U.S. patent application number 11/049830 was filed with the patent office on 2005-11-24 for embryonic stem cells and neural progenitor cells derived therefrom.
Invention is credited to Ben-Hur, Tamir, Pera, Martin Frederick, Reubinoff, Benjamin Eithan.
Application Number | 20050260747 11/049830 |
Document ID | / |
Family ID | 27158213 |
Filed Date | 2005-11-24 |
United States Patent
Application |
20050260747 |
Kind Code |
A1 |
Reubinoff, Benjamin Eithan ;
et al. |
November 24, 2005 |
Embryonic stem cells and neural progenitor cells derived
therefrom
Abstract
The present invention provides undifferentiated human embryonic
stem cells, methods of cultivation and propagation and production
of differentiated cells. In particular it relates to the production
of human ES cells capable of yielding somatic differentiated cells
in vitro, and committed progenitor cells such as neural progenitor
cells capable of giving rise to mature somatic cells including
neural cells and/or glial cells and uses thereof. The invention
also provides methods that generate in vitro and in vivo models of
controlled differentiation of ES cells towards the neural lineage.
The model and the cells generated along the pathway of neural
differentiation may be used for the study of the cellular and
molecular biology of human neural development, for the discovery of
genes, growth factors, and differentiation factors that play a role
in neural differentiation and regeneration, for drug discovery and
for the development of screening assays for teratogenic, toxic and
neuroprotective effects.
Inventors: |
Reubinoff, Benjamin Eithan;
(Mevaseret-Zion, IL) ; Pera, Martin Frederick;
(Prahran, AU) ; Ben-Hur, Tamir; (Ramat Sharet,
IL) |
Correspondence
Address: |
SCULLY SCOTT MURPHY & PRESSER, PC
400 GARDEN CITY PLAZA
SUITE 300
GARDEN CITY
NY
11530
US
|
Family ID: |
27158213 |
Appl. No.: |
11/049830 |
Filed: |
February 3, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11049830 |
Feb 3, 2005 |
|
|
|
09808382 |
Mar 14, 2001 |
|
|
|
Current U.S.
Class: |
435/366 ;
435/368 |
Current CPC
Class: |
C12N 2501/155 20130101;
A61P 17/02 20180101; A61P 25/28 20180101; C12N 5/0622 20130101;
C12N 2501/385 20130101; A61K 35/12 20130101; A61P 43/00 20180101;
C12N 2506/02 20130101; C12N 2501/91 20130101; C12N 5/0606 20130101;
C12N 2502/13 20130101; A61P 37/00 20180101; A61P 25/00 20180101;
C12N 5/0619 20130101; C12N 2500/32 20130101; C12N 5/0623 20130101;
C12N 2501/115 20130101; C12N 2501/39 20130101; A61P 9/00 20180101;
C12N 2501/135 20130101; C12N 2501/11 20130101 |
Class at
Publication: |
435/366 ;
435/368 |
International
Class: |
C12N 005/08 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 14, 2000 |
AU |
PQ6211 |
Nov 6, 2000 |
AU |
PR1279 |
Feb 6, 2001 |
AU |
PR2920 |
Claims
1-7. (canceled)
8. A differentiated committed human progenitor cell line capable of
differentiation and propagation into mature neurons or glial cells
said cell line derived from undifferentiated human embryonic stem
cells.
9. The differentiated committed human progenitor cell line
according to claim 8 capable of establishing a graft in a recipient
brain.
10. The differentiated committed human progenitor cell line
according to claim 9 capable of differentiating in vivo into other
cell lineages including neurons and glial cells such as astrocytes
and oligodendrocytes.
11. A neural progenitor cell differentiated in vitro from an
undifferentiated human embryonic stem cell.
12. The neural progenitor cell according to claim 11 wherein said
cell is capable of proliferation.
13. The neural progenitor cell according to claim 11 wherein said
cell is capable of differentiating to a mature neuron cell or glial
cell.
14. The neural progenitor cell according to claim 11 wherein said
cell is capable of transdifferentiation into other cell lineages to
generate stem cells and differentiated cells of non-neural
phenotype.
15. The differentiated neural progenitor cell according to claim 8
or 11 characterised by expressed markers including markers of the
neuroectodermal lineage; markers of neural progenitor cells;
neuro-filament proteins; monoclonal antibodies including MAP2 ab;
glutamate; synaptophysin; glutamic acid decarboxylase; tyrosine
hydroxylase; .beta.-tubulin; .beta.-tubulin III; GABA A.alpha.2
receptor, glial fibrillary acidic protein (GFAP),
galactocerebroside (gal C), 2',3'-cyclic nucleotide
3'-phosphodiesterase (CNPase), pip, DM-20 and O4.
16. The neural progenitor cell according to claim 15 which
expresses markers of neuroectoderm and neural progenitor cells
selected from the group including NCAM, nestin, vimentin and the
transcriptional factor Pax-6, and do not express Oct-4.
17. The neural progenitor cell according to claim 16 wherein said
cell is capable of establishing a graft in a recipient brain.
18. The neural progenitor cell according to claim 17 wherein said
cell can incorporate extensively into a recipient brain.
19. The neural progenitor cell according to claim 18 wherein said
cell is capable of migrating along host brain pathways.
20. The neural progenitor cell according to claim 19 wherein said
cell is responsive to host environmental signals.
21. The neural progenitor cell according to claim 20 wherein said
cell differentiates in response to local host environmental
signals.
22. The neural progenitor cell according claim 20 wherein said cell
is capable of differentiation to other cell lineages in a recipient
brain.
23. The enriched preparation of neural progenitor cells including
an enriched population of cells according to claim 15.
24. The enriched preparation of neural progenitor cells according
to claim 23 wherein said cells are capable of prolonged
undifferentiated proliferation.
25. The enriched preparation of neural progenitor cells according
to claim 23 wherein said cells are capable of differentiation into
neurons, mature neurons and glial cells.
26. The enriched preparation of neural progenitor cells according
to claim 25 wherein said cells are capable of establishing a graft
in a recipient brain in the absence of tumors.
27. The enriched preparation of neural progenitor cells according
to claim 26 wherein said cells may be recovered from
cryopreservation.
28-38. (canceled)
39. A method of inducing somatic differentiation of stem cells in
vitro into progenitor cells said method comprising: obtaining
undifferentiated embryonic stem cells; and providing a
differentiating signal under conditions which are non-permissive
for stem cell renewal, do not kill cells and/or induces
unidirectional differentiation toward extraembryonic lineages.
40-45. (canceled)
46. The method according to claim 39 wherein the conditions for
inducing somatic differentiation of stem cells are selected from
any one of the following including: culturing the undifferentiated
stem cells for prolonged periods and at high density on a
fibroblast feeder cell layer to induce differentiation; culturing
the undifferentiated stem cells in serum free media; culturing the
undifferentiated stem cells on a differentiation inducing
fibroblast feeder layer and wherein said fibroblast feeder layer
does not induce extra embryonic differentiation and cell death;
culturing to a high density in monolayer or on semi-permeable
membranes so as to create structures mimicing the postimplantation
phase of human development; or culturing in the presence of a
chemical differentiation factor selected from the group including
bone morphogenic protein-2 or antagonists thereof.
47. The differentiated progenitor cell prepared by the method
according to claim 39.
48. The differentiated progenitor cell according to claim 47
selected from the group including a neural progenitor cell or
mesodermal progenitor cell including hemangioblast or hematopoietic
stem cells.
49. The differentiated progenitor cell according to claim 48 which
is a neural progenitor cell capable of differentiating into a
neuron cell or a glial cell.
50. A method of inducing somatic cells from embryonic stem cell
derived somatic progenitors, said method comprising: obtaining a
source of embryonic stem cell derived somatic progenitors;
culturing the progenitor cells on an adhesive substrate; and
inducing the cells to differentiate to somatic cells under
conditions which favour somatic differentiation.
51. (canceled)
52. The method according to claim 50 wherein the embryonic stem
cell-derived progenitor cell is prepared according to the method of
claim 39.
53. The method according to claim 50 wherein the embryonic stem
cell-derived progenitor cell is selected from the group consisting
of a neural progenitor cell or mesodermal progenitor cell including
hemangioblast or hematopoietic stem cells.
54. The method according to claim 50 wherein the embryonic stem
cell-derived
55. The method according to claim 54 wherein the progenitor cells
are cultured on an adhesive substrate selected from poly-D-lysine
and laminin or poly-D-lysine and fibronectin.
56-63. (canceled)
64. A method of producing an enriched preparation of human ES
derived neural progenitor cells, said method comprising: obtaining
an undifferentiated human embryonic stem cell comprising obtaining
an in vitro fertilised human embryo and growing the embryo to a
blastocyst stage of development; removing inner cells mass (ICM)
cells from the embryo; culturing ICM cells under conditions which
do not induce extraembryonic differentiation and cell death, and
promote proliferation of undifferentiated stem cells; recovering
stem cells; inducing somatic differentiation of the embryonic stem
cell to a neural progenitor cell comprising obtaining
undifferentiated embryonic stem cells; providing a differentiating
signal under conditions which are non-permissive for stem cell
renewal, do not kill cells or induces unidirectional
differentiation toward extraembryonic lineages; identifying a
neural progenitor cell by expressed markers of primitive
neuroectoderm and neural stem cells such as polysialyated N-CAM,
intermediate filament proteins such as nestin and vimentin and the
transcription factor Pax-6; and culturing the neural progenitor
cells to promote proliferation and propagation.
65-85. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/808,382, filed Mar. 14, 2001.
[0002] The present invention relates to undifferentiated human
embryonic stem cells, methods of cultivation and propagation and
production of differentiated cells. In particular it relates to the
production of human ES cells capable of yielding somatic
differentiated cells in vitro, as well as committed progenitor
cells such as neural progenitor cells capable of giving rise to
mature somatic cells including neural cells and/or glial cells and
uses thereof.
INTRODUCTION
[0003] The production of human embryonic stem cells which can be
either maintained in an undifferentiated state or directed to
undergo differentiation into extraembryonic or somatic lineages in
vitro allows for the study of the cellular and molecular biology of
early human development, functional genomics, generation of
differentiated cells from the stem cells for use in transplantation
or drug screening and drug discovery in vitro.
[0004] In general, stem cells are undifferentiated cells which can
give rise to a succession of mature functional cells. For example,
a haematopoietic stem cell may give rise to any of the different
types of terminally differentiated blood cells. Embryonic stem (ES)
cells are derived from the embryo and are pluripotent, thus
possessing the capability of developing into any organ, cell type
or tissue type or, at least potentially, into a complete
embryo.
[0005] The development of mouse ES cells in 1981 (Evans and
Kaufman, 1981; Martin, 1981) provided the paradigm, and, much of
the technology, for the development of human ES cells. Development
of ES cells evolved out of work on mouse teratocarcinomas, (tumours
arising in the gonads of a few inbred strains), which consist of a
remarkable array of somatic tissues juxtaposed together in a
disorganised fashion. Classical work on teratocarcinomas
established their origins from germ cells in mice, and provided the
concept of a stem cell (the embryonal carcinoma or EC cell) which
could give rise to the multiple types of tissue found in the
tumours (Kleinsmith and Pierce, 1964; review, Stevens, 1983). The
field of teratocarcinoma research (review, Martin, 1980) expanded
considerably in the 70's, as the remarkable developmental capacity
of the EC stem cell became apparent following the generation of
chimaeric mice by blastocyst injection of EC cells, and
investigators began to realise the potential value of cultured cell
lines from the tumours as models for mammalian development. EC
cells however had limitations. They often contained chromosomal
abnormalities, and their ability to differentiate into multiple
tissue types was often limited.
[0006] Since teratocarcinomas could also be induced by grafting
blastocysts to ectopic sites, it was reasoned that it might be
possible to derive pluripotential cell lines directly from
blastocysts rather than from tumours, as performed in 1981 by Gail
Martin and Martin Evans independently. The result was a stable
diploid cell line which could generate every tissue of the adult
body, including germ cells. Teratocarcinomas also develop
spontaneously from primordial germ cells in some mouse strains, or
following transplantation of primordial germ cells to ectopic
sites, and in 1992 Brigid Hogan and her colleagues reported the
direct derivation of EG cells from mouse primordial germ cells
(Matsui et al., 1992). These EG cells have a developmental capacity
very similar to ES cells.
[0007] Testicular teratocarcinomas occur spontaneously in humans,
and pluripotential cell lines were also developed from these
(review, Andrews, 1988). Two groups reported the derivation of
cloned cell lines from human teratocarcinoma which could
differentiate in vitro into neurons and other cell types (Andrews
et al., 1984, Thompson et al., 1984). Subsequently, cell lines were
developed which could differentiate into tissues representative of
all three embryonic germ layers (Pera et al., 1989). As analysis of
the properties of human EC cells proceeded, it became clear that
they were always aneuploid, usually (though not always) quite
limited in their capacity for spontaneous differentiation into
somatic tissue, and different in phenotype from mouse ES or EC
cells.
[0008] The properties of the pluripotent cell lines developed by
Pera et al. (1989) are as follows:
[0009] Express SSEA-3,SSEA-4, TRA 1-60, GCTM-2, alkaline
phosphatase, Oct-4
[0010] Grow as flat colonies with distinct cell borders
[0011] Differentiate into derivatives of all three embryonic germ
layers
[0012] Feeder cell dependent (feeder cell effect on growth not
reconstituted by conditioned medium from feeder cells or by feeder
cell extracellular matrix)
[0013] Highly sensitive to dissociation to single cells, poor
cloning efficiency even on a feeder cell layer
[0014] Do not respond to Leukemia Inhibitory Factor
[0015] These studies of human EC cells essentially defined the
phenotype of primate pluripotential stem cells.
[0016] Derivation of primate ES cells from the rhesus monkey
blastocyst and later from that of the marmoset (Thomson et al.,
1995, 1996) has been described. These primate cell lines were
diploid, but otherwise they closely resembled their nearest
counterpart, the human EC cell. The implication of the monkey work
and the work on human EC cells was that a pluripotent stem cell,
which would be rather different in phenotype from a mouse ES cell,
could likely be derived from a human blastocyst. Bongso and
coworkers (1994) reported the short term culture and maintenance of
cells from human embryos fertilised in vitro. The cells isolated by
Bongso and coworkers had the morphology expected of pluripotent
stem cells, but these early studies did not employ feeder cell
support, and it was impossible to achieve long term maintenance of
the cultures.
[0017] James Thomson and coworkers (1998) derived ES cells from
surplus blastocysts donated by couples undergoing treatment for
infertility. The methodology used was not very different from that
used 17 years earlier to derive mouse ES stem cells. The
trophectoderm, thought to be inhibitory to ES cell establishment,
was removed by immunosurgery, the inner cell mass was plated on to
a mouse embryonic fibroblast feeder cell layer, and following a
brief period of attachment and expansion, the resulting outgrowth
was disaggregated and replated onto another feeder cell layer.
There were no significant departures from mouse ES protocols in the
media or other aspects of the culture system and a relatively high
success rate was achieved. The phenotype of the cells was similar
to that outlined above in the human EC studies of Pera et al.
[0018] In the studies of Thomson et al. on monkey and human ES
cells, there was no evidence that the cells showed the capacity for
somatic differentiation in vitro. Evidence for in vitro
differentiation was limited to expression of markers characteristic
of trophoblast and endoderm formation (production of human
chorionic gonadotrophin and alphafoetoprotein). It is not possible
to state whether the cells found producing alphafetoprotein
represent extraembryonic (yolk sac) endoderm or definitive
(embryonic) endoderm though the former is far more likely. Thus an
essential feature for any human ES cell line to be of practical
use, namely the production of differentiated somatic cells in vitro
as seen in previous studies of human EC cells, was not demonstrated
in the monkey or human ES cell studies.
[0019] Much attention recently has been devoted to the potential
applications of stem cells in biology and medicine, the properties
of pluripotentiality and immortality are unique to ES cells and
enable investigators to approach many issues in human biology and
medicine for the first time. ES cells potentially can address the
shortage of donor tissue for use in transplantation procedures,
particularly where no alternative culture system can support growth
of the required committed stem cell. However, it must be noted that
almost all of the wide ranging potential applications of ES cell
technology in human medicine-basic embryological research,
functional genomics, growth factor and drug discovery, toxicology,
and cell transplantation are based on the assumption that it will
be possible to grow ES cells on a large scale, to introduce genetic
modifications into them, and to direct their differentiation.
Present systems fall short of these goals, but there are
indications of progress to come. The identification of novel
factors driving pluripotential stem cell growth or stem cell
selection protocols to eliminate the inhibitory influence of
differentiated cells, both offer a way forward for expansion and
cloning of human ES cells.
[0020] The mammalian nervous system is a derivative of the
ectodermal germ layer of the postimplantation embryo. During the
process of axis formation, it is thought that inductive signals
elaborated by several regions of the embryo (the anterior visceral
endoderm and the early gastrula organiser) induce the pluripotent
cells of the epiblast to assume an anterior neural fate (Beddington
and Robertson, 1999). The molecular identity of the factors
elaborated by these tissues which direct neurogenesis is unknown,
but there is strong evidence from lower vertebrates that
antagonists of the Wnt and BMP families of signalling molecules may
be involved.
[0021] Embryonic stem cells are pluripotent cells which are thought
to correspond to the epiblast of the periimplantation embryo. Mouse
ES cells are able to give rise to neural tissue in vitro either
spontaneously or during embryoid body formation. The neural tissue
often forms in these circumstances in amongst a mixture of a range
of cell types. Alteration of the conditions of culture, or
subsequent selection of neural cells from this mixture, has been
used to produce relatively pure populations of neuronal cells from
differentiating cultures of ES cells (eg Li et al., 1998). These
neuronal cells have been used in experimental models to correct
various deficits in animal model systems (review, Svendsen and
Smith, 1999). The same has not yet been achieved with human ES cell
derived neurons, though neuronal cells have been derived from human
embryonal carcinoma cells which were induced to differentiate using
retinoic acid. These EC cells were subsequently shown to correct
deficits in experimental models of CNS disease.
[0022] A suitable source of human ES derived neurons would be
desirable since their availability would provide real advantages
for basic and applied studies of CNS development and disease.
Controlled differentiation of human ES cells into the neural
lineage will allow experimental dissection of the events during
early development of the nervous system, and the identification of
new genes and polypeptide factors which may have a therapeutic
potential such as induction of regenerative processes. Additional
pharmaceutical applications may include the creation of new assays
for toxicology and drug discovery, such as high-throughput screens
for neuroprotective compounds. Generation of neural progenitors
from ES cells in vitro may serve as an unlimited source of cells
for tissue reconstruction and for the delivery and expression of
genes in the nervous system.
[0023] It is an object of the invention to overcome or at least
alleviate some of the problems of the prior art.
SUMMARY OF THE INVENTION
[0024] In one aspect of the present invention, there is provided an
enriched preparation of undifferentiated human embryonic stem cells
capable of proliferation in vitro and differentiation to neural
progenitor cells, neuron cells and/or glial cells.
[0025] Preferably the undifferentiated ES cells have the potential
to differentiate into neural progenitor cells, neuron cells and/or
glial cells when subjected to differentiating conditions.
[0026] More preferably, the undifferentiated ES cells are capable
of maintaining an undifferentiated state when cultured on a
fibroblast feeder layer.
[0027] In another aspect of the present invention there is provided
an undifferentiated human embryonic stem cell wherein the cell is
immunoreactive with markers for human pluripotent stem cells
including SSEA-4, GCTM-2 antigen, TRA 1-60 and wherein said cell
may differentiate under differentiating conditions to neural cells.
Preferably, the cells express the transcription factor Oct-4 as
demonstrated by RT-PCR. More preferably, the cells maintain a
diploid karyotype during prolonged cultivation in vitro.
[0028] In another aspect there is provided an undifferentiated cell
line capable of differentiation into neural progenitor cells,
neurone cells and glial cells and preferably produced by a method
of the present invention.
