U.S. patent application number 11/079476 was filed with the patent office on 2005-12-15 for methods and compositions for the specific inhibition of gene expression by double-stranded rna.
This patent application is currently assigned to City of Hope. Invention is credited to Behlke, Mark A., Kim, Dongho, Rossi, John J..
Application Number | 20050277610 11/079476 |
Document ID | / |
Family ID | 34994243 |
Filed Date | 2005-12-15 |
United States Patent
Application |
20050277610 |
Kind Code |
A1 |
Rossi, John J. ; et
al. |
December 15, 2005 |
Methods and compositions for the specific inhibition of gene
expression by double-stranded RNA
Abstract
The invention provides compositions and methods for selectively
reducing the expression of a gene product from a desired target
gene, as well as treating diseases caused by expression of the
gene. The method involves introducing into the environment of a
cell an amount of a double-stranded RNA (dsRNA) such that a
sufficient portion of the dsRNA can enter the cytoplasm of the cell
to cause a reduction in the expression of the target gene. The
dsRNA has a first oligonucleotide sequence that is between 26 and
about 30 nucleotides in length and a second oligonucleotide
sequence that anneals to the first sequence under biological
conditions. In addition, a region of one of the sequences of the
dsRNA having a sequence length of from about 19 to about 23
nucleotides is complementary to a nucleotide sequence of the RNA
produced from the target gene.
Inventors: |
Rossi, John J.; (Alta Loma,
CA) ; Behlke, Mark A.; (Coralville, IA) ; Kim,
Dongho; (Los Angeles, CA) |
Correspondence
Address: |
ROTHWELL, FIGG, ERNST & MANBECK, P.C.
1425 K STREET, N.W.
SUITE 800
WASHINGTON
DC
20005
US
|
Assignee: |
City of Hope
Duarte
CA
Integrated DNA Technologies, Inc.
Coralville
IA
|
Family ID: |
34994243 |
Appl. No.: |
11/079476 |
Filed: |
March 15, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60553487 |
Mar 15, 2004 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/455 |
Current CPC
Class: |
A61P 17/06 20180101;
A61P 25/02 20180101; A61P 1/16 20180101; A61P 25/00 20180101; A61P
29/00 20180101; A61P 5/14 20180101; A61P 37/02 20180101; C12N
2310/51 20130101; A61P 1/04 20180101; A61P 11/00 20180101; C12N
2330/30 20130101; A61P 17/00 20180101; C12N 2320/51 20130101; A61P
1/02 20180101; A61P 7/04 20180101; A61P 37/00 20180101; A61P 19/02
20180101; A61P 31/08 20180101; C12N 15/113 20130101; A61P 15/02
20180101; C12N 2320/50 20130101; A61P 35/00 20180101; A61P 21/04
20180101; A61P 27/02 20180101; A61P 27/16 20180101; C12N 2320/30
20130101; A61P 3/10 20180101; A61P 7/06 20180101; A61P 37/06
20180101; A61P 37/08 20180101; C12N 2310/33 20130101; C12N 15/111
20130101; A61P 31/14 20180101; C12N 2310/50 20130101; A61P 35/04
20180101; A61P 1/00 20180101; A61P 11/06 20180101; C12N 2310/14
20130101 |
Class at
Publication: |
514/044 ;
435/455 |
International
Class: |
A61K 048/00; C12N
015/85 |
Goverment Interests
[0002] This invention was made in part with Government support
under Grant Numbers AI29329 and HL074704 awarded by the National
Institute of Health. The Government may have certain rights in this
invention.
Claims
1. A method for reducing expression of a target gene in a cell,
comprising: introducing into the environment of the cell a
double-stranded RNA in an amount sufficient to reduce expression of
the gene, wherein the double-stranded RNA consists of a first
oligonucleotide sequence that is from 25 to about 30 nucleotides in
length and a second oligonucleotide sequence that anneals to the
first sequence under biological conditions; wherein a region of one
of the oligonucleotide sequences in the double-stranded RNA having
a length of from about 19 to about 23 nucleotides can direct the
cleavage of RNA produced from the target gene.
2. The method of claim 1, wherein the cell is in a liquid.
3. The method of claim 1, wherein the cell is in a cell growth
medium.
4. The method of claim 1, wherein the cell is in an animal.
5. The method of claim 1, wherein the cell is in a mammal.
6. The method of claim 1, wherein the cell is a human.
7. The method of claim 1, wherein the target gene is a native gene
of the cell.
8. The method of claim 1 wherein expression of the target gene is
reduced by about 10% or more as compared to untreated cells.
9. The method of claim 1 wherein the amount of double-stranded RNA
sufficient to reduce expression ofthe target gene is about 50
nanomolar or less in the environment of the cell.
10. The method of claim 1 wherein the amount of double-stranded RNA
sufficient to reduce expression of the target gene is about 10
nanomolar or less in the environment of the cell.
11. The method of claim 1 wherein the amount of double-stranded RNA
sufficient to reduce expression of the target gene is about 1
nanomolar or less in the environment of the cell.
12. The method of claim 1 wherein the amount of double-stranded RNA
sufficient to reduce expression of the target gene is about 200
picomolar or less in the environment of the cell.
13. The method of claim 1 wherein the amount of double-stranded RNA
sufficient to reduce expression of the target gene is about 50
picomolar or less in the environment of the cell.
14. The method of claim 4 further comprising the step of
incorporating the double stranded RNA into a pharmaceutical
composition in a unit dosage amount of less than 0.5 milligrams
(mg) of dsRNA per kg body weight of the animal.
15. The pharmaceutical composition of claim 14, wherein the dosage
unit of dsRNA is in a range of 0.001 to 0.25 milligrams per
kilogram body weight.
16. The pharmaceutical composition of claim 14, wherein the dosage
unit of dsRNA is in a range of 0.01 to 20 micrograms per kilogram
body weight.
16. (canceled)
17. The pharmaceutical composition of claim 14, wherein the dosage
unit of dsRNA is in a range of 0.10 to 5 micrograms per kilogram
body weight.
18. The pharmaceutical composition of claim 14, wherein the dosage
unit of dsRNA is in a range of 1.0 to 25 micrograms per kilogram
body weight.
19. The pharmaceutical composition of claim 14, wherein the
pharmaceutically acceptable carrier is an aqueous solution.
20. The pharmaceutical composition of claim 14, wherein the aqueous
solution is phosphate buffered saline.
21. The pharmaceutical composition of claim 14, wherein the
pharmaceutically acceptable carrier comprises a micellar structure
selected from the group consisting of a liposome, capsid, capsoid,
polymeric nanocapsule, and polymeric microcapsule.
22. The pharmaceutical composition of claim 14, wherein the
polymeric nanocapsule and polymeric microcapsule comprise
polybutylcyanoacrylate.
23. The pharmaceutical composition of claim 14, further comprising
administering the pharmaceutical composition by a method selected
from the group consisting of inhalation, infusion, injection, or
orally.
24. The pharmaceutical composition of claim 23, wherein the
composition is administered by inhalation.
25. The pharmaceutical composition of claim 23, wherein the
composition is administered by infusion.
26. The pharmaceutical composition of claim 23, wherein the
composition is administered by injection.
27. The pharmaceutical composition of claim 23, wherein the
composition is administered orally.
28. A double-stranded RNA composition capable of selectively
reducing the expression of a target gene comprising, a Dicer
protein and a double-stranded RNA that does not induce an
interferon response consisting of, a first oligonucleotide sequence
that is from 26 to about 30 nucleotides in length and a second
oligonucleotide sequence that anneals to the first sequence under
biological conditions, wherein one of the oligonucleotide sequences
in the double-stranded RNA having a length of from about 19 to
about 23 nucleotides can direct the cleavage of RNA produced from
the target gene.
29. The double-stranded RNA composition of claim 28, wherein the
second oligonucleotide sequence has about 19 complementary base
pairs or more with the first oligonucleotide sequence.
30. The double-stranded RNA composition ofclaim 28, wherein the
second oligonucleotide sequence has about 21 complementary base
pairs or more with the first oligonucleotide sequence.
31. The double-stranded RNA composition of claim 28, wherein the
second oligonucleotide sequence has about 25 complementary base
pairs or more with the first oligonucleotide sequence.
32. The double-stranded RNA composition ofclaim 28 wherein at least
one end of the double-stranded RNA molecule is a blunt end.
33. The double-stranded RNA composition of claim 28 wherein two
ends of the double-stranded RNA molecule are blunt ends.
34. The double-stranded RNA composition of claim 28 wherein the
double-stranded RNA molecule comprises an oligonucleotide sequence
consisting of 27 to 29 nucleotides.
35. The double-stranded RNA composition of claim 28 wherein the
double-stranded RNA molecule comprises an oligonucleotide sequence
consisting of 27 nucleotides.
36. The double-stranded RNA composition of claim 28 wherein the
double-stranded RNA molecule has at least a one nucleotide
overhang.
37. The double-stranded RNA composition of claim 35 wherein the
double-stranded RNA molecule has at least a two nucleotide
overhang.
38. The double-stranded RNA composition of claim 35 wherein the
overhang is on the 5' terminus of an oligonucleotide sequence.
39. The double-stranded RNA composition of claim 35 wherein the
overhang is on the 3' terminus of an oligonucleotide sequence.
40. The double-stranded RNA composition of claim 28 wherein the
complex is in a eukaryotic cell.
41. The double-stranded RNA composition of claim 40 wherein the
eukaryotic cell is suspended in a cell culture.
42. The double-stranded RNA composition of claim 40 wherein the
eukaryotic cell is in an animal.
43. The double-stranded RNA composition of claim 40 wherein the
eukaryotic cell is in a human.
44. The double-stranded RNA composition of claim 28 wherein the
double-stranded RNA molecule has chemical modifications in the
5'-terminal region.
45. The double-stranded RNA composition of claim 28 wherein the
double-stranded RNA molecule has chemical modifications in the
3'-terminal region.
46. The double-stranded RNA composition of claim 44, wherein the
chemical modification is selected from the group consisting of
modifications of the sugar, base, phosphate backbone, and their
combinations.
47. The double stranded RNA composition of claim 44, wherein the
modification of the base moiety is selected from the group
consisting of 2'-O-alkyl modified pyrimidines, 2'-fluoro modified
pyrimidines, abasic sugars, and their combinations.
48. The double stranded RNA composition of claim 44, wherein the
modification of the phosphate group is selected from the group
consisting of phosphonates, phosphorothioates, phosphotriesters,
and their combinations.
49. The double stranded RNA composition of claim 44, wherein the
modification of the sugar is selected from the group consisting of
2'-deoxy and acyclic groups.
50. The double-strandedRNA composition of claim 28 wherein the
double-stranded RNA comprises two complementary strands.
51. The double-stranded RNA composition of claim 28 wherein the
first oligonucleotide sequence and the second oligonucleotide
sequence are linked together by a linker.
52. The double-stranded RNA composition of claim 51 wherein the
linker is a nucleotide sequence.
53. The double-stranded RNA composition of claim 51, wherein the
linker is a chemical linker.
54. An expression vector comprising a nucleic acid sequence
encoding the double-stranded RNA composition of claim 28 and
provides for expression of the nucleic acid molecule under
appropriate conditions.
55. A mammalian cell comprising an expression vector of claim
54.
56. The double-stranded RNA composition of claim 28, wherein at
least one of said nucleotide sequences comprises a nucleotide
overhang of between about one and about four nucleotides in
length.
57. The double-stranded RNA composition of claim 28, wherein the
nucleotide overhang is one or two nucleotides in length.
58. The double-stranded RNA composition of claim 28, wherein at
least one of said nucleotide sequences has a nucleotide overhang on
the 3'-terminus.
59. The double-stranded RNA composition of claim 28, wherein only
one of the nucleotide sequences has a nucleotide overhang, and
wherein the overhang is on the 3'-terminus of the first
complementary RNA strand.
60. The double-stranded RNA composition of claim 28, wherein the
RNA is produced by chemical synthetic methods.
61. The double-stranded RNA composition of claim 28, together with
a pharmaceutically acceptable carrier.
62. A ribonucleic acid (RNA) having a double-stranded structure
comprising a single self complementary RNA strand comprising a
double-stranded RNA that consists of a first oligonucleotide
sequence that is from 25 to about 30 nucleotides in length and a
second oligonucleotide sequence that anneals to the first sequence
under biological conditions; wherein a region of one of the
oligonucleotide sequences in the double-stranded RNA having a
length of from about 19 to about 23 nucleotides can direct the
destruction of RNA produced from the target gene.
63. A method for reducing expression of a target gene in a
eukaryotic cell, comprising, a) identifying a target gene for
attenuation; b) synthesizing a double-stranded RNA that consists of
a first oligonucleotide sequence that is from 26 to about 30
nucleotides in length and a second oligonucleotide sequence that
anneals to the first sequence under biological conditions; wherein
a region of one of the oligonucleotide sequences in the
double-stranded RNA having a length of from about 19 to about 23
nucleotides can direct the cleavage of RNA produced from the target
gene; and c) introducing a sufficient amount ofthe double-stranded
RNA into the environment of a eukaryotic cell to reduce the
expression of the target gene.
64. The method of claim 63, wherein the eukaryotic cell is a
leukocyte.
65. The method of claim 63, wherein the eukaryotic cell is a
myelogenic cell.
66. The method of claim 63, wherein the target gene contains a
chromosomal aberration.
67. The method of claim 63, wherein the target gene causes or is
likely to cause disease.
68. The method of claim 67, wherein the disease is cancer, a viral
infection or an autoimmune disease.
69. The method of claim 67, wherein the disease is leukemia or
lymphoma.
