U.S. patent application number 10/766560 was filed with the patent office on 2005-12-22 for immunologically active peptides with altered toxicity useful for the preparation of antipertussis vaccine.
This patent application is currently assigned to Chiron S.r.l.. Invention is credited to Bartoloni, Antonella, Pizza, Mariagrazia, Rappuoli, Rino.
Application Number | 20050281837 10/766560 |
Document ID | / |
Family ID | 31998603 |
Filed Date | 2005-12-22 |
United States Patent
Application |
20050281837 |
Kind Code |
A1 |
Pizza, Mariagrazia ; et
al. |
December 22, 2005 |
Immunologically active peptides with altered toxicity useful for
the preparation of antipertussis vaccine
Abstract
Immunologically active polypeptides with no or reduced toxicity
useful for the preparation of an antipertussis vaccine. Method for
the preparation of said polypeptides which comprises, cultivating a
microorganisms transformed with a hybrid plasmid including the
gene/s which codes for at least one of said polypeptides in a
suitable medium and recovering the desired polypeptide from the
cells or from the culture medium.
Inventors: |
Pizza, Mariagrazia; (Siena,
IT) ; Bartoloni, Antonella; (Siena, IT) ;
Rappuoli, Rino; (Siena, IT) |
Correspondence
Address: |
Chiron Corporation
Intellectual Property - R440
P.O. Box 8097
Emeryville
CA
94662-8097
US
|
Assignee: |
Chiron S.r.l.
Siena
IT
|
Family ID: |
31998603 |
Appl. No.: |
10/766560 |
Filed: |
January 29, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10766560 |
Jan 29, 2004 |
|
|
|
08261668 |
Jun 17, 1994 |
|
|
|
6713072 |
|
|
|
|
08261668 |
Jun 17, 1994 |
|
|
|
08012243 |
Feb 1, 1993 |
|
|
|
08012243 |
Feb 1, 1993 |
|
|
|
07265742 |
Nov 1, 1988 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
530/350 |
Current CPC
Class: |
C07K 14/235 20130101;
Y10S 424/832 20130101; A61K 39/00 20130101 |
Class at
Publication: |
424/190.1 ;
530/350 |
International
Class: |
A61K 039/02; C07K
014/195 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 2, 1987 |
IT |
22481 A/87 |
Claims
1-19. (canceled)
20. A polypeptide comprising the S1 subunit of pertussis toxin
wherein the S1 subunit is modified by the substitution in one or
more sites selected from the group consisting of tyrosine in
position 8, arginine in position 9, phenylalanine in position 50,
threonine in position 53, glutamic acid in position 129, glycine in
position 121, alanine in position 124, aspartic acid in position
109, glycine in position 99, arginine in position 135, threonine in
position 159 and tyrosine in position 111 with another amino acid
capable of destroying or reducing the toxicity of the S1
subunit.
21. The polypeptide of claim 20 wherein at least glutamic acid in
position 129 of the S1 subunit is substituted with another amino
acid.
22. The polypeptide of claim 21 wherein said polypeptide is further
modified by the substitution in one or more sites selected from the
group consisting of tyrosine in position 8, arginine in position 9,
phenylalanine in position 50, threonine in position 53, glycine in
position 121, alanine in position 124, aspartic acid in position
109, glycine in position 99, arginine in position 135, threonine in
position 159, and tyrosine in position 111 with another amino acid
capable of destroying or reducing the toxicity of the S1
subunit.
23. The polypeptide of claim 22 wherein arginine in position 9 of
the S1 subunit is substituted with another amino acid.
24. The polypeptide of claim 20 wherein said polypeptide further
comprises at least one of the S2, S3, S4, and S5 subunits of the
pertussis toxin.
25. The polypeptide of claim 24 wherein said polypeptide comprises
the S2, S3, S4, and S5 subunits and said S2, S3, S4, and S5
subunits have the same arrangement as that present in natural
pertussis toxin.
26. The polypeptide of claim 20 wherein tyrosine in position 8 of
the S1 subunit is substituted with aspartic acid and wherein
arginine in position 9 of the S1 subunit is substituted with
glycine.
27. The polypeptide of claim 20 wherein phenylalanine in position
50 of the S1 subunit is substituted with glutamic acid and wherein
threonine in position 53 of the S1 subunit is substituted with
glycine.
28. The polypeptide of claim 20 wherein glycine in position 99 of
the S1 subunit is substituted with glutamic acid.
29. The polypeptide of claim 20 wherein the glycine in position 121
of the S1 subunit is substituted with glutamic acid.
30. The polypeptide of claim 20 wherein the alanine in position 124
of the S1 subunit is substituted with aspartic acid.
31. A method for the preparation of a polypeptide of claim 20,
comprising: a) modifying by direct mutagenesis a DNA molecule
coding for an S1 subunit of pertussis toxin a base sequence of
which codes for an amino acid selected from the group consisting of
(1) tyrosine in position 8, (2) arginine in position 9, (3)
phenylalanine in position 50, (4) threonine in position 53, (5)
glutamic acid in position 129, (6) glycine in position 121, (7)
alanine in position 124, (8) aspartic acid in position 109, (9)
glycine in position 99, (10) arginine in position 135, (11)
threonine in position 159, and (12) tyrosine in position 111 of the
S1 subunit with a base sequence that codes for an amino acid of
interest; b) constructing a hybrid plasmid linking a cloning vector
with the DNA molecule; c) transforming a host microorganism with
the hybrid plasmid; d) cultivating the transformed host
microorganism in a suitable culture medium; and e) recovering the
polypeptide from the culture medium or from the host
microorganism.
32. The method of claim 31 wherein the DNA molecule is the gene
coding for the S1 subunit is contained in the pertussis toxin
operon.
33. The method of claim 32 wherein the DNA molecule further encodes
at least one of the S2, S3, S4, or S5 subunits of the pertussis
toxin.
34. The method of claim 33 wherein the DNA molecule is the operon
that codes for the pertussis toxin.
35. The method of claim 32 wherein the host microorganism is
selected from the group consisting of E. coli, a bacillus, and a
yeast.
36. The method of claim 35 wherein the microorganism is E.
coli.
37. An antipertussis vaccine comprising a therapeutically effective
quantity of at least one polypeptide of claim 21.
38. An antipertussis vaccine comprising a therapeutically effective
quantity of at least one polypeptide of claim 22.
39. An isolated DNA molecule comprising a nucleotide sequence
coding for a polypeptide comprising the S1 subunit of pertussis
toxin wherein bases coding for one or more sites of the S1 subunit
selected from the group consisting of (1) tyrosine in position 8,
(2) arginine in position 9, (3) phenylalanine in position 50, (4)
threonine in position 53, (5) glutamic acid in position 129, (6)
glycine in position 121, (7) alanine in position 124, (8) aspartic
acid in position 109, (9) glycine in position 99, (10) arginine in
position 135, (11) threonine in position 159, and (12) tyrosine in
position 111 are substituted with bases coding for another amino
acid capable of destroying or reducing toxicity of the S1
subunit.
