U.S. patent application number 11/189080 was filed with the patent office on 2005-12-22 for microparticle-based methods and systems and applications thereof.
Invention is credited to Cui, Xiumin, Dam, Rudy J., Hendrickson, Edwin R., Jiang, Xueping, Perry, Michael P., Prober, James M., Steenhoek, Larry Eugene.
Application Number | 20050282220 11/189080 |
Document ID | / |
Family ID | 32312763 |
Filed Date | 2005-12-22 |
United States Patent
Application |
20050282220 |
Kind Code |
A1 |
Prober, James M. ; et
al. |
December 22, 2005 |
Microparticle-based methods and systems and applications
thereof
Abstract
Microparticle-based analytical methods, systems and applications
are provided. Specifically, the use of resonant resonant light
scattering as an analytical method for determining either or both a
particle's identity and the presence and optionally, the
concentration of one or more particular target analytes is
described. Applications of these microparticle-based methods in
biological and chemical assays are also disclosed.
Inventors: |
Prober, James M.;
(Wilmington, DE) ; Cui, Xiumin; (Swarthmore,
PA) ; Dam, Rudy J.; (Maple Valley, WA) ;
Hendrickson, Edwin R.; (Hockessin, DE) ; Jiang,
Xueping; (Wilmington, DE) ; Perry, Michael P.;
(Landenberg, PA) ; Steenhoek, Larry Eugene;
(Wilmington, DE) |
Correspondence
Address: |
E I DU PONT DE NEMOURS AND COMPANY
LEGAL PATENT RECORDS CENTER
BARLEY MILL PLAZA 25/1128
4417 LANCASTER PIKE
WILMINGTON
DE
19805
US
|
Family ID: |
32312763 |
Appl. No.: |
11/189080 |
Filed: |
July 25, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11189080 |
Jul 25, 2005 |
|
|
|
10702320 |
Nov 5, 2003 |
|
|
|
60424168 |
Nov 6, 2002 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12; 435/7.92 |
Current CPC
Class: |
B82Y 10/00 20130101;
G01N 33/54373 20130101; G01N 33/54346 20130101; B82Y 15/00
20130101; B82Y 5/00 20130101; B82Y 20/00 20130101 |
Class at
Publication: |
435/006 ;
435/007.92 |
International
Class: |
C12Q 001/68; G01N
033/53; G01N 033/537; G01N 033/543 |
Claims
1. (canceled)
2. A method for the identification of an analyte comprising: (a)
providing a light scanning source which produces light over an
analytical wavelength range; (b) providing at least two
substantially spherical identifiable particles; (c) applying at
least one capture probe to the particles of (b) which binds to the
surface of the particle, the at least one capture probe having
affinity for at least one analyte; (d) affixing the particles of
(c) in a defined spatial array wherein each particle has a defined
locus; (e) optionally scanning the particles of (d) one or more
times over the analytical wavelength range to produce at least one
first reference resonant light scattering signature for each
particle of (d); (f) contacting the particle of (e) with a sample
suspected of containing at least one analyte where, if the analyte
is present, binding occurs between the at least one capture probe
and the at least one analyte; (g) scanning the particles of (f) one
or more times over the analytical wavelength range to produce at
least one second binding resonant light scattering signature for
each particle of (f); (h) detecting binding of the at least one
analyte to the at least one capture probe by comparing the
differences between the resonant light scattering signatures
selected from the group consisting of: any of the at least one
first reference light scattering signature and any of the at least
one second light scattering signature; and (i) identifying one or
more bound analytes on the basis of the affixed particle locus.
3. (canceled)
4. A method for the detection of analyte binding to a capture probe
comprising: (a) providing a light scanning source which produces
light over an analytical wavelength range; (b) providing at least
one substantially spherical identifiable particle; (c) applying at
least one capture probe to the particles of (b) which binds to the
surface of the particle, the at least one capture probe having
affinity for at least one analyte; (d) optionally scanning the
particles of (c) one or more times over the analytical wavelength
range to produce at least one first reference resonant light
scattering signature for each particle of (c); (e) contacting the
particle of (d) with a sample suspected of containing at least one
analyte where, if the analyte is present, binding occurs between
the at least one capture probe and the at least one analyte; (f)
scanning the particles of (e) one or more times over the analytical
wavelength range to produce at least one second binding resonant
light scattering signature for each particle of (e); and (g)
detecting binding of the at least one analyte to the at least one
capture probe by comparing the differences between the resonant
light scattering signatures selected from the group consisting of:
any of the at least one first reference light scattering signature
and any of the at least one second light scattering signature.
5-6. (canceled)
7. A method according to any of claims 2 or 4 wherein the
analytical wavelength range is a window spanning about 1 to about
20 nanometers, within optical wavelengths ranging from about 275 to
about 1900 nanometers.
8. A method according to claim 4 wherein the analyte is optionally
identified by analytical methods.
9. A method according to claim 8 wherein the analytical methods are
selected from the group consisting of mass spectroscopy,
fluorescence, optical absorbance radioactivity, and surface plasmon
resonance.
10. A method according to claim 8 wherein the analytical methods
comprise a detectable label selected from the group consisting of
fluorescent moieties, chemiluminescent moieties, particles,
enzymes, radioactive tags, quantum dots, light emitting moieties,
light absorbing moieties, intercalating dyes and members of binding
pairs.
11. A method according to any of claims 2 or 4 wherein the amount
of bound analyte is determined by comparing the differences between
the resonant light scattering signatures selected from the group
consisting of: the first reference light scattering signature and
any of the at least one second light scattering signature.
12-13. (canceled)
14. A method according to claim 7 wherein the optical wavelengths
range from about 600 to about 1650 nanometers.
15. A method according to claim 7 wherein the optical wavelengths
range from about 770 to about 780 nanometers.
16. A method according to any of claims 2 or 4 wherein the particle
is about 100 micrometers in diameter or less.
17. A method according to any of claims 2 or 4 wherein the particle
is about 75 micrometers in diameter or less.
18. A method according to any of claims 2 or 4 wherein the particle
is about 50 micrometers in diameter or less.
19. A method according to any of claims 2 or 4 wherein the particle
is substantially transparent to light over the analytical
wavelength range.
20. A method according to any of claims 2 or 4 wherein the particle
comprises: a) a substantially spherical core; and b) one or more
layers overlaying the core; wherein the one or more layers is
substantially transparent to light over the analytical wavelength
range.
21. A method according to claim 20 wherein the one or more layers
are optically active.
22. A method according to claim 20 wherein the one or more layers
are biologically active.
23. A method according to claim 20 wherein the one or more layers
are chemically active.
24. A method according to either of claims 22 or 23 wherein the
layers have a thickness ranging from about 1 nanometer to about 10
micrometers.
25. A method according to claim 21 wherein the core is light
absorbing.
26. A method according to claim 20 wherein the one or more layers
has a thickness of about 1 nanometer to about 20 micrometers.
27. A method according to claim 21 wherein the one or more layers
have a thickness of about 50 nanometers to about 20
micrometers.
28. A method according to claim 20 wherein the core is comprised of
materials selected from the group consisting of: glasses, silica,
polystyrene, polyester, polycarbonate, acrylic polymers,
polyacrylamide, polyacrylonitrile, polyamide, fluoropolymers,
silicone, celluloses, semiconducting materials, optically absorbing
materials, metals, magnetic materials, minerals, nanoparticles,
colloidal particles, metal oxides, metal sulfides, metal selenides,
and composites thereof.
29. A method according to claim 28 wherein the magnetic material is
iron oxide.
30. A method according to claim 20 wherein the core is hollow.
31. A method according to claim 20 wherein the layers are comprised
of materials independently selected from the group consisting of:
glasses, silica, polystyrene, polyester, polycarbonate, acrylic
polymers, polyacrylamide, polyacrylonitrile, polyamide,
fluoropolymers, silicone, celluloses, polyelectrolytes, minerals,
nanoparticles, colloidal particles, metal oxides, metal sulfides,
metal selenides, and composites thereof.
32. A method according to any of claims 2 or 4 wherein the particle
is comprised of glass having an index of refraction of about 1.45
to about 2.1 over the analytical wavelength range.
33. A method according to any one of claims 2 or 4 wherein the at
least one capture probe is selected from the group consisting of
proteins, nucleic acids, peptide nucleic acids, one member of a
binding pair, antibodies, biological cells, microorganisms, cell
membrane fragments, cellular organelles, receptors, viruses, viral
fragments, bacteriophage, bacteriophage fragments, organic ligands,
and organometallic ligands.
34. A method according to claim 33 wherein the at least one analyte
is present in a sample comprising sample matrix components.
35. A method according to any one of claims 2 or 4 wherein the at
least one analyte is selected from the group consisting of
proteins, nucleic acids, peptide nucleic acids, biological cells,
microorganisms, cell membrane fragments, cellular organelles,
antibodies, receptors, viruses, viral fragments, bacteriophage,
bacteriophage fragments, and one member of a binding pair.
36. A method according to claim 10 wherein the one member of a
binding pair is selected from the binding pair combinations
consisting of: antigen/antibody, antigen/antibody fragment, Protein
A/antibody, Protein G/antibody, hapten/anti-hapten, biotin/avidin,
biotin/streptavidin, folic acid/folate binding protein;
hormone/hormone receptor, lectin/carbohydrate, enzyme/enzyme
cofactor, enzyme/substrate, enzyme/inhibitor, peptide nucleic
acid/complimentary nucleic acid, polynucleotide/polynucleotide
binding protein, vitamin B12/intrinsic factor; complementary
nucleic acid segments; pairs comprising sulfhydryl reactive groups,
pairs comprising carbodiimide reactive groups, and pairs comprising
amine reactive groups.
37. A method according to claim 33 wherein the one member of a
binding pair is selected from the binding pair combinations
consisting of: antigen/antibody, antigen/antibody fragment, Protein
A/antibody, Protein G/antibody, hapten/anti-hapten, biotin/avidin,
biotin/streptavidin, folic acid/folate binding protein;
hormone/hormone receptor, lectin/carbohydrate, enzyme/enzyme
cofactor, enzyme/substrate, enzyme/inhibitor, peptide nucleic
acid/complimentary nucleic acid, polynucleotide/polynucleotide
binding protein, vitamin B12/intrinsic factor; complementary
nucleic acid segments; pairs comprising sulfhydryl reactive groups,
pairs comprising carbodiimide reactive groups, and pairs comprising
amine reactive groups.
38. A method according to claim 35 wherein the one member of a
binding pair is selected from the binding pair combinations
consisting of: antigen/antibody, antigen/antibody fragment, Protein
A/antibody, Protein G/antibody, hapten/anti-hapten, biotin/avidin,
biotin/streptavidin, folic acid/folate binding protein;
hormone/hormone receptor, lectin/carbohydrate, enzyme/enzyme
cofactor, enzyme/substrate, enzyme/inhibitor, peptide nucleic
acid/complimentary nucleic acid, polynucleotide/polynucleotide
binding protein, vitamin B12/intrinsic factor; complementary
nucleic acid segments; pairs comprising sulfhydryl reactive groups,
pairs comprising carbodiimide reactive groups, and pairs comprising
amine reactive groups.
39. A method according to any one of claims 2 or 4 wherein the
capture probe is synthesized on the surface of the particle.
40. A method according to any one of claims 2 or 4 wherein the
capture probe is isolated from natural sources or synthesized
separately prior to being added to the surface of the particle.
41. A method according to claim 34 wherein after applying the
capture probe to the particle, the particle is treated to prevent
non-specific binding of sample matrix components.
42. A method according to claim 34 wherein the particles are coated
with a thin film to prevent non-specific binding of components of
the sample matrix and then the thin film coating is activated to
attach the capture probe.
43. (canceled)
44. A method according to any one of claims 2 or 4 wherein the
reference and binding resonant light scattering signatures are
compared on the basis of spectral features selected form the group
consisting of; peak wavelength positions, peak widths, wavelength
intervals among peaks, peak amplitudes, and polarization-dependent
properties.
45. A method according to any of claims 2 or 4 wherein the particle
comprises one of more optically active layers.
46. A method according to any of claims 2 or 4 wherein the particle
comprises one of more biologically active layers.
47. A method according to any of claims 2 or 4 wherein the particle
comprises one of more chemically active layers.
48-70. (canceled)
Description
FIELD OF INVENTION
[0001] This invention generally relates to methods, systems, and
applications for microparticle-based measurements using resonant
light scattering, comprising one or more of the following elements:
particle identification, determining the identity and degree of
analyte binding, and application of these methods in multiplexed
biological and chemical assays.
BACKGROUND
[0002] Advances in bioanalysis are increasingly driven by
miniaturization and multiplexing, i.e. the ability to measure many
samples simultaneously. The ability to measure more analytes from
smaller sample volumes, dictated in many cases by limited sample
size, has led to development of miniaturized microfluidics-based
sample manipulation systems and novel methods for analysis in
micro-scale systems. Examples include a wide variety of existing
biological and chemical measurements, for example DNA sequencing,
protein analysis, single-nucleotide polymorphism (SNP) analysis,
high-speed and high-resolution separations and chromatography using
lab-on-chip devices, and many others. Special emphasis has been
given in the past decade on development of highly parallel,
miniaturized assay systems for the large-scale study of genomics
and proteomics and for high-throughput screening in discovery
research. Examples include 2-dimensional fixed "biochip"
microarrays and, more recently, identifiable micrometer-sized
particles. Both approaches depend on specific binding or capture of
analytes to complementary probes on the surface of the array or
particle, for example by base-pair hybridization between nucleic
acids, or hydrogen bonding, hydrophobic interactions, and other
binding mechanisms between polypeptides.
[0003] Microarrays and associated support technologies emerged in
the 1990's and now comprise an established industry. For example,
Affymetrix's GeneChip.RTM. technology is a manufacturing process
that uses photolithography, solid phase chemistry, and
semiconductor fabrication techniques to build hundreds of thousands
of DNA sequence probes on a two-dimensional array. This technology
is described in, for example, Schena, M. et al., "Quantitative
monitoring of gene expression patterns with a complementary DNA
microarray", Science 270, 467-470 (1995); Shalon, D. et al., "A DNA
microarray system for analyzing complex DNA samples using two-color
fluorescent probe hybridization", Genome Res. 6, 639-645 (1996);
Goldberg, M. J. and Rava, R. P., "Method of manufacturing
biological chips, U.S. Pat. No. 6,309,831 (2001) and Chee, M. et
al., "Arrays of nucleic acid probes on biological chips", U.S. Pat.
No. 5,837,832 (1998). Other DNA microarray technologies have been
developed, for example by Hyseq, Inc., Molecular Dynamics, Inc.,
Nanogen, Incyte Pharmaceuticals, Inc., and others known in the
art.
[0004] Fixed arrays are also being developed for proteomics,
defined herein as the systematic study of the proteins in a
biological system. For example, Ciphergen Biosystems'
ProteinChip.RTM. array technology is a process that includes
chromatography and protein characterization based upon the
surface-enhanced laser desorption/ionization (SELDI). These
techniques combine laser-based molecular weight determination with
the use of a chemically active protein chip array. This technology
is described in, for example, Hutchens, T. W., "Use of retentate
chromatography to generate difference maps", U.S. Pat. No.
6,225,047 (2001); Hutchens, T. W., "Methods and apparatus for
desorption and ionization of analytes", U.S. Pat. No. 5,719,060
(1998); and Weinberger, S. R., et al., "Current achievements using
ProteinChip.RTM. Array technology", Curr. Opin. Chem. Biol., 6(1),
86-91 (2002). A number of other protein array technologies have
also been developed for example by Agilent Technologies, Inc.,
Zyomyx, Inc., Cambridge Antibody Technology, and others known in
the art.
[0005] Independent of the type of analyte being measured,
microarrays base the ability to determine the identity of each
probe by its fixed position within the array. Typically, each probe
is synthesized or spotted at known coordinates within a grid on the
surface of a substrate or chip. These "biochip" systems can carry
out large numbers of analyses simultaneously, but they suffer from
known disadvantages. For example, microarrays have inherently
inefficient binding kinetics. Because of poor mixing at the surface
and the dimensions of a typical biochip, an analyte must cover
relatively large diffusion distances to bind to its complementary
probe. This results in slow diffusion of analytes to and on the
surface, incomplete binding reactions, and substantial lengthening
of the protocol. Additionally, the application and measurement of
samples on microarrays is inherently a batch process, not
particularly well suited for automation. Some types of microarrays
can be expensive and difficult to customize quickly as the needs of
an experiment or assay might require. Variability across a
microarray can lead to degraded reproducibility and precision,
requiring in some cases substantial redundancy in the measurements.
Sensitivity and dynamic range are frequently reported to be
problematic in the analysis of microarray data. Also, with fixed
microarrays it is not typically possible to recover, sort,
post-process, or perform subsequent measurements on the analyte.
Finally, in most microarray systems, a reporter group such as a
fluorophore is required to detect binding of an analyte. Although
some advances have been reported (see for example Kayyem, J. F.,
"Cycling probe technology using electron transfer detection", U.S.
Pat. No. 6,063,573 (2000); Nelson, B. P., et al., "Surface plasmon
resonance imaging measurements of DNA and RNA hybridization
adsorption onto DNA microarrays", Anal. Chem. 73, 1-7 (2001)), the
use of external reporter groups requires washing the array after
exposure to the sample in order to remove interfering signals from
unbound reporters. The resulting measurement in most microarray
systems is thus an end-point measurement; i.e. the microarray is
not capable of real-time, continuous measurement of binding between
analyte and probe.
[0006] The use of microparticles circumvent many of the
deficiencies of 2-dimensional microarrays, primarily because the
assays can be done in a small, well-mixed volume in which binding
kinetics are more favorable. When the sample is well mixed, there
is no location-dependent variability as is the case with fixed
arrays. Further, small particle size and small sample volumes
increase the local concentration of probes and reduce the diffusion
length an analyte must travel in order to bind to a probe, thus
increasing the speed and degree of completion of binding reactions.
Microparticles can be manipulated more readily by automated sample
handling systems, thus the potential for customization and
automation is favorable compared to two-dimensional biochip
formats.
[0007] Flexibility is a further key advantage in particle-based
assays. Since individual particles can be tracked and manipulated,
it is in principle possible to isolate the analyte or carry out
additional measurements on a subset of the particles. Creation of
custom assays is made simpler by the ability to quickly select a
subset of particles for a specific purpose out of a larger master
library.
[0008] There remains, however, a need for innovation in the
detection of binding. As mentioned previously, although non-labeled
binding detection has been reported for fixed array systems, the
continuing use of external reporter groups in particle-based assays
remains a key disadvantage since the associated drawbacks are the
same as for fixed arrays. As will be disclosed in detail below, a
key object of the present invention is to eliminate the requirement
for reporter groups in particle-based assays, thus simplifying the
protocol, reducing time and cost, and enabling the measurement of
binding in real time.
[0009] In a typical particle-based assay system, each microparticle
carries many copies of a unique probe on its surface. Because the
microparticles can be in free suspension in some applications, it
is not possible in those cases to link the identity of the probe to
a fixed position, as done in fixed arrays. Rather, identity of the
probe must be uniquely linked to the identity of the particle, thus
requiring each particle to have a unique identifying label or
marker. In the literature, particle identification is typically
accomplished by incorporation of colored or fluorescent molecules,
barcodes, or nanoparticles with distinctive fluorescent signatures.
Thus, the number of particle-based assays that can be performed in
parallel is limited by the number of distinguishable combinations
provided by the specific labels employed, e.g. the number of
fluorophores, and possibly their relative abundance.
[0010] An example of fluorescence-based particle identification is
Luminex Corporation's FlowMetrix.RTM. system and Laboratory
Multi-Analyte Profiling (LabMAP.RTM.) technology. This system
allows up to about 100 to 1000 analytes to be measured sequentially
by flow cytometry. This technology incorporates microspheres that
are internally labeled with two or more distinct fluorescent dyes.
The microspheres are further coded with varying combinations of
intensities of the fluorophores. The process also includes a third
different fluorophore integrated to a reporter molecule for
quantification of reactions on the surface of the encoded
microspheres. The fabrication of the encoded microspheres and the
system is described in, for example, Chandler, V. S., et al.,
"Multiplexed analysis of clinical specimens apparatus and methods,
U.S. Pat. No. 5,981,180 (1999). Due to the relatively wide emission
spectra of many fluorophores, a moderate number of patterns can be
uniquely distinguished with this class of labels, typically less
than 1000.
[0011] The use of nanoparticles with relatively narrow fluorescent
emission spectra (described for example by Chandler, M. B., et al.,
"Microparticles attached to nanoparticles labeled with fluorescent
dye", U.S. Pat. No. 6,268,222 (2001); Xu, H. et. al., "Multiplexed
SNP genotyping using the Qbead.TM. system; a quantum dot-encoded
microsphere-based assay, Nucleic Acids Research 31(8), e43 (2003)).
Encoding particles with other optical markers, e.g.
electrochemically deposited codes (described for example by
Nicewarner-Pena, S. R. et al., "Submicrometer metallic barcodes",
Science 294, 137-141 (2001); and Walton, I. D. et al., "Particles
for multiplexed analysis in solution: detection and identification
of striped metallic particles using optical microscopy", Anal.
Chem. 74, 2240-2247 (2002)) can improve the multiplicity of the
assay while retaining the operational advantages of particle-based
assays.
[0012] The present invention relies on the interaction between
light and particles possessing defined physical and optical
properties. More specifically, resonant light scattering from
spherical particles (interchangeably referred to herein as resonant
Mie scattering because the interaction of light with the particles
used in the present invention is described by Mie theory) is used
to determine either or both the particle identity and the degree of
binding of target species to the particle surface. Theories of
interactions between light and particles are provided in many
references, for example Bohren, C. F., and Huffman, D. R.,
Absorption and Scattering of Light By Small Particles, John Wiley
and Sons (1983); Kerker, M., The Scattering of Light and Other
Electromagnetic Radiation, Academic Press (1969). More specifically
pertaining to the present invention are treatments of resonance
structures in the resonant light scattering spectrum, see for
example Chylek, P. et al., "Narrow resonance structure in the Mie
scattering characteristics", Appl. Optics 17, 3019-3021 (1978);
Conwell, P. R. et al., "Resonant spectra of dielectric spheres", J.
Opt. Soc. America A 1, 62-67 (1984); Probert-Jones, J. R.,
"Resonance component of backscattering by large dielectric
spheres", J. Opt. Soc. America A 1, 822-830 (1984); Hill, S. C. and
Benner, R. E., "Morphology-dependent resonances associated with
stimulated processes in microspheres", J. Opt. Soc. America B 3,
1509-1514; Lettieri, T. R., and Marx, E., "Resonance light
scattering from a liquid suspension of microspheres", Appl. Optics
25(23), 4325-4331 (1986); Chylek, P. and Zhan, J., "Interference
structure of the Mie extinction cross section", J. Opt. Soc.
America A 6, 1846-1851 (1989); and Hill, S. C. et al., "Structural
resonances observed in the fluorescence emission from small spheres
on substrates", Appl. Optics 23, 1680 (1984). The development of
computational methods and computer algorithms for deriving
structure and property information from scattered light is
described in, for example, Conwell, P. R. et al., "Efficient
automated algorithm for the sizing of dielectric microspheres using
the resonance spectrum", J. Opt. Soc. America A 1, 1181-1186
(1984); Lam, C. C. et al., "Explicit asymptotic formulas for the
positions, widths, and strengths of resonances in Mie scattering",
J. Opt. Soc. America B 9, 1585-1592 (1992); Chylek, P., "Resonance
structure of Mie scattering: distance between resonances", J. Opt.
Soc. America A 7, 1609-1613 (1990); and Guimaraes, L. G., and
Nussenzveig, H. M., "Uniform approximation to Mie resonances", J.
Modern Optics 41, 625-647 (1994). Of further specific relevance to
the microparticles of this invention are treatments of layered
spheres, for example Kaiser, T. and Schweiger, G., "Stable
algorithm for the computation of Mie coefficients for scattered and
transmitted fields of a coated sphere", Computers in Physics 7,
682-686 (1993); and Hightower, R. L. and Richardson, C. B.,
"Resonant Mie scattering from a layered sphere", Appl. Optics 27,
4850-4855 (1988).
[0013] In practical applications, resonant light scattering has
been used for particle size and refractive index measurements,
studies of atmospheric aerosols, interstellar particles, and other
measurements; for example see the two articles cited above for
Conwell (1984) and Lettieri (1986); also see Ray, A. K. and
Nandakumar, R., "Simultaneous determination of size and
wavelength-dependent refractive indices of thin-layered droplets
from optical resonances", Appl. Optics 34, 7759-7770 (1995);
Huckaby, J. L., et al., "Determination of size, refractive index,
and dispersion of single droplets from wavelength-dependent
scattering spectra", Appl. Optics 33, 7112-7125 (1994); Hill, S.
C., et al., "Sizing dielectric spheres and cylinders by aligning
measured and computed resonance locations: algorithm for multiple
orders", Appl. Optics 24, 2380-2390 (1985); Chylek, P. V. et al.,
"Simultaneous determination of refractive index and size of
spherical dielectric particles from light scattering data", Appl.
Optics 22, 2303-2307 (1983), and the references therein. In these
references it is shown that accurate detection of fine resonance
features in the scattered light spectrum requires detection methods
with high spectral resolution. Typical experimental relative error
in measuring the wavelength position of peaks in the earlier
reports, e.g. Chylek et al., (1983) is about 1 part in 10.sup.5.
More recently, for example in Huckaby (1994), the relative
precision of peak determination is between about 1 part in
2.times.10.sup.6 and 1 part in 2.times.10.sup.7.
[0014] Whitten et al., in "Morphological resonances for
multicomponent immunoassays", Appl. Optics 34, 3203-3207 (1995),
describe a technique for distinguishing among antibody-coated
microspheres based on their sizes as measured by resonance features
in their fluorescence spectrum. The technique reported in that
article was capable of distinguishing among a low number of
subpopulations of particles (two in the example reported), each
subpopulation having a nominal mean diameter, with relatively large
differences between the two subpopulations in mean diameter (6.5
and 10 micrometers). In essence, particle diameter was used as an
identifying label, the diameter being measured by fitting the
observed resonance pattern with theoretical calculations. As
disclosed in that article, the diameter "label" could only
distinguish between two subpopulations differing substantially in
mean diameter. No extension of this approach to identifying large,
diverse populations of very similar microparticles is taught in
that disclosure. Moreover, the methods and system of the present
invention also differ substantially from the method and system
taught in the Whitten et. al. disclosure. That disclosure teaches a
fluorescence detection method in which the incident light is fixed
in wavelength and the optical resonances occur in the scanned
fluorescence spectrum. In contrast, a preferred embodiment of the
present invention does not rely on fluorescence, uses a scanned
incident wavelength, and detects a scattered light spectrum through
means differing substantially from what is disclosed by Whitten et
al.
[0015] Vollmer et al. in "Protein detection by optical shift of a
resonant microcavity". Appl. Phys. Lett. 80, 4057-4059 (2002)
describe the detection of protein binding to a dielectric
microparticle based upon a shift in optical resonances in the
particle. The resonances were excited by evanescent coupling to an
eroded optical fiber and were detected as dips in the light
intensity transmitted through the fiber. The detection method
described in that disclosure is not based on light scattering
measurements. Moreover, the possibility of using the optical
resonances for particle identification is not taught by Vollmer et
al.
[0016] Hightower, R. L. and Richardson, C. B, supra, used
theoretical modeling to compute the resonant response of large,
layered spheres to an incident linearly polarized plane wave. Based
on the results of these computations, they suggest that the sharp
and unique features of the scattered light spectrum may be used in
studies of immiscible fluids, adsorbed layers, coatings, and
vesicles. However, use of resonant light scattering spectra for
identification of microparticles or for detection in biological and
chemical assays is not taught in that disclosure.
[0017] Serpenguzel et al. in "Excitation of resonances of
microspheres on an optical fiber", Optics Lett 20, 654-656 (1995)
describe the measurement of resonant light scattering of solid
microspheres that are excited using evanescent coupling to an
optical fiber. The authors of that disclosure postulate that the
measurement of these light scattering resonances may be used for
performing extremely sensitive adsorption and reaction measurements
between species bonded to the microsphere surface and reagents in
the surrounding solution. However, how such measurements could be
made is not taught in that disclosure. Moreover, the possibility of
using the optical resonances for particle identification is not
taught by Serpenguzel et al.
[0018] Arnold et al. in U.S. Patent Application Publication No.
2003/0174923 describe a method and system for detecting a substance
based on a resonance shift of photons orbiting within a microshere
of a sensor. The microsphere is coupled with at least one optical
fiber such that the microsphere is excited by evanescent coupling
to the fiber. The resonances are detected as dips in the light
intensity transmitted through the optical fiber. The detection
method described in that disclosure is not based on light
scattering measurements. That disclosure also teaches that a
plurality of microspheres may be used for multianalyte detection.
However, in that disclosed method, the microspheres are kept in a
fixed position attached to the optical fiber. The possibility of
using optical resonances as signatures for particle identification
for use in tracking the particles, and therefore the attached
probes, is neither taught nor suggested by Arnold et al.
[0019] In contrast to the reports in the literature, the basis for
identification of microparticles in the present invention is to
effectively use the very rich information content inherent in the
resonant light scattering pattern. As will be disclosed in more
detail later in this application, a resonant light scattering
pattern may be characterized by a diverse set of variables
including but not limited to peak location, peak width, peak order,
periods between peaks of different orders, and
polarization-dependent spectral properties. Distinguishable
resonant light scattering patterns may be realized among members of
a large set of similar microparticles by varying, from particle to
particle, one or more of the main parameters affecting the
scattering pattern, namely the structure, composition, and
dimensions of the particle. Thus, according to the present
invention a very rich and diverse set of scattering patterns among
members of a large population of similar microparticles is created,
providing a means to distinguish and identify individual
microparticles.
[0020] The principal drawbacks to existing labeling techniques
include limited multiplicity, i.e., limited combinations of unique
identifying features, difficulties in preparing the encoded
particles, speed and accuracy of decoding, and, in some cases,
cost. There is a need therefore, for a method for parallel,
simultaneous, particle-based measurement of binding kinetics for
moderate to large numbers of analytes. Specifically, a method is
needed that exhibits one or more of the following attributes: (1)
the ability to measure binding without need of external reporter
moieties; (2) the ability to determine quantitatively the binding
of a target analyte in real time; (3) the ability to optionally
amplify the binding signal; and (4) the ability to identify and
optionally track individual microparticles. Each of these
represents a distinct improvement over the current practice, and
taken together, provide not only improved speed, accuracy, and cost
reduction for existing assays, but also enable new applications not
previously possible.
[0021] The present invention solves the stated problem by providing
reliable, easily manufacturable, and cost-effective methods of
particle identification and binding detection, capable of high
multiplicity and superior in performance to current practice. In
the present invention, the microparticles are identified by a novel
application of high-resolution light scattering, employing specific
features in the scattering spectrum as unique identifying patterns
or optical signatures. Specifically, the present invention employs
resonant light scattering, also known as resonant Mie scattering,
as the analytical method for both determining a particle's identity
and also for determining the presence of, and optionally the degree
of binding to the surface of the particle. These methods may be
used together, or separately, to afford assays that are
substantially improved over the state of the art.
SUMMARY OF THE INVENTION
[0022] The present invention provides methods of identifying
analytes bound to particles on the basis of unique light scattering
resonance patterns that identify the particle and differences
between the those patterns pre and post binding. Accordingly the
invention provides a method for the identification of an analyte
comprising:
[0023] (a) providing a light scanning source which produces light
over an analytical wavelength range;
[0024] (b) providing at least two substantially spherical
identifiable particles;
[0025] (c) applying at least one capture probe to the particles of
(b) which binds to the surface of the particle, the at least one
capture probe having affinity for at least one analyte;
[0026] (d) scanning each particle of (c) one or more times over a
first analytical wavelength range to produce at least one first
reference resonant light scattering signature for each particle of
(c), said first resonant light scattering signature uniquely
identifying each particle;
[0027] (e) correlating the at least one capture probe with each
identified particle of (d);
[0028] (f) contacting the particle of (e) with a sample suspected
of containing at least one analyte where, if the analyte is present
in said sample, binding occurs between the at least one capture
probe and the at least one analyte;
[0029] (g) scanning the particles of (f), one or more times over a
second analytical wavelength range to produce at least one second
binding resonant light scattering signature for each particle of
(f), wherein:
[0030] 1) the at least one first reference and at least one second
binding resonant light scattering signatures may be the same or
different; and
[0031] 2) the at least first and second analytical wavelength
ranges may be the same or different;
[0032] (h) detecting binding of the at least one analyte to the at
least one capture probe by comparing the differences between the
resonant light scattering signatures selected from the group
consisting of: any of the at least one first reference light
scattering signature and any of the at least one second light
scattering signature; and
[0033] (i) identifying one or more bound analytes on the basis of
the correlation made in step (e) and the at least one second
binding resonant light scattering signature.
[0034] In an alternate embodiment the invention provides a method
for the identification of an analyte comprising:
[0035] (a) providing a light scanning source which produces light
over an analytical wavelength range;
[0036] (b) providing at least two substantially spherical
identifiable particles;
[0037] (c) applying at least one capture probe to the particles of
(b) which binds to the surface of the particle, the at least one
capture probe having affinity for at least one analyte;
[0038] (d) affixing the particles of (c) in a defined spatial array
wherein each particle has a defined locus;
[0039] (e) optionally scanning the particles of (d) one or more
times over the analytical wavelength range to produce at least one
first reference resonant light scattering signature for each
particle of (d);
[0040] (f) contacting the particle of (e) with a sample suspected
of containing at least one analyte where, if the analyte is
present, binding occurs between the at least one capture probe and
the at least one analyte;
[0041] (g) scanning the particles of (f) one or more times over the
analytical wavelength range to produce at least one second binding
resonant light scattering signature for each particle of (f);
[0042] (h) detecting binding of the at least one analyte to the at
least one capture probe by comparing the differences between the
resonant light scattering signatures selected from the group
consisting of: any of the at least one first reference light
scattering signature and any of the at least one second light
scattering signature; and
[0043] (i) identifying one or more bound analytes on the basis of
the affixed particle locus.
[0044] In similar fashion the invention provides a method for the
identification of an analyte comprising:
[0045] (a) providing light scanning source which produces light
over an analytical wavelength range;
[0046] (b) providing at least two substantially spherical
identifiable particles;
[0047] (c) applying at least one capture probe to the particles of
(b) which binds to the surface of the particle, the at least one
capture probe having affinity for at least one analyte;
[0048] (d) scanning each particle of (c) one or more times over the
analytical wavelength range to produce at least one first reference
resonant light scattering signature for each particle of (c), said
first resonant light scattering signature uniquely identifying each
particle;
[0049] (e) correlating the at least one capture probe with each
identified particle of (d);
[0050] (f) contacting the particle of (e) with a sample suspected
of containing at least one analyte where, if the analyte is
present, binding occurs between the at least one capture probe and
the at least one analyte, the analyte comprising a detectable
label; and
[0051] (g) identifying one or more analytes on the basis of the
correlation of step (e) and the detectable label of the
analyte.
