U.S. patent application number 10/516779 was filed with the patent office on 2005-11-10 for retrons for gene targeting.
Invention is credited to Lydiate, Derek J., Rozwadowski, Kevin L..
Application Number | 20050250207 10/516779 |
Document ID | / |
Family ID | 29736192 |
Filed Date | 2005-11-10 |
United States Patent
Application |
20050250207 |
Kind Code |
A1 |
Rozwadowski, Kevin L. ; et
al. |
November 10, 2005 |
Retrons for gene targeting
Abstract
The invention provides methods and nucleic acid constructs that
may be used to modify a nucleic acid of interest at a target locus
within the genome of a host. In some aspects, the invention
contemplates producing in vivo a gene targeting substrate (GTS),
which may be comprised of both DNA and RNA components. The gene
targeting substrate may comprise a gene targeting nucleotide
sequence (GTNS), which is homologous to the target locus, but
comprises a sequence modification compared to the target locus. The
gene targeting substrate may be produced by reverse transcription
of a gene targeting message RNA (gtmRNA). The gene targeting
message RNA may be folded for self-priming for reverse
transcription by a reverse transcriptase. The gene targeting
message RNA may in turn be the product of transcription of a gene
targeting construct (GTC) encoding the gene targeting message RNA.
The gene targeting construct may for example be a DNA sequence
integrated into the genome of the host, or integrated into an
extrachromosomal element. Following expression of the gene
targeting systems of the invention, hosts may for example be
selected having genomic modifications at a target locus that
correspond to the sequence modification present on the gene
targeting nucleotide sequence. In some embodiments, the structure
of retrons may be adapted for use in the gene targeting systems of
the invention.
Inventors: |
Rozwadowski, Kevin L.;
(Saskatoon Sakatchewan, CA) ; Lydiate, Derek J.;
(Saskatoon Kaskatchewan, CA) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
121 SW SALMON STREET
SUITE 1600
PORTLAND
OR
97204
US
|
Family ID: |
29736192 |
Appl. No.: |
10/516779 |
Filed: |
June 29, 2005 |
PCT Filed: |
June 5, 2003 |
PCT NO: |
PCT/CA03/00850 |
Current U.S.
Class: |
435/468 ;
435/254.2; 435/325; 435/348; 435/419; 435/455; 435/483 |
Current CPC
Class: |
A01K 2217/05 20130101;
A61K 48/00 20130101; C12N 9/1276 20130101; C12N 15/902 20130101;
C12N 15/102 20130101 |
Class at
Publication: |
435/468 ;
435/455; 435/483; 435/254.2; 435/419; 435/325; 435/348 |
International
Class: |
C12N 001/18; C12N
005/06; C12N 005/04; C12N 015/85; C12N 015/74 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 5, 2002 |
US |
60386640 |
Claims
1) A method of modifying a target nucleic acid of interest at a
target locus within a genome of a host comprising: a) introducing
into the host a gene targeting construct (GTC) and culturing the
host so as to: i) express the gene targeting construct encoding a
gene targeting RNA, to produce the gene targeting message RNA
capable of priming reverse transcription by a reverse transcriptase
(RT); ii) reverse transcribe at least a portion of the gene
targeting message RNA to produce an in vivo gene targeting
substrate (GTS) having a gene targeting nucleotide sequence (GTNS),
wherein the GTNS is homologous to the target locus and comprises a
sequence modification compared to the target nucleic acid; and, b)
selecting a host having the sequence modification at the target
locus.
2) The method of claim 1, wherein the host is capable of expressing
the RT prior to transforming the host with the gene targeting
conduct.
3) The method of claim 1, wherein the host is modified to be
capable of expressing the RT at the same time as, or after,
transforming the host with the gene targeting conduct.
4) The method of claim 1, wherein the GTC is introduced into the
host by transformation, by cross breeding or by cell fusion.
5) A gene targeting construct comprised of recombinant nucleic acid
sequence in a host having a host genome, wherein the gene targeting
construct encodes and is capable of expressing a gene targeting
message RNA, wherein the gene targeting message RNA is capable of
self-priming reverse transcription by a reverse transcriptase in
the host to produce a gene targeting substrate having a gene
targeting nucleotide sequence, wherein the gene targeting
nucleotide sequence is homologous to a target locus in the host
genome and comprises a sequence modification compared to the target
locus, wherein expression of the gene targeting construct in the
host introduces the sequence modification as a heritable genetic
change in the target sequence in the genome of the host.
6) The gene targeting construct of claim 5, wherein the gene
targeting construct comprises an msr coding region and an msd
coding region.
7) A recombinant reverse transcriptase coding sequence encoding a
reverse transcriptase having a nuclear localization signal
sequence.
8) The gene targeting construct of claim 6, wherein the msr and msd
coding regions are in operative association with a first regulatory
region, and the construct further comprises a nucleotide sequence
encoding a reverse transcriptase.
9) The gene targeting construct of claim 8, wherein the nucleotide
sequence encoding the reverse transcriptase is in operative
association with the first regulatory region or with a second
regulatory region.
10) The gene targeting construct of claim 8, wherein the reverse
transcriptase comprises a nuclear localization signal sequence.
11) The gene targeting construct of claim 8 wherein the regulatory
region is operatively active in an S phase, a G1/S boundary of a
cell cycle, or during meiosis.
12) The gene targeting construct of claim 11, wherein the
regulatory region is selected from the group consisting of a
histone promoter, a cyclin promoter, a promoter associated with a
gene involved in DNA replication, a promoter associated with a gene
involved in DNA repair and a promoter associated with a gene
involved in DNA homologous recombination.
13) The gene targeting construct of claim 8, further comprising a
nucleotide sequence encoding a selectable marker.
14) A vector comprising the gene targeting construct of claim
8.
15) An host comprising the vector of claim 14.
16) The host of claim 15, selected from the group consisting of a
plant cell, an animal cell, a yeast cell, and an insect cell.
17) The host of claim 16, wherein the host is a plant cell.
18) A method of modifying a target locus in a host comprising
transforming the host with the gene targeting construct of claim
8.
19) A method of modifying a target locus in a host comprising
transforming the host with the vector of claim 14.
20) The method of claim 19 wherein the host is a eukaryotic
organism.
21) The method of claim 20, wherein the host is selected from the
group consisting of a plant cell, an animal cell, a yeast cell, and
an insect cell.
22) The gene targeting construct of claim 1, wherein the gene
targeting nucleotide sequence comprises one, or more than one,
region of 15 to about 500 nucleotides, exhibiting about 70% to
about 99% sequence similarity with the target locus sequence, as
determined using the following conditions: Program: blastp;
Database: nr; Expect 10; filter: default; Alignment: pairwise;
Query genetic Codes: Standard (1).
23) The gene targeting construct of claim 22, wherein the one or
more than one region is of less than 300 nucleotides in length.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to nucleic acid constucts and
manipulations that may be used for in vivo gene modification. More
specifically the present invention relates to systems for producing
gene targeting substrates using reverse transcriptase, as well as
methods for promoting in vivo gene modification using such gene
targeting substrates.
BACKGROUND OF THE INVENTION
[0002] Gene targeting generally refers to the directed alteration
of a specific DNA sequence in its genomic locus in vivo. This may
involve the transfer of genetic information from a nucleic acid
molecule, which may be referred to as a gene targeting substrate,
to a specific target locus in the host cell genome. In current
methods, the gene targeting substrate usually exists as an
extrachromosomal nucleic acid molecule. The target locus may be
present in the host cell's nuclear chromosomes or organellar
chromosomes (e.g. mitochondria or plastids) or a cellular episome.
The gene targeting substrate typically encodes sequences homologous
to the target locus. However, the sequence of the gene targeting
substrate is modified to encode changed genetic information,
vis-a-vis the target genetic locus, through the insertion or
deletion of one or more base pairs or by the substitution of one or
more bases for other types of bases. As a result, the gene
targeting substrate may encode, for example, a different gene
product than the target locus or a nucleic acid sequence which is
non-functional or that functions differently than the nucleic acid
sequence encoded by the target locus.
[0003] The process of gene targeting may involve the action of host
nucleic acid recombination and repair functions. The homology
between the target locus and the gene targeting substrate, in
combination with host cell functions, is thought to facilitate the
process of the gene targeting substrate "scanning" the host genome
to find and associate with the target locus. Host nucleic acid
recombination and repair functions may then act to transfer genetic
information from the gene targeting substrate to the target locus
by the processes of homologous recombination or gene conversion. In
this manner, the novel sequence of the gene targeting substrate is
transferred into the host genome at the targeted locus, which may
result in loss of the wild-type genetic information at this locus.
The modified target locus may now be stably inherited through cell
divisions and, if present in germ cells and gametes, to subsequent
progeny resulting from sexual reproduction.
[0004] This ability to perform precise genetic modifications of a
host cell's genome at defmed loci is an extremely powerful
technology for basic and applied biological research. A principal
advantage of gene targeting over conventional transformation
technologies, which results in integration of the exogenously
supplied DNA cassettes at random sites in the host genome is the
maintenance of appropriate chromosomal context for the modified
gene. In contrast, transformational integration of DNA cassettes
into random sites of the host genome can have large negative
effects on the host cell by causing insertional inactivation of the
resident gene where the DNA cassette integrates, for example. In
addition, integration at random sites can affect expression of the
introduced gene encoded by a cassette. Such `position effects` may
result from epigenetic control of gene expression relating to the
regulation of chromatin conformation (Mlynarova, L, et al., 1996,
Plant Cell 8, pp. 1589-1599). Thus transgenes which integrate at
random sites in the genome may not be expressed in the correct
fashion to accurately reflect the biological effect of the gene
under basic study, or provide the desired phenotype in a
biotechnology application. Targeting of a transgene to its correct
native site in the host genome may help to ensure correct
epigenetic regulation of its expression.
[0005] Gene targeting may enable the accurate analysis of the
phenotypic effects of modified genes by simultaneously replacing
the endogenous gene copy. In contrast, placement of a transgene
encoding a modified version of an endogenous gene at random sites
in the genome may not enable accurate analysis of the effect of
this transgene because the endogenous gene copy is still
functioning. Expression of the endogenous gene copy may compensate
for or impair the action of the gene product encoded by the
transgene. Through gene targeting, the endogenous gene copy may be
replaced by the introduced modified gene. As a result, the
endogenous gene copy will not be able to interfere with the action
of the introduced modified gene and an accurate interpretation of
the biological effects of the modified gene may be possible. This
ability is important for accurate assessment of gene function in
basic studies, and is important for biotechnology applications
aimed at modifying the physiological, biochemical or developmental
paths and responses of cells and organisms.
[0006] Through gene targeting a non-exclusive list of possible
modifications or combinations of modifications to the host genome
includes:
[0007] 1. Gene replacement and gene addition: by replacing the
targeted chromosomal gene or genes, or promoter or promoters, or
portions of the aforementioned, with another gene or genes, or
promoter or promoters, or portions of the aforementioned; or adding
a gene or genes and regulatory components, or portions thereof, at
a targeted chromosomal locus adjacent to resident endogenous
loci.
[0008] 2. Gene inactivation and gene deletion: Inactivating a
targeted chromosomal gene through disruption of transcription or
translation by changing the sequence composition or by inserting or
deleting one or more base pairs of the gene sequence. Furthermore,
the coding region or regulatory components, or portions thereof, of
a targeted chromosomal gene or genes may be deleted as
required.
[0009] Using gene targeting, an absolute inactivation of specified
target genes may be possible by, for example, creating insertion,
deletion or substitution mutations in the target genes. Thus the
phenotypic effects of the gene may be assessed by studying the
engineered null-mutant. This null-mutant may also be genetically
stable in subsequent generations ensuring the continued propagation
of this line maintaining the same engineered phenotype. The
modified line may also be isogenic to the original cell line or
organism from which it is derived thus enabling reliable and
accurate comparisons between the modified and original lines so
that the effects of the modification may be accurately determined.
Targeted gene inactivation may therefore have advantages over
conventional means of gene silencing, such as antisense RNA and
cosuppression, which may not provide absolute inactivation of the
target gene and/or may not cause a stable and consistent level of
inactivation through generations.
[0010] 3. Allele modification: Changing the sequence of a targeted
chromosomal gene to create a new allele which encodes a protein
with a changed amino acid composition (i.e. protein engineering),
or which has modified translatability or stability of the
transcript.
[0011] Gene targeting has been demonstrated in several species
including lower eukaryotes, invertebrate animals, mammals, lower
plants and higher plants. Gene targeting substrates include
single-stranded DNA (ssDNA; Simon J. R., Moore, P. D.,1987,. Mol
Cell Biochem 7, pp. 2329-2334), double-stranded DNA (dsDNA;
Rothstein, R, 1991, Methods Enzymol. 194: 281-301), or hybrid
molecules with RNA and DNA constituents. For some prior DNA-based
gene targeting substrates, the amount of homology to the target
locus present in the gene targeting substrate has varied from 10's
of basepairs (bp) to 10's of kilobasepairs (kb; Yang, X W, et. al.,
1997, Nat. Biotechnol. 15, pp. 859-865), depending upon the nature
of the target locus and the type of host cell or species and the
efficiency of homologous recombination functions in that host cell
or species. For RNA/DNA hybrid gene targeting substrates, the
homology in some cases has been 10's of basepairs (for example see
Zhu, T, 2000, Nat. Biotechnol. 18: 555-558; Beetham, P. R., 1999,
Proc. Natl. Acad. Sci. U.S.A 96: 8774-8778).
[0012] Successful gene targeting has been achieved by treatment of
cultured cells, tissues or organisms with gene targeting substrate.
This has resulted in modified target loci which are stable through
cell divisions. However, the frequency of these events is low. To
obtain modified target loci stably transmissible through sexual
reproduction in mammals, specialized procedures employing specific
embryonic stem cell lines may be employed. In other animal systems,
gene targeting substrates may be injected into gonads, or gene
targeting substrate may be engineered to be present in the cells at
early developmental stages to ensure modification of germ line
cells. Conversely, in some plants the totipotency of all cells may
enable nearly any modified cell line to be regenerated into intact
plants capable of transmitting the modified locus to progeny.
[0013] Application of gene targeting methods, especially in plants
and mammals, may be inhibited by several limitations in
conventional technology, which may be technically demanding, rely
on tedious and expensive in vitro procedures, or be successful only
in specialized cell lines. These limitations may be compounded by a
low frequency of gene targeting events which may not be easily
identifiable. In some applications, only target loci which when
modified result in selectable or easily screenable phenotypes may
be employed, so that the rare gene targeting events may be
identified.
[0014] Conventional gene targeting strategies may rely on
incorporation of a selectable marker at the target locus resulting
in insertional-inactivation mutants by interruption of the target
gene with the selectable marker, an approach that may not enable
more subtle modifications such as single base-pair changes. Current
selection and enrichment procedures may also be ineffective if they
select false-positives with high frequency.
[0015] A principal factor affecting the frequency of gene targeting
with some conventional approaches may be the mechanism of
delivering gene targeting substrate to the host cells. Current
procedures typically produce a gene targeting substrate exogenously
and rely on various means, including chemical treatments, physical
treatments, or biological vehicles, to get the gene targeting
substrate into the host cell and nucleus. Such methods require
extensive screening since the frequency of modifying the target
locus is low, and background levels of insertion at non-target loci
is high. Methods have accordingly been proposed to address this
perceived problem, such as methods disclosed in U.S. Pat. No.
6,504,081 for transposon-mediated gene targeting which purportedly
enhance the insertion and detection of desired genes in genomic
exons.
[0016] International Patent Publication WO02/062986, published 15
Aug. 2002, describes a replicative gene targeting system that
renews or regenerates a gene targeting cassette using various
mechanisms of DNA replication, to enable repeated cycles of gene
targeting substrate production in vivo . As disclosed therein,
successive rounds of gene targeting cassette replication may allow
the accumulation of multiple molecules of gene targeting substrate
per cell or nucleus, so that the presence of more gene targeting
substrate may result in a higher frequency of gene targeting events
to produce heritable changes in a target host sequence.
[0017] Retrons have been known for some time as a class of
retroelement, first discovered in gram-negative bacteria such as
Myxococcus xanthus, Stigmatella aurantiaca and Escherichia coli.
Retrons mediate the synthesis in host cells of multicopy
single-stranded DNAs (msDNA), which typically include a DNA
component and an RNA component. The native msDNA molecules
reportedly exist as single-stranded DNA-RNA hybrids, characterized
by a structure which comprises a single-stranded DNA branching out
of an internal guanosine residue of a single-stranded RNA molecule
at a 2',5'-phosphodiester linkage. Native retrons have been found
to consist of the gene for reverse transcriptase (RT) and an
msr-msd region under the control of a single promoter. The msd
region typically codes for the DNA component of msDNA, and the msr
region typically codes for the RNA component of msDNA. In some
retrons, the msr and msd genes have overlapping 3' ends, and are
oriented opposite one another with a promoter located upstream of
msr which transcribes through the msd-msr region. The msd-msr
region generally contains two inverted repeat sequences, designated
"a" and "b", which together make up a stable stem structure in
msDNAs. The single RNA transcript from the msr-msd region serves
not only as a template for reverse transcription but, by virtue of
its secondary structure, also serves as a primer for msDNA
synthesis by a reverse transcriptase.
[0018] Retrons have been suggested for use in a variety of
applications, including production of polypeptides and anti-sense
inhibition of target genes, see for example U.S. Pat. Nos.
5,849,563; 6,017,737; 5,849,563; 5,780,269; 5,436,141; 5,405,775;
5,320,958; and CA 2,075,515.
SUMMARY OF THE INVENTION
[0019] In various aspects, the present invention relates to in vivo
gene modification methods and constructs. More specifically the
present invention relates to systems that may be used for producing
gene targeting substrates in vivo, as well as methods for promoting
in vivo gene modification using the gene targeting substrates of
the invention. As such, in various aspects, the invention provides
methods that may be used to mediate heritable genetic change in a
host using heterologous gene targeting nucleic acid constructs.
Such heritable genetic changes may be chosen to confer altered
activity on a target sequence or locus of interest. The heritable
genetic change, and altered activity of the target, may be manifest
in subsequent generations of the host, including in subsequent
generations in that do not include the heterologous nucleic acid
constructs that were originally used to mediate the genetic change
in the progenitor host. Heritable genetic changes mediated by the
methods of the invention may for example be targeted to coding or
non-coding sequences.
[0020] In one aspect, the present invention provides a method to
modify a nucleic acid of interest at a target locus within the
genome of a host comprising steps that include the following.
Expressing a gene targeting construct (GTC) nucleotide sequence
encoding an RNA, to produce a gene targeting message RNA (gtmRNA).
The GTC may for example be a DNA sequence integrated into the
genome of the host, or integrated into an extrachromosomal element.
The gtmRNA may be folded for self-priming for reverse transcription
by a reverse transcriptase (RT). Reverse transcription of the
gtmRNA produces a gene targeting substrate (GTS), which may be
comprised of both DNA and RNA components. The GTS may comprise a
gene targeting nucleotide sequence (GTNS), which is homologous to
the target locus, but comprises a sequence modification compared to
the target locus. Following expression of the gene targeting
systems of the invention, hosts may for example be selected having
genomic modifications at the target locus that correspond to the
sequence modification present on the gene targeting nucleotide
sequence.
[0021] In various embodiments, the present invention relates to
gene targeting methods as described above, wherein the host is
modified to express the RT prior to introducing the nucleotide
sequence into the host that encodes the RNA that comprises the
GTNS. The nucleotide sequence encoding an RNA that comprises the
GTNS may for example be introduced into the host by transformation
or cross breeding.
[0022] In alternative embodiments, the present invention includes
gene targeting methods as described above, wherein the host is
modified to express a nucleotide sequence encoding an RNA that
comprises the GTNS, prior to introducing an RT expression system
into the host. The nucleotide sequence encoding RT may for example
be introduced into the host by transformation or cross
breeding.
[0023] In some embodiments, there is provided a nucleotide sequence
comprising msr and msd coding regions, a gene-targeting nucleotide
sequence (GTNS) homologous to a target locus of interest, wherein
the GTNS comprises at least one nucleotide difference compared to
the target locus of interest. Such constructs may be used with a
nucleotide sequence encoding a reverse transcriptase. If the
reverse transcriptase is not included in the nucleotide sequence,
then it may for example be provided on a second nucleotide
sequence.
[0024] In some embodiments, to adapt retrons for use in gene
targeting, the nucleotide sequence encoding a reverse transcriptase
may further comprise a nuclear localization signal sequence. In
alternative embodiments, the msr, and msd coding regions and the
nucleotide sequence homologous to a target locus of interest may be
operatively linked with a first regulatory region, and the
nucleotide sequence encoding a reverse transcriptase may be
operatively linked with a second regulatory region. In such
embodiments, the first regulatory region and second regulatory
region may be the same or different. In further alternative
embodiments, these regulatory regions may be selected to be active
in a selected cell cycle or growth phase, such as during the S
phase or G1/S boundary phase or G2 phase of the cell cycle. For
example, the first regulatory region and second regulatory region
may be selected from the group consisting of histone promoters,
cyclin promoters, promoters of cell division control genes, and
promoters of genes encoding structural or catalytic proteins
participating in DNA synthesis.
[0025] In some embodiments, the nucleotide sequence of the gene
targeting constructs of the invention may further comprise a marker
gene. Also, the marker gene may be operatively linked with a third
regulatory region, which may for example be a constitutive
promoter.
[0026] Further, according to the present invention as defined
above, the gene targeting nucleotide sequence homologous to the
target locus of interest may comprise less than about 5 kb. In an
aspect of an embodiment the gene targeting nucleotide sequence may
comprise less than about 2 kb. In alternative aspects, the gene
targeting nucleotide sequence may be longer than a minimum length
which is an integer between 15 and 500, such as at least 15, 25,
50, 100, 150, 200, 250, 300, 350, 400, 450 or 500 bp.
[0027] In some embodiments, the gene targeting constructs of the
present invention may comprise all or a portion of a vector. The
vector may for example comprise a vector adapted to integrate into
a host genome, such as an Agrobacterium vector capable of
integrating a nucleic acid sequence into a plant genome.
[0028] In some aspects, the invention provides a cell, tissue or
organism transformed with the gene targeting constructs of the
present invention, such as a eukaryotic cell, a plant cell, an
animal cell, an insect cell, or a yeast cell. Transformed tissues
may for example include a plant tissue or animal tissue.
Transformed organisms may for example be plants or animals.
[0029] In some embodiments, the invention provides a branched msDNA
hybrid molecule capable of being produced from a gene targeting
retron of the invention, wherein the msDNA comprises:
[0030] i) an RNA portion covalently linked to a single stranded DNA
portion by a 2',5' phosphodiester bond between a 2'OH group of an
internal rG residue and a 5' phosphate of the DNA molecule; and
wherein,
[0031] ii) the RNA portion may be non-covalently linked to the DNA
portion by base pairing between complementary 3' ends of the RNA
and DNA; and wherein,
[0032] iii) the msDNA comprises,
[0033] a) a stable stem-loop structure in the RNA, DNA or both
portions of the molecule; and,
[0034] b) a gene targeting nucleic acid sequence which comprises
one or more regions that are homologous to a target locus of
interest, wherein the gene targeting nucleic acid sequence encoding
at least one nucleotide difference compared to the target locus of
interest.
[0035] In some embodiments, the gene targeting nucleic acid
sequence of the msDNA of the invention may be located within the
stable stem-loop structure in the RNA, DNA or both portions of the
msDNA molecule.
[0036] In one aspect, the invention provides methods of modifying a
gene of interest within an organism comprising:
[0037] i) transforming the organism with a nucleotide sequence
encoding msr-GTNS-msd; and,
[0038] ii) producing msDNA in sufficient quantities to promote
modification of the target locus of interest with the gene
targeting nucleotide sequence, wherein the GTNS is homologous to
the target locus of interest and encodes at least one nucleotide
difference from the target locus of interest.
[0039] In some embodiments, the invention provides a library of
transformed hosts, wherein the hosts comprise a target genomic
sequence that has been altered using the methods of the invention.
In one aspect, such libraries will be the result of the relatively
error-prone generation of gene targeting substrates by reverse
transcriptase, using the methods of the invention. For example, a
pool of hosts may be modified by the methods of the invention, to
generate a library of transformed hosts having altered target
sequences, and the library may be subject to selection for a
desired alteration in the target sequence.
[0040] In alternative embodiments, a gene targeting construct may
be excised from the genome of a host. For example, the gene
targeting construct may be flanked on each side by a recognition
sequence for a site-specific recombinase such as, for example, FLP
protein of the 2 micron element. Such embodiments may be adapted so
that by the action of the recombinase on its respective recognition
sequence the gene targeting construct is excised, typically as as a
circular dsDNA molecule (having been excised from a chromosomal
locus or an extrachromosomal locus on a vector where it is
integrated). This may for example be useful for producing
subsequent generations of hosts in which the heritable genetic
change mediated by the gene targeting construct is present, while
the construct itself is absent from such hosts. Accordingly, in one
aspect the invention provides hosts having a heritable genetic
change mediated by the methods and constructs of the invention, in
which the heterologous constructs used to mediate the genetic
change are not present.
[0041] In alternative embodiments, the invention provides isolated
gene targeting substrates produced by the methods and constructs of
the invention. A first host may for example be used to produce a
gene targeting substrate for isolation, and the isolated gene
targeting substrate may then be used to modify a target locus in a
second host. Similarly, an isolated gene targeting RNA produced in
a first host may be used to transform and modify a target locus in
a second host.
[0042] In alternative embodiments, first and second complimentary
gene targeting substrates may be produced in a host, so that the
gene targeting substrates hybridize to form a double stranded gene
targeting substrate, the double stranded gene targeting substrate
having a gene targeting nucleotide sequence that is homologous to a
target locus in a host genome.
[0043] In alternative embodiments, recombinant hosts are provided
having a cloning site in a gene targeting construct in the genome
of the host, the cloning site being positioned so that heterologous
sequences introduced into the cloning site will be expressed as
part of the gene targeting substrate.
BRIEF DESCRIPTION OF THE DRAWINGS
[0044] FIG. 1: Reverse transcription of wild type msr-msd
elements.
[0045] This schematic illustration is adapted from published
reports to show a putative mechanism by which an RNA transcript
encoding the msr-msd elements may fold to create stem-and-loop
structures as a result of base-pairing between complimentary
inverted repeat sequences, such as the a1 and a2 or b1 and b2
sequences. As illustrated, a stem-and-loop structure within the msr
element is thought to recruit reverse transcriptase, which may be
expressed in trans, to place the enzyme in an appropriate context
so that it can use the 2'-hydroxyl group of a specific guanosine
residue in the msr element to prime reverse transcription. Reverse
transcription is shown proceeding through the msd element and
terminating at a juncture between msr and msd elements. In the
absence of an RNaseH-like activity, an extended RNA-DNA hybrid
molecule may result. As shown in the alternative, in the presence
of an RNaseH-like activity, an extended ssDNA molecule may
result.
[0046] FIG. 2: The effect of nuclear localisation on functionality
of prokaryotic reverse transcriptase in eukaryotic cells.
[0047] This Figure shows a Southern blot of DNA samples collected
from E. coli and yeast cells expressing components of a reverse
transcription system. The blot was probed with a DNA fragment that
can detect the product of reverse transcription (lower molecular
weight signal). The higher molecular weight signal is the parental
construct which hybridises to the probe. Left panel: Yeast cells
expressing wild type Ec86 msr-msd (pMW29) in combination with wild
type Ec86 reverse transcriptase (RT; pMW25) or Ec86 reverse
transcriptase engineered to encode a nuclear localisation sequence
(NLS-RT; pMW27). Products resulting from reverse transcription are
only detectable when NLS-RT is expressed in the eukaryotic cells.
Right panel: A comparison of the products of reverse transcription
resulting from the action of NLS-RT in E. coli (pMW16, pMW7) and
yeast (pMW27, pMW29).
[0048] FIG. 3: The STEM3 derivative of msr-msd.
[0049] This Figure shows: A) Diagrammatic representation of STEM3
highlighting the positions of restriction enzyme recognition sites.
B) structural comparison of STEM3 to wild type Ec86 msr-msd.
Sequences were folded using a molecular modeling computer program.
The arrow indicates the position of the guanosine residue used to
prime reverse transcription. The position of restriction enzyme
sites for cloning novel sequences into STEM3 are shown (XbaI,
EcoRV). Note that the double-stranded region created in STEM3
resulting from pairing of the a1' and a2' sequences is 13 bp longer
than that in the wild type msr-msd resulting from pairing of a1 and
a2 sequences.
[0050] FIG. 4: Products of reverse transcription of STEM3.
[0051] This is a schematic representation of reverse transcription
of STEM3 encoding an insert in the msd element (hatched region).
The overall process is similar to that described for wild type
msr-smd in FIG. 1. Note that an extended loop structure encoding
the sequence inserted into msd is formed at the end of the stem
created by annealing of the b1 and b2 sequences. The reverse
transcriptase facilitates conversion of this insertion sequence
into cDNA. In the absence of an RNaseH-like activity, an extended
RNA-DNA hybrid molecule may result. In the presence of an
RNaseH-like activity an extended ssDNA molecule may result.
[0052] FIG. 5: Structural modeling-based prediction of insert size
tolerance by retrons.
[0053] The illustrated models represent putative structures of
stems containing no insert or insertions of 50 bp (Stem3+50) or 500
bp (Stem3+500) cloned into the unique XbaI and EcoRV restriction
sites. Structures were predicted using a molecular modeling
computer program. The arrow indicates the position of the guanosine
residue used to prime reverse transcription.
[0054] FIG. 6: Insert size tolerance of retrons expressed in
prokaryotic cells.
[0055] This Figure illustrates results obtained in assessments of
the ability of an msr-msd STEM3 derivative to facilitate in vivo
synthesis of cDNAs of different lengths in the absence (-RT) or
presence (+RT) of reverse transcriptase. DNA samples from E. coli
expressing msr-msd STEM3 derivative containing insert sequences of
0 bp (pMW7), 15 bp (pMW161), 25 bp (pMW162), 35 bp (pMW198), 50 bp
(pMW163), 100 bp, (pMW199), or 250 bp (pMW200) were resolved by
agarobe gel electrophoresis and detected by staining with ethidium
bromide (left panel) or by probing a Southern blot with msr-msd
(right panel). The reverse transcriptase was expressed from pMW7.
The high molecular weight signals represent the parental plasmids
encoding STEM3 components which cross-react with the probe.
[0056] FIG. 7: Insert size tolerance of retrons expressed in
eukaryotic cells.
[0057] This Figure illustrates results obtained in assessments of
the ability of an msr-msd STEM3 derivative to facilitate in vivo
synthesis of cDNAs of different lengths in the absence (-NLS::RT)
or presence (+NLS::RT) of reverse transcriptase encoding a nuclear
localization sequence. DNA samples from S. cerevisiae expressing
msr-msd STEM3 derivative containing insert sequences of 0 bp
(pMW166), 15 bp (pMW167), 25 bp pMW168), 35 bp (pMW202), 50 bp
(pMW169), 100 bp (pMW203), 250 bp (pMW204), 320 bp (pMW211), 500 bp
(pMW212), or 1000 bp (pMW213) were resolved by agarose gel
electrophoresis and detected by probing a Southern blot with
msr-msd. The reverse transcriptase encoding a nuclear localization
sequence was expressed from pMW27. The high molecular weight
signals represent the parental plasmids encoding STEM3 components
which cross-react with the probe.
[0058] FIG. 8: Diagramatic representation of gene targeting
assay.
[0059] This schematic illustration shows one aspect of the
invention, in which separate cassettes may be used for expressing
reverse transcriptase and the msr-msd element encoding the gene
targeting sequence. The gene targeting sequence encodes homology to
the chromosomal target locus as well as the genetic change (hatched
area) to be transferred to the target locus. The RNA transcript of
the element is acted upon by the reverse transcriptase to convert
the gene targeting sequence into a cDNA-based gene targeting
substrate. Host recombination and repair processes facilitate
transfer of genetic information from the gene targeting substrate
to the chromosomal target locus. In this example, the gene
targeting event converts the chromosomal URA3 allele to a mutant
ura3 allele. The altered gene product encoded by ura3 confers
resistance to 5-fluoroorotic acid (FOA.sup.R) whereas the URA3
allele confers sensitivity (FOA.sup.S). Note the cross-over events
depicted in this figure between the gene targeting substrate and
the target locus are solely for illustration and do not necessarily
represent the mechanism for transferring the genetic information
from the gene targeting substrate to the target locus. For example,
alteration of the target locus may occur by a gene conversion event
and not involve double and reciprocal cross-over events suggested
in the illustration.
[0060] FIG. 9: Products of reverse transcription of STOPstem.
[0061] This is a schematic representation of reverse transcription
of STOPstem encoding an insert in the msd element (hatched region).
The overall process is similar to that described for STEM3 in FIG.
4. This illustration highlights the position of the novel inverted
repeat sequences S1 and S2 and the resultant stem-and-loop
structure adjacent to the insert sequence. This novel stem-and-loop
promotes termination of reverse transcription at the end of the
insert sequence. As a result, the 3' end of the cDNA may encode
insert sequence rather than retron sequence as would normally occur
if reverse transcription terminated at the normal site between the
msr and msd elements. In the absence of an RNaseH-like activity an
extended RNA-DNA hybrid molecule may result. In the presence of a
RNaseH-like activity an extended ssDNA molecule may result.
[0062] FIG. 10: Production of cDNA in eukaryotic cells by the
STOPstem system.
[0063] The msr-msd STOPstem derivative was assessed for its ability
to facilitate in vivo synthesis of cDNA in eukaryotic cells in the
absence (-RT) or presence (+RT) of reverse transcriptase encoding a
nuclear localisation sequence. DNA samples from S. cerevisiae
expressing the STOPstem containing an insert of 500 bp (pMW306)
with or without the reverse transcriptase (pMW27) were resolved by
agarose gel electrophoresis and detected by probing a Southern blot
with msr-msd. The high molecular weight signals represent the
parental plasmids encoding STOPstem components which cross-react
with the probe.
[0064] FIG. 11: Products of reverse transcription of the
3'-recruitment system.
[0065] This is a schematic representation of reverse transcription
of the 3'-recruitment system encoding an insert in the msd element
(hatched region). Note that the positions. of the inverted repeat
sequences a1', a2', b1 and b2 have been rearranged versus that of
STEM3 (FIG. 4) or the wild type retron (FIG. 1). However, this
novel rearrangement may still form a structure that recruits
reverse transcriptase and primes conversion of an insert sequence
into cDNA. Note that the insert sequence size or composition may
not confer any structural constraints on the msr-msd elements
required to facilitate reverse transcription in the 3'-recruitment
configuration. By the action of the reverse transcriptase, the
insert sequence may be converted to cDNA. In the absence of an
RNaseH-like activity an extended RNA-DNA hybrid molecule may
result. In the presence of an RNaseH-like activity an extended
ssDNA molecule may result.
[0066] FIG. 12: Insert size tolerance of 3'-recruitment system
expressed in prokaryotic cells.
[0067] The msr-msd 3'-recruitment derivative was assessed for its
ability to facilitate in vivo synthesis of cDNAs of different
lengths. in prokaryotic cells. DNA samples from E. coli strains
expressing the 3'-recruitment system encoding inserts of 100 bp
(pMW159), 250 bp (pMW164) or 500 bp (pMW65) were resolved by
agarose gel electrophoresis and detected by staining with ethidium
bromide. The reverse transcriptase was expressed from pMW120 in all
samples. The upper bands represent parental plasmids and position
of cDNA products is indicated. The lower panel is a longer exposure
image of the same gel as the upper panel.
[0068] FIG. 13: Production of cDNA in eukaryotic cells by the
3-recruitment system.
[0069] The msr-msd 3' recruitment derivative was assessed for its
ability to facilitate in vivo synthesis of cDNA in eukaryotic cells
in the absence (-RT) or presence (+RT) of reverse transcriptase
encoding a nuclear localisation sequence. DNA samples from S.
cerevisiae expressing the 3'-recruitment system containing an
insert of 500 bp (pMW220) with or without the reverse transcriptase
(pMW27) were resolved by agarose gel electrophoresis and detected
by probing a Southern blot with msr-msd. The high molecular weight
signals represent the parental plasmids encodings 3'-recruitment
components which cross-react with the probe.
[0070] FIG. 14: Application of reverse transcription- based gene
targeting systems to plants.
[0071] The figure illustrates one embodiment of the invention where
a transgene construct encoding a gene targeting system is
integrated into the host plant chromosome. The transcript encoding
the gene targeting sequence is reverse transcribed by the reverse
transcriptase to form a cDNA which can act as a gene targeting
substrate. Because multiple transcripts of the gene targeting
sequence may be produced and reverse transcribed, multiple copies
of the gene targeting substrate may be produced in cells throughout
plant developmental stages. Thus multiple opportunities may occur
for the gene targeting substrate to modify the target chromosomal
locus. The transformation construct may be eliminated from the
genome of a plant encoding the modified chromosomal locus by
breeding.
DETAILED DESCRIPTION OF THE INVENTION
[0072] The present invention relates to in vivo gene modification.
More specifically the present invention relates to systems for
producing gene targeting substrates using RNA intermediaries, as
well as methods for promoting in vivo gene modification using such
gene targeting substrates.
[0073] In various aspects, the invention provides methods and
nucleic acid constructs that may be used to modify a nucleic acid
of interest at a target locus within the genome of a host. In some
aspects, the invention contemplates producing in vivo a gene
targeting substrate (GTS), which may be comprised of both DNA and
RNA components. The GTS may comprise a gene targetig nucleotide
sequence (GTNS), which is homologous to the target locus, but which
comprises a sequence modification compared to the target locus. The
GTS may be produced by reverse transcription of a gene targeting
message RNA (gtmRNA). The gtmRNA may be folded or hybridized for
self-priming for reverse transcription by a reverse transcriptase
(RT). The gtmRNA may in turn be the product of transcription of a
gene targeting construct (GTC) encoding the gene targeting message
RNA. The gene targeting construct may for example be a DNA sequence
integrated into the genome of the host, or integrated into an
extrachromosomal element. Following expression of the gene
targeting systems of the invention, hosts may for example be
selected having genomic modifications at a target locus that
correspond to the sequence modification present on the gene
targeting nucleotide sequence. In some embodiments, the structure
of retrons may be adapted for use in the gene targeting systems of
the invention. The gene targeting substrate may for example be
similar in structure to a multi-copy single stranded DNA (msDNA),
as produced by a retron.
[0074] According to an aspect of the present invention, there is
provided a method to modify or insert a nucleic acid of interest at
a target locus within the genome of a host. The nucleic acid of
interest is synthesized in vivo from a suitable RNA template using
reverse transcriptase. An example of this method comprises:
[0075] i) introducing into a host, a nucleotide sequence encoding
an RNA that comprises a gene targeting nucleotide sequence, and a
second nucleotide sequence encoding a reverse transcriptase;
[0076] ii) synthesizing an RNA template from the nucleotide
sequence;
[0077] iii) generating a reverse transcribed product from the RNA
template within the host using the reverse transcriptase, to
produce a gene targeting substrate (GTS); and
[0078] iv) selecting for modification the target locus within the
genome of the host.
[0079] Alternatively, the host may already be modified to express
either a gene targeting nucleotide sequence (GTNS), or a reverse
transcriptase. In the case where the RT is expressed within the
host, the method would involve:
[0080] i) introducing into a host capable of expressing a reverse
transcriptase, a nucleotide sequence encoding an RNA that comprises
a gene targeting nucleotide sequence;
[0081] ii) synthesizing an RNA template from the nucleotide
sequence;
[0082] iii) generating a reverse transcribed product from the RNA
template within the host, to produce a gene targeting substrate
(GTS); and
[0083] iv) selecting for modification the target locus within the
genome of the host.
[0084] The nucleotide sequence encoding an RNA that comprises a
gene targeting nucleotide sequence may be introduced using any
suitable method for example but not limited to, transformation
(either stable or transient), or by cross breeding.
[0085] Similarly, if the host were modified to produce a nucleotide
sequence encoding an RNA that comprises a gene targeting nucleotide
sequence, the
[0086] i) introducing into a host capable of expressing a
nucleotide sequence encoding an RNA that comprises a gene targeting
nucleotide sequence, a second nucleotide sequence encoding a
reverse transcriptase;
[0087] ii) synthesizing an RNA template from the nucleotide
sequence;
[0088] iii) generating a reverse transcribed product from the RNA
template within the host, to produce a gene targeting substrate
(GTS); and
[0089] iv) selecting for modification the target locus within the
genome of the host.
[0090] The second nucleotide sequence encoding the RT may be
introduced using any suitable method for example but not limited
to, transformation (either stable or transient), or by cross
breeding.
[0091] A wide variety of reverse transcriptases (RT) may be used in
alternative embodiments of the present invention, including
prokaryotic and eukaryotic RT, provided that the RT functions
within the host to generate a GTS from the gene targeting RNA
template. If desired, the nucleotide sequence of a native RT may be
modified, for example using known codon optimization techniques, so
that expression within the desired host is optimized. By codon
optimization it is meant the selection of appropriate DNA
nucleotides for the synthesis of oligonucleotide building blocks,
and their subsequent enzymatic assembly, of a structural gene or
fragment thereof in order to approach codon usage within the
host.
[0092] It is preferred that the RT be targeted to the nucleus so
that efficient utilization of the RNA template may take place. An
example of such a RT includes any known RT, either prokaryotic or
eukaryotic, fused to a nuclear localization signal (NLS). Any
suitable NLS may also be used, providing that the NLS assists in
localizing the RT within the nucleus. Even though it is preferred
that the RT be fused to a NLS, the use of an RT in the absence of
an NLS may also be used if the RT is present within the nuclear
compartment at a level that synthesizes a product from the RNA
template.
[0093] A wide variety of RNA templates may be used as described
herein. Examples of alternative RNA templates include retron-like
RNA, retroviral-like RNA, or RNA derived from a retrotransposon. In
some embodiments, for example, the gene targeting message RNA may
further comprise a seqence encoding a reverse transciptase.
[0094] In one embodiment, a method to modify or insert a nucleic
acid of interest at a target locus within the genome of a host
using a reverse transcribed (retron-based) RNA template
comprises:
[0095] i) introducing into the host, a nucleotide sequence encoding
an msr coding region, a gene targeting nucleotide sequence, an msd
coding region (msr-GTNS-msd), and a nucleotide sequence encoding a
reverse transcriptase;
[0096] ii) replicating the msr-GTNS-msd within the host to produce
a gene targeting substrate (GTS); and
[0097] iii) selecting for modification the target locus within the
genome of the host.
[0098] In one aspect, the present invention provides a nucleotide
sequence comprising:
[0099] i) an msr and an msd nucleotide coding region in operative
association with;
[0100] ii) a gene-targeting nucleotide sequence (GTNS), and
optionally;
[0101] iii) a nucleotide sequence encoding a reverse transcriptase
(RT). The nucleotide sequence may comprise, in the following order,
an msr element ORF, a gene-targeting nucleotide sequence, and an
msd element ORF (as shown in FIG. 1), and is referred to herein as
"msr-GTNS-msd". Alternatively, the GTNS may be inserted within the
msd region, preferably within a hairpin region of msd (see for
example FIGS. 4, 3B, 5). In alternative embodiments, the msr and
msd regions may be modifed (inverted) as shown in FIG. 11 so that
the 3' msr, and 5' msd, termini are spatially separated from the
internal rG residue used to prime the synthesi of msDNA. In this
manner foreign inserts may added to the 5' ends of msd. Synthesis
of msDNA (gene targeting susbtrate; GTS) has been observed using
the constructs outlined in FIG. 3B, 5 (modified msd hairpin), as
shown in FIG. 6 and 7. Similarly, synthesis of a GTS has been
observed using constructs shown in FIG. 11 (inverted msr-msd
regions) as shown in FIGS. 12 and 13.
[0102] A nucleotide sequence comprising msr and a GTNS inserted
within the msd region is also referred to as "msr-GINS-msd". The
msr-GTNS-msd may be transcribed to produce an msDNA comprising the
gene targeting nucleotide sequence.
[0103] As used herein, the product msDNA may also be termed "gene
targeting substrate" (GTS). The msDNA may be produced from a
msr-GTNS-msd sequence encoded by a construct that has been
introduced into the genome of a host and that is stabley
integrated, for example, but not limited to Agrobacterium mediated
transformation, or the msDNA may be produced from a transiently
expressed construct, for example introduced into the via biolistics
or via a viral vector.
[0104] The nucleotide sequence encoding a reverse transcriptase may
be part of the same construct comprising the nucleic acid sequence
encoding msr-GTNS-msd, or the nucleotide sequence comprising the
reverse transcriptase (RT) may be separate from the nucleotide
sequence encoding msr-GTNS-msd, and introduced into the host
separately. If the RT is introduced separately, it may be
introduced to the host as a second vector (re-transformation), it
may be introduced by cross breeding, or it maybe introduced into
the host using any other method known in the art. Furthermore, the
vector comprising the RT may be introduced into a host already
comprising a nucleotide sequence encoding msr-GTNS-msd in a
transient manner, for example via biolostics, or viral
transformation as is known in the art. It is preferred that the
nucleotide sequence encoding the RT also encode a nuclear
localization signal (NLS) to promote targeting of the RT to the
nuclear compartment for efficient production of msDNA (FIG. 2).
[0105] By the term "retron" it is meant a genetic element which
encodes components enabling the synthesis of branched RNA-linked
single stranded DNA (msDNA) and a reverse transcriptase. Retrons
which encode msDNA are known in the art, for example, but not
limited to U.S. Pat. Nos. 6,017,737; 5,849,563; 5,780,269;
5,436,141; 5,405,775; 5,320,958; CA 2,075,515; all of which are
herein incorporated by reference).
[0106] The msr element ORF of a retron provides for the RNA portion
of the msDNA molecule, while the msd element ORF provides for the
DNA portion of the msDNA molecule. The primary transcript from the
msr-msd region is thought to serve as both a template and a primer
to produce the msDNA (60). Synthesis of msDNA is primed from an
internal rG residue of the RNA transcript using its 2'-OH group.
The msDNA of the present invention comprises:
[0107] i) a branched RNA portion that is:
[0108] a) covalently linked, near the 5' end of the RNA, to the 2'
end of a single stranded DNA portion by a 2',5' phosphodiester bond
between the 2'-OH group of an internal rG residue and the 5'
phosphate of the DNA molecule; and
[0109] b) non-covalently linked, at the 3' the RNA, to the other
end of the DNA, by base pairing between complementary 3' ends of
the RNA and DNA molecules;
[0110] ii) a stable stem loop structure (secondary structure) in
the RNA portion, the DNA portion, or both; and
[0111] iii) a gene targeting nucleotide sequence (GTNS), comprising
a gene of interest, wherein at least a portion of the GTNS is
homologous to a target gene within the host.
[0112] In some embodiments, the GTNS, GTS or both, may be an
integer length of from about 15 bps to about 5000 bp, for example
of from about 15 bp to about 2000 bp, or from about 15 bp to about
1000 bp. The regions of homology between the GTNS or GTS and the
target gene within the host may for example comprise one or several
regions of homology such as regions or high homology or strict
identity of at least about 5, 10, 15, 20, or 25 bp in length.
[0113] Several msDNAs have been described in the literature,
including but not limited to:
[0114] i) Mx162 (Dhundale et al., cell, 51, 1105-1112, 1987);
[0115] ii) Mx65 (Dhundale et al., J. Biol. Chem, 263, 9055-9058,
1988);
[0116] iii) Sal 63 (Furuichi et al., Cell 48, 47-52, 1987) and
Furuichi et al., Cell, 48, 55-62, 1987);
[0117] iv) Ec67 (Lamson et al, Science, 243, 1033-1038, 1989);
[0118] v) Ec86 (Lim and Maas, Cell, 56, 891-904, 1989);
[0119] vi) Ec73 (Sun et al., J. Bacteriol.173, 4171-4181,
1991);
[0120] vii) Ec107 (Herzer et al., Mol. Microbiol. August 1991),
and;
[0121] viii) msDNA from E. coliB (Lim and Maas, Cell, 56, 891-904,
1989). Further, several retrons which produce msDNA are known in
the art, for example, but not limited to U.S. Pat. Nos. 6,017,737;
5,849,563; 5,780,269; 5,436,141; 5,405,775; 5,320,958; CA 2,075,515
(all of which are herein incorporated by reference). In some
embodiments, a GTNS or GTS may be added to adapt these native
msDNAs for use in the invention.
[0122] At least a portion of the gene-targeting nucleotide sequence
(GTNS), gene targeting substrate (GTS), or both, of the present
invention is homologous to a target locus within a cell. In various
embodiments, the GTNS or GTS further comprises at least one
nucleotide difference when compared to the target locus sequence.
In comparison with a target locus, the gene-targeting nucleotide
sequence may comprise one or more single base pair modifications,
deletions, additions or any combination thereof, provided that
sufficient homology between the GTNS or GTS and the target locus
remains to permit modification of the target locus. Alternately,
the GTNS or GTS may comprise two or more segments that boarder a
nucleotide sequence of interest, where the nucleotide sequence of
interest is not homologous with the target locus. In this
alternative, the boarder segments comprise sufficient homology with
a target locus to permit modification of the target locus arising
from the nucleotide sequence of interest. Furthermore, a decrease
in the overall homology between a GTNS or GTS and a target locus
may arise due to a deletion or an insertion within either the
target locus, the GTNS or GTS, or the use of a cDNA to encode the
GTNS or GTS and sequence differences arising due to introns present
within the target locus. Other reasons for dissimilarity may also
occur, however, such dissimilar sequences may still be used to
modify a target locus provided that a sufficient portion of the
GTNS or GTS is homologous with the target locus to result in
modification of the target locus.
[0123] By the term "homologous" or "homology" it is meant that a
first nucleotide sequence comprises between about 70% and about
100% sequence similarity with a second nucleic acid sequence.
Preferably, the nucleotide sequences exhibit between about 85% to
about 99% similarity, more preferably between about 95% and 100%
similarity. An example of a first nucleotide sequence may be a GTNS
or a GTS, or a segment of a GTNS or GTS, for example a boarder
segment. An example of a second nucleic acid sequence may be a
target locus of interest. It is to be understood that the degree of
homology between a GTNS or GTS and a target locus will vary
depending on whether a full length GTNS or GTS exhibits homology to
the target locus, or whether segments that boarder, or that are
within the GTNS or GTS, comprises one or more than one nucleotide
sequences that are homologous with a target locus of interest.
[0124] Therefore, the present invention pertains to a GTNS
comprising one, or more than one, region of 15 to about 300, or to
about 500 nucleotides in length, and exhibiting about 70% to about
100% sequence similarity with a target locus sequence (determined
using the following conditions: Program: blastp; Database: nr;
Expect 10; filter: default; Alignment: pairwise; Query genetic
Codes: Standard (1)). The GNTS may further comprise a nucleic acid
sequence of interest that may or may not exhibit homology with the
target locus of interest. Using this method, a target locus of
interest may be modified with a partially homologous nucleic acid
sequence, or a non-homologous nucleic acid sequence that also
comprises regions of homology as described above to permit
recombination with the target locus.
[0125] The homology between the GTNS or GTS, or boarder segments of
the GTNS or GTS, and the target locus may be readily determined by
one of skill in the art using any suitable sequence alignment
algorithm, for example but not limited to BLAST (GenBank URL:
www.ncbi.nlm.nih.gov/cgi-b- in/BLAST/, using default parameters:
Program: blastp; Database: nr; Expect 10; filter: default;
Alignment: pairwise; Query genetic Codes: Standard (1)).
[0126] The degree of homology between sequences may be expressed as
a percentage of identity when the sequences are optimally aligned,
meaning the occurrence of exact matches between the sequences.
Optimal alignment of sequences for comparisons of identity may be
conducted using a variety of algorithms, such as, but not limited
to the local homology algorithm of Smith and Waterman,1981, Adv.
Appl. Math 2: 482, the homology alignment algorithm of Needleman
and Wunsch, 1970, J. Mol. Biol. 48:443, the search for similarity
method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:
2444, and the computerised implementations of algorithms such as,
but not limited to GAP, BESTIPT, FASTA and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, Madison, Wis.,
U.S.A. Sequence alignment may also be carried out using the BLAST
algorithm, described in Altschul et al., 1990, J. Mol. Biol.
215:403-10 (using the published default settings or others).
Software for performing BLAST analysis is also available through
the National Center for Biotechnology Information (through the
internet at http://www.ncbi.nlm.nih.gov/). The BLAST programs may
use as defaults a word length (W) of 11, the BLOSUM62 scoring
matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci. USA 89:
10915-10919) alignments (B) of 50, expectation (E) of 10 (which may
be changed in alternative embodiments to 1 or 0.1 or 0.01 or 0.001
or 0.0001; although E values much higher than 0.1 may not identify
functionally similar sequences, it is useful to examine hits with
lower significance, E values between 0.1 and 10, for short regions
of similarity), M=5, N=4, for nucleic acids a comparison of both
strands. For protein comparisons, BLASTP may be used with defaults
as follows: G=11 (cost to open a gap); E=1 (cost to extend a gap);
E=10 (expectation value, at this setting, 10 hits with scores equal
to or better than the defmed alignment score, S, are expected to
occur by chance in a database of the same size as the one being
searched; the E value can be increased or decreased to alter the
stringency of the search.); and W=3 (word size, default is 11 for
BLASTN, 3 for other blast programs). The BLOSUM matrix assigns a
probability score for each position in an alignment that is based
on the frequency with which that substitution is known to occur
among consensus blocks within related proteins. The BLOSUM62 (gap
existence cost=11; per residue gap cost=1; lambda ratio=0.85)
substitution matrix is used by default in BLAST 2.0. A variety of
other matrices may be used as alternatives to BLOSUM62, including:
PAM30 (9,1,0.87); PAM70 (10,1,0.87) BLOSUM80 (10,1,0.87); BLOSUM62
(11,1,0.82) and BLOSUM45 (14,2,0.87). One measure of the
statistical similarity between two sequences using the BLAST
algorithm is the smallest sum probability (P(N)), which provides an
indication of the probability by which a match between two
nucleotide or amino acid sequences would occur by chance. In
alternative embodiments of the invention, nucleotide or amino acid
sequences are considered substantially identical if the smallest
sum probability in a comparison of the test sequences is less than
about 1, preferably less than about 0.1, more preferably less than
about 0.01, and most preferably less than about 0.001.
[0127] An alternative indication that two nucleic acid sequences
are substantially identical is that the two sequences hybridize to
each other under moderately stringent, or preferably stringent,
conditions. Hybridization to filter-bound sequences under
moderately stringent conditions may, for example, be performed in
0.5 M NaHPO.sub.4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at
65.degree. C., and washing in 0.2.times.SSC/0.1% SDS at 42.degree.
C. (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular
Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley
& Sons, Inc., New York, at p. 2.10.3). Alternatively,
hybridization to filter-bound sequences under stringent conditions
may, for example, be performed in 0.5 M NaHPO.sub.4, 7% SDS, 1 mM
EDTA at 65.degree. C., and washing in 0.1.times.SSC/0.1% SDS at
68.degree. C. (see Ausubel, et al. (eds), 1989, supra).
Hybridization conditions may be modified in accordance with known
methods depending on the sequence of interest (see Tijssen, 1993,
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
"Overview of principles of hybridization and the strategy of
nucleic acid probe assays", Elsevier, N.Y.). Generally, but not
wishing to be limiting, stringent conditions are selected to be
about 5.degree. C. lower than the thermal melting point for the
specific sequence at a defined ionic strength and pH.
[0128] By the term "target locus" it is meant one or more regions
of the genome of a host. The target locus may comprise any
nucleotide sequence of interest within a cell that is to be
modified or replaced. It is to be understood that several loci may
have similar sequences, that exhibit sufficient homology with a
GTNS, or a segment thereof, and that a host may comprise multiple
target loci. Preferably, the gene of interest at the target locus
is normally found in nature within the cell. However, a target
locus may also comprise an exogenous nucleotide sequence that has
been integrated in the genome of a cell. The target locus may
comprise a nucleotide sequence that encodes a protein, or a portion
of a protein. Alternatively, the target locus may comprise a
nucleotide sequence, such as, but not limited to a regulatory
region. Examples of regulatory regions may include, but are not
limited to promoters, enhancers terminators, matrix attachment
regions, splicing sites, or portions thereof. Any nucleotide
sequence within the genome of a cell may be considered a target
locus according to the present invention.
[0129] The cell may for example be a eukaryotic cell, such as a
plant cell, animal cell, insect cell, or yeast cell. The invention
also provides hosts comprising the nucleotide constructs of the
invention. The host may for example be a eukaryotic host such as a
plant, animal, insect, or yeast host. The invention provides lineal
relatives of a host. By lineal relative, it is meant either a
parent or progeny of the host.
[0130] The GTNS may for example be homologous to a wide variety of
nucleic acids of interest within a host. A nucleic acid of interest
may include for example, coding and non-coding regions of a gene
encoding a protein or a fragment thereof, or snRNA genes. A nucleic
acid of interest may for example include, a portion of a gene that
encodes a pharmaceutically active protein or fragment thereof, for
example growth factors, growth regulators, antibodies, antigens,
their derivatives useful for immunization or vaccination and the
like. Such proteins include, but are not limited to, interleukins,
insulin, G-CSF, GM-CSF, HPG-CSF, M-CSF or combinations thereof,
interferons, for example, interferon-alpha, interferon-.beta.,
interferon-gamma, blood clotting factors, for example, Factor VIII,
Factor IX, or tPA or combinations thereof. A nucleic acid of
interest may also encode an industrial enzyme, protein supplement,
nutraceutical, or a value-added product for feed, food, or both
feed and food use. Examples of such proteins include, but are not
limited to proteases, oxidases, phytases, chitinases, invertases,
lipases, cellulases, xylanases, enzymes involved in oil
biosynthesis, hydrogenases, dehydrogenases, hydroxylases,
dehydroxylases, etc.
[0131] The msr-msd region and a sequence of interest are "operably
linked" when the sequences are functionally connected so as to
permit transcription of the sequence of interest resulting in the
production of msDNA. Similarly, a transcriptional regulatory region
and a sequence of interest are "operably linked" when the sequences
are functionally connected so as to permit transcription of the
sequence of interest to be mediated or modulated by the
transcriptional regulatory region.
[0132] The gene-targeting nucleotide sequence (GINS) of the present
invention, which exhibits some homologys to a gene of interest at a
target locus, may be located in the msr, msd, between the msr and
msd coding regions, or at and end of a mofied msd region in such a
manner that the GTNS does not affect folding or function of the
msr-GRNS-msd transcript. Further, the position of the gene
targeting sequence is such that it does not prevent recognition of
the ribonucleotide G residue used by the reverse transcriptase to
prime transcription. In some embodiments, the GTNS is positioned
between the msr and msd coding regions of the retron, within the
msd region (see FIG. 5), or in some cases at an end of the msd
region (e.g. FIG. 11). For example, which is not to be considered
limiting in any manner, the msd region may be modified to accept a
GTNS within the hairpin loop as shown in FIGS. 4, 3B, 5. In some
embodiments, a GTS of up to 500 nucleotides in length have been
produced (FIGS. 5 and 6).
[0133] The retron may also be modified so that the free 5' and 3'
termini of msd and msr regions are spatially separated from the
internal rG residue of the RNA transcript required for priming
reverse transcription in the synthesis of msDNA (as described
earlier; see FIG. 11). This structure provides a 5' end for
addition of a GTNS. Termination of replication of the msr-GTNS-msd
results by the reverse transcriptase falling off the end of the
GTNS. Using this cassette, synthesis of a GTS of up to 500 base
pairs has been observed (FIGS. 12 and 13).
[0134] Other modifications of msd, or msr may also be made to
permit insertion of a GTNS within msd without altering the
functioning of msr-GTNS-msd or the production of msDNA. For
example, which is not to be considered limiting, the msd region may
be altered to introduce a second stem-loop structure, in addition
to the insertion of the GTNS within the hairpin of the first
stem-loop structure, as shown in FIGS. 4 and 9. This second
stem-loop structure (stop stem) ensures specific termination of
replication by the reverse transcriptase so as to produce a GTS
with a well defined 3' terminus.
[0135] Canadian Patent Application No. 2,075,515 (which is
incorporated herein by reference) describes heterologous nucleotide
sequences incorporated into retrons which may be used to produce
polypeptides or inhibit production of genes via antisense
technology. The gene-targeting nucleotide sequence of the present
invention may also be located in a similar location when employed
with the same retron or different retrons as described therein.
[0136] The gene-targeting nucleotide sequence may be any length but
is preferably less than about 5 kb nucleotides, or also less than
about 2 kb, provided that an msDNA product is produced.
Non-limiting examples of production of msDNA are provided using a
GTNS of about less than about 500 nucleotides (FIGS. 5, 6, 12 and
13), however, it is to be understood that longer nucleotide
sequences may also be used. As demonstrated in FIGS. 3B and 11, the
msr-msd sequence may be altered to permit the insertion of longer
GTNS.
[0137] In some embodiments, a nucleotide sequence if interest
resides between segments of the GTNS that are homologous, or
preferably, identical to the target locus. In this regard, the GTNS
may comprise more than about 15 nucleotides, preferably more than
about 25 nucleotides in length, over the region of homology or
identity with the target locus sequence. In some embodiments, the
region of the gene targeting sequence which is dissimilar to the
target locus sequence is located between regions of higher homology
or identity to the gene targeting nucleotide sequence.
[0138] In some embodiments, increasing the degree of homology
between the GTS and the target locus may promote modification of
the genome of a cell by gene conversion, homologous recombination
or other process. Accordingly, in one aspect of the invention, the
nucleotide sequence of the target locus of interest may be changed
to be the same as or complimentary to the nucleotide sequence
encoded by the gene-targeting nucleotide sequence of the present
invention.
[0139] In some embodiments, at least one of the copies of the gene
targeting sequence, or a portion thereof, interacts with a target
sequence in the genome of the host to modify the target sequence to
produce a heritable change, for example by the processes of
homologous recombination, or gene conversion or nucleic acid
repair. As discussed above, a portion of the GTS may have a high
degree of identity to a portion of the target sequence, such that
the sequence is sufficiently identical to facilitate homologous
pairing with the target sequence. The relevant portion of the
reproducible sequence may in some embodiments be 5, 10, 15, 20, 25
or more nucleotides in length, and the identity between the
portions of the reproducible and target sequences may for example
be 50%-100%, more than 60%, 70%, 80%, 90% or 95%. In some
embodiments, the degree of homology and the length of the relevant
portion of the reproducible sequence may be selected so that the
reproducible sequence is homologous only to the target sequence in
the genome, and not to other sequences in the genome. The relevant
portion of the reproducible sequence may differ from the
corresponding portion of the target sequence by having at least one
nucleic acid deletion, substitution or addition.
[0140] In alternative embodiments, the methods of the present
invention may utilize a variety of reverse transcriptases, for
exambe being of either eukaryotic or prokaryotic origin, or an
analog or derivative thereof, provided that the RT is capable of
recognizing and reverse transcribing the RNA transcription product
produced by a gene targeting construct of the invention (such as
the msr-GTNS-msd region of such a transcription product). The
sequence encoding RT may be separate from the RNA template, for
example, msr-GTNS-msd, or may be fused to the RNA template encoding
for example, msr-GTNS-msd as required.
[0141] In an aspect of the invention, the nucleotide sequence
encoding a reverse transcriptase further comprises a nuclear
localization signal sequence (NLS). The NLS may be selected to
promote accumulation of the RT in the nucleus of a host cell, and
to increases the yield of msDNA produced (see FIG. 2). The use of
an NLS may be particularly advantageous with an RT of prokaryotic
origin. The NLS may for example be added to the 3' or 5' ends, or
within the interior of the RT. Also, the RT sequence may be
modified to encode an NLS, rather than fusing an NLS to the RT. A
variety of nuclear localization signal sequences may be employed in
the present invention, selected for example so that the NLS is
active within the cell type in which the reverse transcriptase is
produced. Examples of nuclear localization signal sequences are
listed in Table 1.
1TABLE 1 Nuclear Localization Signals Nuclear Protein Organism NLS
Ref AGAMOUS A RienttnrqvtfcKRR (i) TGA-1A T RRlaqnreaaRKsRlRKK (ii)
TGA-1B T KKRaRlvrnresaqlsRqRKK (ii) O2 NLS B M RKRKesnresaRRsRyRK
(iii) NIa V KKnqkhklkm-32aa-KRK (iv) Nucleoplasmin X
KRpaatkkagqaKKKK1 (v) NO38 X KRiapdsaskvpRKKtR (v) N1/N2 X
KRKteeesplKdKdaKK (v) Glucocorticoid (v) receptor M, R
RKclqagmnleaRKtKK (v) .alpha. receptor H RKclqagmnleaRKtKK (v)
.beta. receptor H RKclqagmnleaRKtKK (v) Progesterone receptor C, H,
Ra RKccqagmvlggRKfKK (v) Androgen receptor H RKcyeagmtlgaRKlKK (v)
p53 C RRcfevrvcacpgRdRK (v) .sup.+A, Arabidopsis; X, Xenopus; M,
mouse; R, rat; Ra, rabbit; H, human; C, chicken; T, tobacco; M,
maize; V, potyvirus. References: (i), Yanovsky et al., 1990,
Nature, 346: 35-39. (ii), van der Krol and Chua, 1991, Plant Cell,
3: 667-675. (iii), Varagona et al., 1992, Plant Cell, 4: 1213-1227.
(iv), Carrington et al., 1991, Plant Cell, 3: 953-962. (v), Robbins
et al., 1991, Cell, 64: 615-623.
[0142] In various embodiments, the msr-GTNS-msd, and the nucleotide
sequence encoding the RT, are in operative association with one or
more appropriate regulatory regions, for example but not limited to
a promoter, that mediates transcription of the respective
sequences. The msr-GTNS-msd and nucleotide sequence encoding the RT
may for example be in operative association with a single
regulatory region. Alternatively, the msr-GTNS-msd may be in
operative association with a first regulatory region, and the
nucleotide sequence encoding the RT in operative association with a
second regulatory region. In such embodiments, the first regulatory
region and the second regulatory region may be the same or
different.
[0143] By "regulatory region" or "regulatory element" it is meant a
portion of nucleic acid typically, but not always, upstream of the
protein coding region of a gene, which may be comprised of either
DNA or RNA, or both DNA and RNA. When a regulatory region is
active, and in operative association with a gene of interest, this
may result in expression of the gene of interest. A regulatory
element may be capable of directly or indirectly mediating organ
specificity, or controlling developmental or temporal gene
activation. A "regulatory region" includes promoter elements, core
promoter elements exhibiting a basal promoter activity, elements
that are inducible in response to an external or developmental
stimulus, elements that mediate promoter activity such as negative
regulatory elements or transcriptional enhancers. "Regulatory
region", as used herein, also includes elements that are active
following transcription, for example, regulatory elements that
modulate gene expression such as translational and transcriptional
enhancers, translational and transcriptional repressors, upstream
activating sequences, and mRNA instability determinants. Several of
these latter elements may be located proximal to the coding
region.
[0144] In the context of this disclosure, the term "regulatory
element" or "regulatory region" typically refers to a sequence of
DNA, usually, but not always, upstream (5') to the coding sequence
of a structural gene, which controls the expression of the coding
region by providing the recognition for RNA polymerase and/or other
factors required for transcription to start at a particular site.
However, it is to be understood that other nucleotide sequences,
located within introns, or 3' of the sequence may also contribute
to the regulation of expression of a coding region of interest. An
example of a regulatory element that provides for the recognition
for RNA polymerase or other transcriptional factors to ensure
initiation at a particular site is a promoter element. Most, but
not all, eukaryotic promoter elements contain a TATA box, a
conserved nucleic acid sequence comprised of adenosine and
thymidine nucleotide base pairs usually situated approximately 25
base pairs upstream of a transcriptional start site. A promoter
element typically comprises a basal promoter element, responsible
for the initiation of transcription, as well as other regulatory
elements that modify gene expression.
[0145] There are several types of regulatory regions, including
those that are developmentally regulated, inducible or
constitutive. A regulatory region that is developmentally
regulated, or controls the differential expression of a gene under
its control, is activated within certain organs or tissues of an
organ at specific times during the development of that organ or
tissue. However, some regulatory regions that are developmentally
regulated may preferentially be active within certain organs or
tissues at specific developmental stages, they may also be active
in a developmentally regulated manner, or at a basal level in other
organs or tissues within the plant as well.
[0146] An inducible regulatory region is one that is capable of
directly or indirectly activating transcription of one or more DNA
sequences or genes in response to an inducer. In the absence of an
inducer the DNA sequences or genes will not be transcribed.
Typically the protein factor, that binds specifically to an
inducible regulatory region to activate transcription, may be
present in an inactive form which is then directly or indirectly
converted to the active form by the inducer. However, the protein
factor may also be absent. The inducer can be a chemical agent such
as a protein, metabolite, growth regulator, herbicide or phenolic
compound or a physiological stress imposed directly by heat, cold,
salt, radiation, or toxic elements or indirectly through the action
of a pathogen or disease agent such as a virus. A plant cell
containing an inducible regulatory region may be exposed to an
inducer by externally applying the inducer to the cell or plant
such as by spraying, watering, heating, exposing to radiation,
culturing in an inducing agent, or similar methods. Inducible
regulatory elements may be derived from either plant or non-plant
genes (e.g. Gatz, C. and Lenk, I. R. P.,1998, Trends Plant Sci. 3,
352-358; which is incorporated by reference). Examples, of
potential inducible promoters include, but not limited to,
teracycline-inducible promoter (Gatz, C.,1997, Ann. Rev. Plant
Physiol. Plant Mol. Biol. 48, 89-108; which is incorporated by
reference), steroid inducible promoter (Aoyama, T. and Chua, N.
H.,1997, Plant J. 2, 397-404; which is incorporated by reference)
and ethanol-inducible promoter (Salter, M. G., et al, 1998, Plant
Journal 16, 127-132; Caddick, M. X., et al,1998, Nature Biotech.
16, 177-180, which are incorporated by reference) cytokinin
inducible IB6 and CKI1 genes (Brandstatter, I. and Kieber, J. J.,
1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274,
982-985; which are incorporated by reference) and the auxin
inducible element, DR5 (Ulmasov, T., et al., 1997, Plant Cell 9,
1963-1971; which is incorporated by reference).
[0147] In some embodiments, the regulatory region or regions
employed in the constructs of the invention are
cell-cycle-specific, such as regulatory regions active in the S
phase, G1/S boundary phase, G2 phase, or combinations thereof of
the cell cycle. Examples of such regulatory regions include, but
are not limited to histone promoters, for exarnple H4 promoter from
Arabidopsis (AtH4; Atanassova et al. 1994), cyclins (such as
CycD3), DNA replication proteins and DNA recombination and DNA
repair proteins.
[0148] The nucleotide sequence of the present invention may also
comprise a marker gene in addition to the msr-GTNS-msd and reverse
transcriptase coding regions. The marker gene may be separate from,
or fused with the msr-GTNS-msd and reverse trasncriptase sequence
and comprise a portion of the retron and be expressed within the
msDNA (GTS). Any marker gene in the art may be used in the present
invention. Examples of marker genes include, but are not limited to
antibiotic resistance genes, genes encoding enzymes that may be
detected by enzyme assays, genes encoding products that may be
detected immunologically, or genes that give rise to an observable
phenotype. Useful selectable markers include enzymes which provide
for resistance to an antibiotic such as gentamycin,
phosphinothricin, hygromycin, kanamycin, and the like. Similarly,
enzymes providing for production of a compound identifiable by
colour change such as GUS (glucuronidase), or luminescence, such as
luciferase or GFP may also be used. Further, as would be understood
by a person of skill in the art, the marker gene may comprise an
appropriate regulatory sequence that permits the marker gene to be
expressed in a cell or tissue, for example, but not limited to a
plant or animal cell or tissue.
[0149] In some embodiments, the msr-GTNS-msd of the present
invention comprises at least two sets of inverted repeat nucleotide
sequences. The inverted repeat sequences permit base pairing
between specific regions of the retron transcription product, and
may be adapted to enhances recognition and reverse transcription of
the retron transcription product by the selected reverse
transcriptase. The inverted repeats of known retrons vary
considerably in sequence and size. For example, the inverted
repeats in the Mx162 retron, termed a1 and a2, are 34 nucleotides
long, while the inverted repeats in the Ec86 retron of E. coli B
are 12 nucleotides long. Although the inverted repeat sequences are
different in size, they are typically located within the same
approximate position within a retron. The inverted repeat regions
of the constructs of the present invention may be similarly
varied.
[0150] The msr-GTNS-msd of the present invention may be assembled
in an appropriate vector to facilitate transfer of the gene
targeting system components into a cell. Methods which may be
employed to enhance entry of the vector into a cell include, but
are not limited to biolistic delivery (Klein, T M, et al. 1988,
Proc Natl Acad Sci U S A 85, p. 8502), chemical treatment (Kresn, F
A, et al., 1982, Nature 296, p. 72; Deshayes, A, et al., 1985, EMBO
J 4: 2731-2737), physical treatment (Shillito, R D, 1985,
Bio/technology 3, p. 1099; D'Halluin, K, et al., 1992, Plant Cell
4: 1495-1505; Crossway, A, 1986, Mol Gen Genet 202, p. 179), or
combination thereof. In an aspect of an embodiment wherein the cell
is a plant cell, the vector may be an Agrobacterium Ti plasmid
delivered by an Agrobacterium (Gasser, C. S., and Fraley, R. T.,
1989, Science 244, p. 1293). The constructs of the present
invention can be introduced into plant cells using Ri plasmids,
plant virus vectors, direct DNA transformation, micro-injection,
electroporation, etc. For reviews of such techniques see for
example Weissbach and Weissbach, Methods for Plant Molecular
Biology, Academy Press, New York VIII, pp. 421463 (1988); Geierson
and Corey, Plant Molecular Biology, 2d Ed. (1988); and Miki and
Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism,
2d Ed. D T. Dennis, D H Turpin, D D Lefebrve, D B Layzell (eds),
Addison Wesly, Langmans Ltd. London, pp. 561-579 (1997). The
present invention further includes a suitable vector comprising the
chimeric gene construct.
[0151] Following transformation of a host cell with a nucleotide
sequence of the resent invention, the msr-GTNS-msd may be
integrated into the host genome. If he nucleotide sequence of the
msr-GTNS-msd comprises a marker gene, the transformed cells may be
selected from non-transformed cells using an appropriate selection
method.
[0152] In an aspect of the invention, there is provided temporal
and/or spacial regulation of the production of a msDNA comprising
the gene targeting nucleotide sequence of the present invention.
For example, by using appropriate regulatory sequences, the
production of msDNA may be coordinated with selected points in the
cell cycle or made to occur in particular tissues or during
particular developmental stages so as to regulate the timing of
gene targeting when endogenous homologous recombination functions
may be activated. In alternative embodiments, the invention may for
example provide for expression of a msDNA comprising a gene
targeting sequence in the following manner:
[0153] i) Constitutive: msDNA comprising the gene targeting
nucleotide sequence of the present invention may be produced in all
cells, tissues and at all developmental and physiological stages.
In some instances, constitutive production of msDNA comprising a
gene targeting nucleotide sequence may be undesirable because of
unwanted physiological or genetic load in the cell. Therefore, more
specific expression may be advantageous in some situations.
[0154] ii) Cell cycle coordination: Endogenous homologous
recombination and DNA repair activities may be elevated during
S-phase of the cell cycle (Wong, E A, Capecchi, M R, 1987 Mol Cell
Biol 7: 2294-2295) as well as during G-2-phase [REFs]. Therefore,
production of msDNA comprising a gene targeting nucleotide sequence
may be coordinated with S-phase and/or G-2-phase so that endogenous
DNA recombination and repair enzymes may promote modification of
the target locus by transfer of the genetic information from the
gene targeting nucleotide sequence to the gene of interest.
[0155] Synchronization of the production and presence of msDNA
comprising a gene targeting nucleotide sequence in vivo with
selected points in the cell cycle may for example be achieved
through the use of cell-cycle specific promoters. Examples of
cell-cycle specific promoters include, but are not limited to
histone promoters and promoters of gene encoding cyclins, cell
division control genes, and genes encoding proteins involved in
homologous recombination (e.g. RAD51, RAD54, RAD52, RAD55, RAD57,
MRE11, RAD50, BRCA1, BRCA2). In the case of histone promoters,
histone genes are expressed coordinately with DNA replication to
produce the abundant proteins required to package the newly
synthesized DNA (Reichheld, J. P., et. al. 1998, Nucleic Acids Res
26: 3255-3262; Osley, M. A., 1991, Annu. Rev Biochem 60: 827-861).
A non limiting example is AtH4. In the case of cyclins and cell
division control genes are expressed at various points in the cell
cycle to initiate and terminate passage through the different
stages of the cell cycle (Huntley, R. P., and Murray, J. A. 1999,
Curr. Opin. Plant Biol 2: 440-446), for example but not limited to
AtCycD3.
[0156] In an aspect of an embodiment of the present invention, the
coordination of the production of msDNA comprising a gene targeting
nucleotide sequence with cell division may allow the msDNA
comprising a gene targeting nucleotide sequence to be produced in
dividing cells, for example, but not limited to, in the apical
meristem of a plant. This may provide opportunities for a gene
targeting event to occur in a cell which will, directly or
indirectly, later give rise to the germ line, so that progeny
plants may stably inherit the modified target locus.
[0157] Further alternatives are as follows:
[0158] iii) Developmental stage coordination: Endogenous
recombination and repair activities may be elevated during certain
developmental stages, for example meiosis (Roeder, G., S., 1997,
Genes Dev. 11: 2600-2621). Therefore, production of msDNA
comprising a gene targeting nucleotide sequence (GTS) may be
coordinated with these developmental stages so as to exploit the
elevated levels of endogenous recombination and repair activities
to promote or enhnace the transfer the genetic information from the
gene targeting nucleotide sequence to the target locus. For
example, but not wishing to be limiting, this may be achieved using
meiosis-specific promoters. Numerous examples exist of genes which
are expressed during meiosis and whose promoters may be adapted for
use in this invention (for example but not limited to KIimyuk, V.
I., et. al. 1997, Plant J. 11: 1-14; Ross-Macdonald, P., and
Roeder, G. S., 1994, Cell 79: 1069-1080; Kobayashi, T., 1994, DNA
Res. 1: 15-26; Chu, S, et. al. 1998, Science 282: 699-705).
[0159] iv) Tissue specific promoters: Specific tissues may have
elevated endogenous recombination and repair activity and/or be
more amenable for increased gene targeting frequency due to other
biochemical, cellular, physiological or developmental states. For
example, developing embryos undergo rapid cell division and have
active recombination and repair systems. Production and
accumulation of GTS in embryos or embryonic tissues could lead to
increased gene targeting frequency. In another example, developing
and mature male and female gametophytes (i.e. pollen and egg cells)
are haploid. Haploid cells may be more recombinogenic and amenable
to gene targeting than diploid cells (Schaefer, D. G., and Zryd, J.
P.,: 1997, Plant J. 11: 1195-1206). Therefore, production of GTS in
these cells and tissues using appropriate promoters may increase
gene targeting frequency.
[0160] Tissue specific promoters could also be employed if gene
targeting is to occur only within a particular tissue, or so that
other tissues are not altered by the gene targeting nucleotide
sequence. Thus, without wishing to be limiting, a tissue or
organ-specific promoter may be employed to create a chimeric plant
or animal containing both unmodified and modified target genes,
each being present in different tissues or organs.
[0161] Achieving gene targeting during meiosis and/or in gametes
may also have additional advantages in alternative embodiments,
including, but not limited to, embodiments adapted to generate
homozygous lines with targeted changes. If the gene targeting event
is adapted to occur at Meiosis I, then each of the resultant four
gametes may contain the specified genetic change. When the GTS is
produced in or delivered to meiotic cells, such as in early stages
of Meiosis I, large numbers of male and female gametes with the
desired targeted genetic changes may result.
[0162] In plants and other monoecious organisms where both male and
female gametes are produced by the same individual, simply
self-crossing the individual may result in a relatively high
frequency of diploid progeny which are homozygous for the targeted
genetic change. In alternative embodiments, in the case of plants,
one may obtain individuals homozygous for the targeted genetic
change by performing microspore culture after delivering gene
targeting substrate to the meiotic cells. Microspores are haploid
cells resulting from meiosis in the plant anther. These cells can
in some cases be cultured to regenerate entire plants (Coventry, J,
Kott, L, Beversdorf, W: 1998, Manual for microspore culture
technique for Brassica napus. University of Guelph, Guelph). The
plants can be chemically treated to create a diploid chromosome
content and are thus homozygous for all genetic information.
Therefore, microspores carrying the targeted genetic change as a
result of treating meiotic cells or the microspores themselves with
GTS may be cultured and converted into plants that are homozygous
for the targeted genetic change.
[0163] Alternatively, where male and female gametes are produced by
different individuals, the gene targeting process could be
performed in both male and female plants, and the two crossed. In
addition, achieving gene targeting during meiosis and/or in gametes
may be advantageous in embodiments adapted for direct germ-line
transmission of a targeted genetic change. Targeted genetic change
generated in a gamete in accordance with the invention may be
heritable in the offspring. In contrast, gene targeting conducted
in somatic cells will only be heritable if the somatic cell can
directly or indirectly give rise to the germ-line from which
gametes are derived.
[0164] In alternative embodiments, orchestrating gene targeting
during meiosis and/or in gametes may be advantageous in embodiments
adapted to target changes to either maternal or paternal derived
chromosomes. Targeted changes in either maternal or paternal
chromosomes may for example be obtained with this invention by
producing or delivering GTS to either female or male reproductive
organs.
[0165] Further alternatives are as follows:
[0166] v) Environmentally stimulated: In some embodiments, the
invention may provide for activation of gene targeting by
environmental stimuli, for example by linking expression of
components of the gene targeting system of the invention to
promoters that are responsive. to environmental stimuli. Exposure
of cells to different environmental conditions can elevate activity
of endogenous DNA recombination and repair processes (Friedberg, E
C, et al., 1995, Amer. Soc. Microbiol., Washington, D.C.; Hoffmann,
G R 1994, Environ. Mol Mutagen. 23 Suppl 24: 59-66; Schiestl, R H.,
1989, Nature 337: 285-288). Therefore, it may be beneficial to
coordinate production of gene targeting substrate in response to
these stimuli to take advantage of the elevated recombination and
repair activity so as to transfer the genetic information from the
gene targeting substrate to the target locus.
[0167] For example, the RAD51 gene encodes an enzyme involved in
DNA recombination and repair that is induced in response to DNA
damaging agents (Basile, G., 1992, Mol. Cell Biol. 12: 3235-3246;
Rozwadowski, K, et al., 1999, 10th International Conference on
Arabidopsis Research, Melbourne, Australia, Jul. 4-8, 1999).
Components of the gene targeting system of the invention could be
fused to the RAD51 promoter to coordinate induction and production
of gene targeting substrate with endogenous recombination and
repair functions in response to environmental stimuli.
[0168] vi) Inducible: In alternative aspects of the invention,
inducible promoters may be provided to drive expression of
components of the gene targeting system. For example, a sequence
encoding components of the gene targeting system may be cloned
behind an inducible or repressible promoter. The promoter may then
be induced (or de-repressed) by appropriate external treatment of
the organism when organismal development proceeds to a point when
gene targeting is desired. Regulation of such promoters may be
mediated by environmental conditions such as heat shock (Ainley, W
M,1990, Plant Mol. Biol. 14: 949-967), or chemical stimulus.
Examples of chemically regulatable promoters active in plants and
animals include the ecdysone, dexamethasone, tetracycline and
copper systems (Martinez, A, et al., 1999, Plant J. 19: 97-106;
Bohner, S, et al., 1999, Plant J. 19: 87-95; Gatz, C, et al., 1991,
Mol. Gen. Genet. 227: 229-237; Weinmann, P, et al., 1994, Plant J.
5: 559-569; Mett, V L, 1996, Transgenic Res. 5: 105-113; Mett, V L,
et al. Proc. Natl. Acad. Sci. U.S.A 90: 45674571).
[0169] vii) Bipartitie Systems: nuclear localization signal
sequence In alternative embodiments, bipartite promoters may be
used to express components of the gene targeting system. Bipartite
systems may for example consist of 1) a minimal promoter containing
a recognition sequence for 2) a specific transcription factor. The
bipartite promoter is inactive unless it is bound by the
transcription factor. The gene of interest may be placed behind the
minimal promoter so that it is not expressed, and the transcription
factor may be linked to a `control promoter` which is, for example,
a tissue-specific, developmental stage specific, or environmental
stimuli responsive promoter. The transcription factor may be a
naturally occurring protein or a hybrid protein composed of a
DNA-binding domain and a transcription-activating domain. Because
the activity of the minimal promoter is dependent upon binding of
the transcription factor, the operably-linked coding sequence will
not be expressed unless conditions are appropriate for expression
by the `control promoter`. When such conditions are met, the
`control promoter` will be turned on facilitating expression of the
transcription factor. The transcription factor will act in trans
and bind to the DNA recognition sequence in the minimal promoter
via the cognate DNA-binding domain. The activation domain of the
transcription factor will then be in the appropriate context to aid
recruitment of RNA polymerase and other components of the
transcription machinery. This will cause transcription of the
target gene. With this bipartite system, the gene of interest will
only be expressed in cells where the `control promoter` is
expressed (i.e. the target gene will be expressed in a spatial and
temporal pattern mirroring the `control promoter` expressing the
transcription factor). In addition, a bipartite system could be
used to coordinate expression of more than one gene. Different
genes could be placed behind individual minimal promoters all of
which have the same recognition sequence for a specific
transcription factor and whose expression, therefore, is reliant
upon the presence of the transcription factor. The transcription
factor is linked to a `control promoter`. Therefore, when cells
enter an appropriate stage where gene targeting is to be initiated,
the control promoter expresses the transcription factor which then
can coordinately activate expression of the suite of target genes.
Use of a bipartite system may have the advantage that if expression
of the target genes is no longer required in a particular plant or
animal line, then the transcription factor may be bred out, so that
without the transcription factor present, the target gene(s) will
no longer be expressed in this line. If the target genes are
desired to be expressed at a later stage, the
promoter::transcription factor locus may be bred back into the
line.
[0170] Minimal promoter elements in bipartite promoters may
include, for example:
[0171] 1) truncated CaMV 35S (nucleotides -59 to +48 relative to
the transcription start site; Guyer, D, et al. 1988, Genetics 149:
633-639);
[0172] 2) DNA recognition sequences: E. coli lac operator (Moore,I,
et al.1998, Proc. Natl. Acad. Sci. U.S.A 95: 376-381; Labow, M A,
et al., 1990, Mol. Cell Biol. 10: 3343-3356) yeast GAL4 upstream
activator sequence (Guyer, D, et al. 1988, Genetics 149: 633-639);
TATA BOX, transcription start site, and may also include a ribosome
recruitment sequence.
[0173] Bipartite promoters may for example include transcription
factors such as: the yeast GAL4 DNA-binding domain fused to maize
C1 transcription activator domain (Guyer, D, et al. 1988, Genetics
149: 633-639); E. coli lac repressor fused to yeast GAL4
transcription activator domain (Moore, I, et al.1998, Proc. Natl.
Acad. Sci. U.S.A 95: 376-381); or the E. coli lac repressor fused
to herpes virus VP16 transcription activator domain (Labow, M A, et
al., 1990, Mol. Cell Biol. 10: 3343-3356).
[0174] In some embodiments, the `control promoter`, which may be
for example, a tissue-specific, developmental stage specific, or
environmental stimuli responsive promoter may promote transcription
at too low of a level (i.e. weakly expressed) or at too high of a
level (i.e. strongly expressed) to achieve the desired effect for
gene targeting. Therefore, for example, a weak control promoter may
be used in a bipartite system to express a transcription factor
which can promote a high level of expression when it binds to the
minimal promoter adjacent to an appropriate nucleotide sequence.
Thus, while the nucleotide sequences of the present invention may
be expressed at low levels if they were fused directly to the
`control promoter`, this promoter can indirectly facilitate high
level transcription of the target gene of interest by expressing a
very active transcription factor. Without wishing to be bound by
theory, the transcription factor may be present at low levels when
expressed by a weak "control promoter" but because it is so
effective at activating transcription at the minimal promoter fused
to a specific nucleotide sequence to be expressed, a higher level
of expression of the specific nucleotide sequence may be achieved
than if the gene was directly fused to the weak `control promoter`.
In addition, the transcription factor may also be engineered so
that its mRNA transcript is more stable or is more readily
translated, or that the reverse transcriptase protein itself is
more stable. Conversely, if the "control promoter" is too strong
for a desired application, it may be used to express a
transcription factor with low ability to promote transcription at
the minimal promoter.
[0175] In alternative embodiments, a `control promoter` may be used
in the nucleotide sequence of the present invention to express a
heterologous RNA-polymerase which recognizes specific sequences not
naturally present in the cell. For example, T7 RNA Polymerase may
be used in eukaryotes to specifically promote transcription of a
target gene linked to the T7 RNA Pol recruitment DNA sequence
(Benton, B. M., 1990, Mol. Cell Biol. 10: 353-360). Components of
the gene targeting system may then be regulated by the expression
of T7 RNA Polymerase.
[0176] The embodiments of the invention relating to the control of
production of msDNA comprising a gene targeting sequence as
exemplified for plants may be applicable to animals as well as
other eukaryotes, and prokaryotes, where there is conservation of
processes and abilities to achieve gene expression, such as, but
not limited to the constituitive, cell-cycle coordinated,
developmentally coordinated, tissue specific, environmentally
responsive, inducible, bipartite or any combination thereof.
[0177] In an aspect of the present invention, gene modification of
a target locus mediated by the gene targeting nucleotide sequence
of the present invention may for example occur at any stage from
the initial transformation event, through all subsequent cell
divisions, right up to a fully regenerated host, for example a
plant or animal, and the production of gametes. Thus there are
numerous opportunities for the gene targeting event to occur. When
a cell that gives rise to the germ line has undergone the gene
targeting event, the genetic change may be present in the gametes
and stably passed on to subsequent generation. If one allele of the
target locus is altered by the gene targeting substrate in a
diploid organism then up to 50% of the gametes from that particular
germ line may be expected to carry the modified allele. However, if
both alleles of the target locus are altered then all gametes from
that germ line would be expected to carry the modified allele.
[0178] During meiosis normal chromosome recombination and
reassortment may produce gametes which have the targeted change but
no longer carry the nucleotide sequence of the invention comprising
the retron. Thus self-crossing or out-crossing of a modified host,
for example a plant, can lead to progeny that possess the modified
target locus but not the initial nucleic acid sequence comprising
the retron of the present invention. This may be especially likely
if the target locus has little or no genetic linkage to the genomic
locus where the nucleotide sequence of the present invention has
inserted. Therefore, in an aspect of a embodiment of the invention,
it may be possible to produce genetically changed hosts, including
either plants or animals which no longer have any foreign DNA
sequences.
[0179] According to an aspect of the invention, the creation of
plants with specific genetic alterations at a gene of interest may
involve a single tissue culture procedure, for example, but not
limited to following the initial transformation process wherein the
retron of the present invention which comprises the gene targeting
nucleotide sequence is introduced to a plant cell. It may be
possible for the cell or a progeny thereof to undergo gene
targeting during cell proliferation and regeneration into a plant.
When this plant sexually reproduces, it may be possible for
numerous progeny plants containing the genetic change resulting
from gene targeting to be produced, which may be derived from the
initial single transformation event. Thus the present invention may
be employed to minimize the number of tissue culture propagules
required to be maintained in order to identify a plant which
comprises replacement of a gene of interest with the homologous
nucleotide sequence of the present invention. Further, reducing
tissue culture procedures may be advantageous if genetic changes
resulting from somaclonal variation during tissue culture may
occur. In an alternate embodiment of the present invention, it may
be possible to employ plant transformation procedures that require
no tissue culture steps (for example, Bechtold, N., and Pelletier,
G: 1998, Methods Mol Biol 82: 259-266; Clough, S. J., and Bent, A.
F., 1998 Plant J 16: 735-74).
[0180] In alternative embodiments, specific changes to a gene of
interest, for example a target locus of interest, may also be
achieved when the msDNA comprising the gene targeting sequence of
the present invention is expressed from vectors that are not
integrated into the host genome. Accordingly, the invention
provides for methods of transiently transforming cells with msDNA
comprising a gene targeting sequence.
[0181] Also according to the present invention, if the host is a
plant or an animal, plant or animal viruses may be used as vectors
to carry the retron of the present invention. For example, the
retron of the present invention may be cloned into a viral vector.
In an aspect of an embodiment, cells or tissues are transformed
with the viral vector which comprises the retron of the present
invention. In such an embodiment, the reverse transcriptase is
transcribed and translated and in turn, produces msDNA (GTS) by
reverse transcribing the primary transcript of the retron so that a
gene targeting substrate is produced in vivo.
[0182] If the viral vector is adapted to be localized and replicate
in the host cell nucleus, then the gene targeting substrate may
accumulate in nucleo. If the viral vector is localized and
replicates in the cytoplasm, movement of the gene targeting
substrate into the nucleus may be enhanced, for example, by
covalently or non-covalently linking the gene targeting substrate
to protein(s) encoding a nuclear localization sequence. The gene
targeting substrate may then facilitate the desired genetic change
at the target genomic locus. Cells with the targeted genetic change
can then be directly regenerated into a plant independently or as
part of a chimera with cells not containing the targeted change.
When the germ line of the regenerated plant is derived from a cell
with the targeted genetic alteration, then the genetic change will
be heritable.
[0183] In alternative embodiments, the targeted genomic change
results in a selectable phenotype so that selection may be applied,
resulting in enrichment for the survival and growth of only the
cells with the targeted genetic alteration. Thus, the gene
targeting events can be enriched and non-modified cells eliminated.
If the cells are plant cells, the cells in which the gene of
interest has been modified with the gene targeting nucleotide
sequence can then be regenerated into plants. Selecting for
non-chimeric, genetically altered plants may increase the frequency
of obtaining plants homozygous for the specified genetic change in
a subsequent generation.
[0184] In other embodiments, the viral vector comprising the retron
of the present invention may have a conditional ability for
propagation. Cells may be treated with such a vector and cultured
under "permissive" conditions allowing viral vector replication to
occur. Gene targeting events may then be induced to occur and
screened or selected. For example, but not wishing to be limiting,
the cultured cells/tissues may then be placed under "stringent"
conditions which disable the viral vector, so that plants with the
specified genetic alteration can be regenerated which are free of
the virus vector.
[0185] In other embodiments, intact plants are treated with a viral
vector comprising the retron of the present invention.
Transcription of the retron and genetic alteration of the gene of
interest may occur in random cells of the plant tissues. Cells or
tissues collected from the treated plant can be cultured
appropriately to select or identify cells which have undergone the
gene targeting event. These cells may then be regenerated into
plants which may pass the genetically modified locus to
progeny.
[0186] In some aspects, retron constructs of the present invention
may be present in the desired host on an extrachromosomal nucleic
acid vector, such as, but not limited to an episome, plasmid,
virus, or artificial chromosome. In some embodiments these
extrachromosomal vectors may be capable of replicating in the host
cells by means of a DNA origin of replication inherent to the
vector, for example, as in a viral vector or engineered into the
vector, for example, as in a plasmid vector. In some embodiments
where the retron of the present invention may be cloned into such
vectors, the sequence encoding the retron may be replicated as a
component of the vector so that the number of copies of retron
encoding sequence per cell may equal the number of vector molecules
per cell.
[0187] In some embodiments, transcription of the msr-GTNS-msd which
comprises the gene targeting nucleotide sequence of the present
invention and nucleotide sequence encoding the reverse
transcriptase may occur independently of the replication of the
remainder of the vector. In this manner, the ratio of the number of
copies per cell of the msDNA comprising the gene targeting
nucleotide sequence compared to the number of copies per cell of
the vector backbone encoding the retron may be different than one.
The capability to alter this frequency may result in a desired
frequency of gene targeting. The preferential amplification of a
GTS from the vector backbone may also facilitate modification of a
target locus in a fashion that reduces the chance that sequences
other than those of the gene targeting nucleotide sequence, such
as, but not limited to vector sequences, are incorporated into the
target locus. The presence of vector sequences, or other sequences
in the target locus may be undesirable because, for example, but
not wishing to be limiting or bound by theory, these sequences may
confer reduced genetic stability of the modified locus (due to
recombination involving vector sequences), or they may incorporate
undesirable genetic components into the host genome (such as
selectable markers or viral sequences), or they may have
undesirable effects on the expression, function or both of the
targeted gene nucleotide sequence, or other genes in the host
chromosome, for example, but not limited to by the incorporation of
additional promoter or enhancer sequences encoded by the
vector.
[0188] In some embodiments, the nucleotide sequence comprising a
retron construct of the invention may be introduced into a cell,
for example, but not limited to a plant cell or animal cell by
treating the cells with chemicals (Kresn, F A., et. al. 1982,
Nature 296, p. 7.sup.2; Deshayes, A, et. al., 1985, EMBO J 4:
2731-2737, electrical current (Shillito, R. D., et. al, 1985,
Bio/technology 3, p. 1099; D'Halluin, K, et. al., 1992, Plant Cell
4: 1495-1505), by biolistic introduction of particles coated with
DNA (Klein, T. M., et. al., 1988, Proc Natl Acad Sci U S A 85, p.
8502), by microinjection (Crossway, A, et. al., 1986, Mol Gen Genet
202, p. 179), or a combination thereof. Any method known in the art
may be employed to introduce the nucleotide sequence comprising the
retron of the present invention into a cell, tissue or subject.
[0189] In alternative embodiments, the present invention may be
applied to animals and animal cells, in a variety of ways analogous
to those described for plants. Cells and tissues from many animal
species can be cultured in such embodiments, in accordance with
methods known in the art, including procedures for the transfer of
exogenous vector DNA into animal cells to achieve transient or
stable expression of vector-encoded genetic elements (with the
vector remaining extrachromosomal or being integrated directly into
the chromosome, respectively). In accordance with this aspect of
the invention, vectors may be engineered to encode the retron of
the present invention. The nucleotide sequence of the present
invention which comprises the retron may be transferred into target
cells by various chemical or physical means known in the art. As
with plants, production of msDNA comprising a gene targeting
nucleotide sequence results in accumulation of gene targeting
sequence in vivo and in nucleo, and gene targeting nucleic acid
sequences may be acted upon by host recombination and repair
functions to transfer the information encoded by the GTS to the
target genomic locus.
[0190] In various embodiments, alteration of one or both alleles in
a diploid genome or multiple alleles in a polyploid genome may for
example be achieved by the invention. Modified alleles may also be
identified using various types of molecular markers, as is known in
the art.
[0191] In animals, if it is desired for the modified target locus
to be passed on and heritable then specialized cell types may be
employed (Thomas, K. R., and Capecchi, M. R., 1987, Cell 51:
503-512; Thompson, S, et. al. 1989, Cell 56: 313-321). For example,
but not wishing to be limiting, stem cells may be transformed with
the retron of the present invention, and the target locus modified
as described above. Such stem cells comprising the modified target
locus may then be used to create chimeric animals by adaptation of
procedures known in the art (Thomas, K. R., and Capecchi, M. R.,
1987, Cell 51: 503-512; Thompson, S, et. al. 1989, Cell 56:
313-321). Some of these animals produced by these procedures may
then be able to transfer the modified target locus to their
progeny. Alternatively, procedures are known in the art for cloning
animals using somatic cells (Wilmut, I, et. al. 1997, Nature 385:
810-813). These somatic cells may have a target locus modified
using the retron of the present invention. The cells comprising the
modified target locus may then be used for development of the
cloned animal. Progeny from this animal may then comprise the
modified target locus and stably transfer it to progeny or other
progeny derived from repeating such a cloning process.
[0192] In some embodiments, a mechanism for generating a heritable
modified targeted genomic locus is to perform the gene targeting in
gametes or gonadal cells capable of differentiating into gametes.
Gametes could be collected and treated in vitro with the retron
comprising the gene targeting nucleotide sequence. The resultant
production of msDNA comprising a gene targeting nucleotide sequence
may result in genetic modification of the target locus. Such
gametes could then be used in fertilization. The resulting zygote
and organism may carry the modified locus in all of its cells and
be capable of passing it to progeny. Gametes may also be modified
in situ by using a retron capable of systemic spread through the
host and entry into host cells, particularly the germ-line and
derivatives, or by direct application or injection of the retron
comprising the gene targeting nucleotide sequence to gametes or
gonadal cells differentiating into gametes. In such an embodiment,
gametes or germ-line cells may take up the construct. The msDNA
from the retron may then be produced in vivo to facilitate the
desired change to the target locus in these cells. The gametes upon
fertilization would thus result in an organism carrying the
modified target locus in all of its cells and would be capable of
passing it to progeny. Methods of treatment of gonadal cells with
exogenous gene targeting substrate may be adapted for use in
alternative aspects of the present invention.
[0193] In addition to development of whole organisms carrying a
targeted genetic change, the invention may also be applied to gene
therapy in specific tissues or organs of an individual animal. In
accordance with this aspect of the invention, the animal may be
treated with a retron comprising a gene targeting nucleotide
sequence as provided by the present invention, that is capable of
systemic spread and entry into cells. Production of msDNA (GTS)
front the retron may be regulated by tissue-specific or
organ-specific promoters. The gene targeting nucleotide sequence
may be produced in vivo and only in the desired tissues or organs
where the promoters are active, so that gene targeting would occur
in those specified tissues and organs, or be enriched to occur
there. Furthermore, cells may be treated exogenously and
reintroduced into the host.
[0194] The present invention further contemplates cells, tissue or
entire organisms comprising the retron of the present invention,
msDNA comprising the gene targeting nucleotide sequence (GTS)
produced from the msr-GTNS-msd of the present invention, or both.
The cells, tissue or entire organisms may comprise any eukaryotic
cell for example but not limited to plant, animal or yeast cell,
tissue or organism.
[0195] Also according to the present invention, there is provided a
method of modifying a gene of interest in a cell, tissue or
organism comprising the steps of,
[0196] a) expressing in said cell, tissue or organism a retron
comprising,
[0197] i) msr and msd nucleotide coding regions;
[0198] ii) a gene-targeting nucleotide sequence homologous to a
target locus of interest but comprising at least one nucleotide
difference compared to the gene of interest, and;
[0199] iii) a nucleotide sequence encoding a reverse transcriptase
in sufficient quantities to enhance and promote modification of the
locus of interest with the gene-targeting nucleotide sequence.
[0200] Modification of the target locus of interest with a
homologous GTNS may for example be used to modify a target locus
associated with a disease, or aberrant phenotype to a nucleotide
sequence gene of interest which is not associated with disease or.
an aberrant phenotype. Alternatively, the method may be employed to
modify a normal nucleotide sequence of a gene of interest to a
modified nucleotide sequence which may result in a disease or
aberrant phenotype. For example, but not wishing to be limiting,
the method of the present invention may be employed to study the
function of specific DNA sequences, expressed proteins, or both in
a cell, tissue or organism. In an alternate embodiment of the
present invention which is not meant to be limiting in any manner,
the gene-targeting nucleotide sequence homologous to a gene of
interest may encode elements such as stop codons that result in
"knockout", inactivation or deletion of the protein encoded by the
gene of interest.
[0201] In alternative embodiments, the methods of the invention may
be employed to modify a locus or gene of interest in a wide variety
of eukaryotic cells, tissues or organisms, such as yeast, plant
cells, insect cells, or animal cells. In an aspect of a preferred
embodiment the eukaryotic cell is a plant cell or a human cell or a
non-human cell or host.
[0202] In some embodiments, the retron constructs of the present
invention may be adapted to permit multiple copies of msDNA
comprising a gene targeting nucleotide sequence to accumulate
within a nucleus of a cell. In nucleo accumulation of multiple
copies of the gene targeting nucleotide sequence may facilitate
gene targeting and modification of the target locus.
[0203] In alternative aspects, the invention includes a variety of
self-RT-priming gene targeting RNA constructs that act as an in
vivo template for RT. Such constructs include retron-like
constructs, which do not necessarily include all of the structural
features of native retrons. A wide variety of retron-like
self-RT-priming gene targeting RNA constructs may be used, provided
that they are capable of mediating reverse transcription of a GTNS.
For example, a 3' region of an mRNA may be adapted to fold back on
itself, with complimentary sequences annealing to create a
self-priming 3' untranslated region, such as a hairpin, that is
capable of recruiting a RT to reverse transcribe a portion of the
RNA. Similarly, intron splicing constructs may be modified to
provide self-RT-priming gene targeting RNA constructs in which a
portion of the mRNA folds back on itself to create a self-priming
RNA that is capable of recruiting RT to reverse transcribe a
portion of the RNA. In alternative embodiments, the self-RT-priming
gene targeting RNA construct may comprise two or more separate RNA
molecules, wherein the sequence of the RNAs facilitates
base-pairing to produce a 3'-hydroxyl that may recruit and prime RT
to reverse transcribe portions of one of the RNA molecules into a
cDNA-based gene targeting substrate.
[0204] In various aspects, the present invention provides methods
to modify a nucleic acid of interest at a target locus within the
genome of a host comprising, expressing a gene targeting construct
nucleotide sequence encoding a self-RT-priming gene targeting
message RNA (gtmRNA), wherein the gtmRNA comprises a gene targeting
message that is reverse transcribed within the host in the presence
of a reverse transcriptase (RT), thereby producing an in vivo gene
targeting substrate having a gene targeting nucleotide sequence
(GTNS), and selecting for modification of the target locus within
the genome of the host.
[0205] In some embodiments, the present invention also relates to
methods wherein the host is modified to express the RT prior to
introducing the nucleotide sequence encoding an RNA that comprises
the GTNS into the host. The nucleotide sequence encoding an RNA
that comprises the GTNS may for example be introduced into the host
by transformation or cross breeding.
[0206] The terms "nucleic acid" or "nucleic acid molecule"
encompass both RNA (plus and minus strands) and DNA, including
cDNA, genomic DNA, and synthetic (e.g., chemically synthesized)
DNA. The nucleic acid may be double-stranded or single-stranded.
Where single-stranded, the nucleic acid may be the sense strand or
the antisense strand. A nucleic acid molecule may be any chain of
two or more covalently bonded nucleotides, including naturally
occurring or non-naturally occurring nucleotides, or nucleotide
analogs or derivatives. By "RNA" is meant a sequence of two or more
covalently bonded, naturally occurring or modified ribonucleotides.
One example of a modified RNA included within this term is
phosphorothioate RNA. By "DNA" is meant a sequence of two or more
covalently bonded, naturally occurring or modified
deoxyribonucleotides. By "cDNA" is meant complementary or copy DNA
produced from an RNA template by the action of RNA-dependent DNA
polymerase (reverse transcriptase). Thus a "cDNA clone" means a
duplex DNA sequence complementary to an RNA molecule of interest,
carried in a cloning vector.
[0207] An "isolated nucleic acid" is a nucleic acid molecule that
is substantially free of the nucleic acid molecules that normally
flank it in the genome. Therefore, an "isolated" gene or nucleic
acid molecule is intended to mean a gene or nucleic acid molecule
which is not flanked by nucleic acid molecules which normally (in
nature) flank the gene or nucleic acid molecule (such as in genomic
sequences) and/or has been completely or partially purified from
other transcribed sequences (as in a cDNA or RNA library). For
example, an isolated nucleic acid of the invention may be
substantially isolated with respect to the complex cellular milieu
in which it naturally occurs. In some instances, the isolated
material will form part of a composition (for example, a crude
extract containing other substances), buffer system or reagent mix.
In other circumstance, the material may be purified to essential
homogeneity, for example as determined by PAGE or column
chromatography such as HPLC. The term therefore includes, e.g., a
recombinant nucleic acid incorporated into a vector, such as an
autonomously replicating plasmid or virus; or into the genomic DNA
of a prokaryote or eukaryote, or which exists as a separate
molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or
restriction endonuclease treatment) independent of other sequences.
It also includes a recombinant nucleic acid which is part of a
hybrid gene encoding additional polypeptide sequences. Preferably,
an isolated nucleic acid comprises at least about 50, 80 or 90
percent (on a molar basis) of all macromolecular species present.
Thus, an isolated gene or nucleic acid molecule can include a gene
or nucleic acid molecule which is synthesized chemically or by
recombinant means. Recombinant DNA contained in a vector are
included in the definition of "isolated" as used herein. Also,
isolated nucleic acid molecules include recombinant DNA molecules
in heterologous host cells, as well as partially or substantially
purified DNA molecules in solution. In vivo and in vitro RNA
transcripts of the DNA molecules of the present invention are also
encompassed by "isolated" nucleic acid molecules. Such isolated
nucleic acid molecules are useful in the manufacture of the encoded
polypeptide, as probes for isolating homologous sequences (e.g.,
from other mammalian species), for gene mapping e.g., by in situ
hybridization with chromosomes), or for detecting expression of he
gene in tissue (e.g., human tissue, such as peripheral blood), such
as by Northern blot analysis.
[0208] Various genes and nucleic acid sequences of the invention
may be recombinant sequences. The term "recombinant" means that
something has been recombined, so that when made in reference to a
nucleic acid construct the term refers to a molecule that is
comprised of nucleic acid sequences that are joined together or
produced by means of molecular biological techniques. The term
"recombinant" when made in reference to a protein or a polypeptide
refers to a protein or polypeptide molecule which is expressed
using a recombinant nucleic acid construct created by means of
molecular biological techniques. The term "recombinant" when made
in reference to genetic composition refers to a gamete or progeny
with new combinations of alleles that did not occur in the parental
genomes. Recombinant nucleic acid constructs may include a
nucleotide sequence which is ligated to, or is manipulated to
become ligated to, a nucleic acid sequence to which it is not
ligated in nature, or to which it is ligated at a different
location in nature. Referring to a nucleic acid construct as
`recombinant` therefore indicates that the nucleic acid molecule
has been manipulated using genetic engineering, i.e. by human
intervention. Recombinant nucleic acid constructs may for example
be introduced into a host cell by transformation. Such recombinant
nucleic acid constructs may include sequences derived from the same
host cell species or from different host cell species, which have
been isolated and reintroduced into cells of the host species.
Recombinant nucleic acid construct sequences may become integrated
into a host cell genome, either as a result of the original
transformation of the host cells, or as the result of subsequent
recombination and/or repair events.
[0209] As used herein, "heterologous" in reference to a nucleic
acid or protein is a molecule that has been manipulated by human
intervention so that it is located in a place other than the place
in which it is naturally found. For example, a nucleic acid
sequence from one species may be introduced into the genome of
another species, or a nucleic acid sequence from one genomic locus
may be moved to another genomic or extrachromasomal locus in the
same species. A heterologous protein includes, for example, a
protein expressed from a heterologous coding sequence or a protein
expressed from a recombinant gene in a cell that would not
naturally express the protein.
[0210] By "antisense," as used herein in reference to nucleic
acids, is meant a nucleic acid sequence that is complementary one
strand of a nucleic acid molecule. In some embodiments, an
antisense sequence is complementary to the coding strand of a gene,
preferably, a SARS virus gene. The preferred antisense nucleic acid
molecule is one which is capable of lowering the level of
polypeptide encoded by the complementary gene when both are
expressed in a cell. In some embodiments, the polypeptide level is
lowered by at least 10%, or at least 25%, or at least 50%, as
compared to the polypeptide level in a cell expressing only the
gene, and not the complementary antisense nucleic acid
molecule.
[0211] A "probe" or "primer" is a single-stranded DNA or RNA
molecule of defined sequence that can base pair to a second DNA or
RNA molecule that contains a complementary sequence (the target).
The stability of the resulting hybrid molecule depends upon the
extent of the base pairing that occurs, and is affected by
parameters such as the degree of complementarity between the probe
and target molecule, and the degree of stringency of the
hybridization conditions. The degree of hybridization stringency is
affected by parameters such as the temperature, salt concentration,
and concentration of organic molecules, such as formamide, and is
determined by methods that are known to those skilled in the art.
Probes can be detectably-labeled, either radioactively or
non-radioactively, by methods that are known to those skilled in
the art. Probes can be used for methods involving nucleic acid
hybridization, such as nucleic acid sequencing, nucleic acid
amplification by the polymerase chain reaction, single stranded
conformational polymorphism (SSCP) analysis, restriction fragment
polymorphism (RFLP) analysis, Southern hybridization, northern
hybridization, in situ hybridization, electrophoretic mobility
shift assay (EMSA), and other methods that are known to those
skilled in the art.
[0212] By "complementary" is meant that two nucleic acids, e.g.,
DNA or RNA, contain a sufficient number of nucleotides which are
capable of forming Watson-Crick base pairs to produce a region of
double-strandedness between the two nucleic acids. Thus, adenine in
one strand of DNA or RNA pairs with thymine in an opposing
complementary DNA strand or with uracil in an opposing
complementary RNA strand. It will be understood that each
nucleotide in a nucleic acid molecule need not form a matched
Watson-Crick base pair with a nucleotide in an opposing
complementary strand to form a duplex.
[0213] By "vector" is meant a DNA molecule derived, e.g., from a
plasmid, bacteriophage, or mammalian or insect virus, or artificial
chromosome, that is used to introduce a polypeptide, for example a
SARS virus polypeptide, into a host cell. A vector may contain one
or more unique restriction sites and may be capable of autonomous
replication in a defined host or vehicle organism such that the
cloned sequence is reproducible. By "DNA expression vector" is
meant any autonomous element capable of directing the synthesis of
a recombinant peptide. Such DNA expression vectors include
bacterial plasmids and phages and mammalian and insect plasmids and
viruses. A "shuttle vector" is understood as meaning a vector which
can be propagated in at least two different cell types, or
organisms, for example vectors which are first propagated or
replicated in prokaryotes in order for, for example, eukaryotic
cells then to be able to be transfected with these.
[0214] Although various embodiments of the invention are disclosed
herein, many adaptations and modifications may be made within the
scope of the invention in accordance with the common general
knowledge of those skilled in this art. Such modifications include
the substitution of known equivalents for any aspect of the
invention in order to achieve the same result in substantially the
same way. The following examples are for illustrative purposes
only, and alternative aspects of the invention are exemplified
without implication that the invention necessarily includes each of
the facets disclosed in each exemplary embodiment. Similarly, the
advantages and features of some embodiments are not to be taken to
be achieved with all embodiments. Numeric ranges are inclusive of
the numbers defining the range. The word "comprising" is used
herein as an open-ended term, substantially equivalent to the
phrase "including, but not limited to", and the word "comprises"
has a corresponding meaning. As used herein, the singular forms
"a", "an" and "the" include plural referents unless the context
clearly dictates otherwise. Thus, for example, reference to "a
thing" includes more than one such thing. Citation of references
herein is not an admission that such references are prior art to
the present invention. All publications, including but not limited
to patents and patent applications, cited in this specification are
incorporated herein by reference as if each individual publication
were specifically and individually indicated to be incorporated by
reference herein and as though fully set forth herein. The
invention includes all embodiments and variations substantially as
hereinbefore described and with reference to the examples and
drawings.
EXAMPLES
Example 1
Genetic Assay and Test Alleles
[0215] Several variations of gene targeting cassettes were
developed and tested to demonstrate the potential of using reverse
transcription to generate gene targeting substrates in vivo to
facilitate genetic alteration of a chromosomal locus in eukaryotic
cells. In some examples components of retro-elements (i.e. genetic
elements which can convert the entire or partial region of an RNA
molecule encoded by the genetic elements into a cDNA through the
action of a reverse transcriptase) were used. One example of such
an element is referred to as the retron, different versions of
which are encoded by various bacterial species and strains. One
example of a retron is denoted Ec86 from the E. coli strain HB8
[1685]. Another example of a retron is denoted Ec107 from E. coli
strain ECOR70 [1657]. Functional elements from both Ec86 and Ec107
have been cloned (i.e. pMW3, pMW5, pMW4, pMW9; described later).
Application of components encoded by Ec86 to facilitate gene
targeting in eukaryotic cells is exemplified here to demonstrate
the utility of using reverse transcription to generate gene
targeting substrates in vivo.
[0216] One example of gene targeting cassettes employed here were
designed to convert the chromosomal URA3 gene of S. cerevisiae to a
non-functional allele (i.e. ura3) which could be identified through
its ability to confer resistance to 5-fluoro-orotic acid (FOA) in
the model eukaryotic cells. Thus the ability to alter the function
of a chromosomally encoded protein could be demonstrated. In other
embodiments of the invention, the gene targeting cassettes could be
designed to either restore the function of an inactive genomic
locus or the product it encodes, r modulate the genetic activity of
that locus or the activity of the RNA or protein molecule encoded
by that locus.
[0217] In one example, the gene targeting cassette encoded
.about.500 bp of the ura3.DELTA..sup.PstEcoRV allele. This
.about.500 bp sequence is deleted for .about.20 bp of the promoter
region and .about.190 bp of the open reading frame of the URA3 gene
with .about.250 bp upstream and downstream homology to URA3.
Transfer of this deletion mutation to the chromosomal URA3 locus
may create a mutated chromosomal allele. Such events may be
detected by screening for cells resistant to FOA the frequency of
which reflects the gene targeting frequency. In some examples, the
effect of a gene targeting substrate generated with the reverse
transcription-based system was tested when the gene targeting
substrate was created in a sense or anti-sense orientation with
respect to the chromosomal target locus.
[0218] In another example, the gene targeting cassette encoded
.about.500 bp of the ura3.sup.Pvu allele. This .about.500 bp
sequence encodes a deletion of 8 bp resulting in loss of base pair
#275-284 of the URA3 open reading frame. The deletion also creates
a novel PvuII restriction site and changes the reading frame of the
altered gene to promote premature termination of translation which
can be expected to prevent functional expression of the
carboxy-terminal 176 amino acid residues encoded by URA3 whose wild
type protein product is 267 amino acid residues in length. The
cassette also encodes .about.250 bp upstream and downstream of the
8 bp deletion for a total of .about.500 bp of homology to the
chromosomal URA3 locus.
[0219] In another example, the gene targeting cassette encoded
.about.500 bp of the ura3.sup.Bsp allele. This .about.500 bp DNA
sequence encodes a single base pair change of C to A at nucleotide
position #465 of the URA3 open reading frame. This base pair change
creates a novel BspHI restriction enzyme site within the URA3 locus
and creates a premature translation termination signal which can be
expected to prevent functional expression of the carboxy-terminal
113 amino acid residues encoded by URA3 whose wild type protein
product is 267 amino acid residues in length. The cassette also
encodes .about.250 bp upstream and downstream of the C to A bp
change for a total of .about.500 bp of homology to the chromosomal
URA3 locus.
[0220] In some examples, the ability of in vivo produced cDNAs to
genetically alter a chromosomal target locus was assessed when the
cDNAs were designed to pair with either the transcribed or
non-transcribed strand of a chromosomal target locus. This
evaluation involved cloning the gene targeting sequence into the
reverse transcription system in either the sense or the antisense
orientation. When this gene targeting cassette sequence is cloned
into the reverse transcription-based gene targeting system in the
sense orientation, reverse transcription will create an anti-sense
cDNA which can then base pair with the sense strand of the
chromosomal target locus, and vice versa.
[0221] The DNA sequences encoding the gene targeting sequences from
the three ura3 alleles described above were cloned into various
versions of the Ec86 msr-msd elements engineered to accommodate
these introduced sequences and facilitate their conversion to cDNAs
in vivo in the presence of the Ec86 RTase. The versions of
engineered msr-msd elements exemplified here are referred to as the
STEM3 derivative, the STOPstem derivative and the 3'-recruitment
derivative.
Example 2
Wild Type Retron
[0222] FIG. 1 summarises a current understanding of the reverse
transcription process of at least some retron elements (as for
example reviewed in [1648]). The principal components of a retron
are the msr and msd elements flanked by the al and a2 inverted
repeat sequences. In a RNA transcript of these elements, the a1 and
a2 sequences base pair as do other inverted repeat sequences
encoded within msr and msd, such as the b1 and b2 inverted repeat
sequences within msd, to form stem and loop structures. The
topology of stem and loop structures within the msr region of the
folded RNA molecule enables recruitment of RTase. This protein-RNA
interaction places the RTase in an appropriate context to be able
to use the 2'-hydroxyl of a specific guanosine residue within the
msr element to prime reverse transcription of the msd element. The
reverse transcription proceeds through the msd sequence and
terminates at a position at the boundary between the msd and msr
sequences. In the absence of an RNaseH-like activity, an extensive
RNA-DNA hybrid molecule may be formed whereas in the presence of an
RNaseH-like activity a cDNA molecule may formed.
Example 3
Modification of Reverse Transcriptase for Enhanced Functionality in
Eukaryote Cells
[0223] For effective gene targeting of chromosomal loci in
eukaryote cells, the gene targeting substrate needs to be present
in the nucleus. In some embodiments of the invention, reverse
transcriptases are engineered to localize in the eukaryote host
cell nucleus so that the enzyme can catalyse cDNA synthesis and
production of the gene targeting substrate in the nucleus. One
example to achieve this is to engineer the reverse transcriptase to
encode a nuclear localization sequence. In one embodiment, the
engineered reverse transcriptase may be of prokaryotic origin and
thus may not possess an inherent nuclear localization sequence. One
example is the Ec86 retron-derived reverse transcriptase which was
engineered to encode the NLS from the SV40 T-antigen (i.e. pMW22).
Another example is the Ec107 retron-derived reverse transcriptase
which was engineered to encode the NLS from the SV40 T-antigen
[109] (in a construct denoted herein as pMW39). The activity in E.
coli of such an engineered reverse transcriptase was compared to
that of the WT reverse transcriptase and found not to be
substantially different. However, the effect on cDNA accumulation
in eukaryotic cells when the reverse transcriptase was engineered
to encode an NLS was very dramatic. This was illustrated using S.
cerevisiae as a representative eukaryotic cell. The S. cerevisiae
strain RK2575-URA was transformed with pMW29 capable of expressing
Ec86 msr-msd and with pMW25, expressing WT Ec86 reverse
transcriptase, or pMW27, expressing the engineered NLS-RT from Ec86
(NLS-RT sequence:
2 (SEQ ID NO:1) GGATCCAAAAAAATGGCTCCTAAGAAGAAGAGAAAGGTTGGAG-
GAGGACC CGGGAAGTCCGCTGAATATTTGAACACTTTTAGATTGAGAAATCTCGGC- C
TACCTGTCATGAACAATTTGCATGACATGTCTAAGGCGACTCGCATATCT
GTTGAAACACTTCGGTTGTTAATCTATACAGCTGATTTTCGCTATAGGAT
CTACACTGTAGAAAAGAAAGGCCCAGAGAAGAGAATGAGAACCATTTACC
AACCTTCTCGAGAACTTAAAGCCTTACAAGGATGGGTTCTACGTAACATT
TTAGATAAACTGTCGTCATCTCCTTTTTCTATTGGATTTGAAAAGCACCA
ATCTATTTTGAATAATGCTACCCCGCATATTGGGGCAAACTTTATACTGA
ATATTGATTTGGAGGATTTTTTCCCAAGTTTAACTGCTAACAAAGTTTTT
GGAGTGTTCCATTCTCTTGGTTATAATCGACTAATATCTTCAGTTTTGAC
AAAAATATGTTGTTATAAAAATCTGCTACCACAAGGTGCTCCATCATCAC
CTAAATTAGCTAATCTAATATGTTCTAAACTTGATTATCGTATTCAGGGT
TATGCAGGTAGTCGGGGCTTGATATATACGAGATATGCCGATGATCTCAC
CTTATCTGCACAGTCTATGAAAAAGGTTGTTAAAGCACGTGATTTTTTAT
TTTCTATAATCCCAAGTGAAGGATTGGTTATTAACTCAAAAAAAACTTGT
ATTAGTGGGCCTCGTAGTCAGAGGAAAGTTACAGGTTTAGTTATTTCACA
AGAGAAAGTTGGGATAGGTAGAGAAAAATATAAAGAAATTAGAGCAAAGA
TACATCATATATTTTGCGGTAAGTCTTCTGAGATAGAACACGTTAGGGGA
TGGTTGTCATTTATTTTAAGTGTGGATTCAAAAAGCCATAGGAGATTAAT
AACTTATATTAGCAAATTAGAAAAAAAATATGGAAAGAACCCTTTAAATA
AAGCGAAGACCTAATAACTGCAG
[0224] The sequence of the resynthesized version of NLS-RT (fr.
Ec86, encoded in the plasmid referred to as pNLS-RT-RS) is as
follows:
3 (SEQ ID NO:2) GGATCCAAAA CAATGGCTCC TAAGAAGAAG AGGAAGGTTG
GAGCCGGCGG AGATTACAA GGATGATGAT GATAAGGGAG TTAACGGAGG AGGTGGAGGA
GGTGGAGGT GGAGGCGCCA AGTCTGCTGA GTACCTCAAC ACCTTCAGG CTCAGGAAC
CTCGGACTCC CTGTTATGAA CAACCTCCAC GATATGTCT AAGGCTACC AGGATCTCT
GTTGAGACCC TCAGGCTCCT CATCTACACC GGTGATTTC AGGTACAGGA TCTACACCGT
TGAGAAGAAG GGACCTGAG AAGAGGATG AGGACCAT CTACCAACCT TCTAGGGA
ACTTAAGGC TCTCCAAGG ATGGGTTC TCAGGAACAT CCTCGATAAG CTCTCTTCTT
CTCCTTTCTC TATCGGAT TCGAGAAGCA CCAATCTATC CTCAACAAC GCTACCCCTC
ACATCGGAGC TAACTTCAT CCTCAACATC GATCTTGAAG ATTTCTTCCC TTCTCTCACC
GCTAACAAG GTTTTCGGAG TTTTCCACT CTCTCGGATA CAACAGGCTC ATCTCTTCT
GTTCTCACC AAGATCTG CTGCTACAA GAACCTCCTC CCTCAAGGT GCTCCTTCT
TCTCCTAAGC TCGCTAACC TCATCTGCTC TAAGCTCG ATTACAGA ATTCAAGGA
TACGCTGGAT CTAGGGGACT CATCTACACC AGGTACGCT GATGATCTCA CCCTCTCTGC
TCAATCTATG AAGAAGGTTG TTAAGGCTA GGGATTTCC TCTTCTCTAT CATCCCTTC
TGAGGGACT CGTTATCAAC TCTAAGAAG ACCTGCATCT CTGGACCTAGG TCTCAAAGGA
AGGTTACCGG ACTCGTTA TCTCTCAAGA GAAGGTTGGA ATCGGAAGGG AGAAGTACA
AGGAGATCA GGGCTAAGAT CCACCACATC TTCTGCGGAA AGTCTTCTGA GATCGAGCA
CGTTAGGGGA TGGCTCTCTT TCATCCTCTC TGTTGATTC TAAGTCTCA CAGGAGGCTC
ATCACCTAC ATCTCTAAG CTTGAAAAGA AGTACGGAA AGAACCC TCTCAACA
AGGCTAAGAC CTAATGAG CGGCCGCA CTAGTGAT ATCTCTAGA;
[0225] The cells were cultured overnight in 3 ml of SC-Leu-Trp and
total DNA was extracted as per standard procedures [213]. The DNA
samples were resuspended in 60 ul of LTE (1 mM Tris-HCl, 0.1 mM
EDTA) and 30 ul was resolved on a 2% agarose gel. The DNA was then
Southern blotted to a Hybond N.sup.+ (Amersham) membrane then
probed using a .sup.32P labeled DNA fragment encoding Ec86 msr-msd
(isolated from pMW5 digested with BamHI and PstI) and the signal
detected by autoradiography, all following standard procedures
[213]. To illustrate the similarity of products produced by NLS-RT
in both E. coli and S. cerevisiae, control samples of cDNA were
also produced in E. coli. This material was obtained from E. coli
DH5-alpha (Gibco-BRL) transformed with pMW16 capable of expressing
Ec86 msr-msd and pMW7 capable of expressing NLS-RT derived from
Ec86. The cells were cultured overnight in 3 ml of TYS medium
containing ampicillin (50 ug/ml) and chromamphenicol (20 .mu.g/ml)
plus 0.2 mM IPTG. DNA was isolated from 1.5 ml of culture following
a standard "alkaline mini-prep" method [213] and dissolved in LTE.
Aliquots of the E. coli derived and S. cerevisiae derived DNA were
analysed by Southern blotting as described above. As illustrated in
FIG. 2, the size of cDNA produced in prokaryotic or eukaryotic
cells by NLS-RT is indistinguishable. Thus engineering a reverse
transcriptase to encode an NLS does not impair its functionality in
such embodiments. Rather, by comparing the level of cDNA
accumulation in eukaryotic cells facilitated by WT reverse
transcriptase versus NLS-RT, it is readily apparent that a reverse
transcriptase encoding an NLS is more effective at catalyzing cDNA
synthesis in eukaryotic cells. FIG. 2 illustrates that a very
strong signal indicative of cDNA synthesis is observed in
eukaryotic yeast cells expressing the NLS-RT whereas no signal was
detected in eukaryotic cells expressing WT-reverse transcriptase.
Accordingly, in some embodiments, the functionality of reverse
transcriptases of prokaryotic origin, when expressed in eukaryotic
cells, can be enhanced when they are modified to localize to the
nucleus.
Example 4
STEM3
[0226] 4a) Overview
[0227] As illustrated in FIG. 3 and FIG. 4, the STEM3 derivative of
the msr-msd elements is engineered to encode unique restriction
sites (XbaI, EcoRV) within the loop region of the principal stem
and loop region of the Ec86 msd sequence (i.e. that created by the
b1 and b2 inverted repeat sequences). STEM3 also has 13 bp
extensions of the a1 and a2 inverted repeat sequences (i.e. a1',
a2'). These extensions are composed of sequences which can base
pair with each other. As a result, the dsRNA region created by a1'
and a2' sequences in the primary transcript of msr-msd is increased
in size. This larger dsRNA region thus has a higher dissociation
constant which can serve to isolate the msr-msd sequences from RNA
sequences present in the transcript that are 5' of a1' and 3' of
a2'. This can be important for promoting reverse transcription of
the msd portion in eukaryotic cells. The nature of eukaryotic
transcription results in addition of sequences at the 5' and 3'
ends of the transcript as a result of transcription initiation and
termination. In the case of translated genes these 5' and 3'
sequences are referred to as 5'- and 3-untranslated regions (UTRs).
Depending on the sequence composition of these 5' and 3' sequences,
they can base pair to form secondary structures. Such secondary
structures may affect correct folding of a transcript encoding
msr-msd and thereby could impair recruitment of the RTase and
consequent cDNA synthesis. However, extension of the a1 and a2
inverted repeat regions can act to isolate the msr-msd sequences
from effects mediated by the 5' and 3' `UTR regions` and thereby
promote proper folding of msr-msd to facilitate reverse
transcription of msd sequences.
[0228] In one embodiment, the STEM3 sequence was as follows:
4 (SEQ ID NO:3) GATCCCCCG GGCGCCAG CAGTGGCT GCGCACCC TTAGCGA
GAGGTTTA TCATTAAGG TCAACCTCT GGATGTTGT TTCGGCAT CCTGCATT GAATCTGAG
TTACTGTCT GTTTTCCTT GTTGGAACGG AGAGCATCG TCTAGACAAC GATATCTGA
TGCTCTCC GAGCCAACC AGGAAACCC GTTTTTTCT GACGTAAGG GTGCGCAG CCGCTGTT
GGCGTGGC CAATGCG GCCGC
[0229] To apply the STEM3 system to producing gene targeting
substrates in vivo, a DNA sequence encoding regions of homology to
the target locus as well as the genetic change desired to be
transferred to the target locus is cloned into the XbaI and EcoRV
sites within the msd region in a manner such that the STEM3 and
gene targeting sequence assembly can be transcribed. This assembly
is introduced into a eukaryotic cell which is capable of expressing
RTase. Thus, as illustrated in FIG. 4, the RNA transcript of the
STEM3 assembly will fold in a manner capable of recruiting the
RTase and encode a gene targeting cassette within an extended loop
region within the msd element. The RTase can then reverse
transcribe the msd element which also encodes the gene targeting
cassette resulting in a cDNA-based gene targeting substrate. In the
absence of an RNaseH-like activity, an extended loop of RNA/DNA
hybrid molecule may be created whereby the loop region encodes the
gene targeting substrate. In the presence of an RNaseH-like
activity a molecule with an extensive ssDNA loop may be created
whereby the loop region encodes the gene targeting substrate. As a
result of repeated transcription of the STEM3 assembly and
consequent reverse transcription by reverse transcriptase, multiple
copies of the gene targeting substrate may be made with this
system. This gene targeting substrate may then be acted upon by
host DNA processes, such as recombination or repair processes, to
genetically alter it (which may involve pairing of the GTNS and the
homologous host target locