U.S. patent application number 10/875716 was filed with the patent office on 2005-12-01 for human amine receptor.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Li, Yi, Ruben, Steven M..
Application Number | 20050266522 10/875716 |
Document ID | / |
Family ID | 23856197 |
Filed Date | 2005-12-01 |
United States Patent
Application |
20050266522 |
Kind Code |
A1 |
Li, Yi ; et al. |
December 1, 2005 |
Human amine receptor
Abstract
A Human amine receptor polypeptide and DNA (RNA) encoding such
polypeptide and a procedure for producing such polypeptide by
recombinant techniques is disclosed. Also provided are methods for
detecting compounds which bind to and activate and bind to and
inhibit such polypeptide and the use of compounds for treating
diseases related to the under-expression and over-expression of the
Human amine receptor of the present invention. Also disclosed are
methods for detecting mutations in the nucleic acid sequence
encoding the polypeptide and for detecting altered levels of the
soluble form of the polypeptide.
Inventors: |
Li, Yi; (Sunnyvale, CA)
; Ruben, Steven M.; (Brookeville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
23856197 |
Appl. No.: |
10/875716 |
Filed: |
June 25, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10875716 |
Jun 25, 2004 |
|
|
|
09988745 |
Nov 20, 2001 |
|
|
|
09988745 |
Nov 20, 2001 |
|
|
|
09314006 |
May 19, 1999 |
|
|
|
09314006 |
May 19, 1999 |
|
|
|
08467559 |
Jun 6, 1995 |
|
|
|
5928890 |
|
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 530/350; 536/23.2 |
Current CPC
Class: |
C07K 14/705
20130101 |
Class at
Publication: |
435/069.1 ;
435/320.1; 435/325; 530/350; 536/023.2 |
International
Class: |
C07K 014/705; C07H
021/04; C12P 021/06 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding the polypeptide
as set forth in FIG. 1. (b) a polynucleotide encoding the
polypeptide expressed by the DNA contained in ATCC Deposit No.
______; (c) a polynucleotide capable of hybridizing to and which is
at least 70% identical to the polynucleotide of (a) or (b); and (d)
a polynucleotide fragment of the polynucleotide of (a), (b) or
(c).
2. The polynucleotide of claim 1 encoding the polypeptide of FIG.
1.
3. The polynucleotide of claim 1 wherein said polynucleotide
encodes a mature polypeptide encoded by the DNA contained in ATCC
Deposit No. ______.
4. A vector containing the polynucleotide of claim 1.
5. A host cell genetically engineered with the vector of claim
4.
6. A process for producing a polypeptide comprising: expressing
from the host cell of claim 5 the polypeptide encoded by said
polynucleotide.
7. A process for producing cells capable of expressing a
polypeptide comprising genetically engineering cells with the
vector of claim 4.
8. A polypeptide selected from the group consisting of (i) a
polypeptide having the deduced amino acid sequence of FIG. 1 and
fragments, analogs and derivatives thereof; and (ii) a polypeptide
encoded by the cDNA of ATCC Deposit No. ______ and fragments,
analogs and derivatives of said polypeptide.
9. The polypeptide of claim 8 wherein the polypeptide has the
deduced amino acid sequence of FIG. 1.
10. An antibody against the polypeptide of claim 8.
11. A compound which activates the polypeptide of claim 8.
12. A compound which inhibits activation of the polypeptide of
claim 8.
13. A method for the treatment of a patient having need to activate
a receptor comprising: administering to the patient a
therapeutically effective amount of the compound of claim 11.
14. A method for the treatment of a patient having need to inhibit
a receptor comprising: administering to the patient a
therapeutically effective amount of the compound of claim 12.
15. The method of claim 13 wherein said compound is a polypeptide
and a therapeutically effective amount of the compound is
administered by providing to the patient DNA encoding said agonist
and expressing said agonist in vivo.
16. The method of claim 14 wherein said compound is a polypeptide
and a therapeutically effective amount of the compound is
administered by providing to the patient DNA encoding said
antagonist and expressing said antagonist in vivo.
17. A method for identifying a compound which bind to and activate
the polypeptide of claim 8 comprising: contacting a compound with
cells expressing on the surface thereof the polypeptide of claim 8,
said polypeptide being associated with a second component capable
of providing a detectable signal in response to the binding of a
compound to said polypeptide said contacting being under conditions
sufficient to permit binding of compounds to the polypeptide; and
identifying a compound capable of polypeptide binding by detecting
the signal produced by said second component.
18. A method for identifying compounds which bind to and inhibit
activation of the polypeptide of claim 8 comprising: contacting an
analytically detectable ligand known to bind to the receptor
polypeptide and a compound with host cells expressing on the
surface thereof the polypeptide of claim 8, said polypeptide being
associated with a second component capable of providing a
detectable signal in response to the binding of a compound to said
polypeptide under conditions to permit binding to the polypeptide;
and determining whether the ligand binds to the polypeptide by
detecting the absence of a signal generated from the interaction of
the ligand with the polypeptide.
19. A process for diagnosing in a patient a disease or a
susceptibility to a disease related to an under-expression of the
polypeptide of claim 8 comprising: determining a mutation in the
nucleic acid sequence encoding said polypeptide, or the amount of
the polypeptide in a sample derived from a patient.
20. A diagnostic process comprising: analyzing for the presence of
a soluble form of the polypeptide of claim 8 in a sample derived
from a host.
Description
[0001] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention are human 7-transmembrane
receptors and has been putatively identified as a human amine
receptor. The invention also relates to inhibiting the action of
such polypeptides.
[0002] It is well established that many medically significant
biological processes are mediated by proteins participating in
signal transduction pathways that involve G-proteins and/or second
messengers, e.g., CAMP (Lefkowitz, Nature, 351:353-354 (1991)).
Herein these proteins are referred to as proteins participating in
pathways with G-proteins or PPG proteins. Some examples of these
proteins include the GPC receptors such as those for adrenergic
agents and dopamine (Kobilka, B. K., et al., PNAS, 84:46-50 (1987);
Kobilka, B. K., et al., Science, 233:650-656 (1987); Bunzow, J. R.,
et al., Nature, 336:783-787 (3,988)), G-proteins themselves,
effector proteins, e.g. phospholipase C, adenyl cyclase, and
phosphodiesterase, and actuator proteins, e.g., protein kinase A
and protein kinase C (Simon, M. I., et al., Science, 252:802-8
(1991)).
[0003] For example, in one form of signal transduction, the effect
of hormone binding is activation of an enzyme, adenylate cyclase,
inside the cell. Enzyme activation by hormones is dependent on the
presence of the nucleotide GTP, and GTP also influences hormone
binding. A G-protein connects the hormone receptors to adenylate
cyclase. G-protein was shown to exchange GTP for bound GDP when
activated by hormone receptors. The GTP-carrying form then binds to
an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed
by the G-protein itself, returns the G-protein to its basal,
inactive form. Thus, the G-protein serves a dual role, as an
intermediate that relays the signal from receptor to effector, and
as a clock that controls the duration of the signal.
[0004] The membrane protein gene superfamily of G-protein coupled
receptors has been characterized as having seven putative
transmembrane domains. The domains are believed to represent
transmembrane .alpha.-helices connected by extracellular or
cytoplasmic loops. G-protein coupled receptors include a wide range
of biologically active receptors, such as hormone, viral, growth
factor and neuroreceptors.
