U.S. patent application number 10/989723 was filed with the patent office on 2005-11-17 for protein scaffolds for antibody mimics and other binding proteins.
This patent application is currently assigned to Phylos, Inc.. Invention is credited to Kuimelis, Robert G., Lipovsek, Dasa, Wagner, Richard W..
Application Number | 20050255548 10/989723 |
Document ID | / |
Family ID | 24050620 |
Filed Date | 2005-11-17 |
United States Patent
Application |
20050255548 |
Kind Code |
A1 |
Lipovsek, Dasa ; et
al. |
November 17, 2005 |
Protein scaffolds for antibody mimics and other binding
proteins
Abstract
Disclosed herein are proteins that include a fibronectin type
III domain having at least one randomized loop. Also disclosed
herein are nucleic acids encoding such proteins and the use of such
proteins in diagnostic methods and in methods for evolving novel
compound-binding species and their ligands.
Inventors: |
Lipovsek, Dasa; (Cambridge,
MA) ; Wagner, Richard W.; (Concord, MA) ;
Kuimelis, Robert G.; (Brighton, MA) |
Correspondence
Address: |
FISH & NEAVE IP GROUP
ROPES & GRAY LLP
ONE INTERNATIONAL PLACE
BOSTON
MA
02110-2624
US
|
Assignee: |
Phylos, Inc.
Compound Therapeutics, Inc.
|
Family ID: |
24050620 |
Appl. No.: |
10/989723 |
Filed: |
November 15, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10989723 |
Nov 15, 2004 |
|
|
|
09515260 |
Feb 29, 2000 |
|
|
|
6818418 |
|
|
|
|
09515260 |
Feb 29, 2000 |
|
|
|
09456693 |
Dec 9, 1999 |
|
|
|
60111737 |
Dec 10, 1998 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 530/382; 536/23.5 |
Current CPC
Class: |
C12N 15/1037 20130101;
C07K 16/241 20130101; C07K 2319/30 20130101; C07K 14/78 20130101;
C07K 2318/20 20130101; C07K 2317/21 20130101; C40B 40/02 20130101;
C12Q 1/00 20130101; C12N 15/62 20130101 |
Class at
Publication: |
435/069.1 ;
435/320.1; 435/325; 536/023.5; 530/382 |
International
Class: |
C07H 021/04; C12P
021/06; C07K 014/745 |
Claims
What is claimed is:
1-67. (canceled)
68. A protein comprising: (a) a first fibronectin type III (Fn3)
domain wherein said first Fn3 domain has an amino acid sequence
that has been altered relative to the amino acid sequence of a
first naturally occurring Fn3 domain such that the first Fn3 domain
binds to a first compound that is not bound by the first naturally
occurring Fn3 domain; and (b) a second Fn3 domain, wherein said
second Fn3 domain has an amino acid sequence that has been altered
relative to the amino acid sequence of a second naturally occurring
Fn3 domain such that the second Fn3 domain binds to a compound that
is not bound by the second naturally occurring Fn3 domain.
69. The protein of claim 68, wherein said protein further comprises
one or more additional Fn3 domains.
70. The protein of claim 69, wherein each of said additional Fn3
domains has an amino acid sequence that has been altered relative
to the amino acid sequence of a naturally occurring Fn3 domain such
that each said additional Fn3 domain binds to a compound that is
not bound by the corresponding naturally occurring Fn3 domain.
71. The protein of claim 68, wherein said first Fn3 domain has an
amino acid sequence that is altered relative to the amino acid
sequence of a first human Fn3 domain, such that the first Fn3
domain binds to a first compound that is not bound by the first
human Fn3 domain.
72. The protein of claim 71, wherein said first Fn3 domain has an
amino acid sequence that is at least 50% identical to the amino
acid sequence of said first human Fn3 domain.
73. The protein of claim 71, wherein said first human Fn3 domain is
an Fn3 domain of fibronectin.
74. The protein of claim 73, wherein said first human Fn3 domain is
the tenth Fn3 module of human fibronectin (.sup.10Fn3).
75. The protein of claim 68, wherein the first and second Fn3
domains are altered in one or more loops relative to the first or
second naturally occurring Fn3 domains, respectively.
76. The protein of claim 75, wherein the first and second Fn3
domains are altered in two or more loops relative to the first or
second naturally occurring Fn3 domains, respectively.
77. The protein of claim 74, wherein the amino acid sequence of the
first Fn3 domain is altered relative to the amino acid sequence of
human 10Fn3 in one or more loops defined by amino acids 21-31, 51-6
and 76-88 in human Fn3.
78. The protein of claim 77, wherein the amino acid sequence of the
first Fn3 domain is altered relative to the amino acid sequence of
human .sup.10Fn3 in one or more beta strands.
79. The protein of claim 73, wherein said second Fn3 domain has an
amino acid sequence that is altered relative to the amino acid
sequence of a second human Fn3 domain, such that the second human
Fn3 domain binds to a second compound that is not bound by the
second human Fn3 domain.
80. The protein of claim 79, wherein said second Fn3 domain has an
amino acid sequence that is at least 50% identical to the amino
acid sequence of said second human Fn3 domain.
81. The protein of claim 80, wherein said second human Fn3 domain
is an Fn3 domain of fibronectin.
82. The protein of claim 81, wherein said second human Fn3 domain
is the tenth Fn3 module of human fibronectin (.sup.10Fn3).
83. The protein of claim 68, wherein said first and second
naturally occurring Fn3 domains are the same.
84. The protein of claim 68, wherein said first and second
compounds are the same.
85. The protein of claim 68, wherein said first and second
compounds are different.
86. The protein of claim 68, wherein said first compound is a first
protein.
87. The protein of claim 86, wherein said second compound is a
second protein.
88. The protein of claim 69, wherein said protein comprises: (a) a
first Fn3 domain wherein said first Fn3 domain has an amino acid
sequence that has been altered relative to the amino acid sequence
of the eighth Fn3 module of human fibronectin (.sup.8Fn3) such that
the first Fn3 domain binds to a first compound that is not bound by
human .sup.8Fn3; (b) a second Fn3 domain wherein said first Fn3
domain has an amino acid sequence that has been altered relative to
the amino acid sequence of the ninth Fn3 module of human
fibronectin (9Fn3) such that the second Fn3 domain binds to a
second compound that is not bound by human .sup.9Fn3; and (c) a
third Fn3 domain wherein said third Fn3 domain has an amino acid
sequence that has been altered relative to the amino acid sequence
of the tenth Fn3 module of human fibronectin (.sup.10Fn3) such that
the third Fn3 domain binds to a first compound that is not bound by
human .sup.10Fn3.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of the filing date of
provisional application, U.S. Ser. No. 60/111,737, filed Dec. 10,
1998, and utility application, U.S. Ser. No. 09/456,693, filed Dec.
9, 1999.
BACKGROUND OF THE INVENTION
[0002] This invention relates to protein scaffolds useful, for
example, for the generation of products having novel binding
characteristics.
[0003] Proteins having relatively defined three-dimensional
structures, commonly referred to as protein scaffolds, may be used
as reagents for the design of engineered products. These scaffolds
typically contain one or more regions which are amenable to
specific or random sequence variation, and such sequence
randomization is often carried out to produce libraries of proteins
from which desired products may be selected. One particular area in
which such scaffolds are useful is the field of antibody
design.
[0004] A number of previous approaches to the manipulation of the
mammalian immune system to obtain reagents or drugs have been
attempted. These have included injecting animals with antigens of
interest to obtain mixtures of polyclonal antibodies reactive
against specific antigens, production of monoclonal antibodies in
hybridoma cell culture (Koehler and Milstein, Nature 256:495,
1975), modification of existing monoclonal antibodies to obtain new
or optimized recognition properties, creation of novel antibody
fragments with desirable binding characteristics, and randomization
of single chain antibodies (created by connecting the variable
regions of the heavy and light chains of antibody molecules with a
flexible peptide linker) followed by selection for antigen binding
by phage display (Clackson et al., Nature 352:624, 1991).
[0005] In addition, several non-immunoglobulin protein scaffolds
have been proposed for obtaining proteins with novel binding
properties. For example, a "minibody" scaffold, which is related to
the immunoglobulin fold, has been designed by deleting three beta
strands from a heavy chain variable domain of a monoclonal antibody
(Tramontano et al., J. Mol. Recognit. 7:9, 1994). This protein
includes 61 residues and can be used to present two hypervariable
loops. These two loops have been randomized and products selected
for antigen binding, but thus far the framework appears to have
somewhat limited utility due to solubility problems. Another
framework used to display loops has been tendamistat, a 74 residue,
six-strand beta sheet sandwich held together by two disulfide bonds
(McConnell and Hoess, J. Mol. Biol. 250:460, 1995). This scaffold
includes three loops, but, to date, only two of these loops have
been examined for randomization potential.
[0006] Other proteins have been tested as frameworks and have been
used to display randomized residues on alpha helical surfaces (Nord
et al., Nat. Biotechnol. 15:772, 1997; Nord et al., Protein Eng.
8:601, 1995), loops between alpha helices in alpha helix bundles
(Ku and Schultz, Proc. Natl. Acad. Sci. USA 92:6552, 1995), and
loops constrained by disulfide bridges, such as those of the small
protease inhibitors (Markland et al., Biochemistry 35:8045, 1996;
Markland et al., Biochemistry 35:8058, 1996; Rottgen and Collins,
Gene 164:243, 1995; Wang et al., J. Biol. Chem. 270:12250,
1995).
SUMMARY OF THE INVENTION
[0007] The present invention provides a new family of proteins
capable of evolving to bind any compound of interest. These
proteins, which make use of a fibronectin or fibronectin-like
scaffold, function in a manner characteristic of natural or
engineered antibodies (that is, polyclonal, monoclonal, or
single-chain antibodies) and, in addition, possess structural
advantages. Specifically, the structure of these antibody mimics
has been designed for optimal folding, stability, and solubility,
even under conditions which normally lead to the loss of structure
and function in antibodies.
[0008] These antibody mimics may be utilized for the purpose of
designing proteins which are capable of binding to virtually any
compound (for example, any protein) of interest. In particular, the
fibronectin-based molecules described herein may be used as
scaffolds which are subjected to directed evolution designed to
randomize one or more of the three fibronectin loops which are
analogous to the complementarity-determining regions (CDRs) of an
antibody variable region. Such a directed evolution approach
results in the production of antibody-like molecules with high
affinities for antigens of interest. In addition, the scaffolds
described herein may be used to display defined exposed loops (for
example, loops previously randomized and selected on the basis of
antigen binding) in order to direct the evolution of molecules that
bind to such introduced loops. A selection of this type may be
carried out to identify recognition molecules for any individual
CDR-like loop or, alternatively, for the recognition of two or all
three CDR-like loops combined into a non-linear epitope.