70. A method for reducing expression of a target gene in a
eukaryotic cell, comprising, a) identifying a target gene for
attenuation; b) synthesizing a double-stranded RNA that consists of
a first oligonucleotide sequence that is from 26 to about 30
nucleotides in length and a second oligonucleotide sequence that
anneals to the first sequence under biological conditions; wherein
the double stranded RNA is a substrate for Dicer, and a region of
one of the oligonucleotide sequences in the double-stranded RNA
having a length of from about 19 to about 23 nucleotides can direct
the cleavage of RNA produced from the target gene; and c)
introducing a sufficient amount ofthe double-stranded RNA into the
environment of a eukaryotic cell to reduce the expression of the
target gene.
71. The pharmaceutical composition of claim 14, wherein the dosage
unit of dsRNA is in a range of 0.01 to 10 micrograms per kilogram
body weight.
72. The double-stranded RNA composition of claim 45, wherein the
chemical modification is selected from the group consisting of
modifications of the sugar, base, phosphate backbone, and their
combinations
73. The double stranded RNA composition of claim 45, wherein the
modification of the base moiety is selected from the group
consisting of 2'-O-alkyl modified pyrimidines, 2'-fluoro modified
pyrimidines, abasic sugars, and their combinations.
74. The double stranded RNA composition of claim 45, wherein the
modification of the phosphate group is selected from the group
consisting of phosphonates, phosphorothioates, phosphotriesters,
and their combinations.
75. The double stranded RNA composition of claim 45, wherein the
modification of the sugar is selected from the group consisting of
2'-deoxy and acyclic groups.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application is related to and claims priority
under 35 U.S.C. .sctn. 119(e) to U.S. provisional patent
application No. 60/553,487 filed 15 Mar. 2004, incorporated herein
by reference.
FIELD OF THE INVENTION
[0003] This invention pertains to compositions and methods for
gene-specific inhibition of gene expression by double-stranded
ribonucleic acid (dsRNA) effector molecules. The compositions and
methods are useful in modulating gene expression in a variety of
applications, including therapeutic, diagnostic, target validation,
and genomic discovery.
BACKGROUND OF THE INVENTION
[0004] Suppression gene expression by double-stranded RNA (dsRNA)
has been demonstrated in a variety of systems including plants
(post-transcriptional gene suppression) (Napoli et al., 1990, Plant
Cell. 2:279-289), fungi (quelling) (Romano and Marcino, 1992, Mol
Microbiol. 6:3343-53), and nematodes (RNA interference) (Fire et
al., 1998, Nature 391:806-811). Early attempts to similarly
suppress gene expression using long dsRNAs in mammalians systems
failed due to activation of interferon pathways that do not exist
in lower organisms. Interferon responses are triggered by dsRNAs
(Stark et al., 1998, Annu. Rev. Biochem., 67:227-264). In
particular, the protein kinase PKR is activated by dsRNAs of
greater than 30 bp long (Manche et al., 1992, Mol Cell Biol.,
12:5238-48) and results in phosphorylation of translation
initiation factor eIF2.alpha. which leads to arrest of protein
synthesis and activation of 2'5'-oligoadenylate synthetase
(2'-5'-OAS), which leads to RNA degradation (Minks et al., 1979, J.
Biol. Chem. 254:10180-10183).
[0005] In Drosophila cells and cell extracts, dsRNAs of 150 bp
length or greater were seen to induce RNA interference while
shorter dsRNAs were ineffective (Tuschl et al., 1999, Genes &
Dev., 13:3191-3197). Long double-stranded RNA, however, is not the
active effecter molecule; long dsRNAs are degraded by an RNase III
class enzyme called Dicer (Bernstein et al., 2001, Nature,
409:363-366) into very short 21-23 bp duplexes that have 2-base
3'-overhangs (Zamore et al., 2000, Cell, 101:25-33). These short
RNA duplexes, called siRNAs, direct the RNAi response in vivo and
transfection of short chemically synthesized siRNA duplexes of this
design permits use of RNAi methods to suppress gene expression in
mammalian cells without triggering unwanted interferon responses
(Elbashir et al., 2001, Nature, 411:494-498). The antisense strand
of the siRNA duplex serves as a sequence-specific guide that
directs activity of an endoribonuclease function in the RNA induced
silencing complex (RISC) to degrade target mRNA (Martinez et al.,
2002, Cell, 110:563-574).
[0006] In studying the size limits for RNAi in Drosophila embryo
extracts in vitro, a lower threshold of around 38 bp
double-stranded RNA was established for activation of RNA
interference using exogenously supplied double-stranded RNA and
duplexes of 36, 30, and 29 bp length were without effect (Elbashir
et al., 2001, Genes & Dev., 15:188-200). The short 30-base RNAs
were not cleaved into active 21-23-base siRNAs and therefore were
deemed inactive for use in RNAi (Elbashir et al., 2001, Genes &
Dev., 15:188-200). Continuing to work in the Drosophila embryo
extract system, the same group later carefully mapped the
structural features needed for short chemically synthesized RNA
duplexes to function as siRNAs in RNAi pathways. RNA duplexes of 21
-bp length with 2-base 3'-overhangs were most effective, duplexes
of 20, 22, and 23-bp length had slightly decreased potency but did
result in RNAi mediated mRNA degradation, and 24 and 25-bp duplexes
were inactive (Elbashir et al., 2001, EMBO J., 20:6877-6888).
[0007] Some of the conclusions of these earlier studies may be
specific to the Drosophila system employed. Other investigators
established that longer siRNAs can work in human cells. However,
duplexes in the 21-23-bp range have been shown to be more active
and have become the accepted design (Caplen et al., 2001, Proc.
Natl. Acad. Sci. USA, 98:9742-9747). Essentially, chemically
synthesized duplex RNAs that mimicked the natural products that
result from Dicer degradation of long duplex RNAs were identified
to be the preferred compound for use in RNAi. Approaching this
problem from the opposite direction, investigators studying size
limits for RNAi in C. elegans found that although a microinjected
26-bp RNA duplex could function to suppress gene expression, it
required a 250-fold increase in concentration compared with an
81-bp duplex (Parrish et al., 2000, Mol. Cell, 6:1077-1087).
[0008] Despite the attention given to RNAi research recently, the
field is still in the early stages of development. Not all siRNA
molecules are capable of targeting the destruction of their
complementary RNAs in a cell. As a result, complex sets of rules
have been developed for designing RNAi molecules that will be
effective. Those having skill in the art expect to test multiple
siRNA molecules to find functional compositions. (Ji et al. 2003)
Some artisans pool several siRNA preparations together to increase
the chance of obtaining silencing in a single study. (Ji et al.
2003) Such pools typically contain 20 nM of a mixture of siRNA
oligonucleotide duplexes or more (Ji et al. 2003), despite the fact
that a siRNA molecule can work at concentrations of 1 nM or less
(Holen et al. 2002). This technique can lead to artifacts caused by
interactions of the siRNA sequences with other cellular RNAs ("off
target effects"). (Scherer et al. 2003) Off target effects can
occur when the RNAi oligonucleotides have homology to unintended
targets or when the RISC complex incorporates the unintended strand
from and RNAi duplex. (Scherer et al. 2003) Generally, these
effects tend to be more pronounced when higher concentrations of
RNAi duplexes are used. (Scherer et al. 2003)
[0009] In addition, the duration of the effect of an effective RNAi
treatment is limited to about 4 days (Holen et al. 2002). Thus,
researchers must carry out siRNA experiments within 2-3 days of
transfection with an siRNA duplex or work with plasmid or viral
expression vectors to obtain longer term silencing.
[0010] Additional physical studies are needed to more completely
characterize the structural requirements of RNAi active
oligonucleotide duplexes to identify more potent and longer lasting
compositions and/or methods that simplify site-selection
difficulties. These studies should also include a detailed analysis
of the interferon response. Ideally, such studies will be useful in
identifying new RNAi active compounds that are more potent, that
simplify the site selection process, and decrease "off target
effects."
[0011] The invention provides RNAi compositions with increased
potency, duration of action, and decreased "off target effects"
that do not activate the interferon response and provides methods
for their use. In addition, the compositions ease site selection
criteria and provide a duration of action that is about twice as
long as prior known compositions. These and other advantages of the
invention, as well as additional inventive features, will be
apparent from the description of the invention provided herein.
BRIEF SUMMARY OF THE INVENTION
[0012] The invention provides improved compositions and methods for
selectively reducing the expression of a gene product from a
desired target gene in a eukaryotic cell, as well as for treating
diseases caused by the expression of the gene. The method involves
introducing into the environment of a cell an amount of a
double-stranded RNA (dsRNA) such that a sufficient portion of the
dsRNA can enter the cytoplasm of the cell to cause a reduction in
the expression of the target gene. The dsRNA has a first
oligonucleotide sequence that is between 26 and about 30
nucleotides in length and a second oligonucleotide sequence that
anneals to the first sequence under biological conditions, such as
the conditions found in the cytoplasm of a cell. In addition, a
region of one of the sequences of the dsRNA having a sequence
length of from about 19 to about 23 nucleotides is complementary to
a nucleotide sequence of the RNA produced from the target gene. A
dsRNA composition of the invention is at least as active as any
isolated 19, 20, 21, 22, or 23 basepair sequence that is contained
within it. Pharmaceutical compositions containing the disclosed
dsRNA compositions are also contemplated. The compositions and
methods give a surprising increase in the potency and duration of
action of the RNAi effect. Although the invention is not intended
to be limited by the underlying theory on which it is believed to
operate, it is thought that this increase in potency and duration
of action are caused by the fact the dsRNA serves as a substrate
for Dicer which appears to facilitate incorporation of one sequence
from the dsRNA into the RISC complex that is directly responsible
for destruction of the RNA from the target gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 provides a comparison of RNAi efficacy using several
dsRNAs having variable length and formats including a two
nucleotide 3' overhang (+2), a two nucleotide 5' overhang (-2), and
blunt ends (+0). The sequences are disclosed in the Example 2. In
each panel A-D 200 .mu.g of reporter vector was co-transfected with
the indicated concentration of dsRNA. Each bar represents the
average of three duplicate experiments. In FIG. 1A, 50 nM of each
dsRNA was used. In FIG. 1B, 1 nM of each dsRNA was used. In FIG.
1C, 200 pM of each dsRNA was used. In FIG. 1D, 50 pM of each dsRNA
was used.
[0014] FIG. 2 shows an RNAi assay in 3T3 cells expressing
endogenous EGFP. The experimental procedure is described in Example
2. Measurements were made 4 days after treatment. The dose response
curves for 21-mer duplex with 2-base 3'-overhang (SEQ ID No. 6/7),
25-mer duplex with 2-base 5'-overhang (SEQ ID Nos. 16/17), and
blunt 27-mer duplex (SEQ ID Nos. 30/31) are shown.
[0015] FIG. 3 shows RNAi assays of various 27-mer RNA duplex
formats as outlined in Example 2. Duplex 27+0UU (SEQ ID Nos. 30/31)
was most potent.
[0016] FIG. 4 shows RNAi assays on HEK 293 cells that were either
mock transfected (negative control), transfected with 200 ng EGFP
reporter plasmid alone (positive control), or reporter plasmid+RNA
duplexes at varying concentrations as described in Example 3.
[0017] FIG. 5 shows superior knockout of the HNRPH1 gene by a
27-mer of the invention as compared to a 21-mer directed to the
same target. Western blots obtained from HEK 293 cells after
transfection with with EGFP-specific siRNA (SEQ ID No. 6/7; C)
(negative control) and an HNRPH1 specific 21-mer siRNA duplex (SEQ
ID Nos. 51/52; 21+2) at varying concentrations, or with an HNRPH1
specific 27-mer siRNA duplex (SEQ ID Nos. 53/54; 27+0) at varying
concentrations, as described in Example 4.
[0018] FIG. 6 shows the reaction of Dicer with various length RNA
duplexes as described in Example 5. Dicer was able to digest
25-29-mers primarily into about a 21 basepair duplex but dd not
digest the 21 nucleotide long test duplex.
[0019] FIG. 7 shows the relative expression of EGFP after RNAi
assays using a 27-mer dsRNA versus shorter 21 -mer siRNAs contained
within the 27-mer sequence as described in more detail in Example
6. As shown a blunt ended 27-mer that covers a poor site for a 21
nucleotide RNAi can effectively target that site.
[0020] FIG. 8 shows the results of RNAi assays after treatment by
various effector dsRNA molecules and pools of molecules as set
forth in Example 6.
[0021] FIG. 9 shows the time course study of the duration of the
RNAi effect with various effector molecules as described in Example
7. The study shows the duration of the RNAi effect is at least
about twice as long with the 27-mer dsRNA of the invention as with
21-mers. The "27+0 UU" sequences are set forth in SEQ ID NOs:28 and
29. The "Mut-16" sequences are set forth in SEQ ID NOs:70 and 71.
The "Mut-16,17" sequences are set forth in SEQ ID NOs:72 and 73.
The "Mut-15,16,17" sequences are set forth in SEQ ID NOs:74 and
75.
[0022] FIG. 10 shows the images of cells in a time course study of
the duration of the RNAi effect with various effector molecules as
described in Example 7. The study shows the duration of the RNAi
effect is at least about twice as long with the 27-mer dsRNA of the
invention as with 21-mers.
[0023] FIG. 11 shows that neither interferon alpha (FIG. 11A) or
interferon beta (FIG. 11B) are induced by the 27-mer dsRNA of the
invention as described in more detail in Example 8.
[0024] FIG. 12 shows the results of a PKR activation assay in which
long dsRNA resulted in strong PKR activation (positive control)
while all of the short synthetic RNAs showed no evidence for PKR
activation.