[0005] G-protein coupled receptors can be intracellularly coupled
by heterotrimeric G-proteins to various intracellular enzymes, ion
channels and transporters (see, Johnson et al., Endoc., Rev.,
10:317-331 (1989)). Different G-protein .alpha.-subunits
preferentially stimulate particular effectors to modulate various
biological functions in a cell. Phosphorylation of cytoplasmic
residues of G-protein coupled receptors have been identified as an
important mechanism for the regulation of G-protein coupling of
some G-protein coupled receptors. G-protein coupled receptors are
found in numerous sites within a mammalian host.
[0006] The Human Amine Receptor of the present invention is a
G-protein coupled receptor. Neurosensory and neuromotor functions
are carried out by neurotransmission. Neurotransmission is the
conductance of a nerve impulse from one neuron, called the
presynaptic neuron, to another neuron, called the postsynaptic
neuron, across the synaptic cleft. Transmission of the nerve
impulse across the synaptic cleft involves the secretion of
neurotransmitter substances. The neurotransmitter is packaged into
vesicles in the presynaptic neuron and released into the synaptic
cleft to find its receptor at the postsynaptic neuron. Transmission
of the nerve impulse is normally transient.
[0007] An essential property of synaptic transmission is the rapid
termination of action following neurotransmitter release. For many
neurotransmitters, including catecholamine, serotonin, and certain
amino acids (e.g., gamma-aminobutyric acid (GABA), glutamate and
glycine), rapid termination of synaptic action is achieved by the
uptake of the neurotransmitter into the presynaptic terminal and
surrounding glial cells. This rapid re-accumulation of a
neurotransmitter is the result of re-uptake by the presynaptic
terminals.
[0008] At presynaptic terminals, the various molecular structures
for re-uptake are highly specific for such neurotransmitters as
choline and the biogenic amines (low molecular weight
neurotransmitter substances such as dopamine, norepinephrine,
epinephrine, serotonin and histamine). These molecular apparatuses
are receptors which are termed transporters. These transporters
move neurotransmitter substances from the synaptic cleft back
across the cell membrane of the presynaptic neuron into the
cytoplasm of the presynaptic terminus and therefore terminate the
function of these substances. Inhibition or stimulation of
neurotransmitter uptake provides a means for modulating the effects
of the endogenous neurotransmitters.
[0009] The neurotransmitter substances are implicated in numerous
pathophysiologies and treatments including, movement disorders,
schizophrenia, drug addiction, anxiety, migraine headaches,
epilepsy, myoclonus, spastic paralysis, muscle spasm,
schizophrenia, cognitive impairment, depression, Parkinson's
Disease and Alzheimer's Disease, among others.
[0010] Re-uptake of neurotransmitter substances by the transporters
may be sodium-dependent. For instance, the GABA transporter is a
member of the recently described sodium-dependent neurotransmitter
transporter gene family. These transporters are transmembrane
receptor complexes having an extracellular portion, a transmembrane
portion and an intracellular portion. A significant degree of
homology exists in the transmembrane domains of the entire family
of sodium-dependent neurotransmitter transporter proteins, with
considerable stretches of identical amino acids, while much less
homology is apparent in the intracellular and extracellular loops
connecting these domains. The extracellular loop in particular
seems to be unique for each transporter. This region may contribute
to substrate and/or inhibitor specificities.
[0011] The polypeptide of the present invention has been putatively
identified as an amine receptor. This identification has been made
as a result of amino acid sequence homology to the rat amine
receptor.
[0012] In accordance with one aspect of the present invention,
there are provided novel mature receptor polypeptides as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof. The receptor
polypeptides of the present invention are of human origin.
[0013] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding the
receptor polypeptides of the present invention, including mRNAs,
DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and
biologically active and diagnostically or therapeutically useful
fragments thereof.
[0014] In accordance with a further aspect of the present
invention, there are provided processes for producing such receptor
polypeptides by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing
nucleic acid sequences encoding the receptor polypeptides of the
present invention, under conditions promoting expression of said
polypeptides and subsequent recovery of said polypeptides.
[0015] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such receptor
polypeptides.
[0016] In accordance with another aspect of the present invention
there are provided methods of screening for compounds which bind to
and activate or inhibit activation of the receptor polypeptides of
the present invention.
[0017] In accordance with still another embodiment of the present
invention there are provided processes of administering compounds
to a host which bind to and activate the receptor polypeptide of
the present invention for the prevention and/or treatment of
abnormal conditions resulting from under-expression of the amino
receptor of the present invention.
[0018] In accordance with another aspect of the present invention
there is provided a method of administering the receptor
polypeptides of the present invention via gene therapy to treat
conditions related to under-expression of the polypeptide or
underexpression of a ligand to the receptor polypeptide.
[0019] In accordance with still another embodiment of the present
invention there are provided processes of administering compounds
which bind to and inhibit activation of the receptor polypeptides
of the present invention for prevention and/or treatment of
conditions resulting from expression of the amine receptor of the
present invention.
[0020] In accordance with yet another aspect of the present
invention, there are provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to the polynucleotide sequences of the present
invention.
[0021] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to mutations in the nucleic acid sequences
encoding such polypeptides and for detecting an altered level of
the soluble form of the receptor polypeptides.
[0022] In accordance with yet a further aspect of the present
invention, there are provided processes for utilizing such receptor
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA vectors.
[0023] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
[0024] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0025] FIG. 1 illustrates the cDNA sequence and corresponding
deduced amino acid sequence of the human amine receptor of the
present invention. The standard one-letter abbreviations for amino
acids are used. Sequencing was performed using a 373 Automated DNA
sequencer (Applied Biosystems, Inc.).
[0026] FIG. 2 is an illustration of an amino acid homology
alignment between the amine transporter or the present invention
(top line) and murine .beta.-1 Adrenoreceptor (bottom line).
[0027] FIG. 3 is an illustration of an amino acid homology
alignment between the amine transporter or the present invention
(top line) and human dopamine D2 receptor (bottom line).
[0028] The amine receptor of the present invention may be
responsible for re-uptake of one or any of the amine
neurotransmitters present in mammalian cells. Examples of such
amine transporters include, but are not limited to, dopamine,
norepinephrine, epinephrine, serotonin and histamine, and other
amino acid transmitters, including GABA, glycine and glutamate.
[0029] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the cDNA of the clone deposited as ATCC Deposit No. ______ on Jun.
1, 1995.
[0030] A polynucleotide encoding a polypeptide of the present
invention may be found in human monocytes. The polynucleotide of
this invention was discovered in a human genomic library. It is
structurally related to the G protein-coupled receptor family. It
contains an open reading frame encoding a protein of 337 amino acid
residues. The protein exhibits the highest degree of homology to a
murine .beta.-1 Adrenoreceptor with 32.099% identity and 55.864%
similarity over a 330 amino acid stretch. The protein also exhibits
homology to a human dopamine D.sub.2 receptor with 32% identity and
58.333% similarity over a 312 amino acid stretch.
[0031] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIG. 1 (SEQ ID NO:1) or that of the deposited clone or may
be a different coding sequence which coding sequence, as a result
of the redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of FIG. 1 (SEQ ID NO:1) or the
deposited cDNA.