[0009] Accordingly, the present invention features a protein that
includes a fibronectin type III domain having at least one
randomized loop, the protein being characterized by its ability to
bind to a compound that is not bound by the corresponding
naturally-occurring fibronectin.
[0010] In preferred embodiments, the fibronectin type III domain is
a mammalian (for example, a human) fibronectin type III domain; and
the protein includes the tenth module of the fibronectin type III
(.sup.10Fn3) domain. In such proteins, compound binding is
preferably mediated by either one, two, or three .sup.10Fn3 loops.
In other preferred embodiments, the second loop of .sup.10Fn3 may
be extended in length relative to the naturally-occurring module,
or the .sup.10Fn3 may lack an integrin-binding motif. In these
molecules, the integrin-binding motif may be replaced by an amino
acid sequence in which a basic amino acid-neutral amino acid-acidic
amino acid sequence (in the N-terminal to C-terminal direction)
replaces the integrin-binding motif; one preferred sequence is
serine-glycine-glutamate. In another preferred embodiment, the
fibronectin type III domain-containing proteins of the invention
lack disulfide bonds.
[0011] Any of the fibronectin type III domain-containing proteins
described herein may be formulated as part of a fusion protein (for
example, a fusion protein which further includes an immunoglobulin
F.sub.c domain, a complement protein, a toxin protein, or an
albumin protein). In addition, any of the fibronectin type III
domain proteins may be covalently bound to a nucleic acid (for
example, an RNA), and the nucleic acid may encode the protein.
Moreover, the protein may be a multimer, or, particularly if it
lacks an integrin-binding motif, it may be formulated in a
physiologically-acceptable carrier.
[0012] The present invention also features proteins that include a
fibronectin type III domain having at least one mutation in a
.beta.-sheet sequence which changes the scaffold structure. Again,
these proteins are characterized by their ability to bind to
compounds that are not bound by the corresponding
naturally-occurring fibronectin.
[0013] In addition, any of the fibronectin scaffolds of the
invention may be immobilized on a solid support (for example, a
bead or chip), and these scaffolds may be arranged in any
configuration on the solid support, including an array.
[0014] In a related aspect, the invention further features nucleic
acids encoding any of the proteins of the invention. In preferred
embodiments, the nucleic acid is DNA or RNA.
[0015] In another related aspect, the invention also features a
method for generating a protein which includes a fibronectin type
III domain and which is pharmaceutically acceptable to a mammal,
involving removing the integrin-binding domain of said fibronectin
type III domain. This method may be applied to any of the
fibronectin type III domain-containing proteins described above and
is particularly useful for generating proteins for human
therapeutic applications. The invention also features such
fibronectin type III domain-containing proteins which lack
integrin-binding domains.
[0016] In yet other related aspects, the invention features
screening methods which may be used to obtain or evolve randomized
fibronectin type III proteins capable of binding to compounds of
interest, or to obtain or evolve compounds (for example, proteins)
capable of binding to a particular protein containing a randomized
fibronectin type III motif. In addition, the invention features
screening procedures which combine these two methods, in any order,
to obtain either compounds or proteins of interest.
[0017] In particular, the first screening method, useful for the
isolation or identification of randomized proteins of interest,
involves: (a) contacting the compound with a candidate protein, the
candidate protein including a fibronectin type III domain having at
least one randomized loop, the contacting being carried out under
conditions that allow compound-protein complex formation; and (b)
obtaining, from the complex, the protein which binds to the
compound.
[0018] The second screening method, for isolating or identifying a
compound which binds to a protein having a randomized fibronectin
type III domain, involves: (a) contacting the protein with a
candidate compound, the contacting being carried out under
conditions that allow compound-protein complex formation; and (b)
obtaining, from the complex, the compound which binds to the
protein.
[0019] In preferred embodiments, the methods further involve either
randomizing at least one loop of the fibronectin type III domain of
the protein obtained in step (b) and repeating steps (a) and (b)
using the further randomized protein, or modifying the compound
obtained in step (b) and repeating steps (a) and (b) using the
further modified compound. In addition, the compound is preferably
a protein, and the fibronectin type III domain is preferably a
mammalian (for example, a human) fibronectin type III domain. In
other preferred embodiments, the protein includes the tenth module
of the fibronectin type III domain (.sup.10Fn3), and binding is
mediated by one, two, or three .sup.10Fn3 loops. In addition, the
second loop of .sup.10Fn3 may be extended in length relative to the
naturally-occurring module, or .sup.10Fn3 may lack an
integrin-binding motif. Again, as described above, the
integrin-binding motif may be replaced by an amino acid sequence in
which a basic amino acid-neutral amino acid-acidic amino acid
sequence (in the N-terminal to C-terminal direction) replaces the
integrin-binding motif; one preferred sequence is
serine-glycine-glutamate.
[0020] The selection methods described herein may be carried out
using any fibronectin type III domain-containing protein. For
example, the fibronectin type III domain-containing protein may
lack disulfide bonds, or may be formulated as part of a fusion
protein (for example, a fusion protein which further includes an
immunoglobulin F.sub.c domain, a complement protein, a toxin
protein, or an albumin protein). In addition, selections may be
carried out using the fibronectin type III domain proteins
covalently bound to nucleic acids (for example, RNAs or any nucleic
acid which encodes the protein). Moreover, the selections may be
carried out using fibronectin domain-containing protein
multimers.
[0021] Preferably, the selections involve the immobilization of the
binding target on a solid support. Preferred solid supports include
columns (for example, affinity columns, such as agarose columns) or
microchips.
[0022] In addition, the invention features diagnostic methods which
employ the fibronectin scaffold proteins of the invention. Such
diagnostic methods may be carried out on a sample (for example, a
biological sample) to detect one analyte or to simultaneously
detect many different analytes in the sample. The method may employ
any of the scaffold molecules described herein. Preferably, the
method involves (a) contacting the sample with a protein which
binds to the compound analyte and which includes a fibronectin type
III domain having at least one randomized loop, the contacting
being carried out under conditions that allow compound-protein
complex formation; and (b) detecting the complex, and therefore the
compound in the sample.
[0023] In preferred embodiments, the protein is immobilized on a
solid support (for example, a chip or bead) and may be immobilized
as part of an array. The protein may be covalently bound to a
nucleic acid, preferably, a nucleic acid, such as RNA, that encodes
the protein. In addition, the compound is often a protein, but may
also be any other analyte in a sample. Detection may be
accomplished by any standard technique including, without
limitation, radiography, fluorescence detection, mass spectroscopy,
or surface plasmon resonance.
[0024] As used herein, by "fibronectin type III domain" is meant a
domain having 7 or 8 beta strands which are distributed between two
beta sheets, which themselves pack against each other to form the
core of the protein, and further containing loops which connect the
beta strands to each other and are solvent exposed. There are at
least three such loops at each edge of the beta sheet sandwich,
where the edge is the boundary of the protein perpendicular to the
direction of the beta strands. Preferably, a fibronectin type III
domain includes a sequence which exhibits at least 30% amino acid
identity, and preferably at least 50% amino acid identity, to the
sequence encoding the structure of the .sup.10Fn3 domain referred
to as "1ttg" (ID="1ttg" (one ttg)) available from the Protein Data
Base. Sequence identity referred to in this definition is
determined by the Homology program, available from Molecular
Simulation (San Diego, Calif.). The invention further includes
polymers of .sup.10Fn3-related molecules, which are an extension of
the use of the monomer structure, whether or not the subunits of
the polyprotein are identical or different in sequence.
[0025] By "naturally occurring fibronectin" is meant any
fibronectin protein that is encoded by a living organism.
[0026] By "randomized" is meant including one or more amino acid
alterations relative to a template sequence.
[0027] By a "protein" is meant any sequence of two or more amino
acids, regardless of length, post-translation modification, or
function. "Protein" and "peptide" are used interchangeably
herein.
[0028] By "RNA" is meant a sequence of two or more covalently
bonded, naturally occurring or modified ribonucleotides. One
example of a modified RNA included within this term is
phosphorothioate RNA.
[0029] By "DNA" is meant a sequence of two or more covalently
bonded, naturally occurring or modified deoxyribonucleotides.
[0030] By a "nucleic acid" is meant any two or more covalently
bonded nucleotides or nucleotide analogs or derivatives. As used
herein, this term includes, without limitation, DNA, RNA, and
PNA.
[0031] By "pharmaceutically acceptable" is meant a compound or
protein that may be administered to an animal (for example, a
mammal) without significant adverse medical consequences.
[0032] By "physiologically acceptable carrier" is meant a carrier
which does not have a significant detrimental impact on the treated
host and which retains the therapeutic properties of the compound
with which it is administered. One exemplary physiologically
acceptable carrier is physiological saline. Other physiologically
acceptable carriers and their formulations are known to one skilled
in the art and are described, for example, in Remington's
Pharmaceutical Sciences, (18.sup.th edition), ed. A. Gennaro, 1990,
Mack Publishing Company, Easton, Pa., incorporated herein by
reference.
[0033] By "selecting" is meant substantially partitioning a
molecule from other molecules in a population. As used herein, a
"selecting" step provides at least a 2-fold, preferably, a 30-fold,
more preferably, a 100-fold, and, most preferably, a 1000-fold
enrichment of a desired molecule relative to undesired molecules in
a population following the selection step. A selection step may be
repeated any number of times, and different types of selection
steps may be combined in a given approach.
[0034] By "binding partner," as used herein, is meant any molecule
which has a specific, covalent or non-covalent affinity for a
portion of a desired compound (for example, protein) of interest.
Examples of binding partners include, without limitation, members
of antigen/antibody pairs, protein/inhibitor pairs, receptor/ligand
pairs (for example cell surface receptor/ligand pairs, such as
hormone receptor/peptide hormone pairs), enzyme/substrate pairs
(for example, kinase/substrate pairs), lectin/carbohydrate pairs,
oligomeric or heterooligomeric protein aggregates, DNA binding
protein/DNA binding site pairs, RNA/protein pairs, and nucleic acid
duplexes, heteroduplexes, or ligated strands, as well as any
molecule which is capable of forming one or more covalent or
non-covalent bonds (for example, disulfide bonds) with any portion
of another molecule (for example, a compound or protein).