40. The DNA molecule of claim 39 wherein at least the bases of the
DNA molecule coding for glutamic acid in position 129 of said S1
subunit are substituted with bases coding for another amino
acid.
41. The DNA molecule of claim 40 which is further modified by the
substitution of bases coding for one or more amino acids of the S1
subunit selected from the group consisting of (1) tyrosine in
position 8, (2) arginine in position 9, (3) phenylalanine in
position 50, (4) threonine in position 53, (5) glycine in position
121, (6) alanine in position 124, (7) aspartic acid in position
109, (10) glycine in position 99, (11) arginine in position 135,
(12) threonine in position 159, and (13) tyrosine in position 111
are substituted with bases coding for another amino acid capable of
destroying or reducing toxicity of the S1 subunit.
42. The DNA molecule of claim 41 wherein bases coding for arginine
in position 9 of the S1 subunit are substituted with bases coding
for another amino acid.
43. The DNA molecule of claim 41 wherein the polypeptide contains
at least one of the S2, S3, S4, or S5 subunits of the pertussis
toxin.
44. The DNA molecule of claim 43 wherein the polypeptide comprises
the S2, S3, S4, and S5 subunits in the same arrangement as that
present in natural pertussis toxin.
45. The DNA molecule of claim 39 wherein bases coding for tyrosine
in position 9 are substituted with bases coding for aspartic acid
and wherein bases coded for arginine in position 9 of the S1
subunit are substituted with bases coding for glycine.
46. The DNA molecule of claim 39 wherein bases coding for
phenylalanine in position 50 are substituted with bases coding for
glutamic acid and wherein bases coding for threonine in position 53
of the S1 subunit are substituted with bases coding for
isoleucine.
47. The DNA molecule of claim 39 wherein bases coding for glycine
in position 99 of the S1 subunit are substituted with bases coding
for glutamic acid.
48. The DNA molecule of claim 39 wherein bases coding for glycine
in position 121 of the S1 subunit are substituted with bases coding
for glutamic acid.
49. The DNA molecule of claim 39 wherein bases coding for alanine
in position 124 of the S1 subunit are substituted with bases coding
for aspartic acid.
50. A method for immunizing a human against pertussis comprising
administering an effective amount of a vaccine selected from the
group consisting of the vaccine of claim 37 and the vaccine of
claim 38.
51. A method of preparing an antipertussis vaccine comprising
formulating a therapeutically effective amount of a polypeptide in
vaccine form, wherein the polypeptide is selected from the group
consisting of the polypeptides of claims 21-25.
52. An isolated preparation of E. coli selected from the group
consisting of PTE 255-22 deposited as ATCC Accession No. 67542, PTE
255-28 deposited as ATCC Accession No. 67543, and PTE 255-41
deposited as ATCC Accession No. 67544.
Description
[0001] This application is a continuation application of co-pending
application Ser. No. 08/261,668, filed Jun. 17, 1994, which is a
continuation application of application Ser. No. 08/012,243, filed
Feb. 1, 1993, abandoned, which is a continuation application of
application Ser. No. 07/265,742, filed Nov. 1, 1988, abandoned,
which claims priority under 35 U.S.C. .sctn. 119 to Italian
application serial number 22481 A/87 filed Nov. 2, 1987.
FIELD OF THE INVENTION
[0002] The present invention relates to immunologically active
polypeptides with no or reduced toxicity useful for the production
of an antipertussis vaccine.
[0003] The invention also relates to a method for the preparation
of said polypeptides and to an antipertussis vaccine comprising a
therapeutically effective amount of at Least one of said
polypeptides.
BACKGROUND
[0004] Pertussis is a respiratory system disease caused by
Bordetella pertussis (B. pertussis), a bacillus the transmission of
which occurs during the catarrhal and convulsive phase from a sick
person to a healthy predisposed individual through the respiratory
system.
[0005] A vaccine effective against said disease is particularly
desirable since pertussis may cause convulsions, cerebral damages
and, sometimes, death, principally in tender age children and in
newborn Babies lacking maternal antipertussis antibodies obtained
passively.
[0006] At present, it is employed an antipertussis vaccine
comprising virulent bacteria killed with merthiolate and treated at
56.degree. C. that, even if it confers a permanent protection, it
is not, however, completely satisfactory, either for the presence
of undesired side effects or for the numerous problems deriving
from the preparation and purification thereof.
[0007] This results in the necessity of preparing an antipertussis
vaccine lacking of the aforementioned drawbacks.
[0008] It is known that B. pertussis has, per se, no virulence and
that its toxicity is correlated with the synthesis, during the
phase I (virulent), of such substances as: hemolysin (HLs),
adenylcyclase (Adc), dermonecrotic toxin (Dnc), filamentary
hemagglutinin (Fha) and pertussis toxin (PT). The latter, in
particular, represents not only the major virulence factor caused
by B. pertussis (Weiss A. et al. (1983) Infect, Immun. 42, 333-41;
Weiss A. et al. (1984) J. Inf. Dis. 150, 219-222) but also one of
the major protective antigens against infections caused by said
bacterium.
[0009] Anti-PT antibodies, in fact, have been found in individuals
immunized by the cellular vaccine (Ashworth L. A. E. et al. (1983)
Lancet. October 878-881) and a protective immunity has been
obtained in mice infected, via aerosol or intracerebrally, using
formaldehyde-detoxified PT (Sato Y. et al. (1983) Inf. and Imm. 41,
313). Even if the pertussis toxin represents an essential component
in the preparation of new antipertussis vaccines, its use is
Limited by the numerous drawbacks deriving from its toxicity.
[0010] The PT, in fact, induces undesirable pathophysiologic
effects such as: lymphocytosis, histamine sensitivity,
hypoglycemia, insensitivity to the hyperglycemic effect of
epinephrine and activation of the islands of Langerhans.
[0011] Furthermore, it has been found that the PT presence in the
vaccine now employed is the principal cause of such side effects
as: fever, pomphus, neurologic alteration and death which have led,
in recent years, to drastically reducing the use of the vaccine
with the consequent new outbreak of pertussis cases.
SUMMARY OF THE INVENTION
[0012] The PT detoxification treatment by means of formaldehyde
though allowing to get an immunogenic protein without toxicity
(Sato et al. reference reported above), presents some drawbacks
deriving from the fact that said protein is not obtainable in pure,
reproducible and stable form. According to that, polypeptides have
now been found which are able to overcome the prior art drawbacks
and are obtainable in pure form by means of a simple and
economically feasible method. One object of the present invention,
therefore, consists of immunologically active polypeptides with no
or reduced toxicity useful for the preparation of an antipertussis
vaccine.
[0013] A further object of the present invention consists of a
method for the preparation of said polypeptides.
[0014] Another object of the present invention is a vaccine
comprising a therapeutically effective amount of at least one of
said polypeptides.
[0015] Further objects of the present invention will become
apparent from a reading of the following description and
examples.
