U.S. patent application number 11/165930 was filed with the patent office on 2006-01-05 for mesoderm and definitive endoderm cell populations.
Invention is credited to Paul Gadue, Gordon Keller.
Application Number | 20060003446 11/165930 |
Document ID | / |
Family ID | 37595867 |
Filed Date | 2006-01-05 |
United States Patent
Application |
20060003446 |
Kind Code |
A1 |
Keller; Gordon ; et
al. |
January 5, 2006 |
Mesoderm and definitive endoderm cell populations
Abstract
The present invention provides cell populations that are
enriched for mesendoderm and mesoderm, and cell populations that
are enriched for endoderm. The cell populations of the invention
are useful for generating cells for cell replacement therapy.
Inventors: |
Keller; Gordon; (New York,
NY) ; Gadue; Paul; (New York, NY) |
Correspondence
Address: |
Janet M. MacLeod;DORSEY & WHITNEY LLP
Intellectual Property Department
250 Park Avneue
New York
NY
10177
US
|
Family ID: |
37595867 |
Appl. No.: |
11/165930 |
Filed: |
June 24, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10514759 |
|
|
|
|
PCT/US03/15658 |
May 19, 2003 |
|
|
|
11165930 |
Jun 24, 2005 |
|
|
|
60381617 |
May 17, 2002 |
|
|
|
60444851 |
Feb 4, 2003 |
|
|
|
Current U.S.
Class: |
435/366 |
Current CPC
Class: |
A61P 7/00 20180101; C12N
2506/02 20130101; C12N 2501/40 20130101; C12N 2501/148 20130101;
C12N 2501/12 20130101; C12N 5/0607 20130101; C12N 2501/415
20130101; C12N 2501/385 20130101; C12N 2501/11 20130101; C12N
5/0606 20130101; C12N 5/0603 20130101; C12N 2506/03 20130101; A61P
1/16 20180101; A61P 21/00 20180101; A61P 3/10 20180101; C12N 5/067
20130101; C12N 2501/155 20130101; C12N 2501/16 20130101; A61P 19/00
20180101; C12N 2500/90 20130101; C12N 2501/115 20130101; A61P 9/00
20180101 |
Class at
Publication: |
435/366 |
International
Class: |
C12N 5/08 20060101
C12N005/08 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under Grant
Nos. 2RO1 HL 48834-09 and 2RO1 HL 65169-02 awarded by the National
Institutes of Health. The government may have certain rights in the
invention.
Claims
1. A method of making a cell population enriched for endoderm cells
comprising culturing embryonic stem cells in the absence of serum
and the presence of activin and Wnt for about one to about six
days, isolating brach.sup.+/HNF3.beta..sup.+ cells, a culturing
said isolated cells in the absence of serum and the presence of
activin and an inhibitor of Wnt signalling for at least about one
day.
2. The method of claim 1 wherein the embryonic stem cells are human
embryonic stem cells.
3. The method of claim 1 wherein Wnt is Wnt 3d.
4. The method of claim 1 wherein the inhibitor of Wnt signalling is
DKK-1.
5. The method of claim 1 wherein activin is present at a
concentration of at least about 30 ng/ml.
6. A method of making a cell population enriched for endoderm cells
comprising culturing human embryonic stem cells in the presence of
serum for about two to about ten days, isolating
brach.sup.+/HNF3.beta..sup.+ cells, and culturing said
brach.sup.+/HNF3.beta..sup.+ cells in the absence of serum and the
presence of activin and an inhibitor of Wnt signalling for at least
about one day.
7. The method of claim 6 wherein the concentration of activin is at
least about 30 ng/ml.
8. The method of claim 6 wherein the concentration of activin is
about 100 ng/ml.
9. The method of claim 6 wherein the inhibitor of Wnt signalling is
DKK-1.
10. The method of claim 9 wherein the concentration of DKK-1 is at
least about 30 ng/ml.
11. An embryonic stem cell in which a nucleic acid encoding a
selectable marker is present in the HNF3.beta. locus.
12. The stem cell of claim 11 in which the selectable marker is
human CD4.
13. The stem cell of claim 11 in which a second nucleic acid
encoding a second selectable marker is present in the brachury
locus.
14. The stem cell of claim 13 in which the second selectable marker
is green fluorescent protein.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 10/514,759, the disclosure of which is
incorporated herein by reference, which is a 371 of PCT/US03/15658
filed May. 19, 2003 and which application claims the benefit of
U.S. application Ser. Nos. 60/381,617 filed May. 17, 2002 and
60/444,851 filed Feb. 4, 2003, the disclosures of which are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] During embryonic development, the tissues of the body are
formed from three major cell populations: ectoderm, mesoderm and
definitive endoderm. These cell populations, also known as primary
germ cell layers, are formed through a process known as
gastrulation. Following gastrulation, each primary germ cell layer
generates a specific set of cell populations and tissues. Mesoderm
gives rise to blood cells, endothelial cells, cardiac and skeletal
muscle, and adipocytes. Definitive endoderm generates liver,
pancreas and lung. Ectoderm gives rise to the nervous system, skin
and adrenal tissues.
[0004] The process of tissue development from these germ cell
layers involves multiple differentiation steps, reflecting complex
molecular changes. With respect to mesoderm and its derivatives,
three distinct stages have been defined. The first is the induction
of mesoderm from cells within a structure known as the epiblast.
The newly formed mesoderm, also known as nascent mesoderm, migrates
to different positions that will be sites of future tissue
development in the early embryo. This process, known as patterning,
entails some molecular changes that are likely reflective of the
initial stages of differentiation towards specific tissues. The
final stage, known as specification, involves the generation of
distinct tissues from the patterned mesodermal subpopulations.
Recent studies have provided evidence which suggests that mesoderm
is induced in successive waves which represent subpopulations with
distinct developmental potential. The mesoderm that is formed first
migrates to the extraembryonic region and gives rise to
hematopoietic and endothelial cells, whereas the next population
migrates anteriorly in the developing embryo and contributes to the
heart and cranial mesenchyme. These lineage relationships were
defined initially through histological analysis and have been
largely confirmed by cell tracing studies. While this segregation
of developmental fates is well accepted in the field of
developmental biology, to date, there are no available methods of
isolating mesoderm and endoderm, prior to commitment to these
lineages.
[0005] The present invention provides a method for isolating
mesoderm and definitive endoderm cell populations. These cell
populations are useful to identify agents that affect cell growth
and differentiation, to identify genes involved in tissue
development, and to generate differentiated cells and tissues for
cell replacement therapies.
SUMMARY OF THE INVENTION
[0006] The present invention provides cell populations that are
enriched for mesendoderm and mesoderm cells. Mesendoderm cells are
defined herein as cells that express brachyury (brach.sup.+) and
which, in the presence of differentiation-inducing conditions, are
capable of generating mesoderm and mesoderm derivatives including
cardiac and skeletal muscle, vascular smooth muscle, endothelium
and hematopoietic cells, and also are capable of generating
endoderm and endoderm derivatives including liver cells and
pancreatic cells. Mesoderm cells are defined herein as cells that
are brach.sup.+ and which, in the presence of differentiation
inducing conditions, are capable of generating cardiac and skeletal
muscle, vascular smooth muscle, endothelium and hematopoietic
cells, and are not capable of generating endoderm and endoderm
derivatives.
[0007] The present invention further provides cell populations that
are enriched for endoderm cells. Endoderm cells are defined herein
as cells that do not express brachyury (brach.sup.-) and which, in
the presence of differentiation-inducing conditions, are capable of
generating lung cells, liver cells and pancreatic cells.
[0008] The present invention also provides methods of isolating
cell populations enriched for mesendoderm and mesoderm cells, and
cell populations enriched for endoderm cells.
[0009] In another embodiment, the present invention provides
methods of identifying agents that affect the proliferation,
differentiation or survival of the cell populations of the
invention. A method of identifying genes involved in cell
differentiation and development of specific lineages and tissues is
also provided.
[0010] Antibodies that specifically recognize brach.sup.+ cells are
also provided. The antibodies are useful, for example, for
isolating mesendoderm and mesoderm cell populations.
[0011] In another embodiment, the present invention provides a
method for generating cells in vitro. Such cells are useful, for
example, for cell replacement therapy.
[0012] The present invention also provides a transgenic non-human
mammal having a genome in which DNA encoding a selectable marker is
present in the brachyury locus such that one brachyury allele is
inactivated and the selectable marker is expressed in cells in
which the brachyury locus is transcribed.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 depicts the scheme of the vector and the strategy
used for targeting the green fluorescence protein (GFP) to the
brachyury locus.
[0014] FIGS. 2A and 2B depict the expression of GFP and brachyury
in developing embryoid bodies (EBs). FIG. 2A depicts the kinetics
of brachyury expression determined by reverse
transcriptase-polymerase chain reaction (RT-PCR). FIG. 2B depicts
the kinetics of GFP expression determined by fluorescence activated
cell sorting (FACS) analysis. Numbers above the figure in FIG. 2A
and the histograms in FIG. 2B represent day of EB
differentiation.
[0015] FIGS. 3A-C depict the developmental potential of wild type
and GFP-Bry ES cells. FIG. 3A is a histogram showing developmental
potential of day 6 EBs. (Mac/Ery: colonies of macrophages and
definitive erythroid cells; Mac: pure macrophage colonies;
Ery.sup.d: colonies of definitive erythroid cells; Mix:
multilineage colonies; Ery.sup.p: primitive erythtoid colonies.
FIG. 3B is a histogram depicting blast colony-forming cell (BL-CFC)
potential of EBs. FIG. 3C shows gene expression patterns during EB
development for wild-type and GFP-Bry cells. Numbers at the top of
the lanes represent day of EB differentiation.
[0016] FIGS. 4A and 4B depict the gene expression profile of EB
fractions isolated on the basis of GFP. FIG. 4A shows the profile
of GFP expression in day 3.5 EBs. 1 and 2 represent the gates used
to isolate the GFP.sup.- and GFP.sup.+ fractions. FIG. 4B depicts
RT-PCR expression analysis of isolated fractions.
[0017] FIGS. 5A-C demonstrate the isolation and characterization of
GFP and Flk-1 populations. FIG. 5A depicts the profiles and gates
used to isolate the GFP.sup.-/Flk-1.sup.-, GFP.sup.+/Flk-1.sup.-
and GFP.sup.+/Flk-1.sup.+ fractions from day 3.0 and 3.5 EBs
Numbers next to the gates represent the three different
populations. FIG. 5B shows the Blast colony (Blast) and secondary
EB (2.degree.) potential of the different fractions. FIG. 5C shows
the expression analysis of the isolated fractions. Expression shown
in the top panel was evaluated using a polyA.sup.+ global
amplification PCR method described by Brady et al. (1990) Meth. In
Mol. And Cell Bio. 2:17-25. The data in the lower panels was
obtained by RT-PCR analysis using gene specific oligonucleotides.
Numbers on the top of each row indicate the cell population as
designated in FIG. 5A.
[0018] FIG. 6 depicts the expression of GFP and Flk-1 in isolated
day 3 EB-derived fractions. The top row shows the expression
profiles of the three fractions prior to culture (pre). The bottom
row indicates the profile of the same cell populations following 20
hours of culture (post). The numbers below each profile indicate
the BL-CFC and primitive erythroid (Ery.sup.P-CFC) potential
(precursors per 1.times.10.sup.5 cells plated) of each
population.
[0019] FIGS. 7A and 7B depict the BL-CFC potential and Flk-1
expression of the isolated cell populations prior to and following
culture. In FIG. 7A, the numbers on the bottom refer to the cell
population: 1 is the presort, 3 is the GFP.sup.+/Flk-1.sup.-
fraction and 4 is the GFP.sup.+/Flk-1.sup.+ fraction. Cells were
cultured for 20 hours, and the aggregates were then dissociated and
analyzed for BL-CFC. Data are shown for cells isolated from day 3,
3.5 and 4.0 EBs. In FIG. 7B, the top row represents
GFP.sup.+/Flk-1.sup.- cells isolated from day 3.0, 3.5 and 4.0 EBs
prior to culture (pre). The bottom row shows the Flk-1 expression
pattern of the same fraction, following culture (post). Numbers
above the bars represent the percentage of Flk-1.sup.+ cells.
[0020] FIGS. 8A and 8B demonstrate the effects of BMP-4 and fetal
calf serum (FCS) on the development of brachyury and Flk-1.sup.+
in/on day 3.0 EB derived cells under the conditions indicated at
the top of each histogram. FIG. 8B depicts expression of brachyury
and Flk-1 on cell populations generated from GFP.sup.+//Flk-1.sup.-
cells cultured for 20 hours under the indicated conditions.
[0021] FIG. 9 is a schematic model of mesoderm formation and
specification in EBs. FIG. 10 shows the expression of genes in EBs
in the presence and absence of serum.
[0022] FIG. 11 is a graph depicting brachyury expression in EBs
generated under different conditions. FIG. 13 is a schematic
diagram showing neuronal differentiation is the presence and
absence of serum.
[0023] FIG. 14 shows the expression of genes in EBs initiated for
two days in serum and then switched to serum free conditions.
[0024] FIG. 15 shows gene expression in EBs cultured in the
presence of bFGF.
[0025] FIG. 16 shows gene expression patterns in Bry.sup.+ and
Bry.sup.- cells cultured in the presence of bFGF.
[0026] FIG. 17 is a diagram of the mesoderm and endoderm
populations of the present invention and the differentiation of
these population to derivative cell types.
[0027] FIG. 18 depicts the kinetics of expression of GFP
(brachyury) and Flk-1 in EBs differentiated for 2.5, 3.0, 3.5 and
4.0 days. Arrows indicate the GFP.sup.+ population isolated used
for the analyses in subsequent studies.
