U.S. patent application number 11/172144 was filed with the patent office on 2005-12-01 for progenitor cells, methods and uses related thereto.
This patent application is currently assigned to Curis, Inc.. Invention is credited to Lu, Kuanghui, Pang, Kevin, Rubin, Lee.
Application Number | 20050266555 11/172144 |
Document ID | / |
Family ID | 34991927 |
Filed Date | 2005-12-01 |
United States Patent
Application |
20050266555 |
Kind Code |
A1 |
Lu, Kuanghui ; et
al. |
December 1, 2005 |
Progenitor cells, methods and uses related thereto
Abstract
The present invention relates to a substantially pure population
of viable pancreatic progenitor cells, and methods for isolating
such cells. The present invention further concerns certain
therapeutic uses for such progenitor cells, and their progeny.
Inventors: |
Lu, Kuanghui; (Brookline,
MA) ; Pang, Kevin; (Belmont, MA) ; Rubin,
Lee; (Wellesley, MA) |
Correspondence
Address: |
FISH & NEAVE IP GROUP
ROPES & GRAY LLP
ONE INTERNATIONAL PLACE
BOSTON
MA
02110-2624
US
|
Assignee: |
Curis, Inc.
|
Family ID: |
34991927 |
Appl. No.: |
11/172144 |
Filed: |
June 30, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11172144 |
Jun 30, 2005 |
|
|
|
09635370 |
Aug 9, 2000 |
|
|
|
6946293 |
|
|
|
|
09635370 |
Aug 9, 2000 |
|
|
|
09499362 |
Feb 10, 2000 |
|
|
|
6326201 |
|
|
|
|
60119576 |
Feb 10, 1999 |
|
|
|
60142305 |
Jul 2, 1999 |
|
|
|
60171338 |
Dec 21, 1999 |
|
|
|
Current U.S.
Class: |
435/366 |
Current CPC
Class: |
C12N 2501/01 20130101;
C12N 5/0678 20130101; C12N 2501/11 20130101; C12N 2501/115
20130101; C12N 2501/39 20130101; C12N 2501/70 20130101 |
Class at
Publication: |
435/366 |
International
Class: |
C12N 005/08 |
Claims
1-30. (canceled)
31. A method of isolating progenitor cells comprising: i) obtaining
pancreatic ductal cells; ii) culturing said pancreatic cells in a
suitable nutrient medium; iii) isolating a population of progenitor
cells from said culture.
32. A method of claim 31, comprising obtaining pancreatic
intralobular ductal epithelial cells.
33. A method of claim 31, wherein said pancreatic ductal epithelial
cells are obtained by explant or by enzymatic digestion.
34. A method of claim 31, wherein said pancreatic ductal cells are
grown to confluence.
35. A method of claim 31, wherein said progenitor cells are
isolated by mechanical separation.
36. A method of claim 34, wherein after growing said culture to
confluence non-adherent cells are isolated and further treated with
an agent.
37. A method of claim 36, wherein said agent induces
differentiation and is selected from the group consisting of
Forskolin, Di-butyrl cAMP, Na-Butyrate, dexamethasone and cholera
toxin.
38. A method of claim 36, wherein said agent is a growth
factor.
39. A method of claim 38, wherein said growth factor is selected
from a group consisting of IGF, TGF, FGF, EGF, HGF, hedgehog and
VEGF.
40. A method of claim 38, wherein said growth factor is selected
from a group consisting of the TGF.beta. superfamily, BMP2 and
BMP7.
41. (canceled)
42. A method for stimulating the ex vivo proliferation of mammalian
pancreatic .beta.-islet cells, comprising the steps of: (a)
preparing a primary culture of mammalian pancreatic cells; and, (b)
contacting said primary culture cells with an effective
concentration of a cAMP agonist, wherein the effective
concentration is an amount sufficient to induce the primary culture
to differenitate to .beta.-islet cells.
43. The method of claim 42, wherein the primary culture cells are
human pancreatic cells.
44. The method of claim 41, wherein said cell differentiation
comprises an increase in average cellular insulin production.
45. The method of claim 41, further comprising growing said
cultured cells in monolayer on an extracellular matrix in the
presence of a growth factor.
46. The method of claim 41, further comprising contacting said
cells with an agent that upregulates the insulin gene, e.g., a poly
(ADP-ribose) synthetase inhibitor such as nicotinamide or a
benzamide.
47. A method for stimulating the ex vivo proliferation of human
adult pancreatic beta-cells, comprising the steps of: (a) preparing
a monolayer culture of primary human adult pancreatic cells; and
(b) culturing said cells with an effective concentration of a
growth factor and a cAMP agonist, wherein the effective
concentration is an amount sufficient to induce the primary culture
to produce insulin-producing cells.
48-54. (canceled)
55. A method for preparing a substantially pure non-adherent
population of progenitor cells comprising: obtaining a cell
suspension from an animal tissue, wherein said cell suspension
comprises at least one progenitor cell; treating the cell
suspension with a growth factor preparation; and allowing
proliferation of said at least one progenitor cell such that a
substantially pure non-adherent progenitor cell population is
obtained, thereby obtaining a substantially pure non-adherent
progenitor cell population.
56. The method of claim 55, wherein said non-adherent population of
progenitor cells is at least about 50% pure.
57. The method of claim 55, wherein said non-adherent population of
progenitor cells is at least about 60% pure.
58. The method of claim 55, wherein said non-adherent population of
progenitor cells is at least about 70% pure.
59. The method of claim 55, wherein said non-adherent population of
progenitor cells is at least about 80% pure.
60. The method of claim 55, wherein said non-adherent population of
progenitor cells is at least about 90% pure.
61. The method of claim 55, wherein said animal tissue is obtained
from a mammalian organ.
62. The method of claim 55, wherein said animal tissue is selected
from the group consisting of: pancreatic tissue, liver tissue,
smooth muscle tissue, striated muscle tissue, cardiac muscle
tissue, bone tissue, bone marrow tissue, bone spongy tissue,
cartilage tissue, liver tissue, pancreas tissue, pancreatic ductal
tissue, spleen tissue, thymus tissue, tonsil tissue, Peyer's patch
tissue, lymph nodes tissue, thyroid tissue, epidermis tissue,
dermis tissue, subcutaneous tissue, heart tissue, lung tissue,
vascular tissue, endothelial tissue, blood cells, bladder tissue,
kidney tissue, digestive tract tissue, esophagus tissue, stomach
tissue, small intestine tissue, large intestine tissue, adipose
tissue, uterus tissue, eye tissue, lung tissue, testicular tissue,
ovarian tissue, prostate tissue, connective tissue, endocrine
tissue, mesentery tissue, fetal tissue and umbilical tissue.
63. The method of claim 55, wherein said cell suspension is
obtained by mechanical disruption of said animal tissue.
64. The method of claim 55, wherein said cell suspension is
obtained by enzymatic disruption of said animal tissue.
65. The method of claim 55, wherein said growth factor preparation
comprises at least one of: epidermal growth factor, transforming
growth factor, hepatocyte growth factor, fibroblast growth factor,
leukemia inhibitory factor, insulin-like growth factor and
platelet-derived growth factor.
66. The method of claim 55, wherein said substantially pure
non-adherent progenitor cells are floating cells.
67. The method of claim 55, wherein said substantially pure
non-adherent progenitor cells are non-adherent cells.
68. The method of claim 55, wherein said substantially pure
non-adherent progenitor cells forms a homotypic cell sphere.
69. A method for preparing a substantially pure non-adherent
population of progenitor cells comprising: providing an animal
tissue; disrupting said animal tissue so as to obtain a cell
suspension comprising at least one progenitor cell; and allowing
proliferation of said at least one progenitor cell such that a
substantially pure non-adherent progenitor cell population is
obtained, thereby obtaining a substantially pure non-adherent
progenitor cell population.
70. The method of claim 69, wherein said animal tissue is selected
from the group consisting of: pancreatic tissue, liver tissue,
smooth muscle tissue, striated muscle tissue, cardiac muscle
tissue, bone tissue, bone marrow tissue, bone spongy tissue,
cartilage tissue, liver tissue, pancreas tissue, pancreatic ductal
tissue, spleen tissue, thymus tissue, tonsil tissue, Peyer's patch
tissue, lymph nodes tissue, thyroid tissue, epidermis tissue,
dermis tissue, subcutaneous tissue, heart tissue, lung tissue,
vascular tissue, endothelial tissue, blood cells, bladder tissue,
kidney tissue, digestive tract tissue, esophagus tissue, stomach
tissue, small intestine tissue, large intestine tissue, adipose
tissue, uterus tissue, eye tissue, lung tissue, testicular tissue,
ovarian tissue, prostate tissue, connective tissue, endocrine
tissue, mesentery tissue, fetal tissue and umbilical tissue
71. The method of claim 55, wherein said non-adherent progenitor
cell population expresses Nestin.
72. The method of claim 55, wherein said non-adherent progenitor
cell population expresses at least one: c-kit and Sca.
73. The method of claim 55, wherein said non-adherent progenitor
cell population under proper conditions can give rise to cells that
express a marker selected from the group comprising: Pdx-1,
glucagon, and insulin.
74. A composition comprising the substantially-pure nonadherent
progenitor cell population obtained by the method of claim 55.
75. The composition of claim 74, wherein the substantially-pure
nonadherent progenitor cell population expresses a marker selected
from the group consisting of: Nestin, c-kit and Sca.
76. The composition of claim 74, wherein the substantially-pure
nonadherent progenitor cell population under proper conditions can
give rise to cells that express a marker selected from the group
comprising: Pdx-1, glucagon, and insulin.
77. The method of claim 55, wherein said substantially pure
non-adherent population of progenitor cells is at least about one
thousand-fold enriched from said animal cell suspension.
78. The method of claim 55, wherein said substantially pure
non-adherent population of progenitor cells is at least about one
hundred-fold enriched from said animal cell suspension.
Description
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Utility application
Ser. No. 09/499,362 filed 2 Feb. 2000 and U.S. Provisional
Applications: U.S. Ser. No. 60/119,576 filed 10 Feb. 1999; U.S.
Ser. No. 60/142,305 filed 2 Jul. 1999; and U.S. Ser. No. 60/171,338
filed 21 Dec. 1999. The specifications of which are incorporated by
reference herein.
BACKGROUND OF THE INVENTION
[0002] Pluripotent stem cells have generated tremendous interest in
the biomedical community. With the realization that stem cells can
be isolated from many adult tissues has come the hope that cultures
of relatively pure stem cells can be maintained in vitro for use in
treating a wide range of conditions. Stem cells, with their
capability for self-regeneration in vitro and their ability to
produce differentiated cell types, may be useful for replacing the
function of aging or failing cells in nearly any organ system. By
some estimates, over 100 million Americans suffer from disorders
that might be alleviated by tranplantation technologies that
utilize stem cells (Perry (2000) Science 287:1423). Such illnesses
include, for example, cardiovascular diseases, autoimmune diseases,
diabetes, osteoporosis, cancers and burns.
[0003] Insulin-dependent diabetes (IDDM) is a good example of a
disease that could be cured or ameliorated through the use of stem
cells. Insulin-dependent diabetes mellitus is a disease
characterized by elevated blood glucose and the absence of the
hormone insulin. The cause of the raised sugar levels is
insufficient secretion of the hormone insulin by the pancreas. In
the absence of this hormone, the body's cells are not able to
absorb sugar from the blood stream in normal fashion, and the
excess sugar accumulates in the blood. Chronically elevated blood
glucose damages tissues and organs. IDDM is treated with insulin
injections. The size and timing of insulin injections are
influenced by measurements of blood sugar.
[0004] There are over 400 million diabetics in the world today. For
instance, diabetes is one of the most prevalent chronic diseases in
the United States, and a leading cause of death. Estimates based on
the 1993 National Health Interview Survey (NHIS) indicate that
diabetes has been diagnosed in 1% of the U.S. population age <45
years, 6.2% of those age 45-64 years, and 10.4% of those age >65
years. In other terms, in 1993 an estimated 7.8 million persons in
the United States were reported to have this chronic condition. In
addition, based on the annual incidence rates for diabetes, it is
estimated that about 625,000 new cases of diabetes are diagnosed
each year, including 595,000 cases of non-insulin-dependent
diabetes mellitus (NIDDM) and 30,000 cases of insulin-dependent
diabetes mellitus (IDDM). Persons with diabetes are at risk for
major complications, including diabetic ketoacidosis, end-stage
renal disease, diabetic retinopathy and amputation. There are also
a host of less directly related conditions, such as hypertension,
heart disease, peripheral vascular disease and infections, for
which persons with diabetes are at substantially increased
risk.
[0005] While medications such as injectable insulin and oral
hypoglycemics allow diabetics to live longer, diabetes remains the
third major killer, after heart disease and cancer. Diabetes is
also a very disabling disease, because medications do not control
blood sugar levels well enough to prevent swinging between high and
low blood sugar levels, with resulting damage to the kidneys, eyes,
and blood vessels.
[0006] Replenishment of functional glucose-sensing,
insulin-secreting pancreatic beta cells through islet
transplantation has been a longstanding therapeutic target. The
limiting factor in this approach is the availability of an islet
source that is safe, reproducible, and abundant. Current
methodologies use either cadaverous material or porcine islets as
transplant substrates (Korbutt et al., 1997). However, significant
problems to overcome are the low availability of donor tissue, the
variability and low yield of islets obtained via dissociation, and
the enzymatic and physical damage that may occur as a result of the
isolation process (reviewed by Secchi et al., 1997; Sutherland et
al., 1998). In addition are issues of immune rejection and current
concerns with xenotransplantation using porcine islets (reviewed by
Weir & Bonner-Weir, 1997).
[0007] As a further example, stem cells capable of generating blood
cells would also be of tremendous value for treatment of several
diseases. A number of diseases or conditions result frown
inappropriate levels or inadequate function of blood platelets. For
example, "thrombocytopenias" are the result of an abnormally small
number of platelets in the circulating blood. Thombocytopenia can
be due to antibody mediated platelet destruction, massive blood
transfusions, cardio-pulmonary by-pass or bone marrow failure from
malignant infiltration, aplastic anemia or chemotherapy.
"Thrombocythemic" disorders, on the other hand, are the result of a
high platelet count. Finally, "thrombocytopathic" blood disorders
are characterized by abnormally low or high platelet function,
although platelet counts may be normal. Blood platelets are
required for the maintenance of normal hemostasis. Platelets
initiate blood clot formation and release growth factors that speed
the process of wound healing as well as potentially serving other
functions. Blood platelets are circulating cells that are crucial
for the prevention of bleeding and for blood coagulation.
Megakaryocytes are the cellular source of platelets and arise from
a common bone marrow precursor cell which gives rise to all
hematopoietic cell lineages. Stem cells could be used to generate
cells in vitro or could be implanted to provide a stable source of
cells capable of producing platelets.
[0008] In addition, extensive radiation therapy is used to treat
many cancers. The radiation is lethal to the patient's endogenous
bone marrow stem cells. Currently, these are replaced by
transplantation in a procedure fraught with complications. An
abundant supply of hematopoietic stem cells could be used for
repeated treatments to replenish the depleted endogenous cells.
[0009] Many neural disorders are marked by death of nerve cells.
Adult nerve cells regenerate poorly and nerve death often causes
irreparable damage to congnitive and sensorimotor functions. There
has been some success in treating disorders caused by nerve death
with transplants of fetal nerve tissue. Fetal tissue has a greater
ability to take up residence in the adult brain and differentiate
into the appropriate cell type. However, obtaining sufficient fetal
tissue is difficult and presents many ethical problems. Neural stem
cells are capable of differentiating into many cell types of the
nervous system. Remarkably, some neural stem cells are capable of
migrating through the brain and settling in regions of nerve cell
death. Such cells may then generate new neural processes to
integrate with the endogenous neural network. It is expected that
neural stem cells can be used to treat disorders such as
Alzheimer's disease, Parkinson's disease, stroke, ischemia, trauma,
spinal cord injuries, damage from infectious disease etc.
[0010] It is an object of the present invention to provide simple
methods for the isolation and propagation of stem cells from
virtually any tissue type. Such stem cells can then be used, for
example, for direct transplantation or to produce differentiated
cells in vitro for transplantation or. The invention accordingly
provides, for example, pancreatic and hepatic stem cells that may
serve as a source for many other, more differentiated cell types
such as pancreatic beta cells. Advantages lie in obviating the need
for physical dissociation of tissue in order to obtain
differentiated cells for various uses, and the potential for
greater reproducibility and control of the process. With respect to
pancreratic cells, successful achievement requires the
differentiation and maturation of glucose-sensing,
insulin-secreting beta cells from an expandable precursor
population.
SUMMARY OF THE INVENTION
[0011] The present invention relates to materials and methods for
obtaining substantially pure populations of animal stem or
progenitor cells. The invention further provides animal stem or
progenitor cell populations and cell derivatives thereof, as well
as method of using these cell populations.
[0012] In a preferred embodiment the invention provides a method
for preparing a substantially pure non-adherent population of
progenitor cells which is at least about 50%, but more preferably
about 60%, 70%, 80% or most preferably about 90% pure. In certain
embodiments, the population of progenitor cells is obtained from an
animal tissue, preferably a mammalian organ or other mammalian
tissue, which is disrupted by mechanical or enzymatic means so as
to yield a cell population which includes at least one progenitor
cell. The animal tissue may be any adult or embryonic tissue
including, but not exclusive to: pancreatic tissue, liver tissue,
smooth muscle tissue, striated muscle tissue, cardiac muscle
tissue, bone tissue, bone marrow tissue, bone spongy tissue,
cartilage tissue, liver tissue, pancreas tissue, pancreatic ductal
tissue, spleen tissue, thymus tissue, tonsil tissue, Peyer's patch
tissue, lymph nodes tissue, thyroid tissue, epidermis tissue,
dermis tissue, subcutaneous tissue, heart tissue, lung tissue,
vascular tissue, endothelial tissue, blood cells, bladder tissue,
kidney tissue, digestive tract tissue, esophagus tissue, stomach
tissue, small intestine tissue, large intestine tissue, adipose
tissue, uterus tissue, eye tissue, lung tissue, testicular tissue,
ovarian tissue, prostate tissue, connective tissue, endocrine
tissue, mesentery tissue, fetal tissue and umbilical tissue. In
certain embodiments, the tissue is a non-neuronal animal tissue
which does not include brain or central nervous system tissue.
Preferably the enrichment of stem/progenitor cells from the
original cell suspension obtained from the tissue is at least about
100-fold, but more preferably is at least about 1000-fold.
[0013] In certain preferred embodiments, the cell suspension
derived from this animal tissue is then treated with a growth
factor preparation which may include any of a number of different
growth factors including epidermal growth factor, transforming
growth factor, hepatocyte growth factor, fibroblast growth factor,
leukemia inhibitory factor, insulin-like growth factor and
platelet-derived growth factor.
[0014] The progenitor cell population within the animal cell
suspension is then allowed to proliferate in the presence of the
growth factor population and takes on a non-adherent, floating
characteristic. In certain instances, the progenitor cell
population form homotypic cell spheres. The phenotypic
characteristics of the progenitor cell population provide both an
indication that the cell suspension has become enriched in the
stem/progenitor cell population as well as providing certain
physical features which may be used to enrich for the
stem/progenitor cells.
[0015] The invention further provides certain markers, including
c-kit, Sca and Nestin, for identifying and/or enriching the
population of stem/progenitor cells. The invention still further
provides for derivatives of these stem/progenitor populations which
can be obtained under proper conditions. The stem/progenitor cell
derivatives may express a marker such as Pdx-1, glucagon, or
insulin.
[0016] The present invention further relates to substantially pure
preparations of viable pancreatic progenitor cells, and methods for
isolating such cells from essentially any tissue, notably liver,
muscle and pancreatic tissue. The present invention further
concerns certain uses for such progenitor cells, and their
progeny.
[0017] In general, the invention features a cellular composition
including, as the cellular component, a substantially pure
population of viable pancreatic progenitor cells which progenitor
cells are capable of proliferation in a culture medium. In a
preferred embodiment, the cellular composition has fewer than about
20%, more preferably fewer than about 10%, most preferably fewer
than about 5% of lineage committed cells.
[0018] In one embodiment, the progenitor cells of the present
invention are characterized by an ability for self-regeneration in
a culture medium and differentiation to pancreatic lineages. In a
preferred embodiment, the progenitor cells are inducible to
differentiate into pancreatic islet cells, e.g., .beta. islet
cells, .alpha. islet cells, .delta. islet cells, or .phi. islet
cells. Such pancreatic progenitor cells may be characterized in
certain circumstances by the expression of one or more of:
homeodomain type transcription factors such as STF-1; PAX gene(s)
such as PAX6; PTF-1; hXBP-1; HNF genes(s); villin; tyrosine
hydroxylase; insulin; glucagon; and/or neuropeptide Y. The
pancreatic progenitor cells of the present invention may also be
characterized by binding to lectin(s), and preferably to a plant
lectin, and more preferably to peanut agglutinin. In certain
preferred embodiments, the progenitor cells are PDX1+, e.g., by
FACS sorting, and capable of differentiation into
glucose-responsive insulin secreting cells. In certain preferred
embodiments, the progenitor cells are PDX1+ and Glut2+. In certain
preferred embodiments, the progenitor cells are PDX1.sup.+,
Glut2.sup.+ and stain with PNA.
[0019] In certain preferred embodiments, the subject pancreatic
progenitor cells will have one or more of the following
characteristics: (i) able to grow in 2-5 percent fetal calf serum;
(ii) able to grow on plastic, e.g., no need to use matrigel; (iii)
no statistically significant induction of cells to proliferate or
differentiate when treated with TGF.beta.5 (GenBank accession
P16176) at concenrates up to 30 pg/ml.
[0020] In yet another embodiment, the invention features a
pharmaceutical composition including as the cellular component, a
substantially pure population of viable pancreatic progenitor
cells, which progenitor cells are capable of proliferation in a
culture medium.