[0016] The pertussis toxin is a protein comprising five different
subunits the toxicity of which is due to ADP-ribosylation of
proteins which bind GTP involved in the transmission of messages
through eukaryotic cells membranes.
[0017] Said PT comprises two fractions with different
functionality: A comprising the S1 subunit and B comprising S2, S3,
S4 and S5 subunits placed in two dimers D1 (S2+S4) and D2 (S3+S4)
linked to each other by the S5 subunit.
[0018] The A fraction represents the enzymatically active and
therefore toxic part of PT, whereas the B fraction is linked to the
eukaryotic cells membrane receptors and allows the introduction of
the S1 subunit therein.
[0019] In the copending Italian patent application No. 19208-A/86,
now filed in the United States as U.S. application Ser. No.
07/006,438, filed Jan. 23, 1987, the cloning, sequencing and
expression of the genes which code for said subunits have been
described and claimed and it has been shown that said genes are
grouped in a sole operon.
[0020] Furthermore, the ADP-ribosylation activity of the S1 subunit
has been determined, by cultivating a micro-organism transformed
with the hybrid plasmid PTE225, and it has been found that said
subunit possesses an enzymatic activity comparable to that of
PT.
[0021] According to that and to the end of obtaining a protein
having the immunologic and protective properties of the pertussis
toxin but with no or reduced toxicity, the positions and the
fundamental amino acids for the enzymatic activity of the protein
have been identified. In particular, the following positions and
amino acids have been found: tyrosine (8), arginine (9),
phenylalanine (50), threonine (53), glutamic acid (129), glycine
(121), alanine (124), aspartic acid (109), glycine (99), arginine
(135), threonine (159) and tyrosine (111).
[0022] The substitution of one or more of said amino acids with any
amino acid different from the one which is bound to be changed,
allows to obtain a protein with altered toxicity.
[0023] According to that, in accordance with the present invention,
polypeptides have been synthesized containing S1 subunits of the
modified pertussis toxin by means of direct mutagenesis
substituting, in one or more positions of the S1 region comprised
between the 1-180 amino acids, one amino acid with another capable
of destroying or reducing its enzymatic activity without altering
the immunologic properties thereof.
[0024] In particular, polypeptides have been synthesized containing
the S1 subunit of the pertussis toxin modified by substituting:
[0025] the tyrosine in position 8 and arginine in position 9 with
aspartic acid and glycine;
[0026] the phenylalanine in position 50 and the threonine in
position 53 with glutamic acid and isoleucine;
[0027] the glutamic acid in position 129 with glycine;
[0028] the glycine in position 121 with glutamic acid;
[0029] the alanine in position 124 with aspartic acid;
[0030] the aspartic acid in position 109 and the alanine in
position 124 with glycine and aspartic acid respectively;
[0031] the glycine in position 99 with glutamic acid;
[0032] the aspartic acid in position 109 with glycine;
[0033] the arginine in position 135 with glutamic acid;
[0034] the threonine in position 159 with lysine;
[0035] the tyrosine in position 111 with glycine and insertion of
Asp Thr Gly Gly amino acids in position 113.
[0036] In particular, the polypeptides according to the present
invention have been prepared by a method which comprises:
[0037] a) modifying by means of direct mutagenesis the gene which
codes for the S1 subunit of the pertussis toxin substituting, in
one or more sites of the DNA molecule, the bases sequence which
codes for a predetermined amino acid with a bases sequence which
codes for the amino acid of interest;
[0038] b) constructing a hybrid plasmid linking a cloning vector
with the DNA fragment containing the modified S1;
[0039] c) transforming a host microorganism with a hybrid plasmid
obtained as reported in b);
[0040] d) cultivating in a suitable culture medium, in presence of
carbon, nitrogen and mineral salts sources a transformed
microorganism and then,
[0041] e) recovering the polypeptide containing the modified S1
subunit from the culture medium or from the cells.
[0042] According to the present invention and to the end of
identifying the S1 aminoacidic region correlated to the enzymatic
activity of the protein, the gene which codes for S1 has been
treated with restriction enzymes that cut in different sites and
the DNA fragments so obtained, lacking of the 3' and/or 5' of
different length terminal sequences, have been cloned in an
expression plasmid operating according to one of the generally
known techniques. The vectors containing the DNA fragments with the
deleted sequences have been then employed to transform Escherichia
coli (E. coli) cells.
[0043] The positive transformants, obtained screening the cells on
a selective medium, have been cultivated in a suitable culture
medium at temperatures between 30.degree. C. and 40 .degree. C. for
a period of from 20 minutes to 5 hours.
[0044] At the end of said period, the cells have been recovered
from the culture medium and lysed by means of lysozyme treatment
and sonication.
[0045] The proteins so extracted have been analyzed to determine
the presence of an enzymatic activity.
[0046] In practice the ADP-ribosylation activity of said proteins
has been tested operating according to the method described by
Manning et al. (1984) (J. Biol. Chem. 259, 749-756). The results
obtained, listed in table I of the following example 2, show that
S1 sequences following the amino acid in position 179, are not
necessary for the ADP-ribosylation activity, unlike the first ten
amino acids.
[0047] The enzymatically active region of the S1 subunit,
therefore, is comprised between the 1 and 180 amino acids.
According to that, in accordance with the present invention, the
identification of the active sites present in said region has been
performed and at least one of said sites has been modified.
[0048] In practice, the gene coding for S1 has been isolated from
the PTE 255 plasmid, the construction of which is reported in the
copending Italian patent application No. 19208-A/86, by means of
digestion with the restriction enzymes EcoRI and HindIII.
[0049] The 600 base pairs DNA fragment, comprising the gene coding
for S1, has been separated from the digestion mixture by means of
gel electrophoresis and, after electroelution, has been modified by
direct mutagenesis which allows to introduce in vitro mutations in
determined sites of a DNA molecule and to test in vitro or in vivo
the effect of said mutation.
[0050] By this method the substitution of the desired base it is
made possible operating in one of the following ways:
[0051] by incorporating base analogues in DNA sites;
[0052] by incorporating in a wrong way nucleotides;
[0053] by introducing the mutation during the synthesis in vitro of
oligonucleotides with definite sequences;
[0054] by using specific chemical mutagen agents, such as sodium
bisulfite, which react with the DNA bases.
[0055] According to the present invention, the gene coding for S1
has been modified by using synthetic oligonucleotides with definite
sequences operating according to the method described by Zoller M.
J. et al. (DNA 3:479-488, (1984)).
[0056] In practice, the 600 bp DNA fragment has been cloned in a
vector which allows the isolation of the single helix clone
fragment of the DNA.
[0057] To this end, suitable vectors may be selected from
Bluescript SK (Stratagene S. Diego, Calif.), pEMBL (Dente et al.
Nucleic Acids Research 11, 1645-1655 (1983) or M13 phages (Messing
and Viera (1982) Gene 19, 269-76).
[0058] According to the present invention the commercially
available Bluescript SK vector has been employed.
[0059] Said vector has been treated with suitable restriction
enzymes and then linked to the 600 bp DNA fragment in ligase
mixture in presence of the T4 DNA ligase enzyme.
