U.S. patent application number 10/866525 was filed with the patent office on 2005-12-15 for crude biological derivatives competent for nucleic acid detection.
This patent application is currently assigned to Ambion, Inc.. Invention is credited to Fang, Xingwang, Pasloske, Brittan L..
Application Number | 20050277121 10/866525 |
Document ID | / |
Family ID | 34972511 |
Filed Date | 2005-12-15 |
United States Patent
Application |
20050277121 |
Kind Code |
A1 |
Pasloske, Brittan L. ; et
al. |
December 15, 2005 |
Crude biological derivatives competent for nucleic acid
detection
Abstract
The invention relates generally to the fields of making
biological unit lysates or admixtures of body fluids and of RNA
analysis. More specifically, it relates to direct methods for the
detection of a specific sequence of RNA in a biological unit, for
example a virus, cell or tissue sample, or a body fluid, for
example saliva, sputum, blood plasma, etc. More generally, the
invention may be used to enzymatically manipulate and protect the
RNA in lysate or bodily fluids for a number of applications.
Inventors: |
Pasloske, Brittan L.;
(Austin, TX) ; Fang, Xingwang; (Austin,
TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Assignee: |
Ambion, Inc.
|
Family ID: |
34972511 |
Appl. No.: |
10/866525 |
Filed: |
June 11, 2004 |
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12N 15/1096 20130101;
C12Q 1/6806 20130101; C12Q 2527/119 20130101; C12Q 2521/119
20130101; C12Q 2521/107 20130101; C12Q 1/6806 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Goverment Interests
[0001] The government may own rights in the present invention
pursuant to grant number R44 HL69718 from National Institutes of
Health National Heart, Lung, and Blood Institute.
Claims
What is claimed is:
1. A method comprising: obtaining at least one biological unit
containing RNA or sample comprising RNA not comprised in a
biological unit; obtaining a low pH buffer; mixing the biological
unit and the buffer to prepare a low pH lysate or mixing the sample
and the buffer to prepare a low pH admixture; and mixing at least a
portion of the lysate or admixture with a composition comprising
enzyme using RNA as a substrate to form a reaction mixture.
2. The method of claim 1, wherein the low pH lysate or admixture
has a pH of from 0 to 6.
3. The method of claim 2, wherein the low pH lysate or admixture
has a pH of less than 5.
4. The method of claim 1, wherein the enzyme is comprised in a
buffer that adjusts the pH of the reaction mixture to a level
suitable for enzyme function upon mixing.
5. The method of claim 4, wherein the pH of the reaction mixture is
between 7.0 and 9.5.
6. The method of claim 1, wherein the buffer comprised a
strong-weak acid.
7. The method of claim 6, wherein the acid has a pKa of 1-4.
8. The method of claim 7, wherein the strong-weak acid is arginine,
glycine, or chloroacetic acid.
9. The method of claim 6, wherein the buffer further comprises a
detergent.
10. The method of claim 9, wherein the detergent is a non-ionic
detergent.
11. The method of claim 9, wherein the detergent is an anionic
detergent or cationic detergent.
12. The method of claim 1, further defined as comprising mixing RNA
from the lysate or admixture with a composition comprising reverse
transcriptase to form a reverse transcriptase reaction mixture and
incubating the reaction mixture under conditions resulting in a
reverse transcription reaction.
13. The method of claim 12, wherein the reverse transcriptase is
comprised in a reverse transcriptase buffer that adjusts the pH of
the reaction mixture to a level suitable for reverse transcriptase
function upon mixing.
14. The method of claim 13, wherein the pH of the reaction mixture
is between 7.0 and 9.5.
15. The method of claim 14, wherein the pH of the reaction mixture
is between 8.0 and 8.4.
16. The method of claim 12, wherein the lysate or admixture is not
incubated with a proteinase K, pepsin, another protease, or DNase
prior to mixing at least a portion of the lysate or admixture with
the composition comprising reverse transcriptase.
17. The method of claim 12, wherein the lysate or admixture is not
incubated with pepsin prior to mixing at least a portion of the
lysate or admixture with the composition comprising reverse
transcriptase.
18. The method of claim 12, wherein the lysate or admixture is not
incubated with a DNA or protein precipitating agent prior to
admixture with the composition comprising reverse
transcriptase.
19. The method of claim 12, wherein the RNA is not isolated from
the lysate or admixture prior to mixing at least a portion of the
lysate or admixture with the composition comprising reverse
transcriptase.
20. The method of claim 12, wherein RNA is isolated from the lysate
or admixture prior to mixing the RNA with the composition
comprising reverse transcriptase.
21. The method of claim 12, further comprising amplifying at least
one cDNA product of the reverse transcription reaction.
22. The method of claim 21, wherein the amplification involves
PCR.
23. The method of claim 12, further comprising determining the
presence of and/or quantity of an RNA in the biological unit or
sample.
24. The method of claim 23, further comprising admixing an RNA
control with the reaction mixture or the at least a portion of the
lysate or admixture prior to reverse transcription.
25. The method of claim 23, further defined as a method of
determining whether or not an siRNA with which the biological unit
or organism from which the sample is obtained has been contacted
has altered the concentration of one or more RNA in the biological
unit or body.
26. The method of claim 25, further comprising comparing the
presence of and/or quantity of cDNA products from the biological
unit or organism contacted with the siRNA with cDNA products
obtained from a biological unit or organism not contacted with an
siRNA or contacted with a negative control siRNA.
27. The method of claim 23, further defined as a method of
determining whether or not a compound with which the biological
unit or organism from which the sample is obtained has been
contacted has altered the concentration of one or more RNA in the
biological unit or sample.
28. The method of claim 27, further comprising comparing the
presence of and/or quantity of cDNA products from the biological
unit or organism contacted with the compound with cDNA products
obtained from a biological unit or organism not contacted with the
compound or contacted with a control.
29. The method of claim 23, further comprising employing a labeled
probe or intercalating dye to determine the presence of and/or
quantify the RNA.
30. The method of claim 1, further comprising detecting one or more
protein in the lysate or admixture.
31. The method of claim 30, wherein the protein is detected in an
antibody-based assay.
32. The method of claim 31, wherein the antibody-based assay
comprises immunoblotting, ELISA, or immunoprecipitation.
33. The method of claim 1, further defined as amplifying RNA from
the lysate or sample.
34. The method of claim 33, further comprising analyzing the
amplified RNA in a microarray analysis.
35. The method of claim 1, further comprising making a low pH
biological unit lysate.
36. The method of claim 35, wherein the biological unit is a
cell.
37. The method of claim 36, wherein the cell is a prokaryotic
cell.
38. The method of claim 36, wherein the cell is a fungal cell.
39. The method of claim 36, wherein the cell is a eukaryotic
cell.
40. The method of claim 39, wherein the cell is a human cell.
41. The method of claim 36, wherein the biological unit is obtained
from a subject.
42. The method of claim 41, wherein the biological unit is obtained
from a sample of body fluid.
43. The method of claim 42, wherein the body fluid is saliva,
sputum, plasma, serum, whole blood, cerebral spinal fluid, fecal
material, or urine.
44. The method of claim 41, wherein the biological unit is in a
tissue sample.
45. The method of claim 36, wherein the biological unit is a cell
from a cell culture.
46. The method of claim 35, wherein the biological unit is a
virus.
47. The method of claim 1, further defined as comprising making an
admixture of sample comprising RNA not comprised in a biological
unit and the buffer.
48. The method of claim 47, wherein the sample is a body fluid.
49. The method of claim 47, wherein the body fluid is saliva,
sputum, whole blood, plasma, serum, cerebral spinal fluid, fecal
material or urine.
50. The method of claim 47, wherein the sample comprises partially
purified or purified RNA.
51. The method of claim 1, wherein the RNA remains substantially
intact at ambient temperature.
52. The method of claim 1, wherein the RNA remains substantially
intact from RNA degradation if the lysate is stored for 8 hours at
ambient temperature.
53. The method of claim 1, wherein lysis or admixing occurs between
15.degree. C. and 37.degree. C.
54. The method of claim 1, wherein the lysis or admixing occurs at
ambient temperature.
55. The method of claim 1, further comprising adding an RNase
inhibitor to the lysate or admixture.
56. A method of assaying RNA comprising: obtaining at least one
biological unit containing RNA or sample comprising RNA not
comprised in a biological unit; obtaining a low pH buffer; mixing
the biological unit and the buffer to prepare a low pH lysate or
mixing the sample and the buffer to prepare an admixture; and
mixing at least a portion of the lysate or admixture with a
composition comprising reverse transcriptase to form a reverse
transcriptase reaction mixture and incubating the reaction mixture
under conditions resulting in a reverse transcription reaction to
prepare cDNA.
57. The method of claim 56, further comprising amplifying cDNA
products of the reverse transcription reaction.
58. The method of claim 56, further comprising determining the
presence of and/or quantity of an RNA in the biological unit or
sample.
59. The method of claim 58, further comprising employing a labeled
probe or intercalating dye to determine the presence of and/or
quantify the RNA.
60. A kit for assaying RNA in a biological unit or sample
comprising, in one or more suitable container(s): a low pH buffer,
a high pH buffer, or a buffer that precipitates RNA; a reverse
transcription buffer; reverse transcriptase; and dNTPs.
61. The kit of claim 60, further comprising an RNA control.
62. The kit of claim 60, further comprising a thermostable DNA
polymerase.
63. The kit of claim 60, further comprising an RNase inhibitor.
64. The kit of claim 60, further defined as comprising a low pH
buffer.
65. The kit of claim 60, further defined as comprising a high pH
buffer.
66. The kit of claim 60, further defined as comprising a buffer
that precipitates RNA.
67. A method comprising: obtaining at least one biological unit
containing RNA or sample comprising RNA not comprised in a
biological unit; obtaining a high pH buffer; mixing the biological
unit and the buffer to prepare a high pH lysate or mixing the
sample and the buffer to prepare a high pH admixture; and mixing at
least a portion of the lysate or admixture with a composition
comprising an enzyme using RNA as a substrate to form a reaction
mixture.
68. The method of claim 67, wherein the lysate or admixture has a
pH of from 9 to 14.
69. The method of claim 68, wherein the lysate or admixture has a
pH of greater than or equal to 11 and less than 14.
70. The method of claim 69, further comprising mixing at least a
portion of the lysate or admixture with a composition comprising
reverse transcriptase to form a reverse transcriptase reaction
mixture and incubating the reaction mixture under conditions
resulting in a reverse transcription reaction.
71. The method of claim 70, wherein the reverse transcriptase is
comprised in a reverse transcriptase buffer that adjusts the pH of
the reaction mixture to a level suitable for reverse transcriptase
function.
72. The method of claim 71, wherein the pH of the reaction mixture
is between 7.0 and 9.5.
73. The method of claim 72, wherein the pH of the reaction mixture
is between 8.0 and 8.4.
74. A method comprising: obtaining at least one biological unit
containing RNA or sample comprising RNA not comprised in a
biological unit; obtaining a buffer; mixing the biological unit and
the buffer to prepare a low pH lysate or mixing the sample and the
buffer to prepare an admixture, wherein the buffer precipitates RNA
in the lysate or admixture; and detecting and/or quantifying RNA in
the biological unit or sample.
75. The method of claim 74, wherein the buffer is a low pH
buffer.
76. The method of claim 74, wherein the buffer is a high pH
buffer.
77. The method of claim 74, wherein the buffer comprises a
detergent.
78. The method of claim 77, wherein the buffer comprises a
non-ionic detergent.
79. The method of claim 77, wherein the detergent comprises an
anionic or cationic detergent.
Description
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the fields of
making biological unit lysates or admixtures of body fluids for RNA
analysis. More specifically, it teaches a more direct method for
the detection of a specific sequence of RNA in a biological unit,
for example a virus, cell or tissue sample, or a body fluid, for
example saliva, sputum, blood plasma, etc. More generally, the
invention may be used to enzymatically manipulate and protect the
RNA in lysate or bodily fluids for a number of applications.
[0004] 2. Description of Related Art
[0005] There are many molecular biology techniques that can be used
to analyze RNA or RNA-containing samples. For example, reverse
transcription followed by the polymerase chain reaction (RT-PCR) is
one of the main methods used for measuring MRNA levels from cells
or other biological samples such as viruses. Additionally, reverse
transcription is the first step of several different strategies for
labeling or amplifying a small quantity of RNA for the purpose of
expression profiling (U.S. Pat. No. 5,554,516; U.S. Pat. No.
5,891,636; Phillips, 1996; Lockhart, 1996; U.S. Pat. No.
6,316,608). Those of ordinary skill in the field know many other
such RNA-based techniques.
[0006] In most cases, prior to performing any enzymatic methods,
the substrate RNA is isolated from a biological sample to prevent
the degradation of the RNA and to remove inhibitors of the
enzymatic processes used to analyze the RNA. Current procedures for
RNA isolation involve numerous steps and are not very amenable to
high throughout analysis. Some procedures require the use of
enzymes, such as proteinase K, pepsin, or DNase or the use of DNA
or protein precipitating agents to "clean up" the RNA containing
sample prior to use. Some require the use of temperature variation,
such as freezing of samples, or heating of reaction mixtures to
obtain RNA that is appropriate for use. Further, some of these
procedures require the use of RNase inhibitors in their reaction
mixtures. Also, many of these procedures have fairly defined limits
on the numbers of cells that can be employed in the respective
procedures. Currently, the majority of samples are probably
processed using high concentrations of chaotropic or denaturing
reagents as a first step to disrupt the sample. As such, the RNA
must be isolated from these disruptive reagents before it can be
processed enzymatically for analysis since the enzymes would be
inactive in the presence of these reagents. For these reasons, many
prior art techniques are not amenable to easy practice in the
laboratory and also not amenable to automation.
[0007] A procedure that resolves one or more of the
above-referenced problems and enables the direct use of a cell
lysate or body fluid sample for RNA-based techniques immediately
after the addition of a buffer at room and/or ambient temperature
would be highly beneficial and more adaptable to automation.
