U.S. patent application number 10/834397 was filed with the patent office on 2006-01-05 for protein (poly)peptides libraries.
This patent application is currently assigned to Morphosys AG. Invention is credited to Knappik Achim, Pluckthun Andreas, Ge Liming, Peter Pack, Moroney Simon.
Application Number | 20060003334 10/834397 |
Document ID | / |
Family ID | 8219537 |
Filed Date | 2006-01-05 |
United States Patent
Application |
20060003334 |
Kind Code |
A1 |
Achim; Knappik ; et
al. |
January 5, 2006 |
Protein (poly)peptides libraries
Abstract
The present invention relates to synthetic DNA sequences which
encode one or more collections of homologous
proteins/(poly)peptides, and methods for generating and applying
libraries of these DNA sequences. In particular, the invention
relates to the preparation of a library of human-derived antibody
genes by the use of synthetic consensus sequences which cover the
structural repertoire of antibodies encoded in the human genome.
Furthermore, the invention relates to the use of a single consensus
antibody gene as a universal framework for highly diverse antibody
libraries.
Inventors: |
Achim; Knappik; (Grafelfing,
DE) ; Pack; Peter; (Laufstetten, DE) ; Liming;
Ge; (Munchen, DE) ; Simon; Moroney; (Neuried,
DE) ; Andreas; Pluckthun; (Zurich, CH) |
Correspondence
Address: |
HELLER EHRMAN WHITE & MCAULIFFE LLP
1717 RHODE ISLAND AVE, NW
WASHINGTON
DC
20036-3001
US
|
Assignee: |
Morphosys AG
Munich
DE
|
Family ID: |
8219537 |
Appl. No.: |
10/834397 |
Filed: |
April 29, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09490324 |
Jan 24, 2000 |
6828422 |
|
|
10834397 |
Apr 29, 2004 |
|
|
|
PCT/EP96/03647 |
Aug 19, 1996 |
|
|
|
09490324 |
Jan 24, 2000 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/91.2 |
Current CPC
Class: |
C07K 2317/21 20130101;
C12N 15/10 20130101; C07K 16/44 20130101; C07K 16/00 20130101; C07K
2317/622 20130101; C07K 2317/565 20130101; C07K 2319/00 20130101;
C07K 16/242 20130101; C40B 40/02 20130101; C07K 16/2854 20130101;
C07K 16/2896 20130101; C07K 16/18 20130101; C07K 1/047 20130101;
C12N 15/1037 20130101; C07K 16/26 20130101; C07K 16/005
20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 18, 1995 |
EP |
95 11 3021.0 |
Claims
1-55. (canceled)
56. A method of preparing a library of nucleic acids, wherein each
nucleic acid encodes an immunoglobulin variable domain comprising
consensus framework sequences, comprising: (a) identifying a
plurality of immunoglobulin variable domain amino acid sequences,
each comprising four consensus framework regions interspaced by
three complementary determining regions CDR1, CDR2, and CDR3,
wherein said consensus framework regions have been identified by
the following steps: (i) aligning three or more known human
immunoglobulin sequences; (ii) identifying the conserved framework
regions of said known human immunoglobulin sequences; (iii)
comparing the amino acids at each corresponding position of said
conserved framework regions; and (iv) deducing consensus framework
regions from said comparing in step (a)(iii); and (b) synthesizing
a plurality of nucleic acids encoding said plurality of
immunoglobulin variable domain amino acid sequences provided in
step (a), wherein each of said nucleic acids comprises DNA cleavage
sites at the boundary between each consensus framework region and
complementary determining region, and wherein each of said cleavage
sites is unique within said nucleic acid but common to all nucleic
acid sequences of said library at corresponding positions.
57. The method according to claim 56, wherein said known human
immunoglobulin sequences in step (a)(i) are human V.kappa.
immunoglobulin sequences.
58. The method according to claim 56, wherein said known human
immunoglobulin sequences in step (a)(i) are human V.lamda.
immunoglobulin sequences.
59. The method according to claim 56, wherein said known human
immunoglobulin sequences in step (a)(i) are human VH immunoglobulin
sequences.
60. The method according to claim 57, wherein said nucleic acids
synthesized in step (b) are selected from the group consisting of
V.kappa.1 (SEQ ID NO:42), V.kappa.2 (SEQ ID NO: 44), V.kappa.3 (SEQ
ID NO: 46), and V.kappa.4 (SEQ ID NO: 48).
61. The method according to claim 58, wherein said nucleic acids
synthesized in step (b) are selected from the group consisting of
V.lamda.1 (SEQ ID NO:50), V.lamda.2 (SEQ ID NO: 52), and V.lamda.3
(SEQ ID NO: 54).
62. The method according to claim 59, wherein said nucleic acids
synthesized in step (b) are selected from the group consisting of
VH1A (SEQ ID NO:56), VH1B (SEQ ID NO: 58), VH2 (SEQ ID NO: 60), VH3
(SEQ ID NO: 62), VH4 (SEQ ID NO: 64), VH5 (SEQ ID NO: 66), and VH6
(SEQ ID NO: 68).
63. The method according to claim 56, further comprising inserting
said nucleic acids into an expression vector.
64. The method according to claim 63. The method according to claim
83, wherein said nucleic acids encoding said immunoglobulin
variable domain amino acid sequences comprise codons that are
frequently used in said host cell.
65. The method according to claim 64, wherein said host cell is E.
coli.
66. The method according to claim 65, wherein said expression
vector is a phagemid vector.
67. The method according to claim 56, wherein said CDR1 is selected
from the group consisting of VH CDR1 germline sequences.
68. The method according to claim 67, wherein said CDR1 is selected
from the group consisting of VH1-12-1, VH1-13-16, VH2-31-10,
VH3-13-8, VH4-11-7, CH5-12-1, and VH6-35-1.
69. The method according to claim 56, wherein said CDR1 is selected
from the group consisting of V.lamda. CDR1 germline sequences.
70. The method according to claim 69, wherein said CDR1 is selected
from the group consisting of VHUMLV86, DPL11, and DPL23.
71. The method according to claim 56, wherein said CDR1 is selected
from the group consisting of V.kappa. CDR1 germline sequences.
72. The method according to claim 71, wherein said CDR1 is selected
from the group consisting of V.kappa.1-14, V.kappa.2-6,
V.kappa.33-1, and V.kappa.4-1.
73. The method according to claim 56, wherein said CDR2 is selected
from the group consisting of VH CDR2 germline sequences.
74. The method according to claim 73, wherein said CDR2 is selected
from the group consisting of VH1-12-1, VH1-13-6, VH2-31-3,
VH3-13-8, VH4-11-8, VH4-31-17, VH5-12-1, and VH6-35-1.
75. The method according to claim 56, wherein said CDR2 is selected
from the group consisting of V.lamda. CDR2 germline sequences.
76. The method according to claim 75, wherein said CDR2 is selected
from the group consisting of DPL5, DPL12, and HUMLV318.
77. The method according to claim 56, wherein said CDR2 is selected
from the group consisting of V.kappa. CDR2 germline sequences.
78. The method according to claim 77, wherein said CDR2 is selected
from the group consisting of V.kappa.1-2, V.kappa.2-6, V.kappa.3-4,
and V.kappa.4-1.
79. The method according to claim 56, wherein said CDR3 is selected
from random amino acid sequences.
80. The method according to claim 56 wherein said CDR3 is an amino
acid sequence selected from V.kappa. CDR3 sequences comprising the
amino acid sequence N1-Gln-N-3-N4-N-5-N6-N-7-N8-Thr, wherein: N1 is
an amino acid selected from the group consisting of Phe, His, Leu,
Met, and Gln; N3 is an amino acid other than Cys or Pro; N4 is an
amino acid selected from the group consisting of Asp, Gly, Asn,
Ser, and Phe; N5 is an amino acid selected from the group
consisting of Asp, Gly, Asn, and Ser; N6 is an amino acid other
than Cys; N7 is Pro or Ser; and N8 is an amino acid other than
Cys.
81. The method according to claim 56 wherein said CDR3 is an amino
acid sequence selected from V.lamda. CDR3 sequences comprising the
amino acid sequence Gln-Ser-N-3-Asp-N-5-N6-N-7-N8-N-9-N10, wherein:
N1 is an amino acid selected from the group consisting of Arg, Trp,
or Phe; N3 is an amino acid other than Cys or Pro; N5 is an amino
acid other then Cys or Trp; N6 is an amino acid other than Cys or
Trp; N7 is an amino acid other than Cys or Trp; N8 is an amino acid
other than Cys or Trp or N8 is absent; N9 is an amino acid other
than Cys or Trp or N9 is absent; and N10 is an amino acid other
than Cys.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to synthetic DNA sequences
which encode one or more collections of homologous
proteins/(poly)peptides, and methods for generating and applying
libraries of these DNA sequences. In particular, the invention
relates to the preparation of a library of human-derived antibody
genes by the use of synthetic consensus sequences which cover the
structural repertoire of antibodies encoded in the human genome.
Furthermore, the invention relates to the use of a single consensus
antibody gene as a universal framework for highly diverse antibody
libraries.
BACKGROUND TO THE INVENTION
[0002] All current recombinant methods which use libraries of
proteins/(poly)peptides, e.g. antibodies, to screen for members
with desired properties, e.g. binding a given ligand, do not
provide the possibility to improve the desired properties of the
members in an easy and rapid manner. Usually a library is created
either by inserting a random oligonucleotide sequence into one or
more DNA sequences cloned from an organism, or a family of DNA
sequences is cloned and used as the library. The library is then
screened, e.g. using phage display, for members which show the
desired property. The sequences of one or more of these resulting
molecules are then determined. There is no general procedure
available to improve these molecules further on.
[0003] Winter (EP 0 368 684 B1) has provided a method for
amplifying (by PCR), cloning, and expressing antibody variable
region genes. Starting with these genes he was able to create
libraries of functional antibody fragments by randomizing the CDR3
of the heavy and/or the light chain. This process is functionally
equivalent to the natural process of VJ and VDJ recombination which
occurs during the development of B-cells in the immune system.
[0004] However the Winter invention does not provide a method for
optimizing the binding affinities of antibody fragments further on,
a process which would be functionally equivalent to the naturally
occurring phenomenon of "affinity maturation", which is provided by
the present invention. Furthermore, the Winter invention does not
provide for artificial variable region genes, which represent a
whole family of structurally similar natural genes, and which can
be assembled from synthetic DNA oligonucleotides. Additionally,
Winter does not enable the combinatorial assembly of portions of
antibody variable regions, a feature which is provided by the
present invention. Furthermore, this approach has the disadvantage
that the genes of all antibodies obtained in the screening
procedure have to be completely sequenced, since, except for the
PCR priming regions, no additional sequence information about the
library members is available. This is time and labor intensive and
potentially leads to sequencing errors.
[0005] The teaching of Winter as well as other approaches have
tried to create large antibody libraries having high diversity in
the complementarity determining regions (CDRs) as well as in the
frameworks to be able to find antibodies against as many different
antigens as possible. It has been suggested that a single universal
framework may be useful to build antibody libraries, but no
approach has yet been successful.
[0006] Another problem lies in the production of reagents derived
from antibodies. Small antibody fragments show exciting promise for
use as therapeutic agents, diagnostic reagents, and for biochemical
research. Thus, they are needed in large amounts, and the
expression of antibody fragments, e.g. Fv, single-chain Fv (scFv),
or Fab in the periplasm of E. coli (Skerra & Pluckthun, 1988;
Better et al., 1988) is now used routinely in many laboratories.
Expression yields vary widely, however. While some fragments yield
up to several mg of functional, soluble protein per liter and OD of
culture broth in shake flask culture (Carter et al., 1992,
Pluckthun et al. 1996), other fragments may almost exclusively lead
to insoluble material, often found in so-called inclusion bodies.
Functional protein may be obtained from the latter in modest yields
by a laborious and time-consuming refolding process. The factors
influencing antibody expression levels are still only poorly
understood. Folding efficiency and stability of the antibody
fragments, protease lability and toxicity of the expressed proteins
to the host cells often severely limit actual production levels,
and several attempts have been tried to increase expression yields.
For example, Knappik & Pluckthun (1995) could show that
expression yield depends on the antibody sequence. They identified
key residues in the antibody framework which influence expression
yields dramatically. Similarly, Ullrich et al. (1995) fount that
point mutations in the CDRs can increase the yields in periplasmic
antibody fragment expression. Nevertheless, these strategies are
only applicable to a few antibodies. Since the Winter invention
uses existing repertoires of antibodies, no influence on
expressibility of the genes is possible.
[0007] Furthermore, the findings of Knappik & Pluckthun ard
Ullrich demonstrate that the knowledge about antibodies, especially
about folding and expression is still increasing. The Winter
invention does not allow to incorporate such improvements into the
library design.
[0008] The expressibility of the genes is important for the library
quality as well, since the screening procedure relies in most cases
on the display of the gene product on a phage surface, and
efficient display relies on at least moderate expression of the
gene.
[0009] These disadvantages of the existing methodologies are
overcome by the present invention, which is applicable for all
collections of homologous proteins. It has the following novel and
useful features illustrated in the following by antibodies as an
example:
[0010] Artificial antibodies and fragments thereof can be
constructed based on known antibody sequences, which reflect the
structural properties of a whole group of homologous antibody
genes. Therefore it is possible to reduce the number of different
genes without any loss in the structural repertoire. This approach
leads to a limited set of artificial genes, which can be
synthesized de novo, thereby allowing introduction of cleavage
sites and removing unwanted cleavages sites. Furthermore, this
approach enables (i), adapting the codon usage of the genes to that
of highly expressed genes in any desired host cell and (ii),
analyzing all possible pairs of antibody light (L) and heavy (H)
chains in terms of interaction preference, antigen preference or
recombinant expression titer, which is virtually impossible using
the complete collection of antibody genes of an organism and all
combinations thereof.
[0011] The use of a limited set of completely synthetic genes makes
it possible to create cleavage sites at the boundaries of encoded
structural sub-elements. Therefore, each gene is built up from
modules which represent structural sub-elements on the
protein/(poly)peptide level. In the case of antibodies, the modules
consist of "framework" and "CDR" modules. By creating separate
framework and CDR modules, different combinatorial assembly
possibilities are enabled. Moreover, if two or more artificial
genes carry identical pairs of cleavage sites at the boundaries of
each of the genetic sub-elements, pre-built libraries of
sub-elements can be inserted in these genes simultaneously, without
any additional information related to any particular gene sequence.
This strategy enables rapid optimization of, for example, antibody
affinity, since DNA cassettes encoding libraries of genetic
sub-elements can be (i), pre-built, stored and reused and (ii),
inserted in any of these sequences at the right position without
knowing the actual sequence or having to determine the sequence of
the individual library member.
[0012] Additionally, new information about amino acid residues
important for binding, stability, or solubility and expression
could be integrated into the library design by replacing existing
modules with modules modified according to the new
observations.
[0013] The limited number of consensus sequences used for creating
the library allows to speed up the identification of binding
antibodies after screening. After having identified the underlying
consensus gene sequence, which could be done by sequencing or by
using fingerprint restriction sites, just those part(s) comprising
the random sequence(s) have to be determined. This reduces the
probability of sequencing errors and of false-positive results.
[0014] The above mentioned cleavage sites can be used only if they
are unique in the vector system where the artificial genes have
been inserted. As a result, the vector has to be modified to
contain none of these cleavage sites. The construction of a vector
consisting of basic elements like resistance gene and origin of
replication, where cleavage sites have been removed, is of general
interest for many cloning attempts. Additionally, these vector(s)
could be part of a kit comprising the above mentioned artificial
genes and pre-built libraries.
[0015] The collection of artificial genes can be used for a rapid
humanization procedure of non-human antibodies, preferably of
rodent antibodies. First, the amino acid sequence of the non-human,
preferably rodent antibody is compared with the amino acid
sequences encoded by the collection of artificial genes to
determine the most homologous light and heavy framework regions.
These genes are then used for insertion of the genetic sub-elements
encoding the CDRs of the non-human, preferably rodent antibody.
[0016] Surprisingly, it has been found that with a combination of
only one consensus sequence for each of the light and heavy chains
of a scFv fragment an antibody repertoire could be created yielding
antibodies against virtually every antigen. Therefore, one aspect
of the present invention is the use of a single consensus sequence
as a universal framework for the creation of useful (poly)peptide
libraries and antibody consensus sequences useful therefor.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The present invention enables the creation of useful
libraries of (poly)peptides. In a first embodiment, the invention
provides for a method of setting up nucleic acid sequences suitable
for the creation of said libraries. In a first step, a collection
of at least three homologous proteins is identified and then
analyzed. Therefore, a database of the protein sequences is
established where the protein sequences are aligned to each other.
The database is used to define subgroups of protein sequences which
show a high degree of similarity in both the sequence and, if
information is available, in the structural arrangement. For each
of the subgroups a (poly)peptide sequence comprising at least one
consensus sequence is deduced which represents the members of this
subgroup; the complete collection of (poly)peptide sequences
represent therefore the complete structural repertoire of the
collection of homologous proteins. These artificial (poly)peptide
sequences are then analyzed, if possible, according to their
structural properties to identify unfavorable interactions between
amino acids within said (poly)peptide sequences or between said or
other (poly)peptide sequences, for example, in multimeric proteins.
Such interactions are then removed by changing the consensus
sequence accordingly. The (poly)peptide sequences are then analyzed
to identify sub-elements such as domains, loops, helices or CDRs.
The amino acid sequence is backtranslated into a corresponding
coding nucleic acid sequence which is adapted to the codon usage of
the host planned for expressing said nucleic acid sequences. A set
of cleavage sites is set up in a way that each of the sub-sequences
encoding the sub-elements identified as described above, is flanked
by two sites which do not occur a second time within the nucleic
acid sequence. This can be achieved by either identifying a
cleavage site already flanking a sub-sequence of by changing one or
more nucleotides to create the cleavage site, and by removing that
site from the remaining part of the gene. The cleavage sites should
be common to all corresponding sub-elements or sub-sequences, thus
creating a fully modular arrangement of the sub-sequences in the
nucleic acid sequence and of the sub-elements in the corresponding
(poly)peptide.
[0018] In a further embodiment, the invention provides for a method
which sets up two or more sets of (poly)peptides, where for each
set the method as described above is performed, and where the
cleavage sites are not only unique within each set but also between
any two sets. This method can be applied for the creation of
(poly)peptide libraries comprising for example two .alpha.-helical
domains from two different proteins, where said library is screened
for novel hetero-association domains.
[0019] In yet a further embodiment, at least two of the sets as
described above, are derived from the same collection of proteins
or at least a part of it. This describes libraries comprising for
example, but not limited to, two domains from antibodies such as VH
and VL, or two extracellular loops of transmembrane receptors.
[0020] In another embodiment, the nucleic acid sequences set up as
described above, are synthesized. This can be achieved by any one
of several methods well known to the practitioner skilled in the
art, for example, by total gene synthesis or by PCR-based
approaches.
[0021] In one embodiment, the nucleic acid sequences are cloned
into a vector. The vector could be a sequencing vector, an
expression vector or a display (e.g. phage display) vector, which
are well known to those skilled in the art. Any vector could
comprise one nucleic acid sequence, or two or more nucleic
sequences, either in different or the same operon. In the last
case, they could either be cloned separately or as contiguous
sequences.
[0022] In one embodiment, the removal of unfavorable interactions
as described above, leads to enhanced expression of the modified
(poly)peptides.
[0023] In a preferred embodiment, one or more sub-sequences of the
nucleic acid sequences are replaced by different sequences. This
can be achieved by excising the sub-sequences using the conditions
suitable for cleaving the cleavage sites adjacent to or at the end
of the sub-sequence, for example, by using a restriction enzyme at
the corresponding restriction site under the conditions well known
to those skilled in the art, and replacing the sub-sequence by a
different sequence compatible with the cleaved nucleic acid
sequence. In a further preferred embodiment, the different
sequences replacing the initial sub-sequence(s) are genomic or
rearranged genomic sequences, for example in grafting CDRs from
non-human antibodies onto consensus antibody sequences for rapid
humanization of non-human antibodies. In the most preferred
embodiment, the different sequences are random sequences, thus
replacing the sub-sequence by a collection of sequences to
introduce variability and to create a library. The random sequences
can be assembled in various ways, for example by using a mixture of
mononucleotides or preferably a mixture of trinucleotides (Virnekas
et al., 1994) during automated oligonucleotide synthesis, by
error-prone PCR or by other methods well known to the practitioner
in the art. The random sequences may be completely randomized or
biased towards or against certain codons according to the amino
acid distribution at certain positions in known protein sequences.
Additionally, the collection of random sub-sequences may comprise
different numbers of codons, giving rise to a collection of
sub-elements having different lengths.
[0024] In another embodiment, the invention provides for the
expression of the nucleic acid sequences from a suitable vector and
under suitable conditions well known to those skilled in the
art.
[0025] In a further preferred embodiment, the (poly)peptides
expressed from said nucleic acid sequences are screened and,
optionally, optimized. Screening may be performed by using one of
the methods well known to the practitioner in the art, such as
phage-display, selectively infective phage, polysome technology to
screen for binding, assay systems for enzymatic activity or protein
stability. (Poly)peptides having the desired property can be
identified by sequencing of the corresponding nucleic acid sequence
or by amino acid sequencing or mass spectrometry. In the case of
subsequent optimization, the nucleic acid sequences encoding the
initially selected (poly)peptides can optionally be used without
sequencing. Optimization is performed by repeating the replacement
of sub-sequences by different sequences, preferably by random
sequences, and the screening step one or more times.
[0026] The desired property the (poly)peptides are screened for is
preferably, but not exclusively, selected from the group of
optimized affinity or specificity for a target molecule, optimized
enzymatic activity, optimized expression yields, optimized
stability and optimized solubility.
[0027] In one embodiment, the cleavage sites flanking the
sub-sequences are sites recognized and cleaved by restriction
enzymes, with recognition and cleavage sequences being either
identical or different, the restricted sites either having blunt or
sticky ends.
[0028] The length of the sub-elements is preferably, but not
exclusively ranging between 1 amino acid, such as one residue in
the active site of an enzyme or a structure-determining residue,
and 150 amino acids, as for whole protein domains. Most preferably,
the length ranges between 3 and 25 amino acids, such as most
commonly found in CDR loops of antibodies.
[0029] The nucleic acid sequences could be RNA or, preferably,
DNA.
[0030] In one embodiment, the (poly)peptides have an amino acid
pattern characteristic of a particular species. This can for
example be achieved by deducing the consensus sequences from a
collection of homologous proteins of just one species, most
preferably from a collection of human proteins. Since the
(poly)peptides comprising consensus sequences are artificial, they
have to be compared to the protein sequence(s) having the closest
similarity to ensure the presence of said characteristic amino acid
pattern.
[0031] In one embodiment, the invention provides for the creation
of libraries of (poly)peptides comprising at least part of members
or derivatives of the immunoglobulin superfamily, preferably of
member or derivatives of the immunoglobulins. Most preferably, the
invention provides for the creation of libraries of human
antibodies, wherein said (poly)peptides are or are derived from
heavy or light chain variable regions wherein said structural
sub-elements are framework regions (FR) 1, 2, 3, or 4 or
complementary determining regions (CDR) 1, 2, or 3. In a first
step, a database of published antibody sequences of human origin is
established where the antibody sequences are aligned to each other.
The database is used to define subgroups of antibody sequences
which show a high degree of similarity in both the sequence and the
canonical fold of CDR loops (as determined by analysis of antibody
structures). For each of the subgroups a consensus sequence is
deduced which represents the members of this subgroup; the complete
collection of consensus sequences represent therefore the complete
structural repertoire of human antibodies.
[0032] These artificial genes are then constructed e.g. by total
gene synthesis or by the use of synthetic genetic subunits. These
genetic subunits correspond to structural sub-elements on the
(poly)peptide level. On the DNA level, these genetic subunits are
defined by cleavage sites at the start and the end of each of the
sub-elements, which are unique in the vector system. All genes
which are members of the collection of consensus sequences are
constructed such that they contain a similar pattern of
corresponding genetic sub-sequences. Most preferably, said
(poly)peptides are or are derived from the HuCAL consensus genes:
V.kappa.1, V.kappa.2, V.kappa.3, V.kappa.4, V.lamda.1, V.lamda.2,
V.lamda.3, VH1A, VH1B, VH2, VH3, VH4, VH5, VH6, C.kappa., C.pi.,
CH1 or any combination of said HuCAL consensus genes.
[0033] This collection of DNA molecules can then be used to create
libraries of antibodies or antibody fragments, preferably Fv,
disulphide-linked Fv, single-chain Fv (scFv), or Fab fragments,
which may be used as sources of specificities against new target
antigens. Moreover, the affinity of the antibodies can be optimized
using pre-built library cassettes and a general procedure. The
invention provides a method for identifying one or more genes
encoding one or more antibody fragments which binds to a target,
comprising the steps of expressing the antibody fragments, and then
screening them to isolate one or more antibody fragments which bind
to a given target molecule. Preferably, an scFv fragment library
comprising the combination of HuCAL VH3 and HuCAL V.lamda.2
consensus genes and at least a random sub-sequence encoding the
heavy chain CDR3 sub-element is screened for binding antibodies. If
necessary, the modular design of the genes can then be used to
excise from the genes encoding the antibody fragments one or more
genetic sub-sequences encoding structural sub-elements, and
replacing them by one or more second sub-sequences encoding
structural sub-elements. The expression and screening steps can
then be repeated until an antibody having the desired affinity is
generated.
[0034] Particularly preferred is a method in which one or more of
the genetic subunits (e.g. the CDRs) are replaced by a random
collection of sequences (the library) using the said cleavage
sites. Since these cleavage sites are (i) unique in the vector
system and (ii) common to all consensus genes, the same (pre-built)
library can be inserted into all artificial antibody genes. The
resulting library is then screened against any chosen antigen.
Binding antibodies are selected, collected and used as starting
material for the next library. Here, one or more of the remaining
genetic subunits are randomized as described above.
[0035] A further embodiment of the present invention relates to
fusion proteins by providing for a DNA sequence which encodes both
the (poly)peptide, as described above, as well as an additional
moiety. Particularly preferred are moieties which have a useful
therapeutic function. For example, the additional moiety may be a
toxin molecule which is able to kill cells (Vitetta et al., 1993).
There are numerous examples of such toxins, well known to the one
skilled in the art, such as the bacterial toxins Pseudomonas
exotoxin A, and diphtheria toxin, as well as the plant toxins
ricin, abrin, modeccin, saporin, and gelonin. By fusing such a
toxin for example to an antibody fragment, the toxin can be
targeted to, for example, diseased cells, and thereby have a
beneficial therapeutic effect. Alternatively, the additional moiety
may be a cytokine, such as IL-2 (Rosenberg & Lotze, 1986),
which has a particular effect (in this case a T-cell proliferative
effect) on a family of cells. In a further embodiment, the
additional moiety may confer on its (poly)peptide partner a means
of detection and/or purification. For example, the fusion protein
could comprise the modified antibody fragment and an enzyme
commonly used for detection purposes, such as alkaline phosphatase
(Blake et al., 1984). There are numerous other moieties which can
be used as detection or purification tags, which are well known to
the practitioner skilled in the art. Particularly preferred are
peptides comprising at least five histidine residues (Hochuli et
al., 1988), which are able to bind to metal ions, and can therefore
be used for the purification of the protein to which they are fused
(Lindner et al., 1992). Also provided for by the invention are
additional moieties such as the commonly used C-myc and FLAG tags
(Hopp et al., 1988; Knappik & Pluckthun, 1994).
[0036] By engineering one or more fused additional domains,
antibody fragments or any other (poly)peptide can be assembled into
larger molecules which also fall under the scope of the present
invention. For example, mini-antibodies (Pack, 1994) are dimers
comprising two antibody fragments, each fused to a self-associating
dimerization domain. Dimerization domains which are particularly
preferred include those derived from a leucine zipper (Pack &
Pluckthun, 1992) or helix-turn-helix motif (Pack et al., 1993).
[0037] All of the above embodiments of the present invention can be
effected using standard techniques of molecular biology known to
anyone skilled in the art.
[0038] In a further embodiment, the random collection of
sub-sequences (the library) is inserted into a singular nucleic
acid sequence encoding one (poly)peptide, thus creating a
(poly)peptide library based on one universal framework. Preferably
a random collection of CDR sub-sequences is inserted into a
universal antibody framework, for example into the HuCAL H3.kappa.2
single-chain Fv fragment described above.
[0039] In further embodiments, the invention provides for nucleic
acid sequence(s), vector(s) containing the nucleic acid
sequence(s), host cell(s) containing the vector(s), and
(poly)peptides, obtainable according to the methods described
above.
[0040] In a further preferred embodiment, the invention provides
for modular vector systems being compatible with the modular
nucleic acid sequences encoding the (poly)peptides. The modules of
the vectors are flanked by restriction sites unique within the
vector system and essentially unique with respect to the
restriction sites incorporated into the nucleic acid sequences
encoding the (poly)peptides, except for example the restriction
sites necessary for cloning the nucleic acid sequences into the
vector. The list of vector modules comprises origins of
single-stranded replication, origins of double-stranded replication
for high- and low copy number plasmids, promotor/operator,
repressor or terminator elements, resistance genes, potential
recombination sites, gene III for display on filamentous phages,
signal sequences, purification and detection tags, and sequences of
additional moieties.
[0041] The vectors are preferably, but not exclusively, expression
vectors or vectors suitable for expression and screening of
libraries.
[0042] In another embodiment, the invention provides for a kit,
comprising one or more of the list of nucleic acid sequence(s),
recombinant vector(s), (poly)peptide(s), and vector(s) according to
the methods described above, and suitable host cell(s) for
producing the (poly)peptide(s).
[0043] In a preferred embodiment, the invention provides for the
creation of libraries of human antibodies. In a first step, a
database of published antibody sequences of human origin is
established: The database is used to define subgroups of antibody
sequences which show a high degree of similarity in both the
sequence and the canonical fold (as determined by analysis of
antibody structures). For each of the subgroups a consensus
sequence is deduced which represents the members of this subgroup;
the complete collection of consensus sequences represent therefore
the complete structural repertoire of human antibodies.
[0044] These artificial genes are then constructed by the use of
synthetic genetic subunits. These genetic subunits correspond to
structural sub-elements on the protein level. On the DNA level,
these genetic subunits are defined by cleavage sites at the start
and the end of each of the subelements, which are unique in the
vector system. All genes which are members of the collection of
consensus sequences are constructed such that they contain a
similar pattern of said genetic subunits.
[0045] This collection of DNA molecules can then be used to create
libraries of antibodies which may be used as sources of
specificities against new target antigens. Moreover, the affinity
of the antibodies can be optimised using pre-built library
cassettes and a general procedure. The invention provides a method
for identifying one or more genes encoding one or more antibody
fragments which binds to a target, comprising the steps of
expressing the antibody fragments, and then screening them to
isolate one or more antibody fragments which bind to a given target
molecule. If necessary, the modular design of the genes can then be
used to excise from the genes encoding the antibody fragments one
or more genetic sub-sequences encoding structural sub-elements, and
replacing them by one or more second sub-sequences encoding
structural sub-elements. The expression and screening steps can
then be repeated until an antibody having the desired affinity is
generated.
[0046] Particularly preferred is a method in which one or more or
the genetic subunits (e.g. the CDR's) are replaced by a random
collection of sequences (the library) using the said cleavage
sites. Since these cleavage sites are (i) unique in the vector
system and (ii) common to all consensus genes, the same (pre-built)
library can be inserted into all artificial antibody genes. The
resulting library is then screened against any chosen antigen.
Binding antibodies are eluted, collected and used as starting
material for the next library. Here, one or more of the remaining
genetic subunits are randomised as described above.
Definitions
Protein:
[0047] The term protein comprises monomeric polypeptide chains as
well as homo- or heteromultimeric complexes of two or more
polypeptide chains connected either by covalent interactions (such
as disulphide bonds) or by non-covalent interactions (such as
hydrophobic or electrostatic interactions).
Analysis of Homologous Proteins:
[0048] The amino acid sequences of three or more proteins are
aligned to each other (allowing for introduction of gaps) in a way
which maximizes the correspondence between identical or similar
amino acid residues at all positions. These aligned sequences are
termed homologous if the percentage of the sum of identical and/or
similar residues exceeds a defined threshold. This threshold is
commonly regarded by those skilled in the art as being exceeded
when at least 15% of the amino acids in the aligned genes are
identical, and at least 30% are similar. Examples for families of
homologous proteins are: immunoglobulin superfamily, scavenger
receptor superfamily, fibronectin superfamilies (e.g. type II and
III), complement control protein superfamily, cytokine receptor
superfamily, cystine knot proteins, tyrosine kinases, and numerous
other examples well known to one of ordinary skill in the art.
Consensus Sequence:
[0049] Using a matrix of at least three aligned amino acid
sequences, and allowing for gaps in the alignment, it is possible
to determine the most frequent amino acid residue at each position.
The consensus sequence is that sequence which comprises the amino
acids which are most frequently represented at each position. In
the event that two or more amino acids are equally represented at a
single position, the consensus sequence includes both or all of
those amino acids.
Removing Unfavorable Interactions:
[0050] The consensus sequence is per se in most cases artificial
and has to be analyzed in order to change amino acid residues
which, for example, would prevent the resulting molecule to adapt a
functional tertiary structure or which would block the interaction
with other (poly)peptide chains in multimeric complexes. This can
be done either by (i) building a three-dimensional model of the
consensus sequence using known related structures as a template,
and identifying amino acid residues within the model which may
interact unfavorably with each other, or (ii) analyzing the matrix
of aligned amino acid sequences in order to detect combinations of
amino acid residues within the sequences which frequently occur
together in one sequence and are therefore likely to interact with
each other. These probable interaction-pairs are then tabulated and
the consensus is compared with these "interaction maps". Missing or
wrong interactions in the consensus are repaired accordingly by
introducing appropriate changes in amino acids which minimize
unfavorable interactions.
Identification of Structural Sub-Elements:
[0051] Structural sub-elements are stretches of amino acid residues
within a protein/(poly)peptide which correspond to a defined
structural or functional part of the molecule. These can be loops
(e.g. CDR loops of an antibody) or any other secondary or
functional structure within the protein/(poly)peptide (domains,
.alpha.-helices, .beta.-sheets, framework regions of antibodies,
etc.). A structural sub-element can be identified using known
structures of similar or homologous (poly)peptides, or by using the
above mentioned matrices of aligned amino acid sequences. Here the
variability at each position is the basis for determining stretches
of amino acid residues which belong to a structural sub-element
(e.g. hypervariable regions of an antibody).
Sub-Sequence:
[0052] A sub-sequence is defined as a genetic module which is
flanked by unique cleavage sites and encodes at least one
structural sub-element. It is not necessarily identical to a
structural sub-element.
Cleavage Site:
[0053] A short DNA sequence which is used as a specific target for
a reagent which cleaves DNA in a sequence-specific manner (e.g.
restriction endonucleases).
Compatible Cleavage Sites:
[0054] Cleavage sites are compatible with each other, if they can
be efficiently ligated without modification and, preferably, also
without adding an adapter molecule.
Unique Cleavage Sites:
[0055] A cleavage site is defined as unique if it occurs only once
in a vector containing at least one of the genes of interest, or if
a vector containing at least one of the genes of interest could be
treated in a way that only one of the cleavage sites could be used
by the cleaving agent.
Corresponding (Poly)Peptide Sequences:
[0056] Sequences deduced from the same part of one group of
homologous proteins are called corresponding (poly)peptide
sequences.
Common Cleavage Sites:
[0057] A cleavage site in at least two corresponding sequences,
which occurs at the same functional position (i.e. which flanks a
defined sub-sequence), which can be hydrolyzed by the same cleavage
tool and which yields identical compatible ends is termed a common
cleavage site.
Excising Genetic Sub-Sequences:
[0058] A method which uses the unique cleavage sites and the
corresponding cleavage reagents to cleave the target DNA at the
specified positions in order to isolate, remove or replace the
genetic sub-sequence flanked by these unique cleavage sites.
Exchanging Genetic Sub-Sequences:
[0059] A method by which an existing sub-sequence is removed using
the flanking cleavage sites of this sub-sequence, and a new
sub-sequence or a collection of sub-sequences, which contain ends
compatible with the cleavage sites thus created, is inserted.
Expression of Genes:
[0060] The term expression refers to in vivo or in vitro processes,
by which the information of a gene is transcribed into mRNA and
then translated into a protein/(poly)peptide. Thus, the term
expression refers to a process which occurs inside cells, by which
the information of a gene is transcribed into mRNA and then into a
protein. The term expression also includes all events of
post-translational modification and transport, which are necessary
for the (poly)peptide to be functional.
Screening of Protein/(Poly)Peptide Libraries:
[0061] Any method which allows isolation of one or more
proteins/(poly)peptides having a desired property from other
proteins/(poly)peptides within a library.
Amino Acid Pattern Characteristic for a Species:
[0062] A (poly)peptide sequence is assumed to exhibit an amino acid
pattern characteristic for a species if it is deduced from a
collection of homologous proteins from just this species.
Immunoglobulin Superfamily (IgSF):
[0063] The IgSF is a family of proteins comprising domains being
characterized by the immunoglobulin fold. The IgSF comprises for
example T-cell receptors and the immunoglobulins (antibodies).
Antibody Framework:
[0064] A framework of an antibody variable domain is defined by
Kabat et al. (1991) as the part of the variable domain which serves
as a scaffold for the antigen binding loops of this variable
domain.
Antibody CDR:
[0065] The CDRs (complementarity determining regions) of an
antibody consist of the antigen binding loops, as defined by Kabat
et al. (1991). Each of the two variable domains of an antibody Fv
fragment contain three CDRs.
HuCAL:
[0066] Acronym for Human Combinatorial Antibody Library. Antibody
Library based on modular consensus genes according to the invention
(see Example 1).
Antibody Fragment:
[0067] Any portion of an antibody which has a particular function,
e.g. binding of antigen. Usually, antibody fragments are smaller
than whole antibodies. Examples are Fv, disulphide-linked Fv,
single-chain Fv (scFv), or Fab fragments. Additionally, antibody
fragments are often engineered to include new functions or
properties.
Universal Framework:
[0068] One single framework which can be used to create the full
variability of functions, specificities or properties which is
originally sustained by a large collection of different frameworks,
is called universal framework.
Binding of an Antibody to its Target:
[0069] The process which leads to a tight and specific association
between an antibody and a corresponding molecule or ligand is
called binding. A molecule or ligand or any part of a molecukle or
ligand which is recognized by an antibody is called the target.
Replacing Genetic Sub-Sequences
[0070] A method by which an existing sub-sequence is removed using
the flanking cleavage sites of this sub-sequence, and a new
sub-sequence or collection of sub-sequences, which contains ends
compatible with the cleavage sites thus created, is inserted.
Assembling of Genetic Sequences:
[0071] Any process which is used to combine synthetic or natural
genetic sequences in a specific manner in order to get longer
genetic sequences which contain at least parts of the used
synthetic or natural genetic sequences.
Analysis of Homologous Genes:
[0072] The corresponding amino acid sequences of two or more genes
are aligned to each other in a way which maximizes the
correspondence between identical or similar amino acid residues at
all positions. These aligned sequences are termed homologous if the
percentage of the Sum of identical and/or similar residues exceeds
a defined threshold. This threshold is commonly regarded by those
skilled in the art as being exceeded when at least 15 percent of
the amino acids in the aligned genes are identical, and at least 30
percent are similar.
LEGENDS TO FIGURES AND TABLES
[0073] FIG. 1: Flow chart outlining the process of construction of
a synthetic human antibody library based on consensus
sequences.
[0074] FIG. 2: Alignment of consensus sequences designed for each
subgroup (amino acid residues are shown with their standard
one-letter abbreviation). (A) kappa sequences, (B) lambda sequences
and (C), heavy chain sequences. The positions are numbered
according to Kabat (1991). In order to maximize homology in the
alignment, gaps (-) have been introduced in the sequence at certain
positions.
[0075] FIG. 3: Gene sequences of the synthetic V kappa consensus
genes. The corresponding amino acid sequences (see FIG. 2) as well
as the unique cleavage sites are also shown.
[0076] FIG. 4: Gene sequences of the synthetic V lambda consensus
genes. The corresponding amino acid sequences (see FIG. 2) as well
as the unique cleavage sites are also shown.
[0077] FIG. 5: Gene sequences of the synthetic V heavy chain
consensus genes. The corresponding amino acid sequences (see FIG.
2) as well as the unique cleavage sites are also shown.
[0078] FIG. 6: Oligonucleotides used for construction of the
consensus genes. The oligos are named according to the
corresponding consensus gene, e.g. the gene V.kappa.1 was
constructed using the six oligonucleotides O1K1 to O1K6. The
oligonucleotides used for synthesizing the genes encoding the
constant domains C.kappa. (OCLK1 to 8) and CH1 (OCH1 to 8) are also
shown.
[0079] FIG. 7A/B: Sequences of the synthetic genes encoding the
constant domains C.kappa. (A) and CH1 (B). The corresponding amino
acid sequences as well as unique cleavage sites introduced in these
genes are also shown.
[0080] FIG. 7C: Functional map and sequence of module M24
comprising the synthetic C.lamda. gene segment (huCL lambda).
[0081] FIG. 7D: Oligonucleotides used for synthesis of module
M24.
[0082] FIG. 8: Sequence and restriction map of the synthetic gene
encoding the consensus single-chain fragment VH3-V.kappa.2. The
signal sequence (amino acids 1 to 21) was derived from the E. coli
phoA gene (Skerra & Pluckthun, 1988). Between the phoA signal
sequence and the VH3 domain, a short sequence stretch encoding 4
amino acid residues (amino acid 22 to 25) has been inserted in
order to allow detection of the single-chain fragment in Western
blot or ELISA using the monoclonal antibody M1 (Knappik &
Pluckthun, 1994). The last 6 basepairs of the sequence were
introduced for cloning purposes (EcoRI site).
[0083] FIG. 9: Plasmid map of the vector pIG10.3 used for phage
display of the H3.kappa.2 scFv fragment. The vector is derived from
pIG10 and contains the gene for the lac operon repressor, lacI, the
artificial operon encoding the H3.kappa.2-gene3ss fusion under
control of the lac promoter, the lpp terminator of transcription,
the single-strand replication origin of the E. coli phage f1
(F1_ORI), a gene encoding .beta.-lactamase (bla) and the ColEI
derived origin of replication.
[0084] FIG. 10: Sequencing results of independent clones from the
initial library, translated into the corresponding amino acid
sequences. (A) Amino acid sequence of the VH3 consensus heavy chain
CDR3 (position 93 to 102, Kabat numbering). (B) Amino acid
sequences of 12 clones of the 10-mer library. (C) Amino acid
sequences of 11 clones of the 15-mer library, single base
deletion.
[0085] FIG. 11: Expression test of individual library members. (A)
Expression of 9 independent clones of the 10-mer library. (B)
Expression of 9 independent clones of the 15-mer library. The lane
designated with M contains the size marker. Both the gp3-scFv
fusion and the scFv monomer are indicated.
[0086] FIG. 12: Enrichment of specific phage antibodies during the
panning against FITC-BSA. The initial as well as the subsequent
fluorescein-specific sub-libraries were panned against the blocking
buffer and the ratio of the phage eluted from the FITC-BSA coated
well vs. that from the powder milk coated well from each panning
round is presented as the "specificity factor".
[0087] FIG. 13: Phage ELISA of 24 independent clones after the
third round of panning tested for binding on FITC-BSA.
[0088] FIG. 14: Competition ELISA of selected FITC-BSA binding
clones. The ELISA signals (OD.sub.405 nm) of scFv binding without
inhibition are taken as 100%.
[0089] FIG. 15: Sequencing results of the heavy chain CDR3s of
independent clones after 3 rounds of panning against FITC-BSA,
translated into the corresponding amino acid sequences (position 93
to 102. Kabat numbering).
[0090] FIG. 16: Coomassie-Blue stained SDS-PAGE of the purified
anti-fluorescein scFv fragments: M: molecular weight marker, A:
total soluble cell extract after induction, B: fraction of the
flow-through, C, D and E: purified scFv fragments 1HA-3E4, 1HA-3E5
and 1HA-3E10, respectively.
[0091] FIG. 17: Enrichment of specific phage antibodies during the
panning against .beta.-estradiol-BSA, testosterone-BSA, BSA, ESL-1,
interleukin-2, lymphotoxin-.beta., and LeY-BSA after three rounds
of panning.
[0092] FIG. 18: ELISA of selected ESL-1 and .beta.-estradiol
binding clones.
[0093] FIG. 19: Selectivity and cross-reactivity of HuCAL
antibodies: in the diagonal specific binding of HuCAL antibodies
can be seen, off-diagonal signals show non-specific
cross-reactivity.
[0094] FIG. 20: Sequencing results of the heavy chain CDR3s of
independent clones after 3 rounds of panning against
.beta.-estradiol-BSA, translated into the corresponding amino acid
sequences (position 93 to 102, Kabat numbering). One clone is
derived from the 10mer library.
[0095] FIG. 21: Sequencing results of the heavy chain CDR3s of
independent clones after 3 rounds of panning against
testosterone-BSA, translated into the corresponding amino acid
sequences (position 93 to 102, Kabat numbering).
[0096] FIG. 22: Sequencing results of the heavy chain CDR3s of
independent clones after 3 rounds of panning against
lymphotoxin-.beta., translated into the corresponding amino acid
sequences (position 93 to 102, Kabat numbering). One clone
comprises a 14mer CDR, presumably introduced by incomplete coupling
of the trinucleotide mixture during oligonucleotide synthesis.
[0097] FIG. 23: Sequencing results of the heavy chain CDR3s of
independent clones after 3 rounds of panning against ESL-1,
translated into the corresponding amino acid sequences (position 93
to 102, Kabat numbering). Two clones are derived from the 10mer
library. One clone comprises a 16mer CDR, presumably introduced by
chain elongation during oligonucleotide synthesis using
trinucleotides.
[0098] FIG. 24: Sequencing results of the heavy chain CDR3s of
independent clones after 3 rounds of panning against BSA,
translated into the corresponding amino acid sequences (position 93
to 102, Kabat numbering).
[0099] FIG. 25: Schematic representation of the modular pCAL vector
system.
[0100] FIG. 25a: List of restriction sites already used in or
suitable for the modular HuCAL genes and pCAL vector system.
[0101] FIG. 26: List of the modular vector elements for the pCAL
vector series: shown are only those restriction sites which are
part of the modular system.
[0102] FIG. 27: Functional map and sequence of the multi-cloning
site module (MCS).
[0103] FIG. 28: Functional map and sequence of the pMCS cloning
vector series.
[0104] FIG. 29: Functional map and sequence of the pCAL module M1
(see FIG. 26).
[0105] FIG. 30: Functional map and sequence of the pCAL module
M7-III (see FIG. 26).
[0106] FIG. 31: Functional map and sequence of the pCAL module
M9-II (see FIG. 26).
[0107] FIG. 32: Functional map and sequence of the pCAL module
M11-II (see FIG. 26).
[0108] FIG. 33: Functional map and sequence of the pCAL module
M14-Ext2 (see FIG. 26).
[0109] FIG. 34: Functional map and sequence of the PCAL module M17
(see FIG. 26).
[0110] FIG. 35: Functional map and sequence of the modular vector
pCAL4.
[0111] FIG. 35a: Functional maps and sequences of additional pCAL
modules (M2, M3, M7I, M7II, M8, M10II, M11II, M12, M13, M19, M20,
M21, M41) and of low-copy number plasmid vectors (pCALO1 to
pCALO3).
[0112] FIG. 35b: List of oligonucleotides and primers used for
synthesis of pCAL vector modules.
[0113] FIG. 36: Functional map and sequence of the .beta.-lactamase
cassette for replacement of CDRs for CDR library cloning.
[0114] FIG. 37: Oligo and primer design for V.kappa. CDR3 libraries
FIG. 38: Oligo and primer design for V.lamda. CDR3 libraries.
