U.S. patent application number 11/102497 was filed with the patent office on 2005-12-08 for glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them.
Invention is credited to Gotschlich, Emil C..
Application Number | 20050271690 11/102497 |
Document ID | / |
Family ID | 23211210 |
Filed Date | 2005-12-08 |
United States Patent
Application |
20050271690 |
Kind Code |
A1 |
Gotschlich, Emil C. |
December 8, 2005 |
Glycosyltransferases for biosynthesis of oligosaccharides, and
genes encoding them
Abstract
The present invention is directed to nucleic acids encoding
glycosyltransferases, the proteins encoded thereby, and to methods
for synthesizing oligosaccharides using the glycosyltransfereses of
the invention. In particular, the present application is directed
to identification a glycosyltransferase locus of Neisseria
gonorrhoeae containing five open reading frames for five different
glycosyltransferases. The functionally active glycosyltransferases
of the invention are characterized by catalyzing reactions such as
adding Gal .beta.1.fwdarw.4 to GlcNAc or Glc; adding GalNAc or
GlcNAc .beta.1.fwdarw.3 to Gal; and adding Gal .alpha.1.fwdarw.4 to
Gal. The glycosyltransferases of the invention are particularly
suited to the synthesis of the oligosaccharides
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw- .3Gal.beta.1.fwdarw.4Glc
(a mimic of lacto-N-neotetraose),
GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1-
.fwdarw.4Glc.beta.1.fwdarw.4 (a mimic a ganglioside), and
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc.beta.1.fwdarw.4Hep.fwdarw.R
(a mimic of the saccharide portion of globo-glycolipids).
Inventors: |
Gotschlich, Emil C.; (New
York, NY) |
Correspondence
Address: |
MORGAN, LEWIS & BOCKIUS LLP (SF)
2 PALO ALTO SQUARE
PALO ALTO
CA
94306
US
|
Family ID: |
23211210 |
Appl. No.: |
11/102497 |
Filed: |
April 8, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11102497 |
Apr 8, 2005 |
|
|
|
10654528 |
Sep 2, 2003 |
|
|
|
10654528 |
Sep 2, 2003 |
|
|
|
10007267 |
Dec 3, 2001 |
|
|
|
6780624 |
|
|
|
|
10007267 |
Dec 3, 2001 |
|
|
|
09333412 |
Jun 15, 1999 |
|
|
|
6342382 |
|
|
|
|
09333412 |
Jun 15, 1999 |
|
|
|
08878360 |
Jun 18, 1997 |
|
|
|
5945322 |
|
|
|
|
08878360 |
Jun 18, 1997 |
|
|
|
08683426 |
Jul 18, 1996 |
|
|
|
5705367 |
|
|
|
|
08683426 |
Jul 18, 1996 |
|
|
|
08312387 |
Sep 26, 1994 |
|
|
|
5545553 |
|
|
|
|
Current U.S.
Class: |
424/249.1 ;
435/252.3; 435/85 |
Current CPC
Class: |
C12P 19/18 20130101;
A61P 31/04 20180101; C07K 14/22 20130101; C12N 9/1048 20130101;
C12N 9/1051 20130101 |
Class at
Publication: |
424/249.1 ;
435/252.3; 435/085 |
International
Class: |
A61K 039/095; C12P
019/28; C12N 001/21 |
Goverment Interests
[0001] The research leading to the present invention was supported
in part with funds from grant number AI-10615 from the Public
Health Service. Accordingly, the Government may have certain rights
in the invention.
Claims
1. A Neisserial strain having an open reading frame encoding a
glycosyltransferase, selected from the list consisting of: LgtA,
LgtB, LgtC, LgtD, and LgtE, which has been deleted such that it no
longer expresses said glycosyltransferase.
2. A vaccine preparation effective against Neisserial strains, said
preparation comprising an altered Neisserial oligosaccharide
structure prepared from the Neisserial strain of claim 1.
3. A process of making an altered Neisserial oligosaccharide
structure comprising the steps of deleting an open reading frame
encoding a glycosyltransferase from a Neisserial strain selected
from the list consisting of: LgtA, LgtB, LgtC, LgtD, and LgtE, and
preparing the altered Neisserial oligosaccharide structure from
said strain.
4. A process of making a vaccine preparation effective against
Neisserial strains, comprising the steps of deleting an open
reading frame encoding a glycosyltransferase from a Neisserial
strain selected from the list consisting of: LgtA, LgtB, LgtC,
LgtD, and LgtE, preparing an altered Neisserial oligosaccharide
structure from said strain, and formulating said altered Neisserial
oligosaccharide structure in a vaccine preparation.
Description
FIELD OF THE INVENTION
[0002] The present invention relates to glycosyltransferases useful
for biosynthesis of oligosaccharides, genes encoding such
glycosyltransferases and recombinant methods of producing the
enzymes, and the oligosaccharides produced thereby.
BACKGROUND OF THE INVENTION
Neisseria and Lipo-oligosaccharide (LOS)
[0003] While Neisseria species commonly colonize many mammalian
hosts, human beings are the only species subject to invasive
disease by members of this species. Neisseria meningitidis is the
etiologic agent for septicemia and meningitis that may occur in
epidemic form. Neisseria gonorrhoeae is the causative agent of
gonorrhea and its manifold complications. These organisms,
particularly the gonococcus, have proved remarkably adept at
varying the antigenic array of their surface-exposed molecules,
notably their adhesive pili and opacity-related (opa) proteins. The
genetic mechanisms for the variation of pilus (Meyer et al., 1982,
Cell 30:45; Haas and Meyer, 1986, Cell 44:107; Koomey et al., 1987.
Genetics 117:391; Swanson and Koomey, 1989, American Society for
Microbiology, Washington, 743-761) and opa protein (Stem et al.,
1986, Cell 47:61: Meyer et al., 1990, Ann. Rev. Microbiol. 44:451;
Bhat et al., 1991, Molec. Microbiol. 5:1889) expression are in the
main well understood. Like other Gram-negative bacteria the
Neisseria ssp. carry LPS in the external leaflet of their outer
membranes (Johnston and Gotschlich, 1974, J. Bacterial. 119;250).
In contrast to the high molecular weight LPS molecules with
repeating O-chains seen in many enteric bacteria, the LPS of
Neisseria ssp. is of modest size and therefore is often referred to
as lipooligosaccharide or LOS. Although the molecular size of the
LOS is similar to that seen in rough LPS mutants of Salmonella
ssp., this substance has considerable antigenic diversity. In the
case of the meningococcus, a serological typing scheme has been
developed that separates strains into 12 immunotypes (Zollinger and
Mandrell, 1977, Infect. Immun. 18:424; Zollinger and Mandrell,
1980, Infect. Immun. 28:451). A remarkably complete understanding
of the structure of meningococcal LPS (recently reviewed (Verheul
et al., 1993, Microbiol. Rev. 57:34) has resulted from the studies
of Jennings and his colleagues (Jennings et al., 1983, Carbohyd.
Res. 121:233; Michon et al., 1990, J. Biol. Chem. 265:7243; Gamian
et al., 1992, J. Biol. Chem. 267:922; Pavliak et al., 1993, J.
Biol. Chem. 268:14146). In the case of Neisseria gonorrhoeae,
antigenic variability is so pronounced that a serological
classification scheme has proved elusive. In part this is due to
the heterogeneity of LOS synthesized by a particular strain; LOS
preparations frequently contain several closely spaced bands by
SDS-PAGE (Mandrell et al., 1986, Infect. Immun. 54:63). Further,
studies using monoclonal antibodies indicate that gonococci are
able to change the serological characteristics of the LOS they
express and that this antigenic variation occurs at a frequency of
10.sup.-2 to 10.sup.-3, indicating that some genetic mechanism must
exist to achieve these high frequency variations (Schneider et al.,
1988, Infect. Immun. 56:942; Apicella et al., 1987. Infect. Immun.
55:1755). Because of the molecular heterogeneity and antigenic
variation of the LOS produced by gonococci the determination of the
structural chemistry of this antigen has proved to be a difficult
problem, and definitive information based on very sophisticated
analyses has only recently become available (Yamasaki et al, 1991,
Biochemistry 30:10566; Kerwood et al., 1992, Biochemistry 31:12760;
John et al., 1991, J. Biol. Chem. 266:19303; Gibson et al., 1993,
J. Bacteriol. 175:2702). These are summarized in FIG. 1. Of
particular interest is the presence of the tetrasaccharide
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc.beta.1.fw-
darw.4, which is a perfect mimic of lacto-N-neotetraose of the
sphingolipid paragloboside (Mandrell et al., 1988, J. Exp. Med.
168:107; Tsai and Civin, 1991, Infect. Immun. 59:3604). In LOS this
tetrasaccharide frequently bears an additional N-acetyl
galactosamine residue
(GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3G-
al.beta.1.fwdarw.4Glc.beta.1.fwdarw.4), and then mimics
gangliosides. In some strains of gonococci an alternative side
chain is found which has the structure
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc.beta.1.fwdarw.4H-
ep.fwdarw.R (John et al., 1991, J. Biol. Chem. 266:19303). This is
a mimic of the saccharide portion of globo-glycolipids (Mandrell,
1992, Infect. Immun. 60:3017), and is the structure
characteristically found in Neisseria meningitidis immunotype
L1.
[0004] The LOS molecules have a number of biological activities.
They are potent endotoxic molecules believed to be the toxin
responsible for adrenal cortical necrosis seen in severe
meningococcal disease. They serve as the target antigen for much of
the bactericidal activity present in normal or convalescent human
sera (Rice et al., 1980, J. Immunol. 124:2105). Gonococci possess a
very unusual sialyl transferase activity which is able to use
externally supplied CMP-NANA and add N-acetyl neuraminic acid to
the LOS on the surface of the organism (Nairn et al., 1988, J. Gen.
Microbiol. 134:3295; Parsons et al., 1989, Microb. Pathog. 7:63;
Mandrell et al., 1990, J. Exp. Med. 171:1649). Group B and C
meningococci, have the capacity to synthesize CMP-NANA, and
frequently sialylate their LOS without requiring exogenous CMP-NANA
(Mandrell et al., 1991, J. Bacteriol. 173:2823). In Neisseria
meningitidis strain 6275 immunotype L3, the sialic acid unit is
linked .alpha.2.fwdarw.3 to the terminal Gal residue of the
lacto-N-neotetraose (Yamasaki et al., 1993, J. Bacteriol.
175:4565). The levels of CMP-NANA found in various host
environments is sufficient to support this reaction (Apicella et
al., 1990, J. Infect. Dis. 162:506). The sialylation of the LOS
causes gonococci to become resistant to the antibody-complement
dependent bactericidal effect of serum (Parsons et al., 1989,
Microb. Pathog. 7:63). The resistance is not only to the
bactericidal effect mediated by antibodies to LOS, but to other
surface antigens as well (Wetzler et al., 1992, Infect. Immun.
60:39). van Putten has demonstrated that exposure of gonococci to
CMP-NANA markedly reduces their ability to invade epithelial cells
in tissue culture (Van Putten, 1993, EMBO J. 12:4043). These
findings strongly suggest that the ability of gonococci to vary the
chemical nature of the LOS provides them with the ability to cope
with different host environments (Mandrell and Apicella, 1993,
Immunobiology 187:382).
[0005] Perhaps most telling, it has been found that LOS variation
is selected in vivo in infections of human beings. A well
characterized gonococcal laboratory strain MS11.sub.mk variant A
was used to inoculate volunteers (Swanson et al., 1988, J. Exp.
Med. 168:2121). In the two infected individuals over a period of 4
to 6 days the population of gonococci recovered in their urine
increasingly shifted to two variants that expressed antigenically
different LOS (Schneider et al., 1991, J. Exp. Med. 174:1601). A
structural analysis revealed that the inoculated variant A produced
a truncated. LOS containing only the .beta.-lactosyl group linked
to Hep1, while one of the new variants (variant C) produced a
complete LOS (Kerwood et al., 1992, Biochemistry 31:12760). This
suggests that the addition of the additional sugars
GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3 is
likely to be under control of a phase variation mechanism.
[0006] Little information on the genetics of LOS synthesis in
Neisseria is available. A major advance has been the creation
(Dudas and Apicella, 1988, Infect. Immun. 56:499) and biochemical
characterization (John et al., 1991, J. Biol. Chem. 266:19303) of
five pyocin mutants of gonococcal strain 1291, dubbed 1291a-e.
Immunological and biochemical data have shown that 1291a, 1291c,
1291d and 1291e produce LOS with sequential shortening of the
lacto-N-neotetraose chain, with mutant 1291e lacking the glucose
substitution on the heptose. Mutant 1291b synthesizes the
alternative LOS structure
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc (see FIG. 1). Only the
genetic basis of the 1291e mutant is now defined. It is a mutation
of phosphoglucomutase (pgm), which precludes the synthesis of
UDP-glucose, and hence the addition of the first residue of the
lacto-N-neotetraose unit (Zhou et al., 1994, J. Biol. Chem.
269:11162; Sandlin and Stein, 1994, J. Bacteriol. 176:2930). It
also has been shown that galE mutants of meningococcus or
gonococcus produce truncated LOS in keeping with the inability to
synthesize UDP-galactose (Robertson et al., 1993, Molec. Microbiol.
8:891; Jennings et al., 1993, Molec. Microbiol. 10:361).
Biosynthesis of Oligosaccharides
[0007] Oligosaccharides are polymers of varying number of residues,
linkages, and subunits. The basic subunit is a carbohydrate
monosaccharide or sugar, such as mannose, glucose, galactose,
N-acetylglucosamine, N-acetylgalactosamine, and the like. The
number of different possible stereoisomeric oligosaccharide chains
is enormous.
[0008] Oligosaccharides and polysaccharides play an important role
in protein function and activity, by serving as half-life
modulators, and, in some instances, by providing structure. As
pointed out above, oligosaccharides are critical to the antigenic
variability, and hence immune evasion, of Neisseria, especially
gonococcus.
[0009] Numerous classical techniques for the synthesis of
carbohydrates have been developed, but these techniques suffer the
difficulty of requiring selective protection and deprotection.
Organic synthesis of oligosaccharides is further hampered by the
lability of may glycosidic bonds, difficulties in achieving
regio-selective sugar coupling, and generally low synthetic yields.
In short, unlike the experience with peptide synthesis, traditional
synthetic organic chemistry cannot provide for quantitative,
reliable synthesis of even fairly simple oligosaccharides.
[0010] Recent advances in oligosaccharide synthesis have occurred
with the isolation of glycosyltransferases. These enzymes can be
used in vitro to prepare oligosaccharides and polysaccharides (see,
e.g., Roth, U.S. Pat. No. 5.180.674, issued Jan. 19, 1993). The
advantage of biosynthesis with glycosyltransferases is that the
glycosidic linkages formed by enzymes are highly stereo and
regio-specific. However, each enzyme catalyzes linkage of specific
sugar residues to other specific acceptor molecules, e.g., an
oligosaccharide or lipid. Thus, synthesis of a desired
oligosaccharide may be limited by the availability of
glycosyltransferases (see, Roth, International Patent Publication
No. WO 93/13198, published Jul. 8, 1993).
[0011] Another drawback of biosynthesis is that the
glycosyltransferases themselves are usually present in fairly low
quantities in cells. It is difficult to obtain enough of the enzyme
to be commercially practicable.
[0012] Thus, there is a great need in the art for
glycosyltransferases. There is a further need for genes encoding
such glycosyltransferases, to provide an unlimited source of
glycosyltransferases through recombinant technology.
[0013] The citation of any reference herein should not be construed
as an admission that such reference is available as prior art to
the instant invention.
SUMMARY OF THE INVENTION
[0014] The present invention is directed to nucleic acids encoding
glycosyltransferases, the proteins encoded thereby, and to methods
for synthesizing oligosaccharides using the glycosyltransferases of
the invention. Accordingly, in one aspect, the invention is
directed to a purified nucleic acid that is hybridizable under
moderately stringent conditions to a nucleic acid corresponding to
the LOS locus of Neisseria, e.g., a nucleic acid having a
nucleotide sequence corresponding to or complementary to the
nucleotide sequence shown in FIG. 2 (SEQ ID NO:1). Preferably, the
nucleic acid of the invention is hybridizable to a portion of the
coding sequence for a gene of the LOS locus, i.e., a portion of the
nucleotide sequence shown in FIG. 2 (SEQ ID NO:1) that encodes a
functionally active glycosyltransferase.
[0015] In specific embodiments, the invention relates to a nucleic
acid that has a nucleotide sequence corresponding to or
complementary to a portion of the nucleotide sequence shown in FIG.
2 (SEQ ID NO:1) that encodes a functionally active
glycosyltransferase. In a further aspect, the nucleic acid encodes
a functionally active glycosyltransferase. In a specific
embodiment, the invention is directed to a nucleic acid that has a
nucleotide sequence corresponding to or complementary to the
nucleotide sequence shown in FIG. 2 (SEQ ID NO:1).
[0016] The functionally active glycosyltransferases of the
invention are characterized by catalyzing a reaction selected from
the group consisting of:
[0017] adding Gal .beta.1.fwdarw.4 to GlcNAc or Glc;
[0018] adding GalNAc or GlcNAc .beta.1.fwdarw.3 to Gal; and
[0019] adding Gal .alpha.1.fwdarw.4 to Gal.
[0020] Most preferably, the claimed nucleic acid encodes a
functionally active glycosyltransferase. However, nucleic acids of
the invention include oligonucleotides useful as primers for
polymerase chain reaction (PCR) or for probes for the presence and
level of transcription of a glycosyltransferase gene.
[0021] In specific embodiments, exemplified herein, the nucleic
acid encodes a glycosyltransferase having an amino acid sequence of
SEQ ID NO:3, SEQ ID NO:4. SEQ ID NO:5. SEQ ID NO:6, or SEQ ID
NO:8.
[0022] The invention further relates to an expression vector
comprising the nucleic acid encoding a glycosyltransferase of the
invention operatively associated with an expression control
sequence. Accordingly, the invention extends to recombinant host
cell transformed with such an expression vector.
[0023] In another aspect, the invention is directed to a method for
producing a glycosyltransferase comprising culturing the
recombinant host cell under conditions that allow expression of the
glycosyltransferase; and recovering the expressed
glycosyltransferase.
[0024] In a primary aspect, the invention is directed to
glycosyltransferase having an amino acid sequence of SEQ ID NO:3,
SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:8, a
functionally active fragment thereof. The invention further
contemplates a composition comprising a glycosyltransferase
conjugated to a solid phase support, wherein the
glycosyltransferase is selected from the group consisting of a
glycosyltransferase having an amino acid sequence of SEQ ID NO:3,
or a functionally active fragment thereof; a glycosyltransferase
having an amino acid sequence of SEQ ID NO:8, or a functionally
active fragment thereof; a glycosyltransferase having an amino acid
sequence of SEQ ID NO:4, or a functionally active fragment thereof;
and a glycosyltransferase having an amino acid sequence of SEQ ID
NO:5, or a functionally active fragment thereof; and a
glycosyltransferase having an amino acid sequence of SEQ ID NO:6,
or a functionally active fragment thereof.
[0025] Having provided novel glycosyltransferases, and genes
encoding the same, the invention accordingly further provides
methods for preparing oligosaccharides, e.g., two or more
saccharides. In specific embodiments, the invention relates to a
method for adding GalNAc or GlcNAc .beta.1.fwdarw.3 to Gal,
comprising contacting a reaction mixture comprising an activated
GalNAc or GlcNAc to an acceptor moiety comprising a Gal residue in
the presence of the glycosyltransferase having an amino acid
sequence of SEQ ID NO:3; a method for adding Gal .beta.1.fwdarw.4
to GlcNAc or Glc, comprising contacting a reaction mixture
comprising an activated Gal to an acceptor moiety comprising a
GlcNAc or Glc residue in the presence of the glycosyltransferase
having an amino acid sequence of SEQ ID NO:8; a method for adding
Gal .alpha.1.fwdarw.4 to Gal, comprising contacting a reaction
mixture comprising an activated Gal to an acceptor moiety
comprising a Gal residue in the presence of the glycosyltransferase
having an amino acid sequence of SEQ ID NO:4; a method for adding
GalNAc or GlcNAc .beta.1.fwdarw.3 to Gal, comprising contacting a
reaction mixture comprising an activated GalNAc or GlcNAc to an
acceptor moiety comprising a Gal residue in the presence of the
glycosyltransferase having an amino acid sequence of SEQ ID NO:5;
and a method for adding Gal .beta.1.fwdarw.4 to GlcNAc or Glc,
comprising contacting a reaction mixture comprising an activated
Gal to an acceptor moiety comprising a GlcNAc or Glc residue in the
presence of the glycosyltransferase having an amino acid sequence
of SEQ ID NO:6.
[0026] In a preferred embodiment, the oligosaccharides are prepared
on a carrier that is non-toxic to a mammal, in particular a human,
such as a lipid isoprenoid or polyisoprenoid alcohol. A specific
example of such a carrier is dolichol phosphate. In a specific
embodiment, the oligosaccharide is attached to the carrier via a
labile bond, thus allowing for chemically removing the
oligosaccharide from the lipid carrier. Alternatively, an
oligosaccharide transferase can be used, e.g., to transfer the
oligosaccharide from a lipid carrier to a protein. In yet another
embodiment, the glycosyltransferases can be expressed in a
eukaryotic expression system, to provide for glycosylation of a
protein expressed in such a system.