SUMMARY OF THE INVENTION
[0008] The present invention, in general terms, provides for a
procedure that enables the direct use of samples containing RNA. In
various embodiments, the methods and buffers of the invention
resolve one or more of the problems discussed above. For example,
the methods and buffers of the invention can result in: rapid
preparation of samples; samples containing RNA that is stable for
the purpose for which it will be used in preparations of samples
without the need for temperature variations, addition of proteins,
chaotropic agents, DNA and/or protein precipitating agents, high
salt, etc.; samples with high cell concentrations; reaction
mixtures comprising a high level of RNA in terms of RNA
equivalents; RT-PCR reaction mixtures with Ct values that compare
favorably with reaction mixtures produced by more laborious means;
RNA containing lysates or admixtures that can be produced and
stored at room, ambient, and/or laboratory bench temperature. These
samples also contain the entire genomic DNA content of the original
sample, which is useful for normalizing samples by using a target
in genomic DNA as an internal standard instead of 185 rRNA. The
concentration of genomic DNA does not vary. Most other RNA
isolation procedures lead to some loss of genomic DNA, and,
therefore, genomic DNA could not be used as an internal standard.
Of course, it is not necessary that the invention result in all of
these advantages in all circumstances, or even in at least one of
these advantages in all circumstances. The ability of the invention
to result in any one of these advantages in certain circumstances
provides value to the invention. Those of skill in the art will,
upon reading this specification, be able to implement the invention
in appropriate circumstances and realize appropriate
advantages.
[0009] In broad embodiments, the invention relates to methods
comprising: obtaining a sample containing RNA; obtaining a buffer;
mixing the sample and the buffer; and forming a lysate or admixture
in which the RNA is protected from substantial degradation. In some
cases, this protection may be accomplished by precipitation of the
RNA in the lysate or admixture through the use of a low pH buffer,
a high pH buffer, or a buffer containing an agent that brings about
precipitation of the RNA and/or inactivation of ribonuclease in the
lysate or admixture. "Precipitation" is defined as separating a
majority of the RNA from the lysate or admixture, or rendering the
RNA such that it can be separated, for example, via either
centrifugation to pellet the RNA or collecting the RNA on a filter.
The buffer may be a low pH buffer or a high pH buffer. The buffer
may comprise a detergent, for example, but not limited to, a
non-ionic detergent, an anionic detergent or a cationic detergent.
Additional descriptions of some of the embodiments of the invention
follow.
[0010] The lysates and admixtures of the sample and the buffer can
be used essentially immediately after the addition of a buffer at
room temperature or another appropriate temperature. Additionally,
the invention provides for buffers that allow for such procedures
to be practiced. In some more specific embodiments, the admixtures
are employed in RT-PCR procedures.
[0011] As described elsewhere in the specification and known to
those of skill in the art, the invention may be applied to
compositions or samples comprising at least one biological unit
containing RNA or samples comprising RNA not comprised in a
biological unit.
[0012] The term "biological unit" is defined to mean any cell or
virus that contains genetic material. In most aspects of the
invention, the genetic material of the biological unit will include
RNA. In some embodiments, the biological unit is a prokaryotic or
eukaryotic cell, for example a bacterial, fungal, plant, protist,
animal, invertebrate, vertebrate, mammalian, rodent, mouse, rat,
hamster, primate, or human cell. Such cells may be obtained from
any source possible, as will be understood by those of skill in the
art, for example, a prokaryotic or eukaryotic cell culture. The
biological unit may also be obtained from a sample from a subject
or the environment. The subject may be an animal, including a
human. The biological unit may also be from a tissue sample or body
fluid, e.g., saliva, plasma, serum, urine, whole blood, sputum,
fecal matter or cerebral spinal fluid. The biological unit may be
obtained from a leukocyte enriched blood fraction, which may be
produced in any manner known to those of skill in the art, for
example, the ammonium chloride method of lysing red blood cells or
methods involving selective filtering of leukocytes. Further, the
biological unit may be stored in or obtained from a sample stored
in an RNA preservation medium, such as the medium sold by Ambion
under the RNAlater.RTM. name, and described in U.S. patent
application Ser. Nos. 09/160,284 and 09/815,577, both of which are
entitled "Methods and Reagents for Inactivating Ribonucleases, and
the full disclosures of both of which are incorporated herein by
reference.
[0013] Samples comprising RNA not comprised in a biological unit
include, but are not limited to, body fluids and samples comprising
fully or partially purified RNA. The term "body fluid" is defined
to mean any body fluid that does or may contain RNA. For example,
the body fluid may be saliva, sputum, whole blood, plasma, serum,
cerebral spinal fluid, fecal matter, or urine. The body fluid may
be obtained from an animal, including a human, via any appropriate
means as known to those of skill in art. Of course, those of skill
will be able to determine any number of RNA containing units or
compositions to which the present invention may be applied.
[0014] In some embodiments, the invention relates to methods
comprising: obtaining at least one biological unit containing RNA
or sample comprising RNA not comprised in a biological unit;
obtaining a low pH buffer; mixing the biological unit and the
buffer to prepare a low pH lysate or mixing the sample and the
buffer to prepare a low pH admixture; and mixing at least a portion
of the lysate or admixture with a composition comprising enzyme
using RNA as a substrate to form a reaction mixture.
[0015] The inventors have found that such low pH lysates and
admixtures are capable of use in a wide variety of molecular
biology techniques, and have the benefit of protecting RNA in the
lysate or admixture from degradation for sufficient time to allow
for such molecular biology techniques to be performed without
concern for RNA degradation. Additionally, lysates and admixtures
of the invention can be used at normal ambient or room temperature,
without artificial control or modulation of the temperature of the
lysate or admixture or a reaction mixture comprising all or part of
the lysate or admixture. Of course, this does not mean that
molecular biology techniques, such as PCR, which rely upon
variations in temperature cannot be employed with lysates according
to the invention or reaction mixtures comprising such lysate or
admixture. Rather, it means that many of the lysates of the
invention do not require temperature variations in order to prevent
RNA degradation.
[0016] In its broadest sense in the context of the invention, the
definition of "low pH" is any pH below 7 that allows for the
objects of the invention to be realized. For example, lysate pHs of
equal to or below 6.5, equal to or below 6.0, equal to or below
5.5, equal to or below 5.0, equal to or below 4.5, equal to or
below 4.0, equal to or below 3.5, equal to or below 3.0, equal to
or below 2.5, and equal to or below 2.0, are expected to be of use
in some embodiments of the invention. Further, it is contemplated
that lysate or admixture pH ranges between any two of the
above-described points will be useful in the context of the
invention. In preferred embodiments of this aspect of the
invention, the low pH buffer is one that, when added to the
biological unit or sample comprising RNA not comprised in a
biological unit in an appropriate amount results in a low pH
biological unit lysate or admixture that has a pH of from 0 to 6.
In preferred embodiments, the low pH lysate or admixture has a pH
of 1 to 5.5. In currently favored embodiments, the lysate or
admixture has a pH of less than 5. In some more preferred
embodiments, the pH is between 1.5 and 4.0, with a pH of 2.0 to 3.0
being even more preferred. In some most preferred embodiments, the
pH is about 2.5. Of course, those of skill in the art will realize
that, for most applications, the low pH buffers of and employed in
the practice of the invention may need to be of lower pH than that
ultimately desired in the lysate or admixture, because of dilution
that can occur when one mixes the biological units or sample
comprising RNA not comprised in a biological unit with the
buffer.
[0017] Once a low pH lysate or admixture of the invention is
prepared, the RNA in it is typically stabilized for a relevant
period of time at ambient, or another relevant, temperature. The
lysate or admixture can then be employed in any of the wide variety
of molecular biological techniques such as RT-PCR, the preparation
of cDNA, cloning, Nucleic Acid Sequence Based Amplification
(NASBA), labeling RNA for use in expression analysis, RNA
amplification, microarray analysis, transcription mediated
amplification (TMA), etc. In some embodiments, the lysate or
admixture, or a portion thereof, will be added to another component
in the process of performing a molecular biology technique, to form
a reaction mixture. In such cases, it may be necessary to have the
pH of the reaction mixture be higher, or in some cases even lower,
than the pH of the lysate or admixture. This will be the case in
regard to some molecular biology techniques that rely upon enzymes
that are active, or at least maximally active in a pH range that is
higher than the pH range of the low pH lysate or admixture.
[0018] In some preferred embodiments, the method of the invention
further comprises adding or mixing at least a portion of the lysate
or admixture with a composition comprising reverse transcriptase to
form a reverse transcriptase reaction mixture and incubating the
reaction mixture under conditions resulting in a reverse
transcription reaction. In such embodiments, the reverse
transcriptase may be comprised in a reverse transcriptase buffer
that raises the pH of the reaction mixture to a level suitable for
reverse transcriptase function. Alternatively, a further component
or buffer that acts to raise the pH may be added to the lysate or
admixture before the addition of the reverse transcriptase or to
the reaction mixture. In many reaction mixtures, the final pH of
the reaction mixture will be between 7.0 and 9.5, with a pH of
between 8.0 and 8.4 being particularly preferred for some reverse
transcriptases, and a pH of about 8.3 being especially preferred in
some embodiments. Those of skill in the art will understand that a
variety of reverse transcriptases, as discussed below and elsewhere
in the specification and known to those of skill in the art, can be
employed in the context of the invention. The reverse transcriptase
buffer may contain any suitable buffer in any suitable
concentration, and those of skill will be able to select and
formulate such buffers. One embodiment comprises 50 mM TRIS at pH
8.3.
[0019] Any reverse transcriptase known to those of skill in the art
or discovered after the time of the filing of this application is
anticipated to be useful in the context of the invention. MMLV-RT
(murine maloney leukemia virus-reverse transcriptase) is one of the
most commonly used reverse transcriptases by molecular biologists.
However, there are other reverse transcriptases that function in
the invention. By way of non-limiting example, Avian Myelogenous
Virus reverse transcriptase (AMV-RT; Retzel, 1980), human
immunodeficiency virus (HIV)-RT (Muller, 1989) and the Tth DNA
polymerase (Myers, 1991), which also has reverse transcriptase
activity, can each synthesize cDNA. Further, the Tth DNA polymerase
has reverse transcriptase activity if Mn.sup.+2 is provided in the
buffer and can be used to generate cDNA from a lysate or admixture
following the protocol of the invention. Those of skill in the art
will understand that the above-described nucleic acid polymerases
and any other nucleic acid polymerases having reverse transcriptase
activity can be adaptable to the protocols of the invention and
will be able to select appropriate reverse transcriptases and
employ them under appropriate conditions in reaction mixtures by
following the teachings of this specification.
[0020] The invention, in some cases, provides benefits in that it
is not necessary to incubate the lysate or admixture or a portion
thereof with a DNase, proteinase K, pepsin or other catabolic
enzyme prior to mixing at least a portion of the lysate or
admixture with a composition comprising reverse transcriptase or
another enzyme. Additionally, there is no need, in most
embodiments, for the invention to subject the lysates, admixtures,
and/or reaction mixtures of the invention to treatment with DNA
and/or protein precipitating agents to achieve reverse
transcription or another desired enzymatic action. For many
molecular biology procedures, this provides for streamlining of a
process. Of course, there is no reason why those of skill in the
art could not, in some embodiments, add DNase, proteinase K, pepsin
or precipitating agents to the lysate or admixture. However, such
additives are not required in many embodiments of the invention.
Additionally, in many embodiments RNA need not be not isolated from
the lysate or admixture prior to mixing at least a portion of the
lysate or admixture with a composition comprising reverse
transcriptase or another relevant enzyme.
[0021] In some preferred embodiments, at least one cDNA product of
a reverse transcription reaction mixture as described above is
amplified. This amplification can be done by any manner known to
those of skill in the art. In many embodiments, the amplification
will be done by the polymerase chain reaction (PCR), in which case
the method is a method of "RT-PCR." In some embodiments the
reaction will be a two-step real-time PCR procedure, although a
wide variety of variations in PCR procedures may be employed. Also,
"nested" PCR, as known to those of skill in the art, can allow for
great sensitivity in some embodiments. It is also possible that the
invention may be used in conjunction with isothermal amplification
methods such as transcription mediated amplification (TMA; U.S.
Pat. No. 5,399,491) or Nucleic Acid Sequence-Based Amplification
(NASBA; Compton, 1991). This amplification system typically is
comprised of at least 3 different enzymes (reverse transcriptase,
DNA-dependent DNA polymerase and a DNA-dependent RNA polymerase,
and in some cases comprises RNase H) that function together to
generate multiple copies of an RNA. The levels of the amplified RNA
correlate with the pre-amplified concentration of the target
sequence. Thus, instead of using RT-PCR, TMA could be used to
quantify the levels of an mRNA in a sample. For example, cells from
tissue culture or from blood are lysed using the buffer and then
the cell lysate or admixture is added to reaction mixture
containing all the components to perform TMA or NASBA and amplify
the sequence of a specific MRNA or virus. The amplified RNA can
then be detected using one of several methods including the
hybridization protection assay (HPA; Matsubara, 1992) or molecular
beacons (Tyagi, 1996). Those of skill will be able to use these
exemplary amplification techniques, and any others known at the
time of filing or later developed, in the context of the
invention.