[0028] FIG. 19 depicts the hemangioblast and cardiac potential of
the GFP.sup.+ populations isolated from the four stages of EB
differentiation. Cells from each stage were isolated by cell
sorting, reaggregated for 24 hours and analyzed for hematopoietic
and cardiac potential. Data are indicated as blast colonies
(hemangioblast) per 1.times.10.sup.5 cells recovered from the
reaggregation culture or as the % of aggregates that gave rise to
beating cell masses indicative of cardiac muscle
differentiation.
[0029] FIG. 20 provides the RT-PCR expression analysis of the
indicated genes in the four GFP.sup.+ EB-derived cells populations.
Numbers indicate day of EB differentiation.
[0030] FIG. 21 shows HNF3 .beta. expression in GFP.sup.+
populations isolated from day 3.0 and 4.0 EBs. Pre represents cells
prior to sorting, -/- are cells that express no GFP or Flk-1 and
+/- represents the GFP.sup.+ Flk-1.sup.- population.
[0031] FIGS. 22A-C demonstrate the effects of activin on
development of EBs in serum-free cultures. A) FACS profile showing
GFP expression in day 6 EBs differentiated in the presence of 100
ng/ml of activin. B) Kinetics of GFP induction in cultures
containing 100 ng/ml of activin. Open circles are EB differentiated
in the presence of activin, closed squares are EBs differentiated
in absence of activin. C) RT-PCR expression analysis of indicated
genes in day 6 EBs grown in the presence (+activin) or absence
(-activin) of activin. Numbers indicate day of EB
differentiation.
[0032] FIGS. 23A and B show the effects of different concentrations
of activin on the developmental potential of EBs. A) GFP expression
in day 7 EBs induced with different concentrations of activin. B)
RT-PCR expression analysis of day 7 EBs induced with different
concentrations of activin.
[0033] FIGS. 24A and B show the hematopoietic progenitor content of
EBs differentiated in the presence of different concentrations of
activin. A) Progenitor potential of day 7 EBs, Ep are primitive
erythroid progenitors, mac/mix represent definitive hematopoietic
progenitors. B) Progenitor potential of day 7 activin-induced EBs
following 2.5 days of exposure to serum.
[0034] FIG. 25 shows the development of albumin expressing cells
from GFP.sup.+ cells induced with ether 3 or 100 ng/ml of activin.
GFP.sup.+ and GFP.sup.- cells were isolated at day 6 of
differentiation and cultured for a further 8 days in the conditions
previously described to support hepatocyte differentiation.
[0035] FIGS. 26A and B depict three-week old renal grafts of
bry.sup.+ (FIG. 26A) and bry.sup.- (FIG. 26B) cell populations.
FIG. 26C depicts sections of grafts of the bry.sup.+ and bry.sup.-
populations.
[0036] FIG. 27A is a FACS profile indicating the
bry.sup.+/c-kit.sup.+ (+/+) and bry.sup.+/c-kit.sup.- (+/-)
fractions isolated from day three serum-stimulated EBs. Numbers
represent the proportion of cells in each of the fractions. FIG.
27B shows expression analysis of each of the fractions. Day 3
represents cells analyzed immediately following sorting. Day 15
represents cell populations cultured for 15 days in hepatocyte
conditions.
[0037] FIG. 28 depicts expression analysis of cell populations
derived from EBs induced with different concentrations of activin.
Numbers at the top of the figure indicate activin concentration.
Numbers at the bottom of the figure represent an estimate of the
proportion of EBs with skeletal muscle outgrowths.
[0038] FIGS. 30A and 30B depict the method used to target human CD4
(hCD4) into the HNF3.beta. locus. FIG. 30A depicts the scheme of
the vector and strategy used for targeting CD4. FIG. 30B shows the
southern blot of ES cell clones electroporated with the targeting
vector.
[0039] FIGS. 31A-C depict the expression of GFP, hCD4, Brachyury,
and HNF3.beta. in developing EBs induced with serum. FIG. 31 A
shows dot plots of GFP versus hCD4 expression determined by flow
cytometric analysis. FIG. 31B shows the mean fluorescence intensity
(MFI) of both GFP and hCD4 expression of the plots in part A. The
MFI is displayed as a percent of maximum detected during the time
course for each marker. FIG. 31C depicts the expression of
Brachyury and HNF3.beta. by RT PCR in the same samples used in part
A for flow cytometry.
[0040] FIGS. 32A-C depict gene expression in different GFP hCD4
expressing population as well as tissue dissected from the
primitive streak of mouse embryos. EBs were differentiated in serum
for 3.25 days and sorted by the expression of GFP and hCD4. FIG.
32A shows dot plots of GFP versus hCD4 expression before and after
cell sorting for these populations. GFP.sup.+ hCD4.sup.lo,
GFP.sup.+ hCD4.sup.med, and GFP+hCD4.sup.hi populations were sorted
to the purity indicated. FIG. 32B shows expression of genes by RT
PCR in the samples sorted in part A. FIG. 32C shows expression of
genes by RT PCR in tissue dissected from the primitive streak
dissected from day 7.25 embryos. Abbreviations used: Pre, presort;
ant, anterior primitive streak tissue; mid, middle primitive streak
tissue, pos, posterior primitive steak tissue.
[0041] FIG. 33A-C depict the developmental potential of different
GFP hCD4 expressing populations. EBs were differentiaited and cell
sorted as in FIG. 32. Only two populations were sorted, GFP.sup.+
hCD4.sup.lo and GFP+hCD4hi cells. After sorting, cells were
reaggregated in serum replacement containing medium for 2 days.
FIG. 33A shows cardiac potential of the sorted populations after
plating on matrigel another 24-48 hours. The percentage of EBs
containing beating cells was calculated. FIG. 33B shows
hematopoietic potential of the sorted populations determined by
plating in methycelluose with hematopoietic cytokines. FIG. 33C
shows expression of endodermal genes by RT PCR of the sorted
populations after plating on matrigel for an additional 5 days in
serum free media.
[0042] FIGS. 34A-C depict ES cells differentiated in serum free
conditions with Activin A Wnt3a and/or inhibitors of these
pathways. ES cells were cultured in serum free media for two days
then trypsinized to obtain a single cell population. These cells
were then reaggregated with the indicated conditions. At day six,
the EBs were plated on matrigel coated dishes in serum free media.
FIG. 34A shows dot plots of GFP versus hCD4 expression for days 3
through 6 with EBs that were reaggregated with media alone, Activin
A 25ng/ml, Wnt3a 100 ng/ml, or these stimulations plus either DKK1
100 ng/ml or SB-431542 6uM. FIG. 34B shows RT PCR gene expression
data from RNA obtained from cultures shown in FIG. 34A. FIG. 34C
shows RT PCR gene expression data from RNA obtained from EBs plated
on matrigel for an addition 6 days that had initially been
stimulated with media alone, Activin or Wnt3a as indicated
above.
[0043] FIGS. 35A and 35B depict the effects of DKK1 and activin on
EB differentiation. EBs differentiated and sorted as in FIG. 32 for
GFP.sup.+ hCD4.sup.med were allowed to reaggregate in serum
replacement containing media alone or with the addition of human
DKK1 100 ng/ml, activin 100 ng/ml, or both factors together. FIG.
35A shows histograms for hCD4 and GFP expression of the sorted
cells after 1 day reaggregation. FIG. 35B depicts endodermal gene
expression by RT PCR. The sorted populations were treated as
indicated above for 2 days, then plated on matrigel in serum free
media without factors added. Gene expression was analyzed an
additional 5 days after plating.
[0044] FIG. 29 depicts expression analysis of brachyury fractions
isolated from activin-induced populations. Numbers at the top of
the figure indicate activin concentration.
DETAILED DESCRIPTION OF THE INVENTION
[0045] During embryogenesis, the formation of mesoderm is a
critical step in the establishment of a body plan and in the
development of multiple organ systems such as blood, endothelium,
heart and skeletal muscle. The molecular mechanisms that control
mesoderm formation, however, are poorly defined. A model system
based upon the differentiation of embryonic stem (ES) cells in
culture has been used to study mesodermal-derived populations
including hematopoietic, endothelial, cardiac and skeletal muscle
and adipocyte lineages. The in vitro model supports the induction
and specification of mesoderm, but these differentiation events
take place in complex colonies known as embryoid bodies (EBs)
generated from ES cells. It would be advantageous to isolate
mesoderm cell populations from EBs as they are formed, in order to
better understand mesoderm formation and tissue development.
However, it has not been possible to isolate these populations by
cell sorting using antibodies, because antibodies specific for
nascent mesoderm cell populations are not well-defined.
[0046] Brachyury (also known as T) is the founding member of a
family of transcription factors known as T-box genes and was first
identified as a naturally occurring mutation in mice. Papaioannou
et al. (1998) Bioessays 20:9-19. Heterozygous mice are viable but
have a shorter tail than wild type animals. Homozygous mutants,
which die at approximately day 10 p.c., lack a notochord and
display defects in the development of posterior mesodermal tissues.
Through the analysis of chimeric animals, brachyury has been shown
to affect the migratory properties of the mesodermal cells. Wilson
et al. (1995) Development 121:877-86. Expression analysis revealed
a unique and interesting pattern for brachyury. It is expressed
transiently in all cells ingressing through the primitive streak as
well as in the nascent and early migrating mesoderm. Wilkinson et
al. (1990) Nature 343:657-9; Herrmann et al. (1991) Development
113:913-7. Expression is rapidly downregulated in paraxial, lateral
and extraembryonic mesoderm and following regression of the steak,
is confined to the tailbud and notochord. Given this pattern,
brachyury is considered to be one of the best markers of early
mesoderm and is used to track the development of this lineage.
Brachyury has been identified in all species analyzed, suggesting
that its role in mesoderm development is preserved throughout
phylogeny. Papaioannou et al. (1998).
[0047] In accordance with the present invention, a selectable
marker gene has been recombinantly targeted to the brachyury locus.
It has been discovered that, following the initiation of ES cell
differentiation, the selectable marker is expressed in a pattern
that reflects brachyury expression. The selectable marker has
allowed the sorting of brachyury positive (Brach.sup.+) cells from
EBs, and thereby the isolation and characterization of cell
populations that are enriched for mesendoderm and mesoderm
cells.
[0048] The selectable marker exemplified in accordance with the
present invention is the enhanced green fluorescence protein (EGFP
or GFP). Other selectable markers that will facilitate cell sorting
are known to those of ordinary skill in the art and may be used in
the present invention. The cDNA encoding GFP is known in the art
(and is commercially available, for example as plasmid pEGFP.C1
from Clontech, Palo Alto, Calif.), and may be targeted to the
brachyury locus by constructing targeting vectors (GFP-Bry) by
methods known in the art. The vectors are preferably designed to
replace approximately two-thirds of the first exon of the brachyury
gene with a GFP expression cassette.
[0049] Brachyury genes from numerous species, including human and
mouse, are known in the art and reviewed, for example, by Smith
(1997) Current Opinion in Genetics & Development 7:474-480. The
GFP expression cassette preferably contains GFP cDNA and one or
more translational stop codons to prevent translation of downstream
brachyury exons. The cassette may further contain an exon encoding
the SV40 polyadenylation signal sequence to prevent transcription
of downstream regions of the brachyury gene.
[0050] The vectors are introduced into ES cells by methods known in
the art to integrate the GFP-Bry construct by homologous
recombination. ES cells may be isolated from blastocysts by methods
known in the art and disclosed for example by Evans et al. (1981)
Nature 292:154-156, Thomson et al. (1995) Proc. Nat'l. Acad. Sci.
USA 92; 7844; U.S. Pat. No. 5,843,780; and Reubinoffet al. (2000)
Nature Biotech. 18:399. In a preferred embodiment the ES cells are
mouse or human ES cells. Following successful targeting the
brachyury start codon becomes the start codon of GFP, resulting in
the disruption of the targeted brachyury allele. The resulting
cells are designated GFP-Bry ES cells. GFP-Bry ES cells are defined
herein as ES cells in which one brachyury allele is inactivated and
GFP is expressed under the control of the brachyury regulatory
elements.
[0051] It has been discovered in accordance with the present
invention that GFP-Bry ES cells, in which one brachyury allele is
inactivated, are viable and develop and differentiate normally.
Further, it has been discovered that GFP expression mirrors
endogenous brachyury expression. Accordingly, brach.sup.+ cells may
be isolated by selecting for cells that express GFP. Cells that
express GFP may conveniently be isolated by flow cytometry, for
example by fluorescence-activated cell sorting (FACS). Methods for
sorting cells based on fluorescent properties are well-known to
those of ordinary skill in the art.
[0052] The present invention also provides GFP-Bry ES cells that
have a selectable marker gene recombinantly targeted to the
HNF3.beta. locus. HNF3.beta. is known to be expressed in most
endodermal cell types. The marker allows the sorting of HNF3.beta.+
cells. The marker exemplified in accordance with the present
invention is a truncated human CD4 that lacks most of the
intracellular domain. This cell surface molecule is preferred
because it cannot transduce signals and antibodies are available
for flow cytometry. Other markers that will facilitate cell sorting
are known to those of ordinary skill in the art and may be used in
the present invention. The cDNA encoding human DC4 is known in the
art and may be targeted to the HNF3.beta. locus by methods known in
the art. A targeting vector having cDNA encoding the truncated
human CD4 cloned between two arms of homology of HNF3.beta. may be
electroporated into GFP-Bry ES cells to provide CD4-HNF/GFP-Bry ES
cells. The expression of human CD4 in these cells reflects
endogenous expression of HNF3.beta..
