U.S. patent application number 10/892379 was filed with the patent office on 2005-12-22 for beta-amyloid peptide-binding proteins and polynucleotides encoding the same.
Invention is credited to Bard, Jonathan A., Howland, David, Jacobsen, Jack S., Kajkowski, Eileen M., Ozenberger, Bradley A., Sofia, Heidi, Walker, Stephen G..
Application Number | 20050282999 10/892379 |
Document ID | / |
Family ID | 25312493 |
Filed Date | 2005-12-22 |
United States Patent
Application |
20050282999 |
Kind Code |
A9 |
Ozenberger, Bradley A. ; et
al. |
December 22, 2005 |
Beta-amyloid peptide-binding proteins and polynucleotides encoding
the same
Abstract
Novel proteins which bind human .beta.-amyloid peptide,
polynucleotides which encode these proteins, and methods for
producing these proteins are provided. Diagnostic, therapeutic, and
screening methods employing the polynucleotides and polypeptides of
the present invention are also provided. Transgenic animals and
knockout animals are also provided.
Inventors: |
Ozenberger, Bradley A.;
(Newtown, PA) ; Bard, Jonathan A.; (Doylestown,
PA) ; Kajkowski, Eileen M.; (Ringoes, NJ) ;
Jacobsen, Jack S.; (Ramsey, NJ) ; Walker, Stephen
G.; (East Windsor, NJ) ; Sofia, Heidi; (Walla
Walla, WA) ; Howland, David; (Yardley, PA) |
Correspondence
Address: |
NIXON PEABODY, LLP
401 9TH STREET, NW
SUITE 900
WASHINGTON
DC
20004-2128
US
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 0096460 A1 |
May 5, 2005 |
|
|
Family ID: |
25312493 |
Appl. No.: |
10/892379 |
Filed: |
July 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10892379 |
Jul 16, 2004 |
|
|
|
09852100 |
May 9, 2001 |
|
|
|
6787319 |
|
|
|
|
09852100 |
May 9, 2001 |
|
|
|
09774936 |
Jan 31, 2001 |
|
|
|
09774936 |
Jan 31, 2001 |
|
|
|
09172990 |
Oct 14, 1998 |
|
|
|
09172990 |
Oct 14, 1998 |
|
|
|
09060609 |
Apr 15, 1998 |
|
|
|
09852100 |
|
|
|
|
PCT/US99/21621 |
Oct 13, 1999 |
|
|
|
60064583 |
Apr 16, 1997 |
|
|
|
60104104 |
Oct 13, 1998 |
|
|
|
Current U.S.
Class: |
530/350 ;
435/320.1; 435/354; 435/6.16; 435/69.1; 800/11 |
Current CPC
Class: |
A01K 67/0275 20130101;
A61P 25/28 20180101; C07K 2319/00 20130101; C07K 14/4711 20130101;
A01K 2217/075 20130101; A61K 38/00 20130101; A01K 2227/105
20130101; A01K 2217/05 20130101; C07K 14/47 20130101; A61P 43/00
20180101 |
Class at
Publication: |
530/350 ;
435/069.1; 435/320.1; 435/354; 800/011; 435/006 |
International
Class: |
A01K 067/027; C12Q
001/68; C07K 014/47; C12N 005/06 |
Claims
What is claimed is:
1. An isolated, recombinant or chemically synthesized protein
comprising amino acids 123-202 of SEQ ID NO:2.
2. The protein of claim 1 comprising amino acids 68-202 of SEQ ID
NO:2.
3. The protein of claim 1 comprising amino acids 68-269 of SEQ ID
NO:2.
4. The protein of claim 1 comprising SEQ ID NO:52.
5. The protein of claim 1 comprising an ALU repetitive element.
6. A cell comprising the protein of claim 1.
7. A mammal comprising the protein of claim 1.
8. A method for identifying an agent that modulates an interaction
between a protein of claim 1 and a .beta.-amyloid peptide or
amyloid precursor protein, comprising: contacting a molecule of
interest with an assay system comprising (1) said protein and (2)
said .beta.-amyloid peptide or said amyloid precursor protein; and
comparing the interaction between said protein and said
.beta.-amyloid peptide or said amyloid precursor protein before and
after said contacting to determine if said molecule of interests is
capable of modulating the interaction.
9. The method of claim 8, wherein said assay system is an in vitro
binding assay system.
10. An isolated, recombinant or chemically synthesized protein
comprising amino acids 123-202 of SEQ ID NO:2 with an arginine to
glutamate substitution at residue 200.
11. An isolated, recombinant or chemically synthesized protein
comprising amino acids 68-269 of SEQ ID NO:2 with an amino acid
residue modification at Asp 239.
12. An isolated, recombinant or chemically synthesized
.beta.-amyloid peptide-binding protein comprising amino acids
123-202 of SEQ ID NO:2 with at least one amino acid residue
modification, wherein said .beta.-amyloid peptide-binding protein
is incapable of sensitizing human Ntera2 cells to .beta.-amyloid
peptide, or has an attenuated effect on sensitizing human Ntera2
cells to .beta.-amyloid peptide compared to the same .beta.-amyloid
peptide-binding protein but without said at least one amino acid
residue modification.
13. The .beta.-amyloid peptide-binding protein of claim 12, wherein
said at least one amino acid residue modification includes an
arginine to glutamate substitution at residue 200 of SEQ ID
NO:2.
14. The .beta.-amyloid peptide-binding protein of claim 12,
comprising amino acids 68-269 of SEQ ID NO:2 with said at least one
amino acid residue modification.
15. The .beta.-amyloid peptide-binding protein of claim 14, wherein
said at least one amino acid residue modification includes a
modification at Asp 239 of SEQ ID NO:2.
16. A cell comprising the .beta.-amyloid peptide-binding protein of
claim 12.
17. A mammal comprising the .beta.-amyloid peptide-binding protein
of claim 12.
18. An isolated, recombinant or chemically synthesized
.beta.-amyloid peptide-binding protein comprising an amino acid
sequence which has at least 90% sequence identity to amino acids
123-202 of SEQ ID NO:2.
19. An isolated, recombinant or chemically synthesized
.beta.-amyloid peptide-binding protein comprising an amino acid
sequence which has at least 60% sequence identity to amino acids
123-202 of SEQ ID NO:2.
20. An isolated, recombinant or chemically synthesized comprising
an amino acid sequence selected from the group consisting of: (a)
SEQ ID NO:2 from amino acid 63 to 269, (b) SEQ ID NO:3, and (c) SEQ
ID NO:4.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/852,100, filed May 9, 2001, now pending,
which is a continuation-in-part of U.S. patent application Ser. No.
09/774,936, filed Jan. 31, 2001, now pending, which is a
continuation of U.S. patent application Ser. No. 09/172,990, filed
Oct. 14, 1998, now pending, which is continuation-in-part of U.S.
patent application Ser. No. 09/060,609, filed Apr. 15, 1998, now
abandoned, which claims benefit of U.S. Provisional Application
60/064,583, filed Apr. 16, 1997, all of which are incorporated
herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to novel polynucleotides and
proteins encoded by such polynucleotides, along with therapeutic,
diagnostic, and research utilities for these polynucleotides and
proteins. In particular, the invention relates to polynucleotides
and proteins encoded by such polynucleotides that bind to
.beta.-amyloid peptide, one of the primary components of amyloid
deposits associated with Alzheimer's disease.
BACKGROUND OF THE INVENTION
[0003] Alzheimer's disease (AD) is a progressive dementing disorder
of the elderly characterized by a series of structural
abnormalities of the brain. Neurons in multiple regions of the
central nervous system (CNS) become dysfunctional and die,
resulting in alterations in synaptic inputs. Cell bodies and
proximal dendrites of these vulnerable neurons contain
neurofibrillary tangles composed of paired helical filaments, the
main component of which is a phosphorylated microtubular-binding
protein, namely tau. One of the hallmarks of the disease is the
accumulation of amyloid containing deposits within the brain called
senile (or neuritic) plaques. The principal component of amyloid
plaques is .beta.-amyloid peptide (hereinafter "BAP," also referred
in the literature as A.beta., .beta.AP, etc.), which forms dense
aggregates during the course of AD.
[0004] BAP is a 39-43 amino acid peptide derived by proteolytic
cleavage of amyloid precursor protein (hereinafter "APP") and
composed of a portion of the transmembrane domain and the
luminal/extracellular domain of APP. It is thought that the BAP
peptide comprising 42 amino acids (BAP.sub.42) is potentially the
more toxic aggregated form in humans. APP occurs as several
BAP-containing isoforms. The major forms are comprised of 695, 751,
and 770 amino acids, with the latter two APP containing a domain
that shares structural and functional homologies with Kunitz serine
protease inhibitors. In normal individuals, BAP does not accumulate
and is rapidly removed from circulating fluids. However, the
peptide can form plaques on surfaces of dystrophic dentrites and
axons, microglia, and reactive astrocytes. The aggregation and
deposition of BAP in neuritic plaques is postulated as one of the
initiating events of AD. Investigation of the events leading to the
expression and consequences of BAP and their individual roles in AD
is a major focus of neuroscience research. In particular, the
discovery of proteins that bind to BAP is critical to advance
understanding of the pathogenesis of the disease and to potentially
introduce novel therapeutic targets.
[0005] Until the present invention, proteins and fragments thereof
that bind with human BAP and that may be involved in the biological
effects of BAP in AD had not been identified.
SUMMARY OF THE INVENTION
[0006] This invention provides novel isolated polynucleotides that
encode gene products that selectively bind human .beta.-amyloid
peptide (BAP) amino acid sequences.
[0007] In one embodiment, the present invention provides a
composition comprising an isolated polynucleotide selected from the
group consisting of:
[0008] (a) polynucleotide comprising the nucleotide sequence of SEQ
ID NO: 1;
[0009] (b) a polynucleotide comprising the nucleotide sequence of a
.beta.-amyloid peptide-binding protein (BBP) of clone BBP1-fl
deposited under accession number ATCC 98617;
[0010] (c) a polynucleotide encoding a .beta.-amyloid
peptide-binding protein (BBP) encoded by the cDNA insert of clone
BBP1-fl deposited under accession number ATCC 98617;
[0011] (d) a polynucleotide comprising the nucleotide sequence of
SEQ ID NO: 1 from nucleotide 202 to nucleotide 807;
[0012] (e) a polynucleotide comprising the nucleotide sequence of a
.beta.-amyloid peptide-binding protein (BBP) of clone pEK196
deposited under accession number ATCC 98399;
[0013] (f) a polynucleotide encoding a .beta.-amyloid
peptide-binding protein (BBP) encoded by the cDNA insert of clone
pEK196 deposited under accession number ATCC 98399;
[0014] (g) a polynucleotide encoding a protein comprising the amino
acid sequence of SEQ ID NO: 2;
[0015] (h) a polynucleotide encoding a protein comprising a
fragment of the amino acid sequence of SEQ ID NO: 2 having human
.beta.-amyloid peptide-binding activity, the fragment comprising
the amino acid sequence from amino acid 68 to amino acid 269 of SEQ
ID NO: 2;
[0016] (i) a polynucleotide which is an allelic variant of the
polynucleotide of (a)-(f) above;
[0017] (j) a polynucleotide which encodes a species homologue of
the protein of (g)-(i) above; and
[0018] (k) a polynucleotide capable of hybridizing under stringent
conditions to any one of the polynucleotides specified in
(a)-(h).
[0019] Preferably such polynucleotide comprises the nucleotide
sequence of SEQ ID NO: 1; the nucleotide sequence of a
.beta.-amyloid peptide-binding protein (BBP) of clone BBP1-fl
deposited under accession number ATCC 98617; or a polynucleotide
encoding a .beta.-amyloid peptide-binding protein (BBP) encoded by
the cDNA insert of clone BBP1-fl deposited under accession number
ATCC 98617. Another embodiment provides the gene corresponding to
the cDNA sequence of SEQ ID NO: 1. The present invention also
features isolated, recombinant or chemically synthesized
polynucleotides comprising a nucleic acid sequence encoding an
amino acid sequence selected from the group consisting of:
[0020] (a) SEQ ID NO:2 from amino acid 63 to 269,
[0021] (b) SEQ ID NO:3,
[0022] (c) SEQ ID NO:4, and
[0023] (d) a variant, a splicing isoform or the complement of (a),
(b) or (c).
[0024] In other embodiments, the present invention provides a
composition comprising a protein, wherein said protein comprises an
amino acid sequence selected from the group consisting of:
[0025] (a) the amino acid sequence of SEQ ID NO: 2;
[0026] (b) the amino acid sequence of SEQ ID NO: 2 from amino acid
68 to amino acid 269;
[0027] (c) the amino acid sequence encoded by the cDNA insert of
clone BBP1-fl deposited under accession number ATCC 98617; and
[0028] (d) fragments of the amino acid sequence of SEQ ID NO: 2
comprising the amino acid sequence from amino acid 185 to amino
acid 217 of SEQ ID NO: 2.
[0029] Preferably such protein comprises the amino acid sequence of
SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 2 from amino
acid 68 to amino acid 269. Fusion proteins are also claimed in the
present invention.
[0030] In certain preferred embodiments, the polynucleotide is
operably lined to an expression control sequence. The invention
also provides a host cell, including bacterial, yeast, insect, and
mammalian cells, transformed with such polynucleotide
compositions.
[0031] Processes are also provided for producing a BBP which
comprises (a) growing a culture of the host cell of claim 3 in a
suitable culture medium; and (b) purifying the protein from the
culture medium.
[0032] Compositions comprising an antibody which specifically
reacts with such BBPs are also provided by the present invention.
In one embodiment, an antibody of the present invention binds
specifically to a polypeptide selected from the group consisting
of:
[0033] (a) SEQ ID NO:2 from amino acid 63 to 269,
[0034] (b) SEQ ID NO:3,
[0035] (c) SEQ ID NO:4, and
[0036] (d) a variant or splicing isoform of (a), (b) or (c).
[0037] Methods and diagnostic processes are also provided for
detecting a disease state characterized by the aberrant expression
of human BAP, as well as methods for identifying compounds that
regulate the activity of BBPs. In one embodiment, a method of the
present invention comprises (a) incubating a sample indicative of
the aberrant expression of human .beta.-amyloid peptide with a
reagent comprising a polypeptide comprising a region at least 90%
identical to the amino acid sequence of SEQ ID NO:2 under
conditions effective for specific binding of said reagent to said
human .beta.-amyloid peptide in the sample. In another embodiment,
a method of the invention comprises (a) incubating a sample
indicative of the aberrant expression of human .beta.-amyloid
peptide with a reagent comprising a polypeptide comprising a region
at least 90% identical to the amino acid sequence of the
.beta.-amyloid peptide binding protein encoded by the cDNA insert
of ATCC 98617 under conditions effective for specific binding of
said reagent to said human .beta.-amyloid peptide; and (b)
determining the binding of said reagent to said human
.beta.-amyloid peptide in the sample. In still another embodiment,
the present invention provides a method for the treatment of a
patient having need to inhibit .beta.-amyloid peptide accumulation
in the brain. The method comprises administering to the patient a
therapeutically effective amount of BBP1, or a variant, fragment or
splicing isoform thereof. In a further embodiment, the present
invention provides a method for the treatment of a patient having
need of such treatment comprising administering to the patient a
therapeutically effective amount of an antibody which binds to an
extracellular or intracellular portion of BBP1. Furthermore, the
present invention provides methods for inhibiting expression of a
BBP1 gene. In one embodiment, a method of the present invention
comprises providing to a cell a polynucleotide comprising or
encoding a nucleic acid sequence complementary to a portion of the
BBP1 gene.
[0038] Another embodiment of the invention includes transgenic
animals comprising a polynucleotide encoding a BBP operably linked
to an expression control sequence.
[0039] A further embodiment of the invention provides knockout
animals in which the BBP1 gene has been functionally disrupted. The
invention also relates to conditional knockout animals in which the
BBP1 gene is disrupted in a temporal or tissue-specific manner or
in which the BBP1 disruption can be induced by external
stimuli.
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] The following drawings depict certain embodiments of the
invention They are illustrative only and do not limit the invention
otherwise disclosed herein.
[0041] FIG. 1 shows the yeast 2-hybrid screen design. A Y2H host
strain expressing the Gal4 DNA-binding domain fused to BAP.sub.42
(BAP.sup.BD; plasmid containing TRP1 marker) and nonfusion
BAP.sub.42 (BAP; plasmid containing URA3 marker) was transformed
with a Y2H human fetal brain cDNA library (plasmid containing LEU2
marker) expressing Gal4 activation domain fusion proteins
(unknown.sup.AD) as described. Therefore, strains contained three
episomal plasmids, denoted by circles, expressing the indicated
protein. Positive protein-protein interactions reconstituted Gal4
activity at the upstream activating sequence (GALUAS) thereby
inducing transcription of the reporter gene HIS3.
[0042] FIG. 2 shows that the transfection of cells with pBBP
results in increased cell loss upon treatment with A.beta.. SH-SY5Y
cells were transfected with vector or pBBP. Samples were treated
with 10 M aged A.beta. for 48 hrs, then evaluated for cell
viability compared to untreated control samples. Values represent
the means with standard errors of three independent experiments.
The star indicates P<0.01 (t-test).
[0043] FIG. 3 shows that the A.beta.-induced apoptosis in cells
transfected with pBBP is transduced through G proteins. SH-SY5Y
cells were transfected with pEGFP plus pBBP or pBBP-R>E
expression plasmids. Samples were treated with 10 M A.beta. and
nuclear morphologies were evaluated in transfected (EGFP+) cells as
described in the text. One pBBP sample was simultaneously treated
with pertussis toxin (PTX) at 100 ng/ml to obtain the value labeled
pBBP+PTX. Values are the means of duplicate samples of >100
EGFP+cells, with standard deviations. The star indicates
significant (P<0.01; Yates G-test) effect of pBBP versus
vector.
[0044] FIG. 4 shows that the BBP-mediated response to A.beta. is
caspase-dependent. Nt2 stem cells were transfected with pEGFP plus
vector or pBBP and treated with 10 M A.beta.. Duplicate pBBP
samples were also treated with 25 M BOC-Asp(Ome)-fluoromethylketone
(BAF), a nonspecific caspase inhibitor.
[0045] FIG. 5 shows BBP-specific apoptotic response to A.beta. is
selective for aged (i.e., aggregated) human peptide. Nt2 stem cells
were transfected with pEGFP plus vector or pBBP. Samples were
treated for 48 hrs with the indicated peptide at 10 M, and examined
for nuclear morphology.
[0046] FIG. 6 shows transient transfection assays and demonstrates
that the BBP-R>E variant acts in a dominant negative manner to
suppress the activities of wild-type protein. Nt2 stem cells were
transfected with the indicated mixtures of DNAs, maintaining total
DNA concentrations constant (1.65 .mu.g). Duplicate samples were
treated with 10 M A.beta. and scored for apoptotic nuclei.
Transfection with pBBP in the absence of PBBP-R>E resulted in a
significant (P<0.01) inductin of apoptosis versus vector
control. In dually transfected samples, there was a consistent
(N=5) and significant (P<0.01) dominant negative effect of
pBBP-R>E versus pBBP alone. The intermediate value of the pBBP
plus pBBP-R>E dual transfection versus pBBP-R>E alone was not
statistically significant (P>0.05; Yates G-test).
[0047] FIG. 7 shows a sequence comparison of BBP/BLP translation
products. The amino acid sequences of human, mouse, and Drosophila
melanogaster (fly) BBP, BLP1, and BLP2 proteins were aligned using
the CLUSTALW algorithm. The sequences are identified for BBP as SEQ
ID NO: 2 from residues 63 to 269, SEQ ID NO: 3 and SEQ ID NO: 4 for
human, mouse, and fly, respectively. The sequences are identified
for BLP1 as SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7 for human,
mouse, and fly, respectively. The sequences for BLP2 are SEQ ID NO:
8, SEQ ID NO: 9, and SEQ ID NO: 10 for human, mouse, and fly,
respectively. The fly BLP2 protein has been tentatively identified
as almondex (amx; accession AF217797). Gaps, indicated by dashes,
were introduced to optimize the alignment. Amino acids common
within a subtype are shaded. Amino acids invariant for all proteins
are indicated by arrows. Predicted transmembrane domains (tm1 and
tm2) are indicated. Stars indicate translation stops.
[0048] FIG. 8 shows a comparison of the predicted topology of the
BBP proteins with a 7-tm domain G protein-coupled receptor. The two
tm domains of BBPs correspond to tm domains 3 and 4 of GPCRs.
[0049] FIG. 9 shows a graphical depiction of the BBP1 amplicon with
the splice variant (SEQ ID NO: 11), as well as a partial sequence
from amino acid 217 to the stop codon (SEQ ID NO: 12).
[0050] FIG. 10 shows an analysis of the mutation of the aspartate
in the BBP1 PXDGS motif separates pro- and anti-apoptotic
activities. SY5Y (top panels) or Nt2 stem cells (bottom panels)
were transfected with the indicated expression plasmid, treated
with A.beta. for 48 hrs (left panels) or staurosporine (STS) for 3
hrs (right panels). Duplicate samples were fixed and stained with
the nuclear dye Hoechst 33342. Nuclear morphologies of transfected
cells were scored blindly by fluorescence microscopy. Each value
represents the mean with standard deviation. Each count consisted
of at least 100 cells.
[0051] FIG. 11 shows the genomic structure of the BBP1 gene (SEQ ID
NO: 13) with the individual exon start and stop sites being
indicated.
[0052] FIG. 12 shows a schematic representation of the endogenous
murine BBP1 gene, the BBP1 targeting construct and the mutated BBP1
allele produced by homologous recombination between the endogenous
BBP1 gene and the BBP1 targeting construct.
[0053] FIG. 13 shows a schematic of a conditional knockout
construct after insertion. The asterisks indicate the exons to be
removed and the triangles represent the inserted Lox sites.
DETAILED DESCRIPTION OF THE INVENTION
[0054] The present invention relates to the isolation and cloning
of a human .beta.-amyloid peptide-binding protein (BBP1). BBP1 has
been characterized as a fusion protein in a yeast 2 hyrid assay as
binding to BAP, specifically the 42 amino acid fragment of BAP
(BAP.sub.42). Expression of BBP1 has been shown in human tissues
and in specific brain regions. Importantly BBP1 has been
demonstrated to selectively bind human BAP in a yeast 2 hybrid
system as compared to rodent BAP. These findings support the
premise that the BBP1 of the present invention may be used in the
diagnosis and treatment of Alzheimer's disease.