[0029] In another aspect there is provided a differentiated
committed progenitor cell line that may be cultivated for prolonged
periods and give rise to large quantities of progenitor cells.
[0030] In another aspect there is provided a differentiated
committed progenitor cell line capable of differentiation into
mature neurons and/or glial cells.
[0031] In another aspect, there is provided a neural progenitor
cell, neuron cell and/or a glial cell differentiated in vitro from
an undifferentiated embryonic stem cell. There is also provided a
committed neural progenitor cell capable of giving rise to mature
neuron cells and glial cells.
[0032] In another aspect there is provided a differentiated
committed progenitor cell line capable of establishing a graft in a
recipient brain and to participate in histogenesis of the nervous
system.
[0033] Preferably, the undifferentiated cell line is preserved by
preservation methods such as cryopreservation. Preferably the
method of cryopreservation is a method highly efficient for use
with embryos such as vitrification. Most preferably, the method
includes the Open Pulled Straw (OPS) vitrification method.
[0034] In another aspect the neural progenitor cell line is
preserved by preservation methods such as cryopreservation.
[0035] In another aspect, there is provided a neural progenitor
cell capable of differentiating into glial cells, including
astrocytes and oligodendrocytes.
[0036] In another aspect, there is provided a neural progenitor
cell capable of transdifferentiation into other cell lineages, to
generate stem cells and differentiated cells of non-neuronal
phenotype, such as hematopoietic stem cells.
[0037] In a further aspect of the present invention, there is
provided a method of preparing undifferentiated human embryonic
stem cells for differentiation into neural progenitor cells, said
method including:
[0038] obtaining an in vitro fertilised human embryo and growing
the embryo to a blastocyst stage of development;
[0039] removing inner cells mass (ICM) cells from the embryo;
[0040] culturing ICM cells under conditions which do not induce
extraembryonic differentiation and cell death and promote
proliferation of undifferentiated cells; and
[0041] recovering stem cells.
[0042] In a further preferred embodiment of the present invention
there is provided a method of preparing undifferentiated human
embryonic stem cells for differentiation into neural progenitor
cells, said method including:
[0043] obtaining an in vitro fertilised human embryo;
[0044] removing inner cell mass (ICM) cells from the embryo;
[0045] culturing ICM cells on a fibroblast feeder layer to promote
proliferation of embryonic stem cells; and
[0046] recovering stem cells from the feeder layer.
[0047] In a further embodiment of the invention, the method further
includes:
[0048] replacing the stem cells from the fibroblast feeder layer
onto another fibroblast feeder layer; and
[0049] culturing the stem cells for a period sufficient to promote
proliferation of morphologically undifferentiated stem cells.
[0050] In another aspect of the invention the method further
includes propagating the undifferentiated stem cells.
[0051] In another aspect of the invention there is provided a
method of inducing somatic differentiation of stem cells in vitro
into progenitor cells said method comprising:
[0052] obtaining undifferentiated stem cells; and
[0053] providing a differentiating signal under conditions which
are non-permissive for stem cell renewal, do not kill cells and
induces unidirectional differentiation toward extraembryonic
lineages.
[0054] In a preferred embodiment of the present invention, there is
provided a method of inducing somatic differentiation of stem cells
in vitro into progenitor cells, said method comprising:
[0055] obtaining undifferentiated stem cells; and
[0056] culturing said cells for a prolonged period and at high
density on a fibroblast feeder cell layer to induce
differentiation.
[0057] In another preferred embodiment of the present invention,
there is provided a method of inducing somatic differentiation of
stem cells in vitro into progenitor cells, said method
comprising:
[0058] obtaining undifferentiated stem cells; and
[0059] transferring said cells into serum free media to induce
differentiation.
[0060] In an additional aspect of the invention method may be used
for directing stem cells to differentiate toward a somatic lineage.
Furthermore, the method allows the establishment of a pure
preparation of progenitor cells from a desired lineage and
facilitate the establishment of a pure somatic progenitor cell
line.
[0061] In another preferred embodiment of the present invention,
there is provided a method of inducing the differentiation of ES
derived neural progenitor cells into differentiated mature neuronal
cells, and glial cells including oligodendrocyte and astrocyte
cells.
[0062] This invention provides a method that generates an in vitro
and in vivo model of controlled differentiation of ES cells towards
the neural lineage. The model, and the cells that are generated
along the pathway of neural differentiation may be used for the
study of the cellular and molecular biology of human neural
development, for the discovery of genes, growth factors, and
differentiation factors that play a role in neural differentiation
and regeneration, for drug discovery and for the development of
screening assays for teratogenic, toxic and neuroprotective
effects.
[0063] In a further aspect of the invention there is provided a
neural progenitor cell, a neuronal cell and a glial cell that may
be used for cell therapy and gene therapy.
FIGURES
[0064] FIG. 1A-1F shows phase contrast micrographs of ES cells and
their differentiated progeny. 1A, inner cell mass three days after
plating. 1B, colony of ES cells. 1C, higher magnification of an
area of an ES cell colony. 1D, an area of an ES cell colony
undergoing spontaneous differentiation during routine passage. 1E,
a colony four days after plating in the absence of a feeder cell
layer but in the presence of 2000 units/ml human LIF undergoing
differentiation in its periphery. 1F, neuronal cells in a high
density culture. Scale bars: A and C, 25 microns; B and E, 100
microns; D and F, 50 microns.
[0065] FIG. 2A-2H shows marker expression in ES cells and their
differentiated somatic progeny. 2A, ES cell colony showing
histochemical staining for alkaline phosphatase. 2B. ES cell colony
stained with antibody MC-813-70 recognising the SSEA-4 epitope. 2C,
ES cell colony stained with antibody TRA1-60. 2D, ES cell colony
stained with antibody GCTM-2. 2E, high density culture, cell body
and processes of a cell stained with anti-neurofilament 68 kDa
protein. 2F, high density culture, cluster of cells and network of
processes emanating from them stained with antibody against neural
cell adhesion molecule. 2G, high density culture, cells showing
cytoplasmic filaments stained with antibody to muscle actin. 2H,
high density culture, cell showing cytoplasmic filaments stained
with antibody to desmin. Scale bars: A, 100 microns; B-D, and F,
200 microns; E, G and H, 50 microns.
[0066] FIG. 3A-3D shows RT-PCR analysis of gene expression in ES
cells and their differentiated derivatives. All panels show 1.5%
agarose gels stained with ethidium bromide. 3A, expression of Oct-4
and b-actin in ES stem cells and high density cultures. Lane 1, 100
bpDNA ladder. Lane 2, stem cell culture, b-actin. Lane 3, stem cell
culture, Oct-4. Lane 4, stem cell culture, PCR for Oct-4 carried
out with omission of reverse transcriptase. Lane 5, high density
culture, b-actin. Lane 6, high density culture, Oct-4. Lane 7, high
density culture, PCR for Oct-4 carried out with omission of reverse
transcriptase. b-actin band is 200 bp and Oct-4 band is 320 bp. +B,
expression of nestin and Pax-6 in neural progenitor cells that were
derived from differentiating ES colonies. Left lane, 100 bp DNA
ladder; lane 1, b-actin in HX 142 neuroblastoma cell line (positive
control for nestin PCR); lane 2, b-actin in neural progenitor
cells; lane 3, nestin in HX 142 neuroblastoma cell line; lane 4,
nestin in neural progenitor cells; lane 5, nestin PCR on same
sample as lane 4 without addition of reverse transcriptase; lane 6,
Pax-6; lane 7, Pax-6 PCR on same sample as line 6 without addition
of reverse transcriptase. Nestin band is 208 bp, Pax-6 is 274 bp.
3C, expression of glutamic acid decarboxylase in cultures of
neurons. Left lane, 100 bp DNA ladder; lane 1, b-actin; lane 2,
b-actin PCR on same sample as lane 1 without addition of reverse
transcriptase; lane 3, glutamic acid decarboxylase; lane 4 glutamic
acid decarboxylase on same sample as lane 3 without addition of
reverse transcriptase. Glutamic acid decarboxylase band is 284 bp.
3D, expression of GABA A.alpha.2 receptor. Left lane, 100 bp DNA
ladder; lane 1, b-actin; lane 2, GABA A.alpha.2 receptor; lane 3,
PCR without addition of reverse transcriptase. GABA Aac2 receptor
subunit band is 471 bp.
[0067] FIG. 4A-4F shows histology of differentiated elements found
in teratomas formed in the testis of SCID mice following
inoculation of HES-1 or HES-2 colonies. 4A, cartilage and squamous
epithelium, HES-2. 4B, neural rosettes, HES-2. 4C, ganglion, gland
and striated muscle, HES-1. 4D, bone and cartilage, HES-1. 4E,
glandular epithelium, HES-1. 4F, ciliated columnar epithelium,
HES-1. Scale bars: A-E, 100 microns; F, 50 microns.
[0068] FIG. 5A-5D shows phase contrast microscopy and
immunochemical analysis of marker expression in neural progenitor
cells isolated from differentiating ES cultures. 5A, phase contrast
image of a sphere formed in serum-free medium. 5B-5D, indirect
immunofluorescence staining of spheres, 4 hours after plating on
adhesive substrate, for N-CAM, nestin, and vimentin respectively.
In 5C and 5D, cells at the base of the sphere were placed in plane
of focus to illustrate filamentous staining; confocal examination
revealed that cells throughout the sphere were decorated by both
antibodies. Scale bar is 100 microns in all panels.
[0069] FIG. 6A-6H shows phase contrast appearance and marker
expression in cultures of neurons derived from progenitor cells
shown in FIG. 5A-5D. 6A, phase contrast micrograph of
differentiated cells emanating from a sphere plated onto adhesive
surface. 6B-6H, indirect immunofluorescence microscopy of
differentiated cells decorated with antibodies against 200 kDa
neruofilament protein (6B), 160 kDa neurofilament protein (6C),
MAP2a+b (6D), glutamate (6E), synaptophysin (6F), glutamic acid
decarboxylase (6G) and .beta.-tubulin (6H). Scale bars: A, B, 100
microns; C, 200mircons; D, 20 microns; E and F, 10 microns; G, 20
microns; H, 25 microns.
[0070] FIG. 7 shows neural precursors proliferating as a monolayer
on a plastic tissue culture dish in the presence of EGF and bFGF.
These monolayer cultures of proliferating cells were obtained after
prolonged cultivation (2-3 weeks) of the spheres in the presence of
growth factors without sub-culturing.
[0071] FIG. 8 shows phase contrast appearance of a culture
consisting of differentiated neural cells.
[0072] FIG. 9 shows phase contrast appearance of a sphere that is
formed 72 hours after the transfer of a clump of undifferentiated
ES cells into serum free medium (Scale bar 100 microns).
[0073] FIG. 10 shows linear correlation between the volume of
spheres and the number of progenitor cells within a sphere. Spheres
of various diameters that were generated from differentiating ES
colonies and were propagated for 14-15 weeks were dissaggregated
into single cell suspension and the number of cells per sphere was
counted.
[0074] FIG. 11 shows indirect immunofluorescence staining of a
sphere, 4 hours after plating on adhesive substrate, for N-CAM. The
sphere was generated by direct transfer of undifferentiated ES
cells into serum free medium and propagation of the resulting
spheres for 5 passages. (Scale bar 100 microns).
[0075] FIG. 12 shows indirect immunofluorescence membraneous
staining for N-CAM of single cells at the periphery of a sphere 4
hours after plating on adhesive substrate. The sphere was generated
by direct transfer of undifferentiated ES cells into serum free
medium and propagation of the resulting spheres for 5 passages.
(Scale bar 25 microns).
[0076] FIG. 13 shows indirect immunofluorescence staining of a
spheres 4 hours after plating on adhesive substrate for the
intermediate filament nestin. Cells at the base of the sphere were
placed in plane of focus to illustrate filamentous staining. The
sphere was generated by direct transfer of undifferentiated ES
cells into serum free medium and propagation of resulting spheres
for 5 passages. (Scale bar 25 microns).
[0077] FIG. 14 shows indirect immunofluorescence microscopy of a
differentiated cell decorated with antibodies against the
oligodendrocyte progenitor marker O4. (Scale bar 12.5 microns).
[0078] FIG. 15 shows indirect immunofluorescence staining of a
sphere 4 hours after plating on adhesive substrate for the
intermediate filament vimentin. Cells at the base of the sphere
were placed in plane of focus to illustrate filamentous staining.
The sphere was generated by direct transfer of undifferentiated ES
cells into serum free medium and propagation of resulting spheres
for 7 passages. (Scale bar 25 microns).
[0079] FIG. 16 shows the growth pattern of spheres that were
generated directly from undifferentiated ES cells. Each bar
represents the mean (.+-.SD) increment in volume per week of 24
spheres at first to twelve weeks after derivation. A more excessive
growth rate is evident during the first 5 weeks.
[0080] FIG. 17 shows persistent growth in the volume of spheres
along time. Each bar represents the mean (.+-.SD) increment in
volume per week of 24 spheres at nine to twenty one weeks after
derivation. The spheres were generated from differentiating ES
colonies.
[0081] FIG. 18 shows linear correlation between the volume of
spheres and the number of progenitor cells within a sphere. Spheres
of various diameters, that were generated directly from
undifferentiated ES cells and were propagated 5-7 weeks, were
dissaggregated into single cell suspension and the number of cells
per sphere was counted.
[0082] FIG. 19 shows RT-PCR analysis of gene expression in ES cells
(a week after passage) and neural spheres derived from
differentiating colonies and directly from undifferentiated ES
cell. All panels show 2% agarose gels stained with ethidium
bromide. Lanes 1, 2 and 3, Oct-4 in ES cell culture, neural spheres
derived from differentiating colonies, neural spheres derived from
undifferentiated ES cells. Lane 4, stem cell culture, PCR for Oct-4
carried out with omission of reverse transcriptase. Lanes 5, 6, and
7, nestin in ES cell culture, neural spheres derived from
differentiating colonies, neural spheres derived from
undifferentiated ES cells. Lane 8, stem cell culture, PCR for
nestin carried out with omission of reverse transcriptase. Lanes 9,
10 and 11, Pax-6 in ES cell culture, neural spheres derived from
differentiating colonies, neural spheres derived from
undifferentiated ES cells. Lane 12, stem cell culture, PCR for
Pax-6 carried out with omission of reverse transcriptase. Lane 13,
100 bp DNA ladder. Oct-4 band is 320 bp, nestin is 208 bp and Pax-6
is 274 bp.
[0083] FIG. 20 shows indirect immunofluorescence microscopy of
differentiated astrocyte cells decorated with antibody against
GFAP. (Scale bar 25 microns).
[0084] FIG. 21A-21B shows indirect immunofluorescence microscopy of
brain sections of two mice (21A and 21B) 4 weeks after
transplantation of human neural precursors prelabeled with BrDU.
Cells with a nucleus decorated with anti BrDU (brown stain, black
arrow) are evident near the ventricular surface (white arrow
indicate mouse unstained nuclei, bar=20 microns).
[0085] FIG. 22A-22C shows indirect immunofluorescence microscopy of
brain sections of a mice 4 weeks after transplantation of human
neural precursors prelabeled with BrDU. Wide spread distribution of
transplanted human cells decorated by anti BrDU antibodies is
evident in the periventricular areas. The periventricular area in
22A is demonstrated at a higher magnification in 22B and 22C.
(Bars=150, 60 and 30 microns in 22A, 22B and 22C).
[0086] FIG. 23 shows indirect immunocytochemical microscopy of
brain sections of a mice 4 weeks after transplantation of human
neural precursors prelabeled with BrDU. The transplanted human
cells are migrating along the rostral migratory stream (bar=150
microns).
[0087] FIG. 24A-24B shows RT-PCR analysis of gene expression in
neural spheres derived from differentiating (24A) and
undifferentiated (24B) ES cells. All panels show 2% agarose gels
stained with ethidium bromide. Lanes 1 and 10, 100 bpDNA ladder;
Lane 2, CD-34; Lane 3, Flk-1; lane4, HNF-3; lane 5,
alfafetoprotein. Lanes 6-9 PCR reaction on the same samples as
lanes 2-5 carried out with the omission of reverse transcriptase.
CD-34 band is 200 bp, Flk-1 is 199, HNF-3 is 390, AFP is 340
bp.
[0088] FIG. 25 shows by RT-PCR analysis the expression of GFAP and
the plp gene in differentiated cells from neural spheres derived
from differentiating ES cell colonies. The expression of GFAP
indicates differentiation into astrocytes while the presence of
both dm-20 and plp transcripts indicate that differentiation into
oligodendrocyte cells has occurred. Lanes 2, 4, 6 and lanes 3, 5, 7
are from two separate RNA samples from differentiated spheres that
were independently derived from ES cells. Lane 1 and 8, 100 bp DNA
ladder; Lanes 2 and 4, GFAP; lanes 3 and 5, plp and dm-20; lanes 6
and 7, PCR reaction on the same samples as lanes 3 and 5 carried
out with the omission of reverse transcriptase. GFAP band is 383,
plp band is 354 bp and dm-20 is 249 bp.
[0089] FIG. 26 shows a dark field stereomicroscopic photograph of
areas (arrows) destined to give rise to neural precursors in a
differentiating ES cell colony 3 weeks after passage (bar=1.6
mm).
[0090] FIG. 27A-27C shows indirect immunochemical analysis of
marker expression in cultures of neurons derived from progenitor
cells that were derived directly from undifferentiated ES cells:
27A, indirect immunofluorescence microscopy of neurits decorated
with antibody against 160 kDa neruofilament protein. 27B and 27C,
indirect immunofluorescence staining of differentiated cells for
MAP2a+b and .beta.-tubulin III. Scale bars: A 100 microns, B and C
10 microns.
[0091] FIG. 28A-28B shows indirect immunochemical analysis of the
expression of tyrosine hydroxylase. Neurits (28A) and a
differentiated cell (28B) are decorated with antibodies against
tyrosine hydroxylase. Scale bars: 30 microns.
[0092] FIG. 29A-29B shows in vivo differentiation into astrocyte
cells of transplanted human neural progenitors prelabeled with
BrDU. Donor cells are identified by indirect immunochemical
detection of BrDU (dark nuclei, arrows). Duel staining demonstrates
donor cells decorated by anti GFAP (orange). Transplanted cells are
migrating into the brain parenchyma (white arrow) and are also
found in the periventricular zone (dark arrow) (29A), A higher
magnification of cells that have differentiated into astrocytes and
migrated into the host brain (29B).
[0093] FIG. 30 shows in vivo differentiation into oligodendrocyte
cells of transplanted human neural progenitors prelabeled with
BrDU. Donor cells are identified by indirect immunochemical
detection of BrDU (dark nuclei, arrows). Duel staining demonstrates
donor cells decorated by anti CNPase (orange).
DESCRIPTION OF THE INVENTION
[0094] In one aspect of the present invention there is provided an
enriched preparation of human undifferentiated embryonic stem cells
capable of proliferation in vitro and differentiation to neural
progenitor cells, neuron cells and/or glial cells.
[0095] Throughout the description and claims of this specification,
the word "comprise" and variations of the word, such as
"comprising" and "comprises", is not intended to exclude other
additives, components, integers or steps.
[0096] Established pluripotent ES cell lines from human blastocysts
are shown in, PCT/AU99/00990 by the applicants. In contrast to data
which has published previously, the human ES cell lines that have
been derived by the applicants in the present application have been
shown to differentiate in vitro into somatic lineages and give rise
to neurons and muscle cells. Moreover, Applicants have demonstrated
the derivation of neural progenitor cells from human ES cells in
vitro. These ES derived human neural progenitors may give rise to
mature neurons in vitro. The contents of PCT/AU99/00990 are hereby
incorporated.
[0097] Proliferation in vitro may include cultivation of the cells
for prolonged periods. The cells are substantially maintained in an
undifferentiated state. Preferably the cells are maintained under
conditions which do not induce cell death or extraembryonic
differentiation.
