U.S. patent application number 11/111686 was filed with the patent office on 2005-11-24 for hepatitis c virus constructs characterized by high efficiency replication.
This patent application is currently assigned to Anadys Pharmaceuticals, Inc.. Invention is credited to Bergelson, Svetlana, Bichko, Vadim, Shifrin, Victor.
Application Number | 20050260221 11/111686 |
Document ID | / |
Family ID | 22928409 |
Filed Date | 2005-11-24 |
United States Patent
Application |
20050260221 |
Kind Code |
A1 |
Bichko, Vadim ; et
al. |
November 24, 2005 |
Hepatitis C virus constructs characterized by high efficiency
replication
Abstract
The present invention relates to recombinant hepatitis C virus
(HCV)-derived nucleic acids and to stable rapidly growing cell
clones derived from human hepatoma Huh-7 cell line and supporting
high titer replication of said recombinant HCV nucleic acids. The
subgenomic HCV replicons and cell clones of the instant invention
represent the in vitro system of choice for studies of HCV
propagation, anti-viral drug screening, and vaccine
development.
Inventors: |
Bichko, Vadim; (Waltham,
MA) ; Shifrin, Victor; (Newton, MA) ;
Bergelson, Svetlana; (Newton, MA) |
Correspondence
Address: |
DARBY & DARBY P.C.
P. O. BOX 5257
NEW YORK
NY
10150-5257
US
|
Assignee: |
Anadys Pharmaceuticals,
Inc.
San Diego
CA
|
Family ID: |
22928409 |
Appl. No.: |
11/111686 |
Filed: |
April 20, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11111686 |
Apr 20, 2005 |
|
|
|
10005469 |
Nov 7, 2001 |
|
|
|
6930095 |
|
|
|
|
60245866 |
Nov 7, 2000 |
|
|
|
Current U.S.
Class: |
424/189.1 ;
435/456; 435/5; 435/69.3; 530/350; 536/23.72 |
Current CPC
Class: |
G01N 33/502 20130101;
C12N 2770/24222 20130101; G01N 2469/20 20130101; C07K 14/005
20130101; G01N 33/5767 20130101; G01N 2333/18 20130101; G01N
33/5044 20130101; G01N 33/5091 20130101; G01N 33/5008 20130101 |
Class at
Publication: |
424/189.1 ;
435/005; 435/069.3; 435/456; 530/350; 536/023.72 |
International
Class: |
C12Q 001/70; C07H
021/04; A61K 039/29; C12N 015/86; C07K 014/18 |
Claims
What is claimed is:
1. An isolated nucleic acid molecule encoding a replication
competent recombinant Hepatitis C Virus (HCV) genome, which nucleic
acid comprises all or part of an HCV genome and is able to
replicate efficiently when transfected into a susceptible cell line
without reducing the growth rate of said cell line by more than 10
fold.
2. The isolated nucleic acid molecule encoding a recombinant HCV
genome of claim 1, which nucleic acid comprises from 5' to 3' on
the positive-sense nucleic acid (a) a functional 5' HCV
non-translated region (NTR) comprising an extreme 5'-terminal
conserved sequence; (b) at least one open reading frame (ORF)
encoding a heterologous gene operatively associated with an
expression control sequence, wherein the heterologous gene and
expression control sequence are oriented on the positive-strand
nucleic acid molecule; (c) an ORF encoding at least a portion of an
HCV polyprotein whose cleavage products form functional components
of HCV virus particles and RNA replication machinery, and (d) an
HCV 3' NTR comprising an extreme 3'-terminal conserved sequence,
and wherein said nucleic acid is able to replicate efficiently in a
susceptible cell line without reducing the growth rate of said cell
line by more than 10 fold.
3. The isolated nucleic acid of claim 1, wherein the susceptible
cell line is selected from the group consisting of human hepatoma
cell line Huh-7, human hepatoma cell line HepG2, hepatoma cell line
PH5CH, T. belangeri liver cell line MBTL, human diploid fibroblast
cell line VERO, secondary monkey kidney cell line CV-1, T cell line
MT-2, T cell line HPBMa10-2, T cell line MOLT-4, and B cell line
Daudi.
4. The susceptible cell line of claim 4, which is human hepatoma
cell line Huh-7.
5. The isolated nucleic acid molecule according to claim 1, which
is selected from the group consisting of double stranded DNA,
single stranded DNA, double stranded RNA, and single stranded
RNA.
6. An isolated nucleic acid molecule which is not more than 99.9%
identical and is at least 95% identical to SEQ ID NO: 1.
7. The isolated nucleic acid molecule of claim 6 comprising
nucleotide sequence of HCVR 2 (SEQ ID NO: 2).
8. The isolated nucleic acid molecule of claim 6 comprising
nucleotide sequence of HCVR 8 (SEQ ID NO: 3).
9. The isolated nucleic acid molecule of claim 6 comprising
nucleotide sequence of HCVR 9 (SEQ ID NO: 4).
10. The isolated nucleic acid molecule of claim 6 comprising
nucleotide sequence of HCVR 22 (SEQ ID NO: 5).
11. The isolated nucleic acid molecule of claim 6 comprising
nucleotide sequence of HCVR 24 (SEQ ID NO: 6).
12. A stable cell line transfected with the isolated nucleic acid
molecule according to claim 1, wherein said cell line: (a) has a
growth rate which is not less than 10% of the growth rate of the
corresponding nave cell line, and (b) is capable of supporting
efficient replication of said isolated nucleic acid.
13. The cell line of claim 12 wherein said cell line is selected
from the group consisting of human hepatoma cell line Huh-7, human
hepatoma cell line HepG2, hepatoma cell line PH5CH, T. belangeri
liver cell line MBTL, human diploid fibroblast cell line VERO,
secondary monkey kidney cell line CV-1, T cell line MT-2, T cell
line HPBMa10-2, T cell line MOLT-4, and B cell line Daudi.
14. The cell line of claim 12 wherein said cell line is derived
from a human hepatoma cell line Huh-7.
15. The cell line of claim 14 designated HCVR 2 and having ATCC
Accession No. PTA-2489.
16. The cell line of claim 14 deisgnated HCVR 8 and having ATCC
Accession No. PTA-2490.
17. The cell line of claim 14 designated HCVR 9 and having ATCC
Accession No. PTA-2486.
18. The cell line of claim 14 designated HCVR 22 and having ATCC
Accession No. PTA-2487.
19. The cell line of claim 14 designated HCVR 24 and having ATCC
Accession No. PTA-2488.
20. A method of screening for anti-HCV therapeutics, which method
comprises comparing a level of HCV subgenomic replicon RNA or
replicon RNA-associated protein expression in the cell line of
claim 12 contacted with a candidate therapeutic agent to the cell
line not contacted with the candidate therapeutic agent, wherein a
decrease in the level of HCV subgenomic replicon RNA or replicon
RNA-associated protein expression is indicative of the inhibitory
activity of the agent.
21. A method for detecting antibodies to HCV in a biological sample
from a subject comprising contacting said sample with the protein
fractions derived from the cell line of claim 12 under conditions
that permit interaction of HCV-specific antibodies in the sample
with the HCV protein(s) produced in said cell line, followed by
detecting binding of the antibodies in the sample to these
HCV-derived protein(s), wherein said binding is indicative of the
presence of HCV infection in the subject from which the sample was
derived.
22. The method of claim 21 wherein said biological sample is
selected from the group consisting of blood, serum, plasma, blood
cells, lymphocytes, and liver cells.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/245,866 filed Nov. 7, 2000, which is hereby
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to recombinant hepatitis C
virus (HCV)-derived nucleic acids and to stable rapidly growing
cell clones supporting their efficient replication.
BACKGROUND OF THE INVENTION
[0003] Infection by hepatitis C virus (HCV) is a compelling human
medical problem. HCV is recognized as the causative agent for most
cases of non-A and non-B hepatitis, with an estimated worldwide
prevalence of 170 million cases (i.e., 2-3%) (Choo et al., Science,
1989, 244:359-362; Kuo et al., Science, 1989, 244:362-364; Purcell,
FEMS Microbiol. Rev., 1994, 14:181-192; Van der Poel, In: Current
Studies in Hematology and Blood Transfusion, Reesink ed., Basel:
Karger, pp. 137-163, 1994). Four million individuals may be
infected in the United States alone (Alter and Mast, Gastroenterol.
Clin. North Am., 1994, 23:437-455).
[0004] HCV is primarily transmitted parenterally, although sexual
and perinatal transmission do appear to occur. At present, no risk
factor has been identified in about 40% of HCV-infected individuals
in the US (Alter, Infect. Agents Dis., 1993, 2:155-166). Upon first
exposure to HCV, only about 10% or less of infected individuals
develop acute clinical hepatitis, while others appear to resolve
the infection spontaneously. In most instances, however, the virus
establishes a chronic infection that persists for decades, leading
in about 50% of all cases to chronic hepatitis, which can, in turn,
develop into liver cirrhosis and/or hepatocellular carcinoma
(Iwarson, FEMS Microbiol. Rev., 1994, 14:201-204; Kew, ibid. pp.
211-220; Saito et al., Proc. Natl. Acad. Sci. USA, 1990,
87:6547-6549).
[0005] Apart from liver cells, HCV can also replicate in peripheral
blood mononuclear cells (PBMCs) both in vivo and in experimentally
infected B- and T-cell lines (U.S. Pat. Nos. 5,679,342 and
5,968,775). Such a lymphotropism may account for the numerous
immunological disorders, in particular type II and type III
cryoglobulinaemia, observed in more than 50% of chronic hepatitis C
patients (Esteban et al., In: Hepatitis C Virus, Reesink ed.,
Basel: Karge, 1998, pp. 102-118).
HCV Structure and Genome Organization
[0006] Given the high prevalence of the virus, HCV has become a
focus of intensive research (for recent review see Bartenschlager
and Lohmann, J. Gen. Virol., 2000, 81:1631-1648; Rosen and Gretch,
Mol. Medicine Today, 1999, 5: 393-399). Originally cloned in 1989
(Choo et al., supra), the viral genome is now well characterized.
HCV is a (+) strand enveloped RNA virus, i.e. its genome is
represented by a coding single stranded RNA (cRNA) which is
packaged with the structural proteins in a viral particle
surrounded by a host cell-derived membrane. HCV has been classified
as the sole member of a distinct genus called hepacivirus in the
family Flaviviridae, which includes, e.g., the flaviviruses and the
animal pathogenic pestiviruses. Its genome has a length of
approximately 9.6 kb and its single, long open reading frame (ORF)
encodes an approximately 3000-amino acid polyprotein that is
proteolytically cleaved into a set of distinct products (FIG. 1
[prior art]; see also Rice, In: Virology, Fields et al. eds.,
Lippincott-Raven, 1996, Vol. 1, pp. 931-960; Clarke, J. Gen.
Virol., 1997, 78:2397).
[0007] The HCV ORF is flanked at the 5' and 3' ends by
nontranslated regions (NTRs). Translation of the ORF is directed
via an approximately 340 nucleotide (nt) long 5' NTR functioning as
an internal ribosome entry site (IRES) and permitting the direct
binding of ribosomes in close proximity to the start codon of the
ORF (Tsukiyama-Kohara et al., J. Virol., 1992, 66:1476-1483; Wang
et al., J. Virol., 1993, 67:3338-3344). The first approximately 40
nucleotides of the 5' NTR are not required for translation but,
based on analogy with other (+) strand RNA viruses, are involved
most likely in RNA replication (Boyer and Haenni, Virology, 1994,
198:415-426). The 3' NTR has a tripartite structure composed of a
variable sequence following the stop codon of the ORF, a poly(U)
tract of heterogeneous length and a highly conserved 98 nucleotide
sequence essential for replication in vivo (Kolykhalov et al., J.
Virol., 1996, 70:3363; Tanaka et al., Biochem. Biophys. Res. Comm.,
1995, 215:744; Tanaka et al., J. Virol., 1996, 70:3307; Yamada et
al., Virology, 1996, 223:255; Yanagi et al., Proc. Natl. Acad. Sci.
U.S.A., 1999, 96:2291; Kolykhalov et al., J. Virol., 2000,
74:2046-2051).
[0008] The HCV polyprotein is cleaved co- and post-translationally
by cellular and viral proteinases into ten different products, with
the structural proteins located in the N-terminal one-third and the
non-structural (NS) proteins (i.e., proteins which are not expected
to be constituents of the virus particle) in the remainder (FIG. 1;
reviewed in Bartenschlager and Lohmann, supra; Bartenschlager, J.
Viral Hepatitis, 1999, 6:165-181; Reed and Rice, In: Hepatitis C
Virus, Reesink ed., Basel: Karger, 1998, pp. 1-37). The first
cleavage product of the polyprotein is a highly basic core protein,
which is the major constituent of the nucleocapsid (Yasui et al.,
J. Virol., 1998, 72:6048-605) and is involved in modulation of
several cellular processes leading to induction of hepatocellular
carcinoma (Chang et al., J. Virol., 1998, 72: 3060-3065; Chen et
al., J. Virol., 1997, 71:9417-9426; Matsumoto et al., ibid., pp.
1301-1309; Moriya et al., Nature Med., 1998, 4:1065-1067). Envelope
proteins E1 and E2 are highly glycosylated type 1 transmembrane
proteins, forming two types of stable heterodimeric complexes
(Deleersnyder et al., J. Virol., 1997, 71:697-704). In addition, E2
was shown to interact with the interferon (IFN)-induced
double-stranded RNA-activated protein kinase PKR, allowing
continuation of translation of HCV RNA in the presence of IFN
(Taylor et al., Science, 1999, 285:107-110). Protein p7, located at
the C-terminus of E2, is a highly hydrophobic polypeptide of
unknown function. Most of the nonstructural proteins NS2-5B are
required for replication of the viral RNA (Lohmann et al., Science,
1999, 285:110-113). NS2 and the N-terminal domain of NS3 constitute
the NS2-3 proteinase, catalysing cleavage at the NS2/3 site
(Grakoui et al., 1993, Proc. Natl. Acad. Sci. USA, 1993,
90:10583-10587; Hijikata et al., J. Virol., 1993, 67:4665-4675;
Hirowatari et al., Arch. Virol., 1993, 133:349-356). NS3 is a
bifunctional molecule carrying, in the N-terminal approximately 180
residues, a serine-type proteinase responsible for cleavage at the
NS3/4A, NS4A/B, NS4B/5A and NS5A/B sites and, in the C-terminal
remainder, NTPase/helicase activities essential for translation and
replication of the HCV genome (Bartenschlager et al., J. Virol.,
1993, 67:3835-3844; Eckart et al., Biochem. Biophys. Res. Comm.,
1993, 192:399-406; Grakoui et al., J. Virol., 1993, 67:2832-2843;
Gwack et al., Biochem. Biophys. Res. Comm., 1996, 225:654-659; Hong
et al., J. Virol., 1996, 70:4261-4268; Kim et al., Biochem.
Biophys. Res. Comm., 1995, 215:160-166; Suzich et al., J. Virol.,
1993, 67:6152-6158; Tai et al., J. Virol., 1996, 70:8477-8484;
Tomei et al., J. Gen. Virol., 1993, 77:1065-1070; Kolykhalov et
al., 2000, supra). In addition, NS3 may interfere with host cell
functions by inhibiting protein kinase A (PKA)-mediated signal
transduction and/or by inducing cell transformation (Borowski et
al., Eur. J. Biochem., 1996, 237:611-618; Sakamuro et al., J.
Virol., 1995, 69:3893-3896). NS4A is an essential cofactor of the
NS3 proteinase and is required for efficient polyprotein processing
(Bartenschlager et al., J. Virol., 1994, 68:5045-5055; Failla et
al., ibid., pp. 3753-3760; Lin et al, ibid., pp. 8147-8157; Tanji
et al., J. Virol., 1995, 69:1575-1581). The function of the
hydrophobic NS4B is so far unknown. NS5A is a highly phosphorylated
protein (Asabe et al., J. Virol., 1997, 71:790-796; Kaneko et al.,
Biochem. Biophys. Res. Comm., 1994, 205:320-326; Koch and
Bartenschlager, J. Virol., 1999, 73:7138-7146; Neddermann et al.,
ibid., pp. 9984-9991; Tanji et al., J. Virol., 1995, 69:3980-3986)
which appears to interfere with the antiviral effect of IFN by
binding to PKR (Gale et al., Virology, 1997, 230:217-227; Gale et
al., Mol. Cell Biol., 1998, 18:5208-5218) and may also play role in
RNA replication. NS5B was identified as the RNA-dependent RNA
polymerase (RdRp) (Al et al., Virus Res., 1998, 53:141-149; Behrens
et al., EMBO J., 1996, 15:12-22; Lohmann et al., J. Virol., 1997,
71:8416-8428; Yamashita et al., J. Biol. Chem., 1998,
273:15479-15486; Yuan et al., Biochem. Biophys. Res. Comm., 1997,
232:231-235).
HCV Replication and Variability
[0009] Similarly to related positive (+) strand RNA viruses, HCV
replication occurs by means of a negative (-) strand RNA
intermediate and is catalyzed by the NS proteins forming a
cytoplasmic membrane-associated replicase complex. HCV replication
cycle can be summarized as follows (FIG. 2 [prior art]): (1)
penetration of the host cell and liberation of the genomic RNA
(cRNA) from the virus particle into the cytoplasm; (2) translation
of the input cRNA, processing of the polyprotein and formation of a
replicase complex associated with intracellular membranes; (3)
utilization of the input (+) strand for synthesis of a (-) strand
RNA intermediate; (4) production of new (+) strand RNA molecules
which can be used for synthesis of new (-) strands, for polyprotein
expression or for packaging into progeny virions; (5) release of
virus from the infected cell via cellular secretion pathway
resulting in formation of cell-derived viral membrane envelope.
[0010] The dynamics of HCV replication can be deduced from the
rapid rates of virus production and emergence of mutants. Analysis
of viral dynamics during antiviral treatment of patients with
IFN-.alpha. revealed a virion half-life of 3-5 hours and a
clearance and production rate of approximately 10.sup.12 particles
per day (Zeuzem et al., Hepatology, 1998, 28:245-252; Neumann et
al., Science, 1998, 282:103-107; Ramratnam et al., Lancet, 1999,
354:1782-1785). Although in absolute amounts these numbers are
high, they are not with respect to a single cell, corresponding to
a virion production rate of 50 particles per hepatocyte per day
(Neumann et al., supra).
[0011] Another feature of HCV replication is a rapid generation of
virus variants. Early studies of the mutation rate of HCV in
chronically infected humans and chimpanzees demonstrated that this
virus mutated very rapidly with the rate of change varying between
different genomic regions (Ogata et al., Proc. Natl. Acad. Sci.
USA, 1991, 88:3392-3396; Okamoto et al., Virology, 1992,
190:894-899). Thus, the highest mutation rate was found in the E1
and E2 genes with especially high rate observed in a short sequence
encoding the domain located at the N-terminus of E2 protein (hence
termed "hypervariable region 1" or "HVR1"). Accordingly, even
within a single patient HCV does not exist as a single entity but
rather as a collection of microvariants of a predominant "master
sequence", a phenomenon that has been referred to as quasispecies
(reviewed in Bukh et al., Semin. Liv. Dis., 1995, 15:41-63; Bukh et
al., Clin. Exp. Rheumatol., 1995, 13 (suppl.):S3-S7; Holland et
al., Curr. Topics Microbiol. Immunol., 176:1-20). The master
sequence, as well as the consensus sequence of the quasispecies
sequence population have been found to change sequentially during
the infection. The production of such large number of variants is
primarily due to the high error rate of the viral RdRp that, based
on analogies with RdRps of other (+) strand RNA viruses, is
expected to be in the range of 10.sup.-4. Using comparative
sequence analyses of HCV genomes isolated over intervals of 8 or 13
years, a mutation rate of 1.44.times.10.sup.-3 or
1.9.times.10.sup.-3 base substitutions per site per year was found,
respectively (Ogata et al., supra; Okamoto et al., supra). The high
variation observed with HCV replication may also account for the
fact that a significant fraction of virus genomes appear to be
defective (Martell et al., J. Virol., 1992, 66:3225-3229).
[0012] The biological consequences of quasispecies include: (i) the
development of escape mutants to humoral and cellular immunity
leading to the establishment of a persistent infection; (ii)
variable cell tropism (e.g., lymphotropic vs hepatotropic); (iii)
vaccine failure, and (iv) rapid development of drug resistance
(Bukh et al., Semin. Liv. Dis., supra). For example, it has been
found that the HVR1 contains epitopes that elicit a specific
humoral immune response and that sequential changes of HVR1 during
infection resulted in the emergence of epitopes that were not
recognized by pre-existing antibodies (Weiner et al., Proc. Natl.
Acad. Sci. USA, 1992, 89:3468-72; Taniguchi et al., Virology, 1993,
195:297-301; Kato et al., J. Virol., 1993, 67:3923-30; Kato et al.,
J. Virol., 1994, 68:4776-84).
[0013] It is now well established that HCV exists as distinct
genotypes among different HCV isolates with prevalence of each of
the genotypes in specific geographical locations. Based on the
genomic variability in the most highly conserved NS5B and E1
sequences, HCV has been classified into at least 9 major genetic
groups (genotypes 1a, 1b, 1c, 2a, 2b, 3a, 7, 8, 9) with total over
30 subtypes (Bukh et al., Clin. Exp. Rheumatol., supra; Simmonds et
al., J. Gen. Virol., 1993, 74:2391-2399). Several recent studies
indicate that the extensive genetic heterogeneity of HCV may have
important clinical implications, with genotype 1b (prevalent in the
US and Europe) being associated with a more severe liver disease
and a poorer response to interferon therapy (reviewed in Bukh et
al., supra).
Anti-HCV Therapies
[0014] Despite the intense research, the only anti-HCV therapy
currently available is administration of a high dose of IFN-.alpha.
or a combination treatment with IFN-.alpha. and the nucleoside
analogue ribavirin. However, only about 40% of all patients benefit
from this treatment and develop a sustained response, demonstrating
the urgent need for more effective antiviral therapeutics
(Marcellin et al., Ann. Intern. Med., 1997, 127:875-881; Reichard
et al., Lancet, 1998, 351:83-87).
[0015] As mentioned above, anti-HCV vaccine development has been
hampered by the high degree of viral variability leading to
efficient immune evasion and the lack of protection against
reinfection, even with the same inoculum (Farci et al., Science,
1992, 258:135-140; Kao et al., J. Med. Virol., 1996, 50:303-308;
Shimizu et al., 1994, J. Virol., 68:1494-1500; Wyatt et al., J.
Virol., 1998, 72:1725-1730). Among the most promising approaches to
vaccine development, is immunization with highly conserved HCV core
protein alone or in combination with E1 and/or E2 envelope
proteins, and/or NS3 protein (Major et al., 1995, J. Virol.,
69:5798-5805; Tokushige et al., Hepatology, 1996, 24:14-20;
Geissler et al., J. Immunol., 1997, 158:1231-1237; Inchauspe et
al., Vaccine, 1997, 15:853-856).
[0016] In view of the reasonable scepticism over the "universal"
anti-HCV vaccine, the importance of alternative therapies
increases. Such therapies include without limitation: (i) small
molecule inhibitors directed against specific viral targets (e.g.,
E1/E2 envelope proteins or NS3 protease/helicase); (ii) antisense
oligonucleotides and ribozymes for the inhibition of HCV
replication, and (iii) transdominant-negative proteins (Kim et al.,
Cell, 1996, 87:343-355; Love et al., ibid., 331-342; Yao et al.,
Nat. Struct. Biol., 1997, 4:463-467; Yan et al., Protein Sci.,
1998, 7:837-847; Von Wizsaker et al., Hepatology, 1997, 26:251-255;
Lieber et al., J. Virol., 1996, 70:8782-8791; Rosen and Gretch,
supra; Saito et al., Gastroenterology, 1997, 112:1321-1330; Nakano
et al., J. Virol., 1997, 71:7101-7109; Fournillier et al.,
Hepatology, 1998, 28:237-244; Wakita et al., J. Biol. Chem., 1994,
269:14205-14210; Mizutani et al., Biochem. Biophys. Res. Comm.,
1995, 212:906-911; Alt et al., Hepatology, 1995, 22:707-717;
Havecak et al., J. Virol., 1996, 70:5203-5212; Lima et al., J.
Biol. Chem., 1997, 272:626-638; Alt et al., Arch. Virol., 1997,
142:589-599; Wu and Wu, Gastroenterology, 1998, 114:1304-1312;
Sakamoto et al., J. Clin. Invest., 1996, 98:2720-2728; Ruiz et al.,
J. Viral Hepatitis, 1999, 6:17-34).
In Vivo and In Vitro Systems for HCV Infection
[0017] As the currently available chimpanzee models are too
expensive to be practical for early stage evaluation of anti-HCV
therapeutics, there is a need in the art to develop more manageable
and efficient in vivo and in vitro model systems for HCV
infection.
[0018] In an attempt to establish a small animal model Xie et al.
(Virology, 1998, 244:513-520) experimentally inoculated Tupaias (T.
belangeri chinensis), a tree shrew species which adapt and breed in
the laboratory environment, are closely related to primates, and
were previously shown to be susceptible to infection with the human
rotavirus (Wan et al., Natl. Med. J. Chin., 1982, 62:461-465),
herpes simplex virus type 1 and 2 (Darai et al, J. Infect. Dis.,
1978, 137:221-226), and human hepatitis viruses A, B (both in vitro
and in vivo), and Delta (Li et al., Chung. Hua. I. Hsueh. Tsa.
Chih., 1995, 75:611-613; Walter et al, Hepatology, 1996, 24:1-5;
Yan et al, J. Cancer Res. Clin. Oncol., 1996, 122:283-288 and
289-295; Zan et al, Acta Acad. Med. Sin., 1981, 3:148-152).
Although, upon inoculation, only about one-quarter of the animals
became infected with HCV and developed either transient or
intermittent viraemia with rather low titers, the Tupaia animal
model appears to be very promising. Recently, two potential
alternatives have been described for the propagation of hepatitis B
viruses that might be used for HCV as well. Both systems are based
on the engraftment of human liver tissue into immuno-compromised
mice (Ilan et al, Hepatology, 1999, 29:553-562; Petersen et al,
Proc. Natl. Acad. Sci. USA, 1998, 95:310-315).
[0019] Although development of a small animal model is critical for
studies of HCV pathophysiology and for assaying toxicology and
pharmacokinetics of anti-HCV therapeutics, it is of primary
importance to create a convenient and reliable cell culture-based
assay system that supports HCV infection and replication and allows
detailed molecular studies of HCV propagation and efficient
high-throughput evaluation of anti-HCV therapeutics.
[0020] Until recently, in vitro research on HCV has depended
largely on (i) analogies to the closely related flavi- and
pestiviruses, (ii) characterization of recombinantly produced HCV
proteins, (iii) infection of primary cell cultures with
HCV-containing sera of infected individuals, and (iv) cultivation
of primary cells derived from chronically infected tissues (Lanford
et al., 1994, Virology, 202:606; Shimizu et al., Proc. Natl. Acad.
Sci. U.S.A., 1992, 89:5477; Mizutani et al., J. Virol., 1996,
70:7219-7223; Ikeda et al., Virus Res., 1998, 56:157; Fournier et
al., J. Gen. Virol., 1998, 79:2376). For example, HCV replication
was reported in primary hepatocytes from humans or chimpanzees
following infection with high titer HCV-containing serum (Fournier
et al., supra; Iacovacci et al., Res. Virol., 1993, 144:275-279;
Lanford et al., supra; Rumin et al., J. Gen. Virol., 1999,
80:3007-3018) and in PBMCs isolated from chronically infected
patients (Bouffard et al., J. Infect. Diseases, 1992,
166:1276-1280; Muller et al., J. Gen. Virol., 1993, 74:669-676;
Zignego et al., J. Hepatol., 1992, 15:382-386).
[0021] In the primary cell cultures HCV replication was detected
using a number of highly sensitive methods: (i) detection of (-)
strand replicative RNA intermediates by strand-specific reverse
transcriptase-polymerase chain reaction (RT-PCR) or Northern blot;
(ii) determination of an increase of (+) strand RNA during the
cultivation period using either b-DNA assay or quantitative RT-PCR;
(iii) detection of inhibition of replication upon incubation of the
cells with IFN-.alpha. or antisense oligonucleotides; (iv) the
ability of the cell culture medium (containing viral particles) to
cause infection upon addition to naive cells; (v) sequence analysis
of HCV genomes or genome fragments to demonstrate genomic
variability and selection of variants upon infection and
cultivation, and (vi) detection of viral antigens in situ or upon
isolation using, e.g., immunofluorescence, Western blotting, or
flow cytometry.
[0022] It should be noted, however, that primary cell cultures are
not routinely available, are hard to maintain, and suffer from poor
reproducibility and a low level of HCV replication that can be
measured only with highly sensitive techniques. Accordingly,
numerous attempts have been made to develop stable HCV-replicating
cell lines. Initially, these cell lines were also developed by
infecting them with the virus isolated from infected individuals.
Such HCV-infected cell lines, secondary monkey kidney cells CV-1
and human diploid fibroblasts VERO, are disclosed, for example, in
the PCT Application No. WO 96/24662. With respect to hepatoma cell
lines, the most detailed results are available for the
non-neoplastic cell line PH5CH (Ikeda et al., 1998, supra; Kato et
al., Jap. J. Cancer Res., 1996, 87:787-792). However, a strong
selection for HCV variants in the HVR1 of the E2 protein was
observed in this cell line suggesting that only certain variants
can bind to or replicate in these cells. A similar decrease of
complexity of viral quasispecies has been described for HCV
propagated in primary human hepatocytes for up to 3 months (Rumin
et al., supra).
[0023] HCV replication upon infection was also demonstrated in
cultured cells derived from the T-cell lines MT-2, HPBMa10-2, and
MOLT-4 and from the B-cell line Daudi. For example, in HPBMa10-2
and Daudi cells, long-term propagation of HCV for more than 1 year
has been described (Nakajima et al., J. Virol., 1996,
70:3325-3329), and virus could be transmitted several times to
naive cells by cocultivation (Shimizu and Yoshikura, J. Virol.,
1994, 68:8406-8408). HCV-replicating B- and T-cell lines are also
disclosed in the U.S. Pat. No. 5,679,342. However, similarly to
PH5CH cells, it was found that only certain virus variants
replicate in HPBMa10-2 and Daudi cells as well as in MT-2C cells,
suggesting the selection of lymphotropic HCV quasispecies (Mizutani
et al., J. Virol., 1996, supra; Sugiyama et al., J. Gen. Virol.,
1997, 78:329-336).
Attempts to Create Stable Cell Lines Containing Self-Propagating
Recombinant HCV Replicons
[0024] The recent construction of cloned HCV genomes and
demonstration of their ability to replicate and cause disease
development after intrahepatic inoculation of chimpanzees (Beard et
al., Hepatology, 1999, 30:316-324; Kolykhalov et al., Science,
1997, 277:570-574; Yanagi et al., Proc. Natl. Acad. Sci. USA, 1997,
94:8738; Yanagi et al., Virology, 1998, 244:161) has opened some
new avenues to study HCV replication and pathogenesis.
Specifically, it made feasible the development of stable cell
cultures containing selectable HCV replicons. Compared to the
infection of cell lines with HCV-containing patient material, the
introduction of cloned virus genomes is superior because the
inoculum is well defined and can be generated in high quantities.
Most importantly, the genome can be manipulated at will, permitting
a detailed genetic analysis of viral functions leading to
successful development of anti-viral therapeutics.
[0025] Similarly to experience with several (+) strand RNA viruses
(Boyer and Haenni, supra), it became clear with the first attempts
to create self-replicating subgenomic HCV clones in culture that
the use of in vitro synthesized RNA transcripts (cRNA) of defined
structure (produced, e.g., using T7 or SP6 in vitro transcription
system) is advantageous to transfection of DNA constructs. Indeed,
direct transfection of cRNA avoids the involvement of the cell
nucleus and therefore potential problems associated with
transcriptional regulation, splicing, incorrect 5' and 3'-end
processing, and nucleo-cytoplasmic transport (Dash et al., Am J.
Pathol., 1997, 151:363-373).
[0026] However, in contrast to many other (+) strand RNA viruses,
construction of self-replicating subgenomic HCV clones in culture
turned out to be very difficult. Until recently, only a few
successful attempts were reported, each lacking important controls
and/or being somewhat controversial. Thus, Baumert et al. (J.
Virol., 1998, 72:3827-3836) described assembly of poorly
characterized HCV-like particles in insect cells upon introduction
of a recombinant baculovirus containing the cDNA encoding HCV ORF.
Dash et al. (supra) and Yoo et al. (J. Virol., 1995, 69:32-38)
reported successful replication of putative HCV cRNA upon
transfection in the human hepatoma cell lines Huh-7 and HepG2,
respectively. However, both studies appear to be highly
questionable as they describe the propagation of truncated HCV
genomes lacking the authentic 3' NTR, which is essential for
replication in vivo (Yanagi et al., 1999, supra; Kolykhalov et al.,
2000, supra).
[0027] The most convincing evidence of a functional in vitro
cell-based system for replication of recombinant HCV came from a
recent report by Lohmann et al. (Science, 1999, 285:110-113). These
authors have described selectable subgenomic HCV RNA molecules
replicating after transfection into the human hepatoma cell line
Huh-7. Similar subgenomic HCV replicons capable of propagating in
tissue culture are disclosed in PCT Application No. WO 98/39031.
Based on the assumption that high expression levels of the
structural proteins might be cytotoxic (Moradpour et al., Biochem.
Biophys. Res. Comm., 1998, 246:920-924) and the observation that
for several (+) strand RNA viruses (e.g., alpha-, flavi- and
pestiviruses) the structural proteins are not required for RNA
replication (Behrens et al., J. Virol., 1998, 72:2364-2372;
Khromykh and Westaway, J. Virol., 1997, 71:1497-1505; Liljestrom
and Garoff, Biotechnol., 1991, 9:1356-1361), Lohmann et al. deleted
the sequences of the structural proteins in their HCV-derived
constructs. In addition, to allow selection for only those cells
which support efficient HCV replication, the gene encoding the
neomycin phosphotransferase (neo) and conferring resistance to the
antibiotic G418, was introduced downstream of the HCV IRES (FIG.
3). A second IRES element was included to allow translation of the
HCV NS proteins. Upon transfection of these bicistronic RNAs and
selection in the presence of G418, only cells supporting
replication of HCV-derived RNAs amplified the neo gene and
developed resistance, whereas non-transfected cells and cells
unable to support replication died. The selected cells carried
large amounts of HCV RNAs detectable by Northern blot, or after
metabolic radiolabeling with .sup.3[H]uridine, providing formal
proof that these RNAs were actively replicating in the cells. As
expected for a replicative intermediate, (-) strand RNA was present
in approximately 10-fold lower amounts compared to (+) strand RNA.
Finally, HCV proteins could be detected by immunoprecipitation
after metabolic radiolabelling with .sup.35[S]methionine or Western
blot and were confined to the cytoplasm (see also Bartenschlager
and Lohmann, 2000, supra).
[0028] Although replicon titers observed in several clones
generated by Lohmann et al. were several orders of magnitude higher
compared to previously available cell culture-based HCV infection
systems (described above, see also Blight and Gowans, Viral
Hepatitis Rev., 1995, 1:143-155), the overall efficiency of clone
generation upon transfection was very low. Taken together with the
observation that the majority of cell clones containing
replication-competent subgenomic HCV RNAs were growing much slower
than the naive Huh-7 cells or the cells transformed with
replication-deficient RNA, it can be concluded that the recombinant
HCV replicons of Lohmann et al. are toxic to their host cells.
Clearly, such cytotoxic replicons are deficient as an in vitro
model of HCV propagation as they cannot attain their maximal
replication titers and therefore cannot provide sufficient amounts
of subgenomic viral nucleic acids required for generation of
recombinant anti-viral vaccines, for studies of some of the viral
processes, and for sensitive large-scale anti-viral drug
screening.
[0029] In view of the above, despite the progress made in the last
several years, the field is still lacking an efficient stable cell
culture system for high titer propagation of recombinant HCV. Such
a system is needed for (i) further studies of intracellular viral
processes (e.g., analysis of HCV receptor binding, cellular
infection, replication, virion assembly, and release); (ii)
generation and testing of anti-viral vaccines; (iii) screening and
testing of anti-viral drugs; (iv) development of targets and
methods for HCV diagnostics, and (v) production of concentrated
virion and protein stocks (e.g., for structural analysis of virion
components leading to epitope determination for immunotherapy).
[0030] The present invention addresses these and other needs in the
art by providing novel mutated recombinant HCV-derived nucleic
acids and novel rapidly growing "adapted" cell clones supporting
their efficient replication.
SUMMARY OF THE INVENTION
[0031] The present invention provides novel recombinant hepatitis
C(HCV)-derived nucleic acids. Preferred subgenomic HCV replicons of
the invention include HCVR 2 (SEQ ID NO: 2), HVCR 8 (SEQ ID NO: 3),
HCVR 9 (SEQ ID NO: 4), HCVR 22 (SEQ ID NO: 5) and HCVR 24 (SEQ ID
NO: 6). These replicons are derived from the parental HCV genotype
1b-based recombinant clone I377-NS3-3'UTR (SEQ ID NO: 1) and
contain multiple nucleotide changes (e.g., as shown in Table I, see
Example 1) which occurred following their prolonged replication in
the Huh-7-derived cell clones of the present invention under
stringent selection conditions. At least some of these mutations
are indicative of the non-structural HCV genome regions which are
responsible for high-titer viral replication and virus-induced
cytotoxicity.
[0032] In a specific embodiment, the present invention is directed
to plasmid clones which can be transcribed to produce
self-replicating recombinant HCV RNAs of the invention.
[0033] In a separate embodiment, the instant invention includes a
method for generating novel efficiently replicating recombinant
HCV-derived nucleic acids containing the critical elements of the
HCV replicons described above and comprising from 5' to 3' on the
positive-sense nucleic acid (1) a functional 5' non-translated
region (NTR) comprising an extreme 5'-terminal conserved sequence,
(2) at least one open reading frame (ORF) encoding a heterologous
gene operatively associated with an expression control sequence,
wherein the heterologous gene and expression control sequence are
oriented on the positive-strand nucleic acid molecule, (3) an ORF
encoding at least a portion of an HCV polyprotein whose cleavage
products form functional components of HCV virus particles and RNA
replication machinery, and (4) a 3' NTR comprising an extreme
3'-terminal conserved sequence. In a specific embodiment, where the
selection marker ORF is a drug resistance gene, this gene is a
neomycin resistance gene (neo) operatively associated with an
internal ribosome entry site (IRES).
[0034] The instant invention also includes a method for propagating
the disclosed recombinant HCV-derived nucleic acids in vitro by
culturing a cell line transfected or infected with an appropriate
amount of HCV RNA, e.g., as produced from the plasmid clones
recited above, under conditions that permit replication of the HCV
RNA. In a specific embodiment, replication of the disclosed novel
HCV-derived nucleic acids in susceptible cultured cells leads to
the generation of potentially infectious recombinant viral
particles t which can be used as an attenuated anti-HCV
vaccine.
[0035] Accordingly, in conjunction with the recombinant nucleic
acids disclosed herein, the present invention advantageously
provides cell lines, which are susceptible to HCV infection and/or
transfection and support replication of such recombinant nucleic
acids. In a preferred embodiment, the susceptible cell line of the
invention is a human hepatoma cell line Huh-7.
[0036] The invention further provides stable "adapted" cell clones
which are derived from Huh-7 cell line and are characterized by the
growth properties which are similar to or indistinguishable from
the naive (i.e., untransfected) Huh-7 cells (e.g., as shown in FIG.
5). According to the instant invention, these "adapted" cell clones
are able to support efficient replication of subgenomic HCV RNAs.
Some of the most efficiently propagating cell clones of the present
invention, i.e., HCVR 2, 8, 9, 22 and 24, were deposited with the
American Type Culture Collection (ATCC), 10801 University
Boulevard, Manassas, Va. 20110-2209, USA on Sep. 20, 2000, and
assigned Accession Nos. PTA-2489, PTA-2490, PTA-2486, PTA-2487, and
PTA-2488, respectively.
[0037] The materials disclosed herein provide methods for screening
(both in vitro and in vivo) for agents capable of modulating HCV
infection and/or replication, and/or virion assembly. Such methods
include administering a candidate agent to HCV-replicating cell
line(s) of the invention, and testing for an increase or decrease
in a level of subgenomic HCV replication or HCV-associated protein
expression compared to a level of HCV replication or HCV-associated
protein expression in a control cell line transfected with
replication-defective construct or in the same cell line prior to
administration of the candidate agent, wherein a decrease in the
level of HCV replication or HCV-associated protein expression is
indicative of the inhibitory activity of the agent.
[0038] In a specific embodiment, HCV-replicating cell lines of the
present invention provide a convenient system for high-throughput
initial screening of potential anti-HCV therapeutics.
[0039] Further provided herein is a method for generating massive
quantities of recombinant HCV replicons (which can serve as a basis
for anti-HCV vaccine development) from the cell clones of the
present invention, said replicons being produced either as
intracellular nucleic acids or as infectious or non-infectious
recombinant viral particles.
[0040] The present invention also has significant diagnostic
implications. For example, the invention provides an in vitro
method for detecting antibodies to HCV in a biological sample from
a subject comprising contacting the sample with HCV-replicating
cells, cellular fractions, isolated HCV-derived proteins, or
HCV-derived viral particles prepared as described above. The
contacting operation is conducted under conditions that permit
binding of HCV-specific antibodies in the sample to the HCV
protein(s); and detecting binding of antibodies in the sample to
the HCV-derived protein(s). Detecting binding of antibodies in the
sample to the HCV protein(s) is indicative of the presence of HCV
infection in the subject from which the sample was derived.
[0041] In summary, the present invention provides nucleic acids
encoding recombinant HCV replicons, which are capable of efficient
propagation and expression of HCV-derived proteins in a cell
culture system.
[0042] The invention further provides susceptible cell lines (and
"adapted" rapidly growing cell clones derived from them), which
support high titer replication of recombinant HCV-derived nucleic
acids.
[0043] By providing cell clones supporting efficient subgenomic HCV
replication, the present invention provides (i) in vitro cell
culture models of HCV propagation; (ii) systems for screening
candidate anti-viral compounds and evaluating drug resistance;
(iii) methods for diagnosing HCV infection, and (iv) systems for
production of large quantities of HCV-derived components or
recombinant viral particles for antibody generation and/or vaccine
development.
[0044] The present invention meets these and other objects of the
invention, as set forth in greater detail in the Detailed
Description and Examples, including the accompanying Drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] FIG. 1 (prior art) depicts HCV genome structure and
polyprotein processing. At the top is a schematic representation of
the viral genome with the structural and nonstructural protein
coding regions, and the 5' and 3' NTRs. Boxes below the genome
identify proteins generated by the proteolytic processing cascade.
Different types of arrows represent different types of proteases
responsible for polyprotein processing at each particular site.
[0046] FIG. 2 (prior art) is a schematic representation of the HCV
life cycle comprising the following stages: (1) penetration of the
host cell and liberation of the (+) strand genomic RNA (cRNA) from
the virus particle into the cytoplasm; (2) translation of the input
cRNA, processing of the polyprotein and formation of a replicase
complex associated with intracellular membranes; (3) utilization of
the input (+) strand for synthesis of a (-) strand RNA
intermediate; (4) production of new (+) strand RNA molecules which
can be used for synthesis of new (-) strands, for polyprotein
expression or for packaging into progeny virions; (5) release of
virus from the infected cell via cellular secretion pathway
resulting in formation of cell-derived viral membrane envelope.
[0047] FIG. 3 is a schematic representation of the recombinant
parental HCV replicon I377/NS3-3'UTR (SEQ ID NO: 1) composed of the
5'HCV-IRES, the neo gene, the EMCV-IRES, and HCV sequences from NS3
up to the authentic 3' end.
[0048] FIG. 4 depicts detection of (+) strand HCV RNA in
subpassaged Huh-7 cell clones by RT-PCR using primers flanking the
region corresponding to NS5B nt 7435-7750. Shown is 2% agarose gel
electrophoresis analysis of RT-PCR fragments obtained by amplifying
total RNA isolated from G418-resistant Huh-7 cell clones HCVR 2, 6,
8, 9 and 12 (lanes 2-6). As a negative control, PCR was performed
without a DNA template (lane 1). Lane MW shows position of
molecular size markers.
[0049] FIG. 5 is a graphic representation of relative growth rates
of Huh-7-derived "adapted" cell clones supporting efficient
subgenomic HCV replication. Growth rates (shown as a function of
optical density after sulphorhodamine staining for total cellular
proteins) of clones HCVR 2, 8, 9, 22 and 24 are compared to the
growth rate of nave non-transfected Huh-7 cells (black line) at 9
weeks post-transfection.
DETAILED DESCRIPTION OF THE INVENTION
[0050] All patent applications, patents, and literature references
cited herein are hereby incorporated by reference in their
entirety.
[0051] The present invention provides novel recombinant hepatitis
C(HCV) nucleic acids containing all HCV non-translated sequences
required for replication and expression, all or a portion of the
HCV ORF, as well as one or more heterologous genes. In a preferred
embodiment, disclosed herein are recombinant HCV-derived nucleic
acids (e.g., HCVR 2 [SEQ ID NO: 2], HVCR 8 [SEQ ID NO: 3], HCVR 9
[SEQ ID NO: 4], HCVR 22 [SEQ ID NO: 5] and HCVR 24 [SEQ ID NO: 6])
which differ from the parental chimeric HCV replicon used for their
generation (I377/NS3-3'UTR, SEQ ID NO: 1) in a number of positions
located at various parts of the replicon genome (see, e.g., Table
I). At least some of these mutant subgenomic HCV nucleic acids have
a much lower cytotoxicity, as evident from their growth potential
(FIG. 5) and, subsequently, have a significantly higher rate of
productive transfection compared to the previously described
recombinant HCV replicons. Due to these and other advantageous
properties, the subgenomic HCV nucleic acids of the present
invention are capable of efficient high titer replication in the
susceptible cell lines of the present invention.
[0052] In conjunction with HCV-derived nucleic acids, the present
invention further provides susceptible cell lines and, in
particular, novel "adapted" rapidly growing cell clones derived
from human hepatoma cell line Huh-7 (e.g., clones HCVR 2, 8, 9, 22
and 24), said cell lines and "adapted" clones being capable of
supporting efficient replication of subgenomic recombinant HCV
RNAs.
[0053] Another embodiment is a sensitive high-throughput method for
screening anti-HCV therapeutics by putting them in contact with the
cell clones of the present invention and determining their effect
on propagation of subgenomic HCV replicons.
[0054] Further provided herein is a method for generating large
quantities of recombinant HCV replicons from the cell clones of the
present invention. These replicons can be generated for the purpose
of providing a recombinant attenuated anti-HCV vaccine and can be
produced either as intracellular nucleic acids or as infectious or
non-infectious recombinant viral particles.
[0055] By providing cell clones supporting efficient subgenomic HCV
replication, the present invention provides (i) in vitro cell
culture models of HCV propagation; (ii) systems for screening
candidate anti-viral compounds and evaluating drug resistance;
(iii) methods for diagnosing HCV infection, and (iv) systems for
production of large quantities of HCV-derived components or
recombinant viral particles for antibody generation and/or vaccine
development.
Definitions
[0056] A "nucleic acid molecule" refers to the phosphate ester
polymeric form of ribonucleosides (adenosine, guanosine, uridine or
cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine,
deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"),
in either single stranded form, or a double-stranded form. Double
stranded DNA-DNA, DNA-RNA and RNA-RNA duplexes are possible. The
term nucleic acid molecule, and in particular DNA or RNA molecule,
refers only to the primary and secondary structure of the molecule,
and does not limit it to any particular tertiary forms. In
discussing the structure of particular nucleic acid molecules,
sequences or regions may be described herein according to the
normal convention of giving only the sequence in the 5' to 3'
direction. A "recombinant DNA molecule" is a DNA, molecule that has
undergone a molecular biological manipulation.
[0057] A "coding sequence" or a sequence "encoding" an expression
product, such as a RNA, polypeptide, protein, or enzyme, is a
nucleotide sequence that, when expressed, results in the production
of that RNA, polypeptide, protein, or enzyme, i.e., the nucleotide
sequence encodes an amino acid sequence for that polypeptide,
protein or enzyme. In the present invention, translation of
HCV-derived (+) strand RNA initially yields a polyprotein, which is
cleaved during post-translational processing to yield functional
viral proteins.
[0058] The term "gene" means a DNA sequence that codes for or
corresponds to a particular sequence of amino acids, which comprise
all or part of one or more proteins or enzymes.
[0059] A coding sequence is "under the control" or "operatively
associated with" transcriptional and translational control
sequences in a cell when RNA polymerase transcribes the coding
sequence into mRNA, which is then translated into the protein
encoded by the coding sequence.
[0060] The terms "express" and "expression" mean allowing or
causing the information in a gene or nucleic acid sequence to
become manifest, for example producing a protein by activating the
cellular functions involved in transcription and translation of a
corresponding gene or nucleic acid sequence. A nucleic acid
sequence is expressed in or by a cell to form an "expression
product" such as a mRNA or a protein. The expression product
itself, e.g. the resulting protein, may also be said to be
"expressed" by the cell.
[0061] The term "polypeptide" refers to a polymer of amino acids
and does not refer to a specific length of the product; thus,
peptides, oligopeptides, and proteins are included within the
definition of polypeptide. This term also does not refer to, or
exclude, post-translational modifications of the polypeptide, for
example, glycosylations, acetylations, phosphorylations, and the
like.
[0062] As used herein, the term "conservative mutation" or
"conservative nucleotide change" is used to define a nucleotide
change, which occurs with high frequency within quasispecies.
"Sequence-conservative variants" are those in which a change of one
or more nucleotides in a given codon position results in no
alteration in the amino acid encoded at that position.
"Function-conservative variants" are those in which a given amino
acid residue in a protein or enzyme has been changed without
altering the overall conformation and function of the polypeptide,
including, but not limited to, replacement of an amino acid with
one having similar properties (such as, for example, polarity,
hydrophobicity, size of the side chain, hydrogen bonding potential,
and the like).
[0063] The term "hepatitis C virus" or "HCV" is used herein to
define a viral species of which pathogenic strains cause hepatitis
C, also known as non-A, non-B hepatitis.
[0064] As used herein, the term "viral RNA", which includes HCV
RNA, refers to RNA from the viral genome, fragments thereof,
transcripts thereof, and mutant sequences derived therefrom.
[0065] As used herein, a "(+) stranded genome" or a
"positive-stranded genome" of a virus is one in which the genome,
whether RNA or DNA, is single-stranded and encodes a viral or
virus-derived polypeptide(s). Examples of positive-stranded RNA
viruses include Togaviridae, Coronaviridae, Retroviridae,
Picornaviridae, and Caliciviridae. Included also, are the
Flaviviridae, which were formerly classified as Togaviridae (see
Fields and Knipe, Fundamental Virology, Raven Press, 1986).
[0066] As used herein, a "replicative intermediate" of an HCV
genome or a "(-) stranded genome" or a "negative-stranded genome"
refers to an RNA strand or fragment thereof, which is complementary
to the viral genome, and which is synthesized during the course of
viral replication; the replicative intermediate functions as a
template for the synthesis of (+) RNA strands.
[0067] As used herein, "purified HCV virions" refers to a
preparation of HCV viral or virus-like particles that have been
isolated from the cellular constituents with which the virus
normally associates, and from other types of viruses that may be
present in the infected tissue. The techniques for isolating
viruses are known to those of skill in the art, and include, for
example, centrifugation and affinity chromatography.
[0068] A "construct" is a chimeric virus or nucleic acid encoding a
chimeric virus, such as positive viral genomic RNA or a DNA that
can be transcribed to produce viral genomic RNA.
[0069] The term "chimeric" is used herein in its usual sense: a
construct or protein or virus resulting from the combination of
genes from two or more different sources, in which the different
parts of the chimera function together. The genes are fused, where
necessary in-frame, in a single genetic construct. As used herein,
the term "chimeric" refers specifically to recombinant HCV-derived
nucleic acids or proteins or virions.
[0070] The term "chimeric virus genome" or "recombinant virus" or
"subgenomic HCV replicon" as used herein refers to the genome of
the HCV that is modified by insertion or substitution of sequences.
In some instances, the virus-derived replicon which later undergoes
additional changes (e.g., as a result of in vitro manipulations or
in vivo selection) may be referred to as a "parent" genome or
replicon. In general, according to the present invention, the
recombinant virus genome will include various parts of the parent
virus genome, said parts comprising without limitation genes
encoding proteins involved in replication, infectivity, tropism,
and life cycle.
[0071] The term "junction site" is used herein to refer to the
amino acid sequence joining two different proteins of a
virus-derived polyprotein that is recognized and cleaved by a
protease, e.g., HCV NS3. Various HCV NS3 junction sites are known,
including the NS3/NS4A, NS4A/NS4B, NS4B/NS5A, and NS5A/NS5B
junction sites. Any of these can be used to substitute for an
endogenous junction site of the virus used in the chimeric
construct.
[0072] The term "internal ribosome entry site" or "IRES" defines a
special region of some viral and cellular mRNA molecules that is
capable of cap-independent binding of the ribosome to initiate
translation.
[0073] As used herein, "infectious" refers to the ability of a
virus to enter and replicate in a cell and to produce viral
particles. Infectivity can be evaluated either by detecting virus,
i.e., viral load, or by observing disease progression in an animal.
Virus (viral load) can be detected by the presence of viral (+)
strand RNAs and/or (-) strand replication intermediates, e.g.,
detected by RT-PCR or direct hybridization techniques. It can also
be detected, if present in sufficient amount, by the presence of
replicon-derived proteins, e.g., detected by immunoassay or
biochemical techniques. In another alternative, a culture medium
isolated from a cell line supporting viral replication or
extracts/samples from an animal are used to infect naive cells in
culture. The important aspects of the determination of viral
infectivity in vivo (i.e., in infected subjects) is the development
of either an acute or chronic viral infection, which, in turn, may
include either overt pathology or merely replication and
propagation of the virus.
[0074] The term "viral load" or "viral titer" is used herein to
refer to a quantitative amount of virus in a cell culture or in an
infected animal. The term "titer" can be also used to refer to a
quantitative amount of virus-derived replicons produced within a
susceptible cell. "Disease progression" refers to the course of
disease or symptoms of an infected animal, and may include acute or
chronic disease symptoms. "Pathothogenesis" is a particular
indication of a disease progression, and refers to the pathogenic
effects of viral infection, including morbidity and mortality. In
the present invention, main pathologic effects of HCV are observed
in the hepatic tissue.
[0075] An "individual" or "subject" or "animal", as used herein,
refers to vertebrates, particularly members of the mammalian
species and includes, but is not limited to, rodents, rabbits,
shrews, and primates, the latter including humans.
[0076] As used herein, a "biological sample" refers to a sample of
tissue or fluid isolated from an individual, including but not
limited to, for example, plasma, serum, spinal fluid, lymph fluid,
the external sections of the skin, respiratory, intestinal and
genitourinary tracts, tears, saliva, milk, blood cells, tumors,
organs, and also samples of in vitro cell culture constituents
(including, but not limited to, conditioned medium resulting from
the growth of cultured cells, putatively viral infected cells,
recombinant cells, and cell components).
[0077] As used herein, the term "quasispecies" means a collection
of microvariants of a predominant HCV genome sequence ("master
sequence"), said microvariants being formed in a single infected
animal or even in a single cell clone as a result of high mutation
rate during HCV replication.
[0078] As used herein, an "in vitro cell system" or an
"extracorporeal cell system" refers to cells which are replicated
outside of the body, i.e., cell systems not found in nature; as
such, the term includes primary cultures and cell lines.
[0079] "Primary cultures", as used herein, refers to a culture of
cells that is directly derived from cells or tissues from an
individual, as well as cells derived by passage from these cells,
but not to immortalized cells.
[0080] As used herein, "cell line" refers to a population of cells
capable of continuous or prolonged growth and division in vitro.
The term "cell lines" also includes immortalized cells. Often, cell
lines are clonal populations derived from a single progenitor cell.
Such cell lines are also termed "cell clones". It is further known
in the art that spontaneous or induced changes can occur in
karyotype during storage or transfer of such clonal populations.
Therefore, cells derived from the cell clones referred to may not
be precisely identical to the ancestral cells or cultures.
According to the present invention, if such cell clones are capable
of supporting efficient replication of HCV-derived RNAs without a
significant decrease in their growth properties, they are termed
"adapted" cell clones.
[0081] The term "host cell" means any cultured cell or any cell of
any organism that is susceptible to infection by or propagation of
a wild-type HCV or a chimeric virus construct of the invention.
Host cells can further be used for screening or other assays, as
described herein. A potentially susceptible cell that has not been
transfected or infected with virus-derived nucleic acids is termed
a "naive" cell.
[0082] The term "transfection" means the introduction of a foreign
nucleic acid into a cell. The introduced gene or sequence may also
be called a "cloned" or "foreign" gene or sequence, may include
regulatory or control sequences, such as start, stop, promoter,
signal, secretion, or other sequences used by a cellular molecular
machinery. A host cell that receives and expresses introduced DNA
or RNA has been "transfected" and is a "transfectant" or a
"recombinant cell". According to the present invention, if a
transfection of HCV-derived nucleic acid results in its subgenomic
replication and HCV-derived protein expression, the transfection is
termed "productive".
[0083] The term "antibody", as used herein, includes both
monoclonal and polyclonal antibodies. Additionally, single
polypeptide chain antigen-binding proteins, see U.S. Pat. No.
4,946,778, are included within the term "antibody".
[0084] As used herein, "epitope" refers to an antigenic determinant
of a polypeptide; an epitope can comprise 3 or more amino acids in
a spatial conformation unique to the epitope. Generally an epitope
consists of at least 5 such amino acids and, more usually, consists
of at least 8-10 such amino acids. Methods of determining the
spatial conformation of amino acids are known in the art, and
include, for example, x-ray crystallography and nuclear magnetic
resonance (NMR).
[0085] "Immunologically identifiable with/as" refers to the
presence of epitope(s) and polypeptides(s) that are also present in
the designated polypeptide(s), herein usually HCV proteins.
Immunological identity may be determined by antibody binding and/or
competition in binding; these techniques are known to those of
average skill in the art.
[0086] A polypeptide is "immunologically reactive" with an antibody
when it binds to an antibody due to antibody recognition of a
specific epitope contained within the polypeptide. Immunological
reactivity may be determined by antibody binding, more particularly
by the kinetics of antibody binding, and/or by competition in
binding using as competitor(s) a known polypeptide(s) containing an
epitope against which the antibody is directed. The techniques for
determining whether a polypeptide is immunologically reactive with
an antibody are known in the art.
[0087] As used herein, the term "immunogenic polypeptide" refers to
a polypeptide that elicits a cellular and or humoral immune
response, whether alone or when linked to a carrier, in the
presence or absence of an adjuvant.
[0088] In a specific embodiment, the term "about" or
"approximately" means within a statistically meaningful range of a
value. Such a range can be within an order of magnitude, preferably
within 50%, more preferably within 20%, more preferably still
within 10%, and even more preferably within 5% of a given value or
range. The allowable variation encompassed by the term "about" or
"approximately" depends on the particular system under study, and
can be readily appreciated by one of ordinary skill in the art.
General Techniques
[0089] In accordance with the present invention there may be
employed conventional molecular biology, microbiology,
biochemistry, genetics and immunology techniques within the skill
of the art for the production of recombinant HCV nucleic acids,
HCV-replicating cell cultures, infectious viral particles, viral
and recombinant proteins, antibodies, etc. Such techniques are
explained fully in the literature. See, e.g., Sambrook, Fritsch and
Maniatis, Molecular Cloning. A Laboratory Manual, Second Edition,
1989, Cold Spring Harbor Laboratory Press (herein "Sambrook et al.,
1989"); DNA Cloning: A Practical Approach, Glover ed., Volumes I
and II, 1985; Oligonucleotide Synthesis, Gait ed., 1984; Nucleic
Acid Hybridization, Hames and Higgins eds., 1985; Transcription And
Translation, Hames and Higgins eds., 1984; Animal Cell Culture,
Freshney ed., 1986; Immobilized Cells And Enzymes, IRL Press, 1986;
Perbal, A Practical Guide To Molecular Cloning, 1984; Current
Protocols in Molecular Biology, Ausubel et al., eds., 1994, John
Wiley & Sons.
Construction of Recombinant HCV Replicons
[0090] In a broad aspect, the present invention is directed to
genetically engineered HCV nucleic acid clones which comprise from
5' to 3' on the positive-sense nucleic acid (1) a functional 5'
non-translated region (NTR) comprising an extreme 5'-terminal
conserved sequence, (2) at least one open reading frame (ORF)
encoding a heterologous gene operatively associated with an
expression control sequence, wherein the heterologous gene and
expression control sequence are oriented on the positive-strand
nucleic acid molecule, (3) an ORF encoding at least a portion of an
HCV polyprotein whose cleavage products form functional components
of HCV virus particles and RNA replication machinery, and (4) a 3'
NTR comprising an extreme 3'-terminal conserved sequence. According
to the present invention, the heterologous gene can be a drug
resistance gene or a reporter gene. In a specific embodiment, where
the selection marker ORF is a drug resistance gene, this gene is a
neomycin resistance gene (neo) operatively associated with an
internal ribosome entry site (IRES). Alternatively, the
heterologous gene can be a therapeutic gene, or a gene encoding a
vaccine antigen, i.e., for gene therapy or gene vaccine
applications, respectively.
[0091] In a preferred embodiment, the subgenomic HCV replicons are
derived from a "parent" HCV genotype 1b-based chimeric replicon
I377/NS3-3'UTR (SEQ ID NO: 1, see also FIG. 3). Due to their
prolonged propagation under stringent selection conditions (e.g., 1
mg/ml G418, see Example 1, infra) in susceptible cell lines, the
subgenomic HCV replicons of the present invention have acquired
multiple mutations. Accordingly, also disclosed herein are
positions of at least some of the nucleotide changes identified in
these mutant HCV replicons (e.g., as shown in Table I), said
nucleotide changes being indicative of the genome regions which are
responsible for high-titer virus replication and for virus-induced
cytotoxicity.
[0092] The actual molecular biological techniques required to
generate fusion between heterologous sequences and specific
fragments of HCV genome are routine. For example, a recombinant
replicon can be constructed using PCR (see Lohmann et al., supra;
Example 1, infra).
[0093] Naturally, as noted above, the HCV nucleic acids of the
invention are selected from the group consisting of double stranded
DNA, (+) strand cDNA, or (-) strand DNA, or (+) strand RNA or (-)
strand RNA. Thus, where particular sequences of nucleic acids of
the invention are set forth, both DNA and corresponding RNA are
intended, including positive and negative strands thereof.
[0094] According to the instant invention, an HCV DNA may be
inserted in a plasmid vector for transcription of the corresponding
HCV RNA. Thus, the HCV DNA may comprise a promoter 5' of the 5'-NTR
on (+) strand DNA, whereby transcription of template DNA from the
promoter produces replication-competent RNA. The promoter can be a
member selected from the group consisting of a eukaryotic promoter,
yeast promoter, plant promoter, bacterial promoter, and viral
promoter. The preferred promoter is phage T7 promoter (see Example
1, infra).
[0095] In a specific embodiment, the present invention is directed
to a plasmid clone, pAn/HCVR1, which can be transcribed to produce
self-replicating recombinant "parental" HCV RNA transcript
I377/NS3-3'UTR (see FIG. 3).
[0096] Also disclosed herein are cRNA molecules transcribed from
the recombinant HCV-derived DNA plasmid clones set forth above.
These cRNA molecules are used for transfection into the cell lines
of the present invention.
[0097] The present invention further advantageously provides DNA
plasmid vectors containing inserts derived from the mutant RNA
replicons disclosed herein using reverse transcription followed by
PCR-amplification or other molecular biology techniques well known
in the art.
[0098] Naturally, the invention also includes derivatives of all of
the disclosed nucleic acids, selected from the group consisting of
derivatives produced by substitution of homologous regions from
other HCV isolates or genotypes; derivatives produced by
mutagenesis; derivatives selected from the group consisting of
infectious, adapted, live-attenuated, replication competent
non-infectious, and defective variants; derivatives comprising
additional heterologous gene(s) operatively associated with an
expression control sequence; and derivatives consisting of a
functional fragment of any of the above-mentioned derivatives.
Alternatively, portions of the disclosed nucleic acids, such as the
5' NTRs, the polyprotein coding regions, the 3'-NTRs or more
generally any coding or non-translated region of the HCV genome,
can be substituted with a corresponding region from a different HCV
genotype to generate a new chimeric clone, or by extension, clones
of other isolates and genotypes. For example, an HCV-1a or -2a
polyprotein coding region (or consensus polyprotein coding regions)
can be substituted for the HCV-1b polyprotein coding region of the
deposited clones.
[0099] By providing the engineered HCV nucleic acids of the
invention, the present inventors have made it possible to dissect
the HCV replication machinery and protein activity. The instant
invention has also made possible the preparation of various HCV
derivatives such as attenuated, expressing heterologous gene(s),
replication-competent non-infectious, replication-defective
infection-competent, and replication-defective non-infectious. The
recombinant HCV DNA clones or RNAs of the invention can also be
used in numerous methods, or to derive authentic HCV components, as
set forth below.
Production of "Adapted" Cell Clones Supporting Efficient Subgenomic
HCV Replication
[0100] The instant invention further provides a method for
propagating the disclosed recombinant HCV-derived nucleic acids in
vitro comprising culturing a cell line transfected or infected with
an appropriate amount of HCV RNA, e.g., as produced from the
plasmid clones recited above, under conditions that permit
replication of said HCV-derived RNA.
[0101] By providing novel recombinant HCV nucleic acids, in
particular, nucleic acids containing mutations in the regions
responsible for cytotoxicity and/or replicon titer, the present
invention provides a method for generating stable cell clones
supporting efficient replication of subgenomic HCV RNAs.
[0102] Accordingly, in conjunction with the recombinant nucleic
acids disclosed herein, the present invention advantageously
provides susceptible stable cell lines which, upon transfection or
infection, can support high titer replication of the disclosed
HCV-derived nucleic acids. The susceptible cell lines of the
invention include without limitation human hepatoma cell lines
Huh-7, HepG2, and PH5CH; T. belangeri liver cell line MBTL; human
diploid fibroblast cell line VERO; secondary monkey kidney cell
line CV-1; T cell lines MT-2, HPBMa10-2, and MOLT-4, and B cell
line Daudi.
[0103] As disclosed herein, the HCV-replicating stable cell lines
of the present invention are characterized by the growth rates
which are not less than 10% of the growth rate of the corresponding
nave (non-transfected) cell lines. In a preferred embodiment, these
growth rates are not less than 25% of the growth rate of the
corresponding nave (non-transfected) cell lines, or, even more
preferably, not less than 90% of the growth rate of the
corresponding nave (non-transfected) cell lines.
[0104] In a preferred embodiment, the susceptible cell line is the
human hepatoma cell line Huh-7. As disclosed herein, the "adapted"
cell clones derived from Huh-7 cell line support efficient
replication of subgenomic HCV nucleic acids of the present
invention and are characterized by the growth properties which are
similar to or indistinguishable from the naive (i.e.,
non-transfected) Huh-7 cells (see, e.g., FIG. 5). Besides promoting
the generation of novel quasispecies of recombinant replicons
(e.g., containing mutations leading to lowered cytotoxicity and
increased replication efficiency) these "adapted" cell clones might
have acquired certain mutations in their own genomes, said
mutations distinguishing them from the parental naive cells and
leading to their improved ability to support replication of
subgenomic HCV RNAs. Some of the most efficiently propagating cell
clones of the present invention, i.e., HCVR 2, 8, 9, 22 and 24,
have been deposited with the American Type Culture Collection
(ATCC), 10801 University Boulevard, Manassas, Va. 20110-2209, USA
on Sep. 20, 2000, and assigned Accession Nos. PTA-2489, PTA-2490,
PTA-2486, PTA-2487, and PTA-2488, respectively.
