U.S. patent application number 11/211444 was filed with the patent office on 2005-12-29 for template-dependent nucleic acid polymerization using oligonucleotide triphosphates building blocks.
This patent application is currently assigned to Yeda Research and Development Co. Ltd., Yeda Research and Development Co. Ltd.. Invention is credited to Kless, Hadar.
Application Number | 20050287592 11/211444 |
Document ID | / |
Family ID | 35506312 |
Filed Date | 2005-12-29 |
United States Patent
Application |
20050287592 |
Kind Code |
A1 |
Kless, Hadar |
December 29, 2005 |
Template-dependent nucleic acid polymerization using
oligonucleotide triphosphates building blocks
Abstract
A novel use of a template-dependent polymerase. The novel use is
effected by employing the template-dependent polymerase for
incorporating at least one oligonucleotide triphosphate onto a
nascent oligonucleotide-3'-OH in a template-dependent manner.
Inventors: |
Kless, Hadar; (Rechovot,
IL) |
Correspondence
Address: |
MARTIN MOYNIHAN
c/o ANTHONY CASTORINA
SUITE 207
2001 JEFFERSON DAVIS HIGHWAY
ARLINGTON
VA
22202
US
|
Assignee: |
Yeda Research and Development Co.
Ltd.
NuAce Technologies Ltd.
|
Family ID: |
35506312 |
Appl. No.: |
11/211444 |
Filed: |
August 26, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11211444 |
Aug 26, 2005 |
|
|
|
10069236 |
Feb 22, 2002 |
|
|
|
10069236 |
Feb 22, 2002 |
|
|
|
PCT/IL00/00515 |
Aug 29, 2000 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
435/6.1; 435/91.2 |
Current CPC
Class: |
C12Q 1/686 20130101;
C12Q 1/686 20130101; C12P 19/34 20130101; C12Q 2527/125
20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
What is claimed is:
1. A method of amplifying a nucleic acid template, the method
comprising the step of contacting the nucleic acid template with a
nascent oligonucleotide-3'-OH, a template-dependent polymerase and
at least one oligonucleotide triphosphate under conditions in which
said nascent oligonucleotide-3'-OH hybridizes with the nucleic acid
template and said template-dependent polymerase is active in
incorporating said at least one oligonucleotide triphosphate onto a
growing 3'-OH group of said nascent oligonucleotide-3'-OH, thereby
amplifying the nucleic acid template.
2. A method of amplifying a nucleic acid template, the method
comprising the step of contacting the nucleic acid template with a
nascent oligonucleotide-3'-OH, a template-dependent polymerase and
4.sup.N oligonucleotide triphosphates each including N monomers,
wherein N is an integer greater than 1, under conditions in which
said nascent oligonucleotide-3'-OH hybridizes with the nucleic acid
template and said template-dependent polymerase is active in
incorporating said at least one oligonucleotide triphosphate onto a
growing 3'-OH group of said nascent oligonucleotide-3'-OH, thereby
amplifying the nucleic acid template.
3. A method of exponentially amplifying a nucleic acid template,
the method comprising the step of contacting the nucleic acid
template with a pair of nascent oligonucleotides-3'-OH, said
nascent oligonucleotides-3'-OH being hybridizable with opposite
strands of the nucleic acid template, a template-dependent
polymerase and 4.sup.N oligonucleotide triphosphates each including
N monomers, wherein N is an integer greater than 1, under
conditions in which said nascent oligonucleotides-3'-OH hybridize
with said opposite strands of the nucleic acid template and said
template-dependent polymerase is active in incorporating said at
least one oligonucleotide triphosphate onto a growing 3'-OH group
of each of said nascent oligonucleotides-3'-OH, thereby
exponentially amplifying the nucleic acid template.
4. A method of amplifying a nucleic acid template, the method
comprising the step of contacting the nucleic acid template with a
nascent oligonucleotide-3'-OH, a template-dependent polymerase, at
least one oligonucleotide triphosphate and at least one nucleotide
triphosphate, wherein said at least one oligonucleotide
triphosphate and said at least one nucleotide triphosphate are
selected such that at least one monomer of said at least one
oligonucleotide triphosphate is absent from said at least one
nucleotide triphosphate, under conditions in which said nascent
oligonucleotide-3'-OH hybridizes with the nucleic acid template and
said template-dependent polymerase is active in incorporating said
at least one oligonucleotide triphosphate onto a growing 3'-OH
group of said nascent oligonucleotide-3'-OH, thereby amplifying the
nucleic acid template.
Description
RELATED APPLICATIONS
[0001] The present application is a Divisional of U.S. patent
application Ser. No. 10/069,236, filed on Feb. 22, 2002, which is a
U.S. National Phase of PCT Application No. PCT/ILOO/00515, filed on
Aug. 29, 2000, which claims priority of U.S. patent application
Ser. No. 09/387,777, filed on Sep. 1, 1999. The contents of all of
the above-mentioned applications are incorporated herein by
reference.
FIELD AND BACKGROUND OF THE INVENTION
[0002] The present invention relates to a novel activity of
template-dependent polymerases and, more particularly, to the
incorporation of oligonucleotide triphosphates in a
template-dependent manner onto a growing nascent
oligonucleotide-3'-OH group by such polymerases, to methods
exploiting the advantages of the novel activity, to compositions
for implementing the methods and to compounds generated while
implementing the methods. The present invention provides a novel
platform technology, which can be used to develop novel nucleic
acid-based applications for biotechnology and nanotechnology
including, for example, pharmaceutics, biocatalysis and
diagnostics.
[0003] It is well recognized that nucleic acid polymers possess
functional capacities. These qualities may be exemplified in vivo
as specific recognition of tRNA anticodons during translation, and
by splicing activity of ribozymes. In vitro, several systems have
been established from which functional nucleic acid polymers can be
isolated. These methods of in-vitro evolution, termed hereinafter
the directed evolution approach, include SELEX (systematic
evolution of ligands by exponential enrichment) of RNA (Beaudry
& Joyce, 1992) and DNA (Breaker & Joyce, 1994), and
iterative use of combinatorial libraries of oligonucleotides
(Frank, 1995).
[0004] In spite of their poor number of functional groups (i.e.,
four bases in natural nucleotides), nucleic acid polymers may yield
diverse activities such as specific binding affinity to a target
molecule or catalysis of chemical-bonds formation. Recently, the
inclusion of nucleotide analogs bearing alternative combination of
functional groups further extend the vocabulary of nucleic acids,
and establish enzymatic approaches for directed evolution as
efficient technologies for isolation of functional polymers (Eaton,
1997; Benner et al., 1998; Earnshaw & Gait, 1998).
[0005] Naturally-occurring nucleic acid polymers (DNA and RNA)
maintain their basic information in the sequence order and
combination of four distinct nucleotides, identified by their
nitrogenous base moieties adenine and guanine, which are purine
derivatives, and cytosine and thymidine (for DNA) or uracil (for
RNA), which are pyrimidine derivatives (see FIG. 1).
[0006] Information transfer (e.g., DNA-dependent DNA replication,
DNA-dependent RNA transcription, RNA-dependent DNA reverse
transcription and RNA-dependent RNA replication) is performed
enzymatically by mirror copying of the sequence combination in one
polymer to a new polymer according to a binary code known as
complementation, wherein an adenine nucleotide is complementary to
a thymidine nucleotide (or uracil nucleotide) and vice versa,
whereas a guanine nucleotide is complementary to a cytosine
nucleotide and vice versa.
[0007] The genetic binary code, which stores genome information in
all organisms over time, entails a simple information transfer key
based on electrostatic and steric complementation between two pairs
of matching nucleotides. This code has been optimized by natural
evolution as advantageous for reliable transfer of genetic
information between generations of organisms, between cells within
an organism, and between certain complexes and compartments within
cells. For example, genetic information is transferred in
eukaryotes when DNA stored in the nucleus is transcribed to RNA,
which is then translocated to the cytoplasm and translated by the
ribosomal machinery to polypeptides.
[0008] At the down of evolution, the relatively low complexity of
nucleic acid may have been sufficient for the emergence of some
activities that were probably limited to assembly and cleavage of
nucleic acids. Some of these functions are still exercised today in
processes such as splicing and transposition. Later on in
evolution, the low complexity of the binary code was mainly
utilized for transfer and maintenance of genetic information, while
on top of it, a more complex code was developed that dictates
synthesis of additional polymers with enhanced complexity--the
proteins. These polymers are coded by groups of three successive
building blocks of nucleic acids, known as triplet codons, which
are recognized and decoded by the ribosomal protein-translation
machinery. By evolving the triplet codons, a relatively simple
information code in one polymer can be translated and amplified
into a new polymer with versatile and wide functional space. The
increase in functional capacity may have been a major breakthrough
in evolution developments leading to more advanced molecules and
organisms.
[0009] While conceiving the present invention it was realized that
should template-dependent polymerases be able to employ
oligonucleotide triphosphates, instead of, or in addition to,
nucleotide triphosphates as basic building blocks or units for
template-dependent synthesis, the ability to create highly complex
polymers having precisely locatable functional groups, and thereby
better exploiting the information transfer capacity of nucleic
acids in an unprecedented manner exceeding that of nature, will
become available.
[0010] Assume, for example, the sole use of dinucleotide
triphosphates as building blocks for a template-dependent synthesis
of a nucleic acid molecule. Sixteen (2.sup.4) different
dinucleotide triphosphates are available for such synthesis, which
represent all of the possible combinations of the four natural
nucleotide monomers arranged as dimers. The 16 available
dinucleotide triphosphates are: AA-triphosphate (SEQ ID NO:1);
AC-triphosphate (SEQ ID NO:2); AG-triphosphate (SEQ ID NO:3);
AT-triphosphate (SEQ ID NO:4); CA-triphosphate (SEQ ID NO:5);
CC-triphosphate (SEQ ID NO:6); CG-triphosphate (SEQ ID NO:7);
CT-triphosphate (SEQ ID NO:8); GA-triphosphate (SEQ ID NO:9);
GC-triphosphate (SEQ ID NO:10); GG-triphosphate (SEQ ID NO:11);
GT-triphosphate (SEQ ID NO:12); TA-triphosphate (SEQ ID NO:13);
TC-triphosphate (SEQ ID NO:14); TG-triphosphate (SEQ ID NO:15); and
TT-triphosphate (SEQ ID NO:16).
[0011] Further assume that unique functional groups are attached to
some or all of the dinucleotide triphosphates building blocks. In
this case, a polymer can be synthesized having a maximum of 16
available and precisely locatable types of functional groups,
instead of a maximum of only four such groups. It will be
appreciated that the maximal number of unique and precisely
locatable functional groups depends on the number of monomers
employed per oligonucleotide triphosphate. This maximal number
equals 4.sup.N, where N is the number of monomers per
oligonucleotide triphosphate.
[0012] Therefore, the use of oligonucleotide triphosphates by
template-dependent polymerases, instead of, or in addition to,
nucleotide triphosphates as basic building blocks or units for
template-dependent synthesis, makes possible the creation of highly
complex polymers having precisely locatable functional groups.
[0013] Furthermore, if the use of oligonucleotides as building
blocks for nucleic acid synthesis will become feasible, it will be
appreciated that each building block becomes scarcer as compared to
the use of nucleotide triphosphates. This phenomenon increases with
length (N) of the oligonucleotides employed. Thus, assuming equal
representation for each of the four nucleotides in a given nucleic
acid polymer, a particular mononucleotide is expected,
statistically, every 4 nucleotides in this polymer, a dinucleotide
is expected every 16 nucleotides, a trinucleotide every 64
nucleotides (see Table 1, below), a tetranucleotide every 256
nucleotides, a pentanucleotide every 625 nucleotides, and an
oligonucleotide of N-mer is expected every 4.sup.N nucleotides, in
the nucleic acid polymer. Consequently, while using relatively
short oligonucleotide sequences as building blocks for
template-dependent nucleic acid synthesis, not only the total
number of building blocks required for synthesizing a given nucleic
acid sequence is reduced, but also each building block is less
represented. As is further exemplified below, this feature can be
advantageously exploited in detection of nucleic acid sequences and
related applications through template-dependent polymerization.
1TABLE 1 Nucleotide trimers can be arranged in 64 distinct
combinations (SEQ ID NOs: 17-80, from left to right, top to bottom)
AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA
CAC CAG CAT CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC
GAG GAT GCA GCC GCG GCT GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG
TAT TCA TCC TCG TCT TGA TGC TGG TGT TTA TTC TTG TTT
[0014] Previously, dinucleotides were indicated to be involved in
initiation of transcription by RNA polymerase (Shaw et aL, 1980),
or as building-block units in assembly of oligonucleotide through
non-enzymatic means (Leberton et al., 1993; Ordoukhanian &
Taylor, 1997; Schmidt et aL, 1997). In addition, modified
dinucleotides have been used as inhibitors of various viral enzymes
such as reverse transcriptase (Jahnke et al., 1995; Jahnke et al.,
1997) and integrase (Taktakishvili et al., 2000). However,
dinucleotide triphosphates and oligonucleotide triphosphates have
not been shown to be involved, to our knowledge, in relation with
template-dependent enzymatic polymerization of nucleic acids.