[0098] Preferably, they are capable of maintaining an
undifferentiated state when cultured on a fibroblast feeder layer
preferably under non-differentiating conditions. Preferably the
fibroblast feeder layer does not induce extraembryonic
differentiation.
[0099] More preferably the cells have the potential to
differentiate in vitro when subjected to differentiating
conditions. Most preferably the cells have the capacity to
differentiate in vitro into a wide array of somatic lineages.
[0100] The promotion of stem cells capable of being maintained in
an undifferentiated state in vitro on one hand, and which are
capable of differentiation in vitro into extraembryonic and somatic
lineages on the other hand, allows for the study of the cellular
and molecular biology of early human development, functional
genomics, generation of differentiated cells from the stem cells
for use in transplantation or drug screening and drug discovery in
vitro.
[0101] Once the cells are maintained in the undifferentiated state,
they may be differentiated to mature functional cells. The
embryonic stem cells are derived from the embryo and are
pluripotent and have the capability of developing into any organ or
tissue type. Preferably the tissue type is selected from the group
including endocrine cells, blood cells, neural cells or muscle
cells. Most preferably they are neural cells.
[0102] In another aspect of the present invention there is provided
an undifferentiated human embryonic stem cell wherein the cell is
immunoreactive with markers for human pluripotent stem cells
including SSEA-4, GCTM-2 antigen, and TRA 1-60 and wherein said
cell can differentiate, under differentiating conditions to neural
cells. Preferably, the cells express specific transcription factors
such as Oct-4 as demonstrated by RT-PCR, or methods of analysis of
differential gene expression, microarray analysis or related
techniques. More preferably the cells maintain a diploid karyotype
during prolonged cultivation in vitro. Preferably, the stem cell
will constitute an enriched preparation of an undifferentiated stem
cell line. More preferably, the stem cell line is a permanent cell
line, distinguished by the characteristics identified above. They
preferably have normal karyotype along with the characteristics
identified above. This combination of defining properties will
identify the cell lines of the invention regardless of the method
used for their isolation.
[0103] Methods of identifying these characteristics may be by any
method known to the skilled addressee. Methods such as (but not
limited to) indirect immunoflourescence or immunocytochemical
staining may be carried out on colonies of ES cells which are fixed
by conventional fixation protocols then stained using antibodies
against stem cell specific antibodies and visualised using
secondary antibodies conjugated to fluorescent dyes or enzymes
which can produce insoluble colored products. Alternatively, RNA
may be isolated from the stem cells and RT-PCR or Northern blot
analysis carried out to determine expression of stem cell specific
genes such as Oct-4.
[0104] In a preferred embodiment the undifferentiated cells form
tumours when injected in the testis of immunodeprived SCID mice.
These tumours include differentiated cells representative of all
three germ layers. The germ layers are preferably endoderm,
mesoderm and ectoderm. Preferably, once the tumours are
established, they may be disassociated and specific differentiated
cell types may be identified or selected by any methods available
to the skilled addressee. For instance, lineage specific markers
may be used through the use of fluorescent activated cell sorting
(FACS) or other sorting method or by direct micro dissection of
tissues of interest. These differentiated cells may be used in any
manner. They may be cultivated in vitro to produce large numbers of
differentiated cells which could be used for transplantation or for
use in drug screening for example.
[0105] In another aspect there is provided a differentiated
committed progenitor cell line capable of differentiation and
propagation into mature neurons and/or glial cells. The
undifferentiated cells may differentiate in vitro to form neural
progenitor cells, neuron cells and/or glial cells.
[0106] In another aspect, there is provided a neural progenitor
cell, neuron cell and/or glial cells differentiated in vitro from
an undifferentiated embryonic stem cell. There is also provided a
committed neural progenitor cell capable of giving rise to mature
neuron cells.
[0107] In another aspect, there is provided a neural progenitor
cell capable of differentiating into glial cells, including
astrocytes and oligodendrocytes. The glial cells include microglial
cells and radial glial cells.
[0108] In another aspect, there is provided a neural progenitor
cell capable of transdifferentiation into other cell lineages, to
generate stem cells and differentiated cells of non-neuronal
phenotype, such as hematopoietic stem cells or endothelial stem
cells.
[0109] These cells may be obtained by somatic differentiation of
human ES cells, identified by neural markers. These cells may be
isolated in pure form from differentiating ES cells, in vitro, and
propagated in vitro. They may be induced to under go
differentiation to mature neurons and/or glial cells.
[0110] The cells may undergo differentiation in vitro to yield
neural progenitor cells, neuron or glial cells as well as
extraembryonic cells, such differentiation being characterised by
novel gene expression characteristic of specific lineages as
demonstrated by immunocytochemical or RNA analysis.
Characterisation may be obtained by using expression of genes
characteristic of pluripotent cells or particular lineages.
Preferably, differential expression of Oct-4 may be used to
identify stem cells from differentiated cells. Otherwise, the
presence or absence of expression of other genes characteristic of
pluripotent stem cells or other lineages may include Genesis, GDF-3
or Cripto. Analysis of these gene expressions may create a gene
expression profile to define the molecular phenotype of an ES cell,
a committed progenitor cell, or a mature differentiated cell of any
type. Such analysis of specific gene expression in defined
populations of cells from ES cultures is called cytomics. Methods
of analysis of gene expression profiles include RT-PCR, methods of
differential gene expression, microarray analysis or related
techniques.
[0111] Differentiating cultures of the stem cells secrete human
chorionic gonadotrophin (hCG) and .alpha.-fetoprotein (AFP) into
culture medium, as determined by enzyme-linked immunosorbent assay
carried out on culture supernatants. Hence this may also serve as a
means of identifying the differentiated cells.
[0112] The differentiated cells forming neural progenitor cells,
neuron cells and/or glial cells may also be characterised by
expressed markers characteristic of differentiating cells. The in
vitro differentiated cell culture may be identified by detecting
molecules such as markers of the neuroectodermal lineage, markers
of neural progenitor cells, neuro-filament proteins, monoclonal
antibodies such as MAP2ab, glutamate, synaptophysin, glutamic acid
decarboxylase, tyrosine hydroxylase, .beta.-tubulin, .beta.-tubulin
III, GABA A.alpha.2 receptor, glial fibrillary acidic protein
(GFAP), galactocerebroside (gal C), 2', 3'-cyclic nucleotide
3'-phosphodiesterase (CNPase), plp, DM-20 and O4.
[0113] In another preferred aspect of the present invention there
is provided a neural progenitor cell wherein the cell express
markers for the neuroectodermal lineage as well as neural markers
selected from the group including polysialyated NCAM, nestin,
vimentin and the transcriptional factor Pax-6, and do not express
Oct-4.
[0114] Preferably, the cells do not express the transcriptional
factor OCT-4. This may be demonstrated by RT-PCR, or methods of
analysis of differential gene expression, microarray analysis or
related techniques. More preferably the cells will constitute an
enriched preparation. They can proliferate in vitro for prolonged
periods at an undifferentiated neural progenitor state to produce
large number of cells. The neural progenitor cells can
differentiate, under differentiating conditions to mature neurons
and glial cells.
[0115] In yet another aspect, the invention provides a neural
progenitor cell which is capable of establishing a graft in a
recipient brain. Preferably the neural progenitor cell is as
described above.
[0116] Upon transplantation to the developing brain they
incorporate extensively into the host brain, undergo region
specific differentiation and participate in the development and
histogenesis of the living host. This combination of defining
properties will identify the neural progenitor cell lines of the
invention regardless of the method used for their isolation.
[0117] In yet another aspect of the present invention, there is
provided a glial cell differentiated from a neural progenitor cell.
Preferably, the glial cell is an astrocyte or an
oligodendrocyte.
[0118] In a further aspect of the invention, there is provided a
method of preparing undifferentiated human embryonic stem cells for
differentiation into neural progenitor cells, said method
including:
[0119] obtaining an in vitro fertilised human embryo and growing
the embryo to a blastocyst stage of development;
[0120] removing inner cells mass (ICM) cells from the embryo;
[0121] culturing ICM cells under conditions which do not induce
extraembryonic differentiation and cell death, and promote
proliferation of undifferentiated stem cells; and
[0122] recovering stem cells.
[0123] The stem cells will be undifferentiated cells and can be
induced to differentiate when a differentiating signal is
applied.
[0124] In a preferred embodiment of the present invention there is
provided a method of preparing undifferentiated human embryonic
stem cells for differentiation into neural progenitor cells, said
method including:
[0125] obtaining an in vitro fertilised human embryo;
[0126] removing inner cells mass (ICM) cells from the embryo;
[0127] culturing ICM cells on a fibroblast feeder layer to promote
proliferation of embryonic stem cells; and
[0128] recovering stem cells from the feeder layer.
[0129] Embryonic stem cells (ES) are derived from the embryo. These
cells are undifferentiated and have the capability of
differentiation to a variety of cell types. The "embryo" is defined
as any stage after fertilization up to 8 weeks post conception. It
develops from repeated division of cells and includes the stages of
a blastocyst stage which comprises an outer trophectoderm and an
inner cell mass (ICM).
[0130] The embryo required in the present method may be an in vitro
fertilised embryo or it may be an embryo derived by transfer of a
somatic cell or cell nucleus into an enucleated oocyte of human or
non human origin which is then activated and allowed to develop to
the blastocyst stage.
[0131] The embryo may be fertilised by any in vitro methods
available. For instance, the embryo may be fertilised by using
conventional insemination, or intracytoplasmic sperm injection.
[0132] An embryo that is recovered from cryopreservation is also
suitable. An embryo that has been cryopreserved at any stage of
development is suitable. Preferably embryos that were cryopreserved
at the zygote or cleavage stage are used. Any method of
cryopreservation of embryos may be used. It is preferred that a
method producing high quality (good morphological grade) embryos is
employed.
[0133] It is preferred that any embryo culture method is employed
but it is most preferred that a method producing high quality (good
morphological grade) blastocysts is employed. The high quality of
the embryo can be assessed by morphological criteria. Most
preferably the inner cell mass is well developed. These criteria
can be assessed by the skilled addressee.
[0134] Following insemination, embryos may be cultured to the
blastocyst stage. Embryo quality at this stage may be assessed to
determine suitable embryos for deriving ICM cells. The embryos may
be cultured in any medium that maintains their survival and
enhances blastocyst development.
[0135] Preferably, the embryos are cultured in droplets under
pre-equilibrated sterile mineral oil in IVF-50 or Scandinavian 1
(S1) or G1.2 medium (Scandinavian IVF). Preferably the incubation
is for two days. If IVF-50 or S1 is used, on the third day, an
appropriate medium such as a mixture of 1:1 of IVF-50 and
Scandinavian-2 medium (Scandinavian IVF) may be used. From at least
the fourth day, a suitable medium such as G2.2 or Scandinavian-2
(S2) medium may be used solely to grow the embryos to blastocyst
stage (blastocysts). Preferably, only G2.2 medium is used from the
fourth day onwards.
[0136] In a preferred embodiment, the blastocyst is subjected to
enzymatic digestion to remove the zona pellucida or a portion
thereof. Preferably the blastocyst is subjected to the digestion at
an expanded blastocyst stage which may be approximately on day 6.
Generally this is at approximately six days after insemination.
[0137] Any protein enzyme may be used to digest the zona pellucida
or portion thereof from the blastocyst. Examples include pronase,
acid Tyrodes solution, and mechanical methods such as laser
dissection.
[0138] Preferably, Pronase is used. The pronase may be dissolved in
PBS and G2 or S2 medium. Preferably the PBS and Scandinavian-2
medium is diluted 1:1. For digestion of zona pellucida from the
blastocyst, approximately 10 units/ml of Pronase may be used for a
period sufficient to remove the zona pellucida. Preferably
approximately 1 to 2 mins, more preferably 1 to 1.5 mins is
used.
[0139] The embryo (expanded blastocyst) may be washed in G2.2 or S2
medium, and further incubated to dissolve the zona pellucida.
Preferably, further digestion steps may be used to completely
dissolve the zona. More preferably the embryos are further
incubated in pronase solution for 15 seconds. Removal of the zona
pellucida thereby exposes the trophectoderm.
[0140] In a preferred embodiment of the invention the method
further includes the following steps to obtain the inner cell mass
cell, said steps including:
[0141] treating the embryo to dislodge the trophectoderm of the
embryo or a portion thereof;
[0142] washing the embryo with a G2.2 or S2 medium to dislodge the
trophectoderm or a portion thereof; and
[0143] obtaining inner cell mass cells of the embryo.
[0144] Having had removed the zona pellucida, the ICM and
trophectoderm become accessible. Preferably the trophectoderm is
separated from the ICM. Any method may be employed to separate the
trophectoderm from the ICM. Preferably the embryo (or blastocyst
devoid of zona pellucida) is subjected to immuno-surgery.
Preferably it is treated with an antibody or antiserum reactive
with epitopes on the surface of the trophectoderm. More preferably,
the treatment of the embryo, (preferably an embryo at the
blastocyst stage devoid of zona pellucida) is combined with
treatment with complement. The antibody and/or antiserum and
complement treatment may be used separately or together. Preferred
combinations of antibody and/or antiserum and complement include
anti-placental alkaline phosphatase antibody and Baby Rabbit
complement (Serotec) or anti-human serum antibody (Sigma) combined
with Guinea Pig complement (Gibco).
[0145] Preferably the antibodies and complement are diluted in G2.2
or S2 medium. The antibodies and complement, excluding
anti-placental alkaline phosphate (anti-AP) are diluted 1:5 whereas
anti-AP antibody is diluted 1:20 with S-2 medium.
[0146] Preferably the embryo or blastocyst (preferably having the
zona pellucida removed) is subjected to the antibody before it is
subjected to the complement. Preferably, the embryo or blastocyst
is cultured in the antibody for a period of approximately 30
mins.
[0147] Following the antibody exposure, it is preferred that the
embryo is washed. Preferably it is washed in G2.2 or S2 medium. The
embryo or blastocyst preferably is then subjected to complement,
preferably for a period of approximately 30 mins.
[0148] G2.2 or S2 (Scandinavian-2) medium is preferably used to
wash the embryo or blastocyst to dislodge the trophectoderm or a
portion thereof. Dislodgment may be by mechanical means. Preferably
the dislodgment is by pipetting the blastocyst through a small bore
pipette.
[0149] The ICM cells may then be exposed and ready for removal and
culturing. Culturing of the ICM cells may be conducted on a
fibroblast feeder layer. In the absence of a fibroblast feeder
layer, the cells will differentiate. Leukaemia inhibitory factor
(LIF) has been shown to replace the feeder layer in some cases and
maintain the cells in an undifferentiated state. However, this
seems to only work for mouse cells. For human cells, high
concentrations of LIF were unable to maintain the cells in an
undifferentiated state in the absence of a fibroblast feeder
layer.
[0150] The conditions which do not induce extraembryonic
differentiation and cell death may include cultivating the
embryonic stem cells on a fibroblast feeder layer which does not
induce extraembryonic differentiation and cell death.
[0151] Mouse or human fibroblasts are preferably used. They may be
used separately or in combination. Human fibroblasts provide
support for stem cells, but they create a non-even and sometimes
non-stable feeder layer. However, they may combine effectively with
mouse fibroblasts to obtain an optimal stem cell growth and
inhibition of differentiation.
[0152] The cell density of the fibroblast layer affects its
stability and performance. A density of approximately 25,000 human
and 70,000 mouse cells per cm.sup.2 is most preferred. Mouse
fibroblasts alone are used at 75,000-100,000/cm.sup.2. The feeder
layers are preferably established 6-48 hours prior to addition of
ES or ICM cells.
[0153] Preferably the mouse or human fibroblast cells are low
passage number cells. The quality of the fibroblast cells affects
their ability to support the stem cells. Embryonic fibroblasts are
preferred. For mouse cells, they may be obtained from 135 day old
foetuses. Human fibroblasts may be derived from embryonic or foetal
tissue from termination of pregnancy and may be cultivated using
standard protocols of cell culture. The guidelines for handling the
mouse embryonic fibroblasts may include minimising the use of
trypsin digestion and avoidance of overcrowding in the culture.
Embryonic fibroblasts that are not handled accordingly will fail to
support the growth of undifferentiated ES cells. Each batch of
newly derived mouse embryonic fibroblasts is tested to confirm its
suitability for support and maintenance of stem cells.
[0154] Fresh primary embryonic fibroblasts are preferred in
supporting stem cell renewal and/or induction of somatic
differentiation as compared to frozen-thawed fibroblasts.
Nevertheless, some batches will retain their supportive potential
after repeated freezing and thawing. Therefore each fresh batch
that has proved efficient in supporting ES cells renewal and/or
induction of somatic differentiation is retested after freezing and
thawing. Batches that retain their potential after freezing and
thawing are most preferably used. Batches are tested to determine
suitability for the support of stem cell renewal, the induction of
somatic differentiation or the induction of extraembryonic
differentiation.
[0155] Some mouse strains yield embryonic fibroblasts which are
more suitable for stem cell maintenance and induction of somatic
differentiation than those of other strains. For example,
fibroblasts derived from inbred 129/Sv or CBA mice or mice from a
cross of 129/Sv with C57/B16 strains have proven highly suitable
for stem cell maintenance.
[0156] Isolated ICM masses may be plated and grown in culture
conditions suitable for human stem cells.
[0157] It is preferred that the feeder cells are treated to arrest
their growth. Several methods are available. It is preferred that
they are irradiated or are treated with chemicals such as mitomycin
C which arrests their growth. Most preferably, the fibroblast
feeder cells are treated with mitomycin C (Sigma).
[0158] The fibroblast feeder layer maybe generally plated on a
gelatin treated dish. Preferably, the tissue culture dish is
treated with 0. 1% gelatin.
[0159] The fibroblast feeder layer may also contain modified
fibroblasts. For instance, fibroblasts expressing recombinant
membrane bound factors essential for stem cell renewal may be used.
Such factors may include for example human multipotent stem cell
factor.
[0160] Inner cell mass cells may be cultured on the fibroblast
feeder layer and maintained in an ES medium. A suitable medium is
DMEM (GIBCO, without sodium pyruvate, with glucose 4500 mg/L)
supplemented with 20% FBS (Hyclone, Utah), (betamercaptoethanol
--0.1 mM (GIBCO), non essential amino acids--NEAA 1% (GIBCO),
glutamine 2mM. (GIBCO), and penicillin 50 .mu./ml, streptomycin 50
.mu.g/ml (GIBCO). In the early stages of ES cell cultivation, the
medium maybe supplemented with human recombinant leukemia
inhibitory factor hLIF preferably at 2000 .mu./ml. However, LIF
generally is not necessary. Any medium may be used that can support
the ES cells.
[0161] The ES medium may be further supplemented with soluble
growth factors which promote stem cell growth or survival or
inhibit stem cell differentiation. Examples of such factors include
human multipotent stem cell factor, or embryonic stem cell renewal
factor.
[0162] The isolated ICM may be cultured for at least six days. At
this stage, a colony of cells develops. This colony is comprised
principally of undifferentiated stem cells. They may exist on top
of differentiated cells. Isolation of the undifferentiated cells
may be achieved by chemical or mechanical means or both. Preferably
mechanical isolation and removal by a micropipette is used.
Mechanical isolation may be combined with a chemical or enzymatic
treatment to aid with dissociation of the cells, such as
Ca.sup.2+/Mg.sup.2+ free PBS medium or dispase.
[0163] In a further preferred embodiment of the invention, the
method fither includes:
[0164] replating the stem cells from the fibroblast feeder layer
onto another fibroblast feeder layer; and
[0165] culturing the stem cells for a period sufficient to obtain
proliferation of morphologically undifferentiated stem cells.
[0166] A furter replating of the undifferentiated stem cells is
performed. The isolated clumps of cells from the first fibroblast
feeder layer may be replated on fresh human/mouse fibroblast feeder
layer in the same medium as described above.