[0022] A further advantage of the present invention is that, in
some embodiments, it allows for the processing of samples with high
cell concentrations. This ability to use high cell concentrations
can provide advantages in any of the procedures discussed above or
known to those of skill in the art. For example, many prior RT-PCR
techniques are limited to the use of samples containing less than
1, 1-10, 30, 40, 50, 60, 75, or 100 cells/.mu.l of buffer. When a
sample is added to a reverse transcriptase reaction, the
concentration of cellular equivalents of RNA components in the
reaction mixture is even less. For example, Gaynor et al. (1996)
teach that one can use the 1 to 1000 cells in a 20 .mu.l RT
reaction, i.e., 0.05 to 50 cells per .mu.l of reaction. Given
standard dilutions that occur in making cell sample lysates or
other RNA containing admixtures into reverse transcriptase
reaction, most prior techniques begin with reaction mixtures
comprising the RNA of less than one to about 50 cells. The buffers
and techniques of the present invention certainly work in the
context of low cell concentrations. However, they also allow for
higher concentrations of cells to be used. For example, using the
methods and buffers of the invention, it is possible to make
cellular lysates of 5000 cells per .mu.l, 2000 cells per .mu.l,
1500 cells per .mu.l, 1000 cells per .mu.l, 900 cells per .rho.l,
800 cells per .mu.l, 750 cells per .mu.l, 700 cells per .mu.l, 650
cells per .mu.l, 600 cells per .mu.l, 550 cells per .beta.l, 500
cells per .mu.l, 450 cells per .mu.l, 400 cells per .mu.l, 350
cells per .mu.l, 300 cells per .mu.l, 250 cells per .mu.l, 200
cells per .mu.l, 175 cells per .mu.l, 150 cells per .mu.l, 125
cells per .mu.l, 100 cells per .mu.l, 90 cells per .mu.l, 80 cells
per .mu.l, 75 cells per .mu.l, 70 cells per .mu.l, 65 cells per
.mu.l, 61 cells per .mu.l, 55 cells per .mu.l, 51 cells per .mu.l,
50 cells per .mu.l, 45 cells per .mu.l, 41 cells per .mu.l, 40
cells per .mu.l, 35 cells per .mu.l, 31 cells per .mu.l, 30 cells
per .mu.l, 25 cells per .mu.l, 21 cells per .mu.l, 20 cells per
.mu.l, 18 cells per .mu.l, 16 cells per .mu.l, 15 cells per .mu.l,
14 cells per .mu.l, 12 cells per .mu.l, 11 cells per .mu.l, 10
cells per .mu.l, 9 cells per .mu.l, 8 cells per .mu.l, 7 cells per
.mu.l, 6 cells per .mu.l, 5 cells per .mu.l, 4 cells per .mu.l, 3
cells per .mu.l, 2 cells per .mu.l, 1 cell per .mu.l, 0.9 cell per
.mu.l, 0.8 cell per .mu.l, 0.7 cell per .mu.l, 0.6 cell per .mu.l,
0.5 cell per .mu.l, 0.4 cell per .mu.l, 0.3 cell per .mu.l, 0.25
cell per .mu.l, 0.20 cell per .mu.l, 0.15 cell per .mu.l, 0.1 cell
per .mu.l, 0.05 cell per .mu.l, and/or of any concentration range
defined by any of these points, or any lower cell concentration.
Further, it is possible, according to the invention to make RT-PCR
reaction mixtures comprising concentrations of cellular RNA
equivalent to 1500 cells per .mu.l, 1000 cells per .mu.l, 900 cells
per .mu.l, 800 cells per .mu.l, 750 cells per .mu.l, 700 cells per
.mu.l, 650 cells per .mu.l, 600 cells per .mu.l, 550 cells per
.mu.l, 500 cells per .mu.l, 450 cells per .mu.l, 400 cells per
.mu.l, 350 cells per .mu.l, 300 cells per .mu.l, 250 cells per
.mu.l, 200 cells per .mu.l, 175 cells per .mu.l, 150 cells per
.mu.l, 125 cells per .mu.l, 100 cells per .mu.l, 90 cells per
.mu.l, 80 cells per .mu.l, 75 cells per .mu.l, 70 cells per .mu.l,
65 cells per .mu.l, 61 cells per .mu.l, 55 cells per .mu.l, 51
cells per .mu.l, 50 cells per .mu.l, 45 cells per .mu.l, 41 cells
per .mu.l, 40 cells per .mu.l, 35 cells per .mu.l, 31 cells per
.mu.l, 30 cells per .mu.l, 25 cells per .mu.l, 21 cells per .mu.l,
20 cells per .mu.l, 18 cells per .mu.l, 16 cells per .mu.l, 15
cells per .mu.l, 14 cells per .mu.l, 12 cells per .mu.l, 11 cells
per .mu.l, 10 cells per .mu.l, 9 cells per .mu.l, 8 cells per
.mu.l, 7 cells per .mu.l, 6 cells per .mu.l, 5 cells per .mu.l, 4
cells per .mu.l, 3 cells per .mu.l, 2 cells per .mu.l, 1 cell per
.mu.l, 0.9 cell per .mu.l, 0.8 cell per .mu.l, 0.7 cell per .mu.l,
0.6 cell per .mu.l, 0.5 cell per .mu.l, 0.4 cell per .mu.l, 0.3
cell per .mu.l, 0.25 cell per .mu.l, 0.20 cell per .mu.l, 0.15 cell
per .mu.l, 0.1 cell per .mu.l, 0.05 cell per .mu.l, 0.01 cell per
.mu.l, and/or of any concentration range defined by any of these
points, or any lower cell concentration. The ability to employ
higher cellular concentration has many advantages. For example, if
one can use 2, 3, 4, 5, 10, 20, 50, 100, 500, or even 1000 times
the concentration of cells and therefore obtain 2, 3, 4, 5, 10, 20,
50, 100, 500, or even 1000 times the concentration of RNA in the
RT-PCR reaction mixture, then this can provide a tremendous
advantage in terms of speed, lower numbers of cycles, sensitivity,
tolerance, and/or robustness of the RT-PCR reaction. These
advantages could be significant to overcome any situations where
the lysates and/RT-PCR reaction mixtures of the invention might not
be as stable, from an RNA standpoint or as efficient from an RT-PCR
standpoint, as prior lysates and/or RT-PCR reactions using lower
cell concentrations.
[0023] Another advantage of some embodiments of the invention is
that they can allow for highly efficient RT-PCR reactions using the
methods and buffers of the invention, without the need for RNA
isolation or sample preparation steps that require temperature
variations and/or protein addition, DNA and/or protein
precipitation in the sample, or long incubation times. One manner
of measuring the efficiency of a real-time PCR reaction involves
the determination of "Ct values." Ct refers to "Cycle Threshold."
In real-time PCR, the amount of fluorescent signal is monitored
after each cycle of PCR. Once the signal reaches a certain level,
it has reached the "threshold." The Ct is the number of cycles of
PCR that it took to reach that threshold of fluorescent signal.
Thus, the lower the Ct value, the greater the concentration of
nucleic acid target. For example, in the TaqMan.RTM. assay,
typically each cycle almost doubles the amount of PCR product and
therefore, the fluorescent signal should double if there is no
inhibition of the reaction and the reaction was nearly 100%
efficient with purified nucleic acid. In practice, if the Ct value
produced by an RT plus reaction is at least 3 Ct values less than
the Ct value from an RT minus reaction, the gDNA contribution to
the Ct is less than .about.12%. The lower the Ct value, the greater
the signal. Thus, if the RT step is contributing cDNA in much
greater excess than the gDNA, then you should observe a lower Ct
value in the RT plus reactions. Every 3 cycles is about an 8-fold
(2.times.2.times.2) difference in signal. Thus, if the RT plus
reaction is 3 cycles lower than the RT minus, then there was about
8-fold more cDNA than genomic DNA (gDNA). In the context of the
invention, benefits can be realized when the methods and buffers
result in any difference in Ct value between an RT plus reaction
and an RT minus reaction where all other components are held equal
or substantially equal. For example, in some embodiments of the
invention, differences in Ct values of 1, 2, 3, 4, 5, 6, 7, 8, 9,
10 or more (RT(-)-RT(+), or any range derivable between any two of
these points, will be possible and beneficial. Also, given the ease
of the preparation of the RNA-containing samples for RT-PCR
according to the invention, the invention can provide benefits even
if it results in an RT-PCR reaction with a Ct value that is greater
than a comparable RT-PCR reaction run on an identical
RNA-containing sample that has been prepared by a more laborious
procedure. For example, even if the Ct value of an RT-PCR reaction
on an RNA-containing sample is 1, 2, 3, 4, or more times higher
than that for an RT-PCR reaction on an RNA-containing sample
produced by more laborious means, the lower efficiency of the
RT-PCR reaction of the invention may be more than compensated for
by the easy, more efficient sample preservation of the invention.
This may be particularly true in cases of automation of RT-PCR,
where the ability to quickly prepare samples for RT-PCR with one
step at room temperature or a constant temperature may outweigh the
need for additional amplification cycles.
[0024] In some embodiments, the methods of the invention further
comprise analyzing amplified DNA to determine the presence of
and/or quantity of an RNA in the biological unit. There are many
reasons that one might wish to do this, including but not limited
to determining gene expression patterns for research, diagnostic,
pharmacogenomics, and therapeutic applications. In many cases,
these methods will comprise admixing an RNA control with the
reaction mixture or the at least a portion of the extract prior to
reverse transcription. Such an RNA control can be employed as an
internal standard for quantifying the RNA in the biological unit
and/or as an exogenously added positive control to assure that the
reaction mixture is functioning properly. Of course, controls such
as RNA or DNA controls can also be added to the reaction mixture
prior to an amplification procedure, and it is also possible to use
RNA or DNA controls and external standards or positive controls in
the context of the invention. Those of skill understand that there
are a wide variety of manners in which to employ controls in the
context of the invention, and will be able to employ appropriate
such controls for any specific format that they are practicing.
[0025] In some embodiments, the invention may be employed to
determine differences in RNA levels between biological units
comprised in two or more samples. Skilled molecular biologists
understand that there are a wide variety of contexts in which such
analysis may be employed. For example, they may be employed to
study differences in gene expression during development,
differences in gene expression between normal and diseased tissues,
or differences in gene expression due to the contacting of a
biological unit with some form of nucleic acid, protein, small
molecule, antibody, or other substance. In some embodiments, the
invention relates to methods of determining whether or not an siRNA
with which the biological unit has been contacted has altered the
concentration of one or more RNA in the biological unit. Such
embodiments may comprise comparing the presence of and/or quantity
of cDNA products from the biological unit contacted with the siRNA
with cDNA products obtained from a biological unit not contacted
with an siRNA or contacted with a negative control siRNA. Such
methods also embody the determining of whether or not a compound
with which the biological unit has been contacted has altered the
concentration of one or more RNA in the biological unit, and may
optionally comprise comparing the presence of and/or quantity of
cDNA products from the biological unit contacted with the compound
with cDNA products obtained from a biological unit not contacted
with the compound or contacted with a control.
[0026] There are a wide variety of techniques that can be used to
detect RNA or DNA generated by the methods of the invention and, in
many embodiments, determining the presence of and/or quantifying
RNA. For example the invention contemplates, but is not limited to,
the use of a labeled probe or intercalating dye to determine the
presence of and/or quantify the RNA. Labeled probes are typically
nucleic acids that comprise one or more detectable labels. Such
labels can be visual, fluorescent, chemical, enzymatic, or
radioactive labels, or any other label suitable for the practice of
the invention. Such labels can be detected by methods that are well
known to those of skill in the art. In particular, some embodiments
of the invention involve the use of dual-labeled fluorescent
probes, such as TaqMan.RTM. Gene Expression Assays (Applied
Biosystems), Scorpion.TM. (DxS; Manchester, UK), LUX.TM.
(Invitrogen); Ampliflour.TM. (Chemicon), or molecular beacon
probes. In other particular embodiments, the invention involves the
use of intercalating dyes, including but not limited to SYBR.RTM.
Green and ethidium bromide.
[0027] Some embodiments of the invention comprise amplifying RNA
from the lysate or admixture. There are many cases where
researchers have a limited amount of sample and the RNA isolated
from the sample is not enough to perform the desired assay, and
those of skill will be able to employ the invention in any such
cases. A technique to which this often applies is in producing a
labeled nucleic acid from the isolated RNA and then hybridizing the
labeled nucleic acid to a microarray. The signals produced at each
of the addresses of the microarray indicate the level of expression
for each of the genes on the array. Thus, a snapshot is taken of
the abundance for each of the genes probed by the array.
[0028] Of course, the lysates and admixtures of the present
invention may be used in almost any molecular biology technique
involving the use of a biological unit lysate or admixture.
Therefore, even though the lysates provide particular benefits in
RNA-based techniques, the invention is not limited to such
techniques. For example, the methods of using the lysates of the
invention may comprise detecting one or more proteins in the lysate
or admixture or a portion thereof. In some embodiments, protein
detection may be used in combination with the practice of one of
the RNA-based techniques discussed above, for example to determine
or confirm whether differences detected in RNA or levels between
samples are also detectable in protein levels in the samples.
Proteins can be detected in any manner known to those of skill. In
some examples, the protein is detected in an antibody-based assay,
for example but not limited to immunoblotting, ELISA, or
immunoprecipitation.
[0029] One advantage of the lysates and admixtures of the invention
lies in their ability to stabilize RNA from significant degradation
until such time as an RNA-based protocol can be performed. It is
particularly beneficial that these lysates and admixtures are able
to prevent significant RNA degradation for a relevant period at
ambient temperatures typically found in laboratories. For example,
it is possible for RNA degradation to be prevented at temperatures
between 15.degree. C. and 30.degree. C., which are the far limits
of most ambient lab temperatures. In many embodiments, the
temperature will be room temperature, which is typically around
21.degree. C., but may vary within labs. Of course, it is not
required that the lysates and admixtures be stored at ambient
temperatures. They may be stored at any temperature that allows for
preservation of the RNA. For example one may store the lysates and
admixtures at, -80.degree. C., -20.degree. C., 0.degree. C.,
4.degree. C., 10.degree. C., 15.degree. C., 20.degree. C.,
21.degree. C., 25.degree. C., 30.degree. C., 35.degree. C.,
37.degree. C., 40.degree. C., 45.degree. C., 50.degree. C., or
within any range of temperatures defined by any two of these
individual points.
[0030] Additionally, it is not necessary for the RNA to be
protected from degradation forever. Rather, the objectives of many
aspects of the invention may be realized so long as the RNA is
protected from substantial degradation for enough of a period of
time to allow for the desired assay or protocol to be performed.
"Substantial degradation," may be defined as RNA degradation
sufficient enough to effect the results of a desired assay or
protocol. In some cases, "substantial degradation" does not occur
so long as at least 5%, 10%, 20%, 25%, 30%, 40% 50%, 60%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and/or 100% of the RNA is
preserved in the form of full-length sequences and/or transcripts.
Of course, any range of percentage of preservation derivable
between any of these points is also considered within the scope of
these embodiments of the invention. Those of skill will understand
that there are any of a variety of molecular biological techniques
that can be employed to measure degrees of RNA degradation and/or
preservation. For example, it is possible to use a 2100 BioAnalyzer
(Agilent) as described below to determine intactness of RNA. The
BioAnalyzer, and comparable devices may be employed to the ratio of
28S rRNA to 18S rRNA as an indication of intactness, with a ratio
of between 1.0 and 2.0 to indicate that the RNA is relatively
intact, with higher ratios indicating a greater level of
intactness. This is because 28s rRNA is less stabile than 18s rRNA.
