A replicon
construct can, in these embodiments, be used, for example, to
measure virus burden in a patient such as a human patient. In some
configurations of these embodiments, a plasmid expresses a replicon
under the control of a (DNA) promoter. A replicon can comprise a
viral RNA promoter operably linked to a reporter sequence, for
example a sequence encoding an enzyme or a fluorescent protein. In
these configurations, the host cell accumulates negative sense
viral RNA, although the RNA promoter is not expressed in a host
cell in the absence of a stimulus such as an infecting virus. A
sequence encoding a reporter molecule can be operably linked to
this sequence, in frame with the initiation codon. In the absence
of infection, the replicon can be transcribed by the host cell to
provide a negative sense copy of the viral RNA promoter. Upon
infection or transfection of the cell with a virus, the negative
sense copy of the promoter can act as a template molecule for a
virally-encoded RNA-dependent RNA polymerase, thereby leading to a
host cell making RNA copies of subgenomic plus sense RNA, including
a plus-sense copy of the sequence encoding a reporter. Reporter
amount can be monotonically related to amount of infecting virus.
Measurement of reporter amount, for example through measurement of
enzyme activity or fluorescence of a fluorescent protein, can be
used to measure viral burden. In some configurations of these
embodiments, a plasmid can comprise a 5' end of an RNA virus
genome, such as a norovirus genome, through a translation
initiation codon (ATG) such as the initiation codon most proximal
to the 5' end, or the initiation codon that is comprises by the
second or additional open reading frame of the norovirus
genome.
[0022] In some embodiments, the invention includes methods of
inhibiting RNA virus replication based upon the inventors'
discovery of a novel replicative form. This replicative form is
topologically a lariat, akin to a splicing intermediate formed
during eukaryotic messenger RNA processing (Patel and Steitz,
Nature Reviews Molecular Cell Biology 4: 960-970, 2003). In a
lariat form of a virus such as a norovirus, a 5'-2' linkage is
formed between the 5' terminal nucleotide and an internal
nucleotide. In addition, 5' sequences and sequences near the
linkage site resemble those of known intervening sequences that are
involved in forming lariat structures during intron splicing. Thus,
it is believed that an RNA virus such as a norovirus uses a host
cell's splicing "machinery" during its life cycle. This machinery
involves a large number of molecular components, including over 100
polypeptides as well as RNA molecules such as snRNAs (Patel and
Steitz, supra). Hence, viral gene expression and/or viral RNA
replication can involve the lariat structure, and, accordingly,
interfering or blocking the formation of the lariat, functioning of
the lariat, or disassembly of the lariat can interfere with virus
life cycle. The lariat, as well as the biomolecules involved in its
formation, use, or disassembly, therefore provide targets for
anti-viral agents. These biomolecules can be components of a
spliceosome or a small nuclear ribonucleoprotein molecule (snRNP).
Hence, in some embodiments, the invention provides methods of
inhibiting RNA virus replication. A method of these embodiments can
comprise contacting an RNA virus-infected cell with a compound that
inhibits or interferes with the function of spliceosome component
such as, for example, a debranching enzyme.
[0023] In some embodiments, the invention can be a method of
inhibiting RNA virus replication, wherein the method comprises
contacting an RNA virus-infected cell with an inhibitor of lariat
formation, wherein the cell comprises an RNA virus nucleic acid
replicative form comprising at least one 5'-2' phosphodiester bond.
The RNA virus nucleic acid replicative form comprising at least one
5'-2' phosphodiester bond can comprise a lariat. The inhibitor of
lariat formation can be, in some configurations, an inhibitor of an
enzyme that catalyzes one or more steps in lariat formation. In
some configurations, an inhibitor of lariat formation can comprise
a nucleobase polymer. The nucleobase polymer can comprise one or
more sequences sharing sequence identity with viral sequences
expected to participate in lariat formation or function. The
nucleobase polymer can comprise, for example, a sequence found in a
norovirus or a norovirus replicative form, such as GTGAAATGA (SEQ
ID NO: 2), GTGAAATGAGG (SEQ ID NO: 3), TACCGATCT (SEQ ID NO: 4),
CTACCGATCTCGGG (SEQ ID NO: 5), GTGAAATGAGGTACCGAT (SEQ ID NO: 6) or
a complement thereof. In some configurations, an inhibitor of
lariat formation can comprise a nucleobase polymer which is
topologically a Y-shaped nucleobase polymer or a lariat-shaped
nucleobase polymer. In various configurations, the nucleobase
polymer can be an RNA or a DNA, and comprise at least one internal
L-2'-O-methyl ribopyrimidine subunit, a 3'-terminal
L-2'-deoxycytidine subunit, and/or an arabino-adenosine branch
point. In various embodiments, the inhibitor of lariat formation
can comprise a nucleobase polymer comprising a sequence of at least
about 10 contiguous nucleobases of a sequence of a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, the sequence TACCGATCG
(SEQ ID NO: 7); a nucleobase polymer comprising a sequence of at
least about 10 contiguous nucleobases of a sequence 5' to a lariat
branch point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, the sequence GTGAAATGA
(SEQ ID NO: 8), or a nucleobase polymer comprising a sequence of at
least about 10 nucleobases of a sequence 3' to a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, all or part of the
sequence ATCAATATCAAAACGGCGCAGCTCCAGGCCGCAGGCTTTTCAAAGAC (SEQ ID
NO: 9).
[0024] In some embodiments, the invention can be a method of
inhibiting RNA virus replication, wherein the method comprises
contacting an RNA virus-infected cell with an inhibitor of lariat
debranching, wherein the cell comprises an RNA virus nucleic acid
replicative form comprising at least one 5'-2' phosphodiester bond.
The RNA virus nucleic acid replicative form comprising at least one
5'-2' phosphodiester bond can comprise a lariat. The inhibitor of
lariat debranching can be, in some configurations, a debranching
enzyme inhibitor.
[0025] In some configurations, an inhibitor of lariat debranching
such as, for example, an inhibitor of a debranching enzyme can
comprise a nucleobase polymer. The nucleobase polymer can comprise
one or more sequences sharing sequence identity with viral
sequences expected to participate in lariat formation or function.
The nucleobase polymer can comprise, for example, a sequence found
in a norovirus or a norovirus replicative form, such as GTGAAATGA
(SEQ ID NO: 2), GTGAAATGAGG (SEQ ID NO: 3), TACCGATCT (SEQ ID NO:
4), CTACCGATCTCGGG (SEQ ID NO: 5), GTGAAATGAGGTACCGAT (SEQ ID NO:
6) or a complement thereof. In some configurations, an inhibitor of
lariat debranching can comprise a nucleobase polymer which is
topologically a Y-shaped nucleobase polymer or a lariat-shaped
nucleobase polymer. In various configurations, the nucleobase
polymer can be an RNA or a DNA, and comprise at least one internal
L-2'-O-methyl ribopyrimidine subunit, a 3'-terminal
L-2'-deoxycytidine subunit, and/or an arabino-adenosine branch
point. In various embodiments, the debranching enzyme inhibitor can
comprise a nucleobase polymer comprising a sequence of at least
about 10 contiguous nucleobases of a sequence of a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, the sequence TACCGATCG
(SEQ ID NO: 7); a nucleobase polymer comprising a sequence of at
least about 10 contiguous nucleobases of a sequence 5' to a lariat
branch point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, the sequence GTGAAATGA
(SEQ ID NO: 8), or a nucleobase polymer comprising a sequence of at
least about 10 nucleobases of a sequence 3' to a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, all or part of the
sequence ATCAATATCAAAACGGCGCAGCTCCAGGCCGCAGGCTTTTCAAAGAC (SEQ ID
NO: 9).
[0026] In various embodiments, the RNA virus that forms a lariat
structure upon infection of a permissive cell can be a
single-stranded RNA virus; a positive strand single-stranded RNA
virus; a positive strand single-stranded RNA virus, no DNA stage; a
calicivirus; or a norovirus such as a human norovirus or a murine
norovirus such as MNV-1.
[0027] In some embodiments, the invention provides a method of
translating a nucleic acid encoding a polypeptide. In these
embodiments, the method can comprise inoculating an RNA
virus-permissive cell with a viral nucleic acid which forms a
lariat structure operatively linked to a sequence encoding the
polypeptide, and incubating the cell. In these methods, the RNA
virus translation initiation sequence can comprise a lariat branch
point sequence, such as, for example, GTGAAATGAG (SEQ ID NO: 10).
Alternatively, the RNA virus translation initiation sequence can be
an RNA virus ribosome binding site, such as, for example, an RNA
virus internal ribosome entry site (IRES). In some configurations,
the RNA virus translation initiation sequence, including an ATG
translation initiation codon, can comprise a sequence including an
ATG start codon, such as, for example, SEQ ID NO: 11 , SEQ ID NO:
12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ
ID NO: 17, SEQ ID NO: 18. SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO:
21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ
ID NO: 26, SEQ ID NO:27, or SEQ ID NO: 28, as follows:
TABLE-US-00001 CAGCTCCAGGCCGCAGGCTTTTCAAAGACGGATG (SEQ ID NO: 11)
CCGCACGCCTTGCCTTGGGGCAGCAGCCCACGAG
GGCCGTGGATTGGTCTGGGACGCGGTACTACACC
GCTAACCAGCCAGTCACGGGCTTCTCGGGTGGCT
TTACCCCAACCTACACTCCAGGTAGGCAAGTGAC
ATCCCGCCCTGTGGACACATCCCCTCTACCGATC TGTGAAATG
CCGCAGGCTTTTCAAAGACGGATGCCGCACGCCT (SEQ ID NO: 12)
TGCCTTGGGGCAGCAGCCCACGAGGGCCGTGGAT
TGGTCTGGGACGCGGTACTACACCGCTAACCAGC
CAGTCACGGGCTTCTCGGGTGGCTTTACCCCAAC
CTACACTCCAGGTAGGCAAGTGACATCCCGCCCT GTGGACATCCCCTCTACCGATCTGTGAAATG
TTCAAAGACGGATGCCGCACGCCTTGCCTTGGGG (SEQ ID NO: 13)
CAGCAGCCCACGAGGGCCGTGGATTGGTCTGGGA
CGCGGTACTACACCGCTAACCAGCCAGTCACGGG
CTTCTCGGGTGGCTTTACCCCAACCTACACTCCA
GGTAGGCAAGTGACATCCCGCCCTGTGGACACAT CCCCTCTACCGATCTGTGAAATG
GATGCCGCACGCCTTGCCTTGGGGCAGCAGCCCA (SEQ ID NO: 14)
CGAGGGCCGTGGATTGGTCTGGGACGCGGTACTA
CACCGCTAACCAGCCAGTCACGGGCTTCTCGGGT
GGCTTTACCCCAACCTACACTCCAGGTAGGCAAG
TGACATCCCGCCCTGTGGACACATCCCCTCTACC GATCTGTGAAATG
GCCTTGCCTTGGGGCAGCAGCCCACGAGGGCCGT (SEQ ID NO: 15)
GGATTGGTCTGGGACGCGGTACTACACCGCTAAC
CAGCCAGTCACGGGCTTCTCGGGTGGCTTTACCC
CAACCTACACTCCAGGTAGGCAAGTGACATCCCG CCCTGTGGACACATCCCCTCTACCGAT
CTGTGAAATG GGGGCAGCAGCCCACGAGGGCCGTGGATTGGTCT (SEQ ID NO: 16)
GGGACGCGGTACTACACCGCTAACCAGCCAGTCA
CGGGCTTCTCGGGTGGCTTTACCCCAACCTACAC
TCCAGGTAGGCAAGTGACATCCCGCCCTGTGGAC ACATCCCCTCTACCGATCTGTGAAATG
CCCACGAGGGCCGTGGATTGGTCTGGGACGCGGT (SEQ ID NO: 17)
ACTACACCGCTAACCAGCCAGTCACGGGCTTCTC
GGGTGGCTTTACCCCAACCTACACTCCAGGTAGG
CAAGTGACATCCCGCCCTGTGGACACATCCCCTC TACCGATCTGTGAAATG
CCGTGGATTGGTCTGGGACGCGGTACTACACCGC (SEQ ID NO: 18)
TAACCAGCCAGTCACGGGCTTCTCGGGTGGCTTT
ACCCCAACCTACACTCCAGGTAGGCAAGTGACAT
CCCGCCCTGTGGACACATCCCCTCTACCGATCTG TGAAATG
GTCTGGGACGCGGTACTACACCGCTAACCAGCCA (SEQ ID NO: 19)
GTCACGGGCTTCTCGGGTGGCTTTACCCCAACCT
ACACTCCAGGTAGGCAAGTGACATCCCGCCCTGT GGACACATCCCCTCTACCGATCTGTGAAATG
CGGTACTACACCGCTAACCAGCCAGTCACGGGCT (SEQ ID NO: 20)
TCTCGGGTGGCTTTACCCCAACCTACACTCCAGG
TAGGCAAGTGACATCCCGCCCTGTGGACACATCC CCTCTACCGATCTGTGAAATG
CCGCTAACCAGCCAGTCACGGGCTTCTCGGGTGG (SEQ ID NO: 21)
CTTTACCCCAACCTACACTCCAGGTAGGCAAGTG
ACATCCCGCCCTGTGGACACATCCCCTCTACCGA TCTGTGAAATG
GCCAGTCACGGGCTTCTCGGGTGGCTTTACCCCA (SEQ ID NO: 22)
ACCTACACTCCAGGTAGGCAAGTGACATCCCGCC CTGTGGACACATCCCCTCTACCGAT
CTGTGAAATG GGCTTCTCGGGTGGCTTTACCCCAACCTACACTC (SEQ ID NO: 23)
CAGGTAGGCAAGTGACATCCCGCCCTGTGGACAC ATCCCCTCTACCGATCTGTGAAATG
GTGGCTTTACCCCAACCTACACTCCAGGTAGGCA (SEQ ID NO: 24)
AGTGACATCCCGCCCTGTGGACACATCCCCTCTA CCGATCTGTGAAATG
CCCAACCTACACTCCAGGTAGGCAAGTGACATCC (SEQ ID NO: 35)
CGCCCTGTGGACACATCCCCTCTACCGAT CTGTGAAATG
ACTCCAGGTAGGCAAGTGACATCCCGCCCTGTGG (SEQ ID NO: 26)
ACACATCCCCTCTACCGATCTGTGAAATG GGCAAGTGACATCCCGCCCTGTGGACACATCCCC
(SEQ ID NO: 27) TCTACCGATCTGTGAAATG
GTGGACACATCCCCTCTACCGATCTGTGAAATG (SEQ ID NO: 28)
[0028] In some embodiments, the invention provides a method of
translating a nucleic acid encoding a polypeptide. In these
embodiments, the method can comprise inoculating a eukaryotic cell
with a nucleic acid comprising an RNA lariat-forming sequence of an
RNA virus linked to a sequence encoding the polypeptide wherein the
polypeptide is heterologous to the virus, and incubating the cell.
In these embodiments, the eukaryotic cell can be, for example, an
animal cell, which can be, for example, a mammalian cell, which can
be, for example, an RNA virus-permissive cell, which can be, for
example, a norovirus-permissive cell. In these methods, the RNA
virus translation initiation sequence can comprise viral
translation initiation sequence, including an ATG translation
initiation codon, can comprise a sequence such as, for example, SEQ
ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO:
33, SEQ ID NO: 34, SEQ ID NO: 35, as follows. TABLE-US-00002
TAGTCCCCACGCCACCGATCTGTTTTGCGCTGGG (SEQ ID NO: 29)
TGCGCTTTGGAAAATGGATGCTGAGACCCCGCAG GAACGCTCAGCAGTCTTTGTGAATG
TAGTCCCCACGCCACCGATCTGTTTTGCGCTGGG (SEQ ID NO: 30)
TGCGCTTTGGAAAATGGATGCTGAGACCCCGCAG GAACGCTCAGCAGTCTTTGTGAATG
GCCACCGATCTGTTTTGCGCTGGGTGCGCTTTGG (SEQ ID NO: 31)
AAAATGGATGCTGAGACCCCGCAGGAACGCTCAG CAGTCTTTGTGAATG
TGTTTTGCGCTGGGTGCGCTTTGGAAAATGGATG (SEQ ID NO: 32)
CTGAGACCCCGCAGGAACGCTCAGCAGTC TTTGTGAATG
TGGGTGCGCTTTGGAAAATGGATGCTGAGACCCC (SEQ ID NO: 33)
GCAGGAACGCTCAGCAGTCTTTGTGAATG TTGGAAAATGGATGCTGAGACCCCGCAGGAACGC
(SEQ ID NO: 34) TCAGCAGTCTTTGTGAATG
GATGCTGAGACCCCGCAGGAACGCTCAGCAGTCT (SEQ ID NO: 35) TTGTGAATG
[0029] In certain embodiments, the lariat junction can be located
downstream of a subgenomic promoter. The subgenomic promoter can be
a highly active promoter which is believed to support transcription
at a rate at least that of a beta-actin promoter. Therefore it is
believed that a subgenomic RNA comprising a lariat structure exists
and can transcribe genes. Hence, a subgenomic RNA can be used to
transcribe heterologous genes, such as genes encoding polypeptides
which are useful, for example medically useful polypeptides.
[0030] In certain embodiments, the RNA virus-permissive cell can be
a single stranded RNA virus-permissive cell, a positive strand
single stranded RNA virus-permissive cell, a positive strand single
stranded RNA virus, no DNA stage-permissive cell, a
calicivirus-permissive cell, or a norovirus-permissive cell. For
example, a norovirus-permissive cell can be a macrophage-lineage
cell, a dendritic cell-lineage cell, or any other
norovirus-permissive cell discussed herein.
[0031] In various configurations, the RNA virus translation
initiation sequence can be a single-stranded RNA virus translation
initiation sequence, a positive strand
[0032] single-stranded RNA virus translation initiation sequence, a
positive strand single-stranded RNA virus, no DNA stage translation
initiation sequence, a calicivirus translation initiation sequence,
or a norovirus translation initiation sequence. In certain
configurations, the translation initiation sequence can have at
least about 80% sequence identity with SEQ ID NO: 11. In certain
configurations, the translation initiation sequence can have the
sequence designated SEQ ID NO: 11.
[0033] In various configurations, the nucleic acid can be an RNA or
a DNA.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG. 1 illustrates productive infection in vitro by
brain-derived norovirus of STAT-deficient macrophages, RAW 264.7
cells and dendritic cells.
[0035] FIG. 2 illustrates virus grown from plaques from the culture
system infected with MNV-1.
[0036] FIG. 3 illustrates growth of plaque-derived MNV-1.CW1 virus
in bone marrow-derived macrophages, and RAW 264.7 cells.
[0037] FIG. 4 illustrates mechanisms of plaque-derived MNV-1 growth
control.
[0038] FIG. 5 illustrates a multi-step growth curve in
norovirus-permissive cells infected with plaque-derived
norovirus.
[0039] FIG. 6 illustrates MNV-1 infection in established macrophage
cell lines.
[0040] FIG. 7 illustrates the 7382 nucleotide consensus sequence of
an MNV-1, designated SEQ ID NO: 1.
[0041] FIG. 8 illustrates detection of the lariat form of the viral
genome by PCR and sequencing.
[0042] FIG. 9 illustrates the location of the lariat insertion
within the entire genome of the virus.
[0043] FIG. 10 illustrates proof that the lariat exists by RNase
protection showing the presence of a 283 nt specific for the lariat
form of the viral genome.
[0044] FIG. 11 illustrates the sequence of the MNV-1 lariat site
with a comparison to consensus sequences used in mammalian
splicing.
[0045] FIG. 12 illustrates that the 5' end of norovirus and
calicivirus genomes contain sequences that match the consensus
sites for mammalian splicing. The same is true of the 5' ends of
subgenomic RNAs derived from the same viruses.
[0046] FIG. 13 illustrates demonstration of the lariat form of the
MNV-1 genome.
[0047] FIG. 14 illustrates detection of the lariat form during
replication of the virus by both RNAse protection assays and real
time PCR assay.
[0048] FIG. 15 illustrates implications of the MNV1 lariat
conformation.
[0049] FIG. 16 illustrates MNV-1-specific staining in vivo in
macrophage lineage cells.
[0050] FIG. 17 illustrates replication of MNV-1 from brain
homogenate in cells of the dendritic cell and macrophage lineage in
vitro.
[0051] FIG. 18 illustrates characterization of a triple
plaque-purified MNV-1.
[0052] FIG. 19 illustrates ultrastructure of MNV-1.CW1-infected RAW
264.7 cells.
[0053] FIG. 20 illustrates a role for STAT-1 in limiting MNV-1
growth in vitro.
[0054] FIG. 21 illustrates changes in virulence of plaque-purified
MNV-1.
DETAILED DESCRIPTION
[0055] Methods and compositions for culturing norovirus are
described herein. The methods and compositions described herein
utilize laboratory techniques well known to skilled artisans and
can be found in laboratory manuals such as Sambrook, J., et al.,
Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 2001; Spector, D. L. et
al., Cells: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1998; and Harlow, E., Using
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1999. As used herein, in nucleic
acid sequences a "T" represents a thymine if the sequence refers to
a DNA sequence, or a uracil if the sequence refers to an RNA
sequence. Similarly, a "U" represents a uracil if the sequence
refers to an RNA sequence, or a thymine if the sequence refers to a
DNA sequence.
[0056] The present inventors have succeeded in discovering a cell
culture system for a norovirus. Development of their methods
involved the discovery of norovirus-permissive host cells. As used
herein, a "norovirus-permissive cell" is a cell in which a
norovirus replicates following infection with a norovirus or
transfection with norovirus genome RNA. As used herein, "norovirus
replication" can be understood to include various stages in
norovirus life cycle, such as, for example, binding of a norovirus
to a host cell, entry into the host cell, trafficking, processing,
genome release, translation, transcription, assembly, and release.