[0027] An important advantage of the present invention is that it
provides for the synthesis of oligosaccharide antigens of Neisseria
independently of lipid A, which is highly toxic. Use of the natural
LOS from Neisseria, while theoretically desirable for vaccine
preparation, fails. The lipid A portion of LOS is a potent
endotoxin, and highly toxic. Chemical treatment of the LOS, e.g.,
by hydrolysis. destroys the antigenicity of the oligosaccharide,
leaving a useless product. Thus, it is highly desirable to have a
source of Neisseria oligosaccharides attached to non-toxic lipids
for vaccine preparation.
[0028] Thus, the invention provides glycosyltransferases and
strategies for preparing a number of oligosaccharides, such as but
not limited to, Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc,
Gal.beta.1.fwdarw.4GlcNAc.bet- a.1.fwdarw.3Gal.beta.1.fwdarw.4Glc,
and GalNAc.beta.1.fwdarw.3Gal.beta.1.f-
wdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc.
[0029] Accordingly, it is a primary object of the invention to
provide glycosyltransferases useful for the synthesis of
oligosaccharides.
[0030] It is a further object of the invention to provide for the
synthesis of oligosaccharides characteristic of Neisseria
meningitidis and N. gonorrhoeae.
[0031] It is a further object of the invention to provide for the
synthesis of oligosaccharides characteristic of mammalian
oligosaccharides, including blood group core oligosaccharides.
[0032] It is still a further object of the invention to provide for
vaccines having the oligosaccharide unit of LOS, but lacking lipid.
A.
[0033] Still a further object of the invention is to provide for
synthesis of therapeutically useful oligosaccharides.
[0034] These and other objects of the present will be made clear by
reference to the following Drawings and Detailed Description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1: Alternative structures found in gonococcal LOS. R1
refers to the inner core region of LOS consisting of two
keto-deoxy-octulosonic acid (KDO) residues. These in turn are
attached to a lipid A structure. R2 in gonococci is typically
GlcNAc.beta.1.fwdarw.2Hep.alpha.1.fwdarw.3. The structure in the
top panel contains a tetrasaccharide identical to
lacto-N-neotetraose found in paragloboside glycolipids. In many
strains this tetrasaccharide bears a terminal
GalNAc.beta.1.fwdarw.3. The lower panel shows an alternative
trisaccharide structure with the terminal Gal .alpha.1.fwdarw.4
linked. This trisaccharide is seen in meningococci of the L1
serotype and in some gonococcal strains. The portions of the two
structures recognized by the monoclonal antibodies used in this
study are indicated (4C4) (Dudas and Apicella, 1988, Infect. Immun.
56:499) 3F11 (Mandrell et al., 1988, J. Exp. Med. 168-107; Yamasaki
et al., 1991, Mol. Immunol. 28:1233) 1-1-M (Yamasaki et al., 1991,
Mol. Immunol. 28:1233), 2-1-L8 (Kerwood et al., 1992, Biochemistry
31:12760; Schneider et al., 1991, J. Exp. Med. 174:1601; Schneider
et al., 1985, Infect. Immun. 50:672) 9-2-L378 and 17-1-L1.
[0036] FIG. 2: (A) Genetic map of the LOS locus based on the DNA
sequence. Sequence information bp 1-2725 was obtained from plasmid
pPstCla, bp 2725-5859 from plasmid p3400 (see materials and
methods). IS refers to an area of the sequence that has homology to
a previously reported neisserial insertion sequence IS1106 (Knight
et al., 1992, Molec. Microbiol. 6:1565). The positions of the
reading frames of lgtA-E are indicated. Three tracts of poly-G were
found in lgtA (17 bp), lgtC (10 bp) and lgtD (11 bp) and are
indicated by vertical black bars. Amino acid sequences of (B) LgtA
(SEQ ID NO:3), (C) LgtB (SEQ ID NO:8), (D) LgtC (SEQ ID NO:4), (E)
LgtD (SEQ ID NO:5), and (F) LgtE (SEQ ID NO:6), and (G-M) the
nucleotide sequence of the lgt locus (SEQ ID NO:1).
[0037] FIG. 3(A,B): Homology of the protein products of lgtA and
lgtD. The primary structure of two proteins is very similar,
particularly in the first half of the sequences. The glycine
residues starting at position 86 reflect the coding of the poly-G
regions in the respective genes. The Bestfit program of the GCG
package was used and the symbols .linevert split., :, . represent
degrees of similarity based on the Dayhoff PAM-250 matrix.
[0038] FIG. 4(A,B): Homology of the protein products of lgtB and
lgtE. The primary structure of two proteins is very similar,
particularly in the first half of the sequences. These sequences
also have significant homology to lex-1 (Cope et al., 1991, Molec.
Microbiol. 5:1113) or lic2A (High et al., 1993, Molec. Microbiol.
9:1275) genes of Haemophilus influenzae. For meaning of symbols see
FIG. 3.
[0039] FIG. 5(A,B): Homology of the protein products of rfaI and
lgtC. The E. coli rfaI and rfaJ genes are very closely related.
They serve as glucosyl transferases of two glucose residues in the
LPS core region (Pradel et al., 1992, J. Bacteriol. 174:4736). The
glycines at position 54-56 in lgtC are encoded by the poly-G tract.
For meaning of symbols see FIG. 3.
[0040] FIG. 6: Deletions in the LOS locus. Three insertion and five
deletions of the LOS locus were constructed as detailed in the
methods section. The restriction sites that were used are
indicated. The insertions are marked by triangles and the extent of
the deletions by stippled boxes. The open arrows indicate the open
reading frames disrupted by the construction. In each of the
constructs the erythromycin marker ermC' was inserted at the site
of the insertion or the deletion.
[0041] FIG. 7: Silver-stained SDS-PAGE of LOS preparations. Gel
electrophoresis of purified LOS samples of 375 ng was performed and
stained as described in materials and methods. Above the gel are
indicated the structure of the LOS of the major bands inferred to
be present in each of the preparations. These structures are based
on the reactivity with monoclonal antibodies shown in FIG. 8, but
are presented in this Figure to facilitate interpretation of the
patterns observed. R stands for the inner core region and lipid A.
1291e is a pyocin resistant mutant (Dudas and Apicella, 1988,
Infect. Immun. 56:499)
[0042] FIG. 8: Reactivity of LOS from strain F62 wt and mutants
with monoclonal antibodies. The names of the following monoclonal
antibodies were abbreviated: 17-1-L1 (L1), 9-2-L378 (L3), 2-1-L8
(L8). Purified LOS was applied to Immobilon-P membranes, allowed to
react with the antibodies and developed as described in materials
and methods. The specificity of the monoclonal antibodies is
summarized in FIG. 1.
DETAILED DESCRIPTION OF THE INVENTION
[0043] As disclosed above, the present invention provides five
novel glycosyltransferases, genes encoding the
glycosyltransferases, and methods for biosynthesis of
oligosaccharides using such glycosyltransferases. The glycosyl
transferases of the invention can be used for in vitro biosynthesis
of various oligosaccharides, such as the core oligosaccharide of
the human blood group antigens, i.e., lacto-N-neotetraose.
[0044] Cloning and expression of glycosyltransferases of the
invention can be accomplished using standard techniques, as
disclosed herein. Such glycosyl transferases are useful for
biosynthesis of oligosaccharides in vitro, or alternatively genes
encoding such glycosyltransferases can be transfected into cells,
e.g., yeast cells or eukaryotic cells, to provide for alternative
glycosylation of proteins and lipids.
[0045] The instant invention is based, in part, on the discovery
and cloning of a locus involved in the biosynthesis of gonococcal
LOS has from gonococcal strain F62. The locus contains five open
reading frames. The first and the second reading frames are
homologous, but not identical to the fourth and the fifth reading
frames respectively. Interposed is an additional reading frame
which has distant homology to the E. coli rfaI and rfaJ genes. both
glucosyl transferases involved in LPS core biosynthesis. The second
and the fifth reading frames show strong homology to the lex-1 or
lic2A gene of Haemophilus influenzae. but do not contain the CAAT
repeats found in this gene. Deletions of each of these five genes,
of combinations of genes, and of the entire locus were constructed
and introduced into parental gonococcal strain F62 by
transformation. The LOS phenotypes were then analyzed by SDS-PAGE
and reactivity with monoclonal antibodies. Analysis of the
gonococcal mutants indicates that four of these genes are the
glycosyl transferases that add
GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1-
.fwdarw.4 to the substrate Glc.beta.1.fwdarw.4Hep.fwdarw.R of the
inner core region. The gene with homology to E. coli rfaI/rfaJ is
involved with the addition of the .alpha.-linked galactose residue
in the biosynthesis of the alternative LOS structure
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4G-
lc.beta.1.fwdarw.4Hep.fwdarw.R.
[0046] Since these genes encode LOS glycosyl transferases they have
been named lgtA, lgtB, lgtC, lgtD and lgtE. The DNA sequence
analysis revealed that lgtA, lgtC and lgtD contain poly-G tracts,
which in strain F62 were respectively 17, 10 and 11 bp. Thus, three
of the LOS biosynthetic enzymes are potentially susceptible to
premature termination by reading-frame changes. It is likely that
these structural features are responsible for the high frequency
genetic variation of gonococcal LOS.
[0047] Abbreviations used throughout this specification include:
Lipopolysaccharide, LPS; Lipooligosaccharide, LOS;
N-Acetyl-neuraminic acid cytidine mono phosphate, CMP-NANA; wild
type, wt; Gal, galactose; Glc, glucose; NAc, N-acetyl (e.g., GalNAc
or GlcNAc).
[0048] In accordance with the present invention there may be
employed conventional molecular biology, microbiology, and
recombinant DNA techniques within the skill of the art. Such
techniques are explained fully in the literature. See, e.g.,
Sambrook, Fritsch & Maniatis, "Molecular Cloning: A Laboratory
Manual," Second Edition (1989) Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (herein "Sambrook et al., 1989"); "DNA
Cloning: A Practical Approach," Volumes I and II (D. N. Glover ed.
1985); "Oligonucleotide Synthesis" (M. J. Gait ed. 1984); "Nucleic
Acid Hybridization" [B. D. Hames & S. J. Higgins eds. (1985)];
"Transcription And Translation" [B. D. Hames & S. J. Higgins,
eds. (1984)]; "Animal Cell Culture" [R. I. Freshney, ed. (1986)];
"Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A
Practical Guide To Molecular Cloning" (1984).
[0049] Therefore, if appearing herein, the following terms shall
have the definitions set out below.
[0050] A cell has been "transformed" by exogenous or heterologous
DNA when such DNA has been introduced inside the cell; the cell may
express a gene or genes encoded by such DNA. The transforming DNA
may or may not be integrated (covalently linked) into chromosomal
DNA making up the genome of the cell, or may be contained on an
autonomous replicon. In prokaryotes, yeast, and mammalian cells for
example, the transforming DNA may be maintained on an episomal
element such as a plasmid. A "clone" is a population of cells
derived from a single cell or common ancestor by mitosis.
[0051] A "nucleic acid molecule" refers to the phosphate ester
polymeric form of ribonucleosides (adenosine, guanosine, uridine,
or cytidine; "RNA molecules") or deoxyribonucleosides
(deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine;
"DNA molecules") in either single stranded form, or a
double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA
helices are possible. The term nucleic acid molecule, and in
particular DNA or RNA molecule, refers only to the primary and
secondary structure of the molecule, and does not limit it to any
particular tertiary forms. Thus, this term includes double-stranded
DNA found, inter alia, in linear or circular DNA molecules (e.g.,
restriction fragments), viruses, plasmids, and chromosomes. In
discussing the structure of particular double-stranded DNA
molecules, sequences may be described herein according to the
normal convention of giving only the sequence in the 5' to 3'
direction along the nontranscribed strand of DNA (i.e., the strand
having a sequence homologous to the mRNA). A "recombinant DNA
molecule" is a DNA molecule that has undergone a molecular
biological manipulation.
[0052] A nucleic acid molecule is "hybridizable" to another nucleic
acid molecule, such as a cDNA, genomic DNA, or RNA, when a single
stranded form of the nucleic acid molecule can anneal to the other
nucleic acid molecule under the appropriate conditions of
temperature and solution ionic strength (see Sambrook et al., 1989,
supra). The conditions of temperature and ionic strength determine
the "stringency" of the hybridization. Hybridization requires that
the two nucleic acids contain complementary sequences, although
depending on the stringency of the hybridization, mismatches
between bases are possible. The appropriate stringency for
hybridizing nucleic acids depends on the length of the nucleic
acids and the degree of complementation, variables well known in
the art. The greater the degree of similarity or homology between
two nucleotide sequences, the greater the value of T.sub.m for
hybrids of nucleic acids having those sequences. The relative
stability (corresponding to higher T.sub.m) of nucleic acid
hybridizations decreases in the following order: RNA:RNA, DNA:RNA,
DNA:DNA. For hybrids of greater than 100 nucleotides in length,
equations for calculating T.sub.m have been derived (see Sambrook
et al., supra, 9.50-9.51). For hybridization with shorter nucleic
acids, i.e., oligonucleotides, the position of mismatches becomes
more important, and the length of the oligonucleotide determines
its specificity (see Sambrook et al., supra, 11.7-11.8). Preferably
a minimum length for a hybridizable nucleic acid is at least about
10 nucleotides; more preferably at least about 15 nucleotides; most
preferably the length is at least about 20 nucleotides.
[0053] A DNA "coding sequence" is a double-stranded DNA sequence
which is transcribed and translated into a polypeptide in vivo when
placed under the control of appropriate regulatory sequences. The
boundaries of the coding sequence are determined by a start codon
at the 5' (amino) terminus and a translation stop codon at the 3'
(carboxyl) terminus. A coding sequence can include, but is not
limited to, prokaryotic sequences, cDNA from eukaryotic mRNA,
genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and
even synthetic DNA sequences. If the coding sequence is intended
for expression in a eukaryotic cell, a polyadenylation signal and
transcription termination sequence will usually be located 3' to
the coding sequence.
[0054] Transcriptional and translational control sequences are DNA
regulatory sequences, such as promoters, enhancers, terminators,
and the like, that provide for the expression of a coding sequence
in a host cell. Although the individual genes encoding
glycosyltransferases of the invention are found in a single locus
with very short non-coding sequences between them, phase variation
resulting in deletion of any of lgtA, lgtB, or lgtC does not
preclude reinitiation of transcription at the downstream genes.
Thus, the locus provided herein includes transcription initiation
sequences for transcription in Neisseria. Alternatively, the coding
sequences of the invention can be engineered for expression under
control of heterologous control sequences.
[0055] A "promoter sequence" is a DNA regulatory region capable of
binding RNA polymerase in a cell and initiating transcription of a
downstream (3' direction) coding sequence. For purposes of defining
the present invention, the promoter sequence is bounded at its 3'
terminus by the transcription initiation site and extends upstream
(5' direction) to include the minimum number of bases or elements
necessary to initiate transcription at levels detectable above
background. Within the promoter sequence will be found a
transcription initiation site (conveniently defined for example, by
mapping with nuclease S1), as well as protein binding domains
(consensus sequences) responsible for the binding of RNA
polymerase. Eukaryotic promoters will often, but not always,
contain "TATA" boxes and "CAT" boxes.
[0056] A coding sequence is "under the control" of transcriptional
and translational control sequences in a cell when RNA polymerase
transcribes the coding sequence into mRNA, which is then translated
into the protein encoded by the coding sequence.
[0057] A "signal sequence" can be included before the coding
sequence. This sequence encodes a signal peptide, N-terminal to the
polypeptide, that directs the host cell to translocate the
polypeptide to the cell surface or to organelles within the cell,
or secrete the polypeptide into the media, and this signal peptide
is usually selectively cleaved by the protein transport machinery.
Signal sequences can be found associated with a variety of proteins
native to prokaryotes and eukaryotes. Incorporation of a signal
sequence may be desirable for high level expression of a
glycosyltransferase of the invention by bacteria, yeast, insect
cells (baculovirus), or eukaryotic cells, to avoid affecting
endogenous glycosyltransfer in the host cell.
[0058] A molecule is "antigenic" when it is capable of specifically
interacting with an antigen recognition molecule of the immune
system, such as an immunoglobulin (antibody) or T cell antigen
receptor. As mentioned above, the carbohydrate (oligosaccharide)
moiety of the LOS of Neisseria is an important antigenic
determinant, which determines serotype of meningococcus (Zollinger
and Mandrell, 1977, Infect. Immun. 18:424; Zollinger and Mandrell,
1980, Infect. Immun. 28:451). An antigenic portion of a molecule
can be that portion that is immunodominant for antibody, or it can
be a portion used to generate an antibody to the molecule by
conjugating the antigenic portion to a carrier molecule for
immunization. A molecule that is antigenic need not be itself
immunogenic, i.e., capable of eliciting an immune response without
a carrier.
[0059] A composition comprising "A" (where "A" is a single protein,
DNA molecule, vector, etc.) is substantially free of "B" (where "B"
comprises one or more contaminating proteins, DNA molecules,
vectors, etc.) when at least about 75% by weight of the proteins,
DNA, vectors (depending on the category of species to which A and B
belong) in the composition is "A". Preferably, "A" comprises at
least about 90% by weight of the A+B species in the composition,
most preferably at least about 99% by weight. It is also preferred
that a composition, which is substantially free of contamination,
contain only a single molecular weight species having the activity
or characteristic of the species of interest.
[0060] The phrase "pharmaceutically acceptable" refers to molecular
entities and compositions that are physiologically tolerable and do
not typically produce an allergic or similar untoward reaction,
such as gastric upset, dizziness and the like, when administered to
a human. Preferably, as used herein, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the compound is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water or aqueous solution
saline solutions and aqueous dextrose and glycerol solutions are
preferably employed as carriers, particularly for injectable
solutions. Pharmaceutically acceptable compositions of the
invention are free of amounts of lipid A effective to cause a
response in a mammalian subject, in particular a human subject.
[0061] The term "adjuvant" refers to a compound or mixture that
enhances the immune response to an antigen. An adjuvant can serve
as a tissue depot that slowly releases the antigen and also as a
lymphoid system activator that non-specifically enhances the immune
response (Hood et al., Immunology, Second Ed., 1984,
Benjamin/Cummings: Menlo Park, Calif., p. 384). Often, a primary
challenge with an antigen alone, in the absence of an adjuvant,
will fail to elicit a humoral or cellular immune response.
Adjuvants include, but are not limited to, complete Freund's
adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such
as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil or
hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol,
and potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and Corynebacterium parvum. Preferably, the
adjuvant is pharmaceutically acceptable.
Isolation of Genes for Glycosyltransferases
[0062] The present invention provides the full length coding
sequence of the LOS locus of Neisseria, and thus, allows for
obtaining any one or all five genes, termed herein lgt genes,
encoding glycosyltransferases characteristic of that locus. Any
Neisseria bacterial cell can potentially serve as the nucleic acid
source for the molecular cloning of an lgt gene. In a specific
embodiment, infra, the genes are isolated from Neisseria
gonorrhoeae. The DNA may be obtained by standard procedures known
in the art from cloned DNA (e.g., a DNA "library"), by chemical
synthesis, by cDNA cloning, or by the cloning of genomic DNA, or
fragments thereof, purified from the desired cell (See, for
example, Sambrook et al., 1989, supra; Glover, D. M. (ed.), 1985,
DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K.
Vol. I, II). For example, a N. gonorrhoeae genomic DNA can be
digested with a restriction endonuclease or endonucleases, e.g.,
Sau3A, into a phage vector digested with a restriction endonuclease
or endonucleases, e.g., BamHI/EcoRI, for creation of a phage
genomic library. Whatever the source, the gene should be
molecularly cloned into a suitable vector for propagation of the
gene.
[0063] In the molecular cloning of the gene from genomic DNA, DNA
fragments are generated, some of which will encode the desired
gene. The DNA may be cleaved at specific sites using various
restriction enzymes. Alternatively, one may use DNAse in the
presence of manganese to fragment the DNA, or the DNA can be
physically sheared, as for example, by sonication. The linear DNA
fragments can then be separated according to size by standard
techniques, including but not limited to, agarose and
polyacrylamide gel electrophoresis and column chromatography.
[0064] Once the DNA fragments are generated, identification of the
specific DNA fragment containing the desired lgt gene may be
accomplished in a number of ways. For example, the generated DNA
fragments may be screened by nucleic acid hybridization to the
labeled probe synthesized with a sequence as disclosed herein
(Benton and Davis, 1977, Science 196:180; Grunstein and Hogness,
1975, Proc. Natl. Acad. Sci. U.S.A. 72:3961). Those DNA fragments
with substantial homology to the probe will hybridize. The present
invention provides specific examples of DNA fragments that can be
used as hybridization probes for glycosyltransferases, e.g., SEQ ID
NO:1.
[0065] As described above, the presence of the gene may be detected
by assays based on the physical, chemical, or immunological
properties of its expressed product. For example DNA clones that
produce a protein that, e.g., has similar or identical
electrophoretic migration, isoelectric focusing behavior,
proteolytic digestion maps, proteolytic activity, or functional
properties, in particular glycosyltransferase activity the ability
of a Lgt protein to mediate transfer of a sugar to an acceptor
molecule. Alternatively, the putative lgt gene can be mutated, and
its role as a glycosyltransferase established by detecting a
variation in the structure of the oligosaccharide of LOS.