[0035] By a "solid support" is meant, without limitation, any
column (or column material), bead, test tube, microtiter dish,
solid particle (for example, agarose or sepharose), microchip (for
example, silicon, silicon-glass, or gold chip), or membrane (for
example, the membrane of a liposome or vesicle) to which a
fibronectin scaffold or an affinity complex may be bound, either
directly or indirectly (for example, through other binding partner
intermediates such as other antibodies or Protein A), or in which a
fibronectin scaffold or an affinity complex may be embedded (for
example, through a receptor or channel).
[0036] The present invention provides a number of advantages. For
example, as described in more detail below, the present antibody
mimics exhibit improved biophysical properties, such as stability
under reducing conditions and solubility at high concentrations. In
addition, these molecules may be readily expressed and folded in
prokaryotic systems, such as E. coli, in eukaryotic systems, such
as yeast, and in in vitro translation systems, such as the rabbit
reticulocyte lysate system. Moreover, these molecules are extremely
amenable to affinity maturation techniques involving multiple
cycles of selection, including in vitro selection using RNA-protein
fusion technology (Roberts and Szostak, Proc. Natl. Acad. Sci USA
94:12297, 1997; Szostak et al., U.S. Ser. No. 09/007,005 and U.S.
Ser. No. 09/247,190; Szostak et al. WO98/31700), phage display
(see, for example, Smith and Petrenko, Chem. Rev. 97:317, 1997),
and yeast display systems (see, for example, Boder and Wittrup,
Nature Biotech. 15:553, 1997).
[0037] Other features and advantages of the present invention will
be apparent from the following detailed description thereof, and
from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] FIG. 1 is a photograph showing a comparison between the
structures of antibody heavy chain variable regions from camel
(dark blue) and llama (light blue), in each of two
orientations.
[0039] FIG. 2 is a photograph showing a comparison between the
structures of the camel antibody heavy chain variable region (dark
blue), the llama antibody heavy chain variable region (light blue),
and a fibronectin type III module number 10 (.sup.10Fn3)
(yellow).
[0040] FIG. 3 is a photograph showing a fibronectin type III module
number 10 (.sup.10Fn3), with the loops corresponding to the
antigen-binding loops in IgG heavy chains highlighted in red.
[0041] FIG. 4 is a graph illustrating a sequence alignment between
a fibronectin type III protein domain and related protein
domains.
[0042] FIG. 5 is a photograph showing the structural similarities
between a .sup.10Fn3 domain and 15 related proteins, including
fibronectins, tenascins, collagens, and undulin. In this
photograph, the regions are labeled as follows: constant, dark
blue; conserved, light blue; neutral, white; variable, red; and RGB
integrin-binding motif (variable), yellow.
[0043] FIG. 6 is a photograph showing space filling models of
fibronectin III modules 9 and 10, in each of two different
orientations. The two modules and the integrin binding loop (RGB)
are labeled. In this figure, blue indicates positively charged
residues, red indicates negatively charged residues, and white
indicates uncharged residues.
[0044] FIG. 7 is a photograph showing space filling models of
fibronectin III modules 7-10, in each of three different
orientiations. The four modules are labeled. In this figure, blue
indicates positively charged residues, red indicates negatively
charged residues, and white indicates uncharged residues.
[0045] FIG. 8 is a photograph illustrating the formation, under
different salt conditions, of RNA-protein fusions which include
fibronectin type III domains.
[0046] FIG. 9 is a series of photographs illustrating the selection
of fibronectin type III domain-containing RNA-protein fusions, as
measured by PCR signal analysis.
[0047] FIG. 10 is a graph illustrating an increase in the percent
TNF-.alpha. binding during the selections described herein, as well
as a comparison between RNA-protein fusion and free protein
selections.
[0048] FIG. 11 is a series of schematic representations showing
IgG, .sup.10Fn3, Fn-CH.sub.1--CH.sub.2--CH.sub.3, and
Fn-CH.sub.2--CH.sub.3 (clockwise from top left).
[0049] FIG. 12 is a photograph showing a molecular model of
Fn-CH.sub.1--CH.sub.2--CH.sub.3 based on known three-dimensional
structures of IgG (X-ray crystallography) and .sup.10Fn3 (NMR and
X-ray crystallography).
[0050] FIG. 13 is a graph showing the time course of an exemplary
.sup.10Fn3-based nucleic acid-protein fusion selection of
TNF-.alpha. binders. The proportion of nucleic acid-protein fusion
pool (open diamonds) and free protein pool (open circles) that
bound to TNF-.alpha.-Sepharose, and the proportion of free protein
pool (full circles) that bound to underivatized Sepharose, are
shown.
[0051] FIGS. 14 and 15 are graphs illustrating TNF-.alpha. binding
by TNF-.alpha. Fn-binders. In particular, these figures show mass
spectra data obtained from a .sup.10Fn3 fusion chip and non-fusion
chip, respectively.
[0052] FIGS. 16 and 17 are the phosphorimage and fluorescence scan,
respectively, of a .sup.10Fn3 array, illustrating TNF-.alpha.
binding.
DETAILED DESCRIPTION
[0053] The novel antibody mimics described herein have been
designed to be superior both to antibody-derived fragments and to
non-antibody frameworks, for example, those frameworks described
above.
[0054] The major advantage of these antibody mimics over antibody
fragments is structural. These scaffolds are derived from whole,
stable, and soluble structural modules found in human body fluid
proteins. Consequently, they exhibit better folding and
thermostability properties than antibody fragments, whose creation
involves the removal of parts of the antibody native fold, often
exposing amino acid residues that, in an intact antibody, would be
buried in a hydrophobic environment, such as an interface between
variable and constant domains. Exposure of such hydrophobic
residues to solvent increases the likelihood of aggregation.
[0055] In addition, the antibody mimics described herein have no
disulfide bonds, which have been reported to retard or prevent
proper folding of antibody fragments under certain conditions.
Since the present scaffolds do not rely on disulfides for native
fold stability, they are stable under reducing conditions, unlike
antibodies and their fragments which unravel upon disulfide bond
breakdown.
[0056] Moreover, these fibronectin-based scaffolds provide the
functional advantages of antibody molecules. In particular, despite
the fact that the .sup.10Fn3 module is not an immunoglobulin, its
overall fold is close to that of the variable region of the IgG
heavy chain (FIG. 2), making it possible to display the three
fibronectin loops analogous to CDRs in relative orientations
similar to those of native antibodies. Because of this structure,
the present antibody mimics possess antigen binding properties that
are similar in nature and affinity to those of antibodies, and a
loop randomization and shuffling strategy may be employed in vitro
that is similar to the process of affinity maturation of antibodies
in vivo.
[0057] There are now described below exemplary fibronectin-based
scaffolds and their use for identifying, selecting, and evolving
novel binding proteins as well as their target ligands. These
examples are provided for the purpose of illustrating, and not
limiting, the invention.
[0058] .sup.10Fn3 Structural Motif
[0059] The antibody mimics of the present invention are based on
the structure of a fibronectin module of type III (Fn3), a common
domain found in mammalian blood and structural proteins. This
domain occurs more than 400 times in the protein sequence database
and has been estimated to occur in 2% of the proteins sequenced to
date, including fibronectins, tenscin, intracellular cytoskeletal
proteins, and prokaryotic enzymes (Bork and Doolittle, Proc. Natl.
Acad. Sci. USA 89:8990, 1992; Bork et al., Nature Biotech. 15:553,
1997; Meinke et al., J. Bacteriol. 175:1910, 1993; Watanabe et al.,
J. Biol. Chem. 265:15659, 1990). In particular, these scaffolds
include, as templates, the tenth module of human Fn3 (.sup.10Fn3),
which comprises 94 amino acid residues. The overall fold of this
domain is closely related to that of the smallest functional
antibody fragment, the variable region of the heavy chain, which
comprises the entire antigen recognition unit in camel and llama
IgG (FIGS. 1, 2). The major differences between camel and llama
domains and the .sup.10Fn3 domain are that (i) .sup.10Fn3 has fewer
beta strands (seven vs. nine) and (ii) the two beta sheets packed
against each other are connected by a disulfide bridge in the camel
and llama domains, but not in .sup.10Fn3.
[0060] The three loops of .sup.10Fn3 corresponding to the
antigen-binding loops of the IgG heavy chain run between amino acid
residues 21-31, 51-56, and 76-88 (FIG. 3). The length of the first
and the third loop, 11 and 12 residues, respectively, fall within
the range of the corresponding antigen-recognition loops found in
antibody heavy chains, that is, 10-12 and 3-25 residues,
respectively. Accordingly, once randomized and selected for high
antigen affinity, these two loops make contacts with antigens
equivalent to the contacts of the corresponding loops in
antibodies.
[0061] In contrast, the second loop of .sup.10Fn3 is only 6
residues long, whereas the corresponding loop in antibody heavy
chains ranges from 16-19 residues. To optimize antigen binding,
therefore, the second loop of .sup.10Fn3 is preferably extended by
10-13 residues (in addition to being randomized) to obtain the
greatest possible flexibility and affinity in antigen binding.
Indeed, in general, the lengths as well as the sequences of the
CDR-like loops of the antibody mimics may be randomized during in
vitro or in vivo affinity maturation (as described in more detail
below).
[0062] The tenth human fibronectin type III domain, .sup.10Fn3,
refolds rapidly even at low temperature; its backbone conformation
has been recovered within 1 second at 5.degree. C. Thermodynamic
stability of .sup.10Fn3 is high (.DELTA.G.sub.u=24 kJ/mol=5.7
kcal/mol), correlating with its high melting temperature of
110.degree. C.
[0063] One of the physiological roles of .sup.10Fn3 is as a subunit
of fibronectin, a glycoprotein that exists in a soluble form in
body fluids and in an insoluble form in the extracellular matrix
(Dickinson et al., J. Mol. Biol. 236:1079, 1994). A fibronectin
monomer of 220-250 kD contains 12 type I modules, two type II
modules, and 17 fibronectin type III modules (Potts and Campbell,
Curr. Opin. Cell Biol. 6:648, 1994). Different type III modules are
involved in the binding of fibronectin to integrins, heparin, and
chondroitin sulfate. .sup.10Fn3 was found to mediate cell adhesion
through an integrin-binding Arg-Gly-Asp (RGD) motif on one of its
exposed loops. Similar RGD motifs have been shown to be involved in
integrin binding by other proteins, such as fibrinogen, von
Wellebrand factor, and vitronectin (Hynes et al., Cell 69:11,
1992). No other matrix- or cell-binding roles have been described
for .sup.10Fn3.
[0064] The observation that .sup.10Fn3 has only slightly more
adhesive activity than a short peptide containing RGD is consistent
with the conclusion that the cell-binding activity of .sup.10Fn3 is
localized in the RGD peptide rather than distributed throughout the
.sup.10Fn3 structure (Baron et al., Biochemistry 31:2068, 1992).