[0115] FIG. 39: Functional map of the pBS13 expression vector
series.
[0116] FIG. 40: Expression of all 49 HuCAL scFvs obtained by
combining each of the 7 VH genes with each of the 7 VL genes
(pBS13, 30.degree. C.); Values are given for the percentage of
soluble vs. insoluble material, the total and the soluble amount
compared to the combination H3.kappa.2, which was set to 100%. In
addition, the corresponding values for the McPC603 scFv are
given.
[0117] Table 1: Summary of human immunoglobulin germline sequences
used for computing the germline membership of rearranged sequences.
(A) kappa sequences, (B) lambda sequences and (C), heavy chain
sequences. (1) The germline name used in the various calculations,
(2) the references number for the corresponding sequence (see
appendix for sequence related citations), (3) the family where each
sequence belongs to and (4), the various names found in literature
for germline genes with identical amino acid sequences.
[0118] Table 2: Rearranged human sequences used for the calculation
of consensus sequences. (A) kappa sequences, (B) lambda sequences
and (C), heavy chain sequences. The table summarized the name of
the sequence (1), the length of the sequence in amino acids (2),
the germline family (3) as well as the computed germline
counterpart (4). The number of amino acid exchanges between the
rearranged sequence and the germline sequence is tabulated in (5),
and the percentage of different amino acids is given in (6). Column
(7) gives the references number for the corresponding sequence (see
appendix for sequence related citations).
[0119] Table 3: Assignment of rearranged V sequences to their
germline counterparts. (A) kappa sequences, (B) lambda sequences
and (C), heavy chain sequences. The germline genes are tabulated
according to their family (1), and the number of rearranged genes
found for every germline gene is given in (2).
[0120] Table 4: Computation of the consensus sequence of the
rearranged V kappa sequences. (A), V kappa subgroup 1, (B), V kappa
subgroup 2, (C), V kappa subgroup 3 and (D), V kappa subgroup 4.
The number of each amino acid found at each position is tabulated
together with the statistical analysis of the data. (1) Amino acids
are given with their standard one-letter abbreviations (and B means
D or N, Z means E or Q and X means any amino acid). The statistical
analysis summarizes the number of sequences found at each position
(2), the number of occurrences of the most common amino acid (3),
the amino acid residue which is most common at this position (4),
the relative frequency of the occurrence of the most common amino
acid (5) and the number of different amino acids found at each
position (6).
[0121] Table 5: Computation of the consensus sequence of the
rearranged V lambda sequences. (A), V lambda subgroup 1, (B), V
lambda subgroup 2, and (C), V lambda subgroup 3. The number of each
amino acid found at each position is tabulated together with the
statistical analysis of the data. Abbreviations are the same as in
Table 4.
[0122] Table 6: Computation of the consensus sequence of the
rearranged V heavy chain sequences. (A), V heavy chain subgroup 1A,
(B), V heavy chain subgroup 1B, (C), V heavy chain subgroup 2, (D),
V heavy chain subgroup 3, (E), V heavy chain subgroup 4, (F), V
heavy chain subgroup 5, and (G), V heavy chain subgroup 6. The
number of each amino acid found at each position is tabulated
together with the statistical analysis of the data. Abbreviations
are the same as in Table 4.
EXAMPLES
Example 1
Design of a Synthetic Human Combinatorial Antibody Library
(HuCAL)
[0123] The following example describes the design of a fully
synthetic human combinatorial antibody library (HuCAL), based on
consensus sequences of the human immunoglobulin repertoire, and the
synthesis of the consensus genes. The general procedure is outlined
in FIG. 1.
1.1 Sequence Database
1.1.1 Collection and Alignment of Human Immunoglobulin
Sequences
[0124] In a first step, sequences of variable domains of human
immunoglobulins have been collected and divided into three sub
bases: V heavy chain (VH), V kappa (V.kappa.) and V lambda
(V.lamda.). For each sequence, the gene sequence was then
translated into the corresponding amino acid sequence.
Subsequently, all amino acid sequences were aligned according to
Kabat et al. (1991). In the case of V.lamda. sequences, the
numbering system of Chuchana et al. (1990) was used. Each of the
three main databases was then divided into two further sub bases:
the first sub base contained all sequences derived from rearranged
V genes, where more than 70 positions of the sequence were known.
The second sub base contained all germline gene segments (without
the D- and J-minigenes; pseudogenes with internal stop codons were
also removed). In all cases, where germline sequences with
identical amino acid sequence but different names were found, only
one sequence was used (see Table 1). The final databases of
rearranged sequences contained 386, 149 and 674 entries for
V.kappa., V.lamda. and VH, respectively. The final databases of
germline sequences contained 48, 26 and 141 entries for V.kappa.,
V.lamda. and VH, respectively.
1.1.2 Assignment of Sequences to Subgroups
[0125] The sequences in the three germline databases where then
grouped according to sequence homology (see also Tomlinson et al.,
1992, Williams & Winter, 1993, and Cox et al., 1994). In the
case of V.kappa., 7 families could be established. V.lamda. was
divided into 8 families and VH into 6 families. The VH germline
genes of the VH7 family (Van Dijk et al., 1993) were grouped into
the VH1 family, since the genes of the two families are highly
homologous. Each family contained different numbers of germline
genes, varying from 1 (for example VH6) to 47 (VH3).
1.2 Analysis of Sequences
1.2.1 Computation of Germline Membership
[0126] For each of the 1209 amino acid sequences in the databases
of rearranged genes, the nearest germline counterpart, i.e. the
germline sequence with the smallest number of amino acid
differences was then calculated. After the germline counterpart was
found, the number of somatic mutations which occurred in the
rearranged gene and which led to amino acid exchanges could be
tabulated. In 140 cases, the germline counterpart could not be
calculated exactly, because more than one germline gene was found
with an identical number of amino acid exchanges. These rearranged
sequences were removed from the database. In a few cases, the
number of amino acid exchanges was found to be unusually large
(>20 for VL and >25 for VH), indicating either heavily
mutated rearranged genes or derivation from germline genes not
present in the database. Since it was not possible to distinguish
between these two possibilities, these sequences were also removed
from the database. Finally, 12 rearranged sequences were removed
from the database because they were found to have very unusual CDR
lengths and composition or unusual amino acids at canonical
positions (see below). In summary, 1023 rearranged sequences out of
1209 (85%) could be clearly assigned to their germline counterparts
(see Table 2).
[0127] After this calculation, every rearranged gene could be
arranged in one of the families established for the germline genes.
Now the usage of each germline gene, i.e. the number of rearranged
genes which originate from each germline gene, could be calculated
(see Table 2). It was found that the usage was strongly biased
towards a subset of germline genes, whereas most of the germline
genes were not present as rearranged genes in the database and
therefore apparently not used in the immune system (Table 3). This
observation had already been reported in the case of V.kappa. (Cox,
et al., 1994). All germline gene families, where no or only very
few rearranged counterparts could be assigned, were removed from
the database, leaving 4 V.kappa., 3 V.lamda., and 6 VH
families.
1.2.2 Analysis of CDR Conformations
[0128] The conformation of the antigen binding loops of antibody
molecules, the CDRs, is strongly dependent on both the length of
the CDRs and the amino acid residues located at the so-called
canonical positions (Chothia & Lesk, 1987). It has been found
that only a few canonical structures exist, which determine the
structural repertoire of the immunoglobulin variable domains
(Chothia et al., 1989). The canonical amino acid positions can be
found in CDR as well as framework regions. The 13 used germline
families defined above (7 VL and 6 VH) were now analyzed for their
canonical structures in order to define the structural repertoire
encoded in these families.
[0129] In 3 of the 4 V.kappa. families (V.kappa.1, 2 and 4), one
different type of CDR1 conformation could be defined for every
family. The family V.kappa.3 showed two types of CDR1 conformation:
one type which was identical to V.kappa.1 and one type only found
in V.kappa.3. All V.kappa. CDR2s used the same type of canonical
structure. The CDR3 conformation is not encoded in the germline
gene segments. Therefore, the 4 V.kappa. families defined by
sequence homology and usage corresponded also to 4 types of
canonical structures found in V.kappa. germline genes.
[0130] The 3 V.lamda. families defined above showed 3 types of CDR1
conformation, each family with one unique type. The V.lamda.1
family contained 2 different CDR1 lengths (13 and 14 amino acids),
but identical canonical residues, and it is thought that both
lengths adopt the same canonical conformation (Chothia & Lesk,
1987). In the CDR2 of the used V.lamda. germlines, only one
canonical conformation exists, and the CDR3 conformation is not
encoded in the germline gene segments. Therefore, the 3 V.lamda.
families defined by sequence homology and usage corresponded also
to 3 types of canonical structures.
[0131] The structural repertoire of the human VH sequences was
analyzed in detail by Chothia et al., 1992. In total, 3
conformations of CDR1 (H1-1, H1-2 and H1-3) and 6 conformations of
CDR2 (H2-1, H2-2, H2-3, H2-4, H2-5 and H2-x) could be defined.
Since the CDR3 is encoded in the D- and J-minigene segments, no
particular canonical residues are defined for this CDR.
[0132] All the members of the VH1 family defined above contained
the CDR1 conformation H1-1, but differed in their CDR2
conformation: the H2-2 conformation was found in 6 germline genes,
whereas the conformation H2-3 was found in 8 germline genes. Since
the two types of CDR2 conformations are defined by different types
of amino acid at the framework position 72, the VH1 family was
divided into two subfamilies: VH1A with CDR2 conformation H2-2 and
VH1B with the conformation H2-3 The members of the VH2 family all
had the conformations H1-3 and H2-1 in CDR1 and CDR2, respectively.
The CDR1 conformation of the VH3 members was found in all cases to
be H1-1, but 4 different types were found in CDR2 (H2-1, H2-3, H2-4
and H2-x). In these CDR2 conformations, the canonical framework
residue 71 is always defined by an arginine. Therefore, it was not
necessary to divide the VH3 family into subfamilies, since the 4
types of CDR2 conformations were defined solely by the CDR2 itself.
The same was true for the VH4 family. Here, all 3 types of CDR1
conformations were found, but since the CDR1 conformation was
defined by the CDR itself (the canonical framework residue 26 was
found to be glycine in all cases), no subdivisions were necessary.
The CDR2 conformation of the VH4 members was found to be H2-1 in
all cases. All members of the VH5 family were found to have the
conformation H1-1 and H2-2, respectively. The single germline gene
of the VH6 family had the conformations H1-3 and H2-5 in CDR1 and
CDR2, respectively.
[0133] In summary, all possible CDR conformations of the V.kappa.
and V.lamda. genes were present in the 7 families defined by
sequence comparison. From the 12 different CDR conformations found
in the used VH germline genes, 7 could be covered by dividing the
family VH1 into two subfamilies, thereby creating 7 VH families.
The remaining 5 CDR conformations (3 in the VH3 and 2 in the VH4
family) were defined by the CDRs themselves and could be created
during the construction of CDR libraries. Therefore, the structural
repertoire of the used human V genes could be covered by 49
(7.times.7) different frameworks.
1.2.3 Computation of Consensus Sequences
[0134] The 14 databases of rearranged sequences (4 V.kappa., 3
V.lamda., and 7 VH) were used to compute the HuCAL consensus
sequences of each subgroup (4 HuCAL-V.kappa., 3 HuCAL-V.lamda., 7
HuCAL-VH, see Table 4, 5 and 6). This was done by counting the
number of amino acid residues used at each position (position
variability) and subsequently identifying the amino acid residue
most frequently used at each position. By using the rearranged
sequences instead of the used germline sequences for the
calculation of the consensus, the consensus was weighted according
to the frequency of usage. Additionally, frequently mutated and
highly conserved positions could be identified. The consensus
sequences were cross-checked with the consensus of the germline
families to see whether the rearranged sequences were biased at
certain positions towards amino acid residues which do not occur in
the collected germline sequences, but this was found not to be the
case. Subsequently, the number of differences of each of the 14
consensus sequences to each of the germline sequences found in each
specific family was calculated. The overall deviation from the most
homologous germline sequence was found to be 2.4 amino acid
residues (s.d.=2.7), ensuring that the "artificial" consensus
sequences can still be considered as truly human sequences as far
as immunogenicity is concerned.
1.3 Structural Analysis
[0135] So far, only sequence information was used to design the
consensus sequences. Since it was possible that during the
calculation certain artificial combinations of amino acid residues
have been created, which are located far away in the sequence but
have contacts to each other in the three dimensional structure,
leading to destabilized or even misfolded frameworks, the 14
consensus sequences were analyzed according to their structural
properties.
[0136] It was rationalized that all rearranged sequences present in
the database correspond to functional and therefore correctly
folded antibody molecules. Hence, the most homologous rearranged
sequence was calculated for each consensus sequence. The positions
where the consensus differed from the rearranged sequence were
identified as potential "artificial residues" and inspected.
[0137] The inspection itself was done in two directions. First, the
local sequence stretch around each potentially "artificial residue"
was compared with the corresponding stretch of all the rearranged
sequences. If this stretch was found to be truly artificial, i.e.
never occurred in any of the rearranged sequences, the critical
residue was converted into the second most common amino acid found
at this position and analyzed again. Second, the potentially
"artificial residues" were analyzed for their long range
interactions. This was done by collecting all available structures
of human antibody variable domains from the corresponding PDB files
and calculating for every structure the number and type of
interactions each amino acid residue established to each
side-chain. These "interaction maps" were used to analyze the
probable side-chain/side-chain interactions of the potentially
"artificial residues". As a result of this analysis, the following
residues were exchanged (given is the name of the gene, the
position according to Kabat's numbering scheme, the amino acid
found at this position as the most abundant one and the amino acid
which was used instead): [0138] VH2: S.sub.65T [0139] V.kappa.1:
N.sub.34A, [0140] V.kappa.3: G.sub.9A, D.sub.60A, R.sub.77S [0141]
V.lamda.3: V.sub.78T 1.4 Design of CDR Sequences
[0142] The process described above provided the complete consensus
sequences derived solely from the databases of rearranged
sequences. It was rationalized that the CDR1 and CDR2 regions
should be taken from the databases of used germline sequences,
since the CDRs of rearranged and mutated sequences are biased
towards their particular antigens. Moreover, the germline CDR
sequences are known to allow binding to a variety of antigens in
the primary immune response, where only CDR3 is varied. Therefore,
the consensus CDRs obtained from the calculations described above
were replaced by germline CDRs in the case of VH and V.kappa.. In
the case of V.lamda., a few amino acid exchanges were introduced in
some of the chosen germline CDRs in order to avoid possible
protease cleavage sites as well as possible structural
constraints.
[0143] The CDRs of following germline genes have been chosen:
TABLE-US-00001 HuCAL gene CDR1 CDR2 HuCAL-VH1A VH1-12-1 VH1-12-1
HuCAL-VH1B VH1-13-16 VH1-13-6, -7, -8, -9 HuCAL-VH2 VH2-31-10, -11,
VH2-31-3, -4 -12, -13 HuCAL-VH3 VH3-13-8, -9, -10 VH3-13-8, -9, -10
HuCAL-VH4 VH4-11-7 to -14 VH4-11-8, -9, -11, -12, -14, -16
VH4-31-17, -18, -19, -20 HuCAL-VH5 VH5-12-1, -2 VH5-12-1, -2
HuCAL-VH6 VH6-35-1 VH6-35-1 HuCAL-V.kappa.1 V.kappa.1-14, -15
V.kappa.1-2, -3, -4, -5, -7, -8, -12, -13, -18, -19 HuCAL-V.kappa.2
V.kappa.2-6 V.kappa.2-6 HuCAL-V.kappa.3 V.kappa.3-1, -4 V.kappa.3-4
HuCAL-V.kappa.4 V.kappa.4-1 V.kappa.4-1 HuCAL-V.lamda.1 HUMLV117,
DPL5 DPL5 HuCAL-V.lamda.2 DPL11, DPL12 DPL12 HuCAL-V.lamda.3 DPL23
HUMLV318
[0144] In the case of the CDR3s, any sequence could be chosen since
these CDRs were planned to be the first to be replaced by
oligonucleotide libraries. In order to study the expression and
folding behavior of the consensus sequences in E. coli, it would be
useful to have all sequences with the same CDR3, since the
influence of the CDR3s on the folding behavior would then be
identical in all cases. The dummy sequences QQHYTTPP and
ARWGGDGFYAMDY were selected for the VL chains (kappa and lambda)
and for the VH chains, respectively. These sequences are known to
be compatible with antibody folding in E. coli (Carter et al.,
1992).
1.5 Gene Design
[0145] The final outcome of the process described above was a
collection of 14 HuCAL amino acid sequences, which represent the
frequently used structural antibody repertoire of the human immune
system (see FIG. 2). These sequences were back-translated into DNA
sequences. In a first step, the back-translation was done using
only codons which are known to be frequently used in E. coli. These
gene sequences were then used for creating a database of all
possible restriction endonuclease sites, which could be introduced
without changing the corresponding amino acid sequences. Using this
database, cleavage sites were selected which were located at the
flanking regions of all sub-elements of the genes (CDRs and
framework regions) and which could be introduced in all HuCAL VH,
V.kappa. or V.lamda. genes simultaneously at the same position. In
a few cases it was not possible to find cleavage sites for all
genes of a subgroup. When this happened, the amino acid sequence
was changed, if this was possible according to the available
sequence and structural information. This exchange was then
analyzed again as described above. In total, the following 6 amino
acid residues were exchanged during this design (given is the name
of the gene, the position according to Kabat's numbering scheme,
the amino acid found at this position as the most abundant one and
the amino acid which was used instead): [0146] VH2: T.sub.3Q [0147]
VH6: S.sub.42G [0148] V.kappa.3: E.sub.1D, I.sub.58V [0149]
V.kappa.4: K.sub.24R [0150] V.lamda.3: T.sub.22S
[0151] In one case (5'-end of VH framework 3) it was not possible
to identify a single cleavage site for all 7 VH genes. Two
different type of cleavage sites were used instead: BstEII for
HuCAL VH1A, VH1B, VH4 and VH5, and NspV for HuCAL VH2, VH3, VH4 and
VH6.
[0152] Several restriction endonuclease sites were identified,
which were not located at the flanking regions of the sub-elements
but which could be introduced in every gene of a given group
without changing the amino acid sequence. These cleavage sites were
also introduced in order to make the system more flexible for
further improvements. Finally, all but one remaining restriction
endonuclease sites were removed in every gene sequence. The single
cleavage site, which was not removed was different in all genes of
a subgroup and could be therefore used as a "fingerprint" site to
ease the identification of the different genes by restriction
digest. The designed genes, together with the corresponding amino
acid sequences and the group-specific restriction endonuclease
sites are shown in FIGS. 3, 4 and 5, respectively.
1.6 Gene Synthesis and Cloning
[0153] The consensus genes were synthesized using the method
described by Prodromou & Pearl, 1992, using the
oligonucleotides shown in FIG. 6. Gene segments encoding the human
constant domains C.kappa., C.lamda. and CH1 were also synthesized,
based on sequence information given by Kabat et al., 1991 (see FIG.
6 and FIG. 7). Since for both the CDR3 and the framework 4 gene
segments identical sequences were chosen in all HuCAL V.kappa.,
V.lamda. and VH genes, respectively, this part was constructed only
once, together with the corresponding gene segments encoding the
constant domains. The PCR products were cloned into pCR-Script
KS(+) (Stratagene, Inc.) or pZErO-1 (Invitrogen, Inc.) and verified
by sequencing.
Example 2
Cloning and Testing of a HuCAL-Based Antibody Library
[0154] A combination of two of the synthetic consensus genes was
chosen after construction to test whether binding antibody
fragments can be isolated from a library based on these two
consensus frameworks. The two genes were clones as a single-chain
Fv (scFv) fragment, and a VH-CDR3 library was inserted. In order to
test the library for the presence of functional antibody molecules,
a selection procedure was carried out using the small hapten
fluorescein bound to BSA (FITC-BSA) as antigen.
2.1 Cloning of the HuCAL VH3-Vk2 scFv Fragment
[0155] In order to test the design of the consensus genes, one
randomly chosen combination of synthetic light and heavy gene
(HuCAL-V.kappa.2 and HuCAL-VH3) was used for the construction of a
single-chain antibody (scFv) fragment. Briefly, the gene segments
encoding the VH3 consensus gene and the CH1 gene segment including
the CDR3-framework 4 region, as well as the V.kappa.2 consensus
gene and the C.kappa. gene segment including the CDR3-framework 4
region were assembled yielding the gene for the VH3-CH1 Fd fragment
and the gene encoding the V.kappa.2-C.kappa. light chain,
respectively. The CH1 gene segment was then replaced by an
oligonucleotide cassette encoding a 20-mer peptide linker with the
sequence AGGGSGGGGSGGGGSGGGGS. The two oligonucleotides encoding
this linker were
5'-TCAGCGGGTGGCGGTTCTGGCGGCGGTGGGAGCGGTGGCGGTGGTTCTGGCGGTGGTGGTTCCGATATCG-
GTCCACGTACGG-3' and
5'-AATTCCGTACGTGGACCGATATCGGAACCACCACCGCCAGAACCACCGCCACCGCTCCCACCGC
CGCCAGAACCGCCACCCGC-3', respectively. Finally, the HuCAL-V.kappa.2
gene was inserted via EcoRV and BsiWI into the plasmid encoding the
HuCAL-VH3-linker fusion, leading to the final gene
HuCAL-VH3-V.kappa.2, which encoded the two consensus sequences in
the single-chain format VH-linker-VL. The complete coding sequence
is shown in FIG. 8.
2.2 Construction of a Monovalent Phage-Display Phagemid Vector
pIG10.3
[0156] Phagemid pIG10.3 (FIG. 9) was constructed in order to create
a phage-display system (Winter et al., 1994) for the H3.kappa.2
scFv gene. Briefly, the EcoRI/HindIII restriction fragment in the
phagemid vector pIG10 (Ge et al., 1995) was replaced by the c-myc
followed by an amber codon (which encodes an glutamate in the
amber-suppresser strain XL1 Blue and a stop codon in the
non-suppresser strain JM83) and a truncated version of the gene III
(fusion junction at codon 249, see Lowman et al., 1991) through PCR
mutagenesis.
2.3 Construction of H-CDR3 Libraries
[0157] Heavy chain CDR3 libraries of two lengths (10 and 15 amino
acids) were constructed using trinucleotide codon containing
oligonucleotides (Virnekas et al., 1994) as templates and the
oligonucleotides complementing the flanking regions as primers. To
concentrate only on the CDR3 structures that appear most often in
functional antibodies, we kept the salt-bridge of R.sub.H94 and
D.sub.H101 in the CDR3 loop. For the 15-mer library, both
phenylalanine and methionine were introduced at position 100 since
these two residues were found to occur quite often in human CDR3s
of this length (not shown). For the same reason, valine and
tyrosine were introduced at position 102. All other randomized
positions contained codons for all amino acids except cystein,
which was not used in the trinucleotide mixture.
[0158] The CDR3 libraries of lengths 10 and 15 were generated from
the PCR fragments using oligonucleotide templates O3HCDR103T.
(5'-GATACGGCCGTGTATTATTGCGCGCGT
(TRI).sub.6GATTATTGGGGCCMGGCACCCTG-3') and O3HCDR153T
(5'-GATACGGCCGT
GTATTATTGCGCGCGT(TRI).sub.10(TTT/ATG)GAT(GTT/TAT)TGGGGCCAAGGCACCCTG-3'),
and primers O3HCDR35 (5'-GATACGGCCGTGTATTATTGC-3') and O3HCDR33
(5'-CAGGGTGCCTTGGCCCC-3'), where TRI are trinucleotide mixtures
representing all amino acids without cystein, (TTT/ATG) and
(GTT/TAT) are trinucleotide mixtures encoding the amino acids
phenylalanine/methionine and valine/tyrosine, respectively. The
potential diversity of these libraries was 4.7.times.10.sup.7 and
3.4.times.10.sup.10 for 10-mer and 15-mer library, respectively.
The library cassettes were first synthesized from PCR amplification
of the oligo templates in the presence of both primers: 25 pmol of
the oligo template O3HCDR103T or O3HCDR153T, 50 pmol each of the
primers O3HCDR35 and O3HCDR33, 20 nmol of dNTP, 10.times. buffer
and 2.5 units of Pfu DNA polymerase (Stratagene) in a total volume
of 100 .mu.l for 30 cycles (1 minute at 92.degree. C., 1 minute at
62.degree. C. and 1 minute at 72.degree. C.). A hot-start procedure
was used. The resulting mixtures were phenol-extracted,
ethanol-precipitated and digested overnight with EagI and StyI. The
vector pIG10.3-sCH3.kappa.2cat, where the EagI-StyI fragment in the
vector pIG10.3-sCH3.kappa.2 encoding the H-CDR3 was replaced by the
chloramphenicol acetyltransferase gene (cat) flanked with these two
sites, was similarly digested. The digested vector (35 .mu.g) was
gel-purified, and ligated with 100 .mu.g of the library cassette
overnight at 16.degree. C. The ligation mixtures were isopropanol
precipitated, air-dried and the pellets were redissolved in 100
.mu.l of ddH2O. The ligation was mixed with 1 ml of freshly
prepared electrocompetent XL1 Blue on ice. 20 rounds of
electroporation were performed and the transformants were diluted
in SOC medium, shaken at 37.degree. C. for 30 minutes and plated
out on large LB plates (Amp/Tet/Glucose) at 37.degree. C. for 6-9
hrs. The number of transformants (library size) was
3.2.times.10.sup.7 and 2.3.times.10.sup.7 for the 10-mer and the
15-mer library, respectively. The colonies were suspended in
2.times.YT medium (Amp/Tet/Glucose) and stored as glycerol
culture.
[0159] In order to test the quality of the initial library,
phagemids from 24 independent colonies (12 from the 10-mer and 12
from the 15-mer library, respectively) were isolated and analyzed
by restriction digestion and sequencing. The restriction analysis
of the 24 phagemids indicated the presence of intact vector in all
cases. Sequence analysis of these clones (see FIG. 10) indicated
that 22 out of 24 contained a functional sequence in their heavy
chain CDR3 regions. 1 out of 12 clones of the 10-mer library had a
CDR3 of length 9 instead of 10, and 2 out of 12 clones of the
15-mer library had no open reading frame, thereby leading to a
non-functional scFv; one of these two clones contained two
consecutive inserts, but out of frame (data not shown). All codons
introduced were presented in an even distribution.
[0160] Expression levels of individual library members were also
measured. Briefly, 9 clones from each library were grown in
2.times.YT medium containing Amp/Tet/0.5% glucose at 37.degree. C.
overnight. Next day, the cultures were diluted into fresh medium
with Amp/Tet. At an OD.sub.600 nm of 0.4, the cultures were induced
with 1 mM of IPTG and shaken at RT overnight. Then the cell pellets
were suspended in 1 ml of PBS buffer+1 mM of EDTA. The suspensions
were sonicated and the supernatants were separated on an SDS-PAGE
under reducing conditions, blotted on nylon membrane and detected
with anti-FLAG M1 antibody (see FIG. 11). From the nine clones of
the 10-mer library, all express the scFv fragments. Moreover, the
gene III/scFv fusion proteins were present in all cases. Among the
nine clones from the 15-mer library analyzed, 6/9 (67%) led to the
expression of both scFv and the gene III/scFv fusion proteins. More
importantly, all clones expressing the scFvs and gene III/scFv
fusions gave rise to about the same level of expression.
2.4 Biopanning
[0161] Phages displaying the antibody libraries were prepared using
standard protocols. Phages derived from the 10-mer library were
mixed with phages from the 15-mer library in a ratio of 20:1
(1.times.10.sup.10 cfu/well of the 10-mer and 5.times.10.sup.8
cfu/well of the 15-mer phages, respectively). Subsequently, the
phage solution was used for panning in ELISA plates (Maxisorp,
Nunc) coated with FITC-BSA (Sigma) at concentration of 100 .mu.g/ml
in PBS at 4.degree. C. overnight. The antigen-coated wells were
blocked with 3% powder milk in PBS and the phage solutions in 1%
powder milk were added to each well and the plate was shaken at RT
for 1 hr. The wells were then washed with PBST and PBS (4 times
each with shaking at RT for 5 minutes). The bound phages were
eluted with 0.1 M triethylamine (TEA) at RT for 10 minutes. The
eluted phage solutions were immediately neutralized with 1/2 the
volume of 1 M Tris Cl, pH 7.6. Eluted phage solutions (ca. 450
.mu.l) were used to infect 5 ml of XL1 Blue cells at 37.degree. C.
for 30 min. The infected cultures were then plated out on large LB
plates (Amp/Tet/Glucose) and allowed to grow at 37.degree. C. until
the colonies were visible. The colonies were suspended in
2.times.YT medium and the glycerol cultures were made as above
described. This panning round was repeated twice, and in the third
round elution was carried out with addition of fluorescein in a
concentration of 100 .mu.g/ml in PBS. The enrichment of specific
phage antibodies was monitored by panning the initial as well as
the subsequent fluorescein-specific sub-libraries against the
blocking buffer (FIG. 12). Antibodies with specificity against
fluorescein were isolated after 3 rounds of panning.
2.5 ELISA Measurements
[0162] One of the criteria for the successful biopanning is the
isolation of individual phage clones that bind to the targeted
antigen or hapten. We undertook the isolation of anti-FITC phage
antibody clones and characterized them first in a phage ELISA
format. After the 3rd round of biopanning (see above), 24 phagemid
containing clones were used to inoculate 100 .mu.l of 2.times.YT
medium (Amp/Tet/Glucose) in an ELISA plate (Nunc), which was
subsequently shaken at 37.degree. C. for 5 hrs. 100 .mu.l of
2.times.YT medium (Amp/Tet/1 mM IPTG) were added and shaking was
continued for 30 minutes. A further 100 .mu.l of 2.times.YT medium
(Amp/Tet) containing the helper phage (1.times.10.sup.9 cfu/well)
was added and shaking was done at RT for 3 hrs. After addition of
kanamycin to select for successful helper phage infection, the
shaking was continued overnight. The plates were then centrifuged
and the supernatants were pipetted directly into ELISA wells coated
with 100 .mu.l FITC-BSA (100 .mu.g/ml) and blocked with milk
powder. Washing was performed similarly as during the panning
procedure and the bound phages were detected with anti-M13
antibody-POD conjugate (Pharmacia) using soluble POD substrate
(Boehringer-Mannheim). Of the 24 clones screened against FITC-BSA,
22 were active in the ELISA (FIG. 13). The initial libraries of
similar titer gave rise to no detectable signal.
[0163] Specificity for fluorescein was measured in a competitive
ELISA. Periplasmic fractions of five FITC specific scFvs were
prepared as described above. Western blotting indicated that all
clones expressed about the same amount of scFv fragment (data not
shown). ELISA was performed as described above, but additionally,
the periplasmic fractions were incubated 30 min at RT either with
buffer (no inhibition), with 10 mg/ml BSA (inhibition with BSA) or
with 10 mg/ml fluorescein (inhibition with fluorescein) before
adding to the well. Binding scFv fragment was detected using the
anti-FLAG antibody M1. The ELISA signal could only be inhibited,
when soluble fluorescein was added, indicating binding of the scFvs
was specific for fluorescein (FIG. 14).
2.6 Sequence Analysis
[0164] The heavy chain CDR3 region of 20 clones were sequenced in
order to estimate the sequence diversity of fluorescein binding
antibodies in the library (FIG. 15). In total, 16 of 20 sequences
(80%) were different, showing that the constructed library
contained a highly diverse repertoire of fluorescein binders. The
CDR3s showed no particular sequence homology, but contained on
average 4 arginine residues. This bias towards arginine in
fluorescein binding antibodies had already been described by Barbas
et al., 1992.
2.7 Production
[0165] E. coli JM83 was transformed with phagemid DNA of 3 selected
clones and cultured in 0.5 L 2.times.YT medium. Induction was
carried out with 1 mM IPTG at OD.sub.600 nm=0.4 and growth was
continued with vigorous shaking at RT overnight. The cells were
harvested and pellets were suspended in PBS buffer and sonicated.
The supernatants were separated from the cell debris via
centrifugation and purified via the BioLogic system (Bio-Rad) by
with a POROS.RTM.MC 20 column (IMAC, PerSeptive Biosystems, Inc.)
coupled with an ion-exchange chromatography column. The
ion-exchange column was one of the POROS.RTM.HS, CM or HQ or PI 20
(PerSeptive Biosystems, Inc.) depended on the theoretical pI of the
scFv being purified. The pH of all the buffers was adjusted to one
unit lower or higher than the pI of the scFv being purified
throughout. The sample was loaded onto the first IMAC column,
washed with 7 column volumes of 20 mM sodium phosphate, 1 M NaCl
and 10 mM imidazole. This washing was followed by 7 column volumes
of 20 mM sodium phosphate and 10 mM imidazole. Then 3 column
volumes of an imidazole gradient (10 to 250 mM) were applied and
the eluent was connected directly to the ion-exchanger. Nine column
volumes of isocratic washing with 250 mM imidazole was followed by
15 column volumes of 250 mM to 100 mM and 7 column volumes of an
imidazole/NaCl gradient (100 to 10 mM imidazole, 0 to 1 M NaCl).
The flow rate was 5 ml/min. The purity of scFv fragments was
checked by SDS-PAGE Coomassie staining (FIG. 16). The concentration
of the fragments was determined from the absorbance at 280 nm using
the theoretically determined extinction coefficient (Gill & von
Hippel, 1989). The scFv fragments could be purified to homogeneity
(see FIG. 16). The yield of purified fragments ranged from 5 to 10
mg/L/OD.
Example 3
HuCAL H3.kappa.2 Library Against a Collection of Antigens
[0166] In order to test the library used in Example 2 further, a
new selection procedure was carried out using a variety of antigens
comprising .beta.-estradiol, testosterone, Lewis-Y epitope (LeY),
interleukin-2 (IL-2), lymphotoxin-.beta. (LT-.beta.), E-selectin
ligand-1 (ESL-1), and BSA.
3.1 Biopanning
[0167] The library and all procedures were identical to those
described in Example 2. The ELISA plates were coated with
.beta.-estradiol-BSA (100 .mu.g/ml), testosterone-BSA (100
.mu.g/ml), LeY-BSA (20 .mu.g/ml) IL-2 (20 .mu.g/ml), ESL-1 (20
.mu.g/ml) and BSA (100 .mu.g/ml), LT-.beta. (denatured protein, 20
.mu.g/ml). In the first two rounds, bound phages were eluted with
0.1 M triethylamine (TEA) at RT for 10 minutes. In the case of BSA,
elution after three rounds of panning was carried out with addition
of BSA in a concentration of 100 .mu.g/ml in PBS. In the case of
the other antigens, third round elution was done with 0.1 M
triethylamine. In all cases except LeY, enrichment of binding
phages could be seen (FIG. 17). Moreover, a repetition of the
biopanning experiment using only the 15-mer library resulted in the
enrichment of LeY-binding phages as well (data not shown).
3.2. ELISA Measurements
[0168] Clones binding to .beta.-estradiol, testosterone, LeY,
LT-.beta., ESL-1 and BSA were further analyzed and characterized as
described in Example 2 for FITC. ELISA data for
anti-.beta.-estradiol and anti-ESL-1 antibodies are shown in FIG.
18. In one experiment, selectivity and cross-reactivity of binding
scFv fragments were tested. For this purpose, an ELISA plate was
coated with FITC, testosterone, .beta.-estradiol, BSA, and ESL-1,
with 5 wells for each antigen arranged in 5 rows, and 5 antibodies,
one against each of the antigens, were screened against each of the
antigens. FIG. 19 shows the specific binding of the antibodies to
the antigen it was selected for, and the low cross-reactivity with
the other four antigens.
3.3 Sequence Analysis
[0169] The sequencing data of several clones against
.beta.-estradiol (34 clones), testosterone (12 clones), LT-.beta.
(23 clones), ESL-1 (34 clones), and BSA (10 clones) are given in
FIGS. 20 to 24.
Example 4
Vector Construction
[0170] To be able to take advantage of the modularity of the
consensus gene repertoire, a vector system had to be constructed
which could be used in phage display screening of HuCAL libraries
and subsequent optimization procedures. Therefore, all necessary
vector elements such as origins of single-stranded or
double-stranded replication, promotor/operator, repressor or
terminator elements, resistance genes, potential recombination
sites, gene III for display on filamentous phages, signal
sequences, or detection tags had to be made compatible with the
restriction site pattern of the modular consensus genes. FIG. 25
shows a schematic representation of the pCAL vector system and the
arrangement of vector modules and restriction sites therein. FIG.
25a shows a list of all restriction sites which are already
incorporated into the consensus genes or the vector elements as
part of the modular system or which are not yet present in the
whole system. The latter could be used in a later stage for the
introduction of or within new modules.
4.1 Vector Modules
[0171] A series of vector modules was constructed where the
restriction sites flanking the gene sub-elements of the HuCAL genes
were removed, the vector modules themselves being flanked by unique
restriction sites. These modules were constructed either by gene
synthesis or by mutagenesis of templates. Mutagenesis was done by
add-on PCR, by site-directed mutagenesis (Kunkel et al., 1991) or
multisite oligonucleotide-mediated mutagenesis (Sutherland et al.,
1995; Perlak, 1990) using a PCR-based assembly method.
[0172] FIG. 26 contains a list of the modules constructed. Instead
of the terminator module M9 (HindIII-Ipp-PacI), a larger cassette
M9II was prepared to introduce FseI as additional restriction site.
M9II can be cloned via HindIII/BsrGI.
[0173] All vector modules were characterized by restriction
analysis and sequencing. In the case of module M11-II, sequencing
of the module revealed a two-base difference in positions 164/65
compared to the sequence database of the template. These two
different bases (CA.fwdarw.GC) created an additional BanII site.
Since the same two-base difference occurs in the f1 origin of other
bacteriophages, it can be assumed that the two-base difference was
present in the template and not created by mutagenesis during
cloning. This BanII site was removed by site-directed mutagenesis,
leading to module M11-II. The BssSI site of module M14 could
initially not be removed without impact on the function of the
ColE1 origin, therefore M14-Ext2 was used for cloning of the first
pCAL vector series. FIGS. 29 to 34 are showing the functional maps
and sequences of the modules used for assembly of the modular
vector pCAL4 (see below). The functional maps and sequences of
additional modules can be found in FIG. 35a. FIG. 35b contains a
list of oligonucleotides and primers used for the synthesis of the
modules.
4.2 Cloning Vector pMCS
[0174] To be able to assemble the individual vector modules, a
cloning vector pMCS containing a specific multi-cloning site (MCS)
was constructed. First, an MCS cassette (FIG. 27) was made by gene
synthesis. This cassette contains all those restriction sites in
the order necessary for the sequential introduction of all vector
modules and can be cloned via the 5'-HindIII site and a four base
overhang at the 3'-end compatible with an AatII site. The vector
pMCS (FIG. 28) was constructed by digesting pUC19 with AatII and
HindIII, isolating the 2174 base pair fragment containing the bla
gene and the ColE1 origin, and ligating the MCS cassette.
4.3 Cloning of Modular Vector pCAL4
[0175] This was cloned step by step by restriction digest of pMCS
and subsequent ligation of the modules M1 (via AatII/XbaI), M7III
(via EcoRI/HindIII), and M9II (via HindIII/BsrGI), and M11-II (via
BsrGI/NheI). Finally, the bla gene was replaced by the cat gene
module M17 (via AatII/BglII), and the wild type ColE1 origin by
module M14-Ext2 (via BglII/NheI). FIG. 35 is showing the functional
map and the sequence of pCAL4.
4.4 Cloning of Low-Copy Number Plasmid Vectors pCALO
[0176] A series of low-copy number plasmid vectors was constructed
in a similar way using the p15A module M12 instead of the ColE1
module M14-Ext2. FIG. 35a is showing the functional maps and
sequences of the vectors pCALO1 to pCALO3.
Example 5
Construction of a HuCAL scFv Library
5.1. Cloning of All 49 HuCAL scFv Fragments
[0177] All 49 combinations of the 7 HuCAL-VH and 7 HuCAL-VL
consensus genes were assembled as described for the HuCAL
VH3-V.kappa.2 scFv in Example 2 and inserted into the vector pBS12,
a modified version of the pLisc series of antibody expression
vectors (Skerra et al., 1991).
5.2 Construction of a CDR Cloning Cassette
[0178] For replacement of CDRs, a universal .beta.-lactamase
cloning cassette was constructed having a multi-cloning site at the
5'-end as well as at the 3'-end. The 5'-multi-cloning site
comprises all restriction sites adjacent to the 5'-end of the HuCAL
VH and VL CDRs, the 3'-multi-cloning site comprises all restriction
sites adjacent to the 3' end of the HuCAL VH and VL CDRs. Both 5'-
and 3'-multi-cloning site were prepared as cassettes via add-on PCR
using synthetic oligonucleotides as 5'- and 3'-primers using wild
type .beta.-lactamase gene as template. FIG. 36 shows the
functional map and the sequence of the cassette bla-MCS.
5.3. Preparation of VL-CDR3 Library Cassettes
[0179] The VL-CDR3 libraries comprising 7 random positions were
generated from the PCR fragments using oligonucleotide templates
V.kappa.1&V.kappa.3, V.kappa.2 and V.kappa.4 and primers
O_K3L.sub.--5 and O_K3L.sub.--3 (FIG. 37) for the V.kappa. genes,
and V.lamda. and primers O_L3L.sub.--5 (5'-GCAGAAGGCGAACGTCC-3')
and O_L3LA.sub.--3 (FIG. 38) for the V.lamda. genes. Construction
of the cassettes was performed as described in Example 2.3.
5.4 Cloning of HuCAL scFv Genes With VL-CDR3 Libraries
[0180] Each of the 49 single-chains was subcloned into pCAL4 via
XbaI/EcoRI and the VL-CDR3 replaced by the .beta.-lactamase cloning
cassette via BbsI/MscI, which was then replaced by the
corresponding VL-CDR3 library cassette synthesized as described
above. This CDR replacement is described in detail in Example 2.3
where the cat gene was used.
5.5 Preparation of VH-CDR3 Library Cassette
[0181] The VH-CDR3 libraries were designed and synthesized as
described in Example 2.3.
5.6 Cloning of HuCAL scFv Genes With VL- and VH-CDR3 Libraries
[0182] Each of the 49 single-chain VL-CDR3 libraries was digested
with BssHII/StyI to replace VH-CDR3. The "dummy" cassette digested
with BssHII/StyI was inserted, and was then replaced by a
corresponding VH-CDR3 library cassette synthesized as described
above.
Example 6
Expression Tests
[0183] Expression and toxicity studies were performed using the
scFv format VH-linker-VL. All 49 combinations of the 7 HuCAL-VH and
7 HuCAL-VL consensus genes assembled as described in Example 5 were
inserted into the vector pBS13, a modified version of the pLisc
series of antibody expression vectors (Skerra et al., 1991). A map
of this vector is shown in FIG. 39.
[0184] E. coli JM83 was transformed 49 times with each of the
vectors and stored as glycerol stock. Between 4 and 6 clones were
tested simultaneously, always including the clone H3.kappa.2, which
was used as internal control throughout. As additional control, the
McPC603 scFv fragment (Knappik & Pluckthun, 1995) in pBS13 was
expressed under identical conditions. Two days before the
expression test was performed, the clones were cultivated on LB
plates containing 30 .mu.g/ml chloramphenicol and 60 mM glucose.
Using this plates an 3 ml culture (LB medium containing 90 .mu.g
chloramphenicol and 60 mM glucose) was inoculated overnight at
37.degree. C. Next day the overnight culture was used to inoculate
30 ml LB medium containing chloramphenicol (30 .mu.g/ml). The
starting OD.sub.600 nm was adjusted to 0.2 and a growth temperature
of 30.degree. C. was used. The physiology of the cells was
monitored by measuring every 30 minutes for 8 to 9 hours the
optical density at 600 nm. After the culture reached an OD.sub.600
nm of 0.5, antibody expression was induced by adding IPTG to a
final concentration of 1 mM. A 5 ml aliquot of the culture was
removed after 2 h of induction in order to analyze the antibody
expression. The cells were lysed and the soluble and insoluble
fractions of the crude extract were separated as described in
Knappik & Pluckthun, 1995. The fractions were assayed by
reducing SDS-PAGE with the samples normalized to identical optical
densities. After blotting and immunostaining using the .alpha.-FLAG
antibody M1 as the first antibody (see Ge et al., 1994) and an
Fc-specific anti-mouse antiserum conjugated to alkaline phosphatase
as the second antibody, the lanes were scanned and the intensities
of the bands of the expected size (appr. 30 kDa) were quantified
densitometrically and tabulated relative to the control antibody
(see FIG. 40).
Example 7
Optimization of Fluorescein Binders
7.1. Construction of L-CDR3 and H-CDR2 Library Cassettes
[0185] A L-CDR3 library cassette was prepared from the
oligonucleotide template CDR3L
(5'-TGGAAGCTGAAGACGTGGGCGTGTATTATTGCCAGCAG(TR5)(TRI).sub.4CCG
(TRI)-TTTGGCCAGGGTACGAAAGTT-3') and primer 5'-AACTTTCGTACCCTGGCC-3'
for synthesis of the complementary strand, where (TRI) was a
trinucleotide mixture representing all amino acids except Cys,
(TR5) comprised a trinucleotide mixture representing the 5 codons
for Ala, Arg, His, Ser, and Tyr.
[0186] A H-CDR2 library cassette was prepared from the
oligonucleotide template CDRsH
(5'-AGGGTCTCGAGTGGGTGAGC(TRI)ATT(TRI).sub.2-3(6).sub.2(TRI)ACC(TRI)TATGCG-
GATAGCGTGAAAGGCCGTTTTACCATTTCACGTGATAATTCGAAAAACACCA-3'), and
primer 5'-TGGTGTTTTTCGAATTATCA-3' for synthesis of the
complementary strand, where (TRI) was a trinucleotide mixture
representing all amino acids except Cys, (6) comprised the
incorporation of (A/G) (A/C/G) T, resulting in the formation of 6
codons for Ala, Asn, Asp, Gly, Ser, and Thr, and the length
distribution being obtained by performing one substoichiometric
coupling of the (TRI) mixture during synthesis, omitting the
capping step normally used in DNA synthesis.
[0187] DNA synthesis was performed on a 40 nmole scale, oligos were
dissolved in 1E buffer, purified via gel filtration using spin
columns (S-200), and the DNA concentration determined by OD
measurement at 260 nm (OD 1.0=40 .mu.g/ml).
[0188] 10 nmole of the oligonucleotide templates and 12 nmole of
the corresponding primers were mixed and annealed at 80.degree. C.
for 1 min, and slowly cooled down to 37.degree. C. within 20 to 30
min. The fill-in reaction was performed for 2 h at 37.degree. C.
using Klenow polymerase (2.0 .mu.l) and 250 nmole of each dNTP. The
excess of dNTPs was removed by gel filtration using Nick-Spin
columns (Pharmacia), and the double-stranded DNA digested with
BbsI/MscI (L-CDR3), or XhoI/SfuI (H-CDR2) over night at 37.degree.
C. The cassettes were purified via Nick-Spin columns (Pharmacia),
the concentration determined by OD measurement, and the cassettes
aliquoted (15 pmole) for being stored at -80.degree. C.
7.2 Library Cloning:
[0189] DNA was prepared from the collection of FITC binding clones
obtained in Example 2 (approx. 10.sup.4 to clones). The collection
of scFv fragments was isolated via XbaI/EcoRI digest. The vector
pCAL4 (100 fmole, 10 .mu.g) described in Example 4.3 was similarly
digested with XbaI/EcoRI, gel-purified and ligated with 300 fmole
of the scFv fragment collection over night at 16.degree. C. The
ligation mixture was isopropanol precipitated, air-dried, and the
pellets were redissolved in 100 .mu.l of dd H.sub.2O. The ligation
mixture was mixed with 1 ml of freshly prepared electrocompetent
SCS 101 cells (for optimization of L-CDR3), or XL1 Blue cells (for
optimization of H-CDR2) on ice. One round of electroporation was
performed and the transformants were eluted in SOC medium, shaken
at 37.degree. C. for 30 minutes, and an aliquot plated out on LB
plates (Amp/Tet/Glucose) at 37.degree. C. for 6-9 hrs. The number
of transformants was 5.times.10.sup.4.