[0055] The BBP1 Coding Sequence
[0056] The initial human BBP1 clone (designated clone 14) was
obtained by using a yeast 2-hybrid (Y2H) genetic screen developed
to identify proteins that interact with human BAP.sub.42, a
potentially more toxic form of BAP. BAP.sub.42 was expressed fused
to the yeast Gal4 DNA-binding domain and was also expressed as free
peptide (FIG. 1). This strain was transformed with a human fetal
brain cDNA Y2H library. A single clone, denoted #14, from
approximately I0.sup.6 independent transformants, produced
consistent reporter gene activation and contained a substantial
open reading frame continuous with that of the Gal4 domain. The
cDNA insert comprised 984 base pairs, terminating in a poly-A
tract. This sequence encoded 201 amino acids (amino acid 68 to
amino acid 269 of SEQ ID NO: 2) with two regions of sufficient
length and hydrophobicity to transverse a cellular membrane. There
are also potential asparagine-linked glycosylation sites. Clone 14
was designated clone pEK 196 and was deposited with American Type
Culture Collection (ATCC), 10801 University Boulevard, Manassas,
Va. 20110-2209, on Apr. 9, 1997 and assigned Accession Number
98399. All deposits referred to herein refer to deposits with ATCC
and all such deposits will be maintained under the terms of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purposes of Patent Procedure and under
conditions that will make them available to the public as of the
issue date of any patent granted from this application.
[0057] The library-derived plasmid was isolated from clone 14 and
used to reconstruct Y2H assay strains. Examination of these strains
demonstrated that the BAP fusion protein specifically interacted
with the clone 14 protein, although the response was weak. Since
protein domains of strong hydrophobicity, such as transmembrane
regions, inhibit Y2H responses, the clone 14 insert was truncated
(BBP1.DELTA.tm; see Table 2 below for further description) to
remove the region of strongest hydrophobicity and retested for
interactions with BAP. A much more robust Y2H response was observed
with BBP1.DELTA.tm, supporting the notion that the deleted
sequences encode a potential transmembrane ("tm") anchor. Clone 14
identifies a novel BAP binding protein in the form of a fusion
protein.
[0058] The BBP1 cDNA sequences contained in clone 14 were
identified as lacking the 5' end of the protein coding region as no
potential initiating methionine codon was present. Multiple
attempts at conventional 5' RACE (rapid amplification of cDNA ends)
utilizing a standard reverse-transcriptase only resulted in the
addition of 27 nucleotides. Thus, a genomic cloning approach as
described in Example 2, below, was used to isolate the 5'
terminus.
[0059] Since the 5' coding sequence terminus was derived from a
genomic library, there existed the possibility that this region
contained introns. This potentiality was investigated by two
methods as described in Example 2, below. The resulting data
confirmed the upstream sequences (both from genomic and cDNA
sources) and the lack of introns in this region. Plasmid BBP1-fl
containing a cDNA insert encoding the full length BBP1 protein
coding region was deposited in the American Type Culture Collection
with accession number 98617 on Dec. 11, 1997. The entire coding
region and decuced protein sequence is shown in SEQ ID NOs: 1 and
2. The 3' nontranslated nucleotide sequences are contained in the
original clone 14 (pEK196).
[0060] In accordance with the present invention, nucleotide
sequences that encode BBP1, fragments, fusion proteins or
functional equivalents thereof, may be used to generate recombinant
DNA molecules that direct the expression of BBP1, or a functionally
active peptide, in appropriate host cells. Alternatively,
nucleotide sequences that hybridize to portions of the BBP1
sequence may be used in nucleic acid hybridization assays, Southern
and Northern blot assays, etc.
[0061] The invention also includes polynucleotides with sequences
complementary to those of the polynucleotides disclosed herein.
[0062] The present invention also includes polynucleotides capable
of hybridizing under reduced stringency conditions, more preferably
stringent conditions, and most preferably highly stringent
conditions, to polynucleotides described herein. Examples of
stringency conditions are shown in the table below: highly
stringent conditions are those that are at least as stringent as,
for example, conditions A-F; stringent conditions are at least as
stringent as, for example, G-L; and reduced stringency conditions
are at least as stringent as, for example, conditions M-R.
1TABLE 1 Stringency Conditions Hybrid Stringency Polynucleotide
Length Hybridization Temperature and Wash Temperature Condition
Hybrid (bp).sup.1 Buffer.sup.H and Buffer.sup.H A DNA:DNA >50
65.degree. C.; 1xSSC -or- 65.degree. C.; 0.3xSSC 42.degree. C.;
1xSSC, 50% formamide B DNA:DNA <50 T.sub.B*; 1xSSC T.sub.B*;
1xSSC C DNA:RNA >50 67.degree. C.; 1xSSC -or- 67.degree. C.;
0.3xSSC 45.degree. C.; 1xSSC, 50% formamide D DNA:RNA <50
T.sub.D*; 1xSSC T.sub.D*; 1xSSC E RNA:RNA >50 70.degree. C.;
1xSSC -or- 70.degree. C.; 0.3xSSC 50.degree. C.; 1xSSC, 50%
formamide F RNA:RNA <50 T.sub.F*; 1xSSC T.sub.f*; 1xSSC G
DNA:DNA >50 65.degree. C.; 4xSSC -or- 65.degree. C.; 1xSSC
42.degree. C.; 4xSSC, 50% formamide H DNA:DNA <50 T.sub.H*;
4xSSC T.sub.H*; 4xSSC I DNA:RNA >50 67.degree. C.; 4xSSC -or-
67.degree. C.; 1xSSC 45.degree. C.; 4xSSC, 50% formamide J DNA:RNA
<50 T.sub.J*; 4xSSC, T.sub.J*; 4xSSC K RNA:RNA >50 70.degree.
C.; 4xSSC -or- 67.degree. C.; 1xSSC 50.degree. C.; 4xSSC, 50%
formamide L RNA:RNA <50 T.sub.L*; 2xSSC T.sub.L*; 2xSSC M
DNA:DNA >50 50.degree. C.; 4xSSC -or- 50.degree. C.; 2xSSC
40.degree. C.; 6xSSC, 50% formamide N DNA:DNA <50 T.sub.N*;
6xSSC T.sub.N*; 6xSSC O DNA:RNA >50 55.degree. C.; 4xSSC -or-
55.degree. C.; 2xSSC 42.degree. C.; 6xSSC, 50% formamide P DNA:RNA
<50 T.sub.p*; 6xSSC T.sub.P*; 6xSSC Q RNA:RNA >50 60.degree.
C.; 4xSSC -or- 60.degree. C.; 2xSSC 45.degree. C.; 6xSSC, 50%
formamide R RNA:RNA <50 T.sub.R*; 4xSSC I.sub.R*; 4xSSC
.sup.1The hybrid length is that anticipated for the hybridized
region(s) of the hybridizing polynucleotides. When hybridizing a
polynucleotide to a target polynucleotide of an unknown sequence,
the hybrid length is assumed to be that of the hybridizing
polynucleotide. When polynucleotides of known # sequence are
hybridized, the hybrid length can be determined by aligning the
sequences of the polynucleotides and identifying the region or
regions of optimal sequence complementarity. .sup.HSSPE (1xSSPE is
0.15M NaCl, 10 mM NaH.sub.2PO.sub.4, and 1.25 mM EDTA, pH 7.4) can
be substituted for SSC (1xSSC is 0.15M NaCl and 1.5 mM sodium
citrate) in the hybridization and wash buffers; washes are
performed for 15 minutes after hybridization is complete.
T.sup.B*-T.sup.R*: The hybridization temperature for hybrids
anticipated to be less than 50 base pairs in length should be
5-10.degree. C. less than the melting temperature (T.sub.m) of the
hybrid, where T.sub.m is determined according to the following
equations. For hybrids less than 18 base pairs in length,
T.sub.m(.degree. C.) = 2(# of A + T # bases) + 4(# of G + C bases).
For hybrids between 18 and 49 base pairs in length,
T.sub.m(.degree. C.) = 81.5 + 16.6 (log.sub.10 [Na.sup.+]) + 0.41
(% G + C) - (600/N), where N is the number of bases in the hybrid,
and [Na.sup.+] is the concentration of sodium ions in the
hybridization buffer ([Na.sup.+] for 1xSSC = 0.165 M).
[0063] Additional examples of stringency conditions for
polynucleotide hybridization are provided in Sambrook, J. et al.,
Molecular Cloning: A Laboratory Manual, New York: Cold Spring
Harbor Laboratory Press (1989), chapters 9 and 11, and Ausubel, F.
M. et al., Current Protocols in Molecular Biology, New York: John
Wiley & Sons, Inc. (1995), sections 2.10 and 6.3-6.4,
incorporated herein by reference.
[0064] Preferably, each such hybridizing polynucleotide has a
length that is at least 25% (more preferably at least 50%, and most
preferably at least 75%) of the length of the polynucleotide of the
present invention to which it hybridizes, and has at least 60%
sequence identity (more preferably, at least 75% identity; most
preferably at least 90% or 95% identity) with the polynucleotide of
the present invention to which it hybridizes, where sequence
identity is determined by comparing the sequences of the
hybridizing polynucleotides when aligned so as to maximize overlap
and identity while minimizing sequence gaps.
[0065] Expression of BBP1
[0066] The isolated polynucleotide of the invention may be operably
linked to an expression control sequence such as the pMT2 or pED
expression vectors disclosed in Kaufman, R. J. et al., Nucleic
Acids Res. 19(16):4485-4490 (1991), in order to produce the protein
recombinantly. Many suitable expression control sequences are known
in the art. General methods of expressing recombinant proteins are
also known and are exemplified in Kaufman, R. J., Methods in
Enzymology 185:537-566 (1990). As defined herein "operably linked"
means that the isolated polynucleotide of the invention and an
expression control sequence are situated within a vector or cell in
such a way that the protein is expressed by a host cell that has
been transformed (transfected) with the ligated
polynucleotide/expression control sequence.
[0067] A number of types of cells may act as suitable host cells
for expression of the protein. Mammalian host cells include, for
example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human
kidney 293 cells, human epidermal A431 cells, human Colo205 cells,
3T3 cells, CV-1 cells, other transformed primate cell lines, normal
diploid cells, cell strains derived from in vitro culture of
primary tissue, primary explants, HeLa cells, mouse L cells, BHK,
HL-60, U937, HaK or Jurkat cells.
[0068] Alternatively, it may be possible to produce the protein in
lower eukaryotes such as yeast or in prokaryotes such as bacteria.
Potentially suitable yeast strains include Saccharomyces
cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains,
Candida, or any yeast strain capable of expressing heterologous
proteins. Potentially suitable bacterial strains include
Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any
bacterial strain capable of expressing heterologous proteins. If
the protein is made in yeast or bacteria, it may be necessary to
modify the protein produced therein, for example by phosphorylation
or glycosylation of the appropriate sites, in order to obtain the
functional protein. Such covalent attachments may be accomplished
using known chemical or enzymatic methods.
[0069] The protein may also be produced by operably linking the
isolated polynucleotide of the invention to suitable control
sequences in one or more insect expression vectors, and employing
an insect expression system. Materials and methods for
baculovirus/insect cell expression systems are commercially
available in kit form from, e.g., Invitrogen, San Diego, Calif.,
U.S.A. (the MaxBac7 kit), and such methods are well known in the
art, as described in Summers and Smith, Texas Agricultural
Experiment Station Bulletin No 1555 (1987), incorporated herein by
reference. As used herein, an insect cell capable of expressing a
polynucleotide of the present invention is "transformed."
[0070] The protein of the invention may be prepared by culturing
transformed host cells under culture conditions suitable to express
the recombinant protein. The resulting expressed protein may then
be purified from such culture (i.e., from culture medium or cell
extracts) using known purification processes, such as gel
filtration and ion exchange chromatography. The purification of the
protein may also include an affinity column containing agents that
will bind to the protein; one or more column steps over such
affinity resins as concanavalin A-agarose, heparin-toyopearl7 or
Cibacrom blue 3GA Sepharose7; one or more steps involving
hydrophobic interaction chromatography using such resins as phenyl
ether, butyl ether, or propyl ether; or immunoaffinity
chromatography.
[0071] Alternatively, the protein of the invention may also be
expressed in a form that will facilitate purification. For example,
it may be expressed as a fusion protein, such as those of maltose
binding protein (MBP), glutathione-S-transferase (GST) or
thioredoxin (TRX). Kits for expression and purification of such
fusion proteins are commercially available from New England BioLab
(Beverly, Mass.), Pharmacia (Piscataway, N.J.) and Invitrogen,
respectively. The protein can also be tagged with an epitope and
subsequently purified by using a specific antibody directed to such
epitope. One such epitope ("Flag") is commercially available from
Kodak (New Haven, Conn.).
[0072] Finally, one or more reverse-phase high performance liquid
chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media,
e.g., silica gel having pendant methyl or other aliphatic groups,
can be employed to further purify the protein. Some or all of the
foregoing purification steps, in various combinations, can also be
employed to provide a substantially homogeneous isolated
recombinant protein. The protein thus purified is substantially
free of other mammalian proteins and is defined in accordance with
the present invention as an "isolated protein."
[0073] The protein of the invention may also be expressed as a
product of transgenic animals, e.g., as a component of the milk of
transgenic cows, goats, pigs, or sheep that are characterized by
somatic or germ cells containing a nucleotide sequence encoding the
protein. Example 13 of the present invention describes the
manufacture of transgenic mice in which human BBP1 is expressed in
neurons.
[0074] The protein may also be produced by known conventional
chemical synthesis. Methods for constructing the proteins of the
present invention by synthetic means are known to those skilled in
the art. The synthetically constructed protein sequences, by virtue
of sharing primary, secondary, or tertiary structural and/or
conformational characteristics with proteins may possess biological
properties in common therewith, including protein activity. Thus,
they may be employed as biologically active or immunological
substitutes for natural, purified proteins in screening of
therapeutic compounds and in immunological processes for the
development of antibodies.
[0075] The proteins provided herein also include proteins
characterized by amino acid sequences similar to those of purified
proteins but into which modifications are naturally provided or
deliberately engineered. For example, modifications in the peptide
or DNA sequences can be made by those skilled in the art using
known techniques. Modifications of interest in the protein
sequences may include the alteration, substitution, replacement,
insertion, or deletion of a selected amino acid residue in the
coding sequence. For example, one or more of the cysteine residues
may be deleted or replaced with another amino acid to alter the
conformation of the molecule. Techniques for such alteration,
substitution, replacement, insertion, or deletion are well known to
those skilled in the art (see, e.g., U.S. Pat. No. 4,518,584).
Preferably, such alteration, substitution, replacement, insertion,
or deletion retains the desired activity of the protein.
[0076] Other fragments and derivatives of the sequences of proteins
that would be expected to retain protein activity in whole or in
part and may thus be useful for screening or other immunological
methodologies may also be easily made by those skilled in the art
given the disclosures herein. Such modifications are believed to be
encompassed by the present invention.
[0077] Inhibition of BBP1 Expression
[0078] In addition to the nucleic acid molecules encoding BBP1
proteins described above, another aspect of the invention pertains
to isolated nucleic acid molecules that are antisense thereto. An
"antisense" nucleic acid comprises a nucleotide sequence that is
complementary to a "sense" nucleic acid encoding a protein, e.g.,
complementary to the coding strand of a double-stranded cDNA
molecule or complementary to an mRNA sequence. Accordingly, an
antisense nucleic acid can hydrogen bond to a sense nucleic acid.
The antisense nucleic add can be complementary to an entire BBPI
coding strand, or to only a fragment thereof. In one embodiment, an
antisense nucleic acid molecule is antisense to a "coding region"
of the coding strand of a nucleotide sequence encoding a BBP1
protein. The term "coding region" refers to the region of the
nucleotide sequence comprising codons that are translated into
amino acid residues. In another embodiment, the antisense nucleic
acid molecule is antisense to a "noncoding region" of the coding
strand of a nucleotide sequence encoding a BBP1 protein. The term
"noncoding region" refers to 5' and 3' sequences that flank the
coding region that are not translated into amino acids (i.e., also
referred to as 5' and 3' untranslated regions).
[0079] Given the coding strand sequence encoding the BBP1 protein
disclosed herein (e.g., SEQ ID NO: 1), antisense nucleotide acids
of the invention can be designed according to the rules of Watson
and Crick base pairing. The antisense nucleic acid molecule can be
complementary to the entire coding region of BBP1 mRNA, but more
preferably is an oligonucleotide that is antisense to only a
fragment of the coding or noncoding region of BBP1 mRNA. For
example, the antisense oligonucleotide can be complementary to the
region surrounding the translation start site of the BBP1 mRNA.
[0080] An antisense oligonucleotide can be, for example, about 5,
10, 15, 20, 25, 30, 35, 40, 45, or 50 necleotides in length. An
antisense nucleic acid of the invention can be constructed using
chemical synthesis and enzymatic ligation reactions using
procedures known in the art. For example, an antisense nucleic acid
(e.g., an antisense oligonucleotide) can be chemically synthesized
using naturally occurring nucleotides or variously modified
nucleotides designed to increase the biological stability of the
molecules or to increase the physical stability of the duplex
formed between the antisense and sense nucleic acids, e.g.,
phosphorothioate derivatives and acridine substituted nucleotides
can be used. Examples of modified nucleotides that can be used to
generate the antisense nucleic acid include 5-fluorouracil,
5-bromouracil, 5-clorouracil, 5-iodouracil, hypoxanthine, xanthine,
4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridin- e,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiour- acil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleic acid can be
produced biologically using an expression vector into which a
nucleic acid has been subcloned in an antisense orientation (i.e.,
RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest,
described further in the following subsection).
[0081] The antisense nucleic acid molecules of the invention are
typically administered to a subject or generated in situ such that
they hybridize with or bind to cellular mRNA and/or genomic DNA
encoding a BBP1 protein to thereby inhibit expression of the
protein, e.g., by inhibiting transcription and/or translation. The
hybridization can be conventional nucleotide complementarity to
form a stable duplex or, for example, in the case of an antisense
nucleic acid molecule which binds to DNA duplexes, through specific
interactions in the major groove of the double helix. An example of
a route of administration of an antisense nucleic acid molecule of
the invention includes direct injection at a tissue site.
Alternatively, an antisense nucleic acid molecule can be modified
to target selected cells and then administered systemically. For
example, for systemic administration, an antisense molecule can be
modified such that it specifically binds to a receptor or an
antigen expressed on a selected cell surface, e.g., by linking the
antisense nucleic acid molecule to a peptide or an antibody that
binds to a cell surface receptor or antigen. The antisense nucleic
acid molecule can also be delivered to cells using the vectors
described herein.
[0082] In yet another embodiment, the antisense nucleic acid
molecule of the invention is an .alpha.-anomeric nucleic acid
molecule. An .mu..-anomeric nucleic acid molecule forms specific
double-stranded hybrids with complementary RNA in which, contrary
to the usual .gamma.-units, the strands run parallel to each other
(Gautier, C. et al., Nucleic Acids Res. 15:6625-6641 (1987)). The
antisense nucleic acid molecule can also comprise a
2'-o-methylribonucleotide (Inoue, H. et al., Nucleic Acids Res.
15:6131-6148 (1987)) or a chimeric RNA-DNA analogue (Inoue, H. et
al., FEBS Lett. 215:327-330 (1987)).
[0083] In still another embodiment, an antisense nucleic acid of
the invention is a ribozyme. Ribozymes are catalytic RNA molecules
with ribonuclease activity that are capable of cleaving a
single-stranded nucleic acid, such as an mRNA, to which they have a
complementary region. Thus, ribozymes (e.g., hammerhead ribozymes
(described in Haseloff, J. and Gerlach, W., Nature
334(6183):585-591 (1988)) can be used to catalytically cleave BBP1
mRNA transcripts to thereby inhibit translation of BBP1 mRNA. A
ribozyme having specificity for a BBP-encoding nucleic acid can be
designed based upon the nucleotide sequence of a BBP1 cDNA
disclosed herein (i.e., SEQ ID NO: 1). For example, a derivative of
a Tetrahymena L-19 IVS RNA can be constructed in which the
nucleotide sequence of the active site is complementary to the
nucleotide sequence to be cleaved in a BBP-encoding mRNA. See,
e.g., Cech et al., U.S. Pat. No. 4,987,071 and Cech et al., U.S.
Pat. No. 5,116,742 both incorporated by reference. Alternatively,
BBP1 mRNA can be used to select a catalytic RNA having a specific
ribonuclease activity from a pool of RNA molecules. See, e.g.,
Bartel, D. and Szostak, J. W., Science 261:1411-1418 (1993).
[0084] Alternatively BBP1 gene expression can be inhibited by
targeting nucleotide sequences complementary to the regulatory
region of the BBP1 gene (e.g., the BBP1 gene promoter and/or
enhancers) to form triple helical structures that prevent
transcription of the BBP1 gene in target cells. See generally,
Helene, C., Anticancer Drug Des. 6(6):569-584 (1991); Helene, C. et
al., Ann. N.Y. Acad. Sci. 660:27-36 (1992); and Maher, L. J.,
Bioessays 14(12):807-815 (1992).
[0085] BBP1 gene expression can also be inhibited using RNA
interference (RNAi). This is a technique for post-transcriptional
gene silencing (PTGS) in which target gene activity is specifically
abolished with cognate double-stranded RNA (dsRNA). RNAi resembles
in many aspects PTGS in plants and has been detected in many
invertebrates including trypanosome, hydra, planaria, nematode, and
fruit fly (Drosophila melanogaster). It may be involved in the
modulation of transposable element mobilization and antiviral state
formation. RNAi in mammalian systems is disclosed in PCT
application WO 00/63364, which is incorporated by reference herein
in its entirety. Basically, dsRNA of at least about 600 nucleotides
homologous to the target (BBP1) is introduced into the cell and a
sequence specific reduction in gene activity is observed.
[0086] Yeast 2 Hybrid Assays
[0087] Y2H assays demonstrated that the association of BAP with the
BBP1 fusion protein is specific. The association of BBP1 with BAP
suggests that BBP1 activity may have a defined role in the
pathogenesis of Alzheimer's disease.