[0066] Alternatives to isolating the lgt genomic DNA include, but
are not limited to, chemically synthesizing the gene sequence
itself from a known sequence that encodes an Lgt, e.g., as shown in
SEQ ID NO:1. In another embodiment, DNA for an lgt gene can be
isolated PCR using oligonucleotide primers designed from the
nucleotide sequences disclosed herein. Other methods are possible
and within the scope of the invention.
[0067] The identified and isolated gene can then be inserted into
an appropriate cloning vector. A large number of vector-host
systems known in the art may be used. Possible vectors include, but
are not limited to, plasmids or modified viruses, but the vector
system must be compatible with the host cell used. In a specific
aspect of the invention, the lgt coding sequence is inserted in an
E. coli cloning vector. Other examples of vectors include, but are
not limited to, bacteriophages such as lambda derivatives, or
plasmids such as pBR322 derivatives or pUC plasmid derivatives,
e.g., pGEX vectors, pmal-c, pFLAG, etc. The insertion into a
cloning vector can, for example, be accomplished by ligating the
DNA fragment into a cloning vector which has complementary cohesive
termini. However, if the complementary restriction sites used to
fragment the DNA are not present in the cloning vector, the ends of
the DNA molecules may be enzymatically modified. Alternatively, any
site desired may be produced by ligating nucleotide sequences
(linkers) onto the DNA termini; these ligated linkers may comprise
specific chemically synthesized oligonucleotides encoding
restriction endonuclease recognition sequences. In specific
embodiment, PCR primers containing such linker sites can be used to
amplify the DNA for cloning. Recombinant molecules can be
introduced into host cells via transformation, transfection,
infection, electroporation, etc., so that many copies of the gene
sequence are generated.
[0068] Transformation of host cells with recombinant DNA molecules
that incorporate the isolated lgt gene or synthesized DNA sequence
enables generation of multiple copies of the gene. Thus, the gene
may be obtained in large quantities by growing transformants,
isolating the recombinant DNA molecules from the transformants and,
when necessary, retrieving the inserted gene from the isolated
recombinant DNA.
[0069] The present invention also relates to vectors containing
genes encoding truncated forms of the enzyme (fragments) and
derivatives of Lgt's that have the same functional activity as an
Lgt. The production and use of fragments and derivatives related to
an Lgt are within the scope of the present invention. In a specific
embodiment, the fragment or derivative is functionally active,
i.e., capable of mediating transfer of a sugar to an acceptor
molecule.
[0070] Truncated fragments of the glycosyltransferases can be
prepared by eliminating N-terminal, C-terminal, or internal regions
of the protein that are not required for functional activity.
Usually, such portions that are eliminated will include only a few,
e.g., between 1 and 5, amino acid residues, but larger segments may
be removed.
[0071] Chimeric molecules, e.g., fusion proteins, containing all or
a functionally active portion of a glycosyltransferase of the
invention joined to another protein are also envisioned. A
glycosyltransferase fusion protein comprises at least a
functionally active portion of a non-glycosyltransferase protein
joined via a peptide bond to at least a functionally active portion
of a glycosyltransferase polypeptide. The non-glycosyltransferase
sequences can be amino- or carboxy-terminal to the
glycosyltransferase sequences. Expression of a fusion protein can
result in an enzymatically inactive glycosyltransferase fusion
protein. A recombinant DNA molecule encoding such a fusion protein
comprises a sequence encoding at least a functionally active
portion of a non-glycosyltransferase protein joined in-frame to the
glycosyltransferase coding sequence, and preferably encodes a
cleavage site for a specific protease, e.g., thrombin or Factor Xa,
preferably at the glycosyltransferase-non-glycosyltransferase
juncture. In a specific embodiment, the fusion protein may be
expressed in Escherichia coli.
[0072] In particular, Lgt derivatives can be made by altering
encoding nucleic acid sequences by substitutions, additions or
deletions that provide for functionally equivalent molecules. Due
to the degeneracy of nucleotide coding sequences, other DNA
sequences which encode substantially the same amino acid sequence
as an lgt gene may be used in the practice of the present
invention. These include but are not limited to nucleotide
sequences comprising all or portions of lgt genes that are altered
by the substitution of different codons that encode the same amino
acid residue within the sequence, thus producing a silent change.
Likewise, the Lgt derivatives of the invention include, but are not
limited to, those containing, as a primary amino acid sequence, all
or part of the amino acid sequence of an Lgt including altered
sequences in which functionally equivalent amino acid residues are
substituted for residues within the sequence resulting in a
conservative amino acid substitution. For example, one or more
amino acid residues within the sequence can be substituted by
another amino acid of a similar polarity, which acts as a
functional equivalent, resulting in a silent alteration.
Substitutes for an amino acid within the sequence may be selected
from other members of the class to which the amino acid belongs.
For example, the nonpolar (hydrophobic) amino acids include
alanine, leucine, isoleucine, valine, proline, phenylalanine,
tryptophan and methionine. The polar neutral amino acids include
glycine, serine, threonine, cysteine, tyrosine, asparagine, and
glutamine. The positively charged (basic) amino acids include
arginine, lysine and histidine. The negatively charged (acidic)
amino acids include aspartic acid and glutamic acid.
[0073] The genes encoding Lgt derivatives and analogs of the
invention can be produced by various methods known in the art
(e.g., Sambrook et al., 1989, supra). The sequence can be cleaved
at appropriate sites with restriction endonuclease(s), followed by
further enzymatic modification if desired, isolated, and ligated in
vitro. In the production of the gene encoding a derivative or
analog of Lgt, care should be taken to ensure that the modified
gene remains within the same translational reading frame as the lgt
gene, uninterrupted by translational stop signals, in the gene
region where the desired activity is encoded.
[0074] Additionally, the lgt nucleic acid sequence can be mutated
in vitro or in vivo, to create and/or destroy translation,
initiation, and/or termination sequences, or to create variations
in coding regions and/or form new restriction endonuclease sites or
destroy preexisting ones, to facilitate further in vitro
modification. Any technique for mutagenesis known in the art can be
used, including but not limited to, in vitro site-directed
mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem. 253:6551;
Zoller and Smith, 1984, DNA 3:479488; Oliphant et al., 1986, Gene
44:177; Hutchinson et al., 1986, Proc. Natl. Acad. Sci. U.S.A.
83:710), use of TAB.RTM. linkers (Pharmacia), etc. PCR techniques
are preferred for site directed mutagenesis (see Higuchi, 1989,
"Using PCR to Engineer DNA", in PCR Technology: Principles and
Applications for DNA Amplification, H. Erlich, ed., Stockton Press,
Chapter 6, pp. 61-70). It is notable in this regard that the lgtA,
lgtB, and lgtC genes contain long poly-G stretches that are
particularly susceptible to phase variation mutation.
Expression of a Glycosyltransferase
[0075] The gene coding for an Lgt, or a functionally active
fragment or other derivative thereof, can be inserted into an
appropriate expression vector, i.e., a vector which contains the
necessary elements for the transcription and translation of the
inserted protein-coding sequence. An expression vector also
preferably includes a replication origin. The necessary
transcriptional and translational signals can also be supplied by
the native lgt gene and/or its flanking regions. A variety of
host-vector systems may be utilized to express the protein-coding
sequence. Preferably, however, a bacterial expression system is
used to provide for high level expression of the protein with a
higher probability of the native conformation. Potential
host-vector systems include but are not limited to mammalian cell
systems infected with virus (e.g., vaccinia virus, adenovirus,
etc.); insect cell systems infected with virus (e.g., baculovirus);
microorganisms such as yeast containing yeast vectors, or bacteria
transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
The expression elements of vectors vary in their strengths and
specificities. Depending on the host-vector system utilized, any
one of a number of suitable transcription and translation elements
may be used.
[0076] Preferably, the periplasmic form of the Lgt (containing a
signal sequence) is produced for export of the protein to the
Escherichia coli periplasm or in an expression system based on
Bacillus subtillis.
[0077] Any of the methods previously described for the insertion of
DNA fragments into a vector may be used to construct expression
vectors containing a chimeric gene consisting of appropriate
transcriptional/translational control signals and the protein
coding sequences. These methods may include in vitro recombinant
DNA and synthetic techniques and in vivo recombinants (genetic
recombination).
[0078] Expression of nucleic acid sequence encoding an
glycosyltransferase or peptide fragment may be regulated by a
second nucleic acid sequence so that the glycosyltransferase or
peptide is expressed in a host transformed with the recombinant DNA
molecule. For example, expression of an glycosyltransferase may be
controlled by any promoter/enhancer element known in the art, but
these regulatory elements must be functional in the host selected
for expression. For expression in bacteria, bacterial promoters are
required. Eukaryotic viral or eukaryotic promoters, including
tissue specific promoters, are preferred when a vector containing
an lgt gene is injected directly into a subject for transient
expression, resulting in heterologous protection against bacterial
infection, as described in detail below. Promoters which may be
used to control lgt gene expression include, but are not limited
to, the SV40 early promoter region (Benoist and Chambon, 1981,
Nature 290:304-310), the promoter contained in the 3' long terminal
repeat of Rous sarcoma virus (Yamamoto, et al., 1980, Cell
22:787-797), the herpes thymidine kinase promoter (Wagner et al.,
1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory
sequences of the metallothionein gene (Brinster et al., 1982,
Nature 296:3942); prokaryotic expression vectors such as the
.beta.-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc.
Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer,
et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); see also
"Useful proteins from recombinant bacteria" in Scientific American,
1980, 242:74-94; and the like
[0079] Expression vectors containing lgt gene inserts can be
identified by four general approaches: (a) PCR amplification of the
desired plasmid DNA or specific mRNA, (b) nucleic acid
hybridization, (c) presence or absence of "marker" gene functions,
and (d) expression of inserted sequences. In the first approach,
the nucleic acids can be amplified by PCR with incorporation of
radionucleotides or stained with ethidium bromide to provide for
detection of the amplified product. In the second approach, the
presence of a foreign gene inserted in an expression vector can be
detected by nucleic acid hybridization using probes comprising
sequences that are homologous to an inserted lgt gene. In the third
approach, the recombinant vector/host system can be identified and
selected based upon the presence or absence of certain "marker"
gene functions (e.g., .beta.-galactosidase activity, PhoA activity,
thymidine kinase activity, resistance to antibiotics,
transformation phenotype, occlusion body formation in baculovirus,
etc.) caused by the insertion of foreign genes in the vector. If
the lgt gene is inserted within the marker gene sequence of the
vector, recombinants containing the lgt insert can be identified by
the absence of the marker gene function. In the fourth approach,
recombinant expression vectors can be identified by assaying for
the activity of the lgt gene product expressed by the recombinant.
Such assays can be based, for example, on the physical or
functional properties of the lgt gene product in in vitro assay
systems, e.g., glycosyltransferase activity. Once a suitable host
system and growth conditions are established, recombinant
expression vectors can be propagated and prepared in quantity.
Biosynthesis of Oligosaccharides
[0080] The glycosyltransferases of the present invention can be
used in the biosynthesis of oligosaccharides. The
glycosyltransferases of the invention are capable of stereospecific
conjugation of a specific activated saccharide unit to a specific
acceptor molecule. Such activated saccharides generally consist of
uridine, guanosine, and cytidine diphosphate derivatives of the
saccharides, in which the nucleoside diphosphate serves as a
leaving group. Thus, the activated saccharide may be a
saccharide-UDP, a saccharide-GDP, or a saccharide-CDP. In specific
embodiments, the activated saccharide is UDP-GlcNAC, UDP-GalNAc, or
UDP-Gal.
[0081] The term "acceptor molecule" as used herein refers to the
molecule to which the glycosyltransferase transfers an activated
sugar. As is well known in the art, synthesis of carbohydrates
proceeds by sequential coupling of sugar residues to a lipid, e.g.,
dolichol phosphate. In eukaryotic cells, which glycosylate
proteins, the oligosaccharide or polysaccharide is transferred from
the activated lipid carrier to the polypeptide on the luminal side
of the endoplasmic reticulum. In prokaryotes, the carbohydrate can
be synthesized directly on a lipid A molecule. It is likely that
the glycosyltransferases of the invention may be sensitive to the
core portion of the growing carbohydrate and the lipid molecule.
Thus, in a preferred aspect, the acceptor molecule, or carrier,
contains a lipid, preferably a polyisoprenoid alcohol lipid such as
dolichol phosphate. Maximum synthetic efficiency may ensue from use
of lipid A as the carrier. While the lipid A is not useful as a
carrier for direct administration of the resulting oligosaccharide
to a subject, e.g., as a vaccine preparation, it may be appropriate
for use with a labile linkage for subsequent cleavage (under mild
conditions) and separation of the oligosaccharide from the lipid
carrier. It should further be noted that the glycosyltransferases
will only work efficiently to add a specific activated saccharide
to a saccharide residue on the acceptor molecule that corresponds
to the natural acceptor molecule. For example, LgtE catalyzes
transfer of Gal to Glc.beta.1.fwdarw.4Hep. Thus, where a
glycosyltransferase mediates attachment of GalNAc to Glc, the
nature of the Glc residue (whether it is attached directly or
indirectly to the carrier, for example) will affect the reaction
efficiency. It is unlikely that efficient synthesis can occur in
the absence of a carrier, or using other than a lipid carrier.
However, even inefficient synthesis may be desirable, and practice
of the present invention is not limited to use of acceptor
molecules containing lipids, but extends to saccharides,
polysaccharides, polypeptides, glycoproteins, and the like.
[0082] For the synthesis of an oligosaccharide, a
glycosyltransferase is contacted with an appropriate activated
saccharide and an appropriate acceptor molecule under conditions
effective to transfer and covalently bond the saccharide to the
acceptor molecule. Conditions of time, temperature, and pH
appropriate and optimal for a particular saccharide unit transfer
can be determined through routine testing; generally, physiological
conditions will be acceptable. Certain co-reagents may also be
desirable; for example, it may be more effective to contact the
glycosyltransferase with the activated saccharide and the acceptor
molecule in the presence of a divalent cation.
[0083] According to the invention, the glycosyltransferase enzymes
can be covalently or non-covalently immobilized on a solid phase
support such as SEPHADEX, SEPHAROSE, or
poly(acrylamideco-N-acryloxysucciimide) (PAN) resin. A specific
reaction can be performed in an isolated reaction solution, with
facile separation of the solid phase enzyme from the reaction
products. Immobilization of the enzyme also allows for a continuous
biosynthetic stream, with the specific glycosyltransferases
attached to a solid support, with the supports arranged randomly or
in distinct zones in the specified order in a column, with passage
of the reaction solution through the column and elution of the
desired oligosaccharide at the end. An efficient method for
attaching the glycosyltransferase to a solid support and using such
immobilized glycosyltransferases is described in U.S. Pat. No.
5,180,674, issued Jan. 19, 1993 to Roth, which is specifically
incorporated herein by reference in its entirety.
[0084] An oligosaccharide, e.g., a disaccharide, prepared using a
glycosyltransferase of the present invention can serve as an
acceptor molecule for further synthesis, either using other
glycosyltransferases of the invention, or glycosyltransferases
known in the art (see, e.g., Roth, U.S. Pat. No. 5,180,674, and
Roth, International Patent Publication No. WO 93/13198, published 8
Jul. 1993, each of which is incorporated herein by reference in its
entirety). The oligosaccharide compositions of the invention are
useful in a wide variety of therapeutic and diagnostic
applications. For example, the saccharide compositions can be used
as blocking agents for cell surface receptors in the treatment of
numerous diseases involving cellular adhesion. Alternatively,
saccharide compositions useful as nutritional supplements,
antibacterials, anti-metastases agents, anti-inflammatory agents
(e.g., for binding to inflammatory-associated lectins or cell
surface receptors), to mention but a few, are contemplated by the
instant invention. As noted above the glycosyltransferases of the
invention can be used in conjunction with other
glycosyltransferases known in the art or to be discovered to
synthesize complex oligosaccharides or polysaccharides.
[0085] Alternatively, the glycosyltransferases of the invention can
be used to synthesize oligosaccharides representative of the
oligosaccharides found on various strains of Neisseria. For
example, by deleting open reading frames from the locus, or by
selecting only a few of the glycosyltransferases of the invention
for synthesis, alternative oligosaccharide structures can be
prepared. These can be used in vaccine preparations effective
against Neisseria variants, in particular, subunit vaccines against
gonococcus and meningococcus.
[0086] Alternatively, the glycosyltransferases of the present
invention can be used to prepare oligosaccharides corresponding to
oligosaccharides associated with human glycolipids. Thus, in
specific embodiments, the present invention provides for synthesis
of an oligosaccharide corresponding to lacto-N-neotetraose of the
sphingolipid paragloboside; an oligosaccharide that mimics
gangliosides; and a mimic of the saccharide portion of
globoglycolipids, which is the structure characteristically found
in Neisseria meningitidis immunotype L1. The oligosaccharides of
the present invention correspond to the core oligosaccharides of
the blood group antigens, and therefore have great utility in the
preparation of such blood group antigens for diagnostic or
therapeutic purposes.
[0087] Accordingly, a method for preparing an oligosaccharide
having the structure
GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3-
Gal.beta.1.fwdarw.4Glc (i.e., ganglioside) comprises sequentially
performing the steps of:
[0088] a. contacting a reaction mixture comprising an activated Gal
to an acceptor moiety comprising a Glc residue in the presence of a
glycosyltransferase having an amino acid sequence of SEQ ID NO: 6,
or a functionally active fragment thereof;
[0089] b. contacting a reaction mixture comprising an activated
GlcNAc to the acceptor moiety comprising a Gal.beta.1.fwdarw.4Glc
residue in the presence of a glycosyltransferase having an amino
acid sequence of SEQ ID NO:3. or a functionally active fragment
thereof;
[0090] c. contacting a reaction mixture comprising an activated Gal
to the acceptor moiety comprising a
GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc residue in the
presence of a glycosyltransferase having an amino acid of SEQ ID
NO:8; and
[0091] d. contacting a reaction mixture comprising an activated
GalNAc to the acceptor moiety comprising a
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.- 3Gal.beta.1.fwdarw.4Glc
residue in the presence of a glycosyltransferase having an amino
acid sequence of SEQ ID NO:5, or a functionally active fragment
thereof.
[0092] Similarly, a method for preparing an oligosaccharide having
the structure
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc
(i.e., lacto-N-neotetraose) comprises sequentially performing the
steps of:
[0093] a. contacting a reaction mixture comprising an activated Gal
to an acceptor moiety comprising a Glc residue in the presence of a
glycosyltransferase having an amino acid sequence of SEQ ID NO: 6,
or a functionally active fragment thereof;
[0094] b. contacting a reaction mixture comprising an activated
GlcNAc to the acceptor moiety comprising a Gal.beta.1.fwdarw.4Glc
residue in the presence of a glycosyltransferase having an amino
acid sequence of SEQ ID NO:3, or a functionally active fragment
thereof; and
[0095] c. contacting a reaction mixture comprising an activated Gal
to the acceptor moiety comprising a
GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc residue in the
presence of a glycosyltransferase having an amino acid of SEQ ID
NO:8.
[0096] In another embodiment, a method for preparing an
oligosaccharide having the structure
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc (i.e., globoglycolipids)
comprises sequentially performing the steps of:
[0097] a. contacting a reaction mixture comprising an activated Gal
to an acceptor moiety comprising a Glc residue in the presence of a
glycosyltransferase having an amino acid sequence of SEQ ID NO:6.
or a functionally active fragment thereof, and
[0098] b. contacting a reaction mixture comprising an activated Gal
to the acceptor moiety comprising Gal.beta.1.fwdarw.4Glc in the
presence of a glycosyltransferase having an amino acid sequence of
SEQ ID NO:4, or a functionally active fragment thereof.
[0099] Such oligosaccharides can be prepared using lipid A as a
carrier. Preferably, if the resulting glycolipid is to be used in a
vaccine, a non-toxic lipid, such as dolichol phosphate, is used as
the carrier.
Vaccination
[0100] Active immunity against Neisseria strains can be induced by
immunization (vaccination) with an immunogenic amount of an
oligosaccharide prepared according to the present invention in
admixture with an adjuvant, wherein the oligosaccharide is the
antigenic component of the vaccine. Preferably, the oligosaccharide
is conjugated to a carrier protein. Alternatively, where the
antigen is a glycolipid, it can be incorporated in a liposome.
[0101] The oligosaccharide alone cannot cause bacterial infection,
although the oligosaccharide on lipid A is toxic, and the active
immunity elicited by vaccination according to the present invention
can result in immediate immune response.
[0102] Selection of an adjuvant depends on the subject to be
vaccinated. Preferably, a pharmaceutically acceptable adjuvant is
used. For example, a vaccine for a human should avoid oil or
hydrocarbon emulsion adjuvants, including complete and incomplete
Freund's adjuvant. One example of an adjuvant suitable for use with
humans is alum (alumina gel). A vaccine for an animal, however, may
contain adjuvants not appropriate for use with humans.
[0103] A vaccine of the invention, i.e., a vaccine comprising an
oligosaccharide corresponding to an antigenic determinant on a
strain of Neisseria, can be administered via any parenteral route,
including but not limited to intramuscular, intraperitoneal,
intravenous, and the like.
[0104] Administration of an amount of a Neisseria oligosaccharide
sufficient to inhibit adhesion of the bacterium to its target cell
may also be effective for treating meningococcal or gonococcal
infection. The required amount can be determined by one of ordinary
skill using standard techniques.
Expression of Glycosyltransferases in for Intracellular
Glycosylation
[0105] The present invention further contemplates transforming a
host cell with a glycosyltransferase or glycosyltransferases of the
invention. It is expected that expression of the
glycosyltransferase, possibly in a cell lacking one or more
endogenous glycosyltransferases, may result in novel glycosylation
of lipids and proteins in such eukaryotic cells, and novel
glycosylation of lipids in procaryotic cells.
[0106] For example, transformation of a bacterium with non-toxic
lipid molecules may provide for expression of Neisseria
oligosaccharides on such a bacterium, which can then be used
directly in a whole cell vaccine.
[0107] Alternatively, expression of such a glycosyl transferase in
yeast, insect, or mammalian cell lines may result in novel
glycosylation of lipids and proteins expressed by these cells.
Antibodies to Neissena Oligosaccharides, and Diagnosis and Therapy
Therewith
[0108] Just as the oligosaccharides can be used in vaccines, so to
they can be used to generate antibodies to themselves, which
antibodies, in turn, can be used to detect that particular strain
of bacteria or for passive immunity. Antibodies include but are not
limited to polyclonal, monoclonal, chimeric, single chain, Fab
fragments, and an Fab expression library. Various procedures known
in the art may be used for the production of polyclonal antibodies
to oligosaccharide. For the production of antibody, various host
animals can be immunized by injection with the oligosaccharide,
including but not limited to rabbits, mice, rats, sheep, goats.
etc. In one embodiment, the oligosaccharide can be conjugated to an
immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole
limpet hemocyanin (KLH). Various adjuvants may be used to increase
the immunological response, depending on the host species. For
preparation of monoclonal antibodies directed toward the
oligosaccharide, or fragment, analog, or derivative thereof, any
technique that provides for the production of antibody molecules by
continuous cell lines in culture may be used. These include but are
not limited to the hybridoma technique originally developed by
Kohler and Milstein (1975, Nature 256:495-497), as well as the
trioma technique, the human B-cell hybridoma technique (Kozbor et
al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique
to produce human monoclonal antibodies (Cole et al., 1985, in
Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp.
77-96). In an additional embodiment of the invention, monoclonal
antibodies can be produced in germ-free animals utilizing recent
technology (PCT/US90/02545). According to the invention, human
antibodies may be used and can be obtained by using human
hybridomas (Cote et al., 1983, Proc. Natl. Acad. Sci. U.S.A.
80:2026-2030) or by transforming human B cells with EBV virus in
vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, pp. 77-96). In fact, according to the
invention, techniques developed for the production of "chimeric
antibodies" (Morrison et al., 1984, J. Bacteriol. 159-870;
Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985,
Nature 314:452-454) by splicing the genes from a mouse antibody
molecule specific for an oligosaccharide together with genes from a
human antibody molecule of appropriate biological activity can be
used; such antibodies are within the scope of this invention. Such
human or humanized chimeric antibodies are preferred for use in
therapy of human diseases or disorders, since the human or
humanized antibodies are much less likely than xenogenic antibodies
to induce an immune response, in particular an allergic response,
themselves. According to the invention, techniques described for
the production of single chain antibodies (U.S. Pat. No. 4,946,778)
can be adapted to produce oligosaccharide-specific single chain
antibodies. An additional embodiment of the invention utilizes the
techniques described for the construction of Fab expression
libraries (Huse et al., 1989, Science 246:1275-1281) to allow rapid
and easy identification of monoclonal Fab fragments with the
desired specificity for an oligosaccharide, or its derivatives, or
analogs.
[0109] Antibody fragments which contain the idiotype of the
antibody molecule can be generated by known techniques. For
example, such fragments include but are not limited to: the
F(ab').sub.2 fragment which can be produced by pepsin digestion of
the antibody molecule; the Fab' fragments which can be generated by
reducing the disulfide bridges of the F(ab').sub.2 fragment, and
the Fab fragments which can be generated by treating the antibody
molecule with papain and a reducing agent.
[0110] In the production of antibodies, screening for the desired
antibody can be accomplished by techniques known in the art, e-g.,
radioimmunoassay, ELISA (enzyme-linked immunosorbant assay),
"sandwich" immunoassays, immunoradiometric assays, gel diffusion
precipitin reactions, immunodiffusion assays, in situ immunoassays
(using colloidal gold, enzyme or radioisotope labels, for example),
western blots, precipitation reactions, agglutination assays (e.g.,
gel agglutination assays, hemagglutination assays), complement
fixation assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment, antibody
binding is detected by detecting a label on the primary antibody.
In another embodiment, the primary antibody is detected by
detecting binding of a secondary antibody or reagent to the primary
antibody. In a further embodiment, the secondary antibody is
labeled. Many means are known in the art for detecting binding in
an immunoassay and are within the scope of the present invention.
For example, to select antibodies which recognize a specific
oligosaccharide, one may assay generated hybridomas for a product
which binds to an oligosaccharide containing such epitope. For
selection of an antibody specific to an oligosaccharide from a
particular species or strain of Neisseria, one can select on the
basis of positive binding with oligosaccharide expressed by or
isolated from cells of that species or strain.
[0111] The foregoing antibodies can be used in methods known in the
art relating to the localization and activity of the
oligosaccharide, e.g., for Western blotting, imaging
oligosaccharide in situ, measuring levels thereof in appropriate
physiological samples, etc.
[0112] Diagnosis of infection with a Gram positive bacterium can
use any immunoassay format known in the art, as desired. The
antibodies can be labeled for detection in vitro, e.g., with labels
such as enzymes, fluorophores, chromophores, radioisotopes, dyes,
colloidal gold, latex particles, and chemiluminescent agents.
Alternatively, the antibodies can be labeled for detection in vivo,
e.g., with radioisotopes (preferably technetium or iodine);
magnetic resonance shift reagents (such as gadolinium and
manganese); or radio-opaque reagents.
[0113] Alternatively, the nucleic acids and sequences thereof of
the invention can be used in the diagnosis of infection with
Neisseria, in particular, to identify a particular strain, or to
determine which, if any, of the glycosyltransferase genes are
mutated. For example, the lgt genes or hybridizable fragments
thereof can be used for in situ hybridization with a sample from a
subject suspected of harboring an infection of Neisseria bacteria.
In another embodiment, specific gene segments of a Neisseria can be
identified using PCR amplification with probes based on the lgt
genes of the invention. In one aspect of the invention, the
hybridization with a probe or with the PCR primers can be performed
under stringent conditions, or with a sequence specific for a
unique strain or a limited number of strains of the bacterium, or
both, thus allowing for diagnosis of infection with that particular
strain (or strains). Alternatively, the hybridization can be under
less stringent conditions, or the sequence may be homologous in any
or all strains of a, bacterium, thus allowing for diagnosis of
infection with that species.
[0114] The present invention will be better understood from a
review of the following illustrative description presenting the
details of the constructs and procedures that were followed in its
development and validation.
EXAMPLE
[0115] This Example describes a locus in Neisseria gonorrhoeae
strain F62 containing five genes. Four of the genes are responsible
for the sequential addition of the
GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNA-
c.beta.1.fwdarw.3Gal.beta.1.fwdarw.4 to the substrate
Glc.beta.1.fwdarw.4Hep.fwdarw.R of the inner core region (Yamasaki
et al., 1991, Biochemistry 30:10566). The fifth gene is involved
with the addition of the .alpha.-linked galactose residue in the
biosynthesis of the alternative LOS structure
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc.-
beta.1.fwdarw.4Hep.fwdarw.R (John et al., 1991, J. Biol. Chem.
266:19303). The DNA sequence analysis revealed that the first,
third and fourth reading frames contained poly-G tracts which in
strain F62 were respectively 17, 10 and 11 bp. Thus, three of the
LOS biosynthetic enzymes are potentially susceptible to premature
termination by reading-frame changes, as has been reported for the
gonococcal pilC genes (Jonsson et al., 1991, EMBO J. 10:477; Rudel
et al., 1992, Molec. Microbiol. 6:3439). It is likely that these
structural features are responsible for the high-frequency genetic
variation of gonococcal LOS (Schneider et al., 1988, Infect. Immun.
56:942).
Materials and Methods
[0116] Reagents and chemicals. Most laboratory chemicals were
obtained from Sigma Chemical Co (St. Louis, Mo.). Restriction
enzymes were purchased from New England Biolabs (Beverly,
Mass.).
[0117] Media and growth conditions. E. coli strains were grown in
solid or liquid LB medium (Sambrook et al., 1989, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor); antibiotics were
added as applicable. Carbenicillin was used at 50 .mu.g/ml and
erythromycin at 200 .mu.g/ml. Neisseria gonorrhoeae strain F62 was
grown on GC agar (Swanson, 1978, Infect. Immun. 19:320) or GC agar
containing 2 .mu.g/ml erythromycin. For isolation of LOS or genomic
DNA, gonococci were grown in 1.5% proteose peptone broth (Difco
Laboratories, Detroit Mich.), 30 mM phosphate, 8.5 mM NaCl
supplemented with 1% isovitalex (Becton Dickinson Microbiology
Systems, Cockeysville, Md.).
[0118] Recombinant DNA methods. Plasmids were purified using either
Qiagen columns or the QIAprep spin columns obtained from Qiagen
Inc. (Chatsworth, Calif.). Digestion with restriction enzymes, gel
electrophoresis, ligations with T4 DNA polymerase and
transformation of E. coli were done according to Sambrook et al.
(Sambrook et al., 1989, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor). Southern hybridization was performed on Hybond N+
membranes Amersham Co. (Arlington Heights, Ill.) with DNA labeled
using the ECL kit from Amersham Co. Genomic DNA was isolated as
described by Moxon et al. (Moxon et al., 1984, J. Clin. Invest.
73:298).
[0119] A gene bank of Neisseria gonorrhoeae strain F62 genomic DNA
was constructed by ligating ca 20 kb fragments obtained by
incomplete digestion with Sau3A into BamHI/EcoRI digested
.lambda.2001 (Karn et al., 1984, Gene 32:217). The phage library
was screened by hybridization with random-primer-labeled plasmid
pR10PI, and 5 clones were isolated by plaque purification. The
phage from these clones were purified by sedimentation followed by
flotation on CsCl (Davis et al., 1980, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.), and the DNA was isolated.
From one of these clones, two ClaI fragments of 4.9 and 3.4 kb were
isolated by gel electrophoresis and recovery with Geneclean II (BIO
101 Inc., La Jolla. Calif.). These were ligated into ClaI cut
pBluescript II SK--from Stratagene (La Jolla, Calif.) and called
p4900 and p3400 respectively. p4900 contained a PstI site in the
insert and was subdivided into two clones containing inserts of 2.1
and 2.8 kb. The clone containing the 2.8 kb insert was called
pPstCla. The inserts in p3400 and pPstCla were sequenced by the
chain termination method (Sanger et al., 1977, Proc. Natl. Acad
Sci. USA 74:5463) using Sequenase II, (United States Biochemical
Co., Cleveland. Ohio.). All of the sequence presented in FIG. 2 was
completed in both directions.
[0120] The insertion and deletions shown in FIG. 6 were constructed
as follows. I1, I3, .DELTA.1 and .DELTA.2 used plasmid pPstCla cut
respectively with BsaBI, AscI, SrnI and double cut with StyI and
BsaBI. I2 and .DELTA.3 used plasmid p3400 cut with AgeI or StyI.
The complete locus was assembled by cloning the ClaI-ApaI fragment
from p3400 into pPstCla cut with ClaI and ApaI, and the plasmid was
called pLOS5. Deletions .DELTA.4 and .DELTA.5 were constructed
using pLOS5 and digestion with StyI and BbsI or with StyI alone. In
all instances (except digestion with BsaBI) the cut plasmids were
treated with the Kienow fragment of E. coli DNA polymerase to blunt
the ends, and ermC' (erythromycin resistance marker) was inserted.
The ermC' gene was isolated from plasmid pIM13 (Projan et al.,
1987, J. Bacteriol. 169:5131) as a ClaI-HindIII fragment and cloned
into the same sites in plasmid pHSS6 (Seifert et al., 1986, Proc.
Natl. Acad. Sci. USA 83:735). From this plasmid it was excised as a
NotI fragment, the ends blunted by treatment with Klenow fragment
of DNA polymerase, purified by gel electrophoresis and recovery
with Geneclean II.
[0121] Transformation of piliated Neisseria gonorrhoeae strain F62
was performed with plasmids isolated from E. coli (Klugman et al.,
1989, Infect. Immun. 57:2066) and the transformants selected on GC
agar (Swanson, 1978, Infect. Immun. 19:320) containing 2 .mu.g/ml
erythromycin. The fidelity of the genomic alteration of each of the
gonococcal transformants was verified by sequencing the upstream
and downstream junctions of the ermC' gene in their genomic DNA
using a PCR technique. Two 5' biotinylated primers,
GCCGAGAAAACTATTGGTGGA (SEQ. ID. NO:9) and AAAACATGCAGGAATTGACGAT)
(SEQ. ID. NO:10), were synthesized; these were based on the ermC'
sequence near its upstream and its downstream end respectively. The
primers were designed such that their 3' ends pointed outward from
the ermC' gene. Each of these primers was used together with a
suitable primer matching the sequence of the LOS locus near the
putative insertion. PCR was performed according the instructions
supplied with the GeneAmp PCR Reagent Kit from Perkin Elmer
(Branchburg, N.J.) using 25 cycles. In all instances the expected
size product was obtained. The DNA sequence of these products was
determined by purifying the PCR product on magnetic streptavidin
beads from Dynal, Inc. (Lake Success, N.Y.) and sequencing with the
Sequenase II kit according to a protocol provided by Dynal, Inc.,
based on the method developed by Hultman et al (Hultman et al.,
1989, Nucleic Acids Res. 17:4937). The sequences were analyzed by
computer programs in the GCG package of Genetics Computer Group,
Inc. (Madison, Wis.).
[0122] Immunological methods. Monoclonal antibodies 17-1-L1 (L1),
9-2-L378 (L3), 2-1-L8 (L8) were obtained as filtered ascites
fluids. Antibody 1-1-M was obtained as ascites fluid and 3F11 and
4C4 were obtained as tissue culture supernatants. LOS was extracted
from each of the gonococcal mutants by the hot phenol-water method
(Westphal and Jann, 1965, Academic Press, New York 83-91) and
purified as described (Johnston et al., 1976, J. Exp. Med.
143:741). The LOS was diluted to 200 .mu.g/ml in the Western blot
buffer described by Towbin et al. (Towbin et al., 1979, Proc. Natl.
Acad. Sci. USA 76:4350), and 1.5 .mu.l aliquots were spotted on
Immobilon-P membrane from Millipore Corp (Bedford, Mass.) that was
lying on 3 MM Whatman filter paper (Whatman Ltd., Maidstone,
England) soaked in the blotting buffer. The spots were allowed to
absorb into the membrane over a period of 2 min and the strips were
placed in blocking buffer for at least 60 min. The blocking buffer
consisted of 3% gelatin dissolved in 150 mM NaCl, 10 mM Tris-HCl 10
mM pH 7.5, 5 mM MgCl.sub.2, 0.02% NaN.sub.3. The strips were washed
thrice in the same buffer containing 1% gelatin. The strips were
treated for 2 h with monoclonal antibodies diluted in blocking
buffer. The antibodies available as ascites fluids were diluted
1/1000, antibodies available as tissue culture supernatants 1/10.
The strips were washed, incubated for 60 min with a 1/1000 dilution
of phosphatase-conjugated anti-IgG,IgA,IgM from Cappel (Organon
Teknika Co., West Chester, Pa.), washed and stained as described
previously (Blake et al., 1984, Analyt. Biochem. 136:175).
[0123] Gel electrophoresis. Gel electrophoresis of LOS samples was
performed as described by Lesse et al (Less et al., 1990, J.
Immunol. Meth. 126:109) and the gels silver stained (Hitchcock and
Brown, 1983, J. Bacteriol. 154-269).
Results
[0124] Cloning of the LOS Locus. During attempts to isolate the
porin gene of Neisseria gonorrhoeae, pBR322 clones containing a 4.9
kb ClaI fragment that reacted by colony blots with a rabbit
antiserum to purified porin were repeatedly isolated. An
immunoreactive subclone, pR10PI, consisting of a 1305 bp RsaI-ClaI
fragment was derived and its DNA sequence was determined. This
sequence had homology to a gene isolated from Haemophilus
influenzae called lex-1 (Cope et -a., 1991, Molec. Microbiol.
5:1113) or lic2A (High et al., 1993, Molec. Microbiol. 9:1275) that
is known to be involved in LPS synthesis of that species. Using
subclone pR10PI as a probe, Southern blots of Neisseria gonorrhoeae
genomic DNA digested with ClaI revealed hybridization with two
fragments, 4.9 and 3.4 kb. However, digestion with some other
restriction enzymes gave rise to only a single band. Notably,
digestion with BfaI gave rise to a single band of 4.1 kb,
suggesting that the two copies were closely linked (data not
shown).
[0125] A .lambda.2001 bank of Neisseria gonorrhoeae strain F62 DNA
was screened by hybridization with pR10PI and 5 clones were
isolated. One of these clones, when digested with either ClaI or
BfaI and examined by Southern hybridization using pR10PI as the
probe, gave rise to a pattern identical to that seen with genomic
DNA. The appropriate ClaI fragments of this .lambda.2001 clone were
isolated and cloned into the ClaI site of pBluescript II SK-. The
entire sequence of the 3400 ClaI fragment was determined. Mapping
of the clone containing the 4900 bp ClaI fragment indicated that
there was a single PstI site in the clone about 2.8 kb from one
side, allowing the clone to be divided into two subclones. Partial
sequence of the ends of the 2.1 kb subclone indicated that it
contained a coding frame homologous to the E. coli COOH-terminal
portion of the a subunit of glycyl-tRNA synthetase (glyS) and the
majority of the .beta. subunit of this gene (Webster et al., 1983,
J. Biol. Chem. 258:10637). The predicted length of DNA needed to
match the E. coli sequence was present; this clone was not examined
further.
[0126] DNA Sequence of the LOS Locus. A summary of the features
found by sequencing the two clones is illustrated in FIG. 2.
Following the glyS gene were found five closely spaced open reading
frames. The last frame has 46 bp downstream of the termination
codon a sequence typical of a rho independent termination signal.
Subsequently, there is an area of ca 100 bp that has striking
homology to the IS1106 neisserial insertion sequence (Knight et
al., 1992, Molec. Microbiol. 6:1565). Further elucidation of the
nature of this locus, presented below, showed the five open reading
frames code for LOS glycosyl transferases and hence they have been
named lgtA-lgtE.
[0127] Searches for internal homology within this locus indicates
that the DNA coding for the first two genes (lgtA, lgtB) is
repeated as the fourth and fifth genes (lgtD, lgtE) and that
interposed is an additional open reading frame, lgtC. This is in
keeping with the data obtained by Southern hybridization presented
above, in which pR10PI probe containing the lgtB and a small
portion of the lgtC gene hybridized with two ClaI fragments, but
with only one BfaI fragment (see positions of the BfaI sites in the
LOS locus in FIG. 2). In more detail, 16 bp following the stop
codon of the tRNA synthetase (glyS) is the beginning of a stem loop
structure followed closely by a consensus ribosome binding site
(rbs), and within 6 bp is a TTG believed to be the initiation codon
of lgtA. 2871 bp downstream from the beginning of the stem loop
(closely following the stop codon of lgtC) there is an almost
perfect repeat of the stem loop structure, the rbs, and the TTG
initiation codon of lgtD, with the downstream sequence strongly
homologous for about 500 bp. The sequences then diverge to some
extent. However, at the beginning of lgtB and lgtE the homology
again becomes nearly perfect for ca 200 bases to then diverge
toward the latter part of the orfs. The similarity of the
homologous proteins is illustrated in FIGS. 3 and 4. These
comparisons, demonstrate the near-perfect conservation of the
primary structure in the N-terminal portions of the molecules with
increasing divergence toward the COOH-termini of the proteins.
[0128] The lgtC sequence interposed between the repeated portions
of the locus is not repeated within the locus or in the Neisseria
gonorrhoeae genome (data not shown). It appears to be homologous to
E. coli rfaI or rfaJ genes, which are very closely related genes
that serve as glucosyl transferases in core LPS biosynthesis
(Pradel et al., 1992, J. Bacteriol. 174:4736). The similarity of
rfa with lgtC is illustrated in FIG. 5.
[0129] It was found that three of these genes contained within
their coding frame runs of guanosines coding for stretches of
glycines (see FIG. 2). These poly-G regions were found in lgtA (17
bp), lgtC (10 bp) and lgtD (11 bp); in each case the number G
residues was one that maintained an intact reading frame (see FIGS.
3 and 5). In each of the three genes a change of 1 or 2 G bases
would cause premature termination of the transcript.
[0130] LOS phenotype of Neisseria gonorrhoea F62 with deletions of
the LOS locus. In order to define the function of the lgt genes,
insertions or deletions of the LOS locus were constructed in
plasmids propagated in E. coli. The insertions or deletions in each
case were marked with the ermC' gene, which is an excellent
selective marker in Neisseria gonorrhoeae (Klugman et al., 1989,
Infect. Immun. 57:2066). The constructions are summarized in FIG.
6. I1, I2 and I3 refer to insertions of the ermC' marker into,
respectively, a BsaBI, AgeI and AscI site. Similarly, the deletions
were constructed by excising portions of the plasmids and
substituting the erythromycin marker. The open arrows indicate the
gene or genes disrupted. Each of these plasmids was used to
transform Neisseria gonorrhoeae strain F62 and transformants were
selected on erythromycin-containing plates. The fidelity of the
genomic alteration of a prototype of each of the gonococcal
transformants was verified by sequencing the upstream and
downstream junction of the ermC' gene. To simplify the nomenclature
in this report the gonococcal mutants have been given the same
names used to identify the plasmid constructs in FIG. 6.
[0131] The LOS of the mutants were examined by SDS-PAGE and
compared to the LOS of strain 1291e. This strain was originally
isolated by Dudas and Apicella (Dudas and Apicella, 1988, Infect.
Immun. 56:499) as a pyocin-resistant mutant of strain 1291 wild
type and has been extensively characterized both chemically and
genetically. Chemical analysis has shown that this mutant lacks
completely the lacto-N-neotetraose substitution on heptose 1 (John
et al., 1991, J. Biol. Chem. 266:19303). The genetic basis of this
mutant has been defined (Zhou et al., 1994, J. Biol. Chem.
269:11162; Sandlin and Stein, 1994, J. Bacteriol. 176:2930); it is
a mutation of the pgm gene coding for phosphoglucomutase. This
mutation prohibits the synthesis of UDP-glucose and hence the
addition of glucose to the heptose. As seen in FIG. 7, the parental
wild type F62 strain gives rise to two major LOS bands; their
appearance is indistinguishable from SDS-PAGE patterns previously
published by other workers (Schneider et al., 1985, Amer. Soc.
Microbiology, Washington 400-405). The mutants are arranged on the
gel according to the size of the major band that they contain. The
size decreases from the top band of the F62 wt LOS in four clear
steps to the size of the LOS of .DELTA.4 or I2. Since the I2 mutant
(with an insertion into lgtE, the last gene in the locus) has the
same phenotype as .DELTA.4 (which has a complete deletion of the
locus), it suggests that the lgtE product performs the first
biosynthetic step. Thus, the enzymes encoded by lgtA-D, although
intact, do not have a substrate to act upon. Mutant .DELTA.5 (a
deletion of the locus with the exception of lgtE) gives rise to a
LOS that is one step larger, supporting the idea that this gene
accounts for the initial biosynthetic step. Note that the LOS of
both I2 and .DELTA.4 mutants is perceptibly larger than the LOS of
strain 1291e which is known to be unable to add glucose, the first
residue in the lacto-N-neotetraose chain. These data suggest that
lgtE encodes the galactosyl transferase enzyme which adds the first
galactose of the lacto-N-neotetraose.
[0132] The LOS preparations were also studied using a dot blot
technique for their reactivity with monoclonal antibodies. The
monoclonal antibodies employed and their reported specificities are
shown in FIG. 1. The reactions observed with the LOS obtained from
the parental strain and the mutants are summarized in FIG. 8. The
reactivity of the parental F62 with 1-1-M, 3F11 and L8 was as
reported previously by Mandrell et al (Mandrell et al., 1985, Amer.
Soc. Microbiology, Washington 379-384) and by Yamasaki et al
(Yamasaki et al., 1991, Mol. Immunol. 28:1233). Mutants .DELTA.4
and I2 fail to react with any of the antibodies. However, .DELTA.5
gives a strong reaction with antibodies 4C4 and L8, indicating that
the first galactose residue is present. This is in keeping with the
SDS-PAGE results (see FIG. 6) and supports the role of lgtE as the
galactosyl transferase. It also indicates that deletions upstream
of lgtE do not significantly inactivate its function by polar
effects. The LOS of F62 wt parent has strong reactivity with L3 and
weak reactivity with 3F11. It is known that reactivity 3F11 is
occluded by the addition of the GalNAc residue (Schneider et al.,
J. Exp. Med. 174:1601); this is not the case with the L3 antibody.
The wt LOS reacts with 1-1-M, the antibody reactive when the
terminal GalNAc residue is present. The reactivity with 1-1-M is
lost in .DELTA.3 which has a deletion only in lgtD. This suggest
that this gene encodes the GalNAc transferase.
[0133] The reactivity with antibody L1 (specific for the
alternative LOS structure capped with an .alpha.1.fwdarw.4Gal) is
not seen in wt LOS, is absent in I1, and all deletions which affect
lgtC. The reactivity is strongest in .DELTA.1, which has a deletion
of lgtA only. Note that this mutant also has lost reactivity with
3F11 and L3. These two findings suggest that lgtA codes for the
GlcNAc transferase, and when this residue is not added, the
incomplete chain is a substrate for the action of lgtC to produce
the alternative LOS structure. Note that the sizes of the LOS
products seen in FIG. 7 are in accord with the immunological data.
This conclusion suggests that lgtC encodes the .alpha.-Gal
transferase. This is further supported by the weak reactivity of
mutant .DELTA.3 with antibody L1. Mutant .DELTA.3 has a deletion of
lgtD and fails to add the terminal GalNAc, allowing the .alpha.-Gal
transferase to modify the lacto-N-neotetraose group to produce a
P.sub.i-like globoside (Mandrell, 1992, Infect. Immun. 60:3017).
Mutant I3 (with inactive lgtB) has lost reactivity with 1-1-M, 3F11
and L1, and remains only weakly reactive with L3. Together with the
size of the product, these observations suggest that lgtB encodes
the galactosyl transferase adding Gal.beta.1.fwdarw.4 to the GlcNAc
residue. Ricinus lectin RCA-I is specific for terminal galactose in
.beta. linkage (Nicolson and Blaustein, 1972, Biochim. Biophys.
Acta 266:543; Lin and Li, 1980, Eur. J. Biochem. 105:453) and was
used to confirm the presence of this structure on the LOS
preparations. Using ELISA tests it was found that wild type,
.DELTA.3, .DELTA.2 and .DELTA.5 LOS, expected to bear a terminal
.beta.Gal, bound the lectin (see FIG. 7), while .DELTA.4, I2,
.DELTA.1 and I3 were unreactive (data not shown).
DISCUSSION
[0134] A locus containing 5 open reading frames has been cloned.
The effect of eight defined mutations within this locus on the size
and serological reactivity of the LOS produced by gonococcal
transformants suggests that these genes are the glycosyl
transferases responsible for the biosynthesis of most of the
lacto-N-neotetraose chain. The data obtained allow an
identification of the function of each of these genes. It is
noteworthy that lgtB and lgtE, which are structurally very closely
related, also perform an apparently very similar biosynthetic task,
i.e. the addition of Gal.beta..fwdarw.4 to GlcNAc or Glc,
respectively. Similarly, the closely related lgtA and lgtD add
GalNAc or GlcNAc .beta.1.fwdarw.3, respectively, to a Gal residue.
lgtC, which is unrelated to the other genes in the locus, is
responsible for the addition of a Gal.alpha.1.fwdarw.4.
[0135] The DNA sequence showed that three of the genes (lgtA, lgtC
and lgtD) contain tracts of guanosines which code for glycine
residues in the proteins. These provide a potential mechanism for
high-frequency variation of expression of these genes. Slippage in
such poly-G tracts is well documented to control the expression of
the gonococcal pilC genes, with resultant effects on pilus
adhesiveness to human epithelial cells (Rudel et al., 1992, Molec.
Microbiol. 6:3439). In strain F62, the numbers of bases in each of
the three poly-G regions were such that the proteins are in frame,
and this is in keeping with the ability of F62 wild type to produce
a complete LOS including the addition of the terminal GalNAc.
[0136] Three aspects of LOS biosynthesis appear potentially to be
subject to high frequency variation. The first is the addition of
the terminal GalNAc (lgtD). This would cause an alteration of
reactivity with monoclonal antibody 1-1-M, and this phase variation
has been reported by van Putten (Van Putten, 1993, EMBO J.
12:4043). Similarly, a change in lgtA would cause the failure of
the addition of GlcNAc to the growing chain and truncate the LOS at
the .beta.-lactosyl level. This is a very common form of LOS in
gonococci with a 3.6 kilodalton molecule, which confers resistance
to the bactericidal effect of normal human serum (Schneider et al.,
1985, Infect. Immun. 50:672). It is tempting to speculate that the
in vitro variation between variant A and C of MS11.sub.mk from the
.beta.-lactosyl chain to a complete LOS (which had a selective
advantage in vivo in the volunteers) could be explained by
regaining functional expression, of the GlcNAc transferase lgtA.
Finally, the variable addition of .alpha.1.fwdarw.4Gal to either
the .beta.-lactosyl (p.sup.k-like globo-triose) or the
lacto-N-neotetraose group (P.sub.i-like globoside) (Mandrell, 1992,
Infect. Immun. 60:3017) would be under the control of the
expression of lgtC. The activity of the lgtC transferase appears to
compete poorly with the other transferases for precursor and its
activity is evident only if either lgtA or lgtD are silent. For the
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc trisaccharide to be
synthesized the GlcNAc transferase lgtA must be inactive and for
expression of the P.sub.i-like globoside
Gal.alpha.1.fwdarw.4Gal.beta.1.f-
wdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc the GalNAc
transferase lgtD must be silent.
[0137] Comparable high frequency antigenic variation of Haemophitas
influenzae LOS has also been noted and has been attributed to
changes in translational frame caused by shifts in the number of
CAAT repeats in two separate loci, lic1 (Weiser et al., 1989, Cell
59:657) and lic2 (High et al., 1993, Molec. Microbiol. 9:1275).
Shifts allowing the expression of the lic2 gene are correlated with
the expression of an epitope with the structure
Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.. Since the lic2 gene is
homologous to lgtB and lgtE the galactosyl transferases which link
Gal.beta.1.fwdarw.4 to respectively Glc or GlcNAc, it is likely
that this is its function in Haemophilus influenzae LOS synthesis.
It is remarkable that while both these mucosal pathogens have
evolved frame shift mechanisms to cause antigenic variation of the
LOS, that the gonococcal homologs of lic2, (lgtB and lgtE) are not
the ones that contain poly-G tracts.
[0138] While the frame-shift mechanisms discussed above are suited
for on/off regulation of gene expression, the structure of the
locus also lends itself to more subtle regulation of the level of
expression of the genes. It has been demonstrated that growth rate
affects the molecular weight distribution and antigenic character
LOS species produced (Morse et al., 1983, Infect. Immun. 41:74).
While I have not determined the size of the RNA transcripts it is
very likely that lgtA, lgtB and lgtC (in the instance where the
poly-G tracts are such that the coding frame is maintained) are
transcribed together. The termination codon of lgtA and the
initiation codon of lgtB in fact overlap, and the distance between
the TAA of lgtB and the ATG of lgtC is only 11 bp. Similarly, the
stop codon of lgtD and the start codon of lgtE are separated by
only 18 bp. Yet the organization is such that if any of the three
genes subject to phase variation are in the off configuration,
transcription is able to reinitiate effectively at the beginning of
the next gene. This ability to reinitiate transcription was clearly
seen with the mutations constructed in this study.
[0139] The correlation of LOS structure with function is still in
its early stages. The major advances in the field have been the
development of an understanding of the structure of the molecules
and the ability to relate this, often unambiguously, to the
reactivity with a number of well-characterized monoclonal
antibodies. Added to this is the realization that in the in vivo
environment, which provides CMP-NANA, the organism may or may not
sialylate the LOS, depending whether the LOS synthesized is a
competent acceptor structure. It is well known that sialylation
induces a serum-resistant state in many strains. However, the
effect of sialylation in local infection is not as well studied.
van Putten has shown that sialylation of LOS has a marked
inhibitory effect on epithelial cell invasion, without apparently
greatly altering adhesion (Van Putten, 1993, EMBO J. 12:4043). His
studies suggest that in the mucosal infection, LOS structures that
cannot be sialylated may be important for efficient cell invasion.
In the context of this report, such structures could be achieved
either by the efficient addition of the terminal GalNAc or by
shortening the LOS chain by silencing the GlcNAc transferase. The
correlation of LOS chemistry with biological reaction has been
complicated by the leakiness of the existing LOS mutants isolated
by pyocin selection (Dudas and Apicella, 1988, Infect. Immun.
56:499; Sandlin et al., 1993, Infect. Immun. 61:3360). This is in
fact exemplified with mutant 1291e which shows in addition to the
major low molecular weight band, an additional higher band (see
FIG. 7). The new insight provided into the genetics of the
biosynthesis of gonococcal LOS will allow construction of mutants
that are not leaky. For instance, .DELTA.4 and .DELTA.5 should be
stable mutants since they no longer contain genes with poly-G
tracts. The expression of the genes containing the poly-G tracts
could be stabilized by engineering the areas so that glycines are
encoded by other codons.
[0140] The present invention is not to be limited in scope by the
specific embodiments described herein, since such embodiments are
intended as but single illustrations of one aspect of the invention
and any functionally equivalent embodiments are within the scope of
this invention. Indeed, various modifications of the invention in
addition to those shown and described herein will become apparent
to those skilled in the art from the foregoing description and
accompanying drawings. Such modifications are intended to fall
within the scope of the appended claims. It is also to be
understood that all base pair sizes given for nucleotides are
approximate and are used for the purpose of description. Various
references are cited herein, the disclosures of which are
incorporated by reference herein in their entirety.
[0141] Particular embodiments described herein:
[0142] Paragraph A A purified nucleic acid that is hybridizable
under moderately stringent conditions to a nucleic acid having a
nucleotide sequence corresponding to or complementary to the
nucleotide sequence shown in FIG. 2 (SEQ ID NO: 1).
[0143] Paragraph B The nucleic acid of Paragraph A that is
hybridizable under moderately stringent conditions to a nucleic
acid having a nucleotide sequence corresponding to or complementary
to a portion of the nucleotide sequence shown in FIG. 2 (SEQ ID NO:
1) that encodes a functionally active glycosyltransferase.
[0144] Paragraph C The nucleic acid of Paragraph B that encodes a
functionally active glycosyltransferase.
[0145] Paragraph D The nucleic acid of Paragraph A that has a
nucleotide sequence corresponding to or complementary to a portion
of the nucleotide sequence shown in FIG. 2 (SEQ ID NO: 1) that
encodes a functionally active glycosyltransferase.
[0146] Paragraph E The nucleic acid of Paragraph D that encodes a
functionally active glycosyltransferase.
[0147] Paragraph F The nucleic acid of Paragraph A that has a
nucleotide sequence corresponding to or complementary to the
nucleotide sequence shown in FIG. 2 (SEQ ID NO: 1).
[0148] Paragraph G The nucleic acid of Paragraph C wherein the
functionally active glycosyltransferase catalyzes a reaction
selected from the group consisting of:
[0149] a) adding Gal .beta.1.fwdarw.4 to GlcNAc or Glc;
[0150] b) adding GalNAc or GlcNAc .beta.1.fwdarw.3 to Gal; and
[0151] c) adding Gal .alpha.1.fwdarw.4 to Gal.
[0152] Paragraph H The nucleic acid of Paragraph C which encodes a
glycosyltransferase having an amino acid sequence of SEQ ID
NO:3.
[0153] Paragraph I The nucleic acid of Paragraph C which encodes a
glycosyltransferase having an amino acid sequence of SEQ ID
NO:8.
[0154] Paragraph J The nucleic acid of Paragraph C which encodes a
glycosyltransferase having an amino acid sequence of SEQ ID
NO:4.
[0155] Paragraph K The nucleic acid of Paragraph C which encodes a
glycosyltransferase having an amino acid sequence of SEQ ID
NO:5.
[0156] Paragraph L The nucleic acid of Paragraph C which encodes a
glycosyltransferase having an amino acid sequence of SEQ ID
NO:6.
[0157] Paragraph M An expression vector comprising the nucleic acid
of Paragraph C operatively associated with an expression control
sequence.
[0158] Paragraph N A recombinant host cell transformed with the
expression vector of Paragraph M.
[0159] Paragraph O A method for producing a glycosyltransferase
comprising:
[0160] a) culturing the recombinant host cell of Paragraph N under
conditions that allow expression of the glycosyltransferase;
and
[0161] b) recovering the expressed glycosyltransferase.
[0162] Paragraph P A glycosyltransferase having an amino acid
sequence of SEQ ID NO:3, or a functionally active fragment
thereof.
[0163] Paragraph Q A glycosyltransferase having an amino acid
sequence of SEQ ID NO:8, or a functionally active fragment
thereof.
[0164] Paragraph R A glycosyltransferase having an amino acid
sequence of SEQ ID NO:4, or a functionally active fragment
thereof.
[0165] Paragraph S A glycosyltransferase having an amino acid
sequence of SEQ ID NO:5, or a functionally active fragment
thereof.
[0166] Paragraph T A glycosyltransferase having an amino acid
sequence of SEQ ID NO:6, or a functionally active fragment
thereof.
[0167] Paragraph U A composition comprising a glycosyltransferase
conjugated to a solid phase support, wherein the
glycosyltransferase is selected from the group consisting of:
[0168] a) a glycosyltransferase having an amino acid sequence of
SEQ ID NO:3, or a functionally active fragment thereof;
[0169] b) a glycosyltransferase having an amino acid sequence of
SEQ ID NO:8, or a functionally active fragment thereof;
[0170] c) a glycosyltransferase having an amino acid sequence of
SEQ ID NO:4, or a functionally active fragment thereof;
[0171] d) a glycosyltransferase having an amino acid sequence of
SEQ ID NO:5, or a functionally active fragment thereof; and
[0172] e) a glycosyltransferase having an amino acid sequence of
SEQ ID NO:6 or a functionally active fragment thereof.
[0173] Paragraph V A method for adding GalNAc or GlcNAc
.beta.1.fwdarw.3 to Gal, comprising contacting a reaction mixture
comprising an activated GalNAc or GlcNAc to an acceptor moiety
comprising a Gal residue in the presence of the glycosyltransferase
of Paragraph P.
[0174] Paragraph W A method for adding Gal .beta.1.fwdarw.4 to
GlcNAc or Glc, comprising contacting a reaction mixture comprising
an activated Gal to an acceptor moiety comprising a GlcNAc or Glc
residue in the presence of the glycosyltransferase of Paragraph
Q.
[0175] Paragraph X A method for adding Gal .alpha.1.fwdarw.4 to
Gal, comprising contacting a reaction mixture comprising an
activated Gal to an acceptor moiety comprising a Gal residue in the
presence of the glycosyltransferase of Paragraph R.
[0176] Paragraph Y A method for adding GalNAc or GlcNAc
.beta.1.fwdarw.3 to Gal, comprising contacting a reaction mixture
comprising an activated GalNAc or GlcNAc to an acceptor moiety
comprising a Gal residue in the presence of the glycosyltransferase
of Paragraph S.
[0177] Paragraph Z A method for adding Gal .beta.1.fwdarw.4 to
GlcNAc or Glc, comprising contacting a reaction mixture comprising
an activated Gal to an acceptor moiety comprising a GlcNAc or Glc
residue in the presence of the glycosyltransferase of Paragraph
T.
[0178] Paragraph AA A method for preparing an oligosaccharide
having the structure Gal.alpha.1.fwdarw.4Gal.beta.1.fwdarw.4Glc,
which comprises sequentially performing the steps of:
[0179] a) contacting a reaction mixture comprising an activated Gal
to an acceptor moiety comprising a Glc residue in the presence of a
glycosyltransferase having an amino acid sequence of SEQ ID NO:6,
or a functionally active fragment thereof; and
[0180] b) contacting a reaction mixture comprising an activated Gal
to the acceptor moiety comprising Gal.beta.1.fwdarw.4Glc in the
presence of a glycosyltransferase having an amino acid sequence of
SEQ ID NO:4, or a functionally active fragment thereof.
[0181] Paragraph AB A method for preparing an oligosaccharide
having the structure Gal.beta.1.fwdarw.4Glc, which comprises
contacting a reaction mixture comprising an activated Gal to an
acceptor moiety comprising a Glc residue in the presence of the
glycosyltransferase of Paragraph T.
[0182] Paragraph AC A method for preparing an oligosaccharide
having the structure GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc,
which comprises contacting a reaction mixture comprising an
activated GlcNAc to an acceptor moiety comprising a
Gal.beta.1.fwdarw.4Glc residue in the presence of the
glycosyltransferase of Paragraph P.
[0183] Paragraph AD A method for preparing an oligosaccharide
having the structure
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc- ,
which comprises contacting a reaction mixture comprising an
activated Gal to an acceptor moiety comprising a
GlcNAc.beta.1.fwdarw.3Gal.beta.1.f- wdarw.4Glc residue in the
presence of the glycosyltransferase of Paragraph Q.