[0190] Vector DNA (100 .mu.g) was isolated and digested (sequence
and restriction map of sCH3.kappa.2 see FIG. 8) with BbsI/MscI for
optimization of L-CDR3, or XhoI/NspV for optimization of H-CDR2. 10
.mu.g of purified vector fragments (5 pmole) were ligated with 15
pmole of the L-CDR3 or H-CDR2 library cassettes over night at
16.degree. C. The ligation mixtures were isopropanol precipitated,
air-dried, and the pellets were redissolved in 100 .mu.l of dd
H.sub.2O. The ligation mixtures were mixed with 1 ml of freshly
prepared electrocompetent XL1 Blue cells on ice. Electroporation
was performed and the transformants were eluted in SOC medium and
shaken at 37.degree. C. for 30 minutes. An aliquot was plated out
on LB plates (Amp/Tet/Glucose) at 37.degree. C. for 6-9 hrs. The
number of transformants (library size) was greater than 10.sup.8
for both libraries. The libraries were stored as glycerol
cultures.
7.3. Biopanning
[0191] This was performed as described for the initial
H3.kappa.2H-CDR3 library in Example 2.1. Optimized scFvs binding to
FITC could be characterized and analyzed as described in Example
2.2 and 2.3, and further rounds of optimization could be made if
necessary.
REFERENCES
[0192] Barbas III, C. F., Bain, J. D., Hoekstra, D. M. &
Lerner, R. A., PNAS 89, 4457-4461 (1992). [0193] Better, M., Chang,
P., Robinson, R. & Horwitz, A. H., Science 240, 1041-1043
(1988). [0194] Blake, M. S., Johnston, K. H., Russel-Jones, G. J.
& Gotschlich, E. C., Anal. Biochem. 136, 175-179 (1984). [0195]
Carter, P., Kelly, R. F., Rodrigues, M. L., Snedecor, B.,
Covrrubias, M., Velligan, M. D., Wong, W. L. T., Rowland, A. M.,
Kotts, C. E., Carver, M. E., Yang, M., Bourell, J. H., Shepard, H.
M. & Henner, D., Bio/Technology 10, 163-167 (1992). [0196]
Chothia, C. & Lesk, A. M., J. Biol. Chem. 196, 910-917 (1987).
[0197] Chothia, C., Lesk, A. M., Gherardi, E., Tomlinson, I. A.,
Walter, G., Marks, J. D., Llewelyn, M. B. & Winter, G., J. Mol.
Biol. 227, 799-817 (1992). [0198] Chothia, C., Lesk, A. M.,
Tramontano, A., Levitt, M., Smith-Gill, S. J., Air, G., Sheriff,
S., Padlan, E. A., Davies, D., Tulip, W. R., Colman, P. M.,
Spinelli, S., Alzari, P. M. & Poljak, R. J., Nature 342,
877-883 (1989). [0199] Chuchana, P., Blancher, A., Brockly, F.,
Alexandre, D., Lefranc, G & Lefranc, M.-P., Eur. J. Immunol.
20, 1317-1325 (1990). [0200] Cox, J. P. L., Tomlinson, I. M. &
Winter, G., Eur. J. Immunol. 24, 827-836 (1994). [0201] Ge, L.,
Knappik, A., Pack, P., Freund, C. & Pluckthun, A., In: Antibody
Engineering Borrebaeck, C. A. K. (Ed.). p. 229-266 (1995), Oxford
University Press, New York, Oxford.) [0202] Gill, S. C. & von
Hippel, P. H., Anal. Biochem. 182, 319.326 (1989). [0203] Hochuli,
E., Bannwarth, W., Dobeli, H., Gentz, R. & Stuber, D.,
Bio/Technology 6, 1321-1325 (1988). [0204] Hopp, T. P., Prickett,
K. S., Price, V. L., Libby, R. T., March, C. J., Cerretti, D. P.,
Urdal, D. L. & Conlon, P. J. Bio/Technology 6, 1204-1210
(1988). [0205] Kabat, E. A., Wu, T. T., Perry, H. M., Gottesmann,
K. S. & Foeller, C., Sequences of proteins of immunological
interest, NIH publication 91-3242 (1991). [0206] Knappik, A. &
Pluckthun, A., Biotechniques 17, 754-761 (1994). [0207] Knappik, A.
& Pluckthun, A., Protein Engineering 8, 81-89 (1995). [0208]
Kunkel, T. A., Bebenek, K. & McClary, J., Methods in Enzymol.
204, 125-39 (1991). [0209] Lindner, P., Guth, B., Wulfing, C.,
Krebber, C., Steipe, B., Muller, F. & Pluckthun, A., Methods: A
Companion to Methods Enzymol. 4, 41-56 (1992). [0210] Lowman, H.
B., Bass, S. H., Simpson, N. and Wells, J. A., Biochemistry 30,
10832-10838 (1991). [0211] Pack, P. & Pluckthun, A.,
Biochemistry 31, 1579-1584 (1992). [0212] Pack, P., Kujau. M.,
Schroeckh, V., Knupfer, U., Wenderoth, R., Riesenberg D. &
Pluckthun, A., Bio/Technology 11, 1271-1277 (1993). [0213] Pack,
P., Ph.D. thesis, Ludwig-Maximilians-Universitat Munchen (1994).
[0214] Perlak, F. J., Nuc. Acids Res. 18, 7457-7458 (1990). [0215]
Pluckthun, A., Krebber, A., Krebber, C., Horn, U., Knupfer, U.,
Wenderoth, R., Nieba, L., Proba, K. & Riesenberg, D., A
practical approach. Antibody Engineering (Ed. J. McCafferty). IRL
Press, Oxford, pp. 203-252 (1996). [0216] Prodromou, C. &
Pearl, L. H., Protein Engineering 5, 827-829 (1992). [0217]
Rosenberg, S. A. & Lotze, M. T., Ann. Rev. Immunol. 4, 681-709
(1986). [0218] Skerra, A. & Pluckthun, A., Science 240,
1038-1041 (1988). [0219] Skerra, A., Pfitzinger, I. &
Pluckthun, A., Bio/Technology 9, 273-278 (1991). [0220] Sutherland,
L., Davidson, J., Glass, L. L., & Jacobs, H. T., BioTechniques
18, 458-464, 1995. [0221] Tomlinson, I. M., Walter, G., Marks, J.
D., Llewelyn, M. B. & Winter, G., J. Mol. Biol. 227, 776-798
(1992). [0222] Ullrich, H. D., Patten, P. A., Yang, P. L.,
Romesberg, F. E. & Schultz, P. G., Proc. Natl. Acad. Sci. USA
2, 11907-11911 (1995). [0223] Van Dijk, K. W., Mortari, F.,
Kirkham, P. M., Schroeder Jr., H. W. & Milner, E. C. B., Eur.
J. Immunol. 23, 832-839 (1993). [0224] Virnekas, B., Ge, L.,
Pluckthun, A., Schneider, K. C., Wellnhofer, G. & Moroney, S.
E., Nucleic Acids Research 22, 5600-5607 (1994). [0225] Viletta, E.
S., Thorpe, P. E. & Uhr, J., Immunol. Today 14, 253-259 (1993).
[0226] Williams, S. C. & Winter, G., Eur. J. Immunol. 23,
1456-1461 (1993).
[0227] Winter, G., Griffiths, A. D., Hawkins, R. E. &
Hoogenboom, H. R., Ann. Rev. Immunol. 12, 433-455 (1994).
TABLE-US-00002 TABLE 1A Human kappa germline gene segments Used
Name.sup.1 Reference.sup.2 Family.sup.3 Germline genes.sup.4 Vk1-1
9 1 O8; O18; DPK1 Vk1-2 1 1 L14; DPK2 Vk1-3 2 1 L15(1); HK101;
HK146; HK189 Vk1-4 9 1 L11 Vk1-5 2 1 A30 Vk1-6 1 1 LFVK5 Vk1-7 1 1
LFVK431 Vk1-8 1 1 L1; HK137 Vk1-9 1 1 A20; DPK4 Vk1-10 1 1 L18;
Va'' Vk1-11 1 1 L4; L18; Va'; V4a Vk1-12 2 1 L5; L19(1); Vb; Vb4;
DPK5; L19(2); Vb''; DPK6 Vk1-13 2 1 L15(2); HK134; HK166; DPK7
Vk1-14 8 1 L8; Vd; DPK8 Vk1-15 8 1 L9; Ve Vk1-16 1 1 L12(1); HK102;
V1 Vk1-17 2 1 L12(2) Vk1-18 1 1 O12a (V3b) Vk1-19 6 1 O2; O12; DPK9
Vk1-20 2 1 L24; Ve''; V13; DPK10 Vk1-21 1 1 O4; O14 Vk1-22 2 1 L22
Vk1-23 2 1 L23 Vk2-1 1 2 A2; DPK12 Vk2-2 6 2 O1; O11(1); DPK13
Vk2-3 6 2 O12(2); V3a Vk2-4 2 2 L13 Vk2-5 1 2 DPK14 Vk2-6 4 2 A3;
A19; DPK15 Vk2-7 4 2 A29; DPK27 Vk2-8 4 2 A13 Vk2-9 1 2 A23 Vk2-10
4 2 A7; DPK17 Vk2-11 4 2 A17; DPK18 Vk2-12 4 2 A1; DPK19 Vk3-1 11 3
A11; humkv305; DPK20 Vk3-2 1 3 L20; Vg'' Vk3-3 2 3 L2; L16;
humkv328; humkv328h2; humkv328h5; DPK21 Vk3-4 11 3 A27; humkv325;
VkRF; DPK22 Vk3-5 2 3 L25; DPK23 Vk3-6 2 3 L10(1) Vk3-7 7 3 L10(2)
Vk3-8 7 3 L6; Vg Vk4-1 3 4 B3; VkIV; DPK24 Vk5-1 10 5 B2; EV15
Vk6-1 12 6 A14; DPK25 Vk6-2 12 6 A10; A26; DPK26 Vk7-1 5 7 B1
[0228] TABLE-US-00003 TABLE 1B Human lambda germline gene segments
Used Name.sup.1 Reference.sup.2 Family.sup.3 Germline genes.sup.4
DPL1 1 1 DPL2 1 1 HUMLV1L1 DPL3 1 1 HUMLV122 DPL4 1 1 VLAMBDA 1.1
HUMLV117 2 1 DPL5 1 1 HUMLV117D DPL6 1 1 DPL7 1 1 IGLV1S2 DPL8 1 1
HUMLV1042 DPL9 1 1 HUMLV101 DPL10 1 2 VLAMBDA 2.1 3 2 DPL11 1 2
DPL12 1 2 DPL13 1 2 DPL14 1 2 DPL16 1 3 Humlv418; IGLV3S1 DPL23 1 3
VI III.1 Humlv318 4 3 DPL18 1 7 4A; HUMIGLVA DPL19 1 7 DPL21 1 8
VL8.1 HUMLV801 5 8 DPL22 1 9 DPL24 1 unassigned VLAMBDA N.2
gVLX-4.4 6 10
[0229] TABLE-US-00004 TABLE 1C Human heavy chain germline gene
segments Used Name.sup.1 Reference.sup.2 Family.sup.3 Germline
genes.sup.4 VH1-12-1 19 1 DP10; DA-2; DA-6 VH1-12-8 22 1 RR.VH1.2
VH1-12-2 6 1 hv1263 VH1-12-9 7 1 YAC-7; RR.VH1.1; 1-69 VH1-12-3 19
1 DP3 VH1-12-4 19 1 DP21; 4d275a; VH7a VH1-12-5 18 1 I-4.1b;
V1-4.1b VH1-12-6 21 1 1D37; VH7b; 7-81; YAC-10 VH1-12-7 19 1 DP14;
VH1GRR; V1-18 VH1-13-1 10 1 71-5; DP2 VH1-13-2 10 1 E3-10 VH1-13-3
19 1 DP1 VH1-13-4 12 1 V35 VH1-13-5 8 1 V1-2b VH1-13-6 18 1 I-2;
DP75 VH1-13-7 21 1 V1-2 VH1-13-8 19 1 DP8 VH1-13-9 3 1 1-1
VH1-13-10 19 1 DP12 VH1-13-11 15 1 V13C VH1-13-12 18 1 I-3b; DP25;
V1-3b VH1-13-13 3 1 1-92 VH1-13-14 18 1 I-3; V1-3 VH1-13-15 19 1
DP15; V1-8 VH1-13-16 3 1 21-2; 3-1; DP7; V1-46 VH1-13-17 16 1 HG3
VH1-13-18 19 1 DP4; 7-2; V1-45 VH1-13-19 27 1 COS 5 VH1-1X-1 19 1
DP5; 1-24P VH2-21-1 18 2 II-5b VH2-31-1 2 2 VH2S12-1 VH2-31-2 2 2
VH2S12-7 VH2-31-3 2 2 VH2S12-9; DP27 VH2-31-4 2 2 VH2S12-10
VH2-31-5 14 2 V2-26; DP26; 2-26 VH2-31-6 15 2 VF2-26 VH2-31-7 19 2
DP28; DA-7 VH2-31-14 7 2 YAC-3; 2-70 VH2-31-8 2 2 VH2S12-5 VH2-31-9
2 2 VH2S12-12 VH2-31-10 18 2 II-5; V2-5 VH2-31-11 2 2 VH2S12-2;
VH2S12-8 VH2-31-12 2 2 VH2S12-4; VH2S12-6 VH2-31-13 2 2 VH2S12-14
VH3-11-1 13 3 v65-2; DP44 VH3-11-2 19 3 DP45 VH3-11-3 3 3 13-2;
DP48 VH3-11-4 19 3 DP52 VH3-11-5 14 3 v3-13 VH3-11-6 19 3 DP42
VH3-11-7 3 3 8-1B; YAC-5; 3-66 VH3-11-8 14 3 V3-53 VH3-13-1 3 3
22-2B; DP35; V3-11 VH3-13-5 19 3 DP59; VH19; V3-35 VH3-13-6 25 3
f1-p1; DP61 VH3-13-7 19 3 DP46; GL-SJ2; COS 8; hv3005; hv3005f3;
3d21b; 56p1 VH3-13-8 24 3 VH26 VH3-13-9 5 3 vh26c VH3-13-10 19 3
DP47; VH26; 3-23 VH3-13-11 3 3 1-91 VH3-13-12 19 3 DP58 VH3-13-13 3
3 1-9III; DP49; 3-30; 3d28.1 VH3-13-14 24 3 3019B9; DP50; 3-33;
3d277 VH3-13-15 27 3 COS 3 VH3-13-16 19 3 DP51 VH3-13-17 16 3 H11
VH3-13-18 19 3 DP53; COS 6; 3-74; DA-8 VH3-13-19 19 3 DP54; VH3-11;
V3-7 VH3-13-20 14 3 V3-64; YAC-6 VH3-13-21 14 3 V3-48 VH3-13-22 14
3 V3-43; DP33 VH3-13-23 14 3 V3-33 VH3-13-24 14 3 V3-21; DP77
VH3-13-25 14 3 V3-20; DP32 VH3-13-26 14 3 V3-9; DP31 VH3-14-1 3 3
12-2; DP29; 3-72; DA-3 VH3-14-4 7 3 YAC-9; 3-73; MTGL VH3-14-2 4 3
VHD26 VH3-14-3 19 3 DP30 VH3-1X-1 1 3 LSG8.1; LSG9.1; LSG10.1;
HUM12IGVH; HUM13IGVH VH3-1X-2 1 3 LSG11.1; HUM4IGVH VH3-1X-3 3 3
9-1; DP38; LSG7.1; RCG1.1; LSG1.1; LSG3.1; LSG5.1; HUM15IGVH;
HUM2IGVH; HUM9IGVH VH3-1X-4 1 3 LSG4.1 VH3-1X-5 1 3 LSG2.1 VH3-1X-6
1 3 LSG6.1; HUM10IGVH VH3-1X-7 18 3 3-15; V3-15 VH3-1X-8 1 3
LSG12.1; HUM5IGVH VH3-1X-9 14 3 V3-49 VH4-11-1 22 4 Tou-VH4.21
VH4-11-2 17 4 VH4.21; DP63; VH5; 4d76; V4-34 VH4-11-3 23 4 4.44
VH4-11-4 23 4 4.44.3 VH4-11-5 23 4 4.36 VH4-11-6 23 4 4.37 VH4-11-7
18 4 IV-4; 4.35; V4-4 VH4-11-8 17 4 VH4.11; 3d197d; DP71; 58p2
VH4-11-9 20 4 H7 VH4-11-10 20 4 H8 VH4-11-11 20 4 H9 VH4-11-12 17 4
VH4.16 VH4-11-13 23 4 4.38 VH4-11-14 17 4 VH4.15 VH4-11-15 11 4 58
VH4-11-16 10 4 71-4; V4-59 VH4-21-1 11 4 11 VH4-21-2 17 4 VH4.17;
VH4.23; 4d255; 4.40; DP69 VH4-21-3 17 4 VH4.19; 79; V4-4b VH4-21-4
19 4 DP70; 4d68; 4.41 VH4-21-5 19 4 DP67; VH4-4B VH4-21-6 17 4
VH4.22; VHSP; VH-JA VH4-21-7 17 4 VH4.13; 1-9II; 12G-1; 3d28d;
4.42; DP68; 4-28 VH4-21-8 26 4 hv4005; 3d24d VH4-21-9 17 4 VH4.14
VH4-31-1 23 4 4.34; 3d230d; DP78 VH4-31-2 23 4 4.34.2 VH4-31-3 19 4
DP64; 3d216d VH4-31-4 19 4 DP65; 4-31; 3d277d VH4-31-5 23 4 4.33;
3d75d VH4-31-6 20 4 H10 VH4-31-7 20 4 H11 VH4-31-8 23 4 4.31
VH4-31-9 23 4 4.32 VH4-31-10 20 4 3d277d VH4-31-11 20 4 3d216d
VH4-31-12 20 4 3d279d VH4-31-13 17 4 VH4.18; 4d154; DP79 VH4-31-14
8 4 V4-39 VH4-31-15 11 4 2-1; DP79 VH4-31-16 23 4 4.30 VH4-31-17 17
4 VH4.12 VH4-31-18 10 4 71-2; DP66 VH4-31-19 23 4 4.39 VH4-31-20 8
4 V4-61 VH5-12-1 9 5 VH251; DP73; VHVCW; 51-R1; VHVLB; VHVCH;
VHVTT; VHVAU; VHVBLK; VhAU; V5-51 VH5-12-2 17 5 VHVJB VH5-12-3 3 5
1-v; DP80; 5-78 VH5-12-4 9 5 VH32; VHVRG; VHVMW; 5-2R1 VH6-35-1 4 6
VHVI; VH6; VHVIIS; VHVITE: VHVIJB; VHVICH; VHVICW; VHVIBLK; VHVIMW;
DP74; 6-1G1; V6-1
[0230] TABLE-US-00005 TABLE 2A rearranged human kappa sequences
Computed Germline Diff. to % diff. to Name.sup.1 aa.sup.2
family.sup.3 gene.sup.4 germline.sup.5 germline.sup.6
Reference.sup.7 III-3R 108 1 O8 1 1.1% 70 No. 86 109 1 O8 3 3.2% 80
AU 108 1 O8 6 6.3% 103 ROY 108 1 O8 6 6.3% 43 IC4 108 1 O8 6 6.3%
70 HIV-B26 106 1 O8 3 3.2% 8 GRI 108 1 O8 8 8.4% 30 AG 106 1 O8 8
8.6% 116 REI 108 1 O8 9 9.5% 86 CLL PATIENT 16 88 1 O8 2 2.3% 122
CLL PATIENT 14 87 1 O8 2 2.3% 122 CLL PATIENT 15 88 1 O8 2 2.3% 122
GM4672 108 1 O8 11 11.6% 24 HUM. YFC51.1 108 1 O8 12 12.6% 110 LAY
108 1 O8 12 12.6% 48 HIV-b13 106 1 O8 9 9.7% 8 MAL-NaCl 108 1 O8 13
13.7% 102 STRAb SA-1A 108 1 O2 0 0.0% 120 HuVHCAMP 108 1 O8 13
13.7% 100 CRO 108 1 O2 10 10.5% 30 Am 107 108 1 O2 12 12.6% 108
WALKER 107 1 O2 4 4.2% 57 III-2R 109 1 A20 0 0.0% 70 FOG1-A4 107 1
A20 4 4.2% 41 HK137 95 1 L1 0 0.0% 10 CEA4-8A 107 1 O2 7 7.4% 41
Va' 95 1 L4 0 0.0% 90 TR1.21 108 1 O2 4 4.2% 92 HAU 108 1 O2 6 6.3%
123 HK102 95 1 L12(1) 0 0.0% 9 H20C3K 108 1 L12(2) 3 3.2% 125 CHEB
108 1 O2 7 7.4% 5 HK134 95 1 L15(2) 0 0.0% 10 TEL9 108 1 O2 9 9.5%
73 TR1.32 103 1 O2 3 3.2% 92 RF-KES1 97 1 A20 4 4.2% 121 WES 108 1
L5 10 10.5% 61 DILp1 95 1 O4 1 1.1% 70 SA-4B 107 1 L12(2) 8 8.4%
120 HK101 95 1 L15(1) 0 0.0% 9 TR1.23 108 1 O2 5 5.3% 92 HF2-1/17
108 1 A30 0 0.0% 4 2E7 108 1 A30 1 1.1% 62 33.C9 107 1 L12(2) 7
7.4% 126 3D6 105 1 L12(2) 2 2.1% 34 I-2a 108 1 L8 8 8.4% 70 RF-KL1
97 1 L8 4 4.2% 121 TNF-E7 108 1 A30 9 9.5% 41 TR1.22 108 1 O2 7
7.4% 92 HIV-B35 106 1 O2 2 2.2% 8 HIV-b22 106 1 O2 2 2.2% 8 HIV-b27
106 1 O2 2 2.2% 8 HIV-B8 107 1 O2 10 10.8% 8 HIV-b3 107 1 O2 10
10.8% 8 RF-SJ5 95 1 A30 5 5.3% 113 GAL(I) 108 1 A30 6 6.3% 64
R3.5H5G 108 1 O2 6 6.3% 70 HIV-b14 106 1 A20 2 2.2% 8 TNF-E1 105 1
L5 8 8.4% 41 WEA 108 1 A30 8 8.4% 37 EU 108 1 L12(2) 5 5.3% 40
FOG1-G8 108 1 L8 11 11.6% 41 1X7RG1 108 1 L1 8 8.4% 70 BLI 108 1 L8
3 3.2% 72 KUE 108 1 L12(2) 11 11.6% 32 LUNm01 108 1 L12(2) 10 10.5%
6 HIV-b1 106 1 A20 4 4.3% 8 HIV-s4 103 1 O2 2 2.2% 8 CAR 107 1
L12(2) 11 11.7% 79 BR 107 1 L12(2) 11 11.6% 50 CLL PATIENT 10 88 1
O2 0 0.0% 122 CLL PATIENT 12 88 1 O2 0 0.0% 122 KING 108 1 L12(2)
12 12.6% 30 V13 95 1 L24 0 0.0% 46 CLL PATIENT 11 87 1 O2 0 0.0%
122 CLL PATIENT 13 87 1 O2 0 0.0% 122 CLL PATIENT 9 88 1 O12 1 1.1%
122 HIV-B2 106 1 A20 9 9.7% 8 HIV-b2 106 1 A20 9 9.7% 8 CLL PATIENT
5 88 1 A20 1 1.1% 122 CLL PATIENT 1 88 1 L8 2 2.3% 122 CLL PATIENT
2 88 1 L8 0 0.0% 122 CLL PATIENT 7 88 1 L5 0 0.0% 122 CLL PATIENT 8
88 1 L5 0 0.0% 122 HIV-b5 105 1 L5 11 12.0% 8 CLL PATIENT 3 87 1 L8
1 1.1% 122 CLL PATIENT 4 88 1 L9 0 0.0% 122 CLL PATIENT 18 85 1 L9
6 7.1% 122 CLL PATIENT 17 86 1 L12(2) 7 8.1% 122 HIV-b20 107 3 A27
11 11.7% 8 2C12 108 1 L12(2) 20 21.1% 68 1B11 108 1 L12(2) 20 21.1%
68 1H1 108 1 L12(2) 21 22.1% 68 2A12 108 1 L12(2) 21 22.1% 68 CUR
109 3 A27 0 0.0% 66 GLO 109 3 A27 0 0.0% 16 RF-TS1 96 3 A27 0 0.0%
121 GAR' 109 3 A27 0 0.0% 67 FLO 109 3 A27 0 0.0% 66 PIE 109 3 A27
0 0.0% 91 HAH 14.1 109 3 A27 1 1.0% 51 HAH 14.2 109 3 A27 1 1.0% 51
HAH 16.1 109 3 A27 1 1.0% 51 NOV 109 3 A27 1 1.0% 52 33.F12 108 3
A27 1 1.0% 126 8E10 110 3 A27 1 1.0% 25 TH3 109 3 A27 1 1.0% 25 HIC
(R) 108 3 A27 0 0.0% 51 SON 110 3 A27 1 1.0% 67 PAY 109 3 A27 1
1.0% 66 GOT 109 3 A27 1 1.0% 67 mAbA6H4C5 109 3 A27 1 1.0% 12 BOR'
109 3 A27 2 2.1% 84 RF-SJ3 96 3 A27 2 2.1% 121 SIE 109 3 A27 2 2.1%
15 ESC 109 3 A27 2 2.1% 98 HEW' 110 3 A27 2 2.1% 98 YES8c 109 3 A27
3 3.1% 33 TI 109 3 A27 3 3.1% 114 mAb113 109 3 A27 3 3.1% 71 HEW
107 3 A27 0 0.0% 94 BRO 106 3 A27 0 0.0% 94 ROB 106 3 A27 0 0.0% 94
NG9 96 3 A27 4 4.2% 11 NEU 109 3 A27 4 4.2% 66 WOL 109 3 A27 4 4.2%
2 35G6 109 3 A27 4 4.2% 59 RF-SJ4 109 3 A11 0 0.0% 88 KAS 109 3 A27
4 4.2% 84 BRA 106 3 A27 1 1.1% 94 HAH 106 3 A27 1 1.1% 94 HIC 105 3
A27 0 0.0% 94 FS-2 109 3 A27 6 6.3% 87 JH' 107 3 A27 6 6.3% 38
EV1-15 109 3 A27 6 6.3% 83 SCA 108 3 A27 6 6.3% 65 mAb112 109 3 A27
6 6.3% 71 SIC 103 3 A27 3 3.3% 94 SA-4A 109 3 A27 6 6.3% 120 SER
108 3 A27 6 6.3% 98 GOL' 109 3 A27 7 7.3% 82 B5G10K 105 3 A27 9
9.7% 125 HG2B10K 110 3 A27 9 9.4% 125 Taykv322 105 3 A27 5 5.4% 52
CLL PATIENT 24 89 3 A27 1 1.1% 122 HIV-b24 107 3 A27 7 7.4% 8
HIV-b6 107 3 A27 7 7.4% 8 Taykv310 99 3 A27 1 1.1% 52 KA3D1 108 3
L6 0 0.0% 85 19.E7 107 3 L6 0 0.0% 126 rsv6L 109 3 A27 12 12.5% 7
Taykv320 98 3 A27 1 1.2% 52 Vh 96 3 L10(2) 0 0.0% 89 LS8 108 3 L6 1
1.1% 109 LS1 108 3 L6 1 1.1% 109 LS2S3-3 107 3 L6 2 2.1% 99 LS2 108
3 L6 1 1.1% 109 LS7 108 3 L6 1 1.1% 109 LS2S3-4d 107 3 L6 2 2.1% 99
LS2S3-4a 107 3 L6 2 2.1% 99 LS4 108 3 L6 1 1.1% 109 LS6 108 3 L6 1
1.1% 109 LS2S3-10a 107 3 L6 2 2.1% 99 LS2S3-8c 107 3 L6 2 2.1% 99
LS5 108 3 L6 1 1.1% 109 LS2S3-5 107 3 L6 3 3.2% 99 LUNm03 109 3 A27
13 13.5% 6 IARC/BL41 108 3 A27 13 13.7% 55 slkv22 99 3 A27 3 3.5%
13 POP 108 3 L6 4 4.2% 111 LS2S3-10b 107 3 L6 3 3.2% 99 LS2S3-8f
107 3 L6 3 3.2% 99 LS2S3-12 107 3 L6 3 3.2% 99 HIV-B30 107 3 A27 11
11.7% 8 HIV-B20 107 3 A27 11 11.7% 8 HIV-b3 108 3 A27 11 11.7% 8
HIV-s6 104 3 A27 9 9.9% 8 YSE 107 3 L2/L16 1 1.1% 72 POM 109 3
L2/L16 9 9.4% 53 Humkv328 95 3 L2/L16 1 1.1% 19 CLL 109 3 L2/L16 3
3.2% 47 LES 96 3 L2/L16 3 3.2% 38 HIV-s5 104 3 A27 11 12.1% 8
HIV-s7 104 3 A27 11 12.1% 8 slkv1 99 3 A27 7 8.1% 13 Humka31es 95 3
L2/L16 4 4.2% 18 slkv12 101 3 A27 8 9.2% 13 RF-TS2 95 3 L2/L16 3
3.2% 121 II-1 109 3 L2/L16 4 4.2% 70 HIV-s3 105 3 A27 13 14.3% 8
RF-TMC1 96 3 L6 10 10.5% 121 GER 109 3 L2/L16 7 7.4% 75 GF4/1.1 109
3 L2/L16 8 8.4% 36 mAb114 109 3 L2/L16 6 6.3% 71 HIV-loop13 109 3
L2/L16 7 7.4% 8 bkv16 86 3 L6 1 1.2% 13 CLL PATIENT 29 86 3 L6 1
1.2% 122 slkv9 98 3 L6 3 3.5% 13 bkv17 99 3 L6 1 1.2% 13 slkv14 99
3 L6 1 1.2% 13 slkv16 101 3 L6 2 2.3% 13 bkv33 101 3 L6 4 4.7% 13
slkv15 99 3 L6 2 2.3% 13 bkv6 100 3 L6 3 3.5% 13 R6B8K 108 3 L2/L16
12 12.6% 125 AL 700 107 3 L2/L16 9 9.5% 117 slkv11 100 3 L2/L16 3
3.5% 13 slkv4 97 3 L6 4 4.8% 13 CLL PATIENT 26 87 3 L2/L16 1 1.1%
122 AL Se124 103 3 L2/L16 9 9.5% 117 slkv13 100 3 L2/L16 6 7.0% 13
bkv7 100 3 L2/L16 5 5.8% 13 bkv22 100 3 L2/L16 6 7.0% 13 CLL
PATIENT 27 84 3 L2/L16 0 0.0% 122 bkv35 100 3 L6 8 9.3% 13 CLL
PATIENT 25 87 3 L2/L16 4 4.6% 122 slkv3 86 3 L2/L16 7 8.1% 13 slkv7
99 1 O2 7 8.1% 13 HuFd79 111 3 L2/L16 24 24.2% 21 RAD 99 3 A27 9
10.3% 78 CLL PATIENT 28 83 3 L2/L16 4 4.8% 122 REE 104 3 L2/L16 25
27.2% 95 FR4 99 3 A27 8 9.2% 77 MD3.3 92 3 L6 1 1.3% 54 MD3.1 92 3
L6 0 0.0% 54 GA3.6 92 3 L6 2 2.6% 54 M3.5N 92 3 L6 3 3.8% 54 WEI'
82 3 A27 0 0.0% 65 MD3.4 92 3 L2/L16 1 1.3% 54 MD3.2 91 3 L6 3 3.8%
54 VER 97 3 A27 19 22.4% 20 CLL PATIENT 30 78 3 L6 3 3.8% 122 M3.1N
92 3 L2/L16 1 1.3% 54 MD3.6 91 3 L2/L16 0 0.0% 54 MD3.8 91 3 L2/L16
0 0.0% 54 GA3.4 92 3 L6 7 9.0% 54 M3.6N 92 3 A27 0 0.0% 54 MD3.10
92 3 A27 0 0.0% 54 MD3.13 91 3 A27 0 0.0% 54 MD3.7 93 3 A27 0 0.0%
54 MD3.9 93 3 A27 0 0.0% 54 GA3.1 93 3 A27 6 7.6% 54
bkv32 101 3 A27 5 5.7% 13 GA3.5 93 3 A27 5 6.3% 54 GA3.7 92 3 A27 7
8.9% 54 MD3.12 92 3 A27 2 2.5% 54 M3.2N 90 3 L6 6 7.8% 54 MD3.5 92
3 A27 1 1.3% 54 M3.4N 91 3 L2/L16 8 10.3% 54 M3.8N 91 3 L2/L16 7
9.0% 54 M3.7N 92 3 A27 3 3.8% 54 GA3.2 92 3 A27 9 11.4% 54 GA3.8 93
3 A27 4 5.1% 54 GA3.3 92 3 A27 8 10.1% 54 M3.3N 92 3 A27 5 6.3% 54
B6 83 3 A27 8 11.3% 78 E29.1 KAPPA 78 3 L2/L16 0 0.0% 22 SCW 108 1
O8 12 12.6% 31 REI-based CAMPATH-9 107 1 O8 14 14.7% 39 RZ 107 1 O8
14 14.7% 50 BI 108 1 O8 14 14.7% 14 AND 107 1 O2 13 13.7% 69 2A4
109 1 O2 12 12.6% 23 KA 108 1 O8 19 20.0% 107 MEV 109 1 O2 14 14.7%
29 DEE 106 1 O2 13 14.0% 76 OU(IOC) 108 1 O2 18 18.9% 60 HuRSV19VK
111 1 O8 21 21.0% 115 SP2 108 1 O2 17 17.9% 93 BJ26 99 1 O8 21
24.1% 1 NI 112 1 O8 24 24.2% 106 BMA 0310EUCIV2 106 1 L12(1) 21
22.3% 105 CLL PATIENT 6 71 1 A20 0 0.0% 122 BJ19 85 1 O8 16 21.9% 1
GM 607 113 2 A3 0 0.0% 58 R5A3K 114 2 A3 1 1.0% 125 R1C8K 114 2 A3
1 1.0% 125 VK2.R149 113 2 A3 2 2.0% 118 TR1.6 109 2 A3 4 4.0% 92
TR1.37 104 2 A3 5 5.0% 92 FS-1 113 2 A3 6 6.0% 87 TR1.8 110 2 A3 6
6.0% 92 NIM 113 2 A3 8 8.0% 28 Inc 112 2 A3 11 11.0% 35 TEW 107 2
A3 6 6.4% 96 CUM 114 2 O1 7 6.9% 44 HRF1 71 2 A3 4 5.6% 124 CLL
PATIENT 19 87 2 A3 0 0.0% 122 CLL PATIENT 20 87 2 A3 0 0.0% 122 MIL
112 2 A3 16 16.2% 26 FR 113 2 A3 20 20.0% 101 MAL-Urine 83 1 O2 6
8.6% 102 Taykv306 73 3 A27 1 1.6% 52 Taykv312 75 3 A27 1 1.6% 52
HIV-b29 93 3 A27 14 17.5% 8 1-185-37 110 3 A27 0 0.0% 119 1-187-29
110 3 A27 0 0.0% 119 TT117 110 3 A27 9 9.4% 63 HIV-loop8 108 3 A27
16 16.8% 8 rsv23L 108 3 A27 16 16.8% 7 HIV-b7 107 3 A27 14 14.9% 8
HIV-b11 107 3 A27 15 16.0% 8 HIV-LC1 107 3 A27 19 20.2% 8 HIV-LC7
107 3 A27 20 21.3% 8 HIV-LC22 107 3 A27 21 22.3% 8 HIV-LC13 107 3
A27 21 22.3% 8 HIV-LC3 107 3 A27 21 22.3% 8 HIV-LC5 107 3 A27 21
22.3% 8 HIV-LC28 107 3 A27 21 22.3% 8 HIV-b4 107 3 A27 22 23.4% 8
CLL PATIENT 31 87 3 A27 15 17.2% 122 HIV-loop2 108 3 L2/L16 17
17.9% 8 HIV-loop35 108 3 L2/L16 17 17.9% 8 HIV-LC11 107 3 A27 23
24.5% 8 HIV-LC24 107 3 A27 23 24.5% 8 HIV-b12 107 3 A27 24 25.5% 8
HIV-LC25 107 3 A27 24 25.5% 8 HIV-b21 107 3 A27 24 25.5% 8 HIV-LC26
107 3 A27 26 27.7% 8 G3D10K 108 1 L12(2) 12 12.6% 125 TT125 108 1
L5 8 8.4% 63 HIV-s2 103 3 A27 28 31.1% 8 265-695 108 1 L5 7 7.4% 3
2-115-19 108 1 A30 2 2.1% 119 rsv13L 107 1 O2 20 21.1% 7 HIV-b18
106 1 O2 14 15.1% 8 RF-KL5 98 3 L6 36 36.7% 97 ZM1-1 113 2 A17 7
7.0% 3 HIV-s8 103 1 O8 16 17.8% 8 K-EV15 95 5 B2 0 0.0% 112 RF-TS3
100 2 A23 0 0.0% 121 HF-21/28 111 2 A17 1 1.0% 17 RPMI6410 113 2
A17 1 1.0% 42 JC11 113 2 A17 1 1.0% 49 O-81 114 2 A17 5 5.0% 45
FK-001 113 4 B3 0 0.0% 81 CD5+.28 101 4 83 1 1.0% 27 LEN 114 4 B3 1
1.0% 104 UC 114 4 B3 1 1.0% 111 CD5+.5 101 4 B3 1 1.0% 27 CD5+.26
101 4 B3 1 1.0% 27 CD5+.12 101 4 B3 2 2.0% 27 CD5+.23 101 4 B3 2
2.0% 27 CD5+.7 101 4 B3 2 2.0% 27 VJI 113 4 B3 3 3.0% 56 LOC 113 4
B3 3 3.0% 72 MAL 113 4 B3 3 3.0% 72 CD5+.6 101 4 B3 3 3.0% 27 H2F
113 4 B3 3 3.0% 70 PB17IV 114 4 B3 4 4.0% 74 CD5+.27 101 4 B3 4
4.0% 27 CD5+.9 101 4 B3 4 4.0% 27 CD5-.28 101 4 B3 5 5.0% 27
CD5-.26 101 4 B3 6 5.9% 27 CD5+.24 101 4 B3 6 5.9% 27 CD5+.10 101 4
B3 6 5.9% 27 CD5-.19 101 4 B3 6 5.9% 27 CD5-.18 101 4 B3 7 6.9% 27
CD5-.16 101 4 B3 8 7.9% 27 CD5-.24 101 4 B3 8 7.9% 27 CD5-.17 101 4
B3 10 9.9% 27 MD4.1 92 4 B3 0 0.0% 54 MD4.4 92 4 B3 0 0.0% 54 MD4.5
92 4 B3 0 0.0% 54 MD4.6 92 4 B3 0 0.0% 54 MD4.7 92 4 B3 0 0.0% 54
MD4.2 92 4 B3 1 1.3% 54 MD4.3 92 4 B3 5 6.3% 54 CLL PATIENT 22 87 2
A17 2 2.3% 122 CLL PATIENT 23 84 2 A17 2 2.4% 122
[0231] TABLE-US-00006 TABLE 2B rearranged human lambda sequences
Computed Germline Diff. to % diff. to Name.sup.1 aa.sup.2
family.sup.3 gene.sup.4 germline.sup.5 germline.sup.6
Reference.sup.7 WAH 110 1 DPL3 7 7% 68 1B9/F2 112 1 DPL3 7 7% 9 DIA
112 1 DPL2 7 7% 36 mAb67 89 1 DPL3 0 0% 29 HiH2 110 1 DPL3 12 11% 3
NIG-77 112 1 DPL2 9 9% 72 OKA 112 1 DPL2 7 7% 84 KOL 112 1 DPL2 12
11% 40 T2:C5 111 1 DPL5 0 0% 6 T2:C14 110 1 DPL5 0 0% 6 PR-TS1 110
1 DPL5 0 0% 55 4G12 111 1 DPL5 1 1% 35 KIM46L 112 1 HUMLV117 0 0% 8
Fog-B 111 1 DPL5 3 3% 31 9F2L 111 1 DPL5 3 3% 79 mAb111 110 1 DPL5
3 3% 48 PHOX15 111 1 DPL5 4 4% 49 BL2 111 1 DPL5 4 4% 74 NIG-64 111
1 DPL5 4 4% 72 RF-SJ2 100 1 DPL5 6 6% 78 AL EZI 112 1 DPL5 7 7% 41
ZIM 112 1 HUMLV117 7 7% 18 RF-SJ1 100 1 DPL5 9 9% 78 IGLV1.1 98 1
DPL4 0 0% 1 NEW 112 1 HUMLV117 11 10% 42 CB-201 87 1 DPL2 1 1% 62
MEM 109 1 DPL2 6 6% 50 H210 111 2 DPL10 4 4% 45 NOV 110 2 DPL10 8
8% 25 NEI 111 2 DPL10 8 8% 24 AL MC 110 2 DPL11 6 6% 28 MES 112 2
DPL11 8 8% 84 FOG1-A3 111 2 DPL11 9 9% 27 AL NOV 112 2 DPL11 7 7%
28 HMST-1 110 2 DPL11 4 4% 82 HBW4-1 108 2 DPL12 9 9% 52 WH 110 2
OPL11 11 11% 34 11-50 110 2 DPL11 7 7% 82 HBp2 110 2 DPL12 8 8% 3
NIG-84 113 2 DPL11 12 11% 73 VIL 112 2 DPL11 9 9% 58 TRO 111 2
DPL12 10 10% 61 ES492 108 2 DPL11 15 15% 76 mAb216 89 2 DPL12 1 1%
7 BSA3 109 3 DPL16 0 0% 49 THY-29 110 3 DPL16 0 0% 27 PR-TS2 108 3
DPL16 0 0% 55 E29.1 LAMBDA 107 3 DPL16 1 1% 13 mAb63 109 3 DPL16 2
2% 29 TEL14 110 3 DPL16 6 6% 49 6H-3C4 108 3 DPL16 7 7% 39 SH 109 3
DPL16 7 7% 70 AL GIL 109 3 DPL16 8 8% 23 H6-3C4 108 3 DPL16 8 8% 83
V-lambda-2.DS 111 2 DPL11 3 3% 15 8.12 ID 110 2 DPL11 3 3% 81 DSC
111 2 DPL11 3 3% 56 PV11 110 2 DPL11 1 1% 56 33.H11 110 2 DPL11 4
4% 81 AS17 111 2 DPL11 7 7% 56 SD6 110 2 DPL11 7 7% 56 KS3 110 2
DPL11 9 9% 56 PV6 110 2 DPL12 5 5% 56 NGD9 110 2 DPL11 7 7% 56
MUC1-1 111 2 DPL11 11 10% 27 A30c 111 2 DPL10 6 6% 56 KS6 110 2
DPL12 6 6% 56 TEL13 111 2 DPL11 11 10% 49 AS7 110 2 DPL12 6 6% 56
MCG 112 2 DPL12 12 11% 20 U266L 110 2 DPL12 13 12% 77 PR-SJ2 110 2
DPL12 14 13% 55 BOH 112 2 DPL12 11 10% 37 TOG 111 2 DPL11 19 18% 53
TEL16 111 2 DPL11 19 18% 49 No. 13 110 2 DPL10 14 13% 52 BO 112 2
DPL12 18 17% 80 WIN 112 2 DPL12 17 16% 11 BUR 104 2 DPL12 15 15% 46
NIG-58 110 2 DPL12 20 19% 69 WEIR 112 2 DPL11 26 25% 21 THY-32 111
1 DPL8 8 8% 27 TNF-H9G1 111 1 DPL8 9 9% 27 mAb61 111 1 DPL3 1 1% 29
LV1L1 98 1 DPL2 0 0% 54 HA 113 1 DPL3 14 13% 63 LA1L1 111 1 DPL2 3
3% 54 RHE 112 1 DPL1 17 16% 22 K1B12L 113 1 DPL8 17 16% 79 LOC 113
1 DPL2 15 14% 84 NIG-51 112 1 DPL2 12 11% 67 NEWM 104 1 DPL8 23 22%
10 MD3-4 106 3 DPL23 14 13% 4 COX 112 1 DPL2 13 12% 84 HiH10 106 3
DPL23 13 12% 3 VOR 112 1 DPL2 16 15% 16 AL POL 113 1 DPL2 16 15% 57
CD4-74 111 1 DPL2 19 18% 27 AMYLOID MOL 102 3 DPL23 15 15% 30
OST577 108 3 Humlv318 10 10% 4 NIG-48 113 1 DPL3 42 40% 66 CARR 108
3 DPL23 18 17% 19 mAb60 108 3 DPL23 14 13% 29 NIG-68 99 3 DPL23 25