[0060] The mixture has been then employed to transform E. Coli
cells and the transformants have been successively selected on a
culture medium including ampicillin.
[0061] The positive clones, containing the hybrid plasmids
comprising the vector and the 600 bp DNA fragment, have been
suspended in a liquid medium in the presence of phages and
maintained at a temperature of from 30.degree. C. to 40.degree. C.
for a period of from 2 to 10 hours.
[0062] At the end of said period, the phages have been
precipitated, separated from the solution by centrifugation,
resuspended in a pH 7.5 buffer, extracted with water-ethyl ether
saturated phenol and then extracted with ethanol and ammonium
acetate in order to precipitate the single helix DNA.
[0063] Aliquots of said DNA have then been employed to modify the
S1 gene by direct mutagenesis. To this end oligonucleotides of
about 20 nucleotides have been synthesized in which the bases which
code for one or more amino acids present in determined sites of the
1-180 S1 region have been substituted with others which code for a
different amino acid. In particular oligonucleotides have been
synthesized which allow to prepare the following mutants of the
gene coding for S1.
[0064] 41: Tyrosine 8 and arginine 9 are substituted with Aspartic
and Glycine respectively using the primer GTCATAGCCGTCTACGGT. The
corresponding gene has been modified in this way:
1 620-CGCCACCGTATACCGCTATGACTCCCGCCCG-650
620-CGCCACCGTAGACGGCTATGACTCCCGCCCG-650
[0065] 22: Phenylalanine 50 and threonine 53 are substituted with
glutamic acid and isoleucine respectively using the primer
TGGAGACGTCAGCGCTGT. The corresponding gene has been modified in
this way:
[0066] The sequence 750-AGCGCTTTCGTCTCCACCAGC-770 has been changed
into 750-AGCGCTGACGTCTCCATCAGC-770.
[0067] 15: Glycine 99 has been substituted with glutamic acid using
the primer CTGGCGGCTTCGTAGAAA. The corresponding gene has been so
modified:
[0068] the sequence 910-TACGGCGCCGC-920 has been changed into
910-TACGAAGCCGC-920.
[0069] 17: Aspartic acid 109 has been substituted with glycine
using the primer CTGGTAGGTGTCCAGCGCGCC. The corresponding gene has
been so modified:
[0070] the sequence 930-GTCGACACTTA-940 has been changed into
930-GTCGGCACTTA-940.
[0071] 27: Glycine 121 has been substituted with glutamic acid
using the primer GCCAGCGCTTCGGCGAGG. The corresponding gene has
been so modified:
[0072] the sequence 956-GCCGGCGCGCT-966 has been changed into
956-GCCGAAGCGCT-966.
[0073] 16: Alanine in 124 position has been substituted with
aspartic acid using the primer GCCATAAGTGCCGACGTATTC. The
corresponding gene has been so modified:
[0074] the sequence 976-TGGCCACCTAC-984 has been changed into
976-TGGACACCTAC-986.
[0075] 1716: contains the combined 16 and 17 mutations.
[0076] 28: Glutamic acid 129 has been substituted in glycine using
the primer GCCAGATACCCGCTCGG. The corresponding gene has been so
modified:
[0077] the sequence 990-AGCGAATATCT-1000 has been changed into
990-AGCGGGTATCT-1000.
[0078] 29: Arginine 135 has been substituted with glutamic acid
using the primer GCGGAATGTCCCGGTGTG. The corresponding gene has
been so modified:
[0079] the sequence 1010-GCGCATTCCGC-1020 has been changed into
1010-GGACATTCCGC-1020.
[0080] 31 :Threonine 159 has been substituted with lysine using the
primer TACTCCGTTTTCGTGGTC. The corresponding gene has been so
modified:
[0081] 1070-GCATCACCGGCGAGACCACGACCACGGAGTA-1090 has been changed
into 1070-GCATCACCGGCGAGACCACGAAAACGGAGTA-1090.
[0082] 26: Tyrosine 111 is substituted with glycine.
[0083] Furthermore, owing to a partial duplication of a primer
fragment, the insertion of the Asp Thr Gly Gly amino acids occurred
in position 113 using the primer CGCCACCAGTGTCGACGTATTCGA. The
corresponding gene has been so modified:
2 930-GTCGACACTTATGGCGACAAT-950
930-GTCGACACTGGTGGCGACACTGGTGGCGACAAT-950.
[0084] Said oligonucleotides have been used as primers for DNA
polymerase which transcribes all the nucleotide sequence of the
vector incorporating the mutations present in the primer.
[0085] The vectors containing the S1 gene with the desired
modification have been isolated by the hybridization technique
using as probe the primer itself.
[0086] The exact nucleotide sequence of the modified gene has been
then confirmed by the technique of Sanger F. et al. (P.N.A.S. 74,
5463, 1977).
[0087] The vectors containing the modified genes have been then
digested with the restriction enzymes EcoRI and HindIII and the DNA
fragments containing the gene coding for the modified S1 have been
cloned in an expression plasmid selected from those known in the
art.
[0088] Said hybrid plasmids have been employed to transform a host
microorganism selected among E. coli, Bacillus subtilis and
yeasts.
[0089] In particular, according to the present invention, the
plasmid PEx34 (Center for Molecular Biology, Heidelberg, Federal
Republic of Germany) and the microorganism E. coli
K12-.DELTA.Hl-.DELTA.trp (Remant, E. et al. Gene, 15, 81-93, 1981)
have been employed.
[0090] The transformed microorganisms have been then cultivated in
a liquid culture medium in the presence of carbonium, nitrogen and
mineral salt sources, at a temperature comprised between 30.degree.
C. and 45.degree. C. for a period of from 20 minutes to 5
hours.
[0091] At the end of the period the cells have been recovered from
the culture medium by centrifuging and lysed by means of generally
known techniques.
[0092] The cellular lysates containing the proteins have been then
analyzed to determine the enzymatic activity thereof.
[0093] The results, reported in the following example 3, show that
a good reduction (5-80%) of the ADP-ribosylation activity and
therefore of toxicity has been obtained by substituting in the S1
sequence the amino acids in 109 (17) and 124 (16) positions, either
separately or in combination, and the amino acid in 121 position
(27).
[0094] A complete loss of the S1 subunit enzymatic activity has
been observed by substituting the amino acids in the positions 8
and 9 (41), 50 and 53 (22) and 129 (28).
[0095] Furthermore, said subunits are able to induce in vivo
specific antibodies and to react (subunit 28) with anti-PT
protective monoclonal antibodies.
[0096] Polypeptides containing said modified subunits, therefore,
are suitable for the preparation of an antipertussis vaccine.
[0097] Preferred are the polypeptides containing in addition to the
modified S1 subunit at least one of the S2, S3, S4 and S5 PT
subunits.
[0098] Particularly preferred are the polypeptides having said S2,
S3, S4 and S5 subunits with the same arrangement and configuration
presented by the natural pertussis toxin.