In some embodiments, norovirus replication can be detected by
measuring norovirus protein activity, for example polyprotein
protease activity, viral RNA polymerase activity, VPG activity or
NTPase activity. In some configurations, measurement of an
increased accumulation of viral RNA or viral protein in infected
cells can be considered an indication of viral replication,
although an increase in virus particle production is not measured.
Hence, in certain configurations, in a test of a candidate
anti-viral agent, anti-viral activity can be detected by detecting
inhibition of viral nucleic acid synthesis, or by detecting
inhibition of a norovirus protein activity, such as inhibition of
polyprotein protease activity, viral RNA polymerase activity, VPG
activity or NTPase activity. Furthermore, in certain
configurations, in a test of a candidate anti-viral agent,
anti-viral activity can be detected by detecting inhibition of
formation, disassembly or degradation of a viral RNA replicative
intermediate such as a viral lariat structure. In other
configurations, in a test of a candidate anti-viral agent,
anti-viral activity can be detected by detecting inhibition of a
norovirus protein accumulation, such as inhibition of polyprotein
protease accumulation, viral RNA polymerase accumulation, VPG
accumulation or NTPase accumulation.
[0057] The norovirus-permissive culture and the accompanying
methods can be used for a variety of purposes, such as diagnostic
methods, development of assays for viral replication, selection of
mutant viruses with desirable properties, identification of mutant
viruses, screening of potential anti-viral compounds, and
development of vaccines.
[0058] As used herein, the term "norovirus" can refer to
unmodified, wild-type norovirus, e.g., norovirus obtained from an
individual with viral gastroenteritis, unless specified otherwise.
As used herein, the term "host range-modified norovirus" refers to
norovirus modified, with regard to its host range, using laboratory
methods, e.g., norovirus grown in vitro for multiple passages.
[0059] In various embodiments, the present invention can comprise a
norovirus-permissive cell culture infected with a norovirus. A
norovirus permissive cell culture can be maintained using routine
cell culturing techniques well known to skilled artisans. A
norovirus-permissive cell culture can comprise vertebrate cells,
such as macrophage-lineage cells and dendritic cell-lineage cells.
As used herein, the term "macrophages" refers to mononuclear
phagocytes found in tissues, and the term "dendritic cells" refers
to reticular, immunocompetent antigen presenting cells of the
lymphoid and haemopoietic systems and skin . Macrophage-lineage
cells and dendritic cell-lineage cells can comprise
haematopoietic-lineage cells that can be either mature in their
differentiation state as macrophages or dendritic cells,
respectively, or partially mature, i.e., macrophage or dendritic
cell-like cells which exhibit some of the known characteristics of
macrophages and dendritic cells. Macrophage-lineage cells and
dendritic cell-lineage cells can also comprise precursor cells to
mature macrophages or dendritic cells, such as, for example,
peripheral blood monocytes or circulating dendritic cell-lineage
precursor cells. Because treatment of macrophage-lineage cells or
dendritic cell-lineage cells with cytokines, interleukins,
chemokines, or other reagents (for example, CSF-1, GM-CSF,
TNF-.alpha., lipopolysaccharide (LPS) or CD40 Ligand) can influence
the differentiation state of cells (e.g., Sapi E., Exp. Biol. Med.
229:1-11 2004; Dieu, M.-C. et al., J. Exp. Med. 188: 373-386, 1988)
the differentiation state of many haematopoietic lineage cells can
be altered by such treatments to become norovirus-permissive.
Hence, macrophage-lineage cells can be, for example, macrophages or
dendritic cells such as bone marrow macrophages or dendritic cells,
umbilical cord macrophages or dendritic cells, and peripheral blood
mononuclear cells. Norovirus-permissive cells can therefore
include, for example, cytokine-stimulated macrophage-lineage cells
such as, for example, cytokine-stimulated macrophages such as bone
marrow macrophages, cytokine-stimulated umbilical cord macrophages,
cytokine-stimulated peripheral blood mononuclear cells, and
cytokine-stimulated peripheral blood macrophages or dendritic
cells. For example, mature, wild type macrophages harvested from
peripheral blood but otherwise untreated may not be
norovirus-permissive. However, treatment of such cells with an
appropriate stimulus, such as, for example, a cytokine such as
CSF-1, may alter the macrophages to become norovirus-permissive. In
certain configurations, norovirus-permissive cells can be
macrophages or dendritic cells derived from embryonic stem cells.
The embryonic stem cells can be stimulated to become macrophages or
dendritic cells using methods well known in the art (e.g., Senju,
S. et al., Blood 101: 3501-3508, 2003).
[0060] In certain embodiments, macrophages and dendritic cells
support norovirus replication. The macrophages which can support
norovirus replication can be macrophages deficient in one or more
anti-viral pathways. The deficiency in a cellular anti-viral
pathway can be a deficiency in a STAT-1-dependent anti-viral
pathway, a deficiency in an interferon receptor-dependent
anti-viral pathway, a deficiency in a double-stranded RNA-dependent
serine/threonine protein kinase (PKR) anti-viral pathway
(Hovanessian, A. G. Semin. Virol. 4, 237-245, 1993), or
combinations thereof. Accordingly, macrophages which can support
norovirus replication can be, in some configurations,
STAT-1-deficient macrophages, PKR-deficient macrophages, or
interferon receptor-deficient macrophages. The interferon receptor
deficient macrophages can be deficient in a Type I interferon
response. In some configurations, a norovirus-permissive macrophage
can be deficient for an interferon-.alpha..beta. receptor,
deficient for an interferon-.gamma. receptor, deficient for an
interferon .lamda. receptor, or a combination thereof. Macrophages
deficient in the PKR-dependent anti-viral pathway can be
macrophages deficient in PKR.
[0061] In certain configurations, the macrophage lineage cells can
be transformed macrophages. In some aspects, transformed
macrophages can be established macrophage cell lines such as, for
example, RAW 264.7 cells and J774A.1 cells, both of which are
available from the American Type Culture Collection, P.O. Box 1549,
Manassas Va. 20108.
[0062] In certain configurations, the dendritic cell lineage cells
can be bone marrow dendritic cells, peripheral blood dendritic
cells, or transformed dendritic cells. The dendritic cells can be
from any stage or substage of dendritic cell development or
differentiation (e.g., Herbst, B., et al., Br. J. Haematol. 99:
490-499, 1997).
[0063] In some embodiments, the vertebrate cells can be murine
cells, while in other embodiments, the vertebrate cells can be
human cells. Human cells can be, for example, human bone marrow
macrophages or dendritic cells. In some configurations, a norovirus
can be a murine norovirus, while in other configurations, a
norovirus can be a human norovirus, such as a Norwalk virus.
[0064] In various embodiments, the present invention can involve
methods of replicating a norovirus in vitro. The methods can
comprise inoculating norovirus-permissive cells with a norovirus,
and culturing the cells. In these embodiments, inoculating
norovirus-permissive cells can comprise infecting the cells with
the norovirus, or transfecting the norovirus-permissive cells with
a nucleic acid comprising a norovirus genome or a portion thereof
comprising at least 25 contiguous nucleotides. In some embodiments,
inoculating norovirus-permissive cells with a norovirus can
comprise inoculating the cells with DNA such as a cDNA of a
norovirus genome or a portion thereof comprising at least 25
contiguous nucleotides. The cDNA of a norovirus can be comprised by
a vector, such as, in non-limiting example, a bacteriophage or a
plasmid. In certain aspects, the cDNA can comprise a replicon, or a
sequence encoding a viral polypeptide. A vector can further
comprise a promoter, which can be operatively linked to a sequence
encoding a reporter polypeptide. In certain embodiments, a cDNA of
a norovirus genome can be comprised by an infectious clone. In
various configurations, the methods can comprise inoculating
vertebrate cells which can be macrophage-lineage cells or dendritic
cell-lineage cells. The macrophage-lineage cells which can be
inoculated can be macrophage-lineage cells deficient in a cellular
anti-viral pathway such as a STAT-1-dependent anti-viral pathway,
an interferon receptor-dependent anti-viral pathway, a
PKR-dependent anti-viral pathway, or a combination thereof. The
macrophages deficient in an interferon pathway which can be
inoculated can be deficient in an interferon-.alpha..beta.
receptor, an interferon-.gamma. receptor, an interferon-.lamda.
receptor or a combination thereof. The macrophages deficient in the
PKR-dependent pathway which can be inoculated can be PKR-deficient
macrophages. In some configurations, the macrophage-lineage cells
which can be inoculated can be transformed macrophages such as RAW
264.7 cells and J774A.1 cells. Other macrophage-lineage cells, for
example macrophage-lineage cells available from the American Type
Culture Collection, can also be used to practice the methods of the
invention. In certain configurations, the norovirus-permissive
cells which can be inoculated with norovirus can be dendritic cells
such as bone marrow dendritic cells, peripheral blood dendritic
cells, and transformed dendritic cells.
[0065] In various embodiments of the invention, cells that can be
inoculated with norovirus can be vertebrate cells such as human or
murine cells, and the norovirus can be a murine norovirus or a
human norovirus such as a Norwalk virus.
[0066] In some embodiments, detection of the lariat itself, using,
for example, RT-PCR (real time polymerase chain reaction) provides
a method for detecting the presence of the virus. Because the
lariat is found in a host cell when the virus is replicating its
RNA, detection of the lariat's presence can indicate that the virus
is replicating, and hence the lariat's presence can serve as an
indicator of viral replication. Accordingly, a reduction or
elimination of a viral lariat from infected cells can serve as an
indication of viral inhibition, for example in a test of a
candidate anti-viral compound.
[0067] In various embodiments, the invention comprises methods of
detecting norovirus in a biological sample. The methods can
comprise contacting a cell culture comprising norovirus-permissive
cells with the sample, and detecting norovirus viral replication in
the cell culture. The sample in some configurations can be a
diagnostic sample, such as a diagnostic sample from a mammal
suspected of infection with the norovirus. The mammal can be a
human, a laboratory animal such as a rodent, for example a mouse, a
rat, or a guinea pig, a farm animal such as a cow or a sheep, or a
companion animal such as a cat or dog. The diagnostic sample can be
a tissue sample, a blood sample, or a stool sample. A tissue sample
can be from any tissue or body fluid that is suspected of infection
with a norovirus, such as, for example, liver, kidney, brain,
blood, or saliva. The norovirus-permissive cells in these
embodiments can be dendritic cell-lineage cells or
macrophage-lineage cells. The macrophage-lineage cells can be
macrophages deficient in a cellular anti-viral pathway such a
STAT-1-dependent anti-viral pathway, an interferon
receptor-dependent anti-viral pathway, a PKR-dependent anti-viral
pathway, or combinations thereof. In some configurations, the
macrophage-lineage cells can be transformed macrophages The
transformed macrophages can be, for example, transformed
macrophages selected from the group consisting of RAW 264.7 cells
and J774A.1 cells. In various configurations, a method of detecting
norovirus in a biological sample can comprise detecting a host cell
change that results from norovirus infection. A host cell change
can be, for example, a change in morphology, molecular composition,
or cytopathicity. Hence, a method for detecting norovirus in a
biological sample can comprise performing a cytopathic assay, an
antibody assay, a protein detection assay or a nucleic acid
detection assay. A cytopathic assay can be, in some configurations,
a dye exclusion assay, an enzyme release assay, a necrosis assay,
or an apoptosis assay. A dye exclusion assay can be, in
non-limiting example, a trypan blue exclusion assay, or a
fluorescent dye exclusion assay such as a propidium iodide
exclusion assay. In some configurations, an antibody assay can use
a monoclonal or a polyclonal antibody, such as a monoclonal
antibody directed against a norovirus polypeptide, such as, for
example, monoclonal antibody A6.2. Any antigen detection system
known in the art, such as a Western blot assay, an ELISA assay, an
immunofluorescence assay, an immunoprecipitation assay or a
radioimmunoassay, can be used to detect the presence and/or
quantity of a norovirus. In some configurations, a protein
detection assay can comprise, in non-limiting example, a gel
electrophoresis assay, a column chromatography assay, and an enzyme
assay. In yet other configurations, a nucleic acid detection assay
can be an assay such as a polymerase chain reaction assay or a
hybridization assay such as a Northern blot assay, or an RNase
protection assay. In a PCR assay, primers can be selected such that
their target sequences are located on opposite sides of a lariat
branch point. PCR amplification of a sample comprising a branch
point can lead to synthesis of a DNA molecule of predicted size,
which can be detected by standard methods such as agarose gel
electrophoresis. In an RNAse protection assay, a lariat in a sample
can be detected by forming a mixture comprising the sample and a
nucleic acid probe such as a single stranded RNA or DNA which is
complementary to a branch point-spanning sequence of a lariat. The
mixture can then be exposed to nuclease which selectively digests
single-stranded nucleic acids compared to double-stranded nucleic
acids. The nuclease can be an RNase, such as, for example, S1
nuclease. Protection of a double-stranded structure from nuclease
digestion can be used for detection of the presence of a lariat in
a sample. Similarly, Northern blot analysis can be used to detect
the presence of a lariat. For example, a probe which hybridizes
under high stringency conditions (as defined in Sambrook et al.,
supra) to the lariat can be used to detect the lariat.
[0068] In various embodiments, the invention comprises methods of
identifying a compound having anti-viral activity. "Anti-viral
activity," as used herein, can comprise inhibiting viral activity
at any stage in a virus' life cycle. Hence, anti-viral activity can
comprise, in non-limiting example, inhibition of viral replication,
inhibition of viral gene expression, or inhibition of a viral
protein accumulation or activity. Inhibition of a viral protein
accumulation or activity can comprise, in non-limiting example,
inhibition of norovirus polyprotein protease accumulation,
inhibition of norovirus RNA polymerase accumulation, inhibition of
norovirus VPG accumulation, inhibition of norovirus NTPase
accumulation, inhibition of norovirus polyprotein protease
activity, inhibition of norovirus RNA polymerase activity,
inhibition of norovirus VPG activity inhibition of norovirus NTPase
activity, inhibition of lariat formation, or inhibition of lariat
degradation. Standard methods well known in the for measuring or
detecting norovirus protein accumulation or activity can be used,
for example, enzyme assays and antibody assays.
[0069] In certain configurations, a method for identifying a
compound having anti-viral activity can comprise contacting a
candidate anti-viral compound with a norovirus-permissive cell
culture infected with a norovirus, and detecting inhibition of
norovirus replication. In certain aspects, a candidate anti-viral
compound can be added to an infected norovirus-permissive culture
at a concentration of from about 1 picomolar to about 100
millimolar, or from about 1 nanomolar to about 100 micromolar.
Detecting inhibition of viral replication in some embodiments can
thus comprise detecting inhibition of viral nucleic acid synthesis
or viral protein synthesis. In some configurations, detecting
inhibition of norovirus replication can comprise performing a
plaque assay on the norovirus-permissive cell culture. A plaque
assay can comprise determining a titer of virus accumulated in a
plaque formed by infected cells in the presence of the candidate
anti-viral molecule. In these configurations, assays for
identifying anti-viral compounds can be used for identifying
compounds having anti-RNA virus activity, anti-single-stranded RNA
virus activity, anti-positive strand single-stranded RNA virus
activity, anti-positive strand single-stranded RNA, no DNA stage
virus activity, anti-calicivirus activity, or anti-norovirus
activity. A norovirus infecting a norovirus-permissive cell in
these methods can be, in certain configurations, a norovirus
comprising a nucleic acid consisting of from about 7200 to about
7700 nucleotides and wherein the norovirus nucleic acid hybridizes
under high stringency conditions to a nucleic acid consisting of
the sequence set forth in SEQ ID NO: 1. In some configurations,
anti-viral activity can be detected by detecting differences
between infected norovirus-permissive cells contacted with a
candidate anti-viral agent and control infected
norovirus-permissive cells. Such differences can comprise, in
non-limiting example, gene expression differences, antigenic
differences, enzyme activity differences, dye-staining differences,
or morphological differences (as revealed by light microscopy or
electron microscopy). In some configurations, anti-viral activity
can be detected by performing a cytopathic effects (CPE) inhibition
assay in which the anti-viral activity reduces or prevents
norovirus-induced CPE.
[0070] In some embodiments, the invention includes cDNA of
norovirus genomic RNA. A cDNA in these embodiments can be
single-stranded or double-stranded, and can be comprised by a
vector, such as a plasmid or viral vector. In some configurations,
a cDNA of a norovirus genomic RNA can comprise an infectious clone.
A partial or complete cDNA can be produced using a reverse
transcription techniques well known to skilled artisans. In certain
aspects, a cDNA of a norovirus genomic RNA can comprise a partial
cDNA, such as, for example, an identified viral gene, a viral
promoter, or a viral lariat branch point.
[0071] A subgenomic portion can comprise, in non-limiting example,
a sequence encoding a viral protein, a sequence involved in viral
assembly, or a sequence involved in viral transcription or viral
genome replication. A subgenomic portion can also be linked to an
indicator sequence such as a sequence encoding a reporter
polypeptide, for example a polypeptide encoding an enzyme or a
fluorescent protein.
[0072] In some embodiments, a replicon can comprise an anti-viral
agent. In some configurations of these embodiments, a replicon can
comprise a viral RNA promoter. In some configurations a plasmid can
comprise a promoter operably linked to a cDNA of viral sequence
encoding an RNA promoter. In these configurations, the RNA promoter
can be transcribed by the host cell to provide a negative sense
copy of the viral RNA promoter. Upon infection or transfection of
the cell with a virus, the negative sense copy of the promoter can
act as a template molecule for a virally-encoded RNA-dependent RNA
polymerase, thereby leading to the cell making RNA copies of
subgenomic plus sense RNA. In some configurations, the amount of
subgenomic RNA can be sufficiently great to compete with the viral
RNA for cell or viral components used in viral replication, and
thereby inhibit viral replication.
[0073] In some embodiments, the invention can comprise a replicon
construct which can be used for viral detection. A replicon
construct can, in these embodiments, be used, for example, to
measure virus burden in a patient such as a human patient. In some
configurations of these embodiments, a plasmid expresses a replicon
under the control of a (DNA) promoter. A replicon can comprise a
viral RNA promoter operably linked to a reporter sequence, for
example a sequence encoding an enzyme or a fluorescent protein. In
these configurations, the host cell accumulates negative sense
viral RNA, although the RNA promoter is not expressed in a host
cell in the absence of a stimulus such as an infecting virus. A
sequence encoding a reporter molecule can be operably linked to
this sequence, in frame with the initiation codon. In the absence
of infection, the replicon can be transcribed by the host cell to
provide a negative sense copy of the viral RNA promoter. Upon
infection or transfection of the cell with a virus, the negative
sense copy of the promoter can act as a template molecule for a
virally-encoded RNA-dependent RNA polymerase, thereby leading to a
host cell making RNA copies of subgenomic plus sense RNA, including
a plus-sense copy of the sequence encoding a reporter. Reporter
amount can be monotonically related to amount of infecting virus.
Measurement of reporter amount, for example through measurement of
enzyme activity or fluorescence of a fluorescent protein, can be
used to measure viral burden. In some configurations of these
embodiments, a plasmid can comprise a 5' end of an RNA virus
genome, such as a norovirus genome, through a translation
initiation codon (ATG) such as the initiation codon most proximal
to the 5' end, or the initiation codon that is comprises by the
second or additional open reading frame of the norovirus
genome.
[0074] In some configurations, a subgenomic replicon can comprise a
viral lariat junction. In some configurations, a subgenomic
replicon can comprise a viral RNA promoter. Hence, a subgenomic
replicon can comprise a contiguous sequence of about at least ten
to about 500 nucleotides, about at least ten to about 200
nucleotides, or about at least ten to about 1000 nucleotides, of
viral sequence comprising an RNA promoter A vector comprising a
subgenomic replicon can further comprise a reporter sequence, for
example a reporter sequence encoding a polypeptide such as an
enzyme or a green fluorescent protein. The enzyme can be, for
example, a phosphatase such as an alkaline phosphatase, for example
a secreted alkaline phosphatase. Such vectors can further comprise
a DNA promoter operatively linked to the reporter. Such constructs
can be transfected or transformed into a host cell, and used to
test the efficacy of a candidate anti-viral compound. In some
aspects, testing the efficacy of a candidate anti-viral compound
can comprise contacting cells comprising a norovirus replicon with
the candidate anti-viral compound, and detecting inhibition of
replicon replication. The inhibition detection, in some
configurations, can comprise detecting a reduction in reporter gene
expression. The host cell, in these embodiments, can be, for
example, a norovirus-permissive cell. In addition, such constructs
can be used to measure the virus content of a biological sample,
such as, for example, a stool or vomitus sample from a patient. For
example, a cell line comprising a subgenomic replicon and a
reporter gene can be contacted with a vomitus, blood, serum, or
stool sample from a human patient, and the viral burden can be
quantified by measuring the level of reporter gene expression.
[0075] In various embodiments, the invention comprises a host
range-modified norovirus. In some configurations, a host
range-modified norovirus can be a norovirus adapted for growth in
fibroblasts or macrophage-lineage cells which are not anti-viral
pathway-deficient. In certain aspects, a host range-modified
norovirus can exhibit reduced virulence compared to non-adapted
norovirus infecting the same host cells. A host range-modified
norovirus of these embodiments can be, in certain aspects, a
norovirus comprising an RNA of at least about 7200 to about 7700
nucleotides, wherein the RNA consists of a nucleotide sequence at
least 80% identical to the RNA of the norovirus deposited with ATCC
on Apr. 27, 2004 as Accession Number PTO-5935.