26% 32 KERN 107 3 DPL23 26 25% 59 ANT 106 3 DPL23 17 16% 19 LEE 110
3 DPL23 18 17% 85 CLE 94 3 DPL23 17 17% 19 VL8 98 8 DPL21 0 0% 81
MOT 110 3 Humlv318 23 22% 38 GAR 108 3 DPL23 26 25% 33 32.B9 98 8
DPL21 5 5% 81 PUG 108 3 Humlv318 24 23% 19 T1 115 8 HUMLV801 52 50%
6 RF-TS7 96 7 DPL18 4 4% 60 YM-1 116 8 HUMLV801 51 49% 75 K6H6 112
8 HUMLV801 20 19% 44 K5C7 112 8 HUMLV801 20 19% 44 K5B8 112 8
HUMLV801 20 19% 44 K5G5 112 8 HUMLV801 20 19% 44 K4B8 112 8
HUMLV801 19 18% 44 K6F5 112 8 HUMLV801 17 16% 44 HIL 108 3 DPL23 22
21% 47 KIR 109 3 DPL23 20 19% 19 CAP 109 3 DPL23 19 18% 84 1B8 110
3 DPL23 22 21% 43 SHO 108 3 DPL23 19 18% 19 HAN 108 3 DPL23 20 19%
19 cML23 96 3 DPL23 3 3% 12 PR-SJ1 96 3 DPL23 7 7% 55 BAU 107 3
DPL23 9 9% 5 TEX 99 3 DPL23 8 8% 19 X(PET) 107 3 DPL23 9 9% 51 DOY
106 3 DPL23 9 9% 19 COT 106 3 DPL23 13 12% 19 Pag-1 111 3 Humlv318
5 50% 31 DIS 107 3 Humlv318 2 2% 19 WIT 108 3 Humlv318 7 7% 19 I.RH
108 3 Humlv318 12 11% 19 s1-1 108 3 Humlv318 12 11% 52 DEL 108 3
Humlv318 14 13% 17 TYR 108 3 Humlv318 11 10% 19 J.RH 109 3 Humlv318
13 12% 19 THO 112 2 DPL13 38 36% 26 LBV 113 1 DPL3 38 36% 2 WLT 112
1 DPL3 33 31% 14 SUT 112 2 DPL12 37 35% 65
[0232] TABLE-US-00007 TABLE 2C rearranged human heavy chain
sequences Computed Germline Diff. to % diff. to Name.sup.1 aa.sup.2
family.sup.3 gene.sup.4 germline.sup.5 germline.sup.6
Reference.sup.7 21/28 119 1 VH1-13-12 0 0.0% 31 8E10 123 1
VH1-13-12 0 0.0% 31 MUC1-1 118 1 VH1-13-6 4 4.1% 42 gF1 98 1
VH1-13-12 10 10.2% 75 VHGL 1.2 98 1 VH1-13-6 2 2.0% 26 HV1L1 98 1
VH1-13-6 0 0.0% 81 RF-TS7 104 1 VH1-13-6 3 3.1% 96 E55 1.A15 106 1
VH1-13-15 1 1.0% 26 HA1L1 126 1 VH1-13-6 7 7.1% 81 UC 123 1
VH1-13-6 5 5.1% 5 WIL2 123 1 VH1-13-6 6 6.1% 55 R3.5H5G 122 1
VH1-13-6 10 10.2% 70 N89P2 123 1 VH1-13-16 11 11.2% 77 mAb113 126 1
VH1-13-6 10 10.2% 71 LS2S3-3 125 1 VH1-12-7 5 5.1% 98 LS2S3-12a 125
1 VH1-12-7 5 5.1% 98 LS2S3-5 125 1 VH1-12-7 5 5.1% 98 LS2S3-12e 125
1 VH1-12-7 5 5.1% 98 LS2S3-4 125 1 VH1-12-7 5 5.1% 98 LS2S3-10 125
1 VH1-12-7 5 5.1% 98 LS2S3-12d 125 1 VH1-12-7 6 6.1% 98 LS2S3-8 125
1 VH1-12-7 5 5.1% 98 LS2 125 1 VH1-12-7 6 6.1% 113 LS4 105 1
VH1-12-7 6 6.1% 113 LS5 125 1 VH1-12-7 6 6.1% 113 LS1 125 1
VH1-12-7 6 6.1% 113 LS6 125 1 VH1-12-7 6 6.1% 113 LS8 125 1
VH1-12-7 7 7.1% 113 THY-29 122 1 VH1-12-7 0 0.0% 42 1B9/F2 122 1
VH1-12-7 10 10.2% 21 51P1 122 1 VH1-12-1 0 0.0% 105 NEI 127 1
VH1-12-1 0 0.0% 55 AND 127 1 VH1-12-1 0 0.0% 55 L7 127 1 VH1-12-1 0
0.0% 54 L22 124 1 VH1-12-1 0 0.0% 54 L24 127 1 VH1-12-1 0 0.0% 54
L26 116 1 VH1-12-1 0 0.0% 54 L33 119 1 VH1-12-1 0 0.0% 54 L34 117 1
VH1-12-1 0 0.0% 54 L36 118 1 VH1-12-1 0 0.0% 54 L39 120 1 VH1-12-1
0 0.0% 54 L41 120 1 VH1-12-1 0 0.0% 54 L42 125 1 VH1-12-1 0 0.0% 54
VHGL 1.8 101 1 VH1-12-1 0 0.0% 26 783c 127 1 VH1-12-1 0 0.0% 22
X17115 127 1 VH1-12-1 0 0.0% 37 L25 124 1 VH1-12-1 0 0.0% 54 L17
120 1 VH1-12-1 1 1.0% 54 L30 127 1 VH1-12-1 1 1.0% 54 L37 120 1
VH1-12-1 1 1.0% 54 TNF-E7 116 1 VH1-12-1 2 2.0% 42 mAb111 122 1
VH1-12-1 7 7.1% 71 III-2R 122 1 VH1-12-9 3 3.1% 70 KAS 121 1
VH1-12-1 7 7.1% 79 YES8c 122 1 VH1-12-1 8 8.2% 34 RF-TS1 123 1
VH1-12-1 8 8.2% 82 BOR' 121 1 VH1-12-8 7 7.1% 79 VHGL 1.9 101 1
VH1-12-1 8 8.2% 26 mAb410.30F305 117 1 VH1-12-9 5 5.1% 52 EV1-15
127 1 VH1-12-8 10 10.2% 78 mAb112 122 1 VH1-12-1 11 11.2% 71 EU 117
1 VH1-12-1 11 11.2% 28 H210 127 1 VH1-12-1 12 12.2% 66 TRANSGENE
104 1 VH1-12-1 0 0.0% 111 CLL2-1 93 1 VH1-12-1 0 0.0% 30 CLL10 13-3
97 1 VH1-12-1 0 0.0% 29 LS7 99 1 VH1-12-7 4 4.1% 113 ALL7-1 87 1
VH1-12-7 0 0.0% 30 CLL3-1 91 1 VH1-12-7 1 1.0% 30 ALL56-1 85 1
VH1-13-8 0 0.0% 30 ALL1-1 87 1 VH1-13-6 1 1.0% 30 ALL4-1 94 1
VH1-13-8 0 0.0% 30 ALL56 15-4 85 1 VH1-13-8 5 5.1% 29 CLL4-1 88 1
VH1-13-1 1 1.0% 30 Au92.1 98 1 VH1-12-5 0 0.0% 49 RF-TS3 120 1
VH1-12-5 1 1.0% 82 Au4.1 98 1 VH1-12-5 1 1.0% 49 HP1 121 1 VH1-13-6
13 13.3% 110 BLI 127 1 VH1-13-15 5 5.1% 72 No. 13 127 1 VH1-12-2 19
19.4% 76 TR1.23 122 1 VH1-13-2 23 23.5% 88 S1-1 125 1 VH1-12-2 18
18.4% 76 TR1.10 119 1 VH1-13-12 14 14.3% 88 E55 1.A2 102 1
VH1-13-15 3 3.1% 26 SP2 119 1 VH1-13-6 15 15.3% 89 TNF-H9G1 111 1
VH1-13-18 2 2.0% 42 G3D10H 127 1 VH1-13-16 19 19.4% 127 TR1.9 118 1
VH1-13-12 14 14.3% 88 TR1.8 121 1 VH1-12-1 24 24.5% 88 LUNm01 127 1
VH1-13-6 22 22.4% 9 K1B12H 127 1 VH1-12-7 23 23.5% 127 L3B2 99 1
VH1-13-6 2 2.0% 46 ss2 100 1 VH1-13-6 2 2.0% 46 No. 86 124 1
VH1-12-1 20 20.4% 76 TR1.6 124 1 VH1-12-1 19 19.4% 88 ss7 99 1
VH1-12-7 3 3.1% 46 s5B7 102 1 VH1-12-1 0 0.0% 46 s6A3 97 1 VH1-12-1
0 0.0% 46 ss6 99 1 VH1-12-1 0 0.0% 46 L2H7 103 1 VH1-13-12 0 0.0%
46 s6BG8 93 1 VH1-13-12 0 0.0% 46 s6C9 107 1 VH1-13-12 0 0.0% 46
HIV-b4 124 1 VH1-13-12 21 21.4% 12 HIV-b12 124 1 VH1-13-12 21 21.4%
12 L3G5 98 1 VH1-13-6 1 1.0% 46 22 115 1 VH1-13-6 11 11.2% 118
L2A12 99 1 VH1-13-15 3 3.1% 46 PHOX15 124 1 VH1-12-7 20 20.4% 73
LUNm03 127 1 VH1-1X-1 18 18.4% 9 CEA4-8A 129 1 VH1-12-7 1 1.0% 42
M60 121 2 VH2-31-3 3 3.0% 103 HiH10 127 2 VH2-31-5 9 9.0% 4 COR 119
2 VH2-31-2 11 11.0% 91 2-115-19 124 2 VH2-31-11 8 8.1% 124 OU 125 2
VH2-31-14 20 25.6% 92 HE 120 2 VH2-31-13 19 19.0% 27 CLL33 40-1 78
2 VH2-31-5 2 2.0% 29 E55 3.9 88 3 VH3-11-5 7 7.2% 26 MTFC3 125 3
VH3-14-4 21 21.0% 131 MTFC11 125 3 VH3-14-4 21 21.0% 131 MTFJ1 114
3 VH3-14-4 21 21.0% 131 MTFJ2 114 3 VH3-14-4 21 21.0% 131 MTFUJ4
100 3 VH3-14-4 21 21.0% 131 MTFUJ5 100 3 VH3-14-4 21 21.0% 131
MTFUJ2 100 3 VH3-14-4 22 22.0% 131 MTFC8 125 3 VH3-14-4 23 23.0%
131 TD e Vq 113 3 VH3-14-4 0 0.0% 16 rMTF 114 3 VH3-14-4 5 5.0% 131
MTFUJ6 100 3 VH3-14-4 10 10.0% 131 RF-KES 107 3 VH3-14-4 9 9.0% 85
N51P8 126 3 VH3-14-1 9 9.0% 77 TEI 119 3 VH3-13-8 21 21.4% 20
33.H11 115 3 VH3-13-19 10 10.2% 129 SB1/D8 101 3 VH3-IX-8 14 14.0%
2 38P1 119 3 VH3-11-3 0 0.0% 104 BRO'IGM 119 3 VH3-11-3 13 13.4% 19
NIE 119 3 VH3-13-7 15 15.3% 87 3D6 126 3 VH3-13-26 5 5.1% 35 ZM1-1
112 3 VH3-11-3 8 8.2% S E55 3.15 110 3 VH3-13-26 0 0.0% 26 gF9 108
3 VH3-13-8 15 15.3% 75 THY-32 120 3 VH3-13-26 3 3.1% 42 RF-KL5 100
3 VH3-13-26 5 5.1% 96 OST577 122 3 VH3-13-13 6 6.1% 5 BO 113 3
VH3-13-19 15 15.3% 10 TT125 121 3 VH3-13-10 15 15.3% 64 2-115-58
127 3 VH3-13-10 11 11.2% 124 KOL 126 3 VH3-13-14 16 16.3% 102 mAb60
118 3 VH3-13-17 14 14.3% 45 RF-AN 106 3 VH3-13-26 8 8.2% 85 BUT 115
3 VH3-11-6 13 13.4% 119 KOL-based CAMPATH-9 118 3 VH3-13-13 16
16.3% 41 B1 119 3 VH3-13-19 13 13.3% 53 N98P1 127 3 VH3-13-1 13
13.3% 77 TT117 107 3 VH3-13-10 12 12.2% 64 WEA 114 3 VH3-13-12 15
15.3% 40 HIL 120 3 VH3-13-14 14 14.3% 23 s5A10 97 3 VH3-13-14 0
0.0% 46 s5D11 98 3 VH3-13-7 0 0.0% 46 s6C8 100 3 VH3-13-7 0 0.0% 46
s6H12 98 3 VH3-13-7 0 0.0% 46 VH10.7 119 3 VH3-13-14 16 16.3% 128
HIV-loop2 126 3 VH3-13-7 16 16.3% 12 HIV-loop35 126 3 VH3-13-7 16
16.3% 12 TRO 122 3 VH3-13-1 13 13.3% 61 SA-4B 123 3 VH3-13-1 15
15.3% 125 L2B5 98 3 VH3-13-13 0 0.0% 46 s6E11 95 3 VH3-13-13 0 0.0%
46 s6H7 100 3 VH3-13-13 0 0.0% 46 ss1 102 3 VH3-13-13 0 0.0% 46 ss8
94 3 VH3-13-13 0 0.0% 46 DOB 120 3 VH3-13-26 21 21.4% 116 THY-33
115 3 VH3-13-15 20 20.4% 42 NOV 118 3 VH3-13-19 14 14.3% 38 rsv13H
120 3 VH3-13-24 20 20.4% 11 L3G11 98 3 VH3-13-20 2 2.0% 46 L2E8 99
3 VH3-13-19 0 0.0% 46 L2D10 101 3 VH3-13-10 1 1.0% 46 L2E7 98 3
VH3-13-10 1 1.0% 46 L3A10 100 3 VH3-13-24 0 0.0% 46 L2E5 97 3
VH3-13-2 1 1.0% 46 BUR 119 3 VH3-13-7 21 21.4% 67 s4D5 107 3
VH3-11-3 1 1.0% 46 19 116 3 VH3-13-16 4 4.1% 118 s5D4 99 3 VH3-13-1
0 0.0% 46 s6A8 100 3 VH3-13-1 0 0.0% 46 HIV-loop13 123 3 VH3-13-12
17 17.3% 12 TR1.32 112 3 VH3-11-8 18 18.6% 88 L2B10 97 3 VH3-11-3 1
1.0% 46 TR1.5 114 3 VH3-11-8 21 21.6% 88 s6H9 101 3 VH3-13-25 0
0.0% 46 8 112 3 VH3-13-1 6 6.1% 118 23 115 3 VH3-13-1 6 6.1% 118 7
115 3 VH3-13-1 4 4.1% 118 TR1.3 120 3 VH3-11-8 20 20.6% 88 18/2 125
3 VH3-13-10 0 0.0% 32 18/9 125 3 VH3-13-10 0 0.0% 31 30P1 119 3
VH3-13-10 0 0.0% 106 HF2-1/17 125 3 VH3-13-10 0 0.0% 8 A77 109 3
VH3-13-10 0 0.0% 44 B19.7 108 3 VH3-13-10 0 0.0% 44 M43 119 3
VH3-13-10 0 0.0% 103 1/17 125 3 VH3-13-10 0 0.0% 31 18/17 125 3
VH3-13-10 0 0.0% 31 E54 3.4 109 3 VH3-13-10 0 0.0% 26 LAMBDA-VH26
98 3 VH3-13-10 1 1.0% 95 E54 3.8 111 3 VH3-13-10 1 1.0% 26 GL16 106
3 VH3-13-10 1 1.0% 44 4G12 125 3 VH3-13-10 1 1.0% 56 A73 106 3
VH3-13-10 2 2.0% 44 AL1.3 111 3 VH3-13-10 3 3.1% 117 3.A290 118 3
VH3-13-10 2 2.0% 108 Ab18 127 3 VH3-13-8 2 2.0% 100 E54 3.3 105 3
VH3-13-10 3 3.1% 26 35G6 121 3 VH3-13-10 3 3.1% 57 A95 107 3
VH3-13-10 5 5.1% 44 Ab25 128 3 VH3-13-10 5 5.1% 100 N87 126 3
VH3-13-10 4 4.1% 77 ED8.4 99 3 VH3-13-10 6 6.1% 2 RF-KL1 122 3
VH3-13-10 6 6.1% 82 AL1.1 112 3 VH3-13-10 2 2.0% 117 AL3.11 102 3
VH3-13-10 1 1.0% 117 32.B9 127 3 VH3-13-8 6 6.1% 129 TK1 109 3
VH3-13-10 2 2.0% 117 POP 123 3 VH3-13-10 8 8.2% 115 9F2H 127 3
VH3-13-10 9 9.2% 127 VD 115 3 VH3-13-10 9 9.2% 10 Vh38Cl.10 121 3
VH3-13-10 8 8.2% 74 Vh38Cl.9 121 3 VH3-13-10 8 8.2% 74 Vh38Cl.8 121
3 VH3-13-10 8 8.2% 74 63P1 120 3 VH3-11-8 0 0.0% 104 60P2 117 3
VH3-11-8 0 0.0% 104 AL3.5 90 3 VH3-13-10 2 2.0% 117 GF4/1.1 123 3
VH3-13-10 10 10.2% 39 Ab21 126 3 VH3-13-10 12 12.2% 100 TD d Vp 118
3 VH3-13-17 2 2.0% 16 Vh38Cl.4 119 3 VH3-13-10 8 8.2% 74 Vh38Cl.5
119 3 VH3-13-10 8 8.2% 74 AL3.4 104 3 VH3-13-10 1 1.0% 117 FOG1-A3
115 3 VH3-13-19 2 2.0% 42 HA3D1 117 3 VH3-13-21 1 1.0% 81 E54 3.2
112 3 VH3-13-24 0 0.0% 26
mAb52 128 3 VH3-13-12 2 2.0% 51 mAb53 128 3 VH3-13-12 2 2.0% 51
mAb56 128 3 VH3-13-12 2 2.0% 51 mAb57 128 3 VH3-13-12 2 2.0% 51
mAb58 128 3 VH3-13-12 2 2.0% 51 mAb59 128 3 VH3-13-12 2 2.0% 51
mAb105 128 3 VH3-13-12 2 2.0% 51 mAb107 128 3 VH3-13-12 2 2.0% 51
E55 3.14 110 3 VH3-13-19 0 0.0% 26 F13-28 106 3 VH3-13-19 1 1.0% 94
mAb55 127 3 VH3-13-18 4 4.1% 51 YSE 117 3 VH3-13-24 6 6.1% 72 E55
3.23 106 3 VH3-13-19 2 2.0% 26 RF-TS5 101 3 VH3-13-1 3 3.1% 85
N42P5 124 3 VH3-13-2 7 7.1% 77 FOG1-H6 110 3 VH3-13-16 7 7.1% 42
O-81 115 3 VH3-13-19 11 11.2% 47 HIV-s8 122 3 VH3-13-12 11 11.2% 12
mAb114 125 3 VH3-13-19 12 12.2% 71 33.F12 116 3 VH3-13-2 4 4.1% 129
4B4 119 3 VH3-1X-3 0 0.0% 101 M26 123 3 VH3-1X-3 0 0.0% 103 VHGL
3.1 100 3 VH3-1X-3 0 0.0% 26 E55 3.13 113 3 VH3-1X-3 1 1.0% 26
SB5/D6 101 3 VH3-1X-6 3 3.0% 2 RAY4 101 3 VH3-1X-6 3 3.0% 2 82-D
V-D 106 3 VH3-1X-3 5 5.0% 112 MAL 129 3 VH3-1X-3 5 5.0% 72 LOC 123
3 VH3-1X-6 5 5.0% 72 LSF2 101 3 VH3-1X-6 11 11.0% 2 HIB RC3 100 3
VH3-1X-6 11 11.0% 1 56P1 119 3 VH3-13-7 0 0.0% 104 M72 122 3
VH3-13-7 0 0.0% 103 M74 121 3 VH3-13-7 0 0.0% 103 E54 3.5 105 3
VH3-13-7 0 0.0% 26 2E7 123 3 VH3-13-7 0 0.0% 63 2P1 117 3 VH3-13-7
0 0.0% 104 RF-SJ2 127 3 VH3-13-7 1 1.0% 83 PR-TS1 114 3 VH3-13-7 1
1.0% 85 KIM46H 127 3 VH3-13-13 0 0.0% 18 E55 3.6 108 3 VH3-13-7 2
2.0% 26 E55 3.10 107 3 VH3-13-13 1 1.0% 26 3.B6 114 3 VH3-13-13 1
1.0% 108 E54 3.6 110 3 VH3-13-13 1 1.0% 26 FL2-2 114 3 VH3-13-13 1
1.0% 80 RF-SJ3 112 3 VH3-13-7 2 2.0% 85 E55 3.5 105 3 VH3-13-14 1
1.0% 26 BSA3 121 3 VH3-13-13 1 1.0% 73 HMST-1 119 3 VH3-13-7 3 3.1%
130 RF-TS2 126 3 VH3-13-13 4 4.1% 82 E55 3.12 109 3 VH3-13-15 0
0.0% 26 19.E7 126 3 VH3-13-14 3 3.1% 129 11-50 119 3 VH3-13-13 6
6.1% 130 E29.1 120 3 VH3-13-15 2 2.0% 25 E55 3.16 108 3 VH3-13-7 6
6.1% 26 TNF-E1 117 3 VH3-13-7 7 7.1% 42 RF-SJ1 127 3 VH3-13-13 6
6.1% 83 FOG1-A4 116 3 VH3-13-7 8 8.2% 42 TNF-A1 117 3 VH3-13-15 4
4.1% 42 PR-SJ2 107 3 VH3-13-14 8 8.2% 85 HN.14 124 3 VH3-13-13 10
10.2% 33 CAM' 121 3 VH3-13-7 12 12.2% 65 HIV-B8 125 3 VH3-13-7 9
9.2% 12 HIV-b27 125 3 VH3-13-7 9 9.2% 12 HIV-b8 125 3 VH3-13-7 9
9.2% 12 HIV-s4 125 3 VH3-13-7 9 9.2% 12 HIV-B26 125 3 VH3-13-7 9
9.2% 12 HIV-B35 125 3 VH3-13-7 10 10.2% 12 HIV-b18 125 3 VH3-13-7
10 10.2% 12 HIV-b22 125 3 VH3-13-7 11 11.2% 12 HIV-b13 125 3
VH3-13-7 12 12.2% 12 333 117 3 VH3-14-4 24 24.0% 24 1H1 120 3
VH3-14-4 24 24.0% 24 1B11 120 3 VH3-14-4 23 23.0% 24 CLL3O 2-3 86 3
VH3-13-19 1 1.0% 29 GA 110 3 VH3-13-7 19 19.4% 36 JeB 99 3
VH3-13-14 3 3.1% 7 GAL 110 3 VH3-13-19 10 10.2% 126 K6H6 119 3
VH3-1X-6 18 18.0% 60 K4B8 119 3 VH3-1X-6 18 18.0% 60 K5B8 119 3
VH3-1X-6 18 18.0% 60 K5C7 119 3 VH3-1X-6 19 19.0% 60 K5G5 119 3
VH3-1X-6 19 19.0% 60 K6F5 119 3 VH3-1X-6 19 19.0% 60 AL3.16 98 3
VH3-13-10 1 1.0% 117 N86P2 98 3 VH3-13-10 3 3.1% 77 N54P6 95 3
VH3-13-16 7 7.1% 77 LAMBDA HT112-1 126 4 VH4-11-2 0 0.0% 3 HY18 121
4 VH4-11-2 0 0.0% 43 mAb63 126 4 VH4-11-2 0 0.0% 45 FS-3 105 4
VH4-11-2 0 0.0% 86 FS-5 111 4 VH4-11-2 0 0.0% 86 FS-7 107 4
VH4-11-2 0 0.0% 86 FS-8 110 4 VH4-11-2 0 0.0% 86 PR-TS2 105 4
VH4-11-2 0 0.0% 85 RF-TMC 102 4 VH4-11-2 0 0.0% 85 mAb216 122 4
VH4-11-2 1 1.0% 15 mAb410.7.F91 122 4 VH4-11-2 1 1.0% 52 mAbA6H4C5
124 4 VH4-11-2 1 1.0% 15 Ab44 127 4 VH4-11-2 2 2.1% 100 6H-3C4 124
4 VH4-11-2 3 3.1% 59 FS-6 108 4 VH4-11-2 6 6.2% 86 FS-2 114 4
VH4-11-2 6 6.2% 84 HIG1 126 4 VH4-11.2 7 7.2% 62 FS-4 105 4
VH4-11-2 8 8.2% 86 SA-4A 123 4 VH4-11-2 9 9.3% 125 LES-C 119 4
VH4-11-2 10 10.3% 99 DI 78 4 VH4-11-9 16 16.5% 58 Ab26 126 4
VH4-31-4 8 8.1% 100 TS2 124 4 VH4-31-12 15 15.2% 110 265-695 115 4
VH4-11-7 16 16.5% 5 WAH 129 4 VH4-31-13 19 19.2% 93 268-D 122 4
VH4-11-8 22 22.7% 6 58P2 118 4 VH4-11-8 0 0.0% 104 mAb67 128 4
VH4-21-4 1 1.0% 45 4.L39 115 4 VH4-11-8 2 2.1% 108 mF7 111 4
VH4-31-13 3 3.0% 75 33.C9 122 4 VH4-21-5 7 7.1% 129 Pag-1 124 4
VH4-11-16 5 5.2% 50 B3 123 4 VH4-21-3 8 8.2% 53 IC4 120 4 VH4-11-8
6 6.2% 70 C6B2 127 4 VH4-31-12 4 4.0% 48 N78 118 4 VH4-11-9 11
11.3% 77 B2 109 4 VH4-11-8 12 12.4% 53 WRD2 123 4 VH4-11-12 6 6.2%
90 mAb426.4.2F20 126 4 VH4-11-8 2 2.1% 52 E54 4.58 115 4 VH4-11-8 1
1.0% 26 WRD6 123 4 VH4-11-12 10 10.3% 90 mAb426.12.3F1.4 122 4
VH4-11-9 4 4.1% 52 E54 4.2 108 4 VH4-21-6 2 2.0% 26 WIL 127 4
VH4-31-13 0 0.0% 90 COF 126 4 VH4-31-13 0 0.0% 90 LAR 122 4
VH4-31-13 2 2.0% 90 WAT 125 4 VH4-31-13 4 4.0% 90 mAb61 123 4
VH4-31-13 5 5.1% 45 WAG 127 4 VH4-31-4 0 0.0% 90 RF-SJ4 108 4
VH4-31-12 2 2.0% 85 E54 4.4 110 4 VH4-11-7 0 0.0% 26 E55 4.A1 108 4
VH4-11-7 0 0.0% 26 PR-SJ1 103 4 VH4-11-7 1 1.0% 85 E54 4.23 111 4
VH4-11-7 1 1.0% 26 CLL7 7-2 97 4 VH4-11-12 0 0.0% 29 37P1 95 4
VH4-11-12 0 0.0% 104 ALL52 30-2 91 4 VH4-31-12 4 4.0% 29 EBV-21 98
5 VH5-12-1 0 0.0% 13 CB-4 98 5 VH5-12-1 0 0.0% 13 CLL-12 98 5
VH5-12-1 0 0.0% 13 L3-4 98 5 VH5-12-1 0 0.0% 13 CLL11 98 5 VH5-12-1
0 0.0% 17 CORD3 98 5 VH5-12-1 0 0.0% 17 CORD4 98 5 VH5-12-1 0 0.0%
17 CORD8 98 5 VH5-12-1 0 0.0% 17 CORD9 98 5 VH5-12-1 0 0.0% 17 CD+1
98 5 VH5-12-1 0 0.0% 17 CD+3 98 5 VH5-12-1 0 0.0% 17 CD+4 98 5
VH5-12-1 0 0.0% 17 CD-1 98 5 VH5-12-1 0 0.0% 17 CD-5 98 5 VH5-12-1
0 0.0% 17 VERG14 98 5 VH5-12-1 0 0.0% 17 PBL1 98 5 VH5-12-1 0 0.0%
17 PBL10 98 5 VH5-12-1 0 0.0% 17 STRAb SA-1A 127 5 VH5-12-1 0 0.0%
125 DOB' 122 5 VH5-12-1 0 0.0% 97 VERG5 98 5 VH5-12-1 0 0.0% 17
PBL2 98 5 VH5-12-1 1 1.0% 17 Tu16 119 5 VH5-12-1 1 1.0% 49 PBL12 98
5 VH5-12-1 1 1.0% 17 CD+2 98 5 VH5-12-1 1 1.0% 17 CORD10 98 5
VH5-12-1 1 1.0% 17 PBL9 98 5 VH5-12-1 1 1.0% 17 CORD2 98 5 VH5-12-1
2 2.0% 17 PBL6 98 5 VH5-12-1 2 2.0% 17 CORD5 98 5 VH5-12-1 2 2.0%
17 CD-2 98 5 VH5-12-1 2 2.0% 17 CORD1 98 5 VH5-12-1 2 2.0% 17 CD-3
98 5 VH5-12-1 3 3.1% 17 VERG4 98 5 VH5-12-1 3 3.1% 17 PBL13 98 5
VH5-12-1 3 3.1% 17 PBL7 98 5 VH5-12-1 3 3.1% 17 HAN 119 5 VH5-12-1
3 3.1% 97 VERG3 98 5 VH5-12-1 3 3.1% 17 PBL3 98 5 VH5-12-1 3 3.1%
17 VERG7 98 5 VH5-12-1 3 3.1% 17 PBL5 94 5 VH5-12-1 0 0.0% 17 CD-4
98 5 VH5-12-1 4 4.1% 17 CLL10 98 5 VH5-12-1 4 4.1% 17 PBL11 98 5
VH5-12-1 4 4.1% 17 CORD6 98 5 VH5-12-1 4 4.1% 17 VERG2 98 5
VH5-12-1 5 5.1% 17 83P2 119 5 VH5-12-1 0 0.0% 103 VERG9 98 5
VH5-12-1 6 6.1% 17 CLL6 98 5 VH5-12-1 6 6.1% 17 PBL8 98 5 VH5-12-1
7 7.1% 17 Ab2022 120 5 VH5-12-1 3 3.1% 100 CAV 127 5 VH5-12-4 0
0.0% 97 HOW' 120 5 VH5-12-4 0 0.0% 97 PET 127 5 VH5-12-4 0 0.0% 97
ANG 121 5 VH5-12-4 0 0.0% 97 KER 121 5 VH5-12-4 0 0.0% 97 5.M13 118
5 VH5-12-4 0 0.0% 107 Au2.1 118 5 VH5-12-4 1 1.0% 49 WS1 126 5
VH5-12-1 9 9.2% 110 TD Vn 98 5 VH5-12-4 1 1.0% 16 TEL13 116 5
VH5-12-1 9 9.2% 73 E55 5.237 112 5 VH5-12-4 2 2.0% 26 VERG1 98 5
VH5-12-1 10 10.2% 17 CD4-74 117 5 VH5-12-1 10 10.2% 42 257-D 125 5
VH5-12-1 11 11.2% 6 CLL4 98 5 VH5-12-1 11 11.2% 17 CLL8 98 5
VH5-12-1 11 11.2% 17 Ab2 124 5 VH5-12-1 12 12.2% 120 Vh383ex 98 5
VH5-12-1 12 12.2% 120 CLL3 98 5 VH5-12-2 11 11.2% 17 Au59.1 122 5
VH5-12-1 12 12.2% 49 TEL16 117 5 VH5-12-1 12 12.2% 73 M61 104 5
VH5-12-1 0 0.0% 103 Tu0 99 5 VH5-12-1 5 5.1% 49 P2-51 122 5
VH5-12-1 13 13.3% 121 P2-54 122 5 VH5-12-1 11 11.2% 121 P1-56 119 5
VH5-12-1 9 9.2% 121 P2-53 122 5 VH5-12-1 10 10.2% 121 P1-51 123 5
VH5-12-1 19 19.4% 121 P1-54 123 5 VH5-12-1 3 3.1% 121 P3-69 127 5
VH5-12-1 4 4.1% 121 P3-9 119 5 VH5-12-1 4 4.1% 121 1-185-37 125 5
VH5-12-4 0 0.0% 124 1-187-29 125 5 VH5-12-4 0 0.0% 124 P1-58 128 5
VH5-12-4 10 10.2% 121 P2-57 118 5 VH5-12-4 3 3.1% 121 P2-55 123 5
VH5-12-1 5 5.1% 121 P2-56 123 5 VH5-12-1 20 20.4% 121 P2-52 122 5
VH5-12-1 11 11.2% 121 P3-60 122 5 VH5-12-1 8 8.2% 121 P1-57 123 5
VH5-12-1 4 4.1% 121 P1-55 122 5 VH5-12-1 14 14.3% 121 MD3-4 128 5
VH5-12-4 12 12.2% 5 P1-52 121 5 VH5-12-1 11 11.2% 121 CLL5 98 5
VH5-12-1 13 13.3% 17 CLL7 98 5 VH5-12-1 14 14.3% 17 L2F10 100 5
VH5-12-1 1 1.0% 46 L3B6 98 5 VH5-12-1 1 1.0% 46 VH6.A12 119 6
VH6-35-1 13 12.9% 122 s5A9 102 6 VH6-35-1 1 1.0% 46 s6G4 99 6
VH6-35-1 1 1.0% 46 ss3 99 6 VH6-35-1 1 1.0% 46 6-1G1 101 6 VH6-35-1
0 0.0% 14 F19L16 107 6 VH6-35-1 0 0.0% 68 L16 120 6 VH6-35-1 0 0.0%
69 M71 121 6 VH6-35-1 0 0.0% 103 ML1 120 6 VH6-35-1 0 0.0% 69
F19ML1 107 6 VH6-35-1 0 0.0% 68
15P1 127 6 VH6-35-1 0 0.00% 104 VH6.N1 121 6 VH6-35-1 0 0.0% 122
VH6.N11 123 6 VH6-35-1 0 0.0% 122 VH6.N12 123 6 VH6-35-1 0 0.0% 122
VH6.N2 125 6 VH6-35-1 0 0.0% 122 VH6.N5 125 6 VH6-35-1 0 0.0% 122
VH6.N6 127 6 VH6-35-1 0 0.0% 122 VH6.N7 126 6 VH6-35-1 0 0.0% 122
VH6.N8 123 6 VH6-35-1 0 0.0% 122 VH6.N9 123 6 VH6-35-1 0 0.0% 122
VH6.N10 123 6 VH6-35-1 0 0.0% 122 VH6.A3 123 6 VH6-35-1 0 0.0% 122
VH6.A1 124 6 VH6-35-1 0 0.0% 122 VH6.A4 120 6 VH6-35-1 0 0.0% 122
E55 6.16 116 6 VH6-35-1 0 0.0% 26 E55 6.17 120 6 VH6-35-1 0 0.0% 26
E55 6.6 120 6 VH6-35-1 0 0.0% 26 VHGL 6.3 102 6 VH6-35-1 0 0.0% 26
CB-201 118 6 VH6-35-1 0 0.0% 109 VH6.N4 122 6 VH6-35-1 0 0.0% 122
E54 6.4 109 6 VH6-35-1 1 1.0% 26 VH6.A6 126 6 VH6-35-1 1 1.0% 122
E55 6.14 120 6 VH6-35-1 1 1.0% 26 E54 6.6 107 6 VH6-35-1 1 1.0% 26
E55 6.10 112 6 VH6-35-1 1 1.0% 26 E54 6.1 107 6 VH6-35-1 2 2.0% 26
E55 6.13 120 6 VH6-35-1 2 2.0% 26 E55 6.3 120 6 VH6-35-1 2 2.0% 26
E55 6.7 116 6 VH6-35-1 2 2.0% 26 E55 6.2 120 6 VH6-35-1 2 2.0% 26
E55 6.X 111 6 VH6-35-1 2 2.0% 26 E55 6.11 111 6 VH6-35-1 3 3.0% 26
VH6.A11 118 6 VH6-35-1 3 3.0% 122 A10 107 6 VH6-35-1 3 3.0% 68 E55
6.1 120 6 VH6-35-1 4 4.0% 26 FK-001 124 6 VH6-35-1 4 4.0% 65 VH6.A5
121 6 VH6-35-1 4 4.0% 122 VH6.A7 123 6 VH6-35-1 4 4.0% 122 HBp2 119
6 VH6-35-1 4 4.0% 4 Au46.2 123 6 VH6-35-1 5 5.0% 49 A431 106 6
VH6-35-1 5 5.0% 68 VH6.A2 120 6 VH6-35-1 5 5.0% 122 VH6.A9 125 6
VH6-35-1 8 7.9% 122 VH6.A8 118 6 VH6-35-1 10 9.9% 122 VH6-FF3 118 6
VH6-35-1 2 2.0% 123 VH6.A10 126 6 VH6-35-1 12 11.9% 122 VH6-EB10
117 6 VH6-35-1 3 3.0% 123 VH6-E6 119 6 VH6-35-1 6 5.9% 123 VH6-FE2
121 6 VH6-35-1 6 5.9% 123 VH6-EE6 116 6 VH6-35-1 6 5.9% 123
VH6-FD10 118 6 VH6-35-1 6 5.9% 123 VH6-EX8 113 6 VH6-35-1 6 5.9%
123 VH6-FG9 121 6 VH6-35-1 8 7.9% 123 VH6-E5 116 6 VH6-35-1 9 8.9%
123 VH6-EC8 122 6 VH6-35-1 9 8.9% 123 VH6-E10 120 6 VH6-35-1 10
9.9% 123 VH6-FF11 122 6 VH6-35-1 11 10.9% 123 VH6-FD2 115 6
VH6-35-1 11 10.9% 123 CLL10 17-2 88 6 VH6-35-1 4 4.0% 29 VH6-BB11
94 6 VH6-35-1 4 4.0% 123 VH6-B4I 93 6 VH6-35-1 7 6.9% 123 JU17 102
6 VH6-35-1 3 3.0% 114 VH6-BD9 96 6 VH6-35-1 11 10.9% 123 VH6-BB9 94
6 VH6-35-1 12 11.9% 123
[0233] TABLE-US-00008 TABLE 3A assignment of rearranged V kappa
sequences to their germline counterparts Family.sup.1 Name
Rearranged.sup.2 Sum 1 Vk1-1 28 1 Vk1-2 0 1 Vk1-3 1 1 Vk1-4 0 1
Vk1-5 7 1 Vk1-6 0 1 Vk1-7 0 1 Vk1-8 2 1 Vk1-9 9 1 Vk1-10 0 1 Vk1-11
1 1 Vk1-12 7 1 Vk1-13 1 1 Vk1-14 7 1 Vk1-15 2 1 Vk1-16 2 1 Vk1-17
16 1 Vk1-18 1 1 Vk1-19 33 1 Vk1-20 1 1 Vk1-21 1 1 Vk1-22 0 1 Vk1-23
0 119 entries 2 Vk2-1 0 2 Vk2-2 1 2 Vk2-3 0 2 Vk2-4 0 2 Vk2-5 0 2
Vk2-6 16 2 Vk2-7 0 2 Vk2-8 0 2 Vk2-9 1 2 Vk2-10 0 2 Vk2-11 7 2
Vk2-12 0 25 entries 3 Vk3-1 1 3 Vk3-2 0 3 Vk3-3 35 3 Vk3-4 115 3
Vk3-5 0 3 Vk3-6 0 3 Vk3-7 1 3 Vk3-8 40 192 entries 4 Vk4-1 33 33
entries 5 Vk5-1 1 1 entry 6 Vk6-1 0 6 Vk6-2 0 0 entries 7 Vk7-1 0 0
entries
[0234] TABLE-US-00009 TABLE 3B assignment of rearranged V lambda
sequences to their germline counterparts Family.sup.1 Name
Rearranged.sup.2 Sum 1 DPL1 1 1 DPL2 14 1 DPL3 6 1 DPL4 1 1
HUMLV117 4 1 DPL5 13 1 DPL6 0 1 DPL7 0 1 DPL8 3 1 DPL9 0 42 entries
2 DPL10 5 2 VLAMBDA 2.1 0 2 DPL11 23 2 DPL12 15 2 DPL13 0 2 DPL14 0
43 entries 3 DPL16 10 3 DPL23 19 3 Humlv318 9 38 entries 7 DPL18 1
7 DPL19 0 1 entries 8 DPL21 2 8 HUMLV801 6 8 entries 9 DPL22 0 0
entries unassigned DPL24 0 0 entries 10 gVLX-4.4 0 0 entries
[0235] TABLE-US-00010 TABLE 3C assignment of rearranged V heavy
chain sequences to their germline counterparts Family.sup.1 Name
Rearranged.sup.2 Sum 1 VH1-12-1 38 1 VH1-12-8 2 1 VH1-12-2 2 1
VH1-12-9 2 1 VH1-12-3 0 1 VH1-12-4 0 1 VH1-12-5 3 1 VH1-12-6 0 1
VH1-12-7 23 1 VH1-13-1 1 1 VH1-13-2 1 1 VH1-13-3 0 1 VH1-13-4 0 1
VH1-13-5 0 1 VH1-13-6 17 1 VH1-13-7 0 1 VH1-13-8 3 1 VH1-13-9 0 1
VH1-13-10 0 1 VH1-13-11 0 1 VH1-13-12 10 1 VH1-13-13 0 1 VH1-13-14
0 1 VH1-13-15 4 1 VH1-13-16 2 1 VH1-13-17 0 1 VH1-13-18 1 1
VH1-13-19 0 1 VH1-1X-1 1 110 entries 2 VH2-21-1 0 2 VH2-31-1 0 2
VH2-31-2 1 2 VH2-31-3 1 2 VH2-31-4 0 2 VH2-31-5 2 2 VH2-31-6 0 2
VH2-31-7 0 2 VH2-31-14 1 2 VH2-31-8 0 2 VH2-31-9 0 2 VH2-31-10 0 2
VH2-31-11 1 2 VH2-31-12 0 2 VH2-31-13 1 7 entries 3 VH3-11-1 0 3
VH3-11-2 0 3 VH3-11-3 5 3 VH3-11-4 0 3 VH3-11-5 1 3 VH3-11-6 1 3
VH3-11-7 0 3 VH3-11-8 5 3 VH3-13-1 9 3 VH3-13-2 3 3 VH3-13-3 0 3
VH3-13-4 0 3 VH3-13-5 0 3 VH3-13-6 0 3 VH3-13-7 32 3 VH3-13-8 4 3
VH3-13-9 0 3 VH3-13-10 46 3 VH3-13-11 0 3 VH3-13-12 11 3 VH3-13-13
17 3 VH3-13-14 8 3 VH3-13-15 4 3 VH3-13-16 3 3 VH3-13-17 2 3
VH3-13-18 1 3 VH3-13-19 13 3 VH3-13-20 1 3 VH3-13-21 1 3 VH3-13-22
0 3 VH3-13-23 0 3 VH3-13-24 4 3 VH3-13-25 1 3 VH3-13-26 6 3
VH3-14-1 1 3 VH3-14-4 15 3 VH3-14-2 0 3 VH3-14-3 0 3 VH3-1X-1 0 3
VH3-1X-2 0 3 VH3-1X-3 6 3 VH3-1X-4 0 3 VH3-1X-5 0 3 VH3-1X-6 11 3
VH3-1X-7 0 3 VH3-1X-8 1 3 VH3-1X-9 0 212 entries 4 VH4-11-1 0 4
VH4-11-2 20 4 VH4-11-3 0 4 VH4-11-4 0 4 VH4-11-5 0 4 VH4-11-6 0 4
VH4-11-7 5 4 VH4-11-8 7 4 VH4-11-9 3 4 VH4-11-10 0 4 VH4-11-11 0 4
VH4-11-12 4 4 VH4-11-13 0 4 VH4-11-14 0 4 VH4-11-15 0 4 VH4-11-16 1
4 VH4-21-1 0 4 VH4-21-2 0 4 VH4-21-3 1 4 VH4-21-4 1 4 VH4-21-5 1 4
VH4-21-6 1 4 VH4-21-7 0 4 VH4-21-8 0 4 VH4-21-9 0 4 VH4-31-1 0 4
VH4-31-2 0 4 VH4-31-3 0 4 VH4-31-4 2 4 VH4-31-5 0 4 VH4-31-6 0 4
VH4-31-7 0 4 VH4-31-8 0 4 VH4-31-9 0 4 VH4-31-10 0 4 VH4-31-11 0 4
VH4-31-12 4 4 VH4-31-13 7 4 VH4-31-14 0 4 VH4-31-15 0 4 VH4-31-16 0
4 VH4-31-17 0 4 VH4-31-18 0 4 VH4-31-19 0 4 VH4-31-20 0 57 entries
5 VH5-12-1 82 5 VH5-12-2 1 5 VH5-12-3 0 5 VH5-12-4 14 97 entries 6
VH6-35-1 74 74 entries
[0236] TABLE-US-00011 TABLE 4A Analysis of V kappa subgroup 1
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
A 1 1 102 1 B 1 1 C 1 D 64 E 8 14 1 F 1 6 1 G 105 H I 65 4 K 1 L 6
21 96 1 M 1 66 N P 103 1 2 1 Q 62 88 1 R S 89 102 80 103 103 T 1 88
18 V 1 9 8 2 98 W X 1 Y -- unknown (?) not sequenced 31 31 18 18 17
16 16 2 1 sum of seq.sup.2 74 74 87 87 88 89 89 103 104 105 105 105
105 105 105 105 oomcaa.sup.3 64 65 62 66 88 88 89 103 102 80 96 103
102 103 98 105 mcaa.sup.4 D I Q M T Q S P S S L S A S V G rel.
oomcaa.sup.5 86% 88% 71% 76% 100% 99% 100% 100% 98% 76% 91% 98% 97%
98% 93% 100% pos occupied.sup.6 4 5 5 2 1 2 1 1 3 4 3 2 3 3 5 1
Framework I CDR I amino acid.sup.1 17 18 19 20 21 22 23 24 25 26 27
A B C D A 1 1 1 103 B 1 C 105 D 101 E 2 1 1 2 F 2 G 1 H 1 I 6 4 101
1 K 2 1 L 1 M N 1 P Q 20 100 R 94 81 S 5 1 102 T 6 99 103 1 1 V 98
2 W X 1 Y 1 -- 105 105 105 105 unknown (?) not sentenced sum of
seq.sup.2 105 105 105 105 105 105 105 105 105 105 105 105 105 105
105 oomcaa.sup.3 101 94 98 99 101 103 105 81 103 102 100 105 105
105 105 mcaa.sup.4 D R V T I T C R A S Q -- -- -- -- rel.
oomcaa.sup.5 96% 90% 93% 94% 96% 98% 100% 77% 98% 97% 95% 100% 100%
100% 100% pos occupied.sup.6 4 3 3 4 3 3 1 5 3 4 5 1 1 1 1 CDR I
Framework II amino acid.sup.1 E F 28 29 30 31 32 33 34 35 36 37 38
39 40 A 1 1 1 42 B 1 1 C 1 D 25 1 5 7 1 E 1 2 F 1 1 7 6 G 25 7 3 4
H 1 2 2 1 2 I 98 1 4 1 K 7 95 L 2 1 101 M N 6 16 42 50 P 102 Q 98
103 2 R 16 3 2 3 1 S 41 2 57 32 3 1 1 1 T 7 4 4 1 V 1 4 1 1 W 21
104 X 1 Y 1 60 98 -- 105 105 unknown (?) 3 not sequenced 1 1 1 1 1
1 1 1 1 1 sum of seq.sup.2 105 105 105 105 105 104 104 104 104 104
104 104 104 104 104 oomcaa.sup.3 105 105 41 98 57 42 60 101 50 104
98 98 103 95 102 mcaa.sup.4 -- -- S I S N Y L N W Y Q Q K P rel.