[0088] BBP1 sequences were compared to Genbank using the basic
local alignment search tool (Altschul et al., BLAST, 1990). The
BBP1 protein and translations of available expressed sequence tags
were aligned, searched for conserved segments, and evaluated by
MoST protein motif search algorithm (Tatusov, R., et al., Detection
of conserved segments in proteins: Iterative scanning of sequence
databases with alignment blocks, Proc. Natl. Acad. Sci. USA
91(25):12091-12095 (1994)). These analyses revealed a potential
evolutionary relationship to the G protein-coupled receptor (GPCR)
family. Specifically, these analyses indicated that BBP1 contains
two potential transmembrane (tm) domains equivalent to tm domains 3
and 4 of G protein-coupled receptors. The intervening hydrophilic
loop contains a well-characterized three amino acid mofif,
aspartate (D) or glutamate followed by arginine (R) and an aromatic
residue (Y or F) (commonly referred to as the DRY sequence), that
is conserved in almost all members of this receptor family and has
been shown to serve as a molecular trigger for G protein activation
(Acharya, S. and Karnik, S., Modulation of GDP release from
transducin by the conserved Glu134-Arg135 sequence in rhodopsin. J.
Biol. Chem. 271(41):25406-25411 (1996)).
[0089] Data from Y2H assays indicate that BBP1 represents a novel
protein potentially containing a functional module shared with
members of the G protein-coupled receptor superfamily.
Specifically, it appears that BBP1 retains the critical DRF
sequence (amino acids 199 to amino acids 201 of SEQ ID NO: 2),
between two predicted tm domains, and may have the potential to
couple to a G protein regulated signaling pathway.
[0090] APP has been shown to functionally associate with G.alpha.o.
Alzheimer amyloid protein precursor complexes with brain
GTP-binding protein Go.
[0091] G protein-mediated neuronal DNA fragmentation induced by
familial Alzheimer's disease-binding mutants of APP and BBP1
contains a structural mofif known to be a Ga protein activating
sequence in the related G protein-coupled receptors. Additionally,
a hypothesis based on the predicted position and orientation of
BBP1 tm domains suggests that the region of the protein that
interacts with BAP would be topographically constrained to the same
location as BAP in APP.
[0092] Y2H assay strains were engineered to evaluate the
association of the BBP1 intracellular region with Ga proteins. The
predicted intracellular sequences of BBP1 were expressed as a
fusion protein and assayed for interations with C-terminal regions
of three Ga proteins. Protein segments used in these experiments
are listed in Table 2 below. The BBP1 intracellularloop interacted
with all three Ga proteins, supporting the premise that the BBP1
may function as a modulator of G protein activity. These various
Y2H assays suggest the intriguing model of a multiple protein
complex minimally composed of the integral membrane proteins and
BBP1 and APP coupled to a heterotrimeric G protein.
2TABLE 2 Plasmids used in yeast 2-hybrid assays expression plasmid
Protein segment BAP pEK162 (human) 1-42 pEK24O (mouse) 1-42 BBP1
pEK196 (clone 14) 68-269 pEK198 (.DELTA.tm) 68-202 pEK219
(.DELTA.C) 68-175 pEK216 (.DELTA.N) 123-202 pOZ339 (intracellular)
185-217 G.alpha. pOZ345 (G.alpha.s) 235-394 pOZ346 (G.alpha.o)
161-302 pOZ348 (G.alpha.i2) 213-355
[0093] Further analysis of BBP1 was obtained using Y2H assays. Two
overlapping portions of the BBP1 sequences contained in the
BBP1.DELTA.tm clone were amplified and cloned into the Y2H vector
pACT2 (expression plasmids pEK216 and pEK219, Table 2) and
corresponding proteins BBP1.DELTA.N and BBP1.DELTA.C. The .DELTA.C
construct lacked both tm domains; the .DELTA.N construct encoded
the first tm domain plus the proceeding 52 amino acids. These
fusion proteins were assayed with the BAP fusion protein and
responses compared to those of strains expressing the larger
BBP1.DELTA.tm protein. The BBP1.DELTA.C protein induced a weak Y2H
response (compare BBP1.DELTA.C to vector, FIG. 4), but the
BBP1.DELTA.N protein, containing the first tm domain and adjacent
amino-proximal sequences produced a response only slightly weaker
than that observed with BBP1.DELTA.tm. These results suggest that a
major determinant for the association with BAP is contained within
the BBP1 region predicted to be topographically similar to BAP in
the wild-type APP protein.
[0094] The Y2H system was utilized to demonstrate the selectivity
and specificity of BBP1 binding to human BAP as compared to rodent
BAP. There are three amino acid substitutions (G5R, F10Y and R13H)
in the rodent BAP sequence compared to the human sequence. It was
of interest to evaluate the association of rodent BAP with BBP1 in
the Y2H system. The sequence of human BAP in pEK162 was changed to
encode the rodent peptide by oligonucleotide directed mutagenesis
by PCR. The resultant plasmid, pEK24O, is identical to the human
BAP fusion protein expression plasmid utilized throughout this
report except for the three codons producing the amino acid
substitutions for the rodent peptide sequence. Interactions between
BBP1 fusion protein and rodent and human BAP fusion proteins were
compared by Y2H bioassay. Strains expressing BBP1 and the rodent
BAP failed to produce a growth response. This finding supports the
conclusion that BBP1 serves as a specific mediator of the
neurotoxic effects of BAP, and provides a mechanism to explain the
reduced neurotoxicity of the rodent BAP. Importantly, these data
also serve to illustrate the high degree of specificity of the
BBP1/BAP interaction in the Y2H assays since the substitution of
three amino acids was sufficient to completely abrogate the
association.
[0095] BBP Relationship to the G Protein-Coupled Receptor
Superfamily
[0096] The BBP protein and translations of available ESTs were
assembled, aligned, searched for conserved segments, and evaluated
by the MoST protein motif search algorithm. First, these analyses
revealed three distinct sets of ESTs in both the human and mouse
datasets, indicating that BBP is one member of a structurally
related protein family (as disclosed in PCT publication WO
00/22125, which is hereby incorporated by reference in its
entirety). Subsequently, orthologous sequences to mammalian BBP and
the BBP-like proteins ("BLPs") were also identified in the D.
melanogaster and C. elegans genomes. Human BLP1 and BLP2, and mouse
and fly BBP cDNAs were isolated by reverse transcription-polymerase
chain reaction (RT-PCR) methodologies using EST and genomic DNA
information to guide primer design. The cDNA sequences encoding the
mouse and fly BLP1 and BLP2 proteins were derived from EST and
genomic DNA consensus determinations. A ClustalW alignment of the
human proteins is shown in FIG. 7. The proteins contain potential N
first-terminal secretory signals. Signal peptidase cleavage
(indicated by the arrow in FIG. 7) has been shown to occur in BBP1.
In addition, BBP1 has been shown to be glycosylated. Potential
asparagine-linked carbohydrates are indicated by diamonds.
Importantly, all three proteins contain a conserved segment sharing
primary sequence similarity to the 3.sup.rd and 4.sup.th tm domains
of the G protein coupled receptor (GPCR) superfamily. In 7-tm
domain GPCRs, the arginine in the motif DR (Y or F) has been shown
to be the specific trigger for G protein activation upon agonist
binding. BBP proteins also have this motif, suggesting that they
regulate heterotrimeric G protein signal transduction.
[0097] In addition to a general similarity, >25% identity to the
tm3 through tm4 segment of some GPCR members, other very highly
conserved amino acids include a cysteine immediately preceding tm3
(BBP tm1) and a lysine marking the beginning of tm4 (BBP tm2). A
tryptophan found in tm4 of .about.95% of GPCRs is present at the
equivalent position in the BLP1 and BLP2 subtypes. Preceding the tm
domains, there is little homology between BBP/BLP subtypes, a
common feature of receptor families sharing a conserved signal
coupling domain, with unique activities determined by less
conserved ectodomains. Each protein possesses a region of strong
hydrophobicity near the amino terminus, indicative of an
amino-terminal secretory signal. With the demonstrated
functionality of the amino-terminal signal sequence in BBP, and in
conjunction with the homologies to GPCR topology, it is predicted
that the proteins transverse cellular membranes twice, with both
termini luminal or extracellular as depicted in FIG. 8. As with
prototypic 7-tm domain G protein-coupled receptors, the BBP/BLP
proteins contain the important DRF motif appropriately positioned
between two tm domains, juxtaposed to the first tm domain. This
suggests that the proteins could modulate a heterotrimeric G
protein regulatory pathway.
[0098] Although BBP proteins share a common structure, only the
BBP1 subtype brands AP. All three subtypes were tested for yeast
2-hybrid interactions with A.beta.. Only the BBP1 protein showed a
positive response.
[0099] The specificity of A.beta. for the BBP1 subtype was also
evaluated in human Ntera-2 stem cells transfected with BBP
expression plasmids. Treatment with 10 M aggregated A.beta. for 48
hrs induced a small (20% of maximal apoptosis) response in control
samples. In contrast, cells transfected with a BBP1 expression
plasmid exhibited a substantial and significant increase in
apoptosis No increase was detected with BLP1 or BLP2
transfection.
[0100] Structure of Human BBP1 Gene
[0101] The BBP1 gene comprises seven exons located on the DNA
contig #021923.1. The BBP sequences extend from base 155,044 to
199,466 of the contig. Measuring from the top of human chromosome
1, the BBP mRNA sequence begins near basepair 67,000,000 and ends
near basepair 66,965,000. The coding region is disclosed as SEQ ID
NO: 1. The genomic structure of BBP1 is disclosed in FIG. 11 (SEQ
ID NO: 13).
[0102] BBP1 Homologues
[0103] Species homologues of the disclosed polynucleotides and
proteins are also provided by the present invention (see FIG. 7).
As used herein, a species homologue is a protein or polynucleotide
with a different species of origin from that of a given protein or
polynucleotide, but with significant sequence similarity to the
given protein or polynucleotide indicative of an evolutionary
relationship. For example, human vs. mouse BBP is 84% identical at
the protein level; 85% at the DNA level (in protein coding region).
Comparisons with invertebrates such as Drosophila or C. elegans
produce lower overall identity (human vs. fly BBP proteins are 38%
identical). The core region of BBP proteins (the 2-tm domain
GPCR-like region) shows considerably greater sequence similarity as
shown in FIG. 7. For example, the 67 amino acids of this region of
the human and fly BBP1 are 58% identical.
[0104] Although a wide range of species homologues are disclosed
herein, additional species homologues may be isolated and
identified by making suitable probes or primers from the sequences
provided herein and screening a suitable nucleic acid source from
the desired species. Preferable additional species homologues are
those isolated from certain mammalian species such as, for example,
Pan troglodytes, Gorilla gorilla, Pongo pygmaeus, Hylobates
concolor, Macaca mulatta, Papio papio, Papio hamadryas,
Cercopithecus aethiops, Cebus capucinus, Aotus trivirgatus,
Sanguinus oedipus, Microcebus murinus, Rattus norvegicus,
Cricetulus griseus, Felis catus, Mustela vision, Canis familiaris,
Oryctolagus cuniculus, Bos taurus, Ovis aries, Sus scrofa, and
Equus caballus, for which genetic maps have been created allowing
the identification of syntenic relationships between the genomic
organization of genes in one species and the genomic organization
of the related genes in another species (O'Brien, S. J. et al.,
Ann. Rev. Genet 22:323-351 (1988); O'Brien, S. J. et al., Nature
Genet. 3(2):103-112 (1993); Johansson, M. et al., Genomics
25(3):682-690 (1995); Lyons, L. et al., Nature Genet. 15(1):47-56
(1997); O'Brien, S. J. et al., Trends in Genetics 13(10):393-399
(1997); Carver, E. A. and Stubbs, L., Genome Res. 7(12):1123-1137
(1997); all of which are incorporated by reference herein).
[0105] The invention also encompasses variants of the disclosed
polynucleotides or proteins; that is, naturally occurring
alternative forms of the isolated polynucleotides that also encode
proteins that are identical or have significantly similar sequences
to those encoded by the disclosed polynucleotides. Preferably,
allelic variants have at least 60% sequence identity (more
preferably, at least 75% identity; most preferably at least 90%
identity) with the given polynucleotide, where sequence identity is
determined by comparing the nucleotide sequences of the
polynucleotides when aligned so as to maximize overlap and identity
while minimizing sequence gaps. Variants may be isolated and
identified by making suitable probes or primers from the sequences
provided herein and screening a suitable nucleic acid source from
individuals of the appropriate species.
[0106] The invention also includes polynucleotides with sequences
complementary to those of the polynucleotides disclosed herein as
well as polynucleotides that encode the disclosed proteins but
differ from disclosed sequences as a result of the degeneracy of
the genetic code (see Lewin, B., Genes II, (New York: John Wiley
& Sons, 1985) p. 96, incorporated herein by reference).
[0107] Transgenic Animals
[0108] The transgenic animals of the present invention are
preferentially generated by introduction of the targeting vectors
into embryonal stem (ES) cells. ES cells are obtained by culturing
pre-implantation embryos in vitro under appropriate conditions
(Evans, M. J. and Kaufman, M. H., Nature 292(5819):154-156 (1981);
Bradley, A. et al., Nature 309(5965):255-256 (1984); Gossler, A. et
al., Proc. Natl. Acad. Sci. USA 83(23):9065-9069 (1986); and
Robertson, E. et al., Nature 323(6087):445-448 (1985)). Transgenes
can be efficiently introduced into the ES cells by DNA transfection
using a variety of methods known to the art including
electroporation, calcium phosphate co-precipitation, protoplast or
spheroplast fusion, lipofection and DEAE-dextran-mediated
transfection. Transgenes may also be introduced into ES cells by
retrovirus-mediated transduction or by micro-injection. Such
transfected ES cells can thereafter colonize an embryo following
their introduction into the blastocoel of a blastocyst-stage embryo
and contribute to the germ line of the resulting chimeric animal.
For review, see Jaenisch, R., Science 240(4858):1468-1474 (1988).
Prior to the introduction of transfected ES cells into the
blastocoel, the transfected ES cells may be subjected to various
selection protocols to enrich for ES cells that have integrated the
transgene assuming that the transgene provides a means for such
selection. Alternatively, the polymerase chain reaction may be used
to screen for ES cells that have intergrated the transgene. This
technique obviates the need for growth of the transfected ES cells
under appropriate selective conditions prior to transfer into the
blastocoel.
[0109] Alternative methods for the generation of transgenic animals
containing an altered BBP1 gene are known in the art. For example,
embryonal cells at various developmental stages can be used to
introduce transgenes for the production of transgenic animals.
Different methods are used depending on the stage of development of
the embryonal cell. The zygote is the best target for
micro-injection. In the mouse, the male pronucleus reaches the size
of approximately 20 micrometers in diameter, which allows
reproducible injection of 1-2 picoliters (pl) of DNA solution. The
use of zygotes as a target for gene transfer has a major advantage
in that in most cases the injected DNA will be incorporated into
the host genome before the first cleavage (Brinster, R. L. et al.,
Proc. Natl. Acad. Sci. USA 82(13):4438-4442 (1985)). As a
consequence, all cells of the transgenic non-human animal will
carry the incorporated transgene. This will in general also be
reflected in the efficient transmission of the transgene to
offspring of the founder since 50% of the germ cells will harbor
the transgene. Micro-injection of zygotes is the preferred method
for incorporating transgenes in practicing the invention. U.S. Pat.
No. 4,873,191 describes a method for the micro-injection of
zygotes; the disclosure of this patent is incorporated herein in
its entirety.
[0110] Retroviral infection can also be used to introduce
transgenes into a non-human animal. The developing non-human embryo
can be cultured in vitro to the blastocyst stage. During this time,
the blastomeres can be targets for retroviral infection (Jaenisch,
R., Proc. Natl. Acad. Sci. USA 73(4):1260-1264 (1976)). Efficient
infection of the blastomeres is obtained by enzymatic treatment to
remove the zona pellucida (Hogan, B. et al., Manipulating the Mouse
Embryo (Plainview, N.Y.: Cold Spring Harbor Laboratory Press 1986).
The viral vector system used to introduce the transgene is
typically a replication-defective retrovirus carrying the transgene
(Jahner, D. et al., Proc. Natl. Acad. Sci. USA 82(20):6927-6931
(1985); Van der Putten, H. et al., Proc. Natl. Acad. Sci. USA
82(18):6148-6152 (1985)). Transfection is easily and efficiently
obtained by culturing the blastomeres on a monolayer of
virus-producing cells (Van der Putten, supra; Stewart, C. L. et
al., EMBO J. 6(2):383-388 (1987)). Alternatively, infection can be
performed at a later stage. Virus or virus-producing cells can be
injected into the blastocoele (Jahner, D. et al., Nature
298(5875):623-628 (1982)). Most of the founders will be mosaic for
the transgene since incorporation occurs only in a subset of cells
that form the transgenic animal. Further, the founder may contain
various retroviral insertions of the transgene at different
positions in the genome that generally will segregate in the
offspring. In addition, it is also possible to introduce transgenes
into the germline, albeit with low efficiency, by intrauterine
retroviral infection of the midgestation embryo (Jahner, D. et al.
(1982) supra). Additional means of using retroviruses or retroviral
vectors to create transgenic animals known to the art involves the
micro-injection of retroviral particles or mitomycin C-treated
cells producing retrovirus into the perivitelline space of
fertilized eggs or early embryos (PCT International Application WO
90/08832 (1990) and Haskell, R. E. and Bowen, R. A., Mol. Reprod.
Dev. 40(3):386-390 (1995)).
[0111] Conditional or controllable transgenic animals, as described
in WO 99/31969 (incorporated herein in its entirety by reference)
are also encompassed by this invention. In such animals the
inserted gene is under the control of a regulatable promoter or
other expression control system.
[0112] Knockout Animals
[0113] This invention also pertains to nonhuman animals with
somatic and germ cells having a functional disruption of at least
one, and more preferably both, alleles of an endogenous beta
amyloid binding protein subtype 1 (BBP1) gene. Accordingly, the
invention provides viable animals having a mutated BBP1 gene and
lacking BBP1 activity. These animals will produce substantially
reduced amounts of BBP1 in response to stimuli that produce normal
amounts of BBP1 in wild type control animals. The animals of the
invention are useful, for example, as standard controls by which to
evaluate BBP1 inhibitors, as recipients of a normal human BBP1 gene
to thereby create a model system for screen human BBP1 inhibitors
in vivo, and to identify disease states for treatment with BBP1
inhibitors. The animals are also useful as controls for studying
the effect of BBP1 on .beta.-amyloid and amyloid precursor protein.
In the transgenic nonhuman animal of the invention, the BBP1 gene
preferably is disrupted by homologous recombination between the
endogenous allele and a mutant BBP1 gene, or portion thereof, that
has been introduced into an embryonic stem cell precursor of the
animal. The embryonic stem cell precursor is then allowed to
develop, resulting in an animal having a functionally disrupted
BBP1 gene. The animal may have one BBP1 gene allele functionally
disrupted (i.e., the animal may be heterozygous for the mutation),
or more preferably, the animal has both BBP1 gene alleles
functionally disrupted (i.e., the animal can be homozygous for the
mutation). In one embodiment of the invention, functional
disruption of both BBP1 gene alleles produces animals in which
expression of the BBP1 gene product in cells of the animal is
substantially absent relative to non-mutant animals. In another
embodiment, the BBP1 gene alleles can be disrupted such that an
altered (i.e., mutant) BBP1 gene product is produced in cells of
the animal. A preferred nonhuman animal of the invention having a
functionally disrupted BBP1 gene is a mouse.
[0114] Given the essentially complete inactivation of BBP1 function
in the homozygous animals of the invention and the about 50%
inhibition of BBP1 function in the heterozygous animals of the
invention, these animals are useful as positive controls against
which to evaluate the effectiveness of BBP1 inhibitors. For
example, a stimulus that normally induces production of BBP1 can be
administered to a wild type animal (i.e., an animal having a
non-mutant BBP1 gene) in the presence of a BBP1 inhibitor to be
tested and production of BBP1 by the animal can be measured. The
BBP1 response in the wild type animal can then be compared to the
BBP1 response in the heterozygous and homozygous BBP1 mutant
animals of the invention, similarly administered the BBP1 stimulus,
to determine the percent of maximal BBP1 inhibition of the test
inhibitor. The BBP1 homozygous mutants, of course, will show 100%
inhibition.
[0115] The animals of the invention are useful for determining
whether a particular disease condition involves the action of BBP1
and thus can be treated by a BBP1 inhibitor. For example, an
attempt can be made to induce a disease condition in an animal of
the invention having a functionally disrupted BBP1 gene.
Subsequently, the susceptibility or resistance of the animal to the
disease condition can be determined. A disease condition that is
treatable with a BBP1 inhibitor can be identified based upon
resistance of an animal of the invention (lacking BBP1) to the
disease condition.
[0116] Another aspect of the invention pertains to a transgenic
nonhuman animal having a functionally disrupted endogenous BBP1
gene but which also carries in its genome, and expresses, a
transgene encoding a heterologous BBP1 (i.e., a BBP1 from another
species). Preferably, the animal is a mouse and the heterologous
BBP1 is a human BBP1. An animal of the invention that has been
reconstituted with human BBP1 can be used to identify agents that
inhibit human BBP1 in vivo. For example, a stimulus that induces
production of BBP1 can be administered to the animal in the
presence and absence of an agent to be tested and the BBP1 response
in the animal can be measured. An agent that inhibits human BBP1 in
vivo can be identified based upon a decreased BBP1 response in the
presence of the agent compared to the BBP1 response in the absence
of the agent.
[0117] Yet another aspect of the invention pertains to a nucleic
acid construct for functionally disrupting a BBP1 gene in a host
cell. The nucleic acid construct comprises: a) a nonhomologous
replacement portion; b) a first homology region located upstream of
the nonhomologous replacement portion, the first homology region
having a nucleotide sequence with substantial identity to a first
BBP1 gene sequence; and c) a second homology region located
downstream of the nonhomologous replacement portion, the second
homology region having a nucleotide sequence with substantial
identity to a second BBP1 gene sequence, the second BBP1 gene
sequence having a location downstream of the first BBP1 gene
sequence in a naturally occurring endogenous BBP1 gene.
Additionally, the first and second homology regions are of
sufficient length for homologous recombination between the nucleic
acid construct and an endogenous BBP1 gene in a host cell when the
nucleic acid molecule is introduced into the host cell. In a
preferred embodiment, the nonhomologous replacement portion
comprises a positive selection expression cassette, preferably
including a neomycin phosphotransferase gene operatively linked to
a regulatory element(s). In another preferred embodiment, the
nucleic acid construct also includes a negative selection
expression cassette distal to either the upstream or downstream
homology regions. A preferred negative selection cassette includes
a herpes simplex virus thymidine kinase gene operatively linked to
a regulatory element(s).