In some embodiments of the invention, the ratio will be between 1
and 2. For example, the ratio may be 1.0, 1.05, 1.1, 1.2, 1.3, 1.4,
1.5, 1.6, 1.7, 1.8, 1.9, or 2, or any range derivable between any
of these points. Additionally, the 2100 BioAnalyzer can be used to
determine an RNA integrity number (RIN), as described in various
places in the Agilent literature. The RIN is a number between 1 and
10, wherein 10 relates to completely undegraded RNA and 1 relates
to completely digested RNA. In the context of some embodiments of
the invention, the RIN will be 4, 5, 6, 7, 8, 9, 10 or any range
derivable between these points.
[0031] Additionally, it is possible to evaluate RNA stability under
a variety of storage conditions in terms of its ability to be used
in a standard biological procedure, for example but not limited to
real-time PCR.
[0032] In many embodiments, the lysate, or a portion thereof, will
be employed in a protocol very quickly, i.e., within minutes,
hours, or a day after preparation of the lysate or admixture.
Therefore, the RNA will only need to be protected for a short
amount of time. However, even in these embodiments, the invention
provides benefits in that it allows for ambient temperature lysis
and assurance that RNA degradation is not occurring. Further, in
some embodiments, RNA in lysates and admixtures may be
substantially protected from degradation for 1, 2, 3, 4, 5, or 6
days, 1, 2, 3, or 4 weeks, a number of months, a year, or more.
Further, any range derivable between any of these time points is
contemplated by the invention. Additionally, any combinations of
specific points or ranges of temperature, level of preservation,
and/or times of preservation derivable from the above are
contemplated by the invention. For example, but not limited to: 85%
RNA preservation for at least 2 hours, at 15-30.degree. C.; a ratio
of 28S rRNA to 18S rRNA of between 1.0 and 2.0, for at least 4
hours, at ambient temperature; and/or sufficient RNA preservation
to allow for real-time PCR, or any other molecular biology
procedure requiring intact RNA, for any of the above-described
amounts of time at ambient temperature.
[0033] While the ability to maintain the stability/intactness of
RNA in the lysate is one of the benefits of many of the preferred
buffers and methods of the invention, those of skill will recognize
that integrity of RNA is important in some, but certainly not all
applications, such as RT-PCR applications where an oligo(dT) is
used to prime the RT and the probe is far from the 3' end. In other
cases, it is not necessary to have such a level of intactness or
RNA stability. For example, RNA contained in lysates and admixtures
according to the invention that have 0% full length RNA, can be
used in embodiments of the invention such as one-step quantitative
RT-PCR where gene specific primers are used for RT priming. The
invention still has benefit even if the RNA is substantially
degraded, so long as the degradation does not change the ability to
perform a desired assay. For example, low pH lysis substantially
increases the concentration of the sample, lysate, and/or admixture
that may be used in the RT-PCR. The inventors have found that cells
lysed at pH 7.0 lose linearity of signal earlier than cells lysed
at a lower pH. Further, the precision and/or robustness of methods
employed with low pH samples appears to be greater.
[0034] Temperatures of the lysate or admixture at the time of
preparation may be at any temperature that is effective between
0.degree. C. and 100.degree. C. Typically, preparation occurs
between 0.degree. C. and 50.degree. C., with between 15.degree. C.
and 37.degree. C. preferred, and ambient temperature most preferred
simply from the standpoint of simplicity.
[0035] Some embodiments of the invention further comprise adding an
RNase inhibitor to the admixture. For example, the RNase inhibitor
is a non-proteinaceous RNase inhibitor, such as ADP or a vanadyl
complex. Proteinaceous inhibitors could also be used such as
placental ribonuclease inhibitor or antibodies that inactivate
specific ribonucleases. Other RNase inhibitors include a variety of
small molecules. A listing of a wide variety of RNase inhibitors,
which may be used alone or in combination with other inhibitors in
the context of the invention may be found in U.S. patent
application Ser. No. 10/786,875 entitled "Improved Nuclease
Inhibitor Cocktail" by Latham et al., filed on Feb. 25, 2004, which
is a continuation-in-part application of co-pending U.S.
application Ser. No. 10/675,860 filed Sep. 30, 2003, which is a
continuation of application Ser. No. 09/669,301 filed Sep. 25,
2000, now U.S. Pat. No. 6,664,379, which claims the benefit of U.S.
Provisional Application No. 60/155,874, filed Sep. 24, 1999. The
entire text of each of the foregoing applications is specifically
incorporated herein by reference without disclaimer.
[0036] In some particular embodiments, the invention relates to
methods of assaying RNA comprising: obtaining at least one
biological unit containing RNA or sample comprising RNA not
comprised in a biological unit; obtaining a low pH buffer; mixing
the biological unit and the buffer to prepare a low pH lysate or
mixing the sample and the buffer to prepare an admixture; and
assaying RNA in the reaction mixture. These methods may then
involve any analysis of RNA known to those of skill in the art or
described herein. Some preferred embodiments comprise adding at
least a portion of the lysate or admixture to a composition
comprising reverse transcriptase to form a reverse transcriptase
reaction mixture and incubating the reaction mixture under
conditions resulting in a reverse transcription reaction to prepare
cDNA. These embodiments may further comprise amplifying cDNA
products of the reverse transcription reaction. Additionally, the
embodiments may comprise determining the presence of and/or
quantity of an RNA in the biological unit. For example, such
detection may comprise use of a labeled probe or intercalating dye
to determine the presence of and/or quantify the RNA.
[0037] In other embodiments, the invention relates to kits for
assaying RNA in a biological unit or sample comprising RNA not
comprised in a biological unit comprising, in one or more suitable
container(s): a low pH buffer, high pH buffer, or RNA precipitating
buffer; a reverse transcription buffer; reverse transcriptase; and
dNTPs. Such kits may also comprise an RNA control. Additionally,
such kits may comprise a thermostable DNA polymerase. The kits may
also comprise an RNase inhibitor. The kits may also include primers
and probes for the control RNA. They may further comprise a PCR
buffer for an RT-PCR reaction and/or oligo dT or random primers for
the reverse transcription step.
[0038] The invention also relates to buffers comprising a
strong-weak acid, which are used in the context of the methods and
kits described herein. To create some preferred buffers, with a
buffer strength of .about.10 mM centering around pH 2.5, preferably
strong-weak acids of pKa <3 to 4, for example pKa 1 to 4 are
employed. For example, chloroacetic acid (pKa=2.9), L-arginine
(pKa=1.8), glycine (pKa=2.4); maleate (pKa=2.0); acetic acid
(pKa=4.8); N-acetylalanine (pKa=3.7); .beta.-acetylaminopropionic
acid (pKa=4.4); N-acetylglycine (pKa=3.7); alanine (pKa=2.3);
2-aminobenzenesulfonic acid (pKa=2.5); 3-aminobenzenesulfonic acid
(pKa=3.7); 4-aminobenzenesulfonic acid (pKa=3.2); 3-aminobenzonic
acid (pKa=4.8); 4-aminobenzonic acid (pKa=4.9); 2-aminobutyric acid
(pKa=2.3); 4-aminobutyric acid (pKa=4.0); 2-amino-3-methylpentanoic
acid (pKa=2.3); 2-amino-2-methylpropionic acid (pKa=2.4);
2-aminopentanoic acid (pKa=2.3); 3-aminopropionic acid (pKa=3.6);
arginine (pKa=1.8); barbituric acid (pKa=4.0); benzoic acid
(pKa=4.2); bromoacetic acid (pKa=2.9); 3-bromobenzoic acid
(pKa=3.8); 4-bromobenzoic acid (pKa=4.0); bromopropynoic acid
(pKa=1.9); 3-tert-butylbenzoic acid (pKa=4.2); 4-tert-butylbenzoic
acid (pKa=4.4); 2-butyric acid (pKa=2.6); butyric acid (pKa=4.8);
N-carbamoylalanine (pKa=3.9); N-carbamoylglycine (pKa=3.9);
3-chlorobenzoic acid (pKa=3.8); 4-chlorobenzoic acid (pKa=4.0);
chloropropynoic acid (pKa=1.85); citric acid (pKa=3.1; 4.8);
cyanoacetic acid (pKa=2.5); 2-cyano-2-methylpropioni- c acid
(pKa=2.4); dimethylmalonic acid (pKa=2.2); dimethylbenzoic acids
(pKa=3.4-4.3); 2-ethylbutyric acid (pKa=4.8); fluroacetic acid
(pKa=2.6); formic acid (pKa=3.8); 2-furancarboxylic acid (pKa=3.2);
glycerol-phosphoric acid (pKa=1.3); glycolic acid (pKa=3.8);
glycylasparagine (pKa=2.9); N-glycylglycine (pKa=3.1); hexanoic
acid (pKa=4.9); 4-hydroxylbenzoic acid (pKa=4.6);
2-hydroxy-1-naphthoic acid (pKa=3.3); 2-hydroxypropionic acid
(3.9); 2-hydroxysuccinic acid (pKa=3.5); iodoacetic acid (pKa=3.2);
isoleucine (pKa=2.3); isopropylmalonic acid (pKa=2.4); lactic acid
(pKa=3.9); leucine (pKa=2.3); methyl benzoic acids (pKa=4.3-4.4);
3-methylbutyric acid (pKa=4.8); 4-methylpentanoic acid (pKa=4.8);
2-methylpropionic acid (pKa=4.9); nitrilotriacetic acid (pKa=1.7,
3.0); 4-nitrobenzoic acid (pKa=3.4); nitrous acid (pKa=3.4);
norleucine (pKa=2.3); oxalic acid (pKa=4.3); pentanoic acid
(pKa=4.9); phosphoric acid (pKa=2.2); o-phthalic acid (pKa=2.9);
proline (pKa=2.0); propenoic acid (pKa=4.3); N-propionylglycine
(pKa=3.7); propynoic acid (pKa=1.9); serine (pKa=2.2); succinic
acid (pKa=4.2); sulfuric acid (pKa=2.0); sulfurous acid (pKa=1.9);
tartaric acid (pKa=3.0); 2,3,5,6-tetramethylbenzoic acid (pKa=3.5);
threonine (pKa=2.1); o-toluidine (pKa=4.3); 1,2,4-triazole
(pKa=2.4); 2,4,6-trimethylbenzoic acid (pKa=3.4);
trimethylsilylbenzene acids (pKa=4.1-4.2); .beta.-ureidopropionic
acid (pKa=4.5); and/or valine (pKa=2.3) may be employed in the
invention. Of course, combinations and derivatives of these acids
can be employed. Currently, arginine, glycine, and chloroacetic
acid may be employed in preferred embodiments.
[0039] The buffer may comprise a detergent, for example a non-ionic
detergent such as Triton X-100, NP 40, or Tween 20; an anionic
detergent, for example, sodium dodecyl sulfate (SDS) or sodium
n-dodecyl benzene sulfonate; or a cationic detergent such as cetyl
trimethyl ammonium bromide (CTAB).
[0040] In other embodiments, the invention relates to the
substitution of high pH buffers and high pH lysates and admixtures
for low pH buffers and low pH lysates and admixtures in all of the
embodiments of the invention described above. As shown in the
examples, such high pH embodiments allow for the realization of
many of the same benefits as low pH embodiments. In this regard,
the invention relates to methods comprising: obtaining at least one
biological unit containing RNA or sample comprising RNA not
comprised in a biological unit; obtaining a high pH buffer;
preparing an admixture of the biological unit and the buffer; and
lysing the biological unit in the buffer or adding the buffer to a
sample comprising RNA not comprised in a biological unit to form a
high pH biological unit lysate or sample admixture. In some
embodiments, the high pH biological unit lysate or admixture has a
pH of from 9 to 14. More preferably, the high pH biological unit
lysate or admixture has a pH of greater than or equal to 11 and
less than 14. These embodiments may further comprise adding at
least a portion of the lysate or admixture to a composition
comprising reverse transcriptase to form a reverse transcriptase
reaction mixture and incubating the reaction mixture under
conditions resulting in a reverse transcription reaction. In such
cases, the reverse transcriptase may be comprised in a reverse
transcriptase buffer that adjusts the pH of the reaction mixture to
a level suitable for reverse transcriptase function. In this case,
the pH of the reaction mixture can be between 7.0 and 9.5, more
preferably, based on the type of reverse transcriptase employed,
the pH is between about 8.0 and 8.4. The invention also encompasses
kits comprising such high pH buffers, as well as the buffers
themselves.
[0041] In addition to preserving RNA, the buffers and methods of
the present invention can be used to preserve other types of
nucleic acids, including DNAs, PNAs, etc.
[0042] As used herein the specification, "a" or "an" may mean one
or more. As used herein in the claim(s), when used in conjunction
with the word "comprising", the words "a" or "an" may mean one or
more than one. As used herein "another" may mean at least a second
or more. As used herein, the phrase "at least one" means one or
more.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0043] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
EXAMPLE 1
A Basic Procedure for Cells Derived from Tissue Culture
[0044] HeLa and K562 cells are used as exemplary cell types that
are suitable for treatment using the compositions and methods
described herein. However, the invention is in no way limited to
the exemplary cell types. It is expected that the compositions and
methods apply to all cell types. One of ordinary skill would, in
light of the disclosure, expect all other cells types to be
amenable to the methods of the present invention.
[0045] To demonstrate the basic methods for cells derived from
tissue culture, HeLa cells (adherent) were grown in Dulbecco's
Modified Eagle Medium (Invitrogen Corp., Cat. #10569-010) with 10%
fetal bovine serum (FBS; Invitrogen Corp. Cat. # 10082-147) in a
tissue culture flask to 50 to 75% confluency. The medium was
removed and then the cells were incubated with 0.05% trypsin in
0.53 mM EDTA for 10 minutes at 37.degree. C. Trypsin was
inactivated by suspending the cells in medium with 10% FBS. Human
K562 cells (suspension) were grown to 5.times.10.sup.5 to
1.times.10.sup.6 cells/ml in DMEM with 10% FBS in a T-75 flask.