[0032] The polynucleotide which encodes for the mature polypeptide
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the deposited cDNA may include: only the coding sequence for the
mature polypeptide; the coding sequence for the mature polypeptide
and additional coding sequence; the coding sequence for the mature
polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding sequence 5'
and/or 3' of the coding sequence for the mature polypeptide.
[0033] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0034] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 (SEQ ID NO:2) or the polypeptide encoded by
the cDNA of the deposited clone. The variant of the polynucleotide
may be a naturally occurring allelic variant of the polynucleotide
or a non-naturally occurring variant of the polynucleotide.
[0035] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIG. 1 (SEQ ID
NO:2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIG. 1 (SEQ ID NO:2) or the polypeptide encoded by
the cDNA of the deposited clone. Such nucleotide variants include
deletion variants, substitution variants and addition or insertion
variants.
[0036] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIG. 1 (SEQ ID NO:1) or of the coding
sequence of the deposited clone. As known in the art, an allelic
variant is an alternate form of a polynucleotide sequence which may
have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0037] The polynucleotides may also encode for a soluble form of
the amine receptor polypeptide which is the extracellular portion
of the polypeptide which has been cleaved from the TM and
intracellular domain of the full-length polypeptide of the present
invention.
[0038] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0039] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0040] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIG. 1 (SEQ ID NO:1) or
the deposited cDNA(s), i.e. function as a soluble amine receptor by
retaining the ability to bind the ligands for the receptor even
though the polypeptide does not function as a membrane bound amine
receptor, for example, by eliciting a second messenger
response.
[0041] Alternatively, the polynucleotides may have at least 20
bases, preferably 30 bases and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which have an identity thereto, as hereinabove described, and which
may or may not retain activity. Such polynucleotides may be
employed as probes for the polynucleotide of SEQ ID NO: 1, or for
variants thereof, for example, for recovery of the polynucleotide
or as a diagnostic probe or as a PCR primer.
[0042] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0043] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0044] The present invention further relates to a human amine
receptor polypeptide which has the deduced amino acid sequence of
FIG. 1 (SEQ ID No. 2) or which has the amino acid sequence encoded
by the deposited cDNA, as well as fragments, analogs and
derivatives of such polypeptide.
[0045] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIG. 1 (SEQ ID No. 2) or that
encoded by the deposited cDNA, means a polypeptide which retains
essentially the same biological function or activity as such
polypeptide, i.e. functions as an amine receptor, or retains the
ability to bind the ligand for the receptor even though the
polypeptide does not function as a G-protein coupled receptor, for
example, a soluble form of the receptor.
[0046] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0047] The fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID No. 2) or that encoded by the deposited cDNA may be
(i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol) or (iv) one in which the additional amino
acids are fused to the mature polypeptide which are employed for
purification of the mature polypeptide or (v) one in which a
fragment of the polypeptide is soluble, i.e. not membrane bound,
yet still binds ligands to the membrane bound receptor. Such
fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0048] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0049] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and to
portions of such polypeptide with such portion of the polypeptide
generally contains at least 30 amino acids and more preferably at
least 50 amino acids.
[0050] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and conserved amino
acid substitutes thereto of the polypeptide to the sequence of a
second polypeptide.
[0051] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis, therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0052] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region "leader and trailer" as well as
intervening sequences (introns) between individual coding segments
(exons).
[0053] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0054] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0055] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0056] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0057] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0058] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
genes of the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0059] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0060] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0061] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0062] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0063] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0064] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf 9; animal cells such as
CHO, HEK, COS or Bowes melanoma; adenoviruses; plant cells, etc.
The selection of an appropriate host is deemed to be within the
scope of those skilled in the art from the teachings herein.
[0065] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, PSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0066] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0067] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAB-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0068] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0069] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0070] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0071] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences. optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
[0072] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0073] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEMI (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0074] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0075] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0076] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0077] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HEK, HeLa and BHK cell lines. Mammalian expression
vectors will comprise an origin of replication, a suitable promoter
and enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0078] The human amine receptor polypeptide can be recovered and
purified from recombinant cell cultures by methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0079] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0080] Fragments of the full length human amine transporter gene
may be used as a hybridization probe for a cDNA library to isolate
the full length gene and to isolate other genes which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type are at least 20 bases, preferably at least 30
bases and most preferably at least 50 bases or more. The probe may
also be used to identify a cDNA clone corresponding to a full
length transcript and a genomic clone or clones that contain the
complete human amine transporter gene including regulatory and
promotor regions, exons, and introns. As an example of a screen
comprises isolating the coding region of the human amine
transporter gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0081] This invention provides a method for determining amine
neurotransmitters which are transported by the human amine receptor
of the present invention. An example of an assay which will
identify these neurotransmitters comprises infecting mammalian
cells with recombinant vaccinia virus strain VTF-7 encoding a T7
RNA polymerase and following such infection with liposome-mediated
transfection with the amine receptor gene of the present invention
through the use of a vector, for example, pBSSKII(-). Controlled
transfections are also done with equivalent amounts of vector
alone. Assays are performed eight hours following transfection in
modified Krebs-Ringer-HEPES buffer. Cells are then incubated with
[.sup.3H] neurotransmitter (for example, GABA, dopamine, serotonin,
etc.). Uptake is stopped by placing the cells on ice. Cells are
solubilized in one percent SDS, and the amount of radioactivity
accumulated is determined by liquid scintillation counting. A
significant amount of uptake determines that the particular
neurotransmitter is taken up by the human amine receptor of the
present invention by determining background using control
transfections with pBSSKII for each assay and subtracting the
values obtained from the signals determined for the specific amine
neurotransmitters.
[0082] This invention also provides a method of detecting
expression of the amine receptor of the present invention on the
surface of a cell by detecting the presence of mRNA coding for the
amine receptor. This method comprises obtaining total mRNA from the
cell using methods well-known in the art and contacting the mRNA so
obtained with a nucleic acid probe of at least 10 nucleotides and
which is capable of specifically hybridizing with a sequence
included within the sequence of a nucleic acid molecule encoding a
human amine receptor of the present invention under hybridizing
conditions, detecting the presence of mRNA hybridized to the probe,
and thereby detecting the expression of the amine receptor by the
cell. Hybridization of probes to target nucleic acid molecules such
as mRNA molecules employs techniques well known in the art.
However, in one embodiment of this invention, nucleic acids are
extracted by precipitation from lysed cells and the mRNA is
isolated from the extract using a column which binds the poly-A
tails of the mRNA molecules. The mRNA is then exposed to
radioactively labelled probe on a nitrocellulose membrane, and the
probe hybridizes to and thereby labels complementary mRNA
sequences. Binding may be detected by autoradiography or
scintillation counting. However, other methods for performing these
steps are well known to those of skill in the art.
[0083] Alternatively, an antibody directed to the human amine
receptor may be employed under conditions permitting binding of the
antibody to the transporter, and detecting the presence of the
receptor on the surface of the cell. Such a method may be employed
for determining whether a given cell is defective in expression of
the amine receptor. Detection methods include fluorescent markers
bound to the antibodies.
[0084] The invention also provides a method for determining whether
a compound not known to be capable of specifically binding to a
human amine receptor can specifically bind to the human amine
receptor, which comprises contacting a mammalian cell comprising a
plasmid adapted for expression in a mammalian cell which plasmid
further comprises a DNA which expresses the amine receptor on the
cell surface with the compound under conditions permitting binding
of ligands known to bind to the amine receptor, detecting the
presence of any compound bound to the amine receptor, the presence
of bound compound indicating that the compound is capable of
specifically binding to the human amine receptor.