[0118] Another aspect of the invention pertains to recombinant
vectors into which the nucleic acid construct of the invention has
been incorporated. Yet another aspect of the invention pertains to
host cells into which the nucleic acid construct of the invention
has been introduced to thereby allow homologous recombination
between the nucleic acid construct and an engogenous BBP1 gene of
the host cell, resulting in functional disruption of the endogenous
BBP1 gene. The host cell can be a mammalian cell that normally
expresses BBP1, such as a human neuron, or a pluripotent cell, such
as a mouse embryonic stem cell. Further development of an embryonic
stem cell into which the nucleic acid has been introduced and
homologously recombined with the endogenous BBP1 gene produces a
transgenic nonhuman animal having cells that are descendant from
the embryonic stem cell and thus carry the BBP1 gene disruption
into their genome. Animals that carry the BBP1 gene disruption in
their germline can then be selected and bred to produce animals
having the BBP1 gene disruption in all somatic and germ cells. Such
mice can then be bred to homozygosity for the BBP1 gene
disruption.
[0119] The present invention further relates to nonhuman animals
wherein the BBP1 gene is conditionally knocked out. In such animals
the Cre/Lox system (see U.S. Pat. No. 4,959,317, which is hereby
incorporated by reference in its entirety) is used to create
constructs (FIG. 12) wherein the portion of the gene to be knocked
out is flanked by Lox sites that can be induced to recombine and
therefore remove the exons that they surround. Such animals are
useful to avoid problems of embryonic lethality and developmental
compensation. Tissue and or temporally (developmentally) specific
conditional mutants are also encompassed by this invention and can
be created using standard techniques to activate the Cre/Lox system
using known tissue or developmentally specific regulatory elements
such as promoters.
[0120] Applications
[0121] BBP1 proteins of the present invention can be used in a
variety of applications routine to one of skill in the art based
upon this disclosure. Specifically the BBPs can be used as
immunogens to raise antibodies that are specific to the cloned
polypeptides. Various procedures known in the art may be used for
the production of antibodies to BBP1 proteins. Such antibodies
include, but are not limited to, polyclonal, monoclonal, chimeric,
single chain, Fab fragments and a Fab expression library. For the
production of antibodies, various host animals including, but not
limited to rabbits, mice, and rats, are injected with a BBP. In one
embodiment, the polypeptide or a fragment of the polypeptide
capable of specific immunoactivity is conjugated to an immunogenic
carrier. Adjuvants may also be administered in conjunction with the
polypeptide to increase the immunologic response of the host
animal. Examples of adjuvants that may be used include, but are not
limited to, complete and incomplete Freund's, mineral gels such as
aluminum hydroxide, surface active substances such as lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, keyhole
limpet hemocyanin, and dinitrophenol.
[0122] Monoclonal antibodies to BBP1 proteins of the present
invention can be prepared using any technique that provides for the
production of antibodies by continuous cell line in culture. Such
techniques are well known to those of skill in the art and include,
but are not limited to, hybridoma technology, the human B-cell
hybridoma technique described by Kozbor et al. (Immunology Today
4:72-79 (1983)) and the EBV-hybridoma technique described by Cole
et al. (Monoclonal Antibodies and Cancer Therapy (New York: Alan R.
Liss, Inc.) p. 77-96). Antibodies according to the present
invention were manufactured as described in Example 9.
[0123] Antibodies immunoreactive to the polypeptides of the present
invention can then be used to screen for the presence and
subcellular distribution of similar polypeptides in biological
samples. In addition, monoclonal antibodies specific to the BBP1
proteins of the present invention can be used as therapeutics.
[0124] Antibodies according to the present invention may be used
therapeutically to treat a mammal in need of such treatment.
Specifically the antibodies may be used to inhibit the binding of
extracellular molecules to the extracellular domains of the BBP1
protein. Therapeutic antibodies may also be those that inhibit the
interaction of BBP1 with .beta.-amyloid.
[0125] The BBP1 proteins can also serve as antigens useful in solid
phase assays measuring the presence of antibodies that immunoreact
with the claimed peptides. Solid phase competition assays can be
used to measure immunological quantities of clone 14-related
antigen in biological samples. This determination is not only
useful in facilitating the complete characterization of the
cellular function or functions of the polypeptides of the present
inventions, but can also be used to identify patients with abnormal
amounts of these proteins.
[0126] BBP1 proteins of the present invention can also be used as
capture reagents in affinity chromatography for the detection of
BAP and BAP aggregates as markers for AD.
[0127] In addition, these BBP1s are useful as reagents in an assay
to identify candidate molecules that affect the interaction of BAP
and the cloned protein. Compounds that specifically block this
association could be useful in the treatment or prevention of
AD.
[0128] These BBP1 are also useful in acellular in vitro binding
assays wherein alteration by a compound in the binding of these
.beta.-amyloid peptide associated proteins to BAP or BAP aggregates
is determined. Acellular assays are extremely useful in screening
sizable numbers of compounds since these assays are cost effective
and easier to perform than assays employing living cells. Upon
disclosure of the polypeptides of the present invention, the
development of these assays would be routine to the skilled
artisan. In such assays, either BBP1 or BAP is labeled. Such labels
include, but are not limited to, radiolabels, antibodies, and
fluorescent or ultraviolet tags. Binding of a BBP1 to BAP or BAP
aggregates is first determined in the absence of any test compound.
Compounds to be tested are then added to the assay to determine
whether such compounds alter this interaction. One example of an in
vitro binding assay is described in detail in Example 7.
EXAMPLES
[0129] The present invention is further described by the following
examples. The examples are provided solely to illustrate by
reference to specific embodiments. These exemplifications, while
illustrating certain specific aspects of the invention do not
portray the limitations or circumscribe the scope of the
invention.
[0130] Yeast two-hybrid system (hereinafter "Y2H"): Y2H expression
plasmids were constructed in vectors pAS2 and pACT2 and pCUP. Yeast
strain CY770 served as the host for all Y2H assays.
[0131] Genetic screen: The polymerase chain reaction (PCR) method
was used to amplify and modify sequences encoding BAP.
Oligonucleotides #1 (5'-CC ATG GAT GCA GM TTC CGA C) (SEQ ID NO:
14) and #3 (5'-AAGCTTGTCGAC TTA CGC TATGAC MC ACC GC) (SEQ ID NO:
15) were used to amplify BAP using pCLL621, a modified human APP
clone, as a template (Jacobsen et al. 1994). The release of
Alzheimer's disease .beta.-amyloid peptide is reduced by phorbol
treatment. The amplified DNA consists of codons 389 to 430 (which
encodes BAP.sub.42) of the APP precursor protein with the following
modifications. The sense strand primer added a 5' NcoI restriction
site in the same translational reading frame as the NcoI site in
pAS2. The antisense strand primer added a stop codon and HindIII
and SalI sites for cloning. The product from this amplification was
ligated into the TA cloning system (Invitrogen Corp., Carlsbad,
Calif.) and subsequently removed by digestion with NcoI and SalI.
This fragment was cloned into pAS2 cleaved with NcoI plus SalI. The
resultant plasmid, pEK162, was confirmed by DNA sequencing through
the Gal4/BAP junction. The protein (BAP.sup.BD; FIG. 1) expressed
from pEK162 comprised a fusion protein containing the DNA-binding
domain of the yeast transcriptional activation protein Gal4
(lacking functional activation sequences) with the addition of the
42 amino acids of BAP to the carboxy-terminus. An expression
plasmid was developed that mediates the expression of unmodified
BAP.sub.42. Oligo #2 (5'-MGCTTMG ATG GAT GCA GM TTC CGA C) (SEQ ID
NO: 16) was paired with oligo #3 in a PCR as described above. The
product of this amplification contains a 5' HindIII site and
translation initiation signals optimized for expression in
Saccharomyces cerevisiae. Again, the DNA fragment was cloned into
the TA system. It was then isolated on a HindIII fragment and
cloned into pCUP cleaved with HindIII. The orientation of the BAP
gene in the resultant plasmid, pEK 149 (BAP; FIG. 1), was confirmed
by DNA sequencing. The BAP expression plasmids pEK 149 (which used
URA3 as the selection marker) and pEK 162 (which used TRP1 as the
selection marker) were transformed into the yeast host CY770. The
strain containing both plasmids was designated CY2091. A plasmid
library consisting of cDNA fragments isolated from human fetal
brain cloned into the yeast 2-hybrid expression vector pACT2 (which
used LEU2 as the selection marker) was purchased from Clontech
Laboratories, Inc. (Palo Alto, Calif.). The library-derived protein
is depicted in FIG. 1 as unknown.sup.AD. This library was used to
transform CY2091. The samples were spread on synthetic complete
(SC) yeast growth medium lacking uracil, typtophan, and leucine to
select cells containing all three plasmids. The medium also lacked
histidine and contained 3-amino-triazole, an inhibitor of the
product of the yeast HIS3 gene, at a concentration of 25 mM.
3-Amino-triazole was utilized to reduce activity from low-level
constitutive expression of the HIS3 reporter gene. Plates were
incubated at 30.degree. C. for 12 days, Twenty-four colonies
exhibiting increased histidine prototrophy were isolated.
Transformation controls indicated that the screen assayed 10.sup.6
individual clones. A PCR approach was utilized to quickly determine
the content of positive clones. Total DNA was isolated from each
positive strain by standard methods. This material was used as a
template for PCRs using oligos #4 (5'-TTTAATACCA CTACMTGGA T) (SEQ
ID NO: 17) plus #5 (5'-TTTTCAGTAT CTACGATTCA T) (SEQ ID NO: 18),
which flank the cloning region of the library vector pACT2. DNA
fragments were ligated into the TA system and examined by DNA
sequencing. The library plasmid contained in clone #14 (as
described above) was isolated by shuttle into E. coli. The
nucleotide sequence of the human cDNA sequences was determined,
confirming the sequence of the initial PCR product.
[0132] Bioassays: Strains were grown overnight in 2 ml SC medium
lacking leucine and tryptophan to a density of approximately
7.times.10.sup.7 cells per ml. Cells were counted and 10-fold
serial dilutions made from 10.sup.4 to 10.sup.8 cells per ml in
sterile water. These samples were spotted in 5 .mu.l aliquots on SC
medium lacking leucine, tryptophan and histidine and containing 25
mM 3-amino-triazole. Plates were incubated at 30.degree. C. for 2
to 3 days. Positive protein/protein interactions were identified by
increased prototrophic growth compared to control strains
expressing the Gal4 DNA-binding domain fusion protein plus an
irrelevant transcriptional activation domain fusion protein (or
simply containing the pACT vector without inserted sequences). This
assay method was highly reproducible and provided for the detection
of subtle inductions of growth mediated by the specific interaction
between target proteins. The original BBP1 clone (designated pEK
196 and deposited as ATCC 98399; is referred herein as clone 14),
was used as a PCR template to truncate the protein product to
express BBP1.DELTA.tm. Sense primer #6 (5'-TTTAATACCA CTACAATGGA T)
(SEQ ID NO: 19) annealed to Gal4 sequences in pACT2. The antisense
primer #7 (5'-CTCGAG TTA MA TCG ATC TGC TCC CAA CC) (SEQ ID NO: 20)
incorporated a 3' stop codon and XhoI site immediately 3' to the
sequences encoding the DRF motif of BBP1. The PCR product was
ligated into the TA cloning vector and subsequently digested with
EcoRI+XhoI and cloned into pACT2. The hybrid product expressed from
this plasmid (pEK 198) was denoted BBP1.DELTA.tm. Similarly, primer
#7 was paired with primer #8 (5'-GMTT CCA MA ATA MT GAC GCT ACG)
(SEQ ID NO: 21) to engineer the BBP1.DELTA.N expression plasmid
pEK216. Again, the PCR product was ligated into the TA system and
the resultant plasmid digested with EcoRI+XhoI with the BBP1
fragment (codons 123-202) finally ligated into pACT2 digested with
the same enzymes. BBP1.DELTA.C was made by using the pACT2-specific
oligo #6 with antisense oligo #9 (5'-CTCGAG TCA AGA TAT GGG CTT GM
MA AC) (SEQ ID NO: 22). After TA cloning, isolation of the
EcoRI-XhoI fragment and cloning into pACT2, the resultant plasmid,
pEK219, expressed BBP1 from residue 68 to 175. Sequences encoding
the BBP1 intracellular loop were amplified using oligonucleoides
#10 (5'-CCTTCC ATG GM GTG GCA GTC GCA TTG TCT) (SEQ ID NO: 23) plus
#11 (5'-MCACTCGAG TCA AM CCC TAC AGT GCA MA C) (SEQ ID NO: 24).
This product, containing BBP1 codons 185 to 217, was digested with
NcoI+XhoI and cloned into pAS2 cleaved with NcoI+SalI to generate
pOZ339. Construction of all G.alpha. protein expression plasmids
utilized the BamHI site near the center of each rat cDNA sequence
as the site of fusion in pACT2 (Kang, Y. S. et al., Mol. Cell Biol.
10(6):2582-2590 (1990)). Sense primers annealed to sequences 5' of
the BamHI site; antisense primers annealed to sequences 3' of the
stop codon and included a SalI restriction site. Primers were:
G.alpha.o, sense (#17)=5'-GTGGATCCAC TGCTTCGAGG AT (SEQ ID NO: 25),
antisense (#18)=5'-GTCGACGGTT GCTATACAGG ACMGAGG (SEQ ID NO: 26);
Gas, sense (#19)=5'-GTGGATCCAG TGCTTCMTG AT (SEQ ID NO: 27),
antisense (#20)=5'-GTCGACTMA TTTGGGCGTT CCCTTCTT (SEQ ID NO: 28);
Gai2, sense (#21)=5'-GTGGATCCAC TGCTTTGAGG GT (SEQ ID NO: 29),
antisense (#22)=5'-GTCGACGGTC TTCTTGCCCC CATCTTCC (SEQ ID NO: 30).
PCR products were cloned into the TA vector. Ga sequences were
isolated as BamHI-SalI fragments and cloned into pACT2 digested
with BamHI+SalI. See Table 2 for plasmid designations. Finally,
oligonucleotide #23 was synthesized for the conversion of human BAP
to the rodent sequence. This primer has the sequence 5'-ATATGGCCATG
GAT GCA GM TTC GGA CAT GAC TCA GGA TTT GM GTT CGT (SEQ ID NO: 31).
The triplets represent the first 13 codons of BAP; the three
nucleotides that were changed to produce the rodent sequence are
underlined. Oligo #23 was paired with #24 (5'-TGACCTACAG
GAAAGAGTTA) (SEQ ID NO: 32), which anneals to a region of the Y2H
vectors that is 3' of the cloning site in a PCR using pEK 162 as
the template. The product was cleavd with NcoI+SalI and ligated
into pAS2 to produce pEK240. The nucleotide sequence of the segment
encoding rodent BAP was confirmed.
[0133] Genomic cloning: RACE (rapid amplification of cDNA ends): A
human genomic lambda library (Stratagene), corresponding to
.sup.a2.0.times.10.sup.6 pfus, was screened with randomly primed
EcoRI/ClaI fragment probe corresponding to nucleodites 187-600. The
probe was labeled with [.sup.32P]-CTP using the .sup.T7QuickPrimer
Kit according to the manufacturer's (Pharmacia) protocol. Filters
were hybridized under high stringency: 40.degree. C. in 50%
formamide, 0.12M NaHPO.sub.4, 0.25M NaCl, 7% SDS and 25 mg/ml
sonicated salmon sperm DNA and washed at 65.degree. C. in
0.1.times. SSC containing 0.1% sodium dodecyl sulfate and exposed
to Kodak BioMax MS film. Lambda phage clones hybridizing to the
probe were plaque purified by successive plating and rescreening.
Ten positive clones were purified and subjected to further analysis
by hybridization to a 45 nt oligonucleotide probe directed to the
most 5' sequences known from the original cDNA clone. This
oligonucleotide was the reverse complement of nucleotides 157-201
and has the sequence 5'-CCAGGCGGCC GCCATCTTGG AGACCGACAC TTTCTCGCCA
CTTCC (SEQ ID NO: 33). Lambda phage DNA was isolated by standard
molecular biology techniques and subjected to direct sequencing
using fluorescent dideoxy cycle sequencing on an ABI 373
sequencer.
[0134] RACE: First strand DNA synthesis was performed using the
rTth thermal-stable polymerase system (Perkin Elmer). The following
reagents were combined in a 1.5 mL tube to give a 10 microliter
volume: 1.times. reverse transcription buffer, 1 mM MnCl.sub.2, 1.6
mM dNTP mix, 2.5U rTth polymerase, 100 ng human hippocampus poly
A.sup.+ RNA (Clontech), 10 mM oligonucleotide (nt 429452;
5'-GTTATGTTGG GTGCTGGMA ACAG) (SEQ ID NO: 34). The reaction was
incubated at 70.degree. C. for 15 minutes and immediately placed on
ice. The Marathon cDNA synthesis kit (Clontech) was used for second
strand cDNA generation. The entire 1 Opi from the first strand
reaction was combined with the following reagents: 1.times. second
strand buffer, 0.8 mM dNTP mix, 4.times. second strand cocktail (E.
coli DNA polymerase I, E. coli DNA ligase, E. coli RNaseH), and
dH.sub.2O up to a volume of 80 .mu.l. The tube was incubated at
16.degree. C. for 1.5 hours after which time T4 DNA polymerase
(1OU) was added and incubated for an additional 45 minutes at
16.degree. C. To terminate the reaction, 4 .mu.l of 20.times.
EDTA/glycogen (0.2M EDTA/2 mg/ml glycogen) was added to the
reaction mixes followed by a phenol/chloroform/isoamyl alcohol
extraction to remove enzymes and other impurities. The DNA was
precipitated by adding 0.1.times. volume 3M Na acetate pH 5.2 and
2.5.times. volume reagent grade EtOH and placed at -70.degree. C.
The DNA was washed once with 70% EtOH, dried down and resuspended
in 10 .mu.l dH.sup.2O. Half of the DNA was used for Marathon
adaptor ligation to be used in subsequent RACE PCR reactions
following the Clontech protocol as follows: 5 .mu.l cDNA was added
to 2 .mu.l (10 mM) Marathon (5; --CTMTACGAC TCACTATAGG GCTCGAGCGG
CCGCCCGGGC AGGT) (SEQ ID NO: 35), 1.times. DNA ligation buffer and
1 .mu.l (1 U) T4 DNA ligase. The reaction mix was incubated
overnight at 16.degree. C. The mix was diluted 1:50 for initial
RACE reaction and combined in a 0.2 mL PCR tube with the following:
40 .mu.l dH.sub.2O, 1 .mu.l 10.times. Klentaq DNA polymerase
(Clontech), 1 .mu.l (10 mM) Ap1 primer (5'-CCATCCTMT ACGACTCACT
ATAGGGC) (SEQ ID NO: 36), 1 .mu.l (10 mM) BBP1-specific primer
(corresponding to nucleotides 187-209; 5'-CCAGACGGCCA GGCGGCCGCC
AT) (SEQ ID NO: 37), 5 .mu.l 10.times. Klentaq polymerase buffer, 1
.mu.l 10 mM dNTP mix, 1 .mu.l of diluted cDNA from above reaction.
The following cycling conditions were performed using a Perkin
Elmer GeneAmp PCR system 2400 thermocycler. Denaturing cycle
94.degree. C. for 1 minute followed by 5 cycles of 30" at
94.degree. C., 3' at 72.degree. C., 5 cycles of 30" at 94.degree.
C., 3' at 70.degree. C., followed by 25 cycles of 30" at 94.degree.
C., 3' at 68.degree. C., with a final extension 7' at 72.degree. C.
This was followed by a nested RACE PCR reaction as follows: 40
.mu.l dH.sub.2O, 1 .mu.l (1 U) 10.times. AmplitaqGold DNA
polymerase (Perkin Elmer), 1 .mu.l (10 mM) AP2 primer
(5'-ACTCACTATA GGGCTCGAGC GGC) (SEQ ID NO: 38), 1 .mu.l (10 mM)
BBP1-specific primer (corresponding to nucleotides 172-194;
5'-GCCGCCATCT TGGAGACCGA CAC) (SEQ ID NO: 39), 5 .mu.l 10.times.
Amplitaq polymerase buffer, 1 .mu.l 10 mM dNTP mix, 1 .mu.l of
primary RACE product. The PCR cycling conditions were an initial
denaturing cycle of 9' at 94.degree. C., 25 cycles of 30" at
94.degree. C., 30" at 68.degree. C., 2' at 72.degree. C., followed
by a 72.degree. C. extension for 7'. The PCR product was run on a
1% agarose gel in 1.times.TBE buffer. The resulting 350 base pairs
product was gel purified and directly cloned using the TA Cloning
Kit (Invitrogen). Ligation mixes were transformed into OneShot
Cells (Invitrogen) and plated on LB-ampicillin 100 .mu.g/ml) agar
plates containing X-gal. Mini-prep DNA was obtained and examined by
fluorescent dideoxy cycle sequencing on an ABI 373 sequencer.
[0135] Northern analyses: Human multiple tissue and multiple brain
tissue mRNA Northern blots were obtained from Clontech (Palo Alto,
Calif.). BBP1 sequences extending from the original fusion junction
to the poly-A region were isolated on an EcoRI fragment from a TA
clone derived from pEK196. .beta.-actin DNA was provided by the
manufacturer. Radiolabeled probes were produced from the DNAs using
a random priming method to incorporate .sup.32P-dCTP (Pharmacia
Biotech, Piscataway, N.J.). Hybridizations were performed per
manufacturer's (Clontech) instructions in Express Hyb Solution at
68.degree. C. Blots were washed in 2.times.SSC (1.times.SSC is 0.15
M sodium chloride, 0.015 M sodium citrate), 0.05% SDS at room
temperature, followed by two washes in 0.1.times.SSC, 0.1% SDS at
50.degree. C. Hybridization signals were visualized by exposure to
Kodak BioMax film.