[0105] The methods for detection of subgenomic HCV replicons in the
cell lines of the present invention are well known in the art and
include without limitation (i) Nothern blot or strand-specific
reverse transcriptase-polymerase chain reaction (RT-PCR) detection
of (-) strand replicative RNA intermediates; (ii) determination of
an increase of (+) strand RNA using either b-DNA assay or
quantitative RT-PCR, (iii) detection of expression of a
heterologous reporter gene encoded by a recombinant HCV replicon
(e.g., by assaying fluorescence, luminescence or enzymatic
activity) and (iv) detection of HCV-derived proteins (e.g., by
Westen blot or immuno-fluorescence).
[0106] The permissive cell lines that are identified using the
nucleic acids of the invention are very useful, inter alia, for
studying the HCV infection and propagation, isolating functional
components of HCV, and for sensitive, fast diagnostic and
therapeutic applications.
[0107] In a specific embodiment, the permissive cell line and the
"adapted" cell clones of the present invention are used to select
novel mutant recombinant HCV replicon quasispecies. By providing
HCV nucleic acids comprising a selectable marker, the present
invention provides a method for selecting novel mutated chimeric
HCV replicons characterized by low cytotoxicity, high productive
transformation efficiency, and high replicon titer attained; said
method comprising (i) transformation of a susceptible cell line
followed by (ii) prolonged culturing under stringent selection
conditions which allow only the survival of cells supporting high
titer HCV replication, and (iii) isolation of recombinant replicons
from the cell clones characterized by the best growth properties.
Methods for identification of the novel mutations contained within
these selected replicons are well known in the art and include, for
example, a sequence of steps: reverse transcription->PCR
amplification->automated sequencing->computer sequence
analysis.
Production of Recombinant Virions
[0108] The invention further provides a method for producing
recombinant HCV virus-like particles, comprising isolating HCV
virus-like particles from the cell lines of the invention (or their
culture medium) under conditions that permit subgenomic HCV
replication and virus particle formation. The present invention
extends to a recombinant HCV-derived virus particle comprising a
replication-competent subgenomic HCV RNA, or a
replication-defective HCV-derived RNA; said recombinant HCV virus
particle being either infection-competent or infection-defective.
In a specific embodiment the recombinant viral particles produced
in the cell lines of the present invention provide an attenuated
recombinant vaccine to be administered to an individual to produce
an anti-viral immune response. Alternatively, isolated HCV-derived
proteins expressed in the cell lines of the present invention can
represent starting materials for an HCV vaccine. Preferably, a
vaccine of the invention includes a pharmaceutically acceptable
adjuvant. Representative but not limiting examples of adjuvants
include Complete and Incomplete Freund's Adjuvant, detoxified
endotoxins, mineral oils, surface active substances such as
lipolecithin, pluronic polyols, polyanions, peptides, oil or
hydrocarbon emulsions, immunostimulatory compounds, Bacille
Calmette-Guerin (BCG), and the synthetic adjuvant QS-21 (McCune et
al., Cancer, 1979; 43:1619).
Diagnostic and Therapeutic Applications
[0109] By providing for insertion of heterologous genes in the
recombinant HCV nucleic acids, the present invention provides a
method for transducing an animal susceptible to HCV infection with
said heterologous genes by administering an amount of the HCV RNA
to the animal either directly or in the form of infectious
recombinant viral particles produced in the cell lines disclosed
herein. HCV-mediated introduction of heterologous genes in
susceptible animals can be useful, for example, for gene therapy or
gene vaccination which is targeted to hepatic tissues.
[0110] Also provided is an in vitro cell-free assay system for HCV
replication comprising HCV-derived template cRNA of the invention,
e.g., as transcribed from a plasmid of the invention as set forth
above, functional HCV replicase components, and an isotonic
buffered medium comprising ribonucleotide triphosphate bases. These
elements provide the replication machinery and raw materials
(NTPs).
[0111] In a further embodiment, the invention provides a method for
producing novel polyclonal antibodies to HCV-derived proteins
and/or recombinant viral particles comprising administering an
immunogenic amount of HCV-derived proteins isolated from the cell
cultures or the in vitro cell-free system described above to an
animal, and isolating generated anti-HCV antibodies. A further
method for producing antibodies to HCV comprises screening a human
antibody library for reactivity with HCV-derived proteins of the
invention and selecting a clone from the library that expresses a
reactive antibody. Alternatively, novel monoclonal anti-HCV
antibodies can be produced in hybridoma cell lines using techniques
well known in the art.
[0112] According to the present invention, the usefulness of newly
generated antibodies can be assayed by measuring their affinity and
specificity (e.g., upon their application to isolated HCV-derived
antigens and/or HCV replicating cell lines of the invention and/or
liver tissue sections from chronically infected animals).
[0113] The novel anti-HCV antibodies disclosed herein may be used
diagnostically, e.g., to detect the presence and/or propagation of
HCV in a cell culture or in an animal. Alternatively, these
antibodies may be used therapeutically, e.g., in passive
immunotherapy.
[0114] The present invention further advantageously provides
methods for screening (both in vitro and in vivo) for agents
capable of modulating HCV infection and/or replication and/or
virion assembly. Such methods include administering a candidate
agent to HCV infected or transfected cell line(s) of the invention,
and testing for an increase or decrease in a level of subgenomic
HCV replication or HCV-associated protein expression compared to a
level of HCV replication or HCV-associated protein expression in a
control cell line transfected with replication-defective construct
or in the same cell line prior to administration of the candidate
agent, wherein a decrease in the level of HCV replication (i.e.,
decrease in intra- or extracellular levels of recombinant HCV (+)
and/or (-) RNA) or HCV-associated protein expression (e.g.,
decrease in intra- or extracellular levels of a reporter protein)
is indicative of the inhibitory activity of the agent.
Agent-mediated inhibition of virion formation can be detected
microscopically (performed directly or after immunostaining); and
changes in infectivity of generated HCV virus particles can be
assayed by isolating them from the cell culture medium and applying
to naive cells or a susceptible animal model.
[0115] In a specific embodiment, HCV-replicating cell lines of the
present invention provide a convenient system for high-throughput
initial screening of potential anti-HCV therapeutics. Such
high-throughput screening system involves applying test compounds
to the microcultures of cell clones supporting subgenomic HCV
replication (growing, e.g., in 96- or 324-well microtiter plates)
followed by measuring changes (e.g., using multi-plate readers or
scanners) in HCV replication and/or HCV-associated protein
expression and/or HCV infectivity. According to the instant
invention, candidate therapeutic compounds include without
limitation small molecule enzyme inhibitors (e.g., helating
agents), inhibitory peptides, inhibitory (e.g.,
transdominant-negative) proteins, antibodies, ribozymes, and
antisense nucleic acids.
[0116] A further method for screening for agents capable of
modulating HCV propagation involves a cell-free system described
above. This method (which can be also performed in a
high-throughput format) comprises contacting the in vitro cell-free
system of the invention with a candidate agent and testing for an
increase or decrease in a level of HCV replication or
HCV-associated protein expression compared to a level of HCV
replication or HCV-associated protein expression in a control
cell-based system or a control cell-free system prior to
administration of the candidate agent; wherein a decrease in the
level of HCV replication or HCV-associated protein expression
compared to the control level is indicative of the ability of the
agent to inhibit HCV propagation.
[0117] As disclosed herein, the anti-HCV therapeutic compounds
identified using the initial in vitro screening methods of the
present invention can be further characterized for their ability to
affect subgenomic HCV propagation using secondary screens in cell
cultures and/or susceptible animal models. Based on the tropism of
the HCV, a preferred small animal model of the present invention is
a tree shrew Tupaia belangeri chinensis. A preferred large animal
model is a chimpanzee. Test animals will be treated with the
candidate compounds that produced the strongest inhibitory effects
in cell culture-based assays (control animals would not be treated,
and, if available, a positive control could also be employed). A
compound that protects animals from infection by the chimeric virus
and/or inhibits viral propagation leading to pathogenicity, would
be an attractive candidate for development of an agent for
treatment/prevention of HCV infection. In addition, the animal
models provide a platform for pharmacokinetic and toxicology
studies.
[0118] The present invention also has significant diagnostic
implications. For example, HCV-specific antibodies prepared
according to the invention can be used to detect HCV presence
and/or propagation in various biological samples. On the other
hand, the invention provides an in vitro method for detecting
antibodies to HCV in a biological sample from a subject comprising
contacting said sample with HCV-replicating cells, cellular
fractions, isolated HCV-derived proteins, or HCV-derived viral
particles prepared as described above, under conditions that permit
interaction of HCV-specific antibodies in the sample with the HCV
protein(s), followed by detecting binding of the antibodies in the
sample to the HCV-derived protein(s), wherein said binding is
indicative of the presence of HCV infection in the subject from
which the sample was derived. In the foregoing methods, the
biological sample can be derived without limitation from blood,
serum, plasma, blood cells, lymphocytes, or liver tissue biopsy.
Techniques for isolating proteins and cellular fractions useful in
the foregoing diagnostic methods are also well known in the
art.
[0119] In a related aspect, the invention also provides a test kit
for HCV diagnostics comprising anti-HCV antibodies, HCV virus
components and/or cell lines permissive for HCV replication and
expressing these components.
[0120] Taken together, the primary object of the present invention
is to provide nucleic acids encoding recombinant HCV-derived
replicons, which are capable of efficient propagation in a
permissive cell culture system.
[0121] A related object of the invention is to provide susceptible
cell lines (and "adapted" rapidly growing cell clones derived from
them) which support high titer replication of recombinant
HCV-derived nucleic acids.
[0122] By providing cell clones supporting efficient subgenomic HCV
replication, the present invention provides (i) in vitro cell
culture models of HCV propagation; (ii) systems for screening
candidate anti-viral compounds and evaluating drug resistance;
(iii) methods for diagnosing HCV infection, and (iv) systems for
production of large quantities of HCV-derived components or
recombinant viral particles for antibody generation and/or vaccine
development.
EXAMPLE 1
Generation of Stable Rapidly Growing Huh-7 Hepatoma Cell Lines
Which Support Efficient Replication of Subgenomic Hepatitis C Virus
RNAs
Materials and Methods
[0123] Generation of subgenomic HCV RNAs. Parental recombinant HCV
DNA construct for expression of subgenomic HCV RNAs was produced by
Operon Technologies, Inc. (Alameda, Calif.) using the sequence
described by Lohmann et al. (Science, 1999, supra).
[0124] Bicistronic HCV-derived DNA fragment I377/NS3-3'UTR (SEQ ID
NO: 1, FIG. 3) was chemically synthesized and inserted into a
modified pUC19 vector under the control of T7 promoter to produce
expression plasmid pAn/HCVR1. Plasmid DNA was linearized with Sca I
and used for in vitro transcription reactions with Megascript T7 In
Vitro Transcription Kit (Ambion) according to manufacturer's
instructions. After in vitro transcription and DNase treatment (to
remove template DNA), RNA was extracted with acid phenol
(Kedzierski and Porter, BioTechniques, 1991, 10:210) and used for
transfections.
[0125] Cell line growth. Human hepatoma cell line Huh-7
(Nakabayashi et al., Cancer Res., 1982, 42:3858-3863) was grown in
Dulbecco's Modified Eagles Medium (DMEM), supplemented with 10%
Fetal Bovine Serum (FBS), Penicillin/Streptomycin, 2 mM glutamine,
and non-essential amino acids, in a humidified atmosphere
containing 5% CO.sub.2. Cells were passaged 1-2 times per week at a
split ratio of 1:4-1:5, using trypsin/EDTA solution (0.05%/0.02%).
All tissue culture reagents were from Gibco.
[0126] Cell transfection and selection of efficiently growing
clones supporting high titer subgenomic HCV replication. RNA (10-30
.mu.g) was electroporated into 0.8.times.10.sup.7 cells using Gene
Pulse instrument (Bio-Rad, 0,4 cm-cuvette, 450V, 960 Fa).
Transfection of a construct directing the expression of firefly
luciferase was used to optimize transfection efficiency. Following
electroporation, cells were seeded on 10-cm culture dishes in 10 ml
of growth medium. After 48 hours, G418 was added at 1 mg/ml, and
the medium was changed every second day until (after 3 weeks of
selection) resistant colonies were transferred to 96-well plates
and passaged 1-2 times a week.
[0127] The fraction of HCV-positive cells in the total population
was monitored by immunofluorescence using polyclonal antibodies
raised against non-structural HCV proteins (see below) and by
RT-PCR (see below; see also Lanford et al., Virology, 1994,
202:606; Shimizu et al., Proc. Natl. Acad. Sci. USA, 1992, 89:5477;
Mizutani et al, J. Virol., 1996, 70:7219; Ikeda et al, Virus Res.,
1998, 56:157; Fournier et al, J. Gen. Virol., 1998, 79:2376).
[0128] Stable cell clones were expanded and culture conditions were
optimized to promote rapid cell growth and HCV RNA replication.
Growth rates of the clones were monitored by sulphorhodamine B
staining for total cellular protein. The clones which (i) had the
growth properties better or indistinguishable from the naive Huh-7
cells (see, e.g., FIG. 5) and (ii) supported efficient subgenomic
HCV RNA replication (as determined by quantitative RT-PCR) were
chosen for further analysis.
[0129] RT-PCR assays. Total RNA was prepared from transfected
cells, and serial dilutions were used for RT-PCR amplification of
(i) NS5B region between nt 7435 and 7750 using primers
GCCCTAGATTGTCAGATCTACG and ATAAATCCAACTGGGACGCAGC (SEQ ID NOS: 7
and 8, respectively), (ii) NS5B region between nt 7360 and 7800
using primers CCTTGTGGGCAAGGATGATCC and GACAGGCTGTGATATATGTCTCC
(SEQ ID NOS: 9 and 10, respectively), and (iii) neo region between
nt 650 and 1110 using primers GTTCTTTTTGTCAAGACCGACC and
CCACCATGATATTCGGCAAGC (SEQ ID NOS: 11 and 12, respectively). As a
control, RT-PCR was performed without template DNA or using total
RNA isolated from naive Huh-7 cells.
[0130] Antibodies. Rabbit polyclonal antisera specific for HCV NS3
or NS5A (Lohmann et al., Science 1999, 285:110-113) were obtained
from Ralf Bartenschlager (Institute for Virology,
Johannes-Gutenberg University, Mainz, Germany). A mouse monoclonal
antibody to HCV NS4B was from Virogen, Inc. (Watertown, Mass.).
[0131] In situ detection of HCV antigens using immunofluorescence.
Monolayer cultures on glass coverslips were fixed with
methanol-acetone mixture (1:1) for 2 min, and dried for 10 min at
room temperature. Alternatively, cells were fixed directly in
6-well plates (Costar). Dried cell monolayers were blocked with 2%
bovine serum albumin (BSA) in phosphate-buffered saline (PBS) for
10 min at room temperature. Double staining of cells was achieved
by using rabbit anti-HCV primary antibody followed by the addition
of 2 mg/ml of 4',6-diamidino-2-phenylindole (DAPI, Sigma) to stain
the cellular DNA, and then secondary antibody (goat anti-rabbit IgG
polyclonal antibody conjugated with rhodamine; Sigma). All primary
and secondary antibodies were diluted 1:100 in blocking solution.
After mounting, the samples were viewed with an Olympus BX60
microscope with a .times.20 or .times.40 objective and specific
filter blocks. Images were acquired using a charge-coupled device
camera (Olympus, model FKH025144) and processed using Adobe
Photoshop and Canvas software.
[0132] Detection of HCV antigens by immunoblotting. Monolayer
cultures of cells growing on 6-well plates were lyzed and subjected
to electrophoresis in 12% or 4-20% gradient SDS-polyacrylamide gels
(Laemmli, Nature, 1970, 227:680-685). After electrotransfer of
proteins to a nitrocellulose filter, HCV antigens were detected
using rabbit anti-HCV antibodies and Enhanced Chemiluminescence
(ECL) detection kit (Amersham).
[0133] Analysis of subgenomic HCV replicons isolated from rapidly
growing Huh-7 cell clones. Total RNA was isolated from HCVR 2 (SEQ
ID NO: 2), HVCR 8 (SEQ ID NO: 3), HCVR 9 (SEQ ID NO: 4), HCVR 22
(SEQ ID NO: 5) and HCVR 24 (SEQ ID NO: 6) rapidly growing Huh-7
cell clones carrying replicating subgenomic HCV constructs. The
whole replicon RNA was reverse-transcribed using oligonucleotide
primers CTCGTATGTTGTGTGGAA and GTCGCTCTCGAGGCACATA (SEQ ID NOS: 13
and 14, respectively) designed and synthesized by Operon
Technologies (Alameda, Calif.) and PCR-amplified in overlapping
0.7-1.2 kb-fragments. Total PCR products were sequenced rather then
individual cDNA clones, in order to identify predominant mutations.
Typically, every region was sequenced in both directions, using at
least two PCR products and several primers for each direction.
Sequencing was performed on a contract basis at the Children's
Hospital of Philadelphia (Philadelphia, Pa.). The resulting
sequences were analyzed using Sequencher.TM. 3.1 sequence alignment
software.
Results and Discussion
[0134] Despite the availability of cloned infectious genomes,
molecular studies of HCV replication and the development of
antiviral drugs have been hampered by the low efficiencies of
currently available cell culture systems (see overview in the
Background Section).
[0135] To overcome these limitations, an efficient cell culture
system was established that is based on the transfection of
recombinant HCV-derived RNAs. Using chemical DNA synthesis,
pAn/HCVR1 DNA plasmid was constructed, said plasmid encoding a
selectable bicistronic replicon (I377/NS3-3'UTR; SEQ ID NO: 1)
containing HCV 5' NTR (HCV IRES), the neomycin phosphotransferase
(neo) gene, the IRES of the encephalomyocarditis virus which
directs translation of HCV sequences from NS3 up to NS5B, and HCV
3' NTR (see Materials and Methods and FIG. 3).
[0136] A 5'-flanking T7 RNA polymerase promoter and an engineered
restriction site at the 3' end of pAn/HCVR1 allowed for in vitro
production of run-off RNA transcripts corresponding to a selectable
bicistronic replicon. These in vitro transcripts (termed "parental"
replicons) were transfected into Huh-7 human hepatoma cells.
Particular care was taken to remove template DNA, which might
otherwise integrate into transfected cells and confer G418
resistance independent of HCV replication (see Materials and
Methods). The efficiency of transfection was optimized using
luciferase mRNA.
[0137] In two independent transfection experiments, after 3 weeks
of G418 selection (at 1 mg/ml), a total of 33 drug-resistant clones
were obtained. These clones were transferred to 96-well plates and
passaged 1-2 times a week. Seven cell clones were successfully
expanded and were selected for further study.
[0138] At five weeks posttransfection clones were analyzed by
RT-PCR for the presence of HCV RNA (NS5B region was amplified, see
Materials and Methods). Clones HCVR 2, 8, 9, 22 and 24 produced PCR
fragments of the expected size (FIG. 4). These results were
confirmed by repeating RT-PCR with three other primer pairs: two
corresponding to NS5B, and one to neo gene.
[0139] Although the positive RT-PCR data and the presence of G418
resistance 5-7 weeks posttransfection are strong indications of
subgenomic HCV replication, there is still a possibility that both
of these effects are due to traces of the input replicon RNA. To
rule out this possibility, selected Huh-7 clones which produced
positive results by RT-PCR were assayed for the expression of
HCV-derived NS proteins. Thus, selected clones HCVR 2, 8, 9, 22 and
24 were analyzed by immunoflurescence microscopy using anti-NS3,
NS4, and NS5A antibodies (see Materials and Methods). All three
viral proteins were detected, in all five cell clones. Similarly to
wild-type HCV which replicates in the cytoplasm, the antigens
derived from the recombinant replicons of the present invention
also localized to the cytoplasm. NS5A protein was expressed in a
substantial fraction of cells (at least 30%) in clones HCVR 2 and
HCVR 8, but not in naive Huh-7 cells. Similar pattern was observed
for NS3, NS4 and NS5A proteins in all five selected cell
clones.
[0140] The presence of HCV replicon-derived antigens in clones HCVR
2, 8 and 9 was also analyzed by Western blotting, and both NS5A and
NS3 proteins were detected. Interestingly, when the
immunofluorescence detection of NS5A was repeated at 6, 7, 8, 9,
and 10 weeks posttransfection, it was found that the fraction of
positive cells gradually increased with time, and at 10 weeks
posttransfection over 90% of cells (in clones HCVR 8, 9, 22, 24)
became HCV-positive.
[0141] Importantly, dramatic changes in cell growth potential were
observed over time in several isolated cell clones, which were
efficiently replicating subgenomic HCV. Initially (similarly to
observations of Lohmann et al., Science, 1999, supra), all
HCV-replicating cell lines were growing much slower as compared to
the parental naive cell line, Huh-7 (i.e., growth rate of the cell
lines was not more than 1% of the growth rate of naive Huh-7
cells). At certain points in time, however, (starting 6 weeks
posttransfection) the growth of some of the clones began to
accelerate (10-fold or more), ultimately reaching the growth rates
of parental Huh-7 cells. As shown in FIG. 5, clones HCVR 9 and 24
grew at the same rate as the parental (non-transfected) Huh-7
cells. Similarly, clones HCVR 2, 8 and 22 grew only 4-fold slower
than non-transfected Huh-7 cells. This is in contrast to the growth
rates of cells initially prepared by reproducing experiments of
Lohmann et al., which had a reduction of growth rate of at least
99% as compared to the naive cell line. Such increase in growth
rates of selected clones was not previously reported and coincided
with the emergence of detectable HCV-derived antigens and HCV RNA,
suggesting that the observed changes were not associated with the
loss of HCV replication.
[0142] In the studies of recombinant HCV replicons propagating in
Huh-7 cells, Lohmann et al. did not observe any time-dependent
increase in the efficiency of productive transfection and have not
obtained host cell clones with normal growth properties. On the
basis of these studies Lohmann et al., have hypothesized that HCV
RNA replication and/or the expression of HCV NS proteins is always
disadvantageous to cells. Moreover, Lohmann at el. failed to find
any mutations in the 10 replicons that they have sequenced and
concluded that formation of an "adapted" replicon would be rare and
that the inefficiency of their system is more likely due to
particular host cell conditions or factors present in only a few
cells.
[0143] In contrast, the data reported here support a hypothesis
that at least some of the selected replicons are "attenuated",
i.e., contain mutations that are responsible for their lowered
cytotoxicity and high frequency of productive transfection. To
identify these mutations, replicon RNAs isolated from all five
selected cell clones (HCVR 2, 8, 9, 22 and 24) were amplified using
RT-PCR and sequenced. The obtained sequences (SEQ ID NOS: 2-6) were
analyzed for the presence of mutations by comparing them to the
sequence of the parental I377/NS3-3'UTR clone (SEQ ID NO: 1). As
shown in Table I, mutations are located in various parts of the
replicon genome. Further analysis of these mutations may provide
important information about the evolution of the virus and the
viral genes responsible for replication efficiency and
cytotoxicity.