[0085] The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials for
discovery of treatments and diagnostics to human disease.
[0086] The amine receptor of the present invention may be employed
in a process for screening for compounds which activate (agonists)
or inhibit activation (antagonists) of the receptor polypeptide of
the present invention In general, such screening procedures involve
providing appropriate cells which express the receptor polypeptide
of the present invention on the surface thereof. Such cells include
cells from mammals, yeast, drosophila or E. Coli. In particular, a
polynucleotide encoding the receptor of the present invention is
employed to transfect cells to thereby express the amine receptor.
The expressed receptor is then contacted with a test compound to
observe binding, stimulation or inhibition of a functional
response.
[0087] One such screening procedure involves the use of
melanophores which are transfected to express the amine receptor of
the present invention. Such a screening technique is described in
PCT WO 92/01810 published Feb. 6, 1992.
[0088] Thus, for example, such assay may be employed for screening
for a compound which inhibits activation of the receptor
polypeptide of the present invention by contacting the melanophore
cells which encode the receptor with both the receptor ligand and a
compound to be screened. Inhibition of the signal generated by the
ligand indicates that a compound is a potential antagonist for the
receptor, i.e., inhibits activation of the receptor.
[0089] The screen may be employed for determining a compound which
activates the receptor by contacting such cells with compounds to
be screened and determining whether such compound generates a
signal, i.e., activates the receptor.
[0090] Other screening techniques include the use of cells which
express the amine receptor (for example, transfected CHO cells) in
a system which measures extracellular pH changes caused by receptor
activation, for example, as described in Science, volume 246, pages
181-296 (October 1989). For example, compounds may be contacted
with a cell which expresses the receptor polypeptide of the present
invention and a second messenger response, e.g. signal transduction
or pH changes, may be measured to determine whether the potential
compound activates or inhibits the receptor.
[0091] Another such screening technique involves introducing RNA
encoding the amine receptor into xenopus oocytes to transiently
express the receptor. The receptor oocytes may then be contacted
with the receptor ligand and a compound to be screened, followed by
detection of inhibition or activation of a calcium signal in the
case of screening for compounds which are thought to inhibit
activation of the receptor.
[0092] Another screening technique involves expressing the amine
receptor in which the receptor is linked to a phospholipase C or D.
As representative examples of such cells, there may be mentioned
endothelial cells, smooth muscle cells, embryonic kidney cells,
etc. The screening may be accomplished as hereinabove described by
detecting activation of the receptor or inhibition of activation of
the receptor from the phospholipase second signal.
[0093] Another method involves screening for compounds which
inhibit activation of the receptor polypeptide of the present
invention antagonists by determining inhibition of binding of
labeled ligand to cells which have the receptor on the surface
thereof. Such a method involves transfecting a eukaryotic cell with
DNA encoding the amine receptor such that the cell expresses the
receptor on its surface and contacting the cell with a compound in
the presence of a labeled form of a known ligand. The ligand can be
labeled, e.g., by radioactivity. The amount of labeled ligand bound
to the receptors is measured, e.g., by measuring radioactivity of
the receptors. If the compound binds to the receptor as determined
by a reduction of labeled ligand which binds to the receptors, the
binding of labeled ligand to the receptor is inhibited.
[0094] Amine receptors are ubiquitous in the mammalian host and are
responsible for many biological functions, including many
pathologies. Accordingly, it is desirous to find compounds and
drugs which stimulate the amine receptor on the one hand and which
can inhibit the function of a amine receptor on the other hand.
[0095] Examples of compounds which bind to and inhibit the amine
receptor of the present invention includes antibodies, or in some
cases an oligopeptides, which bind to the amine receptor but do not
elicit a second messenger response such that the activity of the
amine receptor is prevented. Antibodies include anti-idiotypic
antibodies which recognize unique determinants generally associated
with the antigen-binding site of an antibody.
[0096] Another example includes proteins which are closely related
to the ligand of the amine receptors, i.e. a fragment of the
ligand, which has lost biological function and when binding to the
amine receptor, elicits no response.
[0097] An antisense construct prepared through the use of antisense
technology, may be used to control gene expression through
triple-helix formation or antisense DNA or RNA, both of which
methods are based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion of the polynucleotide sequence,
which encodes for the mature polypeptides of the present invention,
is used to design an antisense RNA oligonucleotide of from about 10
to 40 base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
(triple helix--see Lee et al., Nucl. Acids Res., 6:3073. (1979);
Cooney et al, Science, 241:456 (1988); and Dervan et al., Science,
251: 1360 (1991)), thereby preventing transcription and the
production of the amine receptor. The antisense RNA oligonucleotide
hybridizes to the mRNA in vivo and blocks translation of mRNA
molecules into amine receptor (antisense--Okano, J. Neurochem.,
56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988)). The
oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of the amine receptor.
[0098] A small molecule which binds to the amine receptor, making
it inaccessible to ligands such that normal biological activity is
prevented, for example small peptides or peptide-like molecules,
may also be used to inhibit activation of the receptor polypeptide
of the present invention.
[0099] A soluble form of the amine receptor, e.g. a fragment of the
receptor, may be used to inhibit activation of the receptor by
binding to the ligand to the receptor polypeptide of the present
invention and preventing the ligand from interacting with membrane
bound amine receptors.
[0100] This invention additionally provides a method of treating an
abnormal condition related to expression of the amine receptor of
the present invention which comprises administering to a subject an
inhibitory compound as hereinabove described along with a
pharmaceutically acceptable carrier in an amount effective to block
bind to a human amine receptor can specifically bind to the human
amine receptor, which comprises contacting a mammalian cell
comprising a plasmid adapted for expression in a mammalian cell
which plasmid further comprises a DNA which expresses the amine
receptor on the cell surface with the compound under conditions
permitting binding of ligands known to bind to the amine receptor,
detecting the presence of any compound bound to the amine receptor,
the presence of bound compound indicating that the compound is
capable of specifically binding to the human amine receptor.
[0101] The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials for
discovery of treatments and diagnostics to human disease.
[0102] The amine receptor of the present invention may be employed
in a process for screening for compounds which activate (agonists)
or inhibit activation (antagonists) of the receptor polypeptide of
the present invention In general, such screening procedures involve
providing appropriate cells which express the receptor polypeptide
of the present invention on the surface thereof. Such cells include
cells from mammals, yeast, drosophila or E. Coli. In particular, a
polynucleotide encoding the receptor of the present invention is
employed to transfect cells to thereby express the amine receptor.
The invention also provides a pharmaceutical pack or kit comprising
one or more containers filled with one or more of the ingredients
of the pharmaceutical compositions of the invention. Associated
with such container(s) can be a notice in the form prescribed by a
governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects
approval by the agency of manufacture, use or sale for human
administration. In addition, the pharmaceutical compositions may be
employed in conjunction with other therapeutic compounds.
[0103] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0104] The human amine receptor and agonist and antagonist
compounds which are polypeptides may also be employed in accordance
with the present invention by expression of such polypeptides in
vivo, which is often referred to as "gene therapy."