[0136] In situ hybridization: DNA templates for riboprobe synthesis
were prepared by PCR using a plasmid clone containing the full
length human BBP cDNA. A single riboprobe targeted to the 3' UTR of
the cDNA was used. The probe sequences were checked versus the
GenBank database to ensure that they only recognized the
appropriate targets among all deposited sequences. To generate
riboprobes for BBP1, a pair of oligonucleotide primers was designed
to amplify a 275 base pairs region from the 3' UTR of the BBP1 cDNA
and, in addition, add the promoter sequences for T7 (sense) and T3
(antisense) polymerase. These primers contained the following
sequences: 5'-TMTACGACT CACTATAGGG TTAGMGAAA CAGATTTGAG (SEQ ID NO:
40) (forward); 5'-ATTMCCCTC ACTAAAGGGA CAAGTGGCAA CTTGCCTTTG (SEQ
ID NO: 41) (reverse). PCR products were gel purified on 1.5%
low-melt agarose gels, and bands containing the products were
excised, phenol and phenol-chloroform extracted, and ethanol
precipitated. Pellets were dried and resuspended in 1.times. TE
buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4). The APP riboprobe
template consisted of a Ddel-XhoI fragment from the protein coding
region, as described by Jacobsen et al. (A novel species-specific
RNA related to alternatively spliced amyloid precursor protein
mRNAs, Neurobiol of Aging 12:575-583 (1991)). Fifty ng of DNA
template was used for transcription reactions using (.sup.35S)-CTP
(New England Nuclear, Boston, Mass.) and the Riboprobe Gemini.TM.
System (Promega, Madison, Wis.).
[0137] In situ hybridization histochemistry using sections of
postmortem human hippocampus were performed as described previously
(Rhodes K. et al., Voltage-gated K+channel beta subunits:
expression and distribution of Kv beta 1 and Kv beta 2 in adult rat
brain, J. Neurosci. 16: 4846-4860 (1996)). Sections were cut at 10
.mu.m on a Hacker-Brights cryostat and thaw-mounted onto chilled
(-20.degree. C.) slides coated with Vectabond reagent (Vector Labs,
Burlingame, Calif.). All solutions were prepared in dH.sub.2O
treated with 0.1% (v/v) diethylpyrocarbonate and autoclaved.
Sections were fixed by immersion in 4% paraformaldehyde in PBS (pH
7.4) then immersed sequentially in 2.times.SSC, dH.sub.2O, and 0.1M
triethanolamine, pH 8.0. The sections were then acetylated by
immersion in 0.1M triethanolamine containing 0.25% (v/v) acetic
anhydride, washed in 0.2.times.SSC, dehydrated in 50, 70 and 90%
ethanol, and rapidly dried. One ml of prehybridization solution
containing 0.9M NaCl, 1 mM EDTA, 5.times. Denhardt's, 0.25 mg/ml
single-stranded herring sperm DNA (GIBCO/BRL, Gaithersburg, Md.),
50% deionized formamide (EM Sciences, Gibbstown, N.J.) in 10 mM
Tris, (pH 7.6), was pipetted onto each slide, and the slides
incubated for 3 hrs. at 50.degree. C. in a humidified box. The
sections were then dehydrated by immersion in 50, 70, and 90%
ethanol and air dried. Labeled riboprobes were added at a final
concentration of 50,000 cpm/.mu.l to hybridization solution
containing 0.9M NaCl, 1 mM EDTA, 1.times. Denhardt's, 0.1 mg/ml
yeast+RNA, 0.1 mg/ml single-stranded salmon sperm DNA, dextran
sulfate (10%), 0.08% BSA, 10 mM DTT (Boehringer Mannheim,
Indianapolis, Ind.), and 50% deionized formamide in 10 mM Tris (pH
7.6). The probes were then denatured at 95.degree. C. (1 min),
placed on ice (5 min), and pipetted onto the sections and allowed
to hybridize overnight at 55.degree. C. in a humidified chamber.
The sections were subsequently washed 1.times.45 min at 37.degree.
C. in 2.times.SSC containing 10 mM DTT, followed by 1.times.30 min
at 37.degree. C. in 1.times.SSC containing 50% formamide, and
1.times.30 min at 37.degree. C. in 2.times.SSC. Single stranded and
non-specifically hybridized riboprobe was digested by immersion in
10 mM Tris pH 8.0 containing bovine pancreas RNAse A (Boehringer
Mannheim; 40 mg/ml), 0.5M NaCl, and 1 mM EDTA. The sections were
washed in 2.times.SSC for 1 hr at 60.degree. C., followed by
0.1.times.SSC containing 0.5% (w/v) sodium thiosulfate for 2 hrs.
at 60.degree. C. The sections were then dehydrated in 50, 70, 90%
ethanol containing 0.3M ammonium acetate, and dried. The slides
were loaded in X-ray cassettes and opposed to Hyperfilm b-Max
(Amersham) for 14-30 days. Once a satisfactory exposure was
obtained, the slides were coated with nuclear-track emulsion
(NTB-2; Kodak) and exposed for 7-21 days at 4.degree. C. The
emulsion autoradiograms were developed and fixed according to the
manufacturer's instructions, and the underlying tissue sections
were stained with hematoxylin. To assess nonspecific labeling, a
control probe was generated from a template provided in the
Riboprobe Gemini.TM. System kit (Promega). This vector was
linearized using ScaI and transcribed using T3 polymerase. The
resulting transcription reaction generates two products, a 250 base
and a 1,525 base riboprobe, containing only vector sequence. This
control probe mixture was labeled as described above and added to
the hybridization solution at a final concentration of 50,000
cpm/.mu.l. No specific hybridization was observed in control
sections, i.e., these sections gave a very weak uniform
hybridization signal that did not follow neuroanatomical landmarks
(data not shown).
EXAMPLE 1
Cloning and Isolation BAP-Binding Protein (BBP1)
[0138] A yeast 2-hybrid genetic screen was developed to identify
proteins that interact with human BAP.sub.42, a 42 amino acid
proteolytic fragment of APP, which is considered to potentially be
the more toxic aggregated form of BAP. BAP.sub.42 was expressed
fused to the yeast Gal4 DNA-binding domain and was also expressed
as free peptide (FIG. 1). This strain was transformed with a human
fetal brain cDNA Y2H library. A single clone, designated clone14
defined above, from approximately 10.sup.6 independent
transformants, produced consistent reporter gene activation and
contained a substantial open reading frame continuous with that of
the Gal4 domain. The cDNA insert comprised 984 base pairs,
terminating in a poly-A tract. This sequence encoded 201 amino
acids (SEQ ID NO: 2 amino acid residues 68 to 269) with two regions
of sufficient length and hydrophobicity to transverse a cellular
membrane.
[0139] The library-derived plasmid was isolated from clone 14 and
used to reconstruct Y2H assay strains. Examination of these strains
demonstrated that the BAP fusion protein specifically interacted
with the clone 14 protein, although the response was weak. Since
protein domains of strong hydrophobicity, such as transmembrane
regions, inhibit Y2H responses, the clone 14 insert was truncated
(hereinafter BBP1.DELTA.tm) to remove the region of strongest
hydrophobicity and retested for interactions with BAP. A much more
robust Y2H response was observed with BBP1.DELTA.tm, supporting the
notion that the deleted sequences encode a potential transmembrane
("tm") anchor. The nucleotide sequence of clone 14 was searched
against GenBank; the BAP binding protein (BBP1) thus identified was
found to be novel.
EXAMPLE 2
Isolation and Confirmation of the 5' Terminus of BBP1
[0140] The BBP1 cDNA sequences contained in clone 14 described in
Example 1, above, lacked the 5' end of the protein coding region as
no potential initiating methionine codon was present. Multiple
attempts at conventional 5' RACE (rapid amplification of cDNA ends)
utilizing a standard reverse-transcriptase only resulted in the
addition of 27 nucleotides. These sequences included an ATG, but no
upstream stop codon in the same translational reading frame to
provide confidence that this was the initiating codon. A genomic
cloning approach was initiated to isolate the 5' terminus of the
BBP1 gene.
[0141] Hybridization of a human genomic lambda library with a
randomly primed probe corresponding to 400 base pairs (bps) of the
5' sequence of clone 14 resulted in identification of 10 positive
clones. Further characterization of these clones using a 45-base
oligonucleotide probe directed to the most upstream BBP1 sequence
of clone 14 (and corresponding to the 5' upstream sequence of the
400 base pairs probe revealed that 6 of the 10 clones included the
terminal 5' sequences contained within those previously identified.
It was determined that the other 4 lambda clones represented other
exons that were contained within the original 400 base pairs
randomly primed cDNA-derived probe (data not shown). Direct cycle
sequencing of lambda phage DNA from representative clones
corresponding to the 5' end of BBP1 revealed 500 nucleotides
upstream and overlapping with the sequence known for clone 14. This
additional sequence potentially encodes 62 additional amino acids
upstream of the previously characterized MET before arriving at MET
preceded by an in-frame stop codon. Although there exist two MET
residues downstream from the furthest upstream MET, by standard
convention we have tentatively defined the sequence of the amino
terminus of the human BBP1 gene to include the first 5' MET that
follows an in-frame stop codon. The entire coding region and
deduced protein sequence is shown in SEQ ID NOs: 1 and 2. A plasmid
(denoted BBP1-fl) containing this amino acid sequence has been
deposited in the American Type Culture Collection having accession
number 98617.
[0142] Since the 5' coding sequences were derived from a genomic
library, there existed the possibility that this region contained
introns. This potentiality was investigated by two methods. First,
a forward primer directed to the region of the 5' MET and a reverse
primer within the original clone 14 were utilized to amplify
sequences from brain cDNA as well as from genomic DNA. Products of
identical size were generated from both samples, indicating the
absence of introns within this region and confirming the linkage of
the upstream sequence with the original sequence. Secondly, cDNA
sequences were isolated in modified 5' RACE experiments (see
Materials and Methods, above) that were identical to those obtained
from the genomic clone. These findings confirmed the upstream
sequences (both from genomic and cDNA sources) and the lack of
introns in this region.
EXAMPLE 3
Characterization of BBP1
[0143] BBP1 sequences were compared to Genbank using the basic
local alignment search tool (BLAST, Altschul, S. et al., Basic
local alignment search tool, J. Mol. Biol. 215(3):403-410 (1990)).
Two Caenorhabditis elegans and one Drosophila melanogaster genomic
sequence and a larger number of human, mouse, and other mammalian
expressed sequence tags were identified. However, no complete cDNA
sequences were available nor were any functional data attributed to
the gene. The BBP1 protein and translations of available expressed
sequence tags were aligned, searched for conserved segments, and
evaluated by the MoST protein motif search algorithm. These
analyses revealed a potential evolutionary relationship to the G
protein-coupled receptor family. Specifically, these analyses
indicated that BBP1 contains two potential transmembrane (tm)
domains equivalent to tm domains 3 and 4 of G protein-coupled
receptors. The intervening hydrophilic loop contains a
well-characterized three amino acid motif, aspartate (D) or
glutamate followed by arginine (R) and an aromatic residue (Y or F)
(commonly referred to as the DRY sequence) that is conserved in
almost all members of this receptor family and has been shown to
serve as a molecular trigger for G protein activation (Acharya and
Karnik, 1996). These data indicate that BBP1 represents a novel
protein containing a functional module shared with members of the G
protein-coupled receptor superfamily. BBP1 retains the critical DRF
sequence between two predicated tm domains, so has the potential to
couple to a G protein regulated signaling pathway.
[0144] Structural analysis of BBP1 indicated it contained a
structural motif known to be a Ga protein activating sequence in
the related G protein-coupled receptors. Y2H assays demonstrating
the interaction of BBP1 with various members of the G
protein-coupled receptors were performed. The predicted
intracellular domain of BBP1 was expressed as a Gal4 DNA-binding
domain with portions of rat G.alpha.s, G.alpha.o, or G.alpha.i2
expressed as Gal4 activation domain fusion proteins. Y2H responses
of two independently derived clones of each strain were compared to
responses of cells lacking a G protein component (vector). Based on
structural predictions, BBP1 is depicted as transversing a membrane
twice with both termini in the lumenal compartment. Other
orientations cannot be entirely ruled out. The potential protein
interactions described above were investigated in Y2H assays. Two
overlapping portions of the BBP1 sequences contained in the BBP1
.DELTA.tm clone were amplified and cloned into the Y2H vector pACT2
(expression plasmids pEK216 and pEK219, Table 2 and corresponding
proteins BBP1.DELTA.N and BBP1.DELTA.C). The .DELTA.C construct is
lacking both tm domains; the .DELTA.N construct encodes the first
tm domain plus the preceding 52 amino acids. These fusion proteins
were assayed with the BAP fusion protein and responses compared to
those of strains expressing the larger BBP1.DELTA.tm protein. These
results suggest that a major determinant for the association with
BAP is contained within the BBP1 region predicted to be
topographically similar to BAP in the wild-type APP protein.
EXAMPLE 4
Tissue Distribution of Human BBP1 Expression
[0145] Expression of BBP1 mRNA was evaluated as an initial step in
elucidating the activity of the gene and its product. Nylon
membranes blotted with 2 .mu.g size fractionated poly-A RNA
isolated from the indicated tissues were obtained from Clontech.
These were hybridized with a radiolabled BBP1 cDNA probe. Blots
were stripped and reprobed with .beta.-actin as a loading and RNA
integrity control; all lanes exhibited equivalent signal.
[0146] A major transcript of 1.25 kb was observed in all tissues.
There was a high level of expression in heart. Whole brain
exhibited an intermediate level of expression. Samples derived from
separate brain regions all exhibited BBP1 expression.
Interestingly, limbic regions contained relatively greater amounts
of BBP1 mRNA. These are the regions of the brain where BAP
aggregation and associated neurotoxicity initially occur. Higher
molecular weight transcripts likely correspond to heteronuclear
RNA; the BBP1 gene contains several introns. Analysis of in situ
hybridization autoradiograms obtained using a BBP1-specific
riboprobe and postmortem specimens obtained from two different
patients indicated that in human hippocampus and entorhinal cortex,
BBP1 mRNA is expressed in medium to large cells in a pattern
consistent with expression in neurons as opposed to glial cells.
Moreover, BBP1 and mRNA is expressed in virtually all hippocampal
and entorhinal neurons, i.e., there do not appear to be any real or
laminar differences in the intensity of the hybridization signal.
The pattern of BBP1 expression was similar to the pattern observed
using a riboprobe directed against mRNA for the amyloid precursor
protein APP. In summary, BBP1 mRNA was observed in all tissues and
all brain regions examined. In situ analysis of BBP1 mRNA
expression also revealed extensive expression in the hippocampus
region.
EXAMPLE 5
Cell Line Distribution of BBP1 Expression
[0147] BBP1 expression was also investigated in numerous cell lines
and data were extracted from dbEST, the collection of expressed
sequence tags from the National Center for Biotechnology
Information. Reverse-transcription polymerase chain reaction
(RT-PCR) methods were utilized to qualitatively assess BBP1 mRNA
expression in cell lines commonly utilized for recombinant protein
expression as well as a variety of cancer cell lines. BBP1 was
observed in hamster CHO and human HEK293 cells. Signals were
observed in the embryonic stem cell line Ntera-2 and neuroblastoma
lines IMR32 and SK-N-SH. BBP1 expression was observed in cancer
cell lines representing the following tissue origins: colon (Cx-1,
Colo205, MIP101, SW948, CaCo, Sw620, LS174T), ovarian (A2780S,
A2780DDP), breast (MCF-7, SKBr-3, T47-D, B7474), lung (Lx-1,
A5439), melanoma (Lox, Skmel30), leukemia (HL60, CEM), prostate
(LNCAP, Du145, PC-3). A Northern blot probing mRNA isolated from
the following cancer cell lines demonstrated BBP1 expression in all
samples: promyelocytic leukemia (HL-60), carcinoma (HeLa S3),
chronic myelogenous leukemia (K-562), lymphoblastic leukemia
(MOLT-4), Burkitt's lymphoma (Raji), colorectal adenocarcinoma
(SW480), lung carcinoma (A549), and melanoma (G361).
EXAMPLE 6
Selective Interaction of BBP1 with Human BAP Versus Rodent BAP
[0148] There are three amino acid substitutions (G5R, F10Y and
R13H) in the rodent BAP sequence compared to the human sequence.
The rodent peptide demonstrated reduced neurotoxicity and an
absence of binding to human brain homogenates. Reversible in vitro
growth of Alzheimer disease .beta.-amyloid plaques by deposition of
labeled amyloid peptide. Therefore the association of rodent BAP
with BBP1 in the Y2H system was evaluated. The sequence of human
BAP in pEK162 was changed to encode the rodent peptide by
oligonucleotide directed mutagenesis by PCR, as described above.
The resultant plasmid, pEK240, was identical to the human BAP
fusion protein expression plasmid utilized throughout the present
invention except for the three codons producing the amino acid
substitutions for the rodent peptide sequence. Interactions between
BBP1 fusion protein and rodent and human BAP fusion proteins were
compared by Y2H bioassay. Strains expressing BBP1 and the rodent
BAP failed to produce a growth response. This finding supports the
conclusion that BBP1 serves as a specific mediator of the
neurotoxic effects of BAP, and provides a mechanism to explain the
reduced neurotoxicity of the rodent BAP. These data also serve to
illustrate the high degree of specificity of the BBP1/BAP
interaction in the Y2H assays since the substitution of three amino
acids in BAP was sufficient to completely abrogate the
association.
EXAMPLE 7
In Vitro Binding of Radiolabeled Bety-Amyloid Protein to BBP1
Protein
[0149] Initially, the novel gene product, BBP1, expressed from a
fetal brain library as a fusion protein, was shown to interact with
beta-amyloid protein (BAP), also expressed as a fusion protein via
a yeast 2 hybrid system. To confirm these findings, the potential
binding of beta-amyloid protein to full-length BBP1 protein was
investigated in an in vitro radioligand binding assay.
Specifically, radiolabeled human beta-amyloid protein (1-42) was
shown to bind with in vitro synthesized myc-tagged BBP1 protein, as
evidenced by the ability to co-precipitate beta-amyloid protein
with tagged-BBP1 protein. The details of the radioligand binding
assay are described below.
[0150] Protein A agarose bead+secondary antibody complexes were
generated by incubating 2.5 .mu.L ImmunoPurePlus immobilized
Protein A (Pierce, Rockford, Ill.) with 10 mg AffiniPure rabbit
a-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories, Inc., West
Grove, Pa.) in 50 mL cold low salt binding buffer (50 mM Tris pH
7.6, 150 mM NaCl, 2 mM EDTA 1% IGEPAL, and protease inhibitors (5
.mu.g/mL leupeptin, 5 .mu.g/mL aprotinin, 2 .mu.g/mL pepstatin A,
0.25 mMPMSF) with rotation overnight at 4.degree. C. The beads were
washed 4.times. with 1 mL binding buffer and were resuspended in
1.25 mL binding buffer to give a 50% slurry. In some experiments, a
250 mL aliquot of this slurry was incubated in Superblock (Pierce)
with rotation overnight at 4.degree. C. The beads were washed
4.times. with 1 mL Superblock and resuspended in 125 .mu.L
Superblock.
[0151] The DNA template for in vitro transcription/translation of
the BBP1 protein, including a Kozak consensus sequence and
sequences encoding a myc epitope, EQKLISEEDL (SEQ ID NO: 42),
directly upstream of the first methionine of BBP1 coding region,
was inserted into the BamHI/EcoRI sites of pSP64polyA vector
(Promega, Madison, Wis.). The DNA template was, in part, PCR
generated, utilizing the forward primer, 5'
GCAGGATCCCCACCATGGAGCAGMGCT
GATCAGCGAGGAGGACCTGCATATTTTAAAAGGGTCTCCCMTGTG- A (SEQ ID NO: 43)
and reverse primer, 5' TCACGGCCTCCGGAGCAGACGG (SEQ ID NO: 44) and
PFU polymerase, according to the manufacturer's conditions
(Stratagene, La Jolla, Calif.). The PCR cycling conditions were an
initial denaturing step at 95.degree. C. for 3 min, 30 cycles of
denaturation at 94.degree. C. for 30 sec, annealing at 65.degree.
C. for 30 sec, elongation at 72.degree. C. for 1 min 30 sec, and
followed by a final elongation at 72.degree. C. for 5 min. The
amplicon was digested with BamH1+NotI and ligated to the 3' end of
BBP1, housed on a NotI/EcoRI fragment, which had been previously
gel purified from the recombinant expression cassette.
[0152] Approximately 2.5 .mu.Ci of disaggregated human
[.sup.1251]-Tyr-Ab.sub.(142) (American Radiolabeled Chemicals,
Inc., St. Louis, Mo.) was incubated with 5-10 mL of N-terminal
c-myc tagged human BBP1 (1/5-1/10 reaction volume obtained using
the TNT SP6 Coupled Reticulocyte Lysate System [Promega, Madison,
Wis.]) with rotation for .about.6 hrs at 4.degree. C. in a final
volume of 1 mL cold low salt binding buffer (see above). Two
micrograms of mouse a-myc and 25 mL of the Agarose protein A/rabbit
a/mouse IgG complex (see above) were added to the reaction tube and
incubated at 4.degree. C. with rotation. Immune complexes were
washed 4.times. with 1 mL binding buffer and resuspended in 20 mL
2.times. Tricine loading dye (Novex, San Diego, Calif.) containing
5% b-Mercaptoethanol. Samples were boiled for 5 minutes and
immediately placed on ice for 15 minutes. The tubes were briefly
spun at 2500.times.g and the supernatant loaded on a 16% Tricine
polyacrylamide gel (Novex, San Diego, Calif.), which was run at 50
mA for .about.90 min. The gel was soaked for 15 minutes in a drying
solution composed of 20% acetic acid/10% methanol and dried at
80.degree. C. for 1 hr under vacuum. The dried gel was subjected
overnight to a phosphoimager screen, which was scanned for analysis
with the Storm phosphoimager (Molecular Dynamics, Sunnyvale,
Calif.).
[0153] Initial experiments attempting to co-immunoprecipitate
radiolabeled BAP with myc-tagged BBP1 resulted in nonspecific
binding of BAP when agarose protein A/secondary antibody complexes
were prepared in low salt binding buffer, even in samples lacking
BBP1. To reduce these non-specific interactions, the agarose
protein A/rabbit a-mouse IgG was incubated/washed in blocking
reagent prior to binding, as outlined above. This blocking
procedure reduced non-specific Ab binding to near zero when all
immunoprecipitation components were available except myc-tagged
BBP. Radiolabeled human BAP.sub.(142) was able to complex with in
vitro transcribed/translated myc-tagged human BBP1 after
immunoprecipitating myc-tagged BBP1 with anti-myc, as seen by a
band consistent in size with Ab. These data are consistent with
human BAP binding to myc-tagged human BBP1 in vitro and support the
initial observation that BAP interacts the BBP1 in a yeast
two-hybrid system.