[0052] In another embodiment the invention provides a method for
the detection of analyte binding to a capture probe comprising:
[0053] (a) providing a light scanning source which produces light
over an analytical wavelength range;
[0054] (b) providing at least one substantially spherical
identifiable particle;
[0055] (c) applying at least one capture probe to the particles of
(b) which binds to the surface of the particle, the at least one
capture probe having affinity for at least one analyte;
[0056] (d) optionally scanning the particles of (c) one or more
times over the analytical wavelength range to produce at least one
first reference resonant light scattering signature for each
particle of (c);
[0057] (e) contacting the particle of (d) with a sample suspected
of containing at least one analyte where, if the analyte is
present, binding occurs between the at least one capture probe and
the at least one analyte;
[0058] (f) scanning the particles of (e) one or more times over the
analytical wavelength range to produce at least one second binding
resonant light scattering signature for each particle of (e);
and
[0059] (g) detecting binding of the at least one analyte to the at
least one capture probe by comparing the differences between the
resonant light scattering signatures selected from the group
consisting of: any of the at least one first reference light
scattering signature and any of the at least one second light
scattering signature.
[0060] In an alternate embodiment the invention provides method for
the detection of analyte dissociation from a capture probe
comprising:
[0061] (a) providing a light scanning source which produces light
over an analytical wavelength range;
[0062] (b) providing at least one substantially spherical
identifiable particle comprising:
[0063] 1) at least one capture probe affixed to the particle
and;
[0064] 2) at least one analyte bound to the at least one capture
probe;
[0065] (c) scanning the particle of (b) one or more times over the
analytical wavelength range to produce at least one first reference
resonant light scattering signature for said particle;
[0066] (d) dissociating the at least one analyte from the at least
one capture probe of the particle of step (c);
[0067] (e) scanning the particle of (d) one or more times over the
analytical wavelength range to produce at least one second
dissociation resonant light scattering signature for each particle;
and
[0068] (f) detecting dissociation of the at least one analyte from
the at least one capture probe by comparing the differences between
the resonant light scattering signatures selected from the group
consisting of: any of the at least one first reference light
scattering signature and any of the at least one second light
scattering signature.
[0069] Additionally the invention provides an identifiable particle
comprising:
[0070] (a) a substantially spherical core;
[0071] (b) a capture probe affixed to the outer surface of the
particle;
[0072] wherein:
[0073] 1) the particle is characterized by a unique resonant light
scattering signature when scanned over an analytical wavelength
range of about 1 to about 20 nanometers over a range of optical
wavelengths of about 275 nanometers to about 1900 nanometers;
[0074] 2) the particle is about 100 micrometers in diameter or
less;
[0075] 3) the particle has a refractive index between about 1.6 and
about 2.1 over the analytical wavelength range; and
[0076] 4) the particle is substantially non-fluorescing over the
analytical wavelength range.
[0077] In a specific embodiment the invention provides An
identifiable particle comprising:
[0078] (a) a substantially spherical core;
[0079] (b) a capture probe affixed to the outer surface of the
particle;
[0080] wherein:
[0081] 1) the particle is characterized by a unique resonant light
scattering signature when scanned over an analytical wavelength
range of about 1 to about 20 nanometers over a range of optical
wavelengths of about 275 nanometers to about 1900 nanometers;
[0082] 2) the particle is about 100 micrometers in diameter or
less;
[0083] 3) the particle has a refractive index between about 1.6 and
about 2.1 over the analytical wavelength range; and
[0084] 4) the particle is substantially non-fluorescing over the
analytical wavelength range;
[0085] wherein the particle comprises:
[0086] i) one or more optically active layers having a thickness
between about 50 nanometers and about 20 micrometers; and
[0087] ii) one or more biologically active or chemically active
substantially transparent outer layers of thickness between about 1
nanometer to 10 micrometers, said layers overlaying the layer of
(i).
[0088] Additionally the invention provides microparticle based
measuring systems comprising:
[0089] (a) at least one substantially spherical identifiable
particle in solution, each particle comprising a capture probe
affixed to the outer surface of the particle;
[0090] wherein:
[0091] 1) the particle is characterized by a unique resonant light
scattering signature when scanned over an analytical wavelength
range having a window spanning about 1 to about 20 nanometers, over
a range of optical wavelengths from about 275 to about 1900
nanometers;
[0092] 2) the particle is about 75 micrometers in diameter or less;
and
[0093] 3) the particle has a refractive index between about 1.45
and about 2.1 over the analytical wavelength range.
[0094] (b) a light scanning source for scanning the particle over
the analytical wavelength range;
[0095] (c) an optical cell for presenting the particle in a
suitable position and in a suitable environment for detecting
scattered light;
[0096] (d) a particle handling means for placing particles into the
optical cell; and
[0097] (e) a detection means for detecting light from the scanned
particle and converting said light to an electrical signal.
BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCE DESCRIPTIONS
[0098] The invention can be more fully understood from the
following detailed description, figures and the accompanying
sequence descriptions, which form a part of this application.
[0099] FIG. 1 is a schematic representation of a particle-based
specific binding assay according to the invention, showing the
capture of selected targets from a multi-analyte sample and the
non-binding of targets not complementary to one of the probes.
[0100] FIG. 2 is a drawing of a layered microparticle showing a
core coated with an arbitrary number of m layers. The core and each
layer are characterized by a radius R and a refractive index n.
Particle-to-particle variations in R and n give rise to unique
scattered light patterns that can be used to identify each particle
according to the invention.
[0101] FIG. 3 is a schematic diagram of an optical cell for holding
microparticles and an optical probe for illuminating the
microparticles and measuring the scattered light intensity.
[0102] FIG. 4 is a schematic diagram of the optical probe detection
system used to measure scattered light from microparticles. The
components are not drawn to scale.
[0103] FIG. 5 is a set of scattered light spectra from different
microparticles from which unique particle identities can be
established according to the invention.
[0104] FIG. 6 is a schematic diagram of an optical cell for holding
microparticles and a microscope lens for simultaneously imaging the
particles and measuring the scattered light intensity.
[0105] FIG. 7 is a schematic diagram of the imaging detection
systems used to measure scattered light from a multiplicity of
microparticles according to the invention. The components are not
drawn to scale.
[0106] FIG. 8 is a digital image of scattered light from a group of
microparticles, acquired by the imaging detection system of FIG. 7
at a single wavelength of incident light. Both the incident and
scattered light were polarized; the directions of the polarization
were parallel. The numbers 12, 3, 6, and 9 refer to regions of the
scattered light image for each particle as explained in the
text.
[0107] FIG. 9 is a set of wavelength-linked scattered light images
from a single particle and the extracted scattered light spectra
from two regions of interest (polarization 12 and polarization
3).
[0108] FIG. 10A is a digital image of scattered light from
biotinylated glass microparticles according to Example 3.
[0109] FIG. 10B is a scattered light spectrum of a biotinylated
microparticles according to Example 3.
[0110] FIG. 10C shows a comparison of scattered light spectra
before and after binding of avidin on a biotinylated microparticle
according to Example 3.
[0111] FIG. 11 shows the autocorrelation function for the etalon
data and the scattering spectra shown in FIG. 10C, as described in
Example 3.
[0112] FIG. 12 shows the spectrum shift obtained after DTT
treatment on the same microparticle shown in FIG. 10C, as described
in Example 3.
[0113] FIG. 13 shows the autocorrelation functions for the etalon
data and the scattering spectra shown in FIG. 12, as described in
Example 3.
[0114] FIG. 14A shows examples of two scattered light spectra taken
before and after binding of an analyte. The wavelength scales have
not yet been accurately aligned.
[0115] FIG. 14B shows the interference patterns from two stacked
etalons obtained during the spectral scans of FIG. 14A.
[0116] FIG. 14C shows the correlation analysis of the scattered
light spectra (intensity) and of the etalon patterns (ETALON).
[0117] FIG. 14D shows the wavelength-corrected scattered light
spectra before and after binding of an analyte with etalon
alignment, as described in Example 3.
[0118] FIG. 15 shows the scattering spectra of a single
microparticle for the sequential binding steps of the sandwich
assay and the subsequent cleavage with DTT, as described in Example
4.
[0119] FIG. 16 shows the change in resonance wavelength with time
upon IgG binding to Protein G' microparticles, as described in
Example 6.
[0120] FIG. 17 shows the image of a group of microparticles under
Argon ion laser illumination to show the fluorescent microparticles
(A) and under diode laser illumination to show the plain view of
the same area (B), as described in Example 8.
[0121] FIGS. 18 and 19 show the predicted resonant light scattering
spectra of the microparticles described in Example 14.
[0122] FIGS. 20 and 21 show the predicted resonant light scattering
spectra of the microparticles described in Example 15.
[0123] FIGS. 22 and 23 show the predicted resonant light scattering
spectra of the microparticles described in Example 16 FIG. 24 shows
the predicted resonant light scattering spectra of the
microparticles described in Example 17.
[0124] FIGS. 25-27 show the predicted resonant light scattering
spectra of the microparticles described in Example 18.
[0125] FIGS. 28 and 29 show the predicted resonant light scattering
spectra of the microparticles described in Example 19.
[0126] FIGS. 30 and 31 show the predicted resonant light scattering
spectra of the microparticles described in Example 20.
[0127] FIGS. 32 and 33 show the predicted resonant light scattering
spectra of the microparticles described in Example 21.
[0128] FIGS. 34-37 show the predicted resonant light-scattering
spectra of the microparticles described in Example 22.
[0129] The following sequences conform with 37 C.F.R. 1.821-1.825
("Requirements for Patent Applications Containing Nucleotide
Sequences and/or Amino Acid Sequence Disclosures--the Sequence
Rules") and consistent with World Intellectual Property
Organization (WIPO) Standard ST.25 (1998) and the sequence listing
requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and
Section 208 and Annex C of the Administrative Instructions). The
symbols and format used for nucleotide and amino acid sequence data
comply with the rules set forth in 37 C.F.R. .sctn.1.822.
[0130] SEQ ID NO:1 is the nucleotide sequence of the synthetic foot
and mouth disease target described in Example 9.
[0131] SEQ ID NO:2 is the nucleotide sequence of the JBP
oligonucleotide probe described in Example 9.
[0132] SEQ ID NO:3 is the nucleotide sequence of the modified JBP
S2SP3B oligonucleotide probe described in Example 9.
[0133] SEQ ID NO:4 is the nucleotide sequence of the N-JBC
oligonucleotide probe described in Example 9.
[0134] SEQ ID NO:5 is the nucleotide sequence of the
fluorescein-labeled oligonucleotide target JBC-F described in
Example 9.
[0135] SEQ ID NO:6 is the nucleotide sequence of the
fluorescein-labeled oligonucleotide target control Lac2-F described
in Example 9.
[0136] SEQ ID NO:7 is the nucleotide sequence of the
fluorescein-labeled oligonucleotide target JBP-F described in
Examples 9 and 11.
[0137] SEQ ID NO:8 is the nucleotide sequence of the foot and mouth
disease PCR fragment JB described in Example 10.
[0138] SEQ ID NO:9 is the nucleotide sequence of the Lac2-511 PCR
nonspecific target fragment described in Example 10.
[0139] SEQ ID NOs:10-13 are the nucleotide sequences of
oligonucleotide primers used to amplify the PCR target fragments as
described in Example 10.
[0140] SEQ ID NO:14 is the nucleotide sequence of the peptide
nucleic acid probe JBP2C described in Example 11.
[0141] SEQ ID NO:15 is the nucleotide sequence of the modified
peptide nucleic acid probe JBP2BC described in Example 11.
[0142] SEQ ID NO:16 is the nucleotide sequence of the compliment of
the JB PCR product described in Example 12.
[0143] SEQ ID NO:17 is the nucleotide sequence of the
fluorescein-labeled oligonucleotide probe JBP-S2SP3F described in
Example 13.
DETAILED DESCRIPTION OF THE INVENTION
[0144] The invention provides reliable, easily manufacturable, and
cost-effective methods of specific analyte detection and particle
identification, which is capable of parallel analysis with high
multiplicity, and is superior in performance to current methods. In
the present invention, the microparticles are identified by a novel
application of high-resolution light scattering, employing specific
features in the scattering spectrum as unique identifying patterns
or optical signatures. Specifically, the present invention employs
resonant light scattering as the analytical method for both
determining a particle's identity and also for determining the
presence of and optionally the degree of binding to the surface of
the particle. According to the present invention, when an analyte
binds to a specific microparticle, the optical properties of the
microparticle are changed in a way that enables the determination
of the degree of binding while retaining the ability to identify
the microparticle and thus the analyte of interest.
[0145] The present invention advances the art by providing a system
that is unique in: (1) the structure, physical properties, and
functionality of the particles; (2) the ability to measure binding
without need of external reporter moieties; (3) the means of
identifying the particles; (4) the ability to determine
quantitatively the binding of a target analyte in real time; and
(5) the ability to optionally amplify the signal.
[0146] The following definitions are used herein and should be
referred to for interpretation of the claims and the
specification.
[0147] As used in this disclosure, the singular forms "a", "an",
and "the" may refer to plural articles unless specifically stated
otherwise. Thus, for example, references to a method of
manufacturing, derivatizing, or treating "a particle" may include a
mixture of one or more particles. Furthermore, the use of
grammatical equivalents of articles such as "beads", "particles",
"microparticles" and "microspheres" are not meant to imply
differences among these terms unless specifically indicated in the
context.
[0148] The terms "particle", "microparticle", "bead",
"microsphere", and grammatical equivalents refer to small discrete
particles, preferably, substantially spherical in shape, having a
diameter less than about 100 micrometers, preferably less than
about 75 micrometers, more preferably less than about 50
micrometers.
[0149] The term "identifiable microparticle" refers to a
microparticle that may be identified and optionally tracked.
[0150] The terms "spectral features", "optical resonance
structures", "identification features", "scattering resonances",
and "resonant light scattering signatures" are used interchangeably
herein to refer to features in the resonant light scattering
spectrum that may be used for particle identification, including,
but not limited to peak location, peak width, peak order, periods
between peaks of different orders, and polarization-dependent
spectral properties.
[0151] The terms "protein", "peptide", "polypeptide" and
"oligopeptide" are herein used interchangeably to refer to two or
more covalently linked, naturally occurring or synthetically
manufactured amino acids.
[0152] The term "analyte" refers to a substance to be detected or
assayed by the method of the present invention. Typical analytes
may include, but are not limited to proteins, peptides, nucleic
acids, peptide nucleic acids, antibodies, receptors, molecules,
biological cells, microorganisms, cellular organelles, cell
membrane fragments, bacteriophage, bacteriophage fragments, whole
viruses, viral fragments, and one member of a binding pair.
[0153] The terms "target" and "target analyte" will refer to the
analyte targeted by the assay. Sources of targets will typically be
isolated from organisms and pathogens such as viruses and bacteria
or from an individual or individuals, including but not limited to,
for example, skin, plasma, serum, spinal fluid, lymph fluid,
synovial fluid, urine, tears, blood cells, organs, tumors, and also
to samples of in vitro cell culture constituents (including but not
limited to conditioned medium resulting from the growth of cells in
cell culture medium, recombinant cells and cell components).
Additionally, targets may be from synthetic sources.
[0154] The term "binding-pair" includes any of the class of
immune-type binding-pairs, such as, antigen/antibody,
antigen/antibody fragment, or hapten/anti-hapten systems; and also
any of the class of nonimmune-type binding-pairs, such as
biotin/avidin, biotin/streptavidin, folic acid/folate binding
protein, hormone/hormone receptor, lectin/specific carbohydrate,
enzyme/enzyme enzyme/substrate, enzyme/inhibitor, or, vitamin
B12/intrinsic factor. They also include complementary nucleic acid
fragments (including DNA sequences, RNA sequences, and peptide
nucleic acid sequences), as well as Protein A/antibody or Protein
G/antibody, and polynucleotide/polynucleotide binding protein.
Binding pairs may also include members that form covalent bonds,
such as, sulfhydryl reactive groups including maleimides and
haloacetyl derivatives, and amine reactive groups such as
isothiocyanates, succinimidyl esters, carbodiimides, and sulfonyl
halides.
[0155] The terms "capture probe", "probe", "binding agent",
"bioactive agent", "binding ligand", or grammatical equivalents,
refer to any chemical or biological structure or moiety, for
example protein, polypeptide, polynucleotide, antibody or antibody
fragment, biological cells, microorganisms, cellular organelles,
cell membrane fragments, bacteriophage, bacteriophage fragments,
whole viruses, viral fragments, organic ligand, organometallic
ligand, and the like that may be used to bind either
non-specifically to multiple analytes, or preferentially, to a
specific analyte or group of analytes in a sample.
[0156] The term "probe-coupled microparticle" refers to a
microparticle which has a capture probe attached to the
surface.
[0157] The term "ligand" or "reactive ligand" refers to a chemical
moiety or "label" that can act as one member of a binding pair,
including but not limited to antibodies, lectins, receptors,
binding proteins, nucleic acids, or chemical agents.
[0158] The term "label" refers to any atom or molecule that can be
attached to a nucleic acid, protein or a member of a binding-pair.
A label may be coupled to binding-pair or nucleic acid through a
chemically reactive group. A label may be attached to an
oligonucleotide during chemical synthesis or incorporated on a
labeled nucleotide during nucleic acid replication. Labels will
include but are not limited to fluorescent moieties,
chemiluminescent moieties, particles, enzymes, radioactive tags,
quantum dots, light emitting moieties, light absorbing moieties,
and intercalating dyes including propidium iodide (PI) and ethidium
bromide (EB) and the cyanine dyes (see for example, U.S. Pat. No.
5,563,037).
[0159] The term "reporter" refers to any atom or molecule that is
used as a "label" to provide a detectable (preferably quantifiable)
signal, and which can be attached to a nucleic acid, protein or a
member of a binding-pair. Reporters may provide signals detectable
by fluorescence, chemiluminescence, radioactivity, colorimetry,
X-ray diffraction or absorption, magnetism, enzymatic activity, and
the like.
[0160] The term "reporter conjugate" refers to a conjugate
comprising a "reporter-label" coupled to one member of a
binding-pair such as an antibody, lectin, receptor or binding
protein or other moiety which can bind to an analyte.
[0161] The term "oligonucleotide", refers to
polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to
polyribonucleotides (containing D-ribose) and to any
polynucleotide, which is a ribo sugar-phosphate backbone consisting
of an N-glycoside of a purine or pyrimidine base, or modified
purine or pyrimidine base. There is no intended distinction between
the length of a "nucleic acid", "polynucleotide" or an
"oligonucleotide".
[0162] The term "peptide nucleic acid" or "PNA" refers to an
analogue of DNA that has a pseudo-peptide backbone, rather than the
sugar-phosphate backbone of nucleic acids (DNA and RNA). PNA mimics
the behavior of DNA and binds complementary nucleic acid
strands.
[0163] The term "oligomer" refers to any probe or target made up of
two or more monomers and is used herein to describe the structure
of a nucleic acid, peptide, peptide nucleic acid, or any polymer
used in the context of the present invention. The preferred use of
the term is in reference to the structure of peptide nucleic acids
(PNA), similar to "oligonucleotide," which contains a sequence of
"nucleobase" moieties on the pseudopeptide backbone that mimics the
ribo sugar-phosphate backbone of nucleic acids.
[0164] The term "nucleobase" refers to the purine or pyrimidine
moiety of DNA, RNA or PNA.
[0165] The term "primer" is used generally to mean any
sequence-binding oligonucleotide which functions to initiate the
nucleic acid "replication" process or "amplification" process.
[0166] The term "replication" refers to the process in which a
complementary strand of a nucleic acid strand of the nucleic acid
molecule is synthesized by a polymerase enzyme. In a
"primer-directed" replication, this process requires a hydroxyl
group (OH) at 3' position of (deoxy)ribose moiety of the terminal
nucleotide of a duplexed "primer" to initiate replication.
[0167] The term "amplification" refers to the process in which
"replication" is repeated in cyclic process such that the number of
copies of the nucleic acid sequence is increased in either a linear
or logarithmic fashion. Such replication processes may include but
are not limited to, for example, Polymerase Chain Reaction (PCR),
Ligase Chain Reaction (LCR) Strand Displacement Amplification (SDA)
or other such enzymatic reactions.
[0168] The term "primer directed nucleic acid amplification" or
"primer-directed amplification" refers to any method known in the
art wherein primers are used to sponsor replication of nucleic acid
sequences in the linear or logarithmic amplification of nucleic
acid molecules. Applicants contemplate that primer-directed
amplification may be accomplished by any of several schemes known
in this art, including but not limited to the polymerase chain
reaction (PCR), ligase chain reaction (LCR) or strand-displacement
amplification (SDA).
[0169] The term "complementary strand" refers to a nucleic acid
sequence strand or a peptide nucleic acid sequence strand which
when aligned with the nucleic acid sequence of one strand of the
target nucleic acid, such that the 5' end of the sequence is paired
with the 3' end of the other sequence in antiparallel association,
a stable duplex is formed. Complementarity need not be perfect.
Stable duplexes may be formed with mismatched nucleotides.
[0170] A "fragment" constitutes a fraction of the DNA or RNA
sequence of a particular region. A "nucleic acid fragment of
interest" refers to a fragment that is incorporated within or is
part of a target nucleic acid sequence and is useful as a
diagnostic element.
[0171] The term "specific binding" or "specific-analyte binding"
refers to affinity of a binding-pair reagent(s) for an analyte,
which is a member of the binding pair.
[0172] The term "non-specific binding" refers to the non-specific
affinity of the probe-microparticles for sample matrix components.
In the context of the present invention, "non-specific binding" can
be determined as a resonance shift that results from the
non-specific affinity of the probe-microparticles for the sample
matrix components when the target analyte is not present.
[0173] The term "sample matrix components" refers to any components
of the sample matrix other than the target analyte. Sample matrix
components include, but are not limited to proteins, lipids, salts,
nucleic acids, and carbohydrates, and are typically natural
components of biological samples which contain analytes.
[0174] The term "stringency" refers to the strict control of the
parameters that affect the stability or the formation of a nucleic
acid duplex. This can be temperature (Tm), cation concentrations
([Na.sup.+], [K.sup.+], [Mg.sup.2+], [Mn.sup.2+]), the composition
and number of nucleotides in the duplex or the concentration of a
duplex destabilizing agents, e.g., formamide.
[0175] The term "identification of an analyte" refers to the
process of determining the identity of an analyte based on its
binding to a capture probe whose identity is known.
[0176] The term "analytical wavelength range" refers to a
wavelength window over which the microparticles of the present
invention are scanned to produce resonant light scattering
signatures. The window typically has a span of about 1 to about 20
nanometers over the optical wavelengths from about 275 to about
1900 nanometers, preferably from about 600 to about 1650
nanometers. More preferably, the analytical wavelength range is a
window of 10 nanometers from about 770 to about 780 nanometers. It
is contemplated that a number of scans of the particles of the
invention may be made during the process of identifying an analyte
or analyte binding, however each of these scans will be over an
"analytical wavelength range" although that range may differ from
scan to scan depending on the specific object of the assay.
[0177] The term "light scanning source" refers to a source of light
whose wavelength may be varied over the analytical wavelength
range. Light scanning sources include sources that produce light
that may be varied over the analytical wavelength range, such as
scanning diode lasers and tunable dye lasers, and polychromatic
sources which produce light having a range of wavelengths, such as
light-emitting diodes, lamps and the like, used in conjunction with
a wavelength-selecting means.
[0178] The term "reference resonant light scattering signature"
refers to the resonant light scattering signature that is produced
by scanning the particles of the present invention over the
analytical wavelength range after the capture probe has been
applied to the particles or in the case of detection of analyte
dissociation from the capture probe, after the analyte has bound to
the capture probe. The reference resonant light scattering
signature may be used to identify the particles and the probes
attached thereto and may serve as a baseline for the detection of
analyte binding. A number of reference resonant signatures may be
obtained by scanning the particles at different times.
[0179] The term "binding resonant light scattering signature"
refers to the resonant light scattering signature that is produced
by scanning the particles of the present invention over the
analytical wavelength range after the particles are contacted with
the analyte. A series of binding resonant light scattering
signatures may be obtained to follow the binding in real time. The
determination of binding is done by comparing either any one of the
binding resonant light scattering signatures to any one of the
reference resonant light scattering signatures or anyone of the
plurality of binding resonant light scattering signatures with a
previous binding resonant light scattering signature in the
series.
[0180] The term "identifying resonant light scattering signature"
refers to the resonant light scattering signature that is produced
by scanning the particles of the present invention over the
analytical wavelength range before the capture probe is applied to
the particles. The identifying resonant light scattering signature
serves to identify the particles so that a known capture probe may
be attached and its identity correlated with the identified
particle.
[0181] The term "dissociation resonant light scattering signature"
refers to the resonant light scattering signature that is produced
by scanning the particles of the present invention over the
analytical wavelength range after the analyte is dissociated from
the capture probe. A series of dissociation resonant light
scattering signatures may be obtained to follow the dissociation in
real time. The determination of dissociation is done by comparing
either any one of the dissociation resonant light scattering
signatures to any one of the reference resonant light scattering
signatures or anyone of the dissociation resonant light scattering
signatures with a previous second dissociation resonant light
scattering signature in the series.
[0182] The term "optically active" as applied to layers on a
particle means that the layers support the production of additional
or altered light scattering resonances which are associated with
the particle
[0183] The term "biologically active" as applied to layers on a
particle means that the layers has the ability to participate in
interactions among biological moieties.
[0184] The term "chemically active" as applied to layers on a
particle means that the layers has the ability to participate in
interactions among chemical moieties, including but not limited to
binding interactions between chemical moieties. It is contemplated
that such layers will have specific linker chemistry for attaching
capture probes, and or may be derivatized for direct synthesis of
capture probes on surface of the particles.
[0185] The present invention provides microparticle-based
analytical methods, systems, and applications. A primary object of
this invention is to provide improved methods for detecting the
presence, and optionally the concentration, of one or more
particular target analytes (for example specific nucleotide
sequences or particular proteins such as antibodies or antigens),
and performing the measurements without employing external reporter
groups or labels. Specifically, we describe improvements in the art
relating to detection of binding, particle identification, assay
multiplicity, particle preparation, and end uses of the
invention.
[0186] A fundamental element of the present invention is the
preparation and use of microparticles having specific physical and
chemical properties optimized for the measurements required in
biological or chemical assays. For example, chemical
functionalities that serve as specific capture probes for analytes
of interest may be applied to the outer surfaces of members of a
group of microparticles. By "capture probe", "binding agent",
"bioactive agent", "binding ligand", or grammatical equivalents, is
meant any chemical structure or moiety, for example protein,
polypeptide, polynucleotide, antibody or antibody fragment, organic
ligand, organometallic ligand, etc. that may be used to bind either
non-specifically to multiple analytes, or preferentially, to a
specific analyte or group of analytes in a sample. In a typical
application of the present invention, analytes of interest are
exposed to an appropriately constructed set of microparticles, one
or more of which having complementary capture probes exposed on
their surface. Binding of the analyte occurs and is detected by a
novel and sensitive technique described more fully later in this
disclosure.
[0187] A key advance in the art provided by the present invention
is a method for both measuring target binding and determining
particle identity by novel applications of resonant light
scattering. This unified measurement approach, in which resonant
light scattering is used for both particle identity and binding
measurement, is unique to the present invention. However, practical
applications of the invention are not limited to the combination of
determining identification and binding by resonant light
scattering. The invention enables diverse applications, for
example: using particle identification by resonant light scattering
only; particle identification by resonant light scattering with
binding detection by other means; and particle identification by
other means with binding detection by resonant light
scattering.
[0188] In one embodiment of the present invention where these novel
elements are combined, each particle is assigned an identification
code or label based on its unique resonant light scattering
spectrum. During preparation of the microparticles, a correlation
is made between the identity of each microparticle and the specific
capture probe coupled to the microparticle. This correlation
enables identifying the presence of one or more analytes in a mixed
sample. Binding of a specific target moiety to its complementary
probe is measured by changes in the resonant light scattering
spectrum of the pre-identified particle or particles known to carry
the complementary probe on its surface.
[0189] In another embodiment of the present invention, the
detection of binding and determination of particle identity may be
done independently. For example, microparticles may be derivatized
with known capture probes and placed in specific fixed locations
that do not change during the experiment. The identity of a given
particle, and thus the probe that is exposed on its surface, is
thus determined by its location. Binding measurements may be
carried out by resonant light scattering techniques as described
more fully later in this disclosure.
[0190] In still another embodiment, microparticles may be
derivatized by combinatorial methods in which the particle identity
is neither determined nor tracked. Resonant light scattering can
then be used to find assay "hits" in a screening method, and the
identity of the probe can be determined independently, for example
by mass spectroscopy, fluorescence, optical absorbance,
radioactivity, surface plasmon resonance, or other methods known in
the art that use detectable labels, such as fluorescent moieties,
chemiluminescent moieties, particles, enzymes, radioactive tags,
quantum dots, light emitting moieties, light absorbing moieties,
intercalating dyes, and members of binding pairs. A variation of
this method would include tracking the particle identities
throughout the combinatorial process, by either resonant light
scattering as described more fully below, or by other methods known
in the art.
[0191] In yet another embodiment of the present invention,
microparticles may be identified and/or tracked by resonant light
scattering methods, and binding measurements made using detectable
labels, such as fluorescent moieties, chemiluminescent moieties,
particles, enzymes, radioactive tags, quantum dots, light emitting
moieties, light absorbing moieties, intercalating dyes, and members
of binding pairs.
[0192] Particle Structure, Properties, and Manufacture
[0193] By "particle", "microparticle", "bead", "microsphere", and
grammatical equivalents herein is meant small discrete particles.
Preferably, the particles are substantially spherical in shape. The
term "substantially spherical", as used herein, means that the
shape of the particles does not deviate from a perfect sphere by
more than about 10%. Typically, measurement of the resonant light
scattering pattern is carried out by scanning the particles, i.e.,
irradiating the particles with light of varying wavelength, over an
analytical wavelength range within an optical wavelength range,
resulting in an identifying resonant light scattering signature
which is used to identify the particles. Various known probes may
then be applied to the particles, as described in the Capture
probes and particle libraries section infra, and the identity of
the probes may be correlated with the identifying resonant light
scattering signature of the particles. In principle, any optical
wavelength range is applicable for the measurements of this
invention. Preferably, the optical wavelength range is from about
275 to about 1900 nanometers, more preferably from about 600 to
about 1650 nanometers. Preferably, the analytical wavelength range
has a span of about 1 nanometers to about 20 nanometers, more
preferably about 10 nanometers in width. More preferably the
analytical wavelength range has a span of 10 nanometers from about
770 to about 780 nanometers.
[0194] In one preferred embodiment, the particles are substantially
non-fluorescing over the analytical wavelength range. The term
"substantially non-fluorescing", as used herein, means that the
average fluorescence signal of the particle is less than about 10%
of the average elastically scattered light signal, i.e., scattered
light of the same wavelength as the incident light, over the
analytical wavelength range.
[0195] The particles typically consist of a substantially spherical
core and optionally one or more layers. The core may vary in size
and composition depending on the application, as will be described
in more detail below. In addition to the core, the particle may
have one or more layers to provide functionalities appropriate for
the applications of interest. The thicknesses and refractive
indices of layers, if present, may vary depending on the needs of
the specific application and on the wavelengths of light used to
make the required measurements. For example, layers may impart
useful optical properties, such as giving rise to additional
scattered light resonance features or changing the relative
wavelength locations of features. These layers used for optical
properties, herein referred to as "optically active" layers, may
typically range in thickness from about 0.05 micrometers (50
nanometers) to about 20 micrometers or more, depending on the
desired overall particle diameter.
[0196] Layers may also impart chemical or biological
functionalities, referred to herein as chemically active or
biologically active layers, and for these functionalities the layer
or layers may typically range in thickness from about 0.001
micrometers (1 nanometer) to about 10 micrometers or more
(depending on the desired particle diameter), these layers
typically being applied on the outer surface of the particle. These
layers may also include a biologically active porous structure. In
the Examples of this disclosure, the particle size is appropriate
for typical bioanalytical assays, using wavelengths of light in the
visible to near infrared range, but the conditions of these
examples are not meant to limit the invention. Using an incident
wavelength of about 775 nanometers, the diameter of the particle is
preferably about 100 micrometers or less.
[0197] The compositions and therefore the indices of refraction of
the core and layers may vary. In a preferred embodiment, the
compositions are such that the region of the particle outside of
the so-called "caustic surface" (see for example Roll, G. and
Schweiger, G., "Geometrical optics model of Mie resonances, J. Opt.
Soc. Am. A 17, 1301-1311 (2000)) is substantially transparent to
light at the wavelengths of interest. As used herein,
"substantially transparent" means that the absorption of light
within the regions of the particle in which structural resonances
are produced is sufficiently small so that when the particle is
illuminated with light in the analytical wavelength range, the
resonances-remain observable. Theoretical calculations predict that
the absorption of light within the particle is sufficiently small
to enable observation of resonances when the imaginary component of
the refractive index of the particle or the optically active
layers, given as "k", is about 0.1 or less over the analytical
wavelength range. A k value of 0.1 or less over the analytical
wavelength range of 770 to 780 nanometers corresponds to an
absorption coefficient of about 1.6 .mu.m.sup.-1 or less.
[0198] In a more preferred embodiment, in addition to transparency
at the wavelengths of interest, the index or indices of refraction
of the particle are such that resonant light scattering (discussed
more fully below) is manifested at the wavelengths of interest when
the particle is in a substantially aqueous medium. Preferably, the
particle is rugged enough to withstand the conditions required for
its intended application, such as attaching binding moieties or for
undergoing bioassay reactions without significant chemical or
physical degradation. It is also preferable, for optical reasons,
for the core to be substantially rigid, thus maintaining shape
during particle handling and assay conditions.
[0199] Suitable materials for the core include substantially
transparent (at the wavelengths of interest) plastics and other
polymers, ceramics, glasses, minerals, and the like. Examples
include, but are not limited to, standard and specialty glasses,
silica, polystyrene, polyester, polycarbonate, acrylic polymers,
polyacrylamide, polyacrylonitrile, polyamide, fluoropolymers,
silicone, celluloses, semiconducting materials such as silicon,
optically absorbing materials, metals such as gold and silver,
minerals such as ruby, nanoparticles such as gold nanoparticles and
quantum dots, colloidal particles, metal oxides, metal sulfides,
metal selenides, and magnetic materials such as iron oxide, and
composites thereof, and others, subject to the preferred physical
and optical properties previously disclosed. The core could be of
homogeneous composition, or a composite of two or more classes of
material depending on the physical and optical properties
desired.
[0200] The core may serve a number of functions that provide
utility to the invention. For example, the core may be composed of
a light-absorbing material, which can serve to absorb specific
light rays that do not contribute to resonant light scattering, and
would otherwise be refracted out of the microparticle, thus
contributing to stray light and undesired background signals.