[0099] Said preferred polypeptides may be prepared modifying the
gene coding for S1 contained in the PT operon and constructing
plasmids, comprising the whole operon with the modified S1 gene or
regions thereof, which essentially code for a polypeptide
containing the modified S1 subunit and one or more of the S2, S3,
S4 and S5 subunits.
[0100] According to the present invention, the plasmids PTE 255-22,
PTE 255-28 and PTE 255-41, containing the gene which codes for the
S1 modified subunits 22, 28 and 41 respectively, have been
deposited as E. coli (PTE 255-22), E. coli (PTE 255-28) and E. coli
(PTE 255-41) at the American Type Culture Center as ATCC 67542,
ATCC 67543 and ATCC 67544.
[0101] The following experimental examples are illustrative and non
limiting of the invention.
EXAMPLE 1
[0102] Identification of the S1 Subunit Region Correlated to the
ADP-Ribosylation Activity
[0103] A. Construction of the Hybrid Plasmids Containing the Gene
Coding for Modified S1 by Deletion of the 3' Terminal Part.
[0104] 10 .mu.g of the PTE 255 plasmid are suspended in 100 .mu.l
of buffer solution (50 mM Tris-HCl, pH 7.4, 10 mM MgCl.sub.2, 100
mM NaCl) and digested at 37.degree. C. for two hours with 30 units
(U) of XbaI (BRL) restriction enzyme and then aliquots of 10 ,.mu.l
of the digestion mixture are treated with 3 U of one of the
following enzymes: NcoI, BalI, NruI, SalI and SphI at 37.degree. C.
for two more hours.
[0105] The DNA mixtures so digested containing the 75 base pairs
(bp) XbaI-NcoI, 377 bp XbaI-BalI, 165 bp XbaI-NruI, 355 bp
XbaI-SalI and 503 bp XbaI-SphI fragments respectively, were added
with 3 U of Klenow polymerase large fragment and with 2 .mu.l of a
solution containing 50 mM of each of the following
desoxynucleotides dATP, dTTP, dCTP and dGTP to repair the molecules
ends.
[0106] The mixtures are maintained at ambient temperature
(20-25.degree. C.) for 15 minutes and at 65 .degree. C. for further
30 minutes in such a way as to inactivate the polymerase
enzyme.
[0107] At the end of said period, the mixtures are diluted to 200
.mu.l with ligase buffer (66 mM Tris-HCl, pH 7.6, 1 mM ATP, 10 mM
MgCl.sub.2, 10 mM dithiothreitol) and are maintained at 15.degree.
C. for one night in the presence of one unit of T4 DNA ligase so
that the DNA molecules which lost the above mentioned fragments are
linked again to each other. The ligase mixtures are then employed
to transform K12-Hl trp E. coli cells prepared by a treatment with
50 mM CaCl.sub.2 (Mandel M. & Higa (1970) J. Mol. Biol. 53,
154).
[0108] The transformants were selected by plating the cells on LB
agar (10 g/l Bacto Tryptone (DIFCO), 5 g/l Bacto Yeast extract
(DIFCO), 5 g/l NaCl) medium containing 30 .mu.g/ml ampicillin and
incubating the plates at 30.degree. C. for 18 hours. The
recombinant plasmids are analyzed in order to verify the exact
nucleotide sequence.
[0109] The following hybrid plasmids have been therefore
identified:
[0110] PTE NCO in which the S1 gene lacks of the part coding for
the carboxyterminal sequence of the S1 subunit comprised between
the amino acids 255 and 211.
[0111] PTE NRU where the S1 gene lacks of the part coding for the
carboxyterminal sequence of the S1 subunit comprised between the
amino acids 255 and 180.
[0112] PTE BAL where the S1 gene is lacking of the part which codes
for the carboxyterminal sequence of the S1 subunit from 255 to
124.
[0113] PTE SAL: in which the S1 gene is lacking of the part coding
for the carboxyterminal sequence of the S1 subunit comprised
between the amino acids 255 and 110.
[0114] PTE SPH: in which the S1 gene is lacking of the part coding
for the carboxyterminal sequence of the S1 subunit comprised
between the amino acids 255 and 68.
[0115] B. Construction of Hybridplasmids Containing the Gene Coding
for Modified S1 by Deletion of the 5' Terminal Part
[0116] 3 probes (10 .mu.g) of the PTE 255 plasmid were digested in
100 .mu.d of a buffer solution (50 mM Tris-HCl, pH 7.4, 10 mM
MgCl.sub.2, 50 mM NaCl) at 37.degree. C. for 3 hours, with 30 U of
each of the following restriction enzymes SphI, SalI and BalI
respectively.
[0117] 3 U of Klenow large fragment polymerase enzyme are then
added to each solution together with 2 .mu.l of a solution
containing 50 mM of each of the following desoxynucleotides: DATP,
dTTP, dCTP and dGTP and after 15 minutes at 20-25.degree. C. the
enzyme is inactivated at 65.degree. C. for 30 minutes.
[0118] 30 U of HindIII restriction enzyme are then added to each
solution and the resulting mixtures are maintained at 37.degree. C.
for 3 hours and then loaded on a 1.5% agarose gel at 70 Volts for
3.5 hours. In this way two bands are separated for each mixture,
one containing the deletion part of S1 and the other containing the
PeX-34 plasmid and part of S1.
[0119] The 520 bp Sph-Hind III, 372 bp SalI-Hind III and 394 bp
BalI-HindIII fragments are then electroeluted by the Maniatis
method (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor,
1982). 100 ng of each of said fragments are then linked, in 30
.mu.l of ligase mixture in the presence of 1 U T4 DNA ligase, with
the plasmid Pex-34 previously digested with the BanmHI restriction
enzyme, treated with the polymerase enzyme and the solution of
desoxynucleotides and then digested with the HindIII restriction
enzyme.
[0120] The ligase mixtures are successively employed to transform
E. coli K12, .DELTA.Hl, .DELTA.trp cells and the transformants are
selected on LB agar medium containing ampicillin as reported in
point A.
[0121] Among the plasmids extracted from the positive clones, those
containing in a proper frame the cloned fragments have been
identified by Western-blot with pertussis anti-toxin
antibodies.
[0122] Said plasmids, labeled with the abbreviations PTE SPH/HIND,
PTE 255/SAL and PTE 255/BAL are lacking of the S1 gene sequences
which code for aminoterminal parts of the subunit comprised between
the amino acids: 1-67, 1-109 and 1-123 respectively.
[0123] C. Construction of Hybridplasmids Containing the Gene Coding
for Modified S1 by Deletion of 3' and 5' Terminal Parts
[0124] 2 samples (10 .mu.g) of the plasmid PTE NCO (obtained as
illustrated in step A) are digested in 100 .mu.l of 50 .mu.l mM
Tris-HCl, pH 7.4, 10 mM MgCl.sub.2, 50 mM NaCl solution, with 30 U
of BstN1 (BRL) and 30 U of BalI (BRL) respectively, at 37.degree.
C. for 3 hours.
[0125] The digestion mixtures are then treated at 20-25.degree. C.
for 15 minutes with 3 U of Klenow polymerase enzyme in the presence
of 2 mM of DATP, dGTP, dCTP and dTTP to complete the terminal
portions and, after inactivation of the enzyme at 65.degree. C. for
30 minutes, the DNA are again cut with 30 U of HindIII restriction
enzyme at 37.degree. C. for 3 hours.
[0126] The digestion mixtures are loaded on 1.5% agarose gel and
eluted at 70 Volts for 3.5 hours, the 527 bp BstNl-HindIII and the
279 bp BalI-HindIII fragments being electro-eluted as reported
above.
[0127] 100 ng of said fragments are subsequently linked to the
plasmid PeX-34, (previously treated as reported in B) in a ligase
mixture in the presence of 7 U T4 DNA ligase at 15.degree. C. for
18 hours. The transformation of the E. coli cells and the selection
of the transformants is then performed as illustrated above. The
fragments inserted in the right frame have been identified among
the recombinant plasmids extracted from the positive clones.
[0128] Said plasmids, labeled with the abbreviation PTE 34A and PTE
NCO/BAL contain respectively the S1 gene without the sequences
coding for the S1 subunit parts comprised between the amino acids
1-52 and 255-211 and for the parts 1-124 and 255-211.
[0129] D. Construction of PTE 16-A and 18-A Plasmids
[0130] 10 .mu.g of the PTE 255 plasmid are digested in 100 .mu.l of
100 mM Tris-HCl, 50 mM NaCl, 10 mM MgSO.sub.4 buffer with 30 U of
EcoRI and then with 1 U of Bal31 (BRL) in 10 mM CaCl.sub.2, 10 mM
MgCl.sub.2, 0.2 M NaCl, 20 mM Tris-HCl, pH 8, 1 mM EDTA at
37.degree. C.
[0131] Mixture aliquots are withdrawn after 1, 3, 5 and 10 minutes
and the deletion fragments at the 5' terminal are then cut with
HindIII, purified by gel electrophoresis and, after elution, linked
to the Pex-34 plasmid as reported above. The ligase mixtures are
then employed to transform the E. coli cells and the transformants
are selected operating as reported in the preceding steps.
[0132] The plasmids containing the S1 gene fragments inserted in
the right frame, detached by their nucleotide sequence analysis,
are isolated from the plasmids extracted from the positive
clones.
[0133] The plasmids containing the S1 gene without the sequence
which codes for the S1 aminoterminal part are selected from the
plasmids so obtained.
[0134] In particular, the PTE 16-A plasmid lacks of the nucleotides
coding for the first 10 amino acids and therefore codes a protein
containing the 11-235 amino acids, whereas the PTE 18-A plasmid
codes for a protein containing the 149-235 amino acids.
EXAMPLE 2
[0135] Expression of the Modified S1 Subunits and Determination of
the ADP-Ribosylation Activity Thereof
[0136] A. K12, .DELTA.Hl, .DELTA.trp E. coli cells, transformed
with the plasmids prepared as reported in the preceding example 1,
are cultivated in 20 ml of liquid LB medium under smooth mixing at
30.degree. C. for one night.
[0137] 10 ml of each culture are employed to inoculate 400 ml of LB
medium and are cultivated at 30.degree. C. for 2 hours and at
42.degree. C. for 2.5 hours.
[0138] At the end of said period, the culture are centrifuged at
10,000 revolutions per 15 minutes at 4.degree. C., the supernatants
discarded, the cells recovered and then resuspended in 3.2 ml of
2.5% saccharose, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA solution.
[0139] 0.1 ml of a lysozyme solution (40 mg/ml) and 0.8 ml of 0.5 M
EDTA were added to the solutions which are then reacted at
37.degree. C. for 30 minutes.
[0140] 8 ml of a lysis buffer (1% Triton-X 100, 50 mM Tris-HCl, pH
6.0, 63 mM EDTA) are then added to each solution which is
maintained at 0.degree. C. for 15 minutes and at 37.degree. C. for
30 minutes.
[0141] After a 1 minute sonication the mixtures containing the
lysed cells and the parts included, are centrifuged at 10,000
revolution per 10 minutes, the supernatants are discarded and the
precipitates resuspended in 5 ml of 1 M urea and maintained at
37.degree. C. for 30 minutes.
[0142] The mixtures are again centrifuged and the precipitates or
included parts are recovered and dissolved in 5 ml of phosphate
buffered saline (PBS) and stocked at -20.degree. C.
[0143] B. Analysis of the ADP-Ribosylation Activity
[0144] The solutions containing the included parts are centrifuged
and the precipitates resuspended in 100 .mu.l of 8 M urea before
performing the ADP-ribosylation test.
[0145] The ADP-ribosylation test is performed according to the
technique described by Manning et al. (1984). (J. Biol. Chem. 259,
749-756).
[0146] In practice, 10 .mu.l of each solution are preincubated with
a 20 .mu.l solution of 100 mM of dithiothreitol at 20-25.degree. C.
for 30 minutes and then added to 10 .mu.l of ox retina homogenate
(ROS), 80 .mu.l of water, 5 .mu.l Tris-HCl (pH 7.5), 1 .mu.l of an
100 mM ATP solution, 1 .mu.l of 10 mM GTP solution, 10 ml of
thymidine and 1 .mu.l (1 nCi) .sup.32PNAD.
[0147] The mixtures are then reacted at ambient temperature
(20-25.degree. C.) for 30 minutes and, after centrifugation, the
residues containing the ROS are recovered and dissolved in 30 .mu.l
of sodium dodecyl sulfate (SDS) buffer and loaded on 12.5%
polyacrylamide gel. After electrophoresis at 25 mA for 4 hours, the
gels are vacuum-dried at a temperature of 80.degree. C. and then
submitted to autoradiography. The radio-active bands are separated
from the gel, suspended in 5 ml of liquid scintillation cocktail
(Econofluor, NEN) and counted by a beta counter.
[0148] This way the ADP-ribosylation of the modified proteins is
quantitatively determined.
[0149] The results obtained are reported in the following table
I:
3 Plasmids containing ADP-ribosylation activity of the the modified
S1 gene modified S1 (5) PTE NCO 100 PTE NRU 60 PTE BAL -- PTE SAL
-- PTE SPH -- PTE 16-A -- PTE 34-A -- SPH-HIND -- 255/BAL --
255/SAL -- NCO/BAL -- 18-A --
[0150] It is clearly apparent from what is disclosed in the table,
that the sequences following the Nru site (179 position) are not
necessary, contrary to the 5' terminal sequences, for the
ADP-ribosylation activity of the S1 subunit.
EXAMPLE 3
[0151] Identification and Mutation of the Active Sites of the 1-180
Region of the S1 Subunit
[0152] 10 .mu.g of the PTE 255 plasmid are suspended in 100 .mu.l
of 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 10 mM MgCl.sub.2 buffer and
digested with 30 U of each of the EcoRI and Hind-III enzymes at
37.degree. C. for 3 hours.
