U.S. patent application number 11/087528 was filed with the patent office on 2005-12-08 for antibodies for inhibiting blood coagulation and methods of use thereof.
This patent application is currently assigned to Tanox, Inc.. Invention is credited to Jiao, Jin-An, Luepschen, Lawrence, Nieves, Esperanza Liliana, Wong, Hing C..
Application Number | 20050271664 11/087528 |
Document ID | / |
Family ID | 25216046 |
Filed Date | 2005-12-08 |
United States Patent
Application |
20050271664 |
Kind Code |
A1 |
Wong, Hing C. ; et
al. |
December 8, 2005 |
Antibodies for inhibiting blood coagulation and methods of use
thereof
Abstract
The invention includes antibodies that provide superior
anti-coagulant activity by binding native human TF with high
affinity and specificity. Antibodies of the invention can
effectively inhibit blood coagulation in vivo. Antibodies of the
invention can bind native human TF, either alone or present in a
TF:VIIa complex, effectively preventing factor X binding to TF or
that complex, and thereby reducing blood coagulation. Preferred
antibodies of the invention specifically bind a conformational
epitope predominant to native human TF, which epitope provides an
unexpectedly strong antibody binding site.
Inventors: |
Wong, Hing C.; (Fort
Lauderdale, FL) ; Jiao, Jin-An; (Fort Lauderdale,
FL) ; Nieves, Esperanza Liliana; (Newark, DE)
; Luepschen, Lawrence; (Miami, FL) |
Correspondence
Address: |
FOLEY HOAG, LLP
PATENT GROUP, WORLD TRADE CENTER WEST
155 SEAPORT BLVD
BOSTON
MA
02110
US
|
Assignee: |
Tanox, Inc.
Houston
TX
|
Family ID: |
25216046 |
Appl. No.: |
11/087528 |
Filed: |
March 22, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11087528 |
Mar 22, 2005 |
|
|
|
10293417 |
Nov 12, 2002 |
|
|
|
10293417 |
Nov 12, 2002 |
|
|
|
09293854 |
Apr 16, 1999 |
|
|
|
6555319 |
|
|
|
|
09293854 |
Apr 16, 1999 |
|
|
|
08814806 |
Mar 10, 1997 |
|
|
|
5986065 |
|
|
|
|
Current U.S.
Class: |
424/145.1 ;
530/388.25 |
Current CPC
Class: |
A61P 7/02 20180101; A61K
39/395 20130101; A61K 38/00 20130101; A61P 31/00 20180101; A61P
35/00 20180101; A61P 9/00 20180101; C07K 16/36 20130101; A61P 7/00
20180101; A61P 43/00 20180101; A61K 39/395 20130101; A61K 2300/00
20130101 |
Class at
Publication: |
424/145.1 ;
530/388.25 |
International
Class: |
A61K 039/395; C07K
016/22 |
Claims
What is claimed is:
1. An antibody that binds native human tissue factor and does not
substantially bind non-native tissue factor.
2. An antibody of claim 1 wherein the antibody has the binding
specificity for native human tissue factor about equal to or
greater than H36.D2.B7 [ATCC HB-12255].
3. An antibody having the binding affinity for native human tissue
factor about equal to or greater than H36.D2.B7 [ATCC
HB-12255].
4. An antibody having identifying characteristics of H36.D2.B7
[ATCC HB-12255].
5. An antibody of claim 1 wherein the antibody is H36.D2.B7 [ATCC
HB-12255].
6. An antibody that binds native tissue factor to form a complex
whereby factor X binding to the complex is inhibited.
7. An antibody of claim 1 wherein the antibody is a monoclonal
antibody.
8. An antibody of claim 1 that is a chimeric antibody.
9. An antibody of claim 8 that comprises a constant region of human
origin.
10. An antibody of claim 1 that is a single chain antibody.
11. An antibody that comprises a sequence that has at least about
70 percent sequence identity to SEQ ID NO:1.
12. An antibody of claim 11 that comprises a sequence represented
by SEQ ID NO:2 or SEQ ID NO:4.
13. An antibody that comprises hypervariable regions that have at
least 90 percent sequence identity to SEQ ID NOS. 5 through 10
inclusive.
14. An antibody of claim 13 wherein the antibody comprises
hypervariable regions represented by SEQ ID NOS. 5 through 10
inclusive.
15. An isolated nucleic acid comprising a sequence encoding at
least a portion of an antibody that binds native human tissue
factor.
16. The nucleic acid of claim 15 wherein the monoclonal antibody is
H36.D2.B7 [ATCC HB-12255].
17. The nucleic acid of claim 15 wherein the nucleic acid comprises
SEQ ID NO:1 or SEQ ID NO:3.
18. The nucleic acid of claim 15 wherein the nucleic acid comprises
a sequence that has at least about 70 percent sequence identity to
SEQ ID NO:1 or SEQ ID NO:3.
19. The nucleic acid of claim 15 wherein the nucleic acid comprises
sequences coding for antibody hypervariable regions that have at
least 90 percent sequence identity to SEQ ID NOS. 5 through 10
inclusive.
20. A nucleic acid comprising at least about 100 base pairs and
that hybridizes to SEQ ID NO:1 or SEQ ID NO:3 under normal
stringency conditions.
21. A nucleic acid of claim 20 wherein the nucleic acid hybridizes
to SEQ ID NO:1 or SEQ ID NO:3 under high stringency conditions.
22. A nucleic acid of claim 15 wherein the nucleic acid comprises
sequences that have at least 90 percent sequence identitity to SEQ
ID NOS. 11 through 16 inclusive and code for hypervariable
regions.
23. A recombinant vector comprising the nucleic acid of claim 15,
wherein the vector can express at least a portion of an antibody
that binds native human tissue factor.
24. A host cell comprising the vector of claim 23.
25. A method of inhibiting blood coagulation in a mammal,
comprising administering to the mammal an effective amount of an
antibody capable of specifically binding native tissue factor and
whereby the antibody complexes with native tissue factor, and
factor X binding to the complex is inhibited.
26. The method of claim 25 wherein the complex further comprises
factor VII/VIIa.
27. The method of claim 25 wherein the mammal is a human.
28. The method of claim 25 wherein the human is suffering from or
suspected of having a thrombosis.
29. The method of claim 25 wherein the human is suffering from or
susceptible to restenosis associated with an invasive medical
procedure.
30. The method of claim 29 wherein the invasive medical procedure
is angioplasty, endarterectomy, deployment of a stent, use of
catheter, graft implantation or use of an arteriovenous shunt.
31. The method of claim 25 wherein the human is suffering from a
thromboembolic condition associated with cardiovascular disease, an
infectious disease, a neoplastic disease or use of a thrombolytic
agent.
32. The method of claim 25 further comprising administering an
anti-platelet composition, a thrombolytic composition or an
anti-coagulant composition.
33. The method of claim 25 wherein the antibody is H36.D2.B7 [ATCC
HB-12255].
34. A method of reducing tissue factor levels in a mammal
comprising: administering to the mammal a therapeutically effective
amount of an antibody capable of binding native tissue factor, the
antibody linked covalently to a cell toxin or an effector molecule
to provide complement-fixing ability and antibody-dependent
cell-mediated cytotoxicity, the antibody contacting cells
expressing tissue factor to reduce tissue factor levels in the
mammal.
35. The method of claim 34 wherein the cells expressing tissue
factor are cancer cells, immune cells, or endothelial cells.
36. A method of detecting tissue factor in a biological sample
comprising: contacting a biological sample with a monoclonal
antibody of claim 1 and analyzing the biological sample and
monoclonal antibody for the presence of tissue factor in the
biological sample.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates to novel antibodies and
methods of using the. antibodies to inhibit blood coagulation. In
particular, the invention relates to novel antibodies that can
specifically bind native human tissue factor with high affinity.
The antibodies of the invention are useful for a variety of
applications, particularly for reducing blood coagulation in
vivo.
[0003] 2. Background
[0004] Blood clotting assists homeostasis by minimizing blood loss.
Generally, blood clotting requires vessel damage, platelet
aggregation, coagulation factors and inhibition of fibrinolysis.
The coagulation factors act through a cascade that relates the
vessel damage to formation of a blood clot (see generally L.
Stryer, Biochemistry, 3rd Ed, W.H. Freeman Co., New York; and A. G.
Gilman et al., The Pharmacological Basis is of Therapeutics, 8th
Edition, McGraw Hill Inc., New York, pp. 1311-1331).
[0005] There is general agreement that factor X (FX) activation to
factor Xa (FXa) is a critical step in the blood coagulation
process. Generally, FX is converted to FXa by binding a
catalytically active complex that includes "tissue factor" (TF). TF
is a controllably-expressed cell membrane protein that binds factor
VII/VIIa to produce the catalytically active complex (TF:VIIa). A
blood clot follows FXa-mediated activation of prothrombin. Blood
clotting can be minimized by inactivation of TF to non-native forms
which cannot optimally produce the TF:VIIa complex. Excessive
formation of FXa is believed to contribute to various thromboses
including restenosis.
[0006] Thrombosis may be associated with invasive medical
procedures such as cardiac surgery (e.g. angioplasty),
abdominothoracic surgery, arterial surgery, deployment of an
implementation (e.g., a stent or catheter), or endarterectomy.
Further, thrombosis may accompany various thromboembolic disorders
and coagulopathies such as a pulmonary embolism (e.g., atrial
fibrillation with embolization) and disseminated intravascular
coagulation, respectively. Manipulation of body fluids can also
result in an undesirable thrombus, particularly in blood
transfusions or fluid sampling, as well as procedures involving
extracorporeal circulation (e.g., cardiopulmonary bypass surgery)
and dialysis.
[0007] Anti-coagulants are frequently used to alleviate or avoid
blood clots associated with thrombosis. Blood clotting often can be
minimized or eliminated by administering a suitable anti-coagulant
or mixture thereof, including one or more of a coumarin derivative
(e.g., warfin and dicumarol) or a charged polymer (e.g., heparin,
hirudin or hirulog). See e.g., Gilman et al., supra, R. J.
Beigering et al., Ann. Hemathol., 72:177 (1996); J. D. Willerson,
Circulation, 94:866 (1996).
[0008] However, use of anti-coagulants is often associated with
side effects such as hemorrhaging, re-occlusion, "white-clot"
syndrome, irritation, birth defects, thrombocytopenia and hepatic
dysfunction. Long-term administration of anti-coagulants can
particularly increase risk of life-threatening illness (see e.g.,
Gilman et al., supra).
[0009] Certain antibodies with anti-platelet activity have also
been used to alleviate various thromboses. For example, ReoPro.TM.
is a therapeutic antibody that is routinely administered to
alleviate various thromboembolic disorders such as those arising
from angioplasty, myocardial infarction, unstable angina and
coronary artery stenoses. Additionally, ReoPro.TM. can be used as a
prophylactic to reduce the risk of myocardial infarction and angina
(J. T. Willerson, Circulation, 94:866 (1996); M. L. Simmons et al.,
Circulation, 89:596 (1994)).
[0010] Certain anti-coagulant antibodies are also known.
Particularly, certain TF-binding antibodies have been reported to
inhibit blood coagulation, presumably by interfering with assembly
of a catalytically active TF:VIIa complex (see e.g., Jeske et al.,
SEM in THROM. and HEMO, 22:213 (1996); Ragni et al., Circulation,
93:1913 (1996); European Patent No. 0 420 937 B1; W. Ruf et al.,
Throm. Haemosp., 66:529 (1991); M. M. Fiorie et al., Blood, 8:3127
(1992)).
[0011] However, current TF-binding antibodies exhibit significant
disadvantages which can minimize their suitably as anti-coagulants.
For example, current TF-binding antibodies do not exhibit
sufficient binding affinity for optimal anti-coagulant activity.
Accordingly, for many thrombotic conditions, to compensate for such
ineffective binding affinities, unacceptably high antibody levels
must be administered to minimize blood coagulation. Further,
current TF-binding antibodies do not effectively discriminate
between native TF and non-native forms of TF, i.e. the current
antibodies do not exhibit sufficient binding specificity. Still
further, current TF-binding antibodies can not prevent FX from
binding to TF and/or TF:VIIa complex.
[0012] It would thus be desirable to have an anti-coagulant
antibody that binds native human TF with high affinity and
selectivity to thereby inhibit undesired blood coagulation and the
formation of blood clots. It would be further desirable to have
such an anti-coagulant antibody that prevents the binding of Factor
X to TF/VIIa complex.
SUMMARY OF THE INVENTION
[0013] We have now discovered antibodies that provide superior
anti-coagulant activity by binding native human TF with high
affinity and specificity. Antibodies of the invention can
effectively inhibit blood coagulation in vivo. Antibodies of the
invention can bind native human TF, either alone or present in a
TF:VIIa complex, effectively preventing factor X binding to TF or
that complex, and thereby reducing blood coagulation.
[0014] Preferred antibodies of the invention are monoclonal and
specifically bind a conformational epitope predominant to native
human TF, which epitope provides an unexpectedly strong antibody
binding site. Indeed, preferred antibodies of the invention bind to
native human TF at least about 5 times greater, more typically at
least about ten times greater than the binding affinity exhibited
by prior anti-coagulant antibodies. Additionally, preferred
antibodies of the invention are selective for native human TF, and
do not substantially bind non-native or denatured TF. H36.D2.137
(secreted by hybridoma ATCC HB-12255) is an especially preferred
antibody of the invention.
[0015] Preferred antibodies of the invention bind TF so that FX
does not effectively bind to the TF/factor VIIa complex whereby FX
is not effectively converted to its activated form (FXa). Preferred
antibodies of the invention can inhibit TF function by effectively
blocking FX binding or access to TF molecules. See, for instance,
the results of Example 3 which follows.
[0016] Preferred antibodies of the invention also do not
significantly inhibit the interaction or binding between TF and
factor VIIa, or inhibit activity of a TF:factor VIIa complex with
respect to materials other than FX. See, for instance, the results
of Example 4 which follows.
[0017] The invention also provides nucleic acids that encode
antibodies of the invention. Nucleic acid and amino acid sequences
(SEQ ID:NOS 1-4) of variable regions of H36.D2.B7 are set forth in
FIGS. 1A and 1B of the drawings.
[0018] In preferred aspects, the invention provides methods for
inhibiting blood coagulation and blood clot formation, and methods
for reducing human TF levels.
[0019] In general, antibodies of the invention will be useful to
modulate virtually any biological response mediated by FX binding
to TF or the TF:VIIa complex, including blood coagulation as
discussed above, inflammation and other disorders.
[0020] Antibodies of the invention are particularly useful to
alleviate various thromboses, particularly to prevent or inhibit
restenosis, or other thromboses following an invasive medical
procedure such as arterial or cardiac surgery (e.g., angioplasty).
Antibodies of the invention also can be employed to reduce or even
effectively eliminate blood coagulation arising from use of medical
implementation (e.g., a catheter, stent or other medical device).
Preferred antibodies of the invention will be compatible with many
anti-coagulant, anti-platelet and thrombolytic compositions,
thereby allowing administration in a cocktail format to boost or
prolong inhibition of blood coagulation.
[0021] Antibodies of the invention also can be employed as an
anti-coagulant in extracorporeal circulation of a mammal,
particularly a human subject. In such methods, one or more
antibodies of the invention is administered to the mammal in an
amount sufficient to inhibit blood coagulation prior to or during
extracorporeal circulation such as may be occur with
cardiopulmonary bypass surgery, organ transplant surgery or other
prolonged surgeries.
[0022] Antibodies of the invention also can be used as a carrier
for drugs, particularly pharmaceuticals targeted for interaction
with a blood clot such as strepokinase, tissue plasminogen
activator (t-PA) or urokinase. Similarly, antibodies of the
invention can be used as a cytotoxic agent by conjugating a
suitable toxin to the antibody. Conjugates of antibodies of the
invention also can be used to reduce tissue factor levels in a
mammal, particularly a human, by administering to the mammal an
effective amount of an antibody of the invention which is
covalently linked a cell toxin or an effector molecule to provide
complement-fixing ability and antibody-dependent cell-mediated
cytotoxicity, whereby the antibody conjugate contacts cells
expressing tissue factor to thereby reduce tissue factor levels in
the mammal.
[0023] Antibodies of the invention also can be employed in in vivo
diagnostic methods including in vivo diagnostic imaging of native
human TF.
[0024] Antibodies of the invention also can be used in in vitro
assays to detect native TF in a biological sample including a body
fluid (e.g., plasma or serum) or tissue (e.g., a biopsy sample).
More particularly, various heterogeneous and homogeneous
immunoassays can be employed in a competitive or non-competitive
format to detect the presence and preferably an amount of native TF
in the biological sample.
[0025] Such assays of the invention are highly useful to determine
the presence or likelihood of a patient having a blood coagulation
or a blood clot. That is, blood coagulation is usually accompanied
by TF expression on cells surfaces such as cells lining the
vasculature. In the absence of blood coagulation, TF is not usually
expressed. Thus, the detection of TF in a body fluid sample by an
assay of the invention will be indicative of blood coagulation.
[0026] Antibodies of the invention also can be used to prepare
substantially pure native TF, particularly native human TF, from a
biological sample. Antibodies of the invention also can be used for
detecting and purifying cells which express native TF.
[0027] Antibodies of the invention also can be employed as a
component of a diagnostic kit, e.g. for detecting and preferably
quantitating native TF in a biological sample. Other aspects of the
invention are discussed infra.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIGS. 1A and 1B shows the nucleic acid (SEQ ID NOS:1 and 3)
and amino acid (SEQ ID NOS:2 and 4) sequences of light chain and
heavy chain variable regions of H36.D2.B7 with hypervariable
regions (CDRs or Complementarity Determining Regions) underlined
(single underline for nucleic acid sequences and double underline
for amino acid sequences).
[0029] FIG. 2 shows association (K.sub.a) and disassociation
(K.sub.d) constants of anti-tissue factor antibodies as determined
by ELISA or BIACore analysis.
[0030] FIG. 3 shows inhibition of TF:VIIa complex mediated FX
activation by pre-incubation with anti-tissue factor
antibodies.
[0031] FIG. 4 shows inhibition of TF/VIIa activity toward the
FVIIa-specific substrate S-2288 by anti-tissue factor
antibodies.
[0032] FIG. 5 shows the capacity of the H36 antibody to increase
prothrombin time (PT) in a TF-initiated coagulation assay.
[0033] FIGS. 6A and 6B graphically show the relationship between
FXa formation and molar ratio of the H36.D2 antibody and rHTF. FIG.
6A: H36.D2 was pre-incubated with the FT:VIIa complex prior to
adding FX. FIG. 6B: H36.D2, TF:VIIa and FX were added
simultaneously.
[0034] FIG. 7 shows inhibition of TF:VIIa activity by the H36.D2
antibody in a J-82 cell activation assay.
[0035] FIGS. 8A and 8B are representations of dot blots showing
that the H36.D2 antibody binds a conformational epitope on rhTF.
Lane 1-native rHTF, Lane 2-native rhTF treated with 8M urea, Lane
3-native rHTF treated with 8M urea and 5 mM DTT. In FIG. 8A, the
blot was exposed for approximately 40 seconds, whereas in FIG. 8B,
the blot was exposed for 120 seconds.
DETAILED DESCRIPTION OF THE INVENTION
[0036] As discussed above, preferred antibodies of the invention
exhibit substantial affinity for native human TF. In particular,
preferred antibodies of the invention exhibit an association
constant (K.sub.a, M.sup.-1) for native human TF of at least about
1.times.10.sup.8 as determined by surface plasmon analysis
(particularly, BIACore analysis in accordance with the procedures
of Example 1 which follows), more preferably at least about
5.times.10.sup.8 as determined by surface plasmon analysis, still
more preferably a K.sub.a (K.sub.a, M.sup.-1) for native human TF
of at least about 1.times.10.sup.10 as determined by surface
plasmon analysis. Such substantial binding affinity of antibodies
of the invention contrast sharply from much lower binding
affinities of previously reported antibodies.
[0037] In this regard, a quite low of effective concentration of an
antibody of the invention can be employed, e.g. a relatively low
concentration of antibody can be employed to inhibit TF function as
desired (e.g. at least about 95, 98 or 99 percent inhibition) in an
in vitro assay such as described in Example 3 which follows.
[0038] The preferred antibodies are also highly specific for native
human TF, and preferably do not substantially bind with non-native
TF. Preferred antibodies do not substantially bind non-native TF or
other immunologically unrelated molecules as determined, e.g. by
standard dot blot assay (e.g. no or essentially no binding to
non-native TF visually detected by such dot blot assay). References
herein to "non-native TF" mean a naturally-occurring or recombinant
human TF that has been treated with a choatropic agent so that the
TF is denatured. Typical choatropic agents include a detergent
(e.g. SDS), urea combined with dithiothreotol or
.beta.-mercaptoethanol; guanidine hydrochloride and the like. The
H36, H36.D2 or H36. D2.B7 antibody does not substantially bind to
such non-native TF. See, for instance, the results of Example 8
which follows and is a dot blot assay.
[0039] As discussed above, preferred antibodies of the invention
also bind with TF so that FX does not effectively bind to the
TF/factor VIIa complex whereby FX is not effectively converted to
its activated form (FXa). Particularly preferred antibodies of the
invention exhibit will strongly inhibit FX activity to a TF/factor
VIIa complex, e.g. an inhibition of at least about 50%, more
preferably at least about 80%, and even more preferably at least
about 90% or 95%, even at low TF concentrations such as less than
about 1.0 nM TF, or even less than about 0.20 nM or 0.10 nM TF, as
determined by a standard in vitro binding assay such as that of
Example 3 which follows and includes contacting FX with a TF:factor
VIIa complex both in the presence (i.e. experimental sample) and
absence (i.e. control sample) of an antibody of the invention and
determining the percent difference of conversion of FX to FXa
between the experimental and control samples.
[0040] Antibodies of the invention are preferably substantially
pure when used in the disclosed methods and assays. References to
an antibody being "substantially pure" mean an antibody or protein
which has been separated from components which naturally accompany
it. For example, by using standard immunoaffinity or protein A
affinity purification techniques, an antibody of the invention can
be purified from a hybridoma culture by using native TF as an
antigen or protein A resin. Similarly, native TF can be obtained in
substantially pure form by using an antibody of the invention with
standard immunoaffinity purification techniques. Particularly, an
antibody or protein is substantially pure when at least 50% of the
total protein (weight % of total protein in a given sample) is an
antibody or protein of the invention. Preferably the antibody or
protein is at least 60 weight % of the total protein, more
preferably at least 75 weight %, even more preferably at least 90
weight %, and most preferably at least 98 weight % of the total
material. Purity can be readily assayed by known methods such as
SDS (PAGE) gel electrophoresis, column chromatography (e.g.,
affinity chromatography) or HPLC analysis.
[0041] The nucleic acid (SEQ ID NOS: 1 and 3) and amino acid (SEQ
ID NOS: 2 and 4) sequences of a preferred antibody of the invention
(H36.D2.B7) are shown in FIGS. 1A and 1B of the drawings. SEQ ID
NOS. 1 and 2 are the nucleic acid and amino acid respectively of
the light chain variable region, and SEQ ID NOS. 3 and 4 are the
nucleic acid and amino acid respectively of the heavy chain
variable region, with hypervariable regions (CDRs or
Complementarity Determining Regions) underlined in all of those
sequences.
[0042] Additional preferred antibodies of the invention will have
substantial sequence identity to either one or both of the light
chain or heavy sequences shown in FIGS. 1A and 1B. More
particularly, preferred antibodies include those that have at least
about 70 percent homology (sequence identity) to SEQ ID NOS. 2
and/or 4, more preferably about 80 percent or more homology to SEQ
ID NOS. 2 and/or 4, still more preferably about 85, 90 or 95
percent or more homology to SEQ ID NOS. 2 and/or 4.
[0043] Preferred antibodies of the invention will have high
sequence identity to hypervariable regions (shown with double
underlining in FIGS. 1A and 1B) of SEQ ID NOS. 2 and 4). Especially
preferred antibodies of the invention will have one, two or three
hypervariable regions of a light chain variable region that have
high sequence identity (at least 90% or 95% sequence identity) to
or be the same as one, two or three of the corresponding
hypervariable regions of the light chain variable region of
H36.D2.B7 (those hypervariable regions shown with underlining in
FIG. 1A and are the following: 1) LASQTID (SEQ ID NO:5); 2) AATNLAD
(SEQ ID NO:6); and 3) QQVYSSPFT (SEQ ID NO:7)).
[0044] Especially preferred antibodies of the invention also will
have one, two or three hypervariable regions of a heavy chain
variable region that have high sequence identity (at least 90% or
95% sequence identity) to or be the same as one, two or three of
the corresponding hypervariable regions of the heavy chain variable
region of H36.D2.B7 (those hypervariable regions shown with
underlining in FIG. 1B and are the following: 1) TDYNVY (SEQ ID
NO:8); 2) YIDPYNGITIYDQNFKG (SEQ ID NO:9); and 3) DVTTALDF (SEQ ID
NO: 10).
[0045] Nucleic acids of the invention preferably are of a length
sufficient (preferably at least about 100, 200 or 250 base pairs)
to bind to the sequence of SEQ ID NO:1 and/or SEQ ID NO:3 under the
following moderately stringent conditions (referred to herein as
"normal stringency" conditions): use of a hybridization buffer
comprising 20% formamide in 0.8M saline/0.08M sodium citrate (SSC)
buffer at a temperature of 37.degree. C. and remaining bound when
subject to washing once with that SSC buffer at 37.degree. C.
[0046] More preferably, nucleic acids of the invention (preferably
at least about 100, 200 or 250 base pairs) will bind to the
sequence of SEQ ID NO:1 and/or SEQ ID NO:3 under the following
highly stringent conditions (referred to herein as "high
stringency" conditions): use of a hybridization buffer comprising
20% formamide in 0.9M saline/0.09M sodium citrate (SSC) buffer at a
temperature of 42.degree. C. and remaining bound when subject to
washing twice with that SSC buffer at 42.degree. C.
[0047] Nucleic acids of the invention preferably comprise at least
20 base pairs, more preferably at least about 50 base pairs, and
still more preferably a nucleic acid of the invention comprises at
least about 100, 200, 250 or 300 base pairs.
[0048] Generally preferred nucleic acids of the invention will
express an antibody of the invention that exhibits the preferred
binding affinities and other properties as disclosed herein.
[0049] Preferred nucleic acids of the invention also will have
substantial sequence identity to either one or both of the
light-chain or heavy sequences shown in FIGS. 1A and 1B. More
particularly, preferred nucleic acids will comprise a sequence that
has at least about 70 percent homology (sequence identity) to SEQ
ID NOS. 1 and/or 3, more preferably about 80 percent or more
homology to SEQ ID NOS. 1 and/or 3, still more preferably about 85,
90 or 95 percent or more homology to SEQ ID NOS. 1 and/or 3.
[0050] Particularly preferred nucleic acid sequences of the
invention will have high sequence identity to hypervariable regions
(shown with underlining in FIGS. 1A and 1B) of SEQ ID NOS. 1 and
3). Especially preferred nucleic acids include those that code for
an antibody light chain variable region and have one, two or three
sequences that code for hypervariable regions and have high
sequence identity (at least 90% or 95% sequence identity) to or be
the same as one, two or three of the sequences coding for
corresponding hypervariable regions of H36.D2.B7 (those
hypervariable regions shown with underlining in FIG. 1A and are the
following: 1) CTGGCAAGTCAGACCATTGAT (SEQ ID NO:11); 2) GCTGCCACC
AACTTGGCAGAT (SEQ ID NO:12); and 3) CAACAAGTTTACAGTTCT CCATTCACGT
(SEQ ID NO:13)).
[0051] Especially preferred nucleic acids also code for an antibody
heavy chain variable region and have one, two or three sequences
that code for hypervariable regions and have high sequence identity
(at least 90% or 95% sequence identity) to or be the same as one,
two or three of the sequences coding for corresponding
hypervariable regions of H36.D2.B7 (those hypervariable regions
shown with underlining in FIG. 1B and are the following: 1)
ACTGACTACAA-CGTGTAC (SEQ ID NO:14); 2) TATATTGAT
CCTTACAATGGTATTACTATCTACGACCAGAACTTCAAGGGC (SEQ ID NO:15); and 3)
GATGTGACTACGGCCCTTGACTTC (SEQ ID NO:16)).
[0052] Nucleic acids of the invention are isolated, usually
constitutes at least about 0.5%, preferably at least about 2%, and
more preferably at least about 5% by weight of total nucleic acid
present in a given fraction. A partially pure nucleic acid
constitutes at least about 10%, preferably at least about 30%, and
more preferably at least about 60% by weight of total nucleic acid
present in a given fraction. A pure nucleic acid constitutes at
least about 80%, preferably at least about 90%, and more preferably
at least about 95% by weight of total nucleic acid present in a
given fraction.
[0053] Antibodies of the invention can be prepared by techniques
generally known in the art, and are typically generated to a
purified sample of native TF, typically native human TF, preferably
purified recombinant human tissue factor (rhTF). Truncated
recombinant human tissue factor or "rhTF" (composed of 243 amino
acids and lacking the cytoplasmic domain) is particularly preferred
to generate antibodies of the invention. The antibodies also can be
generated from an immunogenic peptide that comprises one or more
epitopes of native TF that are not exhibited by non-native TF.
References herein to "native TF" include such TF samples, including
such rhTF. As discussed above, monoclonal antibodies are generally
preferred, although polyclonal antibodies also can be employed.
[0054] More particularly, antibodies can be prepared by immunizing
a mammal with a purified sample of native human TF, or an
immunogenic peptide as discussed above, alone or complexed with a
carrier. Suitable mammals include typical laboratory animals such
as sheep, goats, rabbits, guinea pigs, rats and mice. Rats and
mice, especially mice, are preferred for obtaining monoclonal
antibodies. The antigen can be administered to the mammal by any of
a number of suitable routes such as subcutaneous, intraperitoneal,
intravenous, intramuscular or intracutaneous injection. The optimal
immunizing interval, immunizing dose, etc. can vary within
relatively wide ranges and can be determined empirically based on
this disclosure. Typical procedures involve injection of the
antigen several times over a number of months. Antibodies are
collected from serum of the immunized animal by standard techniques
and screened to find antibodies specific for native human TF.
Monoclonal antibodies can be produced in cells which produce
antibodies and those cells used to generate monoclonal antibodies
by using standard fusion techniques for forming hybridoma cells.
See G. Kohler, et al., Nature, 256:456 (1975). Typically this
involves fusing an antibody producing cell with an immortal cell
line such as a myeloma cell to produce the hybrid cell.
Alternatively, monoclonal antibodies can be produced from cells by
the method of Huse, et al., Science, 256:1275 (1989).
[0055] One suitable protocol provides for intraperitoneal
immunization of a mouse with a composition comprising purified rhTF
complex conducted over a period of about two to seven months.
Spleen cells then can be removed from the immunized mouse. Sera
from the immunized mouse is assayed for titers of antibodies
specific for rhTF prior to excision of spleen cells. The excised
mouse spleen cells are then fused to an appropriate homogenic or
heterogenic (preferably homogenic) lymphoid cell line having a
marker such as hypoxanthine-guanine phosphoribosyltransfera- se
deficiency (HGPRT.sup.-) or thymidine kinase deficiency (TK.sup.-).
Preferably a myeloma cell is employed as the lymphoid cell line.
Myeloma cells and spleen cells are mixed together, e.g. at a ratio
of about 1 to 4 myeloma cells to spleen cells. The cells can be
fused by the polyethylene glycol (PEG) method. See G. Kohler, et
al., Nature, supra. The thus cloned hybridoma is grown in a culture
medium, e.g. RPMI-1640. See G. E. More, et al., Journal of American
Medical Association, 199:549 (1967). Hybridomas, grown after the
fusion procedure, are screened such as by radioimmunoassay or
enzyme immunoassay for secretion of antibodies that bind
specifically to the purified rhTF, e.g. antibodies are selected
that bind to the purified rhTF, but not to non-native TF.
Preferably an ELISA is employed for the screen. Hybridomas that
show positive results upon such screening can be expanded and
cloned by limiting dilution method. Further screens are preferably
performed to select antibodies that can bind to rhTF in solution as
well as in a human fluid sample. The isolated antibodies can be
further purified by any suitable immunological technique including
affinity chromatography. A hybridoma culture producing the
particular preferred H36.D2.B7 antibody has been deposited pursuant
to the Budapest Treaty with the American Type Culture Collection
(ATCC) at 12301 Parklawn Drive, Rockville, Md., 10852. The
hybridoma culture was deposited with the ATCC on Jan. 8, 1997 and
was assigned Accession Number ATCC HB-12255.
[0056] For human therapeutic applications, it may be desirable to
produce chimeric antibody derivatives, e.g. antibody molecules that
combine a non-human animal variable region and a human constant
region, to thereby render the antibodies less immunogenic in a
human subject than the corresponding non-chimeric antibody. A
variety of types of such chimeric antibodies can be prepared,
including e.g. by producing human variable region chimeras, in
which parts of the variable regions, especially conserved regions
of the antigen-binding domain, are of human origin and only the
hypervariable regions are of non-human origin. See also discussions
of humanized chimeric antibodies and methods of producing same in
S. L. Morrison, Science, 229:1202-1207 (1985); Oi et al.,
BioTechniques, 4:214 (1986); Teng et al., Proc. Natl. Acad. Sci.
U.S.A., 80:7308-7312 (1983); Kozbor et al., Immunology Today,
4:7279 (9183); Olsson et al., Meth. Enzymol., 9:3-16 (1982).
Additionally, transgenic mice can be employed. For example,
transgenic mice carrying human antibody repertoires have been
created which can be immunized with native human TF. Splenocytes
from such immunized transgenic mice can then be used to create
hybridomas that secrete human monoclonal antibodies that
specifically react with native human TF as described above. See N.
Lonberg et al., Nature, 368:856-859 (1994); L. L. Green et al.,
Nature Genet., 7:13-21 (1994); S. L. Morrison, Proc. Natl. Acad.
Sci. U.S.A., 81:6851-6855 (1994).
[0057] Nucleic acids of antibodies of the invention also can be
prepared by polymerase chain reaction (see primers disclosed in
Example 1 which follows). See generally, Sambrook et al., Molecular
Cloning (2d ed. 1989). Such nucleic acids also can be synthesized
by known methods, e.g. the phosphate triester method (see
Oligonucleotide Synthesis, IRL Press (M. J. Gait, ed., 1984)), or
by using a commercially available automated oligonucleotide
synthesizer. Such a prepared nucleic acid of the invention can be
employed to express an antibody of the invention by-known
techniques. For example, a nucleic acid coding for an antibody of
the invention can be incorporated into a suitable vector by known
methods such as by use of restriction enzymes to make cuts in the
vector for insertion of the construct followed by ligation. The
vector containing the inserted nucleic acid sequence, suitably
operably linked to a promoter sequence, is then introduced into
host cells for expression. See, generally, Sambrook et al., supra.
Selection of suitable vectors can be made empirically based on
factors relating to the cloning protocol. For example, the vector
should be compatible with, and have the proper replicon for the
host cell that is employed. Further, the vector must be able to
accommodate the inserted nucleic acid sequence. Suitable host cells
will include a wide variety of eukaryotic or prokaryotic cells such
as E. coli and the like.
[0058] The molecular weight of the antibodies of the invention will
vary depending on several factors such as the intended use and
whether the antibody includes a conjugated or recombinantly fused
toxin, pharmaceutical, or detectable label or the like. In general,
an antibody of the invention will have a molecular weight of
between approximately 20 to l50 kDa. Such molecular weights can be
readily are determined by molecular sizing methods such as SDS-PAGE
gel electrophoresis followed by protein staining or Western blot
analysis.
[0059] "Antibody of the invention" or other similar term refers to
whole immunoglobulin as well immunologically active fragments which
bind native TF. The immunoglobulins and immunologically active
fragments thereof include an antibody binding site (i.e., peritope
capable of specifically binding native human TF). Exemplary
antibody fragments include, for example, Fab, F(v), Fab',
F(ab').sub.2 fragments, "half molecules" derived by reducing the
disulfide bonds of immunoglobulins, single chain immunoglobulins,
or other suitable antigen binding fragments (see e.g., Bird et al.,
Science, pp. 242-424 (1988); Huston et al., PNAS, (USA), 85:5879
(1988); Webber et al., Mol. Immunol., 32:249 (1995)). The antibody
or immunologically active fragment thereof may be of animal (e.g.,
a rodent such as a mouse or a rat), or chimeric form (see Morrison
et al., PNAS, 81:6851 (1984); Jones et al., Nature, pp. 321, 522
(1986)). Single chain antibodies of the invention can be
preferred.
[0060] Similarly, a "nucleic acid of the invention" refers to a
sequence which can be expressed to provide an antibody of the
invention as such term is specified to mean immediately above.
[0061] As discussed above, antibodies of the invention can be
administered to a mammal, preferably a primate such as a human, to
prevent or reduce thromboses such as restenosis, typically in a
composition including one or more pharmaceutically acceptable
non-toxic carriers such as sterile water or saline, glycols such as
polyethylene glycol, oils of vegetable origin, and the like. In
particular, biocompatible, biodegradable lactide polymer, lactide
glycolide copolymer or polyoxyethylene, polyoxypropylene copolymers
may be useful excipients to control the release of the
antibody-containing compositions described herein. Other
potentially useful administration systems include ethylene vinyl
acetate copolymer particles, osmotic pumps, and implantable
infusion systems and liposomes. Generally, an anti-coagulant
composition of the invention will be in the form of a solution or
suspension, and will preferably include approximately 0.01% to 10%
(w/w) of the antibody of the present invention, preferably
approximately 0.01% to 5% (w/w) of the antibody. The antibody can
be administered as a sole active ingredient in the composition, or
as a cocktail including one or more other anti-coagulant (e.g.,
heparin, hirudin, or hirulog), anti-platelet (e.g., ReoPro), or
thrombolytic agents (e.g., tissue plasminogen activator,
strepokinase and urokinase). Additionally, antibodies of the
invention can be administered prior to, or after administration of
one or more suitable anti-coagulant, anti-platelet or thrombolytic
agents to boost or prolong desired anti-coagulation activity.
[0062] As also discussed above, antibodies of the invention can be
employed to reduce potential blood coagulation arising from use of
medical implementation, e.g. an indwelling device such as a
catheter, stent, etc. In one preferred method, the implementation
can be treated with an antibody of the invention (e.g., as a 1
mg/ml saline solution) prior to contact with a body fluid.
Alternatively, or in addition, an antibody of the invention can be
combined with the body fluid in an amount sufficient to minimize
blood clotting.
[0063] Therapeutic anti-coagulant compositions according to the
invention are suitable for use in parenteral or intravenous
administration, particularly in the form of liquid solutions. Such
compositions may be conveniently administered in unit dose and may
be prepared in accordance with methods known in the pharmaceutical
art. See Remington's Pharmaceutical Sciences, (Mack Publishing Co.,
Easton Pa., (1980)). By the term "unit dose" is meant a therapeutic
composition of the present invention employed in a physically
discrete unit suitable as unitary dosages for a primate such as a
human, each unit containing a pre-determined quantity of active
material calculated to produce the desired therapeutic effect in
association with the required diluent or carrier. The unit dose
will depend, on a variety of factors including the type and
severity of thrombosis to be treated, capacity of the subject's
blood coagulation system to utilize the antibody, and degree of
inhibition or neutralization of FX activation desired. Precise
amounts of the antibody to be administered typically will be guided
by judgement of the practitioner, however, the unit dose will
generally depend on the route of administration and be in the range
of 10 ng/kg body weight to 50 mg/kg body weight per day, more
typically in the range of 100 ng/kg body weight to about 10 mg/kg
body weight per day. Suitable regiments for initial administration
in booster shots are also variable but are typified by an initial
administration followed by repeated doses at one or more hour
intervals by a subsequent injection or other administration.
Alternatively, continuous or intermittent intravenous infusions may
be made sufficient to maintain concentrations of at least from
about 10 nanomolar to 10 micromolar of the antibody in the
blood.
[0064] In some instances, it may be desirable to modify the
antibody of the present invention to impart a desirable biological,
chemical or physical property thereto. More particularly, it may be
useful to conjugate (i.e. covalently link) the antibody to a
pharmaceutical agent, e.g. a fibrinolytic drug such as t-PA,
streptokinase, or urokinase to provide fibrinolytic activity. Such
linkage can be accomplished by several methods including use of a
linking molecule such as a heterobifunctional protein cross-linking
agent, e.g. SPDP, carbodimide, or the like, or by recombinant
methods.
[0065] In addition to pharmaceuticals such as a fibrinolytic agent,
an antibody of the invention can be conjugated to a toxin of e.g.
plant or bacterial origin such as diphtheria toxin (i.e., DT),
shiga toxin, abrin, cholera toxin, ricin, saporin, pseudomonas
exotoxin (PE), pokeweed antiviral protein, or gelonin. Biologically
active fragments of such toxins are well known in the art and
include, e.g., DT A chain and ricin A chain. The toxin can also be
an agent active at cell surfaces such as phospholipases (e.g.,
phospholipase C). As another example, the toxin can be a
chemotherapeutic drug such as, e.g., vendesine, vincristine,
vinblastin, methotrexate, adriamycin, bleomycin, or cisplatin, or,
the toxin can be a radionuclide such as, e.g., iodine-131,
yttrium-90, rhenium-188 or bismuth-212 (see generally, Moskaug et
al., J. Biol. Chem., 264:15709 (1989); I. Pastan et al., Cell,
47:641 (1986); Pastan et al., Recombinant Toxins as Novel
Therapeutic Agents, Ann. Rev. Biochem., 61:331 (1992); Chimeric
Toxins Olsnes and Phil, Pharmac. Ther., 25:355 (1982); published
PCT Application No. WO 94/29350; published PCT Application No. WO
94/04689; and U.S. Pat. No. 5,620,939). Also, as discussed above,
in addition to a toxin, an antibody of the invention can be
conjugated to an effector molecule (e.g. IgG1 or IgG3) to provide
complement-fixing ability and antibody-dependent cell-mediated
cytoxicity upon administration to a mammal.
[0066] Such an antibody/cytotoxin or effector molecule conjugate
can be administered in a therapeutically effective amount to a
mammal, preferably a primate such as a human, where the mammal is
known to have or is suspected of having tumor cells, immune system
cells, or endothelia capable of expressing TF. Exemplary of such
tumor cells, immune system cells and endothelia include
malignancies of the breast and lung, monocytes and vascular
endothelia.
[0067] Antibodies of the invention also can be conjugated to a
variety of other pharmaceutical agents in addition to those
described above such as, e.g., drugs, enzymes, hormones, chelating
agents capable of binding a radionuclide, as well as other proteins
and polypeptides useful for diagnosis or treatment of disease. For
diagnostic purposes, the antibody of the present invention can be
used either detectably-labelled or unlabelled. For example, a wide
variety of labels may be suitably employed to detectably-label the
antibody, such as radionuclides, fluors, enzymes, enzyme
substrates, enzyme cofactors, enzyme inhibitors, ligands such as,
e.g., haptens, and the like.
[0068] Diagnostic methods are also provided including in vivo
diagnostic imaging [see, e.g., A. K. Abbas, Cellular and Molecular
Immunology, pg. 328 (W.B. Saunders Co. 1991)]. For most in vivo
imaging applications, an antibody of the invention can be
detectably-labeled with, e.g., .sup.125I, .sup.32P, .sup.99Tc, or
other detectable tag, and subsequently administered to a mammal,
particularly a human, for a pre-determined amount of time
sufficient to allow the antibody to contact a desired target. The
subject is then scanned by known procedures such as scintigraphic
camera analysis to detect binding of the antibody. The analysis
could aid in the diagnosis and treatment of a number of thromboses
such as those specifically disclosed herein. The method is
particularly useful when employed in conjunction with cardiac
surgery, particularly angioplasty, or other surgical procedure
where undesired formation of a blood clot can occur, to visualize
the development or movement of a blood clot.
[0069] Antibodies of the invention also can be used to prepare
substantially pure (e.g., at least about 90% pure, preferably at
least about 96 or 97% pure) native TF, particularly native human TF
from a biological sample. For example, native TF can be obtained
as-previously described (see e.g., L. V. M. Rao et al., Thrombosis
Res., 56:109 (1989)) and purified by admixing the solution with a
solid support comprising the antibody to form a coupling reaction
admixture. Exemplary solid supports include a wall of a plate such
as a microtitre plate, as well as supports including or consisting
of polystyrene, polyvinylchloride, a cross-linked dextran such as
Sephadex.TM. (Pharmacia Fine Chemicals), agarose, polystyrene beads
(Abbott Laboratories), polyvinyl chloride, polystyrene,
polyacrylmide in cross-linked form, nitrocellulose or nylon and the
like. The TF can then be isolated from the solid support in
substantially pure form in accordance with standard immunological
techniques. See generally Harlow and Lane supra and Ausubel et al.
supra).
[0070] As also discussed above, antibodies of the invention can be
employed to detect native human TF in a biological sample,
particularly native TF associated with a blood clot. Exemplary
biological samples include blood plasma, serum, saliva, urine,
stool, vaginal secretions, bile, lymph, ocular humors,
cerebrospinal fluid, cell culture media, and tissue, particularly
vascular tissues such as cardiac tissue. Samples may be suitably
obtained from a mammal suffering from or suspected of suffering
from a thrombosis, preferably restenosis, associated with, e.g., an
invasive medical procedure such as cardiopulmonary bypass surgery;
a heart ailment such as myocardial infarction, cardiomyopathy,
valvular heart disease, unstable angina, or artrial fibrillation
associated with embolization; a coagulopathy including disseminated
intravascular coagulation, deployment of an implementation such as
a stent or catheter; shock (e.g., septic shock syndrome), vascular
trauma, liver disease, heat stroke, malignancies (e.g.,.pancreatic,
ovarian, or small lung cell carcinoma), lupus, eclampsia,
perivascular occlusive disease, and renal disease.
[0071] For such assays, an antibody of the invention can be
detectably-labelled with a suitable atom or molecule e.g.,
radioactive iodine, tritium, biotin, or reagent capable of
generating a detectable product such as an anti-iodiotypic antibody
attached to an enzyme such as .beta.-galactosidase or horseradish
peroxidase, or a fluorescent tag (e.g., fluorescein or rhodamine)
in accordance with known methods. After contacting the biological
sample with the detectably-labelled antibody, any unreacted
antibody can be separated from the biological sample, the label (or
product) is detected by conventional immunological methods
including antibody capture assay, antibody sandwich assay, RIA,
ELISA, immunoprecipitation, immunoabsorption and the like (see
Harlow and Lane, supra; Ausubel et al. supra). Any label (or
product) in excess of that detected in a suitable control sample is
indicative of the presence of native TF, more particularly a blood
clot, in the biological sample. For example, antibodies of the
invention can be detectably-labelled to detect, and preferably
quantitate, native TF in accordance with standard immunological
techniques such as antibody capture assay, ELISA, antibody sandwich
assay, RIA, immunoprecipitation, immunoabsorption and the like. In
some cases, particularly when a tissue is used, the immunological
technique may include tissue fixation with a reagent known to
substantially maintain protein conformation (e.g., dilute
formaldehyde). See generally, Ausubel et al., Current Protocols in
Molecular Biology, John Wiley & Sons, New York, (1989); Harlow
and Lane in Antibodies: A Laboratory Manual, CSH Publications,. NY
(1988).
[0072] Antibodies of the invention also can be used for detecting
and purifying cells which express native TF, including fibroblasts,
brain cells, immune cells, (e.g., monocytes), epithelia, as well as
certain malignant cells. Preferred methods of detecting and
purifying the cells include conventional immunological methods
(e.g., flow cytometry methods such as FACS, and immunopanning).
Substantially pure populations of cells expressing native TF are
useful in clinical and research settings, e.g., to establish such
cells as cultured cells for screening TF-binding antibodies.
[0073] The invention also provides test and diagnostic kits for
detection of native TF, particularly native human TF, in a test
sample, especially a body fluid such as blood, plasma, etc., or
tissue as discussed above. A preferred kit includes a
detectably-labelled antibody of the invention. The diagnostic kit
can be used in any acceptable immunological format such as an ELISA
format to detect the presence or quantity of native TF in the
biological sample.
[0074] All documents mentioned herein are fully incorporated by
reference in their entirety.
[0075] The following non-limiting examples are illustrative of the
invention. In the following examples and elsewhere the antibodies
H36 and H36.D2 are referred to. Those antibodies are the same
antibody as H36.D2.B7, but H36 is derived from the mother clone,
and H36.D2 is obtained from the primary clone, whereas H36.D2.B7 is
obtained from the secondary clone. No differences have been
observed between those three-clones with respect to ability to
inhibit TF Or other physical properties.
EXAMPLE 1
Preparation and Cloning of Anti-rhTF Monoclonal Antibodies
Monoclonal antibodies against rhTF were Prepared as Follows
[0076] A. Immunization and Boosts
[0077] Five female BALB/c mice were immunized with 10 .mu.g each of
lipidated, purified rhTF. The mice were initially sensitized
intraperitoneally using Hunter's Titermax adjuvant. Three final
boosts were administered in 0.85% NaCl. Boosts were 2, 5.5, and 6.5
months post initial sensitization. All boosts were given
intraperitoneally, except the first which was subcutaneous. The
final boost was given 3 days pre-fusion and 20 .mu.g was
administered.
[0078] B. Fusion of Mouse Spleen Lymphocytes with Mouse Myeloma
Cells
[0079] Lymphocytes from the spleen of one rhTF immunized BALB/c
mouse was fused to X63-Ag8.653 mouse myeloma cells using PEG 1500.
Following exposure to the PEG, the cells were incubated for one
hour in heat inactivated fetal bovine serum at 37.degree. C. The
fused cells were then resuspended in RPMI 1640 and incubated
overnight at 37.degree. C. with 10% CO.sub.2. The cells were plated
the next day using RPMI 1640 and supplemented with macrophage
culture supernatant.
[0080] C. ELISA Development
[0081] Plates for the ELISA assay were coated with 100 microliters
of recombinant tissue factor (0.25 .mu.g/ml) in a carbonate based
buffer. All steps were performed at room temperature. Plates were
blocked with BSA, washed, and then the test samples and controls
were added. Antigen/antibody binding was detected by incubating the
plate with goat anti-mouse HRP conjugate (Jackson ImmunoResearch
Laboratories) and then using an ABTS peroxidase substrate system
(Kirkegaad and Perry Laboratories). Absorbance were read on an
automatic plate reader at a wavelength of 405 nm.
[0082] D. Stabilization of rhTF Hybridoma Cell Lines
[0083] Two weeks after fusion, screening of hybridoma colonies by
specific rhTF ELISA was started. Screening for new colonies
continued for three weeks. The positive clones were tested every
one to two weeks for continued antibody production until fifteen
stable clones were frozen down.
[0084] E. Primary and Secondary Cloning
[0085] Limiting dilution cloning was performed on each of the
positive stable hybridomas to obtain primary clones. The cells were
thawed, grown in culture for a short period of time, and then
diluted from 10 cells/well to 0.1 cells/well. Primary clones were
tested by anti-rhTF ELISA and five to six positive clones were
expanded and frozen.
[0086] Secondary clone of anti-rhTF antibody, H36.D2.B7, was
obtained from primary clone, H36.D2, prepared and stored in liquid
nitrogen as described above. Four different dilutions, 5
cells/well, 2 cells/well, 1 cell/well, 0.5 cells/well of the
primary clone were prepared in 96-wells microtiter plates to start
the secondary cloning. Cells were diluted in IMDM tissue culture
media containing the following additives: 20% fetal bovine serum
(FBS), 2 mM L-glutamine, 100 units/ml of penicillin, 100 .mu.g/ml
of streptomycin, 1% GMS-S, 0.075% NaHCO.sub.3. To determine clones
that secrete anti-rhTF antibody, supematants from five individual
wells of the 0.2 cells/well microtiter plate were withdrawn after
two weeks of growth and tested for the presence of anti-rhTF
antibody by ELISA assays as described above. All five clones showed
positive results in the ELISA assay, with H36.D2.B7 being the best
antibody producer. All five clones were adapted and expanded in
RPMI media containing the following additive: 10% FBS, 2 mM
L-glutamine, 100 units/ml of penicillin, 100 .mu.g/ml of
streptomycin, 1% GMS-S, 0.075% NaHCO.sub.3, and 0.013 rhg/ml of
oxalaacetic acid. H36.D2.B7 was purified by Protein A affinity
chromatography from the supernatant of cell culture and was tested
for its ability to inhibit TF:VIIa in a FX activation assay. The
results indicated that H36.D2.B7 had the same inhibition as H36.D2
antibody. All cells were stored in liquid nitrogen.
[0087] F. Isolation of total RNA from H36.D2.B7
[0088] 269 .mu.g of total RNA was isolated from 2.7.times.10.sup.5
H36.D2.B7 hybridoma cells. The isolation of total RNA was performed
as described in the RNeasy Midi Kits protocol from Qiagen. The RNA
sample was stored in water at -20.degree. C. until needed.
[0089] G. cDNA Synthesis and Cloning of Variable Regions of
H36.D2.B7 Gene
[0090] To obtain the first strand of cDNA, a reaction mixture
containing 5 .mu.g of total RNA isolated as above, back primers
JS300 (all primers are identified below) for the heavy chain (HC)
and OKA 57 for the light chain (LC), RNase inhibitor, dNTP's, DTT,
and superscript II reverse transcriptase, was prepared and
incubated at 42.degree. C. for 1 hour. The reaction tube is then
incubated at 65.degree. C. for 15 minutes to stop the
transcription. After cooling down, five units of RNase H was then
added and the reaction was allowed to incubate at 37.degree. C. for
20 minutes. The cDNA sample was stored at -70.degree. C. until
needed.
[0091] PCR (polymerase chain reaction) was conducted separately to
clone the variable regions of both HC and LC of anti-rhTF,
H36.D2.B7 from the cDNA made as above (nucleic acid and amino acid
sequences of those HC and LC variable regions set forth in FIGS. 1A
and 1B). Three rounds of PCR were conducted. Round 1: PCR was run
for 35 cycles at 96.degree. C., 53.degree. C. and 72.degree. C.
using front primer JS002 and back primer JS300 for HC. For LC front
primer JS009 and back primer OKA 57 were used and PCR was rune for
35 cycles at 96.degree. C., 63.degree. C. and 72.degree. C. Round
2: PCR of both HC and LC was rune the same as in Round 1 with the
exception that pMC-18 was used for HC front primer and pMC-15 for
LC front primer. Round 3: PCR was run for 30 cycles at 96.degree.
C., 60-65.degree. C. and 72.degree. C. using H36HCF and H36HCR
primers for HC. For LC, PCR was run for 30 cycles at 96.degree. C.,
58.degree. C. and 72.degree. C. using H36LCF and H36LCR
primers.
[0092] The following primers were used for cloning H36.D2.B7
variable regions of HC and LC.
1 OKA 57: (SEQ ID NO: 17) 5'-GCACCTCCAGATGTTAACTGCT- C-3' JS300:
(SEQ ID NO: 18) 5'-GAARTAVCCCTTGACCAGGC-3' JS009: (SEQ ID NO: 19)
5'-GGAGGCGGCGGTTCTGACATTGTGMTGWCMCARTC-3' JS002: (SEQ ID NO: 20)
5'-ATTTCAGGCCCAGCCGGCCATGGCCGARGTY- CARCTKCARCARYC-3' pMC-15: (SEQ
ID NO: 21) 5'-CCCGGGCCACCATGKCCCCWRCTCAGYTYCTKG-3' pMC-18: (SEQ ID
NO: 22) 5'-CCCGGGCCACCATGGRATGSAGCTGKGTMATSCTC-3' H36HCF: (SEQ ID
NO: 23) 5'-ATATACTCGCGACAGCTACAG- GTGTCCACTCCGAGATCCAGCTGCA
GCAGTC-3' H36HCR: (SEQ ID NO: 24)
5'-GACCTGAATTCTAAGGAGACTGTGAGAGTGG-3' H36LCF: (SEQ ID NO: 25)
5'-TTAATTGATATCCAGATGACCCA- GTCTCC-3' H36LCR: (SEQ ID NO: 26)
TAATCGTTCGAAAAGTGTACTTACGTTTCAGCTCCAGCTTGGTCC
[0093] where in the above SEQ ID NOS: 17 through 26: K is G or T; M
is A or C; R is A or G; S is C or G; V is A, C or G; W is A or T; Y
is C or T.
EXAMPLE 2
Binding Activity of Mabs of the Invention
[0094] Mabs of the invention as prepared in Example 1 above were
employed. The rhTF molecule was expressed in E. coli and purified
by immunoaffinity chromatography in accordance with standard
methods (see Harlow and Lane, supra, Ausubel et al. supra). Mab
association (K.sub.a) and dissociation (K.sub.d) constants were
determined by ELISA and surface plasmon resonance (i.e., BIACore)
assays (see e.g., Harlow and Lane, supra; Ausubel et al. supra;
Altschuh et al., Biochem., 31:6298 (1992); and the BIAcore method
disclosed by Pharmacia Biosensor). For BIACore assays, rhTF was
immobilized on a biosensor chip in accordance with the
manufacturer's instructions. Constants for each Mab were determined
at four antibody concentrations (0.125 nM, 0.25 nM, 0.5 mM, and 1
nM).
[0095] Protein concentrations were determined by standard assay (M.
M. Bradford, Anal. Biochem., 72:248 (1976)) using Bovine Serum
Albumin as a standard and a commercially available dye reagent
(Bio-Rad).
[0096] FIG. 2 shows association and disassociation constants for
each anti-rhTF Mab. Mab H36 exhibited the highest association rate
(K.sub.a=3.1.times.10.sup.10 M.sup.-1) and the lowest
disassociation rate (K.sub.d=3.2.times.10.sup.-11 M) of any of the
anti-rhTF Mabs tested.
EXAMPLE 3
FXa-Specific Substrate Assay
[0097] In general, the experiments described herein were conducted
using rhTF lipidated with phosphatidycholine (0.07 mg/ml) and
phosphatidylserine (0.03 mg/ml) at a 70/30 w/w ratio in 50 mM
Tris-HCl, pH 7.5, 0.1% bovine serum albumin (BSA) for 30 minutes at
37.degree. C. A stock solution of preformed TF:VIIa complex was
made by incubating 5 nM of the lipidated rhTF and 5 nM of FVIIa for
30 minutes at 37.degree. C. The TF:VIIa complex was aliquoted and
stored at -70.degree. C. until needed. Purified human factors VII,
VIIa, and FX were obtained from Enyzme Research Laboratories, Inc.
The following buffer was used for all FXa and FVIIa assays: 25 mM
Hepes-NaOH, 5 mM CaCl.sub.2, 150 mM NaCl, 0.1% BSA, pH 7.5.
[0098] Mabs were screened for capacity to block TF:VIIa-mediated
activation of FX to FXa. The FX activation was determined in two
discontinuous steps. In the first step (FX activation), FX
conversion to FXa was assayed in the presence of Ca.sup.+2. In the
second step (FXa activity assay), FX activation was quenched by
EDTA and the formation of FXa was determined using a FXa-specific
chromogenic substrate (S-2222). The S-2222 and S-2288 (see below)
chromogens were obtained from Chromogenix (distributed by Pharmacia
Hepar Inc.). FX activation was conducted in 1.5 ml microfuge tubes
by incubating the reaction with 0.08 nM TF:VIIa, either
pre-incubated with an anti-rhTF antibody or a buffer control. The
reaction was subsequently incubated for 30 minutes at 37.degree.
C., then 30 nM FX was added followed by an additional incubation
for 10 minutes at 37.degree. C. FXa activity was determined in
96-well titre plates. Twenty microlitres of sample was withdrawn
from step one and admixed with an equal volume of EDTA (500 mM) in
each well, followed by addition of 0.144 ml of buffer and 0.016 ml
of 5 mM S-2222-substrate. The reaction was allowed to incubate for
an additional 15-30 minutes at 37.degree. C. Reactions were then
quenched with 0.05 ml of 50% acetic acid, after which, absorbance
at 405 nm was recorded for each reaction. The inhibition of TF:VIIa
activity was calculated from OD.sub.405nm values in the
experimental (plus antibody) and control (no antibody) samples. In
some experiments, an anti-hTF antibody, TF/VIIa, and FX were each
added simultaneously to detect binding competition. FIG. 3 shows
that the H36.D2 MAb (in bold) inhibited TF:/VIIa activity toward FX
to a significantly greater extent (95%) than other anti-rHTF Mabs
tested.
EXAMPLE 4
FVIIa-Specific Substrate Assay
[0099] Mabs were further screened by an FVIIa specific assay. In
this assay, 5 nM lipidated rhTF was first incubated with buffer
(control) or 50 nM antibody (experimental) in a 96-well titre plate
for 30 minutes at 37.degree. C., then admixed with 5 nM purified
human FVIIa (V.sub.T=0.192 ml), followed by 30 minutes incubation
at 37.degree. C. Eight microliters of a 20 mM stock solution of the
FVIIa specific substrate S-2288 was then added to each well (final
concentration, 0.8 mM). Subsequently, the reaction was incubated
for one hour at 37.degree. C. Absorbance at 405 nm was then
measured after quenching with 0.06 ml of 50% acetic acid. Percent
inhibition of TF/VIIa activity was calculated from OD.sub.405nm
values from the experimental and control samples.
[0100] FIG. 4 shows the H36 antibody did not significantly block
TF/VIIa activity toward the S-2288 substrate when the antibody was
either pre-incubated with TF (prior to VIIa addition) or added to
TF pre-incubated with VIIa (prior to adding the antibody). This
indicates that H36 does not interfere with the interaction
(binding) between TF and FVIIa, and that H36 also does not inhibit
TF:VIIa activity toward a peptide substrate.
EXAMPLE 5
Prothrombin Time (PT) Assay
[0101] Calcified blood plasma will clot within a few seconds after
addition of thromplastin (TF); a phenomenon called the "prothrombin
time" (PT). A prolonged PT is typically a useful indicator of
anti-coagulation activity (see e.g., Gilman et al. supra).
[0102] The H36.D2 antibody was investigated for capacity to affect
PT according to standard methods using commercially available human
plasma (Ci-Trol Control, Level I obtained from Baxter Diagnostics
Inc.). Clot reactions were initiated by addition of lipidated rhTF
in the presence of Ca.sup.++. Clot time was monitored by an
automated coagulation timer (MLA Electra 800). PT assays were
initiated by injecting 0.2 ml of lipidated rhTF (in a buffer of 50
mM Tris-HCl, pH 7.5, containing 0.1% BSA, 14.6 mM CaCl.sub.2. 0.07
mg/ml of phosphatidylcholine, and 0.03 mg/ml of phosphatidylserine)
into plastic twin-well cuvettes. The cuvettes each contained 0.1 ml
of the plasma preincubated with either 0.01 ml of buffer (control
sample) or antibody (experimental sample) for 1-2 minutes. The
inhibition of TF-mediated coagulation by the H36.D2 antibody was
calculated using a TF standard curve in which the log [TF] was
plotted against log clot time.
[0103] FIG. 5 shows the H36.D2 antibody substantially inhibits
TF-initiated coagulation in human plasma. The H36.D2 antibody
increased PT times significantly, showing that the antibody is an
effective inhibitor of TF-initiated coagulation (up to
approximately 99% inhibition).
EXAMPLE 6
FX and the H36.D2 Antibody Compete for Binding to the TF:VIIa
Complex
[0104] Competition experiments were conducted between TF/VIIa, FX
and the H36.D2 antibody. FIG. 6A illustrates the results of an
experiment in which a preformed TF/VIIa complex (0.08 mM) was
pre-incubated at 37.degree. C. for 30 minutes in buffer including
0.02 nM, 0.04 nM, 0.08 nM and 0.16 nM of the H36.D2 monoclonal
antibody, respectively. FX (30 nM) was then added to the TF/VIIa
and H36.D2 antibody mixture and the mixture allowed to incubate for
an additional 10 minutes at 37.degree. C. FX activation was
quenched with EDTA as described previously. The FXa produced
thereby was determined by the FXa-specific assay described in
Example 3, above.
[0105] FIG. 6B shows the results of an experiment conducted along
the lines just-described, except that the H36.D2 antibody,
pre-formed TF:VIIa, and FX were added simultaneously to start the
FX activation assay.
[0106] The data set forth in FIGS. 6A and 6B show that the H36.D2
antibody and FX compete for binding to the pre-formed TF/VIIa
complex.
EXAMPLE 7
Inhibition of TF Activity in Cell Culture
[0107] J-82 is a human bladder carcinoma cell line (available from
the ATCC) which abundantly expresses native human TF as a cell
surface protein. To see if the H36.D2 antibody could prevent FX
from binding to native TF displayed on the cell surface, a J-82 FX
activation assay was conducted in microtitre plates in the presence
of FVII (see D. S. Fair et al., J. Biol. Chem., 262:11692 (1987)).
To each well, 2.times.10.sup.5 cells was added and incubated with
either 50 ng FVII, buffer (control sample) or the anti-TF antibody
(experimental sample) for 2 hours at 37.degree. C. Afterwards, each
well was gently washed with buffer and 0.3 ml of FX (0.05 mg/ml)
was added to each well for 30 minutes at room temperature. In some
cases, the antibody was added at the same time as FX to detect
binding competition for the native TF. Thereafter, 0.05 ml aliquots
were removed and added to new wells in a 96-well titre plate
containing 0.025 ml of 100 mM EDTA. FXa activity was determined by
the FXa-specific assay as described in Example 3, above. Inhibition
of TF activity on the surface of the J-82 cells was calculated from
the OD.sub.405nm in the absence (control sample) and presence of
antibody (experimental sample).
[0108] FIG. 7 shows that the H36.D2 antibody bound native TF
expressed on J-82 cell membranes and inhibited TF-mediated
activation of FX. These results indicate that the antibody competes
with FX for binding to native TF displayed on the cell surface.
Taken with the data of Example 8, below, the results also show that
the H36.D2 antibody can bind a conformational epitope on native TF
in a cell membrane.
EXAMPLE 8
Specific Binding of the H36.D2 Antibody to Native rhTF
[0109] Evaluation of H36.D2 binding to native and non-native rhTF
was performed by a simplified dot blot assay. Specifically, rhTF
was diluted to 30 .mu.g/ml in each of the following three buffers:
10 mM Tris-HCl, pH 8.0; 10 mM Tris-HCl, pH 8.0 and 8 M urea; and 10
mM Tris-HCl, pH 8.0, 8 M urea and 5 mM dithiothreitol. Incubation
in the Tris buffer maintains rhTF in native form, whereas treatment
with 8M urea and 5 nM dithiothreitol produces non-native
(denatured) rhTF. Each sample was incubated for 24 hours at room
temperature. After the incubation, a Millipore Immobilon
(7.times.7cm section) membrane was pre-wetted with methanol,
followed by 25 mM Tris, pH 10.4, including 20% methanol. After the
membranes were air-dried, approximately 0.5 .mu.l, 1 .mu.l, and 2
.mu.l of each sample (30 .mu.g/ml) was applied to the membrane and
air-dried. After blocking the membrane by PBS containing 5% (w/v)
skim milk and 5% (v/v) NP-40, the membrane was probed with H36.D2
antibody, followed by incubation with a goat anti-mouse IgG
peroxidase conjugate (obtained from Jackson ImmunoResearch
Laboratories, Inc.). After incubation with ECL Western Blotting
reagents in accordance with the manufacturer's instructions
(Amersham), the membrane was wrapped with plastic film (Saran Wrap)
and exposed to X-ray film for various times.
[0110] FIG. 8A shows that the H36.D2 Mab binds a conformational
epitope on native TF in the presence of Tris buffer or Tris buffer
with 8M urea (lanes 1 and 2). The autoradiogram was exposed for 40
seconds. However, when the native TF was denatured with 8M urea and
5 mM DTT, H36.D2 binding was significantly reduced or eliminated
(lane 3). FIG. 8B shows an over-exposed autoradiogram showing
residual binding of the H36.D2 antibody to non-native (i.e.,
denatured) rhTF. The over-exposure was for approximately 120
seconds. Treatment with 8M urea alone probably resulted in only
partial denaturation of the native rhTF since the two disulfide
bonds in TF are not reduced. It is also possible that the partially
denatured TF may refold back to native confirmation during later
blotting process when urea is removed. These results also clearly
distinguish preferred antibodies of the invention which do not bind
denatured TF from previously reported antibodies which do not
selectively bind to a conformational epitope and bind to denatured
TF (see U.S. Pat. No. 5,437,864 where in FIG. 18 Western Blot
analysis shows binding to TF denatured by SDS).
[0111] The invention has been described in detail with reference to
preferred embodiments thereof. However, it will be appreciated that
those skilled in the art, upon consideration of the disclosure, may
make modification and improvements within the spirit and scope of
the invention.
Sequence CWU 1
1
26 1 321 DNA Homo sapiens CDS (1)..(321) 1 gac att cag atg acc cag
tct cct gcc tcc cag tct gca tct ctg gga 48 Asp Ile Gln Met Thr Gln
Ser Pro Ala Ser Gln Ser Ala Ser Leu Gly 1 5 10 15 gaa agt gtc acc
atc aca tgc ctg gca agt cag acc att gat aca tgg 96 Glu Ser Val Thr
Ile Thr Cys Leu Ala Ser Gln Thr Ile Asp Thr Trp 20 25 30 tta gca
tgg tat cag cag aaa cca ggg aaa tct cct cag ctc ctg att 144 Leu Ala
Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro Gln Leu Leu Ile 35 40 45
tat gct gcc acc aac ttg gca gat ggg gtc cca tca agg ttc agt ggc 192
Tyr Ala Ala Thr Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly 50
55 60 agt gga tct ggc aca aaa ttt tct ttc aag atc agc agc cta cag
gct 240 Ser Gly Ser Gly Thr Lys Phe Ser Phe Lys Ile Ser Ser Leu Gln
Ala 65 70 75 80 gaa gat ttt gta aat tat tac tgt caa caa gtt tac agt
tct cca ttc 288 Glu Asp Phe Val Asn Tyr Tyr Cys Gln Gln Val Tyr Ser
Ser Pro Phe 85 90 95 acg ttc ggt gct ggg acc aag ctg gag ctg aaa
321 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 2 107 PRT
Homo sapiens 2 Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Gln Ser Ala
Ser Leu Gly 1 5 10 15 Glu Ser Val Thr Ile Thr Cys Leu Ala Ser Gln
Thr Ile Asp Thr Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly
Lys Ser Pro Gln Leu Leu Ile 35 40 45 Tyr Ala Ala Thr Asn Leu Ala
Asp Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Lys Phe Ser Phe Lys Ile Ser Ser Leu Gln Ala 65 70 75 80 Glu Asp Phe
Val Asn Tyr Tyr Cys Gln Gln Val Tyr Ser Ser Pro Phe 85 90 95 Thr
Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 3 351 DNA Homo
sapiens CDS (1)..(351) 3 gag atc cag ctg cag cag tct gga cct gag
ctg gtg aag cct ggg gct 48 Glu Ile Gln Leu Gln Gln Ser Gly Pro Glu
Leu Val Lys Pro Gly Ala 1 5 10 15 tca gtg cag gta tcc tgc aag act
tct ggt tac tca ttc act gac tac 96 Ser Val Gln Val Ser Cys Lys Thr
Ser Gly Tyr Ser Phe Thr Asp Tyr 20 25 30 aac gtg tac tgg gtg agg
cag agc cat gga aag agc ctt gag tgg att 144 Asn Val Tyr Trp Val Arg
Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 gga tat att gat
cct tac aat ggt att act atc tac gac cag aac ttc 192 Gly Tyr Ile Asp
Pro Tyr Asn Gly Ile Thr Ile Tyr Asp Gln Asn Phe 50 55 60 aag ggc
aag gcc aca ttg act gtt gac aag tct tcc acc aca gcc ttc 240 Lys Gly
Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Thr Thr Ala Phe 65 70 75 80
atg cat ctc aac agc ctg aca tct gac gac tct gca gtt tat ttc tgt 288
Met His Leu Asn Ser Leu Thr Ser Asp Asp Ser Ala Val Tyr Phe Cys 85
90 95 gca aga gat gtg act acg gcc ctt gac ttc tgg ggc caa ggc acc
act 336 Ala Arg Asp Val Thr Thr Ala Leu Asp Phe Trp Gly Gln Gly Thr
Thr 100 105 110 ctc aca gtc tcc tca 351 Leu Thr Val Ser Ser 115 4
117 PRT Homo sapiens 4 Glu Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu
Val Lys Pro Gly Ala 1 5 10 15 Ser Val Gln Val Ser Cys Lys Thr Ser
Gly Tyr Ser Phe Thr Asp Tyr 20 25 30 Asn Val Tyr Trp Val Arg Gln
Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Asp Pro
Tyr Asn Gly Ile Thr Ile Tyr Asp Gln Asn Phe 50 55 60 Lys Gly Lys
Ala Thr Leu Thr Val Asp Lys Ser Ser Thr Thr Ala Phe 65 70 75 80 Met
His Leu Asn Ser Leu Thr Ser Asp Asp Ser Ala Val Tyr Phe Cys 85 90
95 Ala Arg Asp Val Thr Thr Ala Leu Asp Phe Trp Gly Gln Gly Thr Thr
100 105 110 Leu Thr Val Ser Ser 115 5 7 PRT Homo sapiens 5 Leu Ala
Ser Gln Thr Ile Asp 1 5 6 7 PRT Homo sapiens 6 Ala Ala Thr Asn Leu
Ala Asp 1 5 7 9 PRT Homo sapiens 7 Gln Gln Val Tyr Ser Ser Pro Phe
Thr 1 5 8 6 PRT Homo sapiens 8 Thr Asp Tyr Asn Val Tyr 1 5 9 17 PRT
Homo sapiens 9 Tyr Ile Asp Pro Tyr Asn Gly Ile Thr Ile Tyr Asp Gln
Asn Phe Lys 1 5 10 15 Gly 10 8 PRT Homo sapiens 10 Asp Val Thr Thr
Ala Leu Asp Phe 1 5 11 21 DNA Homo sapiens 11 ctggcaagtc agaccattga
t 21 12 21 DNA Homo sapiens 12 gctgccacca acttggcaga t 21 13 28 DNA
Homo sapiens 13 caacaagttt acagttctcc attcacgt 28 14 18 DNA Homo
sapiens 14 actgactaca acgtgtac 18 15 51 DNA Homo sapiens 15
tatattgatc cttacaatgg tattactatc tacgaccaga acttcaaggg c 51 16 24
DNA Homo sapiens 16 gatgtgacta cggcccttga cttc 24 17 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 17
gcacctccag atgttaactg ctc 23 18 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 18 gaartavccc ttgaccaggc
20 19 35 DNA Artificial Sequence Description of Artificial Sequence
Primer 19 ggaggcggcg gttctgacat tgtgmtgwcm cartc 35 20 45 DNA
Artificial Sequence Description of Artificial Sequence Primer 20
atttcaggcc cagccggcca tggccgargt ycarctkcar caryc 45 21 33 DNA
Artificial Sequence Description of Artificial Sequence Primer 21
cccgggccac catgkccccw rctcagytyc tkg 33 22 35 DNA Artificial
Sequence Description of Artificial Sequence Primer 22 cccgggccac
catggratgs agctgkgtma tsctc 35 23 52 DNA Artificial Sequence
Description of Artificial Sequence Primer 23 atatactcgc gacagctaca
ggtgtccact ccgagatcca gctgcagcag tc 52 24 31 DNA Artificial
Sequence Description of Artificial Sequence Primer 24 gacctgaatt
ctaaggagac tgtgagagtg g 31 25 29 DNA Artificial Sequence
Description of Artificial Sequence Primer 25 ttaattgata tccagatgac
ccagtctcc 29 26 45 DNA Artificial Sequence Description of
Artificial Sequence Primer 26 taatcgttcg aaaagtgtac ttacgtttca
gctccagctt ggtcc 45
* * * * *