[0167] Preferably, the cells are cultured for a period of 7-14
days. After this period, colonies of undifferentiated stem cells
may be observed. The stem cells may be morphologically identified
preferably by the high nuclear/cytoplasmic ratios, prominent
nucleoli and compact colony formation. The cell borders are often
distinct and the colonies are often flatter than mouse ES cells.
The colonies resemble those formed by pluripotent human embryonal
carcinoma cell lines such as GCT 27 X-1.
[0168] In another embodiment of the invention, the method fturther
includes propagating the undifferentiated stem cells. The methods
of propagation may initially involve removing clumps of
undifferentiated stem cells from colonies of cells. The dispersion
is preferably by chemical or mechanical means or both. More
preferably, the cells are washed in a Ca.sup.2+/Mg.sup.2+ free PBS
or they are mechanically severed from the colonies or a combination
of these methods or any known methods available to the skilled
adressee. In these methods, cells may be propagated as clumps of
about 100 cells about every 7 days.
[0169] In the first method, Ca.sup.2+/Mg.sup.2+ free PBS medium may
be used to reduce cell-cell attachments. Following about 15-20
minutes, cells gradually start to dissociate from the monolayer and
from each other and desired size clumps can be isolated. When cell
dissociation is partial, mechanical dissociation using the sharp
edge of the pipette may assist with cutting and the isolation of
the clumps.
[0170] An alternative chemical method may include the use of an
enzyme. The enzyme may be used alone or in combination with a
mechanical method. Preferably, the enzyme is dispase.
[0171] An alternative approach includes the combined use of
mechanical cutting of the colonies followed by isolation of the
subcolonies by dispase. Cutting of the colonies may be performed in
PBS containing Ca.sup.2+ and Mg.sup.2+. The sharp edge of a
micropipette may be used to cut the colonies to clumps of about 100
cells. The pipette may be used to scrape and remove areas of the
colonies. The PBS is preferably changed to regular equilibrated
human stem cell medium containing dispase (Gibco) 10 mg/ml and
incubated for approximately 5 minutes at 37.degree. C. in a
humidified atmosphere containing 5% CO.sub.2. As soon as the clumps
detached they may be picked up by a wide bore micro-pipette, washed
in PBS containing Ca.sup.2+ and Mg.sup.2+ and transferred to a
fresh fibroblast feeder layer.
[0172] The fibroblast feeder layer may be as described above.
[0173] Undifferentiated embryonic stem cells have a characteristic
morphology as described above. Other means of identifying the stem
cells may be by cell markers or by measuring expression of genes
characteristic of pluripotent cells.
[0174] Examples of genes characteristic of pluripotent cells or
particular lineages may include (but are not limited to) Oct-4 and
Pax-6, polysialyated NCAM, nestin and vimentin as markers of stem
cells and neuronal precursors respectively. Other genes
characteristic of stern cells may include Genesis, GDF-3 and
Cripto. CD-34 is characteristic of hematopoietic stem cells and
flk-1 is expressed by the hemangioblast. Such gene expression
profiles may be attained by any method including RT-PCR, methods of
differential gene expression, microarray analysis or related
techniques.
[0175] Preferably the stem cells may be identified by being
immunoreactive with markers for human pluripotent stem cells
including SSEA-4, GCTM-2 antigen, TRA 1-60. Preferably the cells
express the transcription factor Oct-4. The cells also maintain a
diploid karyotype.
[0176] Preferably the neural progenitor cells are identified by
expressed markers of primitive neuroectoderm and neural stem cells
such as polysialyated N-CAM, intermediate filament proteins such as
nestin and vimentin and the transcription factor Pax-6. Neurons may
be identified by structural markers such as .beta.-tubulin,
.beta.-tubulin III, the 68 kDa and the 200 kDa neurofilament
proteins. Mature neurons may also be identified by the 160 kDa
neurofilament proteins, Map-2a, b and synaptophysin, glutamate,
tyrosine hydroxylase, GABA biosynthesis and receptor subunits
characteristic of GABA minergic neurons (GABA A.alpha.2).
Astrocytes may be identified by the expression of glial fibrillary
acidic protein (GFAP), and oligodendrocyte by galactocerebroside
(gal C), 2', 3'-cyclic nucleotide 3'-phosphodiesterase (CNPase),
plp, DM-20 and O4.
[0177] The stem cells may be further modified at any stage of
isolation. They may be genetically modified through introduction of
vectors expressing a selectable marker under the control of a stem
cell specific promoter such as Oct-4. Some differentiated progeny
of embryonic stem cells may produce products which are inhibitory
to stem cell renewal or survival. Therefore selection against such
differentiated cells, facilitated by the introduction of a
construct such as that described above, may promote stem cell
growth and prevent differentiation.
[0178] The stem cells may be genetically modified at any stage with
markers so that the markers are carried through to any stage of
cultivation. The markers may be used to purify the differentiated
or undifferentiated stem cell population at any stage of
cultivation.
[0179] Genetic construct may be inserted to undifferentiated or
differentiated cells at any stage of cultivation. The genetically
modified cells may be used after transplantation to carry and
express genes in target organs in the course of gene therapy.
[0180] Progress of the stem cells and their maintenance in a
differentiated or undifferentiated stage may be monitored in a
quantitative fashion by the measurement of stem cell specific
secreted products into the culture medium or in fixed preparations
of the cells using ELISA or related techniques. Such stem cell
specific products might include the soluble form of the CD30
antigen or the GCTM-2 antigen or they may be monitored as described
above using cell markers or gene expression.
[0181] In another aspect of the invention there is provided a
method of inducing somatic differentiation of stem cells in vitro
into progenitor cells said method comprising:
[0182] obtaining undifferentiated stem cells; and
[0183] providing a differentiating signal under conditions which
are non-permissive for stem cell renewal, do not kill cells and/or
induces unidirectional differentiation toward extraembryonic
lineages.
[0184] The undifferentiated cell lines of the present invention may
be cultured indefinitely until a differentiating signal is
given.
[0185] In the presence of a differentiation signal,
undifferentiated ES cells in the right conditions will
differentiate into derivatives of the embryonic germ layers
(endoderm, mesoderm and ectoderm) such as neuron tissue, and/or
extraembryonic tissues. This differentiation process can be
controlled.
[0186] This method is useful for directing stem cells to
differentiate toward a somatic lineage. Furthermore, the method
allows the establishment of a pure preparation of progenitor cells
from a desired lineage and the elimination of unwanted
differentiated cells from other lineages. The method facilitates
the establishment of a pure somatic progenitor cell line.
[0187] The method may be used to derive an enriched preparation of
a variety of somatic progenitors such as but not limited to
mesodermal progenitors (such as hemangioblast or hematopoietic stem
cells) and neural progenitors. Preferably the method is used to
derive neural progenitors.
[0188] Conditions for obtaining differentiated cultures of somatic
cells from embryonic stem cells are those which are non-permissive
for stem cell renewal, but do not kill stem cells or drive them to
differentiate exclusively into extraembryonic lineages. A gradual
withdrawal from optimal conditions for stem cell growth favours
somatic differentiation. The stem cells are initially in an
undifferentiated state and can be induced to differentiate.
[0189] In a preferred embodiment of the present invention, there is
provided a method of inducing somatic differentiation of stem cells
in vitro into progenitor cells, said method comprising:
[0190] obtaining undifferentiated stem cells; and
[0191] culturing said cells for prolonged periods and at high
density on a fibroblast feeder cell layer to induce
differentiation.
[0192] In another preferred embodiment of the present invention,
there is provided a method of inducing somatic differentiation of
stem cells in vitro into progenitor cells, said method
comprising:
[0193] obtaining undifferentiated stem cells; and
[0194] transferring said cells into serum free media to induce
differentiation.
[0195] The stem cells may be undifferentiated stem cells and
derived from any source or process which provides viable
undifferentiated stem cells. The methods described above for
retrieving stem cells from embryos is most preferred.
[0196] In these preferred aspects, the conditions of culturing the
cells at high density on a fibroblast feeder cell layer or
transferring to a serum free medium are intended to be
non-permissive for stem cell renewal or cause unidirectional
differentiation toward extraembryonic lineages.
[0197] Generally the presence of a fibroblast feeder layer will
maintain these cells in an undifferentiated state. This has been
found to be the case with the cultivation of mouse and human ES
cells. However, without being restricted by theory, it has now
become evident that the type and handling of the fibroblast feeder
layer is important for maintaining the cells in an undifferentiated
state or inducing differentiation of the stem cells.
[0198] Suitable fibroblast feeder layers are discussed above.
[0199] Somatic differentiation in vitro of the ES cell lines is a
function of the period of cultivation following subculture, the
density of the culture, and the fibroblast feeder cell layer. It
has been found that somatic differentiation may be detected as
early as the first week after subculture and is morphologically
apparent and demonstrable by immunochemistry approximately 14 days
following routine subcultivation as described above in areas of the
colony which are remote from direct contact with the feeder cell
layer (in contrast to areas adjacent to the feeder cell layer where
rapid stem cell growth is occurring such as the periphery of a
colony at earlier time points after subcultivation), or in cultures
which have reached confluence. Depending upon the method of
preparation and handling of the mouse embryo fibroblasts, the mouse
strain from which the fibroblasts are derived, and the quality of a
particular batch, stem cell renewal, extraembryonic differentiation
or somatic differentiation may be favoured.
[0200] Once a suitable fibroblast cell line is selected, it may be
used as a differentiation inducing fibroblast feeder layer to
induce the undifferentiated stem cells to differentiate into a
somatic lineage or multiple somatic lineages. These may be
identified using markers or gene expression as described above.
Preferably the fibroblast feeder layer does not induce
extraembryonic differentiation and cell death.
[0201] The modulation of stem cell growth by appropriate use of
fibroblast feeder layer and manipulation of the culture conditions
thus provides an example whereby somatic differentiation may be
induced in vitro concomitant with the limitation of stem cell
renewal without the induction of widespread cell death or
extraembryonic differentiation.
[0202] Other manipulations of the culture conditions such as
culturing in various compositions of serum free medium may be used
to arrest stem cell renewal without causing stem cell death or
unidirectional extraembryonic differentiation, thereby favouring
differentiation of somatic cells.
[0203] Differentiation may also be induced by culturing to a high
density in monolayer or on semi-permeable membranes so as to create
structures mimicing the postimplantation phase of human
development, or any modification of this approach. Cultivation in
the presence of cell types representative of those known to
modulate growth and differentiation in the vertebrate embryo (eg.
endoderm cells or cells derived from normal embyronic or neoplastic
tissue) or in adult tissues (eg. bone marrow stromal preparation)
may also induce differentiation, modulate differentiation or induce
maturation of cells within specific cell lineage so as to favour
the establishment of particular cell lineages.
[0204] Chemical differentiation may also be used to induce
differentiation. Propagation in the presence of soluble or membrane
bound factors known to modulate differentiation of vertebrate
embryonic cells, such as bone morphogenetic protein-2 or
antagonists of such factors, may be used.
[0205] Applicants have found that Oct-4 is expressed in stem cells
and down-regulated during differentiation and this strongly
indicates that stem cell selection using drug resistance genes
driven by the Oct-4 promoter will be a useful avenue for
manipulating human ES cells. Directed differentiation using growth
factors, or the complementary strategy of lineage selection coupled
with growth factor enhancement could enable the selection of
populations of pure committed progenitor cells from spontaneously
differentiating cells generated as described here.
[0206] Genetic modification of the stem cells or further
modification of those genetically modified stem cells described
above may be employed to control the induction of differentiation.
Genetic modification of the stem cells so as to introduce a
construct containing a selectable marker under the control of a
promoter expressed only in specific cell lineages, followed by
treatment of the cells as described above and the subsequent
selection for cells in which that promoter is active may be
used.
[0207] Once the cells have been induced to differentiate, the
various cell types, identified by means described above, may be
separated and selectively cultivated. Preferably neural progenitor
cells are selected. These progenitors are capable of
differentiating into neuron cells and/or glial cells. More
preferably, they will differentiate into neuron cells and/or glial
cells in the absence of other differentiated cells such as those
from the extra embryonic lineage.
[0208] Selective cultivation means isolation of specific lineages
of progenitors or mature differentiated cells from mixed
populations preferably appearing under conditions unfavourable for
stem cell growth and subsequent propagation of these specific
lineages. Selective cultivation may be used to isolate populations
of mature cells or populations of lineage specific committed
progenitor cells. Isolation may be achieved by various techniques
in cell biology including the following alone or in combination:
microdissection; immunological selection by labelling with
antibodies against epitopes expressed by specific lineages of
differentiated cells followed by direct isolation under
flourescence microscopy, panning, immunomagnetic selection, or
selection by flow cytometry; selective conditions favouring the
growth or adhesion of specific cell lineages such as exposure to
particular growth or extracellular matrix factors or selective
cell-cell adhesion; separation on the basis of biophysical
properties of the cells such as density; disaggregation of mixed
populations of cells followed by isolation and cultivation of small
clumps of cells or single cells in separate culture vessels and
selection on the basis of morphology, secretion of marker proteins,
antigen expression, growth properties, or gene expression; lineage
selection using lineage specific promoter constructs driving
selectable markers or other reporters.
[0209] The derivation of neural progenitors from ES cells, and even
further more, the establishment of a pure neural progenitor cell
line is described below as proof of the above principles. The
following description is illustrative of neural progenitor cells as
somatic cells differentiated from stem cells and should not be
taken as a restriction on the generality of the invention. It
should be noted that the method may be used to derive an enriched
preparation of a variety of somatic progenitors such as but not
limited to mesodermal progenitors such as hemangioblast or
hematopoietic stem cells or neural progenitors.
[0210] The establishment of neural progenitor cells from embryonic
stem cells and more preferably a pure preparation of neural
progenitor cells and even more preferably a neural progenitor cell
line may be achieved by any one or combination of the following
approaches.
[0211] In one preferred approach, somatic differentiation of ES
cells is induced by prolonged culture of ES cells to high density
on an appropriate fibroblast feeder layer that prevents
unidirectional differentiation towards extraembryonic lineage and
promotes somatic differentiation. Once the cells have been induced
to differentiate toward somatic lineages, areas which are destined
to give rise to clusters of mainly neural progenitor cells may be
identified based on characteristic morphological features as
described above. The size and demarcation of these areas may be
enhanced by replacing the growth medium with serum free medium
supplemented with EGF and bFGF. The areas are separated
mechanically and replated in serum-free medium, whereupon they form
spherical structures.
[0212] Any serum free medium may be used. Preferably NS-A
(Euroclone) or DMEM/F12 (Gibco) is used. More preferably NS-A or
DMEM/F12 supplemented with N2 or B27 (Gibco) is used. Most
preferably DMEM/F12 supplemented with B27 is used.
[0213] In the presence of an appropriate supplement of growth
factors such as but not limited to, EGF and basic FGF to the serum
free medium, the neural progenitors may be cultivated and expanded
to establish a cell line. The growth factors inhibit flurther
differentiation of the progenitor cells and promote their
proliferation.
[0214] The culture in the serum free medium and preferably growth
factors is selective and therefore limits prolonged proliferation
of other types of differentiated cells such as the progeny of the
extraembryonic lineage or definitive endoderm that may coexist in
the culture. Therefore the cultivation in these selective
conditions may be used to establish an enriched cell line of neural
progenitors.
[0215] The progenitors may be cultivated as spheres or as a
monolayer. Subculturing may be conducted mechanically. Scraping is
preferred to propagate monolayer cultures. However, any mechanical
method such as tituration or cutting may be used to subculture the
spheres. Most preferably the spheres are sliced into smaller
clumps. The progenitors may be expanded to produce a large number
of cells.
[0216] In another preferred approach, the method involves the
transfer of undifferentiated stem cells into culture conditions
that on one hand direct differentiation toward a desired somatic
lineage, which is the neural lineage in this case, while on the
other hand are selective and therefore limit both the
differentiation toward unwanted lineages (such as extraembryonic
lineages or endoderm) as well as the survival of differentiated
cells from these lineages. Such culture conditions include the
transfer into serum free media (as described above) that may be
supplemented with growth factors including but not limited to bFGF
and EGF. The serum free media promotes differentiation towards the
neuroectodermal lineage (and possibly other non-neural lineages
such as mesoderm). The serum free media may limit the growth and
survival of unwanted cells such as those from the extraembryonic or
endodermal lineages.
[0217] In a further preferred embodiment of the invention, the
method allows the establishment of a pure progenitor cell line from
the desired lineage.
[0218] Growth factors that are added to the medium may promote the
proliferation and the cultivation of the desired somatic
progenitors such as neural progenitors. The selective culture
conditions further eliminate during cultivation, unwanted
differentiated cells from other lineages such as extraembryonic
lineages. The method may be used to derive a pure preparation
and/or a pure cell line of a variety of somatic progenitors
including, but not limited to, neural progenitor and mesodermal
progenitors such as hemangioblast or hematopoietic stem cells.
[0219] Preferably, in the derivation of an enriched cell line of
neural progenitors, clumps of undifferentiated stem cells may be
transferred into plastic tissue culture dishes containing serum
free medium. The serum free medium induces the differentiation of
the ES cells initially towards ectoderm and then towards the
neuroectodermal lineage.
[0220] Any serum free medium may be used. Preferably NS-A medium
(Euroclone) or DMEM/F12 is used. More preferably the serum free
medium is supplemented with N2 or B27 (Gibco). Most preferably the
medium is DMEM/F12 supplemented with B27. The clusters of
undifferentiated stem cells turn into round spheres within
approximately 24 hours after transfer (FIG. 9).
[0221] The serum free medium may be further supplemented with basic
FGF and EGF to promote proliferation of neural progenitors in an
undifferentiated state. The progenitors may be cultivated under
these conditions for prolonged periods. The selective conditions
that are induced by the serum free medium and growth factors result
in a gradual purification and elimination of other differentiated
cell types during cultivation.
[0222] The progenitors may be cultivated as spheres or as a
monolayer. Subculturing may be conducted mechanically. Scraping is
preferred to propagate monolayer cultures. Any mechanical method
known to the skilled addressee such as tituration or cutting may be
used to subculture the spheres. Most preferably the spheres are
sliced into smaller clumps. The progenitors may be expanded to
produce a large number of cells.
[0223] The progenitors that are generated directly from
undifferentiated stem cells have similar properties to the neural
progenitors that are generated from differentiating stem cells
colonies. They express the same markers of primitive neuroectoderm
and neural progenitor cells, such as polysialyated NCAM, the
intermediate filament protein nestin, Vimentin and the
transcription factor Pax-6. They do not express the transcriptional
factor oct-4. They have a similar growth potential. They generate
differentiated neural cells with similar morphology and marker
expression after plating on appropriate substrate and withdrawal of
growth factors.
[0224] In another aspect of the invention, there is provided a
method of inducing somatic cells from embryonic stem cell derived
somatic progenitors, said method comprising:
[0225] obtaining a source of embryonic stem cell derived somatic
progenitor cells;
[0226] culturing the progenitor cells on an adhesive substrate;
and
[0227] inducing the cells to differentiate to somatic cells under
conditions which favour somatic differentiation.
[0228] The source of embryonic stem cell derived progenitor cells
may be from any source. However, they are preferably established by
the methods described above. Preferably, the cells are grown in the
presence of a serum-free media and growth factor.
[0229] The somatic cells may preferably be neurons, or glial
progenitor cells including astrocytes or oligodendrocyte progenitor
cells. Preferably, the somatic progenitors are neural
progenitors.
[0230] Any adhesive substrate may be used. More preferably,
poly-D-lysine and laminin or poly-D-lysine and fibronectin are
used.