[0153] The digestion mixture is then loaded on a 1.3% agarose gel
and eluted at 80 mA for 3 hours.
[0154] Operating in this way two bands are separated; one of 3,500
bp containing the vector and the other of 600 bp containing the
gene which codes for the S1 subunits.
[0155] The bp band is then electro-eluted and 0.2 .mu.g of the
fragment and 0.3 ng of the Bluescript SK (Stratagene, San Diego,
Calif.) plasmid, previously digested with the EcoRI and HindIII
restriction enzymes, are suspended in 20 .mu.l of buffer solution
(66 mM Tris-HCl, pH 7.5, 1 mM ATP, 10 mM MgCl.sub.2, 10 mM
dithiothreitol) and linked together in the presence of 1 U T.sub.4
DNA ligase at 15.degree. C. for 18 hours.
[0156] The ligase mixture is then employed to transform the JM 101
E. coli cells made suitable and the transformants are selected on
plates of LB agar including 100 .mu.g/ml ampicillin, 20 .mu.g/ml
IPTG (isopropyl-B-D-thiogalactopyranoside) and 20 .mu.g/ml X-Gal
(5-bromo-4-chloro-3-indolyl-D-galactopyranoside).
[0157] The plates are incubated at 37.degree. C. in thermostatic
chamber for 18 hours. The white cultures containing the hybrid
plasmid comprising the Bluescript SK vector and the 600 bp DNA
fragment are used to isolate the single helix DNA of the cloned
fragment operating as follows.
[0158] The white cells are cultivated in 1.5 ml LB liquid medium in
order to reach an optical density, (OD) at 590 mm of about
0.15.
[0159] 10 .mu.l of a F1 phage (Stratagene San Diego, Calif.)
suspension in LB (5.times.10.sup.12 phages/ml) are subsequently
added to the cultures and the resulting solutions are maintained at
37.degree. C. for 6-8 hours.
[0160] At the end of said period, the cells are separated from the
culture medium by centrifugation and the supernatant is recovered.
A 20% polyethyleneglycol (PEG) and 2.5 mM NaCl were added to 1 ml
of said supernatant to precipitate the phages.
[0161] After 15 minutes at ambient temperature (20-25.degree. C.),
the mixture is centrifuged at 12,000 g for 5 minutes in an
Eppendorf centrifuge at 20.degree. C. and the phages so recovered
are resuspended in 100 .mu.l TE (10 mM Tris-HCl, pH 7.5, 1 mM EDTA)
buffer.
[0162] The solution is then extracted once with one volume of
water-saturated phenol, twice with ethyl ether and finally, the
single helix DNA is precipitated adding to the aqueous phase 250
.mu.l of ethanol and 10 .mu.l of 3 M ammonium acetate. The DNA is
separated from the mixture by centrifugation, is resuspended in 20
.mu.l of TE buffer and is employed for the direct site mutagenesis
(Zoller et al. DNA, 3, 479-488, 1984).
[0163] To this end, oligonucleotides in which the bases which code
for at least one of the desired amino acids are modified in order
to code for another amino acid, are synthesized by means of a 1
Plus DNA synthesizer System (Beckman) automatic system.
[0164] Said oligonucleotides, complementary of the sequence present
in the single helix DNA cloned in the Bluescript SK plasmid, are
used as primers for the DNA polymerase which transcribes the whole
Bluescript nucleotide sequence incorporating the mutations present
in the primer.
[0165] In practice, 2 .mu.l of 10 mM ATP, 2 .mu.l of kinase 10 X
(550 mM Tris-HCl, pH 8.0, 100 mM MgCl.sub.2) buffer, 1 .mu.l of 100
mM dithiothreitol (DTT) and 5 U of polynucleotide kinase
(Boehringer) are added to 3 mM of the synthetic oligonucleotide and
the final volume is brought to a value of 20 .mu.l.
[0166] The mixture is incubated at 37.degree. C. for 30 minutes and
the enzyme is inactivated at 70.degree. C. for 10 minutes.
[0167] 1 .mu.g of the single filament used as matrix, 1 .mu.l of 1
mM Tris-HCl, pH 8.0, and 10 mM MgCl.sub.2 in 1 volume of 10 X
kinase buffer, are added to 2 .mu.l of the primer.
[0168] The mixture is maintained at 80.degree. C. for about 3
minutes and then at ambient temperature for about 1 hour.
[0169] 10 .mu.l of 1 mM Tris-HCl, pH 8.0, 10 mM MgCl.sub.2 buffer,
0.05 mM ATP, 1 mM DTT, 0.5 mM of the four desoxynucleotides, 1 U of
T4 DNA ligase and 2.5 U of I DNA polymerase (Klenow fragment) are
subsequently added.
[0170] The mixture is incubated at 15.degree. C. for one night and
then used to transform JM 101 E. coli cells as illustrated
above.
[0171] The plasmid containing the mutated S1 gene are then
identified by the hybridization technique using as probe the primer
used for the mutagenesis, marked with .sup.32p. In practice, the
nitrocellulose filters containing the transformed cultures are
hybridized in 6.times.SSC (1.times.SSC=0.015 M NaCl, 0.015M
trisodium citrate, pH7), 10.times. Denhardt's solution (1% BSA, 1%
Ficoll, 1% polyvinyl-pyrrolidone) and 0.2% Sodium-dodecylsulphate
(SDS) at 20-25.degree. C. for 18 hours and then washed for 2 hours
in 6.times.SSC at the following temperatures: (45.degree. C.) 25
and 26 mutants; (48.degree. C.) 28, 22 and 29 mutants; (54.degree.
C.) 27; (46.degree. C.) 31 and 41 mutants.
[0172] The mutations are confirmed by analysis of the nucleotide
sequence of the gene according to the method of Sanger, F. et al.
(PNAS 74, 5463, 1977).
[0173] Operating as reported above, plasmids containing the gene
coding for S1 modified are prepared as follows.
[0174] 41: 8 Tyrosine and 9 arginine are substituted with Aspartic
acid and Glycine respectively, using the GTCATAGCCGTCTACGGT primer.
The corresponding gene has been so modified:
4 620-CGCCACCGTATACCGCTATGACTCCCGCCCG-650
620-CGCCACCGTAGACGGCTATGACTCCCGCCCG-650
[0175] 22: 50 phenylalanine and 53 threonine are substituted with
glutamic acid and isoleucine respectively, using the
TGGAGACGTCAGCGCTGT primer. The corresponding gene has been so
modified:
[0176] The 750-AGCGCTTTCGTCTCCACCAGC-770 sequence has been changed
into 750-AGCGCTGACGTCTCCATCAGC-770.
[0177] 25: 99 glycine has been substituted with glutamic acid using
the CTGGCGGCTTCGTAGAAA primer. The corresponding gene has been so
modified:
[0178] the 910-TACGGCGCCGC-920 sequence has been changed into
910-TACGAAGCCGC-920.