The fact that .sup.10Fn3 without the RGD motif is unlikely to bind
to other plasma proteins or extracellular matrix makes .sup.10Fn3 a
useful scaffold to replace antibodies. In addition, the presence of
.sup.10Fn3 in natural fibrinogen in the bloodstream suggests that
.sup.10Fn3 itself is unlikely to be immunogenic in the organism of
origin.
[0065] In addition, we have determined that the .sup.10Fn3
framework possesses exposed loop sequences tolerant of
randomization, facilitating the generation of diverse pools of
antibody mimics. This determination was made by examining the
flexibility of the .sup.10Fn3 sequence. In particular, the human
.sup.10Fn3 sequence was aligned with the sequences of fibronectins
from other sources as well as sequences of related proteins (FIG.
4), and the results of this alignment were mapped onto the
three-dimensional structure of the human .sup.10Fn3 domain (FIG.
5). This alignment revealed that the majority of conserved residues
are found in the core of the beta sheet sandwich, whereas the
highly variable residues are located along the edges of the beta
sheets, including the N- and C-termini, on the solvent-accessible
faces of both beta sheets, and on three solvent-accessible loops
that serve as the hypervariable loops for affinity maturation of
the antibody mimics. In view of these results, the randomization of
these three loops are unlikely to have an adverse effect on the
overall fold or stability of the .sup.10Fn3 framework itself.
[0066] For the human .sup.10Fn3 sequence, this analysis indicates
that, at a minimum, amino acids 1-9, 44-50, 61-54, 82-94 (edges of
beta sheets); 19, 21, 30-46 (even), 79-65 (odd) (solvent-accessible
faces of both beta sheets); 21-31, 51-56, 76-88 (CDR-like
solvent-accessible loops); and 14-16 and 36-45 (other
solvent-accessible loops and beta turns) may be randomized to
evolve new or improved compound-binding proteins. In addition, as
discussed above, alterations in the lengths of one or more solvent
exposed loops may also be included in such directed evolution
methods. Alternatively, changes in the .beta.-sheet sequences may
also be used to evolve new proteins. These mutations change the
scaffold and thereby indirectly alter loop structure(s). If this
approach is taken, mutations should not saturate the sequence, but
rather few mutations should be introduced. Preferably, no more than
10 amino acid changes, and, more preferably, no more than 3 amino
acid changes should be introduced to the .beta.-sheet sequences by
this approach.
[0067] Fibronectin Fusions
[0068] The antibody mimics described herein may be fused to other
protein domains. For example, these mimics may be integrated with
the human immune response by fusing the constant region of an IgG
(F.sub.c) with a .sup.10Fn3 module, preferably through the
C-terminus of .sup.10Fn3. The F.sub.c in such a .sup.10Fn3-F.sub.c
fusion molecule activates the complement component of the immune
response and increases the therapeutic value of the antibody mimic.
Similarly, a fusion between .sup.10Fn3 and a complement protein,
such as C1q, may be used to target cells, and a fusion between
.sup.10Fn3 and a toxin may be used to specifically destroy cells
that carry a particular antigen. In addition, .sup.10Fn3 in any
form may be fused with albumin to increase its half-life in the
bloodstream and its tissue penetration. Any of these fusions may be
generated by standard techniques, for example, by expression of the
fusion protein from a recombinant fusion gene constructed using
publically available gene sequences.
[0069] Fibronectin Scaffold Multimers
[0070] In addition to fibronectin monomers, any of the fibronectin
constructs described herein may be generated as dimers or multimers
of .sup.10Fn3-based antibody mimics as a means to increase the
valency and thus the avidity of antigen binding. Such multimers may
be generated through covalent binding between individual .sup.10Fn3
modules, for example, by imitating the natural
.sup.8Fn3-.sup.9Fn3-.sup.10Fn3 C-to-N-terminus binding or by
imitating antibody dimers that are held together through their
constant regions. A .sup.10Fn3-Fc construct may be exploited to
design dimers of the general scheme of
.sup.10Fn3-Fc::Fc-.sup.10Fn3. The bonds engineered into the Fc::Fc
interface may be covalent or non-covalent. In addition, dimerizing
or multimerizing partners other than Fc can be used in .sup.10Fn3
hybrids to create such higher order structures.
[0071] In particular examples, covalently bonded multimers may be
generated by constructing fusion genes that encode the multimer or,
alternatively, by engineering codons for cysteine residues into
monomer sequences and allowing disulfide bond formation to occur
between the expression products. Non-covalently bonded multimers
may also be generated by a variety of techniques. These include the
introduction, into monomer sequences, of codons corresponding to
positively and/or negatively charged residues and allowing
interactions between these residues in the expression products (and
therefore between the monomers) to occur. This approach may be
simplified by taking advantage of charged residues naturally
present in a monomer subunit, for example, the negatively charged
residues of fibronectin. Another means for generating
non-covalently bonded antibody mimics is to introduce, into the
monomer gene (for example, at the amino- or carboxy-termini), the
coding sequences for proteins or protein domains known to interact.
Such proteins or protein domains include coil-coil motifs, leucine
zipper motifs, and any of the numerous protein subunits (or
fragments thereof) known to direct formation of dimers or higher
order multimers.
[0072] Fibronectin-Like Molecules
[0073] Although .sup.10Fn3 represents a preferred scaffold for the
generation of antibody mimics, other molecules may be substituted
for .sup.10Fn3 in the molecules described herein. These include,
without limitation, human fibronectin modules .sup.1Fn3-.sup.9Fn3
and .sup.11Fn3-.sup.17Fn3 as well as related Fn3 modules from
non-human animals and prokaryotes. In addition, Fn3 modules from
other proteins with sequence homology to .sup.10Fn3, such as
tenascins and undulins, may also be used. Modules from different
organisms and parent proteins may be most appropriate for different
applications; for example, in designing an antibody mimic, it may
be most desirable to generate that protein from a fibronectin or
fibronectin-like molecule native to the organism for which a
therapeutic or diagnostic molecule is intended.
[0074] Directed Evolution of Scaffold-Based Binding Proteins
[0075] The antibody mimics described herein may be used in any
technique for evolving new or improved binding proteins. In one
particular example, the target of binding is immobilized on a solid
support, such as a column resin or microtiter plate well, and the
target contacted with a library of candidate scaffold-based binding
proteins. Such a library may consist of .sup.10Fn3 clones
constructed from the wild type .sup.10Fn3 scaffold through
randomization of the sequence and/or the length of the .sup.10Fn3
CDR-like loops. If desired, this library may be an RNA-protein
fusion library generated, for example, by the techniques described
in Szostak et al., U.S. Ser. Nos. 09/007,005 and 09/247,190;
Szostak et al., WO98/31700; and Roberts & Szostak, Proc. Natl.
Acad. Sci. USA (1997) vol. 94, p. 12297-12302. Alternatively, it
may be a DNA-protein library (for example, as described in Lohse,
DNA-Protein Fusions and Uses Thereof, U.S. Ser. No. 60/110,549,
U.S. Ser. No. 09/459,190, and US 99/28472). The fusion library is
incubated with the immobilized target, the support is washed to
remove non-specific binders, and the tightest binders are eluted
under very stringent conditions and subjected to PCR to recover the
sequence information or to create a new library of binders which
may be used to repeat the selection process, with or without
further mutagenesis of the sequence. A number of rounds of
selection may be performed until binders of sufficient affinity for
the antigen are obtained.
[0076] In one particular example, the .sup.10Fn3 scaffold may be
used as the selection target. For example, if a protein is required
that binds a specific peptide sequence presented in a ten residue
loop, a single .sup.10Fn3 clone is constructed in which one of its
loops has been set to the length of ten and to the desired
sequence. The new clone is expressed in vivo and purified, and then
immobilized on a solid support. An RNA-protein fusion library based
on an appropriate scaffold is then allowed to interact with the
support, which is then washed, and desired molecules eluted and
re-selected as described above.
[0077] Similarly, the .sup.10Fn3 scaffold may be used to find
natural proteins that interact with the peptide sequence displayed
in a .sup.10Fn3 loop. The .sup.10Fn3 protein is immobilized as
described above, and an RNA-protein fusion library is screened for
binders to the displayed loop. The binders are enriched through
multiple rounds of selection and identified by DNA sequencing.
[0078] In addition, in the above approaches, although RNA-protein
libraries represent exemplary libraries for directed evolution, any
type of scaffold-based library may be used in the selection methods
of the invention.
[0079] Use
[0080] The antibody mimics described herein may be evolved to bind
any antigen of interest. These proteins have thermodynamic
properties superior to those of natural antibodies and can be
evolved rapidly in vitro. Accordingly, these antibody mimics may be
employed in place of antibodies in all areas in which antibodies
are used, including in the research, therapeutic, and diagnostic
fields. In addition, because these scaffolds possess solubility and
stability properties superior to antibodies, the antibody mimics
described herein may also be used under conditions which would
destroy or inactivate antibody molecules. Finally, because the
scaffolds of the present invention may be evolved to bind virtually
any compound, these molecules provide completely novel binding
proteins which also find use in the research, diagnostic, and
therapeutic areas.
[0081] Experimental Results
[0082] Exemplary scaffold molecules described above were generated
and tested, for example, in selection protocols, as follows.
[0083] Library construction
[0084] A complex library was constructed from three fragments, each
of which contained one randomized area corresponding to a CDR-like
loop. The fragments were named BC, DE, and FG, based on the names
of the CDR-H-like loops contained within them; in addition to
.sup.10Fn3 and a randomized sequence, each of the fragments
contained stretches encoding an N-terminal His.sub.6 domain or a
C-terminal FLAG peptide tag. At each junction between two fragments
(i.e., between the BC and DE fragments or between the DE and FG
fragments), each DNA fragment contained recognition sequences for
the EarI Type IIS restriction endonuclease. This restriction enzyme
allowed the splicing together of adjacent fragments while removing
all foreign, non-.sup.10Fn3, sequences. It also allows for a
recombination-like mixing of the three .sup.10Fn3 fragments between
cycles of mutagenesis and selection.
[0085] Each fragment was assembled from two overlapping
oligonucleotides, which were first annealed, then extended to form
the double-stranded DNA form of the fragment. The oligonucleotides
that were used to construct and process the three fragments are
listed below; the "Top" and "Bottom" species for each fragment are
the oligonucleotides that contained the entire .sup.10Fn3 encoding
sequence. In these oligonucleotides designations, "N" indicates A,
T, C, or G; and "S" indicates C or G.