[0231] Induction of somatic cells is preferably achieved by
withdrawing growth factors from the media. However, other
acceptable methods of induction may be used. These may include:
[0232] culturing the undifferentiated cells for prolonged periods
and at high density to induce differentiation;
[0233] culturing the cells in serum free media;
[0234] culturing the cells on a differentiation inducing fibroblast
feeder layer and wherein said fibroblast feeder layer does not
induce extra embryonic differentiation and cell death;
[0235] culturing to a high density in monolayer or on
semi-permeable membrane so as to create structures mimicing the
postimplantation phase of human development; or
[0236] culturing in the presence of a chemical differentiation
factor selected from the group including bone morphogenic protein-2
or antagonists thereof.
[0237] For inducing neurons, it is preferred to further use
poly-D-lysine and laminin.
[0238] Upon plating of neural progenitors on an appropriate
substrate such as poly-D-lysine and laminin, and withdrawal of
growth factors from the serum free medium, differentiated cells
grow out of the spheres as a monolayer and acquire morphology of
mature neurons and expression of markers such as the 160 kd
neurofilament protein, Map-2AB, synaptophysin, Glutamate, tyrosine
hydroxylase, GABA biosynthesis and receptor subunits characteristic
of GABA minergic neurons (GABA A.alpha.2) which are characteristic
of mature neurons.
[0239] In a preferred embodiment, the method for inducing neurons
further includes culturing the somatic progenitor cells, preferably
undifferentiated neural progenitor cells, or differentiating
neuronal progenitors in the presence of retinoic acid.
[0240] Retinoic acid has been found to further induce
differentiation toward mature neurons.
[0241] The establishment of oligodendrocyte and astrocyte cells
indicates the potential of the neural precursors to differentiate
towards the glial lineage.
[0242] For inducing of glial cells including astrocytes and
oligodendrocyte progenitors, it is preferred to use poly-D-lysine
and fibronectin. Fibronectin is significantly more potent than
laminin for the induction of differentiation towards the glial
lineage.
[0243] In a preferred embodiment, the method for inducing glial
cells further includes culturing the somatic progenitor cells,
preferably undifferentiated neural progenitor cells, in the
presence of PDGF-AA and basic FGF.
[0244] In yet another preferred embodiment, the method for inducing
glial cells further includes culturing the somatic progenitor
cells, preferably undifferentiated neural progenitor cells, in the
presence of T3. The cells may be then grown in the absence of
growth factor.
[0245] The glial cells may be selected from astrocytes or
oligodendrocytes.
[0246] Culture in serum free medium supplemented with b-FGF and
PDGF-AA may direct the neural progenitors to turn into glial
progenitors and induce the expansion of glial progenitors. This is
followed by plating the progenitors on poly-D-lysine and
fibronectin and further culture in the presence of the growth
factors and T3 followed by culture in the presence of T3 without
growth factor supplementation. Without being limited by theory, it
is postulated that the growth factors such as bFGF and PDGF-AA
facilitate proliferation and spreading of the glial progenitors,
fibronectin further induces differentiation towards the glial
lineage and T3 induce the differentiation toward and along the
oligodendrocyte lineage.
[0247] In another aspect, differentiation into glial cells
including astrocyte and oligodendrocyte cells is induced by plating
the neural progenitors on poly-D-lysine and fibronectin and
culturing them in the serum free medium supplemented with EGF,
b-FGF and PDGF-AA. The growth factors may then be removed and the
cells further cultured in the presence of T3.
[0248] In yet another aspect, the invention provides differentiated
somatic cells including neural, neural progenitor cells, neuronal
and/or glial cells prepared by the methods of the present
invention. The glial cells include astrocytes or
oligodendrocytes.
[0249] The progenitor cells that are derived by the method that is
described above may be used to generate differentiated cells from
other lineages. The spheres of progenitors may include in addition
to neural progenitors more primitive cells such as primitive
ectodermal cells or progenitor cells of other lineages such as the
hemangioblast or hematopoietic stem cells. By manipulation of the
culture conditions these primitive cells may generate all somatic
cell types.
[0250] Expression of mesodermal markers such as flk-1 and CD-34 has
been demonstrated in the human ES derived progenitor cell
preparation. This may indicate the presence of mesodermal primitive
cells such as the hemangioblast cell or hematopoietic stem cell.
Alternatively it may be that the primitive neural progenitors
within the spheres express these mesodermal markers. The expression
of the markers may indicate the possible high plasticity of the
neural progenitors to transdifferentiate into mesodermal cells.
[0251] The present invention provides a method that generates an in
vitro and in vivo model of controlled differentiation of ES cells
towards the neural lineage. The model, and the cells that are
generated along the pathway of neural differentiation may be used
for the study of the cellular and molecular biology of human neural
development, for the discovery of genes, growth factors, and
differentiation factors that play a role in neural differentiation
and regeneration. The model, and the cells that are generated along
the pathway of neural differentiation may be used for drug
discovery and for the development of screening assays for
teratogenic, toxic and neuroprotective effects.
[0252] In a further aspect of the invention, there is provided a
method of producing large quantities of differentiated and
undifferentiated cells. It is intended to mean that these cells can
be propagated, expanded and grown in cell culture.
[0253] In yet another aspect, the present invention provides a
method of producing an enriched preparation of human ES derived
neural progenitor cells, said method comprising:
[0254] obtaining an undifferentiated human embryonic stem cell as
described herein;
[0255] inducing somatic differentiation of the embryonic stem cell
to a neural progenitor cell by a method described herein;
[0256] identifying a neural progenitor cell by expressed markers of
primitive neuroectoderm and neural stem cells such as polysialyated
N-CAM, intermediate filament proteins such as nestin and vimentin
and the transcription factor Pax-6; and
[0257] culturing the neural progenitor cells to promote
proliferation and propagation.
[0258] The neural progenitor cells will grow as spheres or
monolayers preferably in serum free media. A suitable media is
DMEM/F12 supplemented with growth factors selected from the group
including B27, EGF and bFGF.
[0259] Further enrichment of the preparation may be achieved by
further cultivation in new media which includes transferring the
clumps of cells into new media.
[0260] In a further aspect of the invention there is provided a
method to dis-aggregate the spheres into single cell suspensions.
Dis-aggregation by using digestion with trypsin or dispase may be
ineffective. Dis-aggregation may be accomplished by digestion with
papain combined with mechanical tituration.
[0261] In another aspect of the invention, there is provided a
method of transplanting ES derived neural progenitor spheres, said
method comprising:
[0262] disaggregating the spheres; and
[0263] injecting the disaggregated spheres into a living host.
[0264] Disaggregation of the spheres may be conducted in any way to
separate the cells either to small clumps or single cells. Ideally,
trypsin or dispase are not used. Mechanical disaggregation or
tituration may be adopted to separate the cells prior to injection.
Alternatively the spheres may be disaggregated by digestion with
papain preferably combined with mechanical tituration.
[0265] Injection may be conducted in any manner so as to introduce
the cells into the nervous system of the host. Preferably the cells
are introduced into a specific site in the nervous system. Any
method may be used to introduce the cells into a specific location.
Preferably, the cells are injected using a micro-glass pipette
(300micron outer diameter) connected to a micro-injector
(Narishige, Japan). The glass pipette may be covered by a plastic
sleeve that will limit the depth of penetration into the host
nervous system. The cells may be also injected by a hamilton
syringe into predetermined depth using a stereotaxic device. Any
stereotaxic injection method may be suitable.
[0266] The volume that is injected and the concentration of cells
in the transplanted solution depend on the indication for
transplantation, the location in the nervous system and the species
of the host. Preferably 2 microliters with 25,000-50,000 cells per
microliter are injected to the lateral cerebral ventricles of
newborn rats or mice.
[0267] In another aspect of the invention there is provided a
neural progenitor cell capable of transplantation into a host
nervous system said cell characterised by establishing a stable
graft and contributing in the histogenesis of a living host.
[0268] In another aspect of the present invention there is provided
a method of inducing somatic cells in vivo from embryonic stem cell
derived somatic progenitors, said method comprising:
[0269] obtaining a source of embryonic stem cell derived somatic
progenitor cells, preferably prepared by the methods described
herein; and
[0270] transplanting the somatic progenitors into a host to induce
differentiation to somatic cells.
[0271] The transplanting may be conducted by any of the methods
described herein.
[0272] When engrafted into a developing nervous system, the
progenitor cells will participate in the processes of normal
development and will respond to the host's developmental cues. The
engrafted progenitor cells will migrate along established migratory
pathways, will spread widely into disseminated areas of the nervous
system and will differentiate in a temporally and regionally
appropriate manner into progeny from both the neuronal and glial
lineages in concert with the host developmental program. The
engrafted neural progenitor cell is capable of non-disruptive
intermingling with the host neural progenitors as well as
differentiated cells. The transplanted cells can replace specific
deficient neuronal or glial cell populations, restore defective
functions and can express foreign genes in a wide distribution.
[0273] In a further aspect of the invention the ES derived neural
progenitor cells or their differentiated progeny may be
transplanted into the developed nervous system. They can form a
stable graft, migrate within the host nervous system, intermingle
and interact with the host neural progenitors and differentiated
cells. They can replace specific deficient neuronal or glial cell
populations, restore deficient functions and activate regenerative
and healing processes in the host's nervous system. In an even
further aspect of the invention the transplanted cells can express
foreign genes in the host's nervous system.
[0274] Preferably the stable graft is a graft established in the
central nervous system or the peripheral nervous system.
[0275] In a further aspect of the invention the progenitor cells
are grafted into other organs such as but not limited to the
hematopoietic system where they trans-differentiate and form a
stable functional graft.
[0276] More preferably the spheres are ES derived human neural
progenitor spheres which are transplanted into the living host.
[0277] In a further aspect of the invention there is provided a
neural progenitor cell, a neuronal cell and/or a glial cell that
may be used for cell therapy in a variety of pathological
conditions including but not limited to neurodegenerative
disorders, vascular conditions, autoimmune disorders, congenital
disorders, trauma and others.
[0278] In a further aspect of the invention there is provided a
neural progenitor cell, a neuronal cell and/or a glial cell that
may be used for gene therapy. Genetically manipulated neural
progenitor cells or neuronal cell or glial cells may be used after
transplantation as a vector to carry and express desired genes at
target organs.
[0279] In another aspect of the present invention, there is
provided a committed progenitor cell line. The progenitor cell line
may be expanded to produce large quantities of progenitor cells,
neural progenitor cells, neuronal cells, mature neuronal cells and
glial cells.
[0280] In another aspect of the invention, there are provided
committed neural progenitor cells capable of self renewal or
differentiation into one or limited number of somatic cell
lineages, as well as mature differentiated cell produced by the
methods of the present invention.
[0281] Expansion of the committed progenitor cells may be useful
when the number of progenitors that may be derived from ES cells is
limited. In such a case, expansion of the progenitors may be useful
for various applications such as the production of sufficient cells
for transplantation therapy, for the production of sufficient RNA
for gene discovery studies etc. For example, by using the
techniques described above, expansion of progenitor cells from ten
spheres for ten passages may generate 50.times.10.sup.6 cells that
would be sufficient for any application.
[0282] These observations on cells of the neural lineage establish
the principle that by using the techniques described, committed
progenitor cells may be isolated, from embryonic stem cell cultures
propagated, expanded, enriched and further induced to produce fully
differentiated cells.
[0283] In a further aspect of the invention, there is provided a
method of producing large quantities of differentiated and
undifferentiated cells.
[0284] In another aspect there is provided a differentiated
committed progenitor cell line that may be cultivated for prolonged
periods and give rise to large quantities of progenitor cells and
fully differentiated cells.
[0285] The neural progenitor cells or other committed progenitor
cells derived by the method described above may be used to generate
differentiated cells from other lineages by
transdifferentiation.
[0286] In another aspect there is provided a differentiated
committed progenitor cell line capable of differentiation into
mature neurons and/or glial cells. Preferably the progenitor cell
is a neural progenitor cell.
[0287] In another aspect there is provided an undifferentiated cell
line capable of differentiation into neural progenitor cells
produced by the method of the present invention.
[0288] Specific cell lines HES-1 and HES-2 were isolated by the
procedures described above and have the properties described
above.
[0289] In another aspect of the invention there is provided a cell
composition including a human differentiated or undifferentiated
cell capable of differentiation into neural progenitor cells
preferably produced by the method of the present invention, and a
carrier.
[0290] The carrier may be any physiologically acceptable carrier
that maintains the cells. It may be PBS or ES medium.
[0291] The differentiated or undifferentiated cells may be
preserved or maintained by any methods suitable for storage of
biological material. Vitrification of the biological material is
the preferred method over the traditional slow-rate freezing
methods.
[0292] Effective preservation of ES cells is highly important as it
allows for continued storage of the cells for multiple future
usage. Although traditional slow freezing methods, commonly
utilised for the cryo-preservation of cell lines, may be used to
cryo-preserve undifferentiated or differentiated cells, the
efficiency of recovery of viable human undifferentiated ES cells
with such methods is extremely low. ES cell lines differ from other
cell lines since the pluripotent cells are derived from the
blastocyst and retain their embryonic properties in culture.
Therefore, cryo-preservation using a method which is efficient for
embryos is most appropriate. Any method which is efficient for
cryo-preservation of embryos may be used. Preferably, vitrification
method is used. More preferably the Open Pulled Straw (OPS)
vitrification method previously described by Vajta, G. et al (1998)
Molecular Reproduction and Development, 51, 53-58, is used for
cryopreserving the undifferentiated cells. More preferably, the
method described by Vajta, G. et al (1998) Cryo-Letters, 19,
389-392 is employed. Generally, this method has only been used for
cryopreserving embryos.
[0293] The committed progenitor cell line is efficiently recovered
from cryopreservation using the traditional slow rate cooling
method.
[0294] The differentiated or undifferentiated cells may be used as
a source for isolation or identification of novel gene products
including but not limited to growth factors, differentiation
factors or factors controlling tissue regeneration, or they may be
used for the generation of antibodies against novel epitopes. The
cell lines may also be used for the development of means to
diagnose, prevent or treat congenital diseases.
[0295] Much attention recently has been devoted to the potential
applications of stem cells in biology and medicine. The properties
of pluripotentiality and immortality are unique to ES cells and
enable investigators to approach many issues in human biology and
medicine for the first time. ES cells potentially can address the
shortage of donor tissue for use in transplantation procedures,
particularly where no alternative culture system can support growth
of the required committed stem cell. ES cells have many other far
reaching applications in human medicine, in areas such as
embryological research, functional genomics, identification of
novel growth factors, and drug discovery, and toxicology.
[0296] While the potential applications of neural stem cells
derived from adult or embryonic CNS are considerable, there may be
real advantages to neural progenitor cells derived from ES cell
cultures.
[0297] ES cell lines derived from a patients own tissue via somatic
cell nuclear transfer would produce neuronal precursors which are a
precise match to the recipients own tissue and might therefore be
more suitable for grafting.
[0298] Moreover the use of nuclear transfer to yield ES cells from
individuals with specific genetic predispostions to certain
diseases of the CNS could provide a powerful tool for the
generation of in vitro models for disease pathogenesis.
[0299] It is quite likely that neural precursors generated from ES
cell cultures may demonstrate a greater growth or developmental
potential than committed progenitors from fetal or adult CNS.
[0300] There are a huge range of cell types within the adult CNS,
and while it is clear that ES cells can give rise to any of these
in the mouse, it is not clear that neural stem cells can do so.
[0301] ES derived neural progenitors may allow the study of early
stages of the process of neurogenesis, and thereby provide
important clues for discovery of novel factors enhancing tissue
regeneration, or novel stem cell intermediates which might be more
facile at replacing damaged tissue.
[0302] It may be that the frequency of homologous recombination in
ES cells is much higher than that in neural stem cells, and
therefore that the only practical route for introducing targetted
genetic modifications into human neural tissue-either for
generation of disease models in vitro or for types of gene
therapy-lies in the reproducible generation and isolation of neural
progenitors from genetically modified embryonic stem cells.
[0303] The present invention will now be more fully described with
reference to the following examples. It should be understood,
however, that the description following is illustrative only and
should not be taken in any way as a restriction on the generality
of the invention described above.
REFERENCES
[0304] 1. Evans, M. J. and Kaufinan, M. Establishment in culture of
pluripotential stem cells from mouse embryos. Nature 292, 151-156
(1981).
[0305] 2. Martin, G. R. Isolation of a pluripotent cell line from
early mouse embryos cultured in medium conditioned by
teratocarcinoma stem cells. Proc. Natl. Acad. Sci U.S.A. 78,
7634-7638 (1981).
[0306] 3. Andrews, P. W. et al. Pluripotent embryonal carcinoma
clones derived from the human teratocarcinoma cell line Tera-2.
Lab. Invest. 50, 147-162 (1984).
[0307] 4. Pera, M. F., Cooper, S., Mills, J., & Parrington, J.
M. Isolation and characterization of a multipotent clone of human
embryonal carcinoma-cells. Differentiation 42, 10-23 (1989).
[0308] 5. Thomson, J. A. et al. Isolation of a primate embryonic
stem cell line. Proc. Natl. Acad. Sci. U.S.A. 92, 7844-7844
(1995).
[0309] 6. Thomson, J.A. et al. Pluripotent cell lines derived from
common marmoset (Callithrix jacchus) blastocysts. Biol. Reprod. 55,
254-259. (1996).
[0310] 7. Bongso A., Fong C. Y., Ng S. C., and Ratnam, S. Isolation
and culture of inner cell mass cells from human blastocysts. Hum.
Reprod. 9, 2110-2117 (1994).
[0311] 8. Thomson, J. A. et al. Embryonic stem cell lines derived
from human blastocysts. Science 282, 1145-1147 (1998).
[0312] 9. Andrews, P. W. et al. Comparative-analysis of
cell-surface antigens expressed by cell-lines derived from human
germ-cell tumors. Int.J.Cancer 66, 806-816 (1996).
[0313] 10. Cooper, S., Pera, M. F., Bennett, W., & Finch, J. T.
A novel keratan sulfate proteoglycan from a human embryonal
carcinoma cell-line. Biochem. J. 286, 959-966 (1992).
[0314] 11. Pera, M. F. et al. Analysis of cell-differentiation
lineage in human teratomas using new monoclonal-antibodies to
cytostructural antigens of embryonal carcinoma-cells.
Differentiation 39, 139-149 (1988). 12. Fong C. Y., and Bongso A.
Comparison of human blastulation rates and total cell number in
sequential culture media with and without co-culture. Hum. Reprod.
14, 774-781 (1999).
[0315] 13. Fong C. Y. et al. Ongoing pregnancy after transfer of
zona-free blastocysts: implications for embryo transfer in the
human. Hum. Reprod. 12, 557-560 (1997).
[0316] 14. Solter D., and Knowles, B. Immunosurgery of mouse
blastocyst. Proc. Natl. Acad. Sci. U.S.A. 72, 5099-5102 (1975).
[0317] 15. Vajta G, Holm P, Kuwayama M, Both PJ, Jacobsen H, Greve
T, Callesen H. Open pulled straw (OPS) vitrification: A new way to
reduce cryoinjuries of bovine ova and embryos. Molecular
Reproduction and Development 1998, 51: 53-58.
[0318] 16. Vajta G, Lewis I M, Kuwayama M, Greve T, Callesen H.
Sterile application of the opened pulled straw (OPS) vitrification
method. Cryo-Letters 1998, 19: 389-392.
[0319] 17. Beddington, R. S. P. & Robertson, E. J. Axis
development and early asymmetry in mammals. Cell 96, 195-209
(1999).
[0320] 18. Li, M., Pevny, L., Lovell-Badge, R., and Smith, A.
Generation of purified neural precursors from embryonic stem cells
by lineage selection. Curr. Biol. 8, 971-974 (1998).
[0321] 19. Svensden, C N and Smith A G New prospects for human
stem-cell therapy in the nervous system. Trends in Neurosci 22:
357, 1999.
[0322] 20. Kleinsmith L J and Pierce G B. Multipotentiality of
single embryonal carcinoma cells. Cancer Res. 1964; 24:
797-842.
[0323] 21. Stevens (1983)
[0324] 22. Martin G R. Teratocarcinomas and mammalian
embryogenesis. Science 1980; 209: 768.