[0184] Paragraph AE A method for preparing an oligosaccharide
having the structure
GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3-
Gal.beta.1.fwdarw.4Glc, which comprises contacting a reaction
mixture comprising an activated GalNAc to an acceptor moiety
comprising a
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc
residue in the presence of the glycosyltransferase of Paragraph
S.
[0185] Paragraph AF A method for preparing an oligosaccharide
having the structure
GalNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3-
Gal.beta.1.fwdarw.4Glc, which comprises sequentially performing the
steps of:
[0186] a) contacting a reaction mixture comprising an activated Gal
to an acceptor moiety comprising a Glc residue in the presence of a
glycosyltransferase having an amino acid sequence of SEQ ID NO: 6,
or a functionally active fragment thereof;
[0187] b) contacting a reaction mixture comprising an activated
GlcNAc to the acceptor moiety comprising a Gal.beta.1.fwdarw.4Glc
residue in the presence of a glycosyltransferase having an amino
acid sequence of SEQ ID NO:3, or a functionally active fragment
thereof;
[0188] c) contacting a reaction mixture comprising an activated Gal
to the acceptor moiety comprising a
GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc residue in the
presence of a glycosyltransferase having an amino acid of SEQ ID
NO:8; and
[0189] d) contacting a reaction mixture comprising an activated
GalNAc to the acceptor moiety comprising a
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.- 3Gal.beta.31.fwdarw.4Glc
residue in the presence of a glycosyltransferase having an amino
acid sequence of SEQ ID NO:5, or a functionally active fragment
thereof.
[0190] Paragraph AG A method for preparing an oligosaccharide
having the structure
Gal.beta.1.fwdarw.4GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc- ,
which comprises sequentially performing the steps of:
[0191] a) contacting a reaction mixture comprising an activated Gal
to an acceptor moiety comprising a Glc residue in the presence of a
glycosyltransferase having an amino acid sequence of SEQ ID NO: 6,
or a functionally active fragment thereof;
[0192] b) contacting a reaction mixture comprising an activated
GlcNAc to the acceptor moiety comprising a Gal.beta.1.fwdarw.4Glc
residue in the presence of a glycosyltransferase having an amino
acid sequence of SEQ ID NO:3, or a functionally active fragment
thereof; and
[0193] c) contacting a reaction mixture comprising an activated Gal
to the acceptor moiety comprising a
GlcNAc.beta.1.fwdarw.3Gal.beta.1.fwdarw.4Glc residue in the
presence of a glycosyltransferase having an amino acid of SEQ ID
NO:8.
Sequence CWU 1
1
13 1 5859 DNA Neisseria gonorrheae CDS (1)..(381) glys (glycyl tRNA
syntetase beta chain) 1 ctg cag gcc gtc gcc gta ttc aaa caa ctg ccc
gaa gcc gcc gcg ctc 48 Leu Gln Ala Val Ala Val Phe Lys Gln Leu Pro
Glu Ala Ala Ala Leu 1 5 10 15 gcc gcc gcc aac aaa cgc gtg caa aac
ctg ctg aaa aaa gcc gat gcc 96 Ala Ala Ala Asn Lys Arg Val Gln Asn
Leu Leu Lys Lys Ala Asp Ala 20 25 30 gcg ttg ggc gaa gtc aat gaa
agc ctg ctg caa cag gac gaa gaa aaa 144 Ala Leu Gly Glu Val Asn Glu
Ser Leu Leu Gln Gln Asp Glu Glu Lys 35 40 45 gcc ctg tac gct gcc
gcg caa ggt ttg cag ccg aaa att gcc gcc gcc 192 Ala Leu Tyr Ala Ala
Ala Gln Gly Leu Gln Pro Lys Ile Ala Ala Ala 50 55 60 gtc gcc gaa
ggc aat ttc cga acc gcc ttg tcc gaa ctg gct tcc gtc 240 Val Ala Glu
Gly Asn Phe Arg Thr Ala Leu Ser Glu Leu Ala Ser Val 65 70 75 80 aag
ccg cag gtt gat gcc ttc ttc gac ggc gtg atg gtg atg gcg gaa 288 Lys
Pro Gln Val Asp Ala Phe Phe Asp Gly Val Met Val Met Ala Glu 85 90
95 gat gcc gcc gta aaa caa aac cgc ctg aac ctg ctg aac cgc ttg gca
336 Asp Ala Ala Val Lys Gln Asn Arg Leu Asn Leu Leu Asn Arg Leu Ala
100 105 110 gag cag atg aac gcg gtg gcc gac atc gcg ctt ttg ggc gag
taa 381 Glu Gln Met Asn Ala Val Ala Asp Ile Ala Leu Leu Gly Glu 115
120 125 ccgttgtaca gtccaaatgc cgtctgaagc cttcaggcgg catcaaatta
tcgggagagt 441 aaa ttg cag cct tta gtc agc gta ttg att tgc gcc tac
aac gta gaa 489 Leu Gln Pro Leu Val Ser Val Leu Ile Cys Ala Tyr Asn
Val Glu 130 135 140 aaa tat ttt gcc caa tca tta gcc gcc gtc gtg aat
cag act tgg cgc 537 Lys Tyr Phe Ala Gln Ser Leu Ala Ala Val Val Asn
Gln Thr Trp Arg 145 150 155 aac ttg gat att ttg att gtc gat gac ggc
tcg aca gac ggc aca ctt 585 Asn Leu Asp Ile Leu Ile Val Asp Asp Gly
Ser Thr Asp Gly Thr Leu 160 165 170 gcc att gcc aag gat ttt caa aag
cgg gac agc cgt atc aaa atc ctt 633 Ala Ile Ala Lys Asp Phe Gln Lys
Arg Asp Ser Arg Ile Lys Ile Leu 175 180 185 gca caa gct caa aat tcc
ggc ctg att ccc tct tta aac atc ggg ctg 681 Ala Gln Ala Gln Asn Ser
Gly Leu Ile Pro Ser Leu Asn Ile Gly Leu 190 195 200 205 gac gaa ttg
gca aag tcg ggg ggg ggg ggg ggg gaa tat att gcg cgc 729 Asp Glu Leu
Ala Lys Ser Gly Gly Gly Gly Gly Glu Tyr Ile Ala Arg 210 215 220 acc
gat gcc gac gat att gcc tcc ccc ggc tgg att gag aaa atc gtg 777 Thr
Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val 225 230
235 ggc gag atg gaa aaa gac cgc agc atc att gcg atg ggc gcg tgg ctg
825 Gly Glu Met Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala Trp Leu
240 245 250 gaa gtt ttg tcg gaa gaa aag gac ggc aac cgg ctg gcg cgg
cac cac 873 Glu Val Leu Ser Glu Glu Lys Asp Gly Asn Arg Leu Ala Arg
His His 255 260 265 aaa cac ggc aaa att tgg aaa aag ccg acc cgg cac
gaa gac atc gcc 921 Lys His Gly Lys Ile Trp Lys Lys Pro Thr Arg His
Glu Asp Ile Ala 270 275 280 285 gcc ttt ttc cct ttc ggc aac ccc ata
cac aac aac acg atg att atg 969 Ala Phe Phe Pro Phe Gly Asn Pro Ile
His Asn Asn Thr Met Ile Met 290 295 300 cgg cgc agc gtc att gac ggc
ggt ttg cgt tac gac acc gag cgg gat 1017 Arg Arg Ser Val Ile Asp
Gly Gly Leu Arg Tyr Asp Thr Glu Arg Asp 305 310 315 tgg gcg gaa gat
tac caa ttt tgg tac gat gtc agc aaa ttg ggc agg 1065 Trp Ala Glu
Asp Tyr Gln Phe Trp Tyr Asp Val Ser Lys Leu Gly Arg 320 325 330 ctg
gct tat tat ccc gaa gcc ttg gtc aaa tac cgc ctt cac gcc aat 1113
Leu Ala Tyr Tyr Pro Glu Ala Leu Val Lys Tyr Arg Leu His Ala Asn 335
340 345 cag gtt tca tcc aaa cac agc gtc cgc caa cac gaa atc gcg caa
ggc 1161 Gln Val Ser Ser Lys His Ser Val Arg Gln His Glu Ile Ala
Gln Gly 350 355 360 365 atc caa aaa acc gcc aga aac gat ttt ttg cag
tct atg ggt ttt aaa 1209 Ile Gln Lys Thr Ala Arg Asn Asp Phe Leu
Gln Ser Met Gly Phe Lys 370 375 380 acc cgg ttc gac agc cta gaa tac
cgc caa aca aaa gca gcg gcg tat 1257 Thr Arg Phe Asp Ser Leu Glu
Tyr Arg Gln Thr Lys Ala Ala Ala Tyr 385 390 395 gaa ctg ccg gag aag
gat ttg ccg gaa gaa gat ttt gaa cgc gcc cgc 1305 Glu Leu Pro Glu
Lys Asp Leu Pro Glu Glu Asp Phe Glu Arg Ala Arg 400 405 410 cgg ttt
ttg tac caa tgc ttc aaa cgg acg gac acg ccg ccc tcc ggc 1353 Arg
Phe Leu Tyr Gln Cys Phe Lys Arg Thr Asp Thr Pro Pro Ser Gly 415 420
425 gcg tgg ctg gat ttc gcg gca gac ggc agg atg agg cgg ctg ttt acc
1401 Ala Trp Leu Asp Phe Ala Ala Asp Gly Arg Met Arg Arg Leu Phe
Thr 430 435 440 445 ttg agg caa tac ttc ggc att ttg tac cgg ctg att
aaa aac cgc cgg 1449 Leu Arg Gln Tyr Phe Gly Ile Leu Tyr Arg Leu
Ile Lys Asn Arg Arg 450 455 460 cag gcg cgg tcg gat tcg gca ggg aaa
gaa cag gag att taa 1491 Gln Ala Arg Ser Asp Ser Ala Gly Lys Glu
Gln Glu Ile 465 470 tgcaaaacca cgttatcagc ttggcttccg ccgcagaacg
cagggcgcac attgccgcaa 1551 ccttcggcag tcgcggcatc ccgttccagt
ttttcgacgc actgatgccg tctgaaaggc 1611 tggaacgggc aatggcggaa
ctcgtccccg gcttgtcggc gcacccctat ttgagcggag 1671 tggaaaaagc
ctgctttatg agccacgccg tattgtggga acaggcattg gacgaaggcg 1731
taccgtatat cgccgtattt gaagatgatg tcttactcgg cgaaggcgcg gagcagttcc
1791 ttgccgaaga tacttggctg caagaacgct ttgaccccga ttccgccttt
gtcgtccgct 1851 tggaaacgat gtttatgcac gtcctgacct cgccctccgg
cgtggcggac tacggcgggc 1911 gcgcctttcc gcttttggaa agcgaacact
gcgggacggc gggctatatt atttcccgaa 1971 aggcgatgcg ttttttcttg
gacaggtttg ccgttttgcc gcccgaacgc ctgcaccctg 2031 tcgatttgat
gatgttcggc aaccctgacg acagggaagg aatgccggtt tgccagctca 2091
atcccgcctt gtgcgcccaa gagctgcatt atgccaagtt tcacgaccaa aacagcgcat
2151 tgggcagcct gatcgaacat gaccgccgcc tgaaccgcaa acagcaatgg
cgcgattccc 2211 ccgccaacac attcaaacac cgcctgatcc gcgccttgac
caaaatcggc agggaaaggg 2271 aaaaacgccg gcaaaggcgc gaacagttaa
tcggcaagat tattgtgcct ttccaataaa 2331 aggagaaaag atg gac atc gta
ttt gcg gca gac gac aac tat gcc gcc 2380 Met Asp Ile Val Phe Ala
Ala Asp Asp Asn Tyr Ala Ala 475 480 485 tac ctt tgc gtt gcg gca aaa
agc gtg gaa gcg gcc cat ccc gat acg 2428 Tyr Leu Cys Val Ala Ala
Lys Ser Val Glu Ala Ala His Pro Asp Thr 490 495 500 gaa atc agg ttc
cac gtc ctc gat gcc ggc atc agt gag gaa aac cgg 2476 Glu Ile Arg
Phe His Val Leu Asp Ala Gly Ile Ser Glu Glu Asn Arg 505 510 515 gcg
gcg gtt gcc gcc aat ttg cgg ggg ggg ggt aat atc cgc ttt ata 2524
Ala Ala Val Ala Ala Asn Leu Arg Gly Gly Gly Asn Ile Arg Phe Ile 520
525 530 535 gac gta aac ccc gaa gat ttc gcc ggc ttc ccc tta aac atc
agg cac 2572 Asp Val Asn Pro Glu Asp Phe Ala Gly Phe Pro Leu Asn
Ile Arg His 540 545 550 att tcc att acg act tat gcc cgc ctg aaa ttg
ggc gaa tac att gcc 2620 Ile Ser Ile Thr Thr Tyr Ala Arg Leu Lys
Leu Gly Glu Tyr Ile Ala 555 560 565 gat tgc gac aaa gtc ctg tat ctg
gat acg gac gta ttg gtc agg gac 2668 Asp Cys Asp Lys Val Leu Tyr
Leu Asp Thr Asp Val Leu Val Arg Asp 570 575 580 ggc ctg aag ccc tta
tgg gat acc gat ttg ggc ggt aac tgg gtc ggc 2716 Gly Leu Lys Pro
Leu Trp Asp Thr Asp Leu Gly Gly Asn Trp Val Gly 585 590 595 gcg tgc
atc gat ttg ttt gtc gaa agg cag gaa gga tac aaa caa aaa 2764 Ala
Cys Ile Asp Leu Phe Val Glu Arg Gln Glu Gly Tyr Lys Gln Lys 600 605
610 615 atc ggt atg gcg gac gga gaa tat tat ttc aat gcc ggc gta ttg
ctg 2812 Ile Gly Met Ala Asp Gly Glu Tyr Tyr Phe Asn Ala Gly Val
Leu Leu 620 625 630 atc aac ctg aaa aag tgg cgg cgg cac gat att ttc
aaa atg tcc tgc 2860 Ile Asn Leu Lys Lys Trp Arg Arg His Asp Ile
Phe Lys Met Ser Cys 635 640 645 gaa tgg gtg gaa caa tac aag gac gtg
atg caa tat cag gat cag gac 2908 Glu Trp Val Glu Gln Tyr Lys Asp
Val Met Gln Tyr Gln Asp Gln Asp 650 655 660 att ttg aac ggg ctg ttt
aaa ggc ggg gtg tgt tat gcg aac agc cgt 2956 Ile Leu Asn Gly Leu
Phe Lys Gly Gly Val Cys Tyr Ala Asn Ser Arg 665 670 675 ttc aac ttt
atg ccg acc aat tat gcc ttt atg gcg aac ggg ttt gcg 3004 Phe Asn
Phe Met Pro Thr Asn Tyr Ala Phe Met Ala Asn Gly Phe Ala 680 685 690
695 tcc cgc cat acc gac ccg ctt tac ctc gac cgt acc aat acg gcg atg
3052 Ser Arg His Thr Asp Pro Leu Tyr Leu Asp Arg Thr Asn Thr Ala
Met 700 705 710 ccc gtc gcc gtc agc cat tat tgc ggc tcg gca aag ccg
tgg cac agg 3100 Pro Val Ala Val Ser His Tyr Cys Gly Ser Ala Lys
Pro Trp His Arg 715 720 725 gac tgc acc gtt tgg ggt gcg gaa cgt ttc
aca gag ttg gcc ggc agc 3148 Asp Cys Thr Val Trp Gly Ala Glu Arg
Phe Thr Glu Leu Ala Gly Ser 730 735 740 ctg acg acc gtt ccc gaa gaa
tgg cgc ggc aaa ctt gcc gtc ccg ccg 3196 Leu Thr Thr Val Pro Glu
Glu Trp Arg Gly Lys Leu Ala Val Pro Pro 745 750 755 aca aag tgt atg
ctt caa aga tgg cgc aaa aag ctg tct gcc aga ttc 3244 Thr Lys Cys
Met Leu Gln Arg Trp Arg Lys Lys Leu Ser Ala Arg Phe 760 765 770 775
tta cgc aag att tat tga cggggcaggc cgtctgaagc cttcagacgg 3292 Leu
Arg Lys Ile Tyr 780 catcggacgt atcggaaagg agaaacgga ttg cag cct tta
gtc agc gta ttg 3345 Leu Gln Pro Leu Val Ser Val Leu 785 att tgc
gcc tac aac gca gaa aaa tat ttt gcc caa tca ttg gcc gcc 3393 Ile
Cys Ala Tyr Asn Ala Glu Lys Tyr Phe Ala Gln Ser Leu Ala Ala 790 795
800 gta gtg ggg cag act tgg cgc aac ttg gat att ttg att gtc gat gac
3441 Val Val Gly Gln Thr Trp Arg Asn Leu Asp Ile Leu Ile Val Asp
Asp 805 810 815 820 ggc tcg acg gac ggc acg ccc gcc att gcc cgg cat
ttc caa gaa cag 3489 Gly Ser Thr Asp Gly Thr Pro Ala Ile Ala Arg
His Phe Gln Glu Gln 825 830 835 gac ggc agg atc agg ata att tcc aat
ccc cgc aat ttg ggc ttt atc 3537 Asp Gly Arg Ile Arg Ile Ile Ser
Asn Pro Arg Asn Leu Gly Phe Ile 840 845 850 gcc tct tta aac atc ggg
ctg gac gaa ttg gca aag tcg ggg ggg ggg 3585 Ala Ser Leu Asn Ile
Gly Leu Asp Glu Leu Ala Lys Ser Gly Gly Gly 855 860 865 gaa tat att
gcg cgc acc gat gcc gac gat att gcc tcc ccc ggc tgg 3633 Glu Tyr
Ile Ala Arg Thr Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp 870 875 880
att gag aaa atc gtg ggc gag atg gaa aaa gac cgc agc atc att gcg
3681 Ile Glu Lys Ile Val Gly Glu Met Glu Lys Asp Arg Ser Ile Ile
Ala 885 890 895 900 atg ggc gcg tgg ttg gaa gtt ttg tcg gaa gaa aac
aat aaa agc gtg 3729 Met Gly Ala Trp Leu Glu Val Leu Ser Glu Glu
Asn Asn Lys Ser Val 905 910 915 ctt gcc gcc att gcc cga aac ggc gca
att tgg gac aaa ccg acc cgg 3777 Leu Ala Ala Ile Ala Arg Asn Gly
Ala Ile Trp Asp Lys Pro Thr Arg 920 925 930 cat gaa gac att gtc gcc
gtt ttc cct ttc ggc aac ccc ata cac aac 3825 His Glu Asp Ile Val
Ala Val Phe Pro Phe Gly Asn Pro Ile His Asn 935 940 945 aac acg atg
att atg agg cgc agc gtc att gac ggc ggt ttg cgg ttc 3873 Asn Thr
Met Ile Met Arg Arg Ser Val Ile Asp Gly Gly Leu Arg Phe 950 955 960
gat cca gcc tat atc cac gcc gaa gac tat aag ttt tgg tac gaa gcc
3921 Asp Pro Ala Tyr Ile His Ala Glu Asp Tyr Lys Phe Trp Tyr Glu
Ala 965 970 975 980 ggc aaa ctg ggc agg ctg gct tat tat ccc gaa gcc
ttg gtc aaa tac 3969 Gly Lys Leu Gly Arg Leu Ala Tyr Tyr Pro Glu
Ala Leu Val Lys Tyr 985 990 995 cgc ttc cat caa gac cag act tct tcc