[0076] In some embodiments, the invention can comprise a viral form
which lacks the capacity to make a lariat. This form can be a
non-virulent form, i.e., can be harmless to a cell or an organism.
Such forms can be used, for example, as vectors for expression of
heterologous genes, or for production of a vaccine.
[0077] A host range-modified norovirus can have reduced virulence
against a host cell or organism compared to a non-adapted
norovirus. In certain configurations, a norovirus vaccine can
comprise a therapeutically effective amount of a host
range-modified norovirus. A therapeutically effective amount of a
host range-modified norovirus for use as a vaccine can comprise,
for example, from 1 to about 1,000,000 plaque forming units of a
host range-modified norovirus. In certain configurations, a host
range-modified norovirus can be a norovirus adapted to grow in a
host cell that is approved by a government regulatory agency such
as the US Food and Drug Administration for the production of a
vaccine. An approved host cell can be, for example, Vero cells such
as cells having an ATCC designation of No. CCL-81.
[0078] In various embodiments, the invention comprises methods of
adapting norovirus to have a modified host range. The methods can
comprise serially passaging a norovirus population for three or
more generations in norovirus-permissive cell cultures. The
serially passaging can comprise plaque-purifying a norovirus and
growing the plaque-purified norovirus in norovirus-permissive host
cells for two serial passages, three serial passages, or more
serial passages. Hence, examples of host cells for a norovirus
adapted to a modified host cell range can include not only RAW
264.7 cells, J774A. 1 cells, anti-viral pathway-deficient
macrophages and dendritic cells, but also fibroblasts such as
embryonic fibroblasts, and wild type macrophages (i.e., macrophages
that are not deficient in a cellular anti-viral pathway). In some
configurations, adapting the host range-modified norovirus to
growth in a vaccine production-approved cell line can comprise
infecting the approved cell line with host range-modified
norovirus, and growing the virus. Methods for producing a vaccine
against a virus using a virus exhibiting reduced virulence through
serial passage adaptation (Sabin, A. B., Ann. NY Acad. Sci. 61:
924-938, 1955) or through genetic engineering (e.g., by altering
codons) are well known to skilled artisans.
[0079] In some embodiments, the invention includes methods of
inhibiting RNA virus replication based upon the inventors'
discovery of a novel replicative form. As used herein, the term
"replicative form" refers to a viral nucleic acid form that appears
in an infected cell. The use of the term does not imply that the
form is necessarily a replication intermediate. A replicative form
can also be, for example, a viral nucleic acid form that provides
an active template for transcription. A replicative form can also
be, for example, a viral nucleic acid form that provides an active
template for translation of one or more polypeptides. The
replicative form observed in a virus-permissive cell herein is
topologically a lariat akin to a splicing intermediate formed
during messenger RNA processing (Patel and Steitz, Nature Reviews
Molecular Cell Biology 4: 960-970, 2003). In a lariat form of a
virus such as a norovirus, a 5'-2' linkage is formed between the 5'
terminal nucleotide and an internal nucleotide. In addition, 5'
sequences and sequences near the branch point site can exhibit
sequence similarity with sequences of introns which are involved in
forming lariat structures during intron splicing. Thus, an RNA
virus such as a norovirus uses its host cell's splicing `machinery`
during its life cycle. This `machinery` involves a large number of
molecular components, including over 100 polypeptides as well as
RNA molecules such as snRNAs, (e.g.,. U1, U2, U4, U4atac, U5, U6,
U6atac, U11 and U12; Patel and Steitz, supra). Hence, viral gene
expression and/or viral RNA replication can involve the lariat
structure. Accordingly, interfering or blocking the formation of
the lariat, functioning of the lariat, or disassembly of the lariat
can interfere with virus life cycle. The lariat, as well as the
biomolecules involved in its formation, use, or disassembly,
therefore provide targets for anti-viral agents. These biomolecules
can be components of a spliceosome or a small nuclear
ribonucleoprotein molecule (snRNP). Hence, in some embodiments, the
invention provides methods of inhibiting RNA virus replication. A
method of these embodiments can comprise contacting an RNA
virus-infected cell with a compound that inhibits or interferes
with the function of spliceosome component such as, for example, a
debranching enzyme (Carriero and Damha, Nucleic Acids Research 31:
6157-6167, 2003). The compound can be, for example, an antibody
directed against the lariat itself, against an snRNA, or a
spliceosome polypeptide such as, for example, a branch
point-binding protein such as SF1 (Arning et al., RNA 2, 794-810,
1996). In some configurations, the compound can be a sense or
antisense nucleobase polymer such as, for example, an an antisense
RNA, an antisense DNA, or an antisense peptide nucleic acid (PNA).
In some configurations, the compound can hybridize across a lariat
junction. The antisense RNA or DNA oligonucleotide can, for
example, hybridize to a branch point of the lariat form of the
viral RNA. The sense or antisense nucleobase polymer can comprise
from about 5 to about 100 bases, from about 10 to about 70 base,
from about 15 to about 50 bases, or from about 20 to about 30
bases. The compound can also take the form of a short RNA or DNA,
such as, for example, an interfering RNA (siRNA), a microRNA
(miRNA), an snRNA or a complement thereof. In this connection,
RNAse protection assays show that a nucleic acid probe can anneal
across the lariat junction.
[0080] It is believed that other RNA viruses, in addition to
noroviruses can use a similar strategy in their life cycle. Other
RNA viruses can be, for example, other single stranded RNA viruses,
other positive sense single stranded RNA viruses, such as, for
example, retroviruses, other positive sense single stranded RNA no
DNA stage viruses, such as, for example, poliovirus, or other
caliciviruses. Viruses using a similar strategy can be any virus
that utilizes a subgenomic promoter, such as, for example,
alphaviruses.
[0081] In some embodiments, the invention is a method of inhibiting
RNA virus replication, wherein the method comprises contacting an
RNA virus-infected cell with an inhibitor of the formation,
function, or debranching of the lariat form of the viral genome. In
non-limiting example, a method can comprise contacting an RNA
virus-infected cell with a debranching enzyme inhibitor, wherein
the cell comprises an RNA virus nucleic acid replicative form
comprising at least one 5'-2' phosphodiester bond. The RNA virus
nucleic acid replicative form comprising at least one 5'-2'
phosphodiester bond can comprise a lariat.
[0082] In some configurations, an anti-viral agent can be a
debranching enzyme inhibitor. Because the lariat branch point in
the viral genome uses a T rather than an A as a donor nucleotide in
a splicing reaction, this implies that there are novel activities
encoded in the virus that alter the specificity of host splicing.
Hence, in certain embodiments, and RNA virus such as a norovirus, a
viral RNA such as a norovirus RNA, or a viral polypeptide such as a
norovirus polypeptide can be used to alter host cell biology via
alteration of the host splicing machinery. By altering host cell
biology, a norovirus or a norovirus component can be used as a
toxic protein or protein that alters the gene expression pattern of
the cell.
[0083] Because the lariat branch point in the viral genome uses a T
rather than an A as a nucleophile nucleotide in a splicing
reaction, (although sequences close to the nucleophile nucleotide
are similar or identical to sequences known to be involved in
splicing) there can be novel activities encoded in the virus that
alter the specificity of host splicing. Because there is a 5'-2'
linkage in the lariat, and this linkage can be comprised by a
branch point which also comprises a 5'-3' linkage, in some
configurations, a ribosome encountering a lariat branch point
comprising both a 5'-2'linkage and a 5'-3' linkage can face a
choice of RNA sequence as template for translation. In some
configuration, a ribosome encountering a lariat branch point
comprising both a 5'-2'linkage and a 5'-3' linkage can `jump` to
the 5'-2' linkage. Hence, in certain embodiments, an RNA virus such
as a norovirus, a norovirus RNA, or a norovirus polypeptide can be
used to alter host cell biology. Because of these novel alterations
in cell metabolism during norovirus infection, a norovirus or a
norovirus component can be useful as a toxic protein or protein
that alters the gene expression pattern of the cell. Hence, viral
components which are used in the formation, utilization or
disassembly of the lariat structure can be used to stimulate or
inhibit the production of a host cell polypeptide, or be used to
interfere with host cell RNA processing in therapeutic
applications.
[0084] In some embodiments, an inhibitor of viral replication can
be an inhibitor of the formation, function, or debranching of the
lariat form of the viral genome. In certain configurations, an
inhibitor of viral replication can comprise a nucleobase polymer.
In some configurations, the nucleobase polymer can be a debranching
enzyme inhibitor. In these configurations, the nucleobase polymer
can comprise one or more sequences sharing sequence identity with
viral sequences expected to participate in lariat formation or
function. The nucleobase polymer can be an RNA, a DNA, a hybrid
molecule, or an unnatural polymer such as, for example, a peptide
nucleic acid (PNA). The sequence can be in a sense or an antisense
configuration. One or more subunits of a nucleobase polymer of the
invention can comprise a non-ribose sugar such as an arabinose.
Linkages between nucleobases can include, in addition to 5'-3'
linkages, linkages such as 5'-2' linkages, and linkages to
non-ribose sugars such as arabinose. In some configurations, an
inhibitor can comprise one or more non-standard bases, such as, for
example, L-2'-deoxycytidine or 2'-O-ribopyrimidine. Since the 5'
end of the MNV-1 and other viral genomes contains consensus
sequences for mammalian splicing machinery and since the same
sequences are present at the 5' end of the subgenomic and predicted
subgenomic RNAs of viruses, a lariat form of viral RNA can comprise
a subgenomic lariat or a full (genomic) length.
[0085] The nucleobase polymer can comprise, for example, a sequence
found in a norovirus or a norovirus replicative form, such as
GTGAAATGA (SEQ ID NO: 1), GTGAAATGAGG (SEQ ID NO: 2), TACCGATCT
(SEQ ID NO: 3), CTACCGATCTCGGG (SEQ ID NO: 4), GTGAAATGAGGTACCGAT
(SEQ ID NO: 5) or a complement thereof. In some configurations, a
debranching enzyme inhibitor can comprise a nucleobase polymer
which is topologically a Y-shaped nucleobase polymer or a
lariat-shaped nucleobase polymer. In various configurations, the
nucleobase polymer can be an RNA or a DNA, and comprise at least
one internal L-2'-O-methyl ribopyrimidine subunit, a 3'-terminal
L-2'-deoxycytidine subunit, and/or an arabino-adenosine branch
point (Carriero and Damha, Nucleic Acids Research 31: 6157-6167,
2003). In various embodiments, the debranching enzyme inhibitor can
comprise a nucleobase polymer comprising a sequence of at least
about 10 contiguous nucleobases of a sequence of a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, the sequence SEQ ID NO:
1; a nucleobase polymer comprising a sequence of at least about 10
contiguous nucleobases of a sequence 5' to a lariat branch point of
the RNA virus nucleic acid replicative form or the complement
thereof, such as, for example, the sequence SEQ ID NO: 2, or a
nucleobase polymer comprising a sequence of at least about 10
nucleobases of a sequence 3' to a lariat branch point of the RNA
virus nucleic acid replicative form or the complement thereof, such
as, for example, the sequence SEQ ID NO: 3. In methods of the
present invention, a debranching enzyme inhibitor can be one
described in Carriero and Damha (supra). In some embodiments, these
same sequences, or sequences sharing at least about 50%, sharing at
least about 60%, sharing at least about 70%, sharing at least about
80% or sharing at least about 90% sequence similarity can inhibit
lariat formation.
[0086] In certain configurations, an inhibitor of viral replication
can comprise a nucleobase polymer. In some configurations, the
nucleobase polymer can be an inhibitor of lariat formation. In
these configurations, the nucleobase polymer can comprise one or
more sequences sharing sequence identity with viral sequences
expected to participate in lariat formation or function. The
nucleobase polymer can be an RNA, a DNA, a hybrid molecule, or an
unnatural polymer such as, for example, a peptide nucleic acid
(PNA). The sequence can be in a sense or an antisense
configuration. One or more subunits of a nucleobase polymer of the
invention can comprise a non-ribose sugar such as an arabinose.
Linkages between nucleobases can include, in addition to 5'-3'
linkages, linkages such as 5'-2' linkages, and linkages to
non-ribose sugars such as arabinose. In some configurations, an
inhibitor can comprise one or more non-standard bases, such as, for
example, L-2'-deoxycytidine or 2'-O-ribopyrimidine. Since the 5'
end of the MNV-1 and other viral genomes contains consensus
sequences for mammalian splicing machinery and since the same
sequences are present at the 5' end of the subgenomic and predicted
subgenomic RNAs of viruses, a lariat form of viral RNA can comprise
a subgenomic lariat or a full (genomic) length.
[0087] The nucleobase polymer can comprise, for example, a sequence
found in a norovirus or a norovirus replicative form, such as
GTGAAATGA (SEQ ID NO: 1), GTGAAATGAGG (SEQ ID NO: 2), TACCGATCT
(SEQ ID NO: 3), CTACCGATCTCGGG (SEQ ID NO: 4), GTGAAATGAGGTACCGAT
(SEQ ID NO: 5) or a complement thereof. In some configurations, an
inhibitor of lariat formation can comprise a nucleobase polymer
which is topologically a Y-shaped nucleobase polymer or a
lariat-shaped nucleobase polymer. In various configurations, the
nucleobase polymer can be an RNA or a DNA, and comprise at least
one internal L-2'-O-methyl ribopyrimidine subunit, a 3'-terminal
L-2'-deoxycytidine subunit, and/or an arabino-adenosine branch
point (Carriero and Damha, Nucleic Acids Research 31: 6157-6167,
2003). In various embodiments, the an inhibitor of lariat formation
can comprise a nucleobase polymer comprising a sequence of at least
about 10 contiguous nucleobases of a sequence of a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, the sequence SEQ ID NO:
1; a nucleobase polymer comprising a sequence of at least about 10
contiguous nucleobases of a sequence 5' to a lariat branch point of
the RNA virus nucleic acid replicative form or the complement
thereof, such as, for example, the sequence SEQ ID NO: 2, or a
nucleobase polymer comprising a sequence of at least about 10
nucleobases of a sequence 3' to a lariat branch point of the RNA
virus nucleic acid replicative form or the complement thereof, such
as, for example, the sequence SEQ ID NO: 3. In methods of the
present invention, an inhibitor of lariat formation can be a
molecule described in Carriero and Damha (supra). In some
embodiments, these same sequences, or sequences sharing at least
about 50%, sharing at least about 60%, sharing at least about 70%,
sharing at least about 80% or sharing at least about 90% sequence
similarity can inhibit lariat formation.
[0088] In certain configurations, an inhibitor of viral replication
can comprise a nucleobase polymer. In some configurations, the
nucleobase polymer can be an inhibitor of viral function such as
lariat function. In these configurations, the nucleobase polymer
can comprise one or more sequences sharing sequence identity with
viral sequences expected to participate in lariat formation or
function. The nucleobase polymer can be an RNA, a DNA, a hybrid
molecule, or an unnatural polymer such as, for example, a peptide
nucleic acid (PNA). The sequence can be in a sense or an antisense
configuration. One or more subunits of a nucleobase polymer of the
invention can comprise a non-ribose sugar such as an arabinose.
Linkages between nucleobases can include, in addition to 5'-3'
linkages, linkages such as 5'-2' linkages, and linkages to
non-ribose sugars such as arabinose. In some configurations, an
inhibitor can comprise one or more non-standard bases, such as, for
example, L-2'-deoxycytidine or 2'-O-ribopyrimidine. Since the 5'
end of the MNV-1 and other viral genomes contains consensus
sequences for mammalian splicing machinery and since the same
sequences are present at the 5' end of the subgenomic and predicted
subgenomic RNAs of viruses, a lariat form of viral RNA can comprise
a subgenomic lariat or a full (genomic) length.
[0089] The nucleobase polymer can comprise, for example, a sequence
found in a norovirus or a norovirus replicative form, such as
GTGAAATGA (SEQ ID NO: 1), GTGAAATGAGG (SEQ ID NO: 2), TACCGATCT
(SEQ ID NO: 3), CTACCGATCTCGGG (SEQ ID NO: 4), GTGAAATGAGGTACCGAT
(SEQ ID NO: 5) or a complement thereof. In some configurations, an
inhibitor of lariat function can comprise a nucleobase polymer
which is topologically a Y-shaped nucleobase polymer or a
lariat-shaped nucleobase polymer. In various configurations, the
nucleobase polymer can be an RNA or a DNA, and comprise at least
one internal L-2'-O-methyl ribopyrimidine subunit, a 3'-terminal
L-2'-deoxycytidine subunit, and/or an arabino-adenosine branch
point (Carriero and Damha, Nucleic Acids Research 31: 6157-6167,
2003). In various embodiments, the an inhibitor of lariat function
can comprise a nucleobase polymer comprising a sequence of at least
about 10 contiguous nucleobases of a sequence of a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof, such as, for example, the sequence SEQ ID NO:
1; a nucleobase polymer comprising a sequence of at least about 10
contiguous nucleobases of a sequence 5' to a lariat branch point of
the RNA virus nucleic acid replicative form or the complement
thereof, such as, for example, the sequence SEQ ID NO: 2, or a
nucleobase polymer comprising a sequence of at least about 10
nucleobases of a sequence 3' to a lariat branch point of the RNA
virus nucleic acid replicative form or the complement thereof, such
as, for example, the sequence SEQ ID NO: 3. In methods of the
present invention, an inhibitor of lariat function can be a
molecule described in Carriero and Damha (supra). In some
embodiments, these same sequences, or sequences sharing at least
about 50%, sharing at least about 60%, sharing at least about 70%,
sharing at least about 80% or sharing at least about 90% sequence
similarity can inhibit lariat function.
[0090] In certain configurations, an inhibitor of viral replication
can comprise an antibody. For example, a virus inhibitor can be an
antibody directed against a structure comprising a nucleotide
having 2'- and 3'-linkages. The antibody can be, for example, an
antibody directed against a thymine nucleotide having 2'- and
3'-linkages.
[0091] In various embodiments, the RNA virus that forms a lariat
structure upon infection of a permissive cell can be a
single-stranded RNA virus; a positive strand single-stranded RNA
virus; a positive strand single-stranded RNA virus, no DNA stage; a
calicivirus; or a norovirus such as a human norovirus (i.e., a
Norwalk virus) or a murine norovirus such as MNV-1 (Karst, S. M. et
al., Science 299: 1575-1578, 2003).
[0092] In some embodiments, the invention provides a method of
translating a nucleic acid encoding a polypeptide. In these
embodiments, the method can comprise inoculating an RNA
virus-permissive cell with a viral nucleic acid which forms a
lariat structure operatively linked to a sequence encoding a
polypeptide; and incubating the cell. The cell can be an RNA
virus-permissive cell, such as a norovirus-permissive cell
described supra. In some configurations, a cell in which a lariat
can form upon introduction of lariat-forming sequences of can be a
eukaryotic cell, such as, for example, an animal cell, a plant
cell, or a cell of a eukaryotic microorganism such as a yeast. In
non-limiting example, the virus can be a norovirus, and the cell
can be a macrophage-lineage cell or a dendritic cell-lineage cell,
such as a STAT-1 deficient macrophage, a macrophage-like cell of an
established cell line such as a RAW cell, or a dendritic cell. In
these methods, the RNA virus translation initiation sequence can
comprise a lariat branch point sequence, or a sequence in which the
3' end is located up to about 10 nucleotides upstream or downstream
from the branch point sequence, up to about 20 nucleotides upstream
or downstream from the branch point sequence, up to about 50
nucleotides upstream or downstream from the branch point sequence,
up to about 100 nucleotides upstream or downstream from the branch
point sequence, or up to about 200 nucleotides upstream or
downstream from the branch point sequence. The RNA virus
translation sequence can comprise from at least about 10
nucleotides up to about 200 contiguous nucleotide, from at least
about 15 nucleotides up to up to about 150 contiguous nucleotides,
or from at least about 20 nucleotides up to up to about 100
contiguous nucleotides. T In some configurations, a lariat branch
point sequence can comprise, for example, the sequence
CTACCGATCTGTGAAATGAG (SEQ ID NO: 12). Alternatively, the RNA virus
translation initiation sequence can be an RNA virus ribosome
binding site, such as, for example, an RNA virus internal ribosome
entry site (IRES). In some configurations, the RNA virus
translation initiation sequence can comprise the sequence
ATGAAGATGGC (SEQ ID NO: 13). In some configurations, the presence
of an IRES or IRES-like activity implies that a norovirus or a
vector comprising a norovirus lariat, a norovirus subgenomic RNA
can be used to express heterologous genes in cells other than
norovirus-permissive cells or RNA virus-permissive cells.
[0093] In various embodiments, an RNA virus-permissive cell can be
a single stranded RNA virus-permissive cell, a positive strand
single stranded RNA virus-permissive cell, a positive strand single
stranded RNA virus, no DNA stage-permissive cell, a
calicivirus-permissive cell, or a norovirus-permissive cell. For
example, a norovirus-permissive cell can be a macrophage-lineage
cell or a dendritic cell-lineage cell.
[0094] In various configurations, the RNA virus translation
initiation sequence can be a single-stranded RNA virus translation
initiation sequence, a positive strand single-stranded RNA virus
translation initiation sequence, a positive strand single-stranded
RNA virus, no DNA stage translation initiation sequence, a
calicivirus translation initiation sequence, or a norovirus
translation initiation sequence. In certain configurations, the
translation initiation sequence can have at least about 80%
sequence identity with SEQ ID NO: 13. In certain configurations,
the translation initiation sequence can have the sequence
designated SEQ ID NO: 13.
[0095] In various configurations, the nucleic acid can be an RNA or
a DNA.