oomcaa.sup.5 100% 100% 39% 93% 54% 40% 58% 97% 48% 100% 94% 94% 99%
91% 98% pos occupied.sup.6 1 1 6 4 12 11 9 4 8 1 2 5 2 4 3
Framework II CDR II amino acid.sup.1 41 42 43 44 45 46 47 48 49 50
51 52 53 54 55 A 94 50 95 B C D 21 1 1 1 E 1 3 1 1 1 1 33 F 1 3 1 G
100 1 9 2 H 2 1 I 1 1 100 1 K 95 86 16 2 5 L 1 89 103 101 M 2 N 10
2 1 25 P 104 1 1 Q 1 1 62 R 3 3 1 1 2 S 1 5 1 1 99 41 2 T 3 1 1 4 1
31 V 9 9 1 1 W X 1 1 Y 92 1 -- unknown (?) 3 not sequenced 1 1 1 1
1 1 2 3 3 2 1 1 1 1 1 sum of seq.sup.2 104 104 104 104 104 104 103
102 102 103 104 104 104 104 104 oomcaa.sup.3 100 95 94 104 86 89
103 100 92 50 95 99 41 101 62 mcaa.sup.4 G K A P K L L I Y A A S S
L Q rel. oomcaa.sup.5 96% 91% 90% 100% 83% 86% 100% 98% 90% 49% 91%
95% 39% 97% 60% pos occupied.sup.6 2 6 3 1 8 6 1 2 4 10 6 6 9 3 6
CDR II Framework III amino acid.sup.1 56 57 58 59 60 61 62 63 64 65
66 67 68 69 70 A 3 2 1 1 1 B 1 C D 1 67 E 1 30 F 1 103 3 G 2 105
105 4 101 102 H 3 I 3 4 1 3 K 1 1 1 L 1 M 1 N 6 P 1 101 2 Q 1 R 1
103 1 1 1 2 S 68 2 103 98 96 100 T 19 1 1 2 3 101 V 99 1 1 W X 1 1
1 2 Y 1 1 -- unknown (?) not sequenced sum of seq.sup.2 105 105 105
105 105 105 105 105 105 105 105 105 105 105 105 oomcaa.sup.3 68 105
99 101 103 103 103 98 105 96 101 100 102 101 67 mcaa.sup.4 S G V P
S R F S G S G S G T D rel. oomcaa.sup.5 65% 100% 94% 96% 98% 98%
98% 93% 100% 91% 96% 95% 97% 96% 64% pos occupied.sup.6 10 1 4 4 2
3 3 5 1 5 4 4 4 4 7 Framework III amino acid.sup.1 71 72 73 74 75
76 77 78 79 80 81 82 83 84 85 A 3 1 2 101 1 B 1 3 2 C D 1 16 101 E
83 F 102 1 21 73 G 4 1 2 H I 99 5 17 K L 81 103 1 1 M 1 N 7 4 1 P
97 1 Q 97 R 2 1 2 S 2 1 86 94 4 1 T 98 102 2 1 97 V 1 2 4 1 11 1 W
X 1 1 2 Y 1 -- unknown (?) not sequenced 1 1 1 1 1 1 1 1 2 2 2 2 2
2 3 sum ofseq.sup.2 104 104 104 104 104 104 104 104 103 103 103 103
103 103 102 oomcaa.sup.3 102 98 81 102 99 86 94 103 97 97 83 101 73
101 97 mcaa.sup.4 F T L T I S S L Q P E D F A T rel. oomcaa.sup.5
98% 94% 78% 98% 95% 83% 90% 99% 94% 94% 81% 98% 71% 98% 95% pos
occupied.sup.6 3 4 3 3 3 7 5 2 4 3 5 2 5 2 6 Framework III CDR III
amino acid.sup.1 86 87 88 89 90 91 92 93 94 95 A B C D E F A 1 7 1
5 1 B 2 3 C 102 D 23 5 1 E 1 1 1 1 F 7 3 13 G 1 1 2 1 1 H 1 4 6 7 3
1 I 4 1 2 1 K 1 7 1 L 7 6 2 18 2 M N 6 31 19 1 P 1 82 6 Q 90 86 1 2
R 1 2 2 S 1 27 3 58 5 10 T 3 1 15 25 V 5 W 1 X Y 101 93 42 32 1
23
-- 3 82 88 89 89 89 89 unknown (?) 1 not sequenced 2 3 3 2 2 1 1 1
1 4 16 16 16 16 16 16 sum of seq.sup.2 103 102 102 103 103 104 104
104 104 101 89 89 89 89 89 89 oomcaa.sup.3 101 93 102 90 86 42 32
58 25 82 82 88 89 89 89 89 mcaa.sup.4 Y Y C Q Q Y Y S T P -- -- --
-- -- -- rel. oomcaa.sup.5 98% 91% 100% 87% 83% 40% 31% 56% 24% 81%
92% 99% 100% 100% 100% 100% pos occupied.sup.6 3 3 1 4 5 11 12 10
14 8 3 2 1 1 1 1 CDR III Framework IV amino acid.sup.1 96 97 98 99
100 101 102 103 104 105 106 A 107 108 sum A 1 627 B 1 1 19 C 209 D
1 15 459 E 2 65 258 F 6 86 2 451 G 87 29 87 2 894 H 2 1 40 I 5 1 72
606 K 1 1 77 79 480 L 18 1 1 22 4 2 793 M 1 5 77 N 1 1 2 232 P 6 7
1 620 Q 1 48 1 865 R 6 6 2 70 413 S 2 2 1636 T 2 82 87 3 2 1021 V 2
1 63 3 440 W 15 141 X 14 Y 16 564 -- 4 1 85 1 1250 unknown (?) 7
not sequenced 16 16 18 18 18 18 18 18 19 19 20 20 20 31 589 sum of
seq.sup.2 89 89 87 87 87 87 87 87 86 86 85 85 85 74 oomcaa.sup.3 18
82 86 87 48 87 87 77 63 65 72 85 79 70 mcaa.sup.4 L T F G G G T K V
E I -- K R rel. oomcaa.sup.5 20% 92% 99% 100% 55% 100% 100% 89% 73%
76% 85% 100% 93% 95% pos occupied.sup.6 17 7 2 1 5 1 1 4 3 5 6 1 4
4
[0237] TABLE-US-00012 TABLE 4B Analysis of V kappa subgroup 2
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
A B C D 14 E 3 F 1 1 G 22 H I 8 K L 3 1 17 18 6 M 15 N P 18 18 15 Q
18 R S 18 17 T 17 21 V 6 17 1 18 X Y -- unknown (?) 1 not sequenced
5 5 5 5 4 4 4 4 4 4 4 4 4 1 1 sum of seq.sup.2 17 17 17 17 18 18 18
18 18 18 18 18 18 21 21 22 oomcaa.sup.3 14 8 17 15 17 18 18 18 17
17 18 18 18 21 15 22 mcaa.sup.4 D I V M T Q S P L S L P V T P G
rel. oomcaa.sup.5 82% 47% 100% 88% 94% 100% 100% 100% 94% 94% 100%
100% 100% 100% 71% 100% pos occupied.sup.6 2 3 1 3 1 1 1 1 2 2 1 1
1 1 2 1 Framework I CDR I amino acid.sup.1 17 18 19 20 21 22 23 24
25 26 27 A B C D E A 22 B C 22 D 1 E 15 F G 1 H 16 I 22 K 1 L 1 22
13 M 1 N P 22 Q 7 1 21 R 21 2 S 22 21 22 22 22 19 T V 8 X 1 Y -- 4
unknown (?) not sequenced sum of seq.sup.2 22 22 22 22 22 22 22 22
22 22 22 22 22 22 22 22 oomcaa.sup.3 15 22 22 22 22 21 22 21 22 22
21 22 22 13 16 19 mcaa.sup.4 E P A S I S C R S S Q S L L H S rel.
oomcaa.sup.5 68% 100% 100% 100% 100 95% 100% 95% 100% 100% 95% 100%
100% 59% 73% 86% pos occupied.sup.6 2 1 1 1 1 2 1 2 1 1 2 1 1 3 4 3
CDR I Framework II amino acid.sup.1 F 28 29 30 31 32 33 34 35 36 37
38 39 40 41 42 A B C D 9 1 1 11 E F 2 7 G 22 22 H 1 1 I K 1 15 L 22
16 M N 10 7 12 9 P 22 Q 6 22 22 R 7 S 1 T 8 V W 22 X 1 1 1 Y 1 11
21 15 -- 22 unknown (?) not sequenced sum of seq.sup.2 22 22 22 22
22 22 22 22 22 22 22 22 22 22 22 22 oomcaa.sup.3 22 10 22 11 12 21
22 11 22 15 16 22 15 22 22 22 mcaa.sup.4 -- N G Y N Y L D W Y L Q K
P G Q rel. oomcaa.sup.5 100% 45% 100% 50% 55% 95% 100% 50% 100% 68%
73% 100% 68% 100% 100% 100% pos occupied.sup.6 1 5 1 5 4 2 1 4 1 2
2 1 2 1 1 1 Framework Framework II CDR II III amino acid.sup.1 43
44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 A 14 B C D 7 E 1 F G
12 1 22 H I 1 22 K 5 L 14 21 14 1 M N 18 P 21 Q 12 1 R 8 7 1 22 S
21 2 22 2 22 T 1 V 1 6 22 W X Y 21 1 -- unknown (?) not sequenced 1
1 1 1 1 1 sum of seq.sup.2 21 21 21 22 22 22 21 21 21 22 22 22 22
22 22 22 oomcaa.sup.3 21 21 12 14 21 22 21 14 12 22 18 22 14 22 22
22 mcaa.sup.4 S P Q L L I Y L G S N R A S G V rel. oomcaa.sup.5
100% 100% 57% 64% 95% 100% 100% 67% 57% 100% 82% 100% 64% 100% 100%
100% pos occupied.sup.6 1 1 3 3 2 1 1 4 4 1 4 1 3 1 1 1 Framework
III amino acid.sup.1 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73
74 A B C D 22 1 1 22 E F 21 22 G 21 22 21 H I 1 K 19 L 21 1 M N P
22 Q R 20 1 S 1 22 21 22 T 1 22 21 V 1 W X Y -- unknown (?) 1 not
sequenced 1 1 sum of seq.sup.2 22 22 22 22 22 22 22 22 22 22 22 22
22 22 21 21 oomcaa.sup.3 22 22 20 21 22 21 21 22 22 21 22 22 22 21
21 19 mcaa.sup.4 P D R F S G S G S G T D F T L K rel. oomcaa.sup.5
100% 100% 91% 95% 100% 95% 95% 100% 100% 95% 100% 100% 100% 95%
100% 90% pos occupied.sup.6 1 1 3 2 1 2 2 1 1 2 1 1 1 1 1 3
Framework III CDR III amino acid.sup.1 75 76 77 78 79 80 81 82 83
84 85 86 87 88 89 90 A 20 B 1 C 21 D 1 21 E 19 20 F G 1 21 H I 21 1
K L 1 M 21 N P 1 Q 1 20 R 20 S 20 1 T 1 V 21 21 19 W X Y 21 21 --
unknown (?) not sequenced 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 sum of
seq.sup.2 21 21 21 21 21 21 21 21 21 21 21 21 21 21 21 21
oomcaa.sup.3 21 20 20 21 19 20 20 21 21 21 19 21 21 21 21 20
mcaa.sup.4 I S R V E A E D V G V Y Y C M Q rel. oomcaa.sup.5 100%
95% 95% 100% 90% 95% 95% 100% 100% 100% 90% 100% 100% 100% 100% 95%
pos occupied.sup.6 1 2 2 1 3 2 2 1 1 1 3 1 1 1 1 2 CDR III
Framework IV amino acid.sup.1 91 92 93 94 95 A B C D E F 96 97 98
99 100 A 14 1 B 1 C D E F 1 17 G 6 1 2 17 2 H 1 7 I 1 3 K L 12 2 2
M N P 2 16 1 1 Q 13 1 14 R 1 S 3 2 T 8 7 17 V W 6 2 X Y 7 -- 14 17
17 17 17 17 unknown (?) not sequenced 1 1 1 1 2 5 5 5 5 5 5 5 5 5 5
6 sum of seq.sup.2 21 21 21 21 20 17 17 17 17 17 17 17 17 17 17 16
oomcaa.sup.3 14 12 13 7 16 14 17 17 17 17 17 7 17 17 17 14
mcaa.sup.4 A L Q T P -- -- -- -- -- -- Y T F G Q rel. oomcaa.sup.5
67% 57% 62% 33% 80% 82% 100% 100% 100% 100% 100% 41% 100% 100% 100%
88% pos occupied.sup.6 3 3 3 7 3 3 1 1 1 1 1 7 1 1 1 2
Framework IV amino acid.sup.1 101 102 103 104 105 106 A 107 108 Sum
A 71 B 1 3 C 43 D 112 E 13 71 F 72 G 16 1 233 H 26 I 14 94 K 12 13
66 L 11 219 M 37 N 56 P 159 Q 159 R 4 12 126 S 325 T 16 140 V 5 146
W 31 X 3 Y 123 -- 13 134 unknown (?) 2 not sequenced 6 6 6 6 7 8 9
9 10 211 sum of seq.sup.2 16 16 16 16 15 14 13 13 12 oomcaa.sup.3
16 16 12 11 13 14 13 13 12 mcaa.sup.4 G T K L E I -- K R rel.
oomcaa.sup.5 100% 100% 75% 69% 87% 100% 100% 100% 100% pos
occupied.sup.6 1 1 2 2 3 1 1 1 1
[0238] TABLE-US-00013 TABLE 4C Analysis of V kappa subgroup 3
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
A 5 2 27 1 B 1 C 2 D 2 14 E 76 27 F 1 1 G 1 82 1 152 H 1 I 75 K 3 L
4 1 104 1 150 129 1 M 5 13 N 5 P 124 147 Q 123 R 1 S 119 3 1 150 1
141 T 2 117 147 5 1 V 1 89 1 1 1 22 1 W X Y -- unknown (?) not
sequenced sum of seq.sup.2 88 88 117 118 118 123 123 124 126 149
151 152 152 152 152 152 oomcaa.sup.3 76 75 89 104 117 123 119 124
82 147 150 150 129 141 147 152 mcaa.sup.4 E I V L T Q S P G T L S L
S P G rel. oomcaa.sup.5 86% 85% 76% 88% 99% 100% 97% 100% 65% 99%
99% 99% 85% 93% 97% 100% pos occupied.sup.6 6 6 3 3 2 1 4 1 4 3 2 2
3 4 6 1 Framework I CDR I amino acid.sup.1 17 18 19 20 21 22 23 24
25 26 27 A B C D E A 178 2 166 1 B C 181 1 D 6 E 146 1 1 F 7 1 G 1
1 1 1 1 H 17 I 1 5 2 K 1 5 L 173 1 1 M N 9 P Q 159 R 175 176 1 1 10
S 180 7 175 87 T 1 174 7 2 1 V 1 4 1 1 1 W 1 X Y 1 1 -- 72 182 182
182 182 unknown (?) 1 not sequenced sum of seq.sup.2 153 181 182
182 182 182 181 182 182 181 181 182 182 182 182 182 oomcaa.sup.3
146 175 178 174 173 180 181 176 166 175 159 87 182 182 182 182
mcaa.sup.4 E R A T L S C R A S Q S -- -- -- -- rel. oomcaa.sup.5
95% 97% 98% 96% 95% 99% 100% 97% 91% 97% 88% 48% 100% 100% 100%
100% pos occupied.sup.6 3 7 2 4 3 3 1 3 5 6 6 8 1 1 1 1 CDR I
Framework II amino acid.sup.1 F 28 29 30 31 32 33 34 35 36 37 38 39
40 41 42 A 1 1 181 B C D 1 1 2 1 E 1 1 1 F 1 7 1 G 2 7 3 1 2 1 184
H 1 2 1 12 1 1 I 24 4 1 1 K 1 1 153 L 8 1 1 176 3 2 M N 3 12 25 32
P 1 170 Q 1 1 183 167 1 181 R 10 3 18 16 1 1 27 5 S 72 86 151 118 4
5 T 1 1 3 8 1 1 V 76 68 1 7 3 2 W 5 185 X Y 1 1 115 183 -- 182
unknown (?) 1 not sequenced sum of seq.sup.2 182 182 182 181 181
182 183 184 185 185 185 185 184 184 184 184 oomcaa.sup.3 182 76 86
151 118 115 176 181 185 183 183 167 153 170 184 181 mcaa.sup.4 -- V
S S S Y L A W Y Q Q K P G Q rel. oomcaa.sup.5 100% 42% 47% 83% 65%
63% 96% 98% 100% 99% 99% 90% 83% 92% 100% 98% pos occupied.sup.6 1
6 11 10 13 12 2 3 1 3 2 4 6 6 1 3 Framework Framework II CDR II III
amino acid.sup.1 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 A
176 4 147 176 1 B C 1 D 43 2 4 E F 1 1 4 G 125 2 10 179 H 9 1 I 178
1 168 K 1 7 1 L 1 179 174 1 M 3 1 N 1 1 53 2 P 5 184 2 2 2 Q 1 R
182 1 4 180 S 3 6 4 179 74 1 5 T 3 11 2 44 164 2 V 3 9 3 19 3 15 W
1 1 X Y 165 2 -- unknown (?) 1 not sequenced sum of seq.sup.2 184
185 185 183 183 183 183 183 183 183 183 183 185 185 185 185
oomcaa.sup.3 176 184 182 179 174 178 165 125 147 179 74 180 176 164
179 168 mcaa.sup.4 A P R L L I Y G A S S R A T G I rel.
oomcaa.sup.5 96% 99% 98% 98% 95% 97% 90% 68% 80% 98% 40% 98% 95%
89% 97% 91% pos occupied.sup.6 3 2 3 3 2 4 6 7 6 3 6 4 5 7 3 3
Framework III amino acid.sup.1 59 60 61 62 63 64 65 66 67 68 69 70
71 72 73 74 A 68 3 5 3 1 3 B C D 112 1 152 E 1 1 30 F 183 183 2 G
184 3 178 -- 177 H 1 I 1 1 3 K 1 L 1 182 M 1 N 1 1 P 177 Q 1 R 182
2 1 2 S 7 180 179 185 3 7 2 T 1 2 3 2 177 172 179 V 3 1 1 W 1 X Y 1
-- unknown (?) 1 not sequenced sum of seq.sup.2 185 185 185 185 185
185 185 185 185 185 185 184 184 184 184 184 oomcaa.sup.3 177 112
182 183 180 184 179 178 185 177 177 152 183 172 182 179 mcaa.sup.4
P D R F S G S G S G T D F T L T rel. oomcaa.sup.5 96% 61% 98% 99%
97% 99% 97% 96% 100% 96% 96% 83% 99% 93% 99% 97% pos occupied.sup.6
3 5 3 3 3 2 4 5 1 5 4 4 2 5 2 3 Framework III CDR III amino
acid.sup.1 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 A 3 174
B 1 C 2 1 182 D 1 3 182 E 149 175 2 F 1 178 2 1 4 G 3 1 2 H 1 1 7 I
178 1 1 9 K 1 L 178 1 1 7 1 1 M 1 5 N 1 5 P 149 Q 34 1 181 155 R 1
111 3 1 S 169 65 34 1 2 T 8 4 1 8 V 4 6 1 3 159 7 W X Y 1 1 183 176
1 2 -- unknown (?) not sequenced sum of seq.sup.2 184 184 184 184
184 184 182 184 184 184 184 184 184 183 183 183 oomcaa.sup.3 178
169 111 178 149 149 175 182 178 174 159 183 176 182 181 155
mcaa.sup.4 I S R L E P E D F A V Y Y C Q Q rel. oomcaa.sup.5 97%
92% 60% 97% 81% 81% 96% 99% 97% 95% 86% 99% 96% 99% 99% 85% pos
occupied.sup.6 4 5 5 2 3 3 4 3 6 6 7 2 5 2 3 8 CDR III Framework IV
amino acid.sup.1 91 92 93 94 95 A B C D E F 96 97 98 99 100 A 1 8 3
3 1 B C 2 1 2 D 8 5 1 E 2 1 F 5 2 7 166 G 1 104 15 1 1 2 1 166 41 H
4 1 2 I 1 1 4 K 2 1 1 1 L 2 7 5 42 M 1 1 2 N 28 71 1 P 1 139 24 7 2
9 Q 1 1 3 1 3 114 R 34 2 3 2 2 19 S 2 33 58 102 15 2 1 8 T 2 13 1 1
2 1 154
V 3 1 2 W 69 24 X Y 134 1 1 43 -- 3 3 7 127 167 169 169 169 169 8 1
1 1 1 unknown (?) not sequenced 14 14 14 14 14 14 14 17 16 16 16
sum of seq.sup.2 183 183 183 182 182 169 169 169 169 169 169 169
166 167 167 167 oomcaa.sup.3 134 104 71 102 139 127 167 169 169 169
169 43 154 166 166 114 mcaa.sup.4 Y G N S P -- -- -- -- -- -- Y T F
G Q rel. oomcaa.sup.5 73% 57% 39% 56% 76% 75% 99% 100% 100% 100%
100% 25% 93% 99% 99% 68% pos occupied.sup.6 8 11 13 8 11 12 2 1 1 1
1 18 5 2 2 6 Framework IV amino acid.sup.1 101 102 103 104 105 106
A 107 108 sum A 1345 B 2 C 375 D 23 564 E 3 141 759 F 6 765 G 166 1
1804 H 1 64 I 143 803 K 152 157 489 L 54 1 2 1596 M 3 36 N 1 3 255
P 1 1 1147 Q 1 1 1314 R 9 2 4 134 1326 S 2 2629 T 162 1 1 1593 V
111 11 646 W 287 X Y 1 1014 -- 1 1 1 1 1 1 166 1 1 2151 unknown (?)
4 not sequenced 16 16 15 16 16 16 17 17 45 337 sum of seq.sup.2 167
167 168 167 167 167 166 166 138 oomcaa.sup.3 166 162 152 111 141
143 166 157 134 mcaa.sup.4 G T K V E I -- K R rel. oomcaa.sup.5 99%
97% 90% 66% 84% 86% 100% 95% 97% pos occupied.sup.6 2 5 7 4 5 7 1 5
4
[0239] TABLE-US-00014 TABLE 4D Analysis of V kappa subgroup 4
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
17 18 A 24 1 B C 1 1 D 25 26 E 25 F G 1 24 H I 26 K 1 L 1 26 26 M
24 N 1 P 26 1 Q 1 25 R 26 S 26 25 26 1 T 26 V 25 1 26 W X Y --
unknown (?) not sequenced 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 sum
of seq.sup.2 26 26 26 26 26 26 26 26 26 26 26 26 26 26 26 26 26 26
oomcaa.sup.3 25 26 25 24 26 25 26 26 26 25 26 24 26 26 26 24 25 26
mcaa.sup.4 D I V M T Q S P D S L A V S L G E R rel. oomcaa.sup.5
96% 100% 96% 92% 100% 96% 100% 100% 100% 96% 100% 92% 100% 100%
100% 92% 96% 100% pos occupied.sup.6 2 1 2 3 1 2 1 1 1 2 1 3 1 1 1
3 2 1 Framework I CDR I amino acid.sup.1 19 20 21 22 23 24 25 26 27
A B C D E F 28 29 30 A 26 1 1 B C 33 D 1 1 1 E F G H I 26 1 K 33 2
30 L 2 31 M N 26 30 31 1 P 1 1 Q 32 1 R 1 1 1 S 31 33 33 32 32 1 T
26 1 V 28 2 W X Y 32 -- unknown (?) not sequenced 7 7 7 7 sum of
seq.sup.2 26 26 26 26 33 33 33 33 33 33 33 33 33 33 33 33 33 33
oomcaa.sup.3 26 26 26 26 33 33 31 33 32 33 28 31 32 32 32 30 31 30
mcaa.sup.4 A T I N C K S S Q S V L Y S S N N K rel. oomcaa.sup.5
100% 100% 100% 100% 100% 100% 94% 100% 97% 100% 85% 94% 97% 97% 97%
91% 94% 91% pos occupied.sup.6 1 1 1 1 1 1 3 1 2 1 5 2 2 2 2 3 3 4
CDR I Framework II amino acid.sup.1 31 32 33 34 35 36 37 38 39 40
41 42 43 44 45 46 47 48 A 32 2 B C D E 1 F G 32 H 2 I 32 K 33 32 L
33 29 33 M 1 N 33 P 31 31 33 Q 32 33 32 R 1 1 1 S 2 T 1 V 4 W 33 X
Y 33 31 -- unknown (?) not sequenced sum of seq.sup.2 33 33 33 33
33 33 33 33 33 33 33 33 33 33 33 33 33 33 oomcaa.sup.3 33 33 33 32
33 31 32 33 33 31 32 32 31 33 32 29 33 32 mcaa.sup.4 N Y L A W Y Q
Q K P G Q P P K L L I rel. oomcaa.sup.5 100% 100% 100% 97% 100% 94%
97% 100% 100% 94% 97% 97% 94% 100% 97% 88% 100% 97% pos
occupied.sup.6 1 1 1 2 1 2 2 1 1 2 2 2 2 1 2 2 1 2 Frame- work II
CDR II Framework III amino acid.sup.1 49 50 51 52 53 54 55 56 57 58
59 60 61 62 63 64 65 66 A 30 B C D 33 E 32 F 33 G 33 1 33 33 H I 1
K L M N 2 P 1 33 1 Q R 33 32 S 1 31 1 33 32 33 T 2 1 29 V 1 33 W 33
X Y 33 -- unknown (?) not sequenced sum of seq.sup.2 33 33 33 33 33
33 33 33 33 33 33 33 33 33 33 33 33 33 oomcaa.sup.3 33 33 30 31 29
33 32 33 33 33 33 33 32 33 32 33 33 33 mcaa.sup.4 Y W A S T R E S G
V P D R F S G S G rel. oomcaa.sup.5 100% 100% 91% 94% 88% 100% 97%
100% 100% 100% 100% 100% 97% 100% 97% 100% 100% 100% pos
occupied.sup.6 1 1 3 3 4 1 2 1 1 1 1 1 2 1 2 1 1 1 Framework III
amino acid.sup.1 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83
84 A 33 32 B C D 32 33 E 33 F 32 G 33 1 1 H I 33 K L 33 32 M 1 N 2
1 P Q 32 R 1 S 33 30 32 T 33 33 33 1 V 1 33 W X Y -- unknown (?)
not sequenced sum of seq.sup.2 33 33 33 33 33 33 33 33 33 33 33 33
33 33 33 33 33 33 oomcaa.sup.3 33 33 33 32 32 33 33 33 33 30 32 32
32 33 33 33 33 32 mcaa.sup.4 S G T D F T L T I S S L Q A E D V A
rel. oomcaa.sup.5 100% 100% 100% 97% 97% 100% 100% 100% 100% 91%
97% 97% 97% 100% 100% 100% 100% 97% pos occupied.sup.6 1 1 1 2 2 1
1 1 1 3 2 2 2 1 1 1 1 2 Framework III CDR III amino acid.sup.1 85
86 87 88 89 90 91 92 93 94 95 A B C D E F 96 A 1 B C 33 D 1 1 E F 1
1 G 2 H 1 3 I 2 K L 1 2 1 3 1 M N 4 4 P 1 29 1 4 Q 30 32 1 1 R 1 1
2 S 2 23 2 1 T 2 22 V 33 W 2 X Y 33 31 31 29 1 -- 13 15 15 15 15 15
3 unknown (?) not sequenced 18 18 18 18 18 18 18 sum of seq.sup.2
33 33 33 33 33 33 33 33 33 33 33 15 15 15 15 15 15 15 oomcaa.sup.3
33 33 31 33 30 32 31 29 23 22 29 13 15 15 15 15 15 4 mcaa.sup.4 V Y
Y C Q Q Y Y S T P -- -- -- -- -- -- P rel. oomcaa.sup.5 100% 100%
94% 100% 91% 97% 94% 88% 70% 67% 88% 87% 100% 100% 100% 100% 100%
27% pos occupied.sup.6 1 1 3 1 2 2 2 4 6 7 3 3 1 1 1 1 1 8 CDR III
Framework IV amino acid.sup.1 97 98 99 100 101 102 103 104 105 106
A 107 108 sum A 183 B C 68 D 154 E 14 105 F 15 82 G 15 4 15 228 H 6
I 14 135 K 14 13 158 L 4 258 M 1 27 N 1 136 P 1 195 Q 11 1 264 R 1
1 1 11 116 S 2 1 499 T 12 14 236 V 9 196 W 1 69 X Y 254 -- 15 106
unknown (?) not sequenced 18 18 18 18 18 18 18 18 18 18 18 18 22
518 sum of seq.sup.2 15 15 15 15 15 15 15 15 15 15 15 15 11
oomcaa.sup.3 12 15 15 11 15 14 14 9 14 14 15 13 11 mcaa.sup.4 T F G
Q G T K V E I -- K R rel. oomcaa.sup.5 80% 100% 100% 73% 100% 93%
93% 60% 93% 93% 100% 87% 100%
pos occupied.sup.6 3 1 1 2 1 2 2 4 2 2 1 3 1
[0240] TABLE-US-00015 TABLE 5A Analysis of V lambda subgroup 1
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
19 18 20 B C D E F G 22 H 2 I 1 1 K L 1 41 1 M N P 41 41 1 41 Q 22
1 41 R S 39 41 41 1 T 41 19 V 1 38 20 1 1 W X Y Z 16 -- 41 unknown
(?) not sequenced 2 2 1 1 1 1 1 1 1 1 1 1 1 1 sum of seq.sup.2 40
40 41 41 41 41 41 41 41 41 41 41 41 41 42 oomcaa.sup.3 22 39 38 41
41 41 41 41 41 41 20 41 22 20 41 mcaa.sup.4 Q S V L T Q P P S -- V
S G A P rel. oomcaa.sup.5 55% 98% 93% 100% 100% 100% 100% 100% 100%
100% 49% 100% 54% 49% 98% pos occupied.sup.6 3 2 4 1 1 1 1 1 1 1 4
1 3 4 2 Framework I CDRI amino acid.sup.1 16 17 18 19 20 21 22 23
24 25 26 27 D E 28 A 2 1 B C 42 D 3 E 1 F 1 1 G 42 42 3 1 2 H I 1
41 1 37 K 14 1 L 1 1 M 1 N 2 1 37 P Q 42 R 25 1 1 S 1 1 42 38 34 34
38 T 1 38 3 4 3 2 V 42 1 W X Y Z -- unknown (?) not sequenced sum
of seq.sup.2 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42
oomcaa.sup.3 42 42 25 42 38 41 42 42 38 42 34 34 38 37 37
mcaa.sup.4 G Q R V T I S C S G S S S N I rel. oomcaa.sup.5 100%
100% 60% 100% 90% 98% 100% 100% 90% 100% 81% 81% 90% 88% 88% pos
occupied.sup.6 1 1 5 1 4 2 1 1 3 1 4 6 4 4 5 CDRI Framework II
amino acid.sup.1 29 30 31 A 32 33 34 35 36 37 38 39 40 41 42 A 2 2
1 4 B C D 3 1 3 1 1 E 1 F 1 1 1 4 G 39 4 2 39 H 2 2 2 1 1 6 1 I 1 K
1 1 L 1 31 M 1 N 13 31 2 1 9 P 1 42 1 Q 1 39 34 R 5 2 1 1 S 13 1 1
3 19 T 1 1 7 2 36 V 2 40 1 5 W 42 X Y 4 1 20 7 40 Z -- 36 unknown
(?) not sequenced 1 1 1 1 sum of seq.sup.2 42 42 42 41 41 41 41 42
42 42 42 42 42 42 42 oomcaa.sup.3 39 13 31 36 20 40 19 42 40 39 34
31 42 39 36 mcaa.sup.4 G N N -- Y V S W Y Q Q L P G T rel.
oomcaa.sup.5 93% 31% 74% 88% 49% 98% 46% 100% 95% 93% 81% 74% 100%
93% 86% pos occupied.sup.6 3 8 7 5 10 2 7 1 3 3 4 5 1 4 4 Framework
II CDR II amino acid.sup.1 43 44 45 46 47 48 49 50 51 52 53 54 55
56 A A 40 1 1 B C D 13 10 8 E 2 5 1 F 1 G 1 H 1 1 I 40 1 K 35 1 1
18 L 41 40 1 1 1 M 1 1 N 1 3 28 30 2 P 42 38 Q 15 R 4 7 2 40 S 1 9
2 3 1 2 40 T 1 1 V 1 2 1 W 1 X Y 40 1 1 Z -- 41 unknown (?) not
sequenced 1 1 sum of seq.sup.2 42 42 42 42 42 42 42 42 42 42 42 42
41 41 41 oomcaa.sup.3 40 42 35 41 40 40 40 13 28 30 18 40 38 40 41
mcaa.sup.4 A P K L L I Y D N N K R P S -- rel. oomcaa.sup.5 95%
100% 83% 98% 95% 95% 95% 31% 67% 71% 43% 95% 93% 98% 100% pos
occupied.sup.6 3 1 4 2 2 3 3 10 5 4 9 3 3 2 1 CDR II Framework III
amino acid.sup.1 B C D E 57 58 59 60 61 62 63 64 65 66 A A 5 B C D
38 E F 38 G 41 2 36 H 1 I 17 3 K 38 L 1 M N P 38 Q R 42 4 S 2 42 42
T 1 V 24 1 W X Y Z -- 41 41 41 42 42 unknown (?) not sequenced 1 1
1 1 sum of seq.sup.2 41 41 41 42 41 41 41 41 42 42 42 42 42 42 42
oomcaa.sup.3 41 41 41 42 41 24 38 38 42 38 42 36 42 38 42
mcaa.sup.4 -- -- -- -- G V P D R F S G S K -- rel. oomcaa.sup.5
100% 100% 100% 100% 100% 59% 93% 93% 100% 90% 100% 86% 100% 90%
100% pos occupied.sup.6 1 1 1 1 1 2 3 3 1 3 1 3 1 2 1 Framework III
amino acid.sup.1 B 67 68 69 70 71 72 73 74 75 76 77 78 79 80 A 1 3
41 24 2 B C D 1 E 1 F G 40 17 1 42 H 1 I 41 K L 42 41 M N P 2 Q 31
R 8 S 42 1 42 24 20 20 T 38 18 21 17 V 1 1 1 1 1 W 1 X Y Z -- 42
unknown (?) not sequenced sum of seq.sup.2 42 42 42 42 42 42 42 42
42 42 42 42 42 42 42 oomcaa.sup.3 42 42 40 38 42 41 24 42 24 41 21
42 41 31 20 mcaa.sup.4 -- S G T S A S L A I T G L Q S rel.
oomcaa.sup.5 100% 100% 95% 90% 100% 98% 57% 100% 57% 98% 50% 100%
98% 74% 48% pos occupicd.sup.6 1 1 3 3 1 2 2 1 3 2 3 1 2 5 5
Framework III CDR III amino acid.sup.1 81 82 83 84 85 86 87 88 89
90 91 92 93 94 95 A 38 1 22 15 1 B C 42 D 1 41 37 39 17 E 24 42 1 F
2 1 G 15 14 1 H 2 1 I 1 K L 1 37 M N 1 2 2 P 1 Q 3 R 5 1 S 1 4 17
35 T 3 22 1 1 V 1 1 1 W 2 38 X Y 42 39 3 1 Z -- unknown (?)
not sequenced 1 1 1 1 1 1 1 sum of seq.sup.2 42 42 42 42 42 42 42
42 41 41 41 41 41 41 41 oomcaa.sup.3 24 41 42 38 37 42 39 42 22 22
38 39 17 35 37 mcaa.sup.4 E D E A D Y Y C A T W D D S L rel.
oomcaa.sup.5 57% 98% 100% 90% 88% 100% 93% 100% 54% 54% 93% 95% 41%
85% 90% pos occupied.sup.6 4 2 1 3 5 1 3 1 5 3 2 2 8 3 5 CDR III
Framework IV amino acid.sup.1 A B C D E F 96 97 98 99 100 101 102
103 104 A 16 4 1 B C D 7 E 1 1 1 F 36 G 17 1 5 1 36 31 36 H 1 I 1 1
K 1 30 L 1 1 25 M 1 N 9 1 1 P 6 Q 3 R 2 2 1 S 18 1 1 1 T 1 3 36 1 V
2 9 34 11 W 7 X Y 3 Z -- 2 4 35 39 38 38 1 unknown (?) not
sequenced 1 1 3 3 3 3 3 3 4 4 6 6 6 6 6 sum of seq.sup.2 41 41 39
39 38 38 39 39 36 36 36 36 36 36 36 oomcaa.sup.3 18 17 35 39 38 38
9 34 36 36 31 36 36 30 25 mcaa.sup.4 S G -- -- -- -- V V F G G G T
K L rel. oomcaa.sup.5 44% 41% 90% 100% 100% 100% 23% 87% 100% 100%
86% 100% 100% 83% 69% pos occupied.sup.6 8 6 5 1 1 1 10 6 1 1 4 1 1
5 2 Framework IV amino acid.sup.1 105 106 A 107 108 sum A 285 B C
84 D 224 E 81 F 87 G 26 559 H 25 I 188 K 141 L 34 344 M 5 N 176 P 1
296 Q 1 18 251 R 2 156 S 2 720 T 36 359 V 36 1 282 W 1 92 X Y 202 Z
16 -- 524 unknown (?) not sequenced 6 6 6 10 22 141 sum of
seq.sup.2 36 36 36 31 19 oomcaa.sup.3 36 36 34 26 18 mcaa.sup.4 T V
L G Q rel. oomcaa.sup.5 100% 100% 94% 84% 95% pos occupied.sup.6 1
1 3 4 2
[0241] TABLE-US-00016 TABLE 5B Analysis of V lambda subgroup 2
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
35 30 6 1 1 B C D E F G 42 H 2 I 1 K L 40 3 M N P 42 6 40 Q 22 4 41
R 6 1 S 41 40 42 42 T 42 1 V 1 2 36 W X Y Z 16 -- 42 unknown (?) 1
not sequenced 3 1 1 3 1 1 1 1 1 1 1 1 sum of seq.sup.2 40 42 42 40
42 42 42 42 42 42 42 42 43 43 43 oomcaa.sup.3 22 41 35 40 42 41 42
30 40 42 36 42 42 42 40 mcaa.sup.4 Q S A L T Q P A S -- V S G S P
rel. oomcaa.sup.5 55% 98% 83% 100% 100% 98% 100% 71% 95% 100% 86%
100% 98% 98% 93% pos occupied.sup.6 3 2 4 1 1 1 1 3 3 1 2 1 2 2 2
Framework I CDRI amino acid.sup.1 16 17 18 19 20 21 22 23 24 25 26
27 D E 28 A 3 1 B C 42 1 D 1 39 E F 1 G 42 43 1 H 1 1 I 28 41 1 6 K
L 1 1 M N 1 3 4 P 1 Q 42 R 1 S 43 42 3 3 35 38 T 43 36 39 3 V 14 37
W X Y 1 Z -- unknown (?) not sequenced 1 1 sum of seq.sup.2 43 43
43 43 43 43 42 42 43 43 43 43 43 43 43 oomcaa.sup.3 42 42 43 28 43
41 42 42 36 43 39 35 38 39 37 mcaa.sup.4 G Q S I T I S C T G T S S
D V rel. oomcaa.sup.5 98% 98% 100% 65% 100% 95% 100% 100% 84% 100%
91% 81% 88% 91% 86% pos occupied.sup.6 2 2 1 3 1 3 1 1 4 1 3 7 4 2
2 CDRI Framework II amino acid.sup.1 29 30 31 A 32 33 34 35 36 37
38 39 40 41 42 A 1 1 1 4 B C 1 D 1 4 5 1 2 E 1 F 1 4 2 G 39 26 36 H
1 1 2 34 I 1 K 4 40 L 4 1 1 M N 1 4 3 28 2 P 41 Q 41 39 R 2 1 1 S 5
1 2 4 1 42 1 T 1 1 1 V 41 1 W 43 X Y 1 37 29 41 5 Z -- 1 unknown
(?) 1 1 1 not sequenced 1 1 sum of seq.sup.2 43 43 43 43 43 42 42
43 43 43 43 43 43 43 43 oomcaa.sup.3 39 26 37 28 29 41 42 43 41 41
39 34 41 36 40 mcaa.sup.4 G G Y N Y V S W Y Q Q H P G K rel.
oomcaa.sup.5 91% 60% 86% 65% 67% 98% 100% 100% 95% 95% 91% 79% 95%
84% 93% pos occupied.sup.6 5 7 5 7 6 2 1 1 2 2 3 5 3 4 4 Framework
II CDR II amino acid.sup.1 43 44 45 46 47 48 49 50 51 52 53 54 55
56 A A 40 B C D 20 1 2 1 E 20 2 F 7 1 G 2 2 1 H 1 I 1 9 43 1 K 41 1
21 L 38 6 M 26 1 N 1 8 12 P 43 43 Q 2 R 2 43 S 2 21 3 43 T 7 V 3 4
2 39 W X Y 34 2 Z -- 43 unknown (?) not sequenced sum of seq.sup.2
43 43 43 43 43 43 43 43 43 43 43 43 43 43 43 oomcaa.sup.3 40 43 41
38 26 43 34 20 39 21 21 43 43 43 43 mcaa.sup.4 A P K L M I Y D V S
K R P S -- rel. oomcaa.sup.5 93% 100% 95% 88% 60% 100% 79% 47% 91%
49% 49% 100% 100% 100% 100% pos occupied.sup.6 2 1 2 3 4 1 3 4 4 8
8 1 1 1 1 CDR II Framework III amino acid.sup.1 B C D E 57 58 59 60
61 62 63 64 65 66 A A 2 B C 1 D 17 E F 42 G 43 1 41 H 2 I 3 K 42 L
1 1 M N 19 P 15 Q R 43 1 S 28 2 43 42 T V 39 W X Y 2 Z -- 43 43 43
43 43 unknown (?) not sequenced sum of seq.sup.2 43 43 43 43 43 43
43 43 43 43 43 43 43 43 43 oomcaa.sup.3 43 43 43 43 43 39 28 19 43
42 43 41 42 42 43 mcaa.sup.4 -- -- -- -- G V S N R F S G S K --
rel. oomcaa.sup.5 100% 100% 100% 100% 100% 91% 65% 44% 100% 98%
100% 95% 98% 98% 100% pos occupied.sup.6 1 1 1 1 1 3 2 6 1 2 1 2 2
2 1 Framework III amino acid.sup.1 B 67 68 69 70 71 72 73 74 75 76
77 78 79 80 A 3 1 43 36 B C D 1 2 E 1 F G 39 42 H I 35 K 1 L 43 43
M N 38 P 2 Q 41 R 2 S 42 1 43 42 T 1 41 43 1 2 V 8 3 W X Y Z -- 43
unknown (?) 1 not sequenced 1 sum of seq.sup.2 43 42 43 43 43 43 43
43 43 43 43 43 43 43 43 oomcaa.sup.3 43 42 39 38 41 43 43 43 43 35
42 42 43 41 36 mcaa.sup.4 -- S G N T A S L T I S G L Q A rel.
oomcaa.sup.5 100% 100% 91% 88% 95% 100% 100% 100% 100% 81% 98% 98%
100% 95% 84% pos occupied.sup.6 1 1 3 4 3 1 1 1 1 2 2 2 1 2 4
Framework III CDR III amino acid.sup.1 81 82 83 84 85 86 87 88 89
90 91 92 93 94 95 A 43 2 1 21 1 B C 43 11 D 3 42 39 3 1 2 E 38 43 1
1 F 3 3 1 G 1 1 21 3 4 H 2 1 I 1 1 1 K 3 L M N 1 1 1 5 7 P 1 Q 1 R
2 3 S 1 30 41 12 23 14 T 16 4 4 3 V 1 W X Y 43 39 39 1 6 Z -- 1
unknown (?) 1 2
not sequenced 1 sum of seq.sup.2 43 43 43 43 43 43 43 43 43 42 43
43 43 43 43 oomcaa.sup.3 38 42 43 43 39 43 39 43 30 41 39 21 21 23
14 mcaa.sup.4 E D E A D Y Y C S S Y A G S S rel. oomcaa.sup.5 88%
98% 100% 100% 91% 100% 91% 100% 70% 98% 91% 49% 49% 53% 33% pos
occupied.sup.6 4 2 1 1 3 1 3 1 3 2 3 7 7 8 11 CDR III Framework IV
amino acid.sup.1 A B C D E F 96 97 98 99 100 101 102 103 104 A 1 1
1 B C D 1 E F 1 5 42 G 1 42 33 42 H I 2 1 7 K 36 L 1 1 6 5 28 M 1 1
N 5 1 1 P 4 Q 2 1 R 1 5 1 2 S 9 1 T 21 7 41 V 11 28 14 W 5 X Y 4 1
Z -- 3 36 42 43 43 43 unknown (?) not sequenced 1 1 1 1 1 1 2 2 1
sum of seq.sup.2 42 43 43 43 43 43 43 42 42 42 42 42 41 41 42
oomcaa.sup.3 21 36 42 43 43 43 11 28 42 42 33 42 41 36 28
mcaa.sup.4 T -- -- -- -- -- V V F G G G T K L rel. oomcaa.sup.5 50%
84% 98% 100% 100% 100% 26% 67% 100% 100% 79% 100% 100% 88% 67% pos
occupied.sup.6 6 5 2 1 1 1 13 5 1 1 4 1 1 5 2 Framework IV amino
acid.sup.1 105 106 A 107 108 sum A 280 B C 99 D 188 E 107 F 113 G
19 567 H 48 I 1 184 K 189 L 40 264 M 29 N 146 P 238 Q 14 250 R 4
121 S 1 2 831 T 40 398 V 42 1 327 W 48 X Y 285 Z 16 -- 555 unknown
(?) 8 not sequenced 1 1 2 15 28 80 sum of seq.sup.2 42 42 41 25 14
oomcaa.sup.3 40 42 40 19 14 mcaa.sup.4 T V L G Q rel. oomcaa.sup.5
95% 100% 98% 76% 100% pos occupied.sup.6 3 1 2 3 1
[0242] TABLE-US-00017 TABLE 5C Analysis of V lambda subgroup 3
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
1 1 2 7 20 1 B C D 5 10 E 20 1 F 1 1 1 1 G 1 H I K L 37 4 1 9 M N P
26 35 1 27 Q 4 4 38 R S 13 14 1 1 28 37 18 T 36 1 V 8 1 2 34 36 W X
Y 23 Z -- 20 38 unknown (?) not sequenced sum of seq.sup.2 38 38 38
38 38 38 38 38 38 38 38 38 38 38 38 oomcaa.sup.3 20 23 20 37 36 38
26 35 28 38 34 37 36 20 27 mcaa.sup.4 -- Y E L T Q P P S -- V S V A
P rel. oomcaa.sup.5 53% 61% 53% 97% 95% 100% 68% 92% 74% 100% 89%
97% 95% 53% 71% pos occupied.sup.6 4 3 5 2 3 1 4 3 4 1 2 2 3 2 4
Framework I CDRI amino acid.sup.1 16 17 18 19 20 21 22 23 24 25 26
27 D E 28 A 27 1 5 B C 38 D 30 1 E 1 2 2 F G 37 9 38 1 H 1 I 38 9 K
2 7 L 28 M 1 N 2 4 9 1 P 1 1 Q 36 10 R 25 2 S 9 1 19 10 T 38 3 33 1
V 10 W X Y 1 Z -- 38 38 unknown (?) not sequenced sum of seq.sup.2
38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 oomcaa.sup.3 37 36 38
27 25 38 33 38 19 38 30 10 38 38 28 mcaa.sup.4 G Q T A R I T C S G
D S -- -- L rel. oomcaa.sup.5 97% 95% 100% 71% 66% 100% 87% 100%
50% 100% 79% 26% 100% 100% 74% pos occupied.sup.6 2 2 1 3 4 1 5 1 3
1 5 9 1 1 3 CDRI Framework II amino acid.sup.1 29 30 31 A 32 33 34
35 36 37 38 39 40 41 42 A 1 1 21 3 B C 5 D 10 3 1 E 1 3 6 1 F 1 2 3
G 23 4 36 H 2 9 1 I 1 K 2 13 32 L 2 M 1 N 2 1 2 P 3 36 1 Q 4 37 35
1 36 R 10 1 1 1 4 2 S 11 2 8 14 1 2 T 1 4 V 1 15 W 38 X Y 8 20 1 4
35 Z -- 37 unknown (?) not sequenced 1 1 sum of seq.sup.2 38 38 37
37 37 38 38 38 38 38 38 38 38 38 38 oomcaa.sup.3 23 11 13 37 20 21
14 38 35 37 35 32 36 36 36 mcaa.sup.4 G S K -- Y A S W Y Q Q K P G
Q rel. oomcaa.sup.5 61% 29% 35% 100% 54% 55% 37% 100% 92% 97% 92%
84% 95% 95% 95% pos occupied.sup.6 5 9 9 1 7 4 7 1 2 2 3 4 2 2 3
Framework II CDR II amino acid.sup.1 43 44 45 46 47 48 49 50 51 52
53 54 55 56 A A 23 1 1 1 B C D 9 22 2 8 E 5 3 3 F 2 1 G 9 2 -- H 1
3 1 I 1 28 1 K 2 6 1 13 L 6 33 1 M 1 1 N 1 19 9 P 38 37 1 Q 9 1 R 1
1 1 38 S 14 10 1 1 36 T 2 4 V 1 31 4 37 9 W X Y 35 Z -- 38 unknown
(?) not sequenced sum of seq.sup.2 38 38 38 38 38 38 38 38 38 38 38
38 38 38 38 oomcaa.sup.3 23 38 31 33 37 28 35 9 22 19 13 38 37 36
38 mcaa.sup.4 A P V L V I Y D D N K R P S -- rel. oomcaa.sup.5 61%
100% 82% 87% 97% 74% 92% 24% 58% 50% 34% 100% 97% 95% 100% pos
occupied.sup.6 3 1 3 3 2 3 3 7 8 7 9 1 2 3 1 CDR II Framework III
amino acid.sup.1 B C D E 57 58 59 60 61 62 63 64 65 66 A A B C D 9
E 27 F 38 G 38 38 H I 37 K L M N 21 P 36 Q R 38 S 1 38 38 12 T 5 V
W X Y Z -- 38 38 38 38 38 unknown (?) 1 not sequenced 1 1 1 sum of
seq.sup.2 38 38 38 38 38 37 37 37 38 38 38 38 38 38 38 oomcaa.sup.3
38 38 38 38 38 37 36 27 38 38 38 38 38 21 38 mcaa.sup.4 -- -- -- --
G I P E R F S G S N -- rel. oomcaa.sup.5 100% 100% 100% 100% 100%
100% 97% 73% 100% 100% 100% 100% 100% 55% 100% pos occupied.sup.6 1
1 1 1 1 1 2 2 1 1 1 1 1 3 1 Framework III amino acid.sup.1 B 67 68
69 70 71 72 73 74 75 76 77 78 79 80 A 1 36 1 1 11 1 34 B C D E 10 F
G 37 28 H 1 I 1 1 37 1 K 1 L 38 M N 28 1 P Q 1 25 R 1 10 1 S 37 2
11 23 1 T 1 6 37 25 36 12 13 2 V 2 1 14 1 1 W X Y Z -- 38 unknown
(?) not sequenced sum of seq.sup.2 38 38 38 38 38 38 38 38 38 38 38
38 38 38 38 oomcaa.sup.3 38 37 37 28 37 36 25 38 36 37 23 28 14 25
34 mcaa.sup.4 -- S G N T A T L T I S G V Q A rel. oomcaa.sup.5 100%
97% 97% 74% 97% 95% 66% 100% 95% 97% 61% 74% 37% 66% 89% pos
occupied.sup.6 1 2 2 5 2 2 4 1 3 2 5 2 3 5 4 framework III CDR III
amino acid.sup.1 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 A 38
13 3 2 1 B C 38 D 38 37 32 1 1 E 14 38 1 1 F 2 2 G 10 3 14 H I 1 K
L 2 1 1 1 M 10 1 N 10 2 1 2 P 1 Q 25 1 R 10 1 2 S 1 14 1 28 26 13 T
1 3 7 V 1 11 W 23 X Y 38 36 1 1 Z -- unknown (?)