aaa tac aac ctg caa cag 4014 Arg Phe His Gln Asp Gln Thr Ser Ser
Lys Tyr Asn Leu Gln Gln 1000 1005 1010 cgc agg acg gcg tgg aaa atc
aaa gaa gaa atc agg gcg ggg tat 4059 Arg Arg Thr Ala Trp Lys Ile
Lys Glu Glu Ile Arg Ala Gly Tyr 1015 1020 1025 tgg aag gcg gca ggc
ata gcc gtc ggg gcg gac tgc ctg aat tac 4104 Trp Lys Ala Ala Gly
Ile Ala Val Gly Ala Asp Cys Leu Asn Tyr 1030 1035 1040 ggg ctt ttg
aaa tca acg gca tat gcg ttg tac gaa aaa gcc ttg 4149 Gly Leu Leu
Lys Ser Thr Ala Tyr Ala Leu Tyr Glu Lys Ala Leu 1045 1050 1055 tcc
gga cag gat atc gga tgc ctc cgc ctg ttc ctg tac gaa tat 4194 Ser
Gly Gln Asp Ile Gly Cys Leu Arg Leu Phe Leu Tyr Glu Tyr 1060 1065
1070 ttc ttg tcg ttg gaa aag tat tct ttg acc gat ttg ctg gat ttc
4239 Phe Leu Ser Leu Glu Lys Tyr Ser Leu Thr Asp Leu Leu Asp Phe
1075 1080 1085 ttg aca gac cgc gtg atg agg aag ctg ttt gcc gca ccg
caa tat 4284 Leu Thr Asp Arg Val Met Arg Lys Leu Phe Ala Ala Pro
Gln Tyr 1090 1095 1100 agg aaa atc ctg aaa aaa atg tta cgc cct tgg
aaa tac cgc agc 4329 Arg Lys Ile Leu Lys Lys Met Leu Arg Pro Trp
Lys Tyr Arg Ser 1105 1110 1115 tat tga aaccgaacag gataaatc atg caa
aac cac gtt atc agc ttg gct 4380 Tyr Met Gln Asn His Val Ile Ser
Leu Ala 1120 1125 tcc gcc gca gag cgc agg gcg cac att gcc gat acc
ttc ggc agt 4425 Ser Ala Ala Glu Arg Arg Ala His Ile Ala Asp Thr
Phe Gly Ser 1130 1135 1140 cgc ggc atc ccg ttc cag ttt ttc gac gca
ctg atg ccg tct gaa 4470 Arg Gly Ile Pro Phe Gln Phe Phe Asp Ala
Leu Met Pro Ser Glu 1145 1150 1155 agg ctg gaa cag gcg atg gcg gaa
ctc gtc ccc ggc ttg tcg gcg 4515 Arg Leu Glu Gln Ala Met Ala Glu
Leu Val Pro Gly Leu Ser Ala 1160 1165 1170 cac ccc tat ttg agc gga
gtg gaa aaa gcc tgc ttt atg agc cac 4560 His Pro Tyr Leu Ser Gly
Val Glu Lys Ala Cys Phe Met Ser His 1175 1180 1185 gcc gta ttg tgg
gaa cag gcg ttg gat gaa ggt ctg ccg tat atc 4605 Ala Val Leu Trp
Glu Gln Ala Leu Asp Glu Gly Leu Pro Tyr Ile 1190 1195 1200 gcc gta
ttt gag gac gac gtt tta ctc ggc gaa ggc gcg gag cag 4650 Ala Val
Phe Glu Asp Asp Val Leu Leu Gly Glu Gly Ala Glu Gln 1205 1210 1215
ttc ctt gcc gaa gat act tgg ttg gaa gag cgt ttt gac aag gat 4695
Phe Leu Ala Glu Asp Thr Trp Leu Glu Glu Arg Phe Asp Lys Asp 1220
1225 1230 tcc gcc ttt atc gtc cgt ttg gaa acg atg ttt gcg aaa gtt
att 4740 Ser Ala Phe Ile Val Arg Leu Glu Thr Met Phe Ala Lys Val
Ile 1235 1240 1245 gtc aga ccg gat aaa gtc ctg aat tat gaa aac cgg
tca ttt cct 4785 Val Arg Pro Asp Lys Val Leu Asn Tyr Glu Asn Arg
Ser Phe Pro 1250 1255 1260 ttg ctg gag agc gaa cat tgt ggg acg gct
ggc tat atc att tcg 4830 Leu Leu Glu Ser Glu His Cys Gly Thr Ala
Gly Tyr Ile Ile Ser 1265 1270 1275 cgt gag gcg atg cgg ttt ttc ttg
gac agg ttt gcc gtt ttg ccg 4875 Arg Glu Ala Met Arg Phe Phe Leu
Asp Arg Phe Ala Val Leu Pro 1280 1285 1290 cca gag cgg att aaa gcg
gta gat ttg atg atg ttt act tat ttc 4920 Pro Glu Arg Ile Lys Ala
Val Asp Leu Met Met Phe Thr Tyr Phe 1295 1300 1305 ttt gat aag gag
ggg atg cct gtt tat cag gtt agt ccc gcc tta 4965 Phe Asp Lys Glu
Gly Met Pro Val Tyr Gln Val Ser Pro Ala Leu 1310 1315 1320 tgt acc
caa gaa ttg cat tat gcc aag ttt ctc agt caa aac agt 5010 Cys Thr
Gln Glu Leu His Tyr Ala Lys Phe Leu Ser Gln Asn Ser 1325 1330 1335
atg ttg ggt agc gat ttg gaa aaa gat agg gaa caa gga aga aga 5055
Met Leu Gly Ser Asp Leu Glu Lys Asp Arg Glu Gln Gly Arg Arg 1340
1345 1350 cac cgc cgt tcg ttg aag gtg atg ttt gac ttg aag cgt gct
ttg 5100 His Arg Arg Ser Leu Lys Val Met Phe Asp Leu Lys Arg Ala
Leu 1355 1360 1365 ggt aaa ttc ggt agg
gaa aag aag aaa aga atg gag cgt caa agg 5145 Gly Lys Phe Gly Arg
Glu Lys Lys Lys Arg Met Glu Arg Gln Arg 1370 1375 1380 cag gcg gag
ctt gag aaa gtt tac ggc agg cgg gtc ata ttg ttc 5190 Gln Ala Glu
Leu Glu Lys Val Tyr Gly Arg Arg Val Ile Leu Phe 1385 1390 1395 aaa
tag tttgtgtaaa atatagggga ttaaaatcag aaatggacac actgtcattc 5246 Lys
ccgcgcaggc gggaatctag gtctttaaac ttcggttttt tccgataaat tcttgccgca
5306 ttaaaattcc agattcccgc tttcgcgggg atgacggcgg ggggattgtt
gctttttcgg 5366 ataaaatccc gtgttttttc atctgctagg taaaatcgcc
ccaaagcgtc tgcatcgcgg 5426 cgatggcggc gagtggggcg gtttctgtgc
gtaaaatccg ttttccgagt gtaaccgcct 5486 gaaagccggc ttcaaatgcc
tgttgttctt cctgttctgt ccagccgcct tcgggcccga 5546 ccataaagac
gattgcgccg gacgggtggc ggatgtcgcc gagtttgcag gcgcggttga 5606
tgctcataat cagcttggtg ttttcagacg gcattttgtc gagtgcttca cggtagccga
5666 tgatgggcag tacgggggga acggtgttcc tgccgctttg ttcgcacgcg
gagatgacga 5726 tttcctgcca gcgtgcgagg cgtttggcgg cgcgttctcc
gtcgaggcgg acgatgcagc 5786 gttcgctgat gacgggctgt atggcggtta
cgccgagttc gacgcttttt tgcagggtga 5846 aatccatgcg atc 5859 2 126 PRT
Neisseria gonorrheae 2 Leu Gln Ala Val Ala Val Phe Lys Gln Leu Pro
Glu Ala Ala Ala Leu 1 5 10 15 Ala Ala Ala Asn Lys Arg Val Gln Asn
Leu Leu Lys Lys Ala Asp Ala 20 25 30 Ala Leu Gly Glu Val Asn Glu
Ser Leu Leu Gln Gln Asp Glu Glu Lys 35 40 45 Ala Leu Tyr Ala Ala
Ala Gln Gly Leu Gln Pro Lys Ile Ala Ala Ala 50 55 60 Val Ala Glu
Gly Asn Phe Arg Thr Ala Leu Ser Glu Leu Ala Ser Val 65 70 75 80 Lys
Pro Gln Val Asp Ala Phe Phe Asp Gly Val Met Val Met Ala Glu 85 90
95 Asp Ala Ala Val Lys Gln Asn Arg Leu Asn Leu Leu Asn Arg Leu Ala
100 105 110 Glu Gln Met Asn Ala Val Ala Asp Ile Ala Leu Leu Gly Glu
115 120 125 3 348 PRT Neisseria gonorrheae 3 Leu Gln Pro Leu Val
Ser Val Leu Ile Cys Ala Tyr Asn Val Glu Lys 1 5 10 15 Tyr Phe Ala
Gln Ser Leu Ala Ala Val Val Asn Gln Thr Trp Arg Asn 20 25 30 Leu
Asp Ile Leu Ile Val Asp Asp Gly Ser Thr Asp Gly Thr Leu Ala 35 40
45 Ile Ala Lys Asp Phe Gln Lys Arg Asp Ser Arg Ile Lys Ile Leu Ala
50 55 60 Gln Ala Gln Asn Ser Gly Leu Ile Pro Ser Leu Asn Ile Gly
Leu Asp 65 70 75 80 Glu Leu Ala Lys Ser Gly Gly Gly Gly Gly Glu Tyr
Ile Ala Arg Thr 85 90 95 Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp
Ile Glu Lys Ile Val Gly 100 105 110 Glu Met Glu Lys Asp Arg Ser Ile
Ile Ala Met Gly Ala Trp Leu Glu 115 120 125 Val Leu Ser Glu Glu Lys
Asp Gly Asn Arg Leu Ala Arg His His Lys 130 135 140 His Gly Lys Ile
Trp Lys Lys Pro Thr Arg His Glu Asp Ile Ala Ala 145 150 155 160 Phe
Phe Pro Phe Gly Asn Pro Ile His Asn Asn Thr Met Ile Met Arg 165 170
175 Arg Ser Val Ile Asp Gly Gly Leu Arg Tyr Asp Thr Glu Arg Asp Trp
180 185 190 Ala Glu Asp Tyr Gln Phe Trp Tyr Asp Val Ser Lys Leu Gly
Arg Leu 195 200 205 Ala Tyr Tyr Pro Glu Ala Leu Val Lys Tyr Arg Leu
His Ala Asn Gln 210 215 220 Val Ser Ser Lys His Ser Val Arg Gln His
Glu Ile Ala Gln Gly Ile 225 230 235 240 Gln Lys Thr Ala Arg Asn Asp
Phe Leu Gln Ser Met Gly Phe Lys Thr 245 250 255 Arg Phe Asp Ser Leu
Glu Tyr Arg Gln Thr Lys Ala Ala Ala Tyr Glu 260 265 270 Leu Pro Glu
Lys Asp Leu Pro Glu Glu Asp Phe Glu Arg Ala Arg Arg 275 280 285 Phe
Leu Tyr Gln Cys Phe Lys Arg Thr Asp Thr Pro Pro Ser Gly Ala 290 295
300 Trp Leu Asp Phe Ala Ala Asp Gly Arg Met Arg Arg Leu Phe Thr Leu
305 310 315 320 Arg Gln Tyr Phe Gly Ile Leu Tyr Arg Leu Ile Lys Asn
Arg Arg Gln 325 330 335 Ala Arg Ser Asp Ser Ala Gly Lys Glu Gln Glu
Ile 340 345 4 306 PRT Neisseria gonorrheae 4 Met Asp Ile Val Phe
Ala Ala Asp Asp Asn Tyr Ala Ala Tyr Leu Cys 1 5 10 15 Val Ala Ala
Lys Ser Val Glu Ala Ala His Pro Asp Thr Glu Ile Arg 20 25 30 Phe
His Val Leu Asp Ala Gly Ile Ser Glu Glu Asn Arg Ala Ala Val 35 40
45 Ala Ala Asn Leu Arg Gly Gly Gly Asn Ile Arg Phe Ile Asp Val Asn
50 55 60 Pro Glu Asp Phe Ala Gly Phe Pro Leu Asn Ile Arg His Ile
Ser Ile 65 70 75 80 Thr Thr Tyr Ala Arg Leu Lys Leu Gly Glu Tyr Ile
Ala Asp Cys Asp 85 90 95 Lys Val Leu Tyr Leu Asp Thr Asp Val Leu
Val Arg Asp Gly Leu Lys 100 105 110 Pro Leu Trp Asp Thr Asp Leu Gly
Gly Asn Trp Val Gly Ala Cys Ile 115 120 125 Asp Leu Phe Val Glu Arg
Gln Glu Gly Tyr Lys Gln Lys Ile Gly Met 130 135 140 Ala Asp Gly Glu
Tyr Tyr Phe Asn Ala Gly Val Leu Leu Ile Asn Leu 145 150 155 160 Lys
Lys Trp Arg Arg His Asp Ile Phe Lys Met Ser Cys Glu Trp Val 165 170
175 Glu Gln Tyr Lys Asp Val Met Gln Tyr Gln Asp Gln Asp Ile Leu Asn
180 185 190 Gly Leu Phe Lys Gly Gly Val Cys Tyr Ala Asn Ser Arg Phe
Asn Phe 195 200 205 Met Pro Thr Asn Tyr Ala Phe Met Ala Asn Gly Phe
Ala Ser Arg His 210 215 220 Thr Asp Pro Leu Tyr Leu Asp Arg Thr Asn
Thr Ala Met Pro Val Ala 225 230 235 240 Val Ser His Tyr Cys Gly Ser
Ala Lys Pro Trp His Arg Asp Cys Thr 245 250 255 Val Trp Gly Ala Glu
Arg Phe Thr Glu Leu Ala Gly Ser Leu Thr Thr 260 265 270 Val Pro Glu
Glu Trp Arg Gly Lys Leu Ala Val Pro Pro Thr Lys Cys 275 280 285 Met
Leu Gln Arg Trp Arg Lys Lys Leu Ser Ala Arg Phe Leu Arg Lys 290 295
300 Ile Tyr 305 5 337 PRT Neisseria gonorrheae 5 Leu Gln Pro Leu
Val Ser Val Leu Ile Cys Ala Tyr Asn Ala Glu Lys 1 5 10 15 Tyr Phe
Ala Gln Ser Leu Ala Ala Val Val Gly Gln Thr Trp Arg Asn 20 25 30
Leu Asp Ile Leu Ile Val Asp Asp Gly Ser Thr Asp Gly Thr Pro Ala 35
40 45 Ile Ala Arg His Phe Gln Glu Gln Asp Gly Arg Ile Arg Ile Ile
Ser 50 55 60 Asn Pro Arg Asn Leu Gly Phe Ile Ala Ser Leu Asn Ile
Gly Leu Asp 65 70 75 80 Glu Leu Ala Lys Ser Gly Gly Gly Glu Tyr Ile
Ala Arg Thr Asp Ala 85 90 95 Asp Asp Ile Ala Ser Pro Gly Trp Ile
Glu Lys Ile Val Gly Glu Met 100 105 110 Glu Lys Asp Arg Ser Ile Ile
Ala Met Gly Ala Trp Leu Glu Val Leu 115 120 125 Ser Glu Glu Asn Asn
Lys Ser Val Leu Ala Ala Ile Ala Arg Asn Gly 130 135 140 Ala Ile Trp
Asp Lys Pro Thr Arg His Glu Asp Ile Val Ala Val Phe 145 150 155 160
Pro Phe Gly Asn Pro Ile His Asn Asn Thr Met Ile Met Arg Arg Ser 165
170 175 Val Ile Asp Gly Gly Leu Arg Phe Asp Pro Ala Tyr Ile His Ala
Glu 180 185 190 Asp Tyr Lys Phe Trp Tyr Glu Ala Gly Lys Leu Gly Arg
Leu Ala Tyr 195 200 205 Tyr Pro Glu Ala Leu Val Lys Tyr Arg Phe His
Gln Asp Gln Thr Ser 210 215 220 Ser Lys Tyr Asn Leu Gln Gln Arg Arg
Thr Ala Trp Lys Ile Lys Glu 225 230 235 240 Glu Ile Arg Ala Gly Tyr
Trp Lys Ala Ala Gly Ile Ala Val Gly Ala 245 250 255 Asp Cys Leu Asn
Tyr Gly Leu Leu Lys Ser Thr Ala Tyr Ala Leu Tyr 260 265 270 Glu Lys
Ala Leu Ser Gly Gln Asp Ile Gly Cys Leu Arg Leu Phe Leu 275 280 285
Tyr Glu Tyr Phe Leu Ser Leu Glu Lys Tyr Ser Leu Thr Asp Leu Leu 290
295 300 Asp Phe Leu Thr Asp Arg Val Met Arg Lys Leu Phe Ala Ala Pro
Gln 305 310 315 320 Tyr Arg Lys Ile Leu Lys Lys Met Leu Arg Pro Trp
Lys Tyr Arg Ser 325 330 335 Tyr 6 280 PRT Neisseria gonorrheae 6
Met Gln Asn His Val Ile Ser Leu Ala Ser Ala Ala Glu Arg Arg Ala 1 5
10 15 His Ile Ala Asp Thr Phe Gly Ser Arg Gly Ile Pro Phe Gln Phe
Phe 20 25 30 Asp Ala Leu Met Pro Ser Glu Arg Leu Glu Gln Ala Met
Ala Glu Leu 35 40 45 Val Pro Gly Leu Ser Ala His Pro Tyr Leu Ser
Gly Val Glu Lys Ala 50 55 60 Cys Phe Met Ser His Ala Val Leu Trp
Glu Gln Ala Leu Asp Glu Gly 65 70 75 80 Leu Pro Tyr Ile Ala Val Phe
Glu Asp Asp Val Leu Leu Gly Glu Gly 85 90 95 Ala Glu Gln Phe Leu
Ala Glu Asp Thr Trp Leu Glu Glu Arg Phe Asp 100 105 110 Lys Asp Ser
Ala Phe Ile Val Arg Leu Glu Thr Met Phe Ala Lys Val 115 120 125 Ile
Val Arg Pro Asp Lys Val Leu Asn Tyr Glu Asn Arg Ser Phe Pro 130 135
140 Leu Leu Glu Ser Glu His Cys Gly Thr Ala Gly Tyr Ile Ile Ser Arg
145 150 155 160 Glu Ala Met Arg Phe Phe Leu Asp Arg Phe Ala Val Leu
Pro Pro Glu 165 170 175 Arg Ile Lys Ala Val Asp Leu Met Met Phe Thr
Tyr Phe Phe Asp Lys 180 185 190 Glu Gly Met Pro Val Tyr Gln Val Ser
Pro Ala Leu Cys Thr Gln Glu 195 200 205 Leu His Tyr Ala Lys Phe Leu
Ser Gln Asn Ser Met Leu Gly Ser Asp 210 215 220 Leu Glu Lys Asp Arg
Glu Gln Gly Arg Arg His Arg Arg Ser Leu Lys 225 230 235 240 Val Met
Phe Asp Leu Lys Arg Ala Leu Gly Lys Phe Gly Arg Glu Lys 245 250 255
Lys Lys Arg Met Glu Arg Gln Arg Gln Ala Glu Leu Glu Lys Val Tyr 260
265 270 Gly Arg Arg Val Ile Leu Phe Lys 275 280 7 5859 DNA
Neisseria gonorrheae CDS (1491)..(2330) lgtB 7 ctgcaggccg
tcgccgtatt caaacaactg cccgaagccg ccgcgctcgc cgccgccaac 60
aaacgcgtgc aaaacctgct gaaaaaagcc gatgccgcgt tgggcgaagt caatgaaagc
120 ctgctgcaac aggacgaaga aaaagccctg tacgctgccg cgcaaggttt
gcagccgaaa 180 attgccgccg ccgtcgccga aggcaatttc cgaaccgcct
tgtccgaact ggcttccgtc 240 aagccgcagg ttgatgcctt cttcgacggc
gtgatggtga tggcggaaga tgccgccgta 300 aaacaaaacc gcctgaacct
gctgaaccgc ttggcagagc agatgaacgc ggtggccgac 360 atcgcgcttt
tgggcgagta accgttgtac agtccaaatg ccgtctgaag ccttcaggcg 420
gcatcaaatt atcgggagag taaattgcag cctttagtca gcgtattgat ttgcgcctac
480 aacgtagaaa aatattttgc ccaatcatta gccgccgtcg tgaatcagac
ttggcgcaac 540 ttggatattt tgattgtcga tgacggctcg acagacggca
cacttgccat tgccaaggat 600 tttcaaaagc gggacagccg tatcaaaatc
cttgcacaag ctcaaaattc cggcctgatt 660 ccctctttaa acatcgggct
ggacgaattg gcaaagtcgg gggggggggg gggggaatat 720 attgcgcgca
ccgatgccga cgatattgcc tcccccggct ggattgagaa aatcgtgggc 780
gagatggaaa aagaccgcag catcattgcg atgggcgcgt ggctggaagt tttgtcggaa
840 gaaaaggacg gcaaccggct ggcgcggcac cacaaacacg gcaaaatttg
gaaaaagccg 900 acccggcacg aagacatcgc cgcctttttc cctttcggca
accccataca caacaacacg 960 atgattatgc ggcgcagcgt cattgacggc
ggtttgcgtt acgacaccga gcgggattgg 1020 gcggaagatt accaattttg
gtacgatgtc agcaaattgg gcaggctggc ttattatccc 1080 gaagccttgg
tcaaataccg ccttcacgcc aatcaggttt catccaaaca cagcgtccgc 1140
caacacgaaa tcgcgcaagg catccaaaaa accgccagaa acgatttttt gcagtctatg
1200 ggttttaaaa cccggttcga cagcctagaa taccgccaaa caaaagcagc
ggcgtatgaa 1260 ctgccggaga aggatttgcc ggaagaagat tttgaacgcg
cccgccggtt tttgtaccaa 1320 tgcttcaaac ggacggacac gccgccctcc
ggcgcgtggc tggatttcgc ggcagacggc 1380 aggatgaggc ggctgtttac
cttgaggcaa tacttcggca ttttgtaccg gctgattaaa 1440 aaccgccggc