[0096] Various aspects of the present teachings accordingly
include:
[0097] Aspect 1. A method of inhibiting RNA virus replication, the
method comprising contacting an RNA virus-infected cell with an
inhibitor of lariat formation, wherein the RNA virus nucleic acid
comprises a replicative form comprising at least one 5'-2'
phosphodiester bond.
[0098] Aspect 2. The method of aspect 1, wherein the inhibitor of
lariat formation comprises a nucleobase polymer.
[0099] Aspect 3. The method of aspect 2, wherein the nucleobase
polymer comprises a sequence selected from the group consisting of
GTGAAATGA (SEQ ID NO: 10), GTGAAATGAGG (SEQ ID NO: 11), TACCGATCT
(SEQ ID NO: 12), CTACCGATCTCGGG (SEQ ID NO: 13), GTGAAATGAGGTACCGAT
(SEQ ID NO: 14) and a complement thereof.
[0100] Aspect 4. The method of aspect 2, wherein the nucleobase
polymer is a Y-shaped nucleobase polymer.
[0101] Aspect 5. The method of aspect 4, wherein the nucleobase
polymer comprises at least one internal L-2'-O-methyl
ribopyrimidine subunit.
[0102] Aspect 6. The method of aspect 4, wherein the nucleobase
polymer comprises a 3'-terminal L-2'-deoxycytidine subunit.
[0103] Aspect 7. The method of aspect 4, wherein the nucleobase
polymer comprises an arabino-adenosine branch point.
[0104] Aspect 8. The method of aspect 1, wherein the RNA virus
nucleic acid replicative form comprising at least one 5'-2'
phosphodiester bond further comprises a lariat.
[0105] Aspect 9. The method of aspect 1, wherein the inhibitor
comprises a nucleobase polymer comprising a sequence of at least
about 10 contiguous nucleobases of a lariat branch point of the RNA
virus nucleic acid replicative form or the complement thereof.
[0106] Aspect 10. The method of aspect 9, wherein the nucleobase
polymer comprises the sequence SEQ ID NO: 1.
[0107] Aspect 11. The method of aspect 1, wherein the inhibitor
comprises a nucleobase polymer comprising a sequence of at least
about 10 contiguous nucleobases of a sequence 5' to a lariat branch
point of the RNA virus nucleic acid replicative form or the
complement thereof.
[0108] Aspect 12. The method of aspect 11, wherein the nucleobase
polymer comprises the sequence SEQ ID NO: 2.
[0109] Aspect 13. The method of aspect 1, wherein the inhibitor
comprises a nucleobase polymer comprising a sequence of at least
about 10 nucleobases of a sequence 3' to a lariat branch point of
the RNA virus nucleic acid replicative form or the complement
thereof.
[0110] Aspect 14. The method of aspect 13, wherein the nucleobase
polymer comprises the sequence SEQ ID NO: 3.
[0111] Aspect 15. The method of aspect 1, wherein the RNA virus is
a single-stranded RNA virus.
[0112] Aspect 16. The method of aspect 15, wherein the
single-stranded RNA virus is a positive strand single-stranded RNA
virus.
[0113] Aspect 17. The method of aspect 16, wherein the positive
strand single-stranded RNA virus is a positive strand single
stranded RNA virus, no DNA stage.
[0114] Aspect 18. The method of aspect 17, wherein the positive
strand single-stranded RNA virus, no DNA stage is a
calicivirus.
[0115] Aspect 19. The method of aspect 17, wherein the calicivirus
is a norovirus.
[0116] Aspect 20. The method of aspect 19, wherein the norovirus is
selected from the group consisting of a human norovirus and a
murine norovirus.
[0117] Aspect 21. A method of translating a nucleic acid encoding a
polypeptide, the method comprising:
[0118] inoculating an RNA virus-permissive cell with a viral
nucleic acid which forms a lariat structure operatively linked to a
sequence encoding the polypeptide; and
[0119] incubating the cell.
[0120] Aspect 22. The method of aspect 21, wherein the RNA virus
translation initiation sequence comprises a lariat branch point
sequence.
[0121] Aspect 23. The method of aspect 21, wherein the RNA virus
translation initiation sequence is an RNA virus ribosome binding
site.
[0122] Aspect 24. The method of aspect 23, wherein the RNA virus
ribosome binding site is an RNA virus internal ribosome entry
site.
[0123] Aspect 25. The method of aspect 21, wherein the RNA virus
translation initiation sequence is comprised by a sequence is
selected from the group consisting of SEQ ID NO: 29, SEQ ID NO: 30,
SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 and SEQ
ID NO: 35.
[0124] Aspect 26. The method of aspect 21, wherein the RNA
virus-permissive cell is a single stranded RNA virus-permissive
cell.
[0125] Aspect 27. The method of aspect 26, wherein the single
stranded RNA virus-permissive cell is a single stranded RNA virus,
no DNA stage-permissive cell.
[0126] Aspect 28. The method of aspect 27, wherein the single
stranded RNA virus, no DNA stage-permissive cell is a
calicivirus-permissive cell.
[0127] Aspect 29. The method of aspect 28, wherein the
calicivirus-permissive cell is a norovirus-permissive cell.
[0128] Aspect 30. The method of aspect 29, wherein the norovirus
permissive cell is selected from the group consisting of a
macrophage-lineage cell and a dendritic cell-lineage cell.
[0129] Aspect 31. The method of aspect 21, wherein the RNA virus
translation initiation sequence is a single-stranded RNA virus
translation initiation sequence.
[0130] Aspect 32. The method of aspect 31, wherein the
single-stranded RNA virus translation initiation sequence is a
single-stranded RNA virus, no DNA stage translation initiation
sequence.
[0131] Aspect 33. The method of aspect 32, wherein the
single-stranded RNA virus, no DNA stage translation initiation
sequence is a calicivirus translation initiation sequence.
[0132] Aspect 34. The method of aspect 33, wherein the calicivirus
translation initiation sequence is a norovirus translation
initiation sequence.
[0133] Aspect 35. The method of aspect 21, wherein the translation
initiation sequence has at least about 80% sequence identity with
SEQ ID NO: 11.
[0134] Aspect 36. The method of aspect 21, wherein the translation
initiation sequence is SEQ ID NO: 11.
[0135] Aspect 37. The method of aspect 21, wherein the nucleic acid
is an RNA.
[0136] Aspect 38. The method of aspect 21, wherein the nucleic acid
is a DNA.
[0137] Aspect 39. A replicon comprising an RNA virus translation
initiation site, an RNA virus branch point and a sequence encoding
a heterologous polypeptide.
[0138] Aspect 40. A replicon comprising an RNA virus branch point
and a sequence encoding a heterologous polypeptide.
[0139] Aspect 41. The replicon of aspect 40, further comprising an
RNA virus promoter.
[0140] Aspect 42. The replicon of aspect 40, wherein the RNA virus
branch point is a single-stranded RNA virus branch point.
[0141] Aspect 43. The replicon of aspect 42, wherein the
single-stranded RNA virus branch point is a single-stranded RNA
virus no DNA stage branch point.
[0142] Aspect 44. The replicon of aspect 43, wherein the
single-stranded RNA virus no DNA stage branch point is a
calicivirus branch point.
[0143] Aspect 45. The replicon of aspect 44, wherein the
calicivirus branch point is a norovirus branch point.
[0144] Aspect 46. The replicon of aspect 45, wherein the norovirus
branch point is an MNV-1 branch point.
[0145] Aspect 47. The replicon of aspect 40 wherein the RNA virus
branch point comprises a sequence comprising at least 20
nucleotides and hybridizes under high stringency conditions to a
complement of a sequence selected from the group consisting of SEQ
ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:
15, SEQ ID NO:161, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ
ID NO:25, SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28.
[0146] Aspect 48. The replicon of aspect 40, wherein the RNA virus
branch point comprises a sequence comprising at least 20 contiguous
nucleotides having at least about 70% sequence identity with a
sequence selected from the group consisting of SEQ ID NO: 11, SEQ
ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:161,
SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20,. SEQ ID
NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ
ID NO:26, SEQ ID NO:27, SEQ ID NO:28 and portions thereof.
[0147] Aspect 49. A method for transcribing an RNA sequence, the
method comprising:
[0148] inoculating a eukaryotic cell with a replicon comprising an
RNA virus branch point and the sequence; and
[0149] growing the cell.
[0150] Aspect 50. The method of aspect 49, wherein the RNA virus
branch point comprises a sequence comprising at least 20 contiguous
nucleotides having at least about 70% sequence identity with a
sequence selected from the group consisting of SEQ ID NO: 11, SEQ
ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:161,
SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20,. SEQ ID
NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ
ID NO:26, SEQ ID NO:27, SEQ ID NO:28 and portions thereof.
[0151] Aspect 51. The method of aspect 49, wherein the RNA virus
branch point is a norovirus branch point.
[0152] Aspect 52. The method of aspect 49, wherein the eukaryotic
cell is an animal cell.
[0153] Aspect 53. The method of aspect 52. wherein the animal cell
is a vertebrate cell.
[0154] Aspect 54. The method of aspect 53, wherein the vertebrate
cell is a mammalian cell.
[0155] Aspect 55. The method of aspect 54, wherein the mammalian
cell is selected from the group consisting of a human cell and a
murine cell.
[0156] Aspect 56.The method of aspect 54, wherein the mammalian
cell is a norovirus-permissive cell.
[0157] Aspect 57. A method for synthesizing a polypeptide, the
method comprising:
[0158] inoculating a eukaryotic cell with a nucleic acid comprising
an RNA lariat-forming sequence of an RNA virus linked to a sequence
encoding the polypeptide, wherein the polypeptide is heterologous
to the virus; and
[0159] incubating the cell.
[0160] Aspect 58. The method of aspect 57, wherein the nucleic acid
further comprises an RNA virus promoter.
[0161] Aspect 59. The method of aspect 57, wherein the nucleic acid
further comprises an RNA virus translation initiation sequence.
[0162] Aspect 60. The method of aspect 57, wherein the nucleic acid
further comprising an RNA virus internal ribosome entry site.
[0163] Aspect 61. The method of aspect 57, wherein the RNA virus
branch point is a single-stranded RNA virus branch point.
[0164] Aspect 62. The method of aspect 61, wherein the
single-stranded RNA virus branch point is a single-stranded RNA
virus no DNA stage branch point.
[0165] Aspect 63. The method of aspect 62, wherein the
single-stranded RNA virus no DNA stage branch point is a
calicivirus branch point.
[0166] Aspect 64. The method of aspect 63, wherein the calicivirus
branch point is a norovirus branch point.
[0167] Aspect 65. The method of aspect 64, wherein the norovirus
branch point is an MNV-1 branch point.
[0168] Aspect 66. The method of aspect 57, wherein the RNA virus
branch point comprises a sequence comprising at least 20
nucleotides and hybridizes under high stringency conditions to a
complement of a sequence selected from the group consisting of SEQ
ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO:
33, SEQ ID NO: 34, SEQ ID NO: 35.
[0169] Aspect 67. The method of aspect 57, wherein the RNA virus
branch point comprises a sequence comprising at least 20 contiguous
nucleotides having at least about 70% sequence identity with a
sequence selected from the group consisting of SEQ ID NO: 29, SEQ
ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO:
34, SEQ ID NO: 35 and portions thereof.
[0170] Aspect 68. A method for forming an attenuated RNA virus, the
method comprising altering lariat involved cis acting
sequences.
[0171] Aspect 69. A method for altering host cell splicing by
expressing a viral RNA sequence.
[0172] Aspect 70. The method of aspect 69, wherein the viral RNA
sequence is a single-stranded RNA virus viral RNA sequence.
[0173] Aspect 71.The method of aspect 70, wherein the
single-stranded RNA virus is a single-stranded RNA, no DNA stage
virus.
[0174] Aspect 72. The method of aspect 71, wherein the
single-stranded RNA, no DNA stage virus is a calicivirus.
[0175] Aspect 73. The method of aspect 72, wherein the calicivirus
is a norovirus.
[0176] Aspect 74. The method of aspect 73, wherein the norovirus is
a human norovirus or a murine norovirus.
[0177] Aspect 75. A method for forming an attenuated RNA virus, the
method comprising altering an RNA virus viral polypeptide that
utilizes a thymine as a viral lariat-forming donor nucleotide.
[0178] Aspect 76. The method of aspect 75, wherein the RNA virus is
a single-stranded RNA virus.
[0179] Aspect 77.The method of aspect 76, wherein the
single-stranded RNA virus is a single-stranded RNA, no DNA stage
virus.
[0180] Aspect 78. The method of aspect 77, wherein the
single-stranded RNA, no DNA stage virus is a calicivirus.
[0181] Aspect 79. The method of aspect 78, wherein the calicivirus
is a norovirus.
[0182] Aspect 80. The method of aspect 79, wherein the norovirus is
a human norovirus or a murine norovirus.
[0183] Aspect 81. A method for identifying an antiviral molecule,
the method comprising:
[0184] contacting a cell comprising an RNA comprising a
lariat-forming sequence of an RNA virus with a candidate antiviral
molecule; and
[0185] detecting inhibition of lariat formation, function, or
stability in the cell.
[0186] Aspect 82. A method of expressing a polypeptide in a cell,
the method comprising:
[0187] introducing into the cell a nucleic acid comprising a
genomic sequence encoding the polypeptide and further comprising at
least one intron comprising a branch point sequence comprising a
uridine nucleotide; and
[0188] expressing at least one viral polypeptide which regulates
intron processing in the cell.
[0189] Aspect 83. The method of aspect 82, wherein the at least one
viral polypeptide which regulates intron processing in the cell is
a viral polypeptide which causes the uridine nucleotide to be a 2'
hydroxyl nucleophilic nucleotide in an RNA splicing reaction.
[0190] Aspect 84. The method of aspect 82, wherein the expressing
at least one viral polypeptide comprises inoculating the cell with
an RNA virus.
[0191] Aspect 85. The method of aspect 84, wherein the at least one
viral polypeptide is a viral polypeptide of an RNA virus.
[0192] Aspect 86. The method of aspect 85, wherein the RNA virus is
a single-stranded RNA virus.
[0193] Aspect 87. The method of aspect 86, wherein the
single-stranded RNA virus is a single-stranded RNA virus, no DNA
stage.
[0194] Aspect 88. The method of aspect 87, wherein the
single-stranded RNA virus is a single-stranded RNA virus, no DNA
stage is a calicivirus.
[0195] Aspect 89. The method of aspect 88, wherein the calicivirus
is a norovirus.
[0196] Aspect 90. The method of aspect 89, wherein the norovirus is
selected from a human norovirus and a murine norovirus.
[0197] Aspect 91. The method of aspect 83, wherein the branch point
sequence comprising a nucleophilic 2' hydroxyl uridine residue
comprises the sequence UACCGAUCU.
[0198] Aspect 92. A method of inhibiting expression of a
polypeptide in a eukaryotic cell, the method comprising expressing
in the eukaryotic cell at least one viral polypeptide of an RNA
virus, wherein the at least one viral polypeptide alters host cell
RNA splicing.
[0199] Aspect 93. The method of aspect 92, wherein the at least one
viral polypeptide is a viral polypeptide which causes an intronic
uridine nucleotide to act as a nucleophile in an RNA splicing
reaction.
[0200] Aspect 94. The method of aspect 93, wherein the expressing
at least one viral polypeptide comprises inoculating the cell with
an RNA virus.
[0201] Aspect 95. The method of aspect 94, wherein the at least one
viral polypeptide is a viral polypeptide of an RNA virus.
[0202] Aspect 96. The method of aspect 95, wherein the RNA virus is
a single-stranded RNA virus.
[0203] Aspect 97. The method of aspect 96, wherein the
single-stranded RNA virus is a single-stranded RNA virus, no DNA
stage.
[0204] Aspect 98. The method of aspect 97, wherein the
single-stranded RNA virus is a single-stranded RNA virus, no DNA
stage is a calicivirus.
[0205] Aspect 99. The method of aspect 98, wherein the calicivirus
is a norovirus.
[0206] Aspect 100. The method of aspect 99, wherein the norovirus
is selected from a human norovirus and a murine norovirus.
[0207] Aspect 101. The method of aspect 92, the RNA virus comprises
a branch point sequence comprising a nucleophilic 2' hydroxyl group
uridine residue.
[0208] 102. The method of aspect 101, wherein the branch point
sequence comprises the sequence UACCGAUCU.
[0209] The invention can be further understood by reference to the
examples which follow.
EXAMPLE 1
[0210] This example illustrates methods for growth and harvesting
of cells and cell lines used for investigating norovirus growth in
vitro.
[0211] In this example, murine embryo fibroblasts were obtained and
cultured as described in Pollock et al., Virology 227: 168-179,
1997, or according to instructions provided by the supplier. RAW
264.7 cells were purchased from the American Type Culture
Collection and maintained in Dulbecco's Modified Eagle's Medium
(DMEM) supplemented with 10% low-endotoxin fetal calf serum (FCS,
HyClone, Logan, Utah, cat # SH30070.03), 100 U penicillin/ml, 1100
g/ml streptomycin, 10 mM
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), and 2
mM L-glutamine (Biosource, Camarillo, Calif.). Macrophages were
harvested from bone marrow and cultured as described in Heise et
al., Virology 241: 331-344, 1998. Dendritic cells were obtained by
suspending bone marrow cells in RPMI 1640 medium containing 10% low
endotoxin FCS, 2 mM L-glutamine, 1 mM sodium pyruvate (Biosource),
100 U penicillin/ml, 100 .mu.g/ml streptomycin, 1% non-essential
amino acids (Biosource) and 20 ng/ml recombinant mouse GM-CSF (BD
Biosciences, San Jose, Calif.), and plating the cells at a
concentration of 3.times.10.sup.5 cells/ml in 6 well plates (3
ml/well). The percentage of CD11c.sup.+ dendritic cells was
determined by FACS analysis after culturing cells for seven days at
37.degree. C. and 5% CO.sub.2. Around 70% of the cells were
CD11c-positive. 129 wild-type and STAT 1-/- mice were purchased
from Taconic (Germantown, N.Y.). Interferon (IFN) .alpha..beta.
receptor (R) -/- mice, IFN.gamma.R-/- mice, and IFN
.alpha..beta..gamma.R-/- mice (Muller et al., Science 264,
1918-1921, 1994), protein kinase R -/- mice (Yang et al., EMBO J.
14, 6095-6106, 1995), and inducible nitric oxide (iNOS) -/- mice
(MacMicking et al., Cell 81, 641-650, 1995) were bred and housed at
Washington University in accordance with all federal and university
policies.
EXAMPLE 2
[0212] This example illustrates methods for infection of cells with
norovirus.
[0213] In this example, as shown in FIG. 1, Panel A, adherent cells
were plated in 12 well plates at 2.times.10.sup.5 or
5.times.10.sup.5 cells per well and allowed to attach for several
hours. Infections were carried out at an M.O.I. of 0.05 (for
multi-step growth curves, FIG. 1) or M.O.I. of 2.0 (for single-step
growth curves and other timecourse experiments, FIG. 3) for 30 min
on ice in a volume of 0.5 ml per well. dendritic cells were
infected in bulk. Cells were then washed extensively with 2.times.2
ml of ice-cold PBS per well. To allow viral entry, 1 ml of media
was added to each well and cells were incubated at 37.degree. C.
and 5% CO.sub.2 for different time periods. Growth curve samples
were subjected to two or three cycles of freeze/thawing before
titering. These data show that MNV-1 replicates in macrophages,
dendritic cell's, and RAW cells.
EXAMPLE 3
[0214] This example illustrates a mouse norovirus-1 plaque
assay.
[0215] In this example, as illustrated in FIG. 1, Panels A and B,
RAW 264.7 cells were seeded into 6 well plates at a density of
2.times.10.sup.6 viable cells. On the following day, 10-fold
dilutions of virus inoculum were prepared in complete DMEM and
plated in duplicate wells. Plates were incubated for one hour at
room temperature on a rocking apparatus before aspirating the
inoculum and overlaying the cells with 2 ml of 37-40.degree. C.
1.5% SeaPlaque.RTM. agarose (CBM Intellectual Properties, Inc.) in
MEM supplemented with 10% low-endotoxin FCS, 1% HEPES, 1%
penicillin/streptomycin, and 2% glutamine (complete MEM). Plates
were incubated at 37.degree. C. and 5% CO.sub.2 for 2 days. To
visualize plaques, cells were stained with 2 ml of 56.degree. C.
1.5% SeaKem.RTM. agarose (FMC Corporation) in complete MEM
containing 1% Neutral Red for 6-8 hours. These data show that MNV-1
replication can be quantified using a plaque assay.
EXAMPLE 4
[0216] This example illustrates a mouse norovirus-1 plaque
neutralization assay method.
[0217] In this example, as shown in FIG. 2, Panels E and F,
differing concentrations of purified monoclonal antibody
(A6.2=anti-MNV-1 capsid, isotype control=10H2, anti-.mu.1c
reovirus) were incubated with 2000 pfu of either MNV-1.CW1 or MNV-1
brain homogenate for 30 min at 37.degree. C. prior to performing
the MNV-1 plaque assay as described in Example 3. These data show
that the plaques are due to MNV-1 and that an antibody can block
infection with MNV-1.
EXAMPLE 5
[0218] This example illustrates methods for Cesium Chloride
purification of mouse norovirus-1.
[0219] In this example, as shown in FIG. 2, Panels A, B, C and D,
RAW cells were infected with MNV-1.CW1 for 2 days with an MOI=0.05.
Cellular debris was removed from the freeze/thaw lysate by low
speed centrifugation. The supernatants were layered on top of a 5
ml 30% sucrose cushion and centrifuged at 4.degree. C. for 2.5
hours at 27,000 rpm (90,000.times.g) in a SW32 rotor. The cell
pellets were then resuspended in PBS and mixed with CsCl to a final
density of 1.33 g/cm.sup.3 and centrifuged for at least 18 hours at
35,000 rpm (115,000.times.g) in a SW55 rotor. A wide lower and
narrow upper band were typically seen in the gradient. The lower
band was collected by puncturing the side of the tube with a needle
before overnight dialysis against PBS at 4.degree. C. These data
show that the virus growing is MNV-1 and is a norovirus.