1 HfnLbcTop (His): 5'-GG AAT TCC TAA TAC GAC TCA CTA (SEQ ID NO: 1)
TAG GGA CAA TTA CTA TTT ACA ATT ACA ATG CAT CAC CAT CAC CAT CAC GTT
TCT GAT GTT CCG AGG GAC CTG GAA GTT GTT GCT GCG ACC CCC ACC AGC-3'
HfnLbcTop (an alternative N-terminus): 5'-GG AAT TCC TAA TAC GAC
TCA CTA (SEQ ID NO: 2) TAG GGA CAA TTA CTA TTT ACA ATT ACA ATG GTT
TCT GAT GTT CCG AAG GAC CTG GAA GTT GTT GCT GCG ACC CCC ACC AGC-3'
HFnLBCBot-flag8: 5'-AGC GGA TGC CTT GTC GTC GTC GTC (SEQ ID NO: 3)
CTT GTA GTC GCT CTT CCC TGT TTC TCC GTA AGT GAT CCT GTA ATA TCT
(SNN)7 CCA GCT GAT CAG TAG GCT GGT GGG GGT CGC AGC-3'
HFnBC3'-flag8: 5'-AGC GGA TGC CTT GTC GTC GTC GTC (SEQ ID NO: 4)
CTT GTA GTC GCT CTT CCC TGT TTC TCC GTA AGT GAT CC-3' HFnLDETop:
5'-GG AAT TCC TAA TAC GAC TCA CTA (SEQ ID NO: 5) TAG GGA CAA TTA
CTA TTT ACA ATT ACA ATG CAT CAC CAT CAC CAT CAC CTC TTC ACA GGA GGA
AAT AGC CCT GTC C-3' HFnLDEBot-flag8: 5'-AGC GGA TGC CTT GTC GTC
GTC GTC (SEQ ID NO: 6) CTT GTA GTC GCT CTT CGT ATA ATC AAC TCC AGG
TTT AAG GCC GCT GAT GGT AGC TGT (SNN)4 AGG CAC AGT GAA CTC CTG GAC
AGG GCT ATT TCC TCC TGT-3' HFnDE3'-flag8: 5'-AGC GGA TGC CTT GTC
GTC GTC GTC (SEQ ID NO: 7) CTT GTA GTC GCT CTT CGT ATA ATC AAC TCC
AGG TTT AAG G-3' HFnLFGTop: 5'-GG AAT TCC TAA TAC GAC TCA CTA (SEQ
ID NO: 8) TAG GGA CAA TTA CTA TTT ACA ATT ACA ATG CAT CAC CAT CAC
CAT CAC CTC TTC TAT ACC ATC ACT GTG TAT GCT GTC-3' HFnLFGBot-flag8:
5'-AGC GGA TGC CTT GTC GTC GTC GTC (SEQ ID NO: 9) CTT GTA GTC TGT
TCG GTA ATT AAT GGA AAT TGG (SNN)10 AGT GAC AGC ATA CAC AGT GAT GGT
ATA-3' HFnFG3'-flag8: 5'-AGC GGA TGC CTT GTC GTC GTC GTC (SEQ ID
NO: 10) CTT GTA GTC TGT TCG GTA ATT AAT GGA AAT TGG-3' T7Tmv
(introduces T7 promoter and TMV untranslated region needed for in
vitro translation): 5'-GCG TAA TAC GAC TCA CTA TAG GGA (SEQ ID NO:
11) CAA TTA CTA TTT ACA ATT ACA-3' ASAflag8: 5'-AGC GGA TGC CTT GTC
GTC GTC GTC (SEQ ID NO: 12) CTT GTA TGC-3' Unispl-s (spint
oligonucleotide used to ligate mRNA to the puromycin-containing
linker, described by Roberts et al, 1997, supra):
5'-TTTTTTTTTNAGCGGATGC-3' (SEQ ID NO: 13) A18--2PEG (DNA-puromycin
linker): 5'-(A)18(PEG)2CCPur (SEQ ID NO: 14)
[0086] The pairs of oligonucleotides (500 pmol of each) were
annealed in 100 .mu.L of 10 mM Tris 7.5, 50 mM NaCl for 10 minutes
at 85.degree. C., followed by a slow (0.5-1 hour) cooling to room
temperature. The annealed fragments with single-stranded overhangs
were then extended using 100 U Klenow (New England Biolabs,
Beverly, Mass.) for each 100 .mu.L aliquot of annealed oligos, and
the buffer made of 838.5 .mu.l H.sub.2O, 9 .mu.l 1 M Tris 7.5, 5
.mu.l 1 M MgCl.sub.2, 20 .mu.l 10 mM dNTPs, and 7.5 .mu.l 1M DTT.
The extension reactions proceeded for 1 hour at 25.degree. C.
[0087] Next, each of the double-stranded fragments was transformed
into a RNA-protein fusion (PROfusion.TM.) using the technique
developed by Szostak et al., U.S. Ser. No. 09/007,005 and U.S. Ser.
No. 09/247,190; Szostak et al., WO98/31700; and Roberts &
Szostak, Proc. Natl. Acad. Sci. USA (1997) vol. 94, p. 12297-12302.
Briefly, the fragments were transcribed using an Ambion in vitro
transcription kit, MEGAshortscript (Ambion, Austin, Tex.), and the
resulting mRNA was gel-purified and ligated to a DNA-puromycin
linker using DNA ligase. The mRNA-DNA-puromycin molecule was then
translated using the Ambion rabbit reticulocyte lysate-based
translation kit. The resulting mRNA-DNA-puromycin-protein
PROfusion.TM. was purified using Oligo(dT) cellulose, and a
complementary DNA strand was synthesized using reverse
transcriptase and the RT primers described above (Unisplint-S or
flagASA), following the manufacturer's instructions.
[0088] The PROfusion.TM. obtained for each fragment was next
purified on the resin appropriate to its peptide purification tag,
i.e., on Ni-NTA agarose for the His.sub.6-tag and M2 agarose for
the FLAG-tag, following the procedure recommended by the
manufacturer. The DNA component of the tag-binding PROfusions.TM.
was amplified by PCR using Pharmacia Ready-to-Go PCR Beads, 10 pmol
of 5' and 3' PCR primers, and the following PCR program (Pharmacia,
Piscataway, N.J.): Step 1: 95.degree. C. for 3 minutes; Step 2:
95.degree. C. for 30 seconds, 58/62.degree. C. for 30 seconds,
72.degree. C. for 1 minute, 20/25/30 cycles, as required; Step 3:
72.degree. C. for 5 minutes; Step 4: 4.degree. C. until end.
[0089] The resulting DNA was cleaved by 5 U EarI (New England
Biolabs) per1 ug DNA; the reaction took place in T4 DNA Ligase
Buffer (New England Biolabs) at 37.degree. C., for 1 hour, and was
followed by an incubation at 70.degree. C. for 15 minutes to
inactivate Ear I. Equal amounts of the BC, DE, and FG fragments
were combined and ligated to form a full-length .sup.10Fn3 gene
with randomized loops. The ligation required 10 U of fresh Earl
(New England Biolabs) and 20 U of T4 DNA Ligase (Promega, Madison,
Wis.), and took 1 hour at 37.degree. C.
[0090] Three different libraries were made in the manner described
above. Each contained the form of the FG loop with 10 randomized
residues. The BC and the DE loops of the first library bore the
wild type .sup.10Fn3 sequence; a BC loop with 7 randomized residues
and a wild type DE loop made up the second library; and a BC loop
with 7 randomized residues and a DE loop with 4 randomized residues
made up the third library. The complexity of the FG loop in each of
these three libraries was 10.sup.13; the further two randomized
loops provided the potential for a complexity too large to be
sampled in a laboratory.
[0091] The three libraries constructed were combined into one
master library in order to simplify the selection process; target
binding itself was expected to select the most suitable library for
a particular challenge. PROfusions.TM. were obtained from the
master library following the general procedure described in Szostak
et al., U.S. Ser. Nos. 09/007,005 and 09/247,190; Szostak et al.,
WO98/31700; and Roberts & Szostak, Proc. Natl. Acad. Sci. USA
(1997) vol. 94, p. 12297-12302 (FIG. 8).
[0092] Fusion Selections
[0093] The master library in the PROfusion.TM. form was subjected
to selection for binding to TNF-.alpha.. Two protocols were
employed: one in which the target was immobilized on an agarose
column and one in which the target was immobilized on a BIACORE
chip. First, an extensive optimization of conditions to minimize
background binders to the agarose column yielded the favorable
buffer conditions of 50 mM HEPES pH 7.4, 0.02% Triton, 100 .mu.g/ml
Sheared Salmon Sperm DNA. In this buffer, the non-specific binding
of the .sup.10Fn3 RNA fusion to TNF-.alpha. Sepharose was 0.3%. The
non-specific binding background of the .sup.10Fn3 RNA-DNA to
TNF-.alpha. Sepharose was found to be 0.1%.
[0094] During each round of selection on TNF-.alpha. Sepharose, the
Profusion.TM. library was first preincubated for an hour with
underivatized Sepharose to remove any remaining non-specific
binders; the flow-through from this pre-clearing was incubated for
another hour with TNF-.alpha. Sepharose. The TNF-.alpha. Sepharose
was washed for 3-30 minutes.
[0095] After each selection, the PROfusion.TM. DNA that had been
eluted from the solid support with 0.3 M NaOH or 0.1M KOH was
amplified by PCR; a DNA band of the expected size persisted through
multiple rounds of selection (FIG. 9); similar results were
observed in the two alternative selection protocols, and only the
data from the agarose column selection is shown in FIG. 9.
[0096] In the first seven rounds, the binding of library
PROfusions.TM. to the target remained low; in contrast, when free
protein was translated from DNA pools at different stages of the
selection, the proportion of the column binding species increased
significantly between rounds (FIG. 10). Similar selections may be
carried out with any other binding species target (for example,
IL-1 and IL-13).
[0097] Animal Studies
[0098] Wild-type .sup.10Fn3 contains an integrin-binding
tripepetide motif, Arginine 78-Glycine 79-Aspartate 80 (the "RGD
motif`H) at the tip of the FG loop. In order to avoid integrin
binding and a potential inflammatory response based on this
tripeptide in vivo, a mutant form of .sup.10Fn3 was generated that
contained an inert sequence, Serine 78-Glycine 79-Glutamate 80 (the
"SGE mutant"), a sequence which is found in the closely related,
wild-type .sup.11Fn3 domain. This SGE mutant was expressed as an
N-terminally His.sub.6-tagged, free protein in E. coli, and
purified to homogeneity on a metal chelate column followed by a
size exclusion column.