[0325] 23. Matsui Y, Zsebo K, Hogan B L M. Derivation of
pluripotent embryonic stem cells from murine primordial germ cells
in culture. Cell 1992; 70: 841-847.
[0326] 24. Andrews P W. Human teratocarcinoma. Biochim. Biophys.
Acta 1988; 948: 17-36.
[0327] 25. Thompson S, Stern P L, Webb M, et al., Cloned human
teratoma cells differentiate into neuron-like cells and other cell
types in retinoic acid. J. Cell Sci. 1984; 72: 37-64.
[0328] 26. van Eijk M J T, van Rooijen M A, Modina S, Scesi L,
Folkers G, van Tol H T A, Bevers M M, Fisher S R, Lewin H A, Shehu
D, Galli C, de Vaureix C, Trounson A O, Mummery C L, and Gandolfi
F. Molecular cloning, genetic mapping and developmental expression
of bovine POU5F1. Biology of Reproduction 1999; 60: 1093-1103.
[0329] 27. Kukekov V G, Laywell E D, Suslov O et al. Multipotent
stem/progenitor cells with similar properties arise from two
neurogenic regions of adult human brain. Experimental Neurology
1999, 156: 333-344
[0330] 28. Uchida N, Buck D W, He D, Reitsma M J, Masek M, Phan T
V, Tsukamoto A S, Gage F H, Weissman I L. Direct isolation of human
central nervous system stem cells. Proc Natl Acad Sci USA 2000,
97:14720-5.
[0331] 29. Clarke D L, Johansson C B, Wilbertz J, Veress B, Nilsson
E, Karlstrom H, Lendahl U, Frisen J. Generalized potential of adult
neural stem cells. Science 2000, 288: 1660-3.
[0332] 30. Bjornson C R, Rietze R L, Reynolds B A, Magli M C,
Vescovi A L. Turning brain into blood: a hematopoietic fate adopted
by adult neural stem cells in vivo. Science 1999, 283: 534-7.
[0333] 31. Vescovi, A. L. et al. Isolation and cloning of
multipotential stem cells from the embryonic human CNS and
establishment of transplantable human neural stem cell lines by
epigenetic stimulation. Exp. Neurol. 156, 71-83 (1999).
[0334] 32. Neelands, T.R. et al. GABA.sub.A receptor pharmacology
and subtype expression in human neuronal NT2-N cells. J. Neurosci.
18, 4993-5007 (1998).
[0335] 33. Reubinoff B E, Pera M F, Fong C Y, Trounson A and Bongso
A. Embryonic stem cells. PCT/AU99/00990, U.S. application Ser. No.
09/436164.
[0336] 34. Neelands, T. R et al GABA.sub.A receptor pharmacology
and subtype expression in human neuronal NT2 N cells. J Neurosol
18, 4993-5007 (1998).
[0337] 35. Reubinoff B E, Pera M F, Fong C Y, Trounson A and Bongso
A. Embryonic stem cells. PCT/AU99/00990, U.S. application Ser. No.
09/436164.
Experimental Protocols
[0338] 1. Derivation and Propagation of ES Cells.
[0339] Fertilised oocytes were cultured to the blastocyst stage
(day 6 after insemination), in sequential media, according to a
standard co-culture free protocol (Fong C. Y., and Bongso A.
Comparison of human blastulation rates and total cell number in
sequential culture media with and without co-culture. Hum. Reprod.
14,774-781 (1999)). After zona pellucida digestion by pronase
(Sigma, St. Louis, Mo.) (Fong C. Y. et al. Ongoing pregnancy after
transfer of zona-free blastocysts: implications for embryo transfer
in the human. Hum. Reprod. 12, 557-560 (1997)), ICM were isolated
by immunosurgery (Solter D., and Knowles, B. Immunosurgery of mouse
blastocyst. Proc. Natl. Acad. Sci. U.S.A. 72, 5099-5102 (1975))
using anti-human serum antibody (Sigma) followed by exposure to
guinea pig complement (Life Technologies, Gaithersburg, Md.). ICM
were then cultured on mitomycin C mitotically inactivated mouse
embryonic fibroblast feeder layer (75,000 cells/cm2) in gelatine
coated tissue culture dishes. The culture medium consisted of DMEM
(Gibco, without sodium pyruvate, glucose 4500 mg/L) supplemented
with 20% fetal bovine serum (Hyclone, Logan, Utah), 0.1 mM
beta-mercaptoethanol, 1% non essential amino acids, 2 mM glutamine,
50 u/ml penicillin and 50 (g/ml streptomycin (Life Technologies).
During the isolation and early stages of ES cell cultivation, the
medium was supplemented with human recombinant leukemia inhibitory
factor hLIF at 2000 u/ml (Amrad, Melbourne, Australia). 6-8 days
after initial plating, ICM like clumps were removed mechanically by
a micropipette from differentiated cell outgrowths and replated on
fresh feeder layer. The resulting colonies were further propagated
in clumps of about 100 stem cell like cells, on mouse feeder layer,
about every 7 days. The clumps were either dissociated
mechanically, or with a combined approach of mechanical slicing
followed by exposure to dispase (10 mg/ml, Life Technologies).
[0340] (a) Embryo Culture
[0341] Following insemination, embryos were cultured in droplets
under pre-equilibrated sterile mineral oil in IVF-50 medium
(Scandinavian 2 medium) for 2 days.
[0342] A mixture 1:1 of IVF-50 and Scandinavian 2 medium
(Scandinavian 2 medium) was used in the third day.
[0343] From the forth day of culture, only Scandinavian 2 medium
was used to grow the cleavage stage embryos to blastocysts.
[0344] (b) Zona Pellucida Digestion.
[0345] Zona pellucida digestion was performed at the expanded
blastocyst stage on day 6.
[0346] The digestion solution included Pronase (Sigma, TC tested)
10 u in PBS and Scandinavian 2 medium (1:1).
[0347] The embryos were incubated in pronase solution for 1-1.5
min, washed in Scandinavian 2 medium and incubated for 30 minutes.
If the zona was not completely dissolved, the embryos were further
incubated in pronase solution for 15 seconds.
[0348] (c) Human Stem Cell Culture.
[0349] Human stem cells were grown on MMC treated fibroblasts'
feeder layer. Fibroblasts were plated on gelatine treated dishes. A
combination of human and mouse derived fibroblasts were used at a
density of approximately 25,000 and 70,000 cells per cm2
respectively. The fibroblasts were plated up to 48 hours before
culture of the stem cells. Mouse fibroblasts only could also
support the growth of the stem cells. However, while human
fibroblasts could also support stem cells, they created an uneven
and unstable feeder layer. Therefore, the human fibroblasts were
combined with the mouse fibroblasts to augment and achieve better
support of growth and prevention of differentiation.
[0350] The medium that was used for the growth of human stem was
DMEM (GIBCO, without sodium pyruvate, with glucose 4500 mg/L)
supplemented with 20% FBS (Hyclone, Utah) (-mercaptoethanol--0.1 mM
(GIBCO), Non Essential Amino Acids -NEAA 1% (GIBCO), glutamine 2
mM.(GIBCO), penicillin 50 u/ml, and streptomycin 50 (g/ml (GIBCO).
At the initial isolation of the stem cells the medium was
supplemented by hLIF 2000 u/ml. It was later shown that LIF was not
necessary.
[0351] (d) Human Stem Cell Propagation
[0352] Following plating, the isolated ICM attached and was
cultured for 6 days. At that stage, a colony which included a clump
of stem cells on top of differentiated cells developed. The ICM
clump was isolated and removed mechanically by a micro-pipette with
the aid of using Ca/Mg free PBS medium to reduce cell to cell
attachments.
[0353] The isolated clump was replated on fresh human/mouse
fibroblast feeder layer. Following 2 weeks of culture, a colony
with typical morphology of primate pluripotent stem cells
developed. The stem cells were further propagated in one of two
methods. In both methods cells which appeared nondifferentiated
were propagated in clumps of about 100 cells every 5-7 days.
[0354] In the first method, Ca.sup.2+/Mg.sup.2+ free PBS medium was
used to reduce cell to cell attachments. Following about 15-20
minutes, cells gradually start to dissociate and the desired size
clumps can be isolated. When cell dissociation is partial,
mechanical dissociation using the sharp edge of the pipette
assisted with cutting and the isolation of the clumps.
[0355] An alternative approach was performed by the combined use of
mechanical cutting of the colonies followed by isolation of the
subcolonies by dispase. Cutting of the colonies was performed in
PBS containing Ca and Mg. The sharp edge of micropipette was used
to cut the colonies to clumps of about 100 cells. The pipette was
also used to scrape and remove differentiated areas of the
colonies. The PBS was then changed to regular prequilibrated human
stem cells medium containing dispase (Gibco) 10 mg/ml and incubated
for 5-10 minutes (at 37 (C, 5% CO.sub.2). As soon as the clumps
were detached they were picked up by wide bore micro-pipette,
washed in PBS containing Ca and Mg and transferred to a fresh
feeder layer.
[0356] e) Human Stem Cell Cryopreservation.
[0357] Early passage cells were cryo-preserved in clumps of about
100 cells by using the open pulled straw (OPS) vitrification method
(Vajta et al 1998) with some modifications. French mini-straws (250
(1, IMV, L'Aigle, France) were heat-softened over a hot plate, and
pulled manually until the inner diameter was reduced to about half
of the original diameter. The straws were allowed to cool to room
temperature and were than cut at the narrowest point with a razor
blade. The straws were sterilised by gamma irradiation (15-25 K
Gy). Two vitrification solutions (VS) were used. Both were based on
a holding medium (HM) which included DMEM containing HEPES buffer
(Gibco, without sodium pyruvate, glucose 4500 mg/L) supplemented
with 20% fetal bovine serum (Hyclone, Logan, Utah). The first VS
(VS1) included 10% dimethyl sulfoxide (DMSO, Sigma) and 10%
ethylene glycol (EG, Sigma). The second vitrification solution
(VS2) included 20% DMSO, 20% EG and 0.5M sucrose. All procedures
were performed on a heating stage at 37 (C. 4-6 clumps of ES cells
were first incubated in VSl for 1 minute followed by incubation in
VS2 for 25 seconds. They were then washed in a 20 (1 droplet of VS2
and placed within a droplet of 1-2 (1 of VS2. The clumps were
loaded into the narrow end of the straw from the droplet by
capillary action. The narrow end was immediately submerged into
liquid nitrogen. Straws were stored in liquid nitrogen. Thawing was
also performed on a heating stage at 37 .degree. C. as previously
described with slight modifications (Vajta et al 1998). Three
seconds after removal from liquid nitrogen, the narrow end of the
straw was submerged into HM supplemented with 0.2M sucrose. After 1
minute incubation the clumps were further incubated 5 minutes in HM
with 0.1M sucrose and an additional 5 minutes in HM.
[0358] 2. Stem Cell Characterisation.
[0359] Colonies were fixed in the culture dishes by 100% ethanol
for immuno-fluorescence demonstration of the stem cell surface
markers GCTM-2, TRA 1-60 and SSEA-1, while 90% acetone fixation was
used for SSEA-4. The sources of the monoclonal antibodies used for
the detection of the markers were as follows: GCTM-2, this
laboratory; TRA 1-60, a gift of Peter Andrews, University of
Sheffield; SSEA-1 (MC-480) and SSEA-4 (MC-813-70), Developmental
Studies Hybridoma Bank, Iowa, IA. Antibody localisation was
performed by using rabbit anti-mouse immunoglobulins conjugated to
fluorescein isothiocyanate (Dako,Carpinteria, Calif.).
[0360] Alkaline phosphatase activity was demonstrated as previously
described (Buehr M. and Mclaren A. Isolation and culture of
primordial germ cells. Methods Enzymol. 225, 58-76, (1993)).
Standard G-banding techniques were used for karyotyping.
[0361] 3. Oct-4 Expression Studies.
[0362] To monitor expression of Oct-4, RT-PCR was carried out on
colonies consisting predominantly of stem cells, or colonies which
had undergone spontaneous differenfiation as described below. mRNA
was isolated on magnetic beads (Dynal AS, Oslo) following cell
lysis according to the manufacturer's instructions, and solid-phase
first strand cDNA synthesis was performed using Superscript II
reverse transcriptase (Life Technologies). The PCR reaction was
carried out according to van Eijk et al. (1999), using the solid
phase cDNA as template and Taq polymerase (Pharmacia Biotech, Hong
Kong). OCT-4 transcripts were assayed using the following primers:
5'-CGTTCTCTTTGGAAAGGTGTTC (forward) (SEQ ID NO:5) and
3'-ACACTCGGACCACGTCTTTC (reverse) (SEQ ID NO:6). As a control for
mRNA quality, beta-actin transcripts were assayed using the same
RT-PCR and the following primers: 5'-CGCACCACTGGCATTGTCAT-3'
(forward) (SEQ ID NO:7), 5'-TTCTCCTTGATGTCACGCAC-3' (reverse) (SEQ
ID NO:8). Products were analysed on a 1.5% agarose gel and
visualised by ethidium bromide staining.
[0363] 4. In-vitro Differentiation.
[0364] Colonies were cultured on mitotically inactivated mouse
embryonic fibroblasts to confluency (about 3 weeks) and further on
up to 7 weeks after passage. The medium was replaced every day.
Alphafetoprotein and beta human chorionic gonadotropin levels were
measured in medium conditioned by HES-1 and HES-2 at passage level
17 and 6 respectively. After 4-5 weeks of culture, conditioned
medium was harvested 36 hours after last medium change, and the
protein levels were determined by a specific immunoenzymometric
assays (Eurogenetics, Tessenderllo, Belgium) and a fluorometric
enzyme immunoassay (Dade, Miami, FL) respectively. These compounds
were not detected in control medium conditioned only by feeder
layer.
[0365] Differentiated cultures were fixed 6-7 weeks after passage
(26-HES-1 and 9-HES-2) for immunofluorescence detection of lineage
specific markers. After fixation with 100% ethanol, specific
monoclonal antibodies were used to detect the 68 kDa neurofilament
protein (Amersham, Amersham U.K), and neural cell adhesion molecule
(Dako). Muscle specific actin and desmin were also detected by
monoclonal antibodies (Dako) after fixation with methanol/acetone
(1:1). Antibody localisation was performed as described above.
[0366] 5. Teratoma Formation in Severe Combined Immunodeficient
(SCID) Mice.
[0367] At the time of routine passage, clumps of about 200 cells
with an undifferentiated morphology were harvested as described
above, and injected into the testis of 4-8 week old SCID mice (CB17
strain from the Walter and Eliza Hall Institute, Melbourne,
Australia, 10-15 clumps/testis). 6-7 weeks later, the resulting
tumours were fixed in neutral buffered formalin 10%, embedded in
paraffin and examined histologically after hematoxylin and eosin
staining.
[0368] 6. Derivation and Culture of Neural Progenitors.
[0369] Two approaches were developed for the derivation of neural
precursors from human ES cells:
[0370] (a) Derivation of Neural Precursors from Differentiating ES
Cells:
[0371] Colonies of undifferentiated ES cells were continuously
cultured on mouse embryonic fibroblasts for 2-3 weeks. The medium
was changed every day. Starting from the second week of culture and
more commonly at the third week, areas of tight small
differentiated ES cells could be identified in the colonies both by
phase contrast microscopy as well as stereo microscopy. These areas
tended to become well demarcated in the third week of culture (FIG.
26). The size and demarcation of these areas could be enhanced if
after the first week of culture, the serum containing medium was
replaced with serum free medium that was supplemented with
epidermal growth factor 20 ng/ml (EGF, Gibco), and basic fibroblast
growth factor 20 ng/ml (bFGF, Gibco) and consisted of DMEM/F12
(Gibco, Gaithersburg, Md.), B27 supplementation (1:50, Gibco),
glutamine 2 mM (Gibco), penicillin 50 u/ml and streptomycin 50
.mu.g/ml (Gibco). Clumps of the small tightly packed cells were
dissected mechanically by a micropipette from these areas and were
transferred to plastic tissue culture dishes containing fresh serum
free medium (as detailed above), supplemented with EGF(20 ng/ml),
and basic FGF(20 ng/ml). The medium was supplemented with heparin 5
.mu.g/ml (Sigma St. Louis, Mo.) in some of the experiments. The
clusters of cells turned into round spheres that were comprised of
small tight cells within 24 hours after transfer. The spheres were
sub-cultured about every 7-21 days. The timing of subculture was
determined according to the size of the spheres. The diameter of
spheres at the time of sub-culture was usually above 0.5 mm. Each
sphere was dissected according to its size to 4 parts by two
surgical blades (size 20) to produce clumps with a maximal diameter
between 0.3-0.5 mm. 50% of the medium was changed about every 3
days.
[0372] (b) Derivation of Neural Precursors from Undifferentiated ES
Cells:
[0373] Colonies of undifferentiated ES cells were propagated on
mouse embryonic fibroblasts as described above. Undifferentiated ES
cells were passaged in clumps of about 150-200 cells every 7 days.
At the time of routine passage, clumps of about 200 ES cells were
transferred to plastic tissue culture dishes containing the same
serum free medium that was described in item 1 above. The clusters
of cells turned into round spheres within 24 hours after transfer.
The spheres were sub-cultured about every 7-21 days as described
above. 50% of the medium was changed about every 3 days.
[0374] (c) Characterization of the Growth and the Number of Cells
in the Spheres.
[0375] Growth of the progenitors was roughly evaluated by the
increase in the number of spheres at each passage. The growth was
also monitored by serial measurements of the volume of 24 spheres.
Individual spheres were plated in twenty four well dishes (a sphere
per well) and their diameter was evaluated every 7 days. The volume
was calculated by using the volume equation of a ball. When the
measurements occurred 7 days after passage, growth was evaluated by
comparing the volume before passage of each of six mother sphere
with the sum of volumes of its four daughter spheres a week
later.
[0376] The number of cells per sphere and its correlation with the
diameter of the spheres was evaluated in a sample of spheres with
various sizes. Each sphere was mechanically disaggregated into
single cells or by enzymatic (papain, Wortinington Biochemical Co,
NJ) digestion that was followed by tituration. The cells were than
spun down re-suspended in serum free medium and counted. The cells
were also stained with trypan blue to determine the rate of viable
cells.
[0377] (d) Cryopreservation of Spheres.
[0378] Spheres of precursors were transferred into a 1.2 ml
cryo-vial (Nalge Nunc Napervville, Ill.) containing 0.5-1 ml of
pre-cooled (4.degree. C. ) freezing medium (90% serum free medium
(as above) and 10% DMSO (Sigma)). The vials were slowly cooled
(.about.1.degree. C./min) in a freezing container (Nalgene, Nalge
Nunc Napervville, Ill.) to -80.degree. C. and then plunged into and
stored in liquid nitrogen. The vials were rapidly thawed in a water
bath at 37.degree. C. The freezing medium was gradually diluted
with 10 ml serum free culture medium and the spheres were
transferred to fresh serum free medium.
[0379] 7. Characterization of the Progenitor Cells in the
Spheres.
[0380] (a) Immunohistochemistry Studies
[0381] The spheres were plated on coverslips coated with
poly-D-lysine (30-70 kDa, Sigma) and laminin (Sigma), fixed after 4
hours and examined by indirect immunofluorescence analysis for
expression of N-CAM (acetone fixation, mouse monoclonal antibody
UJ13 a from Dako,Carpinteria, Calif.), nestin (4% paraformaldehyde
fixation, rabbit antiserum a kind gift of Dr. Ron McKay) and
vimentin (methanol fixation, mouse monoclonal antibody Vim3 B4 from
Roche Diagnostics Australia, Castle Hill, NSW).