EXAMPLE 6
[0220] This example illustrates methods for protein analysis using
SDS-polyacrylamide gel electrophoresis and Coomassie blue
staining.
[0221] In this example, as illustrated in FIG. 2, Panel B,
CsCl-purified virions were separated by SDS-PAGE using standard
procedures (Laemmli, U.K., Nature, 227: 680-685, 1970). Proteins
were visualized by Coomassie staining using the Simply Blue.TM.
safe stain (Invitrogen, Carlsbad, Calif.) according to
manufacturer's instructions. These data, together with data shown
in FIG. 2, Panel C, show that the virus growing in the cells
contains the MNV-1 capsid protein.
EXAMPLE 7
[0222] This example demonstrates Western blot analysis methods.
[0223] In this example, as shown in FIG. 2, Panel C, proteins were
transferred to a nitrocellulose membrane and incubated with a
rabbit polyclonal antibody directed against MNV-1 capsid protein,
followed by a peroxidase-labeled secondary antibody. Antibody
binding was visualized using ECL.TM. chemiluminescence (Amersham
Biosciences, Piscataway, N.J.) according to the manufacturer's
instructions. The data show that the capsid in the growing virus is
the MNV-1 capsid protein.
EXAMPLE 8
[0224] This example illustrates Northern blot analysis methods.
[0225] In this example, as shown in FIG. 2, Panel D, probes for
Northern blot analysis were generated by linearizing and gel
purifying plasmid DNA containing portions of the MNV-1 genome (nt
5617-7039) digested with restriction endonuclease NcoI (for a
positive-sense probe) or restriction endonuclease SpeI (for a
negative-sense probe). Labeled probes were generated by performing
a standard P.sup.32 radioactive transcription assay using SP6 or T7
RNA polymerase (Roche, Germany) according to manufacturer's
recommendations. Total RNA from virus-infected or mock-infected
cells were isolated using Trizol (Invitrogen, Carlsbad, Calif.)
according to manufacturer's recommendations. Northern blotting was
performed using standard protocols. Probes were hybridized
overnight at 68.degree. C. The data show that the RNA in the
growing virus is MNV-1 RNA.
EXAMPLE 9
[0226] This example illustrates ELISA analysis methods.
[0227] In this example, as illustrated in FIG. 2, Panel E, ELISA
was performed as described in Karst, S. M. et al., Science 299:
1575-1578, 2003, with the following modifications. ELISA plates
were coated overnight at 4.degree. C. with CsCl-purified MNV-1
particles at 0.2 or 1.0 mg/well. Diluted, purified anti-MNV-1
capsid monoclonal antibody A6.2 and anti-reovirus isotype control
monoclonal antibody 10H2 were applied to coated wells, followed by
a peroxidase-labeled secondary antibody. Antibodies were incubated
in wells for 60 min. at 37.degree. C. These data show that the A6.2
monoclonal antibody binds specifically to MNV-1.
EXAMPLE 10
[0228] This example illustrates electron microscopy methods used to
image mouse MNV-1.
[0229] In this example, as shown in FIG. 2, Panel A, samples of
CsCl-purified MNV-1 virions were negatively stained and observed
using an electron microscope, as described in Karst et al., supra.
The morphology of the observed particles is consistent with that of
a virus. The data show that the growing virus is a norovirus.
EXAMPLE 11
[0230] This example illustrates lytic growth of a norovirus, MNV-1
(Karst, S. M. et al., Science 299: 1575-1578, 2003; U.S. Patent
Application 60/440,016 of Virgin, "Murine Calicivirus" filed Jan.
14, 2003), in murine macrophage-lineage cells.
[0231] In this example, as shown in FIG. 3, macrophage-lineage
cells, including primary murine STAT1-/- bone marrow derived
macrophages and the murine macrophage cell lines RAW 264.7 and
J774A.1, were infected with mouse norovirus MNV-1. As shown in FIG.
3, Panel A, each of these macrophage-lineage cell types supported
viral replication and lytic growth. Using RAW 264.7 cells, a MNV-1
plaque assay was developed and used to study the viral life cycle
(FIGS. 1A, 1B). While a cytopathic effect was visible in
productively infected cells 24 hours postinfection (h.p.i.),
virions were detected between 9 and 12 h.p.i. Virion production was
preceded by the production of genomic and subgenomic RNAs as
detected by Northern blot analysis (FIG. 3, Panel B). Growth in RAW
cells for a single passage did not dramatically alter the virulence
of MNV-1, as a plaque purified strain (MNV-1.CW) still caused
lethal disease in STAT-/- mice after peroral inoculation (FIG. 2,
Panel G MNV-1.CW1 passage 1). However, growth in RAW cells for
three passages generated a virus stock with significantly decreased
virulence towards STAT-/- mice (FIG. 2, Panel G, MNV-1.CW1 passage
3). This example demonstrates that MNV-1 can be cultured in
macrophage-lineage cells, that macrophage-lineage cells can be
norovirus-permissive cells, and that MNV-1 can lose its virulence
upon serial passage in norovirus-permissive cells. Furthermore,
this example shows that replication of viral RNA can be detected by
Northern Blot analysis.
EXAMPLE 12
[0232] This example illustrates that MNV-1 productively infects
STAT-deficient macrophages, RAW 264.7 cells and dendritic cells,
and causes cytopathic effects in these cells.
[0233] In this example, as shown in FIG. 1, wild-type murine
embryonic fibroblasts, STAT-/- embryonic fibroblasts, wild-type
primary mouse macrophages, STAT-/- macrophages, wild-type dendritic
cells, STAT-/- dendritic cells, and RAW 264.7 cells were examined
for their permissiveness towards norovirus infection. In these
experiments, the cells were initially obtained and grown under
conditions described in Example 1, and contacted for 30 minutes on
ice with an MNV-1-containing brain homogenate at a multiplicity of
infection (M.O.I.) of 0.05. (A) Cells were subjected to freezing
and thawing at various time intervals following contact with the
MNV-1 brain homogenate. Virus production was the measured by
titering using the plaque assay as described in Example 3. Each
time point was repeated 2-3 times to generate standard errors of
the mean. The data indicate that STAT-/- macrophages support
significantly more virus production than wild type macrophages,
while wild type dendritic cells, STAT-/- dendritic cell's, and RAW
cells all support significant amounts of virus production. (B)
MNV-1 causes cytopathic effect in permissive cells. Cells contacted
with MNV-1-containing brain homogenate as above, or mock infected
with an uninfected brain homogenate, were cultured for two days and
observed by light microscopy. Cytopathic effects of MNV-1 infection
are evident in STAT-1 -/- macrophage cultures, dendritic cell
cultures (both wild type and STAT-/-), and RAW cell cultures, but
not in mouse embryonic fibroblast cultures (either wild type or
STAT-/-) nor wild type macrophage cultures.
EXAMPLE 13
[0234] This example illustrates that virus grown from plaques from
norovirus-permissive cell cultures infected with MNV-1 is
MNV-1.
[0235] In these experiments, MNV-1 was plaque purified three times
in RAW 264.7 cells. The resulting virus strain was designated
MNV-1.CW1. The MNV-1.CW1 was purified by CsCl buoyant density
gradient centrifugation, then analyzed as shown in FIG. 2: (A)
MNV-1.CW1 visualized by negative staining electron microscopy. CsCl
gradient-purified MNV-1.CW1 particles show typical norovirus
morphology. (B) SDS-polyacrylamide gel electrophoresis analysis of
CsCl gradient-purified MNV-1.CW1 particles. A gel stained with
Coomassie Brilliant Blue reveals that the virus particles comprise
a large amount of a protein with the appropriate molecular weight
for the MNV-1 capsid. (C) Western Blot analysis of CsCl
gradient-purified MNV-1.CW1 particles. A polyacrylamide gel
prepared similar to that shown in (B) was transferred to a membrane
and probed with an antibody directed against recombinant MNV-1
capsid protein. The single prominent band corresponding to the
protein band labeled "VP1" in (A) bound the antibody probe. Because
of its reactivity with the antibody, the polypeptide comprising the
band was deemed to be MNV-1 capsid protein. (D) Northern Blot
analysis of RNA obtained from infected RAW 264.7 cells. Following
separation according to size by gel electrophoresis, the RNA was
transferred to a membrane and probed under high stringency
conditions (Sambrook et al., supra) using a probe specific for the
MNV-1 genome. The hybridization was much stronger for RNA from
infected cells compared to uninfected control cells (data not
shown). (E) ELISA analysis of CsCl gradient-purified MNV-1.CW1
particles. Virus particles were distributed to wells in an ELISA
plate, and probed with monoclonal antibodies directed against
either MNV-1 capsid protein (MAb A6.2) or a reovirus protein (MAb
10H2). Binding of the primary antibodies to the virus samples was
detected using an enzyme-conjugated secondary antibody. The data
indicate that MAb A6.2 specifically bound to the norovirus. (F)
Plaque neutralization assay. Samples of MNV-1 brain homogenate or
MNV-1.CW1 were incubated with increasing concentrations of MAb A6.2
or MAb 10H2 before performing a plaque assay. The data indicate
that MAb A6.2 neutralizes the virus, while control, isotype-matched
MAb 10H2 did not. Thus, a monoclonal antibody can be used as an
anti-viral agent for inhibiting viral infection.
EXAMPLE 14
[0236] This example illustrates that bone marrow-derived
macrophages and RAW 264.7 cells, are permissive for growth of
MNV-1.CW1 virus, and that passaging of the norovirus increases its
host cell range.
[0237] In these experiments, MNV-1.CW1 virus, as described above,
was expanded three times in RAW 264.7 cells, yielding MNV-1.CW1 P3
virus, as shown in FIG. 3. Multi-step (M.O.I. 0.05) and single-step
(M.O.I. 2.0) growth curves were generated using MNV-1.CW1 P3 virus
on indicated cells. While the thrice-passaged virus stock retained
the capacity to grow to high titers in the RAW 264.7 cells, it
showed an increase in host range, in that it replicated in
STAT-1-/- embryonic fibroblasts. Nonetheless, some selective
permissiveness of the virus for viral growth in macrophages over
fibroblasts was still retained, as shown by the higher titers
obtained in macrophages versus murine embryonic fibroblasts. FIG.
3, Panel B shows Northern blot analysis of timecourse of viral RNA
infection from cells infected with MNV-1.CW1 at an M.O.I. of 2.0,
or mock-infected. h.p.i.=hours post infection. Analysis of the
levels of viral RNA over time reveal that viral RNA synthesis was
greater in macrophages than fibroblasts and greater in STAT-1-/-
macrophages than in wild type macrophages. Together, these data
indicate that noroviruses can adapt to grow in normally
non-permissive cells in culture, while retaining sensitivity to
STAT1-dependent antiviral effects.
EXAMPLE 15
[0238] This example illustrates mechanisms of MNV-1 growth
control.
[0239] In these experiments, macrophages lacking specific
components of the antiviral machinery were tested for their MNV-1
permissiveness. As shown in FIG. 4, MNV-1 growth in macrophages is
controlled by STAT-1, type I interferon receptors and PKR.
Multi-step (M.O.I.=0.05, left panel) and single-step (M.O.I.=2.0,
right panel) growth curves of MNV1.CW1 in bone marrow-derived
murine macrophages are shown. Macrophages from mice lacking the
interferon-.alpha..beta. receptor, STAT-1, or PKR all showed
increased permissiveness for MNV-1 growth, demonstrating that these
three molecules are part of the cellular response that limits
norovirus growth. In contrast, deletion of other antiviral
molecules, including iNOS and RNAseL, had no effect on MNV-1
growth.
EXAMPLE 16
[0240] This example illustrates that a Type I interferon response
and STAT-1 are required to prevent MNV-1 replication in bone marrow
macrophages in vitro, as measured by viral RNA production.
[0241] In these experiments, as shown in FIG. 5, accumulation of
viral genomes in infected macrophages was measured using
quantitative real time PCR (Karst, S. M. et al., Science 299:
1575-1578, 2003). STAT-1 -deficient (STAT-1-/-),
interferon-.alpha..beta. receptor-deficient
(IFN-.alpha..beta.R-/-), interferon-.gamma. receptor-deficient
(IFN-.gamma.R-/-), or wild type bone marrow macrophages were
infected with MNV-1, as discussed supra. At 12 hr and 18 hr post
infection (h.p.i.), cells were lysed and cDNA prepared from
cellular RNA. The number of viral genomes as normalized to cDNA
levels was then determined. The results show that viral RNA
expression can be measured to assess replication, and that bone
marrow macrophages can support norovirus replication when deficient
for STAT-1 or an interferon-.alpha..beta. receptor.
EXAMPLE 17
[0242] This example illustrates that MNV-1 productively infects
established macrophage cell lines including a human-murine fusion
cell line.
[0243] In this example, as shown in FIG. 6, RAW 264.7, J774A.1 and
WBC264-9C cells (a human leukocyte/murine macrophage hybrid, ATCC
catalog number HB-8902) were examined for their permissiveness
towards norovirus infection. In these experiments, the cells were
infected as described in example 12 with an MOI of 0.05 with MNV-1
containing brain homogenate or plaque-purified MNV-1.CW1. Cells
were subjected to freezing and thawing at various time intervals
after infection. Virus production was the measured by titering
using the plaque assay described in Example 3. The data in FIG. 8
is from a single experiment. The data indicate that MNV-1
productively infects each of these macrophage cell lines.
EXAMPLE 18
[0244] This example illustrates a consensus sequence of a murine
norovirus.
[0245] This sequence, as shown in FIG. 7, consists of 7382
nucleotides of a single stranded (positive strand) RNA molecule
which can serve as a murine norovirus genome.
EXAMPLE 19
[0246] This example illustrates a screen for an anti-viral
compound.
[0247] In this example, a candidate anti-viral compound is added to
a culture comprising RAW cells inoculated with MNV-1. Twelve hours
after infection, a plaque assay as described in Example 3 is
performed on virus released by the culture. A reduction in the
number of plaques formed in the plaque assay, compared to the
number of plaques formed in a plaque assay on a control culture in
which the candidate anti-viral compound was not added, indicates
that the candidate compound has anti-viral activity. Further
investigation can indicate the viral protein or stage of viral life
cycle targeted by the candidate anti-viral compound.
EXAMPLE 20
[0248] This example illustrates a screen for an anti-viral
compound.
[0249] In this example, a candidate anti-viral compound is added to
a culture comprising RAW cells inoculated with MNV-1. Eight hours
after infection, cells are harvested and lysed, and lysate samples
are applied to wells of an ELISA plate. ELISAs are performed on the
lysate samples using, for primary antibodies, mouse monoclonal
antibodies directed against norovirus polyprotein protease,
norovirus RNA polymerase, norovirus VPG, norovirus NTPase or
norovirus capsid protein (such as monoclonal antibody MAb A6.2
illustrated in Example 13 and FIG. 2). Antibody binding is revealed
using a goat anti-mouse secondary antibody conjugated with
horseradish peroxidase and a chromogenic HRP substrate. Signal is
quantified by measuring light absorbance using an ELISA plate
reader. A reduction in the light absorbance of an ELISA well probed
with an antibody compared to the light absorbance of a well coated
with lysate from a parallel control sample in which the candidate
anti-viral compound was not added, indicates that the candidate
compound caused a reduction in accumulation of the antibody's
target antigen. This observation indicates that the candidate
molecule merits further investigation as an anti-viral compound
directed against the accumulation of the target antigen.
EXAMPLE 21
[0250] Cells, mice, and virus. This example illustrates RAW 264.7
cells which were purchased from ATCC and maintained in DMEM
(Cellgro) supplemented with 10% low-endotoxin fetal calf serum
(FCS, HyClone), 100 U penicillin/ml, 100 .mu.g/ml streptomycin, 10
mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), and
2 mM L-glutamine. Bone marrow was harvested from STAT1-/- mice
(Taconic) and primary macrophages were cultured as previously
described (Heise et al., 1998, Virology v. 241, p. 331). Mice were
housed at Washington University in accordance with all federal and
university policies. In vitro virus infections were performed as
described above with either the original stock of MNV-1 consisting
of brain homogenate from infected IFN.alpha..beta..gamma.R-/- mice
(as in FIG. 1) or the plaque purified stock of MNV-1 passaged 3
times on RAW 264.7 cells (referred to in this work as MNV-1.CW1)
(as in FIGS. 2 and 3). The virus stock, multiplicity of infection
(MOI), and length of infection are indicated in individual
experiments.
EXAMPLE 22
[0251] RT-PCR amplification of the 5'end of MNV-1. This example
illustrates total RNA which was isolated from infected cells or
tissue using the TRIzol reagent. One microgram of RNA was used as
template in RT-PCR reactions performed with the Titanium One-Step
RT-PCR kit (Clontech), following the manufacturer's protocol, and
viral-specific PCR primers (sense=cgacttggaaatgcttggcgctca;
antisense=ttgcgtttctctgtgttg). Two microliters of the RT-PCR
product were then used as template in nested PCR
(sense=atcaatatcaaaacggcg; antisense=ttgcgtttctctgtgttg). The
nested PCR product was gel-purifed, cloned into pGEM-T Easy
(Promega), and sequenced by the Massachusetts General Hospital DNA
Core Facility. Sequences were aligned to the MNV-1 genomic sequence
with the VectorNTI contig program. The 5' end of the genome is
homologous to other norovirus and calicivirus 5' genomic ends and
to the ends of subgenomic RNAs as well (FIG. 12).
EXAMPLE 23
[0252] Ribonuclease protection assays. This examle illustrates
ribonuclease protection assays (FIGS. 10, 13, 14) which were
performed with the Multi-Probe RNase Protection Assay System (BD
RiboQuant) following manufacturer's protocols. The marker probe was
generated by in vitro transcription of 1 microliter of the mCK-5
probe template set (BD RiboQuant). A plasmid containing the MNV-1
lariat nested PCR product adjacent to the T7 promoter was
linearized with SalI and in vitro transcribed with T7 in the
presence of .sup.32P-UTP to generate the lariat probe. A plasmid
containing nucleotides 1-1699 of the MNV-1 genome adjacent to the
SP6 promoter was linearized with Bsu36I and in vitro transcribed
with SP6 to generate the 5'end positive control probe. One
microgram of linearized plasmid was used in each labeling reaction.
A parallel amount of probe (between 10.sup.5-10.sup.6 cpm,
depending on the labeling efficiency of individual probe
preparations) was hybridized with 1-5 micrograms of template RNA
from either MNV-1 infected or mock infected RAW 264 cells prior to
RNase digestion. Reactions were run out on 4.75% polyacrylamide
sequencing gels. Also included on the gels were 5000-10,000 cpm of
markers and undigested probes.
EXAMPLE 24
[0253] Northern hybridization of viral RNA. This example
illustrates Northerns to detect MNV-1 RNA species which were
performed using techniques well known in the art (FIGS. 3, 14).
Briefly, a portion of the MNV-1 genome containing nucleotides
5618-7040 was cloned into pGEM-T Easy (Promega) between the T7 and
SP6 promoters. This plasmid was linearized with Bsu36I and in vitro
transcribed with the SP6 RNA polymerase to generate the
sense-specific probe, or with the T7 RNA polymerase to generate the
antisense-specific probe. 1-2 micrograms of total RNA from MNV-1
infected or mock infected RAW 264 cells were run on 1.0%
agarose/formaldehyde gels. RNA Millennium Size Markers (Ambion)
were used on each gel for size determination.
EXAMPLE 25
[0254] Real-time RT-PCR analysis of viral RNA linear and lariat
species (FIG. 14). This example illustrates equivalent amounts of
total RNA which were used to generate single-stranded cDNA using
ImProm-II reverse transcriptase (Promega), and triplicate
quantitative RT-PCR reactions were performed. Primers specific to a
93 nucleotide region of MNV-1 ORF3 (sense=gttcaaaaccttcaggcaa;
antisense=gatccttctgggcttgaa) were used in the assay to detect
linear genomes. Primers specific to a 98 nucleotide region of MNV-1
surrounding the lariat branch point (sense=ggtaggcaagtgacatcccgc;
antisense=gtgttgcgcacagagggc) were used in the assay to detect
lariat genomes. The number of genomes in each case was determined
by comparison to a standard curve. In addition, triplicate
reactions were also performed with primers specific to cellular 18S
rRNA to normalize overall levels of cDNA in each sample. The data
is reported as log(genomes/ng cDNA).
EXAMPLE 26
[0255] FIG. 8. This example illustrates RT-PCR amplification across
the 5'end of the MNV-1 genome suggests that the MNV-1 genome adopts
an unexpected lariat conformation. A. The experimental design to
amplify, and thus sequence, the 5'end of the MNV-1 genome consisted
of an RT-PCR across a putative branch point between the 5'end and
the poly(A) tail. Shown are the 5'end and the poly(A) tail (in
black), and the sense and antisense nested PCR primers (in gray) on
both a linear and a lariat genome. B. The sequence of the RT-PCR
product shows the 5'end adjacent to nucleotide (nt) 7180 of the
genome, instead of the poly(A) tail. The expected sequence
(5'end-poly(A) tail junction) is shown in the top line and the
obtained sequence (5'end-nt7180) is shown in the bottom line. The
primer sequences are in gray and the 5'end sequence is in italics.
C. The same sequence has been obtained from multiple independent
sources of RNA from cells under various infection conditions with
MNV-1. Together the data show that a novel form of viral RNA which
unites the 5' end of the genome with an internal T present near the
3' end of the genome exists in infected cells.