[0053] Cell populations that are enriched for mesendoderm and
mesoderm cells, as defined hereinabove, may be obtained by
culturing GFP-Bry ES cells in the presence of serum for a time
sufficient to obtain GFP.sup.+ cells, for example for from about
one to about four days for mouse cells, and sorting and isolating
GFP.sup.+ cells, for example by flow cytometry. The cell population
that is isolated contains at least about 50%, and preferably at
least about 75%, and more preferably at least about 90%, and most
preferably at least about 95% or at least about 99% mesendoderm and
mesoderm cells. The relative amounts of mesendoderm and mesoderm
may be varied by adjusting the length of the culture in serum, with
shorter culture times favoring the presence of mesendoderm and
mesoderm patterned to the hematopoietic and endothelial lineages,
and longer culture times favoring the presence of mesoderm
patterned to the cardiac and skeletal muscle lineages. For example,
a cell population enriched for mesoderm may be obtained by
culturing in serum for about 2.5 to 4.5 days, followed by sorting
and isolating GFP.sup.+ cells. Culturing in the presence of serum
is defined herein as culturing in media supplemented with animal
serum, for example fetal calf serum (FCS). In a preferred
embodiment, the media is supplemented with from about 5% to about
25% serum. The optimal concentration may be serum batch dependent
and can be determined by one of ordinary skill in the art.
[0054] Cell populations that are enriched for mesendoderm and
mesoderm cells may be obtained from GFP-Bry ES cells generated from
human ES cells by a similar method in which the length of time of
culture in serum is lengthened to account for difference in times
of differentiation in vitro for human and mouse cells. Accordingly,
GFP-Bry ES cells generated from human ES cells are cultured in
serum for a time sufficient to obtain GFP.sup.+ cells, for example
about 2 to about 18 days, before sorting and isolating GFP.sup.+
cells.
[0055] For both mouse and human cell populations, it can be easily
determined whether the isolated cells have differentiated beyond
mesoderm, for example to hemangioblasts, by assaying for the
presence of the tyrosine kinase receptor, human KDR or mouse Flk-1.
KDR and Flk-1 are not expressed in mesendoderm and nascent
mesoderm, but as these cells differentiate to a
hemangioblast/pre-erythroid population, KDR or Flk-1 expression is
detectable. KDR.sup.+ and flk-1.sup.+ cells may be identified by
flow cytometry using antibodies to KDR or Flk-1. Such antibodies
are known in the art, and may also be generated using standard
methods of antibody production. The cell populations enriched for
mesendoderm and mesoderm may be further enriched by removing
KDR.sup.+ or Flk-1.sup.+ cells by cell sorting.
[0056] As depicted in FIG. 17, it has been discovered in accordance
with the present invention that mesendoderm is a previously
unidentified cell population that gives rise to both endoderm and
mesoderm and their corresponding lineages. It has been further
discovered that presence or absence of serum in the in vitro
culture may be used to dictate which lineage is generated from
mesendoderm. In particular, a cell population that is enriched for
endoderm cells may be obtained by culturing GFP-Bry ES cells
generated from mouse ES cells in the presence of serum for about
two to four days, sorting and isolating GFP.sup.+ cells, for
example by flow cytometry, followed by culturing the GFP in the
absence of serum for from about one to about ten days. The cell
population that is isolated contains at least 50%, and preferably
at least about 75%, and more preferably at least about 90%, and
most preferably at least about 95% or at least about 99% endoderm
cells, as defined hereinabove.
[0057] Cell populations that are enriched for endoderm cells may be
obtained from GFP-Bry ES cells generated from human ES cells by
culturing the GFP-Bry ES cells in the presence of serum for about 2
to 10 days, and then sorting and isolating GFP.sup.+ cells followed
by culturing the GFP.sup.+ cells in the absence of serum for from
about 1 to about 15 days.
[0058] The populations enriched for endoderm cells may be further
enriched by identifying and sorting out KDR.sup.+ or Flk-1.sup.+
cells as described above.
[0059] It has further been discovered in accordance with the
present invention that cell populations enriched for endoderm may
be obtained by culturing GFP-Bry embryonic stem cells in the
absence of serum and in the presence of the growth factor activin,
for about two to about ten days, and isolating cells that express
brachyury. The amount of activin is sufficient to induce
differentiation of embryonic stem cells to endoderm. Such
differentiation may be measured by assaying for the expression of
genes associated with endoderm development, including for example
HNF3.beta., Mix1-1, Sox17, Hex-1 or pdx-1. In a preferred
embodiment, the concentration of activin is at least about 30
ng/ml. In another preferred embodiment the concentration of activin
is about 100 ng/ml. In another embodiment, the GFP-Bry embryonic
stem cells are cultured in the absence of serum and the presence of
activin and an inhibitor of Wnt signalling for about two to about
10 days, and cells expressing brachyury are isolated. In a
preferred embodiment the inhibitor is DKK-1. In other preferred
embodiments the concentration of DKK-1 is at least about 30 ng/ml,
or about 100 ng/ml.
[0060] Cell populations enriched for mesoderm may be obtained by
culturing GFP-Bry embryonic stem cells in the absence of serum and
the presence of activin for about two to about ten days, and
isolating cells that express brachyury. The amount of activin is
sufficient to induce differentiation of embryonic stem cells to
mesoderm, but insufficient to induce differentiation to endoderm.
Differentiation to mesoderm may be measured by assaying for the
expression of genes associated with mesoderm development, including
for example GATA-1, and the absence of expression of genes
associated with endoderm development. In a preferred embodiment,
the concentration of activin is less than 30 ng/ml. In another
preferred embodiment the concentration of activin is about 3
ng/ml.
[0061] It has been further discovered in accordance with the
present invention that cell populations enriched for endoderm may
be obtained by culturing embryonic stem cells in the absence of
serum and the presence of activin and a Wnt molecule for about one
to about six days, isolating brach.sup.+/HFN3.beta.3.sup.+ cells,
and culturing the isolated cells in the absence of serum and the
presence of an inhibitor of Wnt signaling for at least about one
day. Isolation of brach.sup.+/HFN3.beta.3.sup.+ cells may be
facilitated by using the C4-HNF/GFP-Bry ES cells described
hereinabove and selecting for CD4 and GFP, for example by cell
sorting.
[0062] Wnt refers to a family of polypeptides well-known in the
art. See, e.g. U.S. Pat. No. 6,159,462. The Wnt growth factor
family includes proteins encoded by at least ten genes in mice and
at least seven genes in human. In a preferred embodiment of the
present invention, the Wnt molecule is recombinant Wnt 3d.
[0063] Inhibitors of Wnt signalling are also well-known in the art
and include, for example, Wnt-I disclosed in U.S. Pat. No.
6,844,422 and Dickkopf-1 (DKK-1) disclosed by Glinka et al. (1998)
Nature 391:357-362.
[0064] The present invention also provides a method of making cell
populations enriched for endoderm comprising culturing mouse
embryonic stem cells in the presence of serum for about two to
about four days, or human embryonic cells in the presence of serum
for about two to about ten days, sorting and isolating
brach.sup.+/HFN3.beta.3.sup.+ cells, and culturing the isolated
cells for about one to about ten days in the absence of serum and
the presence of activin and an inhibitor of Wnt signalling.
Isolation of brach.sup.+/HFN3.beta.3.sup.+ cells may be facilitated
by using the CD4-HNF/GFP-Bry ES cells as described above.
[0065] In each of the foregoing two methods, the amounts of activin
and Wnt inhibitor are sufficient to induce differentiation of ES
cells to endoderm. Differentiation may be measured by assaying for
the expression of genes associated with endoderm development. In a
preferred embodiment the concentration of activin is at least about
30 ng/ml. In another preferred embodiment the concentration of
activin is about 100 ng/ml. In a preferred embodiment the Wnt
inhibitor is DKK-1 and the concentration of DKK-1 is at least about
30 ng/ml. In another preferred embodiment the concentration of
DKK-1 is about 100 ng/ml.
[0066] The present invention further provides a method of
identifying agents that affect the proliferation, differentiation
or survival of the cell populations described above. The method
comprises culturing cells from one of the cell populations
described hereinabove in the absence and presence of an agent to be
tested, and determining whether the agent has an effect on
proliferation, differentiation or survival of the cell population.
The agent to be tested may be natural or synthetic, one compound or
a mixture, a small molecule or polymer including polypeptides,
polysaccharides, polynucleutides and the like, an antibody or
fragment thereof, a compound from a library of natural or synthetic
compounds, a compound obtained from rational drug design, or any
agent the effect of which on the cell population may be assessed
using assays known in the art, for example standard proliferation
and differentiation assays as described in U.S. Pat. No. 6,110,739.
Such agents are useful for the control of cell growth and
differentiation in vivo and in vitro.
[0067] The present invention further provides a method of
identifying genes involved in cell differentiation and development
of specific lineages and tissues. The method comprises isolating
populations of GFP.sup.+ cells of the invention after different
amounts of time in culture, comparing gene expression profiles in
the different populations, and identifying genes that are uniquely
expressed in a population. In a preferred embodiment, microarray
analysis and subtractive hybridization are used to compare gene
expression profiles.
[0068] In another embodiment, the present invention provides
methods of making antibodies that recognize brachyury positive
(brach.sup.+) cells but not brachyury negative (brach.sup.-) cells.
Polyclonal antibodies may be made by injecting an animal with the
cells of the invention in an immunogenic form. Also, antibodies may
be made by identifying cells surface markers present in GFP.sup.+
but not GFP.sup.- cells, and making antibodies against the markers
or fragments thereof. The antibodies may be monoclonal or
polyclonal, and may be fragments, genetically engineered
antibodies, single chain antibodies, and so on. Antibodies may be
made by methods well-known in the art. Such antibodies are useful
for identifying and isolating brach.sup.+ cells such as mesendoderm
and mesoderm.
[0069] The present invention also provides a method for generating
mammalian cells in vitro. In one embodiment, the method comprises
culturing cells from a cell population enriched in mesendoderm and
mesoderm cells under conditions effective for the differentiation
of mesoderm into cardiac muscle, vascular smooth muscle,
endothelium or hematopoietic cells. Conditions effective for
differentiation into the various cell types in vitro are known in
the art. In another embodiment, the method comprises culturing
cells from a cell population enriched in endoderm cells under
conditions effective for the differentiation of endoderm into liver
cells or pancreatic cells. Effective conditions for such
differentiation are known in the art. The production of
insulin-producing pancreatic islet cells is specifically
contemplated.
[0070] As demonstrated in accordance with the present invention,
brach.sup.+ cells isolated from different aged EBs have different
developmental potentials. Brach.sup.+/Flk.sup.- cells from about
day 3 mouse EBs efficiently generate hemotopoietic and endothelial
lineages, while the cells from about day 3 to 10 EBs generate cells
of cardiomyocyte lineages. Accordingly, by adjusting the time of
culture of the ES cells used for obtaining the cell population
enriched for mesendoderm and mesoderm, one of ordinary skill in the
art can select for efficient production of hemotopoetic and
endothelial lineages or cardiomyocyte lineages.
[0071] Such cells are useful, for example, for cell replacement
therapy for the treatment of disorders that result from destruction
or dysfunction of a limited number of cell types. Such disorders
include diabetes mellitus, liver failure, heart failure,
cardiovascular and other vascular disease, Duchenne's muscular
dystrophy, osteogenesis imperfecta, and disorders treatable by bone
marrow transplant, for example leukemias and anemias. See, Odorico
et al., (2001) Stem Cells 19:193-204.
[0072] The cell populations of the present invention are useful for
generating differentiated cells and tissues for cell replacement
therapies. The suitability of the cell populations of the present
invention for cell replacement therapy may be assessed by
transplanting the cells into animal models of disorders that are
associated with the destruction or dysfunction of a limited number
of cell types. For example, the fumarylacetoacetate (FAH) deficient
mouse disclosed for example by Grompe et al. (1993) Genes &
Dev. 7:2298, incorporated herein by reference, provides a model for
liver failure. FAH deficient mice suffer from progressive liver
failure and renal tubular damage unless treated with NTBC
(2-(2-nitro-4-trifluoromethyl benzoyl)-1,3-cyclohexedione) or
transplanted with normal hepatocytes. These mice thus provide an
ideal model for testing the potential of cells with characteristics
of immature hepatocytes generated from EBs. Methods for
transplantation of hepatocytes into FAH deficient mice removed from
NTBC are known in the art and disclosed for example by Oversturf et
al. (1996) Nature Genet. 12:266-273. Normal liver function is
indicated by survival of the mice, and may also be assessed by
measuring serum aspartate transaminase levels, plasma bilirubin
levels, and by determining normal structure of the regenerated
liver.
[0073] Animal models for other disorders that result from the
destruction or dysfunction of particular cells types are known in
the art. Such models may similarly be used to assess other cell
populations of the present invention.
[0074] The present invention also provides a transgenic non-human
mammal in which DNA encoding a selectable marker is present in the
brachyury locus such that one brachyury allele is inactivated and
the selectable marker is expressed in cells in which the brachyury
locus is transcribed. In a preferred embodiment the mammal is a
mouse and the selectable marker is GFP. In particular, the
transgenic mouse has a genome comprising a transgene in which a DNA
sequence encoding GFP is operably linked to brachyury regulatory
elements, and the transgene is expressed in cells that normally
express brachyury. The transgenic mouse may be obtained by
injecting the GFP-Bry ES cells described hereinabove into
blastocysts, which are then implanted into pseudopregnant females.
Transgenic pups are identified by the short-tail phenotype
associated with brach +/-, and by molecular analysis. Such
transgenic animals are useful for obtaining early embryos from
which to isolate mesoderm to be used in accordance with the methods
of the invention, and for the identification, isolation and
characterization of any adult cell populations that express the
brachyury gene. Such cells may represent novel stem cell
populations.
[0075] All references cited herein are incorporated herein in their
entirety.
[0076] The following examples serve to further illustrate the
present invention.
EXAMPLE 1
Materials and Methods
[0077] ES cell growth and differentiation. ES cells were maintained
on irradiated embryonic feeder cells in Dulbecco's Modified Eagle
Medium (DMEM) supplemented with 15% fetal calf serum (FCS),
penicillin, streptomycin, LIF (1% conditioned medium) and
1.5.times.10.sup.-4 M monothioglycerol (MTG; Sigma). Two days prior
to the onset of differentiation, cells were transferred on
gelatinized plates in the same media. For the generation of EBs, ES
cells were trypsinized and plated at various densities in
differentiation cultures. Differentiation of EBs was carried out in
60 mm petri grade dishes in IMDM supplemented with 15% FCS, 2mM
L-glutamine (Gibco/BRL), transferrin (200 ug/ml), 0.5mM ascorbic
acid (Sigma), and 4.5.times.10.sup.-4 M MTG. Cultures were
maintained in a humidified chamber in a 5% CO.sub.2/air mixture at
37.degree. C.