Another example of utility provided by the core is the use of
magnetic materials, which would impart magnetic properties to the
particles such that they may be collected, screened, moved, or
otherwise manipulated by external magnetic forces. A potentially
useful embodiment would be to use particles with hollow cores, for
example when it is desired to have particles suspended or easily
moved in aqueous media, but when the layer materials are
substantially denser than water. In this instance, a hollow core
could impart a decreased density to the overall particle.
[0201] In a preferred embodiment, the microparticle is composed of
a core comprising a uniform glass microsphere. In a more preferred
embodiment, the microparticle is composed of an optical quality
glass microsphere with index of refraction between about 1.45 and
2.1, more preferably between about 1.6 and 2.1 at the wavelengths
of interest previously disclosed. Suitable particles are
commercially available, for example from Mo-Sci Inc. (Rolla,
Mo.).
[0202] As disclosed more fully below and in the Examples,
variations in the index of refraction of the core may impart
desirable optical or physical properties. Accordingly, in another
preferred embodiment, the core may have indices of refraction or
other properties that vary with location, for example with radial
distance from the center.
[0203] As previously stated in this disclosure, the microparticle
may, in addition to the core, include one or more layers. The
purposes for including layers in the microparticle may vary. A
layer may provide suitable surfaces for attaching chemical
functionalities including bioactive agents or chemical binding
sites, for reducing nonspecific binding, and for protecting the
physical and chemical integrity of the core. Details regarding the
preparation of outer bioactive or chemically active layers are
given in the section "Capture probes and particle libraries", of
this disclosure. As will be disclosed more fully below, layers may
also provide additional optical interfaces to increase the
multiplicity of identification patterns for a population of
particles.
[0204] The dimensions, compositions, and indices of refraction of
the layers, if present, may vary according to the functions desired
as described in the previous paragraph. In a preferred embodiment,
the compositions and indices of refraction of the layers are such
that all the layers are substantially transparent to light at the
wavelengths of interest. The thicknesses of the layers, if present,
are preferably between about 1 nanometer and 20 micrometers.
[0205] Accordingly, in another preferred embodiment, the
microparticle consists of a core plus one or more layers, the
combined function of the layers being to provide a suitable surface
for the attachment of chemical functionalities including, for
example, bioactive agents as described in the section "Capture
probes and particle libraries" of this disclosure.
[0206] In another preferred embodiment, at least one layer is
configured such that additional optical resonance structures are
manifested, or the relative positions of the optical resonance
structures are changed, when the particle is scanned over the
analytical wavelength range, as will be described in more detail
below.
[0207] In another preferred embodiment, the microparticle consists
of a core plus a layer whose function is to provide additional or
changed identification features, plus one or more additional
layers, the combined function of the additional layers being to
provide a suitable surface for the attachment of chemical
functionalities including, for example, bioactive agents as
described in the section "Capture probes and particle libraries" of
this disclosure.
[0208] In still another preferred embodiment, the microparticle
consists of a core plus a layer comprising a zone of varying
refractive index at or near the surface of the core, said layer
providing additional identification or changed features; plus one
or more additional outer layers, the combined function of the
additional layers being to provide a suitable surface for the
attachment of chemical functionalities including, for example,
bioactive agents as described in the section "Capture probes and
particle libraries" of this disclosure.
[0209] Suitable materials for the layers, if present, include all
the classes listed for the core, subject to constraints imposed by
the desired function or functions of the layers, for example
transparency at the wavelengths of interest and polyelectrolytes
such as sodium poly(styrene sulfonate) and
poly(diallyldimethylammonium chloride). Furthermore, the layers may
be uniform in composition or they may vary in composition.
[0210] Layers can be produced on the microparticles in a variety of
ways known to those skilled in the art. Examples include sol-gel
chemistry techniques such as described in Iler, R. K., "Chemistry
of Silica", John Wiley & Sons (1979); Brinker, C. J., and
Scherer, G. W., "Sol-gel Science", Academic Press (1990).
Additional approaches to producing layers on particles include
surface chemistry and encapsulation techniques such as described in
Partch, R. and Brown, S., "Aerosol and solution modification of
particle-polymer interfaces", J. Adhesion 67, 259-276 (1998);
Pekarek, K. et al., "Double-walled polymer microspheres for
controlled drug release", Nature 367, 258 (1994); Hanprasopwattana,
A., "Titania coatings on monodisperse silica spheres", Langmuir 12,
3173-3179 (1996); Davies, R., "Engineered particle surfaces",
Advanced Materials 10, 1264-1270 (1998); and references therein.
Vapor deposition techniques may also be used; see for example
Golman, B. and Shinohara, K., "Fine particle coating by chemical
vapor deposition for functional materials", Trends in Chem.
Engineering 6, 1-6 (2000); and Coulter, K. E. et al., "Bright metal
flake based pigments", U.S. Pat. No. 6,387,498 (2002). Still other
approaches include layer-by-layer self-assembly techniques such as
described in Sukhorukov, G. B. et al., "Stepwise polyelectrolyte
assembly on particle surfaces: a novel approach to colloid design",
Polymers for Advanced Technologies 9(10-11), 759-767 (1998);
Caruso, F. et al., "Electrostatic self-assembly of silica
nanoparticle-polyelectrolyte multilayers on polystyrene latex
particles, Journal of the American Chemical Society 120(33),
8523-8524 (1998); Caruso, F. et al., "Investigation of
electrostatic interactions in polyelectrolyte multilayer films:
binding of anionic fluorescent probes to layers assembled onto
colloids, Macromolecules 32(7), 2317-2328 (1999); Caruso, F.,
"Protein multilayer formation on colloids through a stepwise
self-assembly technique, Journal of the American Chemical Society
121(25), 6039-6046 (1999); Margel, S., and Bamnolker, H., U.S. Pat.
No. 6,103,379 and references cited therein.
[0211] Utility of the present invention is enhanced by using a
multiplicity of microparticles. In one embodiment, the
microparticles could be distributed in a two-dimensional format,
for example organized in a series of tubes, grooves, channels, or
other structures in a substrate, or they may be self-assembled on a
surface with no specific structure. In such formats, if the
particles maintain their relative positions throughout an assay,
identifying the individual particles according to a pattern or
label may be optional since the identities are established by
position. More generally, however, the particles may be used in
applications where their relative positions will vary. In this
case, the particle identities may be established by resonant light
scattering methods as explained more fully below, or by other
techniques known in the art, such as fluorescence, optical
absorbance, radioactivity and surface plasmon resonance.
[0212] It is an object of this invention to provide means for
easily and cost-effectively producing a population of identifiable
microparticles, suitable for use in biological and chemical assays.
In any production process for the particles, there will be natural
variations among the particles in the dimensions and optical
properties of the core and of the layers. It is thus an object of
this invention to use these natural variations, and optionally,
induced variations, to provide a novel basis for particle
identification. In order for the microparticles to provide utility,
the variations must be controlled, or the particles appropriately
screened according to their physical and optical properties. Thus,
in a preferred embodiment, variations in the dimensions and optical
properties of the core and/or of the layers, if present, lie within
the previously disclosed preferences for a single particle. This
could be accomplished in several ways, for example by adequately
controlling the processes of particle production or by including a
quality control screen that selects only those particles suited for
use as disclosed in this invention.
[0213] Capture Probes and Particle Libraries
[0214] Capture probes may comprise various chemical classifications
depending on the specific measurement of interest. Typically, they
are organic or biological molecules, or molecular fragments
thereof, that provide functional groups necessary for interaction
with target molecules in a sample. As known in the art, the probes
may have varying degrees of specificity, ranging for example from a
perfect base-pair complement between a DNA probe and its target, to
less stringent matching of base pairs. Similarly, probes for
protein or peptide targets, for example antibodies or synthetic
peptides, may be very specific, or less so depending on the
structure of the probe and the assay conditions. In the discussion
that follows, when "probe" or "capture probe" is used, it may refer
to a chemical or physical entity with high specificity, or one or
more entities with varying degrees of specificity. The
probe-coupled microparticles of the present invention may be
prepared by applying the capture probe of interest to the surface
of the microparticles. The probe may be applied to the particles by
either directly synthesizing the probe on the surface or by
attaching a probe that is naturally occurring or has been
synthesized, produced, or isolated separately to the surface using
methods know in the art, as will be described in more detail
below.
[0215] As discussed above, the utility of the invention is enhanced
by using a set of microparticles, each of which has one or more
unique capture probes exposed on its surface. Such a set may be
generally referred to as a "library" of microparticles or probes.
As known in the art, in particle-based biological assays it is
generally necessary to associate a specific capture probe with a
specific particle. This is typically accomplished in current
practice by attaching or incorporating labels (fluorophores,
chromophores, nanoparticles, etched "bar codes", etc.) to each
particle. These conventional approaches may be combined with
binding detection by resonant light scattering according to the
present invention. However, the present invention provides for a
novel and effective alternative particle identification approach
that departs substantially from methods described in the literature
by also using resonant light scattering to identify each
particle.
[0216] One class of capture probes comprises proteins. By "protein"
is meant two or more covalently linked amino acids; thus the terms
"peptide", "polypeptide", "oligopeptide", and terms of similar
usage in art are all to be interpreted synonymously in this
disclosure. The amino acids may be either naturally occurring
and/or synthetically manufactured, in any relative order and
abundance. In this embodiment, hydrogen bonding, electrostatic
bonding, hydrophilic interactions, and similar non-covalent binding
mechanisms may be employed to provide increased binding affinity
for selected targets. To increase the specificity of the binding,
particular 3-dimensional structures would be preferred, as is well
known in the art.
[0217] In one preferred embodiment, the capture probes are proteins
or fragments thereof. Preparation of the outer bioactive layer of
the microparticles for use in the present invention may include
derivatizing the microparticle such that the appropriate probes may
be attached to the surface, for example using linker chemistries.
Methods of preparation of protein capture probe libraries and
attaching probes to a surface are well known in the art, see for
example Johnsson, K. and Ge, L., "Phage display of combinatorial
peptide and protein libraries and their applications in biology and
chemistry", Current Topics in Microbiology and Immunology 243,
87-105 (1999); Ruvo, M. and Fassina, G., "Synthesis and
characterization of peptide libraries", in Combinatorial Chemistry
Technology, Dekker, New York, pp. 7-21 (1999); Wagner, P. et al.,
"Arrays of protein-capture agents and methods of use thereof", U.S.
Pat. No. 6,365,418 (2002); Wagner, P. et al., "Protein arrays for
high-throughput screening", U.S. Pat. No. 6,406,921 (2002); McHugh,
T. M., "Flow Microsphere Immunoassay for the Quantitative and
Simultaneous Detection of Multiple Soluble Analytes", Methods in
Cell Biology 42, Academic Press, 1994; Colvin, et al., in
Microspheres: Medical and Biological Applications, 1-13, CRC Press;
Illum, L. et al., "Attachment of Monoclonal Antibodies to
Microspheres", Methods in Enzymology 112, Academic Press, 1985, and
the references cited therein. Libraries of protein capture probes
can be prepared, for example from plant or animal cellular
extracts. Particularly useful and thus preferred are libraries of
human proteins, for example human antibodies.
[0218] Protein capture probes can comprise naturally occurring
polypeptides, synthetic polypeptides, or a combination of these two
types. In one preferred embodiment, the capture probes are
synthesized such that the amino acid sequence is partially or fully
randomized using techniques known in the art, for example
combinatorial biology and directed evolution methods, for example
as shown in Brackmannn, S. and Johnsson, K., eds., Directed
Molecular Evolution of Proteins, John Wiley & Sons (2002);
Short, J. M. and Frey, J. F. "End selection in directed evolution",
U.S. Pat. No. 6,358,709 (2002); Stuart, W. D., "Methods and
compositions for combinatorial-based discovery of new multimeric
molecules", U.S. Pat. No. 5,683,899 (1997), and the references
cited therein.
[0219] In another preferred embodiment, the capture probes are
proteins comprising partially naturally occurring amino acid
sequences and partially randomized amino acid sequences.
[0220] In a another preferred embodiment, the preparation of
protein capture probes, including any randomization, is carried out
on the microparticle of the invention. This provides a particularly
efficient approach to creating an indexed library of probes.
[0221] The optimum size or diversity of a binding library for
proteins may vary depending on the particular application. The
library is most useful when for a given sample, a statistically
significant number of binding events occur so that the sample may
be uniquely characterized. For example, a diversity of 10.sup.7 to
10.sup.8 different antibodies is considered sufficient to provide
at least one combination with sufficient affinity to interact with
most known antigens (see e.g. Walt, D. R. and Michael, K. L.,
"Target analyte sensors utilizing microspheres", U.S. Pat. No.
6,327,410 (2001)). Protein and peptide libraries used for antibody
screening typically have 10.sup.6 to 10.sup.8 members or more
depending on the methods used for their production (see e.g.
Gavilondo, J. V. and Larrick, J. W., "Antibody Engineering at
Millennium", BioTechniques 29, 128-145 (2000); Hanes, J. and
Pluckthun, A., "In vitro selection methods for screening of peptide
and protein libraries", Curr. Topics Microbiol. Immunol. 243,
107-122 (1999)). Thus in one preferred embodiment, at least
10.sup.6, more preferably 10.sup.7, and most preferably 10.sup.8 or
more different capture probes are used to screen for the presence
of antigens. On the other hand, the diversity of a binding library
may be reduced if the object of the measurement is to determine the
presence of a smaller number of specific analytes. Assays for a
limited number of specific biomarkers present in disease states
such as HIV, hepatitis, cancer, and the like, are known in the art
(see for example Petricoin, E. F., et al., "Use of proteomic
patterns in serum to identify ovarian cancer", Lancet 359, 572-577
(2002)). Generally, screens for such states would therefore require
fewer probes than for other applications such as large-scale
genomic or proteomic mapping.
[0222] Another class of capture probes comprise nucleic acids or
nucleic acid mimics (such as peptide nucleic acids described
below), which may also be known as "DNA fragments", "RNA
fragments", "polynucleotides", "oligonucleotides", "gene probes",
"DNA probes" and similar terms used in the art, which are all to be
considered synonymous in the present disclosure. Nucleic acid
probes may contain nucleotide sequences from naturally occurring
gene fragments, cloned gene fragments, synthetically made
polynucleotides, or any combination thereof. The base sequences of
synthetically made polynucleotides may be designed for a specific
nucleic acid target using commercially available software, such as
Oligo.TM. 4.0 or 6.0 (National Biosciences Inc., Plymouth, Minn.),
Vector NTI (Informax.TM., Frederick, Md.) or other computer
programs that assist in designing oligonucleotide sequence and
structure. As is known in the art, the nucleotides may have the
naturally occurring sugar-phosphodiester backbone, or chemical
modifications thereof, these modifications allowing the use of
novel chemical moieties not seen in naturally occurring genes or
gene fragments.
[0223] Additionally, the capture probe may be a peptide nucleic
acid (PNA) probe. PNA is an analogue of DNA that has a
pseudo-peptide backbone, rather than the sugar-phosphate backbone
of nucleic acids (DNA and RNA). PNA mimics the behavior of DNA and
binds complementary nucleic acid strands. PNA oligomer probes may
be based on the aminoethylglycin backbone with acetyl linkers to
the nucleobases. They are produced with either Boc or Fmoc
chemistry or solid phase synthesis using Boc/Cbz monomers (Dueholm,
K. L. et al., J. Org. Chem. 59, 5767-5773 (1994); Christensen, L.
et al. J. Peptide Sci. 3, 175-183 (1995); Thomson, S. A.
Tetrahedron Lett. 22, 6179-6194 (1995); Ganesh, K. N. Curr. Org.
Chem. 4, 931-943 (2000)). PNA probes may be purchased from Applied
Biosystems (Foster City, Calif.). PNA oligomers may also be
designed with terminal modifiers that give functionality to the
nucleic acid probe. The modifiers may also be internal to the
analyte specific variable capture sequence of the PNA.
[0224] Methods for the preparation of nucleic acid probes or
pseudo-nucleic acid probes, such as PNA, on particle surfaces are
known. Typical references include for example Fulton, R. J.,
"Methods and compositions for flow cytometric determination of DNA
sequences", U.S. Pat. No. 6,057,107 (2000); Chandler, M. B., et
al., "Microparticles attached to nanoparticles labeled with
fluorescent dye", U.S. Pat. No. 6,268,222 (2001); Chandler, V. S.
et al., "Multiplexed analysis of clinical specimens apparatus and
methods", U.S. Pat. No. 5,981,180 (1999); Mandecki, W., "Multiplex
assay for nucleic acids employing transponders", U.S. Pat. No.
6,361,950 (2002); Mandecki, W. "Three-dimensional arrays of
microtransponders derivatized with oligonucleotides. Proceedings
from the IBC Biochip Technologies Conference, San Francisco, June
1998 D&MD Library Series publication #1941, Drug & Market
Development Publications, Southborough, Mass. 01772, pp. 179-187
(1999); Brenner, S. et al., "Gene expression analysis by massively
parallel signature sequencing (MPSS) on microbead arrays", Nature
Biotechnology 18, 630-634 (2000); Brenner, S. et al., "In vitro
cloning of complex mixtures of DNA on microbeads: Physical
separation of differentially expressed cDNAs" Proc. Nat. Acad.
Sciences USA 97, 1665-1670 (2000), and references therein.
Alternatively, the nucleic acid probes may be prepared using
standard, .beta.-cyanoethyl phosphoramidite coupling chemistry on
controlled pore glass supports (Beaucage et al., Tetrahedron Lett.
22, 1859 (1981)) using commercially available DNA oligonucleotide
synthesizers, such as that available from Applied Biosystems
(Foster City, Calif.). The synthesized nucleic acid probes may then
be coupled to the microparticles using covalent or non-covalent
coupling, as is well known in the art. The 5' terminus, 3' terminus
or both of the oligonucleotide probes may be derivatized using
.beta.-cyanoethyl phosphoramidite modifiers that give functionality
to the termini of the nucleic acid probe. These modifiers include
but are not limited to amino-modifiers, thio-modifiers,
dithio-modifiers, carboxylic acid N-hydroxysuccinimide ester,
molecular spacer modifiers, affinity reactive ligands or immuno
reactive ligands. The purpose of the modifiers is to give
functionality to the nucleic acid probe to allow for molecular
spacing, covalent crosslinking or affinity capture of the
identifiable microparticle to the probe. The cross-linking or
binding functionality allows for the conjugation of the nucleic
acid probe to the microparticle surfaces. Many different chemical
methods known in the art may be used. These methods typically use
reactive electrophilic intermediates that are capable of easily
coupling to nucleophilic residues such as amine or sulfhydryl
groups. These groups includes: (a) members that form covalent bonds
with sulfhydryl-reactive groups including, but not limited to
maleimides and haloacetyl derivatives; (b) amine-reactive groups,
including but not limited to isothiocyanates, succinimidyl esters
and sulfonyl halides; (c) carbodiimide-reactive groups, which
include amino and carboxyl groups; (d) any of the class of
immune-type binding-pairs, such as antigen/antibody or
hapten/anti-hapten systems; (e) any of the class of nonimmune-type
binding-pairs such as biotin/avidin, biotin/streptavidin, folic
acid/folate binding protein or vitamin B12/intrinsic factor; (f)
any group of complementary nucleic acid segments (including DNA
sequences, RNA sequences and peptide nucleic acid sequences), and
(g) any group of immunoglobulin binding proteins such as Proteins A
or G. In addition to coupling properties and attributes of the
functional moieties, the molecular modifiers can also contribute to
the generation or amplification of the assay signature signal.
[0225] Surface preparation of microparticles useful for this
invention may include for example linker chemistry, affinity
capture by hybridization or by biotin/avidin affinity,
combinatorial chemistry, and others known in the art. Generally,
nucleic acid probes are designed to provide a nucleotide sequence
complementary to a target sequence such that the binding of target
is a measurable event and contributes to the characterization or
screening of a sample. In this case, binding is by complementary
base pairing, and need not be perfect. As is known in the art, the
stringency of such binding is controllable by varying assay
conditions. As disclosed previously for proteins, nucleic acid
probes may consist of any combination of naturally occurring and
synthetic nucleotide sequences, with the possibility of randomizing
all or part of the sequence according to the needs of the specific
assay.
[0226] In one preferred embodiment, the capture probes are
polynucleotides or peptide nucleic acids comprising naturally
occurring nucleotide sequences, for example cloned genes or gene
fragments.
[0227] In another preferred embodiment, the capture probes are
polynucleotides or peptide nucleic acids comprising partially
naturally occurring nucleotide sequences and partially randomized
nucleotide sequences.
[0228] In another preferred embodiment, the capture probes may
comprise more general organic chemical structures,
organic/inorganic ligands, organometallic ligands or similar
complexes, useful for biosensors of diverse types, see for example
Fitzgerald, D. A., The Scientist 16, 38 (2002); Cravatt, B. F., and
Sorensen E. J. "Chemical strategies for the global analysis of
protein function", Curr. Opin. Chem. Biol. 4, 663-668, 2000;
Hergenrother, P. J., et al., "Small-Molecule Microarrays: Covalent
Attachment and Screening of Alcohol-Containing Small Molecules on
Glass Slides, J. Amer. Chem. Soc. 122(32), 7849-7850 (2000);
Korbel, G. A. et al., "Reaction Microarrays: A Method for Rapidly
Determining the Enantiomeric Excess of Thousands of Samples", J.
Amer. Chem. Soc. 123(2), 361-362 (2001); MacBeath, G. et al.,
"Printing Small Molecules as Microarrays and Detecting
Protein-Ligand Interactions en Masse", J. Amer. Chem. Soc. 121(34),
7967-7968 (1999), and the references cited therein. These probe
structures may be derived in many ways, including combinatorial
chemistry, direct synthesis, extraction from tissues, and
others.
[0229] In some applications, e.g., assays in complex biological
fluids such as urine, cerebrospinal fluid, serum, plasma, and the
like (see the section entitled "Assays" below) it is necessary to
treat the microparticles to prevent or reduce non-specific binding
of sample matrix components. Methods to reduce non-specific binding
to a variety of solid supports in heterogeneous assays are well
known in the art and include, but are not limited to treatment with
proteins such as bovine serum albumin (BSA), casein, and non-fat
milk. These treatments are generally done after the attachment of
the capture probe to the microparticles, but before the assay to
block the potential non-specific binding sites. Additionally,
surfaces that resist non-specific binding can be formed by coating
the surface with a thin film comprising synthetic polymers,
naturally occurring polymers, or self-assembled monolayers that
consist of a single component or a mixture of components. The thin
film may be modified with adsorption-repelling moieties to further
reduce non-specific binding. For example, the thin film may be a
hydrophilic polymer such as polyethylene glycol, polyethylene
oxide, dextran, or polysaccharides, as well as self-assembled
monolayers with end functional groups that are hydrophilic, contain
hydrogen-bond acceptors but not hydrogen bond donors, and are
overall electrically neutral (Ostuni, E. et al., "A Survey of
Structure-Property Relationships of Surfaces that Resist the
Adsorption of Protein", Langmuir, 17, 5605-5620, (2001)). In this
approach, the non-specific binding resistant layer is generally
formed on the substrate and then is chemically activated to allow
attachment of the capture probe. For example, the method described
by Huang in copending U.S. Patent Application No. 60/451,068,
incorporated herein by reference, may be used to reduce nonspecific
adsorption to the microparticles of the present invention. In the
method described in that disclosure, a thin film of polyethylene
glycol alkyl acrylate is grown on the surface of the solid
substrate, i.e., the microparticles, using surface initiated atom
transfer radical polymerization. This method is described in detail
in Example 7 below. In summary, the microparticles are first
treated with an initiator molecule to form an initiator-coated
microparticle, which is then contacted with at least one
polyethylene glycol alkyl acrylate monomer in solution in the
presence of a catalyst. The resulting polyethylene glycol alkyl
acrylate coating may be further activated and conjugated to the
capture probe using various methods known in the art, including,
but not limited to the use of trichloro-s-triazine (Abuchowski, A.
et al., J. Bio. Chem. 252, 3578-3581, and 3582-3586 (1977)),
N,N'-carbonyldiimidazole (Bartling, G. J. et al. Nature (London),
243, 342-344 (1973)), and organic sulfonyl chloride such as tosyl
chloride and tresyl chloride (Nilsson, K. and Mosbach, K. Methods
in Enzymology, 1984, 104, pp 56-69).
[0230] As described previously for protein libraries, the diversity
of a nucleic acid or organic molecule library can vary considerably
according to the specific application of the end user. In a
preferred embodiment, each particle in the library carries a
different capture probe, a class of capture probes, or a defined
mixture of capture probes. However, a library can be made redundant
by having more than one particle in the library carry the same
capture probe. This could at times be preferable, since the
certainty of measuring the presence of a specific analyte would be
statistically greater for moderately redundant libraries (3-5
copies of each probe). The needs for redundancy will vary according
to the concentration of the target analyte, the amount of sample
available, and other factors.
[0231] A commercially useful library may thus consist of
pre-manufactured microparticles with known capture probes already
attached, or alternatively the microparticles may be treated with a
specific surface chemistry to enable the user to custom-synthesize
a library of particular interest. The probe may be produced
separately and then attached in a separate step using linker
chemistry, crosslinker chemistries or other techniques known in the
art. Examples of linking groups include, but are not limited to
hydroxyl groups, amino groups, carboxyl groups, aldehydes, amides,
and sulfur-containing groups such as sulfonates and sulfates.
Examples of the crosslinking chemistries include, but are not
limited to hydroxy reactive groups include s-triazines and
bis-epoxides, sulfhydryl reactive groups including maleimides and
haloacetyl derivatives, amine reactive groups such as
isothiocyanates, succinimidyl esters and sulfonyl halides and
carboxyl reactive groups such as carbodiimides.
[0232] In another approach, the capture probe may be directly
synthesized on the surface of the particles of the present
invention. Probes that may be directly synthesized on the particles
include, but are not limited to nucleic acids (DNA or RNA), peptide
nucleic acids, polypeptides and molecular hybrids thereof. In the
direct synthesis approach, a particle that is derivatized with a
reactive residue to be used to chemically or biochemically
synthesize the probe directly on the particle is used. The chemical
linkage of the reactive residue must not be cleavable from the
microparticle-during post-synthesis deprotection and cleanup of the
final probe-coupled microparticles (Lohrmann et al., DNA 3, 1222
(1984); Kadonaga, J. T., Methods of Enzymology 208, 10-23 (1991);
Larson et al., Nucleic Acid Research 120, 3525 (1992); Andreadis et
al. Nucleic Acid Res. 228, e5 (2000); and Chrisey et al.
WO/0146471). This approach allows for mass production and assembly
of libraries.
[0233] In summary, the means for manufacturing a library will
depend on the assay to be performed, the type of library, the
diversity of the library, the redundancy, the type of linker
chemistry, and other factors. A general requirement for a useful
particle library is the correlation between the identities of the
particles and the identities of the capture probes. This
correlation should be preserved regardless of how the library is
synthesized, whether by combinatorial methods, directed automated
synthesis, manual synthesis, or other methods; and regardless of
how and when the correlation is determined.
[0234] In general, each microparticle in the library carries
multiple copies of a specific capture probe or a defined mixture of
capture probes. The optimal surface density of the capture probes
may vary according to the application and reaction conditions. For
example, the kinetics of DNA hybridization to immobilized DNA
probes has been investigated (Chan, et al., "The biophysics of DNA
hybridization with immobilized oligonucleotide probes", Biophysical
Journal 69, 2243-2255 (1995); Livshits, M. A., Theoretical analysis
of the kinetics of DNA hybridization with gel-immobilized
oligonucleotides, Biophysical Journal 71, 2795-2801 (1996)).
Similar studies have been carried out for protein-protein
interactions (Stenberg, M. and Nygren, H., "Kinetics of
antigen-antibody reactions at solid-liquid interfaces", Journal of
Immunological Methods 113, 3 (1998). In general, there is poor
mixing at the interface of a 2-dimensional surface array and the
solution containing the target analytes. For efficient specific
binding to take place on a 2-dimensional fixed arrays, generally
some nonspecific binding must first take place on the surface,
followed by 2-dimensional diffusion along the surface, which then
leads to hybridization or binding. The need for 2-dimensional
diffusion limits the probe surface density, the rate of binding,
and hence the total signal that can be generated in a given time.
In contrast, in particle-based assays carried out in a well-mixed
environment (for example, a free suspension or in a flow field
provided by a microfluidic device), the boundary layer at the
interface is continuously replenished and higher-probe surface
densities are more favorable. This results in higher rates of
binding, potentially larger binding signals, higher probe density,
increased sensitivity, improved specificity, and reduction of
nonspecific binding interferences. In the present invention, higher
probe density on the microparticle surface can thus help reduce
nonspecific binding without adversely affecting specific binding. A
further advantage of particle-based assays, and particularly the
system of the present invention, is that the amount of sample
required for the assay can in principle be reduced. In fixed array
systems, analyte has to be in substantial excess to the probe in
order to drive the reaction kinetics and overcome long diffusion
lengths. Only a fraction of the analyte molecules will typically be
able to interact with its complementary probe in a fixed array. Due
to the shorter diffusion length in a well-mixed system, all of the
analyte is equally available to all of the probe binding sites.
This would increase sensitivity and decrease reaction times and
assay turnaround time.
[0235] In a preferred embodiment of the present invention, the
microparticle library is provided as a multiplicity of identifiable
microparticles with no additional surface chemistry or capture
probes. Such a library may be used for many purposes, including but
not limited to labeling substrates for combinatorial synthesis, and
being used as starting materials for custom made screening
libraries.
[0236] In another preferred embodiment, the microparticle library
is provided with derivatized particle surfaces suitable for
specific linker chemistry, direct synthesis, or other means for
attaching capture probes. The end user may then custom tailor the
library with probes according to their specific assay needs.
[0237] In still another preferred embodiment, the microparticle
library is populated with particles carrying known capture probes
that are correlated with a list of particle identities. The end
user may then use the entire library as provided, or sort the
library into subsets according to their specific assay needs.
[0238] In still another preferred embodiment, the microparticle
library is populated with particles carrying unknown capture
probes, for example created by combinatorial methods. The end user
may then screen the library for "hits" against specific targets by
resonant light scattering techniques, and characterize the
corresponding probes using techniques known in the art.
[0239] Assays
[0240] Chemical or biological assays carried out with the present
invention may make use of the specific interaction of binding
pairs, one member of the pair located on the surface of the
microparticle (also referred to as the "probe", "binding partner",
"receptor", or grammatically similar terms) and the other member of
the pair located in the sample (referred to as the "target",
"analyte", or grammatically similar terms). Generally the analyte
carries at least one so-called "determinant" or "epitopic" site,
which is unique to the analyte and has enhanced binding affinity
for a complementary probe site.
[0241] The nature of assay types possible with this invention
varies considerably. Probe/target binding pairs may, for example,
be selected from any of the following combinations, in which either
member of the pair may be the probe and the other the analyte:
antigen and specific antibody; antigen and specific antibody
fragment; folic acid and folate binding protein; vitamin B12 and
intrinsic factor; Protein A and antibody; Protein G and antibody;
polynucleotide and complementary polynucleotide; peptide nucleic
acid and complementary polynucleotide; hormone and hormone
receptor; polynucleotide and polynucleotide binding protein; hapten
and anti-hapten; lectin and specific carbohydrate; enzyme and
enzyme enzyme/substrate, enzyme/inhibitor, or; biotin and avidin or
streptavidin; and hybrids thereof, and others as known in the art.
Binding pairs may also include members that form covalent bonds,
such as, sulfhydryl reactive groups including maleimides and
haloacetyl derivatives, and amine reactive groups such as
isothiocyanates, succinimidyl esters, sulfonyl halides and
carbodiimide reactive groups such as carboxyl and amino groups.
[0242] Specific examples of binding assays include those for
naturally occurring targets, for example antibodies, antigens,
enzymes, immunoglobulin (Fab) fragments, lectins, various proteins
found on the surface of cells, haptens, whole cells, cellular
fragments, organelles, bacteriophage, phage proteins, viral
proteins, viral particles and the like. These may include
allergens, pollutants, naturally occurring hormones, growth
factors, naturally occurring drugs, synthetic drugs,
oligonucleotides, amino acids, oligopeptides, chemical
intermediates, and the like. Practical applications for such assays
include for example monitoring health status, detection of drugs of
abuse, pregnancy and pre-natal testing, donor matching for
transplantation, therapeutic dosage monitoring, detection of
disease, e.g. cancer antigens, pathogens, sensors for biodefense,
medical and non-medical diagnostic tests, and similar applications
known in the art.
[0243] Proteins are of interest in many diagnostic tests, such as
blood typing, detecting cell populations, screening for pathogens,
screening for immune responses to pathogens, immune complexes,
lectins, mono- and polysaccharides, the presence of allergens and
haptens in samples such as physiological fluids, air, process
streams, water, and the like. Likewise, using nucleic acids or
polynucleotides as probes may find many applications in the
detection of complementary strands in a sample, detection of mRNA
for gene expression, genomic and proteomic microarray applications,
detection of PCR products, DNA sequencing, clinical diagnostics,
medical screening, polymorphism screening, forensic screening,
detection of proteins specifically binding to nucleic acids, and
others as known in the art.
[0244] Assays can be done using various specific protocols. A
schematic diagram of a typical protocol is shown in FIG. 1. For
detection or quantitation of an analyte, a sample 113 is typically
combined with a solution containing the microparticles 110, 111,
etc. Various additional steps may be carried out, such as
incubations, washings, the addition of miscellaneous reagents, etc.
as required by the specific assay. If an analyte of interest is
present and one or more microparticles exists with a complementary
capture probe, that analyte will bind to those microparticles as
illustrated by microparticles 114 and 115. Conversely, according to
FIG. 1, if an analyte complementary to a specific microparticle is
not present, there will be no binding on that particle, for example
microparticle 116.
[0245] In one embodiment of the present invention, resonant light
scattering is used only for particle identification in the assay,
as described in the section "Particle identifications methods and
systems", infra. Detection is done using conventional detection
methods including, but not limited to fluorescence,
chemiluminescence, nanoparticle tags, and other techniques known in
the art. In this embodiment, a label may be attached to a member of
the binding pair to enable detection. Alternatively, a sandwich
assay may be used in which the target analyte is captured by the
probe attached to the microparticle. Then a second binding partner,
which has an attached label, is used to bind to the captured
analyte.
[0246] In another embodiment, resonant scattering is used only for
detection of binding, as described in the section "Particle-based
binding measurement, infra. In this embodiment, particle
identification is done by other means such as having the particles
remain in a fixed position or by the use of fluorescent dyes, as
described by Chandler et al., in U.S. Pat. No. 5,981,180, or
nanoparticle labels, as described by Chandler et al., in U.S. Pat.
No. 6,268,222, attached to the microparticles. Moreover, no
particle identification is required if only one type of probe
microparticle is used in the assay.
[0247] In a preferred embodiment, both particle identification and
detection of binding are done using resonant scattering. The
detection and identification of bound analyte is described in
detail in section "Particle identifications methods and systems"
and in section "Particle-based binding measurement" of this
disclosure. As explained more fully there, whereas in current
practice it is necessary to separate unbound components of the
sample from the microparticles, due to potential interference from
unbound reporter groups, in the present invention this step is
optional.