[0382] To evaluate the proportion of cells that expressed
polysialyated NCAM, nestin and vimentin, spheres that were
cultivated for at least 6 weeks were dissaggregated into single
cells either by mechanical tituration in PBS without calcium and
magnesium or by enzymatic (papain, Wortinington Biochemical Co, NJ)
digestion that was followed by tituration. The cells were than
plated on coverslips coated with poly-D-lysine and laminin fixed
after 24 hours and examined by indirect immunofluorescence analysis
for expression of N-CAM nestin and vimentin. One hundred and
fifty-200 cells were scored for each marker and the scoring was
repeated 2-3 times for each marker. Three progenitor cell lines
derived from differentiating colonies and two lines that were
derived directly from undifferentiated cells were evaluated.
[0383] To examine the expression of endodermal markers, spheres
were plated on coverslips coated with poly-D-lysine and fibronectin
(Sigma, 5 mcg/mk), cultured 4 weeks in the absence of growth
factors and examined by indirect immunofluorescence analysis for
the expression of low molecular weight (LMW) cytokeratin (4%
paraformaldehyde fixation, mouse monoclonal antibody from Beckton
Dickinson, San Jose, Calif.) and laminin (4% paraformaldehyde
fixation, mouse monoclonal antibody, 1:500 dilution, from
Sigma).
[0384] (b) RT-PCR
[0385] Rt PCR was used to study the expression of nestin, the
transcription factor PAX-6, oct4, CD-34, FLK-1, HNF-3, and
alfafetoprotein (AFP),in the spheres.
[0386] Expression of the endodermal markers HNF-3, AFP and
transferin was also studied in differentiated spheres that were
plated on poly-D-lysine (30-70 kDa) and Fibronectin (Sigma, 5
mcg/mk) or laminin (Sigma), cultured in the same serum free medium
supplemented with growth factors for two weeks and then further
cultured two weeks without growth factors supplementation.
[0387] The mRNA was isolated on magnetic beads (Dynal AS, Oslo)
following cell lysis according to the manufacturer's instructions,
and solid-phase first strand cDNA synthesis was performed using
Superscript II reverse transcriptase (Gibco, Gaithersburg,
Md.).
[0388] Alternatively, total RNA was isolated by using the RNA
STAT-60.TM. kit (Tel-Test Inc, Friendswood, Tex.) and first strand
cDNA synthesis was performed using Superscript II reverse
transcriptase (Gibco, Gaithersburg, Md.) according to the
manufacturers' instructions.
[0389] The PCR reaction was carried out according to van Eijk et
al. (1999), using the solid phase cDNA as template and Taq
polymerase (Pharmacia Biotech, Hong Kong). As a control for mRNA
quality, beta-actin transcripts were assayed using the same RT-PCR.
PCR primers were synthesized by Besatec or Pacific Oligos
(Adelaide, Australia). The following primers were used:
1 Gene Primers Product size PAX-6 Forward:
5'AACAGACACAGCCCTCACAAACA3' (SEQ ID NO:1) 274 bp Reverse:
5'CGGGAACTTGAACTGGAACTGAC3' (SEQ ID NO:2) nestin Forward:
5'CAGCTGGCGCACCTCAAGATG3' (SEQ ID NO:3) 208 bp Reverse:
5'AGGGAAGTTGGGCTCAGGACTGG3' (SEQ ID NO:4) Oct-4 Forward:
5'-CGTTCTCTTTGGAAAGGTGTTC (SEQ ID NO:5) 320 bp Reverse:
3'-ACACTCGGACCACGTCTTTC (SEQ ID NO:6) beta-actin Forward:
5'-CGCACCACTGGCATTGTCAT-3' (SEQ ID NO:7) 200 bp Reverse:
5'-TTCTCCTTGATGTCACGCAC-3' (SEQ ID NO:8) CD-34 Forward:
5'-TGAAGCCTAGCCTGTCACCT-3' (SEQ ID NO:9) 200 bp Reverse:
5'-CGCACAGCTGGAGGTCTTAT-3' (SEQ II) NO:10) FLK-1 Forward:
5'-GGTATTGGCAGTTGGAGGAA-3' (SEQ ID NO:11) 199 bp Reverse:
5'-ACATTTGCCGCTTGGATAAC-3' (SEQ ID NO:12) Hnf-3 Forward:
5'-GAGTTTACAGGCTTGTGGCA-3' (SEQ ID NO:13) 390 bp Reverse:
5'-GAGGGCAATTCCTGAGGATT-3' (SEQ ID NO:14) MP Forward:
5'-CCATGTACATGAGCACTGTTG-3' (SEQ ID NO:15) 340 bp Reverse:
5'-CTCCAATAACTCCTGCTATCC-3' (SEQ ID NO:16) transferin Forward:
5'-CTGACCTCACCTGGGACAAT-3' (SEQ ID NO:17) 367 bp Reverse:
5'-CCATCAAGGCACAGCAACTC-3' (SEQ ID NO:18)
[0390] Products were analysed on a 1.5% or a 2% agarose gel and
visualised by ethidium bromide staining.
[0391] (c) Neuronal Differentiation Studies
[0392] In general, differentiation was induced by plating the
spheres on an appropriate substrate (poly-D-lysine, 30-70 kDa, and
laminin, Sigma) combined with the removal of growth factors.
[0393] Two protocols were most commonly used: In the first one,
differentiation was induced by plating the spheres on coverslips
coated with poly-D-lysine and laminin in the same serum free medium
detailed above without growth factors supplementation. The cells in
the spheres were allowed to spread and differentiate for 2-3 weeks
and the medium was changed every 3-5 days. In some of the
experiments, starting from the sixth day after plating, the medium
was supplemented with all trans retinoic acid (Sigma, 10-6M).
[0394] In the second protocol, the spheres were plated on
coverslips coated with poly-D-lysine and laminin in serum free
growth medium supplemented with growth factors. After 5-6 days the
supplementation of growth factors was withdrawn and all trans
retinoic acid (Sigma, 10-6M) was added to the medium. The cells
were further cultured for 1-2 weeks. The medium was changed every 5
days.
[0395] (d) Characterization of Differentiated Neuronal Cells
[0396] Differentiated cells growing out from the spheres were
analysed 2-3 weeks after plating by indirect immunofluorescence for
the expression of the following markers: 200 kDa neurofilament
protein (4% paraformaldehyde fixation, mouse monoclonal antibody
RT97 from Novocastra, Newcastle, UK), 160 kDa neurofilament protein
(methanol fixation, mouse monoclonal NN18 from Chemicon, Temecula,
Calif.) 68 kDa neurofilament protein (100% ethanol, Amersham,
Amersham U.K ), MAP2 a,b (4% paraformaldehyde fixation, mouse
monoclonal AP20 from Neomarkers, Union City Calif.), glutamate (1%
paraformaldehydeand 1% glutaraldehyde, rabbit antiserum from
Sigma), synaptophysin (4% paraformaldehyde, mouse monoclonal SY38
from Dako), tyrosine hydroxylase (4% paraformaldehyde, mouse
monoclonal, Sigma) glutamic acid decarboxylase (1%
paraformaldehyde, 1% glutaraldehyde, rabbit antiserum from
Chemicon, Temecula, Calif.), .beta.-tubulin (4% paraformaldehyde,
mouse monoclonal TUB 2.1 from Sigma) and .beta.-tubulin III
(4%paraformaldehyde mouse monoclonal SDL.3 D10 from Sigma).
[0397] Differentiated cells were also analysed 2-3 weeks after
plating by RT-PCR for the expression of .beta.-actin, glutamic acid
decarboxylase (primers, Vescovi et al., 1999) and GABA.sub.A
receptor subunit .alpha.2 (primers, Neelands et al., 1998). mRNA
preparation and the RT-PCR reaction were carried out as described
above.
[0398] (e) Glial Differentiation Studies.
[0399] At the time of routine passage spheres were subcultured into
serum free medium (as detailed above) supplemented with platelet
derived growth factor (recombinant human PDGF-AA, Peprotech Inc 20
ng/ml) and bFGF (Gibco, 20 ng/ml). Fifty percent of the medium was
replaced by fresh medium every 3 days. After culture for 6 days the
spheres were plated on coverslips coated with poly-D-lysine and
laminin in the same serum free medium without growth factors
supplementation. The cells in the spheres were allowed to spread
and differentiate for 10-12 days and the medium was changed every
3-5 days. An alternative protocol was used in some of the
experiments. In these experiments the spheres were cultured in
serum free medium (as detailed above) supplemented with PDGF-AA,
(20 ng/ml) and bFGF (20 ng/ml) for three weeks. The spheres were
then plated on coverslips coated with poly-D-lysine and Fibronectin
(Sigma, 5 mcg/mk). They were cultured for a week in the serum free
medium supplemented with PDGF-AA, (20 ng/ml), bFGF (20 ng/ml) and
T3 (30 nM). The growth factors were then removed from the medium
and the cells were further cultured for another 1-2 weeks in the
presence of T3 only. Fifty percent of the medium was replaced by
fresh medium every 3 days. In an alternative approach, spheres that
were propagated in the presence of EGF and bFGF were plated on
coverslips coated with poly-D-lysine and Fibronectin (Sigma, 5
mcg/mk). EGF was removed from the medium and the spheres were
cultured in the presence of T3 (30 nM) and bFGF (20 ng/ml) for a
week. The cells were then further cultured for another 3-4 weeks in
the presence of T3 and PDGF-AA (20 ng/ml).
[0400] Oligodendrocyte were identified by indirect
immunofluorescence for the expression of the marker O4. The cells
were first incubated with the primary (Anti oligodendrocyte marker
O4, mouse monoclonal IgM from Chemicon Int. Inc. Temecula, Calif.)
and secondary FITC or rhodamine conjugated antibodiesand were then
fixed with 4% paraformaldehyde.
[0401] To demonstrate differentiation into astrocyte, spheres that
have been propagated in the presence of b-FGF and EGF were plated
on coverslips coated with poly-D-lysine and fibronectin or laminin
and further cultured for 6 days in serum free medium without growth
factors supplementation.
[0402] Alternatively, spheres were propagated in the presence of
PDGF-AA and bFGF for 6 weeks and were then plated on coverslips
coated with poly-D-lysine and fibronectin. They were allowed to
spread into a monolayer in the presence of the above growth factors
for a week. The cells were then further cultured for another week
in the presence of either T3 or the combination of T3 and
PDGF-AA.
[0403] Following this protocols, differentiation into astrocytes
was demonstrated by Indirect immunofluorescence for the expression
of glial fibrillary acidic protein (GFAP) (4% paraformaldehyde
fixation, rabbit anti cow from Dako)
[0404] Differentiation into astrocyte and oligodendrocyte cells was
also confirmed at the mRNA level. Spheres were plated on
poly-D-lysine and fibronectin and cultured for 2 weeks in the serum
free medium supplemented with EGF, bFGF and PDGF-AA. The
differentiating spheres were then further cultured two weeks
without growth factors and in the presence of T3. RT-PCR was used
as above to demonstrate the expression of GFAP and the plp gene.
GFAP transcripts were assayed using the following primers:
5'-TCATCGCTCAGGAGGTCCTT-3' (forward) (SEQ ID NO:19) and
5'-CTGTTGCCAGAGATGGAGGTT-3' (reverse) (SEQ ID NO:20), band size 383
bp. The primers for the analysis of plp gene expression were
5'-CCATGCCTTCCAGTATGTCATC-3' (forward) (SEQ ID NO:21) and
5'-GTGGTCCAGGTGTTGAAGTAAATGT-3' (reverse) (SEQ ID NO:22). The plp
gene encodes the proteolipid protein and its alternatively spliced
product DM-20 which are major proteins of brain myelin. The
expected band size for plp is 354 bp and for DM-20 is 249 bp
(Kukekov et al., 1999). As a control for mRNA quality, beta-actin
transcripts were assayed using the same primers as above. Products
were analysed on a 2% agarose gel and visualised by ethidium
bromide staining.
[0405] (f) Transplantation Studies.
[0406] Spheres were disaggregated into small clumps either
mechanically or by enzymatic (papain, Wortinington Biochemical Co,
NJ) digestion that was followed by tituration. Approximately 50,000
cells (in 2 .mu.l PBS) were injected into the lateral ventricles of
newborn (first day after birth) mice and rats (Sabra) by using a
micro-glass pipette (300 micron outer diameter) connected to a
micro-injector (Narishige, Japan). The glass pipette was covered by
a plastic sleeve that limited the depth of penetration into the
host nervous system. In some experiments, prior to transplantation,
the neural progenitors were labeled with BrDU (20 .mu.M, 4 weeks).
At 4 weeks of age, recipients were anesthetized and perfused with
4% paraformaldehyde in PBS. Serial 7 micrometer Vibratom sections
were examined histologically after hematoxylin and eosin staining.
The human identity of transplanted cells was confirmed by anti BrDU
(Mouse, monoclonal, 1:20, Dako) immunohistochemical staining using
Diaminobenzadine (DAB) peroxidase detection kit (Vector Burlingame,
Calif.) according to the manufacturers' protocols. Cell type
identity of transplanted cells was established by dual staining
with antibodies to BrDU and GFAP (Rabbit polyclonal, 1:100 Dako)
for astrocytes or BrDU and CNPase (mouse monoclonal, 1:50 Sigma)
for oligodendrocyte. Immunoreactivity of anti GFAP and CNPase was
revealed with a fluorescein-conjugated (Jackson, West Grove, Pa.)
secondary antibody.
EXAMPLES
Example 1
Derivation of Cell Lines HES-1 and HES-2
[0407] The outer trophectoderm layer was removed from four
blastocysts by immunosurgery to isolate inner cell masses (ICM),
which were then plated onto a feeder layer of mouse embryo
fibroblasts (FIG. 1A). Within several days, groups of small,
tightly packed cells had begun to proliferate from two of the four
ICM. The small cells were mechanically dissociated from outgrowths
of differentiated cells, and following replating they gave rise to
flat colonies of cells with the morphological appearance of human
EC or primate ES cells (FIG. 1B, C stem cell colonies). These
colonies were further propagated by mechanically disaggregation to
clumps which were replated onto fresh feeder cell layers. Growth
from small clumps of cells (<10 cells) was not possible under
the conditions of these cultures. Spontaneous differentiation,
often yielding cells with the morphological appearance of early
endoderm, was frequently observed during routine passage of the
cells (FIG. 1D). Differentiation occurred rapidly if the cells were
deprived of a feeder layer, even in the presence of LIF (FIG. 1E).
While LIF was used during the early phases of the establishment of
the cell lines, it was subsequently found to have no effect on the
growth or differentiation of established cultures (not shown). Cell
line HES-1 has been grown for 60 passages in vitro and HES-2 for 40
passages, corresponding to a minimum of approximately 360 and 90240
population doublings respectively, based on the average increase in
colony size during routine passage, and both cell lines still
consist mainly of cells with the morphology of ES cells. Both cell
lines have been successfully recovered from cryopreservation.
Example 2
Marker Expression and Karyotype of the Human ES Cells
[0408] Marker and karyotype analysis were performed on HES-1 at
passage levels 5-7, 14-18, 24-26 and 44-46, and on HES-2 at passage
levels 6-8. ES cells contained alkaline phosphatase activity (FIG.
2A). Imiunophenotyping of the ES cells was carried out using a
series of antibodies which detect cell surface carbohydrates and
associated proteins found on human EC cells. The ES cells reacted
positively in indirect immunofluorescence assays with antibodies
against the SSEA-4 and TRA 1-60 carbohydrate epitopes, and the
staining patterns were similar to those observed in human EC cells
(FIG. 2B, 2C). ES cells also reacted with monoclonal antibody
GCTM-2, which detects an epitope on the protein core of a keratan
sulphate/chondroitin sulphate pericellular matrix proteoglycan
found in human EC cells (FIG. 2D). Like human EC cells, human ES
cells did not express SSEA-1, a marker for mouse ES cells. Both
cell lines were karyotypically normal and both were derived from
female blastocysts.
[0409] Oct-4 is a POU domain transcription factor whose expression
is limited in the mouse to pluripotent cells, and recent results
show directly that zygotic expression of Oct-4 is essential for
establishment of the pluripotent stem cell population of the inner
cell mass. Oct-4 is also expressed in human EC cells and its
expression is down regulated when these cells differentiate. Using
RT-PCR to carry out mRNA analysis on isolated colonies consisting
mainly of stem cells, we showed that human ES cells also express
Oct-4 (FIG. 3A-3C, lanes 2-4). The PCR product was cloned and
sequenced and shown to be identical to human Oct-4 (not shown).
Example 3
Differentiation of Human ES Cells in vitro
[0410] Both cell lines underwent spontaneous differentiation under
standard culture conditions, but the process of spontaneous
differentiation could be accelerated by suboptimal culture
conditions. Cultivation to high density for extended periods (4-7
weeks) without replacement of a feeder layer promoted
differentiation of human ES cells. In high density cultures,
expression of the stem cell marker Oct-4 was either undetectable or
strongly downregulated relative to the levels of the housekeeping
gene beta actin (FIG. 3A-3B, lanes 5-7). Alphafetoprotein and human
chorionic gonadotrophin were readily detected by immunoassay in the
supernatants of cultures grown to high density. Alphafetoprotein is
a characteristic product of endoderm cells and may reflect either
extraembryonic or embryonic endodermal differentiation; the levels
observed (1210-5806 ng/ml) are indicative of extensive endoderm
present. Human chorionic gonadotrophin secretion is characteristic
of trophoblastic differentiation; the levels observed (6.4-54.6
IUI/Litre) are consistent with a modest amount of differentiation
along this lineage.
[0411] After prolonged cultivation at high density, multicellular
aggregates or vesicular structures formed above the plane of the
monolayer, and among these structures clusters of cells or single
cells with elongated processes which extended out from their cell
bodies, forming networks as they contacted other cells (FIG. 1F)
were observed. The cells and the processes stained positively with
antibodies against neurofilament proteins and the neural cell
adhesion molecule (FIG. 2E and 2F). Contracting muscle was seen
infrequently in the cultures. While contracting muscle was a rare
finding, bundles of cells which were stained positively with
antibodies directed against muscle specific forms of actin, and
less commonly cells containing desmin intermediate filaments (FIGS.
2G and 2H) were often observed. In these high density cultures,
there was no consistent pattern of structural organisation
suggestive of the formation of embryoid bodies similar to those
formed in mouse ES cell aggregates or arising sporadically in
marmoset ES cell cultures.
Example 4
Differentiation of Human ES cells in Xenografts
[0412] When HES-1 or HES-2 colonies of either early passage level
(6; HES 1 and 2) or late passage level (HES-1, 14 and 27) were
inoculated beneath the testis capsule of SCID mice, testicular
lesions developed and were palpable from about 5 weeks after
inoculation. All mice developed tumours, and in most cases both
testis were affected. Upon autopsy lesions consisting of cystic
masses filled with pale fluid and areas of solid tissue were
observed. There was no gross evidence of metastatic spread to other
sites within the peritoneal cavity. Histological examination
revealed that the lesion had displaced the normal testis and
contained solid areas of teratoma. Embryonal carcinoma was not
observed in any lesion. All teratomas contained tissue
representative of all three germ layers. Differentiated tissues
seen included cartilage, squamous epithelium, primitive
neuroectoderm, ganglionic structures, muscle, bone, and glandular
epithelium (FIG. 4A-4F). Embryoid bodies were not observed in the
xenografts.
Example 5
Development, Propagation and Characterisation of Human ES Cells
Derived Neural Progenitor Cells.
[0413] a) Derivation of Neural Progenitor Cells from Human ES
Cells.