[0179] 17: 109 aspartic acid has been substituted with glycine
using the CTGGTAGGTGTCCAGCGCGCC primer. The corresponding gene has
been so modified:
[0180] the 930-GTCGACACTTA-940 sequence has been changed into
930-GTCGGCACTTA-940.
[0181] 27: 121 glycine has been substituted by glutamic acid using
the GCCAGCGCTTCGGCGAGG primer. The corresponding gene has been so
modified:
[0182] the 956-GCCGGCGCGCT-966 sequence has been changed into
956-GCCGAAGCGCT-966.
[0183] 16: Alanine in position 124 has been substituted with
aspartic acid using the GCCATAAGTGCCGACGTATTC primer. The
corresponding gene has been so modified:
[0184] the 976-TGGCCACCTAC-984 sequence has been changed into
976-TGGACACCTAC-986.
[0185] 1716: contains the combined 16 and 17 mutations.
[0186] 28: 129 glutamic acid has been substituted in glycine using
the GCCAGATACCCGCTCTGG primer. The corresponding gene has been so
modified:
[0187] the 990-AGCGAATATCT-1000 sequence has been changed into
990-AGCGGGTATCT-1000.
[0188] 29: 135 arginine has been substituted with the glutamic acid
using the GCGGAATGTCCCGGTGTG primer. The corresponding gene has
been so modified:
[0189] the 1010-GCGCATTCCGC-1020 sequence has been changed into
1010-GGACATTCCGC-1020.
[0190] 31: 159 threonine has been substituted with lysine using the
TACTCCGTTTTCGTGGTC primer. The corresponding gene has been so
modified:
[0191] 1070-GCATCACCGGCGAGACCACGACCACGGAGTA-1090 has been changed
into 1070-GCATCACCGGCGAGACCACGAAAACGGAGTA-1090.
[0192] 26: 111 tyrosine is substituted with glycine. Furthermore,
owing to a partial duplication of a primer fragment, the insertion
of the Asp Thr Gly Gly amino acids occurred in the position 113
using the CGCCACCAGTGTCGACGTATTCGA primer. The corresponding gene
has been so modified:
5 930-GTCGACACTTATGGCGACAAT-950
930-GTCGACACTGGTGGCGACACTGGTGGCGACAAT-950.
[0193] The plasmids containing the S1 gene are digested again with
the EcoRI and HindIII restriction enzymes and the DNA fragment
containing the above mentioned mutations are separated from the
digestion mixture by gel electrophoresis, are electro-eluted and
cloned in the PEx-34B vector in a ligase mixture operating as
reported above.
[0194] The ligase mixtures are used to transform suitable
K12-.DELTA.Hl-.DELTA.trp E. coli cells and the transformants
isolated on LB agar medium containing 30 .mu.g/ml of ampicillin at
30.degree. C.
[0195] The positive clones containing the mutated plasmids are then
cultivated in LB liquid medium as reported in the preceding example
2 and, after cellular lysis, the ADP-ribosylation activity of the
S1 subunits so obtained is determined.
[0196] The results are reported in the following table II:
6 ADP-ribosylation activity of the mutated Mutant Subunits subunits
(5) 41 0 22 0 25 100 17 46 26 150 27 43 16 50 1617 23 28 0 29 92 31
100 BppB 100
[0197] BppB is an S1 hybrid containing the gene part up to SalI of
B. pertussis and the remaining of B. brochisephica.
[0198] From the results reported above the mutant 28 in which the
substitution of only one amino acid has determined the complete
loss of the enzymatic activity, seems particularly interesting.
Sequence CWU 1
1
30 1 18 DNA Artificial Primer used to modify the S1 gene to encode
an aspartic acid and glycine in place of tyrosine and arginine at
amino acid residues 8 and 9, respectively 1 gtcatagccg tctacggt 18
2 31 DNA Bordetella pertussis 2 cgccaccgta taccgctatg actcccgccc g
31 3 31 DNA Bordetella pertussis 3 cgccaccgta gacggctatg actcccgccc
g 31 4 18 DNA Artificial Primer used to modify the S1 gene to
encode a glutamic acid and isoleucine in place of a phenylalanine
and threonine at amino acid residues 50 and 53, respectively 4
tggagacgtc agcgctgt 18 5 21 DNA Bordetella pertussis 5 agcgctttcg
tctccaccag c 21 6 21 DNA Bordetella pertussis 6 agcgctgacg
tctccatcag c 21 7 18 DNA Artificial Primer used to modify the S1
gene to encode a glutamic acid in place of glycine at amino acid
residue 99 7 ctggcggctt cgtagaaa 18 8 11 DNA Bordetella pertussis 8
tacggcgccg c 11 9 11 DNA Bordetella pertussis 9 tacgaagccg c 11 10
21 DNA Artificial Primer used to modify the S1 gene to encode a
glycine in place of aspartic acid at amino acid residue 109 10
ctggtaggtg tccagcgcgc c 21 11 11 DNA Bordetella pertussis 11
gtcgacactt a 11 12 11 DNA Bordetella pertussis 12 gtcggcactt a 11
13 18 DNA Artificial Primer used to modify the S1 gene to encode a
glutamic acid in place of glycine at amino acid residue 121 13
gccagcgctt cggcgagg 18 14 11 DNA Bordetella pertussis 14 gccggcgcgc
t 11 15 11 DNA Bordetella pertussis 15 gccgaagcgc t 11 16 21 DNA
Artificial Primer used to modify the S1 gene to encode an aspartic
acid in place of alanine at amino acid residue 124 16 gccataagtg
ccgacgtatt c 21 17 11 DNA Bordetella pertussis 17 tggccaccta c 11
18 11 DNA Bordetella pertussis 18 tggacaccta c 11 19 17 DNA
Artificial Primer used to modify the S1 gene to encode a glycine in
place of glutamic acid at amino acid residue 129 19 gccagatacc
cgctcgg 17 20 11 DNA Bordetella pertussis 20 agcgaatatc t 11 21 11
DNA Bordetella pertussis 21 agcgggtatc t 11 22 18 DNA Artificial
Primer used to modify the S1 gene to encode a glutamic acid in
place of arginine at amino acid residue 135 22 gcggaatgtc ccggtgtg
18 23 11 DNA Bordetella pertussis 23 gcgcattccg c 11 24 11 DNA
Bordetella pertussis 24 ggacattccg c 11 25 18 DNA Artificial Primer
used to modify the S1 gene to encode a lysine in place of threonine
at amino acid residue 159 25 tactccgttt tcgtggtc 18 26 31 DNA
Bordetella pertussis 26 gcatcaccgg cgagaccacg accacggagt a 31 27 31
DNA Bordetella pertussis 27 gcatcaccgg cgagaccacg aaaacggagt a 31
28 24 DNA Artificial Primer used to modify the S1 gene to encode
additional amino acid residues Asp Thr Gly Gly at position 113 28
cgccaccagt gtcgacgtat tcga 24 29 21 DNA Bordetella pertussis 29
gtcgacactt atggcgacaa t 21 30 33 DNA Bordetella pertussis 30
gtcgacactg gtggcgacac tggtggcgac aat 33
* * * * *