[0248] Assays using particles of the invention can be carried out
in a large variety of sample matrices including separated or
unfiltered biological fluids such as urine, peritoneal fluid,
cerebrospinal fluid, synovial fluid, cell extracts, gastric fluid,
stool, blood, serum, plasma, lymph fluid, interstitial fluid,
amniotic fluid, tissue homogenate, fluid from ulcers, blisters, and
abscesses, saliva, tears, mucus, sweat, milk, semen, vaginal
secretions, and extracts of tissues including biopsies of normal,
malignant, and suspect tissues, and others known in the art. The
sample can also be obtained from an environmental source such as
soil, water, or air; or from an industrial source such as taken
from a waste stream, a production line, reactors, fermentation
apparatus, cell culture medium, or from consumer products,
foodstuffs, and others. The test sample can be pre-treated prior to
use depending on the details of the assay, techniques for which
would be well known by those in the art.
[0249] Particle Identification Methods and Systems
[0250] According to the present invention, high-resolution features
in the resonant light scattering spectrum are useful for providing
unique identification patterns for each member of a population of
microparticles. The scattered light spectrum carries information
content in the form of resonances of specific widths and shapes at
specific wavelengths. As is known in the art, the location, width,
and relative intensities of the resonance features all vary with
particle size and refractive index of the particle. Generally,
resonance features can be seen over a reasonably wide range of
particle sizes and refractive indices. The resonances useful for
this invention, however, are typically formed within specific
ranges of these particle properties. Furthermore, the it is
contemplated that the addition of layers and/or zones of varying
refractive index to a core particle could, within specific
parameters of size and refractive index, create additional richness
to the resonant light scattering pattern. Additionally it will be
readily apparent that in any microparticle production process,
there would be natural variations, or, if needed, induced
variations, in the key parameters defining the resonant light
scattering pattern, namely particle dimensions and refractive
indices. This variability in turn enables one to create large
populations of microparticles, each of which giving rise to a
distinct resonant light scattering pattern that can be used as an
identifier for the particle.
[0251] A general microparticle according to the present invention
is shown in FIG. 2, which depicts a uniform core 100 of radius r
and index of refraction n.sub.c. FIG. 2 also depicts an optional
number m of layers 101 . . . 103 with outer radii r.sub.1 . . .
r.sub.m and indices of refraction n.sub.1 . . . n.sub.m. The number
of layers m may be zero, and if greater than zero, will typically
be less than about 5. In this context, the term "layer" or "layers"
may include regions containing sharp refractive index boundaries,
or zones of variable refractive index without sharp boundaries. In
either case, variability of refractive index and layer dimension
may provide richness to the resonant light scattering spectrum,
which can be used to advantage in particle identification.
[0252] When irradiated with light of wavelength .lambda., the
particle will scatter a portion of that light to a detector with an
intensity I (.lambda.). As the incident wavelength is scanned,
i.e., varied over the analytical wavelength range, a "scattering
pattern" or "scattering spectrum" as a function of wavelength
results. In order to measure the resonant light scattering spectra
from particles according to this invention, a suitable detection
cell is required in which the particles are placed during the
measurement. FIG. 3 illustrates one embodiment of an optical cell
014 useful for measuring high-resolution resonant light scattering
spectra from a microparticle. FIG. 4 depicts one embodiment of the
associated experimental apparatus, including the optical cell 014,
light detector 008, and associated supporting equipment used to
measure the high-resolution resonant light scattering spectrum from
a microparticle. Details of such a measurement are given in Example
1 and are summarized here.
[0253] The microparticle of Example 1 is about 40 micrometers in
diameter and has an index of refraction about 1.9 at a wavelength
of about 775 nanometers. As is known in the art, light scattered at
the resonant wavelengths emanates from the interior of the particle
and must thus be transmitted through the outer optical region of
the particle prior to being scattered. Therefore, the outer optical
region of the particle (that part of the core outside the caustic
surface) must be substantially transparent at the wavelengths of
interest. In the following discussion, reference is made to FIGS. 3
and 4. The microparticle is held in aqueous suspension in an
optical cell 014 constructed of Delrin.RTM. and Teflon.RTM. AF
2400. Teflon.RTM. AF 2400 is a preferred material because it has
refractive index closely matching that of water, thus reducing the
optical background and associated noise due to reflection and
refraction at the interfaces between water and the cell windows.
Teflon.RTM. AF 1000 has an index of refraction even closer to water
than Teflon.RTM. AF 2400, and is another preferred material.
Another preferred material is fluoroacrylate, commonly used in
photoresist materials, which has a refractive index of about 1.38
at the wavelengths of interest. One practiced in the art would
recognize that other optical cell configurations would be possible,
provided the design and materials are such that incident light
efficiently illuminates the particle or particles, scattered light
is minimized, and the cell dimensions are compatible with the
intended applications of the invention.
[0254] A multi-fiber optical probe 005 comprising one central
excitation fiber 004 and surrounded by 6 detection fibers 007 in a
hexagonal pattern is located above the particle, its end extending
into the water layer. The excitation fiber is connected to the
output of a scanning diode laser 006. One practiced in the art
would recognize that alternative incident light sources could be
used, such as tunable dye lasers, and polychromatic sources such as
gas discharge lamps, light-emitting diodes, and incandescent lamps.
A polychromatic light source, in order to produce incident light of
more selective wavelength, will generally require coupling to one
or more wavelength-selecting means such as non-dispersive elements
(e.g. fixed wavelength passband filters, tunable wavelength
passband filters, holographic filters) or dispersive elements (e.g.
monochromators, prisms, gratings) in order to achieve the required
spectral resolution.
[0255] The light may be coupled into the optical system by
different light coupling means, including lenses, mirrors, prisms,
fiber optic devices, beam expanders, and others well known in the
art.
[0256] The detection of scattered light may be done in different
ways. As shown in the Examples, a preferred embodiment for
detection of scattered light from microparticles is by scanning the
incident wavelength and detecting the light with detectors or
imaging devices that are not wavelength-selective, i.e. are not
suitable for distinguishing light of different wavelengths. One
skilled in the art would recognize that it is also, in principle,
possible to illuminate the particles with polychromatic light and
detect the scattered light with a wavelength-selective detection
means such as non-dispersive elements (e.g. fixed wavelength
passband filters, tunable wavelength passband filters, holographic
filters, wavelength-selective imaging devices such as color digital
cameras) or dispersive elements (e.g. monochromators, prisms,
gratings).
[0257] As the laser is scanned in wavelength, part of the light
interacts with the particle and is scattered. Light that does not
interact with the particle escapes through a window 015 below the
cell. Some light is scattered from the particles in all directions;
however, one preferred direction is near 180 degrees from the
incident beam, otherwise referred to as "back-scattered" light. The
back-scattered light is received by the six detection fibers 007,
combined, and sent to a suitable light detection means, for example
a silicon photodetector, photomultiplier, or the like. A chopper,
in this example located inside the diode laser 006, modulates the
incident light. The electrical signal from the detector output is
in turn sent to a lock-in amplifier 009 along with the modulation
signal. The output of the lock-in amplifier and a "ramp" signal
proportional to the incident wavelength are then routed to a data
capture board installed in a personal computer 010. Software
controls the laser scan and the acquisition and display of the
scattered light spectrum. It should be noted that since resonance
peak positions are not dependent on detection angle, the use of
peak positions to define scattering patterns is equally valid for
other detection geometries.
[0258] For illustrating the present invention, it is useful to
characterize the spectrum of a given particle by the locations and
widths of the resonance features in the spectrum. These features
comprise a spectral pattern, which may be analyzed and
characterized. The spectrum may be analyzed in a number of ways
including peak finding, deconvolution, peak fitting, pattern
recognition, and others known in the art, and these methods may be
automated and computerized.
[0259] To illustrate the principle behind identifying particles
according to the invention, it is useful to consider the scattering
spectrum of a group of similar particles from a single lot of
microparticles, as for example in FIG. 5. As stated previously,
within each lot there will be natural variations in size and
refractive index, which can be used profitably to give rise to
unique scattered light spectra according to the invention. It can
be readily seen that among the six particles from the same lot
(chosen at random), uniquely distinct scattered light spectra are
obtained, and the ability to identify the particles based on these
spectra is readily apparent. It will be apparent to those skilled
in the art that automated spectral analysis techniques (e.g.,
spectral coding, pattern recognition, filtering, and the like)
could be applied to scattered light spectra in order to extract
spectral features including, but not limited to peak location, peak
width, peak order, periods between peaks of different orders, and
polarization-dependent spectral properties that are useful for
creating a unique identifying "tag" or "key" for each particle in a
population of particles.
[0260] It should be noted that there is opportunity to add further
richness and therefore multiplicity of combinations to the
scattered light spectrum through purposeful modifications of the
untreated commercial microparticles. For example, additional layers
101 . . . 103 could be employed, each layer having the potential
for adding or modifying scattering resonance features, thereby
creating additional combinations of identifying codes. Likewise,
variations, whether naturally occurring or purposely induced, in
refractive index, thickness, or both will give rise to useful
variations in the scattering spectrum. It should be noted that by
these variations, entirely different spectral patterns are
produced, rather than shifting of spectral patterns as is the case
with variations in diameter only. The concept of adding layers for
the purpose of adding richness to the resonant light scattering
spectrum is illustrated in Examples 14-19.
[0261] To be useful in identifying microparticles according to this
invention, the dimensions and refractive indices of the core and
layers must fall within limits imposed by the fundamental Mie
theory of light scattering. Simply put, although particles of
virtually any size and refractive index will interact with light to
some degree, for a given range of wavelengths only specific
combinations of these parameters will give rise to spectra useful
for identification according to the present invention. In addition,
since most assays of interest will be done in aqueous media, the
wavelengths chosen for analysis must be such that there is minimal
interference from optical absorption by water. Furthermore, the
wavelengths chosen should be obtainable by available light sources
such as arc lamps, lasers, or diode lasers.
[0262] The inventors, through use of computer models and subsequent
laboratory measurements, have determined useful ranges for several
of the critical parameters. In what follows, distinction is made
between (1) layers that give rise to additional optical resonance
features or changed features, i.e. positionally changed in their
wavelength locations relative to one another (so-called "optically
active" layers), and (2) layers that serve only to preserve the
integrity of the core or serve as chemically or biologically
suitable substrates for the attachment of capture probes or
suppression of non-specific binding ("chemically active" or
"biologically active" layers). It is also possible that a layer
could serve both functions, in which case it would be "optically
active" as well as being a suitable chemical or biological
substrate. A typical, but non-limiting example of an optically
active layer is one in which the layer has thickness of between
about 50 and 20,000 nanometers (20 micrometers).
[0263] Accordingly, one preferred embodiment of an identifiable
microparticle comprises a substantially spherical, transparent
glass core of diameter about 100 micrometers or less, preferably
about 75 micrometers or less, and more preferably about 50
micrometers or less, and of refractive index between about 1.45 and
about 2.1, preferably between about 1.6 and 2.1, at wavelengths
between about 600 and 1650 nanometers.
[0264] Another preferred embodiment of an identifiable
microparticle comprises (1) a substantially spherical,
substantially transparent glass core of diameter about 100
micrometers or less, preferably about 75 micrometers or less, and
more preferably about 50 micrometers or less, and of refractive
index between about 1.45 and about 2.1, preferably between about
1.6 and 2.1 at wavelengths between about 600 and 1650 nanometers;
and (2) one substantially transparent, optically active layer,
capable of supporting additional resonance light scattering
features or changing existing features.
[0265] Still another preferred embodiment of an identifiable
microparticle comprises (1) a substantially spherical,
substantially transparent glass core of diameter about 100
micrometers or less, preferably about 75 micrometers or less, and
more preferably about 50 micrometers or less, and of refractive
index between about 1.45 and about 2.1, preferably between about
1.6 and 2.1 at wavelengths between about 600 and 1650 nanometers;
and (2) one substantially transparent, optically active layer,
capable of either or both supporting additional resonance light
scattering features or changing existing features, and (3) one or
more chemically or biologically active, substantially transparent,
layers of thickness between about 1 nanometer to 10 micrometers
useful for procedures described in the previous section "Capture
probes and particle libraries".
[0266] Still another preferred embodiment of the identifiable
microparticle comprises (1) a substantially spherical,
substantially transparent glass core of diameter about 100
micrometers or less, preferably about 75 micrometers or less, and
more preferably about 50 micrometers or less, and of refractive
index between about 1.45 and about 2.1, preferably between about
1.6 and 2.1 at wavelengths between about 600 and 1650 nanometers;
and (2) two or more substantially transparent, optically active
layers, each capable of either or both supporting additional
resonance light scattering features or changing existing features,
and (3) one or more chemically or biologically active,
substantially transparent layers of thickness between about 1
nanometer to 10 micrometers useful for procedures described in the
previous section "Capture probes and particle libraries".
[0267] Another preferred embodiment of the present invention is a
multiplicity or population of identifiable microparticles, such a
population being useful for a number of applications including
biological or chemical assays and the like. The type of
microparticle (i.e. the number and composition of the core and
layers) chosen for a specific application will depend on the nature
of the sample and the number of analytes to be screened or
detected. In many applications, for example high-throughput
screening for drug candidates or screening for disease biomarkers,
the utility of a population of identifiable microparticles
according to the present invention will be directly related to the
number of unique microparticles in the population, higher numbers
generally being preferred. The number of possible combinations of
scattering patterns that can be used for identifying a population
of microparticles in the above embodiments can be very large
(greater than about 10.sup.6 should be readily attainable) as the
core radii, the layer thicknesses, and their respective refractive
indices are allowed to vary within a population, thus producing a
very rich set of scattering patterns for use as particle
identifiers. In other applications, for example biomarker screening
or specific disease diagnostics, a smaller number of unique
microparticles may suffice.
[0268] The detection system and method described above and depicted
in FIGS. 2 and 3 is suitable for measuring the high-resolution
scattered light spectrum of one particle at a time. This apparatus,
while effective for demonstrating the principles of the invention,
requires the alignment of a single particle with the optical probe
and is generally manual and somewhat time-consuming.
[0269] An improvement to the single-particle detection means would
be to form a linear or rectangular array of particles by
constraining them, for example in tubes or in a series of channels,
indentations, or grooves on a substrate. The particles could then
be scanned in a known order by rapidly moving the laser beam from
particle to particle or by moving the substrate holding the
particles. In this case, identity of the particles and their probes
is first established by their spectral scattering patterns (or by
any other means), and then the particles are loaded into the tubes,
grooves, indentations, or channels in a known order. In the
Examples, the particle handling is accomplished by manual pipetting
operations. One skilled in the art would recognize that other
particle handling means would be suitable, including the use of
automated or semi-automated microfluidics devices, and combinations
of fluid control devices such as pumps, syringes, control valves,
and the like. After the particles are placed in position, the
identities of the particles are thereafter maintained by their
relative locations within the channels, and optionally confirmed by
their scattering patterns. Similarly, in a two-dimensional but
otherwise unstructured arrangement of microparticles in which they
remain stationary during the assay, the identities of the particles
are maintained by their relative positions.
[0270] A still more efficient detection means is based on resonant
light scattering imaging. In this method, resonant light scattering
spectra are detected simultaneously from a field of multiple
particles by imaging means, such as a camera. The camera images the
particles repeatedly as the incident wavelength is scanned,
typically acquiring one image for each wavelength step in the scan.
Each image contains scattering intensity information from every
particle in the image, at a specific wavelength. By suitably
processing the entire set of images thus obtained, the scattered
light spectrum from each particle may be derived. The camera could
be any imaging device capable of the speed and sensitivity required
for this application. The camera is preferably a digital camera,
more preferably based on a two-dimensional CCD (charge coupled
device) or equivalent imaging means. Preferably, the camera
functions and data acquisition are controlled by a computer
operably linked to the camera and to the scanning light source,
said computer having software suitable for these purposes.
Additionally, the computer may contain data analysis means, i.e.,
software utilizing various methods including peak finding,
deconvolution, peak fitting, pattern recognition, and others known
in the art, for identifying the particle, detecting binding and
identifying the analyte or groups of analytes. A typical
experimental setup is schematically shown in FIGS. 6 and 7. FIG. 6
shows an imaging optical cell 019 useful for spectral imaging
according to this invention; FIG. 7 shows the associated components
needed to carry out the measurement. Details of the method and
system are given in Example 2; a summary is given here. A
population of microparticles is isolated in imaging optical cell
019 and imaged with microscope 021, using a scanning diode laser
022 as light source. The particles could be randomly distributed,
or distributed in an ordered fashion such as in a tube or in a
linear or rectangular array by constraining them in grooves,
channels, or indentations on a substrate. The magnification is set
to simultaneously image the particles of interest. Back-scattered
light from particles in the field is collected and imaged by the
objective lens 020 and associated optics on the plane of a digital
camera 026. As the laser wavelength is scanned, a digital image is
taken at each wavelength step and stored; thus a complete
wavelength scan results in a series of digital images of all the
particles, one image for each interval. The intensity of scattering
from a particle a given wavelength is related to the brightness of
that particle's scattering image at that wavelength. Thus, with
suitable computerized image processing and spectral analysis, the
complete scattering spectra of all particles can be extracted from
the set of images obtained during the scan. An example of one
typical image taken from such a set of images is shown in FIG. 8.
It is seen that the light of interest (scattered light) 106
emanates from a ring or from a segmented ring of light along the
particle's edge (see a discussion of this effect for example in
Lynch, D. K. and Livingston, W., Color and Light in Nature,
Cambridge University Press (2001). The incident and scattered light
beams used in Example 2 were polarized independently, with the two
axes of polarization parallel to each other. This results in
sectors of scattered light centered approximately at the 12:00,
3:00, 6:00, and 9:00 positions of the circle as indicated for the
center image of FIG. 8 by the numbers 12, 3, 6, and 9 respectively.
Theory predicts, and results confirm, that scattered light spectra
from the "12" and "6" regions are equivalent and scattered light
spectra from the "3" and "9" regions are equivalent. Furthermore,
spectra from the two pairs of sectors are different from one
another. This results in the ability to identify a particle by a
combination of two substantially independent spectra, rather than a
single spectrum, increasing the multiplicity of identifiable
particles and also the accuracy of identification.
[0271] Light from this ring is measured by image processing
techniques, for example from measuring the image intensity from a
subset of pixels 101, and repeated for each image 102 . . . 105 in
the wavelength series (See FIG. 9). The subset of pixels could be
selected by a variety of means including average intensity
threshold, signal/noise or other spectral property threshold,
geometrical features, radial or azimuthal position relative to the
center, digital filtering, and the like. The image intensity could
be calculated by a variety of means including pixel-averaging,
taking the maximum value from a subset of pixels, weighted
averaging according to statistical criteria such as signal/noise
ratio, etc. as would be known in the art. An example of such
scattered light spectra 150 for one of the particles, obtained by
applying specific selection rules as explained in Example 2, is
shown in FIG. 9. By extension of this Example, it would be possible
to measure scattering spectra from a large population of
microparticles rapidly and efficiently. This would be especially
advantageous over methods reported in the literature in biological
or chemical assays, for applications including drug discovery,
high-throughput biomedical screening, genomic mapping, and the
like.
[0272] In order to carry out useful detection of analytes, a
suitable means for effectively contacting the particles with
reagents and analytes is required. Preferably, the particles may be
contacted with reagents and analytes in any order and any number of
times throughout an experiment. Thus, the detection cell requires
at least one port, preferably two or more ports, enabling the flow
of reagents and analytes into the cell, and suitable flow control
elements enabling the selection of reagents or analytes and the
flow speed. In the Examples of this application, the particles are
introduced into the detection cell with a manually operated
pipette, and the reagents and analytes are delivered to the
detection cell through two ports ("inlet" and "outlet") by
peristaltic pumps or syringe pumps connected to the cell with
flexible tubing. The pumps and any associated flow control valves,
check valves, flow metering devices, and the like may be manually
operated or automatically operated by computer control. Those
skilled in the art would recognize that many possible arrangements
of ports, pumps, tubing, and flow control elements could be
employed, provided that the resulting system enables contacting the
particles with reagents and analytes in a suitable manner.
[0273] Accordingly, a preferred embodiment of the system for
identifying microparticles according to the present invention
comprises an imaging system containing (1) a scanning diode laser
light source; (2) an optical cell suitable for spectroscopic
scattered light imaging and stray light rejection; (3) a means for
contacting the microparticles with analytes and reagents; (4) a
microscope with optical components suitable for imaging the field
containing the population of particles of interest; (5) digital
camera and monitor; (6) digital image acquisition hardware; (7) a
computer operably linked to the components as needed and (8)
software suitable for controlling the components, capturing data,
and processing the data.
[0274] A preferred embodiment of a method for identifying
microparticles further comprises (1) placing the population of
microparticles in the field of view and focusing the microscope on
the particles; (2) initializing the data capture software; (3)
scanning the diode laser from a starting wavelength to an ending
wavelength while simultaneously (4) capturing a digital image
representative of the scattered light from all particles in the
field of view for each wavelength step in the scan; (5) processing
the digital images so as to produce scattered light spectra for
each particle; and (6) applying spectral processing techniques to
create a unique identifying marker or code for each particle.
[0275] Methods for Identification of Analytes
[0276] The identity of an analyte may be determined based upon the
detection of binding to a capture probe whose identity is known.
The absence of an analyte in a sample may also be determined using
the same methods. Various methods are possible for the
identification of analytes based upon the measurement of resonant
light scattering.
[0277] In one preferred embodiment, one or more known capture
probes are applied to the particles and then the particles are
scanned over a first analytical wavelength range to produce a first
reference resonant light scattering signature which is used to
identify each particle and to correlate the identity of the capture
probe to the identified particle. A number of first reference
resonant light scattering signatures may be produced for the
particles by repeating the scan at different times. For example,
one first reference resonant light scattering signature may be
obtained at the time of manufacture of the probe-coupled
microparticles and then a second first reference resonant light
scattering signature may be obtained immediately before the
particles are used in the assay. Any one of the first reference
resonant light scattering signatures may be used for the
identification of the microparticle and the attached probe.
However, it is preferred to use the most recently obtained first
reference resonant light scattering signature to serve as the
reference signature to detect binding. Alternatively, the particles
may be scanned over a first analytical wavelength range to produce
an identifying resonant light scattering signature for each
particle before applying the capture probe. Then one or more known
probes are applied to the particles. The identity of the probe is
correlated with the identifying resonant light scattering signature
of the particles to which it has been applied. In either case, the
particles are contacted with a sample suspected of containing at
least one analyte and if the analyte is present, binding occurs
between the capture probe and the analyte. The particles are
scanned over a second analytical wavelength range to produce a
second binding resonant light scattering signature. The second
analytical wavelength-range used to detect binding may be the same
or different from the first analytical wavelength range used to
identify the particle. For example, only a portion of the first
analytical wavelength range, which corresponds to a particular peak
or other spectral feature, may be used as the second analytical
range to detect binding. A series of second binding resonant light
scattering signatures may be produced by successively scanning the
particles to follow the binding in real time. Detection of binding
is done by comparing either any one of the second binding resonant
light scattering signatures to any one of the first reference
resonant light scattering signatures, preferably the one most
recently obtained, or any one of the second binding resonant light
scattering signatures with a previous second binding resonant light
scattering signature in the series. If the analyte is not present
in the sample, there will be no difference, within experimental
error, between the two compared resonant signatures. The identity
of each bound analyte may then be determined on the basis of the
correlation to the particle identity, determined as described
above, and at least one second binding resonant light scattering
signature. If desired, the amount of bound analyte, which is
directly related to the amount of analyte in the sample under the
appropriate conditions, may be determined by comparing the
differences between the two compared resonant light scattering
signatures, specifically, the degree of shift of the scattering
pattern observed upon binding. The amount of analyte in the sample
may then be determined from a calibration curve prepared using
known standards, as is well known in the art.
[0278] In another preferred embodiment, at least one capture probe
is applied to the particles, which are then affixed in a defined
spatial array, such as in tubes or in a series of channels,
indentations, or grooves on a substrate, wherein each particle has
a defined locus. In this case, the identity of the particle and the
attached probe is determined by the affixed particle locus. Then,
the particles are optionally scanned over the analytical wavelength
range one or more times to produce at least one reference resonant
light scattering signature, as described above. The particles are
contacted with a sample suspected of containing at least one
analyte and the particles are scanned one or more times over the
analytical wavelength range to produce at least one second binding
resonant light scattering signature for each particle. Binding is
detected as described above. Each bound analyte is identified on
the basis of the affixed particle locus. The amount of analyte
present in the sample may be determined by comparing the
differences between the two compared resonant light scattering
signatures, as described above.
[0279] In another preferred embodiment, at least one capture probe
is applied to the particles and the particles are scanned over the
analytical wavelength range to produce at least one first reference
resonant light scattering signature for each particle, as described
above. The capture probes are correlated with each identified
particle, as described above. The particles are then contacted with
a sample suspected of containing at least one analyte, the analyte
comprising a detectable label, such as fluorescent moieties,
chemiluminescent moieties, particles, enzymes, radioactive tags,
quantum dots, light emitting moieties, light absorbing moieties,
and intercalating dyes. Each analyte is identified on the basis of
the correlation described above and the detectable label of the
analyte using methods known in the art.
[0280] Particle-Based Binding or Dissociation Measurement
[0281] As previously disclosed, it is an object of this invention
to provide improved particles, methods, and systems for detecting
binding between probe and target in biological and chemical assays.
In this respect, the improvements of the present invention over
current methods relating to particle-based assays have as a basis
the phenomenon that resonant scattering patterns are sensitive to
changes in the index of refraction at or near the surface of the
particle. As is known in the art (see for example Hightower, R. L.
and Richardson, C. B., "Resonant Mie scattering from a layered
sphere", Appl. Optics 27, 4850-4855 (1988) and the references
therein), a change of refractive index at the surface of a
microparticle changes the conditions (specifically the wavelengths)
at which resonances occur, and potentially the shapes and
intensities of the resonances, which are measurable phenomena.
Binding of target analytes to the surface of a microparticle in
aqueous suspension can be viewed as displacing water molecules with
chemical species that have, in general, indices of refraction
different from water. The bound molecule or structure will in
general have index of refraction greater than that of water.
Theoretical models developed by the inventors show that for a
typical microparticle of about 40 micrometers in diameter, binding
of a protein or nucleic acid layer shifts the entire scattered
light pattern in wavelength relative to the reference or
unbound-state, and the amount of shift is proportional to the
thickness of the bound layer up to thicknesses of about 50
nanometers. As noted above, thicker layers, i.e., up to about 10
micrometers, may be used, but layers with a thickness greater than
about 50 nanometers will alter the original resonances and in some
cases result in the production of additional light scattering
resonances in addition to the shift. It should be noted that this
phenomenon does not require the use of reporter groups, a
substantial improvement over existing particle-based assay
technology. It should also be noted that other changes near the
particle surface that may occur during binding, for example
conformational changes in the probe or target, could result in
shifts due to relative movement of chemical or physical groups and
thus changes in mass distribution near the surface. Since, as is
known in the art, the scattered light spectrum is affected by the
interaction of the evanescent light wave with the mass distribution
near the surface, changes in the mass distribution potentially lead
to changes the spectrum. The net mass distribution change relative
to the evanescent light wave upon binding a target moiety could be
either away from or towards the particle surface, depending on the
specific nature of the probe, target, surface charge, ionic
environment, and other factors. Resulting resonant light scattering
spectral shifts may thus be either "positive" (toward longer
wavelengths) or "negative" (toward shorter wavelengths) depending
on the assay being performed.
[0282] In general, when determining binding of an analyte by
resonant light scattering methods, two measurements are made, one
before exposing the particles to the analyte to establish a
baseline, and one after exposing the particles to the analyte, as
described above. The determination of binding is done by comparing
the two signatures and is thus typically a "differential"
measurement. Specifically, to detect binding of an analyte to a
capture probe, at least one capture probe is applied to the
particles of the present invention. The particles are optionally
scanned one or more times over the analytical wavelength range to
produce at least one first reference resonant scattering signature
for each particle, as described above. The particles are then
contacted with a sample suspected of containing an analyte. The
particles are then scanned one or more times to produce at least
one second binding resonant light scattering signature for each
particle. Detection of analyte binding is done by comparing either
any one of the second binding resonant light scattering signatures
to any one of the first reference resonant light scattering
signatures, preferably the one most recently obtained, or any one
of the second binding resonant light scattering signatures with a
previous second binding resonant light scattering signature in the
series. The amount of analyte in the sample may be determined as
described above.
[0283] It is also possible to detect the dissociation of an analyte
from the capture probe by similar differential measurement. To
detect dissociation, the probe-coupled microparticles are contacted
with at least one analyte to allow binding of the analyte to the
probe, and then the particles are scanned one or more times over
the analytical wavelength range to obtain at least one first
reference resonant light scattering signature for each particle.
Then, the analyte is dissociated from the capture probe of the
particle using any means known in the art. The means used to
dissociate the analyte from the probe will depend on the nature of
the analyte and capture probe. For example, for nucleic acid or
peptide nucleic acid binding pairs, dissociation may be effected by
increasing the temperature to melt the duplex or by treatment with
base. For antibody-antigen binding pairs, the analyte may be
dissociated by treatment with acid or base or a chaotropic agent
such as urea, guanidine hydrochloride or sodium thiocyanate. After
dissociation, the particles are scanned one or more times over the
analytical wavelength range to produce at least one second
dissociation resonant light scattering signature for each particle.
Dissociation is detected by comparing either any one of the second
binding resonant light scattering signatures to any one of the
first reference resonant light scattering signatures or anyone of
the second binding resonant light scattering signatures with a
previous second binding resonant light scattering signature in the
series.
[0284] Ideally, any shifts that occur will be due to the binding or
dissociation of target analyte molecules. Since the optical effects
used in this invention may be sensitive to variations in the
environment of the microparticles (e.g. temperature, ionic
strength, refractive index of the medium, etc.), undesired
variations in these parameters represent "noise" insofar as they
can contribute to changes in the scattered light pattern.
Accordingly, it will be useful in this invention to provide a means
of referencing to compensate for such effects, leaving only the
shifts due to actual binding of analyte remain as "signal". This
could be accomplished, for example by using some particles as
reference particles on which no probes are attached and which have
been treated if necessary to minimize non-specific binding. Any
shifts measured in these reference particles would be caused
primarily by environmental changes and could be used to compensate
shifts measured from the particles containing capture probes.
[0285] Additionally, when measuring resonant light scattering
spectral shifts, it is imperative that the wavelength component of
the acquired scattering spectra be known with high precision.
Timing uncertainty between the startup of the laser scan and the
start of computer data acquisition can result in apparent spectral
shifts in the data when no true shift has occurred. The spectral
data must therefore be corrected to remove any spurious "timing"
shifts. To determine how large a wavelength correction is needed,
it is necessary to record a reference spectrum with known and
stable features for wavelength registration. To accomplish
wavelength correction/registration with sufficient precision, it is
further important that the spectral features in the reference
spectra be fairly sharp. This correction may be done using etalons
(a device used in spectroscopy to measure wavelengths by
interference effects produced by multiple reflections between
parallel half-silvered glass or quartz plates) to produce
wavelength reference signals which can be aligned very accurately,
as described in detail in Example 3 below.
[0286] FIGS. 10-16 illustrate the detection of protein layers on a
40-micrometer diameter microparticle, using etalon correction,
according to the present invention. Details are given in Examples
3-6.
[0287] A significant advantage of the present invention is the
potential elimination of binding-related reporter groups in a
particle-based assay. Some non-labeled binding methods have been
developed for fixed arrays and on other fixed surfaces (for example
using surface plasmon resonance in a planar biosensor according to
Larsson, A. and Persson, B., "Method for nucleic acid analysis",
U.S. Pat. No. 6,207,381 and Lyon, L. A. et al., "An improved
surface plasmon resonance imaging apparatus", Rev. Scientific
Instruments 70, 2076-2081 (1999); Thiel, A. J. et al., "In situ
surface plasmon resonance imaging detection of DNA hybridization to
oligonucleotide arrays on gold surfaces", Anal. Chem. 69, 4948-4956
(1997)). However, no such label-free methods exist for
particle-based assays. Methods described in the literature relating
to particle-based assays, fluorophores, chromophores,
nanoparticles, or other reporter groups are either bound to the
target or associated in some way with the binding event. A typical
measurement is thus the amount of reporter bound to the particle by
its association with the target. Before the measurement is made,
the excess unbound reporter must be washed away to eliminate high
background readings. This takes time and eliminates the opportunity
for dynamic measurements, since essentially only an end point is
detected.
[0288] In the present invention, since only bound material is
detected by means of wavelength shifts in the scattered light
spectrum, the presence of unbound targets does not interfere with
the measurement in any way. A reporter group is not required for
this invention; however, a species associated with the target could
still be used to increase assay sensitivity by enhancing the
perturbation of refractive index near the particle surface upon
binding. Such a signal amplification means would preferably be a
small, dielectric particle attached to the analyte, for example a
titanium dioxide or silica nanoparticle. The particle should be
small enough not to interfere with binding between probe and target
and also small enough not to interfere with the detection of
scattered light resonances. Typically such a particle would be
several nanometers to tens of nanometers in size.
[0289] Another approach toward signal amplification would be to
employ a chemical reaction, such as an enzymatic reaction,
antibody/antigen reactions, or in situ nucleic acid amplification
methods such as rolling circle amplification. Such a method would
be specifically triggered to add mass to the particle surface only
when binding of a specific target occurs. Whether or not a signal
amplifying species is used, the washing step required in literature
methods is made optional and, most importantly, the measurement of
binding can still be made in real time during the course of the
experiment. This feature of the invention enables an entirely new
class of particle-based assay measurements, namely the rapid,
massively parallel determination of time-dependent binding on a
large population of identifiable microparticles, each carrying on
its surface a known capture probe. Those skilled in the art would
appreciate the large opportunity for applications of this
technology in such diverse areas as drug target screening,
proteomics, gene or protein expression analysis, and the like.
[0290] An additional advantage of the invention is that a unified
detection method and system may be employed for determining both
the particle identity and the degree of binding of an analyte. It
should be noted that the identity of a particle is contained in the
relative pattern of spectral features and not in the absolute
locations of the features. When a target is bound, the relative
pattern (i.e. the particle identity) is preserved while the pattern
shift is indicative of the degree of analyte binding. The use of a
unified detection method results in a simpler overall system with
fewer reagents, less hardware, and simplified protocols compared to
current methods, resulting in a faster, less costly, and more
automatable system.
[0291] The final step to determining the presence and optionally
the concentration of a given analyte is the association of a
specific probe or capture probe with the microparticle whose
scattering spectrum has shifted. As explained previously, in a
preferred embodiment of the present invention, this association may
be provided by the unique identity of the microparticle as
reflected in the pattern of resonant light scattering spectral
features. By this method, the binding properties of a complex
sample can be determined in a single experiment, including not only
which specific targets have bound but also the kinetics of binding
under defined conditions. Alternatively, the probe and analyte
identity may be determined by other techniques already known in the
art, while the presence and optionally the concentration of a given
analyte is determined by resonant light scattering, as illustrated
in the following Examples.