[0414] Colonies of undifferentiated ES cells from the cell lines
HES-1 and HES-2 were continuously cultured on mouse embryonic
fibroblasts feeder layer for 2-3 weeks. At one week after passage,
some spontaneous differentiation was usually identified by changes
in cell morphology in the center of the colonies. The process of
differentiation included at this early stage the neuroectodermal
lineage as evident by the expression of early neural markers such
as nestin and PAX-6 (FIG. 19). From the second week after passage,
areas with differentiated small piled tightly packed cells could be
identified in the colonies of both cell lines by phase and inverted
microscope. During the third week these areas became more defined
from neighboring areas of the colony (FIG. 26). The size and
demarcation of these areas was enhanced if the serum containing ES
cell culture medium was replaced after a week or preferably after
two weeks from passage with serum free medium supplemented with EGF
(20 ng/ml) and FGF (20 ng/ml). The cells in these areas were not
reactive in immunohistochemical staining with the antibody against
the early neuroectodermal marker polysialyated NCAM. The areas were
large and well demarcated sufficiently to allow mechanical removal
of clumps of cells by a micropipette in 54% of the colonies
cultured in serum containing medium (67/124, HES-1). Clumps were
removed from differentiating colonies of HES-1 and HES-2 and were
transferred to serum free medium supplemented with basic fibroblast
growth factor (bFGF) and epidermal growth factor (EGF). At the time
of isolation, the clumps were comprised mostly of a layer of the
small tightly packed cells (about 100-300 cells/clump), on top of
some loosely attached larger cells, It was possible to remove these
larger cells mechanically or by enzymatic digestion. Within an hour
the clumps started to change their shape toward spheres and after
24 hours all the clumps turned into round spheres (FIG. 5A).
[0415] After 7-10 days in culture, gradual increase in the size of
the majority of the spheres was evident and most of the spheres
were still floating or loosely attached to the dish while a
minority attached and started to spread.
[0416] In an alternative approach, somatic differentiation of ES
cells into spheres of progenitor cells was induced by transferring
clumps of undifferentiated ES cells into serum free medium
supplemented with basic fibroblast growth factor (bFGF) and
epidermal growth factor (EGF). Within 24 hours the clumps have
turned into spheres. Some of these spheres were round and some had
an irregular shape. After 72 hours in serum free medium 42% (10/24)
of the spheres had a round symmetrical appearance (FIG. 9) and
after 12 days 62.5% (15/24). Significant growth was observed in the
majority of the spheres during this early culture. It was possible
to measure and calculate the average volume of the round floating
spheres and it increased by 64% (mean growth of 15 spheres) between
days 5 and 12.
[0417] b) In vitro Propagation of Spheres of Progenitor Cells
[0418] After 7-10 days in culture, floating or loosely attached
spheres with a diameter of >0.5 mm were sub-cultured by
mechanical dissection into 4 pieces, which were re-plated in fresh
pre-equilibrated medium. The spheres were cultivated in this manner
during a five to six months period (15 passages). Although some of
the spheres had an irregular shape at the initial phase of culture,
the rate of round symmetrical spheres increased along propagation.
In addition, while at early passage levels the appearance (under a
stereo-microscope) of the inner part of the spheres was irregular,
it gradually turned to be uniform at more advanced passage levels.
By passage level five (five-six weeks after derivation) all spheres
had a round symmetrical shape and a uniform appearance.
[0419] Proliferation of the cells was evaluated by determining the
increase in the number of spheres with each passage as well as
measuring the increase in the volume of the spheres along time. In
general, the growth rate of spheres that were generated either from
undifferentiated or from differentiating ES cells had a similar
pattern characterized by a more excessive growth during the first
5-6 passages. The number of spheres increased by 126% +54%
(Mean.+-.SD, sum of results from 3 cell lines) at each passage
(performed every 7 days) during the first 5 passages. The growth of
the number of spheres with each passage was then reduced to 10-50%
per week. This growth rate was maintained for prolonged periods (4
months) (mean data from 3 cell lines). The mean volume of spheres
generated either from differentiating ES cells or directly from
undifferentiated cells also increased by similar rates (FIGS. 16
and 17).
[0420] Dis-aggregation of the spheres by using trypsin digestion
could be ineffective in particular when the spheres were cultivated
for prolonged periods, however it was possible to dis-aggregate
them into a single cell suspension mechanically following enzymatic
digestion with papain. A linear correlation was found between the
volume of spheres and the number of cells within the spheres. The
coefficients that define the regression line of this correlation
were similar in spheres that were derived from differentiating or
undifferentiated ES cells. Most of the cells (>90%) were viable
following the dissagregation procedure (FIG. 10, FIG. 18).
[0421] Given the growth rate of the spheres with each passage and
the number of cells (20,000, FIG. 10, 18) per averaged size sphere
(0.1 mm.sup.3 based on the mean diameter .+-.S.D. of 24 spheres 7
days after passage 5, 0.59.+-.0.14 mm), it was calculated that 10
clumps of ES cells may generate within 10 passages 2500 spheres
containing 50.times.10.sup.6 cells.
[0422] Spheres that were cultured in the serum free growth medium
(supplemented with growth factors) for prolonged periods (3 weeks)
without passage, tended to attach to the tissue culture plastic and
gradually spreaded as a monolayer of cells. The cells in the
monolayer had a uniform appearance of neural progenitors and a high
mitotic activity was evident (FIG. 7).
[0423] It was possible to recover the spheres from
cryopreservation.
[0424] c) Characterization of the Progenitor Cells within the
Spheres.
[0425] Cells in the spheres that were produced either from
differentiating ES cell colonies or directly from undifferentiated
ES cells expressed markers of primitive neuroectoderm and neural
progenitor cells, such as polysialylated N-CAM (FIG. 5b, 11,12),
the intermediate filament proteins nestin (immunostaining, FIG. 5C
and 13; RT-PCR, FIG. 3B and FIG. 19) and vimentin (FIG. 5D and FIG.
15), and the transcription factor Pax-6 (FIG. 3B and FIG. 19). The
expression of these markers was maintained along prolonged
cultivation (18 weeks). The transcriptional factor oct4 was not
expressed by the cells in the spheres indicating that
undifferentiated human ES cells were not present within the spheres
(FIG. 19).
[0426] To evaluate the proportion of cells in the spheres that
expressed polysialyated NCAM, nestin and vimentin, spheres that
were cultivated at least 6 weeks ( and up to 18 weeks) were
disaggregated to single cell suspension. The resulting single cells
were plated on substrate in growth medium. Twenty four hours after
plating, an average of 99% (94.5%-100%, n=7 experiments) and 95.5%
(95.7%-96.7%, n=6) of the cells from spheres generated form
differentiating (three progenitor cell lines) and undifferentiated
ES cells (two progenitor cell lines) respectively were decorated
with the antibody against polysialyated NCAM. The average
proportion of cells that were positively stained for nestin and
vimentin was 96.6% (94.3%-100%, n=6) and 73.1% (42.1%-97.5%, n=4)
respectively in spheres that were established from differentiating
colonies. These markers were expressed by 66.8% (48.5% -100%, n=5)
and 58% (41.6%-76.5%, n=5) of the cells that originated from
spheres that were generated from undifferentiated cells. These
proportions were stable during prolonged cultivation (18
weeks).
[0427] The high proportion of cells that expressed polysialyated
NCAM indicate that the spheres from both sources were comprised of
a highly enriched preparation of neural progenitor cells. An
extremely high proportion of cells from spheres that were derived
from differentiating ES colonies also expressed the neural
progenitor marker nestin.
[0428] The proportion of cells expressing nestin was less extensive
in spheres that originated from undifferentiated ES cells. The high
proportion of cells that expressed these markers was stable along
prolonged cultivation.
[0429] To determine whether cells from other lineages were present
within the spheres, the expression of markers of endodermal and
mesodermal lineages was examined by RT-PCR and
immunohistochemistry.
[0430] There was no evidence for the expression of markers of the
endodermal lineage (HNF-3, AFP, RT-PCR, FIG. 24A-24 B,) by cells of
spheres that were derived by either methods. Moreover, the
expression of markers of the endodermal lineage was also not
detected in spheres that were derived from differentiating colonies
and that were induced to differentiate by plating on an appropriate
substrate and culturing in the absence of growth factors for 4
weeks (HNF-3, AFP, transferin were evaluated by RT-PCR; LMW
cytokeratin and laminin were_evaluated by immunohistochemistry). ES
cell colonies that were induced to differentiate by prolonged
culture (3-4 weeks) expressed all of the above markers and served
as positive controls.
[0431] However, expression of markers of mesodermal precursors
(FLK-1 and CD-34) was demonstrated in the spheres that were
produced by either methods (FIG. 24A-24B).
[0432] It may be concluded that the spheres were comprised of a
highly enriched population of neural precursors (>95%) and
probably no cells from the endodermal lineage. The expression of
the early mesodermal markers may indicate the presence of a minute
population of mesodermal precursors within the spheres.
Alternatively it may be that the primitive neural precursors within
the spheres express these mesodermal markers. The expression of the
hematopoietic marker AC-133 (Uchida et al., 2000) that was recently
demonstrated in neural stem cells derived from human fetal brains
support this possibility. In addition, expression of hematopoietic
markers by neural precursors may be in line with the recently
reported broad potential of neural stem cells to
trans-differentiate into a variety of tissues including the
hematopoietic system (Bjornson et al., 1999; Clarke et al.,
2000).
[0433] (d) In Vitro Neuronal Differentiation
[0434] When plated on poly-D-lysine and laminin, spheres that were
produced either from differentiating ES cell colonies or from
undifferentiated ES cells attached, and differentiated cells grew
out onto the monolayer from them.
[0435] When the bFGF and EGF were removed at the time of plating,
differentiating cells gradually spread from them in a radial
fashion (FIG. 6A) If the growth factors were removed only after 1-2
weeks, a more extensive spreading of cells with processes, which
formed a monolayer was evident (FIG. 8). Two to three weeks after
plating, the differentiated cells originating from spheres derived
by either methods displayed morphology and expression of structural
markers characteristic of neurons, such as .beta.-tubulin (FIG.
6H), .beta.-tubulin III (FIG. 27C, the 200 kDa neurofilament (FIG.
6B) and 68 kDA neurofilament proteins . Moreover, differentiated
cells originating from spheres derived by either methods expressed
markers of mature neurons such as the 160 kDa neurofilament protein
(FIG. 6C, FIG. 27A), Map-2 a,b (FIG. 6D, FIG. 27B) and
synaptophysin (FIG. 6F), Furthermore, the cultures contained cells
which synthesised glutamate (FIG. 6E), expressed the rate limiting
enzyme in GABA biosynthesis (glutamic acid decarboxylase, FIG. 3C
and FIG. 6G), expressed the enzyme tyrosine hydroxylase (FIG.
28A-28B) and receptor subunits characteristic of GABAminergic
neurons (GABA.alpha.2, FIG. 3D).
[0436] e) In vitro Glial Differentiation
[0437] Differentiation into both astrocyte cells and
oligodendrocyte cells was observed with spheres that were produced
either from differentiating ES cells or from undifferentiated
cells.
[0438] While differentiation at a low scale toward glial cells was
observed upon withdrawal of growth factors and plating on
poly-D-lysine and laminin, various protocols were developed to
enhance the differentiation toward this lineage. These protocols
were all based on plating the neural progenitor cells on
poly-D-lysin and fibronectin, which significantly enhanced the
differentiation toward glial cells, and supplementation of the
medium with PDGF-AA that promotes glial progenitor cell
proliferation and T3 that induces maturation of oligodendrocytes
precursors.
[0439] Differentiation into the astrocyte glial lineage was
demonstrated by indirect immunofluorescent staining for GFAP. Few
positive cells were occasionally demonstrated when differentiation
was induced by withdrawal of growth factors and plating on
poly-D-lysin and laminin. However, differentiation into astrocytes
was significantly enhanced when the spheres were allowed to
differentiate on poly-D-lysin and fibronectin. Moreover,
differentiation into astrocytes was highly abundant after the
following protocol. The spheres were first propagated six weeks in
the presence of PDGF-AA and bFGF and were then plated on
poly-D-lysine and fibronectin. They were allowed to spread for a
week into a monolayer in the presence of the above growth factors.
The differentiating cells were then fulrther cultured for another
week in the presence of T3 and PDGF-AA followed by another 1-2
weeks of culture either with T3 or the combination of T3 and
PDGF-AA (FIG. 20).
[0440] To promote differentiation towards oligodendrocyte, spheres
were initially cultured for 6 days in serum free medium
supplemented with PDGF-AA (20 ng/ml) and bFGF (20 ng/ml) and were
then plated on coverslips coated with poly-D-lysine and laminin in
the same medium without growth factors supplementation. The cells
in the spheres were allowed to spread and differentiate for 10-12
days. Small cells decorated with the antibody O4 could be
demonstrated at that time indicating differentiation into
oligodendrocyte progenitors.
[0441] It was also possible to promote the differentiation into
oligodendrocyte progenitors by incubation of the spheres in the
presence of PDGF and basic FGF for 3 weeks followed by plating on
poly lysine and fibronectin and culture for a week in the presence
of the growth factors and T3 followed by 1-2 weeks culture in the
presence of T3 without growth factors supplementation (FIG. 14).
Alternatively, spheres that were propagated in the presence of bFGF
and EGF were plated on poly lysine and fibronectin and cultured for
a week in the presence of bFGF and T3. The cells were then fther
cultured in the presence of PDGF and T3 for 3-4 weeks.
[0442] Differentiation into astrocyte and oligodendrocyte cells was
further confirmed at the mRNA level. Spheres were plated on
poly-D-lysine and fibronectin and cultured for 2 weeks in the serum
free medium supplemented with EGF, bFGF and PDGF-AA. The
differentiating spheres were then further cultured two weeks
without growth factors in the presence of T3. The expression of
GFAP was demonstrated by RT-PCR indicating and confirming the
presence of astrocyte cells (FIG. 25). The expression of the plp
gene was used as a marker of differentiation into oligodendrocyte
cells. The plp gene encodes the proteolipid protein and its
alternatively spliced product DM-20, which are major proteins of
brain myelin.
[0443] RT-PCR analysis of the differentiated spheres demonstrated
both dm-20 and plp transcripts indicating that differentiation into
oligodendrocyte has occurred (FIG. 25).
[0444] f) Transplantation of Neural Spheres.
[0445] To explore the developmental potential of the human
ES-derived neural precursors in vivo, and to reveal whether the
human precursors can respond to positional cues and participate in
the development and histogenesis of a living host, dis-aggregated
spheres were implanted into the lateral cerebral ventricles of
newborn rats and mice. In some experiments, prior to the
transplantation, the neural progenitors were labeled with BrDU.
Histological and immunochemical evaluation of serial brain sections
was performed 4 weeks after transplantation. In transplanted mice,
human cells with nuclei decorated by anti BrDU (FIG. 21A-21B) have
migrated in large numbers from the ventricles and integrated in the
host brain. The human cells demonstrated a wide spread distribution
in the periventricular areas that are mainly consisted of white
matter tracks where glial differentiation is predominant and
therefore glial differentiation of the transplanted cells is
anticipated (FIG. 22A-22C). Indeed the transplanted cells responded
to regional differentiating signals and double immunochemical
staining for BrDU and GFAP demonstrated cells in the
periventricular area that where decorated by both antibodies
indicating that the transplanted neural progenitors underwent
in-vivo differentiation into astrocytes (FIG. 29A-29B).
Transplanted cells that have differentiated into oligodendrocyte
and were therefore reactive with both anti BrDU and anti CNPase,
were also demonstrated in the periventricular areas (FIG. 30). The
transplanted human cells also migrated to a far distance along the
rostral migratory stream where neurons are continuously generated
through out life and therefore a neuronal fate of the transplanted
cells is expected (FIG. 23). These data indicate that the
transplanted cells could respond to host cues, could migrate and
differentiate according to regional signals.
[0446] There was no histological evidence of tumor formation in the
recipient animals.
Example 6
Cryo-Preservation of Human ES Cells.
[0447] Attempts to cryo-preserve human ES cells by using
conventional slow freezing protocols were associated with a very
poor outcome after thawing. Since ES cells are derived from the
blastocyst and retain their embryonic properties in culture, we
have postulated that cryopreservation by using a method which is
efficient for embryos may be beneficial. Early passage clumps of
human ES cells were frozen by using the open pulled straw (OPS)
vitrification method which was recently shown to be highly
efficient for the cryopreservation of bovine blastocysts (Vatja et
al. 1998). Both cell lines were successfully thawed and further
propagated for prolonged periods. The outcome of the vitrification
procedure was further studied on cell line HES-1, and recovery of
viable cells with this procedure was found to be highly efficient.
All clumps (n=25) survived the procedure and attached and grew
after thawing. Vitrification was associated with some cell death as
evidenced by the reduced size of colonies originating from
vitrified clumps two days after thawing in comparison to colonies
from non-vitrified control clumps. However, two days in culture
were sufficient to overcome this cell deficit, and 9 days after
plating the size of colonies from frozen-thawed clumps exceeded
that of control colonies at 7 days. Vitrification did not induce
differentiation after thawing. Thawed cells retained a normal
karyotype and the expression of primate stem cell markers, and
formed teratomas in SCID mice.
[0448] Finally it is to be understood that various other
modifications and/or alterations may be made without departing from
the spirit of the present invention as outlined herein.
Sequence CWU 1
1
22 1 23 DNA Artificial Sequence Description of Artificial
SequencePAX-6 forward primer 1 aacagacaca gccctcacaa aca 23 2 23
DNA Artificial Sequence Description of Artificial SequencePAX-6
reverse primer 2 cgggaacttg aactggaact gac 23 3 21 DNA Artificial
Sequence Description of Artificial Sequencenestin forward primer 3
cagctggcgc acctcaagat g 21 4 23 DNA Artificial Sequence Description
of Artificial Sequencenestin reverse primer 4 agggaagttg ggctcaggac
tgg 23 5 22 DNA Artificial Sequence Description of Artificial
SequenceOct-4 forward primer 5 cgttctcttt ggaaaggtgt tc 22 6 20 DNA
Artificial Sequence Description of Artificial SequenceOct-4 reverse
primer 6 acactcggac cacgtctttc 20 7 20 DNA Artificial Sequence
Description of Artificial Sequencebeta-actin forward primer 7
cgcaccactg gcattgtcat 20 8 20 DNA Artificial Sequence Description
of Artificial Sequencebeta-actin reverse primer 8 ttctccttga
tgtcacgcac 20 9 20 DNA Artificial Sequence Description of
Artificial SequenceCD-34 forward primer 9 tgaagcctag cctgtcacct 20
10 20 DNA Artificial Sequence Description of Artificial
SequenceCD-34 reverse primer 10 cgcacagctg gaggtcttat 20 11 20 DNA
Artificial Sequence Description of Artificial SequenceFLK-1 forward
primer 11 ggtattggca gttggaggaa 20 12 20 DNA Artificial Sequence
Description of Artificial SequenceFLK-1 reverse primer 12
acatttgccg cttggataac 20 13 20 DNA Artificial Sequence Description
of Artificial SequenceHnf-3 forward primer 13 gagtttacag gcttgtggca
20 14 20 DNA Artificial Sequence Description of Artificial
SequenceHnf-3 reverse primer 14 gagggcaatt cctgaggatt 20 15 21 DNA
Artificial Sequence Description of Artificial SequenceAFP forward
primer 15 ccatgtacat gagcactgtt g 21 16 21 DNA Artificial Sequence
Description of Artificial SequenceAFP reverse primer 16 ctccaataac
tcctgctatc c 21 17 20 DNA Artificial Sequence Description of
Artificial Sequencetransferin forward primer 17 ctgacctcac
ctgggacaat 20 18 20 DNA Artificial Sequence Description of
Artificial Sequencetransferin reverse primer 18 ccatcaaggc
acagcaactc 20 19 20 DNA Artificial Sequence Description of
Artificial SequenceGFAP forward primer 19 tcatcgctca ggaggtcctt 20
20 21 DNA Artificial Sequence Description of Artificial
SequenceGFAP reverse primer 20 ctgttgccag agatggaggt t 21 21 22 DNA
Artificial Sequence Description of Artificial Sequenceplp forward
primer 21 ccatgccttc cagtatgtca tc 22 22 25 DNA Artificial Sequence
Description of Artificial Sequenceplp reverse primer 22 gtggtccagg
tgttgaagta aatgt 25
* * * * *