[0078] Serum Free Medium. Two different serum-free media were used
in different aspects of the following examples: IIMD supplemented
with Knockout SR (Gibco BRL) and StemPro 34 (Gibco BRL).
[0079] Methylcellulose Colony Assay. A) Blast colonies: For the
generation of blast cell colonies (BL-CFC assay), EB-derived cells
were plated at 0.5.times.1.5.times.10.sup.5 cells/ml in 1%
methylcellulose supplemented with 10% FCS (Hyclone), vascular
endothelial growth factor (VEGF; 5 ng/ml), c-kit ligand (KL; 1%
conditioned medium), IL-6 (5ng/ml) and 25% D4T endothelial cell
conditioned medium (Kennedy et al. (1997) Nature 386:488-93).
Transitional colonies were generated in the absence of VEGF.
Colonies were scored following four days of culture. B)
Hematopoietic colonies: For the growth of primitive and definitive
hematopoietic colonies, cells were plated in 1% methylcellulose
containing 10% plasma-derived serum (PDS; Antech), 5% protein-free
hybridoma medium (PFHM-II; Gibco-BRL) plus the following cytokines:
c-kit ligand (KL; 1% conditioned medium), erythropoietin (2 U/ml),
IL-11 (25 ng/ml), IL-3 (1% conditioned medium), GM-CSF (3 ng/ml),
G-CSF (30 ng/ml), M-CSF (5 ng/ml), IL-6 (5 ng/ml) and
thrombopoietin (TPO; 5 ng/ml). Cultures were maintained at
37.degree. C., 5% C0.sub.2. Primitive erythroid colonies were
scored at day 5-6 of culture, whereas definitive erythroid (BFU-E),
macrophage, and multilineage colonies were counted at 7-10 days of
culture. C-kit ligand was derived from media conditioned by CHO
cells transfected with KL expression vector (kindly provided by
Genetics Institute). IL-3 was obtained from medium conditioned by
X63 AG8-653 myeloma cells transfected with a vector expressing
IL-3. VEGF, GM-CSF, M-CSF, IL-6 ,IL-11, activin BMP2, BMP4, bFGF,
FGF8, and 1 hh were purchased from R&D systems.
[0080] Reaggregation Cultures. Cells were cultured at
2.times.10.sup.5 per ml IMDM supplemented with 15% FCS (or Knockout
SR), 2mM L-glutamine (Gibco/BRL), 0.5 mM ascorbic acid (Sigma), and
4.5.times.10.sup.4 M MTG in 24-well petri-grade plates. These were
used to prevent adhesion of the cells to the bottom of the
well.
[0081] Cardiac muscle assays. GFP.sup.+ cells were reaggregated in
IMDM supplemented with 15% serum replacement. Twenty hours later
the aggregates were cultured in wells of either a 24- or 96-well
plate in IMDM with 10% serum replacement (serum-free). The wells
were pre-treated with gelatin. Cultured were monitored daily for
the development of the appearance of beating cells. Beating cells
were usually detected between days 2 and 6 of culture.
[0082] Cell surface markers staining and FACS analysis. Standard
conditions were used to stain the cells. Stained suspensions were
analyzed on a FACScan (Becton Dickinson, CA).
[0083] Gene Expression Analysis For the poly A.sup.+ RT-PCR
analysis the method of Brady et al. ((1990) Meth. in Mol. and Cell
Bio. 2:17-25) was used. Reverse transcription, poly-A tailing and
PCR procedures were performed as described, with the exception that
the X-dT oligonucleotide was shortened to
5'-GTTAACTCGAGAATTC(T).sub.24-3'. The amplified products from the
PCR reaction were separated on agarose gels and transferred to a
Zeta-probe GT membrane (Biorad) or transferred to the membrane with
a slot blot apparatus (Schleicher & Schuell). The resulting
blots were hybridized with .sup.32P randomly primed cDNA fragments
(Ready-to-Go Labelling, Pharmacia) corresponding to the 3' region
of the genes (for all except .beta.-H1). A .beta.-H1-specific probe
was prepared by annealing two oligonucleotides,
(5'-TGGAGTCAAAGAGGGCATCATAGACACATGGG-3',
5'-CAGTACACTGGCAATCCCATGTG-3') which share an 8 base homology at
their 3' termini. This .beta.-H1 specific otigonucleotide was
labeled with .sup.32P using a Klenow fill-in reaction. For gene
specific PCR, total RNA was extracted from each sample with RNeasy
mini kit and treated with RNase free DNase (Qiagen). Two microgram
of total RNA was reverse-transcribed into cDNA with random hexamer
using a Omniscript RT kit (Qiagen). PCR was carried out using
appropriate oligonucleotides. The PCR reactions were performed with
2.5 U of Taq polymerase (Promega), PCR buffer, 2.5 mM MgCI.sub.2,
0.2 uM of each primer and 0.2 mM dNTP. Cycling conditions were as
follows; 94.degree. C. for 5 min followed by 35 cycles of
amplification (94.degree. C. denaturation for 1 min, 60.degree. C.
annealing for 1 min, 72.degree. C. elongation for 1 min) with a
final incubation at 72.degree. C. for 7 min.
EXAMPLE 2
Generation of Targeted ES Cells
[0084] Under appropriate conditions in culture, embryonic stem (ES)
cells will differentiate and form three dimensional colonies known
as embryoid bodies (EBs) that contain developing cell populations
from a broad spectrum of lineages. Smith (2001) Annu. Rev. Cell
Dev. Biol. 17:435-62. Among these EB-derived populations, one can
detect mesodermal derivatives including those of the hematopoietic,
endothelial, cardiac muscle and skeletal muscle lineages.
[0085] In order to track the onset of mesoderm in EBs and to
isolate cells representing this population, the green fluorescence
protein (GFP) was targeted to the brachyury locus. The targeting
construct contained the GFP cDNA, and artificial intron, SV40
poly(A) sequences and a loxP flanked neo cassette in the first exon
and is depicted in FIG. 1. The thymidine kinase (TK) gene was
included at the 3' end of the targeting construct to select against
random integration. The targeting vector was constructed as
follows.
[0086] A BAC clone carrying the entire mouse Brachyury (Bry) gene
was isolated by PCR screening of a 129/O1a strain genomic library
(Genome Systems) with primers 5'-AAGGAGCTAACT AACGAGATGAT-3' and
5'-TACCTTCAGCACCGGGAACAT3'. These primers anneal within the first
and second Bry exon, respectively, and amplify a diagnostic band of
.about.600 bp. An approximately 3 kb long PstI restriction fragment
carrying the 1 exon of the Bry gene along with more than 2 kb of 5'
flanking region was identified and subcloned from the BAC into
plasmid pBSK (Strategene), resulting in construct pBSK.Bry-5'.
Approximately 2 kb of the region immediately upstream of the start
codon were sequenced to identify appropriate primer annealing sites
for the construction of vectors.
[0087] Oligos 5'-GCTAGCTAATGGATCCA-3'/5'- GATCTGGATCCA
TTAGCTAGCTGCA-3' and 5'- GATCTTAATGAACGGCAGGTGGGTGCGCGTCCGGA
G-3'/5' TCGACTCCGGACGCGCACCCACCTGCCGTTCATTAA-3' were inserted into
the PstI/SaII sites of plasmid pBSK to create a new, more suitable
polylinker with two successive translational stop codons and an
artificial 3' splice site (construct pBry-AA). Plasmid pEGFP.C1
(Clontech) was double-digested with NheI/BgIII and the resulting
.about.760 bp DNA fragment encoding EGFP without stop codon was
cloned into the NheI/BgIII sites of pBRY-AA, resulting in construct
pBry-AB. An XhoI/SaII fragment of plasmid pL2-Neo2 carrying a
loxP-flanked neomycin resistance gene was inserted into the SaII
site of pBry-AB to give rise to plasmid pBry-AC (transcription of
EGFP and Neo in same direction).
[0088] A 556 bp XmaI/MluI fragment carrying a consensus splice
donor site, an artificial intron, a splice acceptor site and a
short exon including the SV40 polyadenylation sequence, was excised
from the commercial expression vector pBK-CMV (Stratagene). This
fragment was inserted into plasmid pBry-AC in the following way:
the XmaI end was ligated into the BspEI site following the last
EGFP codon, whereas the Mlu end was inserted along with oligos
5'-CGCGTTACTAGTAAGACGTCT-3'/5'-CCGGAGA CGTCTTACTAGTAA-3' as linkers
into the BspEI site located just upstream of the loxP-neo-loxp
cassette. Resulting construct: pBry-AE. An .about.1.9 kb XhoI/SaII
fragment encoding the HSV thymidine kinase gene was inserted into
the XhoI site of pBry-AE to allow selection against random
integration (construct pBry-AH). A NotI/Eco47III fragment encoding
the "short arm" of homology was excised from pBry-AF and cloned
into the NotI/Eco47III sites of pBry-AH to give rise to plasmid
pBry-AI. The "long arm" of homology was excised from pBry-AK with
SaII and inserted in the correct orientation into the Sail site of
pBry-AI to yield final targeting vector B.
[0089] Embryonic stem cells (E14. 1, 129/Ola Hooper et al. (1987)
Nature 326:292) were electroporated with NotI-linearized targeting
vector pBry-AM. Four dishes with transfected cells were subjected
to G418 single-and another four dishes to G418+Gancyclovir (Ganc)
double-selection. Clones that had undergone a homologous
recombination event were identified by PCR with one primer
(5'-CAGGTAGAACCCACAA CTCCGAC-3') annealing to genomic sequences in
the 5' region of the Bry gene, just upstream of the "short arm of
homology", the other (5'-CCGGACACGCTGAACTTGTGGC-3') to the 5'
portion of EGFP (diagnostic band: approximately 1.3 kb). Correctly
targeted clones were confirmed by Southern blot analysis: genomic
DNA of candidate clones was digested with HincII and hybridized to
a probe located outside of the targeting construct. The probe was
derived from the Bry 5' flanking region (-2018 to -1249 with
respect to the Bry ATG start codon) by PCR using the
oiigonucleotide pair
5'-ACAGGATCCCTAAGCCTCAAAGAGTCGCT-3'/5'-TCTTGGATCCTCCTAT
CCTATCCCGAAGCTCCT-3'. 384 G418 single- and 80 G418+Ganc
double-selected clones were screened, of which 4 respectively 3
proved to be positive, corresponding to a targeting efficiency of
1.04% and 3.75%. Two positive clones were transiently transfected
with a modified Cre recombinase expression vector to remove the neo
gene. These targeted clones are referred to hereinafter as GFP-Bry
ES cells.
[0090] Brachyury is expressed transiently in developing EBs with
the onset preceding the expression of genes that define the
establishment of the hematopoietic and endothelial lineages. To
determine whether GFP expression in GFP-Bry ES cells accurately
reflects expression of the brachyury gene during EB development,
GFP expression was assessed.
[0091] A typical expression pattern during a 6-day EB
differentiation period is shown in FIG. 2A. In this experiment, low
levels of message were detected within 24 hours of differentiation.
Expression was upregulated over the next 48 hours, persisted
through day 4 and then declined sharply to undetectable levels by
day 6 of differentiation. GFP expression, as defined by FACS
analysis, followed a similar temporal pattern. Low levels of
GFP.sup.+ cells (.about.5%) were detected as early as day 2 of
differentiation. More than half (65%) of the EB-derived cells
expressed GFP at day 3 and almost all the cells were positive at
day 4 of differentiation. As observed by PCR, expression dropped
sharply after this point and by day 6 few, if any, GFP.sup.+ cells
were present. This rapid decline in GFP expression indicated that
it did not persist within the cells for extended periods of time.
The high proportion of GFP.sup.+ cells at days 3 and 4 of
differentiation suggests that development of mesoderm within the
EBs under these conditions is extensive. Taken together, these
findings indicate that GFP expression accurately reflects
expression of the brachyury gene during EB development.
[0092] The possibility that inactivation of a single brachyury
allele could have detrimental effects on the in vitro developmental
potential of the ES cells was assessed. As indicated, heterozygous
mice demonstrate a mild phenotype. To determine if the GFP-Bry ES
cells display any detectable defects in hematopoietic development,
EBs generated from them were analyzed for hematopoietic precursor
and blast colony-forming cell (BL-CFC) content and for gene
expression patterns. The data in FIGS. 3A and 3B indicate that
GFP-Bry ES cells generate comparable numbers of primitive
(Ery.sup.p) and definitive (Ery.sup.d, Mac, Mac/Ery, and Mix)
hematopoietic precursors and BL-CFC compared to the wild type
cells. Gene expression patterns (FIG. 3C) confirmed the precursor
analysis and show little difference between the EBs generated from
the GFP-Bry and wild type ES cells. Both sets of EBs showed a
decline in Rex-1 expression over the first 3 days of
differentiation. Rex-1 is a transcription factor that is expressed
in ES cells and downregulated as they undergo differentiation.
Rogers et al. (1991) Development 113:815-24. The decline in Rex-1
is followed by the typical transient wave of brachyury expression
which immediately precedes the onset of genes involved in the
development of the hematopoietic and endothelial lineages. FIk-1, a
receptor tyrosine kinase essential for the establishment of these
lineages (Shalaby et al. (1995) Nature 376:62-6) is expressed
between day 3 and 6 of differentiation. GATA-1, a hematopoietic
transcription factor, and the embryonic and adult globin genes,
.beta.H1 and .beta.major, were detected at low levels at day 4 of
differentiation. Expression of all 3 genes was upregulated over the
next 24 hours, reflecting the expansion and maturation of the
primitive erythroid lineage at this developmental stage. Palis et
al. (1999) Development 126:5073-84. The precursor numbers and the
gene expression patterns observed in this example are consistent
with those found in previous studies and indicate that the
molecular programs leading to the establishment of the
hematopoietic system are intact in the targeted GFP-Bry ES
cells.
EXAMPLE 3
Isolation of Brachyury.sup.+ Cells
[0093] To determine if brachyury.sup.+ cells could be isolated
based on GFP expression, the GFP.sup.+ population from day 3.5 EBs
was sorted and analyzed for expression of appropriate genes. FIG.
4A shows the gates used for the isolation of the GFP positive (2)
and negative(1) populations. RT-PCR analysis revealed brachyury
expression was restricted to the GFP.sup.+ fraction indicating that
cell sorting based on GFP expression can be used to isolate
brachyury.sup.+ cells. Flk-1, one of the earliest makers of
hematopoietic and endothelial development, was present at higher
levels in GFP.sup.+ that in the GFP.sup.- fraction indicating that
it was expressed in at least a subpopulation of brachyury.sup.+
cells. In contrast to brachyury and Flk-1, Pax-6, a gene involved
in early neuronal development [79,80], was expressed at higher
levels in the GFP.sup.- fraction consistent with precursors of this
lineage being brachyury negative. These cell-sorting studies
indicate that expression of GFP under the control of the brachyury
locus provides a novel marker for the isolation, characterization
and manipulation of brachyury.sup.+ cells from EBs.
[0094] This example demonstrates that GFP.sup.+ cells can be
isolated from day 3.5 EBs by cell sorting. Gene expression analysis
of the GFP.sup.+ and GFP.sup.- fractions shows that brachyury
expression segregates predominantly to the positive fraction, a
finding which clearly demonstrates that fractionation based on GFP
provides a method for isolating brachyury positive cells. In
addition to brachyury, the receptor tyrosine Flk-1 involved in
early hematopoietic and endothelial development is also expressed
at higher levels in the positive than in the negative fraction. In
contrast, Rex-1 and Pax-6, markers of early ectoderm and
neuroectoderm, are expressed in the GFP.sup.- fraction. These
findings demonstrate that expression of GFP in the context of
brachyury can be used to separate mesoderm from ectoderm.
EXAMPLE 4
Separation of Brachyury Positive Cells into Subpopulations Based
Upon Flk-1 Expression
[0095] Flk-1 has been shown to be essential for the establishment
of the hematopoietic and endothelial lineages in the early embryo
and is expressed on the earliest precursors of these lineages,
including the BL-CFC [Faloon et al. (2000) Development
127:1931-41]. Given this pivotal role in blood and vascular
development, its expression within the GFP.sup.+ population was
hypothesized to define a subpopulation of mesoderm undergoing
specification to these lineages. To investigate this possibility
further, EBs were analyzed at several stages of development for the
presence of GFP and Flk-1 positive cells. In the experiment
illustrated in FIG. 5A, 4.8% of the day 3.0 EB population expressed
GFP but not Flk-1, whereas 1.2% of the cells expressed both
markers. The size of both fractions increased dramatically over the
next 12 hours with the GFP.sup.+/Flk-1.sup.- and
GFP.sup.+/Flk-1.sup.+ cells representing 52% and 26% of the total
EB population, respectively. To assess the developmental potential
of the three populations defined by GFP and Flk-1 expression,
GFP.sup.-/Flk-1.sup.- (fraction 2), GFP.sup.+/Flk-1.sup.- (fraction
3) and GFP.sup.+/Flk-1.sup.+ (fraction 4) cells were isolated at
both time points and analyzed for BL-CFC and 2.degree. EB content
and for gene expression patterns. The potential of the fractions
was compared to that of the pre-sorted population (fraction 1). The
majority of the BL-CFC were found in the GFP.sup.+/Flk-1.sup.+
fraction at both day 3.0 and 3.5 of differentiation (FIG. 5B). This
is not surprising given that previous studies have shown that all
BL-CFC express Flk-1. The 2.degree. EB were restricted to the
GFP.sup.-/Flk-1.sup.- fraction, a finding consistent with the fact
that they derive from residual undifferentiated ES cells in the
primary EBs. The GFP.sup.+/Flk-1.sup.- fraction generated few
colonies under the conditions used in these cultures. The gene
expression analysis revealed some interesting differences between
the populations isolated at the 2 time points (FIG. 5C). Rex-1, the
ES cell marker, was expressed at lower levels in the GFP.sup.+ than
in the GFP.sup.- fraction, indicating that these populations are
undergoing differentiation. Brachyury was expressed in the
GFP.sup.+ fractions at both time points. The levels appear to be
higher in the GFP.sup.+/Flk-1.sup.- than the GFP.sup.+/Flk-1.sup.+
fraction isolated from day 3.5 EBs, suggesting that its expression
could be downregulated as these cells mature towards the
hematopoietic and endothelial lineages. As expected, Flk-1 was
expressed predominantly in the GFP.sup.+/Flk-1.sup.+ cells at both
time points. Scl, a helix-loop-helix transcription factor that is
essential for both primitive and definitive hematopoietic
development (Shivdasani et al. (1995) Nature 373:432-4), appears to
be restricted to the GFP.sup.+/Flk-1.sup.+ fraction. Similarly, the
transcription factor Runx1, required for establishment of the
definitive hematopoietic system (Wang et al. (1996) Proc. Natl.
Acad. Sci. 93:3444-9), was most readily detected in
GFP.sup.+/Flk-1.sup.+ fraction. There was some Runx1 expression in
the GFP.sup.+/Flk-1.sup.- fraction isolated from day 3.0 EBs. Nodal
is expressed in all 3 fractions at day 3 of differentiation. At day
3.5, the levels of expression in the GFP.sup.+/Flk-1.sup.+ fraction
appear to be significantly lower than in the other fractions. Wnt3a
and Wnt8a showed a remarkably restricted pattern of expression and
were found only in the GFP.sup.+/Flk-1.sup.- fraction at both time
points, consistent with an early mesoderm function prior to the
expression of lineage restricted markers. BMP2 was expressed in
both GFP.sup.+ fractions whereas BMP4 was found predominantly in
the GFP.sup.+/Flk-1.sup.+ cells, indicating that these molecules
play a role at distinct stages of development in this system. The
BL-CFC potential and gene expression pattern of the
GFP.sup.+/Flk-1.sup.+ cells indicates that they are representative
of the extraembryonic mesoderm found in the mouse embryo.
[0096] This example demonstrates that the brachyury fraction of day
3 and day 3.5 EBs can be separated into two fractions based on
Flk-1 expression: brachyury.sup.+/Flk-1.sup.-
(GFP.sup.+/Flk-1.sup.-) and brachyury.sup.+/Flk-1.sup.+
(GFP.sup.+/Flk-1.sup.+) (FIG. 5A). Functional studies demonstrated
that precursors (BL-CFC) able to generate both hematopoietic and
endothelial cell segregated to the (GFP.sup.+/Flk-1.sup.+)
fraction, suggesting that upregulation of Flk-1 is indicative of
commitment to these lineages (FIG. 5B). Gene expression studies
demonstrated distinct differences between the GFP.sup.+/Flk-1.sup.-
and GFP.sup.+/Flk-1.sup.+ populations (FIG. 5C).
EXAMPLE 5
Developmental Relationships among the GFP/FLK Fractions
[0097] The expression patterns observed in FIG. 5 are consistent
with the interpretation that the three fractions represent a
developmental continuum with the GFP.sup.-/Flk-1.sup.- cells giving
rise to the GFP.sup.+/Flk-1.sup.- cells which in turn give rise to
the GFP.sup.+/Flk-1.sup.+ cells. To determine if these fractions do
represent specific stages within a common developmental pathway,
each was isolated from day 3 EBs, cultured for 20 hours and then
re-analyzed for GFP and Flk-1 expression. BL-CFC and Ery.sup.p-CFC
potential was determined for each of the populations prior to and
following culture. The isolated cells were cultured at densities of
1.times.10.sup.5 cells or greater in petri-grade 24-well plates in
the same medium used for EB differentiation. Under these
conditions, the cells rapidly reaggregate and form EB-like
structures that appear to follow a normal developmental program
with little expansion or loss in cell number. Following the 20-hour
reaggregation culture, the GFP.sup.-/Flk-1.sup.- cells gave rise to
a significant population of GFP.sup.+/Flk-1.sup.- cells as well as
to a small number of GFP.sup.+/Flk-1.sup.+. GFP.sup.+/Flk-1.sup.-
cells generated a substantial population of GFP.sup.+/Flk-1.sup.+
cells during the same culture period. The GFP.sup.+/Flk-1.sup.+
population appeared to lose some GFP and Flk-1 expression following
the reaggregation culture. Results are shown in FIG. 6. The changes
in precursor potential were consistent with the changes in surface
markers. The GFP.sup.-/Flk-1.sup.- fraction, the most immature of
the three, contained an undetectable number of BL-CFC and
Ery.sup.p-CFC before or after culture. The GFP.sup.+/Flk-1.sup.-
fraction also contained few BL-CFC and Ery.sup.p-CFC prior to
culture. However, following culture, the BL-CFC potential increased
dramatically, from 74 to 1564 per 10.sup.5 cells, consistent with
the increase in Flk-1 expression. The frequency of Ery.sup.p-CFC
did not change during the culture period. The GFP.sup.+
/Flk-1.sup.+ fraction contained BL-CFC but few Ery.sup.p-CFC prior
to culture. No BL-CFC were detected following culture, however, the
population now contained Ery.sup.p-CFC. Together with the surface
marker analysis, these precursor data support a developmental
progression from a pre-mesoderm (GFP.sup.-/Flk-1.sup.-) to a
mesoderm/pre-hemangioblast (BL-CFC) population
(GFP.sup.+/Flk-1.sup.-) to a hemangioblast/pre-erythroid population
(GFP.sup.+/Flk-1.sup.+) to a post hemangioblast/erythroid
population (possibly GFP.sup.lo/Flk-1.sup.lo). Not all the cells in
a given population appear to differentiate following the 20-hour
culture period as cells with the starting phenotype persisted in
the GFP.sup.-/Flk-1.sup.- and GFP.sup.+/Flk-1.sup.- cultures.
[0098] This example indicates that when isolated and recultured for
20-24 hours, each of the three populations isolated from day 3 EBs
continued to differentiate and in a pattern that indicates that
these populations represent a developmental continuum. For
instance, GFP.sup.-/Flk-1.sup.- gave rise to GFP.sup.+/Flk-1.sup.-
cells which in turn gave rise to GFP.sup.+/Flk-1.sup.+. These
changes in cell surface characteristics were associated with the
expected changes in developmental potential. The
GFP.sup.+/Flk-1.sup.- fraction contained few
hematopoietic/endothelial precursors (BL-CFC) prior to culture.
Following culture, these precursors were detected, clearly
demonstrating that the GFP.sup.+/Flk-1.sup.- fraction from day 3
EBs does contain the potential to give rise to Flk-1.sup.+ cells
with hematopoietic and endothelial potential.
EXAMPLE 6
Potential of GFP/Flk-1.sup.- Cells
[0099] The foregoing examples demonstrated that
GFP.sup.+/Flk-1.sup.- cells isolated from day 3.0 EBs efficiently
generated GFP.sup.+/Flk-1.sup.+ cells and BL-CFC following
overnight culture. To determine if this pre-BL-CFC potential was
specific to the GFP.sup.+/Flk-1.sup.- fraction isolated at this
stage of development, GFP.sup.+/Flk-1.sup.- cells from different
aged EBs were assayed for their ability to give rise to BL-CFC. As
shown in FIG. 7A, the capacity to generate BL-CFC was most robust
in the day 3 GFP.sup.+/Flk-1.sup.- cells. This developmental
potential decreased dramatically by day 3.5 of differentiation and
was almost non-existent at day 4.0. The BL-CFC content of the
freshly isolated GFP.sup.+/Flk-1.sup.+ fraction from these same EBs
increased over this period of time, indicating that differentiation
was progressing in a normal fashion. The Flk-1 expression patterns
in the reaggregated cultures from the different staged EB cells
were consistent with BL-CFC data. The cultures from the
reaggregated day 3.0 GFP.sup.+/Flk-1.sup.- cells contained a
distinct Flk-1 fraction that represented more than 40% of the total
population (FIG. 7B). Flk-1 expression in the day 3.5 and 4.0
cultures was significantly lower and consisted of a shoulder of the
total population rather than a distinct peak.
EXAMPLE 7
Cardiomyocyte Potential of GFP and Flk-1 Subpopulations
[0100] Given the sequence of events in the mouse embryo in which
the development of hematopoietic and endothelial mesoderm is
followed by the development of cardiac and cranial mesoderm, the
cardiomyocyte potential of the isolated populations was determined.
For this analysis, aggregates from the cultures of the different
populations were transferred to microtiter or 24-well plates in
serum-free medium and monitored for the development of beating cell
masses, indicative of cardiomyocytes. These conditions are known to
support the efficient development of cardiomyocytes from the
reaggregated cells. As an independent confirmation of the
cardiomyocyte nature of the cells within these masses, a
representative group was transferred to microscope slides, fixed
and stained for the presence of the cardiac-specific isoform of
Troponin T. All beating cell masses analyzed were found to contain
Troponin T positive cells indicating that they were cardiomyocytes.
Using this assay, the cardiomyocyte potential of the reaggregated
GFP.sup.+/Flk-1.sup.- and GFP.sup.+/Flk-1.sup.+ fractions from
different staged EBs was determined. For comparison, the BL-CFC
potential of the freshly isolated GFP.sup.+/Flk-1.sup.+ cells and
of the cultured GFP.sup.+/Flk-1.sup.- cells was analyzed.