DETAILED DESCRIPTION OF THE INVENTION
[0025] The invention is directed to compositions that contain
double stranded RNA ("dsRNA"), and methods for preparing them, that
are capable of reducing the expression of target genes in
eukaryotic cells. One of the strands of the dsRNA contains a region
of nucleotide sequence that has a length that ranges from about 19
to about 23 nucleotides that can direct the destruction of the RNA
transcribed from the target gene.
[0026] For purposes of the invention a suitable dsRNA contains one
oligonucleotide sequence, a first sequence, that is at least 25
nucleotides in length and no longer than about 30 nucleotides. More
preferably this sequence of RNA is between about 26 and 29
nucleotides in length. Still more preferably this sequence is about
27 or 28 nucleotides in length, 27 nucleotides is most preferred.
The second sequence of the dsRNA can be any sequence that anneals
to the first sequence under biological conditions, such as within
the cytoplasm of a eukaryotic cell. Generally, the second
oligonucleotide sequence will have at least 19 complementary base
pairs with the first oligonucleotide sequence, more typically the
second oligonucleotides sequence will have about 21 or more
complementary base pairs, and more preferably about 25 or more
complementary base pairs with the first oligonucleotide sequence.
In a preferred embodiment the second sequence is the same length as
the first sequence.
[0027] In certain embodiments the double-stranded RNA structure the
first and second oligonucleotide sequences exist on separate
oligonucleotide strands which can be and typically are chemically
synthesized. In preferred embodiments both strands are between 26
and 30 nucleotides in length. In one preferred embodiment both
strands are 27 nucleotides in length, are completely complementary
and have blunt ends. The dsRNA can be from a single RNA
oligonucleotide that undergoes intramolecular annealing or, more
typically, the first and second sequences exist on separate RNA
oligonucleotides.
[0028] Suitable dsRNA compositions that contain two separate
oligonucleotides can be chemically linked outside their annealing
region by chemical linking groups. Many suitable chemical linking
groups are known in the art and can be used. Suitable groups will
not block Dicer activity on the dsRNA and will not interfere with
the directed destruction of the RNA transcribed from the target
gene.
[0029] The first and second oligonucleotide sequences are not
required to be completely complimentary. In fact, it is preferred
that the 3'-terminus of the sense strand contains one or more
mismatches. It is more preferred that two mismatches be
incorporated at the 3'terminus. In a most preferred embodiment the
dsRNA of the invention is a double stranded RNA molecule containing
two RNA oligonucleotides each of which is 27 nucleotides in length
and, when annealed to each other, have blunt ends and a two
nucleotide mismatch on the 3'-terminus of the sense strand (the
5'-terminus of the antisense strand).
[0030] One feature of the dsRNA compositions of the invention is
that they can serve as a substrate for Dicer. Typically, the dsRNA
compositions of this invention will not have been treated with
Dicer, other RNAses, or extracts that contain them. Such treatments
could digest the dsRNA to lengths of less than 25 nucleotides that
are no longer Dicer substrates. Several methods are known and can
be used for determining whether a dsRNA composition serves as a
substrate for Dicer. For example, Dicer activity can be measured in
vitro using the Recombinant Dicer Enzyme Kit (GTS, San Diego,
Calif.) according to the manufacturer's instructions. Dicer
activity can be measured in vivo by treating cells with dsRNA and
maintaining them for 24 h before harvesting them and isolating
their RNA. RNa can be isolated using standard methods, such as with
the RNeasy.TM. Kit (Qiagen) according to the manufacturer's
instructions. The isolated RNA can be separated on a 10% PAGE gel
which is used to prepare a standard RNA blot that can be probed
with a suitable labeled deoxyoligonucleotide, such as an
oligonucleotide labeled with the Starfire.TM. Oligo Labeling System
(Integrated DNA Technologies, Inc., Coralville, Iowa).
[0031] It has been found empirically that these longer dsRNA
species of from 25 to about 30 nucleotides give unexpectedly
improved results in terms of increased potency and increased
duration of action over shorter prior art RNAi compositions. The
dsRNA compositions of the invention are at least as active as any
isolated 23 nucleotide dsRNA sequence contained within them and in
preferred embodiments more active. Without wishing to be bound by
the underlying theory of the invention, it is thought that the
longer dsRNA species serve as a substrate for the enzyme Dicer in
the cytoplasm of a cell. In addition to cleaving the dsRNA of the
invention into shorter segments, Dicer is thought to facilitate the
incorporation of a single-stranded cleavage product derived from
the cleaved dsRNA into the RISC complex that is responsible for the
destruction of the cytoplasmic RNA derived from the target gene.
Studies have shown that the cleavability of a dsRNA species by
Dicer corresponds with increased potency and duration of action of
the dsRNA species.
[0032] Suitable dsRNA compositions of this invention do not induce
apoptosis in the cells in which they are used. Apoptosis or
"programmed cell death," includes any non-necrotic, cell-regulated
form of cell death, as defined by criteria well established in the
art. Cells undergoing apoptosis show characteristic morphological
and biochemical features. Once the process is triggered, or the
cells are committed to undergoing apoptosis, morphological and
physiological changes include cell shrinkage, chromatin
condensation, nuclear and cytoplasmic condensation, membrane
blebbing, partitioning of cytoplasm and nucleus into membrane bound
vesicles which contain ribosomes (apoptotic bodies), and DNA
degradation into a characteristic oligonucleosomal ladder composed
of multiples of 200 base pairs, leading eventually to cell death.
In vivo, these apoptotic bodies are rapidly recognized and
phagocytized by either macrophages or adjacent epithelial cells. In
vitro, the apoptotic bodies as well as the remaining cell fragments
ultimately swell and finally lyse. This terminal phase of in vitro
cell death has been termed "secondary necrosis."
[0033] The effect that a dsRNA has on a cell can depend upon the
cell itself. In some circumstances a dsRNA could induce apoptosis
or gene silencing in one cell type and not another. Thus, it is
possible that a dsRNA could be suitable for use in one cell and not
another. To be considered "suitable" a dsRNA composition need not
be suitable under all possible circumstances in which it might be
used, rather it need only be suitable under a particular set of
circumstances.
[0034] Modifications can be included in the disclosed dsRNA so long
as the dsRNA remains sufficiently chemically stable, does not
induce apoptosis, does not substantially interrupt annealing of the
first and second strands, and otherwise does not substantially
interfere with the directed destruction of the RNA transcribed from
the target gene. Modifications can be incorporated in the
3'-terminal region, the 5'-terminal region, in both the 3'-terminal
and 5'-terminal region or in some instances throughout the
sequence. With the restrictions noted above in mind any number and
combination of modifications can be incorporated into the dsRNA.
Where multiple modifications are present, they may be the same or
different. Modifications to bases, sugar moieties, the phosphate
backbone, and their combinations are contemplated.
[0035] For example, either the 3' or 5' terminal regions of the
sequences in a dsRNA can be phosphorylated or biotinylated.
Examples of modifications contemplated for the phosphate backbone
include phosphonates, including methylphosphonate,
phosphorothioate, and phosphotriester modifications such as
alkylphosphotriesters, and the like. Examples of modifications
contemplated for the sugar moiety include 2'-alkyl pyrimidine, such
as 2'-O-methyl, 2'-fluoro, amino, and deoxy modifications and the
like. Examples of modifications contemplated for the base groups
include a basic sugars, 2-O-alkyl modified pyrimidines,
4-thiouracil, 5-bromouracil, 5-iodouracil, and
5-(3-aminoallyl)-uracil and the like. Many other modifications are
known and can be used so long as the above criteria are
satisfied
[0036] The double-stranded RNA sample can be suitably formulated
and introduced into the environment of the cell by any means that
allows for a sufficient portion of the sample to enter the cell to
induce gene silencing, if it is to occur. Many formulations for
dsRNA are known in the art and can be used so long as dsRNA gains
entry to the target cells so that it can act. For example, dsRNA
can be formulated in buffer solutions such as phosphate buffered
saline solutions, liposomes, micellar structures, and capsids.
Formulations of dsRNA with cationic lipids can be used to
facilitate transfection of the dsRNA into cells. Suitable lipids
include Oligofectamine, Lipofectamine (Life Technologies), NC388
(Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6
(Roche) all of which can be used according to the manufacturer's
instructions.
[0037] It can be appreciated that the method of introducing dsRNA
into the environment of the cell will depend on the type of cell
and the make up of its environment. For example, when the cells are
found within a liquid, one preferable formulation is with a lipid
formulation such as in lipofectamine and the dsRNA can be added
directly to the liquid environment of the cells. Lipid formulations
can also be administered to animals such as by intravenous,
intramuscular, or intraperitoneal injection, or orally or by
inhalation or other methods as are known in the art. When the
formulation is suitable for administration into animals such as
mammals and more specifically humans, the formulation is also
pharmaceutically acceptable. Pharmaceutically acceptable
formulations for administering oligonucleotides are known and can
be used. In some instances, it may be preferable to formulate dsRNA
in a buffer or saline solution and directly inject the formulated
dsRNA into cells, as in studies with oocytes. The direct injection
of dsRNA duplexes
[0038] Suitable amounts of dsRNA must be introduced and these
amounts can be empirically determined using standard methods.
Typically, effective concentrations of individual dsRNA species in
the environment of a cell will be about 50 nanomolar or less 10
nanomolar or less, more preferred are compositions in which
concentrations of about 1 nanomolar or less can be used. Even more
preferred are methods that utilize a concentration of about 200
picomolar or less and even a concentration of about 50 picomolar or
less can be used in many circumstances.
[0039] The method can be carried out by addition of the dsRNA
compositions to any extracellular matrix in which cells can live
provided that the dsRNA composition is formulated so that a
sufficient amount of the dsRNA can enter the cell to exert its
effect. For example, the method is amenable for use with cells
present in a liquid such as a liquid culture or cell growth media,
in tissue explants, or in whole organisms, including animals, such
as mammals and especially humans.
[0040] As is known, RNAi methods are applicable to a wide variety
of genes in a wide variety of organisms and the disclosed
compositions and methods can be utilized in each of these contexts.
Examples of genes which can be targeted by the disclosed
compositions and methods include endogenous genes which are genes
that are native to the cell or to genes that are not normally
native to the cell. Without limitation these genes include
oncogenes, cytokine genes, idiotype (Id) protein genes, prion
genes, genes that expresses molecules that induce angiogenesis,
genes for adhesion molecules, cell surface receptors, proteins
involved in metastasis, proteases, apoptosis genes, cell cycle
control genes, genes that express EGF and the EGF receptor,
multi-drug resistance genes, such as the MDR1 gene.
[0041] Expression of a target gene can be determined by any
suitable method now known in the art or that is later developed. It
can be appreciated that the method used to measure the expression
of a target gene will depend upon the nature of the target gene.
For example, when the target gene encodes a protein the term
"expression" can refer to a protein or transcript derived from the
gene. In such instances the expression of a target gene can be
determined by measuring the amount of mRNA corresponding to the
target gene or by measuring the amount of that protein. Protein can
be measured in protein assays such as by staining or immunoblotting
or, if the protein catalyzes a reaction that can be measured, by
measuring reaction rates. All such methods are known in the art and
can be used. Where the gene product is an RNA species expression
can be measured by determining the amount of RNA corresponding to
the gene product. Several specific methods for detecting gene
expression are described in Example 1. The measurements can be made
on cells, cell extracts, tissues, tissue extracts or any other
suitable source material.
[0042] The determination of whether the expression of a target gene
has been reduced can be by any suitable method that can reliably
detect changes in gene expression. Typically, the determination is
made by introducing into the environment of a cell undigested dsRNA
such that at least a portion of that dsRNA enters the cytoplasm and
then measuring the expression of the target gene. The same
measurement is made on identical untreated cells and the results
obtained from each measurement are compared. When the method
appears to reduce the expression of the target gene by about 10% or
more (which is equivalent to about 90% or less) of the level in an
untreated organism, for purposes of this invention, the method is
considered to reduce the expression of the target gene. Typically,
the method can be used to reduce the expression of a target gene by
far more than 10%. In some instances the method can be used to
reduce the expression by about 50% or more, in more preferred
methods the expression is reduced by about 75% or more, still more
preferable are methods that reduce the expression by about 90% or
more, or even about 95% or more, or about 99% or more or even by
completely eliminating expression of the target gene.
[0043] The dsRNA can be formulated as a pharmaceutical composition
which comprises a pharmacologically effective amount of a dsRNA and
pharmaceutically acceptable carrier. A pharmacologically or
therapeutically effective amount refers to that amount of a dsRNA
effective to produce the intended pharmacological, therapeutic or
preventive result. The phrases "pharmacologically effective amount"
and "therapeutically effective amount" or simply "effective amount"
refer to that amount of an RNA effective to produce the intended
pharmacological, therapeutic or preventive result. For example, if
a given clinical treatment is considered effective when there is at
least a 20% reduction in a measurable parameter associated with a
disease or disorder, a therapeutically effective amount of a drug
for the treatment of that disease or disorder is the amount
necessary to effect at least a 20% reduction in that parameter.
[0044] The phrase pharmaceutically acceptable carrier refers to a
carrier for the administration of a therapeutic agent. Exemplary
carriers include saline, buffered saline, dextrose, water,
glycerol, ethanol, and combinations thereof. For drugs administered
orally, pharmaceutically acceptable carriers include, but are not
limited to pharmaceutically acceptable excipients such as inert
diluents, disintegrating agents, binding agents, lubricating
agents, sweetening agents, flavoring agents, coloring agents and
preservatives. Suitable inert diluents include sodium and calcium
carbonate, sodium and calcium phosphate, and lactose, while corn
starch and alginic acid are suitable disintegrating agents. Binding
agents may include starch and gelatin, while the lubricating agent,
if present, will generally be magnesium stearate, stearic acid or
talc. If desired, the tablets may be coated with a material such as
glyceryl monostearate or glyceryl distearate, to delay absorption
in the gastrointestinal tract. The pharmaceutically acceptable
carrier of the disclosed dsRNA composition may be micellar
structures, such as a liposomes, capsids, capsoids, polymeric
nanocapsules, or polymeric microcapsules.
[0045] Polymeric nanocapsules or microcapsules facilitate transport
and release of the encapsulated or bound dsRNA into the cell. They
include polymeric and monomeric materials, especially including
polybutylcyanoacrylate. A summary of materials and fabrication
methods has been published (see J. Kreuter, (1991)
Nanoparticles-preparation and applications. In: M. Donbrow (Ed.)
Microcapsules and nanoparticles in medicine and pharmacy. CRC
Press, Boca Raton, Fla., pp. 125-14). The polymeric materials which
are formed from monomeric and/or oligomeric precursors in the
polymerization/nanoparticle generation step, are per se known from
the prior art, as are the molecular weights and molecular weight
distribution of the polymeric material which a person skilled in
the field of manufacturing nanoparticles may suitably select in
accordance with the usual skill.
[0046] Suitably formulated pharmaceutical compositions of this
invention can be administered by any means known in the art such as
by parenteral routes, including intravenous, intramuscular,
intraperitoneal, subcutaneous, transdermal, airway (aerosol),
rectal, vaginal and topical (including buccal and sublingual)
administration.
[0047] In general a suitable dosage unit of dsRNA will be in the
range of 0.001 to 0.25 milligrams per kilogram body weight of the
recipient per day, preferably in the range of 0.01 to 20 micrograms
per kilogram body weight per day, more preferably in the range of
0.01 to 10 micrograms per kilogram body weight per day, even more
preferably in the range of 0.10 to 5 micrograms per kilogram body
weight per day, and most preferably in the range of 0.1 to 2.5
micrograms per kilogram body weight per day. Preferably,
pharmaceutical composition comprising the dsRNA is administered
once daily. However, the therapeutic agent may also be dosed in
dosage units containing two, three, four, five, six or more
sub-doses administered at appropriate intervals throughout the day.
In that case, the dsRNA contained in each sub-dose must be
correspondingly smaller in order to achieve the total daily dosage
unit. The dosage unit can also be compounded for a single dose over
several days, e.g., using a conventional sustained release
formulation which provides sustained and consistent release of the
dsRNA over a several day period. Sustained release formulations are
well known in the art. In this embodiment, the dosage unit contains
a corresponding multiple of the daily dose. Regardless of the
formulation, the pharmaceutical composition must contain dsRNA in a
quantity sufficient to inhibit expression of the target gene in the
animal or human being treated. The composition can be compounded in
such a way that the sum of the multiple units of dsRNA together
contain a sufficient dose.
[0048] Data can be obtained from cell culture assays and animal
studies to formulate a suitable dosage range for humans. The dosage
of compositions of the invention lies, preferably, within a range
of circulating concentrations that include the ED50 (as determined
by known methods) with little or no toxicity. The dosage may vary
within this range depending upon the dosage form employed and the
route of administration utilized. For any compound used in the
method of the invention, the therapeutically effective dose can be
estimated initially from cell culture assays. A dose may be
formulated in animal models to achieve a circulating plasma
concentration range of the compound that includes the IC50 (i.e.,
the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels of dsRNA in plasma may be measured by
standard methods, for example, by high performance liquid
chromatography.
[0049] The following examples further illustrate the invention but,
of course, should not be construed as in any way limiting its
scope.
EXAMPLE 1
[0050] This example demonstrates the preparation of double-stranded
RNA oligonucleotides
[0051] Oligonucleotide synthesis and purification. RNA
oligonucleotides were synthesized using solid phase phosphoramidite
chemistry, deprotected and desalted on NAP-5 columns (Amersham
Pharmacia Biotech, Piscataway, N.J.) using standard techniques
(Damha and Olgivie, Methods Mol Biol 1993, 20:81-114; Wincott et
al., Nucleic Acids Res 1995, 23:2677-84). The oligomers were
purified using ion-exchange high performance liquid chromatography
(IE-HPLC) on an Amersham Source 15Q column (1.0 cm.times.25 cm)
(Amersham Pharmacia Biotech, Piscataway, N.J.) using a 15 min
step-linear gradient. The gradient varied from 90:10 Buffers A:B to
52:48 Buffers A:B, where Buffer A was 100 mM Tris pH 8.5 and Buffer
B was 100 mM Tris pH 8.5, 1 M NaCl. Samples were monitored at 260
nm and peaks corresponding to the full-length oligonucleotide
species were collected, pooled, desalted on NAP-5 columns, and
lyophilized.
[0052] The purity of each oligomer was determined by capillary
electrophoresis (CE) on a Beckman PACE 5000 (Beckman Coulter, Inc.,
Fullerton, Calif.). The CE capillaries had a 100 .mu.m inner
diameter and contained ssDNA 100R Gel (Beckman-Coulter). Typically,
about 0.6 nmole of oligonucleotide was injected into a capillary,
ran in an electric field of 444 V/cm and detected by UV absorbance
at 260 nm. Denaturing Tris-Borate-7 M-urea running buffer was
purchased from Beckman-Coulter. Oligoribonucleotides were at least
90% pure as assessed by CE for use in experiments described below.
Compound identity was verified by matrix-assisted laser desorption
ionization time-of-flight (MALDI-TOF) mass spectroscopy on a
Voyager DE.TM. Biospectometry Work Station (Applied Biosystems,
Foster City, Calif.) following the manufacturer's recommended
protocol. Relative molecular masses of all oligomers were within
0.2% of expected molecular mass.
[0053] Preparation of Duplexes. Single-stranded RNA (ssRNA)
oligomers were resuspended at 100 .mu.M concentration in duplex
buffer consisting of 100 mM potassium acetate, 30 mM HEPES, pH 7.5.
Complementary sense and antisense strands were mixed in equal molar
amounts to yield a final solution of 50 .mu.M duplex. Samples were
heated to 95 .degree. C. for 5' and allowed to cool to room
temperature before use. Double-stranded RNA (dsRNA) oligomers were
stored at -20.degree. C. Single-stranded RNA oligomers were stored
lyophilized or in nuclease-free water at -80.degree. C.
[0054] Nomenclature. For consistency, the following nomenclature
has been employed throughout the Examples. Names given to duplexes
indicate the length of the oligomers and the presence or absence of
overhangs. A "21+2" duplex contains two RNA strands both of which
are 21 nucleotides in length, also termed a 21-mer siRNA duplex,
and having a 2 base 3'-overhang. A "21-2" design is a 21-mer siRNA
duplex with a 2 base 5'-overhang. A 21-0 design is a 21-mer siRNA
duplex with no overhangs (blunt). A "21+2UU" is a 21-mer duplex
with 2-base 3'-overhang and the terminal 2 bases at the 3'-ends are
both U residues (which may result in mismatch with target
sequence).
EXAMPLE 2
[0055] This example demonstrates that dsRNAs having strands that
are 25 nucleotides in length or longer have surprisingly increased
potency in mammalian systems than known 21-23-mer siRNAs.
[0056] Cell Culture, Transfection, and EGFP Assays. Human embryonic
kidney (HEK) 293 cells were grown in DMEM medium supplemented with
10% fetal bovine serum (FBS) (Irvine Scientific, Santa Ana,
Calif.). Transfections were done at 90% confluence in 24-well
plates using Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.)
according to the manufacturer's instructions. Briefly, 50 .mu.l of
Opti-MEM media was mixed with nucleic acids, including siRNA
duplexes and/or 100-200 ng plasmid pEGFP-C1 (Clontech, Palo Alto,
Calif.) for 5 min. Nucleic acids were then mixed with 50 .mu.l of
Opti-MEM media that had been pre-mixed with 1.5 .mu.l of
Lipofectamine 2000 and incubated at room temperature for 15 min.
The lipid--nucleic acid mixtures were added to cells after removal
of old media and swirled and then an additional 0.4 ml of media
pre-warmed to 37.degree. C. was added. Incubation was continued at
37.degree. C. and cells were assayed for fluorescence at the times
indicated. Each assay was performed in triplicate. EGFP expression
levels were measured by direct fluorescence in a
fluorescence-activated cell sorter (FACS) (Moslo-MLS, Dako
Cytomation, Fort Collins, Colo.) in the City of Hope Cytometrics
Core Facility (Duarte, Calif.). EGFP expression was measured as the
percentage of cells showing detectable fluorescence above
background (mock-transfected negative control cells).
[0057] NIH 3T3 cells that stably expressed EGFP (Kim and Rossi,
2003, Antisense Nucleic Acid Drug Dev., 13:151-155) were grown in
DMEM media supplemented with 10% FBS. Cells were plated at 30%
density on 24-well plates and transfected with siRNA alone without
reporter plasmid using the same method described above. Media was
changed at 24 h and EGFP assays were performed at 3, 6 and 9 days
post-transfection. At 3 days post-transfection, 1.times.10.sup.5
cells were used for extract preparation and 1.times.10.sup.4 cells
were re-plated and continued incubation for later assay. At day 6,
1.times.10.sup.5 cells were used for extract preparation, and
1.times.10.sup.4 cells were re-plated and continued incubation for
later assay. At day 9, 1.times.10.sup.5 cells were used for extract
preparation. For extract preparation, 1.times.10.sup.5 cells were
suspended in 300 .mu.l phosphate buffered saline (PBS) and
sonicated for 10 sec. Cells were centrifuged at 14,000 g for 2 min
and cell supernatant was recovered for fluorometry. EGFP
fluorescence was examined using a VersaFluor Cuvette Fluorometer
(Bio-Rad, Hercules, Calif.) using excitation filter D490 and
emission filter D520. Percentage of EGFP expression was determined
relative to extract prepared from non-transfected control
cells.
[0058] In addition, cells were directly examined by fluorescence
microscopy using a Nikon Eclipse TE2000-S (Nikon Instech Co.,
Kanagawa, JP) using the program Spot v3.5.8. Images were digitally
captured with identical exposure times so that comparisons between
cells samples could be made.
[0059] Nucleic Acid Reagents. The reporter system employed EGFP
either as a transfection plasmid vector pEGFP-C1 (Clontech, Palo
Alto, Calif.) or as a stable transformant in an NIH 3T3 cell line.
The coding sequence of EGFP is shown below, from Genbank accession
#U55763. The ATG start codon and TAA stop codons are highlighted in
bold font and sites target by siRNA reagents are underscored.
1 SEQ ID NO. 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccat- cctggt
cgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagg
gcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacc
accggcaagctgcccgtgccctggcccaccctcgtgaccaccctgaccta
cggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgact
tcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttc
ttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgaggg
cgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagg
acggcaacatcctggggcacaagctggagtacaactacaacagccacaac
gtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaa
gatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactacc
agcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccac
tacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcga
tcacatggtcctgctggagttCgtgaccgccgccgggatcactctcggca
tggacgagctgtacaagtaa:
[0060] Site-1 used for siRNA targeting in EGFP was:
2 SITE 1: (SEQ ID NO:67) 5' GCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGC
3'
[0061] Site-2 used for siRNA targeting in EGFP was:
3 SITE 2: (SEQ ID NO:68) 5'UGAAGCAGCACGACUUCUUCA- AGUCCGCCAUG
3'
[0062] RNA duplexes were synthesized and prepared as described in
Example 1. RNA duplexes targeting EGFP Site-1 are summarized in
Table 1 below. Some sequences had the dinucleotide sequence "UU"
placed at the 3'-end of the sense strand (Elbashir et al., 2001,
EMBO J., 20:6877-6888; Hohjoh, 2002, FEBS Lett., 521: 195-199).
Mismatches that resulted from including 3'-terminal "UU" or where a
mismatch was intentionally positioned are highlighted in bold and
underscored.
4TABLE 1 Summary of Oligonucleotide Reagents, EGFP Site-1 Sequence
Name SEQ ID NOo. 5' GCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGC 3' EGFP
Site-1 SEQ ID NO: 67 5' GCAAGCUGACCCUGAAGUUCA EGFPS1-21 - 2 SEQ ID
No. 2 3' UUCGACUGGGACUUCAAGUAG SEQ ID NO. 3 5'
AAGCUGACCCUGAAGUUCAUC EGFPS1-21 + 0 SEQ ID No. 4 3'
UUCGACUGGGACUUCAAGUAG SEQ ID NO. 5 5' GCUGACCCUGAAGUUCAUCUG
EGFPS1-21 + 2 (7) SEQ ID No. 6 3' UUCGACUGGGACUUCAAGUAG SEQ ID NO.
7 5' GCAAGCUGACCCUGAAGUUCAUU EGFPS1-23 - 2UU SEQ ID No. 8 3'
UUCGACUGGGACUUCAAGUAGAC SEQ ID NO. 9 5' GCUGACCCUGAAGUUCAUCUGUU
EGFPS1-23 +]2UU SEQ ID No. 10 3' UUCGACUGGGACUUCAAGUAGAC SEQ ID NO.