[0021] In general, the preferred progenitor cells will be of
mammalian origin, e.g., cells isolated from a primate such as a
human, from a miniature swine, or from a transgenic mammal, or are
the cell culture progeny of such cells. In one embodiment,
pancreatic ductual tissue is isolated from a patient and subjected
to the present method in order to provide a resulting culture of
pancreatic progenitor cells (or differentiated cells derived
therefrom). Gene replacement or other gene therapy is carried out
ex vivo, and the isolated cells are transplanted back into the
initial donor patient or into a second host patient.
[0022] In another aspect, the invention features a cellular
composition comprising, as a cellular population, at least 75%
(though more preferably at least 80, 90 or 95%) progenitor cells
and capable of self-regeneration in a culture medium.
[0023] In yet another aspect, the invention features a cellular
composition consisting essentially of, as the cellular population,
viable pancreatic progenitor cells capable of self-regeneration in
a culture medium and differentiation to pancreatic lineages. For
instance, in certain embodiments the progenitor cells are isolated
from pancreatic intralobular duct explants, e.g. isolated by
biopsy, or are the cell culture progeny of such cells.
[0024] One aspect of the invention features a method for isolating
pancreatic progenitor cells from a sample of pancreatic duct. In
general, the method provides for a culture system that allows
reproducible expansion of pancreatic ductual epithelium while
maintaining "stemmedness" and the ability to differentiate into
endocrine and exocrine cells. As illustrated below, in a preferred
embodiment, pancreatic ductal epithelium is obtained, e.g., by
explant or enzymatic digestion, and cultured to confluence. The
confluent cell population is contacted with an agent, e.g., a
trophic agent such as a growth factor, which causes differentiation
of progenitor cells in the cultured population. Subsequently,
progenitor cells from the explant that proliferate in response to
the agent are isolated, such as by direct mechanical separation of
newly emerging buds from the rest of the explant or by dissolution
of all or a portion of the explant and subsequent isolation of the
progenitor cell population.
[0025] In certain embodiments, the culture is contacted with a cAMP
elevating agents, such as
8-(4-chlorophenylthio)-adenosine-3':5'-cyclic-m- onophosphate
(CPT-cAMP) (see, for example, Koike Prog. Neuro-Psychopharmacol.
and Biol. Psychiat. 16 95-106 (1992)), CPT-cAMP, forskolin,
Na-Butyrate, isobutyl methylxanthine (IBMX) and cholera toxin (see
Martin et al. J. Neurobiol. 23 1205-1220 (1992)) and 8-bromo-cAMP,
dibutyryl-cAMP and dioctanoyl-cAMP (e.g., see Rydel et al. PNAS
85:1257 (1988)).
[0026] In certain embodiments, the culture is contacted with a
growth factor, e.g., a mitogenic growth factor, e.g., the growth
factor is selected from a group consisting of IGF, TGF, FGF, EGF,
HGF, hedgehog or VEGF. In other embodiments, the growth factor is a
member of the TGF.beta. superfamily, preferably of the DVR (dpp and
vg1 related) family, e.g., BMP2 and/or BMP7.
[0027] In certain embodiments, the culture is contacted with a
steroid or corticosteroid such as, for example, hydrocortisone,
deoxyhydrocortisone, fludrocortisone, prednisolone,
methylprednisolone, prednisone, triamcinolone, dexamethasone,
betamethasone and paramethasone. See, generally, The Merck Manual
of Diagnosis and Therapy, 15th Ed., pp. 1239-1267 and 2497-2506,
Berkow et al., eds., Rahay, N.J., 1987).
[0028] In a preferred embodiment, the cultures are contacted with a
cAMP elevating agent, a growth factor and a steroid or
corticosteroid, e.g., with the DCE cocktail described herein.
[0029] In another aspect, the invention features, a method for
screening a compound for ability to modulate one of growth,
proliferation, and/or differentiation of progenitor cells obtained
by the subject method, including: (i) establishing an isolated
population of pancreatic progenitor cells; (ii) contacting the
population of cells with a test compound; and (iii) detecting one
of growth, proliferation, and/or differentiation of the progenitor
cells in the population, wherein a statistically significant change
in the extent of one of growth, proliferation, and/or
differentiation in the presence of the test compound relative to
the extent of one of growth, proliferation, and/or differentiation
in the absence of the test compound indicates the ability of the
test compound to modulate one of the growth, proliferation, and/or
differentiation.
[0030] In another aspect, the invention features, a method for
treating a disorder characterized by insufficient insulin activity,
in a subject, including introducing into the subject a
pharmaceutical composition including pancreatic progenitor cells
derived by the subject method, or differentiated cells arising
therefrom, and a pharmaceutically acceptable carrier. In preferred
embodiments, the progenitor cells are derived from a donor source
(which may also be the transplant patient), and expanded at least
order of magnitude prior to implantation. As shown in FIG. 40, the
subject cellular compositions can be used to rescue diabetic
mice.
[0031] In a preferred embodiment the subject is a mammal, e.g., a
primate, e.g, a human.
[0032] In another preferred embodiment the disorder is an insulin
dependent diabetes, e.g, type I diabetes.
[0033] In yet another embodiment, the pancreatic progenitor cells
are induced to differentiate into pancreatic islet cells, e.g.,
.beta. islet cells, .alpha. islet cells, .delta. islet cells, or
.phi. islet cells, subsequent to being introduced into the
subject.
[0034] In other embodiments, the pancreatic progenitors cells are
induced to differentiate into pancreatic islet, e.g., .beta. islet
cells, .alpha. islet cells, .delta. islet cells, or .phi. islet
cells, in culture prior to introduction into the subject.
[0035] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of cell biology, cell
culture, molecular biology, transgenic biology, microbiology,
recombinant DNA, and immunology, which are within the skill of the
art. Such techniques are described in the literature. See, for
example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by
Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory
Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed.,
1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et
al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D.
Hames & S. J. Higgins eds. 1984); Transcription And Translation
(B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal
Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells
And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To
Molecular Cloning (1984); the treatise, Methods In Enzymology
(Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian
Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor
Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al.
eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer
and Walker, eds., Academic Press, London, 1987); Handbook Of
Experimental Immunology, Volumes I-IV (D. M. Weir and C. C.
Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
[0036] Other features and advantages of the invention will be
apparent from the following detailed description, and from the
claims.
DETAILED DESCRITPTION OF THE DRAWINGS
[0037] FIG. 1. Isolation of pancreatic ducts. The cartoon
illustrates the process by which the ducts under study were
obtained. Pancreatic tissue from 2-3 week old rats was dissociated
in collagenase solution and ductal material was obtained by
handpicking. Clean ducts were placed in culture on plastic. Within
3-5 days a monolayer was obtained, from which NACs were produced
upon exposure to an inductive medium. Shown below the cartoon is a
series of photographs showing the various stages of duct isolation
and purity. The first panel shows the primary digest, and the
second panel shows the result of the first round of handpicking.
Note that there is still some contaminating exocrine tissue. After
the second round of selection, the ducts are free of both islet and
exocrine tissue.
[0038] FIG. 2. Culture and insulin staining of pancreatic ducts.
Depicted is a time series of single ducts in culture from time zero
plating (T0) to day five (T5) in culture. The upper panel shows
examples of Cy3-labelled immunocytochemical staining for insulin,
and the lower panel shows the combined brightfield and fluorescence
images. At T0 there are no insulin-expressing cells. Within 24
hours of culture, the duct begins to distend and disintegrate, with
cells moving toward the periphery. Proliferating cells are present
primarily in the outgrowing monolayer of mesenchymal cells,
although ductal epithelial cells do also incorporate BrdU (not
shown). Insulin-positive cells emerged spontaneously from the duct
over time in culture, but their overall replication rate is slow
(not shown). By T5 some monolayers contained sizable clusters of
insulin-positive cells; typically these contained 20 cells or
less.
[0039] FIG. 3. The duct monolayer expresses multiple progenitor
cell markers. Monolayers were stained for both insulin (A) and
amylase (B). Panel C is a composite showing that some cells express
both insulin and amylase. Two morphologically distinct cell types
are present, those that are adherent and flat, and cells that are
semi-adherent and round. Arrowheads denote* rounded semi-adherent
cells that may coexpress both insulin and amylase. Panels D and E
show staining for glucagon and PYY, respectively, and Panel F is a
composite showing that one of the glucagon-bright cells also
expresses PYY. Panel G shows a composite of nuclear PDX-1 (Cy3) and
cytoplasmic insulin (FITC) staining. Arrowheads indicate cells that
express PDX-1 but not insulin or vice versa.
[0040] FIG. 4. Factor addition influences the appearance of the
nonadherent cell (NAC) type. Hoffman modulation contrast
photographs were taken of cultures treated with various factors.
Cultures were grown in 5% FBS for five days until a confluent
monolayer was obtained; factors were then added for an additional
48 hours and the cultures were photographed. NACs were observed in
all conditions. Panel A shows the control culture grown in FBS;
panel B, culture treated with DCE (1 .mu.M Dexamethasone, 100 ng/ml
Cholera toxin, 10 ng/ml EGF); Panel C, HGF (10 ng/ml), and Panel D,
TGF.beta.1 (10 ng/ml). Arrow 1 in Panel A indicates the adherent
and confluent monolayer and the Arrow 2 points to a pair of rounded
loosely or non-adherent cells. The HGF and TGF.beta.1 treated
cultures also contained semi- and non-adherent cells. However, the
pharmacological cocktail DCE induced, on average, at least 8-fold
more NACs than all other conditions tried. BrdU pulsing experiments
showed strong proliferation and a confluent monolayer even after 48
hours of DCE exposure, indicating perhaps asymmetric division as
opposed to simple loss of cell adherence. The inset in Panel B
illustrates the morphology and granularity of NACs.
[0041] FIG. 5. Multiple hormone-containing cell types are detected
in the NAC population. NACs were collected from DCE-stimulated
monolayer cultures and analyzed immunocytochemically for endocrine
marker expression. Cells expressing insulin (A, C), PDX-1 (D),
glucagon (E), somatostatin (F), and pancreatic polypeptide (G) were
all present in the NAC population. Markers were visualized with
FITC or Cy3 immunofluorescence and the nuclei counterstained with
DAPI (C-G). Panel A shows a 10.times. objective field magnification
of insulin staining. Heterogeneous signal strength was observed;
shown here are one brightly stained cell and many dimly stained
cells along with negative cells. Panel B shows staining with normal
preimmune serum. Note that the dim cells in A are significantly
above background, yet contain much less insulin than the bright
cell observed. Panel C shows higher magnification (20.times.
objective) of another insulin staining (Cy3) showing dim and
negative cells. In this field and others approximately 40-50% of
the cells test insulin-positive. Panels D, E, F, and G show PDX-1,
glucagon, somatostatin and pancreatic polypeptide staining,
respectively (60.times. objective). Arrows indicate DAPI-stained,
hormone-negative cells.
[0042] FIG. 6. Single cell PCR(SC-PCR) analysis of PDX-1, insulin
and glucagon expression in NACs. Forty cells were selected from a
random population of NACs and processed for cDNA as described in
the Methods section. These cDNAs were then analyzed for insulin
(B), glucagon (C), and PDX-1 (D) message. Panel A shows the
ethidium bromide staining of the cDNA on a 1.2% agarose gel. The
bulk of cDNA product fell within the targeted 500-1000 bp range.
Panel B shows that there is variation in the amount of insulin
message per cell, with some cells giving much stronger signal than
others. 15/40 (37%) of the cells tested positive for insulin mRNA.
Of these, one was also positive for glucagon, and both messages
were relatively weak compared to the other cells that expressed
insulin only. Panel C shows that 2/40 (5%) of the cells contained
glucagon message, a result that correlates well with the
immunocytochemistry data. Panel D shows that many of the picked
cells contained PDX-1 mRNA. Note that a significant fraction of
cells express PDX-1 mRNA only, with no insulin or glucagon.
[0043] FIG. 7. Insulin content and glucose response of cultured
ducts. Freshly isolated ducts (T=0), ducts cultured for one week
(T=7), and NACs harvested from the DCE-induced duct culture were
all tested for glucose-stimulated insulin secretion (GSIS) and also
extracted for total insulin content. The time zero ducts contained
no detectable insulin by RIA. In contrast, the cultured ducts did
have a discernible increase in insulin content, but no glucose
response. In this representative experiment, the isolated NACs
showed an insulin content that was 18-fold greater than the
DCE-treated monolayer when normalized to a per cell level. In
addition, the NACs demonstrated a strong 3-fold GSIS response, well
within the 3-5 fold physiological range observed with adult islets.
ML=monolayer, n.d.=not detectable.
[0044] FIG. 8. Glucose-induced calcium currents in NACs. Glucose
induces an inward calcium current in the NAC population. Changes in
intracellular calcium at the single cell level were monitored using
Fluo-3 and confcal microscopy. A, In this representative experiment
(n>10) approximately one-third of the population initiated a
robust calcium influx in response to glucose administration, and
58% of the cells showed no response to glucose. In every
experiment, approximately 6-10% of the cells begin with a high
intracellular calcium content that decreases with time; these were
judged to be dying cells. 80 cells were analyzed in this
experiment. B, The reversibility of the induced calcium current is
demonstrated. In this representative experiment (n>6), the
glucose-stimulated calcium current could be washed out with Krebs
Ringer Phosphate (KRP) solution. A second calcium current could
then be stimulated by readministration of 17 mM glucose. Washout of
the glucose followed by tolbutamide stimulation, a SUR-linked
potassium channel blocker, also stimulated a calcium current, as
expected. Arrows indicate times of administration. A total of 123
cells were analyzed in this experiment. 7-13% of the cells gave
rise to calcium currents in response to the stimulus (shown in red)
whereas 45-65% of the cells showed no response to any of the
stimuli (shown in blue). The remaining 35% of cells exhibited
varying amplitudes and kinetics in response to challenge,
indicating a complex population.
[0045] FIG. 9. Graph showing induction of differentiation by
DCE
[0046] FIG. 10. Graph showing effect of Forskolin, Dibutyrl cAMP
and Na-Butyrate on induction of differentiation.
[0047] FIGS. 11 and 12. Graphs illustrating the effect of secretin
on induction of floating progenitor cells.
[0048] FIG. 13. Graph demonstrates that Vasoactive Intestinal
Peptide (VIP) also differentiates duct monolayers by inducing the
appearance of floating progenitor cells.
[0049] FIG. 14. Graph showing that insulin diminishes
secretin-induced differentiation.
[0050] FIGS. 15-17. Micrographs that illustate the phenotype of
cells which have been cultured for two weeks after being sorted on
the basis of PNA staining.
[0051] FIGS. 18 and 19. Micrographs that illustrate the specificity
of PNA in adult and embryonic pancreas.
[0052] FIG. 20. Electrophoretic gel showing the results of typical
single cell mRNA PCR amplification reactions.
[0053] FIG. 21. Table illustrating the changes in the gene
expression during pancreatic development.
[0054] FIG. 22. Chart illustrating one embodiment of an array of
markers for detecting beta cells and precursors thereof.
[0055] FIG. 23. Autoradiographs profiling gene expression in adult
and embryonic pancreatic tissue, and heart.
[0056] FIG. 24. Graph demonstating how quantatitve analysis of gene
expression can be carried out as part of a determination of the
gene expression profile of a cell.
[0057] FIG. 25. Autoradiographs profiling gene expression in
embryonic pancreatic tissue at different stages and after different
stimulus
[0058] FIG. 26. Graphs illustating the quantatitve analysis of the
autoradiagraphs.
[0059] FIG. 27. Autoradiographs profiling gene expression in the
so-called floating progenitor cells.
[0060] FIG. 28. Graph illustating the quantatitve analysis of the
autoradiagraphs of FIG. 27.
[0061] FIG. 29. Table showing the relative levels of expression of
certain genes between adult islets and during pancreatis
development.
[0062] FIGS. 30-31. Micrographs that illustrate the binding of
certain lectins to adult rat pancreas.
[0063] FIGS. 32-39. Micrographs that illustrate the binding of
certain lectins to adult human pancreas.
[0064] FIG. 40. Implanted cells from a pancreatic duct-derived
culture transiently rescues the diabetic state. A heterogeneous
population containing functional beta cells derived from the
non-adherent portion of a differentiated pancreatic duct monolayer
was implanted into streptozotocin (STZ)-treated diabetic mice. SCID
mice injected with STZ became diabetic within 48 hours. Insulin
containing pellets were then implanted subcutaneously to stabilize
the blood glucose and create a more stable environment for cell
implantation. The insulin pellet was designed to expire 7 days
post-implantation at T=11 days (TI 1). Within 48 hours of pellet
implant the fasting blood glucose of these animals were reduced
from a range of 280-380 mg/dl blood glucose to less than 50 mg/dl.
In test groups either cells or adult islets as positive control
were then implanted under the renal capsule. One week later (T13)
fasting blood glucose was measured and again at days 16, 21, and
28. Black squares represent placebo group (n=5 mice) and as
expected, in the absence of insulin, the blood glucose slowly
climbed over time to well over 300 mg/dl. Animals (n=5) implanted
with insulin pellets only and no cell implants also performed as
expected, with a transient rescue followed by diabetic rebound
after the insulin release tablet had expired (red diamonds).
Animals receiving islets (blue triangles, n=5, 400 islets per
animal) showed perfect long term rescue with fasting blood glucose
being maintained at approximately 100 mg/dl. The single surviving
animal receiving duct-derived cells (green circles, n=1 of 7)
showed a transient rescue of the diabetic state. The single animal
demonstrated a 4-5 day lowering of >150 mg/dl blood glucose
before rebounding to pre-implant blood glucose levels.
DETAILED DESCRIPTION OF THE INVENTION
[0065] (i) Overview
[0066] In certain aspects of the present invention relate to
isolated populations of progenitor cells capable of subsequent
differentiation to distinct lineages, methods for isolating such
cells and therapeutic uses for such cells. Stem cells are thought
to exist in most adult and fetal tissues, but the stem cells are
rare and difficult to enrich for. The invention is based in part on
the surprising discovery that stem cells from many different tissue
types all appear to share the common ability to proliferate in the
absence of any attachment (direct or indirect) to a substrate. This
property can be used for enrichment of stem cells. Most cell types
require a substrate for survival and/or growth. As a result, a
suspension of mixed cells obtained from a tissue can be cultured in
the absence of an adherent surface with the result that stem cells
proliferate to form "sphere" in suspension, while other cells die
or at least fail to grow. Continued selective growth of the stem
cells results in a substantial enrichment.
[0067] In one aspect, the invention in part provides novel methods
for obtaining stem cells by utilizing their ability to proliferate
in the absence of an adherent surface. In another aspect, the
invention provides another novel method of isolating pancreatic
progenitor cells using a monolayer system that can give rise to
non-adherent cells. Stem cells obtained by the various methods of
the invention may be used for many purposes.
[0068] The existence within the adult pancreas of a progenitor cell
that is capable of giving rise to the endocrine islet was proposed
long ago (e.g., Bensley, 1911). A number of regeneration models
provide early in vivo evidence for islet neogenesis in the adult
organ (Shaw and Latimer, 1925, Waren and Root 1925). Histological
studies indicated a physical attachment between what was assumed to
be newly forming islets and the ductal network. From these and more
recent work (Bonner-Weir et al. 1993; Gu et al. 1994; Fernandes et
al. 1997) developed the now widely held belief that islet
progenitor cells derive from a subpopulation of the pancreatic duct
epithelium.
[0069] The ductal network is one of three functional components of
the adult pancreas (the other two being the exocrine acini and the
endocrine islets), and is responsible for fluid secretion and
delivery of digestive enzymes into the small intestine. Estimates
of pancreatic ductal mass in the rat average 11%. The exocrine
acini, which produce the digestive enzymes, make up by far the
greatest portion of the adult pancreas, accounting for
approximately 77-89% of overall tissue mass. The islets contain the
insulin-secreting beta cells and are responsible for hormonal
regulation of glucose metabolism; they comprise less than 5% of
total organ mass (reviewed by Githens, 1988).
[0070] Pancreatic regeneration models such as 90% pancreatectomy
(Bonner-Weir et al. 1993, Lampeter et al, 1995), duct ligation
(Wang et al. 1995, Rosenberg 1995), and transgenic mice (Gu and
Sarvetnick, 1993), all provide further in vivo evidence that islet
tissue arises de novo from duct-associated pancreatic progenitor
cells. A common observation in each of these injury models is the
rapid appearance of endocrine cells in the proliferating ductal
epithelium after experimental insult, and the subsequent appearance
over the course of weeks of presumably newly formed islets in the
periductular space. In addition, cells that appear to express both
insulin and amylase, which mark endocrine and exocrine cells,
respectively, have been observed during the regenerative process
and it is thought that these cells might represent activated
progenitor cells (Melmed, 1979; Cossel, 1984; Gu et al. 1994). The
exact origin of these activated cells, whether ductal, acinar, or
otherwise, and the mechanism of their activation, from progenitor
cells or through selective dedifferentiation, remains to be
determined. Despite these uncertainties, these studies underscore
the potential islet neogenic capacity of the mature pancreas.
[0071] It has been proposed that during pancreatic development,
early expression of PDX-1, a transcription factor that regulates
expression of insulin and other beta cell components marks
progenitor cells capable of giving rise to both the exocrine and
endocrine compartments ((Ohlsson et al. 1993; Offield et al. 1996;
Ahlgren et al. 1996, and reviewed by Madsen et al. 1996 and Edlund,
1998). Developmental mechanisms may also play a role in adult beta
cell neogenesis. Indeed, Ferandes et al. (1997) describe the
appearance of PDX-1 expressing cells in adult pancreatic ducts
after streptozotocin insult. Another embryonic product is the
hormone PYY, whose expression is also postulated to mark committed
endocrine progenitor cells (Upchurch et al. 1994). Both of these
cell types are found in islets as well as early in pancreatic
development, and it is not yet clear if they contribute directly to
islet formation. However they provide early markers against which
regenerative systems can be analyzed.
[0072] (ii) Definitions
[0073] For convenience, certain terms employed in the
specification, examples, and appended claims are collected
here.
[0074] As used herein the term "animal" refers to mammals,
preferably mammals such as humans. Likewise, a "patient" or
"subject" to be treated by the method of the invention can mean
either a human or non-human animal.