HeLa and K562 cell concentrations were determined with a
hemacytometer and then 1 million cells were centrifuged at 3000 rpm
for 5 minutes. The medium was removed and the cells were washed
once with 1 ml of cold phosphate buffered saline (PBS). The cells
were suspended in 100 .mu.l of PBS to obtain a stock solution of
10,000 cells/.mu.l. A five-fold serial dilution of the stock
solution with PBS was carried out to give 10000, 2000, 400, 80 and
16 cells/.mu.l. 10 .mu.l of each dilution were added to 90 .mu.l of
buffer [10 mM L-Arginine, 16 mM HCl, 1% Triton X100, pH 2.5.+-.0.2]
at room temperature such that the final concentrations in the
lysate were equivalent to 1000, 200, 40, 8, and 1.6 cells/.mu.l in
lysis solution (all specific examples in this specification use
this buffer composition in the preparation of cell lysates and/or
biological fluid admixtures, unless otherwise specified). The
lysates were either incubated at room temperature for 1 to 2
minutes after a brief vortexing or gently shaken. 2 .mu.l of the
Control RNA (10 pg/.mu.l) were spiked in 100 .mu.l of the cell
lysate as a positive control. The Control RNA primers and probe
sequences were as follows: Forward primer,
5'-GCTCAATAATCGCCTCACTTGTG-3' (SEQ ID NO.1); Reverse primer,
5'-CAACAAAGGGTACTCGTCTATACTATATAAGC-3' (SEQ ID NO. 2); TaqMan
Probe: 5'-(FAM)-TAGCCAGGCGTTTCCCGCGTTT-(TAMRA)-3' (SEQ ID
NO.3).
[0046] One Step RT-PCR (Reverse Transcription Followed by the
Polymerase Chain Reaction in the Same Reaction Mixture)
[0047] A 1.times. master reaction mixture for RT-PCR (10 .mu.l
reaction volume in a 384 well PCR plate) is prepared with 1 .mu.l
of 10.times. RT buffer (500 mM Tris pH8.3, 750 mM KCl, 50 mM
MgCl.sub.2, 50 mM DTT), 1.6 .mu.l of dNTP mix (2.5 mM each), 0.2
.mu.l of 50.times. ROX standard [5 mg of ROX succinimide ester
(Molecular Probe, Cat. #C-6125) dissolved in 0.5 ml DMSO; dissolve
7.5 mg glycine (100 .mu.moles) in 5 ml 0.1 M Sodium Bicarbonate, pH
8.2; add the ROX ester to the bicarbonate, wrap tube in foil,
rotate at room temperature, 12-18 hours; quench by adding the
entire sample to 24.5 ml of 20 mM Tris-Cl pH8.4, 0.1 mM EDTA, 0.01%
Tween 20. This is a 500.times. stock. Dilute to a 50.times.
solution in of 20 mM Tris-Cl pH 8.4, 0.1 mM EDTA, 0.01% Tween 20.
Store at -20.degree. C.], 0.1 .mu.l (40 U/.mu.l) of placental RNase
inhibitor (RIP; Ambion, Inc. Cat. #2687), 0.4 .mu.l of mixture of
gene specific primers (10 .mu.M each of forward and reverse) and
TaqMan probe (2 .mu.M), 0.08 .mu.l (5 U/.mu.l) of SuperTaq
polymerase (Ambion, Inc. Cat. #2050 or 2052), 0.1 .mu.l of MMLV-RT
(100U/.mu.l, Ambion Inc. Cat. #2043 & 2044) and Nuclease-free
water (Ambion, Inc. Cat. #9937) to 7 .mu.l. For each 10 .mu.l
RT-PCR, the final concentration of each of the components are 50 mM
Tris (pH 8.3), 75 mM KCl, 5 mM MgCl.sub.2, 5 mM DTT, 0.4 mM each
dNTP, 1.times. ROX standard, 0.4 U/.mu.l RIP, 400 nM reverse and
forward primers, 80 nM TaqMan probe, 0.04 U/.mu.l SuperTaq and 1
U/.mu.l MMLV-RT. In a 384-well plate, 3 .mu.l of each cell lysate
dilution from above is added to 7 .mu.l of the master reaction
mixture on ice such that the final cell concentrations in the
RT-PCR reactions are 300, 60, 12, 2.4 and 0.48 cells/.mu.l. Control
reactions are included that do not include reverse transcriptase or
any template by adding nuclease-free water. They should not
generate any detectable signal if primers were designed to span
intron(s) and no pseudogenes are present for the target gene. The
samples were processed in a Prism 7900HT Sequence Detection System
(Applied Biosystems, #4329002) and the following profile run:
42.degree. C., 15 minutes; 95.degree. C, 5 minutes; [95.degree. C.,
15 seconds; 60.degree. C., 60 seconds].times.40 cycles.
[0048] These studies employed the Human CDC-2 (Cell Division Cycle)
gene. Of course, any gene may be employed in regard to the methods
discussed herein. Human CDC-2 primer and probe sequences were
employed as follows: Forward primer, 5'-CCAGAAGTGGAATCTTTACAGGAC-3'
(SEQ ID NO. 4); Reverse primer, 5'-CAAGTTTTTGACATGGGATGCT-3' (SEQ
ID NO. 5); and TaqMan probe:
5'-(FAM)-TACATTTCCCAAATGGAAACCAGGAAGC-(TAMRA)-3' (SEQ ID NO.
6).
[0049] CDC-2 was detected by real-time PCR. These CDC-2 primers did
not span introns. For this reason, the reverse transcriptase minus
reactions produced Ct values 5-7 units higher compared to reverse
transcriptase plus reactions, indicating the detection of the CDC-2
sequence in the genomic DNA (gDNA). Ct refers to "Cycle Threshold."
In real-time PCR, the amount of fluorescent signal is monitored
after each cycle of PCR. Once the signal reaches a certain level,
it has reached the "threshold." The Ct is the number of cycles of
PCR that it took to reach that threshold of fluorescent signal.
Thus, the lower the Ct value, the greater the concentration of
nucleic acid target. In the TaqMan assay, typically each cycle
almost doubles the amount of PCR product and therefore, the
fluorescent signal should double if there is no inhibition of the
reaction and the reaction was nearly 100% efficient with purified
nucleic acid.
[0050] CDC-2 was detected in all cell strains tested: HeLa, K562,
MCF-7, SKNAS, and NHDF-neo (a primary cell line). A plot of the Ct
values against cell lysate concentrations was linear up to 1000
cells/.mu.l. CDC-2 signal was readily detected at cell lysate
concentrations greater than 1000 cells/.mu.l, but the signals were
no longer linear due to an inhibitory effect attributed to the
higher cell concentrations. In addition, the Ct value for the
control RNA was unchanged in all of the cell concentrations up to
1000 cells/.mu.l indicating that there was no inhibition up to 1000
cells/.mu.l. Above 1000 cells/.mu.l, the Ct values were higher,
indicating that the cell lysates and admixtures were creating an
inhibitory effect.
[0051] Two-Step RT-PCR
[0052] For each cell lysate, a 20 .mu.l reverse transcription (RT)
reaction was assembled with 2 .mu.l 10.times. RT buffer (500 mM
Tris [pH 8.3], 750 mM KCl, 50 mM MgCl.sub.2, 50 mM DTT), 2 .mu.l of
random primers or oligo d(T).sub.18 (both at 50 .mu.M), 4 .mu.l
dNTP mix (2.5 mM each), 1 .mu.l RIP (10 U/.mu.l) (Ambion, Inc. Cat.
#2687), and 1 .mu.l of MMLV-RT (25 U/.mu.l) and 4 .mu.l of
RNase-free water (Ambion, Inc., Cat. #9937). As prepared above, 6
.mu.l of each cell lysate dilution was added to 14 .mu.l of the RT
reaction and the reaction was incubated at 42.degree. C. from 15
minutes to 60 minutes to synthesize cDNA. The reverse transcription
reaction was incubated at 92.degree. C. for 10 minutes to
inactivate the MMLV-RT. Control reactions were included that do not
include reverse transcriptase (RT minus) or any template (template
minus).
[0053] To perform PCR, 7.5 .mu.l of the cDNA were combined with 0.2
.mu.l of SuperTaq Polymerase (5U/.mu.l) (Ambion, Inc., Cat. #2050),
2.5 .mu.l 10.times. real-time PCR buffer (100 mM Tris HCl pH 8.3,
500 mM KCl, 8% glycerol, 0.1% Tween 20), 2 .mu.l dNTP mix (2.5 mM
each), 5 .mu.l 25 mM MgCl.sub.2, 1 .mu.l of the primer pair (10
.mu.M mixture of the forward and reverse primers) and 1 .mu.l of
the TaqMan.RTM. probe (2 .mu.M), 0.5 .mu.l 50.times. ROX Standard,
5.3 .mu.l Nuclease-free water (Ambion, Inc.). Human CDC-2 was
detected with the same primers and TaqMan probe sequences as above.
The reactions were placed in an ABI 7700 Prism thermocycler and ran
using following profile: 95.degree. C., 5 minutes; [95.degree. C.,
15 seconds; 60.degree. C., 60 seconds].times.40 cycles.
[0054] CDC-2 was tested in duplicates and detected in all cell
samples that included K562 cells. Ct values against cell
concentrations was linear up to 1000 cells/.mu.l. Of course, those
of skill in the art will be able to readily adapt these
EXAMPLE 2
Exemplary Low pH Buffers of the Invention
[0055] Many of the embodiments of the present invention are based
on low pH buffers for generating cell lysates and body fluid
admixture that can be used directly in RT-PCR or other enzymatic
reactions. Strong-weak acids are used to make a low pH buffer
(about less than pH 3). At this low pH, nuclease activity derived
from a cell lysate is substantially lessened.
[0056] In order to create enough buffer strength (.about.10 mM)
centering around pH 3.0, the inventors decided to use strong-weak
acids (pKa <3 to 4). Chloroacetic acid (Sigma-Aldrich,
#40,292-3), L-arginine (Sigma-Aldrich, #A8094) and glycine
(Sigma-Aldrich, #G7403) were dissolved in water to 10 mM and the pH
was adjusted with 1N HCl (Sigma-Aldrich, #H9892) to between pH 2
and 4. pH .about.2.5 was found to be optimal. All acids worked well
and results were comparable. In considering toxicity and cost,
L-arginine was selected for preferred use, although all the other
acids assessed performed equally. Other strong-weak acids with pKa
<5.0 will also work by the same principle.
[0057] Studies defining of low pH buffers able to function in the
context of the invention were done as set forth in EXAMPLE 1. HeLa
and K562 cells were harvested and cell lysates were prepared using
lysis buffers comprised of the different strong-weak acids
chloroacetic acid, L-arginine and glycine about pH 2.5. 30% in
volume of each cell lysate was added to one step real-time RT-PCR
master reaction mix. In both cell lines, the mRNA of GAPDH and
Rho-A were detected by real-time TaqMan PCR at each cell
concentration up to 1000 cells/.mu.l. Although the primer pair sets
used in these reactions detected genomic DNA, the RT plus reactions
were at least 6 Ct values fewer than the RT minus, indicating that
the mRNA were detected in much greater abundance (at least greater
than about 100-fold) than the genomic DNA sequences.
[0058] Human GAPDH primer and probe sequences were employed as
follows: Forward 5'-CACCAGGGCTGCTTTTAACTCT-3' (SEQ ID NO. 7);
Reverse 5'-TGGAATCATATTGGAACATGTAAACC-3' (SEQ ID NO. 8); TaqMan
probe: 5'-(FAM)-ATATTGTTGCCATCAATGACCCCTTCATTG-(TAMRA)-3' (SEQ ID
NO. 9).
[0059] Human Rho-A Primer and Probe sequences were employed as
follows: Forward 5'-AGGCTGGACTCGGATTCGT-3' (SEQ ID NO. 10); Reverse
5'-TCCATCACCAACAATCACCAGT-3' (SEQ ID NO. 11); TaqMan probe:
5'-(FAM)-CTGAGCAATGGCTGCCATCCGG-(TAMRA)-3' (SEQ ID NO. 12).
[0060] Those of skill will be able to use these, and other similar
test methods to examine the suitability of other low pH buffers in
the context of the invention without undue experimentation.
EXAMPLE 3
The Invention Functions with Multiple Cell Lines
[0061] HeLa, MCF-7, K562, SKNAS, and NHDF-neo (a primary cell line)
were grown to 50-75% confluency in appropriate growth media. The
adherent cells were harvested by trypsin, suspended in growth
medium and counted with a hemacytometer. Suspension cells were
counted directly in their medium. One million cells of each type
was collected and centrifuged at 2000 .times.G for 5 minutes. The
cells were washed with PBS (Ambion, Inc.) and pelleted again by
centrifugation 3,000 rpm (2,000 .times.G) for 5 minutes. The cells
were suspended in 100 .mu.l PBS and five 1:5 dilutions were made in
PBS. Ten .mu.l of each cell suspension was added to 90 .mu.l buffer
at room temperature for final cell concentrations of 1000, 200, 40,
8, and 1.6 cells/.mu.l in the Buffer. Two .mu.l of the positive
control RNA at 10 pg/.mu.l was included in 100 .mu.l of each cell
lysate. After vortexing, the room temperature cell lysate was used
for one step real-time TaqMan RT-PCR (EXAMPLE 1).
[0062] In each cell line, mRNA of C-JUN, CDC-2, GAPDH, PKC-alpha,
VEG-F and the added control RNA was detected by real-time RT-PCR at
each cell concentration. A plot of the Ct values against cell
concentrations was linear up to 1000 cells/.mu.l. For primer pairs
that could amplify genomic DNA, the MMLV-RT minus controls (RT
minus) had significantly higher Ct values compared to RT plus
reactions indicating that the RT-plus reactions were detecting mRNA
and not just the genomic DNA. The positive control RNA generated a
similar Ct value in all cell types from each cell lysate
concentration indicating that there was no inhibition of the
RT-PCR. CDC-2 and GAPDH primers and probe sequences were as in
EXAMPLE 1.
[0063] Human C-JUN primer and probe sequences were employed as
follows: Forward: 5'-ACGTTAACAGTGGGTGCCAA-3' (SEQ ID NO. 13);
Reverse: 5'-CCCCGACGGTCTCTCTTCA-3' (SEQ ID NO. 14); TaqMan Probe:
5'-(FAM)-TCATGCTAACGCAGCAGTTGCAAACA-(TAMRA)-3' (SEQ ID NO. 15).