aggcgcggtc ggattcggca gggaaagaac aggagattta atg caa 1496 Met Gln 1
aac cac gtt atc agc ttg gct tcc gcc gca gaa cgc agg gcg cac att
1544 Asn His Val Ile Ser Leu Ala Ser Ala Ala Glu Arg Arg Ala His
Ile 5 10 15 gcc gca acc ttc ggc agt cgc ggc atc ccg ttc cag ttt ttc
gac gca 1592 Ala Ala Thr Phe Gly Ser Arg Gly Ile Pro Phe Gln Phe
Phe Asp Ala 20 25 30 ctg atg ccg tct gaa agg ctg gaa cgg gca atg
gcg gaa ctc gtc ccc 1640 Leu Met Pro Ser Glu Arg Leu Glu Arg Ala
Met Ala Glu Leu Val Pro 35 40 45 50 ggc ttg tcg gcg cac ccc tat ttg
agc gga gtg gaa aaa gcc tgc ttt 1688 Gly Leu Ser Ala His Pro Tyr
Leu Ser Gly Val Glu Lys Ala Cys Phe 55 60 65 atg agc cac gcc gta
ttg tgg gaa cag gca ttg gac gaa ggc gta ccg 1736 Met Ser His Ala
Val Leu Trp Glu Gln Ala Leu Asp Glu Gly Val Pro 70 75 80 tat atc
gcc gta ttt gaa gat gat gtc tta ctc ggc gaa ggc gcg gag 1784 Tyr
Ile Ala Val Phe Glu Asp Asp Val Leu Leu Gly Glu Gly Ala Glu 85 90
95 cag ttc ctt gcc gaa gat act tgg ctg caa gaa cgc ttt gac ccc gat
1832 Gln Phe Leu Ala Glu Asp Thr Trp Leu Gln Glu Arg Phe Asp Pro
Asp 100 105 110 tcc gcc ttt gtc gtc cgc ttg gaa acg atg ttt atg cac
gtc ctg acc 1880 Ser Ala Phe Val Val Arg Leu Glu Thr Met Phe Met
His Val Leu Thr 115 120 125 130 tcg ccc tcc ggc gtg gcg gac tac ggc
ggg cgc gcc ttt ccg ctt ttg 1928 Ser Pro Ser Gly Val Ala Asp Tyr
Gly Gly Arg Ala Phe Pro Leu Leu 135 140 145 gaa agc gaa cac tgc ggg
acg gcg ggc tat att att tcc cga aag gcg 1976 Glu Ser Glu His Cys
Gly Thr Ala Gly Tyr Ile Ile Ser Arg Lys Ala 150 155 160 atg cgt ttt
ttc ttg gac agg ttt gcc gtt ttg ccg ccc gaa cgc ctg 2024 Met Arg
Phe Phe Leu Asp Arg Phe Ala Val Leu Pro Pro Glu Arg Leu 165 170 175
cac cct gtc gat ttg atg atg ttc ggc aac cct gac gac agg gaa gga
2072 His Pro Val Asp Leu Met Met Phe Gly Asn Pro Asp Asp Arg Glu
Gly 180 185 190 atg ccg gtt tgc cag ctc aat ccc gcc ttg tgc gcc caa
gag ctg cat 2120 Met Pro Val Cys Gln Leu Asn Pro Ala Leu Cys Ala
Gln Glu Leu His 195 200 205 210 tat gcc aag ttt cac gac caa aac agc
gca ttg ggc agc ctg atc gaa 2168 Tyr Ala Lys Phe His Asp Gln Asn
Ser Ala Leu Gly Ser Leu Ile Glu 215 220 225 cat gac cgc cgc ctg aac
cgc aaa cag caa tgg cgc gat tcc ccc gcc 2216 His Asp Arg Arg Leu
Asn Arg Lys Gln Gln Trp Arg Asp Ser Pro Ala 230 235 240 aac aca ttc
aaa cac cgc ctg atc cgc gcc ttg acc aaa atc ggc agg 2264 Asn Thr
Phe Lys His Arg Leu Ile Arg Ala Leu Thr Lys Ile Gly Arg 245 250 255
gaa agg gaa aaa cgc cgg caa agg cgc gaa cag tta atc ggc aag att
2312 Glu Arg Glu Lys Arg Arg Gln Arg Arg Glu Gln Leu Ile Gly Lys
Ile 260 265 270 att gtg cct ttc caa taa aaggagaaaa gatggacatc
gtatttgcgg 2360 Ile Val Pro Phe Gln 275 cagacgacaa ctatgccgcc
tacctttgcg ttgcggcaaa aagcgtggaa gcggcccatc 2420 ccgatacgga
aatcaggttc cacgtcctcg atgccggcat cagtgaggaa aaccgggcgg 2480
cggttgccgc caatttgcgg ggggggggta atatccgctt tatagacgta aaccccgaag
2540 atttcgccgg cttcccctta aacatcaggc acatttccat tacgacttat
gcccgcctga 2600 aattgggcga atacattgcc gattgcgaca aagtcctgta
tctggatacg gacgtattgg 2660 tcagggacgg cctgaagccc ttatgggata
ccgatttggg cggtaactgg gtcggcgcgt 2720 gcatcgattt gtttgtcgaa
aggcaggaag gatacaaaca aaaaatcggt atggcggacg 2780 gagaatatta
tttcaatgcc ggcgtattgc tgatcaacct gaaaaagtgg cggcggcacg 2840
atattttcaa aatgtcctgc gaatgggtgg aacaatacaa ggacgtgatg caatatcagg
2900 atcaggacat tttgaacggg ctgtttaaag gcggggtgtg ttatgcgaac
agccgtttca 2960 actttatgcc gaccaattat gcctttatgg cgaacgggtt
tgcgtcccgc cataccgacc 3020 cgctttacct cgaccgtacc aatacggcga
tgcccgtcgc cgtcagccat tattgcggct 3080 cggcaaagcc gtggcacagg
gactgcaccg tttggggtgc ggaacgtttc acagagttgg 3140 ccggcagcct
gacgaccgtt cccgaagaat ggcgcggcaa acttgccgtc ccgccgacaa 3200
agtgtatgct tcaaagatgg cgcaaaaagc tgtctgccag attcttacgc
aagatttatt
3260 gacggggcag gccgtctgaa gccttcagac ggcatcggac gtatcggaaa
ggagaaacgg 3320 attgcagcct ttagtcagcg tattgatttg cgcctacaac
gcagaaaaat attttgccca 3380 atcattggcc gccgtagtgg ggcagacttg
gcgcaacttg gatattttga ttgtcgatga 3440 cggctcgacg gacggcacgc
ccgccattgc ccggcatttc caagaacagg acggcaggat 3500 caggataatt
tccaatcccc gcaatttggg ctttatcgcc tctttaaaca tcgggctgga 3560
cgaattggca aagtcggggg ggggggaata tattgcgcgc accgatgccg acgatattgc
3620 ctcccccggc tggattgaga aaatcgtggg cgagatggaa aaagaccgca
gcatcattgc 3680 gatgggcgcg tggttggaag ttttgtcgga agaaaacaat
aaaagcgtgc ttgccgccat 3740 tgcccgaaac ggcgcaattt gggacaaacc
gacccggcat gaagacattg tcgccgtttt 3800 ccctttcggc aaccccatac
acaacaacac gatgattatg aggcgcagcg tcattgacgg 3860 cggtttgcgg
ttcgatccag cctatatcca cgccgaagac tataagtttt ggtacgaagc 3920
cggcaaactg ggcaggctgg cttattatcc cgaagccttg gtcaaatacc gcttccatca
3980 agaccagact tcttccaaat acaacctgca acagcgcagg acggcgtgga
aaatcaaaga 4040 agaaatcagg gcggggtatt ggaaggcggc aggcatagcc
gtcggggcgg actgcctgaa 4100 ttacgggctt ttgaaatcaa cggcatatgc
gttgtacgaa aaagccttgt ccggacagga 4160 tatcggatgc ctccgcctgt
tcctgtacga atatttcttg tcgttggaaa agtattcttt 4220 gaccgatttg
ctggatttct tgacagaccg cgtgatgagg aagctgtttg ccgcaccgca 4280
atataggaaa atcctgaaaa aaatgttacg cccttggaaa taccgcagct attgaaaccg
4340 aacaggataa atcatgcaaa accacgttat cagcttggct tccgccgcag
agcgcagggc 4400 gcacattgcc gataccttcg gcagtcgcgg catcccgttc
cagtttttcg acgcactgat 4460 gccgtctgaa aggctggaac aggcgatggc
ggaactcgtc cccggcttgt cggcgcaccc 4520 ctatttgagc ggagtggaaa
aagcctgctt tatgagccac gccgtattgt gggaacaggc 4580 gttggatgaa
ggtctgccgt atatcgccgt atttgaggac gacgttttac tcggcgaagg 4640
cgcggagcag ttccttgccg aagatacttg gttggaagag cgttttgaca aggattccgc
4700 ctttatcgtc cgtttggaaa cgatgtttgc gaaagttatt gtcagaccgg
ataaagtcct 4760 gaattatgaa aaccggtcat ttcctttgct ggagagcgaa
cattgtggga cggctggcta 4820 tatcatttcg cgtgaggcga tgcggttttt
cttggacagg tttgccgttt tgccgccaga 4880 gcggattaaa gcggtagatt
tgatgatgtt tacttatttc tttgataagg aggggatgcc 4940 tgtttatcag
gttagtcccg ccttatgtac ccaagaattg cattatgcca agtttctcag 5000
tcaaaacagt atgttgggta gcgatttgga aaaagatagg gaacaaggaa gaagacaccg
5060 ccgttcgttg aaggtgatgt ttgacttgaa gcgtgctttg ggtaaattcg
gtagggaaaa 5120 gaagaaaaga atggagcgtc aaaggcaggc ggagcttgag
aaagtttacg gcaggcgggt 5180 catattgttc aaatagtttg tgtaaaatat
aggggattaa aatcagaaat ggacacactg 5240 tcattcccgc gcaggcggga
atctaggtct ttaaacttcg gttttttccg ataaattctt 5300 gccgcattaa
aattccagat tcccgctttc gcggggatga cggcgggggg attgttgctt 5360
tttcggataa aatcccgtgt tttttcatct gctaggtaaa atcgccccaa agcgtctgca
5420 tcgcggcgat ggcggcgagt ggggcggttt ctgtgcgtaa aatccgtttt
ccgagtgtaa 5480 ccgcctgaaa gccggcttca aatgcctgtt gttcttcctg
ttctgtccag ccgccttcgg 5540 gcccgaccat aaagacgatt gcgccggacg
ggtggcggat gtcgccgagt ttgcaggcgc 5600 ggttgatgct cataatcagc
ttggtgtttt cagacggcat tttgtcgagt gcttcacggt 5660 agccgatgat
gggcagtacg gggggaacgg tgttcctgcc gctttgttcg cacgcggaga 5720
tgacgatttc ctgccagcgt gcgaggcgtt tggcggcgcg ttctccgtcg aggcggacga
5780 tgcagcgttc gctgatgacg ggctgtatgg cggttacgcc gagttcgacg
cttttttgca 5840 gggtgaaatc catgcgatc 5859 8 279 PRT Neisseria
gonorrheae 8 Met Gln Asn His Val Ile Ser Leu Ala Ser Ala Ala Glu
Arg Arg Ala 1 5 10 15 His Ile Ala Ala Thr Phe Gly Ser Arg Gly Ile
Pro Phe Gln Phe Phe 20 25 30 Asp Ala Leu Met Pro Ser Glu Arg Leu
Glu Arg Ala Met Ala Glu Leu 35 40 45 Val Pro Gly Leu Ser Ala His
Pro Tyr Leu Ser Gly Val Glu Lys Ala 50 55 60 Cys Phe Met Ser His
Ala Val Leu Trp Glu Gln Ala Leu Asp Glu Gly 65 70 75 80 Val Pro Tyr
Ile Ala Val Phe Glu Asp Asp Val Leu Leu Gly Glu Gly 85 90 95 Ala
Glu Gln Phe Leu Ala Glu Asp Thr Trp Leu Gln Glu Arg Phe Asp 100 105
110 Pro Asp Ser Ala Phe Val Val Arg Leu Glu Thr Met Phe Met His Val
115 120 125 Leu Thr Ser Pro Ser Gly Val Ala Asp Tyr Gly Gly Arg Ala
Phe Pro 130 135 140 Leu Leu Glu Ser Glu His Cys Gly Thr Ala Gly Tyr
Ile Ile Ser Arg 145 150 155 160 Lys Ala Met Arg Phe Phe Leu Asp Arg
Phe Ala Val Leu Pro Pro Glu 165 170 175 Arg Leu His Pro Val Asp Leu
Met Met Phe Gly Asn Pro Asp Asp Arg 180 185 190 Glu Gly Met Pro Val
Cys Gln Leu Asn Pro Ala Leu Cys Ala Gln Glu 195 200 205 Leu His Tyr
Ala Lys Phe His Asp Gln Asn Ser Ala Leu Gly Ser Leu 210 215 220 Ile
Glu His Asp Arg Arg Leu Asn Arg Lys Gln Gln Trp Arg Asp Ser 225 230
235 240 Pro Ala Asn Thr Phe Lys His Arg Leu Ile Arg Ala Leu Thr Lys
Ile 245 250 255 Gly Arg Glu Arg Glu Lys Arg Arg Gln Arg Arg Glu Gln
Leu Ile Gly 260 265 270 Lys Ile Ile Val Pro Phe Gln 275 9 21 DNA
Artificial Sequence PCR primer 9 gccgagaaaa ctattggtgg a 21 10 22
DNA Artificial Sequence PCR primer 10 aaaacatgca ggaattgacg at 22
11 348 PRT non-Neisseria 11 Leu Gln Pro Leu Val Ser Val Leu Ile Cys
Ala Tyr Asn Val Glu Lys 1 5 10 15 Tyr Phe Ala Gln Ser Leu Ala Ala
Val Val Asn Gln Thr Trp Arg Asn 20 25 30 Leu Asp Ile Leu Ile Val
Asp Asp Gly Ser Thr Asp Gly Thr Leu Ala 35 40 45 Ile Ala Lys Asp
Phe Gln Lys Arg Asp Ser Arg Ile Lys Ile Leu Ala 50 55 60 Gln Ala
Gln Asn Ser Gly Leu Ile Pro Ser Leu Asn Ile Gly Leu Asp 65 70 75 80
Glu Leu Ala Lys Ser Gly Gly Gly Gly Gly Glu Tyr Ile Ala Arg Thr 85
90 95 Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val
Gly 100 105 110 Glu Met Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala
Trp Leu Glu 115 120 125 Val Leu Ser Glu Glu Lys Asp Gly Asn Arg Leu
Ala Arg His His Lys 130 135 140 His Gly Lys Ile Trp Lys Lys Pro Thr
Arg His Glu Asp Ile Ala Ala 145 150 155 160 Phe Phe Pro Phe Gly Asn
Pro Ile His Asn Asn Thr Met Ile Met Arg 165 170 175 Arg Ser Val Ile
Asp Gly Gly Leu Arg Tyr Asp Thr Glu Arg Asp Trp 180 185 190 Ala Glu
Asp Tyr Gln Phe Trp Tyr Asp Val Ser Lys Leu Gly Arg Leu 195 200 205
Ala Tyr Tyr Pro Glu Ala Leu Val Lys Tyr Arg Leu His Ala Asn Gln 210
215 220 Val Ser Ser Lys His Ser Val Arg Gln His Glu Ile Ala Gln Gly
Ile 225 230 235 240 Gln Lys Thr Ala Arg Asn Asp Phe Leu Gln Ser Met
Gly Phe Lys Thr 245 250 255 Arg Phe Asp Ser Leu Glu Tyr Arg Gln Thr
Lys Ala Ala Ala Tyr Glu 260 265 270 Leu Pro Glu Lys Asp Leu Pro Glu
Glu Asp Phe Glu Arg Ala Arg Arg 275 280 285 Phe Leu Tyr Gln Cys Phe
Lys Arg Thr Asp Thr Pro Pro Ser Gly Ala 290 295 300 Trp Leu Asp Phe
Ala Ala Asp Gly Arg Met Arg Arg Leu Phe Thr Leu 305 310 315 320 Arg
Gln Tyr Phe Gly Ile Leu Tyr Arg Leu Ile Lys Asn Arg Arg Gln 325 330
335 Ala Arg Ser Asp Ser Ala Gly Lys Glu Gln Glu Ile 340 345 12 337
PRT non-Neisseria 12 Leu Gln Pro Leu Val Ser Val Leu Ile Cys Ala
Tyr Asn Ala Glu Lys 1 5 10 15 Tyr Phe Ala Gln Ser Leu Ala Ala Val
Val Gly Gln Thr Trp Arg Asn 20 25 30 Leu Asp Ile Leu Ile Val Asp
Asp Gly Ser Thr Asp Gly Thr Pro Ala 35 40 45 Ile Ala Arg His Phe
Gln Glu Gln Asp Gly Arg Ile Arg Ile Ile Ser 50 55 60 Asn Pro Arg
Asn Leu Gly Phe Ile Ala Ser Leu Asn Ile Gly Leu Asp 65 70 75 80 Glu
Leu Ala Lys Ser Gly Gly Gly Glu Tyr Ile Ala Arg Thr Asp Ala 85 90
95 Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val Gly Glu Met
100 105 110 Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala Trp Leu Glu
Val Leu 115 120 125 Ser Glu Glu Asn Asn Lys Ser Val Leu Ala Ala Ile
Ala Arg Asn Gly 130 135 140 Ala Ile Trp Asp Lys Pro Thr Arg His Glu
Asp Ile Val Ala Val Phe 145 150 155 160 Pro Phe Gly Asn Pro Ile His
Asn Asn Thr Met Ile Met Arg Arg Ser 165 170 175 Val Ile Asp Gly Gly
Leu Arg Phe Asp Pro Ala Tyr Ile His Ala Glu 180 185 190 Asp Tyr Lys
Phe Trp Tyr Glu Ala Gly Lys Leu Gly Arg Leu Ala Tyr 195 200 205 Tyr
Pro Glu Ala Leu Val Lys Tyr Arg Phe His Gln Asp Gln Thr Ser 210 215
220 Ser Lys Tyr Asn Leu Gln Gln Arg Arg Thr Ala Trp Lys Ile Lys Glu
225 230 235 240 Glu Ile Arg Ala Gly Tyr Trp Lys Ala Ala Gly Ile Ala
Val Gly Ala 245 250 255 Asp Cys Leu Asn Tyr Gly Leu Leu Lys Ser Thr
Ala Tyr Ala Leu Tyr 260 265 270 Glu Lys Ala Leu Ser Gly Gln Asp Ile
Gly Cys Leu Arg Leu Phe Leu 275 280 285 Tyr Glu Tyr Phe Leu Ser Leu
Glu Lys Tyr Ser Leu Thr Asp Leu Leu 290 295 300 Asp Phe Leu Thr Asp
Arg Val Met Arg Lys Leu Phe Ala Ala Pro Gln 305 310 315 320 Tyr Arg
Lys Ile Leu Lys Lys Met Leu Arg Pro Trp Lys Tyr Arg Ser 325 330 335
Tyr 13 306 PRT Escherichia coli 13 Leu Asp Ile Ala Tyr Gly Thr Asp
Lys Asn Phe Leu Phe Gly Cys Gly 1 5 10 15 Ile Ser Ile Ala Ser Ile
Leu Lys Tyr Asn Glu Gly Ser Arg Leu Cys 20 25 30 Phe His Ile Phe
Thr Asp Tyr Phe Gly Asp Asp Asp Arg Lys Tyr Phe 35 40 45 Asp Ala
Leu Ala Leu Gln Tyr Lys Thr Arg Ile Lys Ile Tyr Leu Ile 50 55 60
Asn Gly Asp Arg Leu Arg Ser Leu Pro Ser Thr Lys Asn Trp Thr His 65
70 75 80 Ala Ile Tyr Phe Arg Phe Val Ile Ala Asp Tyr Phe Ile Asn
Lys Ala 85 90 95 Pro Lys Val Leu Tyr Leu Asp Ala Asp Ile Ile Cys
Gln Gly Thr Ile 100 105 110 Glu Pro Leu Ile Asn Phe Ser Phe Pro Asp
Asp Lys Val Ala Met Val 115 120 125 Val Thr Glu Gly Gln Ala Asp Trp
Trp Glu Lys Arg Ala His Ser Leu 130 135 140 Gly Val Ala Gly Ile Ala
Lys Gly Tyr Phe Asn Ser Gly Phe Leu Leu 145 150 155 160 Ile Asn Thr
Ala Gln Trp Ala Ala Gln Gln Val Ser Ala Arg Ala Ile 165 170 175 Ala
Met Leu Asn Glu Pro Glu Ile Ile Lys Lys Ile Thr His Pro Asp 180 185
190 Gln Asp Val Leu Asn Met Leu Leu Ala Asp Lys Leu Ile Phe Ala Asp
195 200 205 Ile Lys Tyr Asn Thr Gln Phe Ser Leu Asn Tyr Gln Leu Lys
Glu Ser 210 215 220 Phe Ile Asn Pro Val Thr Asn Asp Thr Ile Phe Ile
His Tyr Ile Gly 225 230 235 240 Pro Thr Lys Pro Trp His Asp Trp Ala
Trp Asp Tyr Pro Val Ser Gln 245 250 255 Ala Phe Met Glu Ala Lys Asn
Ala Ser Pro Trp Lys Asn Thr Ala Leu 260 265 270 Leu Lys Pro Asn Asn
Ser Asn Gln Leu Arg Tyr Ser Ala Lys His Met 275 280 285 Leu Lys Lys
His Arg Tyr Leu Lys Gly Phe Ser Asn Tyr Leu Phe Tyr 290 295 300 Phe
Ile 305
* * * * *