[0075] As used herein, the term "cellular composition" refers to a
preparation of cells, which preparation may include, in addition to
the cells, non-cellular components such as cell culture media, e.g.
proteins, amino acids, nucleic acids, nucleotides, co-enzyme,
anti-oxidants, metals and the like. Furthermore, the cellular
composition can have components which do not affect the growth or
viability of the cellular component, but which are used to provide
the cells in a particular format, e.g., as polymeric matrix for
encapsulation or a pharmaceutical preparation.
[0076] The term "culture medium" is recognized in the art, and
refers generally to any substance or preparation used for the
cultivation of living cells. Accordingly, a "tissue culture" refers
to the maintenance or growth of tissue, e.g., explants of organ
primordia or of an adult organ in vitro so as to preserve its
architecture and function. A "cell culture" refers to a growth of
cells in vitro; although the cells proliferate they do not organize
into tissue per se.
[0077] Tissue and cell culture preparations of the subject
micro-organ explants and amplified progenitor cell populations can
take on a variey of formats. For instance, a "suspension culture"
refers to a culture in which cells multiply while suspended in a
suitable medium. Likewise, a "continuous flow culture" refers to
the cultivation of cells or explants in a continuous flow of fresh
medium to maintain cell growth, e.g. viablity. The term
"conditioned media" refers to the supernatant, e.g. free of the
cultured cells/tissue, resulting after a period of time in contact
with the cultured cells such that the media has been altered to
include certain paracrine and/or autocrine factors produced by the
cells and secreted into the culture.
[0078] "Differentiation" in the present context means the formation
of cells expressing markers known to be associated with cells that
are more specialized and closer to becoming terminally
differentiated cells incapable of further division or
differentiation. For example, in a pancreatic context,
differentiation can be seen in the production of islet-like cell
clusters containing an increased proportion of beta-epithelial
cells that produce increased amounts of insulin.
[0079] The term "ED.sub.50" means the dose of a drug which produces
50% of its maximum response or effect.
[0080] An "effective amount" of, e.g., a cAMP regulator, with
respect to the subject method, refers to an amount of a cAMP
elevating agent which, when added to pancreatic cells cultures,
brings about a change in the rate of cell proliferation and/or the
state of differentiation of a cell.
[0081] The term "explant" refers to a portion of an organ taken
from the body and grown in an artificial medium.
[0082] By "ex vivo" is meant cells that have been taken from a
body, temporarily cultured in vitro, and returned to a body.
[0083] "Hematopoietic stem cells" (HSCs) as used herein are stem
cells that can give rise to cells of at least one of the major
hematopoietic lineages in addition to producing daughter cells of
equivalent potential. Three major lineages of blood cells include
the lymphoid lineage, eg. B-cells and T-cells, the myeloid lineage,
eg. monocytes, granulocytes and megakaryocytes, and the erythroid
lineage, eg. red blood cells. Certain HSCs are capable of giving
rise to many other cell types including brain cells. "Multipotent"
or "pluripotent" HSCs are HSCs that can give rise to at least three
of the major hematopoietic lineages.
[0084] The term "lineage committed cell" refers to a progenitor
cell that has been induced to differentiate into a specific cell
type, e.g., a pancreatic, cell.
[0085] The term "liver" refers to the large, dark-red gland in the
upper part of the abdomen on the right side, just beneath the
diaphragm. Its manifold functions include storage and filtration of
blood, conversion of sugars into glycogen, and many other metabolic
activities. It also supplies bile to intestine. In adult
vertebrates, this function is a minor one, but the liver originally
arose as a digestive gland in lower chordates. Throughout the
liver, a network of tiny tubules collects bile--a solution of
salts, bilirubin (made when hemoglobin from red blood cells is
broken down in liver), and fatty acids. Bile accumulates in the
gall bladder, which empties into the small intestine by way of a
duct. Bile has two functions in the intestine. First, it acts as a
detergent, breaking fat into small globules that can be attacked by
digestive enzymes. Second, and more important, bile salts aid in
the absorption of lipids form the intestine; removal of the gall
bladder sometimes causes difficulty with lipid absorption.
[0086] The term "organ" refers to two or more adjacent layers of
tissue, which layers of tissue maintain some form of cell-cell
and/or cell-matrix interaction to form a microarchitecture.
[0087] The term "primary culture" denotes a mixed cell population
of cells that permits interaction of many different cell types
isolated from a tissue. The word "primary" takes its usual meaning
in the art of tissue culture. For example, a primary culture of
pancreatic duct cells may allow the interaction between mesenchymal
and epithelial cells.
[0088] The term "progenitor cell" is used synonymously with "stem
cell". Both terms refer to an undifferentiated cell which is
capable of proliferation and giving rise to more progenitor cells
having the ability to generate a large number of mother cells that
can in turn give rise to differentiated, or differentiable daughter
cells. In a preferred embodiment, the term progenitor or stem cell
refers to a generalized mother cell whose descendants (progeny)
specialize, often in different directions, by differentiation,
e.g., by acquiring completely individual characters, as occurs in
progressive diversification of embryonic cells and tissues.
Cellular differentiation is a complex process typically occurring
through many cell divisions. A differentiated cell may derive from
a multipotent cell which itself is derived from a multipotent cell,
and so on. While each of these multipotent cells may be considered
stem cells, the range of cell types each can give rise to may vary
considerably. Some differentiated cells also have the capacity to
give rise to cells of greater developmental potential. Such
capacity may be natural or may be induced artificially upon
treatment with various factors.
[0089] "Proliferation" indicates an increase in cell number.
[0090] The term "tissue" refers to a group or layer of similarly
specialized cells which together perform certain special
functions.
[0091] The term "pancreas" is art recognized, and refers generally
to a large, elongated, racemose gland situated transversely behind
the stomach, between the spleen and duodenum. The pancreatic
exocrine function, e.g., external secretion, provides a source of
digestive enzymes. Indeed, "pancreatin" refers to a substance from
the pancreas containing enzymes, principally amylase, protease, and
lipase, which substance is used as a digestive aid. The exocrine
portion is composed of several serous cells surrounding a lumen.
These cells synthesize and secrete digestive enzymes such as
trypsinogen, chymotrypsinogen, carboxypeptidase, ribonuclease,
deoxyribonuclease, triacylglycerol lipase, phospholipase A.sub.2,
elastase, and amylase.
[0092] The endocrine portion of the pancreas is composed of the
islets of Langerhans. The islets of Langerhans appear as rounded
clusters of cells embedded within the exocrine pancreas. Four
different types of cells-.alpha., .beta., .delta., and .phi.-have
been identified in the islets. The a cells constitute about 20% of
the cells found in pancreatic islets and produce the hormone
glucagon. Glucagon acts on several tissues to make energy available
in the intervals between feeding. In the liver, glucagon causes
breakdown of glycogen and promotes gluconeogenesis from amino acid
precursors. The .delta. cells produce somatostatin which acts in
the pancreas to inhibit glucagon release and to decrease pancreatic
exocrine secretion. The hormone pancreatic polypeptide is produced
in the .phi. cells. This hormone inhibits pancreatic exocrine
secretion of bicarbonate and enzymes, causes relaxation of the
gallbladder, and decreases bile secretion. The most abundant cell
in the islets, constituting 60-80% of the cells, is the .beta.
cell, which produces insulin. Insulin is known to cause the storage
of excess nutrients arising during and shortly after feeding. The
major target organs for insulin are the liver, muscle, and
fat-organs specialized for storage of energy.
[0093] The term "pancreatic duct" includes the accessory pancreatic
duct, dorsal pancreatic duct, main pancreatic duct and ventral
pancreatic duct. Serous glands have extensions of the lumen between
adjacent secretory cells, and these are called intercellular
canaliculi. The term "interlobular ducts" refers to intercalated
ducts and striated ducts found within lobules of secretory units in
the pancreas. The "intercalated ducts" refers to the first duct
segment draining a secretory acinus or tubule. Intercalated ducts
often have carbonic anhydrase activity, such that bicarbonate ion
may be added to the secretions at this level. "Striated ducts" are
the largest of the intralobular duct components and are capable of
modifying the ionic composition of secretions.
[0094] The term "pancreatic progenitor cell" refers to a cell which
can differentiate into a cell of pancreatic lineage, e.g. a cell
which can produce a hormone or enzyme normally produced by a
pancreatic cell. For instance, a pancreatic progenitor cell may be
caused to differentiate, at least partially, into .alpha., .beta.,
.delta., or .phi. islet cell, or a cell of exocrine fate. The
pancreatic progenitor cells of the invention can also be cultured
prior to administration to a subject under conditions which promote
cell proliferation and differentiation. These conditions include
culturing the cells to allow proliferation and confluence in vitro
at which time the cells can be made to form pseudo islet-like
aggregates or clusters and secrete insulin, glucagon, and
somatostatin.
[0095] The term "substantially pure", with respect to progenitor
cells, refers to a population of progenitor cells that is at least
about 75%, preferably at least about 85%, more preferably at least
about 90%, and most preferably at least about 95% pure, with
respect to progenitor cells making up a total cell population.
Recast, the term "substantially pure" refers to a population of
progenitor cell of the present invention that contain fewer than
about 20%, more preferably fewer than about 10%, most preferably
fewer than about 5%, of lineage committed cells in the original
unamplified and isolated population prior to subsequent culturing
and amplification.
[0096] (iii) Exemplary Embodiments
[0097] Certain terms being set out above, it is noted that one
aspect of the present invention features a method for enriching for
stem cells, and differentiated progeny thereof, from a range of
tissue types. It is anticipated that the trait of nonadherency may
be used to isolate stem cells from essentially any tissue
including, but not limited to the following tissue types: smooth
muscle, striated muscle, cardiac muscle, bones (including marrow
and spongy bone), cartilage, liver, pancreas (including ductal
tissue), spleen, thymus, tonsils, Peyer's patches, lymph nodes,
thyroid, epidermis, dermis, subcutaneous tissue, heart, lung,
vascular tissue (including smooth muscle and endothelium), blood
cells, bladder, kidney, digestive tract (including esophagus,
stomach, small intestine, large intestine, adipose tissue, uterus,
eye, lung, testis, ovaries, prostate, connective tissue, endocrine
tissue, mesentery tissue, fetal tissue, umbilical tissue.
[0098] Various techniques may be employed to obtain suspensions of
cells (both differentiated and undifferentiated) from tissues.
Preferred isolation procedures are ones that result in as little
cell death as possible. For example, the cells can be removed from
the explant sample by mechanical means, e.g., mechanically sheared
off with a pipette. In other instances, it will be possible to
dissociate the progenitor cells from the entire explant, or
sub-portion thereof, e.g., by enzymatic digestion of the explant,
followed by isolation of the activated progenitor cell population
based on specific cellular markers, e.g., using affinity separation
techniques or fluorescence activated cell sorting (FACS). Cells may
be obtained from liquid samples, such as blood, by
centrifugation.
[0099] In general, the tissue is prepared using any suitable
method, such as by gently teasing apart the excised tissue or by
digestion of excised tissue with collagenase (for example,
collagenase A), via, to illustrate, perfusion through a duct or
simple incubation of, for example, teased tissue in a
collagenase-containing buffer of suitable pH and tonic strength.
The prepared tissue may then, optionally, be concentrated using
suitable methods and materials, such as centrifugation through
Ficol gradients for concentration (and partial purification). The
concentrated tissue then is resuspended into any suitable vessel,
such as tissue culture glassware or plasticware. In certain
embodiments, the samples pancreatic tissue are allowed to form a
confluent monolayer culture, from which NACs are formed. In other
preferred embodiments, the cell suspension is placed in a
non-adherent culture container and spheres of progenitor cells are
formed.
[0100] One salient feature of the subject method is that the
starting material can be adult or fetal tissue or tissue from any
developmental stage. Moreover, the method can be practiced with
relatively small amounts of starting material. Accordingly, small
samples of tissue from a donor can be obtained without sacrificing
or seriously injuring the donor. The progenitor cells of the
present invention can be amplified, and subsequently isolated from
a tissue sample.
[0101] In certain embodiments, the culture may be contacted with a
growth factor or a composition comprising a growth factor, e.g., a
mitogenic growth factor, e.g., the growth factor is selected from a
group consisting of IGF-I, IGF-II, LIF, TGF.alpha., TGF.beta.,
bFGF, aFGF, EGF, PDGF, HGF, hedgehog or VEGF. In other embodiments,
the growth factor is a member of the TGF.beta. superfamily,
preferably of the DVR (dpp and vg1 related) family, e.g., BMP2
and/or BMP7.
[0102] In certain embodiments, the culture is contacted with a cAMP
elevating agents, such as
8-(4-chlorophenylthio)-adenosine-3':5'-cyclic-m- onophosphate
(CPT-cAMP) (see, for example, Koike Prog. Neuro-Psychopharmacol.
and Biol. Psychiat. 16 95-106 (1992)), CPT-cAMP, forskolin,
Na-Butyrate, isobutyl methylxanthine (IBMX) and cholera toxin (see
Martin et al. J. Neurobiol. 23 1205-1220 (1992)) and 8-bromo-cAMP,
dibutyryl-cAMP and dioctanoyl-cAMP (e.g., see Rydel et al. PNAS
85:1257 (1988)).
[0103] In certain embodiments, the culture is contacted with a
steroid or corticosteroid such as, for example, hydrocortisone,
deoxyhydrocortisone, fludrocortisone, prednisolone,
methylprednisolone, prednisone, triamcinolone, dexamethasone,
betamethasone and paramethasone. See, generally, The Merck Manual
of Diagnosis and Therapy, 15th Ed., pp. 1239-1267 and 2497-2506,
Berkow et al., eds., Rahay, N.J., 1987).
[0104] In a preferred embodiment, the cultures are contacted with a
cAMP elevating agent, a growth factor and a steroid or
corticosteroid, e.g., with the DCE cocktail described herein.
[0105] Alternatively, or in addition, treatment with cAMP
upregulating agents can be used as described above to induce
differentiation. The cell products of such a method can include
insulin-producing cells, and more preferably, glucose-responsive
insulin-producing cells.
[0106] There are a large number of tissue culture media that exist
for culturing tissue from animals. Some of these are complex and
some are simple. While it is expected that the ductal epithelial
explants may grow in complex media, it will generally be preferred
that the explants be maintained in a simple medium, such as
Dulbecco's Minimal Essential Media (DMEM), in order to effect more
precise control over the activation of certain progenitor
populations in the explant. In a preferred embodiment, pancreatic
ductal epithelium is cultured in Isocove's modified MEM cell
culture medium with 5% FBS. Moreover, the explants can be
maintained in the absence of sera for extended periods of time. In
preferred embodiments of the invention, the growth factors or other
mitogenic agents are not included in the primary media for
maintenance of the cultures in vitro, but are used subsequently to
cause proliferation of distinct populations of progenitor cells.
See the appended examples.
[0107] In a preferred embodiment, stem cells are enriched because
of their ability to grow with adherence, either direct or indirect,
to a culture surface. In other words, one aspect of the invention
requires that the stem cells are obtained from a culture wherein
said stem cells are free floating in suspension and are not in
fixed or semi-fixed contact with a surface of the culture vessel or
with other cells or materials that are in contact
[0108] In an alternative embodiment, progenitor cells can be
isolated from pancreatic ducts using a monolayer intermediate
stage. Pancreatic ducts in their entirety were chosen as a source
of stem cells because it was considered that the duct fragment
inclusive of its component epithelium and mesenchyme might be the
basic biological unit that contains endocrine progenitor cell
activity. The dependence of pancreatic epithelium on its
surrounding mesenchyme for survival and growth during development
was first demonstrated by the early work of Goloslow and Grobstein
(1962) and others (Wessels and Cohen, 1967). More recent work using
gene knockout technology demonstrated that the loss of dorsal
pancreatic mesenchyme correlated with the loss of the developing
pancreatic epithelium (Ahlgren, et al. 1997) and consequently the
absence of pancreas formation from the dorsal bud. Respecification
of pancreatic mesenchyme identity to smooth muscle by sonic
hedgehog protein also resulted in deranged pancreatic epithelial
outgrowth (Apelqvist et al. 1997). From these results in the
developing pancreas, it was hypothesized that the relationship
between mesenchyme and epithelium may continue to be functionally
important in the adult pancreas, particularly with respect to islet
neogenesis and regrowth.
[0109] Freshly isolated duct fragments are comprised of a single
epithelial layer surrounded by mesenchymal stroma and contain few,
if any, differentiated endocrine cells. After the ducts are grown
in culture, we observed the presence of multiple endocrine cell
types and also potential progenitor cells coexpressing markers such
as insulin and amylase, which might contribute to the formation of
differentiated beta cells. In addition, we observed the emergence
of a nonadherent cell type previously undescribed in pancreatic
cell culture. The number and properties of this novel cell type are
affected by the addition of various factors, one combination of
which reproducibly leads to the formation of functional,
glucose-responsive beta-like cells. Our data thus suggest the
presence and induction of pancreatic progenitor cell activities in
this duct culture system, which now makes possible the in vitro
study of beta cell neogenesis and also provides a first step in the
process of producing beta cells for the treatment of
insulin-dependent diabetes.
[0110] This shows for the first time that functional beta-like
cells can be obtained via in vitro duct culture, suggests the
presence and activation of a progenitor cell from pancreatic ducts,
and provides a system for the isolation and manipulation of those
cells. In one preferred embodiment, the subject method can be used
to produce islet-like cell clusters ("ICC") containing a
high-percentage of .beta.-epithelial cells with increased insulin
production.
[0111] Moreover, as demonstrated in the appended examples, the
subject cellular compositions can be used to rescue diabetic
mice.
[0112] Accordingly, in one embodiment, the invention provides a
method for isolating pancreatic progenitor cells. In general, the
method includes the steps of obtaining pancreatic ductal cells;
culturing the pancreatic cells in a suitable nutrient medium;
isolating a population of progenitor cells from said culture. In
preferred embodiments, the ductal epithelial cells are obtained
from intralobular ducts. For instance, the pancreatic ductal
epithelial cells can be obtained by enzymatic digestion or other
mechanical separation of ductal fragments. The pancreatic ductal
cells are grown to confluence, e.g., preferably in a monolayer.
Viable, non-adherent cells can be isolated from the culture,
optionally after treatment of the culture with an agent(s) that
induce proliferation/differentiation of pancreatic progenitor cells
from the adherent epithelial cells. As described below, the
non-adherent cell population is enriched for pancreatic progenitor
cells.
[0113] Another aspect of the present invention relates to our
finding that cAMP elevating agents can be used to proliferation and
differentiation of pancreatic progenitor cells. In this regard, the
invention relates to the use of a cAMP elevating agents to induce
ex vivo the proliferation and differentiation of pancreatic cells
prior to their transplantation into a diabetic subject. In yet
other embodiments, the invention contemplates the in vivo
administration of cAMP agonists to patients which have been
transplanted with pancreatic tissue, as well as to patients which
have a need for improved pancreatic performance, or are at risk for
developing functional deficits in the organ, especially of
glucose-dependent insulin secretion, e.g., the subject method can
be used prophylactically.
[0114] Another salient feature of certain embodiments of the
subject method concerns the use of defined culture conditions for
isolating and propagating discrete pancreatic progenitor cell
populations.
[0115] For instance, as described below, the progenitor source
ductal tissue explants preferably are digested or otherwise teased
apart, thereby providing purified ductal properties, which in turn
are placed in the culture medium and grown. The pancreatic duct
preparations are permitted to expand and form monolayer of cells in
culture, e.g., a ductal epithelial monolayer. In preferred
embodiments, the majority (e.g., >25 percent, more preferably
>10%) of the cells are vimentin-positive, non-endocrine and
proliferative. Viable non-adherent cells (NACs) can be isolated
from the culture of otherwise adherent pancreatic cells. As
described below, these NAC preparations are enriched for pancreatic
progenitor cells.
[0116] We have also discovered that ductal cells of the subject
cultures, and the NACs arising in the culture, can be purified
based on binding to lectins. For example, fluorescently labeled
lectins can be used to, e.g., facilitate FACS or other cell
sorting. In other embodiments, the lectin can be derivatized for
immobilization, e.g., on a solid surface such as a filter or bead,
and used for affinity purification of the cells. Exemplary lectins
for these purposes include the fluorescent lectins, peroxidase
conjugated lectins and biotinylated lectins marketed by Vector
Laboratories, Inc. of Burlingame, Calif. In preferred embodiments,
the lecting is a plant lectin, and more preferably to peanut
agglutinin. In other embodiments, the lectin is selected from the
group consisting of Aleuria Aurantia Lectin (AAL); Amaranthus
Caudatus Lectin (ACL, ACA); Bauhinia Purpurea Lectin (BPL, BPA);
Concanavalin A (Con A); Succinylated Concanavalin A (Con A); Datura
Stramonium Lectin (DSL); Dolichos Biflorus Agglutinin (DBA);
Erythrina Cristagalli Lectin (ECL, ECA); Euonymus Europaeus Lectin
(EEL); Galanthus Nivalis Lectin (GNL); Griffonia (Bandeiraea)
Simplicifolia Lectin I (GSL I, BSL I); Isolectin-B4; Griffonia
(Bandeiraea) Simplicifolia Lectin II (GSL II, BSL II); Hippeastrum
Hybrid Lectin (HHL, AL); Lens Culinaris Agglutinin (LCA, LcH);
Lotus Tetragonolobus Lectin (LTL); Lycopersicon Esculentum (Tomato)
Lectin (LEL, TL); Maackia Amurensis Lectin I (MAL I); Maackia
Amurensis Lectin II (MAL II); Maclura Pomifera Lectin (MPL);
Narcissus Pseudonarcissus Lectin (NPL, NPA, DL); Peanut Agglutinin
(PNA); Phaseolus Vulgaris Agglutinin (PHA); Pisum Sativum (PSA);
Psophocarpus Tetragonolobus Lectin I (PTL I, WBA I); Psophocarpus
Tetragonolobus Lectin II (PTL II, WBA II); Ricinus Communis
Agglutinin I (RCA I, RCA120); Ricinus Communis Agglutinin II (RCA
II, RCA60, ricin); Sambucus Nigra (EBL, SNA); Solanum Tuberosum
(Potato) Lectin (STL, PL); Sophora Japonica Agglutinin (SJA);
Soybean Agglutinin (SBA); Ulex Europaeus Agglutinin I (UEA I); Ulex
Europaeus Aggluutinin II (UEA II); Vicia Villosa Lectin (VVA, VVL);
Wheat Germ Agglutinin (WGA); Succinylated Wheat Germ Agglutinin;
and Wisteria Floribunda Lectin (WFA, WFL).