EXAMPLE 27
[0256] FIG. 9. This example illustrates schematic representation of
the viral lariat. Shown is a schematic of the viral genome with
coordiates of the sequences joined in the lariat. Sequences 1-62 of
the viral genome were discovered as in FIG. 8 united with sequences
6957 to 7180 of the viral genome. This covalent linkage between the
5' end of the genome and an internal nucleotide defines the lariat
form of the genome.
EXAMPLE 28
[0257] FIG. 10: This example illustrates proof that the viral
lariat exists using a method other than PCR. Using RNAs protection
the lariat exists in infected cells. An RNAse protection probe was
generated that spans the lariat junction between the 5' end of the
genome and the internal NT defined in FIGS. 8 and 9. If the lariat
exists than a 283 nt portion of the probe should be protected. Such
a band is observed, demonstrating that the lariat exists.
EXAMPLE 29
[0258] FIG. 11: This example illustrates the sequences of the
lariat junction and the 5' end of the MNV-1 genome closely match
consensus sequences for mammalian splicing. As lariats are formed
as an intermediate in mammalian splicing the sequences of the MNV-1
genome in the region of the viral lariat were compared to the
sequences used in host splicing. The 5' end of the MNV-1 genome
(and not shown the 5' end of the MNV-1 subgenomic RNA) closely
match the 5' intronic sequences involved in cellular splicing.
Furthermore, while the MNV-1 latriat utilized a T rather than an A
as is characteristic of host cell splicing, the internal sequences
surrounding the MNV-1 lariat site contain a consensus match to the
sequences internal to the host intron that is used to initiate
lariat formation. These data show that the MNV-1 lariat formation
occurs in regions showing complete matches to the sequences used in
host cell lariat formation as it occurs during the splicing
reaction.
EXAMPLE 30
[0259] FIG. 12: This example illustrates comparison of the viral
genomes of noroviruses and other caliciviruses shows that the
consensus sequences described in FIG. 11 are conserved across many
viruses. This shows that these sequences are common to many viruses
consistent with involvement of viral lariats and lariat formation
playing a role in infection with a range of viruses.
EXAMPLE 31
[0260] FIG. 13. This example illustrates the lariat conformation of
the MNV-1 genome can be detected in infected cells, but not in
viral particles, by ribonuclease protection assay (RPA). A.
Products corresponding to both linear and lariat viral genomes are
detected with an RPA probe designed to anneal across the putative
lariat branch point. Undigested lariat probe was run in lane 1 to
verify the size of the labeled probe (373 nt). Lariat probe was
hybridized with RNA from MNV-1 infected cells (lane 2), RNA from
mock infected cells (lane 3), or tRNA (lane 4) prior to RNase
digestion. The expected size for lariat probe annealed to linear
genomes is 223 nt, while the expected size for lariat probe
annealed to lariat genomes is 284 nt. A positive control probe to
the 5'end of the genome was either run undigested (lane 5; expected
size of 435 nt) or hybridized with RNA from MNV-1 infected cells
prior to digestion (lane 6; expected size of 364 nt annealed to
either linear or lariat genomes). RNA for this experiment was
isolated from RAW 264.7 cells either infected with MNV-1 at an MOI
of 0.25 or mock infected for 3 days. B. The lariat-specific product
is detected in infected cells but not in purified viral particles
by RPA. Lane 1=undigested lariat probe; lane 2=lariat probe+2
micrograms of total RNA from MNV-1 infected cells 18 hpi; lane
3=lariat probe+2 micrograms of total RNA from mock infected cells
18 hpi; and lane 4=lariat probe+250 nanograms of RNA from MNV-1
virions. RNA for this experiment was isolated from RAW 264.7 cells
either infected with MNV-1.CW1 at an MOI of 10.0 or mock infected
(lanes 2 and 3, respectively), or from MNV-1.CW1 virions purified 3
times on cesium chloride gradients (lane 4). These data show that
the lariat is present in infected cells but not the viral particle.
This proves that the lariat is formed during viral infection in a
process that occurs in the infected cell.
EXAMPLE 32
[0261] FIG. 14. This example illustrates the lariat conformation of
the MNV-1 genome is present in infected cells during the period of
viral RNA replication. A. Ribonuclease protection assay shows
lariat genomes are detected only after newly synthesized linear
genomes are detectable. 2 micrograms of total RNA from MNV-1 or
mock infected cells at each time point (hours post-infection, hpi,
listed above the lanes) was hybridized with an equivalent amount of
lariat probe prior to RNase digestion. B. One microgram of total
RNA from the same samples as in Panel A was run on denaturing gels
and probed for either positive or minus sense viral RNA species in
Northern hybridization. The expected migrations of genomic and
subgenomic species are indicated. The hpi are listed above each
lane. The data shown in panels A and B are representative of three
independent experiments. One microgram of total RNA from the same
samples used in Panels A and B was used in first strand cDNA
synthesis, followed by quantitative real time PCR with primers
specific for linear genomes (C), or for lariat genomes (D). Levels
of viral genomes in both cases were normalized to levels of
cellular 18S RNA determined in parallel real time assays. All mock
samples were negative in these assays. For Panels C and D, data
from three independent experiments was averaged to generate error
bars. In all experiments in this figure, RNA was isolated from RAW
264.7 cells infected with MNV-1.CW1 at an MOI of 10.0, or mock
infected. These data show that the lariat is formed concurrent with
viral RNA synthesis of positive and negative strands of the viral
genome. Two independent methods were used. These data also
demonstrate that the lariat form of the genome can be
quantitatively measured as a readout for viral replication in a
permissive cell.
EXAMPLE 33
[0262] FIG. 15. This example illustrates a model of lariat
formation in the MNV-1 genome is depicted based on similarities to
cellular intron lariat formation. The basic steps of cellular
splicing are depicted on the left side of Panel A, with the
sequences required for intron lariat formation, the 5'splice site
and the branch point sequences, indicated. The adenosine residue of
the branch point attacks the first guanidine residue of the intron,
generating a 2'-5' phosphodiester bond between the two residues.
This reaction results in the formation of a lariat in the intronic
sequence and brings the 2 exons into proximity. Splicing is then
completed by a second attack, specifically the 3'end of exon 1
attacking the 5'end of exon 2 and generating a new phosphodiester
bond between the 2 exons. This also results in release of the
lariat intron. In the case of the MNV-1 genome, the parallel
sequences involved in lariat formation are shown; based on the
sequence analysis presented in this work, a uridine residue acts as
the branch point residue. B. Alignment of the genomic and
subgenomic 5'ends of calicivirus genomes shows conservation of the
5'splice site across the family and suggests that lariat formation
may be a common event in calicivirus replication.
EXAMPLE 34
[0263] This example illustrates the implication of the
demonstration of the novel lariat form of the viral genome, the
conservation of sequences in the viral genome involved in host cell
splicing, and the use of T rather than an A as the branch point in
the lariat are denoted in summary form.
[0264] All references cited in this specification are hereby
incorporated by reference in their entireties. Any discussion of
references cited herein is intended merely to summarize the
assertions made by their authors and no admission is made that any
reference or portion thereof constitutes relevant prior art.
Applicants reserve the right to challenge the accuracy and
pertinency of the cited references.
[0265] The norovirus described above assigned ATCC Accession Number
PTO-5935 is on deposit under the terms of the Budapest Treaty with
the American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209. The strain was deposited on Apr. 27, 2004
and the requisite fees were paid. The accession number indicated is
assigned after successful viability testing. Access to the culture
will be available during pendency of the patent application to one
determined by the Commissioner to be entitled thereto under 37
C.F.R. .sctn. 1.14 and 35 U.S.C. .sctn. 122. All restriction on
availability of said culture to the public will be irrevocably
removed upon the granting of a patent based upon the application.
Moreover, the designated deposit will be maintained for a period of
thirty (30) years from the date of deposit, or for five (5) years
after the last request for the deposit, or for the enforceable life
of the U.S. patent, whichever is longer. Should a culture become
nonviable or be inadvertently destroyed, or, in the case of
plasmid-containing strains, lose its plasmid, it will be replaced
with a viable culture. The deposited material mentioned herein is
intended for convenience only, and is not required to practice the
present invention in view of the description herein, and in
addition, this material is incorporated herein by reference.
[0266] The description of the invention is merely exemplary in
nature and, thus, variations that do not depart from the gist of
the invention are intended to be within the scope of the invention.
Such variations are not to be regarded as a departure from the
spirit and scope of the invention.
EXAMPLE 35
[0267] This example illustrates cell cultures and mice used in
experiments presented herein.
[0268] In these experiments, mouse embryo fibroblasts were
generated and cultured as described previously (Pollock J L, et
al., Virology 227, 168-179, 1997). RAW 264.7 cells were purchased
from ATCC (Manassas, Va., United States) and maintained in DMEM
(Cellgro, Mediatech, Herndon, Va., United States) supplemented with
10% low-endotoxin fetal calf serum (SH30070.03, HyClone, Logan,
Utah, United States), 100 U penicillin/ml, 100 .mu.g/ml
streptomycin, 10 mM HEPES
(N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), and 2 mM
L-glutamine (Biosource, Camarillo, Calif., United States). Bone
marrow was harvested and macrophages were cultured as described
previously (Heise M. T., et al., Virology 241, 331-344, 1998). To
culture dendritic cells, bone marrow cells were resuspended in
RPMI1640 containing 10% low endotoxin fetal calf serum, 2 mM
L-glutamine, 1 mM sodium pyruvate (Biosource), 100 U penicillin/ml,
100 .mu.g/ml streptomycin, 1% nonessential amino acids (Biosource),
and 20 ng/ml recombinant mouse GM-CSF (BD Biosciences, San Jose,
Calif., United States) and plated at a concentration of 3.times.105
cells/ml in six-well plates in a total volume of 3 ml per well. The
percentage of CD11c-positive dendritic cells was determined by FACS
staining after culturing cells for 7 d at 37.degree. C. and 5% CO2.
Approximately 70% of the cells were CD11c positive.
[0269] Wt 129 and STAT1-/- mice were purchased from Taconic
(Germantown, N.Y., United States). IFN.alpha..beta.R-/-,
IFN.gamma.R-/- , and IFN.alpha..beta..gamma.R-/- (Muller et al.,
Science 264: 1918-1921, 1994), PKR-/- (Yang et al., EMBO J 14:
6095-6106, 1995), and iNOS-/- (MacMicking et al., Cell 81: 1-10,
1995). Mice were bred and housed at Washington University in
accordance with all federal and university policies.
EXAMPLE 36
[0270] This example illustrates methods of preparation of rabbit
anti-MNV-1 serum.
[0271] In these experiments, rabbits were immunized subcutaneously
with 140 .mu.g of MNV-1 VLPs in complete Freunds adjuvant and
boosted 4 or 8 wk later with 70 .mu.g of MNV-1 VLPs or 50 .mu.g of
UV-inactivated CsCl-purified MNV-1 in incomplete Freunds adjuvant.
Serum was collected two weeks after the last boost, heat
inactivated, and filtered before use.
EXAMPLE 37
[0272] This example illustrates immunohistochemistry methods used
in the present experiments.
[0273] In these methods, seven-week-old STAT1-/- mice were infected
orally with 25 .mu.l of brain homogenate containing MNV-1
(6.times.105 pfu) or brain homogenate from uninfected mice. Organs
were collected into 10% buffered formalin and embedded in paraffin
for sectioning by standard methods. Immunohistochemistry was
performed as described previously (Weck et al., Nat Med 3:
1346-1353, 1997) using tyramide signal amplification (NEN Life
Science Products, Boston, Mass., United States). Slides were
blocked in tyramide signal amplification blocking reagent (NEN Life
Science Products) containing 10% mouse serum (IHC blocking buffer)
for 30 min before adding antibodies. Serum was diluted 1:20,000
(spleen) or 1:100,000 (liver) in IHC blocking buffer, and tissue
sections were incubated overnight at 4.degree. C. Horseradish
peroxidase-conjugated donkey anti-rabbit secondary antibody
(Jackson ImmunoResearch Laboratories, West Grove, Pa., United
States) was diluted 1:250 in IHC blocking buffer and applied to
tissue sections for 1 h at room temperature. Biotin-tyramide was
added at a dilution of 1:50 in 1.times. amplification diluent (NEN
Life Science Products) for 10 min, slides were washed, and
horseradish peroxidase-conjugated streptavidin (NEN Life Science
Products) was added at a 1:100 dilution in tyramide signal
amplification blocking reagent and incubated for 30 min at room
temperature before washing. Antigen was visualized by a 3-min
staining with a solution of 3,3'-diaminobenzidine (Vector
Laboratories, Burlingame, Calif., United States). Slides were
washed and lightly counterstained with hematoxylin, dehydrated, and
covered with Cytoseal XYL (Richard Allan Scientific, Kalamazoo,
Mich., United States) coverslips. No staining was observed in
infected tissues incubated with preimmune serum or mock-infected
tissues incubated with immune serum.
EXAMPLE 38
[0274] This example illustrates methods for infection of cells.
[0275] In these experiments, adherent cells were plated in 12-well
plates and allowed to attach for several hours. Infections were
carried out at a multiplicity of infection (MOI) of 0.05 or 2.0 for
30 min on ice in a volume of 0.5 ml per well. dendritic cells were
infected in bulk in the same volume. Cells were then washed twice
with 2 ml of ice-cold PBS per well. To allow viral entry, 1 ml of
medium was added to each well, and cells were incubated at
37.degree. C. and 5% CO2 for different time periods. For growth
curve samples, infected cells and media were subjected to two or
three cycles of freezing and thawing before plaque titration.
EXAMPLE 39
[0276] This example illustrates generation of monoclonal antibody
mAb A6.2.
[0277] In these experiments, an MNV-1-seropositive 129 mouse was
injected intraperitoneally with 100 .mu.l of a brain homogenate
containing MNV-1, and the spleen was harvested 3 d later. Hybridoma
fusions were performed as described previously (Virgin et al., J
Virol 65: 6772-6781, 1991) with the following modifications.
Hybridoma supernatants were screened for binding to recombinant
MNV-1 capsids by ELISA as described (Karst et al., Science 299:
1575-1578, 2003). Stable hybridomas were characterized by Western
blotting and ELISA after two rounds of subcloning by limiting
dilution. A6.2 was unable to detect MNV-1 capsid protein by Western
blot analysis but specifically bound to recombinant MNV-1 capsids
by ELISA. The A6.2 isotype is IgG2a and was determined using the
mouse mAb isotyping kit (Amersham Biosciences, Amersham, United
Kingdom) and following manufacturer's protocol.
EXAMPLE 40
[0278] This example illustrates MNV-1 plaque assay and plaque
neutralization assay methods.
[0279] In these experiments, RAW 264.7 cells were seeded into
six-well plates at a density of 2.times.106 viable cells per well.
On the following day, 10-fold dilutions of virus inoculum were
prepared in complete DMEM medium and plated in duplicate wells.
Plates were incubated for 1 h at room temperature on a rocking
apparatus before aspirating the inoculum and overlaying the cells
with 2 ml of 37-40.degree. C. 1.5% SeaPlaque agarose in MEM
supplemented with 10% low-endotoxin fet al.calf serum, 1% HEPES, 1%
penicillin/streptomycin, and 2% glutamine (complete MEM) per well.
Plates were incubated at 37.degree. C. and 5% CO2 for 2 d. To
visualize plaques, cells were stained with 2 ml of 56.degree. C.
1.5% SeaKem agarose in complete MEM containing 1% neutral red per
well for 6-8 h.
[0280] For plaque neutralization assays, differing concentrations
of purified mAb (A6.2, anti-MNV-1 capsid; isotype control, 10H2,
anti-reovirus .mu.1c) were incubated with equal plaque-forming
units of either MNV-1.CW1 or MNV-1 brain homogenate for 30 min at
37.degree. C. prior to performing the MNV-1 plaque assay.
EXAMPLE 41
[0281] This example illustrates methods of purification of virus
particles.
[0282] In these experiments, RAW 264.7 cells were infected with
MNV-1.CW1 for 2 d at an MOI of 0.05. Cellular debris was removed
from freeze/thaw lysates by low-speed centrifugation for 20 min at
3,000 rpm. Supernatants were layered on top of a 5-ml 30% sucrose
cushion and centrifuged at 4.degree. C. for 2.5 h at 27,000 rpm
(90,000 g) in a SW32 rotor. Cell pellets were then resuspended in
PBS and mixed with CsCl to a final density of 1.335 g/cm3 and
centrifuged for at least 18 h at 35,000 rpm (115,000 g) in a SW55
rotor. A wide lower band (1.35.+-.0.01 g/cm3) and narrow upper band
(1.31.+-.0.01 g/cm3) were typically seen in the gradient. Each band
was collected by puncturing the side of the tube with a needle
before overnight dialysis against PBS at 4.degree. C.
EXAMPLE 42
[0283] This example illustrates protein analysis methods.
[0284] In these experiments, CsCl-purified virions were separated
by SDS-PAGE gel electrophoresis using standard protocols (Sambrook
et al., supra). Proteins were visualized by Coomassie blue staining
using the Simply Blue safe stain (Invitrogen, Carlsbad, Calif.,
United States) according to manufacturer's instructions. For
Western blot analysis, proteins were transferred to nitrocellulose
membrane and incubated with an anti-MNV-1-capsid rabbit polyclonal
antibody, followed by a peroxidase-labeled secondary antibody, and
visualized by ECL (Amersham Biosciences) according to
manufacturer's instructions. Immunoprecipitation of radiolabeled
infected cell lysates was performed as described previously
(Sosnovtsev et al., J Virol 76: 7060-7072, 2002) with serum
obtained from a 129 wt mouse infected orally with MNV-1.
EXAMPLE 43
[0285] This example illustrates Northern blotting methods used in
the present analyses.
[0286] In these experiments, the region of the MNV-1 genome from nt
5,617 to 7,039 was amplified by RT-PCR and cloned into the pGEM-T
Easy (Promega, Madison, Wis., United States) vector between the T7
and SP6 promoters. The resulting plasmid was linearized with Bsu361
and in vitro transcribed with SP6 RNA polymerase (Roche,
Indianapolis, Ind., United States) to generate RNA transcript
probes for detection of positive-sense viral RNA, or with T7
polymerase (Roche) to generate transcripts for detection of
negative-sense viral RNA. To label probes, the transcription
reaction was carried out in the presence of P.sup.32-UTP according
to manufacturer's recommendations. Total RNA from virus-infected or
mock-infected cells was isolated using Trizol (Invitrogen)
according to the manufacturer's recommendations. One microgram of
total RNA from MNV-1- or mock-infected cells was subjected to
electrophoresis on a 1% formaldehyde gel. RNA Millennium Size
Markers (Ambion, Austin, Tex., United States) were used as size
markers. Northern blotting was performed using standard protocols
(Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed.
Cold Spring Harbor (N.Y.): Cold Spring Harbor Laboratory Press. 3.
v., 1989). Probes were hybridized overnight at 68.degree. C. in 50%
formamide containing 6.times.SSC, 5.times. Denhardt's, 0.5% SDS,
and 100 .mu.g/ml ssDNA.
EXAMPLE 44
[0287] This example illustrates MNV-1 ELISA methods used in the
present analyses.
[0288] In these experiments, ELISA was performed as described
previously (Karst et al., Science 299: 1575-1578, 2003) with the
following modifications. ELISA plates were coated overnight at
4.degree. C. with CsCl-purified MNV-1 particles at 0.2 or 1.0
.mu.g/well. Diluted purified anti-MNV-1-capsid (A6.2) and isotype
control (reovirus 10H2) mAbs, as well as the peroxidase-labeled
secondary antibodies, were incubated for 60 min at 37.degree.
C.
EXAMPLE 45
[0289] This example illustrates methods of electron microscopy
analysis.
[0290] In these experiments, negative staining electron microscopy
of CsCl-purified virions was performed as described previously
(Karst et al., Science 299: 1575-1578, 2003). For thin-section
electron microscopy, RAW cells were infected with MNV-1.CW1 at an
MOI of 2.0, as described above. At various times postinfection
cells were washed with PBS and fixed with 3% glutaraldehyde diluted
in PBS at room temperature for 2 h. Cells were pelleted and washed
with buffer prior to incubation with 1% osmium tetroxide (in 0.1 M
cacodylate buffer) for 40 min at room temperature. After washing,
the cells were incubated overnight at 4.degree. C. in 2% uranyl
acetate/80% acetone. The pellets were then dehydrated with an
acetone series and embedded in Epon before polymerization at
65.degree. C. for 72 h. Ultrathin sections (60 nm) were cut with a
Micro Star (Huntsville, Tex., United States) diamond knife, and the
sections were stained and contrasted with uranyl acetate and lead
citrate before viewing on a JOEL 1010 electron microscope at 80 kV.
Images were captured on a MegaView III side-mounted CCD camera
(Soft Imaging System, Lakewood, Colo., United States), and figures
were processed using Adobe Photoshop software (Adobe Systems, San
Jose, Calif., United States).
EXAMPLE 46
[0291] This example illustrates methods of consensus sequence
analysis of viral RNA.
[0292] In these experiments, RNA was extracted from brain tissue or
cell culture material with Trizol (Invitrogen) and reverse
transcribed with Superscript II enzyme (Invitrogen).
Genome-specific sequences were PCR-amplified with Elongase enzyme
(Invitrogen) to produce seven overlapping fragments. The DNA
fragments were gel-purifed and sequenced directly with reagents in
the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied
Biosystems, Foster City, Calif., United States) on a 3100 DNA
sequencer (Applied Biosystems). Data were analyzed with the
Sequencher software package (Gene Codes Corporation, Ann Arbor,
Mich., United States).