EXAMPLES
[0292] The present invention is further defined in the following
Examples. It should be understood that these Examples, while
indicating preferred embodiments of the invention, are given by way
of illustration only. From the above discussion and these Examples,
one skilled in the art can ascertain the essential characteristics
of this invention, and without departing from the spirit and scope
thereof, can make various changes and modifications of the
invention to adapt it to various uses and conditions.
[0293] General Methods
[0294] Standard recombinant DNA and molecular cloning techniques
used in the Examples are well known in the art and are described by
Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A
Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring
Harbor, (1989) (Maniatis) and by T. J. Silhavy, M. L. Bennan, and
L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. (1984) and by Ausubel, F. M.
et al., Current Protocols in Molecular Biology, Greene Publishing
Assoc. and Wiley-Interscience, New York, N.Y. (1987).
[0295] The meaning of abbreviations used is as follows: "min" means
minute(s), "h" means hour(s), ".mu.L" means microliter(s), "mL"
means milliliter(s), "L" means liter(s), "nm" means nanometer(s),
"mm" means millimeter(s), "cm" means centimeter(s), ".mu.m" means
micrometer(s), ".ANG." means angstrom(s), "mM" means millimolar,
"M" means molar, "mmol" means millimole(s), ".mu.mol" means
micromole(s), "pmol" means picomole(s), "nmol" means nanomole(s),
"g" means gram(s), ".mu.g" means microgram(s), "mg" means
milligram(s), "V" means volts, "dc" means direct current, "g" means
the gravitation constant, "W" means watt(s), "mW" means
milliwatt(s), "PBS" means phosphate-buffered saline, "rpm" means
revolutions per minute, and "PEGM" means poly(ethylene glycol)
methacrylate.
[0296] The resonant light scattering spectral shifts reported in
the following Examples are given as the mean.+-.the standard
deviation.
Example 1
Identification of Individual Glass Microparticles by Resonant Light
Scattering
[0297] The purpose of this Example was to demonstrate the
identification of individual glass microparticles using resonant
light scattering spectra using an optical probe system.
[0298] Spherical glass microparticles of refractive index
approximately 1.9 and diameter approximately 35-40 .mu.m (MO-Sci
Corp., Rolla, Mo., Product number GL-0175, Lot 7289552-S1) were
used without further treatment. Approximately 0.5 g of particles
was placed in approximately 10 mL of distilled water and a
suspension was created using a magnetic stir bar. A sample of
approximately 0.1 mL of this suspension was placed on the top
Teflon.RTM. AF 2400 (DuPont Co., Wilmington, Del.) window of
thickness about 2 mm 001 as shown in FIG. 3. The suspension was
optionally covered with a Teflon.RTM. AF 2400 cover film (about
0.05 to 0.13 mm thickness) 003 and the glass microparticles 002
were allowed to settle to the upper surface of the top window 001.
The cell was then sealed with screws. The cell was placed on a
translation stage in the detection apparatus of FIG. 4. The center
excitation fiber 004 of a multi-fiber optical probe 005 (RoMack,
Inc., Williamsburg, Va.) was connected to a tunable diode laser
light source 006 (Model AQ4321, Ando Electric Co. Ltd., Germantown,
Md.). A chopper internal to the laser controller was used to
modulate the laser light. The outer six collection fibers 007 were
optically combined and the combination connected to a light
detector 008 (Model 2011, New Focus Inc., San Jose, Calif.). The
signal output was in turn routed to a lock-in amplifier 009 (Model
5301A, EG&G Princeton Applied Research, Oak Ridge, Tenn.) used
in synchronous detection mode with the chopper. The output of the
lock-in amplifier was routed to a data acquisition board
(PCI-6110E, National Instruments, Austin, Tex.) installed in a
personal computer 010 (Dell Precision 420 Workstation, Dell
Computer Corporation, Round Rock, Tex.). Custom software was
written to control the laser scan and to acquire and display the
scattered light intensity as a function of wavelength.
[0299] To acquire a scattered light spectrum from a single
particle, the fiber optic probe 005 was centered above one particle
by moving the translation stage 011 containing the optical cell 014
with the aid of a microscope-mounted video camera 012 (model
KP-M2RN CCD camera, Hitachi Instruments, San Jose, Calif., coupled
to a Wild Makrozoom Type 246634 microscope 013, Leica Microsystems,
Bannockburn, Ill.) mounted underneath the cell. The image of field
of view of the fiber optic probe was displayed on a video monitor
017. An additional layer of water 016 was used to optically couple
the detection probe with the sample microparticles. Once the probe
was aligned with a single particle, the diode laser 006 was scanned
in wavelength (typically from 1570 to 1620 nm in 20 s). The
resulting scattered light spectrum was acquired, displayed, and
stored on disk. This process was repeated to acquire spectra from
other particles in the sample. A representative set of spectra is
shown in FIG. 5. It can be seen that each particle has a unique
scattering spectrum. These spectra could be further subjected to
automated spectral analysis techniques in order to extract features
that uniquely identify each particle.
Example 2
Identification of a Multiplicity of Glass Microparticles by
Resonant Light Scattering Imaging
[0300] The purpose of this Example was to demonstrate the
identification of a multiplicity of glass microparticles by
resonant light scattering using a spectral imaging system.
[0301] The spectral imaging system shown in FIG. 7 was used to
acquire and process resonant light scattering spectra from multiple
glass microspheres simultaneously. The optical cell of FIG. 3 was
modified as shown in FIG. 6 by replacing the water underneath the
top Teflon.RTM. AF 2400 window with an ink absorber solution 018,
which consisted of 1 part ink (Higgins Fountain Pen India Ink, Item
46030-723, Sanford Co., Bellwood, Ill.) to 100 parts distilled
water. The ink solution served to absorb any incident light that
had not interacted with the microspheres, thereby reducing optical
noise from scattering and back reflection. The imaging optical cell
019 was loaded with glass microparticles 002 as in Example 1 and
placed in the stage of a commercial optical microscope 021 (Model
DMRXE, Leica Microsystems) fitted with objective lens 020.
Particles with an index of refraction of approximately 1.9
comprised about 70% of the particles of this Example; particles
with an index of refraction of approximately 1.7 comprised about
30%.
[0302] The Teflon.RTM. AF film 003, used for isolating the
particles and their liquid environment from the optical system, was
optional and did not affect the results of the analysis. The use of
such a film, or its equivalent, was determined by the length of the
experiment, the temperature, the rate of evaporation loss from the
solution surrounding the particles, the time scale of the
experiment, and other factors. When the film 003 was used, an
additional layer of water was added between the film and the
optical probe in order to provide efficient optical coupling of the
signal. The microscope 013 was set up for bright field illumination
using a diode laser 022 (Model Velocity 6312, New Focus, Inc.) as
the light source. The output of the laser was coupled into a 4 mm
diameter plastic fiber 023 and the output of this fiber placed in
the illumination optical train of the microscope, replacing the
standard light source. The fiber was mechanically vibrated by
attaching the shaft of a miniature "buzzer" motor 024 (Marlin P.
Jones & Assoc. Inc., Lake Park, Fla., Item #12342-MD), driven
by approximately 3 V dc, directly to the fiber. This vibration
served to eliminate the laser speckle pattern in the illumination
field, which would otherwise interfere with the acquisition and
analysis of image data. The standard beam splitter installed by the
microscope manufacturer was replaced by a pellicle-type beam
splitter 025 (Edmund Industrial Optics, Barrington, N.J., Item
#A39-481) in order to further eliminate interference fringes in the
image.
[0303] To acquire scattering spectra from a multiplicity of
particles simultaneously, a set of particles was first placed in
the field of view of the microscope and focused with the objective
lens 020. Depending on the wavelength of the diode laser, this was
accomplished by illuminating the sample, either with the laser
itself or with an alternate light source that temporarily replaced
the laser, for example a helium-neon laser. Once the particles of
interest were in the field of view and focused, the laser was
scanned in wavelength, typically from 770 to 780 nm in 20 s. During
this scan, the digital camera 026 (Model KP-M2RN, Hitachi
Instruments) acquired a complete scattered light image of the field
of view at each wavelength. Each image was captured by an image
capture board 027 (IMAC PCI-1409, National Instruments) installed
in a personal computer 010 (Dell Precision 420 Workstation). Custom
software was written to store each image. A wavelength scan
resulted in a set of linked images, one for each wavelength in the
scan. A typical image is shown in FIG. 8.
[0304] To determine the scattering spectra of each particle in the
field of view from a set of wavelength-linked images, software was
written to identify a representative region or regions of the image
corresponding to each particle, for example a portion of the
ring-shaped scattered light image 106 surrounding the bright spot
of reflected light 107 at each particle center as seen in the image
of FIG. 8. In this Example, the incident and scattered light beams
were polarized independently, with the two axes of polarization
parallel to each other. This results in sectors of scattered light
centered approximately at the 12:00, 3:00, 6:00, and 9:00 positions
of the circle as indicated for the center image of FIG. 8 by the
numbers 12, 3, 6, and 9 respectively. Theory predicts, and results
confirm, that scattered light spectra from the "12" and "6" regions
are equivalent and scattered light spectra from the "3" and "9"
regions are equivalent. Furthermore, spectra from the two pairs of
sectors are different from one another. This results in the ability
to identify a particle by a combination of two substantially
independent spectra, rather than a single spectrum, increasing the
multiplicity of identifiable particles and also the accuracy of
identification.
[0305] The concept of polarization-dependent spectra is illustrated
for a single particle in FIG. 9. Regions at "12" and "3" positions
were identified as the regions of interest from which pixels were
chosen to represent the particle's scattering spectrum. The pixels
were chosen as follows. First a region of the image (for example,
at 12:00 in FIG. 9) was selected from the larger image. Within the
selected area, software calculated the spectra represented by each
pixel in the stack of images L1, L2, L3 . . . Ln, where each image
is acquired at a single wavelength. Then a selection algorithm was
used to choose those pixels for which the corresponding spectra met
or exceeded a selection criterion. In this Example, the criterion
was to select the 10 to 20 pixels in the selected area for which
the quantity (Max-Min)/Min was the highest (if Min=0, the software
set Min=1), where Max is the maximum value of the intensity in the
spectrum and Min is the minimum value of the intensity in the
spectrum. The spectra for these pixels were then averaged. Examples
of such spectra are shown on the right side of FIG. 9. Shown are
spectra for the "12" and for the "3" regions. As indicated above,
the spectra for these regions are different.
[0306] The above pixel selection criterion is illustrated as an
example only, and represents one measure of the contrast between
spectral peaks and the underlying spectral baseline. Other
criteria, or combination of criteria, could also be used to select
specific pixels from a larger set.
[0307] The use of unique spectra to identify a multiplicity of
particles is illustrated by the following example. Pairs of spectra
(one from the "12" and one from the "3" region of each particle)
were obtained from 87 different particles as explained above. Each
spectrum contained 1500 data points from wavelength 770 nm to 780
nm. These spectra were used as "fingerprints" to identify the
particles. Each particle's "12" spectrum was compared to the "12"
spectra of all the other particles in the set. Quantitatively, the
correlation coefficient squared (R-squared) was calculated between
each particle's "12" spectrum and all the other particles' "12"
spectra. The same correlation calculation was done for each
particle's "3" spectrum and all other "3" spectra in the set. The
degree of uniqueness of each particle's "fingerprint" was
determined by determining if any particle (say Particle n) appeared
sufficiently similar to any other particle (say Particle m) in the
set according to the following algorithm:
IF R-Squared(Pn, Pm, 12)>T AND R-Squared(Pn, Pm, 3)>T THEN
Particle_match=True
Otherwise: Particle_match=False
[0308] Where:
[0309] R-Squared(Pn, Pm, 12)=the correlation coefficient squared
between the scattered light spectra of Particle n and Particle m,
taken from the "12" position of the scattered light image
[0310] R-Squared(Pn, Pm, 3)=the correlation coefficient squared
between the scattered light spectra of Particle n and Particle m,
taken from the "3" position of the scattered light image
[0311] T=a threshold value
[0312] Particle_match=True if the particles are considered to have
the same identity, False otherwise
[0313] The purpose of developing pixel selection and particle
similarity criteria was to develop an effective means for uniquely
identifying all particles in a set. Ideally, if the spectra are
sufficiently unique, and the threshold is chosen appropriately, no
particle matches should exist by the above algorithm. In this
Example, setting T between 0.75 to 1.0 resulted in completely
unique spectral signatures for all 87 particles. This means there
were no "false positives", i.e., two particles assigned as matched.
Reducing T to 0.60 resulted in 10 false positives out of 4950
combinations (accuracy reduced from 100% to 99.8%), since the
stringency of match is reduced and particles that are somewhat
similar are now accepted as identical. Thus, in this Example, a
threshold of 0.75 was appropriate to prevent false positives.
[0314] It was also necessary to test for "false negatives", i.e.,
when two scans of the same particle, taken at different times,
under different environmental conditions, or with slight variations
in the pixel selection criterion, fail to match by the algorithm
chosen. The ability to faithfully identify the particles in spite
of such variabilities was tested in the following way. For 4 of the
particles, different, independent spectral scans of the same
particle, taken at different times or by using small variations on
the pixel selection criterion, were used as image data sources. A
total of 13 different variations of these particles were used.
Again, setting T=0.75 resulted in perfect matches with no false
negatives. Increasing T to 0.90 resulted in 7 false negatives out
of 4950 combinations (accuracy reduced from 100% to 99.9%), and at
T=0.95 the accuracy was reduced from 100% to 99.7% (14 false
negatives out of 4950 combinations). This reflects the fact that
when using very high stringency requirements, small variations in
spectra from the same particle under slightly different conditions
can lead to a failure to match. However, this Example clearly shows
that for a representative set of particles, a pixel selection
criterion and a similarity criterion can be defined such that very
high accuracy of particle identification can be obtained.
[0315] The Example shown here is for illustration only, and could
readily be extended and automated to identify and track larger
numbers of particles. For example, advanced pixel selection
criteria, pattern recognition techniques, and spectral coding
methods could be developed by one skilled in the art to locate and
identify each particle in a field of many particles.
Example 3
Detection of Binding of Avidin on Biotinylated Microparticles Using
Resonant Light Scattering
[0316] The purpose of this Example was to demonstrate detection of
avidin binding to biotinylated glass microparticles using resonant
light scattering. Amine groups were introduced on the surface of
glass microparticles using silane chemistry. Then, the
microparticles were biotinylated by reaction with Sulfo-NHS-SS
Biotin. Avidin binding to the biotinylated microparticles was
detected using resonant light scattering. Reversibility of the
binding signal upon cleaving the avidin from the particle was also
demonstrated.
[0317] A. Surface Preparation of Microparticles:
[0318] High-refractive index glass microparticles (Mo-Sci Corp.,
Rolla, Mo., Product number GL-0175, Lot 7289552-S1, refractive
index approximately 1.9) were first cleaned by leaching with 0.5 M
HNO.sub.3 at room temperature for 5 min. The glass particles were
then treated with the following series of steps: a deionized water
rinse, treatment with 5-10% NaOH at room temperature for 30 min, a
water rinse, and drying at 110.degree. C. in a vacuum oven
overnight.
[0319] The cleaned glass microparticles were silanized with
3-aminopropyl triethoxysilane (Aldrich, Milwaukee, Wis., product
number 440140, lot number 20515DA) by refluxing in anhydrous
toluene for 24 h to introduce amine groups on the surface of the
particles. The reaction mixture was filtered to isolate the
silanized microparticles. The silanized microparticles were then
rinsed with toluene and acetone in sequence, followed by drying in
air for 0.5-1 h and cured at 110-120.degree. C. in an oven for a
period ranging from 4 h to overnight.
[0320] The surface coverage of amine groups on the silanized
microparticles was determined by titration. Before the titration,
0.3 g of silanized microparticles was dispersed in 50 mL of
distilled water that contained 1 mL of a 1% acetic acid solution.
The acetic acid was used to soften the glass microparticles to
allow the titrant access to all amine groups. The microparticle
dispersion was stirred and heated to 40.degree. C. for 4 h, then
allowed to cool to room temperature prior to titration. The surface
amine groups on the microparticles were then titrated using diluted
perchloric acid (0.0259 N) as titrant. The surface amine coverage
was found to be 0.045 mmol per gram of microparticles. The
silanized microparticles were also analyzed using ESCA (Electron
Spectroscopy for Chemical Analysis). The ESCA results indicated
that about 5% of the silanized microparticle surface elements were
nitrogen atoms from the amine groups.
[0321] B. Microparticle Surface Biotinylation:
[0322] Biotinylation was carried out by incubating the silanized
microparticles in 2-fold molar excess of
sulfosuccinimidyl-2-(biotinamido- ) ethyl-1,3-dithiopropionate
(Sulfo-NHS-SS-Biotin) (Pierce Biotechnology Inc., Rockford, Ill.;
product number 21331, lot number DD53927), dissolved in pH 7.4, 0.1
M phosphate buffered saline (PBS) at a concentration of 25 mg/mL.
The microparticles were incubated in this solution for 0.5-1 h at
room temperature. The surface amine groups react with
N-hydroxysulfosuccinimide (NHS) at neutral pH values and above,
resulting in covalent binding of biotin to the microparticle
surface. The unreacted Sulfo-NHS-SS-Biotin was removed with a
buffer wash using a microconcentrator (Centriplus.RTM. Centrifugal
Filter, Model YM-100, Millipore Corporation, Bedford, Mass.). The
biotinylated microparticles were then dried in vacuum at room
temperature overnight.
[0323] C. Biotin-Avidin Binding:
[0324] A procedure based on Example 2 was used to measure the
scattered light spectrum of the microparticles. The biotinylated
microparticles prepared by the procedure of part B were dispersed
in pH 7.4, 0.4 M (0.1M sodium phosphate, 0.3 M NaCl) PBS buffer. An
aliquot of this suspension was placed in an optical cell. For this
experiment, the cell 019 shown in FIG. 6 was modified for use as a
flow cell by removing the upper Teflon.RTM. AF film 003 and
incorporating fluid inlet and outlet ports on the side of the cell.
A field of view was selected that contained a number of
microparticles. The diode laser light source 022 was then scanned
between 770 and 780 nm in 50 s. At each wavelength interval, a
digital image of the scattered light from all particles in the
field of view was acquired by the image capture board 027 and the
data was stored and analyzed by software installed in the personal
computer 010. Several microparticles in the field of view were
selected for subsequent detailed spectral analysis, for example as
shown in FIG. 10A. FIG. 10A is one of the 1500 individual scattered
light images taken during a wavelength scan, one for each
wavelength step. By analyzing the full set of wavelength-dependent
scattered light images as described in Example 2, a scattered light
spectrum from this particle was obtained. The scattered light
spectrum from the upper left microparticle of FIG. 10A is shown in
FIG. 10B.
[0325] To bind avidin to the biotinylated surface, a solution
consisting of 56 .mu.g/mL of fluorescein isothiocyanate-labeled
avidin (FITC-avidin) (Sigma Chemical Co., St. Louis, Mich., product
number A2050, Lot 091 K4842, FITC/protein molar ratio=3.9) in pH
7.4, 0.4 M PBS buffer was flowed through the biotinylated
microparticles for 15 min at a flow rate of about 1.45 mL/min. The
sample cell was then flushed with pure PBS buffer, so that the
resonant light scattering was measured in the same medium as that
used before binding. The binding was confirmed independently by
fluorescence detection of the fluorescein label.
[0326] To accurately measure the absolute wavelength shift between
scattered light spectra, it is necessary to account for variations
in laser scan trigger timing. This was done by using two etalons to
produce wavelength reference signals which can be aligned very
accurately, thus correcting for any scan timing variability. The
etalon referencing technique is explained in more detail in Section
E, infra. One example of wavelength-aligned spectral comparison
before and after avidin binding is shown in FIG. 10C. The shift was
quantified by calculating the cross-correlation coefficient squared
(R-squared) between the spectra before and after binding of
FITC-avidin, as a function of an induced wavelength shift between
the spectra. One of the two spectra was artificially shifted in
wavelength relative to the other, and the R-squared value between
them was calculated. The spectrum was then shifted again; the
R-squared value was recalculated, and so on, generating a
relationship between the shift and the correlation. The R-squared
value would be expected to maximize at the wavelength shift
corresponding to the natural shift induced by addition of the
FITC-avidin to the microparticle. The results of this analysis are
shown in FIG. 11 in which the shift is expressed as the difference
between the maximum of etalon correlation and the maximum of the
scattering spectra correlation. After spectral alignment, the
wavelength shift induced by avidin binding was 0.034.+-.0.007 nm
for a data set consisting of 54 independent laser scan comparisons
over four independent particles and also over two different
days.
[0327] A comparable data set from another experimental run on a
different date, using the same protocol as above, yielded a
wavelength shift of 0.038.+-.0.010 (N=36 measurements, one
particle) upon specific binding of avidin, showing good day-to-day
reproducibility of the spectral shift measurements.
[0328] The binding of avidin on biotinylated microparticles was
also quantified using the Bradford method for protein determination
(Bradford, Anal. Biochem. 72, 248-254 (1976)). As the biotinylation
reagent Sulfo-NHS-SS-Biotin adds a disulfide bond in the
biotin-microparticle linkage, the entire avidin-biotin conjugate
can be cleaved from the microparticle by reducing agents such as
2-mercaptoethanol or dithiothreitol (DTT). After a 40 min
incubation of the avidin-bound microparticles in 50 mM DTT (Sigma
Chemical Co., product number D-9779, lot number 072K0916) in pH
7.4, 0.4 M PBS, the Bradford method was used to determine how much
avidin was released in the incubation supernatant. The result was
2.28 nmol of avidin per gram of microparticles, corresponding to
approximately a monolayer coverage of avidin on the
microparticles.
[0329] D. DTT Cleavage:
[0330] Reversibility of the resonant light scattering spectrum
shift resulting from avidin binding was tested by removing the
biotin/avidin complex from the microparticles by DTT treatment. DTT
reduced the disulfide bonds of the biotin linkage to the
microparticles obtained in step B. About 40 mL of 50 mM DTT in pH
7.4, 0.4 M-PBS was passed through the optical cell and over the
microparticles, followed by a 15-min incubation. The sample cell
was then flushed with pH 7.4, 0.4 M PBS, and resonant light
scattering spectra were taken. The scattering spectra before and
after DTT treatment are given in FIG. 12 and the relative shift, as
measured by autocorrelation function, as explained above, is shown
in FIG. 13. The reverse shift induced by DTT treatment was
confirmed by multiple runs and different microparticles, and the
average was -0.034.+-.0.007 nm, indicating the removal of the
biotin/avidin complex from the microparticles.
[0331] These results demonstrate that it is possible to detect
protein binding and release on a multiplicity of microparticles
using resonant light scattering.
[0332] E. Wavelength Alignment Using Etalons:
[0333] When measuring resonant light scattering spectral shifts, it
is imperative that the wavelength component of the acquired
scattering spectra be known with high precision. Timing uncertainty
between the startup of the laser scan and the start of computer
data acquisition can result in apparent spectral shifts in the data
when no true shift has occurred. The spectral data must therefore
be corrected to remove any spurious "timing" shifts. To determine
how large a wavelength correction is needed, it is necessary to
record a reference spectrum with known and stable features for
wavelength registration. To accomplish wavelength
correction/registration with sufficient precision, it is further
important that the spectral features in the reference spectra be
fairly sharp.
[0334] We chose to use planar etalon spectra as the reference
spectra. An etalon is a device used in spectroscopy to measure
wavelengths by interference effects produced by multiple
reflections between parallel half-silvered glass or quartz plates.
We used two glass plates with different thickness (specifically, 1
mm and 0.15 mm thick borosilicate glass) to give us a high and low
frequency component in the interference pattern. The equation for
the transmission of an ideal etalon, an Airy Function, is 1 T = [ 1
+ 4 R ( 1 - R 2 ) sin 2 ( 2 ) ] - 1
[0335] where:
[0336] T=transmission
[0337] R=reflectivity of the mirrors
[0338] .phi.=the roundtrip phase change of the light ray
[0339] If any phase change at the mirror surfaces is ignored then 2
= 2 2 nd cos
[0340] where:
[0341] .lambda.=the wavelength of the light
[0342] n=the index of refraction of the material between the
mirrors
[0343] d=the distance between the mirrors
[0344] .theta.=the angle of the incoming light beam
[0345] The two etalons of different thicknesses, and thus giving
rise to different spectral frequencies (or relatively "broad" and
"narrow" interference fringes), were used in series to eliminate
the possibility of misaligning the data if a false "timing" shift
was more than a single narrow interference fringe. Each time a
laser scan was taken, an etalon spectrum was acquired
simultaneously with a resonant light scattering spectrum. The
reference etalon spectra for two laser scans to be compared were
analyzed by an autocorrelation algorithm to determine the magnitude
of any false spectral shift, which was then used to correct the
resonant light scattering data. The two spectra were shifted
incrementally in wavelength relative to one another, and the
autocorrelation coefficient between them was computed at each
wavelength increment. The maximum of the autocorrelation
coefficient occurred when the spectra were best aligned, and the
wavelength shift corresponding to the maximum correlation of the
reference etalon spectra was used to correct the apparent shift in
the corresponding resonant light scattering spectra.
[0346] An example of two scattered light spectra to be compared for
spectral shift is shown in FIG. 14A. As shown, these spectra have
not been wavelength-aligned so the true spectral shift is unknown.
During each wavelength scan, a portion of the incident light is
routed to the etalons simultaneously, thus producing an
interference pattern that accurately reflects the wavelength scale
for that scan. An example of two etalon spectra associated with the
two scattered light spectra to be compared are shown in FIG. 14B. A
correlation analysis was then performed between the original pair
of spectra (FIG. 14A) and between the pair of etalon traces (FIG.
14B). An example of such an analysis is shown in FIG. 14C, which
shows the original spectra to be shifted 0.185 nm and the etalon
spectra to be shifted 0.145 nm. Therefore, the net shift of the
scattered light spectra due to binding is the difference between
these two shifts or 0.040 nm. The wavelength-corrected spectra are
shown in FIG. 14D.
Example 4
Detection of Multiple Protein Layer Binding in a
Biotin-Avidin-Based Sandwich Assay Using Resonant Light
Scattering
[0347] The purpose of this Example was to demonstate the
measurement of multiple protein layer binding, based on
biotin-avidin interaction, on glass microparticles using resonant
light scattering. Biotinylated glass microparticles were reacted in
sequence with avidin, biotinylated anti-bovine IgG, and bovine IgG.
The binding after each step was detected using resonant light
scattering.
[0348] A. Surface Preparation and Microparticle Surface
Biotinylation:
[0349] The same high refractive index glass microparticles and the
same microparticle surface biotinylation protocol as described in
Example 3 (steps A and B) were used.
[0350] B. Biotin-Avidin Binding:
[0351] For in situ binding detection using resonant light
scattering, the same procedure as described in Example 3 was used.
Before avidin binding, resonant light scattering spectra were taken
on biotinylated microparticles in pH 7.4, 0.15 M (0.01M sodium
phosphate, 0.14 M NaCl) PBS. Then 20 mL of a solution consisting of
75 .mu.g/mL avidin (from egg white, Sigma Chemical Co., product
number A9275, lot number 22K7017) in pH 7.4, 0.4 M (0.1 M sodium
phosphate, 0.3 M NaCl) PBS buffer was passed through the sample
cell containing the biotinylated microparticles at a flow rate of
about 1.5 mL/min. The cell was then flushed with pure pH 7.4, 0.15
M PBS, so that the resonant light scattering was measured in the
same medium as that used before binding.
[0352] C. Avidin-Biotinylated Antibody Binding:
[0353] After step B, 20 mL of a solution consisting of 50 .mu.g/mL
of biotinylated anti-bovine immunoglobulin G (IgG) [H+ L] [Goat]
(Rockland Inc., Gilbertsville, Pa., product number 601-1602, lot
number 1040, biotinylation sites were randomly distributed over the
whole IgG molecule, about 10-20 biotinylated sites per IgG
molecule) in pH 7.4, 0.15 M PBS was passed through the sample cell
at a flow rate of about 1.5 mL/min. The microparticles were then
incubated in the biotinylated anti-bovine IgG solution for 1 h.
Afterwards, the sample cell was flushed with the same PBS, and
multiple resonant light scattering spectra were taken.
[0354] D. Antibody-Antigen Binding:
[0355] After Step C, 20 mL of a solution consisting of 50 .mu.g/mL
of bovine IgG (Sigma Chemical Co., product number 1-5506, lot
number 042K9023) in pH 7.4, 0.15 M PBS was passed through the
sample cell at a flow rate of about 1.5 mL/min. The microparticles
were then incubated in the bovine IgG solution for 1 h. Afterwards,
the sample cell was flushed with the same PBS, and multiple
resonant light scattering spectra were taken.
[0356] Examples of the spectra from steps B-D are shown in FIG. 15.
All spectra were aligned with etalon correction, as described in
Example 3. The spectrum shifts of steps B, C and D compared to the
reference (unbound) state were, respectively 0.031.+-.0.005 nm,
0.069.+-.0.007 nm and 0.077.+-.0.008 nm, determined by the
autocorrelation method (all averages with N=18 measurements). These
results show clearly that the sequential binding of avidin,
anti-IgG, and IgG were individually measurable. The shift increase
induced by bovine IgG binding was small compared to that induced by
avidin binding and biotinylated anti-bovine IgG binding. It is most
likely that the biotinylated anti-bovine IgG molecules bound to
avidin in a random orientation, and their antigen binding ends were
not optimally aligned and exposed for the binding of bovine IgG
molecules.
[0357] E. DTT Cleavage
[0358] The same DTT treatment as described in Example 3 was
performed to cleave the biotin/avidin/anti-IgG/IgG complex from the
microparticles. The reverse spectral shifts were observed for all
different runs and microparticles, and the average shift relative
to the starting condition was 0.026.+-.0.008 nm (N=18
measurements). These results indicate that most bound protein
layers were released from the microparticles upon DTT treatment,
and only a part of the first biotin/avidin layer was left on the
surface.
Example 5
Detection of Multiple Protein Layer Binding in a Protein G-Based
Sandwich Assay Using Resonant Light Scattering
[0359] The purpose of this Example was to demonstrate the
measurement of multiple protein layer binding with controlled
orientation on glass microparticles using resonant light
scattering. Protein G' was coupled to amine-derivatized
microparticles with a bifunctional crosslinking agent. The binding
of mouse IgG and then, anti-mouse IgG to the Protein G'
microparticles was detected using resonant light scattering.
[0360] A. Surface Preparation and Derivatization of Protein G' on
the Microparticle Surface:
[0361] The same high refractive index glass microparticles (RI=1.9,
Mo-Sci GL-0175) and the same amino silanization protocol as
described in Example 3 (step A) were used to introduce amine groups
on the microparticle surface. Such microparticles are herein
referred to as amine microparticles. Protein G is a bacterial
membrane protein prepared from a group G Streptococcal strain. It
can specifically bind the constant region (Fc) of mammalian IgG
molecules. Therefore, protein G can be used to control the
orientation of the IgG molecules. Protein G' is a truncated protein
which lacks the albumin, Fab, and membrane binding sites while
retaining the Fc binding site; therefore it is more specific for
IgG than the native form. Protein G' was coupled to the amine
microparticles with the bifunctional linker
dimethylpimelimidate.2HCL (DMP). Protein G' (Sigma Chemical Co.
product P-4689, Lot 042K15451) was lyophilized from Tris-HCl
buffer, and needed to be buffer exchanged to the crosslinking
buffer (pH 8.0, 0.1 M PBS). Protein G' (1 mg) was dissolved in 0.5
mL of deionized water, and the buffer salts were removed using a
Centriplus.RTM. YM-10 microconcentrator (Millipore Corp.,
Billerica, Mass.). This process was repeated three times, and
Protein G' was reconstituted with 0.5 mL of pH 8.0 PBS. At the same
time, about 10 mg of DMP (Pierce Biotechnology Inc., Rockford,
Ill.; product number 20666, Lot DH55682) was dissolved in 1 mL of
pH 8.0, 0.1 M PBS and then 0.6 g of amine microparticles was added
to the DMP solution. This mixture was vortexed and then incubated
at room temperature for about 0.5 h. After this time, the excess
DMP was washed away with PBS buffer using the microconcentrator,
and the DMP-reacted microparticles were transferred to the protein
G' solution. The microparticle suspension was vortexed, and then
incubated for about 1.5 h while mounted on a rotator. Then, the
supernatant was removed and pH 8.5, 0.2 M Tris buffer was added to
quench the reaction and the solution was incubated for 1 h. The
microparticles were then washed thee times with PBS buffer, using a
centrifuge with a swinging-bucket rotor to collect the
microparticles.
[0362] The Protein G' microparticles were tested using a direct
ELISA (Enzyme Linked Immunosorbent Assay) to verify that the
Protein G' was successfully coupled to the microparticles and to
determine the probe density. In the ELISA test, a series of
accurately weighted Protein G' microparticles and control
microparticles, which did not contain Protein G', were incubated in
Rabbit anti-Chicken IgY, (H+ L), peroxidase conjugate (Pierce, Cat.
No. 31401, a Rabbit IgG peroxidase conjugate) at different
concentrations. Then, the microparticles were washed seven times.
OPD substrate (Pierce, Cat. No. 34006) solution was added to each
protein G' microparticle sample and control microparticle sample
and the samples were incubated for 15 min. After this incubation,
stopping solution (1 M sulfuric acid) was added to each sample. The
peroxidase conjugate standards were treated in the same manner. The
supernatant from each microparticle sample and the standard
solution of equal volume were transferred to a 96 well microtiter
plate to measure the absorbance. There was very little absorbance
from the control microparticle samples. The saturated absorbance
obtained at high enzyme conjugate concentration for protein G'
microparticles was used to calculate the protein G' surface
density. The calculated protein G' surface density was 0.44 pmol
per gram of microparticles with the assumption that each Protein G'
molecule binds two IgG molecules (Akerstrom, B. and Bjorck L. J.
Biol. Chem., 261, 10240-10247 (1986)). Compared to the activity of
the free enzyme in solution, the activity of an immobilized enzyme
might be reduced. Therefore, the ELISA result was not accurate
based on a standard curve acquired from the free enzyme and an
enzyme activity-reducing factor was determined and used for
activity correction. Binding experiments were carried out with
incubation of excess Protein G' microparticles in very dilute
solutions of rabbit anti-chicken IgY, (H+ L), peroxidase conjugate.
The enzyme activity taken up by the particles was determined from
the difference in enzyme activity in the peroxidase conjugate
solution before and after binding to the Protein G' microparticles.
The enzyme activity on the particles was then measured. The enzyme
activity-reducing factor was calculated as the ratio of enzyme
activity taken up by the Protein G' particles to the enzyme
activity measured on the particles. The enzyme activity-reducing
factor was determined to be 26, 19 and 18 in three tests. The
median activity-reducing factor of 19 was used to correct the
Protein G' surface density, resulting in a corrected Protein G'
surface density of 8.36 pmol per gram of microparticles.