[0117] In certain embodiments, the dissociated monolayers derived
from the ductal explants can be sorted by presence of A2B5 epitope,
e.g., the ability to be bound by the A2B5 monoclonal antibody
(Eisenbarth et al., (1979) PNAS 76:4913), or other glycolipids
present on astrocytes, such as gangliosides like GM3 or GD3.
[0118] Moreover, we have unexpectedly found that a combination of
growing such cells as monolayers, with treatment of such cultures
with cAMP elevating agents produces an increased induction of NACs,
e.g., pancreatic progenitor cells. Accordingly, when the ductal
cells have grown to confluence (cells covering the surface of a
culture plate), the cells cans be treated with a cAMP elevating
agent in order to cause differentiation of certain cells in the
culture into progenitor cells, and subsequently into
insulin-producing or other endocrine or exocrine cells.
Accordingly, carefully defined conditions can be acquired in the
culture so as selectively activate discrete populations of cells in
the tissue explant. The progenitor and differentiated cells of the
present invention can be amplified, and subsequently isolated from
the culture.
[0119] In general, in such an expanded culture procedure a
commercial-sized bioreactor, such as the OPTICAL.TM. culture
system, Model 5300E (Charles River Labs.; Wilmington, Mass.), or
the CELLMAX.TM. QUAD cell culture system (Cellco, Inc.; Germantown,
Md.), is seeded with a primary culture of human pancreatic cells.
The bioreactor is perfused with a suitable, complete growth medium
supplemented with an appropriately effective concentration of
mitogens, and as appropriate, cAMP elevating agents. The
.beta.-epithelial cell-containing islet-like clusters can then be
harvested. Cells may be cryopreserved prior to use as described,
for example, by Beattie et al., Transplantation 56: 1340
(1993).
[0120] The cultures may be maintained in any suitable culture
vessel, such as a 12 or 24 well microplate, and may be maintained
under typical culture conditions for cells isolated from the same
animal, e.g., such as 37.degree. C. in 5% CO.sub.2. The cultures
may be shaken for improved aeration, the speed of shaking being,
for example, 12 rpm.
[0121] In order to isolate progenitor cells from the ductal
cultures, it will generally be desirable to contact the explant
with an agent which causes proliferation of one or more populations
of progenitor cells in the explant. For instance, a mitogen, e.g.,
a substance that induces mitosis and cell transformation, can be
used to detect a progenitor cell population in the explant, and
where desirable, to cause the amplification of that population. To
illustrate, a purified or semi-purifed preparation of a growth
factor can be applied to the culture. Induction of progenitor cells
which respond to the applied growth factor can be detected by
proliferation of the progenitor cells. However, as described below,
amplification of the population need not occur to a large extent in
order to use certain techniques for isolating the responsive
population.
[0122] In yet other embodiments, the ductal explants and/or
amplified progenitor cells can be cultured on feeder layers, e.g.,
layers of feeder cells which secrete inductive factors or polymeric
layers containing inductive factors. For example, a matrigel layer
can be used to induce hematopoietic progenitor cell expansion, as
described in the appended examples. Matrigel (Collaborative
Research, Inc., Bedford, Mass.) is a complex mixture of matrix and
associated materials derived as an extract of murine basement
membrane proteins, consisting predominantly of laminin, collagen
IV, heparin sulfate proteoglycan, and nidogen and entactin was
prepared from the EHS tumor as described Kleinman et al, "Basement
Membrane Complexes with Biological Activity", Biochemistry, Vol. 25
(1986), pages 312-318. Other such matrixes can be provided, such as
Humatrix. Likewise, natural and recombinantly engineered cells can
be provided as feeder layers to the instant cultures.
[0123] As described in further detail below, it is contemplated
that the subject methods can be carried out using cyclic AMP (cAMP)
agonists to induce differentiation of the cultures cells of
endocrine or exocrine phenotypes. In yet other embodiments, the
invention contemplates the in vivo administration of cAMP agonists
to patients which have been transplanted with pancreatic tissue, as
well as to patients which have a need for improved pancreatic
performance, especially of glucose-dependent insulin secretion.
[0124] In light of the present disclosure, it will be apparent to
those in the art that a variety of different small molecules can be
readily identified, for example, by routine drug screening assays,
which upregulate cAMP-dependent activities. For example, the
subject method can be carried out using compounds which may
activate adenylate cyclase include forskolin (FK), cholera toxin
(CT), pertussis toxin (PT), prostaglandins (e.g., PGE-1 and PGE-2),
colforsin and .beta.-adrenergic receptor agonists.
.beta.-Adrenergic receptor agonists (sometimes referred to herein
as ".beta.-adrenergic agonists") include albuterol, bambuterol,
bitolterol, carbuterol, clenbuterol, clorprenaline, denopamine,
dioxethedrine, dopexamine, ephedrine, epinephrine, etafedrine,
ethylnorepinephrine, fenoterol, formoterol, hexoprenaline,
ibopamine, isoetharine, isoproterenol, mabuterol, metaproterenol,
methoxyphenamine, oxyfedrine, pirbuterol, prenalterol, procaterol,
protokylol, reproterol, rimiterol, ritodrine, soterenol,
salmeterol, terbutaline, tretoquinol, tulobuterol, and
xamoterol.
[0125] Compounds which may inhibit cAMP phosphodiesterase(s), and
thereby increase the half-life of cAMP, are also useful in the
subject method. Such compounds include aminone, milrinone,
xanthine, methylxanthine, anagrelide, cilostamide, medorinone,
indolidan, rolipram, 3-isobutyl-1-methylxanthine (IBMX),
chelerythrine, cilostazol, glucocorticoids, griseolic acid,
etazolate, caffeine, indomethacin, theophylline, papverine, methyl
isobutylxanthine (MIX), and fenoxamine.
[0126] Certain analogs of cAMP, e.g., which are agonists of cAMP,
can also be used. Exemplary cAMP analogs which may be useful in the
present method include dibutyryl-cAMP (db-cAMP),
(8-(4)-chlorophenylthio)-cAMP (cpt-cAMP),
8-[(4-bromo-2,3-dioxobutyl)thio]-cAMP,
2-[(4-bromo-2,3-dioxobutyl)thio]-cAMP, 8-bromo-cAMP,
dioctanoyl-cAMP, Sp-adenosine 3':5'-cyclic phosphorothioate,
8-piperidino-cAMP, N.sup.6-phenyl-cAMP, 8-methylamino-cAMP,
8-(6-aminohexyl)amino-cAMP, 2'-deoxy-cAMP,
N.sup.6,2'-O-dibutryl-cAMP, N.sup.6,2'-O-disuccinyl-cAMP,
N.sup.6-monobutyryl-cAMP, 2'-O-monobutyryl-cAMP,
2'-O-monobutryl-8-bromo-- cAMP, N.sup.6-monobutryl-2'-deoxy-cAMP,
and 2'-O-monosuccinyl-cAMP.
[0127] Above-listed compounds useful in the subject methods may be
modified to increase the bioavailability, activity, or other
pharmacologically relevant property of the compound. For example,
forskolin has the formula: 1
[0128] Modifications of forskolin which have been found to increase
the hydrophilic character of forskolin without severly attenuating
the desired biological activity include acylation of the hydroxyls
at C6 and/or C7 (after removal of the acetyl group) with
hydrophilic acyl groups. In compounds wherein C6 is acylated with a
hydrophilic acyl group, C7 may optionally be deacetylated. Suitable
hydrophilic acyl groups include groups having the structure
--(CO)(CH.sub.2).sub.nX, wherein X is OH or NR.sub.2; R is
hydrogen, a C.sub.1-C.sub.4 alkyl group, or two Rs taken together
form a ring comprising 3-8 atoms, preferably 5-7 atoms, which may
include heteroatoms (e.g., piperazine or morpholine rings); and n
is an integer from 1-6, preferably from 1-4, even more preferably
from 1-2. Other suitable hydrophilic acyl groups include
hydrophilic amino acids or derivatives thereof, such as aspartic
acid, glutamic acid, asparagine, glutamine, serine, threonine,
tyrosine, etc., including amino acids having a heterocyclic side
chain. Forskolin, or other compounds listed above, modified by
other possible hydrophilic acyl side chains known to those of skill
in the art may be readily synthesized and tested for activity in
the present method.
[0129] Similarly, variants or derivatives of any of the
above-listed compounds may be effective as cAMP agonists in the
subject method. Those skilled in the art will readily be able to
synthesize and test such derivatives for suitable activity.
[0130] In certain embodiments, the subject cAMP agonists can be
chosen on the basis of their selectivity for cAMP activation.
[0131] In certain embodiments, it may be advantageous to administer
two or more of the above cAMP agonists, preferably of different
types. For example, use of an adenylate cyclase agonist in
conjunction with a cAMP phosphodiesterase antagonist may have an
advantageous or synergistic effect.
[0132] In certain preferred embodiments, the subject agents raise
effective cAMP levels with an ED.sub.50 of 1 mM or less, more
preferably of 1 .mu.M or less, and even more preferably of 1 nM or
less.
[0133] In certain embodiments of the subject method, it will be
desirable to monitor the growth state of cells in the culture,
e.g., cell proliferation, differentiation and/or cell death.
Methods of measuring cell proliferation are well known in the art
and most commonly include determining DNA synthesis characteristic
of cell replication. There are numerous methods in the art for
measuring DNA synthesis, any of which may be used according to the
invention. In an embodiment of the invention, DNA synthesis has
been determined using a radioactive label (.sup.3H-thymidine) or
labeled nucleotide analogues (BrdU) for detection by
immunofluorescence.
[0134] However, in addition to measuring DNA synthesis,
morphological changes can be, and preferably will be, relied on as
the basis for isolating responsive progenitor cell populations. For
instance, as described in the appended examples, we have observed
that certain growth factors cause amplification of progenitor cells
in ductal explants so as to form structures that can be easily
detected by the naked eye or microscopy. In an exemplary
embodiment, those progenitor cells which respond to growth factors
by proliferation and subsequent formation of outgrowths from the
explant, e.g., buds or blebs, can be easily detected. In another
illustrative embodiment, other structural changes, e.g., changes in
optical density of proliferating cells, can be detected via
contrast microscopy.
[0135] To further illustrate, ICCs can be incubated with
bromodeoxyuridine ("BrdU"), fixed in formaldehyde, embedded in
paraffin and sectioned. Sections can be stained for insulin using
an immunoalkaline phosphatase technique described, for exampole, by
Erber et al., Am. J. Clin. Path. 88: 43 (1987), using polyclonal
guinea pig anti-porcine insulin (Chemicon; El Sequndo, Calif.) as
the primary antibody.
[0136] Cell nuclei that have incorporated BrdU during DNA synthesis
can be identified using mouse monoclonal anti-BrdU (Dako;
Carpintaria, Calif.), detected with the immuno-peroxide technique
of Stemberger et al., J. Histochem., Cytochem. 18: 315 (1970),
followed by hematoxylin counterstaining.
[0137] Epithelial cells can be identified on separate sections
using a mouse monoclonal anti-epithelial antigen antibody (Ber-EP4,
Dako, above) as the primary antibody.
[0138] Surface areas of insulin-positive and epithelial cells,
calculated as percent of the total ICC area, can be quantified with
a computerized image analyzer (American Innovision; San Diego,
Calif.). The same method can be used for the determination of the
BrdU labeling index. Cells positive for both insulin and BrdU may
also be recorded in separate sections of the same samples after
double staining of the two antigens.
[0139] Mean cell size can be calculated by the ratio of total ICC
area to the number of nuclei.
[0140] Mean beta-cell size can be estimated by measuring the
surface area of individual insulin-positive cells.
[0141] A sufficient number of ICC sections (at least 15) and nuclei
(at least 1000) should be analyzed for each sample to correct for
biological and experimental variability of the samples.
[0142] To further illustrate, the examples below demonstrate that
ductal explants contain growth factor responsive progenitor cell
types. It is further demonstrated that different growth factors can
induce/amplify distinct populations of progenitor cells within the
ductal tissue explant to proliferate. This indicates the presence
of specific growth factor receptors on the surface of distinct
progenitor cell populations. This is important because the
expression of these receptors marks the progenitor cell populations
of interest. Monoclonal antibodies are particularly useful for
identifying markers (surface membrane proteins, e.g., receptors)
associated with particular cell lineages and/or stages of
differentiation. Procedures for separation of the subject
progenitor cell may include magnetic separation, using antibody
coated magnetic beads, affinity chromatography, and "panning" with
antibody attached to a solid matrix, e.g., plate, or other
convenient technique. Techniques providing accurate separation
include fluorescence activated cell sorting, which can have varying
degrees of sophistication, e.g., a plurality of color channels, low
angle and obtuse light scattering detecting channels, impedance
channels, etc.
[0143] Conveniently, the antibodies may be conjugated with markers,
such as magnetic beads, which allow for direct separation, biotin,
which can be removed with avidin or streptavidin bound to a
support, fluorochromes, which can be used with a fluorescence
activated cell sorter, or the like, to allow for ease of separation
of the particular cell type. Any technique may be employed which is
not unduly detrimental to the viability of the cells.
[0144] In an illustrative embodiment, some of the antibodies for
growth factor receptors that exist on the subject progenitor cells
are commercially available (e.g., antibodies for EGF receptors, FGF
receptors and/or TGF receptors), and for other growth factor
receptors, antibodies can be made by methods well known to one
skilled in the art. In addition to using antibodies to isolate
progenitor cells of interest, one skilled in the art can also use
the growth factors themselves to label the cells, for example, to
permit "panning" processes.
[0145] Upon isolation, the progenitor cells of the present
invention can be further characterized in the following manner:
responsiveness to growth factors, specific gene expression,
antigenic markers on the surface of such cells, and/or basic
morphology.
[0146] For example, extent of growth factor responsivity, e.g., the
concentration range of growth factor to which they will respond to,
the maximal and minimal responses, and to what other growth factors
and conditions to which they might respond, can be used to
characterize the subject progenitor cells.
[0147] Furthermore, the isolated progenitor cells can be
characterized by the expression of genes known to mark the
developing (i.e., stem or progenitor) cells for the pancreas.
[0148] Once isolated and characterized, the subject progenitor
cells can be cultured under conditions which allow further
differentiation into specific cell lineages. This can be achieved
through a paradigm of induction that can be developed. For example,
the subject progenitor cells can be recombined with the
corresponding embryonic tissue to see if the embryonic tissue can
instruct the adult cells to codevelop and codifferentiate.
Alternatively, the progenitor cells can be contacted with one or
more growth or differentiation factors which can induce
differentiation of the cells. For instance, the cells can be
treated with an agent such as Forskolin, Di-butyrl cAMP,
Na-Butyrate, dexamethasone or cholera toxin, or a growth factor
such as TGF.beta., such as DVR sub-family member.
[0149] In an illustrative embodiment, the hepatocyte nuclear factor
(HNF) transcription factor family, e.g., HNF1-4, are known to be
expressed in various cell types at various times during pancreas
development. For example, the progenitor cell may express one or
more HNF protein such as HNF1.alpha., HNF1.beta., HNF3.beta.,
HNF3.gamma., and/or HNF4. The glucose transporter Glut2 is also a
marker for both early pancreatic cells. Certain of the "forkhead"
transcription factors, such as fkh-1 or the like, are understood to
be markers in early gut tissue.
[0150] In another illustrative embodiment, homeodomain type
transcription factors such as STF-1 (also known as IPF-1, IDX-1 or
PDX) have recently been shown to mark different populations of the
developing pancreas. Some LIM genes have also been shown to
regulate insulin gene expression and would also be markers for
protodifferentiated .beta. islet cells. Likewise, certain of the
PAX genes, such as PAX6, are expressed during pancreas formation
and may be used to characterize certain pancreatic progenitor cell
populations. Other markers of pancreatic progenitor cells include
the pancreas specific transcription factor PTF-1, and hXBP-1 and
the like. Moreover, certain of the HNF proteins are expressed
during early pancrease development and may used as markers for
pancreatic progenitor cells.
[0151] Progenitor cells giving rise to pancreatic cells may also
express such as markers as villin and/or tyrosine hydroxylase, as
well as secrete such factors as insulin, glucagon and/or
neuropeptide Y.
[0152] Other markers which can be scored in the NACs include: Rab3A
(Zahraoui et al. (1989) J. Biol. Chem. 12:394; Baldini et al.
(1995) PNAS 92:4284); vesicle-associated membrane protein 2 (VAMP2,
Fujita-Yoshigaki et al. (1996) J. Biol. Chem. 271:13130; and
Nielsen et al. (1995) J Clin Invest 96:1834); amylin, and/or A2B5
(Eisenbarth et al., (1979) PNAS 76:4913)
[0153] In other embodiments, the subject cultures of small ductal
epithelial cells, as well as possibly the pancreatic progenitor
cells arsing therefrom, are characterized by binding to lectin(s),
and preferably to a plant lectin, and more preferably to peanut
agglutinin. In a preferred embodiment, the lectin is peanut
agglutinin. In other embodiments, the lectin is selected from the
group consisting of Aleuria Aurantia Lectin (AAL); Amaranthus
Caudatus Lectin (ACL, ACA); Bauhinia Purpurea Lectin (BPL, BPA);
Concanavalin A (Con A); Succinylated Concanavalin A (Con A); Datura
Stramonium Lectin (DSL); Dolichos Biflorus Agglutinin (DBA);
Erythrina Cristagalli Lectin (ECL, ECA); Euonymus Europaeus Lectin
(EEL); Galanthus Nivalis Lectin (GNL); Griffonia (Bandeiraea)
Simplicifolia Lectin I (GSL I, BSL I); Isolectin-B4; Griffonia
(Bandeiraea) Simplicifolia Lectin II (GSL II, BSL II); Hippeastrum
Hybrid Lectin (HHL, AL); Lens Culinaris Agglutinin (LCA, LcH);
Lotus Tetragonolobus Lectin (LTL); Lycopersicon Esculentum (Tomato)
Lectin (LEL, TL); Maackia Amurensis Lectin I (MAL I); Maackia
Amurensis Lectin II (MAL II); Maclura Pomifera Lectin (MPL);
Narcissus Pseudonarcissus Lectin (NPL, NPA, DL); Peanut Agglutinin
(PNA); Phaseolus Vulgaris Agglutinin (PHA); Pisum Sativum (PSA);
Psophocarpus Tetragonolobus Lectin I (PTL I, WBA I); Psophocarpus
Tetragonolobus Lectin II (PTL II, WBA II); Ricinus Communis
Agglutinin I (RCA I, RCA120); Ricinus Communis Agglutinin II (RCA
H, RCA60, ricin); Sambucus Nigra (EBL, SNA); Solanum Tuberosum
(Potato) Lectin (STL, PL); Sophora Japonica Agglutinin (SJA);
Soybean Agglutinin (SBA); Ulex Europaeus Agglutinin I (UEA 1); Ulex
Europaeus Aggluutinin II (UEA II); Vicia Villosa Lectin (VVA, VVL);
Wheat Germ Agglutinin (WGA); Succinylated Wheat Germ Agglutinin;
and Wisteria Floribunda Lectin (WFA, WFL).
[0154] For instance, as shown the attached figures, various
components of human pancreas can be marked by different lectins.
DSL marks inter- and intralobular ducts. LCA appears to mark
mesenchyme. ECL marks intralobular ducts without marking larger
ducts. Succinylated-Wheat Germ Agglutinin marks a subset of main
duct cells and is quite restricted compared to WGA.
[0155] In another example, mammalian blood cells can be used to
obtain stem cells as per the methods provided herein. Stem cells
derived from blood can provide for an extraordinarily diverse range
of cell types. Three major lineages of blood cells include the
lymphoid lineage, eg. B-cells and T-cells, the myeloid lineage, eg.
monocytes, granulocytes and megakaryocytes, and the erythroid
lineage, eg. red blood cells. Hematopoietic stem cells (HSCs) are
cells that can give rise to cells of at least two of the above
lineages in addition to producing daughter cells of equivalent
multipotency. In preferred embodiments, the HSCs can give rise to
three major blood cell lineages.
[0156] HSCs may be isolated from suspensions of a variety of tissue
types. Bone marrow cells are a good source of HSCs. Bone marrow
cells may be obtained from a source of bone marrow, e.g., iliac
crests, tibiae, femora, spine, or other bone cavities. Other
sources of human hematopoietic stem cells include embryonic yolk
sac, fetal liver, fetal and adult spleen, blood, including adult
peripheral blood and umbilical cord blood.
[0157] HSCs can be identified both by the types of cells they give
rise to and by various cytological markers. HSCs often extrude
certain dyes, such as Hoechst 33324 and Rhodamine 123 (Bhatia et
al. (1998) Nature Med. 4:1038). Such dye staining properties can be
used to identify HSCs among other cells of the circulatory system.
Antibodies that react with certain cell markers can also be used to
identify and purify HSCs. For example, mAb AC133 is thought to
specifically bind to HSCs (Miraglia et al. (1997) Blood 90:5013).
The Thy-1 molecule is a highly conserved protein present in the
brain and hematopoietic system of rat, mouse and man. The Thy-1
molecule has been identified on rat, mouse and human HSCs and can
be useful in identifying HSCs (U.S. Pat. No. 5,914,108). Many HSCs
are CD34+ and/or CD38+as well (U.S. Pat. No. 5,840,580). A
population of HSCs will often have some variation in cell surface
markers and a positive identification may be made on the basis of
the presence of at least two of the above cytological markers.
[0158] HSCs can also be distinguished from other more
differentiated cell types by the absence of certain markers. CD3,
CD7, CD8, CD10, CD14, CD15, CD19, CD20 and CD33 are all typically
absent from HSCs. The absence of several of the above markers adds
confidence to the identification of HSCs. Morphology may also help
distinguish an HSC, as described above.