EXAMPLE 47
[0293] This example illustrates MNV-1 Replication in Murine
macrophages and dendritic cells.
[0294] In these experiments, STAT1-/- mice were infected with MNV-1
by the oral route and tissue sections analyzed by
immunohistochemistry for the presence of MNV-1 protein.
MNV-1-specific staining was observed in spleen and liver 2 d
postinfection (FIG. 16). Interestingly, in the liver, Kupffer cells
(resident macrophages of the liver) lining the sinusoids were
specifically stained by MNV-1 immune serum (compare FIG. 16, Panels
A and B). In the spleen, staining was found primarily in the red
pulp and the marginal zone, but also in non-lymphoid cells within
the white pulp (FIG. 16, Panels C and D). This pattern is
consistent with staining of macrophages and dendritic cells (Metlay
et al., J Exp Med 171: 1753-1771, 1990; Leenen et al., J Immunol
160: 2166-2173, 1998). Furthermore, in some cases
virus-antigen-positive macrophages were detected (FIG. 16, Panel
C).
[0295] As shown in FIG. 16, MNV-1-specific staining in vivo occurs
in cells of the macrophage lineage. In these experiments,
immunohistochemistry was performed on liver (FIG. 16, Panels A and
B) and spleen (FIG. 16, Panels C and D) sections from STAT1-/- mice
2 d after oral infection. MNV-1-specific staining was seen in
Kupffer cells of infected livers when probed with MNV-1 immune (A)
but not preimmune (B) serum. A selected Kupffer cell lining the
sinusoid is indicated by an arrowhead. MNV-1-specific staining
consistent with macrophages was seen in red pulp (C) and marginal
zone (D) in the spleen. The arrow indicates a cell with macrophage
morphology. No staining was observed in tissues from mice infected
for 1 d, in infected tissues incubated with preimmune serum, or in
mock-infected tissues incubated with immune serum. RP, red pulp;
WP, white pulp.
[0296] These experiments illustrate that MNV-1 infects macrophages
in vitro.
EXAMPLE 48
[0297] This example illustrates permissiveness of hematopoietic
lineage cells for MNV-1 replication in vitro.
[0298] In these experiments, Bone-marrow-derived macrophages
(BMM.PHI.) and bone-marrow-derived dendritic cells (BMDCs) were
inoculated with a MNV-1 stock derived from the brain of infected
IFN.alpha..beta..gamma. receptor-/- (IFN.alpha..beta..gamma.R-/-)
mice (Karst et al., Science 299: 1575-1578 2003). Cytopathic effect
(CPE) in cell monolayers was visible within 2 d in STAT1-/-
BMM.PHI. and BMDCs, but not STAT1-/- murine embryonic fibroblasts
(MEFs) (FIG. 17, Panel A). While BMDCs showed CPE even when STAT-1
was present, wild-type (wt) BMM.PHI. exhibited less CPE than their
STAT1-/- counterparts.
[0299] As shown in FIG. 17, MNV-1 from brain homogenate replicates
in cells of the dendritic cell and macrophage lineage in vitro.
[0300] BMDCs and BMM.PHI., as well as MEFs from wt or STAT1-/-
mice, and RAW 264.7 cells were infected with a multiplicity of
infection (MOI) of 0.05.
[0301] Panel 17A: MNV-1 causes cytopathic effect in permissive
cells. MNV-1- or mock-infected cells were observed by light
microscopy 2 d postinfection. The boxed area is magnified further
to show the border of the plaque.
[0302] Panel 17B: Infected cell lysates were analyzed in two to
four independent experiments by plaque assay at various timepoints
postinfection to calculate standard deviations. For wild type
BMM.PHI., MNV-1 growth was detected in two out of four
experiments.
[0303] These data show that MNV-1 have a marked tropism for
macrophages and dendritic cells but not fibroblasts.
[0304] This information was used to screen available macrophage
cell lines for growth of MNV-1, including the murine lines RAW
264.7 (Raschke et al., Cell 15: 261-267, 1978) and J774A.1 (Ralph
et al., J Immunol 114: 898-905, 1975), and the human/murine hybrid
line WBC264-9C (Aksamit, Biochem Biophys Res Commun 138: 1001-1008,
1986). These cells also showed visible cytopathic effect (CPE) when
inoculated with the MNV-1 stock (FIG. 17; data not shown). In these
experiments, plaques were observed when infected RAW 264.7
monolayers were maintained under agarose (FIG. 17, Panel A),
allowing us to develop a plaque assay and quantify virus
titers.
[0305] STAT1-/- BMMD, STAT1-/- and wt BMDCs, and RAW 264.7 cells
consistently supported the growth of MNV-1, while wt BMM.PHI.
varied in their ability to support virus growth (FIG. 17, Panel B).
BMM.PHI. and BMDCs cells lacking STAT-1 always yielded higher MNV-1
titers than their wt counterparts. Furthermore, a low level of
virus replication was observed in STAT1-/- MEFs, but as reported
previously, no virus growth was observed in wt MEFs (Karst et al.,
Science 299: 1575-1578, 2003). MNV-1 replication proceeded rapidly
in permissive cells, with newly synthesized infectious virions
first detected in cell lysates 9 to 12 hours postinfection
(h.p.i.). Taken together, these data indicate that MNV-1 can
productively infect macrophages and dendritic cells.
EXAMPLE 49
[0306] This example illustrates verification of viral growth in
vitro
[0307] In these experiments, several approaches were used to verify
that the observed CPE and plaques were caused by MNV-1. We first
performed a clonal selection from the MNV-1 stock (from infected
brain tissue) with three rounds of plaque purification in RAW 264.7
cells to generate the MNV-1.CW1 strain. This strain was amplified
in RAW 264.7 cells, after which virus particles were concentrated
and subjected to purification by isopycnic centrifugation in CsCl.
A distinct band was observed in CsCl gradients at a density of
1.35.+-.0.01 g/cm3, consistent with that described for noroviruses
(Kapikian et al., Philadelphia: Lippincott-Raven, pp 783-810,
1996). Examination of the material in this fraction by negative
staining electron microscopy showed the presence of virus particles
with calicivirus morphology (FIG. 18, Panel A). Furthermore,
SDS-PAGE analysis of this material revealed a major protein of
approximately 59 kDa, consistent with the calculated mass of the
MNV-1 capsid protein (FIG. 18 Panels B,C). Western blot analysis
with antibodies generated against bacterially expressed MNV-1
capsid protein (FIG. 18, Panel B) and mass spectrometry (data not
shown) confirmed its identity as the MNV-1 capsid protein. A
genomic-sized RNA molecule of approximately 7.4 kb was detected in
nucleic acid isolated from the purified virions with a probe
specific for the MNV-1 genome in Northern blots (data not shown).
Finally, a neutralization assay was performed with the monoclonal
antibody (mAb) A6.2 specific for the MNV-1 capsid protein (see
Materials and Methods). MAb A6.2 specifically bound to
CsCl-purified MNV-1 virions in an immunoassay, while the
isotype-matched mAb 10H2, an anti-reovirus .mu.1c mAb (Virgin et
al., J Virol 65: 6772-6781, 1991), did not bind (FIG. 18, Panel D).
MAb A6.2, but not the isotype control antibody 10H2, showed
neutralization activity in a plaque reduction assay for both the
virus in the original brain homogenate (MNV-1), and the three-times
plaque-purified strain MNV-1.CW1 (FIG. 18, Panel E).
[0308] FIG. 18 illustrates characterization of the triple
plaque-purified strain MNV-1.CW1.
[0309] Panel 18, Panels A-C: MNV-1.CW1 purified on CsCl density
gradients was visualized by (A) negative staining electron
microscopy, (C) Coomassie staining, and (B) Western blot analysis
with a polyclonal anti-MNV-1-capsid antibody. Molecular weight
markers are indicated in kiloDaltons.
[0310] Panel 18, Panel D: Specific binding of mAb A6.2 to two
different concentrations of CsCl-purified MNV-1 particles in an
enzyme-linked immunosorbent assay.
[0311] Panel 18, Panel E: Neutralization of MNV-1 from brain
homogenate and MNV-1.CW1 by mAb A6.2 but not the isotype control
(10H2) mAb in a plaque neutralization assay. The assay was repeated
three times to calculate standard deviations. The limit of
detection is indicated by the dashed line.
[0312] Panel 18, Panel F: Timecourse of viral RNA synthesis in RAW
264.7 cells. Northern blot analysis of viral RNA from cells
infected with MNV-1.CW1 (MOI of 2.0) or mock-infected cells. The
size of RNA markers in kilobases is shown on the left. The
positions of subgenomic- and genomic-length RNA are indicated on
the right. This timecourse is a representative of two independent
experiments.
[0313] Panel 18, Panel G: Timecourse of viral protein synthesis in
infected RAW 264.7 cells. MNV-l-specific proteins were precipitated
from radiolabeled cell lysates of MNV-1.CW1-infected RAW 264.7
cells (MOI of 2.0) at indicated times after infection. The size of
the proteins in kiloDaltons is indicated.
[0314] Together these data confirm that MNV-1 was the infectious
agent associated with viral growth observed in the infected cell
cultures.
EXAMPLE 50
[0315] This example illustrates MNV-1 RNA and protein production in
permissive cells.
[0316] In these experiments, viral RNA and protein synthesis in
MNV-1.CW1-infected RAW 264.7 cells were analyzed to compare MNV-1
replication in cells with that of other caliciviruses. Northern
blot analysis using a probe specific for the positive strand of the
MNV-1 genome showed an increase in the accumulation of full-length
(7.4 kb) and subgenomic-length (2.3 kb) MNV-1 genome over time
(FIG. 18, Panel F). Radiolabeled MNV-1-infected RAW 264.7 cell
lysates were analyzed by immunoprecipitation with serum from a
MNV-1 infected mouse, and a 59-kDa protein consistent with the
capsid protein was detected as early as 6 h.p.i. (FIG. 18, Panel
G). Additional proteins accumulated over time that corresponded in
size to expected calicivirus nonstructural proteins such as the
76-kDa proteinase-polymerase precursor and an approximately 40-kDa
NTPase protein (Sosnovtsev et al., J Virol 76, 7060-7072, 2002).
These data show that the viral RNA and proteins synthesized in
infected cells are consistent with calicivirus replication (Green
et al., In: Knipe D M, Howley P M, editors Fields Virology,
Philadelphia: Lippincott Williams and Wilkins, pp 841-874,
2001).
EXAMPLE 51
[0317] This example illustrates ultrastructural examination of
MNV-1-infected RAW 264.7 cells
[0318] Positive-strand RNA viruses (Dales et al., Virol 26:
379-389, 1965; Mackenzie et al., J Virol 73: 9555-9567, 1999;
Pedersen et al., J Virol 73: 2016-2026, 1999), including
caliciviruses (Love et al., Arch Virol 48: 213-228, 1975; Studdert
and O'Shea, Arch Virol 48: 317-325, 1975; Green et al., J Virol 76:
8582-8595, 2002), are known to replicate in association with
intracellular membranes. Therefore, we examined the ultrastructural
morphology of MNV-1.CW1-infected RAW 264.7 cells (FIG. 19). Over
time, virus-infected cells showed a striking change in overall
morphology and intracellular organization (FIG. 19 Panels D-4L)
compared to mock-infected cells (FIG. 19, Panels A-C). Structures
resembling virus particles were observed within or next to single-
or double-membraned vesicles in the cytoplasm by 12 hours post
infection (h.p.i.) (FIG. 19, Panel D). The vesiculated areas
increased in size with time (FIG. 19, Panels G-I), and by 24
h.p.i., large numbers of these vesicles and viral particles
occupied most of the cytoplasm, displacing the nucleus (FIG. 19,
Panels J-L). In addition, a complete rearrangement of intracellular
membranes with some confronting membranes occurred (FIG. 19, Panel
J), leading to a rearrangement of the endoplasmic reticulum and
loss of an intact Golgi apparatus (FIG. 19, Panel E; data not
shown). Interestingly, these smooth-membraned vesicles were often
surrounded by mitochondria. A small proportion of cells also showed
crystalline arrays of cytoplasmic virus particles (data not
shown).
[0319] FIG. 19 illustrates ultrastructural studies of
MNV-1.CW1-infected RAW 264.7 cells.
[0320] As shown in FIG. 19, cells were infected with MNV-1.CW1 (P3)
(MOI of 2.0) (Panels D-L) or mock-infected (Panels A-C) and
processed for electron microscopy 12 hours post infection (h.p.i.)
(FIG. 19, Panels D-F), 18 h.p.i. (FIG. 21 Panels G-I), or 24 h.p.i.
(FIG. 21A-C; J-L). MNV-1 particles are indicated by arrows and
confronting membranes by arrowheads. VA, vesiculated areas; Nuc,
nucleus; rER, rough endoplasmic reticulum. Scale bars, 200 nm for
(A), (D), (G), and (J); 500 nm for (B), (E), (H), and (K); 2 .mu.m
for (C), (F), (I), and (L).
[0321] These observations indicate that like other positive-strand
RNA viruses, norovirus RNA replication likely occurs in association
with intracellular membranes.
EXAMPLE 52
[0322] This example illustrates characterization of the
plaque-purified strain MNV-1.CW1 in vitro
[0323] In these experiments, to determine whether the plaque
purification and sequential amplification of MNV-1 in RAW 264.7
cells had altered its growth characteristics, different cell types
were infected with passage (P) 3 of MNV-1.CW1. In general, the
growth of MNV-1.CW1 (P3) in wt or STAT1-/- macrophages and MEFs
(FIG. 20, Panel A) as well as RAW 264.7 cells (data not shown) was
similar to that observed for the original parental MNV-1 virus
stock (compare FIGS. 17, Panel B and 20, Panel A). Virus titers
were reproducibly higher in STAT1-/- cells compared to wild type
(wt) cells, and MNV-1.CW1 (P3) growth was consistently observed in
wt BMM.PHI..
[0324] FIG. 20 illustrates a critical role for STAT-1 in limiting
MNV-1 growth in vitro.
[0325] Panel 20, Panel A illustrates that MNV-1.CW1 has no defect
in viral growth in vitro. Growth curves (MOI of 0.05) were
performed two or three times with MNV-1.CW1 (P3) on indicated cells
to calculate standard deviations.
[0326] Panel 20, Panel B illustrates that MNV-1 growth in
macrophages is controlled by STAT-1 and Type I IFNs. BMM.PHI. of
the indicated genotype were infected with MNV-1.CW1 (P3) at the
indicated MOI. The experiment was performed twice to calculate
standard deviations. The p-values for PKR versus wt infection at
MOI 0.05 and 2.0, 0.8867 and 0.1616, respectively, are not
significant. Statistical analysis was performed using the paired
t-test (GraphPad Prism, version 3.03).
[0327] These data demonstrate that our plaque purification and
serial passage in RAW 264.7 cells does not change the tropism of
the virus for primary dendritic cells and macrophages and confirms
the importance of STAT-1 in controlling MNV-1 growth at the
cellular level.
EXAMPLE 53
[0328] This example illustrates cellular factors controlling MNV-1
growth in vitro
[0329] Previous studies demonstrated that a lack of STAT-1 or both
IFN.alpha..beta.R and IFN.gamma.R increases susceptibility to MNV-1
infection. However, mice lacking individual IFNR, inducible nitric
oxide (iNOS)-/-, or protein kinase R (PKR)-/- are not susceptible
(Karst at al. 2003). Therefore, we determined whether molecules
other than STAT-1 exhibited antiviral effects at the level of the
infected cell. Primary BMM.PHI. from wt mice or mouse strains
deficient in STAT-1, IFN.alpha..beta.R, IFN.gamma.R,
IFN.alpha..beta..gamma.R, iNOS, or PKR were directly compared for
their ability to support virus replication at two different
multiplicities of infection (MOIs) (FIG. 20, Panel B). Again,
BMM.PHI. cells from both wt and STAT1-/- mice supported MNV-1 virus
replication, with higher titers observed in cells deficient in
STAT-1. Cells obtained from mice lacking both Type I and II IFNR
(IFN.alpha..beta..gamma.R-/-) or Type I IFNR alone
(IFN.alpha..beta.R-/-) supported replication of virus as
efficiently as STAT1-/- cells. In addition, wt BMM.PHI. and wt
BMDCs secrete IFN.alpha. after MNV-1-infection, as determined by
IFN.alpha. enzyme-linked immunosorbent assay (ELISA) (data not
shown). This is consistent with a direct role for IFN signaling in
MNV-1 growth but does not rule out the possibility that effects of
STAT-1 and IFN.alpha..beta.R occur in vivo prior to explantation of
the bone marrow. Absence of IFN.gamma.R, iNOS, or PKR did not have
a statistically significant effect on MNV-1 growth in BMM.PHI..
Together, these data demonstrate that the antiviral molecules
STAT-1 and IFN.alpha..beta. are part of a cellular response that
limits norovirus growth.
EXAMPLE 54
[0330] This example illustrates characterization of Plaque-Purified
Strain MNV-1.CW1 In Vivo
[0331] In these experiments, to address the effects of cell culture
adaptation on virulence, STAT1-/- mice were infected orally with
MNV-1.CW1 from three successive passages (P1, P2, and P3) (FIG. 20,
Panel A). Oral administration of MNV-1.CW1 (P1) resulted in lethal
infection, similar to that previously reported for the parental
MNV-1 brain tissue stock (Karst et al., Science 299: 1575-1578,
2003). These data fulfill a Koch's postulate with regard to MNV-1
infection and are consistent with the identification of MNV-1 as
the infectious agent that was passaged in animals in our initial
studies (Karst et al., Science 299: 1575-1578, 2003). In contrast,
MNV-1.CW1 (P3) failed to cause a lethal infection in STAT1-/- mice
after oral inoculation, even when administered a dose of
1.5.times.106 plaque-forming units (pfu), 5,000 times greater than
the lethal dose for P1. In addition, immunohistochemical analysis
of sectioned spleen and liver from STAT1-/- mice infected orally
with 1.5.times.106 pfu of MNV-1.CW1 (P3) did not reveal any
MNV-1-specific staining, unlike the parental virus (see FIG. 18,
data not shown). This striking difference in virulence and decrease
of viral antigen in infected mice, coupled with an intermediate
lethality phenotype of the MNV-1.CW1 (P2) virus, show that serial
passage of the virus in cell culture can attenuate MNV-1 virulence
in vivo.
[0332] FIG. 21 illustrates that changes in virulence of
plaque-purified MNV-1 over multiple passages are associated with
limited amino acid changes.
[0333] Panel 21, Panel A illustrates that serial passage of
MNV-1.CW1 in cell culture causes attenuation. In these experiments,
STAT1-/- mice were infected orally with the indicated virus dose.
The number of mice analyzed is indicated in parentheses.
[0334] Panel 21, Panel B presents a summary of sequence analysis of
MNV-1 over several passages. The nucleotide and amino acid
differences between the indicated viruses are shown (for details
see Table 1).
EXAMPLE 55
[0335] This example illustrates molecular analysis of serially
passaged MNV-1.CW1
[0336] In these experiments, consensus sequence analysis was
performed on the RNA genome of MNV-1 present in the original brain
tissue stock (parental virus), and in viruses from each subsequent
cell culture passage of MNV-1.CW1 (P1 through P3) to examine the
molecular basis for the attenuation (FIG. 21, Panel B; Table 1).