[0064] Human PKC-alpha primer and probe sequences were employed as
follows: Forward: 5'-ACTCCACGGCGTCTCAGGA-3' (SEQ ID NO. 16);
Reverse: 5'-GCGCGCGATGAATTTGTG-3' (SEQ ID NO. 17); TaqMan Probe:
5'-(FAM)-CCAACCGCTTCGCCCGCAAA-(TAMRA)-3' (SEQ ID NO. 18).
[0065] Human VEG-F primer and probe sequences were employed as
follows: Forward: 5'-GATCGAGTACATCTTCAAGCCATC-3' (SEQ ID NO. 19);
Reverse: 5'-CTCGTCATTGCAGCAGCC-3' (SEQ ID NO. 20); TaqMan Probe:
5'-(FAM)-TGTGTGCCCCTGATGCGATGC-(TAMRA)-3' (SEQ ID NO. 21).
EXAMPLE 4
Use of Methods without the DNase Treatment
[0066] RNA samples are commonly incubated with DNase I to degrade
contaminating genomic DNA prior to using it for RT-PCR such that
the PCR primers only amplify the cDNA and not the genomic DNA. In
using this method, it is preferred that the signal derived from the
genomic DNA should be almost or completely undetectable. The signal
contributed by the genomic DNA is usually assessed by performing
PCR, instead of RT-PCR, on the sample. This reaction is often
referred to as the reverse transcriptase (RT) minus reaction. Since
there is no reverse transcriptase in the reaction, only target DNA
will be amplified. However, the DNase I strategy may be omitted if
primers can be designed that only amplify cDNA or amplify cDNA in
preference to the genomic DNA. It is often possible to design
primers that anneal to sequences in exons spanning a large intron
in the gene of interest if the genomic sequence of the gene is
known. In using this strategy, the PCR product derived from genomic
DNA will be much longer than the cDNA PCR product. The shorter cDNA
PCR product is preferentially amplified usually to the extent that
the genomic product is not detected. Thus, using this strategy, a
DNase treatment is not required to prevent genomic DNA
contamination. Primers and probes designed using this strategy are
commercially available from TaqMan.RTM. Gene Expression Assays--M
Type (Applied Biosystems). No amplification is detected in RT minus
reactions (Example 11).
[0067] In practice, if the Ct value produced by an RT plus reaction
is at least 3 Ct values less than the Ct value from an RT minus
reaction, the genomic DNA contribution to the Ct is less than
(.about.12%). Therefore, omitting the DNase treatment will not
significantly affect the mRNA quantification. The lower the Ct
value, the greater the signal. Thus, if the RT step is contributing
cDNA in much greater excess than the genomic DNA, then one should
observe a lower Ct value in the RT plus reactions. Every 3 cycles
is about an 8-fold (2.times.2.times.2) difference in signal. Thus,
if the RT plus reaction is 3 cycles lower than the RT minus, then
there was about 8-fold more cDNA than genomic DNA.
EXAMPLE 5
RNA Stability of Cell Lysates
[0068] RNA stability was measured from HeLa cells lysed in buffer
and incubated at 5 minutes and 1, 2, 4, 8 and 24 h at room
temperature (.about.21.degree. C.). Concentrations of 1000, 200,
40, 8 and 1.6 cells/.mu.l were assessed. One-step real-time RT-PCR
was performed with CDC-2 and GAPDH as in EXAMPLES 1 and 2 from each
lysate and compared with a fresh lysate. No significant changes in
Ct values were observed over the 24 hour period indicating that the
intactness of the RNA was sufficiently maintained to generate
equally sensitive signals.
[0069] In another study to directly assess intactness, RNA was
isolated using the RNAqueous kit (Ambion, Inc., Cat. #1912)
directly from HeLa cells and from cells disrupted with the buffer
at 1000 cells/.mu.l as above. The purified RNA was fractionated in
an RNA LabChip (Caliper) using the 2100 BioAnalyzer (Agilent). The
ratio of the 28S rRNA to 18S rRNA are an indication of the degree
of RNA intactness. Ratios in a range from about 1.0 to 2.0 reflect
that the RNA is relatively intact. The data from this analysis
demonstrate that the RNA was substantially intact when stored at
room temperature for 8 h but is somewhat degraded at the 24 h
period. However, as noted above, the RNA at all time points
produced equal signals by real-time RT-PCR.
[0070] The ratios of 28S to 18S rRNA as analyzed by the 2100
Bioanalyzer (Agilent) for RNA isolated from cells disrupted using
buffer and stored at room temp (.about.21.degree. C.) for 0 to 24
hr.
1TABLE 1 Cell Lysate 24 h 8 h 4 h 2 h 1 h 5 min 0 h RNAqueous RNA
Conc. (ng/ul) 273.2 413.6 312.1 400.4 393.3 312.4 409.9 246.1 rRNA
ratio (28S/18S) 0.42 1.00 1.03 1.18 1.38 1.34 1.50 1.80
[0071] Of course, those of skill will be able to test the RNA of
any cell lysates or body fluid admixtures of the invention using
these or similar studies.
EXAMPLE 6
Long-Term Stability of the Cell Lysate
[0072] HeLa cell lysates of 1000, 200, 40 and 8 cells/.mu.l were
prepared as in EXAMPLE 1 and stored at -80, -20, 4.degree. C. and
room temperature (.about.21.degree. C.) for one week, one month and
two months. One-step real-time RT-PCR was performed with VEG-F
(EXAMPLES 1 & 3) from each lysate and compared with a lysate
made fresh. The real-time data showed no significant changes in
signal for any storage conditions less than one month.
[0073] The RNA from lysates at 1000 cells/.mu.l stored for one and
two months and from cells freshly lysed were purified using
RNAqueous and analyzed using the RNA LabChip and the 2100
Bioanalyzer (as in EXAMPLE 5). The profile of the RNA stored at
-80.degree. C. and -20.degree. C. for two months was as intact as
the RNA from a fresh lysate.
EXAMPLE 7
Cells Preserved in RNAlater.RTM.
[0074] Compatibility of the invention was tested with cells stored
in RNAlater.RTM. (Ambion Inc. Cat. #7020). RNAlater.RTM. is a
solution that protects RNA from degradation in cells and tissues.
An experiment was performed first to see if RNAlater.RTM. needed to
be washed from the cells before lysing. Cells were washed once with
cold PBS and then suspended in cold PBS and stored on ice. Two
samples of 2.times.10.sup.6 HeLa cells were suspended in 200 .mu.l
RNAlater.RTM. for 2 h on ice. After 2 h, one sample was washed,
suspended and diluted with PBS to 32 to 20,000 cells/.mu.l. The
other sample was diluted in RNAlater.RTM. to 32 to 20,000
cells/.mu.l. Cell lysate was made by adding 5 .mu.l of the cells to
95 .mu.l of lysis buffer for one-step RT-PCR (EXAMPLE 1). CDC-2,
GAPDH, VEG-F and PKC-.alpha. one-step, real-time RT-PCR were
performed in duplicate on each cell lysates with lysate
concentrations of 1000, 200, 40 cell, 8 and 1.6 cells/.mu.l
(EXAMPLES 1, 2 and 3). Cells taken directly from RNAlater for cell
lysis did not generate signal whereas those cells stored in
RNAlater, washed in PBS and then subjected to cell lysis generated
a strong signal in real-time RT-PCR.
[0075] Cells stored in RNAlater.RTM. 24 h at room temperature were
then tested with the acid lysis protocol after washing with PBS. A
total 2.times.10.sup.6 HeLa cells were stored in 1 ml of
RNAlater.RTM. at room temp for 24 h. The RNAlater.RTM. was removed
by centrifuging the cells at 3000 rpm for 5 minutes at 4.degree. C.
The pelleted cells were suspended in PBS, and kept on ice. This was
compared to cells lysed freshly. GAPDH and VEG-F one-step RT-PCR
were performed in duplicate on cell lysates with lysate
concentrations of 1000, 200, 40 and 8 cells/.mu.l. There was no
difference in signal among the differently treated samples.
EXAMPLE 8
Use of Methods on siRNA Validation
[0076] Cells-to-Signal can be used to measure the siRNA knockdown
of gene expression. siRNA are .about.21 base pair double-stranded
RNAs that can be used to specifically target the degradation of an
mRNA by transfecting these siRNA into a cell (Elbashir, 2001).
30000 HeLa or MCF-7 cells were seeded in each well of a 24-well
culture plate (Nalge Nunc International, Cat. # 143982) in 450
.mu.l of Dulbecco's Modified Eagle Medium (DME; Invitrogen Corp.,
Cat. #10569-010) with 10% fetal bovine serum (Invitrogen Corp.,
Cat. #10082-147). Gene specific siRNAs (GAPDH, Ambion, Inc., Cat.
#4605; RAF1, Ambion, Inc., Cat. #51197) and a negative control
scrambled siRNA sequence (Ambion, Inc., Cat. #4605) were diluted in
OptiMem to a 10.times. concentration to which 2 .mu.l of
Oligofectamine.TM. transfection reagent (Invitrogen, Cat.
#12252-011) was added and incubated for 15 minutes at room
temperature (.about.21.degree. C.). 50 .mu.l of the complex in
OptiMem was then added to the cells. The cells were then incubated
at 37.degree. C. for 48 hrs. The medium was removed and the cells
washed once with PBS. 500 .mu.l of buffer was added to the
transfected culture cells and the plates shaken for 5 minutes at
room temperature. Each cell lysate was tested in one step real-time
RT-PCR reaction for GAPDH, RAF and 18S rRNA in triplicate (EXAMPLE
1).
[0077] The expression levels of GAPDH and RAF were decreased by
>80% by their respective gene specific siRNAs after
normalization with 18S rRNA as assessed by RT-PCR. GAPDH levels in
HeLa cells were decreased by 88% with 3 nM of its siRNA compared to
3 nM of scrambled negative control, while the expression of 18S
rRNA was unchanged.
[0078] Human RAF1 primer and probe sequences were employed as
follows: Forward: 5'-CCCCAACAATCTGAGCCCA-3' (SEQ ID NO. 22);
Reverse: 5'-GGGTCCCAGATACTGGTGCC-3' (SEQ ID NO. 23); TaqMan Probe:
5'-(FAM)-TCACAGCCGAAAACCCCCGTGC-(TAMRA)-3' (SEQ ID NO. 24).
[0079] Human 18S rRNA primer and probe sequences were employed as
follows Forward: 5'-TCAAGAACGAAAGTCGGAGG-3' (SEQ ID NO. 25);
Reverse: 5'-GGACATCTAAGGGCATCACA-3' (SEQ ID NO. 26); TaqMan Probe:
5'-(FAM)-TGGCTGAACGCCACTTGTCCCTCTAA-(TAMRA)-3' (SEQ ID NO. 27).
EXAMPLE 9
SYBR Green Real-time PCR
[0080] HeLa and K562 cells were processed with buffer to
concentrations of 1000, 200, 40, 8 and 1.6 cells/.mu.l. 2 .mu.l of
positive control RNA (10 pg/.mu.l) was spiked into 100 .mu.l of
each cell lysate and into buffer without cells as in EXAMPLE 1. For
two-step, real time RT-PCR, reverse transcription was carried out
separately with either oligo dT primers or random decamers (EXAMPLE
1). Real-time PCR for CDC-2, GAPDH and control RNA was performed
using the cDNA from the reverse transcription step (EXAMPLES 1 and
2).
[0081] SYBR Green (Molecular Probes, S-7563, 10000.times.
concentration in DMSO) was first diluted 1:100 in water and 25
.mu.l of it was added to 975 .mu.l of 10.times. RT buffer (500 mM
Tris pH 8.3, 750 mM KCl, 50 mM MgCl.sub.2, 50 mM DTT) for a final
dilution of 1:4000 in the RT buffer. A 1.times. master reaction
mixture of 10 .mu.l reaction is prepared with 1 .mu.l of 10.times.
real time buffer (100 mM Tris-HCl pH 8.3, 500 mM KCl, 8% glycerol,
0.1% Tween 20) with final 1:4000 diluted SYBR Green in it, 1.6
.mu.l of dNTP mix (2.5 mM each), 0.2 .mu.l of 50.times. ROX
standard (see Example I), 0.1 .mu.l (40 U/.mu.l) of placental RNase
inhibitor (Ambion, Inc. Cat. #2687), 0.4 .mu.l of mixture of gene
specific primers and TaqMan probe (10 .mu.M of forward and reverse
primers and 2 .mu.M of the TaqMan probe), 0.08 .mu.l (5 U/.mu.l) of
SuperTaq polymerase (Ambion, Inc. Cat. #2050 or 2052), 0.1 .mu.l of
MMLV-RT (100 U/.mu.l, Ambion Inc. Cat. #2043 & 2044) and
Nuclease-free water (Ambion, Inc. Cat. #9937) added to bring the
volume to 7 .mu.l. In a 384-well plate, 3 .mu.l of each cDNA from
the RT reaction is added to 7 .mu.l of the master reaction mixture
on ice. Place the samples in the Prism 7900HT Sequence Detection
System (Applied Biosystems, Product #4329002) and run the following
profile: 95.degree. C., 5 minutes; [95.degree. C., 15 seconds;
60.degree. C., 60 seconds].times.40 cycles with dissociation
protocol.
[0082] Real-time PCR for CDC-2 and the positive control RNA were
performed with their primers and probes on cDNA from the RT step
(primer and probe sequences in EXAMPLES 1 and 2). The dissociation
curves of the two-step SYBR Green RT-PCR from CDC-2 and the control
RNA generated single peaks indicating gene specific products. Ct
values for CDC-2 were linear (R.sup.2=0.99) with log cell inputs
for two cell lines tested (HeLa and K562) with either oligo(dT)
priming or random decamer priming.
EXAMPLE 10
Multi-Well Format for Gene Expression Analysis and Comparison of
Methods to RNAqueous-MAG, an established RNA Isolation Method
[0083] Cells-to-Signal and an established RNA isolation method
[RNAqueous-MAG, a 96-well Automated Kit (Ambion Inc. Cat. #1812)]
were compared in a 96-well plate experiment. To demonstrate the
utility of the invention in a multi-well format for gene expression
analysis, 3000 HeLa cells were plated in 48 wells of a 96-well
plate and 3000 MCF-7 cells were seeded in the other 48 wells and
grown overnight in 0.2 ml DME medium with 10% FBS (Phenix, Cat.