[0159] It is understood that HSCs may be identified by an
aggregation of multiple traits, such as morphology, the presence of
certain markers and the absence of other markers. A positive
identification does not typically require detection of all of the
above markers.
[0160] The culturing of HSCs to give rise to differentiated stem
cells can be achieved in many ways. For example, cells may be
cultured in a defined, enriched medium such as Iscove's Modified
Dulbecco's Medium (IMDM), gerierally composed of salts, amino
acids, vitamins, antibiotics and fetal calf serum. Cultures
supplemented with hydrocortisone tend to give rise to myeloid
cells, while cultures lacking cortisone tend to give rise to B
lymphocytes. To demonstrate that HSCs can develop in cells of the
erythroid lineage, various conventional methods can be used. For
example culturing on methylcellulose culture can stimulate
formation of erythroid cells. (U.S. Pat. Nos. 5,840,580 and
5,914,108; Metcalf (1977) In: Recent Results in Cancer Research 61.
Springer-Verlag Berlin, pp. 1-227).
[0161] In a further example, hematopoietic stem cells may be
isolated from liver tissue. Such cells may be identified by certain
markers. Such cells will typically be Sca-1+, c-kit+, Lin-.
[0162] In another preferred embodiment, the subject progenitor
cells can be implanted into one of a number of regeneration models
used in the art, e.g., a host animal which has undergone partial
pancreatectomy or streptozocin treatment or radiation killing of
bone marrow cells.
[0163] Accordingly, another aspect of the present invention
pertains to the progeny of the subject progenitor cells, e.g. those
cells which have been derived from the cells of the initial explant
culture. Such progeny can include subsequent generations of
progenitor cells, as well as lineage committed cells generated by
inducing differentiation of the subject progenitor cells after
their isolation from the explant, e.g., induced in vitro.
[0164] Another aspect of the invention relates to cellular
compositions enriched for progenitor cells, or the progeny thereof.
In certain embodiments, the cells will be provided as part of a
pharmaceutical preparation, e.g., a sterile, free of the presence
of unwanted virus, bacteria and other (human) pathogens, as well as
pyrogen-free preparation. That is, for human administration, the
subject cell preparations should meet sterility, pyrogenicity,
general safety and purity standards as required by FDA Office of
Biologics standards.
[0165] In certain embodiments, such cellular compositions can be
used for transplantation into animals, preferably mammals, and even
more preferably humans. The cells can be autologous, allogeneic or
xenogeneic with respect to the transplantation host. In one aspect,
the present invention relates to transplantation of fetal or mature
pancreatic cells to treat Type 1 diabetes mellitus.
[0166] Yet another aspect of the present invention concerns
cellular compositions which include, as a cellular component,
substantially pure preparations of the subject progenitor cells, or
the progeny thereof. Cellular compositions of the present invention
include not only substantially pure populations of the progenitor
cells, but can also include cell culture components, e.g., culture
media including amino acids, metals, coenzyme factors, as well as
small populations of non-progenitor cells, e.g, some of which may
arise by subsequent differentiation of isolated progenitor cells of
the invention. Furthermore, other non-cellular components include
those which render the cellular component suitable for support
under particular circumstances, e.g., implantation, e.g.,
continuous culture.
[0167] As common methods of administering the progenitor cells of
the present invention to subjects, particularly human subjects,
which are described in detail herein, include injection or
implantation of the cells into target sites in the subjects, the
cells of the invention can be inserted into a delivery device which
facilitates introduction by, injection or implantation, of the
cells into the subjects. Such delivery devices include tubes, e.g.,
catheters, for injecting cells and fluids into the body of a
recipient subject. In a preferred embodiment, the tubes
additionally have a needle, e.g., a syringe, through which the
cells of the invention can be introduced into the subject at a
desired location. The progenitor cells of the invention can be
inserted into such a delivery device, e.g., a syringe, in different
forms. For example, the cells can be suspended in a solution or
embedded in a support matrix when contained in such a delivery
device. As used herein, the term "solution" includes a
pharmaceutically acceptable carrier or diluent in which the cells
of the invention remain viable. Pharmaceutically acceptable
carriers and diluents include saline, aqueous buffer solutions,
solvents and/or dispersion media. The use of such carriers and
diluents is well known in the art. The solution is preferably
sterile and fluid to the extent that easy syringability exists.
Preferably, the solution is stable under the conditions of
manufacture and storage and preserved against the contaminating
action of microorganisms such as bacteria and fungi through the use
of, for example, parabens, chlorobutanol, phenol, ascorbic acid,
thimerosal, and the like. Solutions of the invention can be
prepared by incorporating progenitor cells as described herein in a
pharmaceutically acceptable carrier or diluent and, as required,
other ingredients enumerated above, followed by filtered
sterilization.
[0168] Support matrices in which the progenitor cells can be
incorporated or embedded include matrices which are
recipient-compatible and which degrade into products which are not
harmful to the recipient. Natural and/or synthetic biodegradable
matrices are examples of such matrices. Natural biodegradable
matrices include plasma clots, e.g., derived from a mammal, and
collagen matrices. Synthetic biodegradable matrices include
synthetic polymers such as polyanhydrides, polyorthoesters, and
polylactic acid. Other examples of synthetic polymers and methods
of incorporating or embedding cells into these matrices are known
in the art. See e.g., U.S. Pat. No. 4,298,002 and U.S. Pat. No.
5,308,701. These matrices provide support and protection for the
fragile progenitor cells in vivo and are, therefore, the preferred
form in which the progenitor cells are introduced into the
recipient subjects.
[0169] The present invention also provides substantially pure
progenitor cells which can be used therapeutically for treatment of
various disorders associated with insufficient functioning of the
pancreas.
[0170] To illustrate, the subject progenitor cells can be used in
the treatment or prophylaxis of a variety of pancreatic disorders,
both exocrine and endocrine. For instance, the progenitor cells can
be used to produce populations of differentiated pancreatic cells
for repair subsequent to partial pancreatectomy, e.g., excision of
a portion of the pancreas. Likewise, such cell populations can be
used to regenerate or replace pancreatic tissue loss due to,
pancreatolysis, e.g., destruction of pancreatic tissue, such as
pancreatitis, e.g., a condition due to autolysis of pancreatic
tissue caused by escape of enzymes into the substance.
[0171] In an exemplary embodiment, the subject progenitor cells can
be provided for patients suffering from any insulin-deficiency
disorder. For instance, each year, over 728,000 new cases of
diabetes are diagnosed and 150,000 Americans die from the disease
and its complications; the total yearly cost in the United States
is over 20 billion dollars (Langer et al. (1993) Science
260:920-926). Diabetes is characterized by pancreatic islet
destruction or dysfunction leading to loss of glucose control.
Diabetes mellitus is a metabolic disorder defined by the presence
of chronically elevated levels of blood glucose (hyperglycemia).
Insulin-dependent (Type 1) diabetes mellitus ("IDDM") results from
an autoimmune-mediated destruction of the pancreatic .beta.-cells
with consequent loss of insulin production, which results in
hyperglycemia. Type 1 diabetics require insulin replacement therapy
to ensure survival. Non-insulin-dependent (Type 2) diabetes
mellitus ("NIDDM") is initially characterized by hyperglycemia in
the presence of higher-than-normal levels of plasma insulin
(hyperinsulinemia). In Type 2 diabetes, tissue processes which
control carbohydrate metabolism are believed to have decreased
sensitivity to insulin. Progression of the Type 2 diabetic state is
associated with increasing concentrations of blood glucose, and
coupled with a relative decrease in the rate of glucose-induced
insulin secretion.
[0172] The primary aim of treatment in both forms of diabetes
mellitus is the same, namely, the reduction of blood glucose levels
to as near normal as possible. Treatment of Type 1 diabetes
involves administration of replacement doses of insulin. In
contrast, treatment of Type 2 diabetes frequently does not require
administration of insulin. For example, initial therapy of Type 2
diabetes may be based on diet and lifestyle changes augmented by
therapy with oral hypoglycemic agents such as sulfonylurea. Insulin
therapy may be required, however, especially in the later stages of
the disease, to produce control of hyperglycemia in an attempt to
minimize complications of the disease, which may arise from islet
exhaustion.
[0173] More recently, tissue-engineering approaches to treatment
have focused on transplanting healthy pancreatic islets, usually
encapsulated in a membrane to avoid immune rejection. Three general
approaches have been tested in animal models. In the first, a
tubular membrane is coiled in a housing that contained islets. The
membrane is connected to a polymer graph that in turn connects the
device to blood vessels. By manipulation of the membrane
permeability, so as to allow free diffusion of glucose and insulin
back and forth through the membrane, yet block passage of
antibodies and lymphocytes, normoglycemia was maintained in
pancreatectomized animals treated with this device (Sullivan et al.
(1991) Science 252:718).
[0174] In a second approach, hollow fibers containing islet cells
were immobilized in the polysaccharide alginate. When the device
was place intraperitoneally in diabetic animals, blood glucose
levels were lowered and good tissue compatibility was observed
(Lacey et al. (1991) Science 254:1782).
[0175] Finally, cells have been placed in microcapsules composed of
alginate or polyacrylates. In some cases, animals treated with
these microcapsules maintained normoglycemia for over two years
(Lim et al. (1980) Science 210:908; O'Shea et al. (1984) Biochim.
Biochys. Acta. 840:133; Sugamori et al. (1989) Trans. Am. Soc.
Artif. Intern. Organs 35:791; Levesque et al. (1992) Endocrinology
130:644; and Lim et al. (1992) Transplantation 53:1180). However,
all of these transplantation strategies require a large, reliable
source of donor islets.
[0176] The progenitor cells of the invention can be used for
treatment of diabetes because they have the ability to
differentiate into cells of pancreatic lineage, e.g., .beta. islet
cells. The progenitor cells of the invention can be cultured in
vitro under conditions which can further induce these cells to
differentiate into mature pancreatic cells, or they can undergo
differentiation in vivo once introduced into a subject. Many
methods for encapsulating cells are known in the art. For example,
a source of .beta. islet cells producing insulin is encapsulated in
implantable hollow fibers. Such fibers can be pre-spun and
subsequently loaded with the .beta. islet cells (Aebischer et al.
U.S. Pat. No. 4,892,538; Aebischer et al. U.S. Pat. No. 5,106,627;
Hoffman et al. (1990) Expt. Neurobiol. 110:39-44; Jaeger et al.
(1990) Prog. Brain Res. 82:41-46; and Aebischer et al. (1991) J
Biomech. Eng. 113:178-183), or can be co-extruded with a polymer
which acts to form a polymeric coat about the .beta. islet cells
(Lim U.S. Pat. No. 4,391,909; Sefton U.S. Pat. No. 4,353,888;
Sugamori et al. (1989) Trans. Am. Artif. Intern. Organs 35:791-799;
Sefton et al. (1987) Biotehnol. Bioeng. 29:1135-1143; and Aebischer
et al. (1991) Biomaterials 12:50-55).
[0177] In certain embodiments, the cells of the invention may also
be used for the treatment of, for example, diseases of the liver,
or disorders of insufficient production of blood cells, such as
thrombocytopenias, anemias or for transplanting into radiation
therapy patients.
[0178] Moreover, in addition to providing a source of implantable
cells, either in the form of the progenitor cell population of the
differentiated progeny thereof, the subject cells can be used to
produce cultures of pancreatic cells for production and
purification of secreted factors. For instance, cultured cells can
be provided as a source of insulin. Likewise, exocrine cultures can
be provided as a source for pancreatin.
[0179] Yet another aspect of the present invention provides methods
for screening various compounds for their ability to modulate
growth, proliferation or differentiation of distinct progenitor
cell populations from pancreatic ductal epithelial culture. In an
illustrative embodiment, the subject progenitor cells, and their
progeny, can be used to screen various compounds or natural
products. Such explants can be maintained in minimal culture media
for extended periods of time (e.g., for 7-21 days or longer) and
can be contacted with any compound, e.g., small molecule or natural
product, e.g., growth factor, to determine the effect of such
compound on one of cellular growth, proliferation or
differentiation of progenitor cells in the explant. Detection and
quantification of growth, proliferation or differentiation of these
cells in response to a given compound provides a means for
determining the compound's efficacy at inducing one of the growth,
proliferation or differentiation in a given ductal explant. Methods
of measuring cell proliferation are well known in the art and most
commonly include determining DNA synthesis characteristic of cell
replication. There are numerous methods in the art for measuring
DNA synthesis, any of which may be used according to the invention.
In an embodiment of the invention, DNA synthesis has been
determined using a radioactive label (.sup.3H-thymidine) or labeled
nucleotide analogues (BrdU) for detection by immunofluorescence.
The efficacy of the compound can be assessed by generating dose
response curves from data obtained using various concentrations of
the compound. A control assay can also be performed to provide a
baseline for comparison. Identification of the progenitor cell
population(s) amplified in response to a given test agent can be
carried out according to such phenotyping as described above.
[0180] (iv) Exemplification
[0181] The invention now being generally described, it will be more
readily understood by reference to the following examples which are
included merely for purposes of illustration of certain aspects and
embodiments of the present invention, and are not intended to limit
the invention.
EXAMPLE 1
Isolation of Pancreatic Progenitor Cells
[0182] Methods
[0183] Duct Isolation and Culture
[0184] Pancreata from two litters of 2 week old Sprague-Dawley rat
pups were isolated and placed into 10 ml of (1 U/ml in DMEM)
Collagenase A (Boehringer-Mannheim, St. Louis) and digested for 40
min at 37.degree. C. in a shaking water bath at 150-175 rpm. The
digest was vortexed briefly and washed once with
Ca.sup.++/Mg.sup.++-free HBSS (Gibco BRL, Grand Island, N.Y.). The
pellet was resuspended in HBSS and filtered through a 500 .mu.m
mesh (Costar Corning, Cambridge, Mass.) and washed again. The
pellet was resuspended to 50 ml in HBSS; 10 ml was transferred to a
10 cm culture plate (Costar Corning) and placed under a dissecting
scope. Individual duct fragments were selected by aspiration with a
micropipette and transferred to a plate containing medium with
serum. The fragments were selected from this plate a second time,
transferred to a fresh tube of medium and serum, and washed before
being plated. Fragments were cultured on plastic in Iscoveis
modified DMEM (Gibco-BRL) containing 5% FBS (Gibco-BRL), glutamine
and 1% Pen/Strep (Gibco-BRL). For the study of individual duct
fragments, ducts were grown on 8 well chamber slides (Lab-Tek,
Naperville Ill.). For generating monolayers or NACs, duct fragments
were plated to four 4-well plates (Nunc) per prep. Induction of
NACs was achieved by a medium change after confluence (generally
day 5 in culture) to Iscoveis DMEM supplemented with 5% FBS,
glutamine, Pen/Strep and Dexamethasone (1 .mu.M, Sigma), Cholera
Toxin (100 ng/ml, Sigma), and EGF (10 ng/ml, Gibco). NACs were
harvested after 48 hours.
[0185] Immunocytochemistry
[0186] Cultures, ducts, and non-adherent cells were fixed in 1%
paraformaldehyde and permeabilized in PBS containing 0.3%
TritonX-100 (PBST). Nonspecific binding sites were blocked by
preincubation in a blocking buffer consisting of 5% normal donkey
serum (Jackson ImmunoResearch) and 1% BSA (Sigma) in PBST. All
antibodies were diluted in this blocking buffer. Incubations with
primary antibody were carried out overnight at 4.degree. C. in a
humidified chamber. Primary antibodies used were: guinea pig
anti-insulin (Linco, 1:2000); mouse anti-insulin/proinsulin
(Biodesign, directly conjugated to biotin using a labeling kit from
Boehringer Mannheim); guinea pig anti-glucagon (Linco, 1:2500),
mouse anti-somatostatin (Biomeda, 1:50); rabbit anti-pancreatic
polypeptide (Zymed, 1:50); rabbit anti-amylase (Sigma, 1:1500), and
rabbit anti-PDX-1 (gift of Christopher Wright, Vanderbilt, 1:2000).
Secondary antibodies and tertiary reagents were: FITC-conjugated
donkey anti-guinea pig IgG (Jackson ImmunoResearch, 1:200);
Cy3-conjugated donkey anti-guinea pig, rabbit, or mouse IgG
(Jackson, 1:1000); biotin-conjugated donkey anti-rabbit or mouse
IgG (Jackson, 1:500); AvidinD-FITC (Vector Labs, 1:1000);
streptavidin-Cy3 (Jackson, 1:1000). Cells were scored on a Nikon
Eclipse E800 epifluorescent or Nikon Diaphot 300 inverted
fluorescent/phase photomicroscope.
[0187] Single Cell cDNA Amplification and PCR Analysis
[0188] cDNAs from single cells were amplified according to Brady et
al. (1993) and Dulac and Axel (1995). Single NACs were randomly
picked and transferred into PCR tubes containing ice-cold lysis
buffer. The first strand cDNA synthesis and subsequent PCR
amplification were performed exactly as described (Dulac and Axel,
1995) except that the PCR reactions were performed in a total
volume of 50 .mu.l instead of 100 .mu.l. The amplified cDNAs were
electrophoresed on a 1% agarose gel and the size of DNA fragments
ranged from 0.5-1 kb as expected. The aliquots of individual cDNAs
were then analyzed for marker genes by PCR using specific PCR
primers. The PCR reactions were run for 35 cycles each at
94.degree. C. for 30 sec, 55.degree. C. for 1 min, and 72.degree.
C. for 2 min. Amplimer sequences were:
ATGTCGTCCAGGCCGCTCTGGACAAAATATGAATTCT.sub- .24; insulin: 5 primer,
CACAACTGGAGCTGGGTGGAG; 3 primer, CAAAGGCTTTATTCATTGCAGAGG; PDX-1:
50 primer, GACCGCAGGCTGAGGGTGAG; 3 primer, CAGAGGTCTGCCAGCATCTCG;
glucagon: 50 primer, TCCCAGAAGAAGTCGCCATTG; 3 primer,
TTCATTCCGCAGAGATGTTGTG; beta-actin: 5' primer, AAG TCC CTC ACC CTC
CCA AAA G; 3' primer, AAC ACC TCA AAC CAC TCC CAG G.
[0189] Insulin Release Assay
[0190] Insulin release was measured under static incubation
conditions using NACs, isolated ducts, monolayer cells, or batches
of 10 islets. Cells or islets were preincubated in Krebs Ringer
Phosphate buffer (KRP) containing 3 mM Glucose (Sigma) and 0.2% BSA
(Sigma) for 30 minutes at 37.degree. C. Supernatant was collected
and the cells washed once before further incubation in 17 mM
glucose for 1 hour at 37.degree. C. This supernatant was then
collected and all samples were kept at -20.degree. C. until the
insulin-specific radioimmunoassay was performed using a RIA kit for
rat C-peptide from Linco Research (St. Charles, Mo.). For insulin
content measurements, cells were extracted in acid-ethanol and
sonicated prior to assay.
[0191] Calcium Imaging
[0192] NACs were immobilized in 0.7% low melting agarose in Hanks
buffer (GIBCO) and dye-loaded for 1 hour at room temperature with 5
.mu.M Fluo-3 acetoxy-methyl (AM) ester (Molecular Probes) in
standard Krebs Ringer Phosphate (KRP) buffer that additionally
contained 0.1% pluronic acid (Molecular Probes) and 1% dimethyl
sulfoxide (Sigma). Cells were then washed to remove excess dye and
placed onto a heated microscope stage (Olympus) and maintained at
32.degree. C. Fluo-3 fluorescence intensity was used as an
indicator of intracellular calcium concentration and was measured
with a confocal laser-scanning microscope (Olympus). The excitation
wavelength was set to 488 nm (argon ion laser) and a 40.times.
water lens was used. The same parameters for laser scanning were
set for each experiment, including confocal aperture and laser
intensity. The laser scanning was performed as an XYT series with
an interval of 10 seconds between each scan in order to resolve
glucose-induced changes in intracellular calcium. The imaging files
were stored and subsequently analyzed with FLUOVIEW software
(Olympus). Cells of interest were circled and the mean intensity of
the circled areas was plotted over time.
[0193] Results
[0194] Isolation, Characterization, and Culture of Pancreatic
Ducts
[0195] In order to establish a defined in vitro culture system, a
population of interlobular ducts was isolated and characterized.
Adult tissue from 1-2 month old animals was initially used to
establish the described culture system, but was eventually replaced
with tissue from 2-3 week old rats which provide a more consistent
and greater yield of clean ducts. Pancreatic tissue was harvested
and subjected to collagenase digestion (Githens & Whelan, 1983;
Githens et al. 1989). Digested tissue was then handpicked in
multiple iterations until a pure population of ducts was obtained
(FIG. 1). A typical experiment provided up to 200-300 fairly
uniform duct fragments per 20 animals. Staining for tubulin beta
III and acetylated -LDL-DiI showed that the selected duct
population was free of neurons and blood vessels (not shown).
[0196] Characterization of the starting material was performed by
analyzing single ducts for expression of insulin, PDX-1, PYY, and
amylase. Table 1 shows that the majority of the handpicked ducts at
time zero were free of these endocrine and exocrine markers.
Greater than 92% of all ducts contained no insulin-immunopositive
cells at the start of culture, and a similar proportion of all
ducts had no immunohistochemically detectable PDX-1. Of those ducts
that tested positive, almost all had only 1-2 cells that were
insulin immunopositive. Analysis of dissociated ducts also showed
that less than 0.05% of time zero duct cells were immunopositive
for insulin and PDX-1 protein (not shown). Similarly,
PYY-containing cells were rare, constituting no more than 0.015% of
the counted cells. Amylase-positive cells constituted 0.02% of the
initial population and probably represented exocrine carryover
since they occurred in rare clusters. The number of cells
expressing either PDX-1 or the endocrine markers insulin or PYY
totaled much less than 0.1% of the cells (Table 1), corroborating
the immunohistochemical observations on sections of adult pancreas
that these cells are rare in mature ducts (data not shown). Since
the average duct fragment contained 3450.+-.1860 cells (n=10
determinations), and the average duct yield was 225 fragments, the
initial number of insulin positive cells at the start of culture
ranged from 80400 per approximately 800,000 cells (Table 1).