[0099] In particular, the DNA sequence encoding
His.sub.6-.sup.10Fn3(SGE) was cloned into the pET9a expression
vector and transformed into BL21 DE3 pLysS cells. The culture was
then grown in LB broth containing 50 .mu.g/mL kanamycin at
37.degree. C., with shaking, to A.sub.560=1.0, and was then induced
with 0.4 mM IPTG. The induced culture was further incubated, under
the same conditions, overnight (14-18 hours); the bacteria were
recovered by standard, low speed centrifugation. The cell pellet
was resuspended in {fraction (1/50)} of the original culture volume
of lysis buffer (50 mM Tris 8.0, 0.5 M NaCl, 5% glycerol, 0.05%
Triton X-100, and 1 mM PMSF), and the cells were lysed by passing
the resulting paste through a Microfluidics Corporation
Microfluidizer M 110-EH, three times. The lysate was clarified by
centrifugation, and the supernatant was filtered through a 0.45
.mu.m filter followed by filtration through a 0.2 .mu.m filter. 100
mL of the clarified lysate was loaded onto a 5 mL Talon cobalt
column (Clontech, Palo Alto, Calif.), washed by 70 mL of lysis
buffer, and eluted with a linear gradient of 0-30 mM imidazole in
lysis buffer. The flow rate through the column through all the
steps was 1 mL/min. The eluted protein was concentrated 10-fold by
dialysis (MW cutoff=3,500) against 15,000-20,000 PEG. The resulting
sample was dialysed into buffer 1 (lysis buffer without the
glycerol), then loaded, 5 mL at a time, onto a 16.times.60 mm
Sephacryl 100 size exclusion column equilibrated in buffer 1. The
column was run at 0.8 mL/min, in buffer 1; all fractions that
contained a protein of the expected MW were pooled, concentrated
10.times. as described above, then dialyzed into PBS. Toxikon (MA)
was engaged to perform endotoxin screens and animal studies on the
resulting sample.
[0100] In these animal studies, the endotoxin levels in the samples
examined to date have been below the detection level of the assay.
In a preliminary toxicology study, this protein was injected into
two mice at the estimated 100.times. therapeutic dose of 2.6
mg/mouse. The animals survived the two weeks of the study with no
apparent ill effects. These results suggest that .sup.10Fn3 may be
incorporated safely into an IV drug.
[0101] Alternative Constructs for In Vivo Use
[0102] To extend the half life of the 8 kD .sup.10Fn3 domain, a
larger molecule has also been constructed that mimics natural
antibodies. This .sup.10Fn3-F.sub.c molecule contains the
--CH.sub.1 --CH.sub.2--CH.sub.3 (FIG. 11) or --CH.sub.2--CH.sub.3
domains of the IgG constant region of the host; in these
constructs, the .sup.10Fn3 domain is grafted onto the N-terminus in
place of the IgG V.sub.H domain (FIGS. 11 and 12). Such
antibody-like constructs are expected to improve the
pharmacokinetics of the protein as well as its ability to harness
the natural immune response.
[0103] In order to construct the murine form of the
.sup.10Fn3-CH.sub.1--CH.sub.2--CH.sub.3 clone, the
--CH.sub.1--CH.sub.2--CH.sub.3 region was first amplified from a
mouse liver spleen cDNA library (Clontech), then ligated into the
pET25b vector. The primers used in the cloning were 5'Fc Nest and
3' 5 Fc Nest, and the primers used to graft the appropriate
restriction sites onto the ends of the recovered insert were 5'Fc
HIII and 3'Fc Nhe:
2 5' Fc Nest 5' GCG GCA GGG TTT GCT TAC TGG GGC (SEQ ID NO: 15) CAA
GGG 3'; 3' Fc Nest 5' GGG AGG GGT GGA GGT AGG TCA CAG (SEQ ID NO:
16) TCC 3'; 3' Fc Nhe 5' TTT GCT AGC TTT ACC AGG AGA GTG (SEQ ID
NO: 17) GGA GGC 3'; and 5' Fc HIII 5' AAA AAG CTT GCC AAA ACG ACA
CCC (SEQ ID NO: 18) CCA TCT GTC 3'.
[0104] Further PCR is used to remove the CH.sub.1 region from this
clone and create the Fc part of the shorter,
.sup.10Fn3-CH.sub.2--CH.sub.3 clone. The sequence encoding
.sup.10Fn3 is spliced onto the 5' end of each clone; either the
wild type .sup.10Fn3 cloned from the same mouse spleen cDNA library
or a modified .sup.10Fn3 obtained by mutagenesis or randomization
of the molecules can be used. The oligonucleotides used in the
cloning of murine wild-type .sup.10Fn3 were:
3 Mo 5PCR-NdeI: 5' CATATGGTTTCTGATATTCCGAGA (SEQ ID NO: 19)
GATCTGGAG 3'; Mo5PCR-His-NdeI (for an alternative N-terminus with
the His.sub.6 purification tag): 5' CAT ATG CAT CAC CAT CAC CAT CAC
(SEQ ID NO: 20) GTT TCT GAT ATT CCG AGA 3'; and Mo3PCR-EcoRI: 5'
GAATTCCTATGTTTTATAATTG (SEQ ID NO: 21) ATGGAAAC 3'.
[0105] The human equivalents of the clones are constructed using
the same strategy with human oligonucleotide sequences.
[0106] .sup.10Fn3 Scaffolds in Protein Chip Applications
[0107] The suitability of the .sup.10Fn3 scaffold for protein chip
applications is the consequence of (1) its ability to support many
binding functions which can be selected rapidly on the bench or in
an automated setup, and (2) its superior biophysical
properties.
[0108] The versatile binding properties of .sup.10Fn3 are a
function of the loops displayed by the Fn3 immunoglobulin-like,
beta sandwich fold. As discussed above, these loops are similar to
the complementarity determining regions of antibody variable
domains and can cooperate in a way similar to those antibody loops
in order to bind antigens. In our system, .sup.10Fn3 loops BC
(residues 21-30), DE (residues 51-56), and FG (residues 76-87) are
randomized either in sequence, in length, or in both sequence and
length in order to generate diverse libraries of mRNA-.sup.10Fn3
fusions. The binders in such libraries are then enriched based on
their affinity for an immobilized or tagged target, until a small
population of high affinity binders are generated. Also,
error-prone PCR and recombination can be employed to facilitate
affinity maturation of selected binders. Due to the rapid and
efficient selection and affinity maturation protocols, binders to a
large number of targets can be selected in a short time.
[0109] As a scaffold for binders to be immobilized on protein
chips, the .sup.10Fn3 domain has the advantage over antibody
fragments and single-chain antibodies of being smaller and easier
to handle. For example, unlike single-chain scaffolds or isolated
variable domains of antibodies, which vary widely in their
stability and solubility, and which require an oxidizing
environment to preserve their structurally essential disulfide
bonds, .sup.10Fn3 is extremely stable, with a melting temperature
of 110.degree. C., and solubility at a concentration >16 mg/mL.
The .sup.10Fn3 scaffold also contains no disulfides or free
cysteines; consequently, it is insensitive to the redox potential
of its environment. A further advantage of .sup.10Fn3 is that its
antigen-binding loops and N-terminus are on the edge of the
beta-sandwich opposite to the C-terminus; thus the attachment of a
.sup.10Fn3 scaffold to a chip by its C-terminus aligns the
antigen-binding loops, allowing for their greatest accessibility to
the solution being assayed. Since .sup.10Fn3 is a single domain of
only 94 amino acid residues, it is also possible to immobilize it
onto a chip surface at a higher density than is used for
single-chain antibodies, with their approximately 250 residues. In
addition, the hydrophilicity of the .sup.10Fn3 scaffold, which is
reflected in the high solubility of this domain, leads to a lower
than average background binding of .sup.10Fn3 to a chip
surface.
[0110] The stability of the .sup.10Fn3 scaffold as well as its
suitability for library formation and selection of binders are
likely to be shared by the large, Fn3-like class of protein domains
with an immunoglobulin-like fold, such as the domains of tenascin,
N-cadherin, E-cadherin, ICAM, titin, GCSF--R, cytokine receptor,
glycosidase inhibitor, and antibiotic chromoprotein. The key
features shared by all such domains are a stable framework provided
by two beta-sheets, which are packed against each other and which
are connected by at least three solvent-accessible loops per edge
of the sheet; such loops can be randomized to generate a library of
potential binders without disrupting the structure of the framework
(as described above).
[0111] Immobilization of Fibronectin Scaffold Binders
(Fn-binders)
[0112] To immobilize Fn-binders to a chip surface, a number of
exemplary techniques may be utilized. For example, Fn-binders may
be immobilized as RNA-protein fusions by Watson-Crick hybridization
of the RNA moiety of the fusion to a base complementary DNA
immobilized on the chip surface (as described, for example, in
Addressable Protein Arrays, U.S. Ser. No. 60/080,686; U.S. Ser. No.
09/282,734; and WO 99/51773). Alternatively, Fn-binders can be
immobilized as free proteins directly on a chip surface. Manual as
well as robotic devices may be used for deposition of the
Fn-binders on the chip surface. Spotting robots can be used for
deposition of Fn-binders with high density in an array format (for
example, by the method of Lueking et al., Anal Biochem. 1999 May
15;270(1):103-11). Different methods may also be utilized for
anchoring the Fn-binder on the chip surface. A number of standard
immobilization procedures may be used including those described in
Methods in Enzymology (K. Mosbach and B. Danielsson, eds.), vols.
135 and 136, Academic Press, Orlando, Fla., 1987; Nilsson et al.,
Protein Expr. Purif. 1997 October; 11(1): 1-16; and references
therein. Oriented immobilization of Fn-binders can help to increase
the binding capacity of chip-bound Fn-binders. Exemplary approaches
for achieving oriented coupling are described in Lu et al., The
Analyst (1996), vol. 121, p. 29R-32R; and Turkova, J Chromatogr B
Biomed Sci App. 1999 Feb. 5; 722(1-2):11-31. In addition, any of
the methods described herein for anchoring Fn-binders to chip
surfaces can also be applied to the immobilization of Fn-binders on
beads, or other supports.
[0113] Target Protein Capture and Detection
[0114] Selected populations of Fn-binders may be used for detection
and/or quantitation of analyte targets, for example, in samples
such as biological samples. To carry out this type of diagnostic
assay, selected Fn-binders to targets of interest are immobilized
on an appropriate support to form multi-featured protein chips.