[0363] A second approach was also used to determine the probe
surface density. Protein G, Alexa Fluor488 conjugate (Molecular
Probes, catalog number P-11065) was coupled to the amine
microparticles with a cleavable bifunctional linker
3,3'-dithiobis(sulfosuccinimidylpropionate) (DTSSP, Pierce, Catalog
number 21578), in the same way that Protein G' was coupled to the
amine microparticles with DMP. The Protein G, Alexa Fluor488
conjugate was then cleaved with 50 mM DTT at 37.degree. C.
overnight to ensure complete cleavage. The supernatant from the
cleavage was examined with a spectrophotometer, and the absorbance
at 494 nm was used to calculate the concentration of the Alexa
Fluor488 dye using the manufacturer's suggested extinction
coefficient of 71,000 cm.sup.-1M.sup.-1. The Protein G
concentration was then calculated from the ratio of 2.3 moles of
dye per mole of protein which was determined by the manufacturer.
The results indicated that the Protein G density was 1.3 nmol per
gram of microparticles, about 150 times larger than the corrected
ELISA result. This result suggested that the enzyme
activity-reducing factor may not be sufficient to correct the ELISA
results for the Protein G probe density determination on the
microparticles. However, the ELISA test can be applied to
microparticles prepared from all linking chemistries, and was used
for probe density measurements on most of the derivatized
microparticles in this disclosure. The ELISA results are valid to
compare probe derivation efficiency from batch to batch, but may
not be suitable to determine an absolute number for the probe
density.
[0364] B. Mouse IgG Binding:
[0365] The same procedure as described in Example 3 was used for in
situ binding detection with resonant light scattering. Before the
mouse IgG binding, resonant light scattering spectra were taken on
Protein G' microparticles in pH 7.2, 25 mM (10 mM sodium phosphate,
15 mM NaCl) PBS buffer as the reference spectra. Then, 15 mL of a
solution consisting of 50 .mu.g/mL mouse IgG (Sigma Chemical Co.,
product number 15381, lot number 042K9027) in the same pH 7.2 PBS
buffer was passed through the sample cell containing the Protein G'
microparticles with circulation at a flow rate of about 1.5 mL/min
for 0.5 h. The sample cell was then flushed with pure pH 7.2 PBS
buffer, so resonant light scattering was measured in the same
medium as that used before binding.
[0366] C. Anti Mouse IgG Binding:
[0367] After step B, 15 mL of a solution consisting of 40 .mu.g/mL
Fab specific goat anti-mouse IgG (Sigma Chemical Co. product M
6898, Lot 012K4811) in pH 7.2, 25 mM PBS was passed through the
sample cell with circulation at a flow rate of about 1.5 mL/min for
0.5 h. Afterwards, the sample cell was flushed with the same PBS,
and multiple runs of resonant light scattering spectra were
taken.
[0368] The correlation results indicated that the resonance shift
after step B (mouse IgG binding on Protein G' microparticles) was
0.054.+-.0.007 nm compared to the reference (unbound) state, and
the shift after step C (anti mouse IgG binding to mouse IgG) was
0.111.+-.0.016 nm compared to the reference (unbound) state.
Therefore, with control of the IgG molecule orientation, the shift
was proportional to the size of the binding molecules.
Example 6
Real Time Binding Detection Using Resonant Light Scattering
[0369] The purpose of this Example was to demonstrate real time
detection of protein binding on glass microparticles using resonant
light scattering. The binding of mouse IgG to Protein G'
microparticles was measured as a function of time.
[0370] A. Surface Preparation and Derivatization of Protein G' on
Glass Microparticles:
[0371] The same high refractive index glass microparticles (RI=1.9,
Mo-Sci GL-0175) and the same Protein G' derivation protocol as
described in Example 5 (step A) were used to make Protein G'
microparticles.
[0372] B. Real Time Detection on Mouse IgG Binding:
[0373] For in situ binding detection with resonant light
scattering, the same procedure as described in Example 3 was used.
Before mouse IgG binding, resonant light scattering spectra were
taken on Protein G' microparticles in pH 7.2, 25 mM (10 mM sodium
phosphate, 15 mM NaCl) PBS buffer as the reference spectra. Then,
15 mL of mouse IgG (Sigma Chemical Co., product number 15381, lot
number 042K9027) in the same pH 7.2 PBS buffer was passed through
the sample cell containing the Protein G' microparticles with
circulation at a flow rate of about 1.5 mL/min for about 30-60 min.
Every 5 min, the circulation was stopped, resonant light scattering
spectra were taken, and the circulation was restarted again.
Therefore, binding dynamics could be followed in real time. At the
end of the incubation, the sample cell was flushed with pure pH 7.2
PBS buffer, and resonant light scattering was measured in the same
medium as that used before binding. These real time binding
detection experiments were carried out with mouse IgG
concentrations of 10 .mu.g/mL, 50 .mu.g/mL and 500 .mu.g/mL.
Autocorrelation analysis was used to obtain the resonance
wavelength shift.
[0374] The results of this study, which show the change of
resonance shift over time at the tested mouse IgG concentrations,
are summarized in Table 1, and shown in FIG. 16. Each data point is
the average over 3-4 different microparticles, and the error bars
represent the standard deviation of the measurements. As can be
seen from the data, the higher the mouse IgG concentration tested,
the faster the resonance shift increased with time, indicating a
higher rate of binding. The data also show that the resonance
shift, and therefore the binding, reached a maximum when the mouse
IgG concentration was over 50 .mu.g/mL, while at the 10 .mu.g/mL
concentration, only about 70% of the saturation binding level was
observed. Therefore, the resonant light scattering detection is
sensitive enough to detect submonolayer binding.
1TABLE 1 Mouse IgG Binding Dynamics Wavelength Wavelength shift
shift at 50 .mu.g/mL Wavelength shift at 10 .mu.g/mL mouse at 500
.mu.g/mL Time (min) mouse IgG (nm) IgG (nm) mouse IgG 0 0 0 0 5
0.010 .+-. 0.008 0.032 .+-. 0.006 0.037 .+-. 0.005 11 0.022 .+-.
0.007 0.037 .+-. 0.004 0.049 .+-. 0.010 16 0.026 .+-. 0.006 --
0.050 .+-. 0.005 20 0.030 .+-. 0.008 0.051 .+-. 0.012 0.053 .+-.
0.008 25 0.041 .+-. 0.010 -- 0.052 .+-. 0.008 30 0.036 .+-. 0.009
0.058 .+-. 0.006 0.054 .+-. 0.009 35 0.036 .+-. 0.010 0.060 .+-.
0.008 0.054 .+-. 0.008 40 0.041 .+-. 0.010 -- -- 50 0.043 .+-.
0.007 -- -- 60 0.043 .+-. 0.007 -- --
[0375] Because there was no mixing involved in the process, the
binding dynamics shown in FIG. 16 only reflect the diffusion
limited binding rate. The real biological binding kinetics can be
measured in real time with the use of a microfluidic mixing device
to enhance the rate of mass transfer.
[0376] The resonance shifts measured after the buffer flush were
the same as those obtained at the end of the incubation, but before
the buffer flush. This result indicates that a low concentration of
protein molecules in the buffered saline had almost no effect on
the spectra from the medium in which the spectra were taken.
Therefore, we could use the spectra taken in the pure buffer as the
starting point and zero shift reference for the dynamic data taken
in the mouse IgG solution. For real biological samples such as sera
or cellular extracts, which have high concentration of proteins and
nucleic acids, the resonant light scattering spectra will shift
simply because of the medium change. For those cases, the starting
point in the biological sample would be used as the reference point
of zero shift for real time detection.
Example 7
Protein Binding Assay in a Serum Background Using Resonant Light
Scattering Detection
[0377] The purpose of this Example was to demonstrate specific
binding detection in a serum background using resonant light
scattering. The microparticles were coated with poly(ethylene
glycol) methacrylate (PEGM) to reduce nonspecific binding and then
a fluorescent dye, Alexa Fluor.RTM. 488, was coupled to the
hydroxyl groups of the PEGM coating. Anti Alexa Fluor.RTM. 488
antibody binding to the fluorescent dye-coupled particles was
detected in diluted rabbit serum using resonant light
scattering.
[0378] A. Formation of a Nonspecific Binding Resistant Layer on the
Microparticles Using Surface Initiated ATRP (Atom Transfer Radical
Polymerization):
[0379] Real biological samples, such as sera and cellular extracts,
normally contain-analytes in a high concentration protein
background. Nonspecific binding of background proteins to the
microparticles leads to false diagnostic results and therefore, has
to be prevented. We used a layer of poly(ethylene glycol)
methacrylate (PEGM) coating, formed by surface initiated ATRP, to
reduce nonspecific binding to the microparticles.
[0380] The synthesis procedure described by Husseman et al.
(Macromolecules 32, 1424-1431 (1999)) was used to prepare the
initiator 5-trichlorosilyl pentyl 2-bromo-2-methyl propionate. Then
the initiator was reacted with the cleaned glass microparticles, as
described below. The same high refractive index glass
microparticles (RI=1.9, Mo-Sci GL-0175) and the same cleaning
procedure as described in Example 3 (step A) were used, and the
microparticles were dried at 110.degree. C. in a vacuum oven
overnight before use. All glassware was cleaned and dried at
110.degree. C. in an oven for a period of 2 h up to overnight. One
hundred milliliters of dry toluene (EM Science, product number
TX0732-6) was added to a 250 mL round bottom flask, and 45 .mu.L of
pyridine (Aldrich, product number P57506, batch number 03012LA,
dried with 4 .ANG. molecular sieves overnight before use) was
added. Then, 8 g of dried, clean microparticles and 250 .mu.L of
5-trichlorosilyl pentyl 2-bromo-2-methyl propionate initiator were
added. The flask was sealed with a glass stopper and the reaction
proceeded at room temperature with vigorous stirring for 4 h. The
microparticles were isolated by filtration and were rinsed with 100
mL of toluene and 100 mL of acetone in sequence. Then, the
microparticles were collected, dried and cured at 110.degree. C. in
an oven for a period of 2 h up to overnight.
[0381] The initiator-loaded microparticles were then ready for
polymerization. ATRP was conducted in aqueous solution at room
temperature. The composition was optimized on the basis of the
disclosure by Huang, in copending U.S. Patent Application No.
60/451,068, which is incorporated herein by reference. Forty six
grams of poly(ethylene glycol) methacrylate (PEGM monomer, Aldrich,
product P409537, batch 15304CB, average Mn=360) and 120 mL of
deionized water were added to a 250 mL round bottom flask. The
solution was stirred under nitrogen for 0.5 h. Then, 0.46 g of
bipyridyl (Aldrich, product D216305, batch 08015CO) and 28 mg of
CuCl.sub.2 (Aldrich, product 203149, Lot 04907EA) were added, and
the colorless solution turned light blue. Then, 140 mg of CuCl
(Aldrich 224332, Lot 08319 JA) was added, and the solution turned
dark brown. The nitrogen purge was continued for another 15 min,
and then, 2 g of initiator-loaded microparticles was added. The
reaction was sealed under a nitrogen atmosphere and allowed to
proceed for 4 h. After this time, the microparticles were isolated
by filtration and rinsed with abundant amounts of deionized water
until the color was rinsed away. The microparticles were then
collected and dried overnight in vacuum at room temperature.
[0382] The presence of the PEGM coating on the microparticles was
confirmed using ESCA (Electron Spectroscopy for Chemical Analysis)
and ToF-SIMS (Time of Flight Secondary Ion Mass Spectroscopy)
imaging. With ESCA, the element composition in the top 100 .ANG. of
sample surface can be obtained. The elemental percentage for the
surface of the PEGM coated microparticles and that of the bare
glass microparticles, as determined by ESCA, is given in Table 2.
As can be seen from the data in the table, most bulk elements
present in the bare glass microparticles, such as Ba, Ti, B, Ca and
Si, were not detected or were found to be present at significantly
lower levels on the surface of PEGM coated microparticles, on which
C was the major element found. This result indicates that there was
good coverage of the PEGM coating on the surface of the
microparticles. ToF-SIMS imaging can give spatial distribution of
chemical species on the surface, and can be used to check the
uniformity of the PEGM coating on individual microparticles. The
results of the ToF-SIMS imaging revealed that, except for a few
small spots of bulk metal ions on their surface, the majority of
the microparticles' surface was covered with the PEGM coating.
[0383] The nonspecific adsorption of protein onto the PEGM coated
microparticles was tested by exposing the particles to a solution
consisting of 50 .mu.g/mL avidin-FITC conjugate (Sigma Chemical
Co., product number A2050, Lot: 091K4842) in pH 7.4, 0.4 M PBS
buffer. The bare microparticles were treated in the same manner to
act as the control. Fluorescence microscope examination of the
microparticles indicated that the PEGM coated microparticles had
significantly reduced nonspecific adsorption of avidin compared to
the control. The reduction in nonspecific binding was greater after
both the PEGM coated microparticles and the control microparticles
were treated with a 0.25% BSA blocking step before exposure to the
avidin-FITC solution.
2TABLE 2 Results of ESCA Analysis of PEGM Coated Glass
Microparticles: Elemental Percentages Excluding Hydrogen Sample C O
Na N Si Ba Ti Cl B Ca Sr PEGM Coated 69 30 ND.sup.1 ND 0.6 ND
DL.sup.2 ND ND ND ND Glass Microparticles Bare Glass 21 53 0.2 2.8
3.1 13 0.7 4.8 1.3 0.1 Microparticles, .sup.1ND means Not Detected
.sup.2DL means at the Detection Limit
[0384] B. Activation of PEGM Coated Microparticles and Coupling of
Fluorescent Dye Probe Thereto:
[0385] The PEGM coating can be further activated and conjugated to
biological ligands using many different chemical methods, including
the use of trichloro-s-triazine (Abuchowski, A. et al., J. Bio.
Chem. 252, 3578-3581, and 3582-3586 (1977)),
N,N'-carbonyldiimidazole (Bartling, G. J. et al. Nature (London),
243, 342-344 (1973)), and organic sulfonyl chloride such as tosyl
chloride and tresyl chloride (Nilsson, K. and Mosbach, K. Methods
in Enzymology, 1984, 104, pp 56-69). The process is typically done
by reacting with the hydroxyl groups in the PEGM chains to create a
reactive electrophilic intermediate that is capable of easily
coupling to nucleophilic residues such as the amine or sulfhydryl
groups in the protein molecules. Tresyl chloride was chosen because
it offers high yields of coupled product at neutral pH, and mild
conditions, and results in good stability.
[0386] The protocol used for activation of the PEGM coated
microparticles and ligand coupling, using Alexa Fluor.RTM. 488 as
the ligand example, was as follows. Dry PEGM coated glass
microparticles (2 g), prepared as described above, were washed
successively with 50 mL of each of the following: 30:70 and 70:30
of acetone: water (v/v), twice with acetone, and three times with
dried acetone (dried with 4 .ANG. molecular sieves overnight at a
ratio of 25 g of the molecular sieves per liter of acetone). The
PEGM coated glass microparticles were then transferred to a dried
flask containing 7 mL of dry acetone and 350 .mu.L of dry pyridine
that was dried with 4 .ANG. molecular sieves overnight before use.
This mixture was stirred using a magnetic stirrer and placed in an
ice/water bath. Tresyl chloride (360 .mu.L) (Aldrich, product
number 324787, batch number 01910AB) was added dropwise to the
suspension over a period of about 10 min. Then, the reaction was
allowed to continue in the ice/water bath for 1.5 h with stirring.
At the end of the reaction, the microparticles were isolated by
filtration and washed twice with 50 mL of each of the following:
acetone; 30%, 50%, and 70% (v/v) of 5 mM HCl in acetone; and
finally, 1 mM HCl. The activated microparticles were briefly dried
in vacuum at room temperature and stored in a desiccator at
4.degree. C.
[0387] The Alexa Fluor.RTM. 488 dye was coupled to the tresylated
microparticles in 0.2 M sodium phosphate buffer, pH 8.2 as the
coupling buffer using the following procedure. One milligram of
Alexa Fluro.RTM. 488 hydrazide, sodium salt (Molecular Probes, Inc.
Eugene, Oreg.; product number A-10436, lot 34C1) was dissolved in 2
mL of the coupling buffer. The tresylated microparticles (0.5 g)
were washed briefly with the cold coupling buffer using the
microconcentrator, as described above, and then were transferred to
the Alexa Fluro.RTM. 488 solution. The coupling reaction was
allowed to proceed with stirring on for 36 h at 4.degree. C. The
supernatant was then removed with a pipette and the reaction was
quenched with 0.1 M mercaptoethanol in 0.1 M Tris-HCl, pH 8.5
buffer for 5 h. The microparticles were washed in sequence with 0.2
M sodium acetate-0.5M NaCl, pH 3.5 buffer; 0.5 M NaCl solution;
distilled water; and 0.2 M, pH 7.5 PBS buffer. The microparticles
were dried briefly at room temperature and stored in the
refrigerator for future use.
[0388] The Alexa Fluor.RTM. 488 microparticles were tested with a
direct ELISA to verify the success of coupling and to determine the
probe density using the same procedure described in Example 5, step
A. The anti-Alexa Fluor.RTM. 488 rabbit IgG peroxidase conjugate
was prepared using the EZ-Link.TM. Plus Activated Peroxidase Kit
(Pierce, Cat. No. 31489) and the anti-Alexa Fluor.RTM. 488 rabbit
IgG from Molecular Probes (Cat No. A-11094). Very low absorbance
was observed from the control microparticle samples, and the
saturated absorbance obtained at high enzyme conjugate
concentration for Alexa Fluor.RTM. 488 microparticles was used to
calculate the Alexa Fluor.RTM. 488 surface density. The calculated
surface density was 0.42 pmol per gram of microparticles. No effort
was made to determine the enzyme activity-reducing factor to
correct the Alexa Fluor.RTM. 488 surface density in this case.
[0389] C. Antibody Binding Detection in a Serum Background:
[0390] Anti-Alexa Fluor.RTM. 488 rabbit IgG fraction was obtained
from Molecular Probes, Inc. (product number A-11094, lot number
7581), and was diluted to a concentration of 50 .mu.g/mL with 10
mg/mL rabbit serum to test its binding to the Alexa Fluor.RTM. 488
dye coupled microparticles, prepared as described in step B. The
rabbit serum (Sigma Chemical Co. product R9133, lot 041K9089)
containing 50 mg/mL proteins was diluted with pH 7.2, 25 mM (10 mM
sodium phosphate, 15 mM NaCl) PBS buffer to give a 10 mg/mL protein
concentration. Before the binding detection with resonant light
scattering, about 50 mg of the Alexa Fluor.RTM. 488 dye coupled
microparticles was incubated in 1.5 mL of the 10 mg/mL rabbit serum
solution for 1 h to further block nonspecific binding sites. The
Alexa Fluor.RTM. 488 dye coupled microparticles were washed twice
with PBS buffer and then were dispersed in the PBS buffer. These
dispersed Alexa Fluor.RTM. 488 dye coupled microparticles were
loaded into the sample cell for binding experiments. For in situ
binding detection with resonant light scattering, the same
procedure as described in Example 3 was used. Before rabbit IgG
binding, resonant light scattering spectra were taken on Alexa
Fluor.RTM. 488 dye coupled microparticles in pH 7.2, 25 mM (10 mM
sodium phosphate, 15 mM NaCl) PBS buffer as the reference spectra.
Then, 12 mL of a solution containing 10 mg/mL rabbit serum proteins
in the same pH 7.2 PBS buffer was passed through the sample cell
with circulation at a flow rate of about 1.5 mL/min for 0.5 h, in
order to test for nonspecific binding. The sample cell was then
flushed with pure pH 7.2 PBS, so resonant light scattering was
measured in the same medium in which the reference spectra were
taken. Afterwards, 10 mL of a solution containing 50 .mu.g/mL of
the anti-Alexa Fluor.RTM. 488 rabbit IgG in 10 mg/mL rabbit serum
was passed through the sample cell with circulation at a flow rate
of about 1.5 mL/min for 0.5 h. At the end of the incubation, the
sample cell was flushed with pure pH 7.2 PBS, and resonant light
scattering was measured in the same medium in which the reference
spectra were taken.
[0391] Autocorrelation analysis was used to obtain the resonance
wavelength shift for the serum background testing step and the
anti-Alexa Fluor.RTM. 488 rabbit IgG binding step. The average
shifts for the background test step and for the rabbit IgG binding
step were 0.004.+-.0.004 nm and 0.037.+-.0.006 nm, respectively.
These values are averages for 3 different microparticles and 9
different before-and-after laser scan run pairs. The wavelength
shift results showed almost no shift in the background test step,
implying good resistance against nonspecific binding. The
wavelength shift in the rabbit IgG binding step was a bit smaller
than that observed with the Protein G'-mouse IgG binding (Example
5), possibly because of a lower binding strength in the different
system.
Example 8
Multiple Protein Binding Assay in an E. coli Cellular Extract
Background Using Resonant Light Scattering Detection
[0392] The purpose of this Example was to demonstrate multiplex
assays using resonant light scattering on a mixture of two kinds of
probe microparticles in an E. coli cellular extract background. A
mixture of Alexa Fluor.RTM. 488 and mouse IgG microparticles were
used in the multiplex assay and the binding of the particles to
their corresponding antibody was detected using resonant light
scattering.
[0393] A. Preparation of Alexa Fluor.RTM. 488 Microparticles and
Mouse IgG Microparticles:
[0394] Two kinds of probe microparticles with the same PEGM coating
but different capture ligands, namely Alexa Fluro.RTM. 488 and
mouse IgG, were prepared according to the procedure described in
Example 7 (step A and step B). The PEGM coating was used to prevent
nonspecific binding in a high protein concentration background.
Procedures used for PEGM coating, tresyl chloride activation and
the coupling of Alexa Fluro.RTM. 488 to the activated
microparticles are described in Example 7. Mouse IgG was coupled to
the tresyl chloride activated microparticles in the same way. PBS
buffer (0.2 M, pH 8.2) was used as the coupling buffer. Ten
milligrams of mouse IgG (Sigma Chemical Co. product 15381) was
dissolved in the coupling buffer to make a 1 mg/mL solution. The
tresyl chloride activated microparticles (0.5 g) were briefly
washed with the cold coupling buffer and transferred to 5 mL of the
mouse IgG solution. The microparticle suspension was stirred for
about 36 h at 4.degree. C. The supernatant was then removed with a
pipette, and the reaction was quenched with 5 mL of a solution
consisting of 0.1 M mercaptoethanol (Aldrich Chemical Company, Inc.
product M3701) in 0.1 M Tris-HCl, pH 8.5 buffer for 5 h. The
microparticles were then washed successively with 0.2 M sodium
acetate-0.5 M NaCl, pH 3.5 buffer; 0.5 M NaCl solution; distilled
water; and then 0.2M, pH 7.5 PBS buffer. The microparticles were
dried briefly at room temperature and stored in the refrigerator
before use.
[0395] B. Preparation of E. coli Cellular Extract:
[0396] E. coli cellular extract was used as a competing protein
background for the multiplex assay demonstration. E. coli bacterial
cells (0.5 mL, Invitrogen Co. Carlsbad, Calif., DH10B.TM. cells,
Catalog number 18290-015, Lot: 1172474) were inoculated in 250 mL
Miller's LB broth (Mediatech Inc. Herndon, Va., Catalog number
46-050CM Lot: 46050009), and the culture was incubated overnight in
a shaking incubator at 37.degree. C. and 225 rpm. The cells were
harvested using centrifugation at 5,000.times.g for 15 min. The
amount of cell pellet was about 1.0 g. The supernatant was removed
from the cell pellet, 15 mL of CelLytic.TM. B Bacterial Cell Lysis
Reagent (Sigma Chemical Co. product B3553, Lot:052k9319) was added,
and the suspension was mixed well to completely resuspend the
cells. The cell extract suspension was incubated with shaking at
room temperature for 15 min to fully extract the cells, and was
centrifuged at 25,000.times.g for 20 min to pellet the insoluble
material. The supernatant that contains the soluble proteins was
carefully removed. About 90-95% of soluble protein was found in
this fraction. The total protein concentration was determined to be
4.4 mg/mL using the Bradford method (Bradford, supra).
[0397] C. Antibody Binding Detection in the Background of E. coli
Cellular Extract:
[0398] In order to demonstrate a multiplex assay using resonant
light scattering, Alexa Fluor.RTM. 488 microparticles and mouse IgG
microparticles of equal weight, prepared in step A, were mixed.
This microparticle mixture was incubated in 1.5 mL of 1% BSA
(Sigma, product B4287) in 10 mM, pH 7.4 PBS buffer for 3 h at room
temperature to further block nonspecific binding sites. This
incubation was followed by two washes with 1.5 mL of PBS buffer and
resuspension in PBS buffer. Then, the suspended microparticles were
loaded into the sample cell for binding experiments. To determine
which microparticles were labeled with Alexa Fluor.RTM. 488, a 488
nm Ar ion laser (25 mW, Omnichrome Corp., Carlsbad, Calif.) was
used to excite the fluorescent dye and an excitation cutoff
high-pass filter was inserted in the output optical path to examine
the fluorescence emission. A field containing both fluorescing
microparticles and non-fluorescing microparticles was selected for
resonant light scattering experiments. The fluorescing
microparticles were Alexa Fluor.RTM. 488 labeled microparticles and
the non-fluorescing microparticles were assumed to be mouse
IgG-labeled microparticles. The fluorescence image and the plain
image of this view are shown for comparison in FIG. 17. It should
be noted that fluorescence was used in this study to identify the
microparticles because the automated pattern recognition software,
required to enable resonant light scattering identification, was
not available. The microparticles remained in place during the
experiments, so their location was used to track them. However,
with the required software it would be possible to use resonant
light scattering for particle identification and tracking, as
demonstrated in Examples 1 and 2, and for the detection of
binding.
[0399] For in situ binding detection with resonant light
scattering, the same procedure as described in Example 3 was used.
Resonant light scattering spectra were first taken on the selected
microparticles in pH 7.2, 25 mM (10 mM sodium phosphate, 15 mM
NaCl) PBS buffer as the reference spectra. Then, three binding step
measurements were carried out to check whether there was
nonspecific binding from competing background proteins and to test
whether there was cross-reactivity between the Alexa Fluor.RTM. 488
probe and rabbit anti-mouse IgG, and between the mouse IgG probe
and anti Alexa Fluor.RTM. 488 rabbit IgG. In step 1, 12 mL of a
solution consisting of 2.2 mg/mL E. coli cellular extract proteins
in the same PBS buffer was passed through the sample cell with
circulation at a flow rate of about 1.5 mL/min for 0.5 h, as a test
of the background. In step 2, anti-Alexa 488 rabbit IgG (Molecular
Probes, Inc. product number A-11094, lot number 7581) was added to
the same cellular extract solution used in step 1 to give a 50
.mu.g/mL working concentration, and the solution was passed through
the sample cell with circulation at a flow rate of about 1.5 mL/min
for 0.5 h to test the binding of the anti-Alexa 488 rabbit IgG to
the microparticles. In step 3, rabbit anti-mouse IgG (H+ L)
(unconjugated, Pierce, product 31188, lot EE761527) was added in
the solution used in step 2 to give a 50 .mu.g/mL working
concentration, and the solution was passed through the sample cell
with circulation at a flow rate of about 1.5 mL/min for 0.5 h to
test the binding of anti-mouse IgG to the microparticles. There was
a PBS buffer wash after each step, and spectra were taken after
each washing step.
[0400] Autocorrelation analysis was used to obtain the resonance
wavelength shifts for both Alexa Fluor.RTM. 488 microparticles and
mouse IgG microparticles after the cellular extract background
testing step, the anti-Alexa Fluor.RTM. 488 rabbit IgG binding step
and the rabbit anti-mouse IgG binding step. The results are
summarized in the Table 3 (all shifts are referenced to the spectra
taken at the beginning). The values given in the table are the
averages over 3 different microparticles and 9 different
before-and-after laser scan run pairs.
3TABLE 3 Resonance Wavelength Shifts in the Resonant light
Scattering Spectra of Alexa Fluor .RTM. 488 Microparticles and
Mouse IgG Microparticles in Three-Step Binding Experiments
Resonance Resonance wavelength wavelength shift (nm) shift (nm)
Resonance step step 3: wavelength shift 2: 50 .mu.g/mL 50 ug/mL
(nm), step 1: 2.2 anti-Alexa anti-mouse mg/mL protein rabbit IgG
rabbit IgG cell extract in step1 in step 2 Microparticles
background background background Alexa Fluor .RTM. 488 0.004 .+-.
0.004 0.034 .+-. 0.006 0.030 .+-. 0.005 microparticles Mouse IgG
-0.005 .+-. 0.006 -0.004 .+-. 0.004 0.056 .+-. 0.007
microparticles
[0401] As can be seen from the data in Table 3, the average shifts
in the background test step for both types of microparticles were
almost zero, indicating no nonspecific binding of background
proteins. For Alexa Fluor.RTM. 488 microparticles, there was a
corresponding resonance wavelength shift of 0.034.+-.0.006 nm upon
anti-Alexa Fluor.RTM. 488 rabbit IgG binding in the second step,
and that shift remained almost unchanged in the third step. For
mouse IgG microparticles, there was almost zero shift in the second
step and 0.056.+-.0.007 nm shift in the third step. These results
clearly indicate that there was no cross-reactivity between the two
antibodies and two ligands, but exclusive binding of anti-Alexa
Fluor.RTM. 488 rabbit IgG to Alexa Fluor.RTM. 488 probes and
exclusive binding of anti-mouse IgG to mouse IgG probes. These
results demonstrate the use of resonant light scattering for
detection in multiplex assays.
Example 9
DNA Probe-Coupled Microparticles for Detection of a Specific DNA
Analyte Using Resonant Light Scattering
[0402] The purpose of this Example was to demonstrate the use of
resonant light scattering to specifically detect nucleic acid
analytes using microparticles linked to nucleic acid probes.
Fluorescent-labeled analytes were used as assay controls to verify
specific binding of the analyte to the DNA
probe-microparticles.
[0403] A. Microparticle Preparations:
[0404] The high refractive index glass microparticles (Cat. No.
GL-0175, Mo-Sci Corp., Rolla, Mo.) were prepared as described in
Example 3. The cleaned glass microparticles were silanized to
produce surface reactive amine groups, as described in Example 3,
for coupling to the nucleic acid oligomer probe. The
amine-derivatized glass microparticles were further derivatized
with maleimide groups by coupling sulfosuccinimidyl (NHS)
4-[N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC) to the
amine groups. An aliquot of 400 mg of amine-derivatized glass
microparticles was added to a reaction mixture consisting of 130 mM
carbonate/bicarbonate buffer, pH 9.6, 13.3 mg/mL sulfo-SMCC (Pierce
Biotechnology Inc., Rockford, Ill.; product number 22322), and
33.3% dimethylformamide (DMF). This mixture was placed into a 1.5
mL round-bottom tube that was rotated at room temperature for 1 h
to allow the surface amines to react with the NHS group on the
sulfo-SMCC. The maleimide-derivatized microparticles were washed at
room temperature with 500 .mu.L of 100 mM sodium phosphate, 150 mM
NaCl buffer, pH 7.2 (PBS). The buffer was removed by centrifuging
the suspended microparticles using a microconcentrator
(Microcon.RTM. 100, Amicon, W.R. Grace Co., Beverley, Mass.) in a
Sorvall Microspin microcentrifuge (Kendro Laboratory Products,
Newtown, Conn.) at 12,000 rpm and room temperature. The
microparticles were washed twice with the PBS buffer using the
microconcentrator. The maleimide-derivatized microparticle pellet
was transferred to a second 1.5 mL round-bottom reaction tube and
stored at 4.degree. C.
[0405] A second set of microparticles was produced with a
nonspecific-binding resistant layer using a PEGM coating as
described in Example 7. The PEGM surface was activated with tresyl
chloride for conjugation to thio-activated oligonucleotides, as
described in Example 7.
[0406] B. The Oligonucleotide Probes and Preparation of the
Oligonucleotide Probe-Coupled Microparticles:
[0407] The oligonucleotide probe sequences were designed to
specifically detect the synthetic foot and mouth disease (FMD)
target nucleic acid sequence, given as SEQ ID NO:1, disclosed by
Ebersole et al. in copending U.S. Patent Application No.
60/434,974, which is incorporated herein by reference. The FMD
oligonucleotide probe specific sequence (JBP) used in the assay was
5' TCAACCAGATGCAGGAGGACATGTCAACAAAACACGGACCCGACT TAA 3', given as
SEQ ID NO:2. This sequence was modified at the 5' and 3' ends as
described below, to obtain the modified FMD probe (JBP S2SP3B):
C.sub.6--S--S(SP).sub.2-TCAACCAGATGCAGGAGGACATGTCAACAAAACACGGACC
CGACTTAA-B 3', given as SEQ ID NO:3. The "B" is a 3' biotin group
added to the sequences during DNA synthesis as a 3' coupling
reagent attached to control-pore glass solid supports used in
.beta.-cyanoethyl phosphoramidite synthesis chemistry (Biotin CPG,
Glen Research, Sterling, Va.). "Sp" refers to the 18-atom spacer
arm phosphoramidite, 18-O-dimethoxytritylhexaethyleneglycol,
1-[(2-cyanoethyl)-(N,N-diisopropy- l)]-phosphoramidite (Glen
Research, Sterling, Va.). Two of these spacer moieties were coupled
to the 5' end between the probe sequence and the probe crosslinking
moiety to serve as molecular spacers using .beta.-cyanoethyl
chemistry. The "C.sub.6--S--S" (1-O-dimethoxytritylhexy-
l-disulfide, 1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite,
Glen Research, Sterling, Va.) is a disulfide moiety used as a
crosslinking thiol-modifier.
[0408] To prepare the modified JBP S2SP3B probe for coupling to the
maleimide-derivatized microparticles, the disulfide modifier was
cleaved from 70 nmol of the probe using 400 .mu.L of 100 mM
dithiothreitol (DTT) in 0.2 M Tris buffer, pH 8.3, creating a
thiol-activated probe. The thiol-activated probe was purified from
the C6-thio group and DTT using ethanol precipitation by adding 100
.mu.L of 3 M sodium acetate, pH 5.4 and 1000 .mu.L of 100% ethanol,
and mixing well. The DNA precipitate was centrifuged into a pellet
by centrifugation in a Sorvall Microspin microcentrifuge at 12,000
rpm and room temperature. The oligonucleotide pellet was washed
twice with 70% ethanol and dissolved in 200 .mu.L of
double-distilled water.
[0409] The maleimide-derivatized microparticles (400 .mu.g),
prepared as described in Part A, were transferred to a 1.5 mL
round-bottom reaction tube for coupling to the thiol-activated JBP
S2SP3B probe. The thiol-activated JBP S2SP3B probe (70 nmol),
prepared as described above, was added to the tube. Then, 500 .mu.L
of PBS, pH 7.4 was added and the tube was rotated, in order to mix
and suspend the microparticles, at room temperature for 2 h to
allow the surface maleimide groups to react with the
thiol-activated probe. The DNA probe-coupled microparticles were
washed at room temperature with 500 .mu.L of PBS. The PBS was
removed by centrifuging the suspended microparticles using a
Microcon.RTM. 100 microconcentrator in a Sorvall Microspin
microcentrifuge at 12,000 rpm and room temperature. The
microparticles were washed twice with PBS buffer and then the JBP
S2SP3B probe-coupled microparticle pellet was transferred to a 1.5
mL micro-tube and stored at 4.degree. C.
[0410] An additional probe, N-JBC (5'
NH.sub.2-TTAAGTCGGGTCCGTGTTTTGTTGACA- TGTCCTCCTGCATCT GGTTGA-B 3'),
given as SEQ ID NO:4, was synthesized by MWG Biotech, Inc. (High
Point, N.C.). This probe contained a 5' amine group and a 3' biotin
group. The probe was coupled to the tresyl activated PEGM
microparticles through the 5' amine. Specifically, 100 .mu.L of 100
.mu.M N-JBC DNA was incubated with 40 mg of tresylated PEGM
microparticles in 0.2 M PBS buffer, pH 8.2 for 3 days at room
temperature. The N-JBC probe-coupled microparticles were then
washed two times in 0.1 M PBS, pH 7.2 using a Microcon.RTM. 100
microconcentrator. The microparticle pellet was transferred to a
1.5 mL micro-tube. The N-JBC probe-coupled microparticles were
designated JBC-PEGM and were stored at 4.degree. C.
[0411] C. Detection of Hybridization Capture of a FMD
Oligonucleotide Target DNA onto the DNA Probe-Coupled
Microparticles Using Fluorescence:
[0412] A FMD specific DNA oligonucleotide target labeled with a 3'
fluorescein tag (JBC-F), specifically, 5'
TTAAGTCGGGTCCGTGTTTTGTTGACATGTC- CTCCTGCATCTGGTT GA-F 3', given as
SEQ ID NO:5, that is complementary to the JBP probe sequences (SEQ
ID NO:2 and SEQ ID NO:3), was used to test the functionality of the
microparticle probe. A second oligonucleotide was designed with no
sequence complementary to the JBP S2SP3B probe to act as a
fluorescein-labeled, nonspecific target control (Lac2-F), 5'
TGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCA GAC-F 3', given as
SEQ ID NO:6.
[0413] The JBP S2SP3B probe-modified microparticles (2 .mu.L) were
mixed with 2 .mu.L of 10 .mu.M JBC-F (SEQ ID NO:5) or Lac2-F (SEQ
ID NO:6) in 20 .mu.L of 0.3 M NaCl, PBS buffer and were hybridized
for 1 h at room temperature on a rolling mixer. The tubes were
centrifuged briefly to pellet the microparticles and the
supernatant was removed. The assay microparticles were then washed
three times with 200 .mu.L aliquots of 0.3 M NaCl, PBS buffer with
brief vortexing and centrifugation. After the final wash, the
microparticles were suspended in 50 .mu.L of the 0.3 M NaCl, PBS
buffer. One microliter of suspended microparticles from each sample
was mounted onto slides in 2 .mu.L of VECTASHIELD.RTM. Mounting
Medium (Vector Laboratories, Inc., Burlingame, Calif.). Samples
were observed under a fluorescence microscope (Zeiss Axioskop 40,
Carl Zeiss Microimaging, Inc., Thorwood, N.Y.)) fitted with a Spot
RTKE CCD camera (Diagnostic Instruments, Inc. Sterling Heights,
Mich.).
[0414] The resulting fluorescence micrographs demonstrated that the
JBC-F DNA target was captured onto the JBP S2SP3B-coupled
microparticles and that the Lac2-F nonspecific control target was
not captured. The background autofluorescence of the JBP
S2SP3B-coupled microparticles without a target was also tested.
Autofluorescence was small compared to the fluorescence attributed
to the binding of the fluorescein-labeled JBC-F target. These
results indicate that the JBP S2SP3B-coupled microparticles were
specific for the JBC-F target sequence.
[0415] D. Detection of Hybridization Capture of a FMD
Oligonucleotide Target DNA onto DNA Probe-Coupled Microparticles
Using Resonant Light Scattering:
[0416] Next, resonant light scattering was used to detect the
binding of the DNA target to the DNA probe-coupled microparticles.
The procedure used was similar to that described in Examples 2 and
3. The JBP S2SP3B probe-coupled microparticles, prepared as
described in Parts A and B, were dispersed in 0.3 M NaCl, 0.1 M
sodium phosphate buffer, pH 7.4 (0.3 M NaCl, PBS buffer). A 2 .mu.L
aliquot of this suspension was placed in an optical flow cell,
similar to the one described in Example 3 and shown in FIG. 6. A
field of view was selected that contained a small number (2-6) of
microparticles. A "prescan" measurement was taken to determine the
assay background spectra. As described in Example 3, the diode
laser light source was then scanned between 770 and 780 nm in 50 s,
and 1500 images were captured and stored as a pixel stack file and
analyzed by software installed in the system's personal computer.
Several microparticles in the field of view were selected for
subsequent detailed spectral analysis, similar to that described in
Example 3 and shown in FIG. 8. By analyzing the full set of
wavelength-dependent scattered light images as described in Example
2, a scattered light spectrum from this particle was obtained. The
scattered light spectra acquired from the JBP S2SP3B probe-coupled
microparticles were similar to those described in Example 2 and
shown in FIG. 9.
[0417] The resonant light scattering assay was performed as
described below and spectral measurements were taken after each
incubation/wash step. Approximately 5 mL of the control Lac2-F
target DNA, at a concentration of 1 .mu.M in 0.3 M NaCl, PBS
buffer, was flowed continuously across the JBP S2SP3B probe-coupled
microparticles at a flow rate of about 1 mL/min, and was collected
into waste. The effluent tube was then transferred back into the
original sample and the remaining 5 mL of target DNA was recycled
in a closed loop system for 1 h. The JBP S2SP3B probe-coupled
microparticles were then washed with 10 mL of 0.3 M NaCl, PBS
buffer, and the effluent was discarded. A resonant light scattering
spectral scan was taken of the JBP S2SP3B probe-coupled
microparticles after the wash. Approximately 5 mL of a 1 .mu.M
sample of the probe specific JBC-F oligonucleotide target in 0.3 M
NaCl, PBS buffer was then added to the flow cell and flowed
continuously across the microparticles for 1 h. The microparticles
were then washed with 10 mL of 0.3 M NaCl, PBS buffer. Again, a
resonant light scattering spectral scan was taken of the JBP S2SP3B
probe-coupled microparticles after the wash.
[0418] The results are shown Table 4. A negative shift in the
resonant light scattering pattern was observed upon non-specific
binding of the Lac2-F target oligonucleotide to the microparticles.
A significant negative shift in the resonant light scattering
pattern was observed upon binding of the specific JBC-F target
oligonucleotide to the JBP S2SP3B probe-coupled microparticles.
These results show that the binding of oligonucleotide
probe-coupled microparticles to non-specific or specific
oligonucleotide targets results in a negative resonance wavelength
shift in the resonant light scattering spectra of the particles.
These results also demonstrate the use of resonant light scattering
to detect binding of oligonucleotide DNA targets to specific DNA
oligonucleotide probes coupled to microparticles.
4TABLE 4 Resonance Wavelength Shifts in the Resonant Light
Scattering Spectra of Oligonucleotide DNA Probe-Coupled
Microparticles Upon Binding to Oligonucleotide Targets Resonance
Resonance wavelength wavelength shift shift (nm), (nm), step 2-
step 1- nonspecific Resonance background: analyte target:
wavelength 0.3 M Lac2-F shift (nm), step 3- NaCl, oligonucleotide
specific analyte PBS buffer, non- target Microparticles pH 7.4
specifically bound specifically bound JBP S2SP3B 0.0 .+-. 0.004
-0.01426 .+-. 0.007 -0.02634 .+-. 0.009 probe-coupled (JBC-F
target) microparticles JBC-PEGM 0.0 .+-. 0.0007 -0.00136 .+-.
0.0006 -0.01910 .+-. 0.0011 microparticles (JBP-F target)
[0419] E. Detection of Hybridization Capture of a FMD
Oligonucleotide Target DNA onto the DNA Probe-Coupled, PEGM-Coated
Microparticles Using Fluorescence:
[0420] An FMD specific DNA oligonucleotide target labeled with a 3'
fluorescein tag (JBP-F) (5'
TCAACCAGATGCAGGAGGACATGTCAACAAAACACGGACCCGACT TAA-F 3'), given as
SEQ ID NO:7, was used to test the functionality of the
microparticle probe. The fluorescein-labeled, nonspecific target
(Lac2-F), SEQ ID NO:6, was used as a control.
[0421] Two microliters of the N-JBC probe-coupled, PEGM-coated
microparticles (JBC-PEGM) were mixed with 2 .mu.L of 10 .mu.M JBP-F
or Lac2-F (SEQ ID NO:6) in 20 .mu.L of 0.3 M NaCl, PBS buffer and
were hybridized for 1 h at room temperature on a rolling mixer. The
microparticles were pelleted briefly by centrifugation and the
supernatant was removed. The microparticles were then washed three
times with 200 .mu.L of 0.3 M NaCl, PBS buffer with brief vortexing
and centrifugation. The microparticles were then suspended in 50
.mu.L of the 0.3 M NaCl, PBS buffer. One microliter of suspended
microparticles from each sample was mounted onto slides and
observed under a fluorescence microscope as described above.
[0422] The resulting fluorescence micrographs demonstrated that the
specific JBP-F DNA target was captured onto the microparticles and
that the Lac2-F nonspecific control target was not. These results
indicate that the N-JBC probe-coupled, PEGM-coated microparticles
were specific for the JBP-F target DNA.
[0423] F. Detection of Hybridization Capture of a FMD
Oligonucleotide Target DNA onto the DNA Probe-Coupled, PEGM-Coated
Microparticles Using Resonant Light Scattering:
[0424] Resonant light scattering was used to detect the binding of
target DNA to the N-JBC probe-coupled, PEGM-coated microparticles.
The procedure used was similar to that described in Examples 2 and
3. The JBC-PEGM microparticles were dispersed in 0.3 M NaCl, 0.1 M
sodium phosphate buffer, pH 7.4 (0.3 M NaCl, PBS buffer). A 2 .mu.L
aliquot of this suspension was placed in the optical flow cell. A
"prescan" measurement was taken to determine the assay background
spectra and several microparticles in the field of view were
selected for subsequent detailed spectral analysis, similar to that
described above and in Example 3 and shown in FIG. 8. The scattered
light spectra acquired from the JBC-PEGM microparticles were
similar to those described in Example 2 and shown in FIG. 9.
[0425] The resonant light scattering assay was performed as
described below and spectral measurements were taken after each
incubation/wash step. Approximately 5 mL of the control Lac2-F
target DNA, at a concentration of 1 .mu.M in 0.3 M NaCl, PBS
buffer, was flowed continuously across the JBC-PEGM microparticles
at a flow rate of about 1 mL/min, and was collected into waste. The
effluent tube was then transferred back into the original sample
and the remaining 5 mL of target DNA was recycled in a closed loop
system for 1 h. The microparticles were then washed with 10 mL of
0.3 M NaCl, PBS buffer, and the effluent was discarded. A resonant
light scattering spectral scan was taken of the microparticles
after the wash.
[0426] The previous microparticles were removed from the cell and
were replaced with fresh JBC-PEGM microparticles. Again, the assay
background spectra were determined by a "prescan" measurement.
Approximately 5 mL of a 1 .mu.M sample of the probe specific JBP-F
oligonucleotide target in 0.3 M NaCl, PBS buffer was then added to
the flow cell and flowed continuously across the microparticles.
The effluent tube was then transferred back into the original
sample and the remaining 5 mL of target DNA was recycled in a
closed loop system for 1 h. The microparticles were then washed
with 10 mL of 0.3 M NaCl, PBS buffer. Again, a resonant light
scattering spectral scan was taken of the microparticles after the
wash.
[0427] The results are shown Table 4. An insignificant negative
shift in the resonant light scattering pattern was observed upon
non-specific binding of the Lac2-F target oligonucleotide to the
JBC-PEGM microparticles. A significant negative shift in the
resonant light scattering pattern was observed for the specific
JBP-F target oligonucleotide binding to the JBC-PEGM
microparticles. These results show that the DNA probe-coupled,
PEGM-coated microparticles behave similarly to the uncoated, DNA
probe-coupled microparticles as described above, but they have less
background resonance for the nonspecific target (Table 4).
Example 10
Detection of Hybridization Capture of a PCR Product Target onto DNA
Probe-Coupled Microparticles Using Resonant Light Scattering
[0428] The purpose of this Example was to demonstrate the use of
resonant light scattering for detecting PCR product DNA analytes
using microparticles linked to nucleic acid probes.
[0429] A. Microparticle Preparation and Oligonucleotide Probe
Coupling:
[0430] The JBP S2SP3B probe-coupled microparticles were prepared as
described in Example 9.
[0431] B. Preparation of PCR Targets:
[0432] A 206 bp amplified FMD DNA fragment (JB), given as SEQ ID
NO:8, and a 511 bp amplified LacIQ fragment (Lac2-511), given as
SEQ ID NO:9, were produced using standard PCR protocols as follows.
The 206 bp PCR fragment was produced as an asymmetric PCR product
from the 516 bp synthetic FMD target (SEQ ID NO:1) insert cloned
into pCR4-TOPO plasmid vector (Invitrogen, Carlsbad, Calif.) using
2 pmol of the forward primer, P2FWD, 5' GAGTCCAACCCTGGGCCCTTCTTCTTC
3', given as SEQ ID NO:10, and 20 pmol of the reverse primer,
P33-4, 5' ATGAGCTTGTACCAGGGTTTGGC 3', given as SEQ ID NO:11. Five
microliters of the product was then reamplified in the presence of
5 pmol of P2FWD and 50 pmol of P33-4.
[0433] The 511 bp PCR fragment was produced as an asymmetric PCR
product from E. coli LacIQ insert cloned into pCR4-TOPO plasmid
vector using 2 pmol of the forward primer, Lac1pst, 5'
ATACTGCAGAACGCGTCAGTGGGCTGATCA 3', given as SEQ ID NO:12, and 20
pmol of the reverse primer, Lac4eco, 5'
ACAGAATTCCATGAGCTGTCTTCGGTATCGTCGTA 3', given as SEQ ID NO:13. Five
microliters of the product was then reamplified in the presence of
5 pmol of Lac1pst and 50 pmol of Lac4eco. The asymmetric PCR
reaction mixes contained 200 .mu.M dNTPs and 2.5 units of Pfu Turbo
DNA polymerase (Stratagene, La Jolla, Calif.) in a final volume of
50 .mu.L PCR buffer (10.times.: 100 mM KCl, 100 mM
(NH.sub.4).sub.2SO.sub.4, 200 mM Tris-HCl pH 8.75, 20 mM
MgSO.sub.4, 1% Triton X-100, 1 mg/mL BSA). Amplifications were
performed in a GeneAmp.RTM.9600 thermal cycler (Perkin-Elmer Corp.,
Norwalk, Conn.). The samples were denatured for 2 min at 94.degree.
C., followed by 35 cycles with denaturation at 94.degree. C. for 20
s, annealing at 55.degree. C. for 20 s, and extension at 72.degree.
C. for 1 min. After completion of the amplification cycles, the
final chain extension was at 72.degree. C. for 5 min. Samples were
then ramped to 4.degree. C. and maintained at that temperature
until sample analysis.
[0434] Amplified DNA products were analyzed for their yield of
asymmetric amplified product by agarose gel electrophoresis. PCR
products were separated on 1.5% SeaKem.RTM. LE agarose (FMC
BioProducts, Rockland, Me.) in 0.5.times.TBE buffer (Digene
Diagnostics, Inc., Silver Spring, Md.) containing 0.5 .mu.g/mL of
ethidium bromide. An aliquot of 4 .mu.L from the amplified samples
was mixed with 1 .mu.L of gel loading buffer and loaded onto the
agarose gel. Gel electrophoresis was carried out by applying 100 V
(or 5.9 V/cm) to the gel for 1 h. The ethidium bromide-stained DNA
bands were visualized and digitally recorded using an Eagle Eye II
Still Video System (Stratagene, La Jolla, Calif.).
[0435] Detection of Hybridization Capture of the FMD PCR Product
Target DNA onto DNA Probe-Coupled Microparticles Using Resonant
Light Scattering:
[0436] Resonant light scattering detection was performed as
described in Examples 3 and 9, and shown in FIG. 9. Resonant light
scattering measurements were taken after each incubation/wash step.
As described in Example 9, a small aliquot, 2 to 3 .mu.L, of the
JBP S2SP3B probe-coupled microparticle suspension was placed in an
optical cell. A field of view similar to that shown in FIG. 8 was
selected that contained a small number (2 to 6) of microparticles.
A prescan measurement was taken to record the assay background.
Approximately 5.0 mL of the nonspecific control PCR target
fragment, Lac2-511 DNA (5 pmol of the PCR product in 5 mL of 0.3 M
NaCl, PBS buffer) was flowed continuously across the microparticles
at a flow rate of about 1 mL/min, and was recycled in a closed loop
system for 1 h. The JBP S2SP3B probe-coupled microparticles were
then washed with 10 mL of 0.3 M NaCl, PBS buffer, and the effluent
was discarded. A resonant light scattering spectral scan was taken
of the JBP S2SP3B probe-coupled microparticles after the wash.
Approximately 5.0 mL of the specific JB PCR target fragment (5 pmol
in 5 mL of 0.3 M NaCl, PBS buffer) was flowed continuously across
the microparticles for 1 h followed by a 10 mL wash with 0.3 M
NaCl, PBS buffer. Again, a resonant light scattering spectral scan
was taken of the JBP S2SP3B probe-coupled microparticles after the
wash.
[0437] The results are shown in Table 5. A negative shift in the
resonant light scattering pattern was observed upon non-specific
binding of the Lac2-F PCR fragment to the microparticles. When a
specific PCR target, the JB PCR product, was used as the analyte, a
significant negative shift in the resonant light scattering pattern
was observed upon binding to the JBP S2SP3B probe-coupled
microparticles. These results show that oligonucleotide
probe-coupled microparticles exhibit a negative resonance
wavelength shift in their resonant light scattering spectra upon
binding to PCR specific analytes. These results also demonstrate
the use of resonant light scattering and DNA oligonucleotide probes
coupled to microparticles to detect PCR produced DNA analytes.
5TABLE 5 Resonance Wavelength Shifts in the Resonant Light
Scattering Spectra of Oligonucleotide DNA Probe-Coupled
Microparticles Upon Binding to PCR Produced DNA Analytes Resonance
wavelength shift (nm), step 2- Resonance nonspecific wavelength
analyte shift target: (nm), step 1- Lac2-511 Resonance background:
PCR wavelength shift (nm), 0.3 M fragment step 3-specific analyte
NaCl, PBS non- target: JB PCR buffer, pH specifically fragment
specifically Microparticles 7.4 bound bound JBP S2SP3B 0.0 .+-.
0.002 -0.0026 .+-. 0.009 -0.0200 .+-. 0.006 probe-coupled
microparticles
Example 11
Detection of DNA Binding onto PNA Probe-Coupled Microparticles by
Resonant Light Scattering
[0438] The purpose of this Example was to demonstrate the use of
resonant light scattering to detect binding of nucleic acid
analytes to microparticles linked to peptide nucleic acid (PNA)
probes. PNA is an analogue of DNA that has a pseudo-peptide
backbone, rather than the sugar-phosphate backbone of nucleic acids
(DNA and RNA). PNA mimics the behavior of DNA and binds
complementary nucleic acid strands. The unique chemical, physical
and biological properties of PNA have been exploited to produce
powerful biomolecular tools, antisense and antigene agents,
molecular probes and biosensors. The neutral peptide-like backbone
provides stronger and more specific binding to the target nucleic
acid that is independent of salt concentrations. Therefore, we
wanted to assess the feasibility of hybridization capture of DNA
analytes using PNA probe-coupled microparticles.
Fluorescent-labeled oligonucleotide analytes were used as assay
controls to verify specific binding of the DNA analyte to the PNA
microparticles.
[0439] A. Microparticle Preparation
[0440] The high refractive index glass microparticles (Cat. No.
GL-0175, Mo-Sci Corp., Rolla, Mo.) were prepared as described in
Example 3. The cleaned glass microparticles were silanized to
produce surface reactive amine groups for coupling to the PNA
oligomer probe. The amine-derivatized glass microparticles were
further derivatized with maleimide groups, as described in Example
9. The maleimide-derivatized microparticle pellet was transferred
to a second 1.5 mL round-bottom reaction tube and stored at
4.degree. C.
[0441] B. Coupling the PNA Oligomer Probe to the
Microparticles:
[0442] The PNA probe base sequence was designed to specifically
detect FMD sequences described in Examples 9 and 10 to demonstrate
the use of PNA oligomers as resonant light scattering assay probes.
The sequence chosen was 5' TCCGTGTTTTGTTGAC 3' (JBP2C), given as
SEQ ID NO:14. The modified JBP2C PNA oligomer probe sequence used
in this Example, 5' B-OO-TCCGTGTTTTGTTGAC-Cy 3' (JBP2BC), given as
SEQ ID NO:15, was synthesized by Applied Biosystems (Foster City,
Calif.). The JBP2BC PNA oligomer was modified with a biotin moiety
(B) at the 5' end (N-terminal). The "OO" represents the linker
between the PNA oligomer and the biotin moiety. A cysteine residue
(Cy) amino acid moiety was used to modify the JBP2BC PNA oligomer
at the 3' end (C-terminal). The free thiol group on the cysteine
was used to couple the PNA oligomer to the maleimide-derivatized
microparticles.
[0443] To couple the PNA oligomer probe to the microparticles, 20
.mu.L of 100 .mu.M JBP2BC PNA oligomer was added to 40 mg of
maleimide-derivatized microparticles in pH 7.4 PBS. The reaction
mixture was incubated at room temperature for 2 h on a rolling
mixer. The unreacted JBP2BC PNA oligomer and PBS were removed by
centrifuging the suspended microparticles using a Microcon.RTM.100
microconcentrator in a Sorvall Microspin microcentrifuge at 12,000
rpm and room temperature. The microparticles were washed twice with
PBS. The JBP2BC PNA probe-coupled microparticle pellet was
transferred to a 1.5 mL micro-tube and stored at 4.degree. C.
[0444] C. Detection of Hybridization Capture of a FMD
Oligonucleotide Target DNA onto the PNA Probe-Coupled
Microparticles Using Fluorescence:
[0445] A FMD specific DNA oligonucleotide target (JBP-F) labeled
with a 3' fluorescein, 5'
TCAACCAGATGCAGGAGGACATGTCAACAAAACACGGACCCGACT TAA-F 3', given as
SEQ ID NO:7, which is a complementary sequence to the JBP2BC PNA
probe, was used to test the functionality of the PNA probe-coupled
microparticles. The fluorescein-labeled Lac2-F oligonucleotide (SEQ
ID NO:6), described in Example 9, was used as a nonspecific
control, which had no sequence complementarity to the JBP2BC PNA
probe.
[0446] The JBP2BC PNA probe-coupled microparticles (2 .mu.L) were
mixed with 2 .mu.L of 10 .mu.M JBP-F assay target or 10 .mu.M of
the Lac2-F control target in 20 .mu.L of 0.3 M NaCl, PBS buffer and
were hybridized for 1 h at room temperature on a rolling mixer. The
microparticles were pelleted and washed three times with 200 .mu.L
portions of 0.3 M NaCl, PBS buffer, as described in Example 9.
After the final wash, the microparticles were suspended in 50 .mu.L
of the 0.3 M NaCl, PBS buffer. The samples (1 .mu.L) were mounted
onto slides in 2 .mu.L of VECTASHIELD.RTM. Mounting Medium (Vector
Laboratories, Inc., Burlingame, Calif.). The samples were observed
under a fluorescence microscope, as described in Example 9.
[0447] The fluorescence micrographs demonstrated that the specific
JBP-F assay target was captured onto the PNA probe-coupled
microparticles and that Lac2-F nonspecific control target was not
captured. The background autofluorescence of the PNA probe-coupled
microparticles without a target was also tested. Autofluorescence
was small compared to the fluorescence attributed to the binding of
the fluorescein-labeled JBP-F target. These results indicate that
the JBP2BC PNA probe-coupled microparticles were specific for the
respective target JBP-F sequence.
[0448] D. Resonant Light Scattering Detection Using PNA
Probe-Coupled Microparticles:
[0449] Resonant light scattering was used to detect the binding of
the DNA target to the PNA probe-coupled microparticles. The
procedure used was similar to that described in Examples 2, 3 and
9. The JBP2BC PNA probe-coupled microparticles, prepared as
described in Parts A and B, were dispersed in 0.3 M NaCl, PBS
buffer, pH 7.4 and a small aliquot (2 to 3 .mu.L) of the resulting
microparticle suspension was placed in an optical cell similar to
the one described in Example 3 and shown in FIG. 6. A field of view
similar to that shown in FIG. 8 and described in Example 9 was
selected that contained a small number (2 to 6) of microparticles.
Images were captured and stored as a pixel stack file and analyzed
by software installed in the system's personal computer. As
described in Example 9, a prescan measurement was taken to record
the assay background.
[0450] Approximately 5 mL of 1 .mu.M Lac2-F nonspecific target DNA
in 0.3 M NaCl, PBS buffer was flowed continuously across the JBP2BC
PNA probe-coupled microparticles at a flow rate of about 1 mL/min,
and was collected and recycled in a closed loop system for 1 h. The
JBP2BC PNA probe-coupled microparticles were then washed with 10 mL
of 0.3 M, PBS buffer, and the effluent was discarded. Resonant
light scattering measurements were taken after the wash.
Approximately 5 mL of 1 .mu.M JBP-F specific target DNA in 0.3 M
NaCl, PBS buffer was then added to the flow cell and was flowed
continuously across the microparticles for 1 h, followed by a 10 mL
wash with 0.3 M NaCl, PBS buffer. Again, a resonant light
scattering spectral scan, as described in Example 3, was taken of
the JBP2BC PNA probe-coupled microparticles after the wash.
[0451] The results are shown in Table 6. A negative shift in the
resonant light scattering pattern was observed upon nonspecific
binding of the Lac2-F target oligonucleotide to the microparticles.
The results also show that a larger negative shift in the resonant
light scattering pattern was observed upon binding of the specific
JBP-F oligonucleotide DNA target to the JBP2BC PNA probe-coupled
microparticles, demonstrating the use of resonant light scattering
to detect DNA oligonucleotide binding to PNA oligomer-coupled
microparticles. A negative resonance wavelength shift in resonant
light scattering spectra was observed when oligonucleotide DNA
targets, either as nonspecific or specific analytes, were bound to
PNA oligomer-coupled microparticles.
6TABLE 6 Resonance Wavelength Shifts in the Resonant Light
Scattering Spectra of PNA Probe-Coupled Microparticles upon Binding
to Oligonucleotide Targets Resonance Resonance wavelength Resonance
wavelength shift shift (nm), step 2- wavelength (nm), step 1-
nonspecific shift (nm), step 3- background: analyte specific
analyte: 0.3 M target: Lac2-F target NaCl, oligonucleotide JBC-F
PBS buffer, non- oligonucleotide Microparticles pH 7.4 specifically
bound specifically bound JBP2BC PNA 0.0 .+-. 0.003 -0.0127 .+-.
0.005 -0.0222 .+-. 0.009 probe-coupled microparticles
Example 12
Detection of Hybridization Capture of a PCR Product Target onto PNA
Probe-Coupled Microparticles Using Resonant Light Scattering
[0452] The purpose of this Example was to demonstrate the detection
of a PCR product analyte using PNA probe-coupled microparticles
with resonant light scattering.
[0453] A. Microparticle Preparation and Oligonucleotide Probe
Coupling:
[0454] The JBP2BC PNA probe-coupled microparticles were the same as
those used in Example 11.
[0455] B. Preparation of PCR Targets:
[0456] The nonspecific PCR test target for the JBP2BC PNA
probe-coupled microparticles was the same 511 bp amplified Lac2-511
asymmetric PCR product (SEQ ID NO:9) used to test the JBP S2SP3B
probe-coupled microparticles in Example 10. The specific test
target was the compliment of the 206 bp amplified JB asymmetric PCR
product, given as SEQ ID NO:16, amplified as in Example 10 but with
the forward primer (P2FWD, SEQ ID NO:10) at 20 pmol and the reverse
primer (P33-4, SEQ ID NO:11) at 2 pmol. Five microliters of the
product was then reamplified in the presence of 50 pmol of the
forward primer and 5 pmol of the reverse primer.
[0457] C. Detection of Hybridization Capture of the FMD PCR Product
Target DNA onto JBP2BC PNA Probe-Coupled Microparticles Using
Resonant Light Scattering:
[0458] As described in Example 10, a small aliquot, 2 to 3 .mu.L,
of the JBP2BC PNA probe-coupled microparticle suspension was placed
in an optical cell. A field of view similar to that shown in FIG. 8
and described in Examples 9, 10 and 11 was selected that contained
a small number (2 to 6) of microparticles. Resonant light
scattering detection was performed as described in Example 10 and
spectral measurements were taken after each incubation/wash step.
The Lac2-511 PCR fragment and the JB PCR target fragment were used
as the control and assay targets, respectively.
[0459] The results in Table 7 show that a significant negative
shift was observed in the resonant light scattering pattern upon
binding of the JB PCR product to the JBP2BC PNA probe-coupled
microparticles, demonstrating the use of resonant light scattering
to detect specific PCR DNA targets bound to PNA oligomer-coupled
microparticles.
7TABLE 7 Resonance Wavelength Shifts in the Resonant Light
Scattering Spectra of PNA Probe-Coupled Microparticles upon Binding
to PCR Produced DNA Analytes Resonance Resonance wavelength shift
wavelength shift Resonance (nm), step 1- (nm), step 2- wavelength
background: nonspecific shift (nm), 0.3 M analyte step 3-specific
NaCl, PBS target: analyte buffer, pH Lac2-511 PCR target: JB PCR
Microparticles 7.4 fragment fragment JBP2BC PNA 0.0 .+-. 0.00013
-0.0029 .+-. 0.0016 -0.0158 .+-. 0.0016 probe-coupled
microparticles
Example 13
Detection of Cleavage of DNA Probe off Microparticles Using
Resonant Light Scattering
[0460] The purpose of this Example was to demonstrate that the
negative resonant light scattering spectral shift observed when a
DNA target analyte was captured onto a DNA probe-coupled
microparticle is due to the binding of the nucleic acid to the
DNA-probe. Fluorescent-labeled analytes were used as assay controls
to verify specific binding of the analyte to the nucleic
acid-coupled microparticles and that the hybridization complex
formed was removed when the coupling cross-linker was cleaved.
[0461] A. Microparticle Preparation:
[0462] The high refractive index glass microparticles were prepared
and silanized to produce surface reactive amine groups, as
described in Examples 3, 9 and 10. These amine-derivatized glass
microparticles were further derivatized with pyridyldithio groups
that couple to thiol-modified oligonucleotide probes to form
disulfide bonds, as described below. The disulfide bonds are
cleavable with DTT, which can be used to remove the oligonucleotide
probe or the nucleic acid hybridization complex from the
microparticles.
[0463] The coupling agent used to modify the microparticles with
pyridyldithio groups was sulfosuccinimidyl
6-[3'-(2-pyridyidithio)-propio- namido]hexanoate (sulfo-LC-SPDP)
(Pierce Biotechnology, Inc, Rockford, Ill.). This coupling agent
has a NHS group at one end of the molecule that couples the
sulfo-LC-SPDP cross-linker to the amine groups on the surface of
the microparticles. An aliquot of 100 .mu.g of amine-derivatized
glass microparticles was added to a reaction mixture consisting of
100 mM carbonate/bicarbonate buffer, pH 9.6, 122 mg/mL of
sulfo-LC-SPDP, and 25% dimethylformamide (DMF). The mixture was
placed into a 1.5 mL round-bottom tube that was rotated at room
temperature for 2 h to allow the surface amines to react with the
NHS group on sulfo-LC-SPDP. The resulting pyridyidithio-derivatized
microparticles were washed at room temperature with 500 .mu.L of
PBS, pH 7.4. The buffer and sulfo-LC-SPDP were removed by
centrifuging the suspended microparticles using a Microcon.RTM.100
microconcentrator in a Sorvall Microspin microcentrifuge at 12,000
rpm and room temperature. The microparticles were washed twice with
PBS buffer. The pyridyldithio-derivatized microparticle pellet was
transferred to a second 1.5 mL round-bottom tube and stored at
4.degree. C.
[0464] B. The Oligonucleotide Probes:
[0465] The oligonucleotide probe was JBP S2SP3B, which was
described in Example 9 and is given by SEQ ID NO:2. The JBP S2SP3B
was coupled to the pyridyldithio-derivatized microparticles as
described below. Also coupled to the pyridyidithio-derivatized
microparticles was a 3' labeled fluorescein probe (JBP S2SP3F)
C.sub.6--S--S(Sp).sub.2-TCAACCAGATGCAGGAGG-
ACATGTCAACAAAACACGGACCCGACTTA A-F 3', given as SEQ ID NO:17. This
probe was also modified at the 5' end by a disulfide moiety to
react with the pyridyldithio groups on the derivatized
microparticles.
[0466] To prepare the modified JBP probes, JBP S2SP3F and JBP
S2SP3B, for coupling to the pyridyidithio-derivatized
microparticles, the disulfide modifier was cleaved on each of the
JBP probes in separate reaction mixtures. The reaction mixtures
contained 70 nmol of one of the JBP probes in 600 .mu.L of PBS
buffer, and 100 mM dithiothreitol (DTT). The thiol-modified
oligonucleotides were purified from the C6-thio group and DTT by
ethanol precipitation. One hundred microliters of 3 M sodium
acetate, pH 5.4, and 1000 .mu.L of 100% ethanol were added to each
reaction and the solutions were mixed well. The DNA precipitates
were centrifuged into pellets in a Sorvall Microspin
microcentrifuge at 12,000 rpm and room temperature. The JBP probe
pellets were washed twice with 70% ethanol, and then dissolved in
200 .mu.L of double-distilled water in separate reaction tubes.
Both oligonucleotides were coupled to 100 .mu.g of
pyridyldithio-derivatized microparticles in 1.5 mL round-bottom
tubes by adding 500 .mu.L of PBS, pH 7.4, and rotating at room
temperature for 2 h to allow the surface pyridyldithio-groups to
react with the thiol-activated JBP probes. Preparations of both
types of JBP probe-coupled microparticles were washed at room
temperature with 500 .mu.L of PBS. The PBS, DTT, and unreacted JBP
probes were removed by centrifuging the suspended microparticles
using a Microcon.RTM.100 microconcentrator in a Sorvall Microspin
microcentrifuge at 12,000 rpm and room temperature. The
microparticles were washed twice with PBS. The JBP probe-coupled
microparticle pellets were transferred to 1.5 mL micro-tubes, and
stored at 4.degree. C.