[0197] Culturing was performed by placing single duct fragments
within a 1 cm.sup.2 well (FIG. 2) or multiple fragments into 4-well
plates (1.9 cm.sup.2/well). Various substrates were tested
(Matrigel, collagen, hydrogels) but the cleanest and most
interesting results were obtained by simply plating onto charged
plastic. Iscoveis Modified Dulbeccois Media (IMDM) containing 5%
fetal calf serum (FCS) was added to each well and the ducts
cultured over 5 days. The top panel in FIG. 2 shows insulin
staining in a time series of cultured ducts and the bottom panel
the corresponding bright field images. An analysis of single duct
populations indicated that whereas at time zero 8% of the duct
fragments were positive for insulin (Table 1), in as short a time
as 24 hours, the number of ducts containing insulin-positive cells
had increased to 13% and to 17% by day two. These positives
appeared most frequently as single cells or small foci of 24 cells
(FIG. 2). By day five of individual culture 23-25% of the wells
contained insulin-positive cells on the monolayer, with little
change thereafter (through day seven, 46/185 single duct cultures).
One implication of these results is that non-insulin positive ducts
become insulin-positive through culture.
[0198] Increasing the number of duct fragments per well resulted in
a more rapid outgrowth and confluence of the monolayer generally
within 5 days, suggesting that some cross-feeding takes place. We
have standardized our platings to 16 wells (1.9 cm.sup.2) per duct
preparation as a balance between time and cell yield. At seven days
of culture in FBS (T7), the monolayer contains an average of
25.+-.20 (range 0-51) insulin-positive cells per well (0.02% of
total cells) for a maximum expansion of 5-fold over the starting
material. In this system, the majority of cells are
vimentin-positive, non-endocrine and proliferative (as indicated by
BrdU uptake), and probably arise from the stromal cells surrounding
the epithelial layer of duct cells. The insulin-positive cells are
capable of BrdU uptake but this occurs rarely (not shown). The bulk
of BrdU uptake is by vimentin-positive fibroblasts. The slow growth
rate of the early appearing insulin-positive cells on the monolayer
agrees with observations from other investigators demonstrating
that beta cells replicate very infrequently in vitro and in vivo
(reviewed by Sjoholm, 1996; Nielsen et al. 1999). Further culture
beyond seven days did not significantly increase either the number
of wells containing insulin-positive cells or the number of
insulin-positive cells.
[0199] In addition to an increase in the number of cells expressing
insulin, we also observed that some wells in FBS culture contained
a number of amylase-positive cells, often cells that coexpressed
insulin (FIG. 3A-C). Cells expressing both insulin and amylase have
been documented to appear during pancreatic regeneration and are
thought to be activated progenitor cells (Melmed, 1979, Gu et al.
1994). In addition, these cultures contained a rounded and
semi-adherent cell type, many of which appear to express both
markers although the insulin is faint.
[0200] Cells that express PYY and/or glucagon are observed in our
duct cultures (FIG. 3D-F). The coexpression of PYY and glucagon
during early pancreatic development has been postulated to mark
endocrine progenitor cell progression (Upchurch et al. 1994). In
contrast to insulin, the number of PYY-positive cells did not
change during culture (Table 2). Of cells that were
insulin-positive on the monolayer, most but not all coexpressed
PDX-1. Cells that expressed PDX-1 but did not yet express insulin
and vice versa were also observed in culture (FIG. 3G, arrows).
Thus cells representing various stages of differentiation and
different developmental lineages appear in our cultures.
[0201] Appearance of a Non-Adherent Cell Type
[0202] The number of insulin-positive cells did not increase
significantly with culture beyond 5 days due to their slow
replication rate and perhaps cell death. Factors were added to T5
cultures to determine if an increase in the number of
insulin-positive cells could be induced. A number of factors that
affect either epithelial cells or pancreatic development were
tested: dexamethasone, cholera toxin, EGF, TGF.alpha., PDGF.alpha.,
HGF, TGF.beta.I, IL-1.alpha., GLP-1, glucagon, gastrin, GIP, PYY,
NPY, and PP were added to T5 cultures for 2 further days of
incubation. When tested alone most of the factors did not
significantly boost the number of observed insulin-positive cells
(not shown). However, a cocktail of DCE, dexamethasone, cholera
toxin and EGF, significantly increased the number of
insulin-positive cells on the monolayer (an average increase of 2-3
fold over n=8 experiments, Table 1). In addition, the presence of
DCE significantly enhanced the appearance of a population of
non-adherent cells (NACs) over the course of 48 hours (FIG. 4).
NACs were observed even in control cultures (FIG. 4A) as well as in
growth factor-treated cultures (FIGS. 4C,D), but none of these
conditions led to the level of induction seen with DCE. In the
examples shown, HGF and TGF.beta.1 were tested for effects on the
monolayer. HGF has been shown to stimulate the growth of fetal
islets (Otonkoski et al. 1994) and TGF.beta.1 has been shown to
inhibit the appearance of endocrine cells in in vitro pancreatic
culture (Sanvito et al. 1994). In our system, HGF and TGF.beta.1
had only slight effects on culture phenotype or NAC production.
[0203] NACs appear spontaneously in confluent monolayer cultures.
Both the number and rate of appearance of NACs are significantly
increased (often >8-fold) by the addition of the DCE cocktail
(FIG. 4B). These cells are characteristically phase-bright, possess
a secretory appearance with high granularity, and generally range
in size from 20-50 .mu.m (FIG. 4 inset). True NACs most often
appear as large round cells freely floating at the surface of the
monolayer. Many others are often still attached and apparently in
the process of emerging. An increase in NACs can be seen by 24
hours post-DCE addition, but appears maximal at 48 hours. Repeated
dosing of DCE into the cultures gave rise to successive waves of
NAC formation but with successively fewer numbers (not shown).
[0204] DCE has previously been shown to promote the growth and
function of primary purified pancreatic epithelial cultures
(Githens et al. 1987, 1989), but no NACS or endocrine cell types
were reported. Perhaps the effect of DCE is indirect; working on
the stromal component of our mixed cell culture system to induce
the differentiation of beta and other islet cell types. Subsequent
testing in our cultures showed that neither dexamethasone nor EGF
alone had significant effects on NAC generation in comparison to
controls, but that the majority of the activity was associated with
the cAMP-elevating effects of the cholera toxin. In fact, many cAMP
agonists also had this effect (data not shown; to be described
elsewhere). The presence of dexamethasone and EGF appeared to
enhance the effect of CT. The size and granularity of the cells
within the NAC population varied markedly, but vital dye staining
showed greater than 99% of the NACs to be viable.
[0205] In terms of the number of ducts that were responsive to DCE,
over 95% of the DCE-treated wells (n>10 experiments, single duct
per well) gave rise to at least a 2-fold increase in NACs over
control wells. Each treated well in a normal culture (8-16 ducts
per well) yielded 3,000-18,000 NACs after 48 hours in DCE (n=9
experiments) with an average yield of about 7000 per well or
approximately 1.times.10.sup.5 NAC cells per prep. BrdU
incorporation experiments demonstrated that one of the effects of
DCE is to stimulate cell division. Pulsing at the end of the 48
hours showed 4-fold more BrdU-positive cells in the DCE-treated
monolayers than in controls, indicating a long-lasting stimulation
of proliferation (not shown). When pulsed at the beginning of DCE
addition, 10% of the NACs recovered at 48 hours were BrdU-positive,
indicating that these cells may derive from a DCE-responsive,
cycling cell. DCE does not appear simply to stimulate the loss of
cell adhesion.
[0206] Hormone Expression in NACs
[0207] Analysis of the monolayer demonstrated that approximately
0.02% of the cells in FBS culture expressed insulin (see Table 1),
with DCE addition increasing that number 2-3 fold to give an
average of 59.+-.52 (range 5-196) insulin-positive cells per well.
In addition to analysis of the monolayer, NACs were analyzed for
expression of insulin and other endocrine markers. Since NACs are
free-floating in the media, they were collected by aspiration at 48
hours post DCE addition, when their appearance was maximal. All
four islet endocrine cell types could be detected
immunocytochemically in this population. FIG. 5 shows NAC
immunostaining for insulin, PDX-1, glucagon, somatostatin, and
pancreatic polypeptide. As shown in FIG. 5A, insulin labeling
demonstrated a continuum of fluorescence intensity with
approximately 4-5% of the cells consistently bright (range 2.5-13%,
n=6 measurements), and the majority of positive cells (>3040% of
the total cell population) exhibiting low levels of
immunofluorescence (A, C) that were still above background (B).
This number of low-insulin-expressing cells was confirmed by FACS
analysis (data to be described elsewhere). Cells expressing PDX-1,
glucagon, somatostatin, and pancreatic polypeptide were also
present in the population (D, E, F and G respectively), with
glucagon-positive cells being the next most frequent (6%), followed
by somatostatin (3%) and pancreatic polypeptide cells the rarest
(2%). The NAC population thus constitutes an enrichment from a
cultured monolayer of the full set of islet endocrine cell
types.
[0208] Transcriptional Profiling
[0209] As a further determination of the number of
insulin-expressing cells within the NAC population, we also
performed semi-quantitative single-cell PCR (Brady et al. 1993,
Dulac & Axel, 1995) to detect insulin mRNA in randomly selected
individual NACs. FIG. 6 shows that 15 of 40 or >35% of the cells
analyzed contained insulin mRNA. Panel A demonstrates that cDNA was
amplified from each single cell sample. Panel B shows that the
insulin message varied in intensity among the positive cells. This
variation in signal intensity, similar to that observed by
immunocytochemistry, was also observed and verified by array
hybridization analysis (data not shown). Two of the 40 selected
cells contained glucagon message (Panel C) with one of them also
containing insulin and PDX-1 message. Panel D shows that greater
than 80% (35/40) of the cells analyzed contained PDX-1 message.
Only one of the insulin-positive cells did not express PDX1,
whereas there were many cells that were PDX-1 positive with no
detectable insulin or glucagon message. The absolute and relative
numbers of insulin and glucagon cells are in good agreement with
that observed by immunocytochemistry, and in the case of insulin,
with flow analysis as well. Interestingly, there were a number of
NACs that did not express any of the three markers. The identities
of these cells is currently unknown. Array hybridization of the 40
cDNAs with a labeled probe to the ribosomal component S6 (RPS6)
demonstrated its presence in all samples (not shown).
Transcriptional profiling confirms the immunocytochemistry results
that many of the NACs express PDX-1, that approximately 40% of the
cells are both insulin mRNA and protein positive, albeit at varying
levels, and that the majority of NACs appear to have a beta cell
phenotype. In addition, there is a significant fraction of cells
that are PDX-1 positive but insulin-negative, which might indicate
progenitor cell status. SC-PCR of monolayer cells showed 23/23
actin-positive, 0/23 insulin positive cells (not shown),
demonstrating the relative enrichment of endocrine phenotypes in
the NAC population.
[0210] Insulin Content and Glucose-Stimulated Insulin Secretion
[0211] A hallmark of functional beta cells is their ability to
secrete insulin in response to elevated glucose levels. In order to
determine whether there are functional beta cells within the duct
cultures, we performed static insulin release assays on both the
monolayer and the NAC populations to determine their responses to
glucose challenge. We also measured total insulin content by RIA in
order to determine the relative increase in insulin expression due
to culture. FIG. 7 shows the glucose-induced insulin release in
isolated time zero ducts, DCE-cultured monolayer, and harvested
NACs. The NAC population demonstrated a 3-fold increase in secreted
insulin in response to elevated glucose. In contrast, the cells
contained in the monolayer exhibited little glucose response and
secreted far less insulin in either high or low glucose conditions.
Analysis of the time zero ducts (n=3) showed no glucose-stimulated
insulin secretion and acid-ethanol extraction of the ducts showed
no detectable insulin within the level of sensitivity (approx. 100
pg/ml) of the RIA. Extraction for total insulin showed a content of
1.34 ng of insulin per 50,000 cells on the monolayer, and 25.0 ng
of insulin per 50,000 NAC cells. In comparison, a normal rat islet
of approximately 1000 cells typically contains about 20 ng of
insulin (data not shown). Furthermore, when NACs recovered from
cultures exposed to DCE for 24, 48, or 72 hours were compared, only
the NACs from the 48-hour cultures demonstrated a reliable
glucose-stimulated insulin response. The data thus show a large
increase in the amount of insulin produced through duct culture and
that the insulin can be productively released in response to
glucose, demonstrating the presence of functional beta cells.
Current studies in are focused on further understanding of the
variables leading to increased cell number, insulin content and/or
functionality.
[0212] Demonstration of a Glucose-Stimulated Reversible Calcium
Current
[0213] A key question to address is how many of the
insulin-containing cells generated in culture possess a functional
glucose response. One way to determine this is to measure the
number of cells capable of generating an inward calcium current in
response to glucose administration. Insulin secretion is known to
be mediated by an inward calcium current linked to glucose
metabolism (Kalkhoff& Siegesmund, 1981, Wang & McDaniel,
1990). To assess the presence and number of functional beta cells
within the culture, we measured cytosolic calcium influx in
response to glucose using the calcium-dependent fluorescent dye
Fluo-3. The results of a representative experiment (n>10) using
NACs is shown in FIG. 8. In this example 33% of the sampled cells
showed strong amplitude and kinetics of calcium current induction
in response to elevated glucose. Measurements of cells still
attached to the monolayer failed to detect glucose-induced changes
in intracellular calcium.
[0214] The amplitude and kinetics of the glucose-induced calcium
current that we observe in our duct culture-derived beta cells are
similar with those documented to occur in islet-derived beta cells
(Asada et al. 1998; Schuit, 1996). Cell-to-cell variations in the
amplitude and kinetics of glucose induced calcium currents have
been interpreted as evidence of heterogeneity in beta cell
physiology. Single beta cells studied in isolation have been shown
to have altered insulin secretion rates and glucose sensitivity in
comparison to intact islets (Halban et al. 1982; Bosco et al.
1989), and individual beta cells have been shown to have markedly
different rates of insulin synthesis (Moitoso de Vargas et al.
1997), all of which are observed in our culture. The amplitude
variation in calcium currents might also be explained by
differences in Fluo-3 dye loading.
[0215] The characteristic calcium current profile was not induced
by 2-deoxyglucose, a non-metabolized glucose analog (Niki et al.
1974, 1993; Malaisse 1979). It was completely inhibited by
diazoxide, a high affinity inhibitor of the SUR-linked potassium
channel (Thomas et al. 1996) that is necessary for calcium-induced
insulin secretion (Henquin et al. 1982; Trube et al. 1986), and was
also inhibited by EGTA (Wollheim & Sharp 1981; Wang &
McDaniel, 1990), which sequesters extracellular calcium (not
shown). It could however be activated by tolbutamide, a
high-affinity activator of the SUR-linked potassium channel, which
is used specifically to stimulate insulin secretion in diabetics
(Sato et al. 1999; Melander, 1998). The reversibility of this
stimulated calcium current is demonstrated in FIG. 8B. In these
experiments (n=3) 10% of the cells could respond reversibly to
glucose and be stimulated finally by the insulin secretagogue
tolbutamide. Fifty-five percent of the cells did not respond to
either stimulus, and the remaining 35% of the cells responded
either to glucose but not tolbutamide, or to tolbutamide but not
glucose, indicating a heterogeneous and complex population. We
conclude that, despite having heterogeneous insulin expression
levels, 10-40% of the NACs could respond to glucose and thus behave
like functional beta cells.
[0216] Discussion
[0217] We describe here an in vitro culture system that allows the
study of functional beta cell formation from a purified pancreatic
duct population. Culture of such ducts resulted both in an increase
in insulin-positive cells over time and an increase in the total
number of duct fragments that became insulin-positive. This latter
result indicates that cells capable of expressing insulin may
become activated during culture. In addition to these results, we
describe the appearance of an interesting population of
non-adherent cells that arises during culture, and whose numbers
and emergence can be directly regulated by addition of factors and
agents.
[0218] These non-adherent cells, which we refer to as NACs, are
heterogeneous in size, granularity, and marker expression.
Immunocytochemical analysis shows that all four islet endocrine
markers can be detected within this population. Our analysis also
shows that these cells appear in ratios similar to their ratios in
the adult pancreatic islet, with the insulin expressing cells being
the most numerous, followed by glucagon, somatostatin, and
pancreatic polypeptide. Because of their relevance to human
disease, assessing the number and functionality of the
insulin-expressing cells has been our major focus.
[0219] The handpicked duct material contained very few
insulin-positive cells at the start of culture. Analysis of the
number of insulin-positive cells at the start and endpoint of
culture demonstrated an increase of up to 500-fold, primarily in
the new nonadherent cell population. Since the insulin-positive
cells observed early in culture rarely incorporated BrdU, we
propose that the majority of the observed beta-like cells arose
from an expanding precursor within the duct.
[0220] The mechanism of DCE stimulation of insulin expression and
NAC formation is not known. One of the components, dexamethasone,
is a glucocorticoid analog known to have multiple effects on
pancreas, including stimulation of fetal islet differentiation
(Korsgren et al. 1993), stimulation of pancreatic tumor cell growth
(Brons et al. 1984), and upregulation of exocrine marker expression
(Rall et al. 1977; Van Nest et al. 1983), but surprisingly also
suppresses insulin expression in mature mouse islets (Lambillotte
et al. 1997). Glucocorticoids have also been shown to upregulate
EGF receptor expression in some cell types such as hepatocytes
(Gladhaug et al. 1989). EGF is an important mitogen and regulator
of gastric and pancreatic epithelium (Meittinen 1997), and in fact
has been shown to stimulate epithelial-like outgrowths in cultured
pancreatic ducts (Heimann & Githens 1991). Agents such as
cholera toxin which raise intracellular cAMP levels have been shown
to stimulate epithelial cell properties (Rindler et al. 1979), and
cholera toxin in combination with EGF has been shown to induce cyst
formation in pancreatic duct and islet cultures (Heimann &
Githens, 1991; Yuan et al. 1996). Interestingly, Heimann and
Githens (1991) used this combination of DCE to identify and purify
ductal epithelium from fibroblasts through the stimulation of cyst
formation in collagen or agarose-embedded cultures. In our hands,
continuous culture of ducts in DCE also leads to monolayer
formation, but without NAC formation. It may be that the choices of
culture architecture (embedded versus flat monolayer) and the
timing of factor addition are responsible for these differences,
and these are currently being investigated.
[0221] Perhaps due to the early and possibly immature nature of the
generated cells, or the fact that the cells have not yet formed the
electrical contacts required for full islet function, the level of
hormone expression found within individual monolayer or NAC cells
was much lower than in adult beta cells. Our insulin extraction
studies indicated that the average NAC cell contains 20-50 fold
less insulin than a comparable adult rat beta cell. It may be that
only the insulin bright cells possess a glucose response and that
the dim cells represent less mature, non-glucose responsive
pre-beta cells. Nonetheless, a much larger proportion of cells
could be demonstrated to possess a glucose-stimulated insulin
secretion response in the NAC population than in a randomly
selected population of monolayer cells. It is likely that our
culture system is missing the trophic influences necessary for
stimulating cell-cell contact, full hormone expression and complete
beta cell maturation. A number of factors have been shown to
increase fetal beta cell insulin expression and enhance insulin
secretion (Otonkoski et al., 1993, 1994; Huotari et al., 1998;
Sorenson & Brelje, 1997) and these are currently being tested
in our system.
[0222] The system we describe herein allows for the first time the
in vitro study of regenerative and neogenic events that until now
have only been described in vivo. We show that the system can be
manipulated to give a range of cell identities, that a significant
increase in insulin-positive cells can be obtained and that within
this population of cells, beta cell-like function can be detected.
Our studies indicate that much of the regenerative and stem cell
activities ascribed to the pancreatic duct system by in vivo
manipulations can be recapitulated through in vitro culture. This
system now makes possible a systematic search for those cells
responsible for these activities as well as the identification of
factors that influence their numbers, hormone content, and
functionality. In addition, this system constitutes the first step
towards achieving the goal of a controlled and defined process to
create functional beta cells through a naturally occurring,
non-cell-engineered process as a therapeutic pathway for the
treatment of insulin-dependent diabetes.
EXAMPLE 2
Induction of Pancreatic Progenitor Cell Differentiation
[0223] The monolayer can be grown in the presence of EGF (10 ng/ml)
or TGF-a (10 ng/ml) to enhance growth. Induction of differentiation
is believed to be cAMP dependent. Agents which induce an increase
in intracellular cAMP levels are anticipated to induce
differentiation.
[0224] The cocktail DCE (1 .mu.M Dexamethasone, 100 ng/ml Cholera
toxin, 10 ng/ml EGF) induces an increase in the number of insulin
positive cells in the cultured duct monolayers. FIG. 9 shows the
comparison of monolayers treated with DCE+5% FCS versus 5% FCS
alone. Ducts were cultured for five days and then treated for an
additional 48 hours. Note that there is an approximate 5-fold
increase in the total number of insulin positive cells in the
culture in response to DCE treatment. The total number of cells in
the culture also increases by approximately 20%. The bars represent
the average of quadruplicate wells.
[0225] Dexamethasone, Cholera toxin, Forskolin, Dibutyrl cAMP and
Na-Butyrate have all been tested and found to induce
differentiation. FIG. 10 shows that Forskolin, Dibutyrl cAMP and
Na-Butyrate can substitute for DCE in inducing the appearance of
floating progenitor cells. Briefly, monolayers of ductal fragments
induced after 5 days culture with the cAMP agonists forskolin and
dibutyryl cAMP as well as the fetal islet differentiating agent
sodium butyrate. Both low and high concentrations of each factor
were applied to the duct monolayer. After 48 hours, the resultant
NACS were collected and counted. Treatments are shown on the x-axis
and number of floating progenitor cells is shown on the y-axis.
Each bar is the added total of duplicate wells.
[0226] We have also observed that secretin can induce
differentiation of the monolayer and the appearance on pancreatic
progenitor cells. In FIG. 11, after 5 days of culture, secretin was
added to the monolayers in a dose range of 1-100 nM. The number of
floating progenitor cells was determined after 48 hours of
treatment. Each bar represents the total of two combined 1.9
cm.sup.2 wells.