#TC-9296). For the Cells-to-Signal protocol, the medium was removed
and the cells washed with 0.2 ml PBS. 200 .mu.l of buffer was added
to each well and the plate was shaken on a plate shaker at 60 rpm
for 5 minutes at room temperature (.about.21.degree. C.). For the
RNAqueous-MAG protocol, a laboratory automation workstation (Biomek
2000, Beckman) was used and all processing steps were entered into
it for automation. The final RNA product was eluted to 200
.mu.l.
[0084] One step real-time RT-PCR to detect GAPDH and VEG-F was
performed using the RNA purified from RNAqueous MAG and the cell
lysates as templates, in a 384-well Plate (EXAMPLES 1, 2 and 3). In
each sample, GAPDH and VEG-F was detected by real-time PCR. Ct
values for GAPDH and VEG-F from HeLa and MCF-7 cells were almost
identical between the two methods. The preparation of template by
Cells-to-Signal was completed one hour faster than by the automated
RNAqueous-MAG.
2TABLE 2 Gene GAPDH (Ct Values) VEG-F (Ct Values) Method
RNAqueous-Mag Cells-to-Signal RNAqueous-Mag Cells-to-signal Cell
line Ave Ct St dev CV % Ave Ct St dev CV % Ave Ct St dev CV % Ave
Ct St dev CV % HeLa 20.65 0.45 2.2 20.47 0.16 0.8 26.71 0.45 1.8
26.54 0.20 0.8 MCF-7 21.90 0.24 1.1 22.08 0.20 0.9 27.92 0.24 0.86
28.2 0.29 1.0
EXAMPLE 11
Compatibility of the Invention with TaqMan.RTM. Gene Expression
Assays
[0085] TaqMan.RTM. Gene Expression Assays (Applied Biosystems) are
pre-designed primers and probe sets for real-time TaqMan PCR. Two
different types of primers and probe sets were tested: "M"--primers
from multiple exons that are designed to eliminate signal from
genomic DNA, and "S"--primers that hybridize to a single exon and
may amplify genomic DNA.
[0086] HeLa cells were harvested and suspended in buffer to
concentrations of 1000, 200, 40 and 8 cells/.mu.l (EXAMPLE 1). One
step, real-time TaqMan RT-PCR reactions were prepared with 10
different TaqMan.RTM. Gene Expression Assays including C-JUN (S),
CDC-2 (M), ATP10 (S), GJA1 (S), KRT6B (S), MGAT2 (S), PTP4A1 (S),
COL6A2 (S), BCL2 (S) and CCNA1 (M) as in EXAMPLE 1. Prepare lx
master reaction mixture of 10 .mu.l reaction with 0.5 .mu.l of the
primers/probe mixture (20.times.) instead of the 0.4 .mu.l gene
specific primers and TaqMan probe (10 .mu.M of forward and reverse
primers and 2 .mu.M of the TaqMan probe) as described in EXAMPLE
1.
[0087] All of the TaqMan.RTM. Gene Expression Assays primers/probe
sets were able to detect their respective mRNA from each cell
lysate. RT minus reactions did not generate any detectable signal
from the "M"--type assays whereas for the S-type, only C-JUN and
PTP4A1 showed >5Ct difference between RT plus and RT minus
reactions. For all other S types, Ct difference was only 1-3.
EXAMPLE 12
Use of Methods on Whole Blood
[0088] Fresh blood was drawn using a Microtainer safety flow lancet
(Becton Dickinson, Cat. # 366357). 1 to 20 .mu.l of fresh
finger-prick whole blood was transferred to a 1.5 ml nuclease-free
microfuge tube (Ambion, Inc., Cat. #12400) with 20 .mu.l pipet
barrier tips (Ambion, Inc., Cat. #12645) and was lysed with buffer
(EXAMPLE 1) containing the positive control RNA. 3 .mu.l of the
whole blood lysate was used for one-step real time RT-PCR. Both
spiked control RNA and 18S rRNA were detected when up to 10 .mu.l
of whole blood was processed with 90 .mu.l buffer.
EXAMPLE 13
Use of Invention on Leukocyte Enriched Blood
[0089] Volumes from 6.25 .mu.l to 100 .mu.l of fresh human whole
blood drawn by the finger-prick method were mixed with 1.2 ml of
red blood cell (RBC) lysis solution (144 mM NH.sub.4Cl, 1 mM EDTA,
1 mM NaHCO.sub.3, pH 7.0), vortexed, and then incubated on ice for
5 minutes to preferentially lyse the red cells. The lysate was
centrifuged for 5 min at 800 .times.G to pellet the leukocytes. The
supernatant was removed and the enriched leukocytes were processed
with 100 .mu.l buffer (EXAMPLE 1). 3 .mu.l of the leukocyte lysates
were used for a 10 .mu.l qRT-PCR to quantify C-JUN, Rho-A, VEG-F
(EXAMPLES 2 and 3), alpha 1 hemoglobin (HBA 1) and beta hemoglobin
(HBB). All genes were detected from the leukocyte lysates derived
from 1 .mu.l to 15 .mu.l of whole blood. The Ct values were linear
up to 10 .mu.l whole blood or approximately 70,000 leukocytes.
[0090] Human HBA1 Primer and Probe sequences were: Forward primer,
5'-CGCCTCCCTGGACAAGTTC-3' (SEQ ID NO. 28); Reverse primer,
5'-GCTCCAGCTTAACGGTATTTGG-3' (SEQ ID NO. 29); TaqMan probe:
5'-(FAM)-TGGCTTCTGTGAGCACCGTGCTG-(TAMRA)-3' (SEQ ID NO. 30).
[0091] Human HBB Primer and Probe sequences were: Forward primer,
5'-GCTGGCCCATCACTTTGG-3' (SEQ ID NO. 31); Reverse primer,
5'-CCAGCCACCACTTTCTGATAGG-3' (SEQ ID NO. 32); TaqMan probe:
5'-(FAM)-AGAATTCACCCCACCAGTGCAGGC-(TAMRA)-3' (SEQ ID NO. 33).
EXAMPLE 14
Monitoring Effects of Drug Treatment with the Invention
[0092] HeLa cells were seeded DME media with 10% FBS in each of
three wells in a 12-well tissue culture plate (Nalge Nunc
International, Cat. #150628) at 125,000 cells/well. After an
overnight incubation, phorbol myristate acetate (PMA) was added to
final concentrations of 10, 1 and 0 nM in the growth medium. The
cells were incubated at 37.degree. C. for 24 hours. The medium was
removed and the cells washed with PBS. The cells were incubated
with 0.05% trypsin in 0.53 mM EDTA for 10 minutes at 37.degree. C.
to detach the cells. Cells were counted and concentration was
determined. Cells were centrifuged at 800.times.g for 5 minutes.
The medium was removed and the cells were washed once with PBS.
Each cell pellet was suspended in PBS to obtain a stock solution of
10000 cells/.mu.l. A five-fold serial dilution of the stock
solution with PBS was carried out to give 10000, 2000 and 400
cells/.mu.l. 10 .mu.l of each dilution was added to 90 .mu.l of
Buffer at room temperature such that the final cell concentrations
in the lysate were 1000, 200 and 40 cells/.mu.l. The samples were
gently shaken at room temperature (.about.21.degree. C.) for 1 to 2
min. As in EXAMPLE 1, cell lysate of 30% of the final reaction
volume was added to a one step real-time RT-PCR reaction with
primers and TaqMan probe for tissue plasminogen activator (t-PA)
and 18S rRNA (EXAMPLE 8). The t-PA primer and probe sequences were
as follows: Forward primer, 5'-GGCGCAGTGCTTCTCTACAG-3' (SEQ ID NO.
34); Reverse primer, 5'-TAGGGTCTCGTCCCGCTTC-3' (SEQ ID NO. 35);
TaqMan Probe: 5'-(FAM)-TTCTCCAGACCCACCACACCGC-(TAMRA)-3' (SEQ ID
NO. 36).
[0093] Control RNA (1036 nt long artificial mRNA) sequence: (SEQ ID
NO. 37)
3 GGGAGAAGACUGCGGCAUAUAAGCGCUCAAUGGCCCUUACUUGUUGCCUA
GAUUAUAUUAAAGAUCCAUACGUUACCUGCCAACCGUCAACUCCCCGACG
UCCUUUACUUGAGAACAUCGAGCAAAUCUUCUGCCACCUAAGCGGCCGCA
GCCUAAAGAUUACUUAGUUCUGUUGGGUGCUGCAAUAACAACAAAGGGUA
CUCGUCUAUACUAUAUAAGCGCGAUAAUAUCUAGAAACGCGGGAAACGCC
UGGCUAGUCAUCGCACAAGUGAGGCGAUUAUUGAGCCAAUCAUCGGCGAU
UAACUUAAAGAAAAGCGGGUACGGGAUAUCGCUAUGUGCCGCGGCAAAGG
CUGCCAACAUAAAAUGUGCAAGCGUAAAUGCAGCGUCCAUGGUAAAAUUA
GUUUGAGCCUUGAUGUCUUAGAUGAUCCACUAAUCGGCUACCCUUGCUAG
UAGGUGUAGAUUCUCGAAAAGUCUUUUAGUAGGUGAUCCUCUGGUACGUC
AUAUAAUAUAUCUGCUCUAUAUAGCCACUUCCACGCUUAGAUCUCCGUGC
UCAUCACCAUCCGUAGAUCGUCGACCUCUCAUACUCUAGUCACUGUGGUG
UUCGUGGGUGCAGGUAUUGACAGGCUCAUACAUAUAAUAUGAAAUUGGGC
CUUCCGCAGCUCUGAACUAUCGAGCUUCCUUCUAAGAAUGAAUGUUGGGA
AGCCCGAUUUGAUAAACGCACGGCGCAAUAGCUAAACAGAUCUUAGGAGU
UUCACCACUGGAGUCAGCGUAAAUACACUGAUCUUGCGAAAAUAGUUGGC
CGUCUUAUAAACUGAGUAGAGCGCGCUUGCGUCCAAUACGAUUAGAUUCC
AACCGCGAUGCCACUAUGGCGUACAAAUAAGAAUGUUUUCAAGGGGAUAA
GAUGGAGUCAUCUGGCCGCGUAACCCUACAAAAAAAAUGAACCGUAAUAG
AGCAGUUGUACAUCGAGACGUACGUUGCACGAAAAAUAGUGACUUUACGU
CAGUACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
[0094] t-PA was detected by real-time PCR at all cell
concentrations and PMA concentrations. As expected (Arts, 1997),
the level of t-PA MRNA increased when the cells were grown in the
presence of PMA (Table 3).
4TABLE 3 Leukocyte Lysate t-PA (fold increase compared to
(cells/.mu.l) PMA (nM) 0 nM PMA) 1000 1 8 1000 10 39 200 1 9 200 10
62 40 1 16 40 10 147
EXAMPLE 15
Use of the Invention with Fixed Cells
[0095] HeLa and MCF-7 cells grown to 80% confluency in DME media
with 10% FBS were harvested and washed with PBS. The cells were
then fixed using three different methods: formalin,
paraformadehyde, or ethanol fixation. The cells were suspended in 1
ml of 4% formalin or paraformaldehyde in PBS. The cells were
incubated on wet ice for 2 hours. For the ethanol fixation, the
cells were subjected to a gradient fixation protocol. The cells
were suspended in 75% ethanol at room temperature for 30 seconds
then spun down and removed. The cells were then washed with 85%
ethanol, followed by 95% and 100% at room temperature for 30
seconds. The cells were left in 100% ethanol for 1 hour on ice.
[0096] After the fixation, the cells were washed twice with 1 ml
ice cold PBS, suspended in PBS and lysed with buffer. This was
compared with cells that were not fixed. Cell lysates were used in
one-step real-time RT-PCR at cell concentrations of 1000, 200, 40
and 8 cells/.mu.l to detect GAPDH and VEG-F. Signals were detected
for both genes in both cell lines, but for nearly all of the
samples, the Ct values were higher for the fixed cells. However,
this does indicate that fixed cells can be employed in at least
some embodiments of the invention.
EXAMPLE 16
Immunoblotting using the Cell Lysate
[0097] Measuring protein concentrations is an important tool for
RNAi experiments and it may become more important if miRNA or miRNA
inhibitors are used to screen target gene expression, analyze
pathways, identify antagonistic or cooperative miRNA effects or
determine the optimal combinations of miRNA that regulate a given
gene. Since the buffer does not contain any reagents that will
degrade protein, the cell lysates may also be used for detecting
protein by immunoblotting or ELISA. Thus, after a target MRNA was
demonstrated to be up- or down-regulated by RT-PCR from a cell
lysate, then the same cell lysate could be used to assay for the
effect on the translated protein.
[0098] HeLa cells were transfected with siRNA for GAPDH or
scrambled sequence siRNA (Ambion, Cat. #4605). 48 hours after
transfection, the cells were processed with buffer to a
concentration of 1000 cells/.mu.l. Real-time RT-PCR was performed
for the cells transfected with the scrambled and GAPDH siRNA. The
cells transfected with the GAPDH siRNA had a decreased
concentration of GAPDH mRNA. Additionally, 1 M TRIS pH 8.0 was used
to raise the pH of the cell lysates, the protein concentration was
assessed using a Bradford assay, 6.times. SDS PAGE loading buffer
was added to the lysate and incubated at 95.degree. C. for 3
minutes. The lysates were fractionated on a 10% acrylamide gel and
then the proteins were transferred to nitrocellulose membrane.
Using standard immunoblotting procedures, the immunoblot was probed
using an anti-GAPDH antibody (Ambion, Cat. #4300) at 1:5000 in
PBSTM (PBS, 0.05% Tween20, 5% non-fat dry milk) at 4.degree. C. for
overnight and an anti-mouse HRP antibody was used as the secondary
antibody at 1:5000 in PBSTM, incubated for 60 minutes at room
temperature (.about.21.degree. C.). The blot was washed five times
with PBST. SuperSignal.RTM. West Pico Chemiluminescent Substrate
Kit (Pierce, Cat. #34080) was used for detection. The GAPDH protein
was reduced in the cells transfected with siRNA compared to the
transfected with scrambled sequence, correlating with the real-time
RT-PCR data.