Next, a sample is applied to the chip, and the components of the
sample that associate with the Fn-binders are identified based on
the target-specificity of the immobilized binders. Using this
technique, one or more components may be simultaneously identified
or quantitated in a sample (for example, as a means to carry out
sample profiling).
[0115] Methods for target detection allow measuring the levels of
bound protein targets and include, without limitation, radiography,
fluorescence scanning, mass spectroscopy (MS), and surface plasmon
resonance (SPR). Autoradiography using a phosphorimager system
(Molecular Dynamics, Sunnyvale, Calif.) can be used for detection
and quantification of target protein which has been radioactively
labeled, e.g., using .sup.35S methionine. Fluorescence scanning
using a laser scanner (see below) may be used for detection and
quantification of fluorescently labeled targets. Alternatively,
fluorescence scanning may be used for the detection of
fluorescently labeled ligands which themselves bind to the target
protein (e.g., fluorescently labeled target-specific antibodies or
fluorescently labeled streptavidin binding to target-biotin, as
described below).
[0116] Mass spectroscopy can be used to detect and identify bound
targets based on their molecular mass. Desorption of bound target
protein can be achieved with laser assistance directly from the
chip surface as described below. Mass detection also allows
determinations, based on molecular mass, of target modifications
including post-translational modifications like phosophorylation or
glycosylation. Surface plasmon resonance can be used for
quantification of bound protein targets where the Fn-binder(s) are
immobilized on a suitable gold-surface (for example, as obtained
from Biacore, Sweden).
[0117] Described below are exemplary schemes for selecting Fn
binders (in this case, Fn-binders specific for the protein,
TNF-.alpha.) and the use of those selected populations for
detection on chips. This example is provided for the purpose of
illustrating the invention, and should not be construed as
limiting.
[0118] Selection of TNF-.alpha. Binders Based on .sup.10Fn3
Scaffold
[0119] In one exemplary use for fibronectin scaffold selection on
chips, an .sup.10Fn3-based selection was performed against
TNF-.alpha., using a library of human .sup.10Fn3 variants with
randomized loops BC, DE, and FG. The library was constructed from
three DNA fragments, each of which contained-nucleotide sequences
that encoded approximately one third of human .sup.10Fn3, including
one of the randomized loops. The DNA sequences that encoded the
loop residues listed above were rebuilt by oligonucleotide
synthesis, so that the codons for the residues of interest were
replaced by (NNS)n, where N represents any of the four
deoxyribonucleotides (A, C, G, or T), and S represents either C or
G. The C-terminus of each fragment contained the sequence for the
FLAG purification tag.
[0120] Once extended by Klenow, each DNA fragment was transcribed,
ligated to a puromycin-containing DNA linker, and translated in
vitro, as described by Szostak et al. (Roberts and Szostak, Proc.
Natl. Acad. Sci USA. 94:12297, 1997; Szostak et al., U.S. Ser. No.
09/007,005 and U.S. Ser. No. 09/247,190; Szostak et al.,
WO98/31700), to generate an mRNA-peptide fusion, which was then
reverse-transcribed into a DNA-mRNA-peptide fusion. The binding of
the FLAG-tagged peptide to M2 agarose separated full-length fusion
molecules from those containing frameshifts or superfluous stop
codons; the DNA associated with the purified full-length fusion was
amplified by PCR, then the three DNA fragments were cut by Ear I
restriction endonuclease and ligated to form the full length
template. The template was transcribed, ligated to
puromycin-containing DNA linkers, and translated to generate a
.sup.10Fn3-PROfusion.TM. library, which was then
reverse-transcribed to yield the DNA-mRNA-peptide fusion library
which was subsequently used in the selection.
[0121] Selection for TNF-.alpha. binders took place in 50 mM HEPES,
pH 7.4, 0.02% Triton-X, 0.1 mg/mL salmon sperm DNA. The
PROfusion.TM. library was incubated with Sepharose-immobilized
TNF-.alpha.; after washing, the DNA associated with the tightest
binders was eluted with 0.1 M KOH, amplified by PCR, and
transcribed, ligated, translated, and reverse-transcribed into the
starting material for the next round of selection.
[0122] Ten rounds of such selection were performed (as shown in
FIG. 13); they resulted in a PROfusion.TM. pool that bound to
TNF-.alpha.-Sepharose with the apparent average Kd of 120 nM.
Specific clonal components of the pool that were characterized
showed TNF-.alpha. binding in the range of 50-500 nM.
[0123] Fn-binder Immobilization, Target Protein Capture, and
MALDI-TOF Detection
[0124] As a first step toward immobilizing the Fn-binders to a chip
surface, an oligonucleotide capture probe was prepared with an
automated DNA synthesizer (PE BioSystems Expedite 8909) using the
solid-support phosphoramidite approach. All reagents were obtained
from Glen Research. Synthesis was initiated with a solid support
containing a disulfide bond to eventually provide a 3'-terminal
thiol functionality. The first four monomers to be added were
hexaethylene oxide units, followed by 20 T monomers. The
5'-terminal DMT group was not removed. The capture probe was
cleaved from the solid support and deprotected with ammonium
hydroxide, concentrated to dryness in a vacuum centrifuge, and
purified by reverse-phase HPLC using an acetonitrile gradient in
triethylammonium acetate buffer. Appropriate fractions from the
HPLC were collected, evaporated to dryness in a vacuum centrifuge,
and the 5'-terminal DMT group was removed by treatment with 80%
AcOH for 30 minutes. The acid was removed by evaporation, and the
oligonucleotide was then treated with 100 mM DTT for 30 minutes to
cleave the disulfide bond. DTT was removed by repeated extraction
with EtOAc. The oligonucleotide was ethanol precipitated from the
remaining aqueous layer and checked for purity by reverse-phase
HPLC.
[0125] The 3'-thiol capture probe was adjusted to 250 .mu.M in
degassed 1.times.PBS buffer and applied as a single droplet (75
.mu.L) to a 9.times.9 mm gold-coated chip (Biacore) in an
argon-flushed chamber containing a small amount of water. After 18
hours at room temperature, the capture probe solution was removed,
and the functionalized chip was washed with 50 mL 1.times.PBS
buffer (2.times. for 15 minutes each) with gentle agitation, and
then rinsed with 50 .mu.L water (2.times. for 15 minutes each) in
the same fashion. Remaining liquid was carefully removed and the
functionalized chips were either used immediately or stored at
4.degree. C. under argon.
[0126] About 1 pmol of .sup.10Fn3 fusion pool from the Round 10
TNF-.alpha. selection (above) was treated with RNAse A for several
hours, adjusted to 5.times.SSC in 70 .mu.L, and applied to a
functionalized gold chip from above as a single droplet. A 50 .mu.L
volume gasket device was used to seal the fusion mixture with the
functionalized chip, and the apparatus was continuously rotated at
4.degree. C. After 18 hours the apparatus was disassembled, and the
gold chip was washed with 50 mL 5.times.SSC for 10 minutes with
gentle agitation. Excess liquid was carefully removed from the chip
surface, and the chip was passivated with a blocking solution
(1.times.TBS+0.02% Tween-20+0.25% BSA) for 10 minutes at 4.degree.
C. Excess liquid was carefully removed, and a solution containing
500 .mu.g/mL TNF-.alpha. in the same composition blocking solution
was applied to the chip as a single droplet and incubated at
4.degree. C. for two hours with occasional mixing of the droplet
via Pipetman. After removal of the binding solution, the chip was
washed for 5 minutes at 4.degree. C. with gentle agitation (50 mL
1.times.TBS+0.02% Tween-20) and then dried at room temperature. A
second chip was prepared exactly as described above, except fusion
was not added to the hybridization mix.
[0127] Next, MALDI-TOF matrix (15 mg/mL
3,5-dimethoxy-4-hydroxycinnamic acid in 1:1 ethanol/I 0% formic
acid in water) was uniformly applied to the gold chips with a
high-precision 3-axis robot (MicroGrid, BioRobotics). A 16-pin tool
was used to transfer the matrix from a 384-well microtiter plate to
the chips, producing 200 micron diameter features with a 600 micron
pitch. The MALDI-TOF mass spectrometer (Voyager DE, PerSeptive
Biosystems) instrument settings were as follows: Accelerating
Voltage=25 k, Grid Voltage=92%, Guide Wire Voltage=0.05%, Delay=200
on, Laser Power=2400, Low Mass Gate=1500, Negative Ions=off. The
gold chips were individually placed on a MALDI sample stage
modified to keep the level of the chip the same as the level of the
stage, thus allowing proper flight distance. The instrument's video
monitor and motion control system were used to direct the laser
beam to individual matrix features.
[0128] FIGS. 14 and 15 show the mass spectra from the .sup.10Fn3
fusion chip and the non-fusion chip, respectively. In each case, a
small number of 200 micron features were analyzed to collect the
spectra, but FIG. 15 required significantly more acquisitions. The
signal at 17.5 kDa corresponds to TNF-.alpha. monomer.
[0129] Fn-binder Immobilization, Target Protein Capture, and
Fluorescence Detection
[0130] Pre-cleaned 1.times.3 inch glass microscope slides
(Goldseal, #3010) were treated with Nanostrip (Cyantek) for 15
minutes, 10% aqueous NaOH at 70.degree. C. for 3 minutes, and 1%
aqueous HCl for 1 minute, thoroughly rinsing with deionized water
after each reagent. The slides were then dried in a vacuum
desiccator over anhydrous calcium sulfate for several hours. A 1%
solution of aminopropytrimethoxysilane in 95% acetone/5% water was
prepared and allowed to hydrolyze for 20 minutes. The glass slides
were immersed in the hydrolyzed silane solution for 5 minutes with
gentle agitation. Excess silane was removed by subjecting the
slides to ten 5-minute washes, using fresh portions of 95%
acetone/5% water for each wash, with gentle agitation. The slides
were then cured by heating at 110.degree. C. for 20 minutes. The
silane treated slides were immersed in a freshly prepared 0.2%
solution of phenylene 1,4-diisothiocyanate in 90% DMF/10% pyridine
for two hours, with gentle agitation. The slides were washed
sequentially with 90% DMF/10% pyridine, methanol, and acetone.
After air drying, the functionalized slides were stored at
0.degree. C. in a vacuum desiccator over anhydrous calcium sulfate.
Similar results were obtained with commercial amine-reactive slides
(3-D Link, Surmodics).