[0227] The duct cultures used in FIG. 12 were cultured as described
above. After 48 hours in varying secretin doses, both the number of
insulin positive cells on the monolayer and the total number of
floating progenitor cells were counted and scored. Scoring of
insulin was done by immunocytochemistry. Note that there is a dose
dependent increase in the number of floating progenitor cells. The
number of insulin positive cells in the monolayer also increases
with secretin dose and the apparent decrease in insulin positive
cells at the 50 nm dose is anomalous. Each point represents the
average of duplicate wells. The left hand y-axis denotes the total
number of obtained floating progenitor cells, and the right hand
y-axis denotes the number of insulin positive cells per well.
Secretin dose is shown on the x-axis.
[0228] FIG. 13 demonstrates that Vasoactive Intestinal Peptide
(VIP) also differentiates duct monolayers by inducing the
appearance of floating progenitor cells. After five days in
culture, VIP was added to the cultures and the number of induced
floating progenitor cells was determined after 48 hours of
treatment. C=control and is 5% FCS. The optimal dosage in this
experiment was 50 ng/ml of VIP, which induced a >3-fold increase
in the number of floating progenitor cells versus control. The
y-axis denotes the number of such cells (.times.100). Each bar is
the total of two pooled wells.
[0229] We also observed that the presence of insulin diminishes
secretin-induced differentiation. See FIG. 14. Floating progenitor
cells were induced with secretin (100 nM). Simultaneous addition of
insulin (10 ng/ml) with secretin diminished the overall induction
of floating progenitor cells. Each bar represents the total of two
pooled duplicate wells and the number is expressed on the y-axis as
number cells (.times.100).
EXAMPLE 3
Isolation of Pancreatic Progenitor Cells using Lectin Cell-Surface
Marker
[0230] We also set out to identify cell-type specific markers which
could be used to isolate/purify pancreatic progenitor cells, or the
pancreatic/ductal epithelial which gives rise to such progenitor
cells. Amongs the various canidate reagents we tested, we
discovered that certain lectins preferentially bound to, and
therefor facilitate the isolation of, duct epithelial cells
ultimately able to produce pancreatic progenitor cells.
[0231] Arachis hypogaea (Peanut Agglutinin, PNA) is a plant lectin
that binds to specific carbohydrate groups on cell surfaces. PNA
binds to galactosyl (.beta.-1,3) N-acetyl galactosamine. It was
initially selected for study as a beta cell marker (ref: Heald K A,
Hail C A, Hurst R P, Kane N, Downing R, Diabetes Res 1991 May;
17(1):1-6, Separation of beta-cells from dispersed porcine pancreas
by selective lectin binding); however, in our hands, PNA did NOT
label islet cells from rat, but DID label duct epithelial
cells.
[0232] PNA (Arachis hypogaea, Peanut Agglutinin) was obtained from
Vector Laboratories, FITC-conjugated (Cat.# FL-1071) and used at
1:250-500 dilution.
[0233] Paraffin sections of adult human pancreas were obtained from
Carolina Biological Supply.
[0234] Protocol for histochemistrv: Paraffin sections of adult
human pancreas, adult rat pancreas, embryonic rat pancreas, or
cryosections of adult mouse pancreas were used. Alternatively, Time
0 duct or cultured duct preparations from 2 week old rat pancreas
were examined, with or without paraformaldehyde fixation. PNA-FITC
was used usually at 1:250 dilution in PBS or DMEM/HEPES medium and
incubated for 1 hr to overnight at 4.degree. C., then washed and
mounted under VectaShield mounting medium containing DAPI. Cells
stained without prior fixation were post-fixed before addition of
mounting medium.
[0235] Protocol for FACS: PNA-FITC was diluted 1:250 in sterile
wash buffer (Ca++Mg++-free PBS containing 1% FBS). Dispersed live
cells (approx. 2.times.106 cells) were spun down and resuspended in
100 .mu.l of lectin and incubated for 30-45 min at 4.degree. C.
Cells were then washed twice with sterile wash buffer, resuspended
in 2 ml of Iscoveis modified DMEM containing 5% FBS, Pen/Strep, 1
mM glutamine, and held on ice until run on the FACSVantage.
Standard FACS procedures were used.
[0236] FACS sorted cells were collected into tubes or delivered
directly into multiwell culture plates containing complete Iscoveis
medium (see above). Cell density at seeding, surface substrates,
and culture times were varied. Some cultures were re-analyzed by
FACS, and some were analyzed by histochemistry.
1 2 week rat duct, Percoll prep .dwnarw. Dissociation to single
cell .dwnarw. Incubation of live single cells with PNA-FITC
.dwnarw. FACS and recovery of PNA+ and PNA- cells .dwnarw. Culture
of sorted cells (currently 2 weeks) .dwnarw. Analysis for
differentiated cell types: Histochemistry, LDL uptake, etc.
.dwnarw. Testing of factors that cause (e.g.,) proliferation,
retention of PNA+ character, or differentiation to islet subtypes
.dwnarw. In vitro growth &/or differentiation .dwnarw.
Expansion, implantation into animals for rescue
[0237] Using PNA, we made the following observations:
[0238] (i) PNA as a marker for Epithelial Cells. PNA marks the
single layer of epithelial cells in the pancreatic duct. It does
NOT mark islet cells in rat, in contrast to the report in the
literature of beta cell marking in porcine islets. It does not mark
blood vessels or stromal cells, by immunohistochemistry. PNA marks
the epithelial cells of pancreatic duct in adult animals as well as
the epithelial sheet in embryogenesis (shown at stages e15, e16 and
e18 in rat).
[0239] (ii) PNA labels cell surfaces.
[0240] (iii) PNA-labels live, unfixed, unpermeabilized cells.
[0241] (iv) PNA does not mark the major pancreatic duct (common
bile duct, CBD). PNA marks primarily the medium-sized interlobular
ducts and many of the larger intralobular ducts.
[0242] (v) PNA is a suitable reagent for Fluorescence Activated
Cell Sorting. PNA allows a viable cell sorting and recovery by FACS
(Becton Dickinson FACSVantage); PNA-positive cells can be sorted
directly into multiwell plates. We have applied PNA labeling to
RIN, islet cells, T0 duct, and cultured duct monolayers.
Approximately 5-15% of a T0 duct prep is PNA-positive by FACS
analysis. The percentage does not seem to change very much with
culture (over 4 days in FBS). PNA-positive sorted cells are 76-94+%
pure upon reanalysis, depending on the selectivity of the sort
(events per drop, sort selection mode, etc.). The PNA-negative
population is 99+% negative.
[0243] (vi) PNA-sorted cells have favorable Growth Characteristics.
Cells are viable but nonadherent after sorting. Dispersed duct
cells take a minimum of 7 days to adhere to substrate and begin to
grow. In contrast, whole single ducts sit and begin to spread after
24 hr. Cell viability is dependent on plating density in the
absence of culture additives. An unsorted population of cells
(iPreSorti) proliferates readily; PNA-positive sorts are slowest.
The implication is that other cell types besides the PNA-positive
cells are required for maintaining healthy outgrowth, as well as
certain cell characteristics (below). PNA-positive cells in culture
do not remain PNA-positive (cells restained with PNA-FITC).
[0244] A distinct population of cuboidal endothelial-like cells is
prominent; also flatter, larger, more fibroblastic cells are
present. The former exhibit uptake of DiI-conjugated
acetylated-LDL, a characteristic of endothelial cells, while the
larger flatter cells do not.
[0245] The unsorted and PNA-negative populations grow into cultures
of very mixed phenotype and morphologies. A very small percentage
of cells in these cultures are dil-Ac-LDL-positive (i.e.,
endothelial-like).
[0246] PNA-positive cells in culture are NOT insulin or PDX-1
positive. Many cells in the mixed PreSort population are positive
for both of these beta cell markers. By and large, the strong
PDX-positive cells are weak or negative for PNA. Strongly
PNA-positive cells are not PDX-positive. This suggests a
progression from one cell type to another.
[0247] A small number of cells in the PNA-negative cell cultures
are positive for Insulin and PDX-1 This suggests either that a
small number of PDX+cells (that were PNA-negative) were recovered,
or that the presence of the other cell types has activated PDX-1
expression, perhaps from a small carryover of PNA-positive
progenitor cells.
[0248] PDX-1 expression is much higher (more numerous and
relatively brighter) than Insulin expression in these cultured duct
preps. Since PDX-1 protein is a regulator of Insulin expression,
this finding also suggests a progression, from PDX-1 positive to
Insulin-positive.
[0249] Glucagon-positive cells outnumber PYY-positive cells,
although both are rare in all sort fractions. Previous work has
indicated that PYY-positive cells precede appearance of Glucagon
cells; thus these results would suggest progenitor cells have
already progressed beyond this point.
[0250] Base on these findings, we conclude that the ability of PNA
to selectively detect pancreatic duct epithelial cells may permit
the recovery of a population of cells containing an islet
progenitor cell type. These cells in themselves appear to be
insufficient to survive and differentiate; that is, other cells or
factors may potentiate proliferation and differentiation.
Nonetheless, PNA-selection represents a large step forward in being
able to perform recombination experiments to identify the
components necessary to grow pancreatic islets.
[0251] FIGS. 15-17 illustate the phenotype of cells which have been
cultured for two weeks after being sorted on the basis of PNA
staining.
[0252] FIGS. 18 and 19 illustrate the specificity of PNA in adult
and embryonic pancreas.
[0253] FIGS. 30 and 31 illustrate the binding of other lectins to
adult rat pancreas.
[0254] FIGS. 32-39 illustrate the specificity of binding of lectins
to adult human pancreas.
EXAMPLE 4
Identification of Genotype of Pancreatic Progenitor Cells
[0255] In order to improve our technique for isolating pancreatic
progenitor cells, we have designed a protocol for determining the
identity of a pancreatic beta cell, or it precursor, in terms of
its gene expression profile. In general, the method applies single
cell cDNA amplification to gene expression analysis. In such a
manner, the gene expression "fingerprint" for a cell at a
particular stage of development can be obtained by arrayed
hybridization.
[0256] Briefly, single cells are isolated, e.g., from pancreatic
tissue, The cDNA from each cell are amplified by the single cell
PCR developed by Brail et al. (1999) Mutat Res 406: 45-54, and
labelled with P.sup.32. The cDNAs are then selected for existence
of particular messages, e.g., insulin and PDX1.
[0257] cDNAs of known pancreatic markers are generated by PCR and
arrayed on nylon membranes. The resulting assays are used to
hybridize with the labelled single cell cDNAs. The autoradiograph
images of the array can be used to define and identify the gene
expression profile for an individual cell.
[0258] FIGS. 20-29 further illustate the protocol. FIG. 20 shows
the results of typical single cell mRNA PCR amplification
reactions. FIG. 21 illustrates the changes in the gene expression
during pancreatic development, as determined by the subject method.
FIG. 22 illustrates one embodiment of an array of markers for
detecting beta cells and precursors thereof.
[0259] FIG. 23 shows typical autoradiographs profiling gene
expression in adult and embryonic pancreatic tissue, and heart.
FIG. 24 demonstates how quantatitve analysis of gene expression can
be carried out as part of a determination of the gene expression
profile of a cell. Likewise, FIG. 25 shows autoradiographs
profiling gene expression in embryonic pancreatic tissue at
different stages and after different stimulus; FIG. 26 illustate
the quantatitve analysis of the autoradiagraphs.
[0260] FIG. 27 shows autoradiographs profiling gene expression in
the so-called floating progenitor cells described in the examples
above; and FIG. 28 illustate the quantatitve analysis of the
autoradiagraphs of FIG. 27. Using the subject method, we have
demonstrated that our pancreatic progenitor cells are PNA.sup.+ and
PDX1.sup.- when they are first isolated. As the cells differentiate
to insulin-secreting cells (insulin.sup.+), they become PNA.sup.+,
PDX1.sup.+. The earlier progenitor cells, in addition to being
PNA.sup.+, PDX1.sup.-, insulin.sup.-, PYY.sup.-, glucagon.sup.- and
cytokeratin.sup.+.
[0261] FIG. 29 shows the relative levels of expression of certain
genes between adult islets and during pancreatis development.
EXAMPLE 5
Implanted Cells from a Pancreatic Duct-Derived Culture Transiently
Rescues the Diabetic State
[0262] SCID/icr1 mice were obtained from Taconic. Average weight
per mouse was 25 g. Streptozotocin (STZ) was purchased from Sigma
and made into a 30 mg/ml solution in 20 mM sodium citrate buffer,
pH 4.5. Each animal received STZ at a dose of 200 mg/kg and fed ad
libitum prior to fasting blood glucose (food removed the previous
evening) on the morning of the 3.sup.rd day post injection.
Diabetic animals were those found to have blood glucose in excess
of 200 mg/dl with the average centering around 300 mg/dl. Insulin
pellets (Innovative Research of America) that released 1.2 U of
porcine insulin per day for 7 days were then implanted via trochar
subcutaneously over the scapula. After monitoring for recovery from
the diabetic state (blood glucose=100 mg/dl), either cells derived
from pancreatic duct culture, or isolated adult pancreatic islets
were then implanted under the renal capsule using standard surgical
procedures. Either 500,000 or 10.sup.6 cells (non-adherent cell
(NAC) fraction of duct culture) were implanted into mice. All
operated mice survived in placebo, islet, and insulin pellet only
groups. 6/7 cell implanted mice died 48-72 hours post implantation.
For all groups fasting blood glucose was measured at standard
intervals by tail bleed.
[0263] As shown in FIG. 40, a heterogeneous population containing
functional beta cells derived from the non-adherent portion of a
differentiated pancreatic duct monolayer was implanted into
streptozotocin (STZ)-treated diabetic mice. SCID mice injected with
STZ became diabetic within 48 hours. Insulin containing pellets
were then implanted subcutaneously to stabilize the blood glucose
and create a more stable environment for cell implantation. The
insulin pellet was designed to expire 7 days post-implantation at
T=11 days (T11). Within 48 hours of pellet implant the fasting
blood glucose of these animals were reduced from a range of 280-380
mg/dl blood glucose to less than 50 mg/dl. In test groups either
cells or adult islets as positive control were then implanted under
the renal capsule. One week later (T13) fasting blood glucose was
measured and again at days 16, 21, and 28. Black squares represent
placebo group (n=5 mice) and as expected, in the absence of
insulin, the blood glucose slowly climbed over time to well over
300 mg/dl. Animals (n=5) implanted with insulin pellets only and no
cell implants also performed as expected, with a transient rescue
followed by diabetic rebound after the insulin release tablet had
expired (red diamonds). Animals receiving islets (blue triangles,
n=5, 400 islets per animal) showed perfect long term rescue with
fasting blood glucose being maintained at approximately 100 mg/dl.
The single surviving animal receiving duct-derived cells (green
circles, n=1 of 7) showed a transient rescue of the diabetic state.
The single animal demonstrated a 4-5 day lowering of >150 mg/dl
blood glucose before rebounding to pre-implant blood glucose
levels.
EXAMPLE 6
Pancreatic Duct Sphere Culture
[0264] Methods:
[0265] Isolation of pancreatic ducts. P14 rat pancreas were
collected and digested with Collagenase type A (1 U/ml) in a 37
degree C. water bath with vigorous shaking for 40 minutes. The
digested tissues were washed with HBSS, filtered through a 500
micron mesh (Co-Star Netwell), and taken into HBSS. The tissue
suspensions were then layered on top of 35% Percoll over 45%
Percoll gradient (at a 1:1:1 volume ratio) and centrifuged at 1970
rpm for 10 minutes. The ducts were collected at the interface
between the top layer and the percoll gradient and washed with HBSS
containing 2% BSA. The islets were carefully picked out from the
duct suspension under the dissecting microscope.
[0266] Dissociation of the duct cells. The duct suspensions in HBSS
were centrifuged at 1000 rpm for 5 minutes. The duct pellets were
taken into dissociation enzyme cocktail containing 1.33 mg/ml
trypsin, 0.7 mg.ml hyaluronidase, 0.2 mg/ml kynerenic acid, and 200
U/ml DNAse in HBSS with Ca.sup.2+/Mg.sup.2+ and were incubated at
37 degrees C. for 4 minutes followed by 3 minutes incubation at
room temperature. The digestions were stopped by the addition of
1/4 volume of 4% BSA in HBSS. The dissociated duct cells were
passed through a 70 micron nylon mesh and centrifuged at 1450 rpm
for 5 minutes. The cell pellets were washed again with 4% BSA in
HBSS with Ca.sup.2+/Mg.sup.2+. The dissociated single duct cells
were resuspended in the culture media and counted with Trypan blue
for viable cells.
[0267] Duct sphere culture for expansion. The dissociated duct
cells were seeded at the density of 6 million cells/P100 Petri dish
in the culture media containing 10 ng/ml bFGF, 20 ng/ml EGF, 10
ng/ml HGF, 8 ng/ml TGF.alpha., 30 ng/ml IGF-I and IGF-II, 2% B27
supplements (Gibco/BRL), 8 mM HEMES, 2 mM glutamine, 100 U/ml
penicillin and 100 .mu.g/ml streptomycin in DMEM-F12 medium. The
growth factors were added to the medium every 48 hours after the
initial plating of the cells. The sphere passages were made by
obtaining the spheres in suspension and dissociating the spheres
with 0.016% trypsin at 37 degrees C. for 3 minutes and the
digestions were stopped by 1/4 volume of 4% BSA. The medium above
is the optimal medium for growth. Other media were tested with
varying effects. Test Media 1 is a KO-Basal medium with 15% KO-SR
plus TGF.alpha., HGF, IGF-I and IGF-II. Test Media 2 is a Liver
Basal medium with 15% KO-SR plus TGFa, HGF, IGF-I and IGF-II. Test
Media 3 is an N-2 based DMEM/F12 Basal medium with EGF, bFGF and
LIF. Cells could be grown rapidly but appeared less healthy in Test
Medium 2. Cells grew more slowly but appeared healthier in Test
Medium 3.
[0268] Partial in vitro differentiation of the duct spheres. The
spheres were gently collected from the culture medium into a 15 ml
tube and the spheres were allowed to settle by gravity. The spheres
were then seeded into 96-well plates containing HTB9 matrix in the
differentiation medium containing 30 micromolar forskolin, 100
ng/ml PYY, 5% FBS in Iscove's Modified Dulbecco's Medium with 25 mM
glucose. The cells formed a monolayer on the matrix and under went
differentiation for 4 to 7 days, and were then stopped for
differentiation by washing with PBS and fixed with 1% PFA.
[0269] Results:
[0270] Duct cells cultured in medium containing growth factors such
as EGF, bFGF and LIF in non-fissue culture (non-adherent) plates
formed spheres over a period of two days after initial seeding. A
few cells became attached to the bottom of the plate, but the
spheres were found in suspension, not adhered to the plate or to
other cells adhered to the plate. The spheres were propagated for
24 days by passaging every five days on average. Only non-adhered
cells were passaged.
[0271] After plating of cells on HTB9 matrix, most cells migrated
out of the spheres and formed a monolayer within 24 hours of
plating. The cells were fixed by 1% PFA and costained with for
anti-Glut2/nestin antibodies. Glut2 positive cells are in clusters
and they are excluded from nestin positive cells, suggesting that
nestin cells are undifferentiated cells in the population. Nestin
is typically a marker for relatively undifferentiated cells of
endodermal lineage. Glut2 is a marker for cells tending towards
becoming pancreatic .beta. cells. There were about 26 Glut2
clusters in a 96 well plate.
[0272] Cells differentiated from the spheres also showed staining
for Pdx-1 and glucagon. There were many colonies of Pdx-1 cells on
the plates and mixed in these colonies were glucagon-positive
cells. Glucagon positive cells were not Pdx-1 positive. Given that
a colony of cells on the plate are likely to have risen from a
common set of progenitor cells, it appears that a single group of
progenitor cells is able to give rise to both cell types: the
glucagon positive cells and the Pdx-1 positive cells. There were
about 24-26 Pdx-1 positive colonies per 96 well plate and each
colony contained 15-20 cells on average.
[0273] Co-staining with Pdx-1 and insulin showed, as above, a large
number of Pdx-1 positive colonies. insulin positive cells were
tightly associated with the Pdx-1 positive colonies. About 16% of
Pdx-1 positive cells were insulin positive, and some
insulin-positive cells did not express Pdx-1. This strongly
suggests that Pdx-1 and insulin positive cells were derived from
the same set of progenitor cells.
[0274] Duct spheres in growth state (undifferentiated) were assayed
for cell marker. Spheres were dissociated and put onto cytospin
slides. The cells were stained with anti-nestin antibodies. 50% of
cells stained nestin positive--a far greater proportion of
nestin-positive cells than after differentiation. This again
suggests that nestin-positive cells are undifferentiated. Cells
from undifferentiated spheres were further co-stained with either
Pdx-1/insulin or Glut-2/nestin. Positive cells were counted under a
fluorescent microscope.
[0275] Although there were Pdx-1 positive cells, the ratio of
positive cell/total cell population was lower with spheres in
growth state (approx. 2%) than in cells from spheres after
differentiation (approx. 5-8%).
EXAMPLE 7
Hematopoietic Cell Sphere ("Hemesphere") Culture
[0276] A. Isolation of Lin- Fetal Liver Cells
[0277] Fetal livers from E13.0 mouse embryos were isolated and
titurated to obtain a single cell suspension. Cells were incubated
with a cocktail of biotin conjugated antibodies specific for the
following hematopoietic lineage markers: Ter-119, Mac-1, Gr-1,
B220, CD4, CD8a, CD8b.2. After incubation with Streptavidin-MACS
magnetic microbeads the labeled cells were passed through a MACS
depletion column. The flow through fraction contained the Lin-cell
population. All cell fractions were FACS analyzed for the presence
of Sca-1, c-kit and Lin markets at the time of isolation (see
below).