EXAMPLE 8
Expression of Recombinant BBP1 Sensitizes NTERA2 Stem Cells to
.beta.-Amyloid Peptide
[0154] A cultured cell system was utilized to investigate the
effects of BBP1 expression on cellular sensitivity to BAP toxicity.
Human Ntera-2 (Nt2) stem cells can be induced to differentiate into
neuron-like cells (Andrews, P., Dev. Biol. 103(2):285-293 (1984)).
In that state, the cells exhibit a vulnerability to BAP that is
similar in degree to that observed in primary neurons. Neurons
affected by BAP exhibit characteristics of apoptosis before dying.
An early indicator of apoptosis, condensation of chromatin, was
used as an indicator for cellular responses to BAP. The
undifferentiated stem cells did not exhibit significant sensitivity
under the experimental conditions used in these studies. However,
Nt2 stem cells transfected with a BBP1 expression plasmid became
markedly sensitive to applied BAP, supporting the premise that BBP1
may act as a mediator of the toxic effects of .beta.-amyloid
peptide. The details of the experiment are below.
[0155] BBP cDNAs were modified by polymerase chain reaction (PCR)
for expression from the vector pcDNA3.1 (Invitrogen Corp.,
Carlsbad, Calif.). BBP1 cDNA was amplified from pBBP1-fl, adding a
5' EcoRI and a 3' SalI site for cloning. The PCR primers were
5'-TGGTGMTTC GAMGTGTCG GTCTCCAAG ATG G (SEQ ID NO: 45) (+strand)
and 5'-CTTCGTCGAC TTA TGG ATA TAA TTG CGT TTT TC (SEQ ID NO: 46)
(-strand). The PCR product was digested with EcoRI+SalI and cloned
into pcDNA3.1/EcoRI-XhoI to create pOZ363. Mutation of the arginine
codon within the `DRF` motif of the BBP1 cDNA was performed using
the QuickChange system (Stratagene Co., La Jolla, Calif.).
Oligonucleotides were synthesized and purified by Genosys
Biotechnologies, Inc. (The Woodlands, Tex.). The R138 codon of BBP1
in pOZ363 was changed to a glutamate codon using the
oligonucleotide 5; -GG TTG GGA GCA GAT GM TTT TAC CTT GGA TAC CC
(SEQ ID NO: 47) and its exact reverse complement.
[0156] Human Ntera2 (Nt2) stem cells were maintained in Dulbecco's
Modified Eagle's medium (high glucose) supplemented with 10% fetal
bovine serum. Retinoic acid was utilized to differentiate cells to
a neuronal phenotype as described by P. Andrews (Dev. Biol.
103(2):285-293 (1984)). Expression constructs were introduced into
stem cells by electroporation. The cells were split 1:2 the day
before electroporation to ensure exponential growth for maximal
survival and efficiency. On the day of electroporation the cells
were treated with trypsin and washed two times in phosphate
buffered saline (PBS). They were resuspended at 1.3.times.10.sup.7
cells per 0.3 ml in RPMI 1640 with 10 mM dextrose and 0.1 mM
dithiothriotol. DNA amounts were 7.5 mg subject DNA with 2.5 mg
pEGFP-N1 (Clontech Laboratories, Palo Alto, Calif.) to monitor
transfection. Cells were pre-incubated for 10 min on ice with DNA,
pulsed, and post-incubated for 10 min on ice. A GenePulser
instrument (BioRad Corp., Hercules, Calif.) was utilized with a
cuvette gap of 0.4 cm, voltage of 0.24 kV, and capacitance of 960
mF. Cells were plated in standard 24-well plates. Approximately 24
hrs after transfection, growth medium was replaced with medium
containing the indicated concentration of BAP. After incubation for
44 to 48 hrs, the chromatin-specific dye Hoechst 33342 (Molecular
Probes, Inc., Eugene, Oreg.) was added to a concentration of 10
ng/ml. Medium was removed after 10 min and cells were washed with
PBS. Cells were then fixed by immersion in PBS containing 4%
paraformaldehyde.
[0157] Forty-residue .beta.-amyloid peptide was obtained from
AnaSpec, Inc., San Jose, Calif. Peptide was dissolved and stored in
hexafluoro-isopropanol at 1 mg/ml. Peptide was lyophilized by
pervasion with nitrogen, then resuspended in 1.155 ml cell growth
medium and divided into 0.13 ml aliquots in a 96-well plate. The
plate was shaken at 500 rpm for 4 hrs. Samples were then combined
and normalized to a final BAP concentration of 50 mM. The same
preparation of aggregated (or aged) BAP utilized in the described
experiments was also shown to be toxic to primary hippocampal
neurons. Forty-two residue .beta.-amyloid peptide was obtained from
Bachem Bioscience Inc. It was dissolved directly in cell growth
medium and added to experimental samples. This preparation had no
discernible effect on differentiated Nt2 neurons.
[0158] Cells were visualized on a Zeiss Axiovert fluorescent
microscope fifted with dichroic filters as follows. Hoechst dye
visualization utilized excitation at 330 microns, emission at 450;
EGFP visualization with excitation at 475, emission at 535. A
minimum of 60 transfected (EGFP+) cells were scored per sample.
.beta.-amyloid peptide exhibited substantial neurotoxicity in
culture only after aging to produce fibrillar aggregates. Peptide
freshly dissolved in media showed reduced potency. To investigate
potential BBP1 effects on BAP-mediated toxicity, Nt2 stem cells
were transfected with pEGFP or with pEGFP plus the BBP1 expression
plasmid pOZ363 as described.
[0159] Samples were treated with aggregated A.beta. peptide for 48
hrs and evaluated for viability. Under these experimental
conditions, A.beta. treatment had no significant toxic effect in
control samples. However, transfection with pBBP resulted in a
significant increase in sensitivity to A.beta., with an average
loss of 22% of total cells, indicating that expression of BBP
stimulated sensitivity to A.beta.. Neurons exposed to toxic
aggregated A.beta. exhibit characteristics of apoptosis before
dying. To determine whether BBP-specific A.beta. toxicity includes
apoptotic events, nuclear morphology assays were conducted. SH-SY5Y
cells were doubly transfected with pEGFP plus test plasmids,
treated with toxic A.beta., and nuclear morphologies of transfected
cells were evaluated by fluorescent microscopy following staining
with a Hoechst chromatin dye. Included in these experiments was a
BBP expression plasmid mutated to substitute glutamate for the
arginine in the DRF motif. The corresponding R>E substitution
has been shown to eliminate activity of 7-tm domain GPCRs.
Transfection with pBBP resulted in a substantial and significant
increase in pyknotic nuclei, and this response was prevented by the
R>E substitution (FIG. 3). An anti-BBP immunoblot of cell
lysates demonstrated that the R>E substitution does not alter
protein expression. The absence of a response in the pBBP-R>E
sample suggested that BBP modulates A.beta. toxicity by coupling to
heterotrimeric G proteins. To further investigate this possibility,
samples were treated with the G.sub.i/o, inhibitor pertussis toxin.
This treatment eliminated cellular sensitivity to A.beta. via BBP
(FIG. 3). The same results were observed in transfected Nt2 stem
cells. Furthermore, Nt2 stem cells transfected with pBBP were
treated with the non-selective caspase inhibitor
BOC-Asp(Ome)-fluoromethylketone (BAF) to evaluate the involvement
of caspases. Treatment with BAF abrogated the induction of nuclear
condensation mediated by A.beta. in BBP-transfected cells (FIG. 4).
These data were replicated in SH-SY5Y cells. These findings
demonstrate that BBP mediates A.beta.-induced apoptosis by a G
protein-regulated caspase-dependent signaling pathway in neurotypic
cells.
[0160] It is only aged (i.e., aggregated) preparations of human
A.beta. that elicit substantial toxicity on primary neurons;
disaggregated human peptide or aggregated rodent peptide confer
greatly reduced toxicity. Cells transfected with pBBP exhibited the
same selectivity for A.beta. preparations, failing to show effects
with disaggregated A.beta., aged reverse peptide, or aged A.beta.
composed of the rodent sequence (FIG. 5). The absence of a response
to A.beta. composed of the rodent sequence correlates with the
inability of human BBP to interact with this peptide in binding
assays. These data demonstrate that selectivity for peptide state
and type leading to BBP/A toxicity in cell culture matches that
required for A.beta. toxicity in neurons. Of further note, A.beta.
toxicity is specific for only the BBP subtype, as no change in
apoptotic response to A.beta. was observed in cells transfected
with BLP1 or BLP2 expression plasmids.
[0161] Central to implicating BBP as a molecular target of A.beta.
was the finding that a signaling-deficient variant of BBP could
block the activity of native BBP in human Nt2 neurons, inhibiting
the induction of apoptosis by A.beta.. These data strongly suggest
that the BBP protein regulates neuronal apoptosis initiated by
A.beta.. The discovery of BBP introduces an important new molecule
to be considered in the complex pathophysiology of Alzheimer's
disease, and presents a promising new target in the intensive
search for novel therapeutic approaches.
EXAMPLE 9
Antibody Generation, Immunoblots
[0162] Predicted BBP ectodomain sequences were synthesized as five
non-overlapping peptides. The peptides were pooled and conjugated
to activated KLH carrier protein per vendor's instructions
(Pierce). Chickens were injected intramuscularly with 0.1 mg
peptides/KLH each week for four weeks. Eggs were collected and
tested for IgY titer to each BBP peptide by ELISA. IgY was
partially purified from egg yolk by dilution and ammonium sulfate
precipitation. This sample was further purified by solid phase
affinity binding to BBP by peptide composed of residues 42-81.
Expression of recombinant BBP protein was evaluated in Chinese
Hamster Ovary cell lysates. Cells were transfected with pBBP by
Lipofectamine-PLUS per manufacturer's (Life Technologies)
instructions. Cells were suspended in hypotonic buffer (50 mM Tris,
pH 7.2; 1 mM EDTA) plus proteinase inhibitors and maintained on
ice. Cells were disrupted using a polytron and debris removed by
centrifugation at 2,000 rpm in a microfuge. Soluble and membrane
fractions were separated by centrifugation at
.about.200,000.times.g using a 45Ti rotor in a TL100 centrifuge
(Beckman Instruments). The membrane pellet was resolubilized in
phosphate-buffered saline (PBS) with 1% TritonX-100 plus proteinase
inhibitors. Laemmli's buffer with detergent and 2-mercaptoethanol
was added to aliquots containing 50 .mu.g protein, and samples were
boiled for 5 min prior to electrophoresis in a 4 to 10%
Tris-glycine NuPage gel (NOVEX). Samples were transferred to PVDF
membrane by the semi-dry method (Biorad). Blots were probed with
the chicken anti-BBP antibody described above, using rabbit
anti-IgY conjugated to horseradish peroxide (Promega) as a
secondary detection reagent. Proteins were visualized by
development with the ECL-Plus reagent and exposure to Hyperfilm
(Amersham). Deglycosylation of proteins was achieved using the
enzymes PNGase-F, NANase II and O-glycosidase DS per manufacturer's
instructions (Biorad).
EXAMPLE 10
Evaluation of Endogenous BBP Activity
[0163] The BBP-R>E variant is unable to mediate an apoptotic
response to A.beta.. Transient transfection assays were utilized to
determine whether BBP-R>E could act as a dominant negative
protein which, if so, would then allow for the possibility of
assessing endogenous BBP activities in human neurons. Nt2 stem
cells were transfected with pEGFP plus equal quantities of mixed
DNAs consisting of either vector, vector plus pBBP, vector plus
pBBP-R>E, or both pBBP plus pBBP-R>E. These samples were
challenged with A.beta. and transfectants scored for nuclear
morphology. As shown previously, BBP stimulated A.beta.-mediated
apoptosis, and protein containing the R>E substitution was
inactive. Cells transfected with pBBP plus pBBP-R>E exhibited
the negative phenotype (FIG. 6), demonstrating that the BBP-R>E
inactive variant is phenotypically dominant over wild-type
protein.
[0164] Nt2 stem cells can be differentiated into cells possessing
the morphological, genetic, and physiological properties of neurons
by treatment with retinoic acid. BBP mRNA levels were evaluated in
Nt2 stem cells and neurons, and a >20-fold increase in BBP gene
expression was observed in the differentiated cells. Stem cells and
neurons were transfected with pEGFP plus vector, pBBP or
pBBP-R>E, and examined for A.beta.-induced apoptosis. Results
are shown in Table 3. Nt2 stem cells became sensitive to A.beta.
either by differentiation into neurons or by transfection with
pBBP. Transfection of neurons with pBBP did not have an additive
effect. Transfection of neurons with the pBBP-R>E dominant
negative variant substantially reduced the induction of apoptosis
by A.beta. exposure, presumptively by inhibiting the activity of
the endogenous BBP protein. These data indicate that the BBP
protein plays a central role in A.beta.-induced apoptosis in human
neurons.
3TABLE 3 BBP gene induction in differentiated Nt2 cells and
apoptotic responses to A.beta.. Ntera2 stem cells Ntera2 neurons
BBP mRNA (relative units) 1.0 .+-. 0.4 22.2 .+-. 2.0 % apoptotic
nuclei Transfection: Vector 5.6 .+-. 0.5 22.6 .+-. 3.0 PBBP *12.3
.+-. 0.6 22.3 .+-. 0.4 PBBP-R > E 4.6 .+-. 0.7 *12.4 .+-.
2.8
[0165] BBP mRNA levels (arbitrary units) in Nt2 stem cells and
differentiated neurons were determined by quantitive RT-PCR,
probing with sequences contained within the BBP protein coding
region. Samples were treated with 10 .mu.M aged A.beta. for 48 hrs
and nuclear morphologies of transfected cells were determined as
described herein. Values indicate the average of three independent
experiments with standard error. Statistical significance
(*P<0.01; Yates G-test) of pBBP or pBBP-R>E transfection
samples were determined by testing against the vector control.
EXAMPLE 11
A Splice Variant of Human BBP1 Contains an ALU Repetitive
Element
[0166] During the examination of the expression of BBP1 mRNA in a
variety of human tissues using either reverse-transcriptase
polymerase chain reaction (RT-PCR) on RNA or PCR on commercially
available cDNA, two amplicons were observed. The cloning and
sequencing of these amplicons revealed the presence of two mRNAs:
the smaller amplicon represents a segment of cDNA corresponding to
the previously determined BBP1 whereas the larger amplicon
contained an additional .about.120 nucleotides, derived from an ALU
repetitive element, which had been inserted in-frame with the BBP1
sequence near its 3' end. The presence of the complete genomic
sequence of BBP1 in Genbank indicated the presence of this exact
.about.120 nucleotides ALU repetitive element within a predicted
intron and flanked by its 5' and 3' by canonical acceptor and donor
mRNA splice site sequences, respectively. These data are consistent
with ubiquitous expression of two forms of BBP1 mRNAs, differing by
the presence or absence of the -120 nucleotides ALU-derived
sequence, generated by an alternative splicing mechanism.
[0167] Reverse-transcriptase polymerase chain reaction: Human
polyA+mRNA from various tissues (Clontech and Invitrogen) were
converted to cDNA by random-priming using Thermoscript RT-PCR
System, according to the manufacturer's protocol (Life
Technologies). This cDNA or commercially purchased cDNA (Clontech)
were amplified by PCR using two different sets of forward and
reverse primers: one set utilized the forward primer, JB44,
5'-CGAGGAGTCGCTTMGTGCGAGG (SEQ ID NO: 48) and reverse primer, JB45,
5'-CAGTCTTGTMG TCTGGTTCCATAG (SEQ ID NO: 49), whereas the second
set utilized the forward primer, JB53, 5'-GGCACTTTCAGAGGACCGAGAAG
(SEQ ID NO: 50) and reverse primer, JB251, 5'-ATATCCCATACTG
GATGGAGGCTG (SEQ ID NO: 51). PCR was accomplished using Expand Long
Polymerase kit according to the manufacturer's conditions (Roche
Biochemicals), with PCR cycling consisting of an initial denaturing
step at 95.degree. C. for 3 min, 30-40 cycles of denaturation at
94.degree. C. for 30 sec, annealing at 65.degree. C. for 30 sec,
elongation at 68.degree. C. for 1 min 30 sec, followed by a final
elongation at 68.degree. C. for 5 min. The PCR products were run on
a 1% agarose gel. In some cases, the appropriate bands were cut out
of the gel, purified by Quantum Prep Freeze 'N Squeeze DNA
Extraction Columns (Bio-Rad), and cloned into pGEM-T Easy vector
(Promega). Sequencing was accomplished by BigDye terminator dideoxy
sequencing using an AB13700. Sequence analysis was accomplished
using DNAstar software package.
[0168] We investigated expression of BBP1 mRNA from 16 different
human tissues by performing PCR on cDNA using primers derived from
BBP1 coding region. Eleven tissues, including prostate, testis,
ovary, heart, brain, placenta, lung, liver, skeletal, kidney,
pancreas showed two bands, differing by about 120. Both upper and
lower bands were isolated, cloned, and sequenced. The smaller lower
band contained a sequence between the PCR forward and reverse
primers (e.g. JB44 and JB45) that was identical to that previously
identified as BBP1. The larger upper band, for both brain and
pancreas, contained the corresponding BBP1 sequence, with an
additional .about.120 nucleotide ALU-derived repetitive element
(see FIG. 9). The presence of the ALU sequence is predicted to
result in the translation of an additional in-frame ALU-derived 44
aa, followed by BBP1-derived but out-of-frame 7 aa (with respect to
BBP1-derived sequence), before reaching an in-frame STOP codon.
Therefore, the ALU-containing mRNA would be predicted to translate
a protein exhibiting an identical 5' end to the non-ALU BBP1 mRNA,
but containing a different 3' end; specifically, expressing an
additional newly derived 44 aa compared to 36 aa from the non-ALU
BBP1 mRNA. This results in a net gain of 15 aa or .about.1.7 Kd for
the ALU-containing BBP1 protein when compared to the shorter
non-ALU containing BBP1 protein. Furthermore, the absence of the 36
aa of BBP1 protein at the C-terminus in the ALU-containing species
coincides with the loss of the "PXDGS" (SEQ ID NO: 52) box located
beginning at aa 237. The "PXDGS" (SEQ ID NO: 52) motif has been
implicated in controlling the apoptotic pathway and therefore,
differential expression of this "PXDGS" (SEQ ID NO: 52) sequence
between the two mRNA species may have distinct functional
consequences.
[0169] To corroborate these findings and confirm that the
ALU-containing BBP1 mRNA contained wild-type sequence extending
from the first MET through to the ALU sequence, we expanded our PCR
amplicon to incorporate the region from the 5' untranslated region
down to the ALU sequence. To this end, we conducted RT-PCR using a
forward primer, JB53, located within the 5' UT region, and a
reverse primer, JB251, located within the ALU sequence, on randomly
primed human brain mRNA. Since the reverse primer, JB251, was
specific for the ALU sequence, we expected to only amplify the
ALU-containing BBP1 mRNA. The expected size amplicon was cloned,
sequenced and revealed 100% identity with the previously cloned and
sequenced BBP1, except with additional ALU-derived sequence at the
3' terminus. We conclude that multiple tissues contain two BBP1
mRNA species, differing only by the presence or absence of
.about.120 nucleotide ALU-derived sequence, which is in-frame at
its 5' end but out-of-frame at its 3' end with respect to BBP1.
[0170] The possible mechanisms that may explain the presence of two
mRNA species are either: (1) two distinct genes with one gene
containing an ALU element, or (2) alternative splicing that results
in alternative utilization of an ALU-containing exon derived from
the same gene. Although a Southern blot approach would directly
address the presence of two BBP1 genes as the determinant for the
two different mRNAs, we have not completed such analysis to date.
However, analysis of a recent entry in GenBank (accession
#AC025691), representing a large genomic sequence containing the
entire coding region of BBP1, is consistent with the second
proposed mechanism of alternative mRNA splicing. Specifically,
located between 109275 and 109404 from accession #AC025691 (e.g. in
the reverse complement orientation), there exists an identical ALU
sequence to that found by the RT-PCR experiments described above.
Furthermore, this ALU sequence is flanked on the corrected 5' and
3' by canonical RNA splicing signal sequences, respectively (e.g.
GT and poly (Py)AG, at the 5' and 3' sides, respectively). Exon 6,
which is predicted to be 3' of the ALU element, is found downstream
of the ALU sequence in this genomic sequence, between 106029-105919
(when corrected for the reverse orientation of this genomic piece
of DNA). Taken together, the data suggests the presence of
alternatively spliced BBP1 mRNAs, one containing an ALU element at
the 3' end of the RNA. A translational prediction concludes that
two proteins would be synthesized that differ in size by .about.1.7
Kd and differ in sequence at the C-terminal portion.
EXAMPLE 12
Physical Association of BBP1 with APP
[0171] BBP1-specific apoptosis in response to A is blocked by
pertussis toxin, or by substitution of the arginine in the DRF
motif, suggesting coupling to hetrotrimeric G protein. The amyloid
precursor protein (APP) can physically and functionally associate
with Gao protein to induce apoptosis. Therefore, it was
hypothesized that BBP1 might be associated with APP to form a
functional G protein-coupled receptor. This hypothesis was first
tested in Y2H assay, then by co-immunoprecipitation from
transfected cells.
[0172] Y2H assay strains were developed to test for potential
associations between ectodomains of APP and BBP protein, as
illustrated above. Surprisingly, all three BBP proteins scored
weakly positive. Similar experiments were conducted with the
APP-like protein APLP2. In those assays, only the BBP1 subtype
demonstrated significant Y2H binding to APLP2.
[0173] BBP1 cDNA was modified to include dual myc epitopes, located
four amino acids C-terminal to the signal peptidase site. The
myc-BBP1 expression plasmid was transfected with an APP expression
plasmid into CHO cells. Control transfections included samples
lacking BBP1 or lacking APP. Lysates were immunoprecipitated with
an anti-myc antibody and subjected to Western blotting with the
anti-APP antibody 22C11. A band corresponding to APP was observed
in only the samples containing myc-BBP1 plus APP. These data
suggest that BBP1 and APP can form a physical association in
vivo.
[0174] Y2H methods were described previously. APP and APLP2
segments used to generate Gal4 DNA-binding domain hybrids began
near the N-terminal signal sequence and extended to the
transmembrane region. For immunoprecipitaton, CHO cells were
transfected with mixtures of pAPP, pBBP1 or vector, as indicated.
Cells were lysed in IP buffer (50 mM Tris pH 7.2, 5 mM EDTA, 150 mM
NaCl, 0.5% NP-40, 0.5% NaDeoxycholate with protease inhibitors) 24
hrs after transfection. Lysates were precleared in a 50% v/v slurry
of protein A-agarose. Anti-myc antibody (A-14, Santa Cruz
Biotechnology) was added at appropriate dilution (tested
empirically) and samples were rocked at 4.degree. C. overnight.
Following incubation with protein A-agarose, beads were spun down
and washed in IP buffer 4 times. Supernatant was aspirated
completely from final wash and pellets resuspended in 50 ul Laemmli
buffer, 5% 2-ME. Proteins were separated by SDS-PAGE and
transferred to PVDF membranes for Western analysis. Primary Western
antibodies were anti-myc (9E10, CalBioChem) or anti-APP (22C11,
Boehringer Mannheim). Goat anti-mouse IgG conjugated to HRP served
for secondary detection by enhanced chemiluminescence.
EXAMPLE 13
Transgenic Mice
[0175] Transgenic mice in which human BBP1 expression is targeted
to mouse brain neurons has been accomplished using the Thy1.2
promoter system. Expression of human BBP1 in neurons facilitates
studies (in vitro and in vivo) involving the interaction of human A
beta and human BBP1 in apoptosis. Two transgenic mice lines have
been established that differ in the putative methionine translation
start sites in human BBP1. Two transgene constructs (Met3BBP and
BBP800) were inserted into C57/b embryos.
[0176] Necropsies from the Met3BBP and the BBP800 lines were
obtained and the level of RNA expression was analyzed using both
RNase protection assay and in situ analysis in the brain. RPA
analysis revealed that BBP1 transgenic mRNA was expressed at levels
5-times endogenous levels of BBP1 in human brain. Expression from
the BBP800 however was only equal to endogenous human levels. These
differences in expression levels were again observed in sagital in
situ sections using the same probe as used in the RPA experiment. A
strong and specific signal for human BBP1 transgene mRNA was
observed in Met3BBP transgenic brains. In this experiment,
transgene localization was confirmed in the cortex, hippocampus and
cerebellum of each transgenic line. All three of these regions are
critical in AD pathogenesis.
EXAMPLE 14
Knockout Mice
[0177] A knockout (KO) targeting vector was designed and cloned
using a 5' short arm upstream of the Met3 start codon in exon 1 of
the mouse BBP1 gene and a long 3' arm that begins just 3' of exon 4
of the BBP1 gene and extends through exon 5 (FIG. 12). Replacement
of exons 1 through 4 of the mouse BBP1 gene with a neomycin
selectable marker results in a BBP1 KO by deleting the met start in
exon 1 as well as critical sequences in exon 4, including the DRF
conserved GPCR motif. The BBP1 targeting vector was electroporated
into 129 R1 Es cells. Approximately 1000 neomycin resistant clones
were produced. These clones were analysed by PCR and southern blot
to isolate successful insertion of the targeting vector and
appropriate clones were microinjected into blastocytes as described
infra.
[0178] Gene Targeting in ES Cells
[0179] ES cells were cultured in standard ES cell culture
conditions of: ES cell media (high glucose DMEM, 20% fetal, bovine
serum, non-essential amino acids, 14 .mu.M 2-mercapto-ethanol, and
10.sup.7 U Leukocyte Inhibitory Factor) on a feeder layer of
division-arrested (mitomycin treated) embryonic fibroblasts at
37.degree. C., 5% CO.sub.2 and in a humidified chamber.
[0180] For gene targeting, R1 ES cells (Joyner, A. L. et al.,
Production of a mutation in mouse En-2 gene by homologous
recombination in embryonic stem cells, Nature 338(6211):153-156
(1989)) were electroporated with 50 .mu.g of linearized targeting
vector and selected in 200 .mu.g/ml G418 for 7-10 days beginning 24
hours after electroporation. G418 resistant clones were picked,
expanded and cryopreserved. Resistant clones were screened for
homologous recombination by an SphI (restriction endonuclease)
genomic southern restriction fragment polymorphism length (RFPL)
analysis using the 5' outside probe which detects the wild type and
targeted alleles of BBP1 as 6 kb and 4.5 kb fragments,
respectively. Gene targeted ES cell clones were thawed, expanded,
characterized by SphI genomic RFPL analysis using the 3' outside
probe, which detects the wild type, and targeted alleles of LRP5 as
15 kb and 4.5 kb fragments, respectively.
[0181] Production of Gene Targeted Mice by Blastocyst Injection
[0182] To general chimeric mice, gene targeted ES cell clones were
thawed, expanded, and injected into 4 day old host blastotcysts of
C57BU6 strain mice. For injection, a single cell suspension was
prepared by dissociation of cells with trypsin and resuspension in
ES media plus Hepes buffer. Ten to twelve cells were injected into
the blastocyst and injected blastocysts were then transferred to
the uterus of pseudopregnant swiss webster recipient female mice
and allowed to develop to term. Chimeric males generated in this
way were back crossed to C57 BL/6 and/or 129SvEv females and tested
for transmission of the targeted allele by PCR genotyping with
primers specific to the Neomycin resistance gene.
[0183] Conditional Knockout Mice
[0184] Conditional knockout mice are created using the Cre/Lox
system. "LoxP" or "lox" refers to a short (34 bp) DNA sequence that
is recognized by Cre recombinase of the E. coli bacteriophage P1.
Placement of two loxP sites in the same orientation on either side
of a DNA segment will result, in the presence of Cre recombinase,
in efficient excision of the intervening DNA segment, leaving
behind only a single copy of the loxP site. Conditional knockouts
are created by introducing the Cre gene into the ES cell under the
control of a regulatable promoter of another expression control
system.
[0185] Deletion of the Neomycin Resistance Cassette via Cre
Recombinase
[0186] To generate BBP1 KO mice without the neomycine resistance
gene, neomycin resistance cassette is deleted using a construct
containing loxP sites around the NEO gene and by micro-injection of
a Cre expressing plasmid (2 .mu.g/ml) into the male pronucleus of
BBP1 KO pre-fusion zygotes. Injected zygotes are then transferred
to the uterus of pseudopregnant swiss webster recipient female mice
and allowed to develop to term. Deletion of the KO cassette is
confirmed by PCR analysis of the cassette insertion site. The site
specific deletion of the neo gene from a mouse cell line is
described in U.S. Pat. No. 4,959,317, which is incorporated by
reference in its entirety herein.
EXAMPLE 15
Mutation of the Aspartate in the BBP1 PXDGS (SEQ ID NO: 52) Motif
Separates Pro- and Anti-Apoptotic Activities
[0187] BBP1 PXDGS (SEQ ID NO: 52) motif sequence is located near
the C-terminus of all BBP proteins. It is evolutionarily conserved
from Drosophila to human, and in all three protein subtypes,
indicating an importance of function. Frequently, charged aspartate
residues mediate critical effect on protein function, so this
residue of human BBP1 was mutated to stop or to alanine, and
apoptotic activities evaluated. BBP1-wt (pFL 19) and D>stop or
D>A mutant expression plasmids were transferred into SY5Y or Nt2
stem cells. Samples were evaluated for both A.beta. responsiveness
and STS sensitivity specific to the expressed BBP1 protein.
Anti-apoptotic effect of wild-type protein and mutant proteins were
readily observed after treatment with 250 nM staurosporine. For
details of the anti-apoptotic effect of BBP1 see PCT WO 00/22125,
which is herein incorporated by reference in its entirety. In
contrast, both the D>stop and D>A substitutions resulted in
the loss of A.beta. sensitivity. These findings indicate that the
invariant PXDGS (SEQ ID NO: 52) motif in BBP proteins is required
for pro-apoptotic activities, and suggest the potential association
of BBPs with differing protein partners conferring distinct
functions.
EXAMPLE 16
Inhibition of BBP1 Production
[0188] Design of RNA Molecules as Compositions of the Invention
[0189] All RNA molecules in this experiment are approximately 600
nts in length, and all RNA molecules are designed to be incapable
of producing functional BBP1 protein. The molecules have no cap and
no poly-A sequence; the native initiation codon is not present, and
the RNA does not encode the full-length product.
[0190] The following RNA molecules are designed:
[0191] (1) a single-stranded (ss) sense RNA polynucleotide sequence
homologous to a portion of BBP1 murine messenger RNA (m.RNA);
[0192] (2) a ss anti-sense RNA polynucleotide sequence
complementary to a portion of BBP1 murine mRNA;
[0193] (3) a double-stranded (ds) RNA molecule comprised of both
sense and anti-sense portions of BBP1 murine mRNA polynucleotide
sequences;
[0194] (4) a ss sense RNA polynucleotide sequence homologous to a
portion of BBP1 murine heterogenerous RNA (hnRNA);
[0195] (5) a ss anti-sense RNA polynucleotide sequence
complementary to a portion of BBP1 murine hnRNA;
[0196] (6) a dsRNA molecule comprised of the sense and anti-sense
BBP1 murine hnRNA polynucleotide sequences;
[0197] (7) a ss murine RNA polynucleotide sequence homologous to
the top strand of a portion of BBP1 promoter;
[0198] (8) a ss murine RNA polynucleotide sequence homologous to
the bottom strand of a portion of BBP1 promoter; and
[0199] (9) a ds RNA molecule comprised of murine RNA polynucleotide
sequences homologous to the top and bottom strands of the BBP1
promoter.
[0200] The various RNA molecules of (1)-(9) above may be generated
through T7 RNA polymerase transcription of PCR products bearing a
T7 promoter at one end. In the instance where a sense RNA is
desired, a T7 promoter is located at the 5' end of the forward PCR
primer. In the instance where an antisense RNA is desired, the T7
promoter is located at the 5' end of the reverse PCR primer. When
dsRNA is desired, both types of PCR products may be included in the
T7 transcription reaction. Alternatively, sense and anti-sense RNA
may be mixed together after transcription.
[0201] Construction of Expression Plasmid Encoding a Fold-Back Type
of RNA
[0202] Expression plasmid encoding an inverted repeat of a portion
of the BBP1 gene may be constructed using the information disclosed
in this application. Two BBP1 gene fragments of approximately at
least 600 nucleotides in length, almost identical in sequence to
each other, may be prepared by PCR amplification and introduced
into suitable restriction of a vector that includes the elements
required for transcription of the BBP1 fragment in an opposite
orientation. CHO cells transfected with the construct will produce
only fold-back RNA in which complementary target gene sequences
form a double helix.
[0203] Assay
[0204] Balb/c mice (5 mice/group) may be injected intramuscularly,
intracranially or intraperitoneally with the murine BBP1 chain
specific RNAs described above or with controls at doses ranging
between 10 .mu.g and 500 .mu.g. Sera is collected from the mice
every four days for a period of three weeks and assayed for BBP1
levels using the antibodies as disclosed herein.
[0205] According to the present invention, mice receiving ds RNA
molecules derived from both the BBP1 mRNA, BBP1 hnRNA and ds RNA
derived from the BBP1 promoter demonstrate a reduction or
inhibition in BBP1 production. A modest, if any, inhibitory effect
is observed in sera of mice receiving the single stranded BBP1
derived RNA molecules, unless the RNA molecules have the capability
of forming some level of double-strandedness.
EXAMPLE 17
Method of the Invention in the Prophylaxis of Disease
[0206] In Vivo Assay
[0207] Using the BBP1 specific RNA molecules described in Example
16, which do not have the ability to make BBP1 protein and BBP1
specific RNA molecules as controls, mice may be evaluated for
protection from BBP1 related disease through the use of the
injected BBP1 specific RNA molecules of the invention. Balb/c mice
(5 mice/group) may be immunized by intramuscular, intracranial, or
intraperitoneal injection with the described RNA molecules at doses
ranging between 10 and 500 .mu.g RNA. At days 1, 2, 4, and 7
following RNA injection, the mice may be observed for signs of BBP1
related phenotypic change and/or assayed for BBP1 expression.
[0208] According to the present invention, the mice that receive
dsRNA molecules of the present invention that contain the BBP1
sequence may be shown to be protected against BBP1 related disease.
The mice receiving the control RNA molecules may be not protected.
Mice receiving the ssRNA molecules that contain the BBP1 sequence
may be expected to be minimally, if at all, protected unless these
molecules have the ability to become at least partially double
stranded in vivo.
[0209] According to this invention, because the dsRNA molecules of
the invention do not have the ability to make BBP1 protein, the
protection provided by delivery of the RNA molecules to the animal
is due to a non-immune mediated mechanism that is gene
specific.
EXAMPLE 18
RNA Interference in Chinese Hamster Cultured Cells
[0210] To observe the effect of RNA interference, either cell lines
naturally expressing BBP1 (see Example 5) can be identified and
used or cell lines that express BBP1 as a transgene can be
constructed by well known methods (and as outlined herein). As an
example, the use of CHO cells is described. Chinese hamster cells
may be cultured in Dulbecco's modified Eagle's medium (Gibco BRL)
at 37.degree. C. Media may be supplemented with 10%
heat-inactivated fetal bovine serum (Mitsubishi Kasei) and
antibiotics (10 units/ml of penicillin (Meiji) and 50 .mu.g/ml of
streptomycin (Meiji).
[0211] Transfection and RNAi Activity Assay
[0212] CHO cells are inoculated at 3.times.10.sup.5 cells/ml in
each well of 24-well plate. After 1 day, using the calcium
phosphate precipitation method, cells are transfected with BBP1
dsRNA (80 .mu.g to 3 .mu.g). Cells may be harvested 20 h after
transfection and BBP1 gene expression measured.
EXAMPLE 19
Antisense Inhibition in Vertebrate Cell Lines
[0213] Antisense can be performed using standard techniques
including the use of kits such as those of Sequitur Inc. (Natick,
Mass.). The following procedure utilizes phosphorothioate
oligodeoxynucleotides and cationic lipids. The oligomers are
selected to be complementary to the 5' end of the mRNA so that the
translation start site is encompassed.
[0214] (1) Prior to plating the cells, the walls of the plate are
gelatin coated to promote adhesion by incubating 0.2% sterile
filtered gelatin for 30 minutes and then washing once with PBS.
Cells are grown to 40-80% confluence. Hela cells can be used as a
positive control.
[0215] (2) the cells are washed with serum free media (such as
Opti-MEMA from Gibco-BRL).
[0216] (3) Suitable cationic lipids (such as Oligofectibn A from
Sequitur, Inc.) are mixed and added to serum free media without
antibiotics in a polystyrene tube. The concentration of the lipids
can be varied depending on their source. Add oligomers to the tubes
containing serum free media/cationic lipids to a final
concentration of approximately 200 nM (50-400 nM range) from a 100
.mu.M stock (2 .mu.l per ml) and mix by inverting.
[0217] (4) The oligomer/media/cationic lipid solution is added to
the cells (approximately 0.5 mls for each well of a 24 well plate)
and incubated at 37.degree. C. for 4 hours.
[0218] (5) The cells are gently washed with media and complete
growth media is added.
[0219] The cells are grown for 24 hours. A certain percentage of
the cells may lift off the plate or become lysed.
[0220] The cells are harvested and BBP1 gene expression is
monitored.
[0221] It is clear that the invention may be practiced otherwise
than as particularly described in the foregoing description and
examples. Numerous modifications and variations of the present
invention are possible in light of the above teachings and
therefore are within the scope of the appended claims.
Sequence CWU 1
1
52 1 810 DNA Homo sapiens CDS (1)..(807) 1 atg cat att tta aaa ggg
tct ccc aat gtg att cca cgg gct cac ggg 48 Met His Ile Leu Lys Gly
Ser Pro Asn Val Ile Pro Arg Ala His Gly 1 5 10 15 cag aag aac acg
cga aga gac gga act ggc ctc tat cct atg cga ggt 96 Gln Lys Asn Thr
Arg Arg Asp Gly Thr Gly Leu Tyr Pro Met Arg Gly 20 25 30 ccc ttt
aag aac ctc gcc ctg ttg ccc ttc tcc ctc ccg ctc ctg ggc 144 Pro Phe
Lys Asn Leu Ala Leu Leu Pro Phe Ser Leu Pro Leu Leu Gly 35 40 45
gga ggc gga agc gga agt ggc gag aaa gtg tcg gtc tcc aag atg gcg 192