11 5' GCAAGCUGACCCUGAAGUUCAUUU EGFPS1-24 - 2UU SEQ ID No. 12 3'
UUCGACUGGGACUUCAAGUAGACG SEQ ID NO. 13 5' GCUGACCCUGAAGUUCAUCUGCUU
EGFPS1-24 + 2UU SEQ ID No. 14 3' UUCGACUGGGACUUCAAGUAGACG SEQ ID
NO. 15 5' GCAAGCUGACCCUGAAGUUCAUCUU EGFPS1-25 - 2UU SEQ ID No. 16
3' UUCGACUGGGACUUCAAGUAGACGU SEQ ID NO. 17 5'
GCUGACCCUGAAGUUCAUCUGCAUU EGFPS1-25 + 2UU SEQ ID No. 18 3'
UUCGACUGGGACUUCAAGUAGACGU SEQ ID NO. 19 5'
AAGCUGACCCUGAAGUUCAUCUGCAC EGFPS1-26 + 0 SEQ ID No. 20 3'
UUCGACUGGGACUUCAAGUAGACGUG SEQ ID NO. 21 5'
AAGCUGACCCUGAAGUUCAUCUGCUU EGFPS1-26 + 0UU SEQ ID No. 22 3'
UUCGACUGGGACUUCAAGUAGACGUG SEQ ID NO. 23 5'
GCAAGCUGACCCUGAAGUUCAUCUUU EGFPS1-26 - 2UU SEQ ID No. 24 3'
UUCGACUGGGACUUCAAGUAGACGUG SEQ ID NO. 25 5'
GCUGACCCUGAAGUUCAUCUGCACUU EGFPS1-26 + 2UU SEQ ID No. 26 3'
UUCGACUGGGACUUCAAGUAGACGUG SEQ ID NO. 27 5'
AAGCUGACCCUGAAGUUCAUCUGCACC EGFPS1-27 + 0 SEQ ID No. 28 3'
UUCGACUGGGACUUCAAGUAGACGUGG SEQ ID NO. 29 5'
AAGCUGACCCUGAAGUUCAUCUGCAUU EGFPS1-27 + OUU SEQ ID No. 30 3'
UUCGACUGGGACUUCAAGUAGACGUGG SEQ ID NO. 31 5'
GCAAGCUGACCCUGAAGUUCAUCUGUU EGFPS1-27 - 2UU SEQ ID No. 32 3'
UUCGACUGGGACUUCAAGUAGACGUGG SEQ ID NO. 33 5'
GCUGACCCUGAAGUUCAUCUGCACAUU EGFPS1-27 + 2UU, mut SEQ ID No. 34 3'
UUCGACUGGGACUUCAAGUAGACGUGG SEQ ID NO. 35 5'
AAGCUGACCCUGUUCAUCAUCUGCACC EGFPS1-27 + 0-mut SEQ ID No. 36 3'
UUCGACUGGGACAAGUAGUAGACGUGG SEQ ID NO. 37 5'
AAGCUGACCCUGAAGUUCAUCUGCACCA EGFPS1-28 + 0 SEQ ID No. 38 3'
UUCGACUGGGACUUCAAGUAGACGUGGU SEQ ID NO. 39 5'
AAGCUGACCCUGAAGUUCAUCUGCACCAC EGFPS1-29 + 0 SEQ ID No. 40 3'
UUCGACUGGGACUUCAAGUAGACGUGGUG SEQ ID NO. 41 5'
AAGCUGACCCUGAAGUUCAUCUGCACCACC EGFPS1-30 + 0 SEQ ID No. 42 3'
UUCGACUGGGACUUCAAGUAGACGUGGUGG SEQ ID NO. 43
[0063] Results. HEK 293 cells were mock transfected (negative
control), transfected with 200 ng EGFP reporter plasmid alone
(positive control), or reporter plasmid+siRNA duplexes at varying
concentrations. EGFP expression was assessed using the FACS assay
at 24 h post-transfection. Results are shown in FIG. 1. At 50 nM
concentration (FIG. 1A), a 21-mer siRNA duplex with 2-base
3'-overhang (21+2 design) (SEQ ID NoS. 6/7) showed about a 70%
reduction in EGFP expression while longer duplexes were more
potent. 25-mer siRNA duplexes (SEQ ID Nos. 16/17 and 18/19) and
longer (SEQ ID Nos. 20/21, 24/25, 26/27, 30/31, 32/33, and 34/35)
suppressed EGFP below detection limits. Typically, 21-mer siRNA
oligos are employed at 10-100 nM concentration by those skilled in
the art. At 1 nM concentration (FIG. 1B), a concentration much
lower than is typically employed today, the 21-mer duplex showed
only about a 40% reduction in EGFP expression while longer duplexes
continued to suppress EGFP below detection limits. At 200 pM
concentration (FIG. 1C), the 21 -mer duplex had no effect on EGFP
expression while the blunt 27-mer duplex continued to suppress EGFP
below detection limits. At 50 pM concentration (FIG. 1D), the
27-mer blunt duplex (SEQ ID No. 30/31) suppressed EGFP expression
by about 90% or more. The longer and shorter duplexes tested
(26-mers SEQ ID No. 22/23, 24/25, 26/27; 29-mer SEQ ID No. 40/41;
or 30-mer SEQ ID No. 42/43) were slightly less effective than the
blunt 27-mer.
[0064] This experiment was repeated using NIH 3T3 cells that stably
express EGFP. EGFP protein was detected in cellular extracts using
a cuvette fluorometer as described above. The dose response curves
for 21-mer duplex with 2-base 3'-overhang (SEQ ID No. 6/7), 25-mer
duplex with 2-base 5'-overhang (SEQ ID Nos. 16/17), and blunt
27-mer duplex (SEQ ID Nos. 30/31) are shown in FIG. 2. The exact
level of suppression varied between experiments done using stably
transfected 3T3 cells compared with transiently transfected HEK 293
cells (FIG. 1), however qualitative trends were identical.
[0065] This example demonstrates that the longer dsRNAs of the
invention have about a 100-fold or more higher potency than
traditional 21-mer siRNAs. The enhanced effect was first seen at
about a 25-mer length and maximal potency was achieved with a
27-mer. Potent RNAi effects were observed for 30-mer duplexes (the
longest compounds tested herein), with no apparent toxicity to
either the HEK 293 cells or NIH 3T3 cells. Furthermore, as duplex
length was increased above 25-mer length (presumably when the
duplex is sufficiently long to be a Dicer substrate), a 2-base
3'-overhang (as taught in the prior art) is no longer necessary. In
the present experiments 25-mer duplexes with a 2-base 5'-overhang
had similar potency as did blunt ended duplexes or duplexes with a
2-base 3'-overhang. In the current experimental system, the 27-mer
blunt duplex showed greatest potency.
[0066] Within the set of 27-mer RNA duplexes tested in this
example, duplexes that included base mismatches between the sense
and antisense strands (SEQ ID Nos. 30/31, 32/33, 34/35) were more
potent than the duplex having perfect complementarity (SEQ ID Nos.
28/29). These duplexes (27+0UU, 27+2UU, and 27-2UU) had 1 or 2
mismatches at the 3'-end of the sense strand. The set of 27-mer
duplexes were compared for effective suppression of EGFP expression
in the HEK 293 cell transient transfection assay and the results
are shown in FIG. 3. Duplex 27+0UU (SEQ ID Nos. 30/31) was most
potent.
[0067] The use of mismatches or decreased thermodynamic stability
(specifically at the 3'-sense/5'-antisense position) has been
proposed to facilitate or favor entry of the antisense strand into
RISC (Schwarz et al., 2003, Cell, 115:199-208; Khvorova et al.,
2003, Cell, 115:209-216), presumably by affecting some
rate-limiting unwinding steps that occur with entry of the siRNA
into RISC. Because of this terminal base composition has been
included in design algorithms for selecting active 21 -mer siRNA
duplexes (Ui-Tei et al., 2004, Nucleic Acids Res., 32:936-948;
Reynolds et al., 2004, Nat. Biotechnol., 22:326-330). It has been
proposed that the 27-mer duplexes employed in this example do not
directly enter RISC but first are cleaved by Dicer into 21-mer
siRNAs. With Dicer cleavage, the small end-terminal sequence which
contains the mismatches will either be left unpaired with the
antisense strand (become part of a 3'-overhang) or be cleaved
entirely off the final 21 -mer siRNA. These "mismatches",
therefore, do not persist as mismatches in the final RNA component
of RISC. It was surprising to find that base mismatches or
destabilization of segments at the 3'-end of the sense strand of a
Dicer substrate improve the potency of synthetic duplexes in RNAi,
presumably by facilitating processing by Dicer.
EXAMPLE 3
[0068] This example demonstrates that the use of 25-30 nucleotide
RNA duplexes allows gene targeting at a site that could not be
effectively targeted using traditional siRNA 21 -mer designs.
[0069] It is currently expected in the art that the majority of
21-mer siRNA duplexes targeted to sites within a given target gene
sequence will be ineffective (Holen et al., 2002, Nucleic Acids
Res., 30:1757-1766). Consequently, a variety of sites are commonly
tested in parallel or pools containing several distinct siRNA
duplexes specific to the same target with the hope that one of the
reagents will be effective (Ji et al., 2003, FEBS Lett.,
552:247-252). To overcome the need to pool or engage in large scale
empiric testing, complex design rules and algorithms have been
devised to increase the likelihood of obtaining active RNAi
effector molecules (Schwarz et al., 2003, Cell, 115:199-208;
Khvorova et al., 2003, Cell, 115:209-216; Ui-Tei et al., 2004,
Nucleic Acids Res., 32:936-948; Reynolds et al., 2004, Nat.
Biotechnol., 22:326-330). These design rules significantly limit
the number of sites amenable to RNAi knockdown within a given
target gene. In fact, the design can be overly restrictive in
situations demanding the suppression of specific alleles or
isoforms. Moreover, the rules are not perfect and do not always
provide active siRNA effector molecules. This example shows that
the use of dsRNA duplexes of the present invention allow RNAi
targeting at sites that were ineffectively targeted by previously
known 21-mer siRNA reagents. This result minimizes the need for
empirically testing multiple sites or using pooled reagent
sets.
[0070] Nucleic Acid Reagents. The reporter system employed EGFP as
in SEQ ID No. 1 above. Site-2 in EGFP, as shown in Example 1, was
targeted. RNA duplexes were synthesized and prepared as described
in Example 1. RNA duplexes targeting EGFP Site-2 are summarized in
Table 2 below. Duplex EGFPS2-27+0 mm was a blunt 27-mer duplex with
a 2 base mismatch at the terminal 2 bases of the sense strand.
These bases are shown in bold and underscored.
5TABLE 2 Summary of Oligonucleotide Reagents, EGFP Site-2 Sequence
Name SEQ ID No. 5' UGAAGCAGCACGACUUCUUCAAGUCCGCCAUG 3' EGFP Site-2
SEQ ID NQ: 68 5' GCAGCACGACUUCUUCAAGUU EGFPS2-21 + 2 SEQ ID No. 44
3' UUCGUCGUGCUGAAGAAGUUC SEQ ID No. 45 5'
AAGCAGCACGACUUCUUCAAGUCCGCC EGFPS2-27 + 0 SEQ ID No. 46 3'
UUCGUCGUGCUGAAGAAGUUCAGGCGG SEQ ID No. 47 5'
AAGCAGCACGACUUCUUCAAGUCCGGG EGFPS2-27 + 0mm SEQ ID No. 48 3'
UUCGUCGUGCUGAAGAAGUUCAGGCGG SEQ ID No. 49
[0071] Results. HEK 293 cells were mock transfected (negative
control), transfected with 200 ng EGFP reporter plasmid alone
(positive control), or reporter plasmid+RNA duplexes at varying
concentrations as described previously. EGFP expression was
assessed using the FACS assay at 24 h post-transfection. Results
are shown in FIG. 4. At 10 nM concentration, the traditional 21-mer
siRNA duplex with 2-base 3'-overhangs targeted to Site-2 in the
EGFP gene (SEQ ID Nos. 44/45) did not detectably reduce EGFP
expression. In contrast, a 10 nM concentration of the longer 27-mer
duplex RNA (SEQ ID No. 46/47) reduced EGFP by about 80% or more and
10 nM of a related 27-mer (SEQ ID No. 48/49) reduced EGFP by about
90% or more. As in Example 2 above, 3'- or 5'-overhangs did not
improve activity over the blunt ended version. The 27-mer with the
2-base mismatch in the sense strand (SEQ ID Nos. 48/49) showed
improved activity as compared to the perfectly matched 27-mer (SEQ
ID Nos. 46/47). It is possible that destabilization of the RNA
duplex at this position improves efficiency of cleavage by
Dicer.
[0072] This example demonstrates that dsRNAs of the invention can
efficiently target sites within the EGFP gene that were previously
considered poor targets by previously known methods. Use of the
method of the invention will therefore simplify site selection and
design criteria for RNAi. This example also shows that the
intentional placement of mismatches at the 3'-terminus of the sense
strand increases the potency of the 27-mer duplex.
EXAMPLE 4
[0073] This example demonstrates the use of the disclosed dsRNA
duplexes to reduce expression of the human HNRPH1 gene in HEK 293
cells.
[0074] Western Blot. HEK 293 cells were cultured in a 6-well plate.
At 30% confluence, cells were transfected with iRNA duplexes as
outlined in Example 2 above except that all reagents were used at
5-fold higher volume due to the larger scale of the cultures. Cells
were harvested at 72 h in 300 .mu.l phosphate buffered saline (PBS)
and sonicated for 10 sec. Cell lysates was centrifuged for 2 min at
14,000 g and the supernatant was collected. Aliquots of 2 .mu.l
were taken from the cleared lysates which were run on a 10%
SDS-PAGE gel. The HNRPH1 gene product was detected using a rabbit
polyclonal anti-HNRPH1 antiserum and an anti-rabbit antibody
conjugated with alkaline phosphatase (Sigma, St. Louis, Mo.). As
control, .beta.-actin was detected by a murine anti-human actin
antibody (Sigma, St. Louis, Mo.) and anti-mouse antibody conjugated
with alkaline phosphatase (Sigma, St. Louis, Mo.), as previously
described (Markovtsov et al., 2000, Mol. Cell Biol.,
20:7463-79).