[0278] B. Culture of Lin- E 13.0 Fetal Liver Cells
[0279] 4-8.times.10e6 Lin- fetal liver cells were resuspended in 10
ml of hemesphere culture media (DMEM/F12, 2 mM L-Glutamine, 8 mM
Hepes buffer, 100 U/ml Penicillin/Streptomycin, 1:50 dilution of
B-27, 20 ng/ml EGF, 10 ng/ml bFGF). Two separate culture conditions
were established; Hemesphere Culture #1 was supplemented with 100
ng/ml mSCF, and Hemesphere Culture #2 was supplemented with 100
ng/ml mSCF, 1000 U/ml mLIF, 50 ng/ml mFlt3 Ligand. The cells were
plated in their respective media on 10 cm non-adherent plastic
Petrie dishes. Cells were incubated for 1 week during which time
cell aggregates or clusters appeared in the media. Cell death was
also apparent in the cultures. After one week the cells were
trysinized to single cells and re-seeded in fresh media. Each time
the culture was passaged by trypsinization new cell clusters
formed. In both culture conditions the cell clusters contained only
healthy, viable cells.
[0280] C. Remarks on the Cultured
[0281] Hemesphere Culture #1 (SCF added): The cell clusters
contained only healthy, viable cells. There were two populations of
single cells evident in the cultures; healthy, viable cells and
dead cells. The cell clusters grew as loose aggregates in
suspension (see FIGS. 1 and 2). Although the clusters could become
quite large, the cells within them remained healthy.
[0282] Hemesphere Culture #2 (SCF, LIF, Flet3-Ligand added): The
cell clusters contained only healthy, viable cells. There were
three populations of single cells evident in the cultures; a few
healthy, viable cells, many irregularly shaped cells and many dead
cells (FIG. 3). This culture showed much higher cell proliferation
rate than Culture #1. Cell clusters did not become large aggregates
as in Culture #1.
[0283] FACS Analysis of Cultures
[0284] The mouse hematopoietic cells with the cell surface antigen
profile Sca-1+, c-kit+, Lin- have been demonstrated previously to
be highly enriched in long-term repopulating stem cells, both from
fetal liver and from bone marrow (Ref. 1, Review).
[0285] Hemesphere Culture #1
[0286] The population of Sca+, c-kit+, Lin- cells in the starting
population of isolated E13.0 fetal liver before Lin depletion was
0.06% (in the stem cell enriched gate, R2) (FIG. 4, lower right,
gate G5). After Lin depletion it was increased to 0.39% (FIG. 5
lower right, gate G5). Less than 1% Lin+cells remained in the Lin-
population (not shown). After 14 days in culture 90% of the cells
remained Lin-. Of those Lin- cells, 79% are also Sca+ and
c-kit+(top left dot plot, FIG. 6). The cell population was very
homogeneous, and contained a few dead cells, as shown by the FSC
and SSC plots (FIG. 6, right panel). After 20 days in culture the
cell population remained homogeneous. The Sca+, c-kit+, Lin-
population comprised 67% of the viable cells in the culture (FIG.
7).
[0287] Hemesphere Culture #2
[0288] The population of Sca+, c-kit+, Lin- cells in the starting
population of isolated E13.0 fetal liver before Lin depletion was
0.27% (in the stem cell enriched gate, R2) (FIG. 8, lower right,
gate G5). After Lin depletion it was increased to 1.99% (FIG. 9,
lower right, gate G5). Approximately 1-2% Lin+cells remained in the
Lin- population (not shown). After 7 days in culture 7.35% of the
cells remained Lin-. Of those Lin- cells, 10.78% are also Sca+ and
c-kit+(FIG. 10). This low percentage is because the majority of the
Lin- population does not express Sca-1 or c-kit. Also, the majority
of the cells in the total population were dead, as judged by
propidium iodide staining (not shown). The dead cells are localized
to the large diagonal population of cells located outside the R1
gate on the FSC and SSC plot (FIG. 10, right panel). After 11 days
in culture the Sca+, c-kit+, Lin- population comprised 28.28% of
all the viable cells in the culture (FIG. 11, lower right, gate
G5). Virtually all of the viable cells were now expressing Sca-1.
There were still many dead cells in the culture, as shown by the
FSC and SSC plot.
[0289] Histological Analysis of Cells in Hemesphere Culture
[0290] Cells from each hemesphere culture were cytospun on to glass
slides and stained with May-Grunwald Giemsa (FIG. 12). Cells from
Hemesphere Culture #1 (cultured for 20 days) are shown in the left
panel. Cells from Hemesphere Culture #2 (cultured for 13 days) are
shown in the right panel. Cell clusters from both cultures show
cells that contain mostly nucleus, with little cytoplasm. This is
consistent with an immature cell type. Many granules and vacuoles
are also seen. The cells on the periphery of the cluster (in
Culture #1) appear more macrophage-like. The immature phenotype and
granular appearance of the cells are similar to that obtained from
in vitro AGM culture (Ref. 2), and from fetal liver cells grown on
an AGM-derived endothelial cell line (Ref. 3).
REFERENCES
[0291] 1. Domen, J. and I. L. Weissman (1999) Molecular Medicine
Today, 5, 201-208.
[0292] 2. Mukouyama, Y. et al. (1998) Immunity, 8, 105-114.
[0293] 3. Ohneda, O. et al. (1998) Blood, 92, 908-919.
REFERENCES FOR EXAMPLES
[0294] King, H., Aubert, R. E., Herman, W. H. Global burden of
diabetes, 1995-2025: prevalence, numerical estimates, and
projections. Diabetes Care 1998;21:1414-1431.
[0295] 1998 Disease Management Handbook, Diabetes Statistics;
prevalence of diabetes in the United States. National Diabetes
Information Clearinghouse. NIH Publication No. 96-3926, October
1995.
[0296] Korbutt, G. S., Warlock, G. L. & Rajotte, R. V. Islet
transplantation. Adv. Exp. Med. Biol. 426, 397410 (1997).
[0297] Secchi, A., Di Carlo, V. & Pozza, G. Pancreas and islet
transplantation: current progresses, problems and perspectives.
Horm. Metab. Res. 29, 1-8 (1997).
[0298] Sutherland, D. E., Pancreas and islet cell transplantation:
now and then. Transplant Proc. 28, 2131-2133 (1996).
[0299] Weir, G. C. & Bonner-Weir, S. Scientific and political
impediments to successful islet transplantation. Diabetes
1997;46:1247-1256.
[0300] Bensley, R. R. Studies on the pancreas of the guinea pig.
Amer. J. Anat. 12, 297-388 (1911).
[0301] Shaw, J. W. & Latimer, E. O. Regeneration of pancreatic
tissue from the transplanted pancreatic duct in the dog. Am. J.
Physiol. 76, 49-53 (1926).
[0302] Warren, S. & Root, H. F. The pathology of diabetes, with
special reference to pancreatic regeneration. Am. J. Pathol. 1,
415429 (1925).
[0303] Bonner-Weir, S., Baxtyer, L. A., Schuppin G. T. & Smith,
F. E. A second pathway for regeneration of adult exocrine and
endocrine pancreas. A possible recapitulation of embryonic
development. Diabetes. 42, 1715-1720, 1993.
[0304] Gu, D. & Sarvetnick, N. Epithelial cell proliferation
and islet neogenesis in IFN-g transgenic mice. Development 118,
33-46, 1993.
[0305] Femandes, A., et al. Differentiation of new
insulin-producing cells is induced by injury in adult pancreatic
islets. Endocrinology 1997; 138:1750-1762.
[0306] Githens, S. The pancreatic duct cell: proliferative
capabilities, specific characteristics, metaplasia, isolation, and
culture. J. Ped. Gastroenterol. and Nutr. 1988;7:486-506.
[0307] Lampeter, E. F. et al. Regeneration of beta-cells in
response to islet inflammation. Exp. Clin. Endocrinol. Diabetes 103
(suppl 2), 74-78, 1995.
[0308] Wang, R. N., Kloppel, G. & Bouwens, L. Duct- to
islet-cell differentiation and islet growth in the pancreas of
duct-ligated adult rats. Diabetologia 38, 1405-1411, 1995.
[0309] Rosenberg L. In vivo cell transformation: neogenesis of beta
cells from pancreatic ductal cells. Cell Transplant. 4, 371-383,
1995.
[0310] Melmed, R. N. Intermediate cells of the pancreas.
Gastroenterology 76, 196-201, 1979.
[0311] Cossel, L. Intermediate cells in the adult human pancreas.
Virchows Arch [Cell Pathol.] 47, 313-328, 1984.
[0312] Gu, D., Lee, M.-S., Krahl, T. & Sarvetnick, N.
Transitional cells in the regenerating pancreas. Development 120,
1873-1881, 1994.
[0313] Ohlsson, H., Karlsson, K., Edlund, T. IPF1, a
homeodomain-containing transactivator of the insulin gene. EMBO J.
12: 4251-4259 (1993).
[0314] Offield, M. F. et al. PDX-1 is required for pancreatic
outgrowth and differentiation of the rostral duodenum. Development
122: 983-995 (1996).
[0315] Ahlgren, U., Jonsson, J., Edlund, H. Arrested development of
the pancreas in IPF1/PDX1 deficient mice reveals that the
pancreatic mesenchyme develops independently of the pancreatic
epithelium. Development 1996; 122:1409-1416.
[0316] Madsen, O. D. et al. Pancreatic development and maturation
of the islet B cell. Eur. J. Biochem. 1996;242:435-445.
[0317] Edlund, H. Transcribing pancreas. Diabetes 1998;47;
1817-1823.
[0318] Upchurch, B. H., Aponte, G. W., Leiter, A. B. Expression of
peptide YY in all four islet cell types in the developing mouse
pancreas suggests a common peptide YY-producing progenitor.
Development 1994; 120:245-252.
[0319] Githens, S. et al. Biochemical and histochemical
characterization of cultured rat and hamster pancreatic ducts.
Pancreas 2, 427-438, 1987.
[0320] Githens, S., Schexnayder, J. A., Desai, K. & Patke, C.
L. Rat pancreatic interlobular duct epithelium: isolation and
culture in collagen gel. In Vitro Cell Dev. Biol. 25, 679-688,
1989.
[0321] Goloslow, N. & Grobstein, C. Epitheliomesenchymal
interactions in pancreatic morphogenesis. Dev., Biol. 4, 242-7255,
1962.
[0322] Wessels, N. K. & Cohen, J. H. Early pancreas
morphogenesis: morphogenesis, tissue interactions and mass effects.
Dev. Biol. 15, 237-270, 1967.
[0323] Apelqvist, A., Ahlgren, U., Edlund, H. Sonic hedgehog
directs specialised mesoderm differentiation in the intestine and
pancreas. Curr. Biol. 1997;7:80.1-804.
[0324] Githens, S. & Whelan, J. F. Isolation and culture of
hamster pancreatic ducts. J. Tissue Cult. Methods
1983;8:97-102.
[0325] Sjoholm, A. diabetes mellitus and impaired pancreatic
beta-cell proliferation. J. Intem. Med. 1996; 239: 211-220.
[0326] Nielsen, J H., Svensson, C., Galsgaard, E D., Moldrup, A.,
Billestrup, N. Beta cell proliferation and growth factors. J. Mol.
Med. 1999; 77: 62-66.
[0327] Otonkoski, T. et al. Hepatocyte growth factor/scatter factor
has insulinotropic activity in human fetal pancreatic cells.
Diabetes 1994;43:947-953.
[0328] Sanvito, F. et al. TGF-beta 1 influences the relative
development of the exocrine and endocrine pancreas in vitro.
Development 1994;120:3451-3462.
[0329] Brady, G., et al. Analysis of gene expression in a complex
differentiation hierarchy by global amplification of cDNA from
single cells. Current Biology 5: 909-922, 1995.
[0330] Dulac, C., & Axel, R. A novel family of genes encoding
putative pheromone receptors in mammals. Cell 83: 195-206,
1995.
[0331] Wang, J.-L. & McDaniel, M. L. Secretagogue-induced
oscillations of cytoplasmic Ca2+ in single and a-cells obtained
from pancreatic islets by fluorescence-activated cell sorting.
Biochem. Biophys. Res. Comm. 166: 813-818, 1990.
[0332] Kalkhoff, R. K. & Siegesmund, K. A. Fluctuations of
calcium, phosphorus, sodium, potassium, and chlorine in single
alpha and beta cells during glucose perifusion of rat islets. J.
Clin. Invest. 68: 517-524, 1981.
[0333] Asada, N., Shibuya, I., Iwanaga, T., Niwa, K., Kanno, T.
Identification of a- and -cells in intact isolated islets of
langerhans by their characteristic cytoplasmic Ca2+ concentration
dynamics and immunocytochemical staining. Diabetes
1998;37:751-757.
[0334] Schuitt, F. Factors determining the glucose sensitivity and
glucose responsiveness of pancreatic beta cells. Horm. Res.
1996;46:99-106.
[0335] Halban, P. A. et al. The possible importance of contact
between pancreatic islet cells for the control of insulin release.
Endocrinology 1982; 111:86-94.
[0336] Bosco, D., Orci, L., Meda, P. Homologous but not
heterologous contact increases the insulin secretion of individual
pancreatic B-cells. Exp. Cell Res. 1989; 184:72-80.
[0337] Moitoso de Vargas, L., Sobolewski, J., Siegel, R., Moss, L.
R. Individual cells within the intact islet differentially respond
to glucose. J. Biol. Chem. 1997; 272: 26573-26577.
[0338] Niki A., Niki, H., Miwa, I., Okuda, J. Insulin secretion by
anomers of glucose. Science 1974;186:150-151.
[0339] Niki, A., Niki, H., Hashioka, T. Effects of specific
inhibitors of sweet taste response on glucose-induced insulin
release. Biomed. Res. 1993;14:13-18.
[0340] Malaisse, W. J., Sener, A., Herchuelz, A., Hutton, J. C.
Insulin release: The fuel hypothesis. Metabolism
1979;28:373-386.
[0341] Thomas, P., Ye, Y., Lightner, E. Mutation of the pancreatic
islet inward rectifier Kir6.2 also leads to familial persistent
hyperinsulinemic hypoglycemia of infancy. Hum. Mol. Genet.
1996;5:1809-1812.
[0342] Henquin J. C. & Meissner H. P. Opposite effects of
tolbutamide and diazoxide on 86Rb+fluxes and membrane potential in
pancreatic-cells. Biochem. Pharmacol. 1982;31:1407-1415.
[0343] Trube, G., Rorsman, P., Shosaku, O. Opposite effects of
tolbutamide and diazoxide on the ATP-dependent K+ channel in mouse
pancreatic-cells. Pfluegers Arch. Eur. J. Physiol.
1986;407:493-499.
[0344] Wollheim, C. B. & Sharp, G. W. G. Regulation of insulin
release by calcium. Physiol. Rev. 1981;61:914-973.
[0345] Sato, Y., Anello, M., Henquin, J. C. Glucose regulation of
insulin secretion independent of the opening or closure of
adenosine triphosphate-sensitive K+ channels in beta cells.
Endocrinology 1999; 140: 2252-2257.
[0346] Melander, A. Pharmacological intervention: the antidiabetic
approach. Eur. J. clin. Invest. 1998; Suppl 2: 23-26.
[0347] Korsgren, O., Andersson, A., Sandler, S. In vitro screening
of putative compounds inducing fetal porcine pancreatic beta-cell
differentiation: Implications for cell transplantation in
insulin-dependent diabetes mellitus. Ups. J. Med. Sci.
1993;98:39-52.
[0348] Brons, G., Newby, A. C. Hales, C. N. Glucocorticoids
stimulate the division of rat pancreatic islet tumour cells in
tissue culture. Daibetologia 1984; 27:540-544.
[0349] Rall, L., Pictet, R., Githens, S., Rutter, W. J.
Glucocroticoids modulate the in vitro development of the embryonic
rat pancreas. J. Cell Biol. 1977;75(2 Pt 1):398-409.
[0350] Van Nest, G., Raman, R. K., Rutter, W. J. Effects of
dexamethasone and 5-bromodeoxyuridine on protein synthesis and
secretion during in vitro pancreatic development. Dev. Biol.
1983;98:295-303.
[0351] Lambillote C., Gilon, P., Henquin, J. C. Direct
glucocorticoid inhibition of insulin secretion. An in vitro study
of dexamethasone effects in mouse islets. J. Clin. Invest.
1997;99:414-423.
[0352] Gladhaug I. P., Refsnes, M., Christoffersen, T. Regulation
of surface expression of high-affinity receptors for epidermal
growth factor (EGF) in hepatocytes by hormones, differentiating
agents, and phorbol ester. Dig. Dis. Sci. 1992;37:233-239.
[0353] Miettinen, P. J. Epidermal growth factor receptor in mice
and men--any applications to clinical practice? Ann. Med.
1997;29:531-534.
[0354] Heimann T. G., Githens, S. Rat pancreatic duct epithelium
cultured on a porous support coated with extracellular matrix.
Pancreas 1991;6:514-521.
[0355] Rindler, M. J., Chuman, L. M., Shaffer, L., Saier, M. H. Jr.
Retention of differentiated properties in an established dog kidney
epithelial cell line (MDCK). J. Cell Biol. 1979;81:635-648.
[0356] Yuan, S. et al. Transdifferentiation of human islets to
pancreatic ductal cells in collagen matrix culture. Differentiation
1996;61:67-75.
[0357] Otonkoski, T., Beattie, G. M., Mally, M. I., Ricordi, C.,
Hayek, A. Nicotinamide is a potent inducer of endocrine
differentiation in cultured human fetal pancreatic cells. J. Clin.
Invest. 92: 1459-1466, (1993).
[0358] Huotari, M. A., Plagi, J., Otonkoski, T. Growth
factor-mediated proliferation and differentiation of
insulin-producing INS-1 and RINm5F cells: identification of
betacellulin as a novel beta-cell mitogen. Endocrinology 139:
1494-1499, (1998).
[0359] Sorenson, R. L. & Brelje, T. C. Adaptation of islets of
Langerhans to pregnancy: beta-cell growth, enhanced insulin
secretion and the role of lactogenic hormones. Horm. Metab. Res.
29: 301-307, (1997).
[0360] All of the above-cited references and publications are
hereby incorporated by reference.
EQUIVALENTS
[0361] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
2TABLE 1 Immunostaining in Duct Cultures Marker Expression in
Pancreatic Ducts at the Start of Culture Insulin PDX-1 PYY Amylase
% Positive Ducts 7.8% 5.3% 8.3% 14.5% % Positive Cells 0.01% 0.01%
0.015% 0.02% Immunostaining for Insulin in Duct Cultures Total Ins
Total Cells Positive % Insulin- Prep Cells/Prep Positive T = 0,
Primary Ducts 800K 80 0.01% T = 7 Control Monolayer 2,000K 400
0.02% days (5.times. .Arrow-up bold.) Activated Monolayer 2,400K
1000 0.04% (+DCE) (12.5.times. .Arrow-up bold.) NACs 100K 40,000
40% (500.times. .Arrow-up bold.) Marker expression in isolated
ducts and Insulin in duct cultures. The average cell number per
duct fragment was 3450 .+-. 1860 (n = 10), comprising a single
layer of epithelial cells surrounded by mesenchymal/stromal cells.
Positive immunostaining on whole isolated ducts (n = 60-90) was as
follows: Insulin 7/90 ducts, 32 positive cells; PDX-1 4/75 ducts, #
15 positive cells; PYY 5/60 ducts, 31 cells; Amylase 10/69 ducts,
49 cells. n = 2 isolations for PDX-1, PYY, amylase; n = 4
isolations for insulin. NAC yield generally ranged from 80,000 to
130,000 cells/prep; maximum seen was 160,000 although theoretical
maximum based on an observed cell density is estimated to be
300,000 cells/prep (10,000 NACs/cm.sup.2).
[0362]
3TABLE 2 Immunostaining for PDX-1, PYY and Amylase in Duct Cultures
Total PDX-1 % PDX-1 Positive Cells/Prep Positive T = 0, Primary
Ducts 80 0.01% T = 7 Control Monolayer 480 0.02% days (6.times.
.Arrow-up bold.) Activated Monolayer 1200 0.05% (+DCE) (15.times.
.Arrow-up bold.) Total PYY Positive Cells/Prep % PYY Positive T =
0, Primary Ducts 120 0.015% T = 7 Control Monolayer 60 0.003% days
(2.times. .dwnarw.) Activated Monolayer 100 0.004% (+DCE) (approx.
no change) Total Amylase % Amylase Positive Cells/Prep Positive T =
0, Primary Ducts 160 0.02% T = 7 Control Monolayer * ** days
(>10.times. .dwnarw.) Activated Monolayer ND ND (+DCE) * Only
two out often preparations contained any Amylase-positive cells at
all. ** % Amylase-positive is on the order of 0.001% for the
positive preps. ND, not detected. 96-100% of Insulin-positive cells
in culture were also PDX-1-positive. In addition, PDX-1-positive,
insulin-negative cells appear in all states of culture; however, in
DCE-activated monolayers, the number of these cells is increased
(20-50% more cells) and there are more cytoplasmic PDX-1 cells.
There is little or no apparent change in PYY in the monolayer;
however, PYY appears to be present in emerging NACs.
[0363]
Sequence CWU 1
1
9 1 60 DNA Artificial Sequence Description of Artificial Sequence
primer 1 atgtcgtcca ggccgctctg gacaaaatat gaattctttt tttttttttt
tttttttttt 60 2 21 DNA Artificial Sequence Description of
Artificial Sequence primer 2 cacaactgga gctgggtgga g 21 3 24 DNA
Artificial Sequence Description of Artificial Sequence primer 3
caaaggcttt attcattgca gagg 24 4 20 DNA Artificial Sequence
Description of Artificial Sequence primer 4 gaccgcaggc tgagggtgag
20 5 21 DNA Artificial Sequence Description of Artificial Sequence
primer 5 cagaggtctg ccagcatctc g 21 6 21 DNA Artificial Sequence
Description of Artificial Sequence primer 6 tcccagaaga agtcgccatt g
21 7 22 DNA Artificial Sequence Description of Artificial Sequence
primer 7 ttcattccgc agagatgttg tg 22 8 22 DNA Artificial Sequence
Description of Artificial Sequence primer 8 aagtccctca ccctcccaaa
ag 22 9 22 DNA Artificial Sequence Description of Artificial
Sequence primer 9 aacacctcaa accactccca gg 22
* * * * *