TABLE-US-00001 TABLE I BL-CFC, pre-BL-CFC and cardiomyocyte
potential of the GFP+/Flk-1- and GFP+/Flk-1+ fractions isolated
from different staged EBs. GFP.sup.+ Flk.sup.- GFP.sup.+ FIk.sup.+
EB BL-CFC beating following BL-CFC beating following Age following
culture culture direct plating culture 2.75 +++ - + - 3.5 + ++ +++
- 4.0 +/- ++ +++ -
[0101] As shown in Table 1, the BL-CFC potential of the different
fractions was similar to that observed in previous experiments. The
GFP.sup.+/Flk-1.sup.+ cells isolated from the three different EB
populations generated BL-CFC, with the highest number found at day
3.5 and 4.0. The pre-BL-CFC potential in the GFP.sup.+/Flk-1.sup.-
cells was greatest at day 2.75 and decreased significantly at 3.5
and 4.0. The cardiomyocyte potential of the fractions showed a
reverse pattern. A significant proportion (>80%) of the
transferred aggregates from day 3.5 and 4.0 GFP.sup.+/Flk-1.sup.-
cells generated beating cardiomyocytes. No beating cells were
observed in the aggregates generated from the earliest (day 2.75)
GFP.sup.+/Flk-1.sup.- cells. Beating cells were not detected in
aggregates generated from the GFP.sup.+/Flk-1.sup.+ cells isolated
from EBs at any of the three stages of development. The findings
from this analysis are consistent with the notion that
GFP.sup.+/Flk-1.sup.- cells isolated at different stages have
different potentials. Those that develop early appear to have a
hemangioblast fate, whereas those that develop later generate the
cardiac lineage and possibly other populations. The
GFP.sup.+/Flk-1.sup.+ populations appear to have lost the
cardiomyocyte potential and may be restricted to the hemangioblast
lineages. Given these findings, the early developing (day 2.75-3.0)
GFP.sup.+/Flk-1.sup.- cells are referred to as pre-hemangioblast
mesoderm whereas the population that develops between day 3.5 and
4.0 are referred to as pre-cardiac mesoderm. The day 3.0-3.5
GFP.sup.+/Flk-1.sup.+ populations generate BL-CFC, whereas those
isolated from later stage EBs (day 4.0) contain primitive erythroid
progenitors, indicating the onset of hematopoietic commitment.
Given this developmental potential, the GFP.sup.+/Flk-1.sup.+
population is referred to as hemangioblast mesoderm.
[0102] Examples 5 and 6 demonstrate that GFP+cells isolated from
different aged EBs have different developmental potential. As
indicated in the previous examples, GFP.sup.+/Flk-1.sup.- cells
from day 3 EBs efficiently generate both hematopoietic and
endothelial lineages. These cells did not give rise to
cardiotiyocytes (heart tissue) as demonstrated by the lack of
beating cell masses. In contrast, GFP.sup.+ cells from day 4 EBs
gave rise to few Flk-1.sup.+ cells and BL-CFC following culture.
This population did, however, generate cells of the cardiomyocte
lineage. These findings demonstrate that the GFP.sup.+
(brachyury.sup.+) fraction isolated from different aged EBs have
become patterned to distinct populations with different
developmental fates. In addition to the conditions used and
potentials observed in the foregoing examples, other potentials may
be observed by altering conditions and additives.
EXAMPLE 8
Role of Serum-Derived Factors
[0103] To assess the role of serum in the development of
brachyury.sup.+ cells, EBs were differentiated the absence of
serum. EBs did develop under these conditions, although they were
somewhat smaller than those found in normal conditions. In the
absence of serum, no GFP.sup.+ cells were detected within these
EBs, indicating that mesoderm was not induced under these
conditions (FIG. 8). Significant numbers of GFP.sup.+/Flk-1.sup.-
and GFP.sup.+/Flk-1.sup.+ cells did develop when serum was added to
the cultures. These findings clearly demonstrate that components
found within serum are able to induce the development and
differentiation of brachyury.sup.+ cells. As a first step in
identifying factors that might play a role in this process, BMP4
(20 ng/ml) was added to the developing EBs in the serum free
cultures. At this concentration, BMP4 did induce a significant
population of brachyury.sup.+ cells within 3 days of
differentiation. However, in contrast to the serum, BMP4 did not
support the development of the GFP.sup.+/Flk-1.sup.+ population in
this period of time. To determine if BMP4 could induce
GFP.sup.+/Flk-1.sup.+ from GFP.sup.+/Flk-1.sup.- cells that were
induced in the presence of serum, GFP.sup.+/Flk-1.sup.- cells were
isolated from EBs differentiated for three days in the presence of
serum. These cells were reaggregated in medium alone, in medium
with serum or in medium with BMP4. As shown in the lower row of
FIG. 8, GFP.sup.+/Flk-1.sup.- cells did not differentiate
substantially when reaggregated in the absence of serum. As
expected, the same population generated a large
GFP.sup.+/Flk-1.sup.+ population when serum was added to the
cultures. Consistent with the findings in the primary
differentiation cultures, BMP4 was unable to induce the development
of significant numbers of GFP.sup.+/Flk-1.sup.+ cells from the
cultured GFP.sup.+/Flk-1.sup.- cells.
[0104] FIG. 9 summarizes the stages in mesoderm development based
upon the foregoing examples. Step #1 represents mesoderm induction
and patterning to a pre-hematopoietic and endothelial
(pre-hemangioblast) fate. Step #2 represents specification to the
hematopoietic and endothelial lineages. Steps #3 and #4 represent
patterning to the pre-cardiac fate.
EXAMPLE 9
Isolation and Characterization of Endoderm Potential of Cell
Populations
[0105] Studies using model systems such as Xenopus and Zebrafish
have suggested that mesoderm and endoderm develop from a common
precursor population known as mesendoderm. To determine whether or
not a mesendoderm stage of development does exist in EBs,
conditions for the development of the endoderm lineage were
established. As a first step in establishing culture conditions for
the development of this lineage, the amount of serum in the
differentiation cultures was varied. EBs were generated in the
presence and absence of serum (SP34 and then IMDM plus SR) and
assayed at different stages for expression of genes associated with
ectoderm, endoderm and mesoderm development. For the ectoderm
lineage, development of the neuronal lineage was assessed analyzing
expression of PAX6, Wnt1, neruoD and neurofilament (NFL). These
genes are known to be expressed at different stages of neruonal
development. The early stages of endoderm development were
monitored by expression of HNF3.beta.. To evaluate later stages of
endoderm development and specification, genes involved in liver
development were analyzed. These included Hex, .alpha.-fetoprotein
(AFP), HNF4, Albumin (Alb), .alpha.-1-antittrypsin (AAT) and
tyrosine aminotransferase (TAT). Mesoderm development was monitored
by expression of brachyury and GATA-1. In addition to gene
expression patterns, neuronal development was assayed by monitoring
neurite outgrowth from EBs. The neuronal nature of these neurites
was demonstrated by .beta.III-Tubulin expression. Mesoderm
development was also assessed by enumeration of hematopoietic
progenitors in the EBs. FIG. 10 shows the impact of serum on the
developmental potential of EBs over a 10-day differentiation
period. In the presence of serum (serum) there is little
neuro-ecotderm differentiation as demonstrated by the lack of
expression of the genes associated with development of this
lineage. HNF3.beta. is expressed at early stages of differentiation
(day 2-3) and then downregulated. As expected, GATA-1 is expressed
in the EBs generated under these conditions. The pattern of
expression of these genes was basically reversed in EBs grown in
the absence of serum (serum-). These EBs expressed all the genes
associated with neuroectoderm, but did not express the
mesoderm/hematopoietic marker GATA-1. HNF3.beta. was expressed in
late stage EBs (day 10) grown under these conditions. The patterns
of brachyury expression as monitored by GFP expression were
consistent with these findings. EBs generated in the presence of
serum generated a substantial brachyury.sup.+ population that was
present between days 2 and 5 of differentiation (FIG. 11,-B-line).
Brachyury was not detected in EBs grown in the absence of serum
(FIG. 11,-H-line). Hematopoietic precursor assays confirmed these
findings. EBs generated in serum contained precursors (FIG. 12,
speckled bar), whereas those grown without serum did not (FIG. 12,
solid bar, not visible). Finally, evaluation of neurite potential
of the EBs was consistent with these various analyses. None of the
EBs grown in serum generated neurites. In contrast, 85% of those
generated in the absence of serum displayed this activity (FIG.
13). Taken together, these findings demonstrate the importance of
culture conditions (serum) for the generation of specific lineages.
They also demonstrate that neither serum complete- nor serum-free-
conditions were optimal for endoderm development.
[0106] The strong upregulation of HNF3.beta. in the early stage EBs
generated in serum suggested that serum might be important for the
establishment, but not the maturation of the endoderm lineage. To
test this possibility, EBs were initiated for 2 days in the
presence of serum and then switched to serum-free conditions (SR).
As shown in FIG. 14, EBs generated under these conditions
(serum+/-) expressed HNF3.beta. between days 3 and 5 of
differentiation. AFP was upregulated at day 5 of differentiation.
GATA- 1expression levels were reduced compared to those found in
serum-stimulated EBs. Next, day 6 EBs generated under the serum+/-
conditions were plated in tissue culture grade dishes (to allow
them to adhere) in the presence of the growth factor bFGF. The
dishes were coated with either gelatin or matrigel to determine if
substrate had any impact on further endoderm differentiation. Five
days later, the medium was changed and additional factors were
added to these cultures to promote the development of the liver
lineage. The experimental outline and data are shown in FIG. 15. In
this experiment AFP was not expressed at the day 6 EB stage. Its
levels of expression were upregulated when cultured in the presence
of bFGF on either gelatin of matrigel. Low levels of ALB were also
detected at this stage. ALB expression increased following the
additional culture period in all conditions tested. AAT and TAT
were also expressed following the last culture step. The highest
levels of TAT were found when EB-derived cells were cultured in the
presence of bFGF and Dex. These findings clearly indicate that it
is possible to generate cells of the endoderm lineage and that
under appropriate conditions, they will give rise to cells that
express genes associated with the developing liver.
[0107] It was further determined if these endodermal cells
developed from brachyury.sup.+ or brachyury.sup.- cells. To address
this question, GFP (Bry).sup.+ and GFP (Bry).sup.- cells were
isolated from day 2.5 EBs by cell sorting. These populations were
allowed to reaggregate and cultured as clusters until day 6. On day
6, they were moved to the tissue culture grade dishes in medium
with bFGF for 4 days (total of 10 days). Gene expression analysis
indicated that cells, which express HNF3.beta., segregated to the
GFP.sup.+ fraction (d2.5) (FIG. 16). With time in culture, this
gene was expressed in cells generated from the GFP-fraction. This
likely reflects the fact that at later stages of expression
HNF3.beta. is expressed in non-endodermal population. AFP, HEX, ALB
and HNF4 were all expressed in derivatives of the GFP.sup.+
fraction, but not in cell populations generated from the GFP.sup.-
cells. In contrast, PAX6 and neuroD, markers of neuroectoderm, were
found predominantly in cells generated from the GFP.sup.- fraction.
These findings indicate that the endoderm lineage is established
from a brachyury.sup.+ population, which also gives rise to the
mesodermal lineage, and that these lineages derive from a common
precursor, the mesendoderm.
[0108] To further evaluate the liver potential of the brachyury
expressing cells, cell populations derived from both the bry.sup.+
and bry.sup.- fractions were analyzed for expression of genes
representing early hepatocyte development such as a-fetoprotein
(AFP), albumin (ALB) and transthyretin (TTR) and genes indicative
of maturation of the lineage including alphal-antitrypsin (AAT),
tyrosine aminotransferase (TAT) and carbamoyl phosphate synthetase
I (CPase). .beta.-actin expression was used as a control. Cells
were analyzed prior to sorting and subsequent to sorting into
bry.sup.+ and bry.sup.- populations. Fetal liver and adult liver
controls were also analyzed. Expression of all of these genes was
restricted to the cells derived from the bry.sup.+ population,
indicating that cells with hepatocyte characteristics develop from
brachyury expressing cells.
EXAMPLE 10
Kinetics of Mesoderm and Endoderm Development in EBs
[0109] The preliminary kinetic analysis described in Example 6
demonstrated that subpopulations of mesoderm with distinct
developmental fates were generated in a defined temporal fashion. A
more detailed kinetic analysis showed the dynamic development of
the GFP.sup.+Flk1.sup.- (hereafter referred to as the GFP.sup.+
population) population between days 2.5 and 4.0 of differentiation
(FIG. 18). When isolated and reaggregated, the day 2.5 and 3.0
GFP.sup.+ fractions generated blast cell colonies (indicated as
hemangioblast potential in FIG. 19) that represent the earliest
stages of hematopoietic and endothelial commitment (FIG. 19). This
population of GFP.sup.+ cells displayed little cardiomyocyte
(cardiac) potential. In contrast to the early GFP.sup.+ cells,
those isolated from day 3.5 EBs showed significantly reduced BL-CFC
potential, but were efficient at differentiating into
cardiomyocytes. GFP.sup.+ cells isolated from day 4 EBs did not
give rise to cardiomyoctes and had little capacity to generate
BL-CFC, suggesting they may be fated to some other mesodermal
lineage. Gene expression analysis supported these functional assays
and demonstrated molecular differences between the four GFP.sup.+
fractions (FIG. 20). While some genes were expressed in all
populations, others showed intriguing differential patterns. Wnt3a,
a gene thought to be important for hematopoietic development and
inhibitory for cardiac differentiation, was expressed in the day
2.5 and 3.0 populations and down regulated in the day 3.5 and 4.0
cells. This pattern is consistent with the change in developmental
potential of these populations from hematopoietic/vascular to
cardiac muscle. A second pattern of interest is that of the gene
Mixl-1. This gene, which plays a role in the development of
mesoderm and endoderm, was expressed in the day 2.5 and 3.0 GFP
populations but not in the day 3.5 and 4.0 fractions. Taken
together, the findings of this example clearly demonstrate that
mesoderm populations with different developmental potential are
generated in a defined temporal pattern within the EBs. In
addition, expression analysis of the mesoderm/endoderm gene Mixl-1
indicates that cells with endoderm potential are also generated at
a specific time, namely between day 2.5 and 3.0 of
differentiation.