[0015] Therefore, there is a widely recognized need for, and it
would be highly advantageous to have, methods for better exploiting
the information transfer capabilities of nucleic acids (Schmidt et
al., 1997; Koppitz et al., 1998; Ogawa et al., 2000), which can
serve as a platform technology for development of molecules with
novel biological activities, and for the development of novel
nucleic acid amplification and identification schemes. Other
applications and advantages of these methods will become apparent
to those of skills in the art while reading the following sections
of the specification.
SUMMARY OF THE INVENTION
[0016] One object of the present invention is to develop a new
approach to augment both information transfer and functional
potential of nucleic acid polymers. According to this novel
approach, using oligonucleotide triphosphates as building blocks
for template-dependent synthesis of nucleic acids, either per se,
or in combination with distinct chemical modifications for the
introduction of functional groups in each or some of these
oligonucleotides, it is possible to extend the information
vocabulary and functional diversity of the polymer in a manner that
is correlated to the number (N) of nucleotide units in each
oligonucleotide triphosphate.
[0017] Another object of the present invention is to develop
nucleic acid libraries and functional nucleic acid polymers of
unprecedented complexity.
[0018] Still another object of the present invention is to develop
template-dependent polymerases capable of efficiently exploiting
oligonucleotide triphosphates for template-dependent synthesis of
nucleic acids.
[0019] Yet another object of the present invention is to develop
new approaches for template-dependent amplification of nucleic
acids.
[0020] Yet another object of the present invention is to develop
new approaches for nucleic acid-based diagnosis.
[0021] Yet another object of the present invention is to develop
new approaches for nucleic acid-based chip technology and
nanotechnology.
[0022] Yet another object of the present invention is to develop
new approaches for directed evolution of nucleic acids and
polypeptides.
[0023] Further and specific objects of the invention include, but
are not limited to: (i) the introduction of a novel use of a
template-dependent polymerase for incorporating oligonucleotide
triphosphates onto a nascent oligonucleotide-3'-OH in a
template-dependent manner; (ii) the development of methods for
identifying a template-dependent polymerase having increased
activity in incorporating oligonucleotide triphosphates onto a
nascent oligonucleotide-3'-OH in a template-dependent manner; (iii)
the development of methods for assaying a template-dependent
polymerase for its activity in incorporating oligonucleotide
triphosphates onto a nascent oligonucleotide-3'-OH in a
template-dependent manner; (iv) the development of methods for
better exploiting the information transfer capacity of nucleic acid
molecules; (v) the development of methods for extending a nascent
oligonucleotide-3'-OH in a template-dependent manner; (vi) the
development of methods for amplifying nucleic acid templates; (vii)
the development of methods for exponentially amplifying nucleic
acid templates; (viii) the development of methods for detecting a
sequence alteration in nucleic acid templates; (ix) the development
of methods for detecting the presence or absence of a sequence
alteration in nucleic acid templates; (x) the development of
methods for determining a sequence of a nucleic acid template; (xi)
the development of nucleic acid libraries and functional nucleic
acid polymers of unprecedented complexity; (xii) the development of
methods for directed evolution of nucleic acids and polypeptides,
(xiii) the development of methods for nucleic acid-based chip
technology and nanotechnology, and (xiv) the development of
compositions for effecting the above methods.
[0024] All and any objects of the present invention as stated above
are made possible by a novel use of a template-dependent
polymerase, the novel use comprising the step of employing the
template-dependent polymerase for incorporating at least one
oligonucleotide triphosphate onto a nascent oligonucleotide-3'-OH
in a template-dependent manner.
[0025] According to further features in preferred embodiments of
the invention described below, the template-dependent polymerase is
selected from the group consisting of DNA-dependent DNA polymerase,
DNA-dependent RNA polymerase, RNA-dependent DNA polymerase and
RNA-dependent RNA polymerase.
[0026] According to still further features in the described
preferred embodiments the template-dependent polymerase is
thermostable.
[0027] According to another aspect of the present invention there
is provided a composition or a plurality of compositions comprising
4.sup.N oligonucleotide triphosphates each having N monomers,
wherein N is an integer greater than 1.
[0028] According to still another aspect of the present invention
there is provided a composition comprising at least one
oligonucleotide triphosphate and at least one nucleotide
triphosphate, wherein the at least one oligonucleotide triphosphate
and the at least one nucleotide triphosphate are selected such that
monomers forming the at least one oligonucleotide triphosphate are
not represented among the at least one nucleotide triphosphate and
vice versa.
[0029] According to further features in preferred embodiments of
the invention described below, each of the oligonucleotide
triphosphates includes at least two monomers. The number of
nucleotide units is preferably up to six, but it may be higher.
[0030] According to one preferred embodiment of the invention, the
at least one oligonucleotide triphosphate is unmodified with
respect to the natural base, sugar, and/or phosphate residues.
[0031] According to still further features in the described
preferred embodiments, at least one of the oligonucleotide
triphosphates is chemically modified in the natural residues of the
base, sugar and/or phosphate or any other intemucleosidyl
linkage.
[0032] The present invention successfully addresses the
shortcomings of the presently known configurations of nucleic acids
as information messengers by exploiting a novel activity of
template-dependent polymerases, i.e., their ability to incorporate,
in a template-dependent manner, an oligonucleotide triphosphate to
a growing 3'-OH group, thereby better exploiting the information
transfer capacity of nucleic acids.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] The invention is herein described, by way of example only,
with reference to the accompanying drawings, wherein:
[0034] FIG. 1 shows the general formula of the natural
2'-deoxynucleoside wherein Base is one of the four natural bases
illustrated in the figure;
[0035] FIG. 2 illustrates the chemical makeup of the
thymidylyl-3'-5'-thymidine dinucleotide triphosphate form, TpT3p
(SEQ ID NO:16);
[0036] FIG. 3 is a schematic representation of the polymerization
assay for detecting incorporation of a dinucleotide triphosphate.
Step I: primer extension using primer T7, template T1, DNA
polymerase and the deoxynucleotides dATP, dCTP and dGTP in the
presence (left) or absence (right) of TpT3P. Step II: treatment of
the products from the previous step with Exo VII to eliminate
ss-DNA regions. Step III: PCR amplification of the products from
the previous step using primers T7 and B, and a connecting
fragment, T2, that overlaps with the extended portion of T1 (bold
line). This portion of T1 contains a run of 3, 4 or 5 A's (in
oligonucleotides T1-3, T1-4 and T1-5, respectively; see Table 2),
flanked (on its 5' side) by a non-A containing region. PCR
amplification in step III will occur only if the extension
proceeded to the end of T1 on step I;
[0037] FIG. 4 shows photographs of agarose gels that illustrate the
polymerization assay using the templates T1-4, T1-3 or T1-5 (see
Table 2). The reactions in step I (lanes a-e) contained; a: all
four dNTP's; b: no dNTP's; c: dATP, dCTP and dGTP; d: as in c, but
with 3.mu.M, of TpT3p, e: no T1 template; f-g: PCR of step III with
and without T1 template, respectively;
[0038] FIG. 5 provides an example of implementing the present
invention for distinguishing between gene sequences of a wild type
(A, SEQ ID NO:87) and a mutant (B, SEQ ID NO:88) containing a
single point mutation (T to G, underlined). The sequences can be
replicated from a specific primer at the 5' end (not shown) using
the two given sets of dinucleotide combinations and a DNA
polymerase. Set I supports complete amplification of A, but not of
B due to the presence and absence of the dinucleotides AC and CC,
respectively. Accordingly, set II is suitable only for the
amplification of sequence B but not of A. The amplified products
can be separated from the reaction to indicate which sequence, wild
type, mutant or both, are present;
[0039] FIG. 6 shows an assay of labeled-primer extension
demonstrating incorporation of the dinucleotide triphosphates TpT3p
and CpA3p in a template-dependent manner onto a 3' end of a primer.
The reactions includes labeled primer p201 (SEQ ID NO:92) and
templates T80 (SEQ ID NO:93) (lanes 1-4), and T81 (SEQ ID NO:94)
(lanes 5-7). The nucleotides content in these reactions is: none
(lane 1), all 4 dNTP's (lane 2), CpA3p (lanes 3 and 5), CpA3p and
TpT3p (lanes 4, 6 and 7). The reaction in lane 7 contains two fold
the concentration of dinucleotides as is compared to that of lane
6;
[0040] FIG. 7 shows an assay of labeled-primer extension
demonstrating incorporation of di-and trinucleotide triphosphates
in a template-dependent manner onto a 3' end of a primer. The
reactions include labeled primer p201 (SEQ ID NO:92) and template
T24 (SEQ ID NO:96). The nucleotide content in these reactions is:
none (lane 1), all 4 dNTP's (lane 2), dCTP and dATP (lane 3), dCTP,
dATP and TpT3p (lane 4), dCTP, dATP and TpTpT3p (lane 5), CpA3p
(lane 6), and CpC3p (lane 7); and
[0041] FIG. 8 shows an assay of labeled-primer extension
demonstrating template-dependent incorporation of ApG3p and TpC3p
dinucleotides. The reactions include labeled primer p201 (SEQ ID
NO:92) and template T83 (SEQ ID NO:95). The nucleotide content in
these reactions is: all 4 dNTP's (lane 1) and ApG3p and TpC3p
dinucleotides (lane 2).
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0042] The present invention is of (i) a novel use of a
template-dependent polymerase for incorporating oligonucleotide
triphosphates onto a nascent oligonucleotide-3'-OH in a
template-dependent manner; (ii) methods for identifying a
template-dependent polymerase having increased activity in
incorporating oligonucleotide triphosphates onto a nascent
oligonucleotide-3'-OH in a template-dependent manner; (iii) methods
for assaying a template-dependent polymerase for its activity in
incorporating oligonucleotide triphosphates onto a nascent
oligonucleotide-3'-OH in a template-dependent manner; (iv) methods
for better exploiting the information transfer capacity of a
nucleic acid molecule; (v) methods for extending a nascent
oligonucleotide-3'-OH in a template-dependent manner; (vi) methods
for amplifying a nucleic acid template; (vii) methods for
exponentially amplifying a nucleic acid template; (viii) methods
for detecting a sequence alteration in a nucleic acid template;
(ix) methods for detecting the presence or absence of a sequence
alteration in a nucleic acid template; (x) methods for determining
a sequence of a nucleic acid template; (xi) nucleic acid libraries
and functional nucleic acid polymers of unprecedented complexity
and functional space; (xii) methods for directed evolution of
nucleic acids and polypeptides; (xiii) methods for nucleic
acid-based chip technology and nanotechnology, and (xiv)
compositions for effecting the above methods.
[0043] The present invention can be used to augment the information
transfer capacity and functionality of nucleic acids in a yet
unprecedented manner. The present invention can be used as a
platform technology for the development of novel nucleic acid-based
applications in biotechnology and nanotechnology.
[0044] The principles and operation of the present invention may be
better understood with reference to the drawings and accompanying
descriptions.
[0045] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not limited
in its application to the details of construction and the
arrangement of the components set forth in the following
description or illustrated in the drawings. The invention is
capable of other embodiments or of being practiced or carried out
in various ways. Also, it is to be understood that the phraseology
and terminology employed herein is for the purpose of description
and should not be regarded as limiting.
[0046] According to one aspect of the present invention there is
provided a novel use of a template-dependent polymerase. The novel
use, according to this aspect of the present invention, comprises
the step of employing the template-dependent polymerase for
incorporating at least one oligonucleotide triphosphate onto a
nascent oligonucleotide-3'-OH in a template-dependent manner.
[0047] As used herein in the specification and in the claims
section that follows, the phrase "template-dependent polymerase"
refers to one or more of a structurally diverse group of
nucleotidyl-transferase enzymes that catalyze template-dependent
extension of nucleic acid polymers, including DNA-dependent DNA
polymerases (E.C. 2.7.7.7), DNA-dependent RNA polymerases (E.C.
2.7.7.6), RNA-dependent DNA polymerases (E.C. 2.7.7.49), and
RNA-dependent RNA polymerase (E.C. 2.7.7.48). Non-limiting examples
of widely employed template-dependent polymerases include T7 DNA
polymerase of the phage T7 and T3 DNA polymerase of the phage T3
which are DNA-dependent DNA polymerases, T7 RNA polymerase of the
phage T7 and T3 RNA polymerase of the phage T3 which are
DNA-dependent RNA polymerases, DNA polymerase I or its fragment
known as Klenow fragment of Escherichia coli which is a
DNA-dependent DNA polymerase, Thermophilus aquaticus DNA
polymerase, Tth DNA polymerase and vent DNA polymerase, which are
thermostable DNA-dependent DNA polymerases, eukaryotic DNA
polymerase .beta., which is a DNA-dependent DNA polymerase,
telomerase which is a RNA-dependent DNA polymerase, and non-protein
catalytic molecules such as modified RNA (ribozymes; Unrau &
Bartel, 1998) and DNA with template-dependent polymerase
activity.