[0075] Nucleic Acid Reagents. The coding sequence of Homo sapiens
heterogeneous nuclear ribonucleoprotein H1 (HNRPH1) MRNA is shown
(Genbank accession No. NM.sub.--005520) below. The ATG start codon
and TAA stop codons are highlighted in bold font and site target by
siRNA reagents is underscored.
6 SEQ ID No. 50 ttttttttttcgtcttagccacgcagaagtcgcgtgtctagtt-
tgtttcg acgccggaccgcgtaagagacgatgatgttgggcacggaaggtggagag- g
gattcgtggtgaaggtccggggcttgccctggtcttgctcggccgatgaa
gtgcagaggtttttttctgactgcaaaattcaaaatggggctcaaggtat
tcgtttcatctacaccagagaaggcagaccaagtggcgaggcttttgttg
aacttgaatcagaagatgaagtcaaattggccctgaaaaaagacagagaa
actatgggacacagatatgttgaagtattcaagtcaaacaacgttgaaat
ggattgggtgttgaagcatactggtccaaatagtcctgacacggccaatg
atggctttgtacggcttagaggacttccctttggatgtagcaaggaagaa
attgttcagttcttctcagggttggaaatcgtgccaaatgggataacatt
gccggtggacttccaggggaggagtacgggggaggccttcgtgcagtttg
cttcacaggaaatagctgaaaaggctctaaagaaacacaaggaaagaata
gggcacaggtatattgaaatctttaagagcagtagagctgaagttagaac
tcattatgatccaccacgaaagcttatggccatgcagcggccaggtcctt
atgacagacctggggctggtagagggtataacagcattggcagaggagct
ggctttgagaggatgaggcgtggtgcttatggtggaggctatggaggcta
tgatgattacaatggctataatgatggctatggatttgggtcagatagat
ttggaagagacctcaattactgtttttcaggaatgtctgatcacagatac
ggggatggtggctctactttccagagcacaacaggacactgtgtacacat
gcggggattaccttacagagctactgagaatgacatttataatttttttt
caccgctcaaccctgtgagagtacacattgaaattggtcctgatggcaga
gtaactggtgaagcagatgtcgagttcgcaactcatgaagatgctgtggc
agctatgtcaaaagacaaagcaaatatgcaacacagatatgtagaactct
tcttgaattctacagcaggagcaagcggtggtgcttacgaacacagatat
gtagaactcttcttgaattctacagcaggagcaagcggtggtgcttatgg
tagccaaatgatgggaggcatgggcttgtcaaaccagtccagctacgggg
gcccagccagccagcagctgagtgggggttacggaggcggctacggtggc
cagagcagcatgagtggatacgaccaagttttacaggaaaactccagtga
ttttcaatcaaacattgcataggtaaccaaggagcagtgaacagcagcta
ctacagtagtggaagccgtgcatctatgggcgtgaacggaatgggagggt
tgtctagcatgtccagtatgagtggtggatggggaatgtaattgatcgat
cctgatcactgactcttggtcaacctttttttttttttttttttctttaa
gaaaacttcagtttaacagtttctgcaatacaagcttgtgatttatgctt
actctaagtggaaatcaggattgttatgaagacttaaggcccagtatttt
tgaatacaatactcatctaggatgtaacagtgaagctgagtaaactataa
ctgttaaacttaagttccagcttttctcaagttagttataggatgtactt
aagcagtaagcgtatttaggtaaaagcagttgaattatgttaaatgttgc
cctttgccacgttaaattgaacactgttttggatgcatgttgaaagacat
gcttttattttttttgtaaaacaatataggagctgtgtctactattaaaa
gtgaaacattttggcatgtttgttaattctagtttcatttaataacctgt
aaggcacgtaagtttaagctttttttttttttaagttaatgggaaaaatt
tgagacgcaataccaatacttaggattttggtcttggtgtttgtatgaaa
ttctgaggccttgatttaaatctttcattgtattgtgatttccttttagg
tatattgcgctaagtgaaacttgtcaaataaatcctccttttaaaaactg c:
[0076] RNA duplexes were synthesized and prepared as described in
Example 1. RNA duplexes targeting HNRPH1 are summarized in Table 3
below.
7TABLE 3 Summary of Oligonucleotide Reagents, HNRPH1 Site-1
Sequence Name SEQ ID No. 5' UGAACUUGAAUCAGAAGAUGAAGUCAAAUUGGC 3'
HNRPH1 Site-1 SEQ ID NO: 69 5' CUUGAAUCAGAAGAUGAAGUU HNRPH1-21 + 2
SEQ ID No. 51 3' UUGAACUUAGUCUUCUACUUC SEQ ID No. 52 5'
AACUUGAAUCAGAAGAUGAAGUCAAAU HNRPH1-27 + 0 SEQ ID No. 53 3'
UUGAACUUAGUCUUCUACUUCAGUUUA SEQ ID No. 54
[0077] HEK 293 cells were transfected with EGFP-specific siRNA (SEQ
ID No. 6/7) (negative control) and an HNRPH1 specific 21-mer siRNA
duplex (SEQ ID Nos. 51/52) at varying concentrations, or with an
HNRPH1 specific 27-mer siRNA duplex (SEQ ID Nos. 53/54) at varying
concentrations, as described previously. HNRPH1 expression was
assessed by Western Blot assay at 72 h post-transfection. Results
are shown in FIG. 5. As shown, only a slight decrease in HNRPH1
protein levels occurred after treatment with 20 nM of the 21-mer
siRNA (SEQ ID Nos 51/52) while significant inhibition was seen
using 1 nM of the 27-mer dsRNA (SEQ ID Nos 53/54) and almost
complete elimination of HNRPH1 protein was achieved using 5 nM of
the 27-mer RNA duplex. Improved reduction in gene expression by
RNAi methods is therefore also seen for human genes using the
method of the invention.
EXAMPLE 5
[0078] This example demonstrates a method for determining whether a
dsRNA serves as s substrate for Dicer.
[0079] In vitro Dicer assay. Recombinant human Dicer enzyme (Gene
Therapy Systems, San Diego, Calif.) was incubated with synthetic
duplex RNA oligonucleotides according to the manufacturer's
instructions. Briefly, 2 units of Dicer was incubated in a buffer
supplied by the manufacturer with 250 pmoles of RNA duplex in a 50
.mu.l volume (5 .mu.M RNA concentration) for 18 h at 37.degree. C.
Half of each reaction was separated on non-denaturing PAGE (10%
acrylamide) and visualized using ethidium bromide staining with UV
excitation.
[0080] Results. RNA duplexes tested included 21-mer (SEQ ID
No.6/7), 25-mer (SEQ ID No. 18/19), 26-mer (SEQ ID No. 24/25),
27-mer (SEQ ID No. 30/31), and 29-mer (SEQ ID No. 40/41). The
duplexes were subjected to Dicer digestion in vitro and visualized
by PAGE. Results are shown in FIG. 6. As shown, the 21-mer RNA
duplex did not react with Dicer. The 25-mer, 26-mer, 27-mer, and
29-mer duplexes all reacted with Dicer and were digested to a
21-mer size product, predominantly.
[0081] This example shows that the longer RNA duplexes used in the
method of the invention are substrates for the Dicer
endoribonuclease.
EXAMPLE 6
[0082] This example demonstrates that 27-mer duplexes have more
RNAi activity than any of the shorter 21 -mer duplexes that they
encompass.
[0083] Theoretically, a variety of short 21-mer siRNAs could result
from the action of Dicer on longer duplex RNAs. For example, based
upon the antisense strand, 7 different 21 -mer species could result
from degradation of a 27-mer sequence. It is possible that one of
these 21 -mers (or a combination of 21-mers) accounts for the
activity observed with the previously tested 27-mer dsRNA. This
example shows that no single 21-mer duplex or mixture of 21-mers
resulting from degradation of a 27-mer sequence functions as
effectively as its parent 27-mer duplex at reducing EGFP
expression.
[0084] Nucleic Acid Reagents. RNA duplexes were prepared as
described in Example 1. The sequences of a set of 21-mer RNA
duplexes from within EGFP Site-1 were prepared. The duplexes are
listed below in Table 4. The 21-mer duplexes are aligned beneath
the parent 27-mer to illustrate their relative positioning. The
27-mer blunt duplex (SEQ ID No. 28/29) and the 21-mer duplex
21+2(7) (SEQ ID No. 6/7) are shown in Example 2 (Table 1) and were
also used.
8TABLE 4 Summary of Oligonucleotide Reagents, EGFP Site-1, Tiled
Set Sequence Name SEQ ID No. 5'
GCAAGCUGACCCUGAGUUCAUCUGCACCACCGGCAAGC 3' EGFP Site-1 SEQ ID NO:67
5' AAGCUGACCCUGAAGUUCAUCUGCACC EGFPS1-27 + 0 SEQ ID No. 28 3'
UUCGACUGGGACUUCAAGUAGACGUGG SEQ ID No. 29 5' CCUGAAGUUCAUCUGCACCAC
EGFPS1-21 + 2 (1) SEQ ID No. 55 3' UGGGACUUCAAGUAGACGUGG SEQ ID No.
56 5' CCCUGAAGUUCAUCUGCACCA EGFPS1-21 + 2 (2) SEQ ID No. 57 3'
CUGGGACUUCAAGUAGACGUG SEQ ID No. 58 5' ACCCUGAAGUUCAUCUGCACC
EGFPS1-21 + 2 (3) SEQ ID No. 59 3' ACUGGGACUUCAAGUAGACGU SEQ ID No.
60 5' GACCCUGAAGUUCAUCUGCAC EGFPS1-21 + 2 (4) SEQ ID No. 61 3'
GACUGGGACUUCAAGUAGACG SEQ ID No. 62 5' UGACCCUGAAGUUCAUCUGCA
EGFPS1-21 + 2 (5) SEQ ID No. 63 3' CGACUGGGACUUCAAGUAGAC SEQ ID No.
64 5' CUGACCCUGAAGUUCAUCUGC EGFPS1-21 + 2 (6) SEQ ID No. 65 3'
UCGACUGGGACUUCAAGUAGA SEQ ID No. 66 5' GCUGACCCUGAAGUUCAUCUG
EGFPS1-21 + 2 (7) SEQ ID No. 6 3' UUCGACUGGGACUUCAAGUAG SEQ ID No.
7
[0085] The each of the 21-mer duplexesfrom Table 4 was transfected
individually or together as a pool into HEK 293 cells with 200 ng
of EGFP reporter plasmid as described previously. The result from
each transfection was compared with the 27-mer duplex (SEQ ID
No.28/29). The relative EGFP expression from each experiment is
shown in FIG. 7. At concentrations of 50 or 200 pM, none of the
individual 21-mer duplexes or the pooled set of 7 21-mer duplexes
showed activity comparable with the 27-mer duplex. For pools, 50 pM
and 200 pM represent the total concentration of all RNAs
transfected together, rather than for individual duplexes. FIG. 7
shows that the potency of the 27-mer duplex was much higher than
for any of the shorter 21 -mer sequences, which included every
possible 21-mer duplex that could result from degradation of the
parent 27-mer.
[0086] The activity of "diced" products made from digestion of the
27-mer duplex with recombinant Dicer enzyme in vitro was compared
with the parent 27-mer compound in RNAi assays. The 27-mer duplex
(SEQ ID No. 28/29) was degraded using Dicer as described in Example
5 above and fragments ("diced" products) were diluted and directly
used in transfection experiments. EGFP expression levels were
measured following transfection of HEK 293 cells with 200 ng EGFP
reporter plasmid with a 21-mer duplex (SEQ ID No. 6/7), a 27-mer
duplex (SEQ ID No. 28/29), products of in vitro Dicer degradation
("diced" products), a mutant 27-mer with 4 base central mismatch
(SEQ ID No. 36/37), and the pooled set of 7 21-mer duplexes (SEQ ID
Nos. 6/7 and 55/56, 57/58, 59/60, 61/62, 63/64, 65/66). Results are
shown in FIG. 8. Again, the 27-mer duplex was the most potent
reagent in reducing EGFP expression. The "diced" products were more
effective than the set of pooled 21 -mer duplexes. One explanation
for this result is that the in vitro dicing reaction was incomplete
and some intact 27-mer remains even after 18 h incubation (residual
27-mer is seen in FIG. 6).
[0087] This example provides another demonstration that the
improved potency of dsRNA 27-mers is not derived from a highly
active individual or a pooled set of short 21 -mer duplexes.
EXAMPLE 7
[0088] This example demonstrates that gene suppression using the
27-mer duplexes of the invention last twice as long as suppression
achieved using 21-mer duplexes.
[0089] Suppression of gene expression using synthetic siRNA
typically has a duration of 3-4 days in tissue culture (Chiu and
Rana, 2002, Mol. Cell, 10:549-561). Methods that increase the
duration of the RNAi effect would improve the functional utility of
RNAi as an experimental tool in tissue culture and would be
beneficial for use of RNAi in vivo.
[0090] NIH 3T3 cells were transfected with 5 nM of either the
21-mer duplex (SEQ ID No. 6/7) or the 27-mer duplex (SEQ ID No.
30/31). Cell extracts were prepared and measured for EGFP protein
expression in a cuvette fluorometer (as described in Example 2
above) at 2, 4, 6, 8, and 10 days post-transfection. Results are
shown in FIG. 9. In addition, images of cells that were transfected
in parallel using 1 nM siRNAs were obtained using fluorescence
microscopy (as described in Example 2) and the images are shown in
FIG. 10. EGFP expression was suppressed to about 70% of control
levels at day 4 but returned to about 80% of control levels at day
6 and was at control levels at day 8. In contrast, suppression
using the 27-mer duplex was about 90% or more at day 8 and was
still at about 70% on day 10.