1TABLE I Mutations in Huh-7 replicon clones change change Clone#
position (nt) (aa code) change aa Gene HCVR2 1234 C to A EMCV IRES
HCVR2 2527 A to G ATG to GTG M to V NS3 HCVR2 5288 G to T CGT to
CTT R to L NS5A HCVR8 2330 A to G GAA to GGA E to G NS3 HCVR8 after
AAA added NS5A 4847 insertion K HCVR8 5366 C to T GCA to GTA A to V
NS5A HCVR9 1236 EMCV IRES HCVR9 1905 A to G CAA to CAG Silent NS3
HCVR9 3797 A to G AAG to AGG K to R NS4A HCVR9 4364 T to C GTT to
GCT V to A NS4B HCVR9 4848 C to A AAC to AAA N to K NS5A HCVR22
2330 A to G GAA to GGA E to G NS3 HCVR22 3935 A to G CAA to CGA Q
to R NS4B HCVR22 5320 G to A GCC to ACC A to T NS5A HCVR24 1760 C
to T EMCV IRES HCVR24 3016 G to T GAC to TAC D to Y NS3 HCVR24 5336
G to T AGC to ATC S to I NS5A
[0144] In summary, in contrast to all previous reports, using
prolonged selection in the presence of G418, the present inventors
have generated HCV-replicating "adapted" cell clones, which grow at
the rate, which is similar to or indistinguishable from the
non-transfected parental Huh-7 cell line. These cell clones support
efficient propagation of recombinant HCV replicon mutants at least
some of which have unusually low cytotoxicity leading to high
replication titers and high cell growth rate.
[0145] Cell clones HCVR 2, 8, 9, 22 and 24, were deposited with the
American Type Culture Collection (ATCC), 10801 University
Boulevard, Manassas, Va. 20110-2209, USA on Sep. 20, 2000, and
assigned Accession Nos. as set forth below:
2 ATCC Deposits HCV cell clone Accession No. HCVR 2 PTA-2489 HCVR 8
PTA-2490 HCVR 9 PTA-2486 HCVR 22 PTA-2487 HCVR 24 PTA-2488
EXAMPLE 2
Screening Assays for Anti-HCV Therapeutics Using HCV-Replicating
Cell Clones of the Present Invention
[0146] In the identified efficiently growing "adapted" Huh-7 cell
clones containing replicating recombinant HCV genomes, conditions
are optimized for cell growth and HCV RNA replication. The timing
of exposure to test compounds is determined based on the kinetics
of HCV RNA accumulation and/or decline in the absence of the
selective agent, and the effects of various known inhibitors of RNA
synthesis. A cell-based assay for HCV genome replication is
developed based on all these data. In this assay, candidate
compounds are tested for inhibition of HCV RNA replication that is
selective with respect to inhibition of cell growth. In particular,
shifting of growth rate curves to a lower growth rate in the
presence of a test compound indicates that the compound is a
potential lead for developing an anti-HCV therapeutic.
[0147] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described
herein will become apparent to those skilled in the art from the
foregoing description and the accompanying figures. Such
modifications are intended to fall within the scope of the appended
claims.
[0148] All values given in the specification are approximate, and
are provided for illustration and not by way of limitation.
Sequence CWU 1
1
14 1 7992 DNA Artificial Sequence HCV replicon I377/NS3-3'UTR 1
gccagccccc gattgggggc gacactccac catagatcac tcccctgtga ggaactactg
60 tcttcacgca gaaagcgtct agccatggcg ttagtatgag tgtcgtgcag
cctccaggac 120 cccccctccc gggagagcca tagtggtctg cggaaccggt
gagtacaccg gaattgccag 180 gacgaccggg tcctttcttg gatcaacccg
ctcaatgcct ggagatttgg gcgtgccccc 240 gcgagactgc tagccgagta
gtgttgggtc gcgaaaggcc ttgtggtact gcctgatagg 300 gtgcttgcga
gtgccccggg aggtctcgta gaccgtgcac catgagcacg aatcctaaac 360
ctcaaagaaa aaccaaaggg cgcgccatga ttgaacaaga tggattgcac gcaggttctc
420 cggccgcttg ggtggagagg ctattcggct atgactgggc acaacagaca
atcggctgct 480 ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc
ggttcttttt gtcaagaccg 540 acctgtccgg tgccctgaat gaactgcagg
acgaggcagc gcggctatcg tggctggcca 600 cgacgggcgt tccttgcgca
gctgtgctcg acgttgtcac tgaagcggga agggactggc 660 tgctattggg
cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct cctgccgaga 720
aagtatccat catggctgat gcaatgcggc ggctgcatac gcttgatccg gctacctgcc
780 cattcgacca ccaagcgaaa catcgcatcg agcgagcacg tactcggatg
gaagccggtc 840 ttgtcgatca ggatgatctg gacgaagagc atcaggggct
cgcgccagcc gaactgttcg 900 ccaggctcaa ggcgcgcatg cccgacggcg
aggatctcgt cgtgacccat ggcgatgcct 960 gcttgccgaa tatcatggtg
gaaaatggcc gcttttctgg attcatcgac tgtggccggc 1020 tgggtgtggc
ggaccgctat caggacatag cgttggctac ccgtgatatt gctgaagagc 1080
ttggcggcga atgggctgac cgcttcctcg tgctttacgg tatcgccgct cccgattcgc
1140 agcgcatcgc cttctatcgc cttcttgacg agttcttctg agtttaaaca
gaccacaacg 1200 gtttccctct agcgggatca attccgcccc tctccctccc
ccccccctaa cgttactggc 1260 cgaagccgct tggaataagg ccggtgtgcg
tttgtctata tgttattttc caccatattg 1320 ccgtcttttg gcaatgtgag
ggcccggaaa cctggccctg tcttcttgac gagcattcct 1380 aggggtcttt
cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca 1440
gttcctctgg aagcttcttg aagacaaaca acgtctgtag cgaccctttg caggcagcgg
1500 aaccccccac ctggcgacag gtgcctctgc ggccaaaagc cacgtgtata
agatacacct 1560 gcaaaggcgg cacaacccca gtgccacgtt gtgagttgga
tagttgtgga aagagtcaaa 1620 tggctctcct caagcgtatt caacaagggg
ctgaaggatg cccagaaggt accccattgt 1680 atgggatctg atctggggcc
tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa 1740 aacgtctagg
ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgataatacc 1800
atggcgccta ttacggccta ctcccaacag acgcgaggcc tacttggctg catcatcact
1860 agcctcacag gccgggacag gaaccaggtc gagggggagg tccaagtggt
ctccaccgca 1920 acacaatctt tcctggcgac ctgcgtcaat ggcgtgtgtt
ggactgtcta tcatggtgcc 1980 ggctcaaaga cccttgccgg cccaaagggc
ccaatcaccc aaatgtacac caatgtggac 2040 caggacctcg tcggctggca
agcgcccccc ggggcgcgtt ccttgacacc atgcacctgc 2100 ggcagctcgg
acctttactt ggtcacgagg catgccgatg tcattccggt gcgccggcgg 2160
ggcgacagca gggggagcct actctccccc aggcccgtct cctacttgaa gggctcttcg
2220 ggcggtccac tgctctgccc ctcggggcac gctgtgggca tctttcgggc
tgccgtgtgc 2280 acccgagggg ttgcgaaggc ggtggacttt gtacccgtcg
agtctatgga aaccactatg 2340 cggtccccgg tcttcacgga caactcgtcc
cctccggccg taccgcagac attccaggtg 2400 gcccatctac acgcccctac
tggtagcggc aagagcacta aggtgccggc tgcgtatgca 2460 gcccaagggt
ataaggtgct tgtcctgaac ccgtccgtcg ccgccaccct aggtttcggg 2520
gcgtatatgt ctaaggcaca tggtatcgac cctaacatca gaaccggggt aaggaccatc
2580 accacgggtg cccccatcac gtactccacc tatggcaagt ttcttgccga
cggtggttgc 2640 tctgggggcg cctatgacat cataatatgt gatgagtgcc
actcaactga ctcgaccact 2700 atcctgggca tcggcacagt cctggaccaa
gcggagacgg ctggagcgcg actcgtcgtg 2760 ctcgccaccg ctacgcctcc
gggatcggtc accgtgccac atccaaacat cgaggaggtg 2820 gctctgtcca
gcactggaga aatccccttt tatggcaaag ccatccccat cgagaccatc 2880
aaggggggga ggcacctcat tttctgccat tccaagaaga aatgtgatga gctcgccgcg
2940 aagctgtccg gcctcggact caatgctgta gcatattacc ggggccttga
tgtatccgtc 3000 ataccaacta gcggagacgt cattgtcgta gcaacggacg
ctctaatgac gggctttacc 3060 ggcgatttcg actcagtgat cgactgcaat
acatgtgtca cccagacagt cgacttcagc 3120 ctggacccga ccttcaccat
tgagacgacg accgtgccac aagacgcggt gtcacgctcg 3180 cagcggcgag
gcaggactgg taggggcagg atgggcattt acaggtttgt gactccagga 3240
gaacggccct cgggcatgtt cgattcctcg gttctgtgcg agtgctatga cgcgggctgt
3300 gcttggtacg agctcacgcc cgccgagacc tcagttaggt tgcgggctta
cctaaacaca 3360 ccagggttgc ccgtctgcca ggaccatctg gagttctggg
agagcgtctt tacaggcctc 3420 acccacatag acgcccattt cttgtcccag
actaagcagg caggagacaa cttcccctac 3480 ctggtagcat accaggctac
ggtgtgcgcc agggctcagg ctccacctcc atcgtgggac 3540 caaatgtgga
agtgtctcat acggctaaag cctacgctgc acgggccaac gcccctgctg 3600
tataggctgg gagccgttca aaacgaggtt actaccacac accccataac caaatacatc
3660 atggcatgca tgtcggctga cctggaggtc gtcacgagca cctgggtgct
ggtaggcgga 3720 gtcctagcag ctctggccgc gtattgcctg acaacaggca
gcgtggtcat tgtgggcagg 3780 atcatcttgt ccggaaagcc ggccatcatt
cccgacaggg aagtccttta ccgggagttc 3840 gatgagatgg aagagtgcgc
ctcacacctc ccttacatcg aacagggaat gcagctcgcc 3900 gaacaattca
aacagaaggc aatcgggttg ctgcaaacag ccaccaagca agcggaggct 3960
gctgctcccg tggtggaatc caagtggcgg accctcgaag ccttctgggc gaagcatatg
4020 tggaatttca tcagcgggat acaatattta gcaggcttgt ccactctgcc
tggcaacccc 4080 gcgatagcat cactgatggc attcacagcc tctatcacca
gcccgctcac cacccaacat 4140 accctcctgt ttaacatcct ggggggatgg
gtggccgccc aacttgctcc tcccagcgct 4200 gcttctgctt tcgtaggcgc
cggcatcgct ggagcggctg ttggcagcat aggccttggg 4260 aaggtgcttg
tggatatttt ggcaggttat ggagcagggg tggcaggcgc gctcgtggcc 4320
tttaaggtca tgagcggcga gatgccctcc accgaggacc tggttaacct actccctgct
4380 atcctctccc ctggcgccct agtcgtcggg gtcgtgtgcg cagcgatact
gcgtcggcac 4440 gtgggcccag gggagggggc tgtgcagtgg atgaaccggc
tgatagcgtt cgcttcgcgg 4500 ggtaaccacg tctcccccac gcactatgtg
cctgagagcg acgctgcagc acgtgtcact 4560 cagatcctct ctagtcttac
catcactcag ctgctgaaga ggcttcacca gtggatcaac 4620 gaggactgct
ccacgccatg ctccggctcg tggctaagag atgtttggga ttggatatgc 4680
acggtgttga ctgatttcaa gacctggctc cagtccaagc tcctgccgcg attgccggga
4740 gtccccttct tctcatgtca acgtgggtac aagggagtct ggcggggcga
cggcatcatg 4800 caaaccacct gcccatgtgg agcacagatc accggacatg
tgaaaaacgg ttccatgagg 4860 atcgtggggc ctaggacctg tagtaacacg
tggcatggaa cattccccat taacgcgtac 4920 accacgggcc cctgcacgcc
ctccccggcg ccaaattatt ctagggcgct gtggcgggtg 4980 gctgctgagg
agtacgtgga ggttacgcgg gtgggggatt tccactacgt gacgggcatg 5040
accactgaca acgtaaagtg cccgtgtcag gttccggccc ccgaattctt cacagaagtg
5100 gatggggtgc ggttgcacag gtacgctcca gcgtgcaaac ccctcctacg
ggaggaggtc 5160 acattcctgg tcgggctcaa tcaatacctg gttgggtcac
agctcccatg cgagcccgaa 5220 ccggacgtag cagtgctcac ttccatgctc
accgacccct cccacattac ggcggagacg 5280 gctaagcgta ggctggccag
gggatctccc ccctccttgg ccagctcatc agctagccag 5340 ctgtctgcgc
cttccttgaa ggcaacatgc actacccgtc atgactcccc ggacgctgac 5400
ctcatcgagg ccaacctcct gtggcggcag gagatgggcg ggaacatcac ccgcgtggag
5460 tcagaaaata aggtagtaat tttggactct ttcgagccgc tccaagcgga
ggaggatgag 5520 agggaagtat ccgttccggc ggagatcctg cggaggtcca
ggaaattccc tcgagcgatg 5580 cccatatggg cacgcccgga ttacaaccct
ccactgttag agtcctggaa ggacccggac 5640 tacgtccctc cagtggtaca
cgggtgtcca ttgccgcctg ccaaggcccc tccgatacca 5700 cctccacgga
ggaagaggac ggttgtcctg tcagaatcta ccgtgtcttc tgccttggcg 5760
gagctcgcca caaagacctt cggcagctcc gaatcgtcgg ccgtcgacag cggcacggca
5820 acggcctctc ctgaccagcc ctccgacgac ggcgacgcgg gatccgacgt
tgagtcgtac 5880 tcctccatgc ccccccttga gggggagccg ggggatcccg
atctcagcga cgggtcttgg 5940 tctaccgtaa gcgaggaggc tagtgaggac
gtcgtctgct gctcgatgtc ctacacatgg 6000 acaggcgccc tgatcacgcc
atgcgctgcg gaggaaacca agctgcccat caatgcactg 6060 agcaactctt
tgctccgtca ccacaacttg gtctatgcta caacatctcg cagcgcaagc 6120
ctgcggcaga agaaggtcac ctttgacaga ctgcaggtcc tggacgacca ctaccgggac
6180 gtgctcaagg agatgaaggc gaaggcgtcc acagttaagg ctaaacttct
atccgtggag 6240 gaagcctgta agctgacgcc cccacattcg gccagatcta
aatttggcta tggggcaaag 6300 gacgtccgga acctatccag caaggccgtt
aaccacatcc gctccgtgtg gaaggacttg 6360 ctggaagaca ctgagacacc
aattgacacc accatcatgg caaaaaatga ggttttctgc 6420 gtccaaccag
agaagggggg ccgcaagcca gctcgcctta tcgtattccc agatttgggg 6480
gttcgtgtgt gcgagaaaat ggccctttac gatgtggtct ccaccctccc tcaggccgtg
6540 atgggctctt catacggatt ccaatactct cctggacagc gggtcgagtt
cctggtgaat 6600 gcctggaaag cgaagaaatg ccctatgggc ttcgcatatg
acacccgctg ttttgactca 6660 acggtcactg agaatgacat ccgtgttgag
gagtcaatct accaatgttg tgacttggcc 6720 cccgaagcca gacaggccat
aaggtcgctc acagagcggc tttacatcgg gggccccctg 6780 actaattcta
aagggcagaa ctgcggctat cgccggtgcc gcgcgagcgg tgtactgacg 6840
accagctgcg gtaataccct cacatgttac ttgaaggccg ctgcggcctg tcgagctgcg
6900 aagctccagg actgcacgat gctcgtatgc ggagacgacc ttgtcgttat
ctgtgaaagc 6960 gcggggaccc aagaggacga ggcgagccta cgggccttca
cggaggctat gactagatac 7020 tctgcccccc ctggggaccc gcccaaacca
gaatacgact tggagttgat aacatcatgc 7080 tcctccaatg tgtcagtcgc
gcacgatgca tctggcaaaa gggtgtacta tctcacccgt 7140 gaccccacca
ccccccttgc gcgggctgcg tgggagacag ctagacacac tccagtcaat 7200
tcctggctag gcaacatcat catgtatgcg cccaccttgt gggcaaggat gatcctgatg
7260 actcatttct tctccatcct tctagctcag gaacaacttg aaaaagccct
agattgtcag 7320 atctacgggg cctgttactc cattgagcca cttgacctac
ctcagatcat tcaacgactc 7380 catggcctta gcgcattttc actccatagt
tactctccag gtgagatcaa tagggtggct 7440 tcatgcctca ggaaacttgg
ggtaccgccc ttgcgagtct ggagacatcg ggccagaagt 7500 gtccgcgcta
ggctactgtc ccaggggggg agggctgcca cttgtggcaa gtacctcttc 7560
aactgggcag taaggaccaa gctcaaactc actccaatcc cggctgcgtc ccagttggat
7620 ttatccagct ggttcgttgc tggttacagc gggggagaca tatatcacag
cctgtctcgt 7680 gcccgacccc gctggttcat gtggtgccta ctcctacttt
ctgtaggggt aggcatctat 7740 ctactcccca accgatgaac ggggagctaa
acactccagg ccaataggcc atcctgtttt 7800 tttccctttt tttttttctt
tttttttttt tttttttttt tttttttttt ttctcctttt 7860 tttttcctct
ttttttcctt ttctttcctt tggtggctcc atcttagccc tagtcacggc 7920
tagctgtgaa aggtccgtga gccgcttgac tgcagagagt gctgatactg gcctctctgc
7980 agatcaagta ct 7992 2 7992 DNA Artificial Sequence HCV Replicon
RNA from cell line HCVR2 2 gccagccccc gattgggggc gacactccac
catagatcac tcccctgtga ggaactactg 60 tcttcacgca gaaagcgtct
agccatggcg ttagtatgag tgtcgtgcag cctccaggac 120 cccccctccc
gggagagcca tagtggtctg cggaaccggt gagtacaccg gaattgccag 180
gacgaccggg tcctttcttg gatcaacccg ctcaatgcct ggagatttgg gcgtgccccc
240 gcgagactgc tagccgagta gtgttgggtc gcgaaaggcc ttgtggtact
gcctgatagg 300 gtgcttgcga gtgccccggg aggtctcgta gaccgtgcac
catgagcacg aatcctaaac 360 ctcaaagaaa aaccaaaggg cgcgccatga
ttgaacaaga tggattgcac gcaggttctc 420 cggccgcttg ggtggagagg
ctattcggct atgactgggc acaacagaca atcggctgct 480 ctgatgccgc
cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg 540
acctgtccgg tgccctgaat gaactgcagg acgaggcagc gcggctatcg tggctggcca
600 cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac tgaagcggga
agggactggc 660 tgctattggg cgaagtgccg gggcaggatc tcctgtcatc
tcaccttgct cctgccgaga 720 aagtatccat catggctgat gcaatgcggc
ggctgcatac gcttgatccg gctacctgcc 780 cattcgacca ccaagcgaaa
catcgcatcg agcgagcacg tactcggatg gaagccggtc 840 ttgtcgatca
ggatgatctg gacgaagagc atcaggggct cgcgccagcc gaactgttcg 900
ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat ggcgatgcct
960 gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg attcatcgac
tgtggccggc 1020 tgggtgtggc ggaccgctat caggacatag cgttggctac
ccgtgatatt gctgaagagc 1080 ttggcggcga atgggctgac cgcttcctcg
tgctttacgg tatcgccgct cccgattcgc 1140 agcgcatcgc cttctatcgc
cttcttgacg agttcttctg agtttaaaca gaccacaacg 1200 gtttccctct
agcgggatca attccgcccc tctacctccc ccccccctaa cgttactggc 1260
cgaagccgct tggaataagg ccggtgtgcg tttgtctata tgttattttc caccatattg
1320 ccgtcttttg gcaatgtgag ggcccggaaa cctggccctg tcttcttgac
gagcattcct 1380 aggggtcttt cccctctcgc caaaggaatg caaggtctgt
tgaatgtcgt gaaggaagca 1440 gttcctctgg aagcttcttg aagacaaaca
acgtctgtag cgaccctttg caggcagcgg 1500 aaccccccac ctggcgacag
gtgcctctgc ggccaaaagc cacgtgtata agatacacct 1560 gcaaaggcgg
cacaacccca gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa 1620
tggctctcct caagcgtatt caacaagggg ctgaaggatg cccagaaggt accccattgt
1680 atgggatctg atctggggcc tcggtgcaca tgctttacat gtgtttagtc
gaggttaaaa 1740 aacgtctagg ccccccgaac cacggggacg tggttttcct
ttgaaaaaca cgataatacc 1800 atggcgccta ttacggccta ctcccaacag
acgcgaggcc tacttggctg catcatcact 1860 agcctcacag gccgggacag
gaaccaggtc gagggggagg tccaagtggt ctccaccgca 1920 acacaatctt
tcctggcgac ctgcgtcaat ggcgtgtgtt ggactgtcta tcatggtgcc 1980
ggctcaaaga cccttgccgg cccaaagggc ccaatcaccc aaatgtacac caatgtggac
2040 caggacctcg tcggctggca agcgcccccc ggggcgcgtt ccttgacacc
atgcacctgc 2100 ggcagctcgg acctttactt ggtcacgagg catgccgatg
tcattccggt gcgccggcgg 2160 ggcgacagca gggggagcct actctccccc
aggcccgtct cctacttgaa gggctcttcg 2220 ggcggtccac tgctctgccc
ctcggggcac gctgtgggca tctttcgggc tgccgtgtgc 2280 acccgagggg