The analysis reveals that three nucleotide changes occurred between
the parental virus and PI, with one of these resulting in an amino
acid substitution (histidine to arginine) at residue 845, located
within the predicted "3A-like" region of the nonstructural
polyprotein. In the P2 virus, which retained virulence but at a
reduced level compared to the parental and P1 viruses, a second
nucleotide substitution within the predicted "3A-like" coding
region was observed that caused an amino acid change (valine to
isoleucine) at residue 716. The partial attenuation of virulence of
the P2 virus in vivo is of interest since the homologous protein in
poliovirus, the 3A protein, alters the amount of cytokines secreted
from cells, with likely effects on viral pathogenesis (Dodd et al.,
J Virol 75: 8158-8165, 2001). Of note, a mixed population of A and
G nucleotides was detected at position 5,941 of the P2 viral genome
that could potentially yield two populations of virus with either
amino acid lysine or glutamic acid at residue 296 of the capsid
protein. In the P3 virus, which was avirulent in mice, the G
nucleotide sequence at position 5,941 emerged as the predominant
sequence. These experiments illustrate that nucleotide changes can
account for the differences in virulence of serially-passaged MNV
virus. TABLE-US-00003 TABLE 1 Open Genomic Reading Position of
Position of Parental MNV-1.CW1 MNV-1.CW1 MNV-1.CW1 Frame (ORF)
Nucleotide Amino Acid MNV-1 (P1) (P2) (P3) ORF1 581 192 CAA/CAT
(Gln/His) CAT CAT CAT 986 327 GTA/GTG (Val) GTG GTG GTG 1,283 426
CTG/CTA (Leu) CTG CTG CTG 1,556 517 CTA (Leu CTG CTG CTG 2,151 716
GTC (Val) GTC ATC (Val.fwdarw.Ile) ATC 2,539 845 CAT (His) CGT
(His.fwdarw.Arg) CGT CGT 2,816 937 GAC/GAT (Asp) GAT GAT GAT 2,996
997 GTT/GTC (Val) GTC GTC GTC 3,902 1,299 AGT/AGC (Ser) AGT AGT AGT
4,322 1,439 GGC/GGT (Gly) GGC GGC GGC ORF2 5,262 69 ATT/ATC (Ile)
ATC ATC ATC 5,466 137 ACC/ACT (Thr) ACT ACT ACT 5,941 296 AAG (Lys)
AAG AAG/GAG (Lys.fwdarw.Lys/Glu) GAG (Lys.fwdarw.Glu) ORF3 6,770 30
AAC (Asn) AAT AAT AAT Nucleotides are numbered according to
consensus sequence of the parental MNV-1 virus genome (in brain
tissue slock) as follows: ORF1 (nt 6-5,069), ORF2 (nt 5,056-6,681),
and ORF3 (nt 6,681-7,307), encoding a large polyprotein (viral
nonstructural proteins), VP1 (major capsid structural protein), and
VP2 (minor capsid structural protein), respectively. Amino acid
residues are numbered according to location in the corresponding
ORF. # The nucleotide position of interest is underlined and its
location in the codon of the translated ORF is shown. Sequence
heterogeneity at a particular residue was determined from the
sequence chromatogram, and the data shown represent direct sequence
analysis of PCR-amplified cDNA products. A change in deduced amino
acid sequence from the previous passage is indicated in
parentheses. DOI: 10.1371/journal.pbio>.0020432.t001
[0337]
Sequence CWU 1
1
35 1 7382 RNA Mouse norovirus 1 gugaauucua gaaggcaacg ccaucuucug
cgcccucugu gcgcaacaca gagaaacgca 60 aaaacaagaa ggcuucgycu
aaagcuagug ucuccuuugg agcaccuagc ccccucucuu 120 cggagagcga
agacgaaruu aauuacauga ccccuccuga gcaggaagcu cagcccggcg 180
cccuugcggc ccuucaugcg gaagggccgc uugccgggcu ccccgugacg cguagugaug
240 cacgcgugcu gaucuucaau gagugggagg agaggaagaa gucugauccg
uggcuacggc 300 uggacauguc ugauaaggcu aucuuccgcc guuaccccca
ucugcggccu aaggaggaua 360 ggccugacgc gcccucccau gcggaggacg
cuauggaugc caaggagccu gugaucggcu 420 cuaucuugga gcaggaugau
cacaaguuuu accauuacuc ugucuacauc gguggcggcc 480 uugugauggg
ggucaacaac cccagugcug cggucugcca ggcaacgauu gauguggaga 540
agcuacaccu cugguggcgg ccugucuggg agccccgcca wccccuugac ucggcugagu
600 ugaggaagug cgugggcaug acuguccccu acguggccac caccgucaac
uguuaucagg 660 ucugcugcug gauuguuggc aucaaggaca ccuggcugaa
gagggcgaag aucucuagag 720 aucugcccuu cuacagcccc guccaggacu
ggaacgucga cccccaggag cccuucauuc 780 cauccaagcu caggaugguc
ucggauggca uccugguggc cuugucggca gugauuggcc 840 ggccaauuaa
gaaccuacug gccucaguua agccgcucaa cauucucaac aucgugcuga 900
gcugugauug gaccuuuucg ggcauuguca augcccugau cuugcuugcu gagcucuuug
960 acaucuuuug gacccccccu gauguracca rcuggaugau cucuaucuuc
ggggaauggc 1020 aggccgaagg gcccuucgac cyugcucuug acguggugcc
cacccuguug ggcgggaucg 1080 ggauggcuuu uggccucrcc ucugagacca
ucgggcgcaa gcucdcuucc accaacucgg 1140 cucucaaggc cgcccaagag
augggcaagu ucgccauaga ggucuucaag caaauuaugg 1200 ccuggaucug
gcccucugag gacccagugc cagcccucuu auccaacaug gagcaggcca 1260
ucauuaagaa ugagugucaa cudgagaacc aacucacggc cauguugcgg gaucgcaacg
1320 caggggcuga auuccuvagg ucccuugaug aggaggagca ggaaguccgc
aagaucgcag 1380 cuaagugcgg caacucggcc accacuggaa ccaccaacgc
ucugcuggcc aggaucagca 1440 uggcccgcgc ggccuuugag aaagcucgcg
cugaacagac cucccgaguc cgcccugugg 1500 ugducauggu cucaggcagg
cccgggaucg ggaaaaccug cuuuugccaa aaccuagcca 1560 agaggauugc
ugcgucccug ggugaugaga ccucuguugg caucauacca cgcgcugaug 1620
ucgaccacug ggaugcuuac aagggagcca gagugguucu cugggaugau uucggcaugg
1680 acaacguggu gaaggaugca cugaggcuuc agaugcuugc cgacacgugc
ccagugacac 1740 ucaauuguga caggauugag aacaagggaa agaugyuuga
cucucagguc auuaucauca 1800 ccacaaauca acaaaccccc gygccccugg
acuaugucaa ccuggaggcg gucugccgcc 1860 gcauagauuu ccugguuuau
gmugagagcc cuguuguuga ugaugcucgg gccagagccc 1920 cuggcgaugu
gaaugcagug aaagcugcca ugaggcccga uuacagccac aucaauuuca 1980
ucuuggcacc gcagggcggc uuugaccguc gggaaacacc cccuacggua agggcgucac
2040 caagaucauu ggcgccacug cucuuugcgc gagagcgguu gcucuugucc
augagcgcca 2100 ugaugauuuc ggccuccaga acaaggucya ugacuuugau
gcgcgcaarg ucaccgccuu 2160 caaagccaug gcggcugacg ccggcauucc
augguacaaa auggcagcua uugggugcaa 2220 agcaaugggg gugcaccugu
guagaggagg ccaugcauuu acuuaaggau uaugaggugg 2280 cucccuguca
ggugaucuac aauggugcca ccuauaaugu gagcugcauc aagggugccc 2340
caaugguuga aaaggucaag gagccugaau ugcccaaaac acuugucaac ugugucagaa
2400 ggauaaagga ggcccgccuc cgcugcuacu guaggauggc ugcugacguc
aucacgucca 2460 uucugcaggc ggccggcacg gccuucucua uuuaccacca
gauugagaag aggucuagac 2520 cauccuuuua uugggaucau ggauacaccu
accgugacgg accuggaucc uuugacaucu 2580 uugaggauga cgaugauggg
ugguaccacu cugagggaaa gaagggcaag aacaagaagg 2640 gccgggggcg
acccggaguc uucagaaccc gugggcucac ggaugaggag uacgaugaau 2700
ucaagaagcg ccgcgagucu aggggcggca aguacuccau ugaugauuac cucgcugrcc
2760 gcgagcgaga agaagaacuc cuggagcggg acgaggagga ggcuaucuuc
ggggayggcu 2820 ucggguugaa ggccacccgc cguucccgca aggcagagag
agccaaacug ggccugguuu 2880 cugguggcga cauccgcgcc cgcaagccga
ucgacuggaa ugugguuggc cccuccuggg 2940 cugacgauga ccgccagguc
gcuacggcga gaagaucaac uuugaggccc caguyuccau 3000 cuggucccgu
guugugcagu ucggcacggg guggggcuuu uggggugagc ggccacgucu 3060
ucaucaccgc caagcaugug gcgcccccca agggcacgga gaucuuuggg cgcaagcccg
3120 gggacuucac ugucrcuucc agcggggacu ucuugaagua cuacuucacc
agcgccguca 3180 ggccugacru ucccgccaug guccuggaga augggugcca
ggagggcguc gucgccucgg 3240 uccuugucaa gagagccucc ggcgagaugc
uugcccuggc ugucaggaug gguucacagg 3300 ccgccaucaa gauugguagu
gccguugugc augggcaaac uggcaugcuc cugacuggcu 3360 cuaaugccaa
ggcccaggac cucgggacca ucccgggcga cuguggcugu cccuauguuu 3420
auaagaaggg uaacaccugg guugugauug gggugcacgu ggcggccacu aggucuggua
3480 acacagucau ugccgccacu cacggagaac ccacacuuga ggcucuggag
uuccagggac 3540 cccccaugcu uccccgcccc ucaggcaccu augcaggccu
ccccaucgcc gauuacggcg 3600 acgcuccccc cuugagcacc aagaccaugu
ucuggcguac cucgccagag aagcuucccc 3660 cuggggcuug ggagccagcc
uaucucggcu cuaaagauga gaggguggac gguccuuccc 3720 uucagcaggu
caugcgagau cagcuuaagc ccuauucaga accacgcggu cugcuucccc 3780
cucaagaaau ccuugaugca gucugcgacg ccauugagaa ccgccuugag aacacccuug
3840 aaccacagaa gcccuggaca uuuaagaagg cuugugagag cuuggacaag
aacaccagya 3900 gyggguaucc cuaucacaag cagaagagca aggacuggac
ggggagcgcu uuuauuggcg 3960 rucuugguga ccaggccacc cacgccaaca
acauguauga gauggguaaa uccaugcgac 4020 ccauuuauac agcugcccuc
aaggaugaac ugguuaagcc agacaagauc uacgggaaga 4080 uaaagaagag
gcuucucugg ggcucugacc uugrcaccau gauucgcgcu gcccgugcyu 4140
uuggcccuuu cugugaugcu cugaaagaar ccugcauuuu caaccccauc agagugggca
4200 ugucgaugaa cgaagauggc cccuucaucu ucgcaagaca cgccaauuuc
agguaccaca 4260 uggaugcuga cuauaccagg ugggacucca cccaacagag
agccauccua aagcgcgcug 4320 gygacaucau ggygcgccuc uccccugagc
cagacuuggc ucggguuguc auggaugauc 4380 uccuggcccc cucgcuguug
gacgucggcg acuruaagau cguugucgag gaggggcucc 4440 cauccggcug
cccuugcacc acacagcuga auaguuuggc ucacuggauu uugacccuuu 4500
gugcaauggu ugagguaacc cgaguugacc cugacauugu gaugcaagaa ucugaguuyu
4560 ccuucuaugg ugaugacgag gugguuucga ccaaccucga guuggauaug
guuaaguaca 4620 ccauggcuuu gaggcgguac ggucuccucc cgacucgcgc
ggacaaggag gagggaccuc 4680 uggagcgucg ccagacgcug cagggcaucu
ccuuccugcg ccgugcgaua guuggugacc 4740 aguuugggug guacggucgu
cuugaucgug ccagcaucga ccgccagcuc cucuggacua 4800 aaggaccuaa
ccaccagaac cccuuugaga cucucccugg acaugcucag agacccuccc 4860
aacuaauggc ccugcucggu gaggcugcca ugcaugguga aaaguauuac aggacugugg
4920 cuucccgugu cuccaaggag gccgcccaaa gugggauara aaugguaguc
cccacgccac 4980 cgaucuguuu ugcgcugggu gcgcuuugga aaauggaugc
ugagaccccg caggaacgcu 5040 cagcagucuu ugugaaugag gaugagugau
ggcgcagcgc caaaagccaa uggcucugag 5100 gccagcggcc aggaucuugu
uccugccgcc guugaacagg ccguccccay ucaacccgug 5160 gcuggcgcgg
cucuugccgc ccccgccgcc gggcaaauua accaaauugr ccccuggauc 5220
uuccaaaauu uuguccagug cccccuuggu gaguuuucca uuucgccucg aaacacccca
5280 ggugaaauac uguuugauuu ggcccucggg ccagggcuua accccuaccu
ugcccaccuc 5340 ucagccaugu acaccggcug gguugggaac ruggagguuc
agcugguccu cgccggcaau 5400 gccuuuacug cuggcaaggu gguuguugcc
cuuguaccac ccuauuuucc caagggguca 5460 cucaccacug cccagaucac
augcuuccca caugucaugu gugaugugcg cacccuggag 5520 cccauucaac
ucccucuucu ugaugugcgu cgaguccuuu ggcaugcuac ccaggaucaa 5580
gaggaaucua ugcgccuggu uugcaugcug uacacgccac uccgcacaaa cagcccgggu
5640 gaugagucuu uuguggucuc uggccgccuu cuuucuaagc cggcggcuga
uuucaauuuu 5700 gucuaccuaa cuccccccau agagagaacc aucuaccgga
uggucgacuu gcccgugaua 5760 cagccgcggc ugugcacgca cgcacguugg
ccugccccgg ucuauggucu cuugguggac 5820 ccaucccucc ccucaaaucc
ccaguggcag aauggaaggg ugcacguuga ugggacccug 5880 cuugguacca
ccccaaucuc cgguucaugg guguccugcu uugcgkcgga ggcugccuau 5940
aaguuccaau cgggcaccgg ugagguggcg acauucaccc ugauugagca ggauggaucu
6000 gccuacgucc ccggugacag ggcagcacca cucggguuac cccgauuucu
cugggcaacu 6060 ggagaucgag guccagaccg agaccaccaa gacuggagac
aagcucaagg ucaccacuuu 6120 gagaugauuc uuggcccaac gaccaacgcg
gaccaggccc ccuaccaggg caggguguuc 6180 gccagcguca cugcugcggc
cucucuugac uugguggaug gcaggguucg ugcgguccca 6240 agauccaucu
acgguuuuca ggacaccauc ccugaauaca acgaugggcu acugguuccc 6300
cuugcccccc caauuggucc cuuucucccc ggcgaggucc uccugagguu ccggaccuac
6360 augcgucaga ucgacaccgc ugacgccgca gcagaggcga uagacugugc
acucccccag 6420 gaguuugucu ccugguucgc gucuaacgcg uucaccgugc
aguccgaggc ccugcuccuu 6480 agauacagga acacccugac ugggcaacug
cuguucgagu gcaagcucua caacgaaggu 6540 uacaucgccu ugucuuauuc
cggcucagga ccccucaccu ucccgaccga uggcaucuuu 6600 gaggucguca
guuggguucc ucgccuuuac caauuggccu cugugggaag uuuggcaaca 6660
ggccgaaugc ucaaacaaua auggcuggug cucuuuuugg agcgauugga gguggccuga
6720 ugggcauaau uggcaauucc aucucaaaug uucaaaaccu ucaggcaaac
aaacaauugg 6780 cagcucagca auuugguuau aauucuuccc ugcuugcaac
gcaaauucaa gcccagaagg 6840 aucucacucu gauggggcag caauucaacc
agcagcucca aaccaacucu uucaagcacg 6900 acuuggaaau gcuuggcgcu
caggugcaag cccaggcgca ggcccaggag aacgccauca 6960 auaucaaaac
ggcgcagcuc caggccgcag gcuuuucaaa gacagaugcc acacgccuug 7020
ccuuggggca gcagcccacg agggccgugg auuggucugg gacgcgguac uacaccgcua
7080 accagccagu cacgggcuuc ucggguggcu uuaccccaac cuacacucca
gguaggcaag 7140 ugacaucccg cccuguggac acauccccuc uaccgaucuc
ggguggacgc uugcccuccc 7200 uucguggagg uuccuggucc ccgcgcgacc
auacgccggc gacucaaggc accuacacga 7260 acggacgguu cgugucucuc
ccuaagaucg ggaguagcag ggcauagguu ggaagagaaa 7320 ccuuuuguga
aaaugauuuc ugcuuacugc uuucuuuucu uugugguagu uagaugcauu 7380 uc 7382
2 9 DNA Mouse norovirus 2 gtgaaatga 9 3 11 DNA Mouse norovirus 3
gtgaaatgag g 11 4 9 DNA Mouse norovirus 4 taccgatct 9 5 14 DNA
Mouse norovirus 5 ctaccgatct cggg 14 6 18 DNA Mouse norovirus 6
gtgaaatgag gtaccgat 18 7 9 DNA Mouse norovirus 7 taccgatcg 9 8 9
DNA Mouse norovirus 8 gtgaaatga 9 9 47 DNA Mouse norovirus 9
atcaatatca aaacggcgca gctccaggcc gcaggctttt caaagac 47 10 10 DNA
Mouse norovirus 10 gtgaaatgag 10 11 213 DNA Mouse norovirus 11
cagctccagg ccgcaggctt ttcaaagacg gatgccgcac gccttgcctt ggggcagcag
60 cccacgaggg ccgtggattg gtctgggacg cggtactaca ccgctaacca
gccagtcacg 120 ggcttctcgg gtggctttac cccaacctac actccaggta
ggcaagtgac atcccgccct 180 gtggacacat cccctctacc gatctgtgaa atg 213
12 203 DNA Mouse norovirus 12 ccgcaggctt ttcaaagacg gatgccgcac
gccttgcctt ggggcagcag cccacgaggg 60 ccgtggattg gtctgggacg
cggtactaca ccgctaacca gccagtcacg ggcttctcgg 120 gtggctttac
cccaacctac actccaggta ggcaagtgac atcccgccct gtggacacat 180
cccctctacc gatctgtgaa atg 203 13 193 DNA Mouse norovirus 13
ttcaaagacg gatgccgcac gccttgcctt ggggcagcag cccacgaggg ccgtggattg
60 gtctgggacg cggtactaca ccgctaacca gccagtcacg ggcttctcgg
gtggctttac 120 cccaacctac actccaggta ggcaagtgac atcccgccct
gtggacacat cccctctacc 180 gatctgtgaa atg 193 14 183 DNA Mouse
norovirus 14 gatgccgcac gccttgcctt ggggcagcag cccacgaggg ccgtggattg
gtctgggacg 60 cggtactaca ccgctaacca gccagtcacg ggcttctcgg
gtggctttac cccaacctac 120 actccaggta ggcaagtgac atcccgccct
gtggacacat cccctctacc gatctgtgaa 180 atg 183 15 173 DNA Mouse
norovirus 15 gccttgcctt ggggcagcag cccacgaggg ccgtggattg gtctgggacg
cggtactaca 60 ccgctaacca gccagtcacg ggcttctcgg gtggctttac
cccaacctac actccaggta 120 ggcaagtgac atcccgccct gtggacacat
cccctctacc gatctgtgaa atg 173 16 163 DNA Mouse norovirus 16
ggggcagcag cccacgaggg ccgtggattg gtctgggacg cggtactaca ccgctaacca
60 gccagtcacg ggcttctcgg gtggctttac cccaacctac actccaggta
ggcaagtgac 120 atcccgccct gtggacacat cccctctacc gatctgtgaa atg 163
17 153 DNA Mouse norovirus 17 cccacgaggg ccgtggattg gtctgggacg
cggtactaca ccgctaacca gccagtcacg 60 ggcttctcgg gtggctttac
cccaacctac actccaggta ggcaagtgac atcccgccct 120 gtggacacat
cccctctacc gatctgtgaa atg 153 18 143 DNA Mouse norovirus 18
ccgtggattg gtctgggacg cggtactaca ccgctaacca gccagtcacg ggcttctcgg
60 gtggctttac cccaacctac actccaggta ggcaagtgac atcccgccct
gtggacacat 120 cccctctacc gatctgtgaa atg 143 19 133 DNA Mouse
norovirus 19 gtctgggacg cggtactaca ccgctaacca gccagtcacg ggcttctcgg
gtggctttac 60 cccaacctac actccaggta ggcaagtgac atcccgccct
gtggacacat cccctctacc 120 gatctgtgaa atg 133 20 123 DNA Mouse
norovirus 20 cggtactaca ccgctaacca gccagtcacg ggcttctcgg gtggctttac
cccaacctac 60 actccaggta ggcaagtgac atcccgccct gtggacacat
cccctctacc gatctgtgaa 120 atg 123 21 113 DNA Mouse norovirus 21
ccgctaacca gccagtcacg ggcttctcgg gtggctttac cccaacctac actccaggta
60 ggcaagtgac atcccgccct gtggacacat cccctctacc gatctgtgaa atg 113
22 103 DNA Mouse norovirus 22 gccagtcacg ggcttctcgg gtggctttac
cccaacctac actccaggta ggcaagtgac 60 atcccgccct gtggacacat
cccctctacc gatctgtgaa atg 103 23 93 DNA Mouse norovirus 23
ggcttctcgg gtggctttac cccaacctac actccaggta ggcaagtgac atcccgccct
60 gtggacacat cccctctacc gatctgtgaa atg 93 24 83 DNA Mouse
norovirus 24 gtggctttac cccaacctac actccaggta ggcaagtgac atcccgccct
gtggacacat 60 cccctctacc gatctgtgaa atg 83 25 73 DNA Mouse
norovirus 25 cccaacctac actccaggta ggcaagtgac atcccgccct gtggacacat
cccctctacc 60 gatctgtgaa atg 73 26 63 DNA Mouse norovirus 26
actccaggta ggcaagtgac atcccgccct gtggacacat cccctctacc gatctgtgaa
60 atg 63 27 53 DNA RNA virus 27 ggcaagtgac atcccgccct gtggacacat
cccctctacc gatctgtgaa atg 53 28 33 DNA Mouse norovirus 28
gtggacacat cccctctacc gatctgtgaa atg 33 29 93 DNA Mouse norovirus
29 tagtccccac gccaccgatc tgttttgcgc tgggtgcgct ttggaaaatg
gatgctgaga 60 ccccgcagga acgctcagca gtctttgtga atg 93 30 93 DNA
Mouse norovirus 30 tagtccccac gccaccgatc tgttttgcgc tgggtgcgct
ttggaaaatg gatgctgaga 60 ccccgcagga acgctcagca gtctttgtga atg 93 31
83 DNA Mouse norovirus 31 gccaccgatc tgttttgcgc tgggtgcgct
ttggaaaatg gatgctgaga ccccgcagga 60 acgctcagca gtctttgtga atg 83 32
73 DNA Mouse norovirus 32 tgttttgcgc tgggtgcgct ttggaaaatg
gatgctgaga ccccgcagga acgctcagca 60 gtctttgtga atg 73 33 63 DNA
Mouse norovirus 33 tgggtgcgct ttggaaaatg gatgctgaga ccccgcagga
acgctcagca gtctttgtga 60 atg 63 34 53 DNA Mouse norovirus 34
ttggaaaatg gatgctgaga ccccgcagga acgctcagca gtctttgtga atg 53 35 43
DNA Mouse norovirus 35 gatgctgaga ccccgcagga acgctcagca gtctttgtga
atg 43
* * * * *