[0091] The 27-mer duplexes used in the present example demonstrates
suppression of gene expression for at least twice the duration seen
using 21 -mer duplexes.
EXAMPLE 8
[0092] This example demonstrates that the dsRNA duplexes of the
invention do not activate the interferon response.
[0093] Historically, long double stranded RNA was considered to be
ineffective as an agent for reducing gene expression in mammalian
cells because it tends to activate interferon pathway responses and
lead to a variety of metabolic disturbances in cells which are not
sequence specific. Short 21-mer siRNAs were considered useful for
RNA I experiments because, in addition to suppressing gene
expression, they avoid interferon activation. Because the more
active double stranded RNAs of this invention are longer than known
siRNA duplexes, they were examined further to show that they do not
activate interferon. Duplexes of up to about 30-mer lengths were
tested.
[0094] Interferon and PKR assays. HEK 293 cells were transfected
with 20 nM T7 ssRNA (Kim et al., 2004, Nat. Biotechnol.,
22:321-325), 21-mer RNA duplex (SEQ ID No. 6/7), or 27-mer RNA
duplex (SEQ ID No. 30/31) as described in Example 2 above. Culture
medium was collected at 24 h and subjected to interferon alpha and
beta ELISA assays (Research Diagnostics, Inc., Flanders, N.J.)
according to the manufacturer's instructions, as previously
described (Kim et al., 2004, Nat. Biotechnol., 22:321-325).
[0095] Human double-stranded RNA (dsRNA)-dependent protein kinase
(PKR) was assayed using the PKR activation assay (Gunnery et al.,
1998, Methods, 15:189-98) in HEK 293 cell extracts. HEK 293 cells
were transfected as described in Example 2 with 20 nM of each RNA
and extracts were prepared 18 h post-transfection.
[0096] Results. HEK 293 cells were transfected with ssRNA, 21-mer
duplex, 27-mer duplex, or no RNA (negative control, mock
transfection) as described above. As shown in FIG. 11, high levels
of interferon alpha (FIG. 11A) and interferon beta (FIG. 11B) were
detected after transfection with ssRNA however no interferon was
detected when 21 -mer or 27-mer RNAs were transfected.
[0097] HEK 293 cells were transfected with 400 bp EGFP dsRNA (at 20
nM), or 20 nM of chemically synthesized short RNA duplexes
including 21+2 (SEQ ID No. 6/7), 25+2 (SEQ ID No. 18/19), 25-2 (SEQ
ID No. 16/17), 27+2 (SEQ ID No. 34/35), and 27-2 (SEQ ID No.
32/33). Results of the PKR activation assay are shown in FIG. 12.
The long dsRNA resulted in strong PKR activation (positive control)
while all of the short synthetic RNAs showed no evidence for PKR
activation.
[0098] We conclude that the longer synthetic RNAs used in the
invention for improved RNAi mediated suppression of gene expression
do not activate interferon responses and therefore should be usable
in a wide variety of mammalian systems.
EXAMPLE 9
[0099] This example demonstrates a method for determining an
effective dose of the dsRNA of the invention in a mammal. A
therapeutically effective amount of a composition containing a
sequence that encodes a dsRNA, (i.e., an effective dosage), is an
amount that inhibits expression of the product of the target gene
by at least 10 percent. Higher percentages of inhibition, e.g., 20,
50, 90 95, 99 percent or higher may be preferred in certain
circumstances. Exemplary doses include milligram or microgram
amounts of the molecule per kilogram of subject or sample weight
(e.g., about 1 microgram per kilogram to about 5 milligrams per
kilogram, about 100 micrograms per kilogram to about 0.5 milligrams
per kilogram, or about 1 microgram per kilogram to about 50
micrograms per kilogram). The compositions can be administered one
or more times per week for between about 1 to 10 weeks, e.g.,
between 2 to 8 weeks, or between about 3 to 7 weeks, or for about
4, 5, or 6 weeks, as deemed necessary by the attending physician.
Treatment of a subject with a therapeutically effective amount of a
composition can include a single treatment or a series of
treatments.
[0100] Appropriate doses of a particular dsRNA composition depend
upon the potency of the molecule with respect to the expression or
activity to be modulated. One or more of these molecules can be
administered to an animal, particularly a mammal, and especially
humans, to modulate expression or activity of one or more target
genes. A physician may, for example, prescribe a relatively low
dose at first, subsequently increasing the dose until an
appropriate response is obtained. In addition, it is understood
that the specific dose level for any particular subject will depend
upon a variety of other factors including the severity of the
disease, previous treatment regimen, other diseases present,
off-target effects of the active agent, age, body weight, general
health, gender, and diet of the patient, the time of
administration, the route of administration, the rate of excretion,
any drug combination, and the degree of expression or activity to
be modulated.
[0101] The efficacy of treatment can be monitored by measuring the
amount of the target gene mRNA (e.g. using real time .PCR) or the
amount of product encoded by the target gene such as by Western
blot analysis. In addition, the attending physician can monitor the
symptoms associated with the disease or disorder afflicting the
patient and compare with those symptoms recorded prior to the
initiation of treatment
[0102] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0103] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0104] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
REFERENCES
[0105] Amarzguioui et al., Tolerance for Mutation and Chemical
Modifications in a siRNA, Nucleic Acids Research, 2003, Vol. 31,
No. 2, 589-595.
[0106] Bernstein, E., Caudy, A. A., Hammond, S. M., and Hannon, G.
J. (2001) Role for a bidentate ribonuclease in the initiation step
of RNA interference. Nature, 409:363-366.
[0107] Braasch et al., RNA Interference in Mammalian Cells by
Chemically-Modified RNA, Biochemistry, 2003, 42, 7967-7975.
[0108] Bridge et al., Induction of an Interferon Response by RNAi
Vectors in Mammalian Cells, Nature Genetics, 2003, Vol. 34, No. 3,
263-264.
[0109] Caplen, N. J., Parrish, S., Imani, F., Fire, A., and Morgan,
R. A. (2001) Specific inhibition of gene expression by small
double-stranded RNAs in invertebrate and vertebrate systems. Proc.
Natl. Acad. Sci. USA, 98:9742-9747.
[0110] Chang et al., Gene Expression from Both Intronless and
Intron-Containing Rous Sarcoma Virus Clones is Specifically
Inhibited by Anti-Sense RNA, Molecular and Cellular Biology, 1985,
Vol. 5, No. 9, 2341-2348.
[0111] Check, RNA to the Rescue?, Nature, 2003, 425, 10-12.
[0112] CHIU et al., siRNA Function in RNAi: A Chemical Modification
Analysis, RNA, 2003, 9:1034-1048.
[0113] Chiu, Y. L., and Rana, T. R. (2002) RNAi in human cells:
basic structural and functional features of small interfering RNA.
Mol. Cell, 10:549-561.
[0114] Czauderna et al., Structural Variations and Stabilising
Modifications of Synthetic siRNAs in Mammalian Cells, Nucleic Acids
Research, 2003, Vol. 31, No. 11, 2705-2716.
[0115] Damha, M. J., and Ogilvie, K. K. (1993) Oligoribonucleotide
synthesis. The silyl-phosphoramidite method. Methods Mol. Biol.
20:81-114.
[0116] Donbrow (Ed.) Microcapsules and nanoparticles in medicine
and pharmacy. CRC Press, Boca Raton, Fla., pp. 125-14.
[0117] Elbashir et al., Functional Anatomy of siRNAs for Mediating
Efficient RNAi in Drosophila melanogaster Embryo Lysate, EMBO
Journal, 2001, Vol. 20, No. 33, 6877-6888.
[0118] Elbashir et al., RNA Interference is Mediated by 21- and
22-Nucleotide RNAs, Genes & Development, 2001, 15:188-200.
[0119] Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A.,
Weber, K., and Tuschl, T. (2001) Duplexes of 21-nucleotide RNAs
mediate RNA interference in cultured mammalian cells. Nature,
411:494-498.
[0120] Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001) RNA
interference is mediated by 21- and 22-nucleotide RNAs. Genes &
Dev., 15:188-200.
[0121] Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver,
S. E., and Mellow, C. C. (1998) Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans.
Nature. 391:806-811.
[0122] Graessmann, M., Michaels, G., Berg, B., and Graessmann, A.
(1991) Inhibition of SV40 gene expression by microinjected small
antisense RNA and DNA molecules. Nucleic Acids Res. 19:53-59.
[0123] Gunnery, S., and Mathews, M. B. (1998) RNA binding and
modulation of PKR activity. Methods, 15:189-98.
[0124] Hamada et al., Effects on RNA Interference in Gene
Expression (RNAi) in Cultured Mammalian Cells of Mismatches and the
Introduction of Chemical Modifications at the 3'-Ends of siRNAs,
Antisense and Nucleic Acid Drug Development, 2002, 12:301-309
[0125] Hannon, RNA Interference, Nature, 2002, 418, 244-251.
[0126] Harborth, J., Elbashir, S. M., Vandenburgh, K., Manninga,
H., Scaringe, S. A., Weber, K., and Tuschl, T. (2003) Sequence,
chemical, and structural variation of small interfering RNAs and
short hairpin RNAs and the effect on mammalian gene silencing.
Antisense Nucleic Acid Drug Dev., 13:83-105.
[0127] Hohjoh, J. (2002) RNA interference (RNAi) induction with
various types of synthetic oligonucleotide duplexes in cultured
human cells. FEBS Lett., 521:195-199.
[0128] Holen, T., Amarzguioui, M., Wilger, M. T., Babaie, E., and
Prydz, H. (2002) Positional effects of short interfering RNAs
targeting the human coagulation trigger tissue factor. Nucleic
Acids Res., 30:1757-1766.
[0129] Ji, J., Wemli, M., Klimkait, T., and Erb, P. (2003) Enhanced
gene silencing by the application of multiple specific small
interfering RNAs. FEBS Lett., 552:247-252.
[0130] Khvorova, A., Reynolds, A., and Jayasena, S. D. (2003)
Functional siRNAs and miRNAs exhibit strand bias. Cell,
115:209-216.
[0131] Kim, D. H., and Rossi, J. J. (2003) Coupling of
RNAi-mediated target downregulation with gene replacement.
Antisense Nucleic Acid Drug Dev., 13:151-155.
[0132] Kim, D. H., Longo, M., Han, Y., Lundberg, P., Cantin, E.,
and Rossi, J. J. (2004) Interferon induction by siRNAs and ssRNAs
synthesized by phage polymerase. Nat. Biotechnol., 22:321-325.
[0133] Kretshmer-Kazemi Far et al., The Activity of siRNA in
Mammalian Cells is Related to Structural Target Accessibility: A
Comparison with Antisense Oligonucleotides, Nucleic Acids Research,
2003, Vol. 31, No. 15, 4417-4424.
[0134] Liu et al., R2D2, a Bridge Between the Initiator and
Effector Steps of the Drosophila RNAi Pathway, Science, 2003, Vol.
301, 1921-1925.
[0135] Manche, L., Green, S. R., Schmedt, C., and Mathews, M. B.
(1992) Interactions between double-stranded RNA regulators and the
protein kinase DAI. Mol. Cell. Biol. 12:5238-5248.
[0136] Markovtsov, V., Nikolic, J. M., Goldman, J. A., Turck, C.
W., Chou, M. Y., and Black, D. L. (2000) Cooperative assembly of an
hnRNP complex induced by a tissue specific homolog of
polypyrimidine tract binding protein. Mol. Cell Biol.,
20:7463-79.
[0137] Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R.,
and Tuschl, T. (2002) Single-stranded antisense siRNAs guide target
RNA cleavage in RNAi. Cell, 110:563-574.
[0138] McManus et al., Gene Silencing in Mammals by Small
Interfering RNAs, Nature Reviews Genetics, 2002, Vol. 3,
737-747.
[0139] Melton, D. A. (1985) Injected anti-sense RNAs specifically
block messenger RNA translation in vivo. Proc. Natl. Acad. Sci.
USA. 82:144-148.
[0140] Minks, M. A., West, D. K., Benvin, S., and Baglioni, C.
(1979) Structural requirements of double-stranded RNA for the
activation of the 2'-5'-oligo(A) polymerase and protein kinase of
interferon-treated HeLa cells. J. Biol. Chem. 254:10180-10183.
[0141] Napoli, C., Lemieux, C., and Jorgensen, R. (1990)
Introduction of a chimeric chalcone synthase gene into petunia
results in reversible co-suppression of homologous genes in trans.
Plant Cell. 2:279-289.
[0142] Ngo et al., Double-Stranded RNA Induces mRNA Degradation in
Trypanosoma brucei, Proceedings of the National Academy of Sciences
of the United States of America, 1998, Vol. 95, 14687-14692.
[0143] Parrish, S., Fleenor, J., Xu, S., Mello, C., and Fire, A.
(2000) Functional anatomy of a dsRNA trigger: differential
requirements for the two trigger strands in RNA interference. Mol.
Cell, 6:1077-1087.
[0144] Pellino et al., R2D2 Leads the Silencing Trigger to mRNA's
Death Star, Cell, 2003, 115:132-133.
[0145] Reynolds et al., Rational siRNA Design for RNA Interference,
Nature Biotechnology, 2004, 22, 1-5.
[0146] Reynolds, A., Leake, D., Boese, Q., Scaringe, S., Marshall,
W. S., and Khvorova, A. (2004) Rational siRNA design for RNA
interference. Nat. Biotechnol. 22:326-330.
[0147] Romano, N., and Macino, G. (1992) Quelling: transient
inactivation of gene expression in Neurospora crassa by
transformation with homologous sequences. Mol Microbiol.
6:3343-53.
[0148] Rossi, presentation at Integrated DNA Technologies,
2003.