ttgcgaaggc ggtggacttt gtacccgtcg agtctatgga aaccactatg 2340
cggtccccgg tcttcacgga caactcgtcc cctccggccg taccgcagac attccaggtg
2400 gcccatctac acgcccctac tggtagcggc aagagcacta aggtgccggc
tgcgtatgca 2460 gcccaagggt ataaggtgct tgtcctgaac ccgtccgtcg
ccgccaccct aggtttcggg 2520 gcgtatgtgt ctaaggcaca tggtatcgac
cctaacatca gaaccggggt aaggaccatc 2580 accacgggtg cccccatcac
gtactccacc tatggcaagt ttcttgccga cggtggttgc 2640 tctgggggcg
cctatgacat cataatatgt gatgagtgcc actcaactga ctcgaccact 2700
atcctgggca tcggcacagt cctggaccaa gcggagacgg ctggagcgcg actcgtcgtg
2760 ctcgccaccg ctacgcctcc gggatcggtc accgtgccac atccaaacat
cgaggaggtg 2820 gctctgtcca gcactggaga aatccccttt tatggcaaag
ccatccccat cgagaccatc 2880 aaggggggga ggcacctcat tttctgccat
tccaagaaga aatgtgatga gctcgccgcg 2940 aagctgtccg gcctcggact
caatgctgta gcatattacc ggggccttga tgtatccgtc 3000 ataccaacta
gcggagacgt cattgtcgta gcaacggacg ctctaatgac gggctttacc 3060
ggcgatttcg actcagtgat cgactgcaat acatgtgtca cccagacagt cgacttcagc
3120 ctggacccga ccttcaccat tgagacgacg accgtgccac aagacgcggt
gtcacgctcg 3180 cagcggcgag gcaggactgg taggggcagg atgggcattt
acaggtttgt gactccagga 3240 gaacggccct cgggcatgtt cgattcctcg
gttctgtgcg agtgctatga cgcgggctgt 3300 gcttggtacg agctcacgcc
cgccgagacc tcagttaggt tgcgggctta cctaaacaca 3360 ccagggttgc
ccgtctgcca ggaccatctg gagttctggg agagcgtctt tacaggcctc 3420
acccacatag acgcccattt cttgtcccag actaagcagg caggagacaa cttcccctac
3480 ctggtagcat accaggctac ggtgtgcgcc agggctcagg ctccacctcc
atcgtgggac 3540 caaatgtgga agtgtctcat acggctaaag cctacgctgc
acgggccaac gcccctgctg 3600 tataggctgg gagccgttca aaacgaggtt
actaccacac accccataac caaatacatc 3660 atggcatgca tgtcggctga
cctggaggtc gtcacgagca cctgggtgct ggtaggcgga 3720 gtcctagcag
ctctggccgc gtattgcctg acaacaggca gcgtggtcat tgtgggcagg 3780
atcatcttgt ccggaaagcc ggccatcatt cccgacaggg aagtccttta ccgggagttc
3840 gatgagatgg aagagtgcgc ctcacacctc ccttacatcg aacagggaat
gcagctcgcc 3900 gaacaattca aacagaaggc aatcgggttg ctgcaaacag
ccaccaagca agcggaggct 3960 gctgctcccg tggtggaatc caagtggcgg
accctcgaag ccttctgggc gaagcatatg 4020 tggaatttca tcagcgggat
acaatattta gcaggcttgt ccactctgcc tggcaacccc 4080 gcgatagcat
cactgatggc attcacagcc tctatcacca gcccgctcac cacccaacat 4140
accctcctgt ttaacatcct ggggggatgg gtggccgccc aacttgctcc tcccagcgct
4200 gcttctgctt tcgtaggcgc cggcatcgct ggagcggctg ttggcagcat
aggccttggg 4260 aaggtgcttg tggatatttt ggcaggttat ggagcagggg
tggcaggcgc gctcgtggcc 4320 tttaaggtca tgagcggcga gatgccctcc
accgaggacc tggttaacct actccctgct 4380 atcctctccc ctggcgccct
agtcgtcggg gtcgtgtgcg cagcgatact gcgtcggcac 4440 gtgggcccag
gggagggggc tgtgcagtgg atgaaccggc tgatagcgtt cgcttcgcgg 4500
ggtaaccacg tctcccccac gcactatgtg cctgagagcg acgctgcagc acgtgtcact
4560 cagatcctct ctagtcttac catcactcag ctgctgaaga ggcttcacca
gtggatcaac 4620 gaggactgct ccacgccatg ctccggctcg tggctaagag
atgtttggga ttggatatgc 4680 acggtgttga ctgatttcaa gacctggctc
cagtccaagc tcctgccgcg attgccggga 4740 gtccccttct tctcatgtca
acgtgggtac aagggagtct ggcggggcga cggcatcatg 4800 caaaccacct
gcccatgtgg agcacagatc accggacatg tgaaaaacgg ttccatgagg 4860
atcgtggggc ctaggacctg tagtaacacg tggcatggaa cattccccat taacgcgtac
4920 accacgggcc cctgcacgcc ctccccggcg ccaaattatt ctagggcgct
gtggcgggtg 4980 gctgctgagg agtacgtgga ggttacgcgg gtgggggatt
tccactacgt gacgggcatg 5040 accactgaca acgtaaagtg cccgtgtcag
gttccggccc ccgaattctt cacagaagtg 5100 gatggggtgc ggttgcacag
gtacgctcca gcgtgcaaac ccctcctacg ggaggaggtc 5160 acattcctgg
tcgggctcaa tcaatacctg gttgggtcac agctcccatg cgagcccgaa 5220
ccggacgtag cagtgctcac ttccatgctc accgacccct cccacattac ggcggagacg
5280 gctaagctta ggctggccag gggatctccc ccctccttgg ccagctcatc
agctagccag 5340 ctgtctgcgc cttccttgaa ggcaacatgc actacccgtc
atgactcccc ggacgctgac 5400 ctcatcgagg ccaacctcct gtggcggcag
gagatgggcg ggaacatcac ccgcgtggag 5460 tcagaaaata aggtagtaat
tttggactct ttcgagccgc tccaagcgga ggaggatgag 5520 agggaagtat
ccgttccggc ggagatcctg cggaggtcca ggaaattccc tcgagcgatg 5580
cccatatggg cacgcccgga ttacaaccct ccactgttag agtcctggaa ggacccggac
5640 tacgtccctc cagtggtaca cgggtgtcca ttgccgcctg ccaaggcccc
tccgatacca 5700 cctccacgga ggaagaggac ggttgtcctg tcagaatcta
ccgtgtcttc tgccttggcg 5760 gagctcgcca caaagacctt cggcagctcc
gaatcgtcgg ccgtcgacag cggcacggca 5820 acggcctctc ctgaccagcc
ctccgacgac ggcgacgcgg gatccgacgt tgagtcgtac 5880 tcctccatgc
ccccccttga gggggagccg ggggatcccg atctcagcga cgggtcttgg 5940
tctaccgtaa gcgaggaggc tagtgaggac gtcgtctgct gctcgatgtc ctacacatgg
6000 acaggcgccc tgatcacgcc atgcgctgcg gaggaaacca agctgcccat
caatgcactg 6060 agcaactctt tgctccgtca ccacaacttg gtctatgcta
caacatctcg cagcgcaagc 6120 ctgcggcaga agaaggtcac ctttgacaga
ctgcaggtcc tggacgacca ctaccgggac 6180 gtgctcaagg agatgaaggc
gaaggcgtcc acagttaagg ctaaacttct atccgtggag 6240 gaagcctgta
agctgacgcc cccacattcg gccagatcta aatttggcta tggggcaaag 6300
gacgtccgga acctatccag caaggccgtt aaccacatcc gctccgtgtg gaaggacttg
6360 ctggaagaca ctgagacacc aattgacacc accatcatgg caaaaaatga
ggttttctgc 6420 gtccaaccag agaagggggg ccgcaagcca gctcgcctta
tcgtattccc agatttgggg 6480 gttcgtgtgt gcgagaaaat ggccctttac
gatgtggtct ccaccctccc tcaggccgtg 6540 atgggctctt catacggatt
ccaatactct cctggacagc gggtcgagtt cctggtgaat 6600 gcctggaaag
cgaagaaatg ccctatgggc ttcgcatatg acacccgctg ttttgactca 6660
acggtcactg agaatgacat ccgtgttgag gagtcaatct accaatgttg tgacttggcc
6720 cccgaagcca gacaggccat aaggtcgctc acagagcggc tttacatcgg
gggccccctg 6780 actaattcta aagggcagaa ctgcggctat cgccggtgcc
gcgcgagcgg tgtactgacg 6840 accagctgcg gtaataccct cacatgttac
ttgaaggccg ctgcggcctg tcgagctgcg 6900
aagctccagg actgcacgat gctcgtatgc ggagacgacc ttgtcgttat ctgtgaaagc
6960 gcggggaccc aagaggacga ggcgagccta cgggccttca cggaggctat
gactagatac 7020 tctgcccccc ctggggaccc gcccaaacca gaatacgact
tggagttgat aacatcatgc 7080 tcctccaatg tgtcagtcgc gcacgatgca
tctggcaaaa gggtgtacta tctcacccgt 7140 gaccccacca ccccccttgc
gcgggctgcg tgggagacag ctagacacac tccagtcaat 7200 tcctggctag
gcaacatcat catgtatgcg cccaccttgt gggcaaggat gatcctgatg 7260
actcatttct tctccatcct tctagctcag gaacaacttg aaaaagccct agattgtcag
7320 atctacgggg cctgttactc cattgagcca cttgacctac ctcagatcat
tcaacgactc 7380 catggcctta gcgcattttc actccatagt tactctccag
gtgagatcaa tagggtggct 7440 tcatgcctca ggaaacttgg ggtaccgccc
ttgcgagtct ggagacatcg ggccagaagt 7500 gtccgcgcta ggctactgtc
ccaggggggg agggctgcca cttgtggcaa gtacctcttc 7560 aactgggcag
taaggaccaa gctcaaactc actccaatcc cggctgcgtc ccagttggat 7620
ttatccagct ggttcgttgc tggttacagc gggggagaca tatatcacag cctgtctcgt
7680 gcccgacccc gctggttcat gtggtgccta ctcctacttt ctgtaggggt
aggcatctat 7740 ctactcccca accgatgaac ggggagctaa acactccagg
ccaataggcc atcctgtttt 7800 tttccctttt tttttttctt tttttttttt
tttttttttt tttttttttt ttctcctttt 7860 tttttcctct ttttttcctt
ttctttcctt tggtggctcc atcttagccc tagtcacggc 7920 tagctgtgaa
aggtccgtga gccgcttgac tgcagagagt gctgatactg gcctctctgc 7980
agatcaagta ct 7992 3 7995 DNA Artificial Sequence HCV Replicon RNA
from cell line HCVR8 3 gccagccccc gattgggggc gacactccac catagatcac
tcccctgtga ggaactactg 60 tcttcacgca gaaagcgtct agccatggcg
ttagtatgag tgtcgtgcag cctccaggac 120 cccccctccc gggagagcca
tagtggtctg cggaaccggt gagtacaccg gaattgccag 180 gacgaccggg
tcctttcttg gatcaacccg ctcaatgcct ggagatttgg gcgtgccccc 240
gcgagactgc tagccgagta gtgttgggtc gcgaaaggcc ttgtggtact gcctgatagg
300 gtgcttgcga gtgccccggg aggtctcgta gaccgtgcac catgagcacg
aatcctaaac 360 ctcaaagaaa aaccaaaggg cgcgccatga ttgaacaaga
tggattgcac gcaggttctc 420 cggccgcttg ggtggagagg ctattcggct
atgactgggc acaacagaca atcggctgct 480 ctgatgccgc cgtgttccgg
ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg 540 acctgtccgg
tgccctgaat gaactgcagg acgaggcagc gcggctatcg tggctggcca 600
cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac tgaagcggga agggactggc
660 tgctattggg cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct
cctgccgaga 720 aagtatccat catggctgat gcaatgcggc ggctgcatac
gcttgatccg gctacctgcc 780 cattcgacca ccaagcgaaa catcgcatcg
agcgagcacg tactcggatg gaagccggtc 840 ttgtcgatca ggatgatctg
gacgaagagc atcaggggct cgcgccagcc gaactgttcg 900 ccaggctcaa
ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat ggcgatgcct 960
gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg attcatcgac tgtggccggc
1020 tgggtgtggc ggaccgctat caggacatag cgttggctac ccgtgatatt
gctgaagagc 1080 ttggcggcga atgggctgac cgcttcctcg tgctttacgg
tatcgccgct cccgattcgc 1140 agcgcatcgc cttctatcgc cttcttgacg
agttcttctg agtttaaaca gaccacaacg 1200 gtttccctct agcgggatca
attccgcccc tctccctccc ccccccctaa cgttactggc 1260 cgaagccgct
tggaataagg ccggtgtgcg tttgtctata tgttattttc caccatattg 1320
ccgtcttttg gcaatgtgag ggcccggaaa cctggccctg tcttcttgac gagcattcct
1380 aggggtcttt cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt
gaaggaagca 1440 gttcctctgg aagcttcttg aagacaaaca acgtctgtag
cgaccctttg caggcagcgg 1500 aaccccccac ctggcgacag gtgcctctgc
ggccaaaagc cacgtgtata agatacacct 1560 gcaaaggcgg cacaacccca
gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa 1620 tggctctcct
caagcgtatt caacaagggg ctgaaggatg cccagaaggt accccattgt 1680
atgggatctg atctggggcc tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa
1740 aacgtctagg ccccccgaac cacggggacg tggttttcct ttgaaaaaca
cgataatacc 1800 atggcgccta ttacggccta ctcccaacag acgcgaggcc
tacttggctg catcatcact 1860 agcctcacag gccgggacag gaaccaggtc
gagggggagg tccaagtggt ctccaccgca 1920 acacaatctt tcctggcgac
ctgcgtcaat ggcgtgtgtt ggactgtcta tcatggtgcc 1980 ggctcaaaga
cccttgccgg cccaaagggc ccaatcaccc aaatgtacac caatgtggac 2040
caggacctcg tcggctggca agcgcccccc ggggcgcgtt ccttgacacc atgcacctgc
2100 ggcagctcgg acctttactt ggtcacgagg catgccgatg tcattccggt
gcgccggcgg 2160 ggcgacagca gggggagcct actctccccc aggcccgtct
cctacttgaa gggctcttcg 2220 ggcggtccac tgctctgccc ctcggggcac
gctgtgggca tctttcgggc tgccgtgtgc 2280 acccgagggg ttgcgaaggc
ggtggacttt gtacccgtcg agtctatggg aaccactatg 2340 cggtccccgg
tcttcacgga caactcgtcc cctccggccg taccgcagac attccaggtg 2400
gcccatctac acgcccctac tggtagcggc aagagcacta aggtgccggc tgcgtatgca
2460 gcccaagggt ataaggtgct tgtcctgaac ccgtccgtcg ccgccaccct
aggtttcggg 2520 gcgtatatgt ctaaggcaca tggtatcgac cctaacatca
gaaccggggt aaggaccatc 2580 accacgggtg cccccatcac gtactccacc
tatggcaagt ttcttgccga cggtggttgc 2640 tctgggggcg cctatgacat
cataatatgt gatgagtgcc actcaactga ctcgaccact 2700 atcctgggca
tcggcacagt cctggaccaa gcggagacgg ctggagcgcg actcgtcgtg 2760
ctcgccaccg ctacgcctcc gggatcggtc accgtgccac atccaaacat cgaggaggtg
2820 gctctgtcca gcactggaga aatccccttt tatggcaaag ccatccccat
cgagaccatc 2880 aaggggggga ggcacctcat tttctgccat tccaagaaga
aatgtgatga gctcgccgcg 2940 aagctgtccg gcctcggact caatgctgta
gcatattacc ggggccttga tgtatccgtc 3000 ataccaacta gcggagacgt
cattgtcgta gcaacggacg ctctaatgac gggctttacc 3060 ggcgatttcg
actcagtgat cgactgcaat acatgtgtca cccagacagt cgacttcagc 3120
ctggacccga ccttcaccat tgagacgacg accgtgccac aagacgcggt gtcacgctcg
3180 cagcggcgag gcaggactgg taggggcagg atgggcattt acaggtttgt
gactccagga 3240 gaacggccct cgggcatgtt cgattcctcg gttctgtgcg
agtgctatga cgcgggctgt 3300 gcttggtacg agctcacgcc cgccgagacc
tcagttaggt tgcgggctta cctaaacaca 3360 ccagggttgc ccgtctgcca
ggaccatctg gagttctggg agagcgtctt tacaggcctc 3420 acccacatag
acgcccattt cttgtcccag actaagcagg caggagacaa cttcccctac 3480
ctggtagcat accaggctac ggtgtgcgcc agggctcagg ctccacctcc atcgtgggac
3540 caaatgtgga agtgtctcat acggctaaag cctacgctgc acgggccaac
gcccctgctg 3600 tataggctgg gagccgttca aaacgaggtt actaccacac
accccataac caaatacatc 3660 atggcatgca tgtcggctga cctggaggtc
gtcacgagca cctgggtgct ggtaggcgga 3720 gtcctagcag ctctggccgc
gtattgcctg acaacaggca gcgtggtcat tgtgggcagg 3780 atcatcttgt
ccggaaagcc ggccatcatt cccgacaggg aagtccttta ccgggagttc 3840
gatgagatgg aagagtgcgc ctcacacctc ccttacatcg aacagggaat gcagctcgcc
3900 gaacaattca aacagaaggc aatcgggttg ctgcaaacag ccaccaagca
agcggaggct 3960 gctgctcccg tggtggaatc caagtggcgg accctcgaag
ccttctgggc gaagcatatg 4020 tggaatttca tcagcgggat acaatattta
gcaggcttgt ccactctgcc tggcaacccc 4080 gcgatagcat cactgatggc
attcacagcc tctatcacca gcccgctcac cacccaacat 4140 accctcctgt
ttaacatcct ggggggatgg gtggccgccc aacttgctcc tcccagcgct 4200
gcttctgctt tcgtaggcgc cggcatcgct ggagcggctg ttggcagcat aggccttggg
4260 aaggtgcttg tggatatttt ggcaggttat ggagcagggg tggcaggcgc
gctcgtggcc 4320 tttaaggtca tgagcggcga gatgccctcc accgaggacc
tggttaacct actccctgct 4380 atcctctccc ctggcgccct agtcgtcggg
gtcgtgtgcg cagcgatact gcgtcggcac 4440 gtgggcccag gggagggggc
tgtgcagtgg atgaaccggc tgatagcgtt cgcttcgcgg 4500 ggtaaccacg
tctcccccac gcactatgtg cctgagagcg acgctgcagc acgtgtcact 4560
cagatcctct ctagtcttac catcactcag ctgctgaaga ggcttcacca gtggatcaac
4620 gaggactgct ccacgccatg ctccggctcg tggctaagag atgtttggga
ttggatatgc 4680 acggtgttga ctgatttcaa gacctggctc cagtccaagc
tcctgccgcg attgccggga 4740 gtccccttct tctcatgtca acgtgggtac
aagggagtct ggcggggcga cggcatcatg 4800 caaaccacct gcccatgtgg
agcacagatc accggacatg tgaaaaaaaa cggttccatg 4860 aggatcgtgg
ggcctaggac ctgtagtaac acgtggcatg gaacattccc cattaacgcg 4920
tacaccacgg gcccctgcac gccctccccg gcgccaaatt attctagggc gctgtggcgg
4980 gtggctgctg aggagtacgt ggaggttacg cgggtggggg atttccacta
cgtgacgggc 5040 atgaccactg acaacgtaaa gtgcccgtgt caggttccgg
cccccgaatt cttcacagaa 5100 gtggatgggg tgcggttgca caggtacgct
ccagcgtgca aacccctcct acgggaggag 5160 gtcacattcc tggtcgggct
caatcaatac ctggttgggt cacagctccc atgcgagccc 5220 gaaccggacg
tagcagtgct cacttccatg ctcaccgacc cctcccacat tacggcggag 5280
acggctaagc gtaggctggc caggggatct cccccctcct tggccagctc atcagctagc
5340 cagctgtctg cgccttcctt gaaggcaata tgcactaccc gtcatgactc
cccggacgct 5400 gacctcatcg aggccaacct cctgtggcgg caggagatgg
gcgggaacat cacccgcgtg 5460 gagtcagaaa ataaggtagt aattttggac
tctttcgagc cgctccaagc ggaggaggat 5520 gagagggaag tatccgttcc
ggcggagatc ctgcggaggt ccaggaaatt ccctcgagcg 5580 atgcccatat
gggcacgccc ggattacaac cctccactgt tagagtcctg gaaggacccg 5640
gactacgtcc ctccagtggt acacgggtgt ccattgccgc ctgccaaggc ccctccgata
5700 ccacctccac ggaggaagag gacggttgtc ctgtcagaat ctaccgtgtc
ttctgccttg 5760 gcggagctcg ccacaaagac cttcggcagc tccgaatcgt
cggccgtcga cagcggcacg 5820 gcaacggcct ctcctgacca gccctccgac
gacggcgacg cgggatccga cgttgagtcg 5880 tactcctcca tgccccccct
tgagggggag ccgggggatc ccgatctcag cgacgggtct 5940 tggtctaccg
taagcgagga ggctagtgag gacgtcgtct gctgctcgat gtcctacaca 6000
tggacaggcg ccctgatcac gccatgcgct gcggaggaaa ccaagctgcc catcaatgca
6060 ctgagcaact ctttgctccg tcaccacaac ttggtctatg ctacaacatc
tcgcagcgca 6120 agcctgcggc agaagaaggt cacctttgac agactgcagg
tcctggacga ccactaccgg 6180 gacgtgctca aggagatgaa ggcgaaggcg
tccacagtta aggctaaact tctatccgtg 6240 gaggaagcct gtaagctgac
gcccccacat tcggccagat ctaaatttgg ctatggggca 6300 aaggacgtcc
ggaacctatc cagcaaggcc gttaaccaca tccgctccgt gtggaaggac 6360
ttgctggaag acactgagac accaattgac accaccatca tggcaaaaaa tgaggttttc
6420 tgcgtccaac cagagaaggg gggccgcaag ccagctcgcc ttatcgtatt
cccagatttg 6480 ggggttcgtg tgtgcgagaa aatggccctt tacgatgtgg
tctccaccct ccctcaggcc 6540 gtgatgggct cttcatacgg attccaatac
tctcctggac agcgggtcga gttcctggtg 6600 aatgcctgga aagcgaagaa
atgccctatg ggcttcgcat atgacacccg ctgttttgac 6660 tcaacggtca
ctgagaatga catccgtgtt gaggagtcaa tctaccaatg ttgtgacttg 6720
gcccccgaag ccagacaggc cataaggtcg ctcacagagc ggctttacat cgggggcccc
6780 ctgactaatt ctaaagggca gaactgcggc tatcgccggt gccgcgcgag
cggtgtactg 6840 acgaccagct gcggtaatac cctcacatgt tacttgaagg
ccgctgcggc ctgtcgagct 6900 gcgaagctcc aggactgcac gatgctcgta
tgcggagacg accttgtcgt tatctgtgaa 6960 agcgcgggga cccaagagga
cgaggcgagc ctacgggcct tcacggaggc tatgactaga 7020 tactctgccc
cccctgggga cccgcccaaa ccagaatacg acttggagtt gataacatca 7080