not sequenced 1 1 1 1 sum of seq.sup.2 38 38 38 38 38 38 38 38 38
38 38 37 37 37 37 oomcaa.sup.3 14 38 38 38 37 38 36 38 25 14 23 32
28 26 14 mcaa.sup.4 E D E A D Y Y C Q S W D S S G rel. oomcaa.sup.5
37% 100% 100% 100% 97% 100% 95% 100% 66% 37% 61% 86% 76% 70% 38%
pos occupied.sup.6 6 1 1 1 2 1 2 1 5 3 5 4 7 8 6 CDR III Framework
IV amino acid.sup.1 A B C D E F 96 97 98 99 100 101 102 103 104 A 2
4 B C D 6 E 2 2 2 F 35 G 3 1 3 1 35 31 35 H 12 1 I 4 K 1 30 L 1 1 4
2 28 M 1 1 N 10 1 P 3 1 Q 1 R 2 2 S 1 1 T 2 4 35 V 18 28 7 W 1 X Y
1 3 1 3 Z -- 10 15 31 36 37 36 1 unknown (?) not sequenced 2 1 1 1
1 1 1 1 3 3 3 3 3 4 3 sum of seq.sup.2 36 37 37 37 37 37 37 37 35
35 35 35 35 34 35 oomcaa.sup.3 10 15 31 36 37 36 18 28 35 35 31 35
35 30 28 mcaa.sup.4 N -- -- -- -- -- V V F G G G T K L rel.
oomcaa.sup.5 28% 41% 84% 97% 100% 97% 49% 76% 100% 100% 89% 100%
100% 88% 80% pos occupied.sup.6 9 8 5 2 1 2 9 6 1 1 2 1 1 3 2
Framework IV amino acid.sup.1 105 106 A 107 108 sum A 265 B C 1 82
D 225 E 145 F 90 G 24 461 H 32 I 160 K 110 L 33 233 M 17 N 126 P 1
249 Q 7 275 R 154 S 2 501 T 35 347 V 35 308 W 62 X Y 211 Z -- 603
unknown (?) 1 not sequenced 3 3 4 11 28 89 sum of seq.sup.2 35 35
34 27 7 oomcaa.sup.3 35 35 33 24 7 mcaa.sup.4 T V L G Q rel.
oomcaa.sup.5 100% 100% 97% 89% 100% pos occupied.sup.6 1 1 2 3
1
[0243] TABLE-US-00018 TABLE 6A Analysis of V heavy chain subgroup
1A Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
A 1 14 60 B C D E 1 2 1 2 64 F G 58 1 64 H 2 I 2 K 2 57 64 L 2 59 3
M 1 N 6 P 63 Q 53 56 2 45 R 1 S 60 3 1 T V 2 55 1 55 61 W X Y Z 3
-- unknown (?) not sequenced 11 10 10 10 10 10 10 10 6 6 6 6 6 6 6
sum of seq.sup.2 59 60 60 60 60 60 60 60 64 64 64 64 64 64 64
oomcaa.sup.3 53 55 56 59 55 45 60 58 60 64 61 57 64 63 64
mcaa.sup.4 Q V Q L V Q S G A E V K K P G rel. oomcaa.sup.5 90% 92%
93% 98% 92% 75% 100% 97% 94% 100% 95% 89% 100% 98% 100% pos
occupied.sup.6 4 4 3 2 4 3 1 2 3 1 2 3 1 2 1 Framework I amino
acid.sup.1 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 A 24 1 62 1
B C 63 D 1 E F 69 G 1 69 41 1 H 1 I 1 K 60 63 1 L M N 2 P Q R 3 1 1
1 S 40 63 63 68 1 40 T 1 1 2 68 25 V 64 64 W X Y 27 Z -- unknown
(?) not sequenced 6 6 6 6 6 6 6 6 5 2 1 sum of seq.sup.2 64 64 64
64 64 64 64 64 65 68 69 70 70 70 70 oomcaa.sup.3 40 63 64 60 64 63
63 63 62 68 69 41 68 69 40 mcaa.sup.4 S S V K V S C K A S G G T F S
rel. oomcaa.sup.5 63% 98% 100% 94% 100% 98% 98% 98% 95% 100% 100%
59% 97% 99% 57% pos occupied.sup.6 2 2 1 3 1 2 2 2 3 1 1 4 3 2 6
CDR I Framework II amino acid.sup.1 31 A B 32 33 34 35 36 37 38 39
40 41 42 43 A 41 70 B C D E F 3 3 G 23 1 68 H 1 1 1 I 61 1 1 K 1 L
1 2 1 M 4 N 5 4 P 1 68 Q 69 69 R 1 70 1 1 S 60 2 60 1 T 3 3 4 V 1
69 W 70 X Y 64 Z -- 70 70 unknown (?) not sequenced sum of
seq.sup.2 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 oomcaa.sup.3
60 70 70 64 41 61 60 70 69 70 69 70 68 68 69 mcaa.sup.4 S -- -- Y A
I S W V R Q A P G Q rel. oomcaa.sup.5 86% 100% 100% 91% 59% 87% 86%
100% 99% 100% 99% 100% 97% 97% 99% pos occupied.sup.6 5 1 1 4 6 4 5
1 2 1 2 1 3 3 2 Framework II CDR II amino acid.sup.1 44 45 46 47 48
49 50 51 52 A B C 53 54 55 A 1 5 B C D 1 E 69 F 2 3 39 G 69 1 69 39
1 68 H I 65 38 34 K L 68 1 1 2 4 M 67 2 4 N 4 3 22 P 1 44 Q 1 1 1 R
1 4 1 S 1 1 22 1 1 T 1 2 4 1 3 V 1 2 2 16 1 W 1 67 26 X Y 1 20 Z --
70 70 unknown (?) not sequenced sum of seq.sup.2 70 70 70 70 70 70
70 70 70 70 70 70 70 70 70 oomcaa.sup.3 69 68 69 67 67 69 39 65 38
44 70 70 34 39 68 mcaa.sup.4 G L E W M G G I I P -- -- I F G rel.
oomcaa.sup.5 99% 97% 99% 96% 96% 99% 56% 93% 54% 63% 100% 100% 49%
56% 97% pos occupied.sup.6 2 3 2 4 4 2 4 4 6 5 1 1 10 6 3 CDR II
Framework III amino acid.sup.1 56 57 58 59 60 61 62 63 64 65 66 67
68 69 70 A 1 34 69 B C D 15 1 2 E 1 F 1 48 3 4 G 1 3 67 H 1 I 4 1
44 K 1 2 1 47 1 1 L 1 1 22 2 1 M 21 N 9 59 18 P 1 7 Q 1 1 70 64 R 2
2 1 69 S 1 2 1 5 T 34 26 4 3 66 65 V 1 65 3 W X Y 1 68 Z -- unknown
(?) not sequenced sum of seq.sup.2 70 70 70 70 70 70 70 70 70 70 70
70 70 70 70 oomcaa.sup.3 34 34 59 68 69 70 47 48 64 67 69 65 66 44
65 mcaa.sup.4 T A N Y A Q K F Q G R V T I T rel. oomcaa.sup.5 49%
49% 84% 97% 99% 100% 67% 69% 91% 96% 99% 93% 94% 63% 93% pos
occupied.sup.6 11 6 7 3 2 1 4 2 5 3 2 3 3 4 2 Framework III amino
acid.sup.1 71 72 73 74 75 76 77 78 79 80 81 82 A B C A 43 64 1 B C
D 70 2 E 33 64 F G 1 H 1 1 I 1 1 3 1 1 K 8 L 3 3 63 70 M 67 N 4 1
16 P Q 1 3 R 1 3 23 1 S 70 62 1 41 49 T 24 27 67 1 69 2 3 2 V 3 3 4
W X Y 68 Z -- unknown (?) not sequenced sum of seq.sup.2 70 70 70
70 70 70 70 70 70 70 70 70 70 70 70 oomcaa.sup.3 43 70 33 70 67 62
69 64 68 67 64 63 41 49 70 mcaa.sup.4 A D E S T S T A Y M E L S S L
rel. oomcaa.sup.5 61% 100% 47% 100% 96% 89% 99% 91% 97% 96% 91% 90%
59% 70% 100% pos occupied.sup.6 3 1 5 1 2 4 2 4 3 2 4 3 6 6 1
Framework III CDR III amino acid.sup.1 83 84 85 86 87 88 89 90 91
92 93 94 95 96 97 A 3 1 70 66 2 16 1 B C 70 1 D 26 70 16 5 3 E 44 9
F 1 1 2 1 G 2 14 13 20 H I 2 2 5 K 3 5 2 L 2 1 4 4 2 M 1 1 1 2 N 2
2 P 20 3 Q 1 R 62 55 1 5 7 S 67 1 1 1 5 5 T 4 67 1 3 3 5 4 V 1 64 3
3 2 4 W 1 1 X Y 69 68 1 2 3 Z -- 1 2 unknown (?)
not sequenced 2 2 2 sum of seq.sup.2 70 70 70 70 70 70 70 70 70 70
70 70 68 68 68 oomcaa.sup.3 62 67 44 70 67 70 64 69 68 70 66 55 16
20 20 mcaa.sup.4 R S E D T A V Y Y C A R A P G rel. oomcaa.sup.5
89% 96% 63% 100% 96% 100% 91% 99% 97% 100% 94% 79% 24% 29% 29% pos
occupied.sup.6 4 2 2 1 4 1 5 2 2 1 3 8 10 14 18 CDR III amino
acid.sup.1 98 99 100 A B C D E F G H I J K 101 A 1 1 4 1 2 2 1 1 1
1 1 2 1 B C 1 16 2 1 1 7 2 1 D 3 5 4 3 4 1 1 14 59 E 2 1 1 1 F 3 2
3 1 2 2 1 28 2 G 10 14 5 20 15 16 3 3 4 15 1 1 7 H 1 1 1 1 I 2 2 2
2 1 1 1 K 1 1 L 5 2 1 1 4 2 1 1 1 M 1 1 1 1 10 N 1 2 1 2 2 2 2 1 1
4 P 1 3 2 2 2 4 2 1 4 1 1 1 Q 1 1 1 1 R 8 1 4 2 1 16 S 5 5 21 5 11
8 4 3 2 1 2 1 T 1 3 4 2 5 2 1 1 1 V 3 3 3 4 2 2 2 1 2 1 W 3 1 1 2 3
1 5 1 X Y 20 5 4 9 1 2 11 20 10 6 9 10 7 1 Z -- 2 3 6 11 11 14 23
26 26 31 34 46 39 21 1 unknown (?) 1 1 1 2 3 not sequenced 4 4 4 4
5 5 5 5 5 5 5 5 5 5 5 sum of seq.sup.2 66 66 66 66 65 65 65 65 65
65 65 65 65 65 65 oomcaa.sup.3 20 16 21 20 15 16 23 26 26 31 34 46
39 28 59 mcaa.sup.4 Y C S G -- -- -- -- -- -- -- -- -- F D rel.
oomcaa.sup.5 30% 24% 32% 30% 23% 25% 35% 40% 40% 48% 52% 71% 60%
43% 91% pos occupied.sup.6 15 18 15 15 17 17 15 12 11 11 10 8 7 6 6
Framework IV amino acid.sup.1 102 103 104 105 106 107 108 109 110
111 112 113 sum A 670 B C 165 D 1 1 308 E 1 1 297 F 2 226 G 58 59 1
1 928 H 1 14 I 3 4 286 K 3 1 325 L 3 1 40 1 386 M 1 3 189 N 1 176 P
5 1 238 Q 52 494 R 1 351 S 53 51 972 T 54 11 1 51 1 736 V 15 1 1 54
54 1 699 W 59 1 243 X Y 34 1 542 Z 3 -- 1 578 unknown (?) 8 not
sequenced 5 9 9 10 11 14 14 14 15 16 16 17 406 sum of seq.sup.2 65
61 61 60 59 56 56 56 55 54 54 53 oomcaa.sup.3 34 59 58 52 59 54 40
54 51 54 53 51 mcaa.sup.4 Y W G Q G T L V T V S S rel. oomcaa.sup.5
52% 97% 95% 87% 100% 96% 71% 96% 93% 100% 98% 96% pos
occupied.sup.6 9 3 4 7 1 3 5 3 2 1 2 3
[0244] TABLE-US-00019 TABLE 6B Analysis of V heavy chain subgroup
1B Frame work I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14
15 A 32 B C D E 1 5 1 35 F G 27 35 H 1 1 I K 3 1 34 33 L 3 26 1 M 1
1 N P 1 33 Q 21 20 26 R 1 1 2 S 27 T 1 1 V 3 21 20 35 W X Y Z --
unknown (?) not sequenced 15 15 15 13 13 13 13 13 6 5 5 5 5 5 5 sum
of seq.sup.2 25 25 25 27 27 27 27 27 34 35 35 35 35 35 35
oomcaa.sup.3 21 21 20 26 20 26 27 27 32 35 35 34 33 33 35
mcaa.sup.4 Q V Q L V Q S G A E V K K P G rel. oomcaa.sup.5 84% 84%
80% 96% 74% 96% 100% 100% 94% 100% 100% 97% 94% 94% 100% pos
occupied.sup.6 3 3 4 2 4 2 1 1 3 1 1 2 2 3 1 Frame work I amino
acid.sup.1 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 A 34 30 B C
35 D E 3 F 2 39 G 1 40 1 H I 1 1 1 K 33 28 L 1 M N 1 1 P 1 Q 2 R 2
2 S 1 34 35 40 5 2 T 2 3 32 34 V 35 34 1 1 1 W X Y 36 Z -- unknown
(?) not sequenced 5 5 5 5 5 5 5 5 5 sum of seq.sup.2 35 35 35 35 35
35 35 35 35 40 40 40 40 40 40 oomcaa.sup.3 34 34 35 33 34 35 35 28
30 40 40 36 32 39 34 mcaa.sup.4 A S V K V S C K A S G Y T F T rel.
oomcaa.sup.5 97% 97% 100% 94% 97% 100% 100% 80% 86% 100% 100% 90%
80% 98% 85% pos occupied.sup.6 2 2 1 2 2 1 1 4 4 1 1 4 4 2 6 CDRI
Frame work II amino acid.sup.1 31 A B 32 33 34 35 36 37 38 39 40 41
42 43 A 2 6 39 B C D 1 5 1 1 E 1 1 F 2 2 G 14 1 1 39 H 3 1 34 I 9 K
1 L 1 5 2 1 M 23 N 3 1 3 P 1 1 34 Q 1 1 1 1 39 39 R 1 37 1 S 15 2 1
1 T 1 4 V 1 2 2 38 W 40 X Y 1 32 19 1 Z -- 40 40 unknown (?) not
sequenced sum of seq.sup.2 40 40 40 40 40 40 40 40 40 40 40 40 40
40 40 oomcaa.sup.3 15 40 40 32 19 23 34 40 38 37 39 39 34 39 39
mcaa.sup.4 S -- -- Y Y M H W V R Q A P G Q rel. oomcaa.sup.5 38%
100% 100% 80% 48% 58% 85% 100% 95% 93% 98% 98% 85% 98% 98% pos
occupied.sup.6 10 1 1 5 11 5 5 1 2 4 2 2 4 2 2 Frame work II CDR II
amino acid.sup.1 44 45 46 47 48 49 50 51 52 A B C 53 54 55 A 1 1 7
1 B C D 1 1 E 39 1 1 F 2 1 1 G 28 39 1 1 9 1 39 H 2 I 3 34 K 1 L 37
1 M 37 2 4 N 35 20 12 1 P 1 31 Q 1 R 10 4 3 1 S 1 2 1 20 T 1 3 V 1
1 W 40 33 X Y 2 Z -- 40 40 unknown (?) not sequenced sum of
seq.sup.2 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 oomcaa.sup.3
28 37 39 40 37 39 33 34 35 31 40 40 20 20 39 mcaa.sup.4 G L E W M G
W I N P -- -- N S G rel. oomcaa.sup.5 70% 93% 98% 100% 93% 98% 83%
85% 88% 78% 100% 100% 50% 50% 98% pos occupied.sup.6 4 3 2 1 2 2 4
4 5 4 1 1 9 8 2 CDR II Framework III amino acid.sup.1 56 57 58 59
60 61 62 63 64 65 66 67 68 69 70 A 1 2 27 2 1 1 B C D 1 4 E 2 2 1 1
F 4 39 3 G 15 6 1 34 H 1 1 I 1 1 1 1 13 K 2 2 8 36 1 L 1 1 1 M 23 N
17 18 1 P Q 36 37 R 2 1 2 37 S 1 2 11 1 T 35 2 1 1 39 40 V 1 38 W 3
X Y 33 Z -- unknown (?) not sequenced sum of seq.sup.2 40 40 40 40
40 40 40 40 40 40 40 40 40 40 40 oomcaa.sup.3 17 35 18 33 27 36 36
39 37 34 37 38 39 23 40 mcaa.sup.4 N T N Y A Q K F Q G R V T M T
rel. oomcaa.sup.5 43% 88% 45% 83% 68% 90% 90% 98% 93% 85% 93% 95%
98% 58% 100% pos occupied.sup.6 8 4 8 4 4 4 5 2 3 4 2 3 2 4 1
Framework III amino acid.sup.1 71 72 73 74 75 76 77 78 79 80 81 82
A B C A 2 12 35 B C D 35 1 4 E 1 35 F 1 G 1 1 2 H 1 I 22 1 K 1 L 2
39 39 M 1 1 37 1 N 4 7 1 2 P 3 Q R 34 1 4 2 16 S 1 37 27 1 35 20 T
1 38 5 1 39 1 V 4 1 1 W X Y 39 Z -- unknown (?) not sequenced sum
of seq.sup.2 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40
oomcaa.sup.3 34 35 38 37 22 27 39 35 39 37 35 39 35 20 39
mcaa.sup.4 R D T S I S T A Y M E L S S L rel. oomcaa.sup.5 85% 88%
95% 93% 55% 68% 98% 88% 98% 93% 88% 98% 88% 50% 98% pos
occupied.sup.6 6 3 3 2 4 5 2 3 2 3 3 2 5 4 2 Framework III CDR III
amino acid.sup.1 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 A 1 2
40 37 1 6 1 B C 37 1 D 19 40 1 7 5 E 19 2 1 F 2 2 1 1 1 G 1 7 7 5 H
1 I 1 1 1 1 K 1 1 1 L 2 1 2 4 4 M 2 2 N 1 P 1 1 6 4 Q 1 R 37 1 31 5
1 S 1 36 1 1 1 3 3 1 T 1 40 2 1 1 2 V 33 1 7 1 1 W 1 1 X Y 38 35 5
5 Z -- 1 1 unknown (?)
not sequenced 1 1 1 1 1 1 3 3 3 sum of seq.sup.2 40 40 40 40 40 40
39 39 39 39 39 39 37 37 37 oomcaa.sup.3 37 36 19 40 40 40 33 38 35
37 37 31 7 7 5 mcaa.sup.4 R S D D T A V Y Y C A R D G D rel.
oomcaa.sup.5 93% 90% 48% 100% 100% 100% 85% 97% 90% 95% 95% 79% 19%
19% 14% pos occupied.sup.6 4 4 3 1 1 1 5 2 4 3 3 8 10 12 18 CDR III
amino acid.sup.1 98 99 100 A B C D E F G H I J K 101 A 1 2 3 1 3 1
5 B C 3 2 1 D 2 3 1 5 4 1 2 2 1 2 27 E 1 1 2 1 1 F 3 2 1 1 1 1 2 15
G 5 9 4 7 1 3 2 2 1 1 3 1 H 2 1 1 I 3 1 1 1 1 1 1 1 K 1 1 1 1 1 L 4
3 1 2 1 1 2 1 2 M 1 1 1 4 N 1 1 1 1 3 1 1 P 1 1 3 2 1 Q 1 2 1 R 1 3
1 1 1 S 4 3 6 3 2 2 1 1 T 2 1 5 1 1 1 1 1 1 V 1 3 1 2 1 1 2 1 1 W 2
2 1 1 1 4 X Y 4 2 3 4 3 3 2 1 2 5 6 2 Z -- 4 6 8 10 11 14 20 23 25
25 25 23 18 11 6 unknown (?) 3 not sequenced 3 3 3 4 4 4 4 4 4 4 4
4 4 4 4 sum of seq.sup.2 37 37 37 36 36 36 36 36 36 36 36 36 36 36
36 oomcaa.sup.3 5 9 8 10 11 14 20 23 25 25 25 23 18 15 27
mcaa.sup.4 G G -- -- -- -- -- -- -- -- -- -- -- F D rel.
oomcaa.sup.5 14% 24% 22% 28% 31% 39% 56% 64% 69% 69% 69% 64% 50%
42% 75% pos occupied.sup.6 13 13 12 12 17 14 13 10 9 8 7 8 8 5 5
Framework IV amino acid.sup.1 102 103 104 105 106 107 108 109 110
111 112 113 sum A 340 B C 79 D 2 179 E 1 159 F 1 130 G 27 26 1 450
H 1 51 I 7 3 113 K 2 194 L 12 1 204 M 2 144 N 1 138 P 1 1 128 Q 23
253 R 1 247 S 3 1 18 18 432 T 21 6 16 1 390 V 6 21 18 342 W 29 158
X Y 11 294 Z -- 3 394 unknown (?) 3 not sequenced 4 11 13 13 14 19
19 19 20 20 21 22 458 sum of seq.sup.2 36 29 27 27 26 21 21 21 20
20 19 18 oomcaa.sup.3 11 29 27 23 26 21 12 21 16 18 18 18
mcaa.sup.4 Y W G Q G T L V T V S S rel. oomcaa.sup.5 31% 100% 100%
85% 100% 100% 57% 100% 80% 90% 95% 100% pos occupied.sup.6 10 1 1 4
1 1 4 1 3 3 2 1
[0245] TABLE-US-00020 TABLE 6C Analysis of V heavy chain subgroup 2
Frame work I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
3 B C D E 1 6 F G 6 H I 1 K 3 6 1 L 6 6 M N 1 P 1 6 6 Q 2 R 2 S 4 T
6 1 2 5 V 5 1 6 W X Y Z 3 -- unknown (?) not sequenced 1 1 1 1 1 1
1 1 1 1 1 1 1 1 1 sum of seq.sup.2 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6
oomcaa.sup.3 3 5 6 6 3 6 4 6 6 3 6 6 6 6 5 mcaa.sup.4 Z V T L K E S
G P A L V K P T rel. oomcaa.sup.5 50% 83% 100% 100% 50% 100% 67%
100% 100% 50% 100% 100% 100% 100% 83% pos occupied.sup.6 3 2 1 1 3
1 3 1 1 3 1 1 1 1 2 Frame work I amino acid.sup.1 16 17 18 19 20 21
22 23 24 25 26 27 28 29 30 A 1 B C 7 D E 2 F 3 6 1 G 7 H I K L 6 6
2 1 6 M N P 1 Q 4 R S 1 6 6 6 T 5 6 6 6 1 V 2 W X Y 1 Z -- unknown
(?) not sequenced 1 1 1 1 1 1 sum of seq.sup.2 6 6 6 6 6 6 7 7 7 7
7 7 7 7 7 oomcaa.sup.3 4 5 6 6 6 6 7 6 3 6 7 6 6 6 6 mcaa.sup.4 Q T
L T L T C T F S G F S L S rel. oomcaa.sup.5 67% 83% 100% 100% 100%
100% 100% 86% 43% 86% 100% 86% 86% 86% 86% pos occupied.sup.6 2 2 1
1 1 1 1 2 3 2 1 2 2 2 2 CDRI Frame work II amino acid.sup.1 31 A B
32 33 34 35 36 37 38 39 40 41 42 43 A 1 1 B C 2 D 1 E F G 4 3 3 1 7
H I 1 7 K 6 L M 5 N 2 P 5 7 Q 6 R 2 1 7 1 1 S 2 4 4 1 T 3 1 V 2 7 W
7 X Y Z -- unknown (?) not sequenced sum of seq.sup.2 7 7 7 7 7 7 7
7 7 7 7 7 7 7 7 oomcaa.sup.3 3 4 4 5 3 7 4 7 7 7 6 5 7 7 6
mcaa.sup.4 T S G M G V S W I R Q P P G K rel. oomcaa.sup.5 43% 57%
57% 71% 43% 100% 57% 100% 100% 100% 86% 71% 100% 100% 86% pos
occupied.sup.6 3 4 3 2 4 1 2 1 1 1 2 3 1 1 2 Frame work II CDR II
amino acid.sup.1 44 45 46 47 48 49 50 51 52 A B C 53 54 55 A 6 7 B
C D 2 3 6 E 7 F 2 G 1 H 2 1 I 6 K L 7 7 2 1 1 M N 3 P Q R 2 S 2 T V
W 7 1 4 X 1 1 1 Y 1 1 Z -- 6 7 7 unknown (?) not sequenced sum of
seq.sup.2 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 oomcaa.sup.3 6 7 7 7 7 7 2
6 2 6 7 7 4 3 6 mcaa.sup.4 A L E W L A H I D -- -- -- W D D rel.
oomcaa.sup.5 86% 100% 100% 100% 100% 100% 29% 86% 29% 86% 100% 100%
57% 43% 86% pos occupied.sup.6 2 1 1 1 1 1 4 2 5 2 1 1 3 3 2 CDR II
Framework III amino acid.sup.1 56 57 58 59 60 61 62 63 64 65 66 67
68 69 70 A B C D 5 E 1 1 F 1 1 G H 1 I 6 K 1 6 4 L 7 7 M N P 2 Q R
2 1 2 7 S 2 6 7 4 1 5 T 4 3 6 2 V 1 W 1 X 1 Y 3 4 Z -- unknown (?)
not sequenced sum of seq.sup.2 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7
oomcaa.sup.3 5 6 3 4 6 4 7 7 4 4 7 7 6 6 5 mcaa.sup.4 D K Y Y S T S
L K S R L T I S rel.oomcaa.sup.5 71% 86% 43% 57% 86% 57% 100% 100%
57% 57% 100% 100% 86% 86% 71% pos occupied.sup.6 3 2 3 4 2 3 1 1 3
2 1 1 2 2 2 Framework III amino acid.sup.1 71 72 73 74 75 76 77 78
79 80 81 82 A B C A B C D 6 1 E F 1 G H I 2 1 K 6 6 L 6 M 7 5 N 1 5
6 P Q 7 R 1 1 S 7 2 T 6 5 5 V 7 7 1 W X Y Z -- 1 1 1 unknown (?)
not sequenced sum of seq.sup.2 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7
oomcaa.sup.3 6 6 6 7 6 5 7 7 7 6 5 7 5 6 5 mcaa.sup.4 K D T S K N Q
V V L T M T N M rel.oomcaa.sup.5 86% 86% 86% 100% 86% 71% 100% 100%
100% 86% 71% 100% 71% 86% 71% pos occupied.sup.6 2 2 2 1 2 2 1 1 1
2 2 1 3 2 3 Framework III CDR III amino acid.sup.1 83 84 85 86 87
88 89 90 91 92 93 94 95 96 97 A 1 5 5 B C 7 D 6 7 E F G 2 H 1 1 I 3
K L M N 1 1 2 P 7 1 1 Q 1 R 6 1 S 1 T 7 7 1 V 6 2 1 1 1 W X Y 7 7 2
Z -- unknown (?)
not sequenced 1 1 1 sum of seq.sup.2 7 7 7 7 7 7 7 7 7 7 7 7 6 6 6
oomcaa.sup.3 6 7 6 7 7 5 7 7 7 7 5 6 3 1 2 mcaa.sup.4 D P V D T A T
Y Y C A R I H N rel.oomcaa.sup.5 86% 100% 86% 100% 100% 71% 100%
100% 100% 100% 71% 86% 50% 17% 33% pos occupied.sup.6 2 1 2 1 1 2 1
1 1 1 2 2 4 6 4 CDR III amino acid.sup.1 98 99 100 A B C D E F G H
I J K 101 A 1 2 1 B C D 6 E 2 1 F 3 G 1 1 1 2 1 1 1 1 H I 2 K 1 L 1
1 1 M 1 2 N 1 P 1 1 Q R 1 S 1 1 T 1 1 V 1 1 1 W 1 1 1 X Y 1 2 1 1 1
2 Z -- 2 2 3 4 4 4 6 5 3 unknown (?) not sequenced 1 1 1 1 1 1 1 1
1 1 1 1 1 1 1 sum of seq.sup.2 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6
oomcaa.sup.3 2 1 2 2 2 2 3 4 4 4 6 5 3 3 6 mcaa.sup.4 I G E A -- --
-- -- -- -- -- -- -- F D rel. oomcaa.sup.5 33% 17% 33% 33% 33% 33%
50% 67% 67% 67% 100% 83% 50% 50% 100% pos occupied.sup.6 5 6 5 5 4
5 3 3 3 3 1 2 3 3 1 Framework IV amino acid.sup.1 102 103 104 105
106 107 108 109 110 111 112 113 sum A 1 35 B C 16 D 43 E 21 F 18 G
6 6 55 H 6 I 29 K 1 1 42 L 1 3 78 M 20 N 23 P 1 1 41 Q 3 23 R 2 41
S 6 3 82 T 6 1 5 102 V 3 6 6 68 W 6 29 X 4 Y 1 35 Z 3 -- 56 unknown
(?) not sequenced 1 1 1 1 1 1 1 1 1 1 1 4 54 sum of seq.sup.2 6 6 6
6 6 6 6 6 6 6 6 3 oomcaa.sup.3 3 6 6 3 6 6 3 6 5 6 6 3 mcaa.sup.4 V
W G Q G T L V T V S S rel. oomcaa.sup.5 50% 100% 100% 50% 100% 100%
50% 100% 83% 100% 100% 100% pos occupied.sup.6 4 1 1 3 1 1 4 1 2 1
1 1
[0246] TABLE-US-00021 TABLE 6D Analysis of V heavy chain subgroup 3
Frame work I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
1 1 12 1 3 1 B 1 1 1 C D 1 1 16 E 110 9 15 166 9 8 2 F 4 G 181 193
174 1 202 H 5 4 I 9 K 5 3 26 L 1 5 176 43 140 1 M 12 1 N 1 P 1 194
Q 41 138 1 3 12 162 R 6 4 S 178 2 8 T 1 V 5 147 1 118 62 195 W 1 X
Y Z 8 -- unknown (?) not sequenced 47 47 45 33 32 32 32 31 10 7 6 6
6 6 6 sum of seq.sup.2 165 165 167 179 180 180 180 181 202 205 206
206 206 206 206 oomcaa.sup.3 110 147 138 176 118 166 178 181 193
174 140 195 162 194 202 mcaa.sup.4 E V Q L V E S G G G L V Q P G
rel. oomcaa.sup.5 67% 89% 83% 98% 66% 92% 99% 100% 96% 85% 68% 95%
79% 94% 98% pos occupied.sup.6 5 4 7 4 5 4 3 1 2 5 3 4 7 4 4 Frame
work I amino acid.sup.1 16 17 18 19 20 21 22 23 24 25 26 27 28 29
30 A 183 192 1 B C 1 209 D 7 E 8 8 3 1 F 1 1 1 201 201 G 134 2 207
3 H 1 I 2 3 17 1 K 15 4 L 205 201 6 3 M 1 1 N 10 10 P 1 2 Q 1 R 62
191 11 S 206 207 4 2 209 15 174 T 4 1 2 4 4 1 163 V 8 7 9 1 6 W X Y
Z -- unknown (?) not sequenced 4 4 4 4 3 3 3 3 3 3 1 1 2 1 2 sum of
seq.sup.2 208 208 208 208 209 209 209 209 209 209 211 211 210 211
210 oomcaa.sup.3 134 206 205 191 201 207 209 183 192 209 207 201
163 201 174 mcaa.sup.4 G S L R L S C A A S G F T F S rel.
oomcaa.sup.5 64% 99% 99% 92% 96% 99% 100% 88% 92% 100% 98% 95% 78%
95% 83% pos occupied.sup.6 4 3 4 3 2 3 1 7 5 1 3 4 8 4 7 CDRI Frame
work II amino acid.sup.1 31 A B 32 33 34 35 36 37 38 39 40 41 42 43
A 1 17 80 1 1 187 1 B C 1 1 D 26 3 7 2 E 1 10 1 1 F 5 G 13 31 1 2
209 H 4 88 I 1 1 15 12 K 7 1 202 L 3 3 2 3 1 2 1 M 193 N 35 8 3 34
P 1 1 4 191 Q 209 1 1 R 7 207 7 8 S 103 17 8 72 3 14 T 9 15 10 4 5
V 2 7 1 197 2 W 30 212 X 1 Y 1 154 19 3 Z -- 210 210 unknown (?)
not sequenced 2 2 2 1 1 1 sum of seq.sup.2 210 210 210 210 210 212
212 212 211 211 211 212 212 212 212 oomcaa.sup.3 103 210 210 154 80
193 88 212 197 207 209 187 191 209 202 mcaa.sup.4 S -- -- Y A M H W
V R Q A P G K rel. oomcaa.sup.5 49% 100% 100% 73% 38% 91% 42% 100%
93% 98% 99% 88% 90% 99% 95% pos occupied.sup.6 14 1 1 9 10 4 9 1 3
3 3 9 5 4 4 Frame work II CDR II amino acid.sup.1 44 45 46 47 48 49
50 51 52 A B C 53 54 55 A 1 77 42 1 2 14 7 B 3 1 C 1 D 1 7 94 8 3 E
198 3 2 1 2 1 F 7 1 2 1 1 8 G 207 33 11 10 46 4 163 85 H 6 1 I 3 3
191 1 1 K 1 37 2 30 3 L 211 5 12 1 M 1 1 N 13 7 9 2 13 11 1 P 1 1 1
Q 7 7 10 R 1 24 1 17 5 1 2 16 S 3 1 102 11 9 118 43 1 74 17 82 T 3
5 4 2 13 12 3 3 V 3 204 49 2 1 6 W 210 1 8 6 X 4 3 Y 1 22 5 58 8 Z
-- 14 178 178 2 1 1 unknown (?) not sequenced sum of seq.sup.2 212
212 212 212 212 212 212 212 212 212 212 212 212 212 212
oomcaa.sup.3 207 211 198 210 204 102 49 191 118 58 178 178 94 163
85 mcaa.sup.4 G L E W V S V I S Y -- -- D G G rel. oomcaa.sup.5 98%
100% 93% 99% 96% 48% 23% 90% 56% 27% 84% 84% 44% 77% 40% pos
occupied.sup.6 4 2 5 3 3 3 15 9 11 19 5 5 12 9 12 CDR II Framework
III amino acid.sup.1 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 A
9 1 2 174 33 1 B 1 2 C D 11 17 160 E 8 3 2 1 2 F 1 3 2 207 G 5 1 5
4 5 212 1 H 1 4 I 3 37 2 8 14 208 K 1 61 199 8 L 1 1 1 1 1 1 M 8 2
1 N 51 4 2 2 P 1 1 6 8 18 1 Q 3 2 2 2 R 5 4 5 6 201 S 48 11 4 193 2
7 211 T 42 97 5 7 189 1 V 2 10 2 204 1 3 W 2 X 4 1 1 Y 9 151 210 1
1 1 Z -- unknown (?) not sequenced sum of seq.sup.2 212 212 212 212
212 212 212 212 212 212 212 212 212 212 212 oomcaa.sup.3 51 97 151
210 174 160 193 204 199 212 201 207 189 208 211 mcaa.sup.4 N T Y Y
A D S V K G R F T I S rel. oomcaa.sup.5 24% 46% 71% 99% 82% 75% 91%
96% 94% 100% 95% 98% 89% 98% 100% pos occupied.sup.6 19 12 15 2 9 8
3 2 6 1 4 5 5 3 2 Framework III amino acid.sup.1 71 72 73 74 75 76
77 78 79 80 81 82 A B C A 57 1 8 1 B 2 C D 199 38 2 2 1 10 E 6 4 5
F 13 G 1 4 H 1 1 2 2 I 1 2 2 3 1 1 K 186 6 3 L 188 209 3 1 212 M 1
2 10 3 2 205 N 5 170 2 188 3 181 10 P 1 Q 7 199 R 211 1 1 2 8 S 153
8 10 56 3 6 186 T 142 1 4 2 V 1 11 1 1 W X 2 2 4 1 Y 194 Z --
unknown (?) not sequenced 1 1 sum of seq.sup.2 212 212 211 211 212
212 212 212 212 212 212 212 212 212 212 oomcaa.sup.3 211 199 170
153 186 188 142 188 194 209 199 205 181 186 212 mcaa.sup.4 R D N S
K N T L Y L Q M N S L rel. oomcaa.sup.5 100% 94% 81% 73% 88% 89%
67% 89% 92% 99% 94% 97% 85% 88% 100% pos occupied.sup.6 2 4 4 3 8 7
6 5 5 3 6 4 11 7 1 Framework III CDR III amino acid.sup.1 83 84 85
86 87 88 89 90 91 92 93 94 95 96 97 A 149 1 1 207 173 2 15 9 11 B C
1 210 5 2 1 D 5 15 209 2 54 7 6 E 1 190 11 2 11 F 1 15 1 9 6 G 1 1
6 4 1 2 8 34 26 35 H 1 1 3 11 I 8 2 4 15 10 K 30 60 4 3 5 L 18 1 6
11 7 M 2 1 6 1 N 1 1 2 20 4 3 P 9 1 3 4 29 10 Q 1 5 3 9 2 R 177 103
9 30 19 S 1 1 3 9 8 11 T 3 28 207 1 25 15 7 6 20 V 9 187 10 1 7 7
15
W 1 3 4 3 X 1 Y 211 194 12 9 8 Z -- 1 3 4 unknown (?) not sequenced
1 1 1 1 1 1 1 1 7 12 13 sum of seq.sup.2 212 212 212 212 211 211
211 211 211 211 211 211 205 200 199 oomcaa.sup.3 177 149 190 209
207 207 187 211 194 210 173 103 54 30 35 mcaa.sup.4 R A E D T A V Y
Y C A R D R G rel. oomcaa.sup.5 83% 70% 90% 99% 98% 98% 89% 100%
92% 100% 82% 49% 26% 15% 18% pos occupied.sup.6 5 10 4 4 4 2 7 1 4
2 5 14 18 20 21 CDR III amino acid.sup.1 98 99 100 A B C D E F G H
I J K 101 A 7 13 7 9 6 2 3 5 5 9 13 2 B C 13 5 1 2 11 3 2 1 D 11 7
10 4 2 3 10 3 3 1 3 2 146 E 6 3 1 13 1 1 1 F 3 5 4 5 5 6 3 5 7 2 1
1 65 1 G 34 17 35 17 14 23 10 5 1 5 3 2 32 6 H 3 4 3 2 9 2 1 3 1 2
8 1 I 6 11 4 4 3 1 3 10 3 3 2 1 2 K 2 11 3 1 L 26 13 4 12 8 2 6 3
10 3 2 1 M 1 2 1 32 N 4 6 4 3 2 2 6 2 5 2 P 6 5 5 6 9 8 2 3 2 1 3 9
Q 4 1 1 1 1 1 1 R 4 10 9 7 5 5 2 3 1 1 2 4 S 16 28 27 25 24 8 11 9
3 2 3 1 1 1 T 6 12 9 17 17 1 2 5 1 9 3 1 V 13 7 15 4 3 6 2 12 1 1 1
1 W 6 5 6 7 2 4 1 6 10 X 1 1 Y 16 14 17 5 8 18 20 13 20 25 28 32 28
Z -- 12 21 35 54 73 87 102 110 126 135 134 120 91 71 21 unknown (?)