[0105] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0106] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0107] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0108] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0109] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as--the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the genes encoding the polypeptides.
[0110] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PES01, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPo.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0111] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0112] This invention is also related to the use of the human amine
receptor gene as part of a diagnostic assay for detecting diseases
or susceptibility to diseases related to the presence of mutations
in the human amine receptor genes. Such diseases are related to
under-expression of the human amine receptor.
[0113] Individuals carrying mutations in the human amine receptor
gene may be detected at the DNA level by a variety of techniques.
Nucleic acids for diagnosis may be obtained from a patient's cells,
such as from blood, urine, saliva, tissue biopsy and autopsy
material. The genomic DNA may be used directly for detection or may
be amplified enzymatically by using PCR (Saiki et al., Nature,
324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used
for the same purpose. As an example, PCR primers complementary to
the nucleic acid encoding the human amine receptor protein can be
used to identify and analyze human amine receptor mutations. For
example, deletions and insertions can be detected by a change in
size of the amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified DNA to
radiolabeled human amine receptor RNA or alternatively,
radiolabeled human amine receptor antisense DNA sequences.
Perfectly matched sequences can be distinguished from mismatched
duplexes by RNase A digestion or by differences in melting
temperatures.
[0114] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0115] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., PNAS, USA,
85:4397-4401 (1985)).
[0116] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0117] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0118] The present invention also relates to a diagnostic assay for
detecting altered levels of soluble forms of the amine receptor
polypeptides of the present invention in various tissues which may
be employed to diagnose diseases related to under-expression of the
amine receptor. Assays used to detect levels of the soluble
receptor polypeptides in a sample derived from a host are well
known to those of skill in the art and include radioimmunoassays,
competitive-binding assays, Western blot analysis and preferably as
ELISA assay.
[0119] An ELISA assay initially comprises preparing an antibody
specific to antigens of the amine receptor polypeptides, preferably
a monoclonal antibody. In addition a reporter antibody is prepared
against the monoclonal antibody. To the reporter antibody is
attached a detectable reagent such as radioactivity, fluorescence
or in this example a horseradish peroxidase enzyme. A sample is now
removed from a host and incubated on a solid support, e.g. a
polystyrene dish, that binds the proteins in the sample. Any free
protein binding sites on the dish are then covered by incubating
with a non-specific protein such as bovine serum albumin. Next, the
monoclonal antibody is incubated in the dish during which time the
monoclonal antibodies attach to any amine receptor proteins
attached to the polystyrene dish. All unbound monoclonal antibody
is washed out with buffer. The reporter antibody linked to
horseradish peroxidase is now placed in the dish resulting in
binding of the reporter antibody to any monoclonal antibody bound
to amine receptor proteins. Unattached reporter antibody is then
washed out. Peroxidase substrates are then added to the dish and
the amount of color developed in a given time period is a
measurement of the amount of amine receptor proteins present in a
given volume of patient sample when compared against a standard
curve.
[0120] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0121] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0122] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0123] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0124] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0125] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0126] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0127] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0128] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide or preparation of monoclonal
antibodies, any technique which provides antibodies produced by
continuous cell line cultures can be used. Examples include the
hybridoma technique (Kohler and Milstein, 1975, Nature,
256:495-497), the trioma technique, the human B-cell hybridoma
technique (Kozbor et al., 1983, Immunology Today 4:72), and the
EBV-hybridoma technique to produce human monoclonal antibodies
(Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy,
Alan R. Liss, Inc., pp. 77-96).
[0129] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0130] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0131] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0132] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available-plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0133] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0134] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0135] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0136] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0137] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
Bacterial Expression and Purification of Human Amine Receptor
[0138] The DNA sequence encoding human amine receptor, ATCC #
______, is initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences of the processed amine
receptor nucleic acid sequence (minus the signal peptide sequence).
Additional nucleotides corresponding to amine receptor gene are
added to the 5' and 3' sequences respectively. The 5'
oligonucleotide primer has the sequence 5'
CGGAATTCCTUATGAGAGCTGTCTTCATC 3' (SEQ ID No. 3) contains an EcoRI
restriction enzyme site followed by 18 nucleotides of human amine
receptor coding sequence starting from the presumed terminal amino
acid of the processed protein. The 3' sequence 5'
CGGAAGCTTCGTCATTCTTGGTACAAAT- CAAC 3' (SEQ ID No. 4) contains
complementary sequences to an HindIII site and is followed by 18
nucleotides of the human amine receptor gene. The restriction
enzyme sites correspond to the restriction enzyme sites on the
bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
Calif.). pQE-9 encodes antibiotic resistance (Amp.sup.r), a
bacterial origin of replication (ori), an IPTG-regulatable promoter
operator (P/o), a ribosome binding site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 is then digested with HindIII and
EcoRI. The amplified sequences are ligated into pQE-9 and are
inserted in frame with the sequence encoding for the histidine tag
and the RBS. The ligation mixture is then used to transform E. coli
strain M15/rep 4 (Qiagen, Inc.) by the procedure described in
Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Laboratory Press, (1989). M15/rep4 contains multiple copies
of the plasmid pREP4, which expresses the laci repressor and also
confers kanamycin resistance (Kan.sup.r). Transformants are
identified by their ability to grow on LB plates and
ampicillin/kanamycin resistant colonies are selected. Plasmid DNA
is isolated and confirmed by restriction analysis. Clones
containing the desired constructs are grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml). The O/N culture is used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells are grown to an
optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells are grown an extra 3 to 4 hours. Cells are then harvested by
centrifugation.. The cell pellet is solubilized in the chaotropic
agent 6 Molar Guanidine HCl. After clarification, solubilized human
amine receptor is purified from this solution by chromatography on
a Nickel-Chelate column under conditions that allow for tight
binding by proteins containing the 6-His tag (Hochuli, E. et al.,
J. Chromatography 411:177-184 (1984)). Human amine receptor protein
is eluted from the column in 6 molar guanidine HCl pH 5.0 and for
the purpose of renaturation adjusted to 3 molar guanidine HCl, 100
mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar
glutathione (oxidized). After incubation in this solution for 12
hours the protein is dialyzed to 10 mmolar sodium phosphate.
EXAMPLE 2
Cloning and Expression of Human Amine Receptor Using the
Baculovirus Expression System
[0139] The DNA sequence encoding the full length human amine
receptor protein, ATCC # ______, is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene:
[0140] The 5' primer has the sequence 5'5' CGGGATCCCTCCATGAGA
GCTGTCTTCATC 3' (SEQ ID No. 5) and contains a BamHI restriction
enzyme site followed by 4 nucleotides resembling an efficient
signal for the initiation of translation in eukaryotic cells
(Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just behind
the first 18 nucleotides of the human amine receptor gene.
[0141] The 3' primer has the sequence 5' CGGGATCCCGCTCATTCTTGG
TACAAATC 3' (SEQ ID No. 6) and contains the cleavage site for the
restriction endonuclease BamHI and 18 nucleotides complementary to
the 3' non-translated sequence of the human amine receptor gene.
The amplified sequences are isolated from a 1% agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla,
Calif.). The fragment is then digested with the endonucleases BamHI
and then purified again on a 1% agarose gel. This fragment is
designated F2.