tgctcctcca atgtgtcagt cgcgcacgat gcatctggca aaagggtgta ctatctcacc
7140 cgtgacccca ccacccccct tgcgcgggct gcgtgggaga cagctagaca
cactccagtc 7200 aattcctggc taggcaacat catcatgtat gcgcccacct
tgtgggcaag gatgatcctg 7260 atgactcatt tcttctccat ccttctagct
caggaacaac ttgaaaaagc cctagattgt 7320 cagatctacg gggcctgtta
ctccattgag ccacttgacc tacctcagat cattcaacga 7380 ctccatggcc
ttagcgcatt ttcactccat agttactctc caggtgagat caatagggtg 7440
gcttcatgcc tcaggaaact tggggtaccg cccttgcgag tctggagaca tcgggccaga
7500 agtgtccgcg ctaggctact gtcccagggg gggagggctg ccacttgtgg
caagtacctc 7560 ttcaactggg cagtaaggac caagctcaaa ctcactccaa
tcccggctgc gtcccagttg 7620 gatttatcca gctggttcgt tgctggttac
agcgggggag acatatatca cagcctgtct 7680 cgtgcccgac cccgctggtt
catgtggtgc ctactcctac tttctgtagg ggtaggcatc 7740 tatctactcc
ccaaccgatg aacggggagc taaacactcc aggccaatag gccatcctgt 7800
ttttttccct tttttttttt cttttttttt tttttttttt tttttttttt tttttctcct
7860 ttttttttcc tctttttttc cttttctttc ctttggtggc tccatcttag
ccctagtcac 7920 ggctagctgt gaaaggtccg tgagccgctt gactgcagag
agtgctgata ctggcctctc 7980 tgcagatcaa gtact 7995 4 7992 DNA
Artificial Sequence HCV Replicon RNA from cell line HCVR9 4
gccagccccc gattgggggc gacactccac catagatcac tcccctgtga ggaactactg
60 tcttcacgca gaaagcgtct agccatggcg ttagtatgag tgtcgtgcag
cctccaggac 120 cccccctccc gggagagcca tagtggtctg cggaaccggt
gagtacaccg gaattgccag 180 gacgaccggg tcctttcttg gatcaacccg
ctcaatgcct ggagatttgg gcgtgccccc 240 gcgagactgc tagccgagta
gtgttgggtc gcgaaaggcc ttgtggtact gcctgatagg 300 gtgcttgcga
gtgccccggg aggtctcgta gaccgtgcac catgagcacg aatcctaaac 360
ctcaaagaaa aaccaaaggg cgcgccatga ttgaacaaga tggattgcac gcaggttctc
420 cggccgcttg ggtggagagg ctattcggct atgactgggc acaacagaca
atcggctgct 480 ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc
ggttcttttt gtcaagaccg 540 acctgtccgg tgccctgaat gaactgcagg
acgaggcagc gcggctatcg tggctggcca 600 cgacgggcgt tccttgcgca
gctgtgctcg acgttgtcac tgaagcggga agggactggc 660 tgctattggg
cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct cctgccgaga 720
aagtatccat catggctgat gcaatgcggc ggctgcatac gcttgatccg gctacctgcc
780 cattcgacca ccaagcgaaa catcgcatcg agcgagcacg tactcggatg
gaagccggtc 840 ttgtcgatca ggatgatctg gacgaagagc atcaggggct
cgcgccagcc gaactgttcg 900 ccaggctcaa ggcgcgcatg cccgacggcg
aggatctcgt cgtgacccat ggcgatgcct 960 gcttgccgaa tatcatggtg
gaaaatggcc gcttttctgg attcatcgac tgtggccggc 1020 tgggtgtggc
ggaccgctat caggacatag cgttggctac ccgtgatatt gctgaagagc 1080
ttggcggcga atgggctgac cgcttcctcg tgctttacgg tatcgccgct cccgattcgc
1140 agcgcatcgc cttctatcgc cttcttgacg agttcttctg agtttaaaca
gaccacaacg 1200 gtttccctct agcgggatca attccgcccc tctccctccc
ccccccctaa cgttactggc 1260 cgaagccgct tggaataagg ccggtgtgcg
tttgtctata tgttattttc caccatattg 1320 ccgtcttttg gcaatgtgag
ggcccggaaa cctggccctg tcttcttgac gagcattcct 1380 aggggtcttt
cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca 1440
gttcctctgg aagcttcttg aagacaaaca acgtctgtag cgaccctttg caggcagcgg
1500 aaccccccac ctggcgacag gtgcctctgc ggccaaaagc cacgtgtata
agatacacct 1560 gcaaaggcgg cacaacccca gtgccacgtt gtgagttgga
tagttgtgga aagagtcaaa 1620 tggctctcct caagcgtatt caacaagggg
ctgaaggatg cccagaaggt accccattgt 1680 atgggatctg atctggggcc
tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa 1740 aacgtctagg
ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgataatacc 1800
atggcgccta ttacggccta ctcccaacag acgcgaggcc tacttggctg catcatcact
1860 agcctcacag gccgggacag gaaccaggtc gagggggagg tccaggtggt
ctccaccgca 1920 acacaatctt tcctggcgac ctgcgtcaat ggcgtgtgtt
ggactgtcta tcatggtgcc 1980 ggctcaaaga cccttgccgg cccaaagggc
ccaatcaccc aaatgtacac caatgtggac 2040 caggacctcg tcggctggca
agcgcccccc ggggcgcgtt ccttgacacc atgcacctgc 2100 ggcagctcgg
acctttactt ggtcacgagg catgccgatg tcattccggt gcgccggcgg 2160
ggcgacagca gggggagcct actctccccc aggcccgtct cctacttgaa gggctcttcg
2220 ggcggtccac tgctctgccc ctcggggcac gctgtgggca tctttcgggc
tgccgtgtgc 2280 acccgagggg ttgcgaaggc ggtggacttt gtacccgtcg
agtctatgga aaccactatg 2340 cggtccccgg tcttcacgga caactcgtcc
cctccggccg taccgcagac attccaggtg 2400 gcccatctac acgcccctac
tggtagcggc aagagcacta aggtgccggc tgcgtatgca 2460 gcccaagggt
ataaggtgct tgtcctgaac ccgtccgtcg ccgccaccct aggtttcggg 2520
gcgtatatgt ctaaggcaca tggtatcgac cctaacatca gaaccggggt aaggaccatc
2580 accacgggtg cccccatcac gtactccacc tatggcaagt ttcttgccga
cggtggttgc 2640 tctgggggcg cctatgacat cataatatgt gatgagtgcc
actcaactga ctcgaccact 2700 atcctgggca tcggcacagt cctggaccaa
gcggagacgg ctggagcgcg actcgtcgtg 2760 ctcgccaccg ctacgcctcc
gggatcggtc accgtgccac atccaaacat cgaggaggtg 2820 gctctgtcca
gcactggaga aatccccttt tatggcaaag ccatccccat cgagaccatc 2880
aaggggggga ggcacctcat tttctgccat tccaagaaga aatgtgatga gctcgccgcg
2940 aagctgtccg gcctcggact caatgctgta gcatattacc ggggccttga
tgtatccgtc 3000 ataccaacta gcggagacgt cattgtcgta gcaacggacg
ctctaatgac gggctttacc 3060 ggcgatttcg actcagtgat cgactgcaat
acatgtgtca cccagacagt cgacttcagc 3120 ctggacccga ccttcaccat
tgagacgacg accgtgccac aagacgcggt gtcacgctcg 3180 cagcggcgag
gcaggactgg taggggcagg atgggcattt acaggtttgt gactccagga 3240
gaacggccct cgggcatgtt cgattcctcg gttctgtgcg agtgctatga cgcgggctgt
3300 gcttggtacg agctcacgcc cgccgagacc tcagttaggt tgcgggctta
cctaaacaca 3360 ccagggttgc ccgtctgcca ggaccatctg gagttctggg
agagcgtctt tacaggcctc 3420 acccacatag acgcccattt cttgtcccag
actaagcagg caggagacaa cttcccctac 3480 ctggtagcat accaggctac
ggtgtgcgcc agggctcagg ctccacctcc atcgtgggac 3540 caaatgtgga
agtgtctcat acggctaaag cctacgctgc acgggccaac gcccctgctg 3600
tataggctgg gagccgttca aaacgaggtt actaccacac accccataac caaatacatc
3660 atggcatgca tgtcggctga cctggaggtc gtcacgagca cctgggtgct
ggtaggcgga 3720 gtcctagcag ctctggccgc gtattgcctg acaacaggca
gcgtggtcat tgtgggcagg 3780 atcatcttgt ccggaaggcc ggccatcatt
cccgacaggg aagtccttta ccgggagttc 3840 gatgagatgg aagagtgcgc
ctcacacctc ccttacatcg aacagggaat gcagctcgcc 3900 gaacaattca
aacagaaggc aatcgggttg ctgcaaacag ccaccaagca agcggaggct 3960
gctgctcccg tggtggaatc caagtggcgg accctcgaag ccttctgggc gaagcatatg
4020 tggaatttca tcagcgggat acaatattta gcaggcttgt ccactctgcc
tggcaacccc 4080 gcgatagcat cactgatggc attcacagcc tctatcacca
gcccgctcac cacccaacat 4140 accctcctgt ttaacatcct ggggggatgg
gtggccgccc aacttgctcc tcccagcgct 4200 gcttctgctt tcgtaggcgc
cggcatcgct ggagcggctg ttggcagcat aggccttggg 4260 aaggtgcttg
tggatatttt ggcaggttat ggagcagggg tggcaggcgc gctcgtggcc 4320
tttaaggtca tgagcggcga gatgccctcc accgaggacc tggctaacct actccctgct
4380 atcctctccc ctggcgccct agtcgtcggg gtcgtgtgcg cagcgatact
gcgtcggcac 4440 gtgggcccag gggagggggc tgtgcagtgg atgaaccggc
tgatagcgtt cgcttcgcgg 4500 ggtaaccacg tctcccccac gcactatgtg
cctgagagcg acgctgcagc acgtgtcact 4560 cagatcctct ctagtcttac
catcactcag ctgctgaaga ggcttcacca gtggatcaac 4620 gaggactgct
ccacgccatg ctccggctcg tggctaagag atgtttggga ttggatatgc 4680
acggtgttga ctgatttcaa gacctggctc cagtccaagc tcctgccgcg attgccggga
4740 gtccccttct tctcatgtca acgtgggtac aagggagtct ggcggggcga
cggcatcatg 4800 caaaccacct gcccatgtgg agcacagatc accggacatg
tgaaaaaagg ttccatgagg 4860 atcgtggggc ctaggacctg tagtaacacg
tggcatggaa cattccccat taacgcgtac 4920 accacgggcc cctgcacgcc
ctccccggcg ccaaattatt ctagggcgct gtggcgggtg 4980 gctgctgagg
agtacgtgga ggttacgcgg gtgggggatt tccactacgt gacgggcatg 5040
accactgaca acgtaaagtg cccgtgtcag gttccggccc ccgaattctt cacagaagtg
5100 gatggggtgc ggttgcacag gtacgctcca gcgtgcaaac ccctcctacg
ggaggaggtc 5160 acattcctgg tcgggctcaa tcaatacctg gttgggtcac
agctcccatg cgagcccgaa 5220 ccggacgtag cagtgctcac ttccatgctc
accgacccct cccacattac ggcggagacg 5280 gctaagcgta ggctggccag
gggatctccc ccctccttgg ccagctcatc agctagccag 5340 ctgtctgcgc
cttccttgaa ggcaacatgc actacccgtc atgactcccc ggacgctgac 5400
ctcatcgagg ccaacctcct gtggcggcag gagatgggcg ggaacatcac ccgcgtggag
5460 tcagaaaata aggtagtaat tttggactct ttcgagccgc tccaagcgga
ggaggatgag 5520 agggaagtat ccgttccggc ggagatcctg cggaggtcca
ggaaattccc tcgagcgatg 5580 cccatatggg cacgcccgga ttacaaccct
ccactgttag agtcctggaa ggacccggac 5640 tacgtccctc cagtggtaca
cgggtgtcca ttgccgcctg ccaaggcccc tccgatacca 5700 cctccacgga
ggaagaggac ggttgtcctg tcagaatcta ccgtgtcttc tgccttggcg 5760
gagctcgcca caaagacctt cggcagctcc gaatcgtcgg ccgtcgacag cggcacggca
5820 acggcctctc ctgaccagcc ctccgacgac ggcgacgcgg gatccgacgt
tgagtcgtac 5880 tcctccatgc ccccccttga gggggagccg ggggatcccg
atctcagcga cgggtcttgg 5940 tctaccgtaa gcgaggaggc tagtgaggac
gtcgtctgct gctcgatgtc ctacacatgg 6000 acaggcgccc tgatcacgcc
atgcgctgcg gaggaaacca agctgcccat caatgcactg 6060 agcaactctt
tgctccgtca ccacaacttg gtctatgcta caacatctcg cagcgcaagc 6120
ctgcggcaga agaaggtcac ctttgacaga ctgcaggtcc tggacgacca ctaccgggac
6180 gtgctcaagg agatgaaggc gaaggcgtcc acagttaagg ctaaacttct
atccgtggag 6240 gaagcctgta agctgacgcc cccacattcg gccagatcta
aatttggcta tggggcaaag 6300 gacgtccgga acctatccag caaggccgtt
aaccacatcc gctccgtgtg gaaggacttg 6360 ctggaagaca ctgagacacc
aattgacacc accatcatgg caaaaaatga ggttttctgc 6420 gtccaaccag
agaagggggg ccgcaagcca gctcgcctta tcgtattccc agatttgggg 6480
gttcgtgtgt gcgagaaaat ggccctttac gatgtggtct ccaccctccc tcaggccgtg
6540 atgggctctt catacggatt ccaatactct cctggacagc gggtcgagtt
cctggtgaat 6600 gcctggaaag cgaagaaatg ccctatgggc ttcgcatatg
acacccgctg ttttgactca 6660 acggtcactg agaatgacat ccgtgttgag
gagtcaatct accaatgttg tgacttggcc 6720 cccgaagcca gacaggccat
aaggtcgctc acagagcggc tttacatcgg gggccccctg 6780 actaattcta
aagggcagaa ctgcggctat cgccggtgcc gcgcgagcgg tgtactgacg 6840
accagctgcg gtaataccct cacatgttac ttgaaggccg ctgcggcctg tcgagctgcg
6900 aagctccagg actgcacgat gctcgtatgc ggagacgacc ttgtcgttat
ctgtgaaagc 6960 gcggggaccc aagaggacga ggcgagccta cgggccttca
cggaggctat gactagatac 7020 tctgcccccc ctggggaccc gcccaaacca
gaatacgact tggagttgat aacatcatgc 7080 tcctccaatg tgtcagtcgc
gcacgatgca tctggcaaaa gggtgtacta tctcacccgt 7140 gaccccacca
ccccccttgc gcgggctgcg tgggagacag ctagacacac tccagtcaat 7200
tcctggctag gcaacatcat catgtatgcg cccaccttgt gggcaaggat gatcctgatg
7260 actcatttct tctccatcct tctagctcag gaacaacttg aaaaagccct
agattgtcag 7320 atctacgggg cctgttactc cattgagcca cttgacctac
ctcagatcat tcaacgactc 7380 catggcctta gcgcattttc actccatagt
tactctccag gtgagatcaa tagggtggct 7440 tcatgcctca ggaaacttgg
ggtaccgccc ttgcgagtct ggagacatcg ggccagaagt 7500 gtccgcgcta
ggctactgtc ccaggggggg agggctgcca cttgtggcaa gtacctcttc 7560
aactgggcag taaggaccaa gctcaaactc actccaatcc cggctgcgtc ccagttggat
7620 ttatccagct ggttcgttgc tggttacagc gggggagaca tatatcacag
cctgtctcgt 7680 gcccgacccc gctggttcat gtggtgccta ctcctacttt
ctgtaggggt aggcatctat 7740 ctactcccca accgatgaac ggggagctaa
acactccagg ccaataggcc atcctgtttt 7800 tttccctttt tttttttctt
tttttttttt tttttttttt tttttttttt ttctcctttt 7860 tttttcctct
ttttttcctt ttctttcctt tggtggctcc atcttagccc tagtcacggc 7920
tagctgtgaa aggtccgtga gccgcttgac tgcagagagt gctgatactg gcctctctgc
7980 agatcaagta ct 7992 5 7992 DNA Artificial Sequence HCV Replicon
from cell line HCVR22 5 gccagccccc gattgggggc gacactccac catagatcac
tcccctgtga ggaactactg 60 tcttcacgca gaaagcgtct agccatggcg
ttagtatgag tgtcgtgcag cctccaggac 120 cccccctccc gggagagcca
tagtggtctg cggaaccggt gagtacaccg gaattgccag 180 gacgaccggg
tcctttcttg gatcaacccg ctcaatgcct ggagatttgg gcgtgccccc 240
gcgagactgc tagccgagta gtgttgggtc gcgaaaggcc ttgtggtact gcctgatagg
300 gtgcttgcga gtgccccggg aggtctcgta gaccgtgcac catgagcacg
aatcctaaac 360 ctcaaagaaa aaccaaaggg cgcgccatga ttgaacaaga
tggattgcac gcaggttctc 420 cggccgcttg ggtggagagg ctattcggct
atgactgggc acaacagaca atcggctgct 480 ctgatgccgc cgtgttccgg
ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg 540 acctgtccgg
tgccctgaat gaactgcagg acgaggcagc gcggctatcg tggctggcca 600
cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac tgaagcggga agggactggc
660 tgctattggg cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct
cctgccgaga 720 aagtatccat catggctgat gcaatgcggc ggctgcatac
gcttgatccg gctacctgcc 780 cattcgacca ccaagcgaaa catcgcatcg
agcgagcacg tactcggatg gaagccggtc 840 ttgtcgatca ggatgatctg
gacgaagagc atcaggggct cgcgccagcc gaactgttcg 900 ccaggctcaa
ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat ggcgatgcct 960
gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg attcatcgac tgtggccggc
1020 tgggtgtggc ggaccgctat caggacatag cgttggctac ccgtgatatt
gctgaagagc 1080 ttggcggcga atgggctgac cgcttcctcg tgctttacgg
tatcgccgct cccgattcgc 1140 agcgcatcgc cttctatcgc cttcttgacg
agttcttctg agtttaaaca gaccacaacg 1200 gtttccctct agcgggatca
attccgcccc tctccctccc ccccccctaa cgttactggc 1260 cgaagccgct
tggaataagg ccggtgtgcg tttgtctata tgttattttc caccatattg 1320
ccgtcttttg gcaatgtgag ggcccggaaa cctggccctg tcttcttgac gagcattcct
1380 aggggtcttt cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt
gaaggaagca 1440 gttcctctgg aagcttcttg aagacaaaca acgtctgtag
cgaccctttg caggcagcgg 1500 aaccccccac ctggcgacag gtgcctctgc
ggccaaaagc cacgtgtata agatacacct 1560 gcaaaggcgg cacaacccca
gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa 1620 tggctctcct
caagcgtatt caacaagggg ctgaaggatg cccagaaggt accccattgt 1680
atgggatctg atctggggcc tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa
1740 aacgtctagg ccccccgaat cacggggacg tggttttcct ttgaaaaaca
cgataatacc 1800 atggcgccta ttacggccta ctcccaacag acgcgaggcc
tacttggctg catcatcact 1860 agcctcacag gccgggacag gaaccaggtc
gagggggagg tccaagtggt ctccaccgca 1920 acacaatctt tcctggcgac
ctgcgtcaat ggcgtgtgtt ggactgtcta tcatggtgcc 1980 ggctcaaaga
cccttgccgg cccaaagggc ccaatcaccc aaatgtacac caatgtggac 2040
caggacctcg tcggctggca agcgcccccc ggggcgcgtt ccttgacacc atgcacctgc
2100 ggcagctcgg acctttactt ggtcacgagg catgccgatg tcattccggt
gcgccggcgg 2160 ggcgacagca gggggagcct actctccccc aggcccgtct
cctacttgaa gggctcttcg 2220 ggcggtccac tgctctgccc ctcggggcac
gctgtgggca tctttcgggc tgccgtgtgc 2280 acccgagggg ttgcgaaggc
ggtggacttt gtacccgtcg agtctatggg aaccactatg 2340 cggtccccgg
tcttcacgga caactcgtcc cctccggccg taccgcagac attccaggtg 2400
gcccatctac acgcccctac tggtagcggc aagagcacta aggtgccggc tgcgtatgca
2460 gcccaagggt ataaggtgct tgtcctgaac ccgtccgtcg ccgccaccct
aggtttcggg 2520 gcgtatatgt ctaaggcaca tggtatcgac cctaacatca
gaaccggggt aaggaccatc 2580 accacgggtg cccccatcac gtactccacc
tatggcaagt ttcttgccga cggtggttgc 2640 tctgggggcg cctatgacat
cataatatgt gatgagtgcc actcaactga ctcgaccact 2700 atcctgggca
tcggcacagt cctggaccaa gcggagacgg ctggagcgcg actcgtcgtg 2760
ctcgccaccg ctacgcctcc gggatcggtc accgtgccac atccaaacat cgaggaggtg
2820 gctctgtcca gcactggaga aatccccttt tatggcaaag ccatccccat
cgagaccatc 2880 aaggggggga ggcacctcat tttctgccat tccaagaaga
aatgtgatga gctcgccgcg 2940 aagctgtccg gcctcggact caatgctgta
gcatattacc ggggccttga tgtatccgtc 3000 ataccaacta gcggagacgt
cattgtcgta gcaacggacg ctctaatgac gggctttacc 3060 ggcgatttcg
actcagtgat cgactgcaat acatgtgtca cccagacagt cgacttcagc 3120
ctggacccga ccttcaccat tgagacgacg accgtgccac aagacgcggt gtcacgctcg
3180 cagcggcgag gcaggactgg taggggcagg atgggcattt acaggtttgt
gactccagga 3240 gaacggccct cgggcatgtt cgattcctcg gttctgtgcg
agtgctatga cgcgggctgt 3300 gcttggtacg agctcacgcc cgccgagacc
tcagttaggt tgcgggctta cctaaacaca 3360 ccagggttgc ccgtctgcca
ggaccatctg gagttctggg agagcgtctt tacaggcctc 3420 acccacatag
acgcccattt cttgtcccag actaagcagg caggagacaa cttcccctac 3480
ctggtagcat accaggctac ggtgtgcgcc agggctcagg ctccacctcc atcgtgggac
3540 caaatgtgga agtgtctcat acggctaaag cctacgctgc acgggccaac
gcccctgctg 3600 tataggctgg gagccgttca aaacgaggtt actaccacac
accccataac caaatacatc 3660 atggcatgca tgtcggctga cctggaggtc
gtcacgagca cctgggtgct ggtaggcgga 3720 gtcctagcag ctctggccgc
gtattgcctg acaacaggca gcgtggtcat tgtgggcagg 3780 atcatcttgt