[0467] C. Fluorescence Detection of Hybridization Capture of a JBP
Oligonucleotide Target DNA onto the DNA-Probe Coupled
Microparticles:
[0468] To demonstrate that the disulfide bonds formed from the
cross-linking of the JBP probes to the microparticles using the
sulfo-LC-SPDP were cleavable, the disulfide bonds were reduced with
DTT. A 50 .mu.L aliquot of the JBP S2SP3F probe-coupled
microparticles in PBS buffer pH 7.4 was treated with 50 .mu.L of
0.2 M DTT for 10 min. Then the microparticles were observed under
the Zeiss fluorescence microscope, as described in Example 9. The
resulting fluorescence micrographs demonstrated that the
fluorescent microparticles were no longer fluorescent, indicating
that the disulfide bonds produced by the pyridyldithio exchange
reaction were cleaved with DTT.
[0469] The JBP specific JBC-F (SEQ ID NO:5) target and the
nonspecific control Lac2-F (SEQ ID NO:6) were used, as described in
Example 9, to test if the JBP probe coupled to the microparticles
with the sulfo-LC-SPDP cross-linker, i.e., the JBP S2SP3B
probe-coupled micro particles described above, could specifically
bind to the JBC-F DNA target.
[0470] Micrographs, developed as described in Example 9, showed
that the JBC-F DNA targets were captured onto JBP probe-coupled
microparticles by forming a fluorescent JBP probe/JBC target
hybridization complex. The Lac2-F control targets were not
captured. These results indicate that the JBP/disulfide-coupled
microparticles are specific for the JBC-F target sequence. The JBP
probe/JBC target hybridization complex was then cleaved from the
microparticles with 0.2 M DTT as described above. The resulting
micrograph showed that the hybridization complex-cleaved
microparticles were much less fluorescent, indicating that at least
some of the hybridization complexes were cleaved from the
JBP-coupled microparticles.
[0471] Resonant Light Scattering Detection Using JBP Probe-Coupled
(w/sulfo-LC-SPDP) Microparticles:
[0472] Resonant light scattering was used to detect the binding of
JBC-F (SEQ ID NO:5) target DNA to the JBP-coupled microparticles.
The procedure was similar to that used in Examples 2, 3, and 9. The
JBP-coupled microparticles, prepared as described in Parts A and B
above, were dispersed in 0.3 M NaCl, PBS buffer, pH 7.4 and a small
aliquot (2-3 .mu.L) of the resulting microparticle suspension was
placed in an optical cell, similar to the one described in Example
3 and shown in FIG. 6. A field of view similar to that shown in
FIG. 8 was selected that contained a small number (2 to 6) of
microparticles. Images were captured and stored as a pixel stack
file and analyzed by software installed in the system's personal
computer. As in Example 9, a prescan measurement was taken to
record the assay background.
[0473] Approximately 5 mL of the specific target JBC-F DNA (1 .mu.M
in 0.3 M NaCl, PBS, pH 7.4) was flowed continuously across the
microparticles at a flow rate of about 1 mL/min and was recycled in
a closed loop system for 1 h. The microparticles were then washed
with 10 mL of 0.3 M NaCl, PBS, pH 7.4, and the effluent was
discarded. Resonant light scattering spectral measurements were
taken after the wash. A reducing agent (0.1 M DTT in 0.1 M
phosphate buffer pH 8.4) was then added for 30 min, followed by a
10 mL wash with 0.3 M NaCl, PBS, pH 7.4. Again, resonant light
scattering spectral measurements were taken after the wash.
[0474] The results given in Table 8 show that there was a
significant negative shift in the resonant light scattering pattern
after the addition of the DNA target and a further negative shift
once the probe-target complex was cleaved off the microparticles.
The data demonstrates that the shift that appears to be negative is
a result of the DNA (nucleic acid) probe coupled to the
microparticles through crosslinkers. From the data, it appears that
the influence of nucleic acids coupled to microparticles is such
that the resonance wavelength shift produced upon binding of the
nucleic acid analytes in the resonant light scattering assay is
negative.
8TABLE 8 Resonance Wavelength Shifts in the Resonant Light
Scattering Spectra of Oligonucleotide DNA Probe-Coupled
Microparticles Upon Binding to Oligonucleotide Targets Resonance
Resonance wavelength wavelength shift (nm), shift (nm), step 1-
step 3-DTT background: Resonance wavelength cleavage 0.3 M shift
(nm), step 3- of probe- NaCl, PBS specific analyte target: target
complex buffer, JBC-F oligonucleotide from the Microparticles pH
7.4 bound microparticles JBP S2SP3B 0.0 .+-. 0.005 -0.0161 .+-.
0.004 -0.0275 .+-. 0.006 probe-coupled microparticles
Example 14
Predicted Resonant Light Scattering Spectra for Microparticles
Having a High Refractive Index Core Plus One Layer, 1 Set of
Resonances
[0475] The purpose of this Example was to use computer simulation
to predict the resonant light scattering spectra for microparticles
with a homogeneous core of high refractive index plus one other
layer. The effect of a 0.10 nm thick protein layer is also
predicted.
[0476] The simulations were constructed using computer models of
resonant light scattering from multilayer spherical microparticles.
The models that were used extend well-known concepts and formulas
from literature references, for example Kaiser, T. and Schweiger,
G., Computers in Physics 7(6), 682-686 (1993). The models allow up
to 10 layers to be specified as to diameter (core) or thickness
(layers) and refractive index (RI). The following parameters were
used in the simulations:
9 Medium refractive index (RI) 1.33 Starting Wavelength 770 Ending
Wavelength 780 Scattering angle 180 degrees Detection full
acceptance angle 21.7 degrees
[0477] The diameter and refractive index of the core and the
thickness and refractive index of the layer were varied. The
binding of a protein layer was modeled by the addition of a uniform
10 nm thick layer of refractive index 1.45 on the outside of the
microparticle.
[0478] Particle-by-Particle Specifications:
[0479] The particle number is listed in Table 9 followed by the
parameters used in the simulations: Core diameter (D.sub.Core in
FIG. 18), Core refractive index (RI.sub.Core in FIG. 18), Layer 1
thickness (T1 in FIG. 18), and Layer 1 refractive index (RI.sub.L1
in FIG. 18).
10TABLE 9 Particle Parameters Used to Calculate the Predicted
Spectra of Example 14 Core Layer one Layer Protein diameter Core
thickness one layer Protein Particle No. (.mu.m) RI (.mu.m) RI
(.mu.m) layer RI 1 40 1.8 0.5 1.65 -- -- (Reference particle) 2
40.8 1.8 0.5 1.65 -- -- 3 40 1.78 0.5 1.65 -- -- 4 40 1.8 0.8 1.65
-- -- 5 40 1.8 0.5 1.62 -- -- 6 39.4 1.83 0.4 1.63 -- -- 7 40 1.8
0.5 1.9 -- -- 8 40 1.8 0.5 1.65 0.01 1.45
[0480] The predicted scattering patterns are shown in FIGS. 18-19.
Variations in diameter of the core and layer, and in refractive
index (RI) of the core and layer, give rise to variations in the
scattering pattern suitable for use as identifying markers for the
particle (Particles 1-7). These results illustrate the use of a
homogeneous core plus one layer as an identifiable
microparticle.
[0481] Addition of a 10 nm thick protein layer induces a shift in
the overall scattering pattern suitable for detecting the binding
of a target protein (Particle 8). The effect of the binding can be
seen graphically by comparing the scattering plot of the particle
containing the protein layer with that of the reference particle,
as shown in FIG. 19. For convenience there are two plots shown
comparing the bound vs. unbound particles, one with an expanded
wavelength scale to more readily show the pattern shifts that occur
upon binding. Although the comparison is shown only for binding to
the reference particle, the same effect could be shown for any of
the other particles in the Example.
Example 15
Predicted Resonant Light Scattering Spectra for Microparticles
Having a Low Refractive Index Core Plus 1 Layer, 1 Set of
Resonances
[0482] The purpose of this Example was to use computer simulation
to predict the resonant light scattering spectra for microparticles
with a homogeneous core of low refractive index plus one other
layer of higher refractive index. The effect of a 10 nm thick
protein layer is also predicted.
[0483] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
medium RI, the starting and ending wavelengths, the scattering
angle, and the detection full acceptance angle. The diameter and
refractive index of the core and the thickness and refractive index
of the layer were varied. The binding of a protein layer was
modeled by the addition of a uniform 10 nm thick layer of
refractive index 1.45 on the outside of the microparticle.
[0484] Particle-by-Particle Specifications:
[0485] The particle number is listed in Table 10 followed by the
parameters used in the simulation: Core diameter (D.sub.Core in
FIG. 20), Core refractive index (RI.sub.core in FIG. 20), Layer 1
thickness (T1 in FIG. 20), and Layer 1 refractive index (RI.sub.L1
in FIG. 20). In this Example, Particle 1 is a homogeneous core
only, given for reference. In the remaining particles, the core and
layer thicknesses are such that the total particle size is the same
as for Particle 1. The addition of protein is done on Particle 2,
so for the purposes of illustrating the detection of protein
binding, Particle 2 should be used as a reference particle.
11TABLE 10 Particle Parameters Used to Calculate the Predicted
Spectra of Example 15 Core Layer one Layer Protein diameter Core
thickness one layer Protein Particle No. (.mu.m) RI (.mu.m) RI
(.mu.m) layer RI 1 40 1.5 0 -- -- -- 2 20 1.5 10 1.7 -- --
(Reference particle) 3 19.1 1.5 10 1.7 -- -- 4 20 1.6 10 1.7 -- --
5 20 1.5 9 1.7 -- -- 6 20 1.5 10 1.74 -- -- 7 20.3 1.57 8 1.67 --
-- 8 20 1.5 10 1.7 0.01 1.45
[0486] The predicted scattering patterns are shown in FIGS. 20-21.
These results illustrate the use of a homogeneous core of low
refractive index, plus one layer of higher refractive index, as an
identifiable microparticle. Such a microparticle gives rise to one
set of scattering resonances that are produced by the high/low
refractive index transition between the layer and the medium.
Variations in diameter of the core outside the caustic surface (for
a definition of the caustic surface, see for example Roll, G. and
Schweiger, G., J. Opt. Soc. Am. A 17(7), 1301-1311 (2000)),
variations in the thickness of the layer, and also in refractive
index (RI) of the core and layer, give rise to variations in the
scattering pattern suitable for use as identifying markers for the
particle (Nos. 1-7). Addition of a 10 nm thick protein layer
induces a shift in the overall scattering pattern suitable for
detecting the binding of a target protein (No. 8), as shown in FIG.
21.
Example 16
Predicted Resonant Light Scattering Spectra for Microparticles
Having a High Refractive Index Core Plus 1 Layer, 2 Sets of
Resonances
[0487] The purpose of this Example was to use computer simulation
to predict the resonant light scattering spectra for microparticles
with a homogeneous core of high refractive index plus one other
layer of lower refractive index. The effect of a 10 nm thick
protein layer is also predicted.
[0488] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
medium RI, the starting and ending wavelengths, the scattering
angle, and the detection full acceptance angle. The diameter and
refractive index of the core and the thickness and refractive index
of the layer were varied. The binding of a protein layer was
modeled by the addition of a uniform 10 nm thick layer of
refractive index 1.45 on the outside of the microparticle.
[0489] Particle-by-Particle Specifications:
[0490] The particle number is listed in Table 11 followed by the
parameters used in the simulations: Core diameter (D.sub.Core in
FIG. 22), Core refractive index (RI.sub.core in FIG. 22), Layer 1
thickness (T.sub.1 in FIG. 22), and Layer 1 refractive index
(RI.sub.L1 in FIG. 22). In this Example, Particle 1 is a
homogeneous core only, given for reference. In the remaining
particles, the core and layer thicknesses are such that the total
particle size is the same as for Particle 1. The addition of
protein is done on Particle 2, so for the purposes of illustrating
the detection of protein binding, Particle 2 should be used as a
reference particle.
12TABLE 11 Particle Parameters Used to Calculate the Predicted
Spectra of Example 16 Core Layer one Layer Protein diameter Core
thickness one layer Protein Particle No. (.mu.m) RI (.mu.m) RI
(.mu.m) layer RI 1 40 1.65 -- -- -- -- 2 30 1.85 10 1.65 -- --
(Reference particle) 3 31.1 1.85 10 1.65 -- -- 4 30 1.87 10 1.65 --
-- 5 30 1.85 10.9 1.65 -- -- 6 30 1.85 10 1.67 -- -- 7 29.5 1.82
9.7 1.63 -- -- 8 1.85 10 1.65 0.01 0.01 1.45
[0491] The predicted scattering patterns are shown in FIGS. 22-23.
These results illustrate the use of a homogeneous core of high
refractive index, plus one layer of lower refractive index, as an
identifiable microparticle. Such a microparticle gives rise to
additional scattering resonances compared to the particles of
Example 6. These additional resonances are produced by the high/low
refractive index transition between the core and the layer because
that transition is sufficient to establish a second set of
resonances. Variations in diameter of the core and layer, and in
refractive index (RI) of the core and layer, give rise to
variations in the scattering pattern suitable for use as
identifying markers for the particle (Nos. 1-7). Addition of a 10
nm thick protein layer induces a shift in the overall scattering
pattern suitable for detecting the binding of a target protein (No.
8), as shown in FIG. 23.
Example 17
Predicted Resonant Light Scattering Spectra for Microparticles
Having a Low Refractive Index Core Plus 2 Layers, 2 Sets of
Resonances
[0492] The purpose of this Example was to use computer simulation
to predict the resonant light scattering spectra for particles with
a homogeneous core of low refractive index, plus two layers, one
having a higher refractive index than the other. The effect of a 10
nm thick protein layer is also predicted.
[0493] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
medium RI, the starting and ending wavelengths, the scattering
angle, and the detection full acceptance angle. The binding of a
protein layer was modeled by the addition of a uniform 10 nm thick
layer of refractive index 1.45 on the outside of the
microparticle.
[0494] Particle-by-Particle Specifications:
[0495] The particle number is listed in 12 followed by the
parameters used in the simulations: Core diameter (D.sub.Core in
FIG. 24), Core refractive index (RI.sub.core in FIG. 24), Layer 1
and 2 thicknesses (T.sub.1 and T.sub.2, respectively in FIG. 24),
and Layer 1 and Layer 2 refractive indices (RI.sub.L1 and
RI.sub.L2, respectively, in FIG. 24. In this Example, Particle 1 is
a homogeneous core only, given for reference. In the remaining
particles, the core and layer thicknesses are such that the total
particle size is the same as for Particle 1. The addition of
protein is done on Particle 2, so for the purposes of illustrating
the detection of protein binding, Particle 2 should be used as a
reference particle.
13TABLE 12 Particle Parameters Used to Calculate the Predicted
Spectra of Example 17 Layer Layer Core one Layer two Protein
diameter Core thickness one thickness Layer layer Protein Particle
No. (.mu.m) RI (.mu.m) RI (.mu.m) two RI (.mu.m) layer RI 1 40 1.7
-- -- -- -- -- -- 2 20 1.7 10 1.85 10 1.7 -- -- (Reference
particle) 3 20 1.7 10 1.85 10 1.7 0.01 1.45
[0496] The predicted scattering patterns are shown in FIG. 24.
These results illustrate the use of a homogeneous core of low
refractive index, plus two layers, one having higher refractive
index than the other, as an identifiable microparticle. Such a
microparticle gives rise to multiple scattering resonances,
produced by the high/low refractive index transition between the
second layer and the medium and also by the high/low refractive
index transition between the core and the first layer. Variations
in diameter of the core and layers, and in refractive index (RI) of
the core and layers, give rise to variations in the scattering
pattern suitable for use as identifying markers for the particle.
In this Example, only a reference particle is shown. Varying the 5
parameters, singly or more than one at a time, produces unique
spectra as in the previous Examples. Addition of a 10 nm thick
protein layer induces a shift in the overall scattering pattern
suitable for detecting the binding of a target protein. For
simplicity, only the base cases are shown. Varying the parameters
in any combination results in changes in the scattered light
pattern, showing the utility for generating a high multiplicity of
identifying markers for a population of particles.
Example 18
Predicted Resonant Light Scattering Spectra for Microparticles
Having a Core with a Black Center
[0497] The purpose of this Example was to use computer simulation
to predict the resonant light scattering spectra for particles with
a two-part core. The inner part is an optically opaque sphere, and
the outer part is an optically transparent shell. The effect of a
10 nm thick protein layer is also predicted.
[0498] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
medium RI, the starting and ending wavelengths, the scattering
angle, and the detection full acceptance angle. The binding of a
protein layer was modeled by the addition of a uniform 10 nm thick
layer of refractive index 1.45 on the outside of the
microparticle.
[0499] Particle-by-Particle Specifications:
[0500] The particle number is listed in Table 13 followed by the
parameters used in the simulations: Core diameter (D.sub.InnerCore
in FIG. 25), Outer Core diameter (D.sub.OuterCore in FIG. 25), and
Outer Core refractive index (RI.sub.OuterCore in FIG. 25). In this
Example, Particle 1 is a homogeneous core only, given for
reference. In the remaining particles, the inner and outer core
diameters are such that the total particle size is the same as for
Particle 1. The addition of protein is done on Particle 11, so for
the purposes of illustrating the detection of protein binding,
Particle 11 should be used as a reference particle.
14TABLE 13 Particle Parameters Used to Calculate the Predicted
Spectra of Example 18 Black Black Black Core core Core Core Layer
Protein Particle diameter Core diameter Real Imag thickness Layer
layer Protein No. (.mu.m) RI (.mu.m) RI RI (.mu.m) RI (.mu.m) layer
RI 1 40 1.8 -- -- -- -- -- -- -- 2-6 -- -- 5 to 25 1.8 0.01 To make
1.8 -- -- increasing 40 .mu.m by 5 overall diameter 7-18 -- -- 26
to 37 1.8 0.01 To make 1.8 -- -- increasing 40 .mu.m by 1 overall
diameter 19 -- -- 30 1.8 0.01 10 1.8 0.01 1.45
[0501] The predicted scattering patterns are shown in FIGS. 25-27.
In FIG. 26, it is seen that for core diameters less than about 29
.mu.m, no effect is observed from the presence of the absorbing
core. These core diameters are smaller than that of the caustic
surface. The disappearance of optical resonances is illustrated as
the diameter of absorbing core reaches the diameter of the caustic
surface. In this Example, the caustic surface is between 31 and 32
.mu.m in diameter. The effect is quite rapid with increasing core
diameter. Some resonance structures are still seen in the 31 .mu.m
core particle; when the core reaches 32 .mu.m the resonances are
substantially destroyed. As the inner absorbing core grows, it
eventually comprises most of the particle. Although some values of
the absorbing core diameter give rise to slowly varying ripple
structure in the resonance patterns, the sharp resonance structures
shown in earlier Examples do not return. FIG. 27 shows the
detection of protein binding on the outside of a two-layer core,
the core comprising an absorbing sphere. In this Example, the core
diameter is less than that of the caustic surface and thus does not
interfere with the production of resonance features.
[0502] The results of this Example show that structures inside of
the caustic surface do not interfere with the production of optical
resonances. Thus, for example, the core may consist of a highly
light-absorbing inner particle such as a magnetic or colored
microsphere, providing the diameter of the inner particle is less
than the diameter of the caustic surface. When the diameter of the
inner absorbing core reaches that of the caustic surface, the
production of resonant scattering features is no longer possible,
as shown in particles 13 through 18 of this Example. Physically
this may be understood by recognizing that the light rays giving
rise to the resonant scattering features travel in orbits just
inside the outer surface of the particle, trapped by total internal
reflection. The caustic surface lies inside the physical outer
surface of the particle, and defines the zone in which the rays
travel. When the absorbing core is large enough to encroach into
this zone, it absorbs the rays, destroying the ability for
resonance to occur.
[0503] Binding of a protein layer on the surface of the
"black-centered" two-layered microparticle is detected as a shift
in the scattering pattern for those particles in which the core is
sufficiently small to enable the production of resonances.
Example 19
Predicted Resonant Light Scattering Spectra for Microparticles
Having a Radially Varying Refractive Index Core
[0504] The purpose of this Example was to use computer simulation
to predict the resonant light scattering spectra for particles
having a core in which the refractive index varies as a function of
the distance from the center. The effect of a 10 nm thick protein
layer is also predicted.
[0505] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
medium RI, the starting and ending wavelengths, the scattering
angle, and the detection full acceptance angle. The refractive
index variation was modeled as a core plus 9 layers, the refractive
index of the layers changing with their radii. Several types of
variation of refractive index with radius were used, including
linear and non-linear variations. The binding of a protein layer
was modeled by the addition of a uniform 10 nm thick layer of
refractive index 1.45 on the outside of the microparticle.
[0506] Particle-by-Particle Specifications:
[0507] Except for Particle 1, the reference particle, the particle
number is listed in Table 14 followed by the parameters used in the
simulations: Core refractive index (RI.sub.core in FIG. 28), and
Layer 1, 2, 3, . . . 9 refractive indices (RI.sub.L1-RI.sub.L9,
respectively, in FIG. 28). In this Example, Particle 1 is a
homogeneous core only, given for reference. In the remaining
particles, the core and layer thicknesses are such that the total
particle size is the same as for Particle 1. The addition of
protein is done on Particle 5, so for the purposes of illustrating
the detection of protein binding, Particle 5 should be used as a
reference particle. Note that for simplicity, not all layers are
shown in the drawing. Particle 1, the reference particle for
homogeneous structure, has a core diameter of 40 .mu.m and a core
RI of 1.8. For particles 2-8, the core diameter is 8 .mu.m and the
layer thicknesses are 2 .mu.m, so as to make the total diameter of
particles 2-8 to be 40 .mu.m, the same as Particle 1.
15TABLE 14 Particle Parameters Used to Calculate the Predicted
Spectra of Example 19 Protein Particle Layer 2 Layer 3 Layer 4
Layer Layer Layer 7 Layer Layer layer No. Core RI RI RI RI 5 RI 6
RI RI 8 RI 9 RI (.mu.m), RI 2 (linear 1.7200 1.7300 1.7400 1.7500
1.7600 1.7700 1.7800 1.7900 1.800 -- variation) 3 (linear) 1.7500
1.7611 1.7667 1.7722 1.7778 1.7833 1.7889 1.7944 1.800 -- 4 (non-
1.7500 1.7512 1.7526 1.7553 1.7595 1.7656 1.77414 1.7853 1.800 --
linear) 5 (non- 1.7500 1.7505 1.7506 1.7510 1.7522 1.7553 1.7620
1.7752 1.800 -- linear) 6 (flat1- 1.7620 1.7620 1.7620 1.7620
1.7620 1.7620 1.7620 1.7752 1.800 -- non- linear) 7 (flat2- 1.7752
1.7752 1.7752 1.7752 1.7752 1.7752 1.7752 1.7752 1.800 -- non-
linear) 8 (non- 1.7500 1.7505 1.7506 1.7510 1.7522 1.7553 1.7620
1.7752 1.800 0.01, linear) 1.4500
[0508] The predicted scattering patterns are shown in FIGS. 28-29.
These results illustrate the use of a core in which the refractive
index varies as a function of the distance from the center. The
results of this Example demonstrate the potential for constructing
a population of identifiable microparticles by manufacturing the
particles in such a way as to induce a radially varying refractive
index. Natural variations will occur in any production method for
such a population of particles, these variations giving rise to
uniquely distinguishable particles by means of their optical
scattering patterns. Binding of a protein layer on the surface of
the radially varying core is detected as a shift in the scattering
pattern.
Example 20
Predicted Effects of the Medium Refractive Index on the Resonant
Light Scattering Spectra
[0509] The purpose of this Example was to use computer simulation
to predict the effect of a change in refractive index of the medium
in which the microparticle is placed on the resonant light
scattering spectra. The Example considers a homogeneous sphere with
no additional optically active layers. The effect of varying
refractive index of the medium is compared with the effect of
binding a layer of protein.
[0510] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
starting and ending wavelengths, the scattering angle, and the
detection full acceptance angle. The refractive index of the medium
was varied. The binding of a protein layer was modeled by the
addition of a uniform 10 nm thick layer of refractive index 1.45 on
the outside of the microparticle.
[0511] Particle-by-Particle Specifications:
[0512] The particle number is listed in Table 15 followed by the
parameters used in the simulations: Core diameter (D.sub.Core in
FIG. 30), Core refractive index (RI.sub.core in FIG. 307), and
Medium refractive index (RI).
16TABLE 15 Particle Parameters Used to Calculate the Predicted
Spectra of Example 20 Core Protein diameter Core layer Protein
Particle No. (.mu.m) RI Medium RI (.mu.m) layer RI 1 (Reference 40
1.8 1.33 -- -- particle) 2 40 1.8 1.33665 -- -- 3 (core plus
protein, 40 1.8 1.33 0.01 1.45 initial RI) 4 (core plus protein, 40
1.8 1.33665 0.01 1.45 changed RI)
[0513] The predicted scattering patterns are shown in FIGS. 30-31.
As shown in FIG. 31 (top and bottom pairs of spectra), there is a
change in the relative peak intensities, as well as a systematic
shift in wavelength when the medium refractive index is changed. As
shown in FIG. 31 (middle pair of spectra), there is only a shift in
the spectrum with no change in relative peak intensities when a
protein layer is added to the reference particle.
Example 21
Predicted Effects of Signal Amplification Using Refractive Index
2.5 Material
[0514] The purpose of this Example was to use computer simulation
to predict the effect of using a high refractive index structure
(for example TiO.sub.2 nanoparticles), attached to the target
molecules, for enhancing the wavelength shift upon binding of the
target to the surface of the microparticle.
[0515] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
medium RI, the starting and ending wavelengths, the scattering
angle, and the detection full acceptance angle. The amplification
effect was modeled by adding a thin layer of high refractive index
material, the thickness of which corresponds to a given mass of
nanoparticles, to the outside of a two-layer microparticle on which
a protein layer has been added. In this Example, the amplifying
structure was assigned a refractive index of 2.5.
[0516] Particle-by-Particle Specifications:
[0517] The particle number is listed in Table 16 followed by the
parameters used in the simulations: Core diameter (D.sub.Core in
FIG. 32), Core refractive index (RI.sub.core in FIG. 32), Layer 1
thickness (T.sub.1 in FIG. 32), Layer 1 refractive index (RI.sub.L1
in FIG. 32), protein layer thickness (T.sub.2 in FIG. 32), protein
layer refractive index (RI.sub.L2 in FIG. 32), amplifying layer
thickness (T.sub.3 in FIG. 32), and amplifying layer refractive
index (RI.sub.L3 in FIG. 32).
17TABLE 16 Particle Parameters Used to Calculate the Predicted
Spectra of Example 21 Amplifying Core Layer one Protein Protein
layer diameter Core thickness Layer layer layer thickness
Amplifying Particle No. (.mu.m) RI (.mu.m) one RI (.mu.m) RI (nm)
layer RI 1 40 1.7 0.4 1.6 -- -- -- -- (Reference particle) 2 40 1.7
0.4 1.6 0.01 1.45 -- -- 3-5 40 1.7 0.4 1.6 0.01 1.45 2 to 6 nm 2.5
increasing by 2
[0518] The effects of increasing the amplifying layer thickness are
shown in FIGS. 32-33. As more amplifying material is added, the
wavelength shift increases relative to that using no amplifying
material. These results illustrate the use of a high refractive
index structure (for example TiO.sub.2 nanoparticles), attached to
the target molecules, for enhancing the wavelength shift upon
binding of the target to the surface of the microparticle. This is
a general concept for on-microparticle amplification of the binding
signal. Note that unbound target molecules with the amplifier
structure attached will have no interfering effect on the
scattering spectrum since only bound target is measured.
Example 22
Predicted Effects of Signal Amplification Using Refractive Index
2.2 Material
[0519] The purpose of this Example was to use computer simulation
to predict the effect of using a high refractive index structure
(for example a metal or metal oxide or other composition of
nanoparticles), attached to the target molecules, for enhancing the
wavelength shift upon binding of the target to the surface of the
microparticle.
[0520] The simulated spectra were calculated as described in
Example 5 using the same values given in that Example for the
medium RI, the starting and ending wavelengths, the scattering
angle, and the detection full acceptance angle. The amplification
effect was modeled by adding a thin layer of high-index material,
the thickness of which corresponds to a given mass of
nanoparticles, to the outside of a two-layer microparticle on which
a protein layer has been added. In this Example, the amplifying
structure was assigned a refractive index of 2.2, slightly less
than that of Example 12.
[0521] Particle-by-Particle Specifications:
[0522] The particle number is listed in Table 17, followed by the
parameters used in the simulations: Core diameter (D.sub.Core in
FIG. 34), Core refractive index (RI.sub.core in FIG. 34), Layer 1
thickness (T.sub.1 in FIG. 34), Layer 1 refractive index (RI.sub.L1
in FIG. 34), protein layer thickness (T.sub.2 in FIG. 34), protein
layer refractive index (RI.sub.L2 in FIG. 34), amplifying layer
thickness (T.sub.3 in FIG. 34), and amplifying layer refractive
index (RI.sub.L3 in FIG. 34).
18TABLE 17 Particle Parameters Used to Calculate the Predicted
Spectra of Example 22 Layer Amplifying Core one Protein layer
Amplifying Particle diameter Core thickness Layer layer Protein
thickness layer No. (.mu.m) RI (.mu.m) one RI (.mu.m) layer RI (nm)
RI 1 40 1.7 0.4 1.6 -- -- -- -- (Reference particle) 2 40 1.7 0.4
1.6 0.01 1.45 -- -- 3-7 40 1.7 0.4 1.6 0.01 1.45 2 to 10 nm 2.2
increasing by 2
[0523] The effects of increasing the amplifying layer thickness are
shown in FIGS. 34-37. As more amplifying material is added, the
wavelength shift increases relative to that using no amplifying
material. It is seen that the amplifying effect is slightly lower
for the lower refractive index material of Example 13 than for the
higher refractive index material of Example 12.
[0524] These results illustrate the use of a high refractive index
structure (for example a layer of metal, metal oxide or other
composition of nanoparticles), attached to the target molecules,
for enhancing the wavelength shift upon binding of the target to
the surface of the microparticle. This is a general concept for
on-microparticle amplification of the binding signal. Note that
unbound target molecules with the amplifier structure attached will
have no interfering effect on the scattering spectrum since only
bound target is measured.
[0525] It should be noted that the shapes and intensities of the
narrow resonance peaks in a spectrum may be affected by the
wavelength step size used in the calculations. In all the preceding
computer simulation Examples, i.e., Examples 5-13, 2000 wavelength
steps were used. In some cases, reducing the step size could give
rise to additional narrow resonances being displayed; however, this
would not substantially alter the results illustrated by these
Examples. In real measurements, the resolution of the detection
equipment will dictate which resonances will be used to identify
the particle and measure binding.
Sequence CWU 1
1
17 1 516 DNA Artificial sequence Synthetic FMD target 1 gcggccgcgc
ccccggccac ttttggccat tcacccgagc gaagctagac acaaacaaaa 60
gattgtggca ccggtgaaac agcttttgag ctttgacctg ctcaagttgg caggggacgt
120 cgagtccaac cctgggcctt tcttcttctc tgacgttagg tcaaattttt
ccaagttggt 180 tgaaaccatc aaccagatgc aggaggacat gtcaacaaaa
cacggacccg actttaaccg 240 gttggtgtct gcatttgagg aactggccac
cggagtgaag gctatcagga ccggtctcga 300 tgaggccaaa ccctggtaca
agctcatcaa gctcttgagc cgcctgtcat gtatggccgc 360 tgtagcagca
cggtcaaagg acccagtcct tgtggccatc atgctggctg acaccggcct 420
tgagattctg gacagtacct ttgtcgtgaa gaagatctcc gactcgctct ccagtctctt
480 tcacgtaccg gcccccgtct tcagtttcgg gaattc 516 2 48 DNA Artificial
Sequence Oligonucleotide probe JBP 2 tcaaccagat gcaggaggac
atgtcaacaa aacacggacc cgacttaa 48 3 48 DNA Artificial Sequence
Modified oligonucleotide probe JBP S2SP3B 3 tcaaccagat gcaggaggac
atgtcaacaa aacacggacc cgacttaa 48 4 48 DNA Artificial Sequence
Oligonucleotide probe N-JBC 4 ttaagtcggg tccgtgtttt gttgacatgt
cctcctgcat ctggttga 48 5 48 DNA Artificial Sequence
Fluorescein-labeled oligonucleotide target JBC-F 5 ttaagtcggg
tccgtgtttt gttgacatgt cctcctgcat ctggttga 48 6 49 DNA Artificial
Sequence Fluorescein-labeled oligonucleotide target control Lac2-F
6 tgaatttgat tgcgagtgag atatttatgc cagccagcca gacgcagac 49 7 48 DNA
Artificial Sequence Fluorescein-labeled oligonucleotide target
JBP-F 7 tcaaccagat gcaggaggac atgtcaacaa aacacggacc cgacttaa 48 8
206 DNA Artificial Sequence FMD PCR fragment JB 8 gagtccaacc
ctgggccctt cttcttctct gacgttaggt caaatttttc caagttggtt 60
gaaaccatca accagatgca ggaggacatg tcaacaaaac acggacccga ctttaaccgg
120 ttggtgtctg catttgagga actggccacc ggagtgaagg ctatcaggac
cggtctcgat 180 gaggccaaac cctggtacaa gctcat 206 9 511 DNA
Artificial Sequence Lac2-511 PCR nonspecific target fragment 9
atactgcaga acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca
60 ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc
tctgaccaga 120 cacccatcaa cagtattatt ttctcccatg aagacggtac
gcgactgggc gtggagcatc 180 tggtcgcatt gggtcaccag caaatcgcgc
tgttagcggg cccattaagt tctgtctcgg 240 cgcgtctgcg tctggctggc
tggcataaat atctcactcg caatcaaatt cagccgatag 300 cggaacggga
aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 360
atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa
420 tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta
gtgggatacg 480 acgataccga agacagctca tggaattctg t 511 10 27 DNA
Artificial Sequence Primer 10 gagtccaacc ctgggccctt cttcttc 27 11
23 DNA Artificial Sequence Primer 11 atgagcttgt accagggttt ggc 23
12 30 DNA Artificial Sequence Primer 12 atactgcaga acgcgtcagt
gggctgatca 30 13 35 DNA Artificial Sequence Primer 13 acagaattcc
atgagctgtc ttcggtatcg tcgta 35 14 16 DNA Artificial Sequence
Peptide nucleic acid probe JBP2C 14 tccgtgtttt gttgac 16 15 16 DNA
Artificial Sequence Modified Peptide Nucleic Acid Probe JBP2BC 15
tccgtgtttt gttgac 16 16 206 DNA Artificial Sequence Compliment of
PCR product JB 16 atgagcttgt accagggttt ggcctcatcg agaccggtcc
tgatagcctt cactccggtg 60 gccagttcct caaatgcaga caccaaccgg
ttaaagtcgg gtccgtgttt tgttgacatg 120 tcctcctgca tctggttgat
ggtttcaacc aacttggaaa aatttgacct aacgtcagag 180 aagaagaagg
gcccagggtt ggactc 206 17 48 DNA Artificial Sequence Modified
fluorescein-labeled oligonucleotide probe JBP S2SP3F 17 tcaaccagat
gcaggaggac atgtcaacaa aacacggacc cgacttaa 48
* * * * *