[0048] Since every living organism contains template-dependent
polymerases, the term also refers to such polymerases still
awaiting to be uncovered.
[0049] In addition, a template-dependent polymerase according to
the present invention can be of a natural source, i.e., purified
from an organism producing it, or from a recombinant source. Since
the genes of the above listed polymerases have been cloned, most of
these enzymes are available as recombinant proteins expressed in
heterologous expression systems. Yet, it will be appreciated that
these genes can be employed to devise methodologies for the
isolation of other genes encoding polymerases based on sequence,
structural and/or functional similarities or homologies using one
or more approaches such as, but not limited to, nucleic acid
libraries screening, expression-libraries screening, antibody-based
screening, nucleic acid-based hybridization screening, functional
screening, polymerase chain-reaction amplification, and the like;
the implementation of which for the isolation of desired nucleic
acids is well known by the skilled artisan.
[0050] As used herein in the specification and in the claims
section that follows, the phrases "nascent oligonucleotide-3'-OH"
relates to a growing nucleic acid chain having a hydroxyl group at
its 3' end. Such a chain may include any number of nucleotides as
this term is further defined below. In some cases, even a single
nucleotide having a 3'-OH group can serve as an initiator of
nascent oligonucleotide-3'-OH. This is particularly true for some
RNA-dependent RNA polymerases. Therefore, the term includes nucleic
acid chains of at least one nucleotide having a hydroxyl group at
its 3' end.
[0051] As used herein in the specification and in the claims
section that follows, the phrases "oligonucleotide triphosphate" or
in plural "oligonucleotide triphosphates" include single-stranded
chains of at least two nucleotides connected via 3'.fwdarw.5'
intemucleosidyl linkages, and which have a triphosphate group
attached to the 5' end of the first nucleotide as illustrated in
FIG. 2.
[0052] As used herein in the specification and in the claims
section that follows, the terms "nucleotide" or in plural
"nucleotides" which are interchangeably used with the terms
"monomer" or in plural "monomers" include native (naturally
occurring) nucleotides, which include a nitrogenous base selected
from the group consisting of adenine, thymidine, cytosine, guanine
and uracil, a sugar selected from the group of ribose and
deoxyribose (the combination of the base and the sugar is known as
nucleoside), and one to three phosphate groups, and which can form
phosphodiester intemucleosidyl linkages. However, these terms, as
used herein, further include nucleotide analogs. Such analogs can
have a sugar analog, a base analog and/or an intemucleosidyl
linkage analog. In addition, analogs exhibiting non-standard base
pairing, such as described in, for example, U.S. Pat. No.
5,432,272, which is incorporated herein by reference, is also
included under these terms. Thus, as used herein these terms read
on molecules capable of, while incorporated in a polymer,
conventional or unconventional pairing via hydrogen bonding with
naturally occurring nucleotides or with nucleotide analogs
exhibiting non standard base pairing and which are present in a
complementary polymer.
[0053] As used herein in the specifications and in the claims
section that follows, the term "nucleotide analog" includes
nucleotides that are chemically modified in the natural base
(hereinafter "base analogs"), in the natural sugar (hereinafter
"sugar analogs"), and/or in the natural phosphodiester or any other
intemucleosidyl linkage (hereinafter "internucleosidyl linkage
analogs").
[0054] The nucleotide analogs of the invention may bear at least
one functional group selected from: (i) a chemically-reactive group
being a group involved in formation or cleavage of any form of a
chemical interaction involving electron, proton, or charge transfer
including, but not being limited to, a nucleophile, a hydrogen-bond
donor, a hydrogen-bond acceptor, an acid, a base, a charged moiety,
a hydrophilic moiety, a metal ligand, and a leaving group; (ii) a
chemically-inert group being a group involved in interactions that
have no electron, proton, or charge transfer, but that may have a
structural role, including, but not being limited to, a hydrophobic
moiety; (iii) a cross-linking group; (iv) a labeling group, and (v)
a first binding-group of a binding pair, which are related to each
other by specific binding affinity.
[0055] The functional group as above may be linked directly to the
base, sugar, or intemucleosidyl linkage, or through a spacer, so as
to reduce steric hindrance that may interfere with binding to the
polymerase and/or with pairing to the template.
[0056] It will be appreciated that a variety of functional groups
have been successfully bound to nucleotides. It will further be
appreciated that such binding did not hamper the ability of
template-dependent polymerases to employ nucleotides derivatized by
such functional groups as building blocks for template-dependent
nucleic acid synthesis.
[0057] A first binding group of a binding pair can be any member of
a binding pair, such as, but not limited to,
biotin-avidin/streptavidin, ligand-receptor,
antigen/hapten-antibody, magnetized bead-magnet/electromagnet,
substrate analog-enzyme, metal ion-chelator, and the like. The
first binding group of the binding pair is preferably selected the
smaller one, so as to minimize steric hindrance. In the listed
examples, the smaller binding pairs are biotin of the
biotin-avidin/streptavidin pair, ligand of the ligand-receptor
pair, antigen/hapten of the antigen/hapten (e.g.,
digoxygenin)-antibody pair, magnetized bead of the magnetized
bead-magnet/electromagnet pair, substrate analog of the substrate
analog-enzyme pair, and metal ion of the metal ion-chelator
pair.
[0058] It will be appreciated that a variety of binding groups,
such as, but not limited to, biotin, the antigen digoxygenin and
magnetized beads have been successfully bound to nucleotides. It
will further be appreciated that such binding did not hamper the
ability of template-dependent polymerases to employ nucleotides
derivatized by binding groups as building blocks for
template-dependent synthesis of nucleic acids.
[0059] A cross-linking group is a reactive group capable of
covalently bonding to another group when appropriate proximity and
orientation are established between the groups. A cross-linking
group can be selected non-reactive unless activated by an external
stimuli, such as radiation of the appropriate wavelength or
wavelength range or a chemical. Examples of cross-linking groups
which can be bound to a nucleotide include, but are not limited to
brominated and iodinated nucleotides such as 5'-bromodeoxyuridine,
8'-bromodeoxyadenosine and 5'-iododeoxycitidine, or
thiol-containing nucleotides such as 6'-thiodeoxyguanosine, and
4'-thiodeoxyuridine and additional cross-linking groups as
described in Eaton, (1997); Benner et al., (1998); Earnshaw &
Gait, (1998) and Sakthivel & Barbas (1998).
[0060] It will be appreciated that a variety of cross-linking
groups have been successfully bound to nucleotides. It will further
be appreciated that such binding did not hamper the ability of
template-dependent polymerases to employ nucleotides derivatized by
such cross-linking groups as building blocks for template-dependent
synthesis of nucleic acids.
[0061] A labeling group according to the present invention can be a
direct labeling group, i.e., a labeling group which is directly
detectable (detectable per se). Examples of direct labeling groups
which can be used according to the present invention to label one
or more nucleotides of an oligonucleotide triphosphate can be an
isotope such as a radioactive isotope, including, but not limited
to, .sup.14C, .sup.32P, .sup.31P, .sup.2H, .sup.3H, .sup.35S,
.sup.125I and the like. The isotope can replace a common isotope
participating in the chemical makeup of the nucleotide or,
alternatively, the isotope can be added in addition to the atoms
constituting the chemical makeup of the nucleotide. A direct
labeling group can also be a colorant, e.g., a fluorescent or
luminescent group, such as, but not limited to, SpectrumOrange.TM.
(emission at 588 nm), SpectrumGreen.TM. (538 nm), Aqua (480 rim),
Texas-Red (615 nm), and fluorescein-5-iso-thiocyanate (FITC, 525
nm).
[0062] A labeling group according to the present invention can
alternatively be an indirect labeling group, i.e., a labeling group
which is indirectly detectable. It will be appreciated, for
example, that any of the above-described binding groups can also
serve as an indirect labeling group according to the present
invention. In this case, the second binding pair is preferably
labeled by a direct labeling group or by an additional indirect
labeling group that binds its pair, which is labeled, by a direct
labeling group. Alternatively, an indirect labeling group can be an
enzyme which directly or indirectly catalyzes a color or
chemoluminescent reaction, such as, but not limited to, alkaline
phosphatase or peroxidase.
[0063] It will be appreciated that a variety of labeling groups has
been successfully bound to nucleotides. It will further be
appreciated that such binding did not hamper the ability of
template-dependent polymerases to employ nucleotides derivatized by
such labeling groups as building blocks for template-dependent
nucleic acid synthesis.
[0064] Examples of base analogs that can be used according to the
invention include, but are not limited to, modified purine and
pyrimidine bases such as, for example, O-methyl, C-methyl,
N-methyl, deaza, aza, halo (F, Br, I), thio, oxo, aminopropenyl,
amino, acyl, propynyl, pentynyl, and etheno base derivatives, as
well as more drastic modifications such as replacement of the base
by phenyl and even complete deletion of the base (abasic), and
additional analogs as described in Eaton, (1997); Benner et al.,
(1998); Eamshaw & Gait, (1998) and Sakthivel & Barbas
(1998).
[0065] Examples of sugar analogs that can be used according to the
invention include, but are not limited to, modifications of the
.beta.-ribofuranosyl and .beta.-2'-deoxyribofuransyl sugar residues
such as, for example, 2'-O-methyl, 2'-O-allyl, 2'-O-amino,
2'-deoxy-2'-halo (F, Cl, Br, I), 2'-deoxy-2'-thio,
2'-deoxy-2'-amino and dideoxy derivatives, as well as corresponding
.alpha.-anomers and hexose analogs, and additional analogs as
described in Eaton, (1997); Benner et aL, (1998); Earnshaw &
Gait, (1998); Groebke et al., (19) and Sakthivel & Barbas
(1998).
[0066] Examples of internucleosidyl analogs that can be used
according to the invention include, but are not limited to, those
in which the natural phosphodiester linkage is replaced by a
linkage such as phosphorothioate, phosphorodithioate,
phosphoroamidate, methylphosphonate, and additional analogs as
described in Eaton, (1997); Benner et al., (1998); Earnshaw &
Gait, (1998) and Sakthivel & Barbas (1998).
[0067] Also can be used peptide nucleic acids (PNA), in which the
entire phosphate-sugar backbone is replaced with a backbone
consisting of (2-aminoethyl) glycine units to which bases are
attached through methylenecarbonyl bridges.
[0068] As used herein in the specification and in the claims
section that follows, the phrases "template-dependent manner" or
"template-dependent synthesis of nucleic acids" refer to successive
polymerization of oligonucleotide triphosphates or of
oligonucleotide triphosphates and nucleotide triphosphates in a
fashion dictated by the sequence order of a complementary
template.
[0069] In order to better suit the applications proposed herein for
the present invention, the polymerization activities of
template-dependent polymerases are preferably improved in terms of
efficiency and specificity. This can be achieved by modifying
certain protein components involved in the catalytic activity of
such polymerases.
[0070] The rational for engineering polymerase activities is based
on available structural and functional information thereof (Joyce
and Steitz, 1994; Steitz et al., 1996; Kiefer et al., 1998; Li et
al., 1998). The active site of the polymerase provides the specific
binding-environment for the substrates including a single-strand
template, a complementary primer, divalent metal ions and a
matching (complementary) nucleotide triphosphate unit. Specific
interactions in the active site are mostly governed by steric and
electrostatic factors. As the reaction seems not to go through
covalent intermediates, these interactions provide all the
physical, chemical and energetic requirements for high fidelity and
processive polymerase activity.
[0071] The chemistry involves attack of the 5'-.alpha.-phosphate of
the incoming nucleotide on the 3'-OH group of the end terminal
nucleotide of the nascent oligonucleotide, which is deprotonated
via the metal ions. This is accompanied by hydrolysis of the
triphosphate, release of a pyrophosphate and formation of a
phosphodiester bond that extends the primer by one nucleotide at a
time.
[0072] Polymerase activity further involves major conformational
changes of the fingers domain that alternate between "closed" and
"open" forms (in the presence and absence of a matching nucleotide
triphosphate, respectively), which facilitate alternating between
substrate binding, chemical reaction and enzyme sliding along the
nucleic acid template.
[0073] Protein modifications could conceivably include, but are not
limited to, replacements, deletions and insertions of amino acid
residues in specific or random locations of the enzyme. As it is
presently impractical to anticipate in advance which amino acid
modifications will be responsible for functional adjustment, a
semi-rational approach for engineering the polymerase is
envisioned. Based on the crystal structure available for the large
fragment of, for example, Taq DNA polymerase (Li et al., 1998) and
other polymerases (Singh & Modak, 1998; Doubli et al., 1999), a
set of enzyme domains are chosen for modifications. For example,
such domains in Taq DNA polymerase include the O helix of the
fingers region (Li et al., 1998; Morales & Kool, 1999).