3 2 1 1 3 2 not sequenced 14 14 14 14 15 19 21 22 23 23 23 25 25 26
25 sum of seq.sup.2 198 198 198 197 196 192 190 189 188 188 188 186
186 185 186 oomcaa.sup.3 34 28 35 54 73 87 102 110 126 135 134 120
91 71 146 mcaa.sup.4 G S G -- -- -- -- -- -- -- -- -- -- -- D rel.
oomcaa.sup.5 17% 14% 18% 27% 37% 45% 54% 58% 67% 72% 71% 65% 49%
38% 78% pos occupied.sup.6 20 20 19 20 19 20 17 14 14 12 12 13 12 8
11 Framework IV amino acid.sup.1 102 103 104 105 106 107 108 109
110 111 112 113 sum A 1 1 2 1767 B 1 13 C 470 D 2 1121 E 1 832 F 2
807 G 140 130 1 2743 H 4 179 I 15 1 1 651 K 13 933 L 10 1 91 2 1881
M 6 496 N 1 1 844 P 17 1 1 568 Q 111 949 R 8 1413 S 7 1 118 110
3009 T 123 27 122 1 1426 V 34 1 1 125 119 1851 W 158 686 X 26 Y 82
1598 Z 8 -- 9 2 2 2 2 2 2 2 2 2 1 1 2023 unknown (?) 12 not
sequenced 27 50 67 75 78 81 83 84 86 89 92 97 1650 sum of seq.sup.2
184 161 144 136 133 130 128 127 125 122 119 114 oomcaa.sup.3 82 158
140 111 130 123 91 125 122 119 118 110 mcaa.sup.4 Y W G Q G T L V T
V S S rel. oomcaa.sup.5 45% 98% 97% 82% 98% 95% 71% 98% 98% 98% 99%
96% pos occupied.sup.6 12 3 4 6 3 6 6 2 3 3 2 4
[0247] TABLE-US-00022 TABLE 6E Analysis of V heavy chain subgroup 4
Frame work I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
19 1 B C D E 32 F G 54 1 53 H 4 2 I K 1 54 L 7 54 53 19 1 M N P 33
51 1 Q 52 50 51 20 R 1 S 33 52 T 1 V 47 1 34 W 20 X Y Z 1 --
unknown (?) not sequenced 3 3 3 3 4 4 4 3 3 4 4 3 3 4 4 sum of
seq.sup.2 54 54 54 54 53 53 53 54 54 53 53 54 54 53 53 oomcaa.sup.3
52 47 50 54 51 32 33 54 33 53 53 34 54 51 52 mcaa.sup.4 Q V Q L Q E
S G P G L V K P S rel. oomcaa.sup.5 96% 87% 93% 100% 96% 60% 62%
100% 61% 100% 100% 63% 100% 96% 98% pos occupied.sup.6 3 2 2 1 2 3
2 1 4 1 1 3 1 3 2 Frame work I amino acid.sup.1 16 17 18 19 20 21
22 23 24 25 26 27 28 29 30 A 1 1 22 B C 53 D 1 E 44 F 1 22 G 2 53
53 H 1 I 1 1 32 K 1 L 53 50 M N 1 P 2 3 Q 7 R 1 3 S 52 2 35 51 1 52
T 52 53 29 V 1 55 1 1 W X Y 19 1 Z -- unknown (?) not sequenced 4 4
4 3 4 4 4 2 2 2 2 2 2 1 1 sum of seq.sup.2 53 53 53 54 53 53 53 55
55 55 55 55 55 56 56 oomcaa.sup.3 44 52 53 52 50 53 53 29 55 35 53
53 51 32 52 mcaa.sup.4 E T L S L T C T V S G G S I S rel.
oomcaa.sup.5 83% 98% 100% 96% 94% 100% 100% 53% 100% 64% 96% 96%
93% 57% 93% pos occupied.sup.6 3 2 1 3 3 1 1 5 1 3 3 3 3 4 3 CDRI
Frame work II amino acid.sup.1 31 A B 32 33 34 35 36 37 38 39 40 41
42 43 A 1 8 1 B C 1 D 4 1 1 1 1 E 1 F 1 1 1 G 21 3 4 8 55 H 2 2 I
51 K 54 L 1 1 M N 1 2 2 1 P 50 49 Q 1 56 R 2 1 57 3 S 25 5 9 1 44 1
3 T 2 1 3 1 1 V 3 W 1 2 56 57 X Y 48 52 Z -- 45 39 unknown (?) not
sequenced 1 1 1 1 sum of seq.sup.2 56 56 56 56 56 56 57 57 57 57 57
57 57 57 57 oomcaa.sup.3 25 45 39 48 52 56 44 57 51 57 56 50 49 55
54 mcaa.sup.4 S -- -- Y Y W S W I R Q P P G K rel. oomcaa.sup.5 45%
80% 70% 86% 93% 100% 77% 100% 89% 100% 98% 88% 86% 96% 95% pos
occupied.sup.6 7 6 6 7 4 1 5 1 5 1 2 5 2 3 2 Frame work II CDR II
amino acid.sup.1 44 45 46 47 48 49 50 51 52 A B C 53 54 55 A 1 B C
D 1 1 E 56 22 F 1 1 G 55 56 1 1 57 H 24 I 54 1 54 K L 55 2 M N 21 P
2 Q 1 1 R 2 9 1 S 7 1 52 T 8 5 V 1 3 W 56 X Y 1 15 32 23 Z -- 57 57
57 unknown (?) not sequenced sum of seq.sup.2 57 57 57 57 57 57 57
57 57 57 57 57 57 57 57 oomcaa.sup.3 55 55 56 56 54 56 22 54 32 57
57 57 24 52 57 mcaa.sup.4 G L E W I G E I Y -- -- -- H S G rel.
oomcaa.sup.5 96% 96% 98% 98% 95% 98% 39% 95% 56% 100% 100% 100% 42%
91% 100% pos occupied.sup.6 2 2 2 2 3 2 8 2 6 1 1 1 5 2 1 CDR II
Framework III amino acid.sup.1 56 57 58 59 60 61 62 63 64 65 66 67
68 69 70 A 1 1 1 B C D 2 1 E F 3 G 1 1 H 2 I 1 1 1 1 48 K 1 53 L 1
55 1 M 7 N 2 40 53 2 P 54 1 Q R 2 3 56 S 49 1 2 56 56 1 56 T 1 54 1
1 1 51 1 V 1 1 53 2 W X Y 11 54 Z -- unknown (?) not sequenced 1 1
1 1 1 1 sum of seq.sup.2 57 57 57 57 56 56 56 56 57 57 57 56 56 57
57 oomcaa.sup.3 49 54 40 54 53 54 56 55 53 56 56 53 51 48 56
mcaa.sup.4 S T N Y N P S L K S R V T I S rel. oomcaa.sup.5 86% 95%
70% 95% 95% 96% 100% 98% 93% 98% 98% 95% 91% 84% 98% pos
occupied.sup.6 7 4 6 2 3 3 1 2 3 2 2 4 5 3 2 Framework III amino
acid.sup.1 71 72 73 74 75 76 77 78 79 80 81 82 A B C A 1 1 B C D 55
1 E 1 1 F 1 54 1 G 1 H I 3 1 1 K 1 51 3 46 2 L 3 1 3 1 55 53 2 M 2
1 1 1 N 1 54 3 3 1 P Q 1 54 1 1 R 2 2 2 S 1 57 1 57 2 1 44 55 T 52
1 4 V 50 1 2 54 W X Y Z -- unknown (?) not sequenced sum of
seq.sup.2 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 oomcaa.sup.3
50 55 52 57 51 54 54 54 57 55 46 53 44 55 54 mcaa.sup.4 V D T S K N
Q F S L K L S S V rel. oomcaa.sup.5 88% 96% 91% 100% 89% 95% 95%
95% 100% 96% 81% 93% 77% 96% 95% pos occupied.sup.6 4 3 5 1 6 2 2 4
1 3 8 4 7 3 3 Framework III CDR III amino acid.sup.1 83 84 85 86 87
88 89 90 91 92 93 94 95 96 97 A 55 57 57 56 3 3 3 B C 57 1 D 57 6 5
E 6 1 1 F 4 1 G 25 9 10 H 1 I 3 1 K 2 1 L 1 2 6 7 M 1 1 4 N 3 P 4 5
Q 1 R 1 54 4 12 2 S 1 2 1 1 1 4 8 T 53 55 1 1 2 1 V 1 55 1 1 4 2 2
W 1 2 1 X Y 57 56 1 4 Z -- unknown (?)
not sequenced 1 1 1 sum of seq.sup.2 57 57 57 57 57 57 57 57 57 57
57 57 56 56 56 oomcaa.sup.3 53 55 57 57 55 57 55 57 56 57 56 54 25
12 10 mcaa.sup.4 T A A D T A V Y Y C A R G R G rel. oomcaa.sup.5
93% 96% 100% 100% 96% 100% 96% 100% 98% 100% 98% 96% 45% 21% 18%
pos occupied.sup.6 3 3 1 1 2 1 3 1 2 1 2 4 12 16 16 CDR III amino
acid.sup.1 98 99 100 A B C D E F G H I J K 101 A 2 5 4 2 2 4 2 1 1
1 12 B C 1 D 5 5 4 3 2 4 3 1 1 2 1 41 E 2 1 1 3 1 2 1 F 1 2 3 2 2 1
1 31 G 8 10 11 4 7 7 6 1 1 1 2 1 9 H 1 1 1 2 I 2 4 1 3 2 3 1 1 K 2
2 1 L 3 5 3 2 4 1 5 3 3 1 M 3 1 2 1 9 N 2 1 1 5 1 1 2 P 3 1 1 2 1 1
1 2 3 1 2 1 Q 1 1 1 1 3 1 R 5 5 3 2 3 1 2 2 1 S 8 1 2 5 7 4 2 1 1 1
T 3 4 4 3 3 1 1 1 V 5 4 4 7 3 1 2 1 W 2 2 4 5 1 1 2 2 1 3 2 X Y 5 3
6 4 2 3 4 8 4 8 3 5 8 2 Z -- 1 2 4 6 9 11 16 23 27 29 34 31 14 4
unknown (?) 1 1 1 1 not sequenced 1 1 2 3 3 6 7 8 9 9 10 11 11 11
11 sum of seq.sup.2 56 56 55 54 54 51 50 49 48 48 47 46 46 46 46
oomcaa.sup.3 8 10 11 7 9 11 16 23 27 29 34 31 14 31 41 mcaa.sup.4 G
G G V -- -- -- -- -- -- -- -- -- F D rel. oomcaa.sup.5 14% 18% 20%
13% 17% 22% 32% 47% 56% 60% 72% 67% 30% 67% 89% pos occupied.sup.6
16 16 16 16 18 18 13 15 13 10 9 8 5 4 4 Framework IV amino
acid.sup.1 102 103 104 105 106 107 108 109 110 111 112 113 sum A 1
1 332 B C 113 D 210 E 176 F 135 G 41 40 1 674 H 1 1 45 I 9 1 282 K
3 278 L 4 19 540 M 9 43 N 1 204 P 3 2 2 281 Q 29 334 R 1 4 1 250 S
1 1 36 33 986 T 1 33 8 34 532 V 12 36 36 488 W 46 267 X Y 16 455 Z
1 -- 466 unknown (?) 4 not sequenced 10 11 16 17 17 20 20 21 21 21
21 22 426 sum of seq.sup.2 47 46 41 40 40 37 37 36 36 36 36 35
oomcaa.sup.3 16 46 41 29 40 33 19 36 34 36 36 33 mcaa.sup.4 Y W G Q
G T L V T V S S rel. oomcaa.sup.5 34% 100% 100% 73% 100% 89% 51%
100% 94% 100% 100% 94% pos occupied.sup.6 8 1 1 6 1 5 4 1 3 1 1
2
[0248] TABLE-US-00023 TABLE 6F Analysis of V heavy chain subgroup 5
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
1 1 89 1 1 B C 1 D 2 E 88 1 2 4 93 F G 1 92 94 H I K 94 94 L 1 91 2
M 3 N P 1 1 94 Q 3 92 1 90 R 1 1 1 1 S 92 T V 90 89 1 91 W X Y Z --
unknown (?) not sequenced 5 5 5 5 4 4 4 4 2 2 2 2 2 2 2 sum of
seq.sup.2 92 92 92 92 93 93 93 93 95 95 95 95 95 95 95 oomcaa.sup.3
88 90 92 91 89 90 92 92 89 93 91 94 94 94 94 mcaa.sup.4 E V Q L V Q
S G A E V K K P G rel. oomcaa.sup.5 96% 98% 100% 99% 96% 97% 99%
99% 94% 98% 96% 99% 99% 99% 99% pos occupied.sup.6 3 3 1 2 4 3 2 2
4 2 3 2 2 2 2 Framework I amino acid.sup.1 16 17 18 19 20 21 22 23
24 25 26 27 28 29 30 A 3 2 4 B C 96 1 D 2 E 92 2 F 1 3 6 97 G 92 93
H I 96 4 K 77 89 1 L 95 M 1 1 N 1 2 4 P 1 Q 3 1 4 R 17 1 1 2 S 94
94 1 90 84 10 T 2 5 75 V W X Y 90 Z -- unknown (?) not sequenced 2
2 2 1 1 1 1 1 1 1 1 1 sum of seq.sup.2 95 95 95 96 96 96 96 96 96
96 96 96 97 97 97 oomcaa.sup.3 92 94 95 77 96 94 96 89 92 90 93 90
84 97 75 mcaa.sup.4 E S L K I S C K G S G Y S F T rel. oomcaa.sup.5
97% 99% 100% 80% 100% 98% 100% 93% 96% 94% 97% 94% 87% 100% 77% pos
occupied.sup.6 2 2 1 4 1 2 1 5 3 4 3 2 7 1 5 CDRI Framework II
amino acid.sup.1 31 A B 32 33 34 35 36 37 38 39 40 41 42 43 A 8 1 1
B C 1 D 2 1 E 1 3 F 2 G 1 72 97 H 1 4 1 I 93 K 1 94 L 1 2 M 1 1 92
N 14 2 P 1 96 Q 97 R 1 95 1 S 61 2 2 15 T 16 2 1 1 V 1 93 2 W 93 97
X Y 87 Z -- 97 97 unknown (?) not sequenced sum of seq.sup.2 97 97
97 97 97 97 97 97 97 97 97 97 97 97 97 oomcaa.sup.3 61 97 97 87 93
93 72 97 93 95 97 92 96 97 94 mcaa.sup.4 S -- -- Y W I G W V R Q M
P G K rel. oomcaa.sup.5 63% 100% 100% 90% 96% 96% 74% 100% 96% 98%
100% 95% 99% 100% 97% pos occupied.sup. 6 8 1 1 5 4 4 5 1 4 3 1 5 2
1 2 Framework II CDR II amino acid.sup.1 44 45 46 47 48 49 50 51 52
A B C 53 54 55 A 1 1 2 1 B C 1 1 D 14 8 93 E 97 2 F 1 2 G 96 95 69
1 H 3 1 I 1 75 92 K L 94 2 2 1 M 89 1 N P 2 1 93 1 Q 1 R 1 14 1 S 1
1 16 96 T 3 1 1 V 5 1 1 2 W 94 X Y 3 76 Z -- unknown (?) not
sequenced sum of seq.sup.2 97 97 97 97 97 97 97 97 97 97 97 97 97
97 97 oomcaa.sup.3 96 94 97 94 89 95 75 92 76 93 97 97 69 93 96
mcaa.sup.4 G L E W M G I I Y P -- -- G D S rel. oomcaa.sup.5 99%
97% 100% 97% 92% 98% 77% 95% 78% 96% 100% 100% 71% 96% 99% pos
occupied.sup.6 2 3 1 2 4 3 7 5 6 5 1 1 6 4 2 CDR II Framework III
amino acid.sup.1 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 A 6 1
B C 1 1 D 77 2 E 3 2 F 2 91 1 3 G 1 94 H 15 I 4 1 1 3 88 K 2 L 1 4
2 M 3 N 2 14 2 P 95 1 1 Q 91 81 R 78 3 1 1 S 2 2 95 1 95 1 1 95 T
85 2 1 96 V 1 93 2 W X Y 12 92 Z -- unknown (?) not sequenced sum
of seq.sup.2 97 97 97 97 97 97 97 97 97 97 97 97 97 97 97
oomcaa.sup.3 77 85 78 92 95 95 95 91 91 94 81 93 96 88 95
mcaa.sup.4 D T R Y S P S F Q G Q V T I S rel. oomcaa.sup.5 79% 88%
80% 95% 98% 98% 98% 94% 94% 97% 84% 96% 99% 91% 98% pos
occupied.sup.6 6 4 5 4 3 3 3 4 4 3 3 3 2 5 2 Framework III amino
acid.sup.1 71 72 73 74 75 76 77 78 79 80 81 82 A B C A 88 1 91 B C
1 D 97 1 E 2 1 F 1 G 3 1 H 3 I 91 K 93 L 96 97 M 1 N 7 2 2 P 1 1 Q
1 93 R 1 1 1 1 3 S 96 1 87 2 1 1 90 91 T 4 2 94 2 1 V 9 2 1 W 95 X
Y 94 Z -- unknown (?) not sequenced sum of seq.sup.2 97 97 97 97 97
97 97 97 97 97 97 97 97 97 97 oomcaa.sup.3 88 97 93 96 91 87 94 91
94 96 93 95 90 91 97 mcaa.sup.4 A D K S I S T A Y L Q W S S L rel.
oomcaa.sup.5 91% 100% 96% 99% 94% 90% 97% 94% 97% 99% 96% 98% 93%
94% 100% pos occupied.sup.6 2 1 4 2 4 4 3 5 4 2 3 3 5 4 1 Framework
III CDR III amino acid.sup.1 83 84 85 86 87 88 89 90 91 92 93 94 95
96 97 A 1 96 93 92 1 1 2 B C 95 D 96 3 3 E 1 1 1 1 F 2 6 1 G 4 1 9
11 H 10 1 I 2 9 3 K 91 1 1 1 1 L 2 11 2 3 M 84 2 N 2 1 P 5 1 4 Q 1
3 2 R 3 92 7 9 2 S 96 5 1 1 3 2 T 1 1 1 88 1 1 1 3 2 V 1 2 2 4 4 W
1 2 X Y 94 89 1 6 Z -- Unknown (?)
not sequenced 1 2 2 2 2 52 52 52 sum of seq.sup.2 97 97 97 97 97 97
97 96 95 95 95 95 45 45 45 oomcaa.sup.3 91 96 96 96 88 93 84 94 89
95 92 92 11 9 11 mcaa.sup.4 K A S D T A M Y Y C A R L G G rel.
oomcaa.sup.5 94% 99% 99% 99% 91% 96% 87% 98% 94% 100% 97% 97% 24%
20% 24% pos occupied.sup.6 5 2 2 2 4 2 5 2 2 1 3 4 13 16 14 CDR III
amino acid.sup.1 98 99 100 A B C D E F G H I J K 101 A 3 4 3 2 1 1
4 2 B C 1 1 1 2 1 D 3 3 1 2 1 1 2 2 1 1 2 37 E 2 1 1 1 1 F 3 3 2 1
26 G 12 12 5 2 4 3 10 2 1 5 H 2 1 1 1 I 2 2 1 1 4 1 1 1 1 K 1 3 1 2
L 1 1 2 5 1 1 1 M 1 1 1 1 1 1 10 N 2 1 1 2 1 2 P 3 1 2 1 1 1 1 Q 1
1 4 2 1 2 3 R 2 2 1 2 S 6 4 4 5 3 5 3 2 2 1 1 T 1 2 6 3 3 6 1 1 V 1
1 2 1 W 1 1 2 1 1 1 X Y 3 6 9 8 7 2 1 2 6 8 9 9 10 1 Z -- 1 1 2 8
10 16 23 30 30 31 32 30 22 7 2 Unknown (?) 1 1 1 1 not sequenced 52
52 52 52 52 52 52 52 52 52 52 52 52 53 52 sum of seq.sup.2 45 45 45
45 45 45 45 45 45 45 45 45 45 44 45 oomcaa.sup.3 12 12 9 8 10 16 23
30 30 31 32 30 22 26 37 mcaa.sup.4 G G Y Y -- -- -- -- -- -- -- --
-- F D rel. oomcaa.sup.5 27% 27% 20% 18% 22% 36% 51% 67% 67% 69%
71% 67% 49% 59% 82% pos occupied.sup.6 18 16 15 16 15 14 11 11 9 8
4 6 6 4 5 Framework IV amino acid.sup.1 102 103 104 105 106 107 108
109 110 111 112 113 sum A 1 611 B C 205 D 1 458 E 1 404 F 2 256 G
41 41 1065 H 44 I 9 2 588 K 3 650 L 2 25 1 549 M 8 303 N 64 P 2 1 1
414 Q 34 612 R 3 S 2 40 39 1545 T 1 40 8 39 604 V 11 40 41 594 W 43
432 X Y 13 738 Z -- 2 635 unknown (?) 4 not sequenced 52 54 56 56
56 56 56 56 56 56 56 57 1678 sum of seq.sup.2 45 43 41 41 41 41 41
41 41 41 41 40 oomcaa.sup.3 13 43 41 34 41 40 25 40 39 41 40 39
mcaa.sup.4 Y W G Q G T L V T V S S rel. oomcaa.sup.5 29% 100% 100%
83% 100% 98% 61% 98% 95% 100% 98% 98% pos occupied.sup.6 10 1 1 4 1
2 3 2 2 1 2 2
[0249] TABLE-US-00024 TABLE 6G Analysis of V heavy chain subgroup 6
Framework I amino acid.sup.1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 A
B C D E F G 52 67 H I K 68 L 52 68 1 M N P 68 67 Q 52 52 51 52 R 1
1 S 52 1 68 T V 52 66 W X Y Z -- unknown (?) not sequenced 22 22 22
22 22 22 22 22 6 6 6 6 6 6 6 sum of seq.sup.2 52 52 52 52 52 52 52
52 68 68 68 68 68 68 68 oomcaa.sup.3 52 52 52 52 51 52 52 52 68 67
68 66 68 67 68 mcaa.sup.4 Q V Q L Q Q S G P G L V K P S rel.
oomcaa.sup.5 100% 100% 100% 100% 98% 100% 100% 100% 100% 99% 100%
97% 100% 99% 100% pos occupied.sup.6 1 1 1 1 2 1 1 1 1 2 1 3 1 2 1
Framework I amino acid.sup.1 16 17 18 19 20 21 22 23 24 25 26 27 28
29 30 A 1 67 B C 68 D 68 E F 2 G 1 69 H I 64 K L 67 1 68 M N 1 P 1
Q 68 R S 66 1 1 69 69 68 T 68 67 V 1 1 4 70 W 1 X Y Z -- unknown
(?) not sequenced 6 6 6 6 6 5 5 5 5 5 5 5 5 4 4 sum of seq.sup.2 68
68 68 68 68 69 69 69 69 69 69 69 69 70 70 oomcaa.sup.3 68 68 67 66
68 67 68 67 64 69 69 68 69 70 68 mcaa.sup.4 Q T L S L T C A I S G D
S V S rel. ommcaa.sup.5 100% 100% 99% 97% 100% 97% 99% 97% 93% 100%
100% 99% 100% 100% 97% pos occupied.sup.6 1 1 2 3 1 3 2 3 3 1 1 2 1
1 2 CDRI Framework II amino acid.sup.1 31 A B 32 33 34 35 36 37 38
39 40 41 42 43 A 66 67 1 B C D 1 1 E F 1 1 1 G 3 1 2 H 1 I 2 1 70 K
3 1 1 L 1 M N 2 66 70 P 73 Q 72 R 2 1 74 73 S 66 67 3 1 74 1 73 T 2
1 4 1 V 6 2 W 74 74 X Y 1 1 Z -- unknown (?) 1 not sequenced sum of
seq.sup.2 74 74 74 74 74 74 74 74 74 74 74 74 74 74 74 oomcaa.sup.3
66 66 67 66 67 74 70 74 70 74 72 74 73 73 73 mcaa.sup.4 S N S A A W
N W I R Q S P S R rel. ommcaa.sup.5 89% 89% 91% 89% 91% 100% 95%
100% 95% 100% 97% 100% 99% 99% 99% pos occupied.sup.6 5 6 3 4 5 1 5
1 4 1 3 1 2 2 2 Framework II CDR II amino acid.sup.1 44 45 46 47 48
49 50 51 52 A B C 53 54 55 A 1 1 B C D E 74 F 2 1 1 G 74 74 1 1 H 1
I K 1 66 L 74 74 M N 1 P Q R 73 72 1 1 S 1 72 T 73 5 V W 74 73 X Y
72 72 Z -- 74 unknown (?) not sequenced sum of seq.sup. 2 74 74 74
74 74 74 74 74 74 74 74 74 74 74 74 oomcaa.sup.3 74 74 74 74 74 74
73 73 72 72 72 74 72 66 73 mcaa.sup.4 G L E W L G R T Y Y R -- S K
W rel. ommcaa.sup.5 100% 100% 100% 100% 100% 100% 99% 99% 97% 97%
97% 100% 97% 89% 99% pos occupied.sup.6 1 1 1 1 1 1 2 2 2 3 3 1 3 5
2 CDR II Framework III amino acid.sup.1 56 57 58 59 60 61 62 63 64
65 66 67 68 69 70 A 73 1 2 B C 1 D 68 1 2 E 1 3 7 1 F 7 G 1 1 8 H 1
I 1 65 2 71 K 1 67 1 L 1 5 2 4 M 1 N 2 65 1 1 69 P 1 1 Q 2 1 R 1 3
73 S 2 2 1 1 73 66 1 2 T 4 69 1 V 58 72 4 2 W X Y 60 1 72 Z --
unknown (?) not sequenced sum of seq.sup.2 74 74 74 74 74 74 74 74
74 74 74 74 74 74 74 oomcaa.sup.3 60 65 68 72 73 58 73 72 67 66 73
65 69 71 69 mcaa.sup.4 Y N D Y A V S V K S R I T I N rel.
ommcaa.sup.5 81% 88% 92% 97% 99% 78% 99% 97% 91% 89% 99% 88% 93%
96% 93% pos occupied.sup.6 7 6 5 3 2 7 2 2 5 2 2 4 4 3 4 Framework
III amino acid.sup.1 71 72 73 74 75 76 77 78 79 80 81 82 A B C A 6
1 B C D 73 3 E 2 F 71 1 G H 1 2 1 I 1 1 K 70 4 L 1 1 74 72 M 1 1 N
74 63 P 66 Q 72 71 R 1 1 1 S 1 73 74 1 73 T 71 1 2 1 V 1 2 1 73 W X
Y Z -- unknown (?) not sequenced sum of seq.sup.2 74 74 74 74 74 74
74 74 74 74 74 74 74 74 74 oomcaa.sup.3 66 73 71 73 70 74 72 71 74
74 71 72 63 73 73 mcaa.sup.4 P D T S K N Q F S L Q L N S V rel.
oomcaa.sup.5 89% 99% 96% 99% 95% 100% 97% 96% 100% 100% 96% 97% 85%
99% 99% pos occupied.sup.6 4 2 4 2 3 1 3 3 1 1 3 3 7 2 2 Framework
III CDR III amino acid.sup.1 83 84 85 86 87 88 89 90 91 92 93 94 95
96 97 A 1 74 69 11 1 3 B C 73 1 D 73 19 4 3 E 73 10 4 2 F 3 1 1 1 1
G 1 1 16 4 15 H 1 I 2 1 2 K 1 1 1 1 L 1 8 4 M 2 1 N 1 1 3 1 P 70 10
4 Q 1 1 1 R 1 69 1 7 8 S 1 3 3 5 5 5 T 73 74 1 1 1 4 V 70 3 1 4 5 1
W 1 6 8 X Y 73 70 6 4 Z -- 2 3 unknown (?)
not sequenced 1 1 2 sum of seq.sup.2 74 73 74 74 74 74 74 74 74 74
74 74 73 72 71 oomcaa.sup.3 73 70 73 73 74 74 70 73 70 73 69 69 19
10 15 mcaa.sup.4 T P E D T A V Y Y C A R D P G rel. oomcaa.sup.5
99% 96% 99% 99% 100% 100% 95% 99% 95% 99% 93% 93% 26% 14% 21% pos
occupied.sup.6 2 2 2 2 1 1 3 2 3 2 4 4 14 20 19 CDR III amino
acid.sup.1 98 99 100 A B C D E F G H I J K 101 A 12 4 3 2 5 8 10 1
B C 1 1 1 1 D 7 4 3 1 6 1 1 1 62 E 1 2 2 1 2 1 F 1 2 3 2 1 38 4 G
15 11 8 6 2 5 1 8 6 1 17 H 1 1 1 1 1 1 1 1 I 2 5 1 K 1 1 1 1 L 2 3
2 1 1 5 8 M 1 5 11 N 2 1 1 1 3 2 1 1 3 P 5 3 5 1 1 Q 1 1 1 R 1 8 8
3 1 1 5 1 S 7 6 7 3 4 2 1 1 T 3 4 4 6 3 1 1 V 9 4 9 5 1 1 2 W 3 2 4
4 4 X Y 2 2 2 6 6 2 4 2 1 8 8 12 12 Z -- 7 14 23 25 33 41 47 53 54
57 56 50 28 12 4 unknown (?) 6 1 5 not sequenced 2 1 1 1 1 1 1 1 1
1 1 1 1 1 1 sum of seq.sup.2 71 72 72 72 72 72 72 72 72 72 72 72 72
72 72 oomcaa.sup.3 15 14 23 25 33 41 47 53 54 57 56 50 28 38 62
mcaa.sup.4 G -- -- -- -- -- -- -- -- -- -- -- -- F D rel.
oomcaa.sup.5 21% 19% 32% 35% 46% 57% 65% 74% 75% 79% 78% 69% 39%
53% 86% pos occupied.sup.6 15 17 16 16 13 13 11 8 8 4 5 7 6 6 5
Framework IV amino acid.sup.1 102 103 104 105 106 107 108 109 110
111 112 113 sum A 2 494 B C 147 D 1 403 E 186 F 2 2 150 G 49 50 571
H 2 18 I 9 3 1 304 K 1 1 293 L 5 26 632 M 8 31 N 436 P 4 6 1 387 Q
40 539 R 2 495 S 4 1 1 43 46 1271 T 45 4 45 640 V 21 2 46 48 647 W
65 5 398 X Y 19 518 Z -- 2 585 unknown (?) 13 not sequenced 5 8 23
24 23 24 25 25 28 25 28 26 580 sum of seq.sup.2 68 65 50 49 50 49
48 48 45 48 45 47 oomcaa.sup.3 21 65 49 40 50 45 26 46 45 48 43 46
mcaa.sup.4 V W G Q G T L V T V S S rel. oomcaa.sup.5 31% 100% 98%
82% 100% 92% 54% 96% 100% 100% 96% 98% pos occupied.sup.6 9 1 2 4 1
3 7 3 1 1 2 2
Appendix to Tables 1A-C
A. REFERENCES OF REARRANGED SEQUENCES
REFERENCES OF REARRANGED HUMAN KAPPA SEQUENCES USED FOR
ALIGNMENT
[0250] 1 Alescio-Zonta, L. Baglioni, C. (1970) Eur. J. Biochem.,
15, 450-463. [0251] 2 Andrews, D. W. Capra, J. D. (1981)
Biochemistry, 20, 5816-5822. [0252] 3 Andris, J. S., Ehrlich, P.
H., Ostberg, L. Capra. J. D. (1992) J. Immunol., 149, 4053-4059.
[0253] 4 Atkinson, P. M., Lampman, G. W., Furie, B. C., Naparstek,
Y., Schwartz, R. S., Stollar, B. D. Furie, B. (1985) J. Clin.
Invest., 75, 1138-1143. [0254] 5 Aucouturier, P., Bauwens, M.,
Khamlichi, A. A., Denoroy, L. Spinelli, S., Touchard, G.,
Preud'homme, J.-L. Cogne, M. (1993) J. Immunol., 150, 3561-3568.
[0255] 6 Avila, M. A., Vazques, J., Danielsson, L., Fernandez De
Cossio, M. E. Borrebaeck, C. A. K. (1993) Gene, 127, 273-274.
[0256] 7 Barbas Iii, C. F., Crowe, Jr., J. E., Cababa, D., Jones,
T. M., Zebedee, S. L., Murphy, B. R., Chanock, R. M. Burton, D. R.
(1992) Proc. Natl. Acad. Sci. Usa, 89, 10164-10168. [0257] 8
Barbas, C. F., Iii, et al. (1993) J-Mol-Biol., 230, 812-23. [0258]
9 Bentley, D. L. Rabbitts, T. H. (1980) Nature, 288, 730-733.
[0259] 10 Bentley, D. L. Rabbitts, T. H. (1983) Cell, 32, 181-189.
[0260] 11 Bentley, D. L. (1984) Nature, 307, 77-80. [0261] 12 Bhat,
N. M., Bieber, M. M., Chapman, C. J., Stevenson, F. K. Teng, N. N.
H. (1993) J. Immunol., 151, 5011-5021. [0262] 13 Blaison, G.,
Kuntz, J.-L. Pasquali, J.-L. (1991) Eur. J. Immunol., 21,
1221-1227. [0263] 14 Braun, H., Leibold, W., Barnikol, H. U.
Hilschmann, N. (1971) Z. Physiol. Chem., 352, 647-651; (1972) Z.
Physiol. Chem., 353, 1284-1306. [0264] 15 Capra, J. D. Kehoe, J. M.
(1975) Adv. Immunology, 20, 1-40.; Andrews, D. W. Capra, J. D.
(1981) Proc. Nat. Acad. Sci. Usa, 78, 3799-3803. [0265] 16 Capra,
J. D. Kehoe, J. M. (1975) Adv. Immunology, 20, 1-40.; Ledford, D.
K., Goni, F., Pizzolato, M., Franklin, E. C., Solomon, A.
Frangione, B. (1983) J. Immunol., 131, 1322-1325. [0266] 17
Chastagner, P., Theze, J. Zouali, M. (1991) Gene, 101, 305-306.
[0267] 18 Chen. P. P., Robbins, D. L., Jirik, F. R., Kipps, T. J.
Carson, D. A. (1987) J. Exp. Med, 166, 1900-1905. [0268] 19 Chen,
P. P., Robbins, D. L., Jirik, F. R., Kipps, T. J. Carson, D. A.
(1987) J. Exp. Med, 166, 1900-1905; Liu, M.-F., Robbins, D. L.,
Crowley, J. J., Sinha, S., Kozin, F., Kipps, T. J., Carson, D. A.
Chen. P. P. (1989) J. Immunol., 142, 688-694. [0269] 20 Chersi, A.
Natali, P. G. (1978) Immunochemistry, 15, 585-589. [0270] 21 Co, M.
S., Deschamps, M., Whitley, R. J. Queen, C. (1991) Proc. Natl.
Acad. Sci. Usa, 88, 2869-2873. [0271] 22 Cuisinier, A.-M., Fumoux,
F., Fougereau, M. Tonnelle, C. (1992) Mol. Immunol., 29, 1363-1373.
[0272] 23 Davidson, A., Manheimer-Lory, A., Aranow, C., Peterson,
R., Hannigan, N. Diamond, B. (1990) J. Clin. Invest., 85,
1401-1409. [0273] 24 Denomme, G. A., Mahmoudi, M., Edwards, J. Y.,
Massicotte, H., Cairns, E. Bell, D. A. (1993) Hum. Antibod.
Hybridomas, 4, 98-103. [0274] 25 Dersimonian, H., Mcadam, K. P. W.
J., Mackworth-Young, C. Stollar, B. D. (1989) J. Immunol., 142,
4027-4033. [0275] 26 Dreyer, W. J., Gray, W. R. Hood, L. (1967)
Cold Spring Harbor Symp. Quantitative Biol., 32, 353-367. [0276] 27
Ebeling, S. B., Schutte, M. E. M. Logtenberg, T. (1993) Eur. J.
Immunol., 23, 1405-1408. [0277] 28 Eulitz, M. Kley, H.-P. (1977)
Immunochem., 14, 289-297. [0278] 29 Eulitz, M. Linke, R. P. (1982)
Z. Physiol. Chem., 363, 1347-1358. [0279] 30 Eulitz, M., Breuer,
M., Eblen, A., Weiss, D. T. Solomon, A. (1990) In Amyloid And
Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B.
Skogen, K. Sletten P. Westermark, Kluwer Academic [0280] 31 Eulitz,
M., Gotze, D. Hilschmann, N. (1972) Z. Physiol. Chem., 353,
487-491: Eulitz, M. Hilschmann, N. (1974) Z. Physiol. Chem., 355,
842-866. [0281] 32 Eulitz, M., Kley, H. P. Zeitler, H. J. (1979) Z.
Physiol. Chem., 360, 725-734. [0282] 33 Ezaki, I., Kanda, H.,
Sakai, K., Fukui, N., Shingu, M., Nobunaga, M. Watanabe, T. (1991)
Arthritis And Rheumatism, 34, 343-350. [0283] 34 Felgenhauer, M.,
Kohl, J. Ruker, F. (1990) Nucl. Acids Res., 18, 4927. [0284] 35
Ferri, G., Stoppini, M., Iadarola, P., Bellotti, V. Merlini, G.
(1989) Biochim. Biophys. Acta, 995, 103-108. [0285] 36 Gillies, S.
D., Dorai, H., Wesolowski, J., Majeau, G., Young, D., Boyd, J.,
Gardner, J. James, K. (1989) Bio/Tech., 7, 799-804. [0286] 37 Goni,
F. Frangione, B. (1983) Proc. Nat. Acad. Sci. Usa, 80, 4837-4841.
[0287] 38 Goni, F. R., Chen, P. P., Mcginnis, D., Arjonilla, M. L.,
Fernandez, J., Carson, D., Solomon, A., Mendez, E. Frangione, B.
(1989) J. Immunol., 142, 3158-3163. [0288] 39 Gorman, S. D., Clark,
M. R., Routledge, E. G., Cobbold, S. P. Waldmann, H. (1991) Proc.
Natl. Acad. Sci. Usa, 88, 4181-4185. [0289] 40 Gottlieb, P. D.,
Cunningham, B. A., Rutishauser, U. Edelman, G. M. (1970)
Biochemistry, 9, 3155-3161. [0290] 41 Griffiths, A. D., Malmqvist,
M., Marks, J. D., Bye, J. M., Embleton, M. J., Mccafferty, J.,
Baier, M., Holliger, K. P., Gorick, B. D., Hughes-Jones, N. C.,
Hoogenboom, H. R. Winter, G. (1993) Embo J., 12, 725-734. [0291] 42
Hieter, P. A., Max, E. E., Seidman, J. G., Maizel, J. V., Jr.
Leder, P. (1980) Cell, 22, 197-207; Klobeck, H. G, Meindl, A.,
Combriato, G., Solomon, A. Zachau, H. G. (1985) Nucl. Acids Res.,
13, 6499-6513; Weir, L. Leder, P. (1986) [0292] 43 Hilschmann, N.
Craig, L. C. (1965) Proc. Nat. Acad. Sci. Usa, 53, 1403-1409;
Hilschmann, N. (1967) Z. Physiol. Chem., 348, 1077-1080. [0293] 44
Hilschmann, N. Craig, L. C. (1965) Proc. Nat. Acad. Sci. Usa, 53,
1403-1409; Hilschmann, N. (1967) Z. Physiol. Chem., 348, 1718-1722;
Hilschmann, N. (1969) Naturwissenschaften, 56, 195-205. [0294] 45
Hirabayashi, Y., Munakata, Y., Sasaki, T. Sano, H. (1992) Nucl.
Acids Res., 20, 2601. [0295] 46 Jaenichen, H.-R., Pech, M.,
Lindenmaier, W., Wildgruber, N. Zachau, H. G. (1984) Nuc. Acids
Res., 12, 5249-5263. [0296] 47 Jirik, F. R., Sorge, J., Fong, S.,
Heitzmann, J. G., Curd, J. G., Chen, P. P., Goldfien, R. Carson, D.
A. (1986) Proc. Nat. Acad. Sci. Usa, 83, 2195-2199. [0297] 48
Kaplan, A. P. Metzger, H. (1969) Biochemistry, 8, 3944-3951.;
Klapper, D. G. Capra, J. D. (1976) Ann. Immunol. (Inst. Pasteur),
127c, 261-271. [0298] 49 Kennedy, M. A. (1991) J. Exp. Med., 173,
1033-1036. [0299] 50 Kim, H. S. Deutsch, H. F. (1988) Immunol., 64,
573-579. [0300] 51 Kipps, T. J., Tomhave, E., Chen, P. P. Carson,
D. A. (1988) J. Exp. Med., 167, 840-852. [0301] 52 Kipps, T. J.,
Tomhave, E., Chen, P. P. Fox, R. I. (1989) J. Immunol., 142,
4261-4268. [0302] 53 Klapper, D. G. Capra, J. D. (1976) Ann.
Immunol. (Inst. Pasteur), 127c, 261-271. [0303] 54 Klein, U.,
Kuppers, R. Rajewsky, K. (1993) Eur. J. Immunol., 23, 3272-3277.
[0304] 55 Klobeck, H. G, Meindl, A., Combriato, G., Solomon, A.
Zachau, H. G. (1985) Nucl. Acids Res., 13, 6499-6513. [0305] 56
Klobeck, H. G., Bornkammm, G. W., Combriato, G., Mocikat, R.,
Pohlenz, H. D. Zachau, H. G. (1985) Nucl. Acids Res., 13,
6515-6529. [0306] 57 Klobeck, H. G., Combriato, G. Zachau, H. G.
(1984) Nuc. Acids Res., 12, 6995-7006. [0307] 58 Klobeck, H. G.,
Solomon, A Zachau, H. G. (1984) Nature, 309, 73-76. [0308] 59
Knight, G. B., Agnello, V., Bonagura, V., Barnes, J. L., Panka, D.
J. Zhang, Q.-X. (1993) J. Exp. Med., 178, 1903-1911. [0309] 60
Kohler, H., Shimizu, A., Paul, C. Putnam, F. W. (1970) Science,
169, 56-59. (Kaplan, A. P. Metzger, H. (1969) Biochemistry, 8,
3944-3951.) [0310] 61 Kratzin, H., Yang, C. Y., Krusche, J. U.
Hilschmann, N. (1980) Z. Physiol. Chem., 361, 1591-1598. [0311] 62
Kunicki, T. J., Annis, D. S., Gorski, J. Nugent, D. J. (1991) J.
Autoimmunity, 4, 433-446. [0312] 63 Larrick, J. W., Wallace, E. F.,
Coloma, M. J., Bruderer, U., Lang, A. B. Fry, K. E. (1992)
Immunological Reviews, 130, 69-85. [0313] 64 Laure, C. J.,
Watanabe, S. Hilschmann, N. (1973) Z. Physiol. Chem., 354,
1503-1504. [0314] 65 Ledford, D. K., Goni, F., Pizzolato, M.,
Franklin, E. C., Solomon, A. Frangione, B. (1983) J. Immunol., 131,
1322-1325. [0315] 66 Ledford, D. K., Goni, F., Pizzolato, M.,
Franklin, E. C., Solomon, A. Frangione, B. (1983) J. Immunol., 131,
1322-1325. [0316] 67 Ledford, D. K., Goni, F., Pizzolato, M.,
Franklin, E. C., Solomon, A. Frangione, B. (1983) J. Immunol., 131,
1322-1325. Pons-Estel, B., Goni, F., Solomon, A. Frangione, B.
(1984) J. Exp. Med., 160, 893. [0317] 68 Levy, S., Mendel, E., Kon,
S., Avnur, Z. Levy, R. (1988) J. Exp. Med., 168, 475-489. [0318] 69
Liepnieks, J. J., Dwulet, F. E. Benson, M. D. (1990) Mol. Immunol.,
27, 481-485. [0319] 70 Manheimer-Lory, A., Katz, J. B., Pillinger,
M., Ghossein, C., Smith, A. Diamond, B. (1991) J. Exp. Med., 174,
1639-1652. [0320] 71 Mantovani, L., Wilder, R. L. Casali, P. (1993)
J. Immunol., 151, 473-488. [0321] 72 Mariette, X., Tsapis, A.
Brouet, J.-C. (1993) Eur. J. Immunol., 23, 846-851. [0322] 73
Marks, J. D., Hoogenboom, H. R., Bonnert, T. P., Mccafferty, J.,
Griffiths, A. D. Winter, G. (1991) J. Mol. Biol., 222, 581-597.
[0323] 74 Marsh, P., Mills, F. Gould, H. (1985) Nuc. Acids Res.,
13, 6531-6544. [0324] 75 Middaugh, C. R. Litman, G. W. (1987) J.
Biol. Chem., 262, 3671-3673. [0325] 76 Milstein, C. Deverson, E. V.
(1971) Biochem. J., 123, 945-958. [0326] 77 Milstein, C. (1969)
Febs Letters, 2, 301-304. [0327] 78 Milstein, C. (1969) Febs
Letters, 2, 301-304. [0328] 79 Milstein, C. P. Deverson, E. V.
(1974) Eur. J. Biochem., 49, 377-391. [0329] 80 Moran, M. J.,
Andris, J. S., Matsumato, Y.-I., Capra, J. D. Hersh, E. M. (1993)
Mol. Immunol., 30, 1543-1551. [0330] 81 Nakatani, T., Nomura, N.,
Horigome, K., Ohtsuka, H. Noguchi, H. (1989) BioTech., 7, 805-810.
[0331] 82 Newkirk, M., Chen, P. P., Carson, D., Posnett, D. Capra,
J. D. (1986) Mol. Immunol., 23, 239-244. [0332] 83 Newkirk, M. M.,
Gram, H., Heinrich, G. F., Ostberg, L., Capra. J. D. Wasserman, R.
L. (1988) J. Clin. Invest., 81, 1511-1518. [0333] 84 Newkirk, M.
M., Mageed, R. A., Jefferis, R., Chen, P. P. Capra, J. D. (1987) J.
Exp. Med., 166, 550-564. [0334] 85 Olee, B. T., Lu, E. W., Huang,
D.-F., Soto-Gil, R. W., Deftos, M., Kozin, F., Carson, D. A. Chen,
P. P. (1992) J. Exp. Med., 175, 831-842. [0335] 86 Palm, W.
Hilschmann, N. (1973) Z. Physiol. Chem., 354, 1651-1654: (1975) Z.
Physiol. Chem., 356, 167-191. [0336] 87 Pascual, V., Victor, K.,
Lelsz, D., Spellerberg, M. B., Hamblin, T. J., Thompson, K. M.,
Randen, I., Natvig, J., Capra, J. D. Stevenson, F. K. (1991) J.
Immunol., 146, 4385-4391. [0337] 88 Pascual, V., Victor, K.,
Randen, I., Thompson, K., Steinitz, M., Forre, O., Fu, S.-M.,
Natvig, J. B. Capra. J. D. (1992) Scand. J. Immunol., 36, 349-362.
[0338] 89 Pech, M. Zachau, H. G. (1984) Nuc. Acids Res., 12,
9229-9236. [0339] 90 Pech, M., Jaenichen, H.-R., Pohlenz, H.-D.,
Neumaier, P. S., Klobeck, H.-G. Zachau, H. G. (1984) J. Mol. Biol.,
176, 189-204. [0340] 91 Pons-Estel, B., Goni, F., Solomon, A.
Frangione, B. (1984) J. Exp. Med., 160, 893-904. [0341] 92
Portolano, S. Mclachlan, S. M. Rapoport, B. (1993) J. Immunol.,
151, 2839-2851. [0342] 93 Portolano, S., Seto, P., Chazenbalk, G.
D., Nagayama, Y., Mclachlan, S. M. Rapoport, B. (1991) Biochem.
Biophys. Res. Commun., 179, 372-377. [0343] 94 Pratt, L. F.,
Rassenti, L., Larrick. J., Robbins, B., Banks, P. M. Kipps, T. J.
(1989) J. Immunol., 143, 699-705. [0344] 95 Prelli, F., Tummolo,
D., Solomon, A. Frangione, B. (1986) J. Immunol., 136, 4169-4173.
[0345] 96 Putnam, F. W., Whitley, E. J., Jr., Paul, C. Davidson, J.
N. (1973) Biochemistry, 12, 3763-3780. [0346] 97 Randen, I.,
Pascual, V., Victor, K., Thompson, K. M., Forre, O., Capra, J. D.
Natvig, J. B. (1993) Eur. J. Immunol., 23, 1220-1225. [0347] 98
Rassenti, L. Z., Pratt, L. F., Chen, P. P., Carson, D. A. Kipps, T.
J. (1991) J. Immunol., 147, 1060-1066. [0348] 99 Reidl, L. S.,
Friedman, D. F., Goldman, J., Hardy, R. R., Jefferies, L. C.
Silberstein, L. E. (1991) J. Immunol., 147, 3623-3631. [0349] 100
Riechmann, L., Clark, M., Waldmann, H. Winter, G. (1988) Nature,
332,323-327. [0350] 101 Riesen, W., Rudikoff, S., Oriol, R. Potter,
M. (1975) Biochemistry, 14, 1052-1057; Riesen, W. F., Braun, D. G.
Jaton, J. C. (1976) Proc. Nat. Acad. Sci. Usa, 73, 2096-2100;
Riesen, W. F. Jaton, J. C. (1976) Biochemistry, 15, 3829. [0351]
102 Rodilla Sala, E., Kratzin, D. H., Pick, A. I. Hilschmann, N.
(1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G.
Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kiuwer
Academic [0352] 103 Schiechl, H. Hilschmann, N. (1971) Z. Physiol.
Chem., 352, 111-115; (1972) Z. Physiol. Chem., 353, 345-370. [0353]
104 Schneider, M. Hilschmann, N. (1974) Z. Physiol. Chem., 355,
1164-1168. [0354] 105 Shearman, C. W., Pollock, D., White, G.,
Hehir, K., Moore, G. P., Kanzy, E. J. Kurrle, R. (1991) J.
Immunol., 147, 4366-4373. [0355] 106 Shinoda, T. (1973) J.
Biochem., 73, 433-446. [0356] 107 Shinoda, T. (1975) J. Biochem.,
77, 1277-1296. [0357] 108 Shinoda, T., Takenawa, T.; Hoshi, A.
Isobe, T. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O.
Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark,
Kluwer Academic Publishers, Dordrecht/Boston/London, Pp. 157-
[0358] 109 Silberstein, L. E., Litwin, S. Carmack, C. E. (1989) J.
Exp. Med., 169, 1631-1643. [0359] 110 Sims, M. J., Hassal, D. G.,
Brett, S., Rowan. W., Lockyer, M. J., Angel, A., Lewis, A. P.,
Hale, G., Waldmann, H. Crowe, J. S. (1993) J. Immunol., 151,
2296-2308. [0360] 111 Spatz, L. A., Wong, K. K., Williams, M.,
Desai, R., Golier, J., Berman, J. E., Alt, F. W. Latov, N. (1990)
J. Immunol., 144, 2821-2828. [0361] 112 Stavnezer, J., Kekish, O.
Batter, D., Grenier, J., Balazs, I., Henderson, E. Zegers, B. J. M.
(1985) Nucl. Acids Res., 13, 3495-3514. [0362] 113 Straubinger, B.,
Thiebe, R., Pech, M. Zachau, H. G. (1988) Gene, 69, 209-214. [0363]
114 Suter, L., Barnikol, H. U., Watanabe, S. Hilschmann. N. (1969)
Z. Physiol. Chem., 350, 275-278; (1972) Z. Physiol. Chem., 353,
189-208. [0364] 115 Tempest, P. R., Bremner, P., Lambert, M.,
Taylor, G., Furze, J. M., Carr, F. J. Harris, W. J. (1991)
Bio/Tech., 9, 266-271. [0365] 116 Titani, K., Shinoda, T. Putnam,
F. W. (1969) J. Biol. Chem., 244, 3550-3560. [0366] 117 Toft, K.
G., Olstad, O. K., Sletten, K. Westermark, P. (1990) In Amyloid And
Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B.
Skogen, K. Sletten P. Westermark, Kluwer Academic [0367] 118 Van
Es, J. H., Aanstoot, H., Gmelig-Meyling, F. H. J., Derksen, R. H.
W. M. Logtenberg, T. (1992) J. Immunol., 149, 2234-2240. [0368] 119
Victor, K. D., Pascual, V., Lefvert, A. K. Capra, J. D. (1992) Mol.
Immunol., 29, 1501-1506. [0369] 120 Victor, K. D., Pascual, V.,
Williams, C. L., Lennon, V. A. Capra, J. D. (1992) Eur. J.
Immunol., 22, 2231-2236. [0370] 121 Victor, K. D., Randen, I.,
Thompson, K., Forre, O., Natvig, J. B., Fu, S. M.
Capra, J. D. (1991) J. Clin. Invest, 87, 1603-1613. [0371] 122
Wagner, S. D. Luzzatto, L. (1993) Eur. J. Immunol., 23, 391-397.
[0372] 123 Watanabe, S. Hilschmann, N. (1970) Z. Physiol. Chem.,
351, 1291-1295. [0373] 124 Weisbart, R. H., Wong, A. L., Noritake,
D., Kacena, A., Chan, G., Ruland, C., Chin, E., Chen, I. S. Y.
Rosenblatt, J. D. (1991) J. Immunol., 147, 2795-2801. [0374] 125
Weng, N.-P., Yu-Lee, L.-Y., Sanz, I., Patten, B. M. Marcus, D. M.
(1992) J. Immunol., 149, 2518-2529. [0375] 126 Winkler, T. H.,
Fehr, H. Kalden, J. R. (1992) Eur. J. Immunol., 22, 1719-1728.
REFERENCES OF REARRANGED HUMAN LAMBDA SEQUENCES USED FOR
ALIGNMENT
[0375] [0376] 1 Alexandre, D., Chuchana, P., Brockly, F., Blancher,
A., Lefranc, G. Lefranc, M.-P. (1989) Nuc. Acids Res., 17, 3975.
[0377] 2 Anderson, M. L. M., Brown, L., Mckenzie, E., Kellow, J. E.
Young, B. D. (1985) Nuc. Acids Res., 13, 2931-2941. [0378] 3
Andris, J. S., Brodeur, B. R. Capra. J. D. (1993) Mol. Immunol.,
30, 1601-1616. [0379] 4 Andris, J. S., Ehrlich, P. H., Ostberg, L.
Capra, J. D. (1992) J. Immunol., 149, 4053-4059. [0380] 5 Baczko,
K., Braun, D. G., Hess, M. Hilschmann, N. (1970) Z. Physiol. Chem.,
351, 763-767; Baczko, K., Braun, D. G. Hilschmann, N. (1974) Z.
Physiol. Chem., 355, 131-154. [0381] 6 Berinstein, N., Levy, S.
Levy. R. (1989) Science, 244, 337-339. [0382] 7 Bhat, N. M.,
Bieber, M. M., Chapman, C. J., Stevenson, F. K. Teng, N. N. H.
(1993) J. Immunol., 151, 5011-5021. [0383] 8 Cairns, E., Kwong, P.