[0131] Oligonucleotide capture probes were prepared with an
automated DNA synthesizer (PE BioSystems Expedite 8909) using
conventional phosphoramidite chemistry. All reagents were from Glen
Research. Synthesis was initiated with a solid support bearing an
orthogonally protected amino functionality, whereby the 3'-terminal
amine is not unmasked until final deprotection step. The first four
monomers to be added were hexaethylene oxide units, followed by the
standard A, G, C and T monomers. All capture oligo sequences were
cleaved from the solid support and deprotected with ammonium
hydroxide, concentrated to dyrness, precipitated in ethanol, and
purified by reverse-phase HPLC using an acetonitrile gradient in
triethylammonium acetate buffer. Appropriate fractions from the
HPLC were collected, evaporated to dryness in a vacuum centrifuge,
and then coevaporated with a portion of water.
[0132] The purified, amine-labeled capture oligos were adjusted to
a concentration of 250 .mu.M in 50 mM sodium carbonate buffer (pH
9.0) containing 10% glycerol. The probes were spotted onto the
amine-reactive glass surface at defined positions in a
5.times.5.times.6 array pattern with a 3-axis robot (MicroGrid,
BioRobotics). A 16-pin tool was used to transfer the liquid from
384-well microtiter plates, producing 200 micron features with a
600 micron pitch. Each sub-grid of 24 features represents a single
capture probe (i.e., 24 duplicate spots). The arrays were incubated
at room temperature in a moisture-saturated environment for 12-18
hours. The attachment reaction was terminated by immersing the
chips in 2% aqueous ammonium hydroxide for five minutes with gentle
agitation, followed by rinsing with distilled water (3.times. for 5
minutes each). The array was finally soaked in 10.times. PBS
solution for 30 minutes at room temperature, and then rinsed again
for 5 minutes in distilled water.
[0133] Specific and thermodynamically isoenergetic sequences along
the .sup.10Fn3 mRNA were identified to serve as capture points to
self-assemble and anchor the .sup.10Fn3 protein. The software
program HybSimulator v4.0 (Advanced Gene Computing Technology,
Inc.) facilitated the identification and analysis of potential
capture probes. Six unique capture probes were chosen and printed
onto the chip, three of which are complementary to common regions
of the .sup.10Fn3 fusion pool's mRNA (CP3', CP5', and CPflag). The
remaining three sequences (CPneg1, CPneg2, and CPneg3) are not
complementary and function in part as negative controls. Each of
the capture probes possesses a 3'-amino terminus and four
hexaethylene oxide spacer units, as described above. The following
is a list of the capture probe sequences that were employed
(5'-3'):
4 CP3': TGTAAATAGTAATTGTCCC (SEQ ID NO: 22) CP5':
TTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 23) CPneg1: CCTGTAGGTGTCCAT (SEQ
ID NO: 24) CPflag: CATCGTCCTTGTAGTC (SEQ ID NO: 25) CPneg2:
CGTCGTAGGGGTA (SEQ ID NO: 26) CPneg3: CAGGTCTTCTTCAGAGA (SEQ ID NO:
27)
[0134] About 1 pmol of .sup.10Fn3 fusion pool from the Round 10
TNF-.alpha. selection was adjusted to 5.times. SSC containing 0.02%
Tween-20 and 2 mM vanadyl ribonucleotide complex in a total volume
of 350 .mu.L. The entire volume was applied to the microarray under
a 400 .mu.L gasket device and the assembly was continuously rotated
for 18 hours at room temperature. After hybridization the slide was
washed sequentially with stirred 500 mL portions of 5.times.SSC,
2.5.times.SSC, and 1.times.SSC for 5 minutes each. Traces of liquid
were removed by centrifugation and the slide was allowed to
air-dry.
[0135] Recombinant human TNF-.alpha. (500 .mu.g, lyophilized, from
PreproTech) was taken up in 230 .mu.L 1.times. PBS and dialyzed
against 700 mL stirred 1.times. PBS at 4.degree. C. for 18 hours in
a Microdialyzer unit (3,500 MWCO, Pierce). The dialyzed TNF-.alpha.
was treated with EZ-Link NHS-LC-LC biotinylation reagent (20 .mu.g,
Pierce) for 2 hours at 0.degree. C., and again dialyzed against 700
mL stirred 1.times. PBS at 4.degree. C. for 18 hours in a
Microdialyzer unit (3,500 MWCO, Pierce). The resulting conjugate
was analyzed by MALDI-TOF mass spectrometry and was found to be
almost completely functionalized with a single biotin moiety.
[0136] Each of the following processes was conducted at 4.degree.
C. with continuous rotation or mixing. The protein microarray
surface was passivated by treatment with 1.times. TBS containing
0.02% Tween-20 and 0.2% BSA (200 .mu.L) for 60 minutes.
Biotinylated TNF-.alpha. (100 nM concentration made up in the
passivation buffer) was contacted with the microarray for 120
minutes. The microarray was washed with 1.times. TBS containing
0.02% Tween-20 (3.times.50 mL, 5 minutes each wash). Fluorescently
labeled streptavidin (2.5 .mu.g/mL Alexa 546-streptavidin conjugate
from Molecular Probes, made up in the passivation buffer) was
contacted with the microarray for 60 minutes. The microarray was
washed with 1.times.TBS containing 0.02% Tween-20 (2.times.50 mL, 5
minutes each wash) followed by a 3 minute rinse with 1.times. TBS.
Traces of liquid were removed by centrifugation, and the slide was
allowed to air-dry at room temperature.
[0137] Fluorescence laser scanning was performed with a GSI
Lumonics ScanArray 5000 system using 10 .mu.M pixel resolution and
preset excitation and emission wavelengths for Alexa 546 dye.
Phosphorimage analysis was performed with a Molecular Dynamics
Storm system. Exposure time was 48 hours with direct contact
between the microarray and the phosphor storage screen.
Phosphorimage scanning was performed at the 50 .mu.M resolution
setting, and data was extracted with ImageQuant v.4.3 software.
[0138] FIGS. 16 and 17 are the phosphorimage and fluorescence scan,
respectively, of the same array. The phosphorimage shows where the
.sup.10Fn3 fusion hybridized based on the .sup.35S methionine
signal. The fluorescence scan shows where the labeled TNF-.alpha.
bound.
Other Embodiments
[0139] Other embodiments are within the claims.
[0140] All publications, patents, and patent applications mentioned
herein are hereby incorporated by reference.
Sequence CWU 1
1
27 1 122 DNA Artificial Sequence oligonucleotide primer 1
ggaattccta atacgactca ctatagggac aattactatt tacaattaca atgcatcacc
60 atcaccatca cgtttctgat gttccgaggg acctggaagt tgttgctgcg
acccccacca 120 gc 122 2 104 DNA Artificial Sequence oligonucleotide
primer 2 ggaattccta atacgactca ctatagggac aattactatt tacaattaca
atggtttctg 60 atgttccgag ggacctggaa gttgttgctg cgacccccac cagc 104
3 108 DNA Artificial Sequence oligonucleotide primer 3 agcggatgcc
ttgtcgtcgt cgtccttgta gtcgctcttc cctgtttctc cgtaagtgat 60
cctgtaatat ctsnnccagc tgatcagtag gctggtgggg gtcgcagc 108 4 62 DNA
Artificial Sequence oligonucleotide primer 4 agcggatgcc ttgtcgtcgt
cgtccttgta gtcgctcttc cctgtttctc cgtaagtgat 60 cc 62 5 99 DNA
Artificial Sequence oligonucleotide primer 5 ggaattccta atacgactca
ctatagggac aattactatt tacaattaca atgcatcacc 60 atcaccatca
cctcttcaca ggaggaaata gccctgtcc 99 6 123 DNA Artificial Sequence
oligonucleotide primer 6 agcggatgcc ttgtcgtcgt cgtccttgta
gtcgctcttc gtataatcaa ctccaggttt 60 aaggccgctg atggtagctg
tsnnaggcac agtgaactcc tggacagggc tatttcctcc 120 tgt 123 7 64 DNA
Artificial Sequence oligonucleotide primer 7 agcggatgcc ttgtcgtcgt
cgtccttgta gtcgctcttc gtataatcaa ctccaggttt 60 aagg 64 8 101 DNA
Artificial Sequence oligonucleotide primer 8 ggaattccta atacgactca
ctatagggac aattactatt tacaattaca atgcatcacc 60 atcaccatca
cctcttctat accatcactg tgtatgctgt c 101 9 87 DNA Artificial Sequence
oligonucleotide primer 9 agcggatgcc ttgtcgtcgt cgtccttgta
gtctgttcgg taattaatgg aaattggsnn 60 agtgacagca tacacagtga tggtata
87 10 57 DNA Artificial Sequence oligonucleotide primer 10
agcggatgcc ttgtcgtcgt cgtccttgta gtctgttcgg taattaatgg aaattgg 57
11 45 DNA Artificial Sequence oligonucleotide primer 11 gcgtaatacg
actcactata gggacaatta ctatttacaa ttaca 45 12 33 DNA Artificial
Sequence oligonucleotide primer 12 agcggatgcc ttgtcgtcgt cgtccttgta
gtc 33 13 19 DNA Artificial Sequence oligonucleotide primer 13
tttttttttn agcggatgc 19 14 6 DNA Artificial Sequence
oligonucleotide primer 14 agccur 6 15 30 DNA Artificial Sequence
oligonucleotide primer 15 gcggcagggt ttgcttactg gggccaaggg 30 16 27
DNA Artificial Sequence oligonucleotide primer 16 gggaggggtg
gaggtaggtc acagtcc 27 17 30 DNA Artificial Sequence oligonucleotide
primer 17 tttgctagct ttaccaggag agtgggaggc 30 18 33 DNA Artificial
Sequence oligonucleotide primer 18 aaaaagcttg ccaaaacgac acccccatct
gtc 33 19 33 DNA Artificial Sequence oligonucleotide primer 19
catatggttt ctgatattcc gagagatctg gag 33 20 42 DNA Artificial
Sequence oligonucleotide primer 20 catatgcatc accatcacca tcacgtttct
gatattccga ga 42 21 30 DNA Artificial Sequence oligonucleotide
primer 21 gaattcctat gttttataat tgatggaaac 30 22 19 DNA Artificial
Sequence oligonucleotide primer 22 tgtaaatagt aattgtccc 19 23 20
DNA Artificial Sequence oligonucleotide primer 23 tttttttttt
tttttttttt 20 24 15 DNA Artificial Sequence oligonucleotide primer
24 cctgtaggtg tccat 15 25 16 DNA Artificial Sequence
oligonucleotide primer 25 catcgtcctt gtagtc 16 26 13 DNA Artificial
Sequence oligonucleotide primer 26 cgtcgtaggg gta 13 27 17 DNA
Artificial Sequence oligonucleotide primer 27 caggtcttct tcagaga
17
* * * * *