Gly Gly Gly Ser Gly Ser Gly Glu Lys Val Ser Val Ser Lys Met Ala 50
55 60 gcc gcc tgg ccg tct ggt ccg tct gct ccg gag gcc gtg acg gcc
aga 240 Ala Ala Trp Pro Ser Gly Pro Ser Ala Pro Glu Ala Val Thr Ala
Arg 65 70 75 80 ctc gtt ggt gtc ctg tgg ttc gtc tca gtc act aca gga
ccc tgg ggg 288 Leu Val Gly Val Leu Trp Phe Val Ser Val Thr Thr Gly
Pro Trp Gly 85 90 95 gct gtt gcc acc tcc gcc ggg ggc gag gag tcg
ctt aag tgc gag gac 336 Ala Val Ala Thr Ser Ala Gly Gly Glu Glu Ser
Leu Lys Cys Glu Asp 100 105 110 ctc aaa gtg gga caa tat att tgt aaa
gat cca aaa ata aat gac gct 384 Leu Lys Val Gly Gln Tyr Ile Cys Lys
Asp Pro Lys Ile Asn Asp Ala 115 120 125 acg caa gaa cca gtt aac tgt
aca aac tac aca gct cat gtt tcc tgt 432 Thr Gln Glu Pro Val Asn Cys
Thr Asn Tyr Thr Ala His Val Ser Cys 130 135 140 ttt cca gca ccc aac
ata act tgt aag gat tcc agt ggc aat gaa aca 480 Phe Pro Ala Pro Asn
Ile Thr Cys Lys Asp Ser Ser Gly Asn Glu Thr 145 150 155 160 cat ttt
act ggg aac gaa gtt ggt ttt ttc aag ccc ata tct tgc cga 528 His Phe
Thr Gly Asn Glu Val Gly Phe Phe Lys Pro Ile Ser Cys Arg 165 170 175
aat gta aat ggc tat tcc tac aaa gtg gca gtc gca ttg tct ctt ttt 576
Asn Val Asn Gly Tyr Ser Tyr Lys Val Ala Val Ala Leu Ser Leu Phe 180
185 190 ctt gga tgg ttg gga gca gat cga ttt tac ctt gga tac cct gct
ttg 624 Leu Gly Trp Leu Gly Ala Asp Arg Phe Tyr Leu Gly Tyr Pro Ala
Leu 195 200 205 ggt ttg tta aag ttt tgc act gta ggg ttt tgt gga att
ggg agc cta 672 Gly Leu Leu Lys Phe Cys Thr Val Gly Phe Cys Gly Ile
Gly Ser Leu 210 215 220 att gat ttc att ctt att tca atg cag att gtt
gga cct tca gat gga 720 Ile Asp Phe Ile Leu Ile Ser Met Gln Ile Val
Gly Pro Ser Asp Gly 225 230 235 240 agt agt tac att ata gat tac tat
gga acc aga ctt aca aga ctg agt 768 Ser Ser Tyr Ile Ile Asp Tyr Tyr
Gly Thr Arg Leu Thr Arg Leu Ser 245 250 255 att act aat gaa aca ttt
aga aaa acg caa tta tat cca taa 810 Ile Thr Asn Glu Thr Phe Arg Lys
Thr Gln Leu Tyr Pro 260 265 2 269 PRT Homo sapiens 2 Met His Ile
Leu Lys Gly Ser Pro Asn Val Ile Pro Arg Ala His Gly 1 5 10 15 Gln
Lys Asn Thr Arg Arg Asp Gly Thr Gly Leu Tyr Pro Met Arg Gly 20 25
30 Pro Phe Lys Asn Leu Ala Leu Leu Pro Phe Ser Leu Pro Leu Leu Gly
35 40 45 Gly Gly Gly Ser Gly Ser Gly Glu Lys Val Ser Val Ser Lys
Met Ala 50 55 60 Ala Ala Trp Pro Ser Gly Pro Ser Ala Pro Glu Ala
Val Thr Ala Arg 65 70 75 80 Leu Val Gly Val Leu Trp Phe Val Ser Val
Thr Thr Gly Pro Trp Gly 85 90 95 Ala Val Ala Thr Ser Ala Gly Gly
Glu Glu Ser Leu Lys Cys Glu Asp 100 105 110 Leu Lys Val Gly Gln Tyr
Ile Cys Lys Asp Pro Lys Ile Asn Asp Ala 115 120 125 Thr Gln Glu Pro
Val Asn Cys Thr Asn Tyr Thr Ala His Val Ser Cys 130 135 140 Phe Pro
Ala Pro Asn Ile Thr Cys Lys Asp Ser Ser Gly Asn Glu Thr 145 150 155
160 His Phe Thr Gly Asn Glu Val Gly Phe Phe Lys Pro Ile Ser Cys Arg
165 170 175 Asn Val Asn Gly Tyr Ser Tyr Lys Val Ala Val Ala Leu Ser
Leu Phe 180 185 190 Leu Gly Trp Leu Gly Ala Asp Arg Phe Tyr Leu Gly
Tyr Pro Ala Leu 195 200 205 Gly Leu Leu Lys Phe Cys Thr Val Gly Phe
Cys Gly Ile Gly Ser Leu 210 215 220 Ile Asp Phe Ile Leu Ile Ser Met
Gln Ile Val Gly Pro Ser Asp Gly 225 230 235 240 Ser Ser Tyr Ile Ile
Asp Tyr Tyr Gly Thr Arg Leu Thr Arg Leu Ser 245 250 255 Ile Thr Asn
Glu Thr Phe Arg Lys Thr Gln Leu Tyr Pro 260 265 3 208 PRT Mus
musculus 3 Met Ala Ala Ala Trp Pro Ala Gly Arg Ala Ser Pro Ala Ala
Gly Pro 1 5 10 15 Pro Gly Leu Leu Arg Thr Leu Trp Leu Val Thr Val
Ala Ala Gly His 20 25 30 Cys Gly Ala Ala Ala Ser Gly Ala Val Gly
Gly Glu Glu Thr Pro Lys 35 40 45 Cys Glu Asp Leu Arg Val Gly Gln
Tyr Ile Cys Lys Glu Pro Lys Ile 50 55 60 Asn Asp Ala Thr Gln Glu
Pro Val Asn Cys Thr Asn Tyr Thr Ala His 65 70 75 80 Val Gln Cys Phe
Pro Ala Pro Lys Ile Thr Cys Lys Asp Leu Ser Gly 85 90 95 Asn Glu
Thr His Phe Thr Gly Ser Glu Val Gly Phe Leu Lys Pro Ile 100 105 110
Ser Cys Arg Asn Val Asn Gly Tyr Ser Tyr Lys Val Ala Val Ala Leu 115
120 125 Ser Leu Phe Leu Gly Trp Leu Gly Ala Asp Arg Phe Tyr Leu Gly
Tyr 130 135 140 Pro Ala Leu Gly Leu Leu Lys Phe Cys Thr Val Gly Phe
Cys Gly Ile 145 150 155 160 Gly Ser Leu Ile Asp Phe Ile Leu Ile Ser
Met Gln Ile Val Gly Pro 165 170 175 Ser Asp Gly Ser Ser Tyr Ile Ile
Asp Tyr Tyr Gly Thr Arg Leu Thr 180 185 190 Arg Leu Ser Ile Thr Asn
Glu Thr Phe Arg Lys Thr Gln Leu Tyr Pro 195 200 205 4 178 PRT
Drosophila melanogaster 4 Met Phe Pro Val Leu Leu Leu Leu Leu Phe
Phe Phe Ala Lys Glu Thr 1 5 10 15 His Gln Ile Asn Val Asp Cys Asn
Glu Leu Gln Met Met Gly Gln Phe 20 25 30 Met Cys Pro Asp Pro Ala
Arg Gly Gln Ile Asp Pro Lys Thr Gln Gln 35 40 45 Leu Ala Gly Cys
Thr Arg Glu Gly Arg Ala Arg Val Trp Cys Ile Ala 50 55 60 Ala Asn
Glu Ile Asn Cys Thr Glu Thr Gly Asn Ala Thr Phe Thr Arg 65 70 75 80
Glu Val Pro Cys Lys Trp Thr Asn Gly Tyr His Leu Asp Thr Thr Leu 85
90 95 Leu Leu Ser Val Phe Leu Gly Met Phe Gly Val Asp Arg Phe Tyr
Leu 100 105 110 Gly Tyr Pro Gly Ile Gly Leu Leu Lys Phe Cys Thr Leu
Gly Gly Met 115 120 125 Phe Leu Gly Gln Leu Ile Asp Ile Val Leu Ile
Ala Leu Gln Val Val 130 135 140 Gly Pro Ala Asp Gly Ser Ala Tyr Val
Ile Pro Tyr Tyr Gly Ala Gly 145 150 155 160 Ile His Ile Val Arg Ser
Asp Asn Thr Thr Tyr Arg Leu Pro Arg Asp 165 170 175 Asp Trp 5 214
PRT Homo sapiens 5 Met Val Leu Gly Gly Cys Pro Val Ser Tyr Leu Leu
Leu Cys Gly Gln 1 5 10 15 Ala Ala Leu Leu Leu Gly Asn Leu Leu Leu
Leu His Cys Val Ser Arg 20 25 30 Ser His Ser Gln Asn Ala Thr Ala
Glu Pro Glu Leu Thr Ser Ala Gly 35 40 45 Ala Ala Gln Pro Glu Gly
Pro Gly Gly Ala Ala Ser Trp Glu Tyr Gly 50 55 60 Asp Pro His Ser
Pro Val Ile Leu Cys Ser Tyr Leu Pro Asp Glu Phe 65 70 75 80 Ile Glu
Cys Glu Asp Pro Val Asp His Val Gly Asn Ala Thr Ala Ser 85 90 95
Gln Glu Leu Gly Tyr Gly Cys Leu Lys Phe Gly Gly Gln Ala Tyr Ser 100
105 110 Asp Val Glu His Thr Ser Val Gln Cys His Ala Leu Asp Gly Ile
Glu 115 120 125 Cys Ala Ser Pro Arg Thr Phe Leu Arg Glu Asn Lys Pro
Cys Ile Lys 130 135 140 Tyr Thr Gly His Tyr Phe Ile Thr Thr Leu Leu
Tyr Ser Phe Phe Leu 145 150 155 160 Gly Cys Phe Gly Val Asp Arg Phe
Cys Leu Gly His Thr Gly Thr Ala 165 170 175 Val Gly Lys Leu Leu Thr
Leu Gly Gly Leu Gly Ile Trp Trp Phe Val 180 185 190 Asp Leu Ile Leu
Leu Ile Thr Gly Gly Leu Met Pro Ser Asp Gly Ser 195 200 205 Asn Trp
Cys Thr Val Tyr 210 6 213 PRT Mus musculus 6 Met Val Leu Gly Gly
Cys Pro Val Ser Tyr Leu Leu Leu Cys Gly Gln 1 5 10 15 Ala Ala Leu
Leu Leu Gly Asn Leu Leu Leu Leu His Cys Val Ser Arg 20 25 30 Ser
His Ser Gln Asn Ala Thr Ala Glu Pro Glu Leu Thr Pro Ser Gly 35 40
45 Ala Ala His Leu Glu Gly Pro Ala Ala Ser Ser Trp Glu Tyr Ser Asp
50 55 60 Pro Asn Ser Pro Val Ile Leu Cys Ser Tyr Leu Pro Asp Glu
Phe Val 65 70 75 80 Asp Cys Asp Ala Pro Val Asp His Val Gly Asn Ala
Thr Ala Ser Gln 85 90 95 Glu Leu Gly Tyr Gly Cys Leu Lys Phe Gly
Gly Gln Ala Tyr Ser Asp 100 105 110 Val Gln His Thr Ala Val Gln Cys
Arg Ala Leu Glu Gly Ile Glu Cys 115 120 125 Ala Ser Pro Arg Thr Phe
Leu Arg Glu Asn Lys Pro Cys Ile Lys Tyr 130 135 140 Thr Gly His Tyr
Phe Ile Thr Thr Leu Leu Tyr Ser Phe Phe Leu Gly 145 150 155 160 Cys
Phe Gly Val Asp Arg Phe Cys Leu Gly His Thr Gly Thr Ala Val 165 170
175 Gly Lys Leu Leu Thr Leu Gly Gly Leu Gly Ile Trp Trp Phe Val Asp
180 185 190 Leu Ile Leu Leu Ile Thr Gly Gly Leu Met Pro Ser Asp Gly
Ser Asn 195 200 205 Trp Cys Thr Val Tyr 210 7 224 PRT Drosophila
melanogaster 7 Met Arg Ile Phe Tyr Gly Leu Leu Ala Phe Leu Val Ala
Arg Gln His 1 5 10 15 Asp Ala Gln Ala Ile Gln Ala Arg Ser Asp Lys
Glu Gln Pro Gln Thr 20 25 30 Val Val Ser Gly Thr Ala Val Gln Ser
Val Val Pro Val Gln Ala Gln 35 40 45 Leu Gly Ser Gly Met Gly Pro
Ser Ser Ser Ser Ser Ser Ala Ser Ser 50 55 60 Ala Ser Gly Gly Ala
Gly Asn Ser Ala Phe Tyr Pro Leu Gly Pro Asn 65 70 75 80 Val Met Cys
Ser Phe Leu Pro Arg Asp Phe Leu Asp Cys Lys Asp Pro 85 90 95 Val
Asp His Arg Glu Asn Ala Thr Ala Gln Gln Glu Lys Lys Tyr Gly 100 105
110 Cys Leu Lys Phe Gly Gly Ser Thr Tyr Glu Glu Val Glu His Ala Met
115 120 125 Val Trp Cys Thr Val Phe Ala Asp Ile Glu Cys Tyr Gly Asn
Arg Thr 130 135 140 Phe Leu Arg Ala Gly Val Pro Cys Val Arg Tyr Thr
Asp His Tyr Phe 145 150 155 160 Val Thr Thr Leu Ile Tyr Ser Met Leu
Leu Gly Phe Leu Gly Met Asp 165 170 175 Arg Phe Cys Leu Gly Gln Thr
Gly Thr Ala Val Gly Lys Leu Leu Thr 180 185 190 Met Gly Gly Val Gly
Val Trp Trp Ile Ile Asp Val Ile Leu Leu Ile 195 200 205 Thr Asn Asn
Leu Leu Pro Glu Asp Gly Ser Asn Trp Asn Pro Tyr Val 210 215 220 8
221 PRT Homo sapiens 8 Met Ala Gly Gly Val Arg Pro Leu Arg Gly Leu
Arg Ala Leu Cys Arg 1 5 10 15 Val Leu Leu Phe Leu Ser Gln Phe Cys
Ile Leu Ser Gly Gly Glu Ser 20 25 30 Thr Glu Ile Pro Pro Tyr Val
Met Lys Cys Pro Ser Asn Gly Leu Cys 35 40 45 Ser Arg Leu Pro Ala
Asp Cys Ile Asp Cys Thr Thr Asn Phe Ser Cys 50 55 60 Thr Tyr Gly
Lys Pro Val Thr Phe Asp Cys Ala Val Lys Pro Ser Val 65 70 75 80 Thr
Cys Val Asp Gln Asp Phe Lys Ser Gln Lys Asn Phe Ile Ile Asn 85 90
95 Met Thr Cys Arg Phe Cys Trp Gln Leu Pro Glu Thr Asp Tyr Glu Cys
100 105 110 Thr Asn Ser Thr Ser Cys Met Thr Val Ser Cys Pro Arg Gln
Arg Tyr 115 120 125 Pro Ala Asn Cys Thr Val Arg Asp His Val His Cys
Leu Gly Asn Arg 130 135 140 Thr Phe Pro Lys Met Leu Tyr Cys Asn Trp
Thr Gly Gly Tyr Lys Trp 145 150 155 160 Ser Thr Ala Leu Ala Leu Ser
Ile Thr Leu Gly Gly Phe Gly Ala Asp 165 170 175 Arg Phe Tyr Leu Gly
Gln Trp Arg Glu Gly Leu Gly Lys Leu Phe Ser 180 185 190 Phe Gly Gly
Leu Gly Ile Trp Thr Leu Ile Asp Val Leu Leu Ile Gly 195 200 205 Val
Gly Tyr Val Gly Pro Ala Asp Gly Ser Leu Tyr Ile 210 215 220 9 229
PRT Mus musculus 9 Met Glu Ala Val Ala Arg Ser Leu Arg Ser Val Arg
His Leu Ser Arg 1 5 10 15 Val Leu Leu Phe Leu Ser Gln Cys Tyr Ile
Leu Ser Gly Asp Glu Asn 20 25 30 Gln Leu Phe Ser His Leu Thr Glu
Ser Thr Glu Ile Pro Pro Tyr Val 35 40 45 Met Lys Cys Pro Ser Asn
Gly Leu Cys Ser Arg Leu Pro Ala Asp Cys 50 55 60 Ile Glu Cys Ala
Thr Asn Val Ser Cys Thr Tyr Gly Lys Pro Val Thr 65 70 75 80 Phe Asp
Cys Thr Val Lys Pro Ser Val Thr Cys Val Asp Gln Asp Leu 85 90 95
Lys Pro Gln Arg Asn Phe Val Ile Asn Met Thr Cys Arg Phe Cys Trp 100
105 110 Gln Leu Pro Glu Thr Asp Tyr Glu Cys Ser Asn Ser Thr Thr Cys
Met 115 120 125 Thr Val Ala Cys Pro Arg Gln Arg Tyr Phe Ala Asn Cys
Thr Val Arg 130 135 140 Asp His Ile His Cys Leu Gly Asn Arg Thr Phe
Pro Lys Leu Leu Tyr 145 150 155 160 Cys Asn Trp Thr Gly Gly Tyr Lys
Trp Ser Thr Ala Leu Ala Leu Ser 165 170 175 Ile Thr Leu Gly Gly Phe
Gly Ala Asp Arg Phe Tyr Leu Ala Gln Trp 180 185 190 Arg Glu Gly Leu
Gly Lys Leu Phe Ser Phe Gly Gly Leu Gly Ile Trp 195 200 205 Thr Leu
Asp Val Leu Leu Ile Gly Val Gly Tyr Val Gly Pro Ala Asp 210 215 220
Gly Ser Leu Tyr Ile 225 10 284 PRT Drosophila melanogaster 10 Met
Arg Leu Gln Arg Gln Cys Ile Val Val Asn Met Arg Ser Ala Ile 1 5 10
15 Val Leu Ile Met Ile Phe Val Leu Thr Gly Ile Arg Asn Ser Glu Thr
20 25 30 Ala Ser Gly Gly Asn Gln Met Asp Leu Ser Asp Ser Lys Gly
Asp His 35 40 45 Lys Asp Asn Ser Asn Ala Ser Asn Gly Asn Gly Asn
Ala Asn Asp Asn 50 55 60 Glu Val Tyr Val Pro Pro Leu Val Ser Ser
Met Val Ala Lys Ser Gly 65 70 75 80 Gly Gly Ala Gly Gly Leu Leu Asp
Asn Ile Thr Ala Tyr Ser Ser Ser 85 90 95 Ser Ser Ser Ser Ser Ser
Asn Gly Asn Asn Asn Met Leu Cys Pro Tyr 100 105 110 Asp Lys Glu Thr
Pro Cys Asp Arg Leu Gln Phe Pro Cys Ile Arg Cys 115 120 125 Asn Tyr
Asn His Gly Cys Ile Tyr Gly Arg Asp Leu Asn Val Thr Cys 130 135 140
Glu Val Ile Asn Asn Val Gln Cys Leu Gly Glu Arg Ser Phe Gln Arg 145
150 155 160 Gln Met Asn Cys Arg Tyr Cys Tyr Gln Thr Glu Met Trp Gln
Gln Ser 165 170 175 Cys Gly Gln Arg Ser Ser Cys Asn Ser Ala Thr Asp
Lys Leu Phe Arg 180 185 190 Thr Asn Cys Thr Val His His Asp Val Leu
Cys Leu Gly Asn Arg Ser 195 200 205 Phe Thr Arg Asn Leu Arg Cys Asn
Trp Thr Gln Gly Tyr Arg Trp Ser 210 215 220 Thr Ala Leu Leu Ile Ser
Leu Thr Leu Gly Gly Phe Gly Ala Asp Arg
225 230 235 240 Phe Tyr Leu Gly His Trp Gln Glu Gly Ile Gly Lys Leu
Phe Ser Phe 245 250 255 Gly Gly Leu Gly Val Trp Thr Ile Ile Asp Val
Leu Leu Ile Ser Met 260 265 270 His Tyr Leu Gly Pro Ala Asp Gly Ser
Leu Tyr Ile 275 280 11 292 DNA Homo sapiens 11 gggttttgtg
gaattgggag cctaattgat ttcattctta tttcaatgca gagacagggt 60
cttgctctgt tgcccaggct ggagtgcagt ggcgtgatca taactcattg cagcctcgaa
120 ttcctgggtt caaacaatct tcctgcctca gcctcccatc cagtatggga
tattttaaaa 180 gattgttgga ccttcagatg gaagtagtta cattatagat
tactatggaa ccagacttac 240 aagactgagt attactaatg aaacatttag
aaaaacgcaa ttatatccat aa 292 12 68 PRT Homo sapiens 12 Gly Phe Cys
Gly Ile Gly Ser Leu Ile Asp Phe Ile Leu Ile Ser Met 1 5 10 15 Gln
Arg Gln Gly Leu Ala Leu Leu Pro Arg Leu Glu Cys Ser Gly Val 20 25
30 Ile Ile Thr His Cys Ser Leu Glu Phe Leu Gly Ser Asn Asn Leu Pro
35 40 45 Ala Ser Ala Ser His Pro Val Trp Asp Ile Leu Lys Asp Cys
Trp Thr 50 55 60 Phe Arg Trp Lys 65 13 1246 DNA Homo sapiens 13
agcgggtgaa gcacctgatt gcctaaacca ctcgtttcct tcctccagca ctcaaagatt
60 aaccttagct ccttccaagg gttcgtgggg gaaaattcgc ctcgagggac
tgggtacatg 120 catattttaa aagggtctcc caatgtgatt ccacgggctc
acgggcagaa gaacacgcga 180 agagacggaa ctggcctcta tcctatgcga
ggtcccttta agaacctcgc cctgttgccc 240 ttctccctcc cgctcctggg
cggaggcgga agcggaagtg gcgagaaagt gtcggtctcc 300 aagatggcgg
ccgcctggcc gtctggtccg tctgctccgg aggccgtgac ggccagactc 360
gttggtgtcc tgtggttcgt ctcagtcact acaggaccct ggggggctgt tgccacctcc
420 gccgggggcg aggagtcgct taagtgcgag gacctcaaag tgggacaata
tatttgtaaa 480 gatccaaaaa taaatgacgc tacgcaagaa ccagttaact
gtacaaacta cacagctcat 540 gtttcctgtt ttccagcacc caacataact
tgtaaggatt ccagtggcaa tgaaacacat 600 tttactggga acgaagttgg
ttttttcaag cccatatctt gccgaaatgt aaatggctat 660 tcctacaaag
tggcagtcgc attgtctctt tttcttggat ggttgggagc agatcgattt 720
taccttggat accctgcttt gggtttgtta aagttttgca ctgtagggtt ttgtggaatt
780 gggagcctaa ttgatttcat tcttatttca atgcagattg ttggaccttc
agatggaagt 840 agttacatta tagattacta tggaaccaga cttacaagac
tgagtattac taatgaaaca 900 tttagaaaaa cgcaattata tccataaata
tttttagaag aaacagattt gagcctcctt 960 gattttaata gagaacttct
agtgtatgga tttaaagatt tctctttttc attcatatac 1020 cattttatga
gttctgtata atttttgtgg tttttgtttt gttgagttaa agtatgttat 1080
tgtgagattt atttaatagg acttcctttg aaagctgtat aatagtgttt ctcgggcttc
1140 tgtctctatg agagatagct tattactctg atactcttta atcttttaca
aaggcaagtt 1200 gccacttgtc atttttgttt ctgaaaaata aaagtataac ttattc
1246 14 21 DNA Artificial 5' Primer 14 ccatggatgc agaattccga c 21
15 32 DNA Artificial 5' Primer 15 aagcttgtcg acttacgcta tgacaacaac
gc 32 16 28 DNA Artificial 5' Primer 16 aagcttaaga tggatgcaga
attccgac 28 17 21 DNA Artificial 5' Primer 17 tttaatacca ctacaatgga
t 21 18 21 DNA Artificial 5' Primer 18 ttttcagtat ctacgattca t 21
19 21 DNA Artificial 5' Primer 19 tttaatacca ctacaatgga t 21 20 29
DNA Artificial 5' Primer 20 ctcgagttaa aatcgatctg ctcccaacc 29 21
26 DNA Artificial 5' Primer 21 gaattccaaa aataaatgac gctacg 26 22
29 DNA Artificial 5' Primer 22 ctcgagtcaa gatatgggct tgaaaaaac 29
23 30 DNA Artificial 5' Primer 23 ccttccatgg aagtggcagt cgcattgtct
30 24 32 DNA Artificial 5' Primer 24 aacactcgag tcaaaaccct
acagtgcaaa ac 32 25 22 DNA Artificial 5' Primer 25 gtggatccac
tgcttcgagg at 22 26 28 DNA Artificial Antisense 5' Primer 26
gtcgacggtt gctatacagg acaagagg 28 27 22 DNA Artificial 5' Primer 27
gtggatccag tgcttcaatg at 22 28 28 DNA Artificial Antisense 5'
Primer 28 gtcgactaaa tttgggcgtt cccttctt 28 29 22 DNA Artificial 5'
Primer 29 gtggatccac tgctttgagg gt 22 30 28 DNA Artificial
Antisense 5' Primer 30 gtcgacggtc ttcttgcccc catcttcc 28 31 50 DNA
Artificial Antisense 5' Primer 31 atatggccat ggatgcagaa ttcggacatg
actcaggatt tgaagttcgt 50 32 20 DNA Artificial 5' Primer 32
tgacctacag gaaagagtta 20 33 45 DNA Artificial 5' Primer 33
ccaggcggcc gccatcttgg agaccgacac tttctcgcca cttcc 45 34 24 DNA
Artificial 5' Primer 34 gttatgttgg gtgctggaaa acag 24 35 44 DNA
Artificial 5' Primer 35 ctaatacgac tcactatagg gctcgagcgg ccgcccgggc
aggt 44 36 27 DNA Artificial 5' Primer 36 ccatcctaat acgactcact
atagggc 27 37 23 DNA Artificial 5' Primer 37 ccagacggcc aggcggccgc
cat 23 38 23 DNA Artificial 5' Primer 38 actcactata gggctcgagc ggc
23 39 23 DNA Artificial 5' Primer 39 gccgccatct tggagaccga cac 23
40 40 DNA Artificial 5' Primer 40 taatacgact cactataggg ttagaagaaa
cagatttgag 40 41 40 DNA Artificial Reverse 5' Primer 41 attaaccctc
actaaaggga caagtggcaa cttgcctttg 40 42 10 PRT Artificial myc
epitope 42 Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10 43 75 DNA
Artificial 5' Primer 43 gcaggatccc caccatggag cagaagctga tcagcgagga
ggacctgcat attttaaaag 60 ggtctcccaa tgtga 75 44 22 DNA Artificial
Reverse 5' Primer 44 tcacggcctc cggagcagac gg 22 45 33 DNA
Artificial 5' Primer 45 tggtgaattc gaaagtgtcg gtctccaaga tgg 33 46
33 DNA Artificial 5' Primer 46 cttcgtcgac ttatggatat aattgcgttt ttc
33 47 34 DNA Artificial 5' Primer 47 ggttgggagc agatgaattt
taccttggat accc 34 48 23 DNA Artificial 5' Primer 48 cgaggagtcg
cttaagtgcg agg 23 49 25 DNA Artificial 5' Primer 49 cagtcttgta
agtctggttc catag 25 50 23 DNA Artificial 5' Primer 50 ggcactttca
gaggaccgag aag 23 51 24 DNA Artificial 5' Primer 51 atatcccata
ctggatggag gctg 24 52 5 PRT Artificial motif 52 Pro Xaa Asp Gly Ser
1 5
* * * * *