Modifications are introduced into the corresponding gene regions
which are cloned in suitable expression vectors by, for example,
directed evolution means involving random point-mutations in the
chosen domain regions, random shuffling of fragments of part or the
whole gene, and family shuffling of genes having similar sequences
(Stemmer, 1994; Crameri et al., 1998; Zhao et al., 1998; Minshull
& Stemmer, 1999). These generate a library of polymerase genes
expressing many different "versions" of the original enzyme, of
which individual clones are identified and selected according to
specific selection measures.
[0074] The main functional goal for polymerase modifications is to
improve catalytic efficiency of template-dependent incorporation of
oligonucleotide triphosphates. This is the basis for selecting the
most proficient enzymes from the diverged library. Proteins
expressed from the library are divided into several batches, which
are used in a polymerase selection-assay that is further described
below. In one step of this assay, the concentration of the
appropriate nucleotide units and the reaction time are monitored to
select for the best enzyme variants. Chosen clones are further
modified by consecutive iterations of the same engineering approach
until the desired efficiency is reached.
[0075] Thus, it will be appreciated that although
template-dependent polymerases are in general tolerant to the use
of nucleotide analogs and/or nucleotides derivatized with
functional groups, their affinity toward certain analogs and
derivatives may be altered. Furthermore, while reducing the present
invention to practice, as is exemplified in the Examples section
that follows, it was realized that, for example, a certain
polymerase has affinity to a certain oligonucleotide triphosphate
which is inferior as is compared to its affinity to nucleotide
triphosphates in catalyzing the incorporation of these building
blocks onto a growing 3'-OH group of a nascent
oligonucleotide-3'-OH in a template-dependent manner.
[0076] Therefore, according to yet another aspect of the present
invention there is provided a method of identifying a
template-dependent polymerase having increased activity in
incorporating oligonucleotide triphosphates onto a nascent
oligonucleotideb-3'-OH in a template-dependent manner, the method
comprising implementation of the following method steps, of which,
in a first step, a library of mutated template-dependent
polymerases is constructed.
[0077] Such construction can be effected, for example, by mutating
(e.g., randomly mutating) a gene encoding the template-dependent
polymerase by nucleotide alteration, deletion, addition, shuffling,
etc., to obtain a repertoire of mutated template-dependent
polymerases genes which encode a repertoire of mutated
template-dependent polymerases. Such polymerases can then be
expressed by, for example, bacteria or eukaryotic cells, by methods
known in the art. In a second step of the method according to this
aspect of the present invention, the library, of proteins of
individual clones or of pooled clones is screened using
template-dependent polymerization of oligonucleotide triphosphates
for selecting a template-dependent polymerase mutant exhibiting
increased activity in incorporating the oligonucleotide
triphosphates onto the nascent oligonucleotide-3'-OH in a
template-dependent manner.
[0078] An assay for template-dependent polymerization of
oligonucleotide triphosphates can be effected in any one of a
plurality of ways. The Examples section that follows demonstrate
template-dependent polymerization of oligonucleotide triphosphates
that can be used with individual or pooled protein extracts, and
with purified or partially purified mutant polymerases.
[0079] Once a template-dependent polymerase mutant exhibiting
increased activity in incorporating oligonucleotide triphosphates
onto a nascent oligonucleotide-3'-OH in a template-dependent manner
is identified, such a polymerase may serve for a second round of
mutating and screening as described above.
[0080] Thus, according to a preferred embodiment of this aspect of
the present invention, the method is further effected and polished
by using the template-dependent polymerase mutant identified above
as a basis for creating a second library of mutated
template-dependent polymerases derived therefrom and screening the
second library using template-dependent polymerization of
oligonucleotide triphosphates for selecting a second
template-dependent polymerase mutant demonstrating yet increased
activity in incorporating the oligonucleotide triphosphates onto
the nascent oligonucleotide-3'-OH in a template-dependent
manner.
[0081] According to still further features in the described
preferred embodiments the library of mutated template-dependent
polymerases is created using random mutagenesis, random fragments
shuffling and/or gene-family shuffling of genes corresponding to
protein fragments and/or domains.
[0082] According to an additional aspect of the present invention
there is provided a method of assaying a template-dependent
polymerase for its activity in incorporating oligonucleotide
triphosphates onto a nascent oligonucleotide-3'-OH in a
template-dependent manner, the method comprising the step of using
template-dependent polymerization of oligonucleotide triphosphates
for assaying the template-dependent polymerase for its activity in
incorporating oligonucleotide triphosphates onto the nascent
oligonucleotide-3'-OH in a template-dependent manner.
[0083] Oligonucleotide triphosphates may be mixed into
compositions, which are useful in implementing the methods of the
present invention as are further described below.
[0084] Thus, according to another aspect of the present invention
there is provided a composition or a plurality of individually
packed compositions forming a kit comprising 4.sup.N
oligonucleotide triphosphates each having N monomers in a single
mix or any combination of sub-mixes, wherein N is an integer
greater than 1.
[0085] Thus, if N equals 2 (dinucleotide), 16 different
oligonucleotide triphosphates are included in the single mix or any
combination of the sub-mixes; if N equals 3 (trinucleotide), 64
different oligonucleotide triphosphates are included in the single
mix or any combination of the sub-mixes; if N equals 4
(tetranucleotide), 256 different oligonucleotide triphosphates are
included in the single mix or any combination of the sub-mixes; if
N equals 5 (pentanucleotide), 1024 different oligonucleotide
triphosphates are included in the single mix or any combination of
the sub-mixes; whereas if N equals 6 (hexanucleotide), 4096
different oligonucleotide triphosphates are included in the single
mix or any combination of the sub-mixes; and so on.
[0086] However, compositions according to the present invention may
include oligonucleotide triphosphates and also combinations of
oligonucleotide triphosphates and nucleotide triphosphates.
[0087] Of particular interest are compositions including at least
one oligonucleotide triphosphate and at least one nucleotide
triphosphate, wherein the at least one oligonucleotide triphosphate
and the at least one nucleotide triphosphate are selected such that
monomers forming the at least one oligonucleotide triphosphate are
not represented among the at least one nucleotide triphosphate and
vice versa. As further detailed below, such compositions may find
use in, for example detection of sequence alterations in a nucleic
acid template.
[0088] Oligonucleotide triphosphates may be attached on a solid
support, which are useful in implementing the methods of the
present invention as are further described below.
[0089] Thus, according to another aspect of the present invention
there is provided a setup, in which at least one of the
oligonucleotide triphosphates, used for template-dependent
polymerization, is attached onto a solid support as part of, for
example, a nanodevice or a DNA chip.
[0090] The following provides detailed description of some methods,
which can find uses in pharmaceutics, biocatalysis, diagnostics,
and nanotechnology according to the present invention.
[0091] Thus, according to still an additional aspect of the present
invention there is provided a method of extending a nascent
oligonucleotide-3'-OH in a template-dependent manner, the method
comprising the step of contacting the nascent oligonucleotide-3'-OH
with a nucleic acid template, a template-dependent polymerase and
at least one oligonucleotide triphosphate under conditions in which
the nascent oligonucleotide-3'-OH hybridizes with the nucleic acid
template and the template-dependent polymerase is active in
incorporating the at least one oligonucleotide triphosphate onto a
growing 3'-OH group of the nascent oligonucleotide-3'-OH, thereby
extending the nascent oligonucleotide-3'-OH in a template-dependent
manner.
[0092] According to a further aspect of the present invention there
is provided still another method of extending a nascent
oligonucleotide-3'-OH in a template-dependent manner, the method
comprising the step of contacting the nascent oligonucleotide-3'-OH
with a nucleic acid template, a template-dependent polymerase and
4.sup.N oligonucleotide triphosphates, each including N monomers,
wherein N is an integer greater than 1, under conditions in which
the nascent oligonucleotide-3'-OH hybridizes with the nucleic acid
template and the template-dependent polymerase is active in
incorporating said oligonucleotide triphosphates onto a growing
3'-OH group of the nascent oligonucleotide-3'-OH, thereby extending
the nascent oligonucleotide-3'-OH in a template-dependent
manner.
[0093] According to yet a further aspect of the present invention
there is provided yet another method of extending a nascent
oligonucleotide-3'-OH in a template-dependent manner, the method
comprising the step of contacting the nascent oligonucleotide-3'-OH
with a nucleic acid template, a template-dependent polymerase, at
least one oligonucleotide triphosphate and at least one nucleotide
triphosphate, wherein the at least one oligonucleotide triphosphate
and the at least one nucleotide triphosphate are selected such that
at least one monomer of the at least one oligonucleotide
triphosphate is absent from the at least one nucleotide
triphosphate, under conditions in which the nascent
oligonucleotide-3'-OH hybridizes with the nucleic acid template and
the template-dependent polymerase is active in incorporating the at
least one oligonucleotide triphosphate and the at least one
nucleotide triphosphate onto a growing 3'-OH of the nascent
oligonucleotide-3'-OH, thereby extending the nascent
oligonucleotide-3'-OH in a template-dependent manner.
[0094] According to still a further aspect of the present invention
there is provided a method of amplifying a nucleic acid template,
the method comprising the step of contacting the nucleic acid
template with a nascent oligonucleotide-3'-OH, a template-dependent
polymerase and at least one oligonucleotide triphosphate under
conditions in which the nascent oligonucleotide-3'-OH hybridizes
with the nucleic acid template and the template-dependent
polymerase is active in incorporating the at least one
oligonucleotide triphosphate onto a growing 3'-OH group of the
nascent oligonucleotide-3'-OH, thereby amplifying the nucleic acid
template.
[0095] According to another aspect of the present invention there
is provided another method of amplifying a nucleic acid template,
the method comprising the step of contacting the nucleic acid
template with a nascent oligonucleotide-3'-OH, a template-dependent
polymerase and 4.sup.N oligonucleotide triphosphates each including
N monomers, wherein N is an integer greater than 1, under
conditions in which the nascent oligonucleotide-3'-OH hybridizes
with the nucleic acid template and the template-dependent
polymerase is active in incorporating the at least one
oligonucleotide triphosphate onto a growing 3'-OH group of the
nascent oligonucleotide-3'-OH, thereby amplifying the nucleic acid
template.
[0096] According to still another aspect of the present invention
there is provided still another method of amplifying a nucleic acid
template, the method comprising the step of contacting the nucleic
acid template with a nascent oligonucleotide-3'-OH, a
template-dependent polymerase, at least one oligonucleotide
triphosphate and at least one nucleotide triphosphate, wherein the
at least one oligonucleotide triphosphate and the at least one
nucleotide triphosphate are selected such that at least one monomer
of the at least one oligonucleotide triphosphate is absent from the
at least one nucleotide triphosphate, under conditions in which the
nascent oligonucleotide-3'-OH hybridizes with the nucleic acid
template and the template-dependent polymerase is active in
incorporating the at least one otriphosphate onto a growing 3'-OH
group of the nascent oligonucleotide-3'-OH, thereby amplifying the
nucleic acid template.
[0097] According to an additional aspect of the present invention
there is provided a method of exponentially amplifying a nucleic
acid template, the method comprising the step of contacting the
nucleic acid template with a pair of nascent
oligonucleotides-3'-OH, the nascent oligonucleotides-3'-OH being
hybridizable with opposite strands of the nucleic acid template, a
template-dependent polymerase and 4.sup.N oligonucleotide
triphosphates each including N monomers, wherein N is an integer
greater than 1, under conditions in which the nascent
oligonucleotides-3'-OH hybridize with the opposite strands of the
nucleic acid template and the template-dependent polymerase is
active in incorporating the at least one oligonucleotide
triphosphate onto a growing 3'-OH group of each of the nascent
oligonucleotides-3'-OH, thereby exponentially amplifying the
nucleic acid template.
[0098] As further described below, a given gene sequence of
interest may be compared to that of a mutant containing one or more
base alterations. Using the present invention, a short region near
the mutation may be replicated by a polymerase starting from a
specific oligonucleotide-3'-OH hybridized thereto. Oligonucleotide
triphosphates used for the reaction are doped to fully complement
only one of the target sequences, while the oligonucleotide
triphosphates that complement the other sequence is omitted from
the reaction. The discriminating oligonucleotide triphosphates
preferably contain a unique functional group, such as a labeling
group as further described above, so as to favor specific
recognition of the polymerized products, if any.
[0099] An example of the following concept is illustrated in FIG.
5.
[0100] In this case, gene sequences of a wild type (A, SEQ ID
NO:87) and a mutant (B, SEQ ID NO:88) containing a single point
mutation (T to G, underlined) are analyzed. The sequences can be
replicated from a specific primer at the 5' end using the two given
sets of dinucleotide combinations and a DNA polymerase. Set I
supports complete amplification of A, but not of B due to the
presence and absence of the dinucleotides AC and CC, respectively.
Accordingly, set II is suitable only for the amplification of
sequence B but not of A. The amplified products can be separated
from the reaction to indicate which sequence, wild type, mutant or
both are present.
[0101] Thus, according to yet another aspect of the present
invention there is provided a method of detecting a sequence
alteration in a nucleic acid template, the method comprising the
step of contacting a nascent oligonucleotide-3'-OH with the nucleic
acid template, a template-dependent polymerase and at least one
oligonucleotide triphosphate under conditions in which the nascent
oligonucleotide-3'-OH hybridizes with the nucleic acid template and
the template-dependent polymerase is active in incorporating the at
least one oligonucleotide triphosphate onto a growing 3'-OH group
of the nascent oligonucleotide-3'-OH, thereby extending the nascent
oligonucleotide-3'-OH in a template-dependent manner, wherein the
at least one oligonucleotide triphosphate is selected so as to
enable extending the nascent oligonucleotide-3'-OH in a
template-dependent manner only if the sequence alteration is
present, or in the alternative, only if the sequence alteration is
absent.
[0102] According to yet an additional aspect of the present
invention there is provided yet an additional method of detecting a
sequence alteration in a nucleic acid template, the method
comprising the step of contacting the nascent oligonucleotide-3'-OH
with a nucleic acid template, a template-dependent polymerase, at
least one oligonucleotide triphosphate and at least one nucleotide
triphosphate, wherein the at least one oligonucleotide triphosphate
and the at least one nucleotide triphosphate are selected such that
at least one monomer of the at least one oligonucleotide
triphosphate is absent from the at least one nucleotide
triphosphate, under conditions in which the nascent
oligonucleotide-3'-OH hybridizes with the nucleic acid template and
the template-dependent polymerase is active in incorporating the at
least one oligonucleotide triphosphate onto the 3'-OH group of the
nascent oligonucleotide-3'-OH, thereby extending the nascent
oligonucleotide-3'-OH in the template-dependent manner, wherein the
at least one oligonucleotide triphosphate is selected so as to
enable extending the nascent oligonucleotide-3'-OH in the
template-dependent manner only if the sequence alteration is
present, or in the alternative, only if the sequence alteration is
absent.
[0103] According to still an additional aspect of the present
invention there is provided still an additional method of detecting
the presence or absence of a sequence alteration in a nucleic acid
template, the method comprising the steps of: (a). contacting the
nucleic acid template with a nascent oligonucleotide-3'-OH, a
template-dependent polymerase and at least one oligonucleotide
triphosphate under conditions in which the nascent
oligonucleotide-3'-OH hybridizes with the nucleic acid template and
the template-dependent polymerase is active in incorporating the at
least one oligonucleotide triphosphate onto a growing 3'-OH group
of the nascent oligonucleotide-3'-OH if appropriate base pairing
exists between the nucleic acid template and the oligonucleotide
triphosphate, and the template-dependent polymerase is
substantially inactive in incorporating the at least one
oligonucleotide triphosphate onto the growing 3'-OH group of the
nascent oligonucleotide-3'-OH if appropriate base pairing fails to
exist between the nucleic acid template and the at least one
oligonucleotide triphosphate; and (b) detecting whether the at
least one oligonucleotide triphosphate is incorporated onto the
growing 3'-OH group of the nascent oligonucleotide-3'-OH, thereby
detecting the presence or absence of the sequence alteration in the
nucleic acid template.
[0104] According to a further aspect of the present invention there
is provided a further method of detecting the presence or absence
of a sequence alteration in a nucleic acid template, the method
comprising the steps of: (a) contacting the nucleic acid template
with a nascent oligonucleotide-3'-OH, a template-dependent
polymerase, at least one oligonucleotide triphosphate and at least
one nucleotide triphosphate, wherein the at least one
oligonucleotide triphosphate and the at least one nucleotide
triphosphate are selected such that at least one monomer of the at
least one oligonucleotide triphosphate is absent from the at least
one nucleotide triphosphate, under conditions in which the nascent
oligonucleotide-3'-OH hybridizes with the nucleic acid template and
the template-dependent polymerase is active in incorporating the at
least one oligonucleotide triphosphate and the at least one
nucleotide triphosphate onto a growing 3'-OH group of the nascent
oligonucleotide-3'-OH if appropriate base pairing exists between
the nucleic acid template and the at least one oligonucleotide
triphosphate, and the template-dependent polymerase is
substantially inactive in incorporating the at least one
oligonucleotide triphosphate onto the growing 3'-OH group of the
nascent oligonucleotide-3'-OH if appropriate base-pairing fails to
exist between the nucleic acid template and the at least one
oligonucleotide triphosphate; and (b) detecting whether the
oligonucleotide triphosphate is incorporated onto the growing 3'-OH
group of the nascent oligonucleotide-3'-OH, thereby detecting the
presence or absence of the sequence alteration in the nucleic acid
template.
[0105] According to yet a further aspect of the present invention
there is provided a method of determining a sequence of a nucleic
acid template, the method comprising the steps of: (a) contacting
in one or more reaction vessels the nucleic acid template with a
nascent oligonucleotide-3'-OH, a template-dependent polymerase,
4.sup.N oligonucleotide triphosphates each including N monomers,
4.sup.N oligonucleotide triphosphate analogs each including N
monomers of which a 3' monomer includes a chain-terminator moiety,
such as a dideoxy-ribose moiety, wherein N is an integer greater
than 1, under conditions in which the nascent oligonucleotide-3'-OH
hybridizes with the nucleic acid template and the
template-dependent polymerase is active in incorporating the
oligonucleotide triphosphates and the oligonucleotide triphosphate
analogs onto a growing 3'-OH group of the nascent
oligonucleotide-3'-OH, so as to obtain a population of nucleic acid
chains each being terminated by a different oligonucleotide
triphosphate analog of the 4.sup.N oligonucleotide triphosphate
analogs; and (b) size-separating, e.g., by gel electrophoresis, the
population of terminated nucleic acid chains, thereby determining
the sequence of the nucleic acid template.
[0106] Several alternative protocols can be followed to execute the
above sequencing method, which protocols depend, to a great extent,
on the labeling strategy employed.
[0107] Thus, if the oligonucleotide-3'-OH is labeled, two options
exist. According to the first option, 4.sup.N different labels are
employed. In this case 4.sup.N reaction mixtures are prepared each
of which includes a uniquely labeled oligonucleotide-3'-OH and a
corresponding unique oligonucleotide triphosphate chain-terminator.
Thereafter, a single lane can be employed for electrophoretic
separation of the population of nucleic acid chains. According to
the second option, a single label is employed. In this case again
4.sup.N reaction mixtures are prepared each of which includes the
labeled oligonucleotide-3'-OH and a unique oligonucleotide
triphosphate chain-terminator. Thereafter, 4.sup.N lanes are
employed for electrophoretic separation of the population of
nucleic acid chains. It will be appreciated that a similar protocol
can be adopted if a single label is employed to label the
oligonucleotide triphosphates employed in the reaction.
[0108] Alternatively, if the oligonucleotide triphosphate
terminators are labeled, again, two options exist. According to the
first option, 4.sup.N different labels are employed. In this case a
single reaction mixture is prepared and a single lane can be
employed for electrophoretic separation of the population of
nucleic acid chains. According to the second option, a single label
is employed. In this case again 4.sup.N reaction mixtures are
prepared and 4.sup.N lanes are employed for electrophoretic
separation.
[0109] Since 4.sup.N according to the present invention are at
least 16 and further since instrumentation capable of uniquely
detecting 16 unique labels is presently not available, according to
a preferred embodiment of the present invention at least some of
the unique labels are combinatorial labels. Fluorescent
combinatorial labels have so far been successfully employed as
chromosomal paints to label each of the 24 human male chromosomes
by a unique identifiable paint and may therefore serve as unique
labels according to the present invention. For further detail
regarding combinatorial labels the reader is referred to U.S. Pat.
No. 5,871,932, which is incorporated herein by reference.
[0110] In any case, the above-described sequencing protocols are
advantageous because the number of bands to be read is reduced by a
factor of N and resolution is increased as compared to conventional
sequencing protocols.
[0111] Systems of genetic-information transfer entail accurate
transition between two alternate sets of building-block
combinations. The information in the new set is then processed by
means that are not applicable to the original set. Information
systems of DNA and RNA use four natural nucleotides displaying only
two mutually exclusive patterns of interactions. Extending the
number of information transfer codes in nucleic acid polymers
allows better ways to decipher DNA and RNA sequences. The transfer
of this information for deciphering and amplification, mostly
assisted by enzymes, is a major task in diagnostics and
bioinformatics.
[0112] The prior art teaches attempts to extend the genetic
alphabet with nucleotide analogs presenting alternative pattern of
base-pair interactions (Benner, 1995; Lutz et al., 1996; Benner et
al., 1998; Kool, 1998; Kool et al, 2000; Ogawa et al., 2000),
although these attempts did not provide the requisite specificity
for accurate information-transfer applications. Some of these prior
art teachings are the subject of U.S. Pat. No. 5,432,272, which is
fully incorporated herein by reference.
[0113] The present invention presents a novel approach for
genetic-information processing based, for example, on the existing
set of Watson-Crick recognition-pattern that is stretched out by
simply linking two nucleotides in a row. As a result, the coding
capacity of nucleic acids is enhanced from 4 to 4.sup.N distinct
combinations of information transfer units. Deciphering this
information in the new polymer may be enhanced by having unique
chemical moiety(ies) on each oligomer that can be used to induce
specific binding or catalytic activity.
[0114] Thus, according to yet an additional aspect of the present
invention, there is provided a method of better exploiting the
information transfer capacity of a nucleic acid molecule, the
method comprising the step of synthesizing a complementary nucleic
acid molecule employing oligonucleotide triphosphates instead of,
or in addition to, nucleotide triphosphates, as basic units for
synthesis.
[0115] Directed evolution systems that select for nucleic acid
polymers with novel activities can extend their functional
repertoire by inclusion of nucleotide analogs with base or sugar
modifications (Sakthivel & Barbas, 1998; Tarasow & Eaton,
1998). Permissive modifications of nucleotides are constrained by
two main factors: organic chemistry means for synthesis of the
nucleotides, and compatibility of the analogs with enzymatic
polymerization. Failure to comply with enzymatic polymerization can
result from interference of base pairing in the template or of
interactions with the polymerase.
[0116] Using oligonucleotide triphosphates for polymerization
overcome some of the above limitations. The addition of chemical
groups in various base and sugar positions may be more suitable for
polymerization, as base-pair interactions between the template and
the incoming unit are more stable. Unique to this system, the
natural connecting phosphodiester-bond between the two nucleosides
is now a novel site for modifications extending flexibility and
conformational space of the polymeric chain. Furthermore, the
complexity of polymers synthesized from 4.sup.N different
nucleotide building blocks, is much higher than of polymers with a
four-base code. For example, a 10-mer oligonucleotide of standard
bases has about 10.sup.6 distinct possibilities, while that of
dimers contain about 10.sup.12 different combinations.
[0117] In screening for novel lead compounds for drug development,
and for polymeric biocatalysts, combinatorial libraries of nucleic
acids generated through enzymatic amplification and directed
evolution are clearly superior over chemically synthesized
libraries. The novel technology of the present invention further
strengthens these approaches. The uncovered activity of
template-dependent polymerases according to the present invention
can serve to generate almost any complex nucleic acid molecule due
to the very high complexity of the combinatorial approach.
[0118] Thus, it enables the preparation of nucleic acid polymers
having at least one functional group in at least one type of
nucleotide at a pre-selected location of the polymer.
[0119] This aspect of the present invention is readily achievable
using functional groups in derivatized oligonucleotide
triphosphates. Consider, for example, using dinucleotide
triphosphates and a modified A. There are 7 different dimers in
which A is in a distinct sequence-context, and therefore one can
use up to 7 different functional groups of A when polymerizing with
dimers. If trinucleotide triphosphates are used, a modified A can
resume any one of 37 distinct trimers (see, for example, all the
A-containing trimers in Table 1), and therefore one can use up to
37 different functional groups of A when polymerizing with trimers.
If oligonucleotide triphosphates of N monomers are used, a modified
A can resume any one of 4.sup.N-3.sup.N distinct sequence-context
positions and therefore one can use 4.sup.N-3.sup.N different
functional groups when polymerizing with of N-mer
oligonucleotides.
[0120] Furthermore, by using a mixture of two different analogs of
the same type of nucleotide, the above-described complexity
increases to 5.sup.N-3.sup.N. Therefore, a very large functional
diversity can be introduced into a given sequence context of the
template by using several different analogs of each nucleotide.
[0121] Some of the applications that can be developed based on the
new technology are further described in the following
paragraphs.
[0122] Nucleotide polymers with specific binding affinity or
catalytic activity can be isolated from combinatorial libraries of
polymers generated using the present invention. The libraries may
be initially formed in the DNA sequences through mutations and
shuffling by conventional means known to those skilled in the art.
The sequence diversity can then be translated to sequence
combinations of distinct oligonucleotide building blocks, each
containing a unique functional group. The functional polymers are
thereafter generated by template-dependent synthesis using a
polymerase and can replace proteins in in-vitro applications such
as specific nucleases, or create novel catalysts that are useful,
for example, in organic synthesis reactions.
[0123] Large combinatorial libraries of nucleic acids have been
efficiently utilized in screening of lead compounds for developing
bioactive compounds such as drugs (Desai et al., 1994; Fauchere et
al., 1998). The nucleic acid libraries generated from oligomeric
units, according to the present invention, have, potentially, the
highest level of complexity, which maximize the diversity and
increase the chances of finding a certain bioactive compound, and
are therefore more efficient for screening of lead bioactive
compounds.
[0124] Specific ligands such as oligonucleotides and antibodies are
used in chips for recognition and quantitation of DNA and protein
molecules. Due to their higher complexity and large repertoire for
generating specific ligands, the dinucleotide-based polymers may be
used to rival the current molecules in DNA and protein chips.
[0125] In nanotechnology, self-assembled units need to form
networks that manage information transfer and processing events in
molecular scale. Functional nucleic acid polymers embody the basic
features for such networks: (a) self-assembly capacity for
molecular network setup; (b) addressing-locating an information
point in the network by specific recognition and affinity; and (c)
information processing-catalytic potential to transfer molecular
changes of specific components of the network. The oligonucleotide
triphosphate system for nucleic acid polymer synthesis presented
herein is the first system to hold all such qualities in one
molecule, and is therefore uniquely suited to function as the basis
of future "molecular software" in nanotechnology.
[0126] Thus, according to yet an additional aspect of the present
invention there is provided a method of better exploiting the
information transfer and functional capacities of nucleic acid
molecules for DNA chip technology and nanotechnology, the method
comprising the step of contacting a component selected from at
least one nucleic acid template, at least one template-dependent
polymerase, at least one nascent oligonucleotide-3'-OH, at least
one oligonucleotide triphosphate and/or at least one
oligonucleotide triphosphate analog, wherein at least one of said
components is attached onto a solid support used in a nanodevice or
DNA chip, and wherein said at least one template-dependent
polymerase is active in incorporating said at least one
oligonucleotide triphosphate and/or said at least one
oligonucleotide triphosphate analog onto said growing 3'-OH group
of said nascent oligonucleotide-3'-OH, so as to obtain a population
of nucleic acid chains bound to the solid support, which can be
further manipulated by means as described above including, but not
limited to, template-dependent extension, template-dependent
amplification, detection of sequence alteration, and detection of
nucleic acid sequences.
[0127] The directed evolution approach revolutionized the field of
nucleic acid and protein engineering. This approach is based on
natural evolution strategies that link between multiplication,
diversity and fitness. These strategies adopted in the directed
evolution approach open enormous possibilities to engineer natural
molecules in vitro, and to create de novo unnatural molecules that
are useful for mankind (Stemmer, 1994; Zhao et al., 1998; Minshull
& Stemmer, 1999). Methods and technologies for performing these
tasks are therefore valuable.
[0128] Thus, according to yet an additional aspect of the present
invention there is provided a method of exploiting oligonucleotide
triphosphates for engineering functional nucleic acid polymers and
polypeptides by directed evolution, the method comprising the steps
of: (a) contacting in reaction vessels a nucleic acid template with
a nascent oligonucleotide-3'-OH, a template-dependent polymerase,
and 4.sup.N oligonucleotide triphosphates, each including N
monomers, wherein N is an integer greater than 1, and wherein at
least one of said oligonucleotide triphosphates has a mismatch as
compared to the template sequence, under conditions in which the
nascent oligonucleotide-3'-OH hybridizes with the nucleic acid
template and the template-dependent polymerase is active in
incorporating said oligonucleotide triphosphates and said at least
one oligonucleotide triphosphate containing said mismatch onto a
growing 3'-OH group of the nascent oligonucleotide-3'-OH, so as to
obtain a population of nucleic acid chains each containing one or
multiple mutations; and (b) amplifying said mutated population of
nucleic acid chains and further shuffling, cloning and expressing
them by methods known in the art to create pools of degenerate
nucleic acid sequences and of degenerate polypeptides; and (c)
screening said pools for individual clones with desired properties,
and then using the selected clones as precursors for additional
cycles of degeneration and selection, as described above, until the
selected molecules are optimized for the desired function. In this
way, the nucleic acid sequences and polypeptides are engineered to
acquire specific functional properties.
[0129] Additional objects, advantages, and novel features of the
present invention will become apparent to one ordinarily skilled in
the art upon examination of the following examples, which are not
intended to be limiting. Additionally, each of the various
embodiments and aspects of the present invention as delineated
above and as claimed in the claims section below finds experimental
support in the following examples.
EXAMPLES
[0130] Reference is now made to the following examples, which
together with the above descriptions illustrate the invention in a
non-limiting fashion.
[0131] Generally, the nomenclature used herein and the laboratory
procedures in recombinant DNA technology described below are well
known and commonly employed in the art. Standard techniques are
used for cloning, DNA and RNA isolation, amplification and
purification. Generally enzymatic reactions involving DNA ligase,
DNA polymerase, restriction endonucleases and the like are
performed according to the manufacturers' specifications. These
techniques and various other techniques are generally performed
according to Sambrook et al., (1989), which is incorporated herein
by reference. Nucleic acid chemistry is generally performed
according to Gait, (1984), which is incorporated herein by
reference. All of the oligonucleotides used for the polymerization
assays were prepared by solid phase synthesis, and further purified
by electrophoresis on Urea-PAGE. Other general references are
provided throughout this document. The procedures therein are
believed to be well known in the art and are provided for the
convenience of the reader. All the information contained therein is
incorporated herein by reference.
Example 1
Dinucleotide Triphosphate Preparation
[0132] Thymidylyl-3'-5'-thymidine (TpT) dinucleotide was
synthesized in liquid by V. Bogachev and V. Silnikove, of the
Novosibirsk Institute of Bioorganic Chemistry in Russia. TpT was
converted to the triphosphate form (TpT3p, SEQ ID NO:16; FIG. 2) in
two steps. First, it was phosphorylated to a 5'-monophosphate form
by phosphoryl chloride; then, the 5'-phosphate group was activated
by N-methylimidazole and reacted with pyrophosphate
(tributylammonium salt) forming the desired triphosphate (Bogachev,
1996).
[0133] Following this procedure, 15 mg of TpT-OH (27 mmol) yielded
3 mg (3.8 mmol) of purified TpT3p. The purified dinucleotide was
analyzed by .sup.31P-NMR (D.sub.2O) recorded on a Bruker AC 250
spectrometer (Karlsruhe, Germany). .sup.31P chemical shifts are
reported in ppm relative to 80% phosphoric acid and are positive
when downfield from the reference. Spectra of four distinct peaks
of the triphosphate TpT3p: delta=-10.32 (d, J=19 Hz, P-alpha.),
-22.04 (t, J=19 Hz, P-beta.), -7.46 (d, J=19 Hz, P-gamma), and of
the phosphodiester phosphate: delta=0.39 (s).
Example 2
Dinucleotide Triphosphate Purification
[0134] TpT3p was purified by two ion-exchange chromatography steps:
a EMD-DEAE (Merck) column using 0.01-1.2 M LiCl gradient, and by
Source 15Q PE column (Pharmacia) using 0.2-1 M NaCl gradient,
buffered with 25 mM triethylamine acetate, pH 4. The dinucleotide
fractions were further desalted on DEAE Sepharose (Merck) column
eluted with IM triethylamine bicarbonate (TEAB), pH 8. After
evaporation and removal of the TEAB, TpT3p was converted to lithium
salt by precipitation with a solution of 6% LiClO.sub.4 in
acetone.
[0135] The chromatography conditions in Source 15Q PE column were
optimized so that the peak position of TpT3p was clearly
distinguished from that of dTTP. The peaks differ by 4 minutes
using the above conditions at 1 ml/min, which exclude the
possibility that some contamination of dTTP may have been
co-purified with the TpT3p and included in the polymerization
assay. This result demonstrates the practical availability of
highly purified dinucleotide triphosphates.
[0136] Paper chromatography (PEI Cellulose F, Merck) of
phosphorylated nucleotides was developed with 1 M LiCl, and
visualized as described (Ludwig, 1981).
Example 3
Polymerization Assay-Methods
[0137] Oligonucleotides (Table 2) used for the polymerization assay
were purified by electrophoresis on Urea-PAGE. For the
polymerization assay, a truncated version of Taq DNA polymerase
(543 amino acids of the C-terminus part), was cloned in the pTTQ
vector (Stark, 1987), and expressed (in E. coli JM109) and purified
as described (Lawyer et al., 1993).
2TABLE 2 Oligonucleotides used in the polymerization assay SEQ ID
Oligo Sequence (5' to 3') NO: T7 GTAATACGACTCACTATAGGGC 81 T1-3
GGTGTCCTTTGCGTGTCGTGTAAATGCCCTATAGTGAGTCGTATTAC 82 T1-4
GGTGTCCTTTGCGTGTCGTGTAAAATGCCCTATAGTGAGTCGTATTAC 83 T1-5
GGTGTCCTTTGCGTGTCGTGTAAAAATGCCCTATAGTGAGTCGTATTAC 84 T2
GGCCGAAGAGGGTCTCCACGTACCGGTGTCCTTTGCGTGTCGTGT 85 B
GGCCGAAGAGGGTCTCC 86
[0138] Template-extension reaction (step I, FIG. 3) includes a
polymerization buffer (40 mM Tricine-KOH, pH 8.0; 16 mM KCl; 3.5 mM
MgCl.sub.2 and 4 .mu.g BSA), 1 pmol T1 template, 1 pmol T7 primer,
20 nM of each of the four dNTP's and 5 units of DNA polymerase in
total volume of 20 .mu.l. Where indicated, 3 .mu.M TpT3p replaced
the dTTP in the reaction mix. Reaction was incubated for 2 min at
94.degree. C., 5 minutes at 55.degree. C., 30 seconds at 60.degree.
C., 30 seconds at 65.degree. C., and then 10 minutes at 72.degree.
C.
[0139] Exonuclease-digestion reaction (step II, FIG. 3) included
0.75 units of Exo VII (GibcoBRL), the supplier's buffer and 3 .mu.I
of the reaction of step I. Reactions were incubated for 30 minutes
at 37.degree. C. and then quenched on ice.
[0140] PCR amplification (step III, FIG. 3) included the above
described polymerization buffer, additional 2 .mu.g BSA, 1 .mu.l of
the reaction of step II, 0.1 mM dNTP's, 0.5 pmol T2 template, and 5
pmol of both, T7 and B primers. The reactions, in 20 .mu.l, were
performed in glass capillaries on RapidCycler (Ideho Technology),
using thermal steps of: 1 minute at 94.degree. C., followed by 30
cycles of 5 seconds at 94.degree. C., 15 seconds at 50.degree. C.;
and 25 seconds at 72.degree. C. The PCR products were separated on
1.4% agarose gels, and visualized by UV light following ethidium
bromide staining.
[0141] The polymerization assay was also used with Klenow
(Exo.sup.-) DNA polymerase (Fermentas), and Tth DNA polymerase
(Promega). Buffer conditions were as recommended by the suppliers.
The polymerization assay was performed as described above, but with
Klenow step I of the assay differed by incubating the
polymerization reaction at 37.degree. C.
Example 4
Polymerization Assay-Results
[0142] Incorporation of TpT3p by template-dependent polymerization
was tested in a very sensitive assay of three steps, as detailed in
Example 3 and FIG. 3, and exemplified in FIG. 4. In step I, a
template containing three (T1-3), four (T1-4) or five (T1-5) runs
of deoxyadenosine (A), followed by a non-A containing region was
extended from a specific oligonucleotide primer (T7) in the
presence of a DNA polymerase and the nucleotide mixtures described
in Example 3. In step II, the polymerization products were treated
by a single-strand specific exonuclease, so that non-extended
single-strand regions in T1 were removed. Only products that were
extended in step I, but not digested in step II, could be amplified
in step III in the presence of oligonucleotides T7, B and T2. This
assay is sensitive enough to identify even a small amount of
molecules that were extended in step I, and can be used as a
general means to amplify the capacity of polymerases to introduce a
nucleotide analog by template extension.
[0143] The results, shown in FIG. 4, indicate that
PCR-amplification products in step III were obtained when the
extension in step I included all the templates in the presence of
the four dNTP's. When TpT3p replaced dTTP in the dNTP mixture in
step I, there were no PCR products with templates T1-3 and T1-5,
but only with template T1-4. This demonstrates that DNA polymerase
can incorporate the dinucleotide triphosphate TpT3p only when the
template contains an even number of A-runs that match the size and
base pairing of the thymidine dinucleotide. DNA sequencing of the
PCR products of T1-4 extension confirmed the expected sequence of
the template.
[0144] TpT3p concentration that support primer extension, albeit
with lower yield, was found to be 50 nM, which is more than 100
fold higher than that found for dTTP. This suggests affinity
differences of the nucleotides to the active site formed by the DNA
polymerase, primer and template.
[0145] In order to test the possibility that TpT3p inhibits Exo VII
in Step II of the polymerization assay, and therefore that the
ss-DNA regions for subsequent amplification in step III were
retained, an additional experiment performed containing the
reactants of step I (but without polymerase added), and 3 .mu.M
TpT3p. The absence of any PCR products in both reactions suggests
that Exo VII is not inhibited in the presence of 3 .mu.M
dinucleotide triphosphates.
[0146] These results establish a new concept in enzymatic synthesis
of nucleic acids, which opens new avenues for employing polymerases
and their substrates in biotechnology.
Example 5
Synthesis and Purification of Additional Di- and Trinucleotide
Triphosphates
[0147] Additional dinucleotide triphosphates and one trinucleotide
triphosphate were prepared following essentially the same
procedures as described above under Examples 1 and 2. These
included the triphosphate form of
2'-deoxycytidylyl(3'-5')-2'-deoxyadenosine (CpA3p, SEQ ID NO:89),
2'-deoxycytidylyl(3'-5')-2'-deoxycytidine (CpC3p, SEQ ID NO:90),
2'-deoxyadenylyl(3'-5')-2'-deoxyguanosine (ApG3p, SEQ ID NO:91),
thymidylyl(3'-5')-2'-deoxycytidine (TpC3p, SEQ ID NO: 14) and
thymidylyl-3'-5'-thymidylyl-3'-5'-thymidine (TpTpT3p, SEQ ID NO:
80). These compounds were all analyzed by .sup.31P-NMR giving the
expected peak spectra corresponding to the four phosphate
groups.
[0148] The oligonucleotide triphosphates were purified essentially
as described under Example 2 above using a Source 15Q PE column
(Pharmacia) and a gradient of 0-40 % ethanol buffered with 50 mM
triethylamine bicarbonate (TEAB), pH 7.5-8.0, at flow rate of 1.6
ml/minute (see Table 3 below). The chromatography conditions were
optimized to distinguish between the dinucleotides and their
corresponding mono-dNTP's so as to eliminate even traces thereof
from the preparations.
3TABLE 3 HPLC purification of dinucleotide triphosphates Peak
position in HPLC Nucleotides (minutes) Peak absorbance (nm*) dATP
27.8 261 dCTP 22.5 271 dGTP 25.2 253 TTP 24.3 266 TpT3p 28 266
TpTpT3p 32 266 CpA3p 28.9 263 TpC3p 25.7 268 ApG3p 28.5 255
*absorbance was measured during the HPLC run in the TEAB/ethanol
buffer
Example 6
Labeled-Primer Extension Assay-Methods
[0149] The oligonucleotides that were used for this assay are
detailed in Table 4 before. The reactions of labeled-primer
extension included: polymerization buffer (40 mM Tricine-KOH, pH
8.0; 16 mM KCl; 5 mM MgCl.sub.2 and 4 .mu.g BSA), 1 pmol template,
0.2 pmol of the p201 primer (labeled at its 5' with
P.sup.32-.gamma.-ATP using T4 polynucleotide kinase), 1 .mu.M of
the indicated dNTP's and 50 .mu.M of the indicated di-or
trinucleotide triphosphates in a total volume of 20 .mu.l. The
reactions were incubated for 5 minutes at 45.degree. C., then 5
units of Taq DNA polymerase (see Example 3 for details) were added,
followed by 20 minutes at 72.degree. C. The reactions were
terminated with 15 .mu.l of stop solution (95% formamide, 20 mM
EDTA and 0.05% bromophenol blue). Three .mu.l were then separated
on Urea-PAGE, and the radiolabeled DNA-bands were detected by
phosphoimaging.
4TABLE 4 Oligonucleotides used in the labeled- primer extension
assay Oligo Sequence (5' to 3') SEQ ID NO: P201
GTAATACGACTCACTATAGG 92 T80 AAAATGTGTGTGCCTATAGTGAGTCGTATTAC 93 T81
AATGAATGAATGCCTATAGTGAGTCGTATTAC 94 T83
GACTGACTCCTATAGTGAGTCGTATTAC 95 T24
TCTGTGTCAAAACCTATAGTGAGTCGTATTAC 96
Example 7
Labeled-Primer Extension Assay-Results
[0150] In addition to the above described results (Example 4),
incorporation of a variety of dinucleotides by template-dependent
polymerization was analyzed using a labeled-primer extension assay,
which enabled to clearly visualize and follow the polymerization
products (FIGS. 6, 7 and 8). Templates T80 (SEQ ID NO:97) and T81
(SEQ ID NO:98) were designed to have combinations of GT (SEQ ID
NO:99) and AA (SEQ ID NO:100) bases for primer extension, which
allow to investigate template-dependent incorporation of the
complementary dinucleotides CpA3p and TpT3p, respectively. The
results in FIG. 6 demonstrate correct incorporation of both
dinucleotide triphosphates CpA3p and TpT3p (FIG. 6, lanes 3-7),
albeit with a lower efficiency as compared to the incorporation of
the natural dNTP's (FIG. 6, lane 2). The experiment of FIG. 7 shows
temple-dependent incorporation of a mix between a subset of two
mononucleotides (dCTP and dATP), and TpT3p (FIG. 7, lane 4), or
with TpTpT3p (FIG. 7, lane 5). In both cases the unnatural building
blocks are utilized, but the dinucleotide is incorporated much
better than the trinucleotide. In both cases, however, there are
traces in the background of polymerization halts in the size of
single nucleotides. This seems to be a result of esterase activity
of polymerases that is well documented (Canard et al., 1995; Meyer
et al., 1998). Incorporation of the dinucleotides CpA3p and CpC3p
is compared in FIG. 7 (lanes 6 and 7, respectively). Only the
complementary dinucleotide (CpA3p) seems to be incorporated by the
polymerase, indicating a correct template-dependent synthesis. In
FIG. 8, two additional dinucleotides, ApC3p and TpC3p, are analyzed
for specific incorporation using the template T83 (SEQ ID NO:95).
Altogether, four distinct dinucleotide triphosphates and a single
trinucleotide triphosphates have been shown to be incorporated in a
template-dependent manner by DNA polymerase, demonstrating a new
means to synthesize nucleic acid polymers.
[0151] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims. All
publications, patents and patent applications mentioned in this
specification are herein incorporated in their entirety by
reference into the specification, to the same extent as if each
individual publication, patent or patent application was
specifically and individually indicated to be incorporated herein
by reference. In addition, citation or identification of any
reference in this application shall not be construed as an
admission that such reference is available as prior art to the
present invention.
REFERENCES
[0152] 1. Beaudry, A. A., and Joyce, G. F. (1992). Directed
evolution of an RNA enzyme. Science 257, 635-641.
[0153] 2. Benner, S. A. (1995). Method for incorporation into a DNA
or RNA oligonucleotide using nucleotide bearing heterocyclic bases.
U.S. Pat. No. 5,432,272
[0154] 3. Benner, S. A., Battersby, T. R., Eschgfaller, B., Hutter,
D., Kodra, J. T., Lutz, S., Arslan, T., Baschlin, D. K., Blattler,
M., Egli, M., Hammer, C., Held, H. A., Horlacher, J., Huang, Z.,
Hyrup, B., Jenny, T. F., Jurczyk, S. C., Konig, M., von, K. U.,
Lutz, M. J., MacPherson, L. J., Moroney, S. E., Muller, E.,
Nambiar, K. P., Piccirilli, J. A., Switzer, C. Y., Vogel, J. J.,
Richert, C., Roughton, A. L., Schmidt, J., Schneider, K. C., and
Stackhouse, J. (1998). Redesigning nucleic acids. Pure Appl Chem
70, 263-266.
[0155] 4. Bogachev, V. S. (1996). Synthesis of
Deoxynu5'-Triphosphate using trifluoroacetic anhydride as an
activating reagent. Bioorg Khim 22, 699-705.
[0156] 5. Breaker, R. R., and Joyce, G. F. (1994). Inventing and
improving ribozyme function: rational design versus iterative
selection methods. Proc Natl Acad Sci, USA 12, 268-275.
[0157] 6. Canard, B., Cardona, B., and Sarfati, R. S. (1995).
Catalytic editing properties of DNA polymerases. Proc Natl Acad Sci
USA, 92, 10859-10863.
[0158] 7. Crameri, A., Raillard, S. A., Bermudez, E., and Stemmer,
W. P. (1998). DNA shuffling of a family of genes from diverse
species accelerates directed evolution. Nature 391, 288-291.
[0159] 8. Desai, M. C., Zuckermann, R. N., and Moos, W. H. (1994).
Recent Advances in the Generation of Chemical Diversity Libraries.
Drug Dev Res 33, 174-188.
[0160] 9. Doubli?, S., Sawaya, M. R., and Ellenberger, T. (1999).
An open and closed case for all polymerases. Structure 7,
31-35.
[0161] 10. Earnshaw, D. J., and Gait, M. J. (1998). Modified
oligoribonucleotides as site-specific probes of RNA structure and
function. Biopolymers 48, 39-55.
[0162] 11. Eaton, B. E. (1997). The joys of in vitro selection:
chemically dressing oligonucleotides to satiate protein targets.
Curr Opin Chem Biol 1, 10-16.
[0163] 12. Fauchere, J. L., Boutin, J. A., Henlin, J. M.,
Kucharczyk, N., and Ortuno, J. C. (1998). Combinatorial chemistry
for the generation of molecular diversity and the discovery of
bioactive leads. Chemometr Intel Lab Sys 43, 43-68.
[0164] 13. Frank, R. (1995). Simultaneous and combinatorial
chemical synthesis techniques for the generation and screening of
molecular diversity. J Biotechnol 41, 259-272.
[0165] 14. Gait, M. J. (1984). Oligonucleotide synthesis: a
practical approach IRL press, Oxford, England
[0166] 15. Groebke, K., Hunziker, J., Fraser, W., Peng, L.,
Diederichsen, U., Zimmermann, K., Holzner, A., Leumann, C., and
Eschemnoser, A. (1998). Why pentose-and not hexose-nucleic acids?
Purine-purine pairing in homo-DNA: Guanine, isoguanine,
2,6-diaminopurine, and xanthine. Hel Chim Acta 81, 375-474.
[0167] 16. Jahnke, T. S., and Nair, V. (1995).
2'-Deoxyadenylyl-(3'-]5')-I- sodideoxyadenosine, a Unique
Dinucleotide--Synthesis, Enzymology, and Conformational Studies.
Bioorg Med Chem Lett 5, 2235-2238.
[0168] 17. Jahnke, T. S., Chao, Q., and Nair, V. (1997).
Dinucleotides incorporating isomeric nucleosides: Synthesis,
structural and stereochemical characterization, and enzymology.
Nucleosides & Nucleotides 16, 1087-1090.
[0169] 18. Joyce, C. M., and Steitz, T. A. (1994). Function and
structure relationships in DNA polymerases. Annu Rev Biochem 63,
777-822.
[0170] 19. Kiefer, J. R., Mao, C., Bramant, J. C., and Beese, L. S.
(1998). Visualizing DNA replication in a catalytically active
Bacillus DNA polymerase crystal. Nature 391, 304-307.
[0171] 20. Kool, E. T. (1998). Replication of non-hydrogen bonded
bases by DNA polymerases: A mechanism for steric matching.
Biopolymers 48, 3-17.
[0172] 21. Kool, E. T., Morales, J. C., and Guckian, K. M. (2000).
Mimicking the structure and function of DNA: Insights into DNA
stability and replication. Angew. Chem.-Int. Ed. 39, 991-1009.
[0173] 22. Koppitz, M., Nielsen, P. E., and Orgel, L. E. (1998).
Formation of oligonucleotide-PNA-chimeras by template-directed
ligation. J Am Chem Soc 120, 4563-4569.
[0174] 23. Lawyer, F. C., Stoffel, S., Saiki, R. K., Chang, S. Y.,
Landre, P. A., Abramson, R. D., and Gelfand, D. H. (1993).
High-level expression, purification, and enzymatic characterization
of full-length Thermus aquaticus DNA polymerase and a truncated
form deficient in 5' to 3' exonuclease activity. PCR Methods Appl
2, 275-287.
[0175] 24. Leberton, J., De, M. A., Waldner, A., Fritch, V., Wolf,
R. M., and Freier, S. M. (1993). Synthesis of thymidine dimer
derivatives containing an amide linkage and their incorporation
into oligodeoxynucleotides. Tetrahedron Lett 34, 6383-6386.
[0176] 25. Li, Y., Korolev, S., and Waksman, G. (1998). Crystal
structures of open and closed forms of binary and ternary complexes
of the large fragment of Thermus aquaticus DNA polymerase I:
structural basis for nucleotide incorporation. EMBO J
17,7514-7525.
[0177] 26. Ludwig, J. (1981). A new route to nucleoside
5'-triphosphates. Acta Biochim Biophys Acad Sci Hung 16,
131-133.
[0178] 27. Lutz, M. J., Held, H. A., Hottiger, M., Hubscher, U.,
and Benner, S. A. (1996). Differential discrimination of DNA
polymerase for variants of the non-standard nucleobase pair between
xanthosine and 2,4-diaminopyrimidine, two components of an expanded
genetic alphabet. Nucleic Acids Res 24, 1308-1313.
[0179] 28. Meyer, P. R., Matsuura, S. E., So, R. G., and Scott, W.