[0099] In some cases, the protein concentration of the protein to
be analyzed may be near the limit of detection in the cell lysate.
It is possible to increase the protein concentration by
precipitating the protein from the cell lysate prior to
immunoblotting. Such standard procedures known by those skilled in
the art are acid precipitation (for example, with 10%
trichloroacetic acid), ethanol precipitation, or acetone
precipitation (e.g., see, http://www.ls.huji.ac.il/.about.purific-
ation/Protocols/ProteinPrecipitation.html).
EXAMPLE 17
RNA Amplification
[0100] DNA microarrays enable scientists to assess the level of
multiple different mRNAs in a biological sample at a specific point
in time. By comparing the expression levels of different genes from
biological samples derived from different tissues or subjected to
different environmental conditions, it is possible to infer which
genes are responsible for generating specific phenotypes. This
process is called expression profiling.
[0101] Expression profiling typically requires that total RNA is
isolated from the biological sample and then the RNA must be
labeled, prior to its hybridization to the microarray. In many
instances, the amount of RNA isolated from the biological sample is
too low to be useful for this procedure and therefore, there are
methods available for increasing the starting material. The
MessageAmp.TM. kits (Ambion, Inc.; Cat. #1750 & 1751) are based
on the procedure of Phillips (1996) and are used to
representationally increase the absolute amount of a total RNA
sample by over 100-fold, often 1000-fold and can be used to go as
high as 1 million-fold. This procedure is also used to label an RNA
sample with biotin or a fluorescent dye for the purposes of probing
a DNA microarray. Typically, the starting material for amplifying
RNA is a minimum of .about.100 ng of total RNA from the sample.
Briefly, the procedure is as follows. The RNA is reverse
transcribed in the presence of an oligonucleotide primer that
encodes an RNA polymerase promoter such as a T7 phage promoter. In
the procedure by Kacian (U.S. Pat. No. 5,554,516), the material is
transcribed by T7 RNA polymerase to synthesize RNA. In the
procedure by Phillips (1996), a second strand of cDNA is produced
and then the double-stranded DNA is transcribed by a phage
polymerase.
[0102] Lysates and admixtures generated using the buffer will
function in the MessageAmp procedure using the same cell
concentrations in the RT step as used in real-time RT-PCR. This
will be useful when a large number of samples are being prepared in
a multi-well plate, especially for microarrays that are formatted
in 96- or 384-wells plates (Gene XP Biosciences, BioGridArray).
EXAMPLE 18
Use of Invention with an Alkaline Lysis Buffer
[0103] A comparison was made of the chloroacetic lysis buffer and
the citric acid lysis buffer at pH 3.0. 10 mM of each was made with
1% Tx-100 and HCl was added to pH to 3.0. Another lysis buffer was
made with 1 mM NaOH and 1% Tx-100 at pH 11.0. HeLa S3 cells were
harvested and suspended and diluted in PBS. 10 .mu.l of each cell
suspension was added to 90 .mu.l of each lysis buffer. The samples
were lysed at 50.degree. C. for 5 minutes. GAPDH was assayed by
one-step qRT-PCR using 3 .mu.l of lysate in a 10 .mu.l reaction.
The Ct values derived from the alkaline lysis were comparable to
those of the acidic buffers (Table 4).
5 TABLE 4 Cells/.mu.l of Lysate 10,000 1,000 100 10 Chloroacetic
13.30 .+-. 0.75 14.64 .+-. 0.11 17.02 .+-. 0.49 20.18 .+-. 0.26
Buffer Citric Acid 13.61 .+-. 0.85 15.98 .+-. 0.58 19.36 .+-. 0.70
21.61 .+-. 0.70 1 mM NaOH 40.00 .+-. 0.00 17.08 .+-. 0.32 17.74
.+-. 0.11 20.31 .+-. 0.20
EXAMPLE 19
Cellular RNA Protected and Precipitated in the Acidic Cell
Pellet
[0104] To test if the acidic lysis buffer precipitates the cellular
RNA in the acidic cell lysate, experiments were performed on HeLa
cell lysates. 3.times.10.sup.6 HeLa cells were harvested and washed
once in PBS. The cells were suspended in 300 .mu.l of PBS to a
concentration of 10000 cells/.mu.l and kept on ice as in EXAMPLE 1.
Three sets of cell lysates were made by adding 20 .mu.l of the cell
suspension to 180 .mu.l of acidic lysis buffer, a final
concentration of 1000 cells/.mu.l. The cell lysates were incubated
for 2 min at room temperature and duplicates were centrifuged for 2
min at 13000 rpm while one set was not centrifuged as a control.
Supernatants were carefully removed to new tubes. RNA from each
pellet and supernatant as well as from the total cell lysate was
purified using a silica filter based total RNA isolation kit with
10 .mu.l of total elution (RNAqueous-Micro kit, Ambion, Inc. Cat. #
1927) and analyzed using the 2100 Bioanalyzer (Agilent). 1 .mu.l of
100 ng of HeLa S3 total RNA (Ambion Inc. Cat. #7852) was used as a
positive RNA control on the Agilent gel analysis. The RNA from each
of the samples were intact. The majority of the RNA was in the
pellets. The ratio was .about.3.5 comparing the quantity of the RNA
in pellet to the supernatant (Table 5).
6TABLE 5 RNA purified Total cell HeLa S3 total from: lysate Pellet
1 Supernatant 1 Pellet 2 Supernatant 2 RNA (100 ng/ul) RNA 294.15
ng/ul 280.57 nl/ul 72.56 ng/ul 188.58 ng/ul 55.13 ng/ul 118.96
ng/ul concentration rRNA ratio 1.28 1.45 1.51 1.50 1.32 1.33
(28S/18S)
EXAMPLE 20
Assaying RNA in Saliva, Plasma, and Other Body Fluids
[0105] Saliva, like other bodily fluids, has been used to monitor
human health and disease. Li et al. (2004) demonstrated that human
MRNA exists in cell-free saliva, and this indicates that salivary
mRNA may provide potential biomarkers to identify populations and
patients at high risk for oral and systemic diseases. This
demonstrates that RNA can be isolated from the cell-free saliva
supematant and linearly amplified with RT-PCR. It is anticipated
that other cell free bodily fluids will contain such mRNA as well,
and that this MRNA will be amenable to amplification and other
techniques. Further, Silva et al. (2002) determined the presence of
plasma tumor RNA in patients with colon cancer patients, indicating
that the methods and buffers of the invention can be used in
context with plasma to assay for cancer and other disease
states.
[0106] In this regard, the methods and compositions of the present
invention will provide significant advantages by allowing for a
streamlined collection then usage of bodily fluids comprising the
use of buffers of the invention to stabilize RNA in body fluid
samples.
[0107] For example, one will, in view of this specification, obtain
a saliva, plasma, or other body fluid sample including but not
limited to serum, urine, whole blood, sputum, fecal matter, or
cerebral spinal fluid, mix the body fluid with a low pH, high pH,
or RNA precipitating buffer to form a body fluid admixture, and
then perform any RNA-based molecular biology procedure on the
admixture. In particular, the studies and techniques performed
above with cell lysates above can be performed with body fluid
admixtures without undue experimentation.
REFERENCES
[0108] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0109] U.S. Pat. No. 5,386,024
[0110] U.S. Pat. No. 5,399,491
[0111] U.S. Pat. No. 5,554,516
[0112] U.S. Pat. No. 5,554,516
[0113] U.S. Pat. No. 5,693,467
[0114] U.S. Pat. No. 5,891,636
[0115] U.S. Pat. No. 5,973,137
[0116] U.S. Pat. No. 6,316,608
[0117] U.S. Pat. No. 6,610,475
[0118] U.S. Pat. No. 6,664,379
[0119] U.S. patent application Ser. No. 09/160,284
[0120] U.S. patent application Ser. No. 09/815,577
[0121] U.S. patent application Ser. No. 10/352,806
[0122] U.S. patent application Ser. No. 10/675,860
[0123] U.S. patent application Ser. No. 10/786,875
[0124] PCT Appln. PCT/US90/03907
[0125] Arts et al., Nucleic Acids Res., 25:311-317, 1997.
[0126] Brady and Iscove, Methods Enzymol., 225:611-623, 1993.
[0127] Busche et al., J. Am. Pathol., 157:605-611, 2000.
[0128] Compton, Nature, 350:91-92, 1991.
[0129] Elbashir et al., Methods, 26:199-213, 2002.
[0130] Fink et al., Am. J. Pathol., 157:1459-1466, 2000a.
[0131] Fink et al., Laboratory Invest., 80:327-333, 2000b.
[0132] Gaynor et al., Biotechniques, 21: 286-291, 1996.
[0133] Klebe et al., BioTechniques, 21:1094-1100, 1996.
[0134] Liss, Nucleic Acids Res., 30:89, 2002.
[0135] Li et al., J Dent Res.; 83(3):199-203, 2004.
[0136] Lockhart et al., Nat. Biotechnol., 14:1675-1680, 1996.
[0137] Matsubara et al., Hum. Immunol., 35:132-139, 1992.
[0138] Mesink et al., Br. J Haematol., 102:768-774, 1998.
[0139] Myers et al., Biochemistry, 30:7661-7666, 1991.
[0140] O'Leary, Clin. Chem., 45:449-450, 1999.
[0141] Phillips and Eberwine, Methods, 10:283-288, 1996.
[0142] Retzel et al., Biochemistry, 19(3):513-518, 1980.
[0143] Silva et al., Gut, 50(4):530-4, 2002.
[0144] Su et al., BioTechniques, 22:1107-1113, 1997.
[0145] Tang et al., J. Microbiol. Methods, 39:121-126, 2000.
[0146] Tyagi and Kramer, Nat. Biotechnol., 14:303-308, 1996.
[0147] Yan et al., Anal. Biochem., 304:267-270, 2002.
Sequence CWU 1
1
37 1 23 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 1 gctcaataat cgcctcactt gtg 23 2 32 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 2
caacaaaggg tactcgtcta tactatataa gc 32 3 22 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 3 tagccaggcg
tttcccgcgt tt 22 4 24 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 4 ccagaagtgg aatctttaca ggac
24 5 22 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 5 caagtttttg acatgggatg ct 22 6 28 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 6
tacatttccc aaatggaaac caggaagc 28 7 22 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 7 caccagggct
gcttttaact ct 22 8 26 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 8 tggaatcata ttggaacatg taaacc
26 9 30 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 9 atattgttgc catcaatgac cccttcattg 30 10 19 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 10 aggctggact cggattcgt 19 11 22 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 11 tccatcacca
acaatcacca gt 22 12 22 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 12 ctgagcaatg gctgccatcc gg 22
13 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 13 acgttaacag tgggtgccaa 20 14 19 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 14
ccccgacggt ctctcttca 19 15 26 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 15 tcatgctaac gcagcagttg
caaaca 26 16 19 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 16 actccacggc gtctcagga 19 17 18 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 17 gcgcgcgatg aatttgtg 18 18 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 18 ccaaccgctt
cgcccgcaaa 20 19 24 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 19 gatcgagtac atcttcaagc catc
24 20 18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 20 ctcgtcattg cagcagcc 18 21 21 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 21
tgtgtgcccc tgatgcgatg c 21 22 19 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 22 ccccaacaat
ctgagccca 19 23 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 23 gggtcccaga tactggtgcc 20 24
22 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 24 tcacagccga aaacccccgt gc 22 25 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 25 tcaagaacga aagtcggagg 20 26 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 26 ggacatctaa
gggcatcaca 20 27 26 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 27 tggctgaacg ccacttgtcc
ctctaa 26 28 19 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 28 cgcctccctg gacaagttc 19 29 22 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 29 gctccagctt aacggtattt gg 22 30 23 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 30 tggcttctgt
gagcaccgtg ctg 23 31 18 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 31 gctggcccat cactttgg 18 32
22 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 32 ccagccacca ctttctgata gg 22 33 24 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 33 agaattcacc ccaccagtgc aggc 24 34 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 34
ggcgcagtgc ttctctacag 20 35 19 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 35 tagggtctcg tcccgcttc 19
36 22 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 36 ttctccagac ccaccacacc gc 22 37 1036 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 37 gggagaagac ugcggcauau aagcgcucaa uggcccuuac uuguugccua
gauuauauua 60 aagauccaua cguuaccugc caaccgucaa cuccccgacg
uccuuuacuu gagaacaucg 120 agcaaaucuu cugccaccua agcggccgca
gccuaaagau uacuuaguuc uguugggugc 180 ugcaauaaca acaaagggua
cucgucuaua cuauauaagc gcgauaauau cuagaaacgc 240 gggaaacgcc
uggcuaguca ucgcacaagu gaggcgauua uugagccaau caucggcgau 300
uaacuuaaag aaaagcgggu acgggauauc gcuaugugcc gcggcaaagg cugccaacau
360 aaaaugugca agcguaaaug cagcguccau gguaaaauua guuugagccu
ugaugucuua 420 gaugauccac uaaucggcua cccuugcuag uagguguaga
uucucgaaaa gucuuuuagu 480 aggugauccu cugguacguc auauaauaua
ucugcucuau auagccacuu ccacgcuuag 540 aucuccgugc ucaucaccau
ccguagaucg ucgaccucuc auacucuagu cacuguggug 600 uucgugggug
cagguauuga caggcucaua cauauaauau gaaauugggc cuuccgcagc 660
ucugaacuau cgagcuuccu ucuaagaaug aauguuggga agcccgauuu gauaaacgca
720 cggcgcaaua gcuaaacaga ucuuaggagu uucaccacug gagucagcgu
aaauacacug 780 aucuugcgaa aauaguuggc ggucuuauaa acugaguaga
gcgcgcuugc guccaauacg 840 auuagauucc aaccgcgaug ccacuauggc
guacaaauaa gaauguuuuc aaggggauaa 900 gauggaguca ucuggccgcg
uaacccuaca aaaaaaauga accguaauag agcaguugua 960 caucgagacg
uacguugcac gaaaaauagu gacuuuacgu caguacaaaa aaaaaaaaaa 1020
aaaaaaaaaa aaaaaa 1036
* * * * *
References