[0149] Scherer et al., Approaches for the Sequence-Specific
Knockdown of mRNA, Nature Biotechnology, 2003, Vol. 21, No. 12,
1457-1465.
[0150] Schwarz, D. S., Hutvagner, G., Du, T., Xu, Z., Aronin, N.,
and Zamore, P. D. (2003) Asymmetry in the assembly of the RNAi
enzyme complex. Cell, 115:199-208.
[0151] Skipper, Elegant Tour de Force, Nature Reviews Genetics,
2003, Vol. 4, 79-80.
[0152] Sledz et al., Activation of the Interferon System by
Short-Interfering RNAs, Nature Cell Biology, 2003, Vol. 5, No. 9,
834-839.
[0153] Stark, G. R., Kerr, I. M., Williams, B. R., Silverman, R.
H., and Schreiber, R. D. (1998) How cells respond to interferons.
Annu. Rev. Biochem. 67:227-264.
[0154] Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D. P., and
Sharp, P. A. (1999) Targeted mRNA degradation by double-stranded
RNA in vitro. Genes & Dev., 13:3191-3197.
[0155] Ui-Tei, K., Naito, Y., Takahashi, F., Haraguchi, T.,
Ohki-Hamazaki, H., Juni, A., Ueda, R., and Saigo, K. (2004)
Guidelines for the selection of highly effective siRNA sequences
for mammalian and chick RNA interference. Nucleic Acids Res.,
32:936-948.
[0156] Waterhouse et al., Exploring Plant Genomes by RNA-Induced
Gene Silencing, Nature Reviews Genetics, 2003, Vol. 4, 29-38.
[0157] Wincott, F., DiRenzo, A., Shaffer, C., Grimm, S., Tracz, D.,
Workman, C., Sweedler, D., Gonzalez, C., Scaringe, S., and Usman,
N. (1995) Synthesis, deprotection, analysis and purification of RNA
and ribozymes. Nucleic Acids Res., 23:2677-84.
[0158] Xu et al., Effective Small Interfering RNAs and
Phosphorothioate Antisense DNAs Have Different Preferences for
Target Sites in the Luciferase mRNAs, Biochemical and Biophysical
Research Communications, 2003, 306, 712-717.
[0159] Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P.
(2000) RNAi: double-stranded RNA directs the ATP-dependent cleavage
of MRNA at 21 to 23 nucleotide intervals. Cell, 101:25-33.
Sequence CWU 1
1
75 1 720 DNA Artificial EGFP from cloning vector pEGFP-C1 1
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac
60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga
tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc
tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag
tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc
cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg
acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac
420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa
gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg
acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc
gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc
cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt
tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 2 21 RNA
Artificial siRNA 2 gcaagcugac ccugaaguuc a 21 3 21 RNA Artificial
siRNA 3 gaugaacuuc agggucagcu u 21 4 21 RNA Artificial siRNA 4
aagcugaccc ugaaguucau c 21 5 21 RNA Artificial siRNA 5 gaugaacuuc
agggucagcu u 21 6 21 RNA Artificial siRNA 6 gcugacccug aaguucaucu g
21 7 21 RNA Artificial siRNA 7 gaugaacuuc agggucagcu u 21 8 23 RNA
Artificial siRNA 8 gcaagcugac ccugaaguuc auu 23 9 23 RNA Artificial
siRNA 9 cagaugaacu ucagggucag cuu 23 10 24 RNA Artificial siRNA 10
gcugacccug aaguucaucu gcuu 24 11 24 RNA Artificial siRNA 11
gcagaugaac uucaggguca gcuu 24 12 24 RNA Artificial siRNA 12
gcaagcugac ccugaaguuc auuu 24 13 24 RNA Artificial siRNA 13
gcagaugaac uucaggguca gcuu 24 14 24 RNA Artificial siRNA 14
gcugacccug aaguucaucu gcuu 24 15 24 RNA Artificial siRNA 15
gcagaugaac uucaggguca gcuu 24 16 25 RNA Artificial siRNA 16
gcaagcugac ccugaaguuc aucuu 25 17 25 RNA Artificial siRNA 17
ugcagaugaa cuucaggguc agcuu 25 18 25 RNA Artificial siRNA 18
gcugacccug aaguucaucu gcauu 25 19 25 RNA Artificial siRNA 19
ugcagaugaa cuucaggguc agcuu 25 20 26 RNA Artificial siRNA 20
aagcugaccc ugaaguucau cugcac 26 21 26 RNA Artificial siRNA 21
gugcagauga acuucagggu cagcuu 26 22 26 RNA Artificial siRNA 22
aagcugaccc ugaaguucau cugcuu 26 23 26 RNA Artificial siRNA 23
gugcagauga acuucagggu cagcuu 26 24 26 RNA Artificial siRNA 24
gcaagcugac ccugaaguuc aucuuu 26 25 26 RNA Artificial siRNA 25
gugcagauga acuucagggu cagcuu 26 26 26 RNA Artificial siRNA 26
gcugacccug aaguucaucu gcacuu 26 27 26 RNA Artificial siRNA 27
gugcagauga acuucagggu cagcuu 26 28 27 RNA Artificial siRNA 28
aagcugaccc ugaaguucau cugcacc 27 29 27 RNA Artificial siRNA 29
ggugcagaug aacuucaggg ucagcuu 27 30 27 RNA Artificial siRNA 30
aagcugaccc ugaaguucau cugcauu 27 31 27 RNA Artificial siRNA 31
ggugcagaug aacuucaggg ucagcuu 27 32 27 RNA Artificial siRNA 32
gcugacccug aaguucaucu gcacauu 27 33 27 RNA Artificial siRNA 33
ggugcagaug aacuucaggg ucagcuu 27 34 27 RNA Artificial siRNA 34
gcugacccug aaguucaucu gcacauu 27 35 27 RNA Artificial siRNA 35
ggugcagaug aacuucaggg ucagcuu 27 36 27 RNA Artificial siRNA 36
aagcugaccc uguucaucau cugcacc 27 37 27 RNA Artificial siRNA 37
ggugcagaug augaacaggg ucagcuu 27 38 28 RNA Artificial siRNA 38
aagcugaccc ugaaguucau cugcacca 28 39 28 RNA Artificial siRNA 39
uggugcagau gaacuucagg gucagcuu 28 40 29 RNA Artificial siRNA 40
aagcugaccc ugaaguucau cugcaccac 29 41 29 RNA Artificial siRNA 41
guggugcaga ugaacuucag ggucagcuu 29 42 30 RNA Artificial siRNA 42
aagcugaccc ugaaguucau cugcaccacc 30 43 30 RNA Artificial siRNA 43
gguggugcag augaacuuca gggucagcuu 30 44 21 RNA Artificial siRNA 44
gcagcacgac uucuucaagu u 21 45 21 RNA Artificial siRNA 45 cuugaagaag
ucgugcugcu u 21 46 27 RNA Artificial siRNA 46 aagcagcacg acuucuucaa
guccgcc 27 47 27 RNA Artificial siRNA 47 ggcggacuug aagaagucgu
gcugcuu 27 48 27 RNA Artificial siRNA 48 aagcagcacg acuucuucaa
guccggg 27 49 27 RNA Artificial siRNA 49 ggcggacuug aagaagucgu
gcugcuu 27 50 2201 DNA Homo sapiens 50 tttttttttt cgtcttagcc
acgcagaagt cgcgtgtcta gtttgtttcg acgccggacc 60 gcgtaagaga
cgatgatgtt gggcacggaa ggtggagagg gattcgtggt gaaggtccgg 120
ggcttgccct ggtcttgctc ggccgatgaa gtgcagaggt ttttttctga ctgcaaaatt
180 caaaatgggg ctcaaggtat tcgtttcatc tacaccagag aaggcagacc
aagtggcgag 240 gcttttgttg aacttgaatc agaagatgaa gtcaaattgg
ccctgaaaaa agacagagaa 300 actatgggac acagatatgt tgaagtattc
aagtcaaaca acgttgaaat ggattgggtg 360 ttgaagcata ctggtccaaa
tagtcctgac acggccaatg atggctttgt acggcttaga 420 ggacttccct
ttggatgtag caaggaagaa attgttcagt tcttctcagg gttggaaatc 480
gtgccaaatg ggataacatt gccggtggac ttccagggga ggagtacggg ggaggccttc
540 gtgcagtttg cttcacagga aatagctgaa aaggctctaa agaaacacaa
ggaaagaata 600 gggcacaggt atattgaaat ctttaagagc agtagagctg
aagttagaac tcattatgat 660 ccaccacgaa agcttatggc catgcagcgg
ccaggtcctt atgacagacc tggggctggt 720 agagggtata acagcattgg
cagaggagct ggctttgaga ggatgaggcg tggtgcttat 780 ggtggaggct
atggaggcta tgatgattac aatggctata atgatggcta tggatttggg 840
tcagatagat ttggaagaga cctcaattac tgtttttcag gaatgtctga tcacagatac
900 ggggatggtg gctctacttt ccagagcaca acaggacact gtgtacacat
gcggggatta 960 ccttacagag ctactgagaa tgacatttat aatttttttt
caccgctcaa ccctgtgaga 1020 gtacacattg aaattggtcc tgatggcaga
gtaactggtg aagcagatgt cgagttcgca 1080 actcatgaag atgctgtggc
agctatgtca aaagacaaag caaatatgca acacagatat 1140 gtagaactct
tcttgaattc tacagcagga gcaagcggtg gtgcttacga acacagatat 1200
gtagaactct tcttgaattc tacagcagga gcaagcggtg gtgcttatgg tagccaaatg
1260 atgggaggca tgggcttgtc aaaccagtcc agctacgggg gcccagccag
ccagcagctg 1320 agtgggggtt acggaggcgg ctacggtggc cagagcagca
tgagtggata cgaccaagtt 1380 ttacaggaaa actccagtga ttttcaatca
aacattgcat aggtaaccaa ggagcagtga 1440 acagcagcta ctacagtagt
ggaagccgtg catctatggg cgtgaacgga atgggagggt 1500 tgtctagcat
gtccagtatg agtggtggat ggggaatgta attgatcgat cctgatcact 1560
gactcttggt caaccttttt tttttttttt ttttctttaa gaaaacttca gtttaacagt
1620 ttctgcaata caagcttgtg atttatgctt actctaagtg gaaatcagga
ttgttatgaa 1680 gacttaaggc ccagtatttt tgaatacaat actcatctag
gatgtaacag tgaagctgag 1740 taaactataa ctgttaaact taagttccag
cttttctcaa gttagttata ggatgtactt 1800 aagcagtaag cgtatttagg
taaaagcagt tgaattatgt taaatgttgc cctttgccac 1860 gttaaattga
acactgtttt ggatgcatgt tgaaagacat gcttttattt tttttgtaaa 1920
acaatatagg agctgtgtct actattaaaa gtgaaacatt ttggcatgtt tgttaattct
1980 agtttcattt aataacctgt aaggcacgta agtttaagct tttttttttt
ttaagttaat 2040 gggaaaaatt tgagacgcaa taccaatact taggattttg
gtcttggtgt ttgtatgaaa 2100 ttctgaggcc ttgatttaaa tctttcattg
tattgtgatt tccttttagg tatattgcgc 2160 taagtgaaac ttgtcaaata
aatcctcctt ttaaaaactg c 2201 51 21 RNA Artificial siRNA 51
cuugaaucag aagaugaagu u 21 52 21 RNA Artificial siRNA 52 cuucaucuuc
ugauucaagu u 21 53 27 RNA Artificial siRNA 53 aacuugaauc agaagaugaa
gucaaau 27 54 27 RNA Artificial siRNA 54 auuugacuuc aucuucugau
ucaaguu 27 55 21 RNA Artificial siRNA 55 ccugaaguuc aucugcacca c 21
56 21 RNA Artificial siRNA 56 ggugcagaug aacuucaggg u 21 57 21 RNA
Artificial siRNA 57 cccugaaguu caucugcacc a 21 58 21 RNA Artificial
siRNA 58 gugcagauga acuucagggu c 21 59 21 RNA Artificial siRNA 59
acccugaagu ucaucugcac c 21 60 21 RNA Artificial siRNA 60 ugcagaugaa
cuucaggguc a 21 61 21 RNA Artificial siRNA 61 gacccugaag uucaucugca
c 21 62 21 RNA Artificial siRNA 62 gcagaugaac uucaggguca g 21 63 21
RNA Artificial siRNA 63 ugacccugaa guucaucugc a 21 64 21 RNA
Artificial siRNA 64 cagaugaacu ucagggucag c 21 65 21 RNA Artificial
siRNA 65 cugacccuga aguucaucug c 21 66 21 RNA Artificial siRNA 66
agaugaacuu cagggucagc u 21 67 39 RNA Artificial mRNA from EGFP from
cloning vector pEGFP-C1 67 gcaagcugac ccugaaguuc aucugcacca
ccggcaagc 39 68 32 RNA Artificial mRNA of EGFP from cloning vector
68 ugaagcagca cgacuucuuc aaguccgcca ug 32 69 33 RNA Homo sapiens 69
ugaacuugaa ucagaagaug aagucaaauu ggc 33 70 27 RNA Artificial siRNA
70 aagcugaccc ugaagaucau cugcauu 27 71 27 RNA Artificial siRNA 71
ggugcagaug aucuucaggg ucagcuu 27 72 27 RNA Artificial siRNA 72
aagcugaccc ugaagaacau cugcauu 27 73 27 RNA Artificial siRNA 73
ggugcagaug uucuucaggg ucagcuu 27 74 27 RNA Artificial siRNA 74
aagcugaccc ugaacaacau cugcauu 27 75 27 RNA Artificial siRNA 75
ggugcagaug uuguucaggg ucagcuu 27
* * * * *