ccggaaagcc ggccatcatt cccgacaggg aagtccttta ccgggagttc 3840
gatgagatgg aagagtgcgc ctcacacctc ccttacatcg aacagggaat gcagctcgcc
3900 gaacaattca aacagaaggc aatcgggttg ctgcgaacag ccaccaagca
agcggaggct 3960 gctgctcccg tggtggaatc caagtggcgg accctcgaag
ccttctgggc gaagcatatg 4020 tggaatttca tcagcgggat acaatattta
gcaggcttgt ccactctgcc tggcaacccc 4080 gcgatagcat cactgatggc
attcacagcc tctatcacca gcccgctcac cacccaacat 4140 accctcctgt
ttaacatcct ggggggatgg gtggccgccc aacttgctcc tcccagcgct 4200
gcttctgctt tcgtaggcgc cggcatcgct ggagcggctg ttggcagcat aggccttggg
4260 aaggtgcttg tggatatttt ggcaggttat ggagcagggg tggcaggcgc
gctcgtggcc 4320 tttaaggtca tgagcggcga gatgccctcc accgaggacc
tggttaacct actccctgct 4380 atcctctccc ctggcgccct agtcgtcggg
gtcgtgtgcg cagcgatact gcgtcggcac 4440 gtgggcccag gggagggggc
tgtgcagtgg atgaaccggc tgatagcgtt cgcttcgcgg 4500 ggtaaccacg
tctcccccac gcactatgtg cctgagagcg acgctgcagc acgtgtcact 4560
cagatcctct ctagtcttac catcactcag ctgctgaaga ggcttcacca gtggatcaac
4620 gaggactgct ccacgccatg ctccggctcg tggctaagag atgtttggga
ttggatatgc 4680 acggtgttga ctgatttcaa gacctggctc cagtccaagc
tcctgccgcg attgccggga 4740 gtccccttct tctcatgtca acgtgggtac
aagggagtct ggcggggcga cggcatcatg 4800 caaaccacct gcccatgtgg
agcacagatc accggacatg tgaaaaacgg ttccatgagg 4860 atcgtggggc
ctaggacctg tagtaacacg tggcatggaa cattccccat taacgcgtac 4920
accacgggcc cctgcacgcc ctccccggcg ccaaattatt ctagggcgct gtggcgggtg
4980 gctgctgagg agtacgtgga ggttacgcgg gtgggggatt tccactacgt
gacgggcatg 5040 accactgaca acgtaaagtg cccgtgtcag gttccggccc
ccgaattctt cacagaagtg 5100 gatggggtgc ggttgcacag gtacgctcca
gcgtgcaaac ccctcctacg ggaggaggtc 5160 acattcctgg tcgggctcaa
tcaatacctg gttgggtcac agctcccatg cgagcccgaa 5220 ccggacgtag
cagtgctcac ttccatgctc accgacccct cccacattac ggcggagacg 5280
gctaagcgta ggctggccag gggatctccc ccctccttgg ccagctcatc agctagccag
5340 ctgtctgcgc cttccttgaa ggcaacatgc actacccgtc atgactcccc
ggacgctgac 5400 ctcatcgagg ccaacctcct gtggcggcag gagatgggcg
ggaacatcac ccgcgtggag 5460 tcagaaaata aggtagtaat tttggactct
ttcgagccgc tccaagcgga ggaggatgag 5520 agggaagtat ccgttccggc
ggagatcctg cggaggtcca ggaaattccc tcgagcgatg 5580 cccatatggg
cacgcccgga ttacaaccct ccactgttag agtcctggaa ggacccggac 5640
tacgtccctc cagtggtaca cgggtgtcca ttgccgcctg ccaaggcccc tccgatacca
5700 cctccacgga ggaagaggac ggttgtcctg tcagaatcta ccgtgtcttc
tgccttggcg 5760 gagctcgcca caaagacctt cggcagctcc gaatcgtcgg
ccgtcgacag cggcacggca 5820 acggcctctc ctgaccagcc ctccgacgac
ggcgacgcgg gatccgacgt tgagtcgtac 5880 tcctccatgc ccccccttga
gggggagccg ggggatcccg atctcagcga cgggtcttgg 5940 tctaccgtaa
gcgaggaggc tagtgaggac gtcgtctgct gctcgatgtc ctacacatgg 6000
acaggcgccc tgatcacgcc atgcgctgcg gaggaaacca agctgcccat caatgcactg
6060 agcaactctt tgctccgtca ccacaacttg gtctatgcta caacatctcg
cagcgcaagc 6120 ctgcggcaga agaaggtcac ctttgacaga ctgcaggtcc
tggacgacca ctaccgggac 6180 gtgctcaagg agatgaaggc gaaggcgtcc
acagttaagg ctaaacttct atccgtggag 6240 gaagcctgta agctgacgcc
cccacattcg gccagatcta aatttggcta tggggcaaag 6300 gacgtccgga
acctatccag caaggccgtt aaccacatcc gctccgtgtg gaaggacttg 6360
ctggaagaca ctgagacacc aattgacacc accatcatgg caaaaaatga ggttttctgc
6420 gtccaaccag agaagggggg ccgcaagcca gctcgcctta tcgtattccc
agatttgggg 6480 gttcgtgtgt gcgagaaaat ggccctttac gatgtggtct
ccaccctccc tcaggccgtg 6540 atgggctctt catacggatt ccaatactct
cctggacagc gggtcgagtt cctggtgaat 6600 gcctggaaag cgaagaaatg
ccctatgggc ttcgcatatg acacccgctg ttttgactca 6660 acggtcactg
agaatgacat ccgtgttgag gagtcaatct accaatgttg tgacttggcc 6720
cccgaagcca gacaggccat aaggtcgctc acagagcggc tttacatcgg gggccccctg
6780 actaattcta aagggcagaa ctgcggctat cgccggtgcc gcgcgagcgg
tgtactgacg 6840 accagctgcg gtaataccct cacatgttac ttgaaggccg
ctgcggcctg tcgagctgcg 6900 aagctccagg actgcacgat gctcgtatgc
ggagacgacc ttgtcgttat ctgtgaaagc 6960 gcggggaccc aagaggacga
ggcgagccta cgggccttca cggaggctat gactagatac 7020 tctgcccccc
ctggggaccc gcccaaacca gaatacgact tggagttgat aacatcatgc 7080
tcctccaatg tgtcagtcgc gcacgatgca tctggcaaaa gggtgtacta tctcacccgt
7140 gaccccacca ccccccttgc gcgggctgcg tgggagacag ctagacacac
tccagtcaat 7200 tcctggctag gcaacatcat catgtatgcg cccaccttgt
gggcaaggat gatcctgatg 7260 actcatttct tctccatcct tctagctcag
gaacaacttg aaaaagccct agattgtcag 7320 atctacgggg cctgttactc
cattgagcca cttgacctac ctcagatcat tcaacgactc 7380 catggcctta
gcgcattttc actccatagt tactctccag gtgagatcaa tagggtggct 7440
tcatgcctca ggaaacttgg ggtaccgccc ttgcgagtct ggagacatcg ggccagaagt
7500 gtccgcgcta ggctactgtc ccaggggggg agggctgcca cttgtggcaa
gtacctcttc 7560 aactgggcag taaggaccaa gctcaaactc actccaatcc
cggctgcgtc ccagttggat 7620 ttatccagct ggttcgttgc tggttacagc
gggggagaca tatatcacag cctgtctcgt 7680 gcccgacccc gctggttcat
gtggtgccta ctcctacttt ctgtaggggt aggcatctat 7740 ctactcccca
accgatgaac ggggagctaa acactccagg ccaataggcc atcctgtttt 7800
tttccctttt tttttttctt tttttttttt tttttttttt tttttttttt ttctcctttt
7860 tttttcctct ttttttcctt ttctttcctt tggtggctcc atcttagccc
tagtcacggc 7920 tagctgtgaa aggtccgtga gccgcttgac tgcagagagt
gctgatactg gcctctctgc 7980 agatcaagta ct 7992 6 7992 DNA Artificial
Sequence HCV Replicon from cell line HCVR24 6 gccagccccc gattgggggc
gacactccac catagatcac tcccctgtga ggaactactg 60 tcttcacgca
gaaagcgtct agccatggcg ttagtatgag tgtcgtgcag cctccaggac 120
cccccctccc gggagagcca tagtggtctg cggaaccggt gagtacaccg gaattgccag
180 gacgaccggg tcctttcttg gatcaacccg ctcaatgcct ggagatttgg
gcgtgccccc 240 gcgagactgc tagccgagta gtgttgggtc gcgaaaggcc
ttgtggtact gcctgatagg 300 gtgcttgcga gtgccccggg aggtctcgta
gaccgtgcac catgagcacg aatcctaaac 360 ctcaaagaaa aaccaaaggg
cgcgccatga ttgaacaaga tggattgcac gcaggttctc 420 cggccgcttg
ggtggagagg ctattcggct atgactgggc acaacagaca atcggctgct 480
ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg
540 acctgtccgg tgccctgaat gaactgcagg acgaggcagc gcggctatcg
tggctggcca 600 cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac
tgaagcggga agggactggc 660 tgctattggg cgaagtgccg gggcaggatc
tcctgtcatc tcaccttgct cctgccgaga 720 aagtatccat catggctgat
gcaatgcggc ggctgcatac gcttgatccg gctacctgcc 780 cattcgacca
ccaagcgaaa catcgcatcg agcgagcacg tactcggatg gaagccggtc 840
ttgtcgatca ggatgatctg gacgaagagc atcaggggct cgcgccagcc gaactgttcg
900 ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat
ggcgatgcct 960 gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg
attcatcgac tgtggccggc 1020 tgggtgtggc ggaccgctat caggacatag
cgttggctac ccgtgatatt gctgaagagc 1080 ttggcggcga atgggctgac
cgcttcctcg tgctttacgg tatcgccgct cccgattcgc 1140 agcgcatcgc
cttctatcgc cttcttgacg agttcttctg agtttaaaca gaccacaacg 1200
gtttccctct agcgggatca attccgcccc tctccctccc ccccccctaa cgttactggc
1260 cgaagccgct tggaataagg ccggtgtgcg tttgtctata tgttattttc
caccatattg 1320 ccgtcttttg gcaatgtgag ggcccggaaa cctggccctg
tcttcttgac gagcattcct 1380 aggggtcttt cccctctcgc caaaggaatg
caaggtctgt tgaatgtcgt gaaggaagca 1440 gttcctctgg aagcttcttg
aagacaaaca acgtctgtag cgaccctttg caggcagcgg 1500 aaccccccac
ctggcgacag gtgcctctgc ggccaaaagc cacgtgtata agatacacct 1560
gcaaaggcgg cacaacccca gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa
1620 tggctctcct caagcgtatt caacaagggg ctgaaggatg cccagaaggt
accccattgt 1680 atgggatctg atctggggcc tcggtgcaca tgctttacat
gtgtttagtc gaggttaaaa 1740 aacgtctagg ccccccgaac cacggggacg
tggttttcct ttgaaaaaca cgataatacc 1800 atggcgccta ttacggccta
ctcccaacag acgcgaggcc tacttggctg catcatcact 1860 agcctcacag
gccgggacag gaaccaggtc gagggggagg tccaagtggt ctccaccgca 1920
acacaatctt tcctggcgac ctgcgtcaat ggcgtgtgtt ggactgtcta tcatggtgcc
1980 ggctcaaaga cccttgccgg cccaaagggc ccaatcaccc aaatgtacac
caatgtggac 2040 caggacctcg tcggctggca agcgcccccc ggggcgcgtt
ccttgacacc atgcacctgc 2100 ggcagctcgg acctttactt ggtcacgagg
catgccgatg tcattccggt gcgccggcgg 2160 ggcgacagca gggggagcct
actctccccc aggcccgtct cctacttgaa gggctcttcg 2220 ggcggtccac
tgctctgccc ctcggggcac gctgtgggca tctttcgggc tgccgtgtgc 2280
acccgagggg ttgcgaaggc ggtggacttt gtacccgtcg agtctatgga aaccactatg
2340 cggtccccgg tcttcacgga caactcgtcc cctccggccg taccgcagac
attccaggtg 2400 gcccatctac acgcccctac tggtagcggc aagagcacta
aggtgccggc tgcgtatgca 2460 gcccaagggt ataaggtgct tgtcctgaac
ccgtccgtcg ccgccaccct aggtttcggg 2520 gcgtatatgt ctaaggcaca
tggtatcgac cctaacatca gaaccggggt aaggaccatc 2580 accacgggtg
cccccatcac gtactccacc tatggcaagt ttcttgccga cggtggttgc 2640
tctgggggcg cctatgacat cataatatgt gatgagtgcc actcaactga ctcgaccact
2700 atcctgggca tcggcacagt cctggaccaa gcggagacgg ctggagcgcg
actcgtcgtg 2760 ctcgccaccg ctacgcctcc gggatcggtc accgtgccac
atccaaacat cgaggaggtg 2820 gctctgtcca gcactggaga aatccccttt
tatggcaaag ccatccccat cgagaccatc 2880 aaggggggga ggcacctcat
tttctgccat tccaagaaga aatgtgatga gctcgccgcg 2940 aagctgtccg
gcctcggact caatgctgta gcatattacc ggggccttga tgtatccgtc 3000
ataccaacta gcggagacgt cattgtcgta gcaacggacg ctctaatgac gggctttacc
3060 ggcgatttcg actcagtgat cgactgcaat acatgtgtca cccagacagt
cgacttcagc 3120 ctggacccga ccttcaccat tgagacgacg accgtgccac
aagacgcggt gtcacgctcg 3180 cagcggcgag gcaggactgg taggggcagg
atgggcattt acaggtttgt gactccagga 3240 gaacggccct cgggcatgtt
cgattcctcg gttctgtgcg agtgctatga cgcgggctgt 3300 gcttggtacg
agctcacgcc cgccgagacc tcagttaggt tgcgggctta cctaaacaca 3360
ccagggttgc ccgtctgcca ggaccatctg gagttctggg agagcgtctt tacaggcctc
3420 acccacatag acgcccattt cttgtcccag actaagcagg caggagacaa
cttcccctac 3480 ctggtagcat accaggctac ggtgtgcgcc agggctcagg
ctccacctcc atcgtgggac 3540 caaatgtgga agtgtctcat acggctaaag
cctacgctgc acgggccaac gcccctgctg 3600 tataggctgg gagccgttca
aaacgaggtt actaccacac accccataac caaatacatc 3660 atggcatgca
tgtcggctga cctggaggtc gtcacgagca cctgggtgct ggtaggcgga 3720
gtcctagcag ctctggccgc gtattgcctg acaacaggca gcgtggtcat tgtgggcagg
3780 atcatcttgt ccggaaagcc ggccatcatt cccgacaggg aagtccttta
ccgggagttc 3840 gatgagatgg aagagtgcgc ctcacacctc ccttacatcg
aacagggaat gcagctcgcc 3900 gaacaattca aacagaaggc aatcgggttg
ctgcaaacag ccaccaagca agcggaggct 3960 gctgctcccg tggtggaatc
caagtggcgg accctcgaag ccttctgggc gaagcatatg 4020 tggaatttca
tcagcgggat acaatattta gcaggcttgt ccactctgcc tggcaacccc 4080
gcgatagcat cactgatggc attcacagcc tctatcacca gcccgctcac cacccaacat
4140 accctcctgt ttaacatcct ggggggatgg gtggccgccc aacttgctcc
tcccagcgct 4200 gcttctgctt tcgtaggcgc cggcatcgct ggagcggctg
ttggcagcat aggccttggg 4260 aaggtgcttg tggatatttt ggcaggttat
ggagcagggg tggcaggcgc gctcgtggcc 4320 tttaaggtca tgagcggcga
gatgccctcc accgaggacc tggttaacct actccctgct 4380 atcctctccc
ctggcgccct agtcgtcggg gtcgtgtgcg cagcgatact gcgtcggcac 4440
gtgggcccag gggagggggc tgtgcagtgg atgaaccggc tgatagcgtt cgcttcgcgg
4500 ggtaaccacg tctcccccac gcactatgtg cctgagagcg acgctgcagc
acgtgtcact 4560 cagatcctct ctagtcttac catcactcag ctgctgaaga
ggcttcacca gtggatcaac 4620
gaggactgct ccacgccatg ctccggctcg tggctaagag atgtttggga ttggatatgc
4680 acggtgttga ctgatttcaa gacctggctc cagtccaagc tcctgccgcg
attgccggga 4740 gtccccttct tctcatgtca acgtgggtac aagggagtct
ggcggggcga cggcatcatg 4800 caaaccacct gcccatgtgg agcacagatc
accggacatg tgaaaaacgg ttccatgagg 4860 atcgtggggc ctaggacctg
tagtaacacg tggcatggaa cattccccat taacgcgtac 4920 accacgggcc
cctgcacgcc ctccccggcg ccaaattatt ctagggcgct gtggcgggtg 4980
gctgctgagg agtacgtgga ggttacgcgg gtgggggatt tccactacgt gacgggcatg
5040 accactgaca acgtaaagtg cccgtgtcag gttccggccc ccgaattctt
cacagaagtg 5100 gatggggtgc ggttgcacag gtacgctcca gcgtgcaaac
ccctcctacg ggaggaggtc 5160 acattcctgg tcgggctcaa tcaatacctg
gttgggtcac agctcccatg cgagcccgaa 5220 ccggacgtag cagtgctcac
ttccatgctc accgacccct cccacattac ggcggagacg 5280 gctaagcgta
ggctggccag gggatctccc ccctccttgg ccagctcatc agctatccag 5340
ctgtctgcgc cttccttgaa ggcaacatgc actacccgtc atgactcccc ggacgctgac
5400 ctcatcgagg ccaacctcct gtggcggcag gagatgggcg ggaacatcac
ccgcgtggag 5460 tcagaaaata aggtagtaat tttggactct ttcgagccgc
tccaagcgga ggaggatgag 5520 agggaagtat ccgttccggc ggagatcctg
cggaggtcca ggaaattccc tcgagcgatg 5580 cccatatggg cacgcccgga
ttacaaccct ccactgttag agtcctggaa ggacccggac 5640 tacgtccctc
cagtggtaca cgggtgtcca ttgccgcctg ccaaggcccc tccgatacca 5700
cctccacgga ggaagaggac ggttgtcctg tcagaatcta ccgtgtcttc tgccttggcg
5760 gagctcgcca caaagacctt cggcagctcc gaatcgtcgg ccgtcgacag
cggcacggca 5820 acggcctctc ctgaccagcc ctccgacgac ggcgacgcgg
gatccgacgt tgagtcgtac 5880 tcctccatgc ccccccttga gggggagccg
ggggatcccg atctcagcga cgggtcttgg 5940 tctaccgtaa gcgaggaggc
tagtgaggac gtcgtctgct gctcgatgtc ctacacatgg 6000 acaggcgccc
tgatcacgcc atgcgctgcg gaggaaacca agctgcccat caatgcactg 6060
agcaactctt tgctccgtca ccacaacttg gtctatgcta caacatctcg cagcgcaagc
6120 ctgcggcaga agaaggtcac ctttgacaga ctgcaggtcc tggacgacca
ctaccgggac 6180 gtgctcaagg agatgaaggc gaaggcgtcc acagttaagg
ctaaacttct atccgtggag 6240 gaagcctgta agctgacgcc cccacattcg
gccagatcta aatttggcta tggggcaaag 6300 gacgtccgga acctatccag
caaggccgtt aaccacatcc gctccgtgtg gaaggacttg 6360 ctggaagaca
ctgagacacc aattgacacc accatcatgg caaaaaatga ggttttctgc 6420
gtccaaccag agaagggggg ccgcaagcca gctcgcctta tcgtattccc agatttgggg
6480 gttcgtgtgt gcgagaaaat ggccctttac gatgtggtct ccaccctccc
tcaggccgtg 6540 atgggctctt catacggatt ccaatactct cctggacagc
gggtcgagtt cctggtgaat 6600 gcctggaaag cgaagaaatg ccctatgggc
ttcgcatatg acacccgctg ttttgactca 6660 acggtcactg agaatgacat
ccgtgttgag gagtcaatct accaatgttg tgacttggcc 6720 cccgaagcca
gacaggccat aaggtcgctc acagagcggc tttacatcgg gggccccctg 6780
actaattcta aagggcagaa ctgcggctat cgccggtgcc gcgcgagcgg tgtactgacg
6840 accagctgcg gtaataccct cacatgttac ttgaaggccg ctgcggcctg
tcgagctgcg 6900 aagctccagg actgcacgat gctcgtatgc ggagacgacc
ttgtcgttat ctgtgaaagc 6960 gcggggaccc aagaggacga ggcgagccta
cgggccttca cggaggctat gactagatac 7020 tctgcccccc ctggggaccc
gcccaaacca gaatacgact tggagttgat aacatcatgc 7080 tcctccaatg
tgtcagtcgc gcacgatgca tctggcaaaa gggtgtacta tctcacccgt 7140
gaccccacca ccccccttgc gcgggctgcg tgggagacag ctagacacac tccagtcaat
7200 tcctggctag gcaacatcat catgtatgcg cccaccttgt gggcaaggat
gatcctgatg 7260 actcatttct tctccatcct tctagctcag gaacaacttg
aaaaagccct agattgtcag 7320 atctacgggg cctgttactc cattgagcca
cttgacctac ctcagatcat tcaacgactc 7380 catggcctta gcgcattttc
actccatagt tactctccag gtgagatcaa tagggtggct 7440 tcatgcctca
ggaaacttgg ggtaccgccc ttgcgagtct ggagacatcg ggccagaagt 7500
gtccgcgcta ggctactgtc ccaggggggg agggctgcca cttgtggcaa gtacctcttc
7560 aactgggcag taaggaccaa gctcaaactc actccaatcc cggctgcgtc
ccagttggat 7620 ttatccagct ggttcgttgc tggttacagc gggggagaca
tatatcacag cctgtctcgt 7680 gcccgacccc gctggttcat gtggtgccta
ctcctacttt ctgtaggggt aggcatctat 7740 ctactcccca accgatgaac
ggggagctaa acactccagg ccaataggcc atcctgtttt 7800 tttccctttt
tttttttctt tttttttttt tttttttttt tttttttttt ttctcctttt 7860
tttttcctct ttttttcctt ttctttcctt tggtggctcc atcttagccc tagtcacggc
7920 tagctgtgaa aggtccgtga gccgcttgac tgcagagagt gctgatactg
gcctctctgc 7980 agatcaagta ct 7992 7 22 DNA Artificial Sequence
primer for NS5B region between nt 7435 and 7750 7 gccctagatt
gtcagatcta cg 22 8 22 DNA Artificial Sequence primer for NS5B
region between nt 7435 and 7750 8 ataaatccaa ctgggacgca gc 22 9 21
DNA Artificial Sequence primer for NS5B region between 7360 and
7800 9 ccttgtgggc aaggatgatc c 21 10 23 DNA Artificial Sequence
primer for NS5B region between nt 7360 and 7800 10 gacaggctgt
gatatatgtc tcc 23 11 22 DNA Artificial Sequence primer for neo
region between nt 650 and 1110 11 gttctttttg tcaagaccga cc 22 12 21
DNA Artificial Sequence primer for neo region between nt 650 and
1110 12 ccaccatgat attcggcaag c 21 13 18 DNA Artificial Sequence
oligonucleotide primer 13 ctcgtatgtt gtgtggaa 18 14 19 DNA
Artificial Sequence oligonucleotide primer 14 gtcgctctcg aggcacata
19
* * * * *