[0142] The vector PRG1 (modification of pVL941 vector, discussed
below) is used for the expression of the human amine receptor
protein using the baculovirus expression system (for review see:
Summers, M. D. and Smith, G. E. 1987, A manual of methods for
baculovirus vectors and insect cell culture procedures, Texas
Agricultural Experimental Station Bulletin, No. 1555). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by the recognition sites for the restriction endonucleases BamHI.
The polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E. coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIMI (Luckow, V. A. and Summers,
M. D., Virology, 170:31-39).
[0143] The plasmid is digested with the restriction enzymes BamHI
and then dephosphorylated using calf intestinal phosphatase by
procedures known in the art. The DNA is then isolated from a 1%
agarose gel using the commercially available kit ("Geneclean" BIO
101 Inc., La Jolla, Calif.). This vector DNA is designated V2.
[0144] Fragment F2 and the dephosphorylated plasmid V2 are ligated
with T4 DNA ligase. E. coli HB101 cells are then transformed and
bacteria identified that contained the plasmid (pBac-Human amine
receptor) with the human amine receptor gene using the enzyme
BamHI. The sequence of the cloned fragment is confirmed by DNA
sequencing.
[0145] 5 .mu.g of the plasmid pBac-Human amine receptor is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus ("BaculoGold.TM. baculovirus DNA",
Pharmingen, San Diego, Calif.) using the lipofection method
(Felgner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417
(1987)).
[0146] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac-Human amine receptor are mixed in a sterile well of a
microtiter plate containing 50 .mu.l of serum free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture is added drop-wise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is rocked back and forth to mix the newly
added solution. The plate is then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution is removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum is added. The plate is put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
[0147] After four days the supernatant is collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue-Gal" (Life Technologies
Inc., Gaithersburg) is used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0148] Four days after the serial dilution, the viruses are added
to the cells and blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar is removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes are harvested and then stored
at 4.degree. C.
[0149] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-Human amine receptor at a multiplicity of infection
(MOI) of 2. Six hours later the medium is removed and replaced with
SF900 II medium minus methionine and cysteine (Life Technologies
Inc., Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine
and 5 .mu.Ci .sup.35S cysteine (Amersham) are added. The cells are
further incubated for 16 hours before they are harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
Expression of Recombinant Human Amine Receptor in COS Cells
[0150] The expression of plasmid, Human amine receptor HA is
derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40
origin of replication, 2) ampicillin resistance gene, 3) E. coli
replication origin, 4) CMV promoter followed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA fragment
encoding the entire Human amine receptor precursor and a HA tag
fused in frame to its 3' end is cloned into the polylinker region
of the vector, therefore, the recombinant protein expression is
directed under the CMV promoter. The HA tag correspond to an
epitope derived from the influenza hemagglutinin protein as
previously described (I. Wilson, et al., Cell, 37:767, (1984)). The
infusion of HA tag to the target protein allows easy detection of
the recombinant protein with an antibody that recognizes the HA
epitope.
[0151] The plasmid construction strategy is described as
follows:
[0152] The DNA sequence encoding Human amine receptor, ATCC #
______, is constructed by PCR using two primers: the 5' primer 5'
GTCCAAGCTTGCCACCATGAGAGCTGTCTTCATC.3' (SEQ ID No. 7) contains a
HindIII site followed by 18 nucleotides of Human amine receptor
coding sequence starting from the initiation codon; the 3' sequence
5' CTAGCTCGAGTCAAGCGTA GTCTGGGACGTCGTATGGGTAGCATTCTTGGTACAAATCAAC
3' (SEQ ID No. 8) contains complementary sequences to an XhoI site,
translation stop codon, HA tag and the last 18 nucleotides of the
Human amine receptor coding sequence (not including the stop
codon). Therefore, the PCR product contains a HindIII site, human
amine receptor coding sequence followed by HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an
HindIII site. The PCR amplified DNA fragment and the vector,
pcDNAI/Amp, are digested with HindIII and XhoI restriction enzymes
and ligated. The ligation mixture is transformed into E. coli
strain SURE (Stratagene Cloning Systems, La Jolla, Calif.) the
transformed culture is plated on ampicillin media plates and
resistant colonies are selected. Plasmid DNA is isolated from
transformants and examined by restriction analysis for the presence
of the correct fragment. For expression of the recombinant amine
receptor, COS cells are transfected with the expression vector by
DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, (1989)). The expression of the Human amine receptor HA
protein is detected by radiolabelling and immunoprecipitation
method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8
hours with .sup.35S-cysteine two days post transfection. Culture
media is then collected and cells are lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM
Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell
lysate and culture media are precipitated with a HA specific
monoclonal antibody. Proteins precipitated are analyzed on 15%
SDS-PAGE gels.
EXAMPLE 4
Expression Pattern of Human Amine Receptor in Human Tissue
[0153] Northern blot analysis is carried out to examine the levels
of expression of Human amine receptor in human tissues. Total
cellular RNA samples are isolated with RNAzol.TM. B system (Biotecx
Laboratories, Inc. Houston, Tex.) About 10 .mu.g of total RNA
isolated from each human tissue specified is separated on 1%
agarose gel and blotted onto a nylon filter (Sambrook, Fritsch, and
Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)). The
labeling reaction is done according to the Stratagene Prime-It kit
with 50 ng DNA fragment. The labeled DNA is purified with a
Select-G-50 column (5 Prime-3 Prime, Inc. Boulder, Colo.). The
filter is then hybridized with radioactive labeled full length
Human amine receptor gene at 1,000,000 cpm/ml in 0.5 M NaPO.sub.4,
pH 7.4 and 7% SDS overnight at 65.degree. C. After wash twice at
room temperature and twice at 60.degree. C. with 0.5.times.SSC,
0.1% SDS, the filter is then exposed at -70.degree. C. overnight
with an intensifying screen.