[0110] To further investigate the kinetics of endoderm development,
GFP.sup.+ cells from day 3.0 and 4.0 EBs were isolated and cultured
under conditions that promote the differentiation into
hepatocyte-like cells. As shown in FIG. 21, GFP.sup.+ cells (+/-)
isolated from day 3.0 but not those from day 4.0 displayed endoderm
potential as defined by expression of HNF3.beta.. These findings
indicate that endoderm is generated within the GFP+population at a
specific period of time, prior to day 4 of differentiation.
EXAMPLE 11
Developmental Potential of GFP.sup.+ Populations In Vivo
[0111] To further evaluate the endoderm potential of the GFP.sup.+
population, GFP.sup.+ and GFP.sup.- day 2.5 EB cells were cultured
for 14 day days under conditions known to promote hepatocyte
differentiation and then transplanted under the kidney capsule of
recipient SCID-beige mice. Several mice were sacrificed immediately
following the transplant, the kidney with the graft was sectioned
and the sections were stained with antibodies against Hep 1 and
AFP. Hep1 is a specific marker of hepatocytes whereas AFP is
expressed in definitive endoderm and immature cells of the
hepatocyte lineage. Some of the cells within the section stained
positive for Hep1, whereas other cells, in the vicinity of the Hep
1.sup.+ cells were found to express AFP. No Hep1.sup.+ or AFP.sup.+
cells were found in the graft of the GFP.sup.- negative cells.
These findings support PCR data and demonstrate that there culture
conditions support the development of cells with characteristics of
immature hepatocytes, as defined by express of Hep1.
[0112] While these transplantation experiments demonstrate the
presence of hepatocyte-like cells in the grafts immediately
following transplantation, it was difficult to monitor the
maturation of these populations over time, as the transplanted
tissues generated tumor-like masses known as teratomas. The
teratomas likely develop from contaminating undifferentiated ES
cells or from GFP.sup.+ primordial germ cells that are known to be
of mesoderm origin and to express brachyury.
EXAMPLE 12
Induction of Mesoderm and Endoderm by Activin
[0113] To further enrich for cells with endodermal potential, the
effects of growth factors known to induce this cell population in
other model systems were tested. Studies in Xenopus have shown that
activin will induce both mesoderm and endoderm from ectoderm in
culture. Of particular interest was the observation that activin
behaved as a morphogen in this model in that it induced different
cell types at different concentrations used. To determine if
activin displayed similar potential in the ES/EB system, it was
added to the EB cultures using the following protocol. ES cells
were differentiated for 2 days in Stem Pro 34 medium without serum.
At this stage, the developing EBs were harvested and recultured in
IMDM supplemented with serum replacement (serum free) and activin
at a concentration of 100 ng/ml. EBs were harvested at different
days and assayed for GFP.sup.+ expression and expression of genes
indicative of ectoderm, mesoderm and endoderm development. As shown
in FIGS. 22A,B this amount of activin-induced brachyury as measured
by GFP. While the kinetics of GFP induction was delayed compared to
EBs differentiated in serum, this concentration of activin did
induce substantial numbers of brachyury positive cells (60%) by day
6 of differentiation. Molecular analysis indicated that the
activin-induced cells expressed a broad spectrum of genes
associated with endoderm development including HNF3.beta., Mixl-1,
Sox17, Hex-1, and pdx-1 (FIG. 23C). Induction of pdx-1 is of
interest, as this gene is essential for pancreas development. Genes
associated with hematopoietic development, such as GA TA-1 and
those indicative of neuroectoderm differentiation such as PAX6 were
not induced by activin.
[0114] To determine if activin displayed morphogenic properties in
the ES differentiation model, different concentrations of the
factor were added to the EB cultures. As little as 1 ng/ml of
activin induced GFP.sup.+ expression (10% of the total population)
by 7 days of culture (FIG. 23A). The frequency of GFP.sup.+ cells
increased to 40% in cultures stimulated with 3 ng/ml and reached
plateau levels of greater than 50% at 30 ng/ml. Gene expression
analysis of these populations indicated that different
concentrations of activin did induce different developmental
programs. EB differentiated in the presence of 1 or 3 ng/ml of
activin showed weak, if any, expression of the genes indicative of
endoderm development (FIG. 23A). HNF3.beta., Sox17, Hex-1 were all
induced in cultures stimulated with 10, 30, or 100 ng/ml of
activin. Pdx-1 expression required the highest amount of activin
and was induced best in EBs stimulated with 100 ng/ml. Neither
GATA1 nor c-fins was expressed at any concentration of activin. The
pattern of PAX6 expression was the reverse to that of the endoderm
genes and was downregulated with increasing concentrations of
activin.
[0115] Activin-induced EBs did not express genes associated with
hematopoietic commitment indicating that this developmental program
was not induced. To further evaluate the hematopoietic potential of
these EBs, they were analyzed for progenitor potential. As expected
from the molecular analysis, these EBs contained no appreciable
numbers of primitive (Ep) or definitive (mac/mix) hematopoietic
progenitors (FIG. 24A). When these activin induced EBs were further
stimulated with serum for 2.5 days, however, they did generate some
hematopoietic progenitors, indicating that they do contain
mesodermal potential (FIG. 24B).
[0116] PCR analysis demonstrated that activin induced expression
HNF3.beta. as well as other genes known to be involved in endoderm
differentiation. To better estimate the proportion of endodermal
progenitors in the activin-induced EBs, cells from cultures
stimulated with 100 ng/ml activin were stained with antibodies
against HNF3.beta. and Hex1. EBs from un-induced cultures were used
as controls (Activin-). A significant portion of the activin
induced population (estimated at 50-60% of total) expressed both
HNF3.beta. and Hex1. None of the cells in the un-induced EBs
expressed these proteins. These findings clearly demonstrate that a
substantial number of cells within these EBs are of the endoderm
lineage.
[0117] To further investigate the potential of these
activin-induced populations, GFP.sup.+ cells were isolated from EBs
stimulated with 3 ng or 100 ng and cultured further (14 day total)
in hepatocyte conductions. As shown in FIG. 25, only cells from the
100 ng cultures differentiated into cells that expressed albumin
consistent with liver differentiation. Taken together, the findings
from these studies indicate that activin functions as a morphogen
in the ES/EB system and that high concentration are required for
endoderm induction.
[0118] If the teratomas generated by the serum-induced
brachyury.sup.+ cells resulted from the presence of primordial germ
cells, it is possible that the activin induced cells may represent
a better source of progenitors for transplantation, as the
germ-cell program may not be induced under these conditions. To
test this hypothesis, GFP.sup.+ and GFP.sup.- cells were isolated
from EBs induced with 100 ng/ml of activin and cultured for 14 days
to promote the differentiation of hepatocyte-like cells. Following
this culture period, the cells were harvested and transplanted to
the kidney capsule of recipient animals. Three weeks following
transplantation, the mice were sacrificed and the kidneys analyzed.
Results are shown in FIGS. 26A-C. All mice engrafted with GFP.sup.-
cells developed large, multilineage teratomas, consisting of cells
from all three germ layers. In contrast, no teratomas were detected
in the animals transplanted with GFP.sup.+ cells. These cells give
rise to differentiated cell masses consisting of endodermal and
mesodermal derived tissues including gut epithelium, bone and
skeletal muscle. In some instances, skin was also observed in the
graft from the GFP.sup.+ cells, suggesting that this lineage might
also develop from a bry.sup.+ cell. These findings indicate that it
is possible to generate GFP.sup.+ populations that give rise to
differentiated tissue without forming teratomas following
transplantation.
EXAMPLE 13
Developmental Potential of bry.sup.+/c-kit.sup.- and
bry.sup.+/c-kit.sup.+ cells
[0119] The foregoing examples clearly indicate that the hepatocyte
lineage develops from a bry.sup.+ cell population that has both
mesoderm and endoderm potential. Analysis of the bry.sup.+ fraction
revealed that a subpopulation of these cells expressed the receptor
tyrosine kinase c-kit (FIG. 27A) and that this population was
distinct from those cells that expressed Flk-1. To determine if
c-kit expression could be a useful marker for the segregation of
cell with endodermal potential, bry.sup.+/c-kit.sup.- (+/-) and
bry.sup.+/c-kit.sup.+ (+/+) cells from day 3 serum-stimulated EBs
were assayed for hepatocyte potential. As shown in FIG. 27B,
HNF3.beta., AFP and ALB expressing cells were all derived from
bry.sup.+/c-kit.sup.+ population. To estimate the endodermal
potential of this fraction, sorted cells were plated onto glass
coverslips and stained with an antibody to HNF3.beta.. Greater than
80% of the bry.sup.+/c-kit.sup.+ cells expressed HNF3.beta.
protein, whereas less than 10% bry.sup.+/c-kit.sup.- were positive.
These findings indicate that endodermal progenitors express both
brachyury and c-kit and that this population is highly enriched for
cells with endoderm potential. Isolation of cells based on
brachyury and c-kit expression provides a novel strategy for the
isolation of endodermal progenitors.
EXAMPLE 14
Developmental Potential of Activin-Induced Cells
[0120] The PCR analysis presented in FIG. 23 indicates that
different concentrations of activin induce different developmental
programs and that cells with endodermal potential are induced with
the highest levels of this factor. To quantify the differential
response of activin, cells stimulated with different concentrations
of activin were adhered to coverslips and stained with the
anti-HNF3.beta. antibody. More than 50% of the entire EB population
stimulated with 100 ng/ml of activin expressed HNF3.beta. whereas
only 10% of the cells stimulated with 3 ng/ml were positive. Only
background levels of staining were observed in the non-stimulated
population. These findings demonstrate that high concentrations of
activin can stimulate a robust endodermal program, representing a
significant portion of entire EB population.
[0121] As a further assessment of the potential of activin treated
cells, day 6 EBs differentiated in the presence of different
concentrations of this factor were transferred to serum replacement
media for 4 days and then replated in hepatocyte conditions for an
additional 4 days. At day 14 of culture, the cells from each group
were harvested and subjected to PCR expression analysis. Expression
of Myf5 and skeletal actin were monitored to evaluate skeletal
muscle development representing an additional mesoderm-derived
lineage. Surfactant protein C (SP-C), a lung-specific gene, was
included as a marker of endoderm differentiation in addition to AFP
and ALB. As shown in FIG. 28, Myf5 and skeletal actin were
expressed in cultures stimulated with as little as 1 ng/ml of
activin and this expression was detected over a broad range of
factor concentrations. Expression of both genes was, however,
downregulated at the highest concentration of activin (100 ng/ml).
Cultures stimulated with low amounts of activin contained groups of
cells with the morphology of skeletal muscle. Immunostaining
demonstrated that these cells expressed both skeletal myosin and
.alpha.-actinin, indicating that they are of the skeletal muscle
lineage. Evaluation of the proportion of replated EBs that
generated skeletal muscle outgrowths was consistent with the gene
expression analysis, as those stimulated with 3 and 10 ng/ml
displayed the most robust skeletal muscle development as depicted
in FIG. 28. The expression patterns of the three endodermal genes
differed from that observed for the skeletal muscle genes. None
were expressed at low activin concentrations and all were readily
detected in cultures stimulated with the highest concentrations of
the factor. Expression of PAX6 was restricted to untreated cultures
and those stimulated with low concentrations of factor. The
findings from this analysis confirm and extend those from Example
12 hereinabove in demonstrating that different concentrations of
activin induce different developmental programs, with low
concentration favoring a mesodermal fate and high concentrations an
endoderm fate. In addition, these results indicate that the
endodermal cells induced by activin are able to differentiate and
give rise to cells with hepatocyte and lung characteristics.
[0122] Brachyury positive and negative populations isolated from
EBs stimulated with low and high concentrations of factor were also
analyzed for expression of the skeletal muscle and endoderm genes.
As shown in FIG. 29, both myf5 and skeletal actin expression were
restricted to the population generated from the bry.sup.+
population isolated from EBs stimulated with 3ng/ml of activin.
Similarly, the endoderm genes were expressed in the
brachyury.sup.+-derived cells isolated from EBs generated in the
presence of 100 ng/ml of factor. These findings further demonstrate
that both mesoderm and endoderm develop from brachyury.sup.+
cells.
EXAMPLE 15
Generation of HNF-CD4 Targeted ES Cells
[0123] In order to track and isolate endodermal as well as
mesodermal populations during EB differentiation, ES cells which
already have GFP targeted to the brachyury locus were targeted with
human CD4 (hCD4) protein into the HNF3 .beta. locus. HNF3 .beta. is
known to be expressed in most endodermal cell types, starting very
early during embryonic development. Kaestner et al. (1994) Genomics
20:177-85. The targeting construct contains the human CD4 cDNA,
truncated at amino acid number 424, and lacks most of the
intracellular domain. This cell surface molecule was chosen because
it cannot transduce signals and there are readily available
antibodies for flow cytometry, which recognize hCD4 and will not
cross react with endogenous mouse CD4. The vector also contains two
regions of homology to the mouse HNF3 .beta. locus, the bovine
growth hormone poly(A) sequence, and a loxp flanked puromycin
cassette as depicted in FIG. 30A. The diptheria toxin A (DTA) gene
was included in the 5' end of the targeting vector to select
against random integration. The targeting vector was constructed as
follows.