A. (1998). Unblocking of chain-terminated primer by HIV-1 reverse
transcriptase through a nucleotide-dependent mechanism. Proc. Natl.
Acad. Sci. USA, 95, 13471-13476.
[0180] 29. Minshull, J., and Stemmer, W. P. (1999). Protein
evolution by molecular breeding. Curr Opin Chem Biol 3,
284-290.
[0181] 30. Morales, J. C., and Kool, E. T. (1999). Minor groove
interactions between polymerase and DNA: More essential to
replication than Watson-Crick hydrogen bonds? J Am Chem Soc 121,
2323-2324.
[0182] 31. Ogawa, A. K., Wu, Y. Q., McMinn, D. L., Liu, J. Q.,
Schultz, P. G., and Romesberg, F. E. (2000). Efforts toward the
expansion of the genetic alphabet: Information storage and
replication with unnatural hydrophobic base pairs. J. Am. Chem.
Soc., 122, 3274-3287.
[0183] 32. Ordoukhanian, P., and Taylor, J. S. (1997). Solid
phase-supported thymine dimers for the construction of
dimer-containing DNA by combined chemical and enzymatic synthesis:
a potentially general method for the efficient incorporation of
modified nucleotides into DNA. Nucleic Acids Res 25, 3783-3786.
[0184] 33. Sakthivel, K., and Barbas, C. F. (1998). Expanding the
potential of DNA for binding and catalysis: Highly functionalized
dUTP derivatives that are substrates for thermostable DNA
polymerases. Angew Chem Int Ed Engl 37, 2872-2875.
[0185] 34. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989).
Molecular cloning--a laboratory manual Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.
[0186] 35. Schmidt, J. G., Christensen, L., Nielsen, P. E., and
Orgel, L. E. (1997). Information transfer from DNA to peptide
nucleic acids by template-directed syntheses. Nucleic Acids Res 25,
4792-4796.
[0187] 36. Shaw, P. A., Marshall, M. V., and Saunders, G. F.
(1980). Dinucleotide priming of RNA synthesis. Cytogenet Cell Genet
26, 211-222.
[0188] 37. Singh, K., and Modak, M. J. (1998). A unified DNA-and
dNTP-binding mode for DNA polymerases. Trends Biochem Sci 23,
277-281.
[0189] 38. Stark, M. J. (1987). Multicopy expression vectors
carrying the lac repressor gene for regulated high-level expression
of genes in Escherichia coli. Gene 51, 255-267.
[0190] 39. Steitz, T. A., Wang, J., Eom, S. H., Jaeger, J., Restle,
T., and Jeruzalmi, D. (1996). DNA and RNA polymerases: Structural
diversity and common mechanisms. FASEB J 10, 795-795.
[0191] 40. Stemmer, W. P. (1994). DNA shuffling by random
fragmentation and reassembly: in vitro recombination for molecular
evolution. Proc Natl Acad Sci, USA 91, 10747-10751.
[0192] 41. Taktakishvili, M., Neamati, N., Pommier, Y., Pal, S.,
and Nair, V. (2000). Recognition and inhibition of HIV integrase by
novel dinucleotides. J Am Chem Soc 122, 5671-5677.
[0193] 42. Tarasow, T. M., and Eaton, B. E. (1998). Dressed for
success: Realizing the catalytic potential of RNA. Biopolymers 48,
29-37.
[0194] 43. Unrau, P. J., and Bartel, D. P. (1998). RNA-catalysed
nucleotide synthesis. Nature 395, 260-263.
[0195] 44. Zhao, H., Giver, L., Shao, Z., Affholter, J. A., and
Arnold, F. H. (1998). Molecular evolution by staggered extension
process (StEP) in vitro recombination. Nat Biotechnol 16, 258-261.
Sequence CWU 1
1
100 1 2 DNA Artificial sequence synthetic oligonucleotide 1 aa 2 2
2 DNA Artificial sequence synthetic oligonucleotide 2 ac 2 3 2 DNA
Artificial sequence synthetic oligonucleotide 3 ag 2 4 2 DNA
Artificial sequence synthetic oligonucleotide 4 at 2 5 2 DNA
Artificial sequence synthetic oligonucleotide 5 ca 2 6 2 DNA
Artificial sequence synthetic oligonucleotide 6 cc 2 7 2 DNA
Artificial sequence synthetic oligonucleotide 7 cg 2 8 2 DNA
Artificial sequence synthetic oligonucleotide 8 ct 2 9 2 DNA
Artificial sequence synthetic oligonucleotide 9 ga 2 10 2 DNA
Artificial sequence synthetic oligonucleotide 10 gc 2 11 2 DNA
Artificial sequence synthetic oligonucleotide 11 gg 2 12 2 DNA
Artificial sequence synthetic oligonucleotide 12 gt 2 13 2 DNA
Artificial sequence synthetic oligonucleotide 13 ta 2 14 2 DNA
Artificial sequence synthetic oligonucleotide 14 tc 2 15 2 DNA
Artificial sequence synthetic oligonucleotide 15 tg 2 16 2 DNA
Artificial sequence synthetic oligonucleotide 16 tt 2 17 3 DNA
Artificial sequence synthetic oligonucleotide 17 aaa 3 18 3 DNA
Artificial sequence synthetic oligonucleotide 18 aac 3 19 3 DNA
Artificial sequence synthetic oligonucleotide 19 aag 3 20 3 DNA
Artificial sequence synthetic oligonucleotide 20 aat 3 21 3 DNA
Artificial sequence synthetic oligonucleotide 21 aca 3 22 3 DNA
Artificial sequence synthetic oligonucleotide 22 acc 3 23 3 DNA
Artificial sequence synthetic oligonucleotide 23 acg 3 24 3 DNA
Artificial sequence synthetic oligonucleotide 24 act 3 25 3 DNA
Artificial sequence synthetic oligonucleotide 25 aga 3 26 3 DNA
Artificial sequence synthetic oligonucleotide 26 agc 3 27 3 DNA
Artificial sequence synthetic oligonucleotide 27 agg 3 28 3 DNA
Artificial sequence synthetic oligonucleotide 28 agt 3 29 3 DNA
Artificial sequence synthetic oligonucleotide 29 ata 3 30 3 DNA
Artificial sequence synthetic oligonucleotide 30 atc 3 31 3 DNA
Artificial sequence synthetic oligonucleotide 31 atg 3 32 3 DNA
Artificial sequence synthetic oligonucleotide 32 att 3 33 3 DNA
Artificial sequence synthetic oligonucleotide 33 caa 3 34 3 DNA
Artificial sequence synthetic oligonucleotide 34 cac 3 35 3 DNA
Artificial sequence synthetic oligonucleotide 35 cag 3 36 3 DNA
Artificial sequence synthetic oligonucleotide 36 cat 3 37 3 DNA
Artificial sequence synthetic oligonucleotide 37 cca 3 38 3 DNA
Artificial sequence synthetic oligonucleotide 38 ccc 3 39 3 DNA
Artificial sequence synthetic oligonucleotide 39 ccg 3 40 3 DNA
Artificial sequence synthetic oligonucleotide 40 cct 3 41 3 DNA
Artificial sequence synthetic oligonucleotide 41 cga 3 42 3 DNA
Artificial sequence synthetic oligonucleotide 42 cgc 3 43 3 DNA
Artificial sequence synthetic oligonucleotide 43 cgg 3 44 3 DNA
Artificial sequence synthetic oligonucleotide 44 cgt 3 45 3 DNA
Artificial sequence synthetic oligonucleotide 45 cta 3 46 3 DNA
Artificial sequence synthetic oligonucleotide 46 ctc 3 47 3 DNA
Artificial sequence synthetic oligonucleotide 47 ctg 3 48 3 DNA
Artificial sequence synthetic oligonucleotide 48 ctt 3 49 3 DNA
Artificial sequence synthetic oligonucleotide 49 gaa 3 50 3 DNA
Artificial sequence synthetic oligonucleotide 50 gac 3 51 3 DNA
Artificial sequence synthetic oligonucleotide 51 gag 3 52 3 DNA
Artificial sequence synthetic oligonucleotide 52 gat 3 53 3 DNA
Artificial sequence synthetic oligonucleotide 53 gca 3 54 3 DNA
Artificial sequence synthetic oligonucleotide 54 gcc 3 55 3 DNA
Artificial sequence synthetic oligonucleotide 55 gcg 3 56 3 DNA
Artificial sequence synthetic oligonucleotide 56 gct 3 57 3 DNA
Artificial sequence synthetic oligonucleotide 57 gga 3 58 3 DNA
Artificial sequence synthetic oligonucleotide 58 ggc 3 59 3 DNA
Artificial sequence synthetic oligonucleotide 59 ggg 3 60 3 DNA
Artificial sequence synthetic oligonucleotide 60 ggt 3 61 3 DNA
Artificial sequence synthetic oligonucleotide 61 gta 3 62 3 DNA
Artificial sequence synthetic oligonucleotide 62 gtc 3 63 3 DNA
Artificial sequence synthetic oligonucleotide 63 gtg 3 64 3 DNA
Artificial sequence synthetic oligonucleotide 64 gtt 3 65 3 DNA
Artificial sequence synthetic oligonucleotide 65 taa 3 66 3 DNA
Artificial sequence synthetic oligonucleotide 66 tac 3 67 3 DNA
Artificial sequence synthetic oligonucleotide 67 tag 3 68 3 DNA
Artificial sequence synthetic oligonucleotide 68 tat 3 69 3 DNA
Artificial sequence synthetic oligonucleotide 69 tca 3 70 3 DNA
Artificial sequence synthetic oligonucleotide 70 tcc 3 71 3 DNA
Artificial sequence synthetic oligonucleotide 71 tcg 3 72 3 DNA
Artificial sequence synthetic oligonucleotide 72 tct 3 73 3 DNA
Artificial sequence synthetic oligonucleotide 73 tga 3 74 3 DNA
Artificial sequence synthetic oligonucleotide 74 tgc 3 75 3 DNA
Artificial sequence synthetic oligonucleotide 75 tgg 3 76 3 DNA
Artificial sequence synthetic oligonucleotide 76 tgt 3 77 3 DNA
Artificial sequence synthetic oligonucleotide 77 tta 3 78 3 DNA
Artificial sequence synthetic oligonucleotide 78 ttc 3 79 3 DNA
Artificial sequence synthetic oligonucleotide 79 ttg 3 80 3 DNA
Artificial sequence synthetic oligonucleotide 80 ttt 3 81 22 DNA
Artificial sequence synthetic oligonucleotide 81 gtaatacgac
tcactatagg gc 22 82 47 DNA Artificial sequence synthetic
oligonucleotide 82 ggtgtccttt gcgtgtcgtg taaatgccct atagtgagtc
gtattac 47 83 48 DNA Artificial sequence synthetic oligonucleotide
83 ggtgtccttt gcgtgtcgtg taaaatgccc tatagtgagt cgtattac 48 84 49
DNA Artificial sequence synthetic oligonucleotide 84 ggtgtccttt
gcgtgtcgtg taaaaatgcc ctatagtgag tcgtattac 49 85 45 DNA Artificial
sequence synthetic oligonucleotide 85 ggccgaagag ggtctccacg
taccggtgtc ctttgcgtgt cgtgt 45 86 17 DNA Artificial sequence
synthetic oligonucleotide 86 ggccgaagag ggtctcc 17 87 40 DNA
Artificial sequence synthetic oligonucleotide 87 tcgattgcta
agtccgatga tagctgatcg ttcgcttaaa 40 88 40 DNA Artificial sequence
synthetic oligonucleotide 88 tcgattgcta agtccgatga tagcggatcg
ttcgcttaaa 40 89 2 DNA Artificial sequence synthetic
oligonucleotide 89 ca 2 90 2 DNA Artificial sequence synthetic
oligonucleotide 90 cc 2 91 2 DNA Artificial sequence synthetic
oligonucleotide 91 ag 2 92 20 DNA Artificial sequence synthetic
oligonucleotide 92 gtaatacgac tcactatagg 20 93 32 DNA Artificial
sequence synthetic oligonucleotide 93 aaaatgtgtg tgcctatagt
gagtcgtatt ac 32 94 32 DNA Artificial sequence synthetic
oligonucleotide 94 aatgaatgaa tgcctatagt gagtcgtatt ac 32 95 28 DNA
Artificial sequence synthetic oligonucleotide 95 gactgactcc
tatagtgagt cgtattac 28 96 32 DNA Artificial sequence synthetic
oligonucleotide 96 tctgtgtcaa aacctatagt gagtcgtatt ac 32 97 32 DNA
Artificial sequence synthetic oligonucleotide 97 aaaatgtgtg
tgcctatagt gagtcgtatt ac 32 98 32 DNA Artificial sequence synthetic
oligonucleotide 98 aatgaatgaa tgcctatagt gagtcgtatt ac 32 99 2 DNA
Artificial sequence synthetic oligonucleotide 99 gt 2 100 2 DNA
Artificial sequence synthetic oligonucleotide 100 aa 2
* * * * *