EXAMPLE 5
Expression Via Gene Therapy
[0154] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0155] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0156] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer contains an EcoRI site and
the 3' primer contains a HindIII site. Equal quantities of the
Moloney murine sarcoma virus linear backbone and the EcoRI and
HindIII fragment are added together, in the presence of T4 DNA
ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0157] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0158] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0159] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0160] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
10 1 1380 DNA Homo sapiens CDS (252)..(1262) 1 ctagagctag
caggagtaac tctcatggaa ccttggaaac cattcttcaa ttgaatttca 60
gggcacattt gaatcagtac ccaggggcac tgtactatgc tcccagctgg accttagttt
120 cctcctcctc gtttcaccct gtgagtaatt aacagacaaa attttttttt
tttttttttt 180 tttttttttt tttttgccct ccagtggaga aggtggccag
ttctcagaca gaggaagagt 240 agaaatcata a atg aga gct gtc ttc atc caa
ggt gct gaa gag cac cct 290 Met Arg Ala Val Phe Ile Gln Gly Ala Glu
Glu His Pro 1 5 10 gcg gca ttc tgc tac cag gtg aat ggg tct tgc ccc
agg aca gta cat 338 Ala Ala Phe Cys Tyr Gln Val Asn Gly Ser Cys Pro
Arg Thr Val His 15 20 25 act ctg ggc atc cag ttg gtc atc tac ctg
acc tgt gca gca ggc atg 386 Thr Leu Gly Ile Gln Leu Val Ile Tyr Leu
Thr Cys Ala Ala Gly Met 30 35 40 45 ctg att atc gtg cta ggg aat gta
ttt gtg gca ttt gct gtg tcc tac 434 Leu Ile Ile Val Leu Gly Asn Val
Phe Val Ala Phe Ala Val Ser Tyr 50 55 60 ttc aaa gcg ctt cac acg
ccc acc aac ttc ctg ctg ctc tcc ctg gcc 482 Phe Lys Ala Leu His Thr
Pro Thr Asn Phe Leu Leu Leu Ser Leu Ala 65 70 75 ctg gct gac atg
ttt ctg ggt ctg ctg gtg ctg ccc ctc agc acc att 530 Leu Ala Asp Met
Phe Leu Gly Leu Leu Val Leu Pro Leu Ser Thr Ile 80 85 90 cgc tca
gtg gag agc tgc tgg ttc ttc ggg gac ttc ctc tgc cgc ctg 578 Arg Ser
Val Glu Ser Cys Trp Phe Phe Gly Asp Phe Leu Cys Arg Leu 95 100 105
cac acc tac ctg gac acc ctc ttc tgc ctc acc tcc atc ttc cat ctc 626
His Thr Tyr Leu Asp Thr Leu Phe Cys Leu Thr Ser Ile Phe His Leu 110
115 120 125 tgt ttc att tcc att gac cgc cac tgt gcc atc tgt gac ccc
ctg ctc 674 Cys Phe Ile Ser Ile Asp Arg His Cys Ala Ile Cys Asp Pro
Leu Leu 130 135 140 tat ccc tcc aag ttc aca gtg agg gtg gct ctc agg
tac atc ctg gca 722 Tyr Pro Ser Lys Phe Thr Val Arg Val Ala Leu Arg
Tyr Ile Leu Ala 145 150 155 gga tgg ggg gtg ccc gca gca tac act tcg
tta ttc ctc tac aca gat 770 Gly Trp Gly Val Pro Ala Ala Tyr Thr Ser
Leu Phe Leu Tyr Thr Asp 160 165 170 gtg gta gag aca agg ctc agc cag
tgg ctg gaa gag atg cct tgt gtg 818 Val Val Glu Thr Arg Leu Ser Gln
Trp Leu Glu Glu Met Pro Cys Val 175 180 185 ggc agt tgc cag ctg ctg
ctc aat aaa ttt tgg ggc tgg tta aac ttc 866 Gly Ser Cys Gln Leu Leu
Leu Asn Lys Phe Trp Gly Trp Leu Asn Phe 190 195 200 205 cct ttg ttc
ttt gtc ccc tgc ctc att atg atc agc ttg tat gtg aag 914 Pro Leu Phe
Phe Val Pro Cys Leu Ile Met Ile Ser Leu Tyr Val Lys 210 215 220 atc
ttt gtg gtt gct acc aga cag gct cag cag att acc aca ttg agc 962 Ile
Phe Val Val Ala Thr Arg Gln Ala Gln Gln Ile Thr Thr Leu Ser 225 230
235 aaa agc ctg gct ggg gct gcc aag cat gag aga aaa gct gcc aag acc
1010 Lys Ser Leu Ala Gly Ala Ala Lys His Glu Arg Lys Ala Ala Lys
Thr 240 245 250 ctg ggc att gtt gtg ggc ata tac ctc ttg tgc tgg ctg
ccc ttc acc 1058 Leu Gly Ile Val Val Gly Ile Tyr Leu Leu Cys Trp
Leu Pro Phe Thr 255 260 265 ata gac acg atg gtc gac agc ctc ctt cac
ttt atc aca ccc cca ctg 1106 Ile Asp Thr Met Val Asp Ser Leu Leu
His Phe Ile Thr Pro Pro Leu 270 275 280 285 gtc ttt gac atc ttt atc
tgg ttt gct tac ttc aac tca gcc tgc aac 1154 Val Phe Asp Ile Phe
Ile Trp Phe Ala Tyr Phe Asn Ser Ala Cys Asn 290 295 300 ccc atc atc
tat gtc ttt tcc tac cag tgg ttt cgg aag gca ctg aaa 1202 Pro Ile
Ile Tyr Val Phe Ser Tyr Gln Trp Phe Arg Lys Ala Leu Lys 305 310 315
ctc aca ctg agc cag aag gtc ttc tca ccg cag aca cgc act gtt gat
1250 Leu Thr Leu Ser Gln Lys Val Phe Ser Pro Gln Thr Arg Thr Val
Asp 320 325 330 ttg tac caa gaa tgattccttc tactaaatgc aggcaaggag
taggacctca 1302 Leu Tyr Gln Glu 335 caggaaagat aagtggcact
gtgaccgcgg gctgtgtggt gttgagtttg tgggcatgct 1362 tccaggacag
catgggtt 1380 2 337 PRT Homo sapiens 2 Met Arg Ala Val Phe Ile Gln
Gly Ala Glu Glu His Pro Ala Ala Phe 1 5 10 15 Cys Tyr Gln Val Asn
Gly Ser Cys Pro Arg Thr Val His Thr Leu Gly 20 25 30 Ile Gln Leu
Val Ile Tyr Leu Thr Cys Ala Ala Gly Met Leu Ile Ile 35 40 45 Val
Leu Gly Asn Val Phe Val Ala Phe Ala Val Ser Tyr Phe Lys Ala 50 55
60 Leu His Thr Pro Thr Asn Phe Leu Leu Leu Ser Leu Ala Leu Ala Asp
65 70 75 80 Met Phe Leu Gly Leu Leu Val Leu Pro Leu Ser Thr Ile Arg
Ser Val 85 90 95 Glu Ser Cys Trp Phe Phe Gly Asp Phe Leu Cys Arg
Leu His Thr Tyr 100 105 110 Leu Asp Thr Leu Phe Cys Leu Thr Ser Ile
Phe His Leu Cys Phe Ile 115 120 125 Ser Ile Asp Arg His Cys Ala Ile
Cys Asp Pro Leu Leu Tyr Pro Ser 130 135 140 Lys Phe Thr Val Arg Val