[0124] The short arm and long arm of homology were obtained from a
published HNF3B targeting vector. Weinstein et al. (1994) Cell 78:
575-588. The same long arm was used while a 1.8 kb fragment of the
short arm was used to create the hCD4 knock in vector. The short
arm contains part of the HNF3.beta. promoter, exon 1, intron 1, and
part of exon 2, ending just before the endogenous ATG initiation
site. The long arm consists of a 7 kb sequence starting 3 kb
downstream of the end of the last exon. Using standard molecular
biology techniques, hCD4 with a kozak sequence followed by the
bovine growth hormone poly(A) sequence along with a puromycin
cassette was cloned in between the two arms of homology as shown in
FIG. 30A.
[0125] The GFP-Bry ES cells described in example 2 were
electroporated with the HNF3 .beta. targeting vector. The cells
were then selected with puromycin and clones were picked and
expanded. Genomic DNA was isolated, cut with the restriction enzyme
Sac I, and a Southern blot analysis was performed with a probe
upstream of the endogenous ATG as indicated in FIG. 30B. The wild
type allele gives a 3.3 kb band while the targeted allele gives a
2.8 kb sized band. Of 48 clones screened, 2 targeted clones were
generated, corresponding to a 4.2% targeting efficiency. Both
targeted clones were transiently transfected with a modified Cre
recombinase expression vector to remove the puro gene. The targeted
clones are referred to hereinafter as CD4-HNF/GFP-T ES cells.
[0126] HNF3.beta. is expressed transiently in EBs during serum
induced differentiation. To determine whether hCD4 expression in
CD4-HNF/GFP-T ES cells accurately reflects expression of the
HNF3.beta. gene during EB development, CD4 versus GFP expression
was assessed.
[0127] A typical expression pattern of GFP versus hCD4 during a 5
day serum induced EB differentiation is shown in FIG. 31A. ES cells
are low to negative for hCD4 expression. Following differentiation,
hCD4 expression is sharply upregulated specifically in the
GFP.sup.+ cells at day 3. Expression falls rapidly by day 3.5 and
is almost undetectable by day 5. In contrast, GFP expression
persists to day 4 and decreases by day 5. The mean fluorescence
intensity for GFP and hCD4 expression is shown in FIG. 3 1B. It is
seen that hCD4 peaks at day 3 and is lost quickly while GFP peaks
at days 3.5 to 4. Semi-quantitative RT PCR for HNF3.beta. and
Brachyury expression was also performed on the samples (FIG. 31C).
The PCR for the endogenous genes follows what is seen using flow
cytometry for GFP and hCD4. HNF3.beta. and Brachyury are both
expressed by day 3, while HNF3.beta. expression decreases by day
3.5 and is undetectable by day 5. Brachyury expression continues at
high levels up to day 4. These data confirm that hCD4 is mirroring
the expression of endogenous HNF3.beta.. In addition, hCD4
expression is seen to decline along with HNF3.beta. RNA levels,
suggesting that the half live of the hCD4 protein is not
excessively long and can be used to accurately select cells
expressing HNF3.beta.. It is also seen that all GFP.sup.+ cells are
initially hCD4.sup.+, but then rapidly lose expression of hCD4.
This data is suggestive of a mesendoderm precursor to both endoderm
and mesoderm, supporting the data in example 9. This population has
been demonstrated in lower organisms such as c. elegans but has not
been established in mammals. The conditions used above have been
selected for robust mesoderm induction. It is possible that
mesendoderm is formed but is rapidly converted into mesoderm.
EXAMPLE 16
EB Differentiation as a Model for Primitive Streak Formation
[0128] During embryogenesis, both the mesoderm and endoderm
lineages are derived from a structure called the primitive streak.
Beddington and Robertson (1999) Cell 96: 195-209. The primitive
streak is characterized by expression of specific genes such as
Brachyury, which is expressed along the whole streak. HNF3.beta. is
also expressed in the streak, though it has only been detected in
the anterior section. HNF3.beta. expression as demonstrated by hCD4
was seen to be heterogeneous in the Bry-GFP.sup.+ population. It is
possible that serum induction allows development of a group of
primitive streak like cells, with the GFP.sup.+ HNF3.beta..sup.10
cells representing the posterior streak while the GFP.sup.+
HNF3.beta..sup.hi cells correspond to the anterior streak.
[0129] To determine if GFP and hCD4 expression could be used to
separate posterior and anterior primitive streak like cells from
CD4-HNF/GFP-T ES cells, EBs differentiated for 3.25 days were
sorted into three populations: GFP.sup.+ hCD4.sup.lo, GFP.sup.+
hCD4.sup.med, and GFP.sup.+ hCD4.sup.hi (FIG. 32A). There are many
genes that are recognized to be expressed asymmetrically in the
primitive streak. RT PCR was performed on the sorted populations
for genes known to be expressed in either the posterior or anterior
primitive streak (FIG. 32B). The posterior primitive streak
specific genes Fgf8, Evx1, HoxB1, and Tbx6 were all expressed at
higher levels in hCD4.sup.lo and hCD4.sup.med populations compared
to hCD4.sup.hi cells. In contrast, the anterior primitive streak
genes Chordin, Cer1, and Gsc are all expressed at high levels in
hCD4.sup.hi cells, low to negative in hCD4.sup.med cells, and not
at all in hCD4.sup.lo cells. HNF3.beta. expression was also
examined to verify that the hCD4 sorting isolated cells expressing
different levels of the HNF3.beta. gene. The highest levels of
HNF3.beta. were seen in the hCD4.sup.hi population with decreasing
amounts in the hCD4.sup.med and hCD4.sup.lo populations as
expected. To confirm that the expression patterns in the various
hCD4 populations is an accurate representation of gene expression
in the primitive streak, the primitive streaks of day 7.25 mouse
embryos were dissected and analyzed for gene expression. Mice
embryos were used that were derived from the GFP-Bry ES cells. The
anterior, middle, and posterior primitive streak tissues were then
dissected under a fluorescent dissection scope to ensure that the
tissues obtained were from the GFP.sup.+ (primitive streak)
portions of the embryo. FIG. 32C shows the results of RT PCRs
performed from the dissected streak tissues. These data indicate
that the sorted hCD4 populations show similar relative gene
expression profiles for the anterior and posterior genes examined.
These data indicate that the expression of hCD4 and GFP in
CD4-HNF/GFP-T ES cells can be used to isolate cells with gene
expression patterns indicative of the anterior and posterior
primitive streak.
EXAMPLE 17
Function Potentials of Different Populations of hCD4 Expressing
Cells
[0130] Lineage tracing experiments have demonstrated that the
anterior and posterior primitive streak develop into distinct
lineages. The posterior streak gives rise to the yolk sac and
hematopoietic cells while the anterior streak forms endoderm and
anterior mesoderm such as cardiac tissue. Robb and Tam (2004) Sem.
Cell & Dev. Biol. 15: 543-554. To determine if the primitive
streak like cells from EBs behave functionally like the endogenous
primitive streak, CD4-HNF/GFP-T ES cells were differentiated for
3.25 days, sorted for GFP.sup.+ hCD4.sup.lo and GFP.sup.+
hCD4.sup.hi populations and assayed for hematopoietic, cardiac, and
endoderm potential. For all assays, the sorted populations were
allowed to reaggregate for 48 hours in serum free conditions. FIG.
33A shows cardiac potential of sorted cells which were plated onto
matrigel after reaggregation. Individual EBs were scored for the
presence of beating cells 24-48 hours after adhering. Beating EBs
were only seen from the hCD4.sup.hi population at this time point.
FIG. 33B demonstrates hematopoietic potential of the sorted
populations. Cells were trypsinized after reaggregation and plated
in methylcellulose with hematopoietic growth factors. The presences
of hematopoietic colonies were counted 5-7 days later. The majority
of all hematopoietic colonies were found in the hCD4.sup.lo
population. FIG. 33C shows RT PCR for endoderm specific genes of
the sorted populations which were plated onto matrigel in serum
free conditions after reaggregation. Only the hCD4.sup.hi cells
expressed the endodermal genes HNF4, Pdx1, AAT, ALB, and HNF3.beta.
after 5 days on matrigel. These data demonstrate that the
expression of hCD4 and GFP can be used to segregate populations
with different developmental potentials. These potentials are
consistent with hCD4.sup.lo and hCD4.sup.hi cells being similar to
the posterior and anterior primitive streak respectively.
EXAMPLE 18
Activin Signaling and Wnt Signaling are Both Required for ES
Derived Primitive Streak Like Cells
[0131] Studies in mice have demonstrated the importance of Wnt
signaling as well as nodal/activin signaling in gastrulation and
endoderm/mesoderm induction. Liu et. al. (1999) Nat. Genet. 22:
361-4. Example 12 hereinafter demonstrates that activin can induce
both mesodermal and endodermal populations from ES cells in serum
free cultures. To determine the effects of activin and Wnt
signaling on the differentiation of ES derived primitive streak
like cells, CD4-HNF/GFP-T cells were differentiated in serum free
culture with either recombinant Wnt3a or activin A. Both activin
and Wnt can initially induce GFP.sup.+ CD4.sup.+ cells, though Wnt
displays a faster kinetics (FIG. 34A). activin stimulation leads to
high levels of CD4 expression that persist after loss of GFP-Bry
expression at day 6. In contrast, GFP.sup.+ cells induced with Wnt
have lower levels of CD4 and rapidly lose expression by day 5.
activin also induces robust expression of other anterior primitive
streak markers such as Gsc and Cer1 while Wnt does not (FIG. 34B).
Wnt does however stimulate expression of the posterior primitive
streak markers HoxB1 and Tbx6, while activin only induces Tbx6.
These data suggest that activin induces ES anterior primitive
streak cells while Wnt induces ES posterior primitive streak cells.
At day 6, EBs that were stimulated with either activin or Wnt3a
were plated on matrigel in serum free media to allow further
development. After a further 6 days, these cultures were harvested
and endodermal gene expression was determined by RT-PCR (FIG. 34C).
activin induction allowed development of cells expressing the
endodermal genes Alb, Aat, HNF4, and Pdx1, confirming findings in
example 12. However, the Wnt3a induced cultures did not express any
of these markers suggesting that activin signaling is required for
endoderm development.
[0132] Considering that Wnt stimulation induces nodal and activin
treatment induces Wnt3 (FIG. 34B), it is unknown whether
activin/nodal signaling or Wnt Signaling alone can induce primitive
streak formation or whether both factors are required together.
CD4-HNF/GFP-T ES cells were induced with either activin or Wnt in
conjunction with specific inhibitors of these pathways. DKK1 was
used to inhibit Wnt signaling while the small molecule inhibitor
SB-431542 (SB) was used to block Nodal/TGF.beta. signaling. DKK1
functions by binding the Wnt co-receptors, LRP5 and LRP6, which are
essential for activation of the .beta.catenin signaling pathway. SB
is a specific inhibitor of the receptors ALK4, 5, and 7 and thus is
able to block TGF.beta., activin, and Nodal signaling. It does not,
however, block BMP signaling. Inman et. al. (2002) Mol. Pharmacol.
62: 65-74. Both inhibitors completely blocked the development of
GFP.sup.+ CD4.sup.+ cells with either inducer (FIG. 34A). The
primitive streak markers Gsc, Cer1, HoxB1, and Tbx6 were also
absent or greatly reduced (FIG. 34B). This indicates that Wnt and
activin/nodal signaling are required together to induce ES derived
primitive streak like cells. Therefore, to induce mesoderm and
endoderm germ layers and their derivative tissues, both
activin/Nodal and Wnt signals are required initially.
EXAMPLE 19
Activin Signaling and Wnt Inhibition can Induce Endoderm
Differentiation
[0133] Example 12 demonstrated that high levels of activin could
induce endodermal gene expression from EBs differentiated in
completely serum free conditions. Nodal, a key molecule involved in
mesoderm/endoderm induction in vivo, signals through the same
receptors as activin. It is also known that Nodal as well as
inhibitors for Wnt signaling are expressed preferentially in or
around the anterior primitive streak. Considering that the endoderm
forms from the anterior primitive streak, it is possible that
nodal/activin signaling in combination with inhibition of Wnt
signals induces endoderm formation. To test this hypothesis,
CD4-HNF/GFP-T ES cells were differentiated for 3.25 days in serum
and GFP.sup.+ hCD4.sup.med cells were sorted and reaggregated in
serum free media with no factor, DKK1 (Wnt inhibitor), activin, or
activin and DKK1. The effect of these culture conditions on
hCD4-HNF3.beta. and GFP-Bry levels were analyzed by flow cytometry
(FIG. 35A). With serum free media alone, hCD4 expression was lost
after 1 day reaggregation. Inhibition of Wnt signaling by the
addition of DKK1 allowed some cells to retain low levels of hCD4.
Addition of activin allowed the retention of HNF3.beta. levels
similar to newly sorted cells. Lastly, activin and DKK 1 worked
synergistically to increase hCD4 levels almost one log over the
levels after sorting. GFP levels were lost for all of the
conditions tested, suggesting that differentiation was proceeding
in all cultures but that the cultures expressing more hCD4 were
differentiating into endodermal lineages. To further test this
idea, sorted cells reaggregated for two days in the culture
conditions above were washed with serum free media without factors
and plated onto martrigel in serum free media. After 5 days, the
cultures were harvested and gene expression determined by RT PCR.
FIG. 35B shows the expression of several endoderm genes specific
for the pancreas, liver, and intestine. None of these genes were
detected in either media alone or DKK1 treated cultures. Very low
levels of just two of the genes, Pdx1 and ALB were detected in the
cultures treated with activin alone. Treatment with both activin
and DKK1 led to high expression of Pdx1, AAT, HNF4, ALB, Cdx2, and
IFABP. These data demonstrate that the combination of signaling
through the activin receptor and inhibition of Wnt signals by DKK1
treatment induces endoderm formation from a cell population that
would not form endoderm when cultured in media alone. These culture
conditions have the potential to allow the large scale production
of endodermal derived tissues such as the pancreas and liver. These
experiments also demonstrate the utility of the CD4-HNF/GFP-T ES
cells as a tool to assess endoderm development in a quantitative
manner.
* * * * *