C., Misener, V., Ip, P., Bell, D. A. Siminovitch, K. A. (1989) J.
Immunol., 143, 685-691. [0384] 9 Carroll, W. L., Yu, M., Link, M.
P. Korsmeyer, S. J. (1989) J. Immunol., 143, 692-698. [0385] 10
Chen, B. L. Poljak, R. J. (1974) Biochemistry, 13, 1295-1302.
[0386] 11 Chen, B. L., Chiu. Y. Y. H., Humphrey, R. L. Poljak, R.
J. (1978) Biochim. Biophys. Acta, 537, 9-21. [0387] 12 Combriato,
G. Klobeck, H. G. (1991) Eur. J. Immunol., 21, 1513-1522. [0388] 13
Cuisinier, A.-M., Fumoux, F., Fougereau, M. Tonnelle, C. (1992)
Mol. Immunol., 29, 1363-1373. [0389] 14 Dwulet, F. E., Strako, K.
Benson, M. D. (1985) Scand. J. Immunol., 22, 653-660. [0390] 15
Elahna, P., Livneh, A., Manheimer-Lory, A. J. Diamond, B. (1991) J.
Immunol., 147, 2771-2776. [0391] 16 Engelhard, M., Hess, M.
Hilschmann, N. (1974) Z. Physiol. Chem., 355, 85-88; Engelhard, M.
Hilschmann, N. (1975) Z. Physiol. Chem., 356, 1413-1444. [0392] 17
Eulitz, M. (1974) Eur. J. Biochem., 50, 49-69. [0393] 18 Eulitz,
M., Breuer, M. Linke, R. P. (1987) Biol. Che. Hoppe-Seyler, 368,
863-870. [0394] 19 Eulitz, M., Murphy, C., Weiss, D. T. Solomon, A.
(1991) J. Immunol., 146, 3091-3096. [0395] 20 Fett, J. W. Deutsch,
H. F. (1974) Biochemistry, 13, 4102-4114. [0396] 21 Fett, J. W.
Deutsch, H. F. (1976) Immunochem., 13, 149-155.; Jabusch, J. R.
Deutsch, H. F. (1982) Mol. Immunol., 19, 901-906. [0397] 22 Furey,
W. Jr., Wang, B. C. Yoo, C. S. Sax, M. (1983) J. Mol. Biol., 167,
661-692. [0398] 23 Fykse, E.-M. Sletten, K., Husby, G. Cornwell, G.
G., Iii (1988) Biochem. J., 256, 973-980. [0399] 24 Garver, F. A.
Hilschmann, N. (1971) Febs Letters, 16, 128-132; (1972) Eur. J.
Biochem., 26, 10-32. [0400] 25 Gawinowicz, M. A., Merlini, G.,
Birken, S., Osserman, E. F. Kabat, E. A. (1991) J. Immunol., 147,
915-920. [0401] 26 Ghiso, J., Solomon, A. Frangione. B. (1986) J.
Immunol. 136, 716-719. [0402] 27 Griffiths, A. D., Malmqvist, M.,
Marks, J. D., Bye, J. M., Embleton, M. J., Mccafferty, J., Baier,
M., Holliger, K. P., Gorick, B. D., Hughes-Jones, N. C.,
Hoogenboom, H. R. Winter, G. (1993) Embo J., 12, 725-734. [0403] 28
Guliasken, N., Idso, H., Nilsen, R., Sletten, K., Husby, G.
Cornwell, G. G. (1990) In Amyloid And Amyloidosis, Eds. J. B.
Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P.
Westermark, Kluwer Academic [0404] 29 Harindranath, N., Goldfarb,
I. S., Ikematsu, H., Burastero, S. E., Wilder, R. L., Notkins, A.
L. Casali, P. (1991) Int. Immunol., 3, 865-875. [0405] 30 Holm, E.,
Sletten, K. Husby, G. (1986) Biochem. J., 239, 545-551. [0406] 31
Hughes-Jones, N. C., Bye, J. M., Beale, D. Coadwell, J. (1990)
Biochem. J., 268, 135-140. [0407] 32 Kametani, F., Yoshimura, K.
Tonoike, H., Hoshi, A., Shinoda, T. Isobe, T. (1985) Biochem.
Biophys. Res. Commun., 126, 848-852. [0408] 33 Kiefer, C. R.,
Mcguire, B. S., Jr., Osserman, E. F. Garver, F. A. (1983) J.
Immunol., 131, 1871-1875. [0409] 34 Kiefer, C. R., Patton, H. M.,
Jr., Mcquire, B. S., Jr. Garver, F. A. (1980) J. Immunol., 124,
301-306. [0410] 35 Kishimoto, T., Okajima, H., Okumoto, T.
Taniguchi, M. (1989) Nucl. Acids Res., 17, 4385. [0411] 36 Klafki,
H.-W., Kratzin, H. D., Pick, A. I. Eckart, K. Hilschmann. N. (1990)
In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby,
A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic
[0412] 37 Kohler, H., Rudofsky, S. Kluskens, L. (1975) J.
Immunology, 114, 415-421. [0413] 38 Kojima, M., Odani, S. Ikenaka,
T. (1980) Mol. Immunol., 17, 1407-1414. [0414] 39 Komori, S.,
Yamasaki, N., Shigeta, M., Isojima, S. Watanabe, T. (1988) Clin.
Exp. Immunol. 71, 508-516. [0415] 40 Kratzin, H. D., Palm, W.,
Stangel, M., Schmidt, W. E., Friedrich, J. Hilschmann, N. (1989)
Biol. Chem. Hoppe-Seyler, 370, 263-272. [0416] 41 Kratzin, H. D.,
Pick. A. I., Stangel, M. Hilschmann, N. (1990) In Amyloid And
Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B.
Skogen, K. Sletten P. Westermark, Kluwer Academic Publishers,
Dordrecht/Boston/London, Pp. 181- [0417] 42 Langer, B.,
Steinmetz-Kayne, M. Hilschmann, N. (1968) Z. Physiol. Chem., 349,
945-951. [0418] 43 Larrick, J. W., Danielsson, L., Brenner, C. A.,
Wallace, E. F., Abrahamson, M., Fry, K. E. Borrebaeck, C. A. K.
(1989) Bio/Tech., 7, 934-938. [0419] 44 Levy, S., Mendel, E., Kon,
S., Avnur, Z. Levy, R. (1988) J. Exp. Med., 168, 475-489. [0420] 45
Lewis. A. P., Lemon, S. M., Barber, K. A., Murphy, P., Parry, N.
R., Peakman, T. C., Sims, M. J., Worden, J. Crowe, J. S. (1993) J.
Immunol., 151, 2829-2838. [0421] 46 Liu, V. Y. S., Low, T. L. K.,
Infante, A. Putnam, F. W. (1976) Science, 193, 1017-1020; Infante,
A. Putnam, F. W. (1979) J. Biol. Chem., 254, 9006-9016. [0422] 47
Lopez De Castro, J. A., Chiu, Y. Y. H. Poljak, R. J. (1978)
Biochemistry, 17, 1718-1723. [0423] 48 Mantovani, L., Wilder, R. L.
Casali, P. (1993) J. Immunol., 151, 473-488. [0424] 49 Marks, J.
D., Hoogenboom, H. R., Bonnert, T. P., Mccafferty, J., Griffiths,
A. D. Winter, G. (1991) J. Mol. Biol, 222, 581-597. [0425] 50
Mihaesco, E., Roy, J.-P., Congy, N., Peran-Rivat, L. Mihaesco, C.
(1985) Eur. J. Biochem., 150, 349-357. [0426] 51 Milstein, C.,
Clegg, J. B. Jarvis, J. M. (1968) Biochem. J., 110, 631-652. [0427]
52 Moran, M. J., Andris, J. S., Matsumato, Y.-I., Capra, J. D.
Hersh, E. M. (1993) Mol. Immunol., 30, 1543-1551. [0428] 53
Nabeshima, Y. Ikenaka, T. (1979) Mol. Immunol., 16, 439-444. [0429]
54 Olee, B. T., Lu, E. W., Huang, D.-F., Soto-Gil, R. W., Deftos,
M., Kozin, F., Carson, D. A. Chen, P. P. (1992) J. Exp. Med., 175,
831-842. [0430] 55 Pascual, V., Victor, K., Randen, I., Thompson,
K., Steinitz, M., Forre, O., Fu, S.-M., Natvig, J. B. Capra, J. D.
(1992) Scand. J. Immunol., 36, 349-362. [0431] 56 Paul, E., Iliev,
A. A., Livneh, A. Diamond, B. (1992) J. Immunol., 149, 3588-3595.
[0432] 57 Pick, A. I., Kratzin, H. D., Barnikol-Watanabe, S.
Hilschmann, N. (1990) In Amyloid And Amyloidosis, Eds. J. B.
Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P.
Westermark, Kluwer Academic [0433] 58 Ponstingl, H. Hilschmann, N.
(1969) Z. Physiol. Chem., 350, 1148-1152; (1971) Z. Physiol. Chem.,
352, 859-877. [0434] 59 Ponstingl, H., Hess, M. Hilschmann, N.
(1968) Z. Physiol. Chem., 349, 867-871; (1971) Z. Physiol. Chem.,
352, 247-266. [0435] 60 Randen, I., Pascual, V., Victor, K.,
Thompson, K. M., Forre, O., Capra, J. D. Natvig, J. B. (1993) Eur.
J. Immunol., 23, 1220-1225. [0436] 61 Scholz, R. Hilschmann, N.
(1975) Z. Physiol. Chem., 356, 1333-1335. [0437] 62 Settmacher, U.,
Jahn, S., Siegel, P., Von Baehr, R. Hansen, A. (1993) Mol.
Immunol., 30, 953-954. [0438] 63 Shinoda, T., Titani, K. Putnam, F.
W. (1970) J. Biol. Chem., 245, 4475-4487. [0439] 64 Sletten, K.,
Husby, G. Natvig, J. B. (1974) Scand. J. Immunol., 3, 833-836.;
Sletten. K., Natvig, J. B., Husby, G. Juul, J. (1981) Biochem. J.,
195, 561-572. [0440] 65 Solomon, A., Frangione, B. Franklin, E. C.
(1982) J. Clin. Invest., 70, 453-460.; Frangione, B., Moloshok, T.
Solomon, A. (1983) J. Immunol., 131, 2490-2493. [0441] 66
Takahashi, N., Takayasu, T., Isobe, T., Shinoda, T., Okuyama, T.
Shimizu, A. (1979) J. Biochem., 86, 1523-1535. [0442] 67 Takahashi,
N., Takayasu, T., Shinoda, T., Ito, S., Okuyama, T. Shimizu, A.
(1980) Biomed. Res., 1, 321-333. [0443] 68 Takahashi, Y.,
Takahashi, N., Tetaert, D. Putnam, F. W. (1983) Proc. Nat. Acad.
Sci. Usa. 80, 3686-3690. [0444] 69 Takayasu, T., Takahashi, N.,
Shinoda, T., Okuyama, T. Tomioka, H. (1980) J. Biochem., 89,
421-436. [0445] 70 Titani, K., Wikler, M., Shinoda, T. Putnam, F.
W. (1970) J. Biol. Chem., 245, 2171-2176. [0446] 71 Toft, K. G.,
Sletten, K. Husby, G. (1985) Biol. Chem. Hoppe-Seyler, 366,
617-625. [0447] 72 Tonoike. H., Kametani, F., Hoshi, A., Shinoda,
T. Isobe, T. (1985) Biochem. Biophys. Res. Commun., 126, 1228-1234.
[0448] 73 Tonoike, H., Kametani, F., Hoshi, A., Shinoda, T. Isobe,
T. (1985) Febs Letters, 185, 139-141. [0449] 74 Tsujimoto, Y.
Croce, C. M. (1984) Nucl. Acids Res., 12, 8407-8414. [0450] 75
Tsunetsugu-Yokota, Y., Minekawa, T., Shigemoto, K., Shirasawa, T.
Takemori, T. (1992) Mol. Immunol., 29, 723-728. [0451] 76
Tveteraas, T., Sletten, K. Westermark, P. (1985) Biochem. J., 232,
183-190. [0452] 77 Vasicek, T. J. Leder, P. (1990) J. Exp. Med.,
172, 609-620. [0453] 78 Victor, K. D., Randen, I., Thompson, K.,
Forre, O., Natvig, J. B., Fu, S. M. Capra, J. D. (1991) J. Clin.
Invest., 87, 1603-1613. [0454] 79 Weng, N.-P., Yu-Lee, L.-Y., Sanz,
I., Patten, B. M. Marcus, D. M. (1992) J. Immunol., 149, 2518-2529.
[0455] 80 Wikier, M. Putnam, F. W. (1970) J. Biol. Chem., 245,
4488-4507. [0456] 81 Winkler, T. H., Fehr, H. Kalden, J. R. (1992)
Eur. J. Immunol., 22, 1719-1728. [0457] 82 Yago, K., Zenita, K.
Ohwaki, I., Harada, Y., Nozawa, S., Tsukazaki, K., Iwamori, M.,
Endo, N., Yasuda, N., Okuma, M. Kannagi, R. (1993) Mol. Immunol.,
30, 1481-1489. [0458] 83 Yamasaki, N., Komori, S. Watanabe, T.
(1987) Mol. Immunol., 24, 981-985. [0459] 84 Zhu, D., Kim, H. S.
Deutsch, H. F. (1983) Mol. Immunol., 20, 1107-1116. [0460] 85 Zhu,
D., Zhang, H., Zhu, N. Luo, X. (1986) Scientia Sinica, 29,
746-755.
REFERENCES OF REARRANGED HUMAN HEAVY CHAIN SEQUENCES USED FOR
ALIGNMENT
[0460] [0461] 1 Adderson, E. E., Azmi, F. H., Wilson, P. M.,
Shackelford, P. G. Carroll, W. L. (1993) J. Immunol., 151, 800-809.
[0462] 2 Adderson, E. E., Shackelford, P. G., Quinn, A. Carroll, W.
L. (1991) J. Immunol., 147, 1667-1674. [0463] 3 Akahori, Y.,
Kurosawa, Y., Kamachi, Y., Torii, S. Matsuoka, H. (1990) J. Clin.
Invest., 85, 1722-1727. [0464] 4 Andris, J. S., Brodeur, B. R.
Capra, J. D. (1993) Mol. Immunol., 30, 1601-1616. [0465] 5 Andris,
J. S., Ehrlich, P. H., Ostberg, L. Capra, J. D. (1992) J. Immunol.,
149, 4053-4059. [0466] 6 Andris, J. S., Johnson, S., Zolla-Pazner,
S. Capra, J. D. (1991) Proc. Natl. Acad. Sci. Usa, 88, 7783-7787.
[0467] 7 Anker, R., Conley, M. E. Pollok, B. A. (1989) J. Exp.
Med., 169, 2109-2119. [0468] 8 Atkinson, P. M., Lampman, G. W.,
Furie, B. C., Naparstek, Y., Schwartz, R. S., Stollar, B. D. Furie,
B. (1985) J. Clin. Invest., 75, 1138-1143.; Lampman, G. W., Furie,
B., Schwartz, R. S., Stollar, B. D. Furie, B. C. (1989) [0469] 9
Avila, M. A., Vazques, J., Danielsson, L., Fernandez De Cossio, M.
E. Borrebaeck, C. A. K. (1993) Gene, 127, 273-274. [0470] 10
Bakkus, M. H. C., Heirman, C., Van Riet, I., Van Camp, B.
Thielemans, K. (1992) Blood, 80, 2326-2335. [0471] 11 Barbas Iii,
C. F., Crowe, Jr. J. E., Cababa. D., Jones, T. M., Zebedee, S. L.,
Murphy, B. R., Chanock, R. M. Burton. D. R. (1992) Proc. Natl.
Acad. Sci. Usa, 89, 10164-10168. [0472] 12 Barbas, C. F., Iii,
Collet, T. A., Amberg, W., Roben, P., Binley, J. M., Hoekstra, D.,
Cababa, D., Jones, T. M., Williamson, R. A., Pilkington, G. R.,
Haigwood, N. L., Cabezas, E., Satterthwait, A. C., Sanz, I. Burton,
D. R. (1993) J. Mol. Biol., 230, 812-823. [0473] 13 Berman, J. E.,
Humphries, C. G., Barth, J., Alt. F. W. Tucker, P. W. (1991) J.
Exp. Med., 173, 1529-1535. [0474] 14 Berman, J. E., Mellis, S. J.,
Pollock, R., Smith, C. L., Suh, H., Heinke, B., Kowal, C., Surti,
U., Chess, L., Cantor, C. R Alt, F. W. (1988) Embo J., 7, 727-738.
[0475] 15 Bhat, N. M., Bieber, M. M., Chapman, C. J., Stevenson, F.
K. Teng, N. N. H. (1993) J. Immunol., 151, 5011-5021. [0476] 16
Bird, J., Galili, N., Link, M., Stites, D. Sklar, J. (1988) J. Exp.
Med., 168, 229-245. [0477] 17 Cai, J., Humphries, C., Richardson,
A. Tucker, P. W. (1992) J. Exp. Med., 176, 1073-1081. [0478] 18
Cairns, E., Kwong, P. C., Misener, V., Ip, P., Bell, D. A.
Siminovitch, K. A. (1989) J. Immunol., 143, 685-691. [0479] 19
Capra, J. D. Hopper, J. E. (1976) Immunochemistry, 13, 995-999;
Hopper, J. E., Noyes, C., Heinrikson, R. Kessel, J. W. (1976) J.
Immunol., 116, 743-746. [0480] 20 Capra, J. D. Kehoe, J. M. (1974)
Proc. Nat. Acad. Sci. Usa, 71, 845-848. [0481] 21 Carroll, W. L.,
Yu, M., Link, M. P. Korsmeyer, S. J. (1989) J. Immunol., 143,
692-698. [0482] 22 Chen, P. P., Liu, M.-F., Glass, C. A., Sinha,
S., Kipps, T. J. Carson, D. A. (1989) Arthritis Rheumatism, 32,
72-76; Kipps, T. J., Tomhave, E., Pratt, L. F., Duffy, S., Chen, P.
P. Carson, D. A. (1989) Proc. Natl. Acad. Sci. Usa, 86, 5913-5917.
[0483] 23 Chiu, Y. Y. H., Lopez De Castro, J. A. Poljak, R. J.
(1979) Biochemistry, 18, 553-560. [0484] 24 Cleary, M. L. Meeker,
T. C., Levy, S., Lee, E., Trela, M., Sklar, J. Levy, R. (1986)
Cell, 44, 97-106. [0485] 25 Cuisinier, A.-M., Fumoux, F.,
Fougereau, M. Tonnelle, C. (1992) Mol. Immunol., 29, 1363-1373.
[0486] 26 Cuisinier, A.-M., Gauthier, L., Boubli, L., Fougereau, M.
Tonnelle, C. (1993) Eur. J. Immunol., 23, 110-118. [0487] 27
Cunningham, B. A., Gottiieb, P. D., Pflumm, M. N. Edelman, G. M.
(1971) Progress In Immunology (B. Amos, Ed.), Academic Press, N.Y.,
Pp. 3-24. [0488] 28 Cunningham, B. A., Rutishauser, U., Gall, W.
E., Gottlieb, P. D., Waxdal, M. J. Edelman, G. M. (1970)
Biochemistry, 9, 3161-3170. [0489] 29 Deane, M. Norton, J. D.
(1990) Eur. J. Immunol., 20, 2209-2217. [0490] 30 Deane, M. Norton,
J. D. (1991) Leukemia, 5, 646-650. [0491] 31 Dersimonian, H.,
Schwartz, R. S., Barrett, K. J. Stollar, B. D. (1987) J. Immunol.,
139, 2496-2501. [0492] 32 Dersimonian, H., Schwartz, R. S.,
Barrett, K. J. Stollar, B. D. (1987) J. Immunol., 139, 2496-2501;
Chen, P. P., Liu, M.-F., Sinha, S. Carson, D. A. (1988) Arth.
Rheum., 31, 1429-1431. [0493] 33 Desai, R., Spatz, L., Matsuda, T.,
Ilyas. A. A., Berman, J. E., Alt, F. W., Kabat, E. A. Latov, N.
(1990) J. Neuroimmunol., 26, 35-41. [0494] 34 Ezaki, I., Kanda, H.,
Sakai, K., Fukui, N., Shingu, M., Nobunaga, M. Watanabe, T. (1991)
Arthritis And Rheumatism, 34, 343-350. [0495] 35 Felgenhauer, M.,
Kohl, J. Ruker, F. (1990) Nucl. Acids Res. 18, 4927. [0496] 36
Florent, G., Lehman, D. Putnam, F. W. (1974) Biochemistry, 13,
2482-2498. [0497] 37 Friedlander, R. M., Nussenzweig, M. C. Leder,
P. (1990) Nucl. Acids Res., 18, 4278. [0498] 38 Gawinowicz, M. A.,
Merlini, G., Birken, S., Osserman, E. F. Kabat, E. A. (1991) J.
Immunol., 147, 915-920. [0499] 39 Gillies, S. D., Dorai, H.,
Wesolowski, J., Majeau, G., Young, D., Boyd, J., Gardner, J. James,
K. (1989) Bio/Tech., 7, 799-804. [0500] 40 Goni, F. Frangione, B.
(1983) Proc. Nat. Acad. Sci. Usa, 80, 4837-4841. [0501] 41 Gorman,
S. D., Clark, M. R., Routledge, E. G., Cobbold, S. P. Waldmann, H.
(1991) Proc. Natl. Acad. Sci. Usa, 88, 4181-4185. [0502] 42
Griffiths, A. D., Malmqvist, M., Marks, J. D., Bye, J. M.,
Embleton, M. J., Mccafferty, J., Baier, M., Holliger, K. P.,
Gorick, B. D., Hughes-Jones, N. C., Hoogenboom, H. R. Winter, G.
(1993) Embo J. 12, 725-734. [0503] 43 Grillot-Courvalin, C.,
Brouet, J.-C., Piller, F., Rassenti, L. Z., Labaume, S., Silverman,
G. J., Silberstein, L. Kipps, T. J. (1992) Eur. J. Immunol., 22,
1781-1788. [0504] 44 Guillaume, T., Rubinstein, D. B., Young, F.,
Tucker, L., Logtenberg, T., Schwartz, R. S. Barrett, K. L. (1990)
J. Immunol., 145, 1934-1945; Young, F., Tucker, L., Rubinstein, D.,
Guillaume, T., Andre-Schwartz, J., Barrett, K. J., Schwartz, R. S.
Logtenberg, T. (1990) [0505] 45 Harindranath, N., Goldfarb, I. S.,
Ikematsu, H., Burastero, S. E., Wilder, R. L., Notkins, A. L.
Casali, P. (1991) Int. Immunol., 3, 865-875. [0506] 46 Hillson, J.
L., Oppliger, I. R., Sasso, E. H., Milner, E. C. B. Wener, M. H.
(1992) J. Immunol., 149, 3741-3752. [0507] 47 Hirabayashi. Y.,
Munakata, Y., Sasaki, T. Sano, H. (1992) Nucl. Acids Res., 20,
2601. [0508] 48 Hoch, S. Schwaber, J. (1987) J. Immunol., 139,
1689-1693. [0509] 49 Huang, C., Stewart, A. K., Schwartz, R. S.
Stollar, B. D. (1992) J. Clin. Invest., 89, 1331-1343. [0510] 50
Hughes-Jones, N. C., Bye, J. M., Beale, D. Coadwell, J. (1990)
Biochem. J., 268, 135-140. [0511] 51 Ikematsu, H., Harindranath,
N., Ueki, Y., Notkins, A. L. Casali, P. (1993) J. Immunol., 150,
1325-1337. [0512] 52 Ikematsu, H., Kasaian, M. T., Schettino, E. W.
Casali, P. (1993) J. Immunol., 151, 3604-3616. [0513] 53 Kelly, P.
J., Pascual, V., Capra, J. D. Lipsky, P. E. (1992) J. Immunol.,
148, 1294-1301. [0514] 54 Kipps, T. J. Duffy, S. F. (1991) J. Clin.
Invest., 87, 2087-2096. [0515] 55 Kipps, T. J., Tomhave, E., Pratt,
L. F., Duffy, S., Chen, P. P. Carson, D. A. (1989) Proc. Natl.
Acad. Sci. Usa, 86, 5913-5917. [0516] 56 Kishimoto, T., Okajima,
H., Okumoto, T. Taniguchi, M. (1989) Nucl. Acids Res., 17, 4385.
[0517] 57 Knight, G. B., Agnello, V., Bonagura, V., Barnes, J. L.,
Panka, D. J. Zhang, Q.-X (1993) J. Exp. Med., 178, 1903-1911.
[0518] 58 Kohler, H., Shimizu, A., Paul, C., Moore, V. Putnam, F.
W. (1970) Nature, 227, 1318-1320; Florent, G., Lehman, D. Putnam,
F. W. (1974) Biochemistry, 13, 2482-2498 [0519] 59 Komori, S.,
Yamasaki, N., Shigeta, M., Isojima, S. Watanabe, T. (1988) Clin.
Exp. Immunol., 71, 508-516. [0520] 60 Kon, S., Levy, S. Levy, R.
(1987) Proc. Natl. Acad. Sci. Usa, 84, 5053-5057. [0521] 61
Kratzin, H., Altevogt, P., Ruban, E., Kortt, A., Staroscik, K.
Hilschmann, N. (1975) Z. Physiol. Chem., 356, 1337-1342; Kratzin,
H., Altevogt, P., Kortt, A., Ruban, E. Hilschmann, N. (1978) Z.
Physiol. Chem., 359, 1717-1745. [0522] 62 Kudo, A. Ishihara. T.
Nishimura, Y. Watanabe, T. (1985) Gene, 33, 181-189. [0523] 63
Kunicki, T. J., Annis, D. S., Gorski, J. Nugent. D. J. (1991) J.
Autoimmunity, 4, 433-446. [0524] 64 Larrick, J. W., Wallace, E. F.,
Coloma, M. J., Bruderer, U., Lang, A. B. Fry, K. E. (1992)
Immunological Reviews, 130, 69-85. [0525] 65 Lehman, D. W. Putnam,
F. W. (1980) Proc. Nat. Acad. Sci. Usa, 77, 3239-3243. [0526] 66
Lewis, A. P., Lemon, S. M., Barber, K. A., Murphy, P., Parry, N.
R., Peakman, T. C., Sims, M. J., Worden, J. Crowe, J. S. (1993) J.
Immunol., 151, 2829-2838. [0527] 67 Liu, V. Y. S., Low, T. L. K.,
Infante, A. Putnam, F. W. (1976) Science, 193, 1017-1020. [0528] 68
Logtenberg, T., Young, F. M., Van Es, J. H., Gmelig-Meyling, F. H.
J., Berman, J. E. Alt, F. W. (1989) J. Autoimmunity, 2, 203-213.
[0529] 69 Logtenberg, T., Young, F. M., Van Es, J. H.,
Gmelig-Meyling, F. H. J. Alt, F. W. (1989) J. Exp. Med., 170,
1347-1355. [0530] 70 Manheimer-Lory, A., Katz, J. B., Pillinger,
M., Ghossein, C., Smith, A. Diamond, B. (1991) J. Exp. Med., 174,
1639-1652. [0531] 71 Mantovani, L., Wilder, R. L. Casali, P. (1993)
J. Immunol., 151, 473-488. [0532] 72 Mariette, X., Tsapis, A.
Brouet, J.-C. (1993) Eur. J. Immunol., 23, 846-851. [0533] 73
Marks, J. D., Hoogenboom, H. R., Bonnert, T. P., Mccafferty, J.,
Griffiths, A. D. Winter, G. (1991) J. Mol. Biol., 222, 581-597.
[0534] 74 Meeker, T. C., Grimaldi, J., O'rourke, R., Loeb, J.
Juliusson, G. Einhorn, S. (1988) J. Immol., 141, 3994-3998. [0535]
75 Milili, M., Fougereau. M., Guglielmi, P. Schiff, C. (1991) Mol.
Immunol., 28, 753-761. [0536] 76 Moran, M. J., Andris, J. S.,
Matsumato, Y.-I., Capra, J. D. Hersh, E. M. (1993) Mol. Immunol.,
30, 1543-1551. [0537] 77 Mortari, F., Wang, J.-Y. Schroeder, Jr.,
H. W. (1993) J. Immunol., 150, 1348-1357. [0538] 78 Newkirk, M. M.,
Gram, H., Heinrich, G. F., Ostberg, L., Capra, J. D. Wasserman, R.
L. (1988) J. Clin. Invest, 81, 1511-1518. [0539] 79 Newkirk, M. M.,
Mageed, R. A., Jefferis, R., Chen, P. P. Capra, J. D. (1987) J.
Exp. Med., 166, 550-564. [0540] 80 Nickerson, K. G., Berman, J.,
Glickman, E., Chess, L. Alt, F. W. (1989) J. Exp. Med., 169,
1391-1403. [0541] 81 Olee, B. T., Lu, E. W., Huang, D.-F.,
Soto-Gil, R. W., Deftos, M., Kozin, F., Carson, D. A. Chen, P. P.
(1992) J. Exp. Med., 175, 831-842. [0542] 82 Pascual, V., Randen,
I., Thompson, K., Sioud, M. Forre, O., Natvig, J. Capra, J. D.
(1990) J. Clin. Invest., 86, 1320-1328. [0543] 83 Pascual, V.,
Randen, I., Thompson, K., Sioud, M. Forre, O., Natvig, J. Capra, J.
D. (1990) J. Clin. Invest., 86, 1320-1328; Randen, I., Brown, D.,
Thompson, K. M., Hughes-Jones, N., Pascual, V., Victor, K., Capra,
J. D., Forre, O. Natvig, J. B. (1992) [0544] 84 Pascual, V.,
Victor, K., Lelsz, D., Spellerberg, M. B., Hamblin, T. J.,
Thompson, K. M., Randen, I., Natvig. J., Capra, J. D. Stevenson, F.
K. (1991) J. Immunol., 146, 4385-4391. [0545] 85 Pascual, V.,
Victor, K., Randen, I., Thompson, K., Steinitz, M., Forre, O., Fu,
S.-M., Natvig, J. B. Capra, J. D. (1992) Scand. J. Immunol., 36,
349-362. [0546] 86 Pascual, V., Victor, K., Spellerberg, M.,
Hamblin, T. J., Stevenson, F. K. Capra, J. D. (1992) J. Immunol.,
149, 2337-2344. [0547] 87 Ponstingl, H., Schwarz, J., Reichel, W.
Hilschmann, N. (1970) Z. Physiol. Chem., 351, 1591-1594.;
Ponstingl, H. Hilschmann, N. (1976) Z. Physiol. Chem., 357,
1571-1604. [0548] 88 Portolano, S., Mclachlan, S. M. Rapoport, B.
(1993) J. Immunol., 151, 2839-2851. [0549] 89 Portolano, S., Seto,
P., Chazenbalk, G. D., Nagayama, Y., Mclachlan, S. M. Rapoport, B.
(1991) Biochem. Biophys. Res. Commun., 179,372-377. [0550] 90
Pratt, L. F., Szubin, R., Carson, D. A. Kipps, T. J. (1991) J.
Immunol., 147, 2041-2046. [0551] 91 Press, E. M. Hogg, N. M. (1970)
Biochem. J., 117, 641-660. [0552] 92 Putnam, F. W., Shimizu, A.,
Paul., C., Shinoda, T. Kohler, H. (1971) Ann. N.Y. Acad. Sci. 190,
83-103. [0553] 93 Putnam, F. W., Takahashi, N., Tetaert, D.,
Debuire, B. Lin, L. C. (1981) Proc. Nat. Acad. Sci. Usa; 78,
6168-6172.; Takahashi, N., Tetaert, D., Debuire, B., Lin, L.
Putnam, F. W. (1982) Proc. Nat. Acad. Sci. Usa, 79, 2850-2854.
[0554] 94 Raaphorst, F. M., Timmers, E., Kenter, M. J. H., Van Tol,
M. J. D., Vossen, J. M. Schuurman, R. K. B. (1992) Eur. J.
Immunol., 22, 247-251. [0555] 95 Rabbitts, T. H., Bentley, D. L.,
Dunnick, W., Forster, A., Matthyssens, G. Milstein, C. (1980) Cold
Spring Harb. Symp. Quanti. Biol., 45, 867-878; Matthyssens, G.
Rabbitts, T. H. (1980) Proc. Nat. Acad. Sci. Usa, 77, 6561-6565.
[0556] 96 Randen, I., Pascual, V., Victor, K., Thompson, K. M.,
Forre, O., Capra, J. D. Natvig, J. B. (1993) Eur. J. Immunol., 23,
1220-1225. [0557] 97 Rassenti, L. Z. Kipps, T. J. (1993) J. Exp.
Med., 177, 1039-1046. [0558] 98 Reidi, L. S., Friedman, D. F.,
Goldman, J., Hardy, R. R., Jefferies, L. C. Silberstein, L. E.
(1991) J. Immunol., 147, 3623-3631. [0559] 99 Roudier, J.,
Silverman, G. J., Chen, P. P., Carson, D. A. Kipps, T. J. (1990) J.
Immunol., 144, 1526-1530. [0560] 100 Sanz, I., Casali, P., Thomas,
J. W., Notkins, A. L. Capra, J. D. (1989) J. Immunol., 142,
4054-4061. [0561] 101 Sanz. I., Dang. H., Takei, M., Talal, N.
Capra, J. D. (1989) J. Immunol., 142, 883-887. [0562] 102 Schmidt,
W. E., Jung, H-.D., Palm, W. Hilschmann, N. (1983) Z. Physiol.
Chem., 364, 713-747. [0563] 103 Schroeder, H. W., Jr. Wang, J. Y.
(1990) Proc. Natl. Acad. Sci. Usa, 87, 6146-6150. [0564] 104
Schroeder, H. W., Jr., Hillson, J. L. Perlmutter, R. M. (1987)
Science, 238, 791-793. [0565] 105 Schroeder, H. W., Jr., Hillson,
J. L. Perlmutter, R. M. (1987) Science, 238, 791-793; Chen, P. P.,
Liu, M.-F., Glass, C. A., Sinha, S., Kipps, T. J. Carson, D. A.
(1989) Arthritis Rheumatism, 32, 72-76. [0566] 106 Schroeder, H.
W., Jr., Hillson, J. L. Perlmutter, R. M. (1987) Science, 238,
791-793; Chen, P. P., Liu, M.-F., Sinha, S. Carson, D. A. (1988)
Arth. Rheum., 31, 1429-1431. [0567] 107 Schutte, M. E., Ebeling, S.
B., Akkermans, K. E, Gmelig-Meyling, F. H. Logtenberg, T. (1991)
Eur. J. Immunol., 21, 1115-1121. [0568] 108 Schutte, M. E.,
Ebeling, S. B., Akkermans, K. E., Gmelig-Meyling, F. H. J.
Logtenberg, T. (1991) Eur. J. Immunol., 21, 1115-1121. [0569] 109
Settmacher, U., Jahn, S., Siegel, P., Von Baehr, R. Hansen, A.
(1993) Mol. Immunol., 30, 953-954. [0570] 110 Shen, A., Humphries,
C., Tucker, P. Blattner, F. (1987) Proc. Natl. Acad. Sci. Usa, 84,
8563-8567. [0571] 111 Shimizu, A., Nussenzweig, M. C., Mizuta,
T.-R., Leder, P. Honjo, T. (1989) Proc. Natl. Acad. Sci. Usa, 86,
8020-8023. [0572] 112 Shin, E. K., Matsuda, F., Fujikura, J.,
Akamizu, T., Sugawa, H., Mori, T. Honjo, T. (1993) Eur. J.
Immunol., 23, 2365-2367. [0573] 113 Silberstein, L. E., Litwin, S.
Carmack, C. E. (1989) J. Exp. Med. 169, 1631-1643.
114 Singal, D. P., Frame, B., Joseph, S., Blajchman, M. A. Leber,
B. F. (1993) Immunogenet., 38, 242. [0575] 115 Spatz, L. A., Wong,
K. K., Williams, M., Desai, R., Golier, J., Berman, J. E., Alt, F.
W. Latov, N. (1990) J. Immunol., 144, 2821-2828. [0576] 116
Steiner, L. A., Garcia-Pardo, A. Margolies, M. N. (1979)
Biochemistry, 18, 4068-4080. [0577] 117 Stewart, A. K., Huang, C.,
Stollar, B. D. Schwartz, R. S. (1993) J. Exp. Med., 177, 409-418.
[0578] 118 Thomas, J. W. (1993) J. Immunol., 150, 1375-1382. [0579]
119 Torano, A. Putnam, F. W. (1978) Proc. Nat. Acad. Sci. Usa, 75,
966-969. [0580] 120 Van Der Heijden, R. W. J., Bunschoten, H.,
Pascual, V., Uytdehaag, F. G. C. M., Osterhaus, A. D. M. E. Capra,
J. D. (1990) J. Immunol., 144, 2835-2839. [0581] 121 Van Der Stoep,
N., Van Der Linden, J. Logtenberg, T. (1993) J. Exp. Med., 177,
99-107. [0582] 122 Van Es, J. H., Gmelig-Meyling, F. H. J.
Logtenberg, T. (1992) Eur. J. Immunol., 22, 2761-2764. [0583] 123
Varade, W. S., Marin, E., Kittelberger, A. M. Insel, R. A. (1993)
J. Immunol., 150, 4985-4995. [0584] 124 Victor, K. D., Pascual, V.,
Lefvert, A. K. Capra, J. D. (1992) Mol. Immunol., 29, 1501-1506.
[0585] 125 Victor, K. D., Pascual, V., Williams, C. L., Lennon, V.
A. Capra, J. D. (1992) Eur. J. Immunol., 22, 2231-2236. [0586] 126
Watanabe, S., Barnikol, H. U., Horn, J., Bertram, J. Hilschmann, N.
(1973) Z. Physiol. Chem., 354, 1505-1509. [0587] 127 Weng, N.-P.,
Yu-Lee, L.-Y., Sanz, I., Patten, B. M. Marcus, D. M. (1992) J.
Immunol., 149, 2518-2529. [0588] 128 White, M. B., Word, C. J.,
Humphries, C. G., Blattner, F. R. Tucker, P. W. (1990) Mol. Cell.
Biol., 10, 3690-3699. [0589] 129 Winkler, T. H., Fehr, H. Kalden,
J. R. (1992) Eur. J. Immunol., 22, 1719-1728. [0590] 130 Yago, K.,
Zenita, K., Ohwaki, I., Harada, Y., Nozawa, S., Tsukazaki, K.,
Iwamori, M., Endo, N., Yasuda, N., Okuma, M. Kannagi, R. (1993)
Mol. Immunol., 30, 1481-1489. [0591] 131 Zelenetz, A. D., Chen, T.
T. Levy, R. (1992) J. Exp. Med., 176, 1137-1148.
B. REFERENCES OF GERMLINE SEQUENCES
REFERENCES OF HUMAN GERMLINE KAPPA SEQUENCES
[0591] [0592] 1 Cox, J. P. L, Tomlinson, I. M. Winter, G. (1994)
Eur. J. Immunol., 24, 827-836. [0593] 2 Huber, C., Et Al. (1993)
Eur. J. Immunol., 23, 2868. [0594] 3 Klobeck, H. G., Bornkammm, G.
W., Combriato, G., Mocikat, R., Pohlenz, H. D. Zachau, H. G. (1985)
Nucl. Acids Res., 13, 6515-6529. [0595] 4 Lautner-Rieske, A.,
Huber, C., Meindl, A., Pargent, W., Schable, K. F., Thiebe, R.,
Zocher, I. Zachau, H. G. (1992) Eur. J. Immunol. 22, 1023. [0596] 5
Lorenz, W., Schable, K. F., Thiebe, R., Stavnezer, J. Zachau, H. G.
(1988) Mol. Immunol., 25, 479. [0597] 6 Pargent, W., Meindl, A.,
Thiebe, R., Mitzel, S. Zachau, H. G. (1991) Eur. J. Immunol., 21,
1821-1827. [0598] 7 Pech, M. Zachau, H. G. (1984) Nuc. Acids Res.,
12, 9229-9236. [0599] 8 Pech, M., Jaenichen, H.-R., Pohlenz, H.-D.,
Neumaier, P. S., Klobeck, H.-G. Zachau, H. G. (1984) J. Mol. Biol.,
176, 189-204. [0600] 9 Scott, M. G., Crimmins, D. L., Mccourt, D.
W., Chung, G., Schable, K. F., Thiebe, R., Quenzel, E.-M., Zachau,
H. G. Nahm, M. H. (1991) J. Immunol., 147, 4007-4013. [0601] 10
Stavnezer, J., Kekish, O., Batter, D., Grenier, J., Balazs, I.,
Henderson, E. Zegers, B. J. M. (1985) Nucl. Acids Res., 13,
3495-3514. [0602] 11 Straubinger, B., Huber, E., Lorenz, W.,
Osterholzer, E., Pargent, W., Pech, M., Pohlenz, H.-D., Zimmer,
F.-J. Zachau, H. G. (1988) J. Mol. Biol., 199, 23-34. [0603] 12
Straubinger, B., Thiebe, R., Huber, C., Osterholzer, E. Zachau, H.
G. (1988) Biol. Chem. Hoppe-Seyer, 369, 601-607.
REFERENCES OF HUMAN GERMLINE LAMBDA SEQUENCES 1 Williams, S. C.
Winter, G. (1993) Eur. J. Immunol., 23, 1456-1461.
[0603] [0604] 2 Siminovitch, K. A., Misener, V., Kwong, P. C.,
Song, Q.-L. Chen, P. P. (1989) J. Clin. Invest., 84, 1675-1678.
[0605] 3 Brockly, F., Alexandre, D., Chuchana, P., Huck, S.,
Lefranc, G. Lefranc, M.-P. (1989) Nuc. Acids. Res., 17, 3976.
[0606] 4 Daley, M. D., Peng, H.-Q., Misener, V., Liu, X.-Y., Chen,
P. P. Siminovitch, K. A. (1992) Mol. Immunol., 29, 1515-1518.
[0607] 5 Deftos, M., Soto-Gil, R., Quan, M., Olee, T. Chen, P. P.
(1994) Scand. J. Immunol., 39, 95. [0608] 6 Stiernholm, N. B. J.,
Kuzniar, B. Berinstein, N. L. (1994) J. Immunol., 152, 4969-4975.
[0609] 7 Combriato, G. Klobeck, H. G. (1991) Eur. J. Immunol., 21,
1513-1522. [0610] 8 Anderson, M. L. M., Szajnert, M. F., Kaplan, J.
C., Mccoll, L. Young, B. D. (1984) Nuc. Acids Res., 12,
6647-6661.
REFERENCES OF HUMAN GERMLINE HEAVY CHAIN SEQUENCES
[0610] [0611] 1 Adderson, E. E. Azmi, F. H., Wilson, P. M.,
Shackelford, P. G. Carroll, W. L. (1993) J. Immunol., 151, 800-809.
[0612] 2 Andris, J. S. Brodeur, B. R. Capra, J. D. (1993) Mol.
Immunol., 30, 1601-1616. [0613] 3 Berman, J. E., Mellis, S. J.,
Pollock, R., Smith, C. L, Suh, H., Heinke, B., Kowal, C., Surti,
U., Chess, L., Cantor, C. R Alt, F. W. (1988) Embo J., 7, 727-738.
[0614] 4 Buluwela, L. Rabbitts, T. H. (1988) Eur. J. Immunol., 18,
1843-1845.; Buluwela, L., Albertson, D. G., Sherrington, P.,
Rabbitts, P. H., Spurr, N. Rabbitts, T. H. (1988) Embo J., 7,
2003-2010. [0615] 5 Chen, P. P., Liu, M.-F., Sinha, S. Carson, D.
A. (1988) Arth. Rheum., 31, 1429-1431. [0616] 6 Chen, P. P., Liu,
M.-F., Glass, C. A., Sinha, S., Kipps, T. J. Carson, D. A. (1989)
Arthritis Rheumatism, 32, 72-76. [0617] 7 Cook, G. P. et al. (1994)
Nature Genetics 7, 162-168. [0618] 8 Haino, M. et al., (1994). J.
Biol. Chem. 269, 2619-2626 [0619] 9 Humphries, C. G., Shen, A.,
Kuziel, W. A., Capra, J. D., Blattner, F. R. Tucker, P. W. (1988)
Nature, 331, 446-449. [0620] 10 Kodaira, M., Kinashi, T., Umemura,
I., Matsuda, F., Noma, T., Ono, Y. Honjo, T. (1986) J. Mol. Biol.,
190, 529-541. [0621] 11 Lee, K. H., Matsuda, F., Kinashi, T.,
Kodaira, M. Honjo, T. (1987) J. Mol. Biol., 195, 761-768. [0622] 12
Matsuda, F., Lee, K. H., Nakai, S., Sato, T., Kodaira, M., Zong, S.
Q., Ohno, H., Fukuhara, S. Honjo, T. (1988) Embo J., 7, 1047-1051.
[0623] 13 Matsuda, F., Shin, E. K, Hirabayashi, Y., Nagaoka, H.,
Yoshida, M. C., Zong, S. Q. Honjo, T. (1990) Embo J., 9, 2501-2506.
[0624] 14 Matsuda, F., Shin, E. K., Nagaoka, H., Matsumura, R.,
Haino, M., Fukita, Y., Taka-Ishi, S., Imai, T., Riley, J. H.,
Anand, R. Et, Al. (1993) Nature Genet. 3, 88-94 [0625] 15 Nagaoka,
H., Ozawa, K., Matsuda, F., Hayashida, H., Matsumura, R., Haino,
M., Shin, E. K., Fukita, Y., Imai, T., Anand, R., Yokoyama, K.,
Eki, T., Soeda, E. Honjo, T. (1993). (Temporal) [0626] 16 Rechavi,
G., Bienz, B., Ram, D., Ben-Neriah, Y., Cohen, J. B., Zakut, R.
Givol. D. (1982) Proc. Nat. Acad. Sci. Usa, 79, 4405-4409. [0627]
17 Sanz, I., Kelly, P., Williams, C., Scholl, S., Tucker, P. Capra,
J. D. (1989) Embo J., 8, 3741-3748. [0628] 18 Shin, E. K., Matsuda,
F., Fujikura, J., Akamizu, T., Sugawa, H., Mori, T. Honjo, T.
(1993) Eur. J. Immunol., 23, 2365-2367. [0629] 19 Tomlinson, Im.,
Walter, G., Marks, Jd., Liewelyn, Mb. Winter. G. (1992) J. Mol.
Biol. 227, 776-798. [0630] 20 Van Der Maarel, S., Van Dijk, K. W.,
Alexander, C. M., Sasso, E. H., Bull, A. Milner, E. C. B. (1993) J.
Immunol., 150, 2858-2868. [0631] 21 Van Dijk, K. W., Mortari, F.,
Kirkham, P. M., Schroeder, Jr., H. W. Milner, E. C. B. (1993) Eur.
J. Immunol. 23, 832-839. [0632] 22 Van Es, J. H., Aanstoot, H.,
Gmelig-Meyling, F. H. J., Derksen, R. H. W. M. Logtenberg, T.
(1992) J. Immunol., 149, 2234-2240. [0633] 23 Weng, N.-P., Snyder,
J. G., Yu-Lee, L.-Y. Marcus, D. M. (1992) Eur. J. Immunol., 22,
1075-1082. [0634] 24 Winkler, T. H., Fehr, H. Kalden, J. R. (1992)
Eur. J. Immunol., 22, 1719-1728. [0635] 25 Olee, T., Yang, P. M.,
Siminovitch, K. A., Olsen, N. J., Hillson, J. L., Wu, J., Kozin,
F., Carson, D. A. Chen, P. P. (1991) J. Clin. Invest 88, 193-203.
[0636] 26 Chen, P. P. Yang, P. M. (1990) Scand. J. Immunol. 31,
593-599. [0637] 27 Tomlinson, M., Walter, G., Cook Winter, G.
(Unpublished)
Sequence CWU 1
1
* * * * *