Ala Leu Arg Tyr Ile Leu Ala Gly Trp Gly 145 150 155 160 Val Pro Ala
Ala Tyr Thr Ser Leu Phe Leu Tyr Thr Asp Val Val Glu 165 170 175 Thr
Arg Leu Ser Gln Trp Leu Glu Glu Met Pro Cys Val Gly Ser Cys 180 185
190 Gln Leu Leu Leu Asn Lys Phe Trp Gly Trp Leu Asn Phe Pro Leu Phe
195 200 205 Phe Val Pro Cys Leu Ile Met Ile Ser Leu Tyr Val Lys Ile
Phe Val 210 215 220 Val Ala Thr Arg Gln Ala Gln Gln Ile Thr Thr Leu
Ser Lys Ser Leu 225 230 235 240 Ala Gly Ala Ala Lys His Glu Arg Lys
Ala Ala Lys Thr Leu Gly Ile 245 250 255 Val Val Gly Ile Tyr Leu Leu
Cys Trp Leu Pro Phe Thr Ile Asp Thr 260 265 270 Met Val Asp Ser Leu
Leu His Phe Ile Thr Pro Pro Leu Val Phe Asp 275 280 285 Ile Phe Ile
Trp Phe Ala Tyr Phe Asn Ser Ala Cys Asn Pro Ile Ile 290 295 300 Tyr
Val Phe Ser Tyr Gln Trp Phe Arg Lys Ala Leu Lys Leu Thr Leu 305 310
315 320 Ser Gln Lys Val Phe Ser Pro Gln Thr Arg Thr Val Asp Leu Tyr
Gln 325 330 335 Glu 3 29 DNA Artificial Sequence Oligonucleotide 3
cggaattcct uatgagagct gtcttcatc 29 4 32 DNA Artificial Sequence
Oligonucleotide 4 cggaagcttc gtcattcttg gtacaaatca ac 32 5 30 DNA
Artificial Sequence Oligonucleotide 5 cgggatccct ccatgagagc
tgtcttcatc 30 6 29 DNA Artificial Sequence Oligonucleotide 6
cgggatcccg ctcattcttg gtacaaatc 29 7 34 DNA Artificial Sequence
Oligonucleotide 7 gtccaagctt gccaccatga gagctgtctt catc 34 8 61 DNA
Artificial Sequence Oligonucleotide 8 ctagctcgag tcaagcgtag
tctgggacgt cgtatgggta gcattcttgg tacaaatcaa 60 c 61 9 365 PRT Mus
musculus 9 Ala Arg Leu Leu Val Leu Ala Ser Pro Pro Ala Ser Leu Leu
Pro Pro 1 5 10 15 Ala Ser Glu Gly Ser Ala Pro Leu Ser Gln Gln Trp
Thr Ala Gly Met 20 25 30 Gly Leu Leu Val Ala Leu Ile Val Leu Leu
Ile Val Val Gly Asn Val 35 40 45 Leu Val Ile Val Ala Ile Ala Lys
Thr Pro Arg Leu Gln Thr Leu Thr 50 55 60 Asn Leu Phe Ile Met Ser
Leu Ala Ser Ala Asp Leu Val Met Gly Leu 65 70 75 80 Leu Val Val Pro
Phe Gly Ala Thr Ile Val Val Trp Gly Arg Trp Glu 85 90 95 Tyr Gly
Ser Phe Phe Cys Glu Leu Trp Thr Ser Val Asp Val Leu Cys 100 105 110
Val Thr Ala Ser Ile Glu Thr Leu Cys Val Ile Ala Leu Asp Arg Tyr 115
120 125 Leu Ala Ile Thr Ser Pro Phe Arg Tyr Gln Ser Leu Leu Thr Arg
Ala 130 135 140 Arg Ala Arg Ala Leu Val Cys Thr Val Trp Ala Ile Ser
Ala Leu Val 145 150 155 160 Ser Phe Leu Pro Ile Leu Met His Trp Trp
Arg Ala Glu Ser Asp Glu 165 170 175 Ala Arg Arg Cys Tyr Asn Asp Pro
Lys Cys Cys Asp Phe Val Thr Asn 180 185 190 Arg Ala Tyr Ala Ile Ala
Ser Ser Val Val Ser Phe Tyr Val Pro Leu 195 200 205 Cys Ile Met Ala
Phe Val Tyr Leu Arg Val Phe Arg Glu Ala Gln Lys 210 215 220 Gln Val
Lys Lys Ile Asp Ser Cys Glu Arg Arg Phe Leu Gly Gly Pro 225 230 235
240 Ala Arg Pro Pro Ser Pro Glu Pro Ser Pro Ser Pro Gly Pro Pro Arg
245 250 255 Pro Ala Asp Ser Leu Ala Asn Gly Arg Ser Ser Lys Arg Arg
Pro Ser 260 265 270 Arg Leu Val Ala Leu Arg Glu Gln Lys Ala Leu Lys
Thr Leu Gly Ile 275 280 285 Ile Met Gly Val Phe Thr Leu Cys Trp Leu
Pro Phe Phe Leu Ala Asn 290 295 300 Val Val Lys Ala Phe His Arg Asp
Leu Val Pro Asp Arg Leu Phe Val 305 310 315 320 Phe Phe Asn Trp Leu
Gly Tyr Ala Asn Ser Ala Phe Asn Pro Ile Ile 325 330 335 Tyr Cys Arg
Ser Pro Asp Phe Arg Lys Ala Phe Gln Arg Leu Leu Cys 340 345 350 Cys
Ala Arg Arg Ala Ala Cys Arg Arg Arg Ala Ala His 355 360 365 10 353
PRT Homo sapiens 10 Asp Asp Asp Leu Glu Arg Gln Asn Trp Ser Arg Pro
Phe Asn Gly Ser 1 5 10 15 Asp Gly Lys Ala Asp Arg Pro His Tyr Asn
Tyr Tyr Ala Thr Leu Leu 20 25 30 Thr Leu Leu Ile Ala Val Ile Val
Phe Gly Asn Val Leu Val Cys Met 35 40 45 Ala Val Ser Arg Glu Lys
Ala Leu Gln Thr Thr Thr Asn Tyr Leu Ile 50 55 60 Val Ser Leu Ala
Val Ala Asp Leu Leu Val Ala Thr Leu Val Met Pro 65 70 75 80 Trp Val
Val Tyr Leu Glu Val Val Gly Glu Trp Lys Phe Ser Arg Ile 85 90 95
His Cys Asp Ile Phe Val Thr Leu Asp Val Met Met Cys Thr Ala Ser 100
105 110 Ile Leu Asn Leu Cys Ala Ile Ser Ile Asp Arg Tyr Thr Ala Val
Ala 115 120 125 Met Pro Met Leu Tyr Asn Thr Arg Tyr Ser Ser Lys Arg
Arg Val Thr 130 135 140 Val Met Ile Ser Ile Val Trp Val Leu Ser Phe
Thr Ile Ser Cys Pro 145 150 155 160 Leu Leu Phe Gly Leu Asn Asn Ala
Asp Gln Asn Glu Cys Ile Ile Ala 165 170 175 Asn Pro Ala Phe Val Val
Tyr Ser Ser Ile Val Ser Phe Tyr Val Pro 180 185 190 Phe Ile Val Thr
Leu Leu Val Tyr Ile Lys Ile Tyr Ile Val Leu Arg 195 200 205 Arg Arg
Arg Lys Arg Val Asn Thr Lys Arg Ser Ser Arg Ala Phe Arg 210 215 220
Ala His Leu Arg Ala Pro Leu Lys Glu Ala Ala Arg Arg Glu Lys Asn 225
230 235 240 Gly His Ala Lys Asp His Pro Lys Ile Ala Lys Ile Phe Glu
Ile Gln 245 250 255 Thr Met Pro Asn Gly Lys Thr Arg Thr Ser Leu Lys
Thr Met Ser Arg 260 265 270 Arg Lys Leu Ser Gln Gln Lys Glu Lys Lys
Ala Thr Gln Met Leu Ala 275 280 285 Ile Val Leu Gly Val Phe Ile Ile
Cys Trp Leu Pro Phe Phe Ile Thr 290 295 300 His Ile Leu Asn Ile His
Cys Asp Cys Asn Ile Pro Pro Val Leu Tyr 305 310 315 320 Ser Ala Phe
Thr Trp Leu Gly Tyr Val Asn Ser Ala Val Asn Pro Ile 325 330 335 Ile
Tyr Thr Thr Phe Asn Ile Glu Phe Arg Lys Ala Phe Leu Lys Ile 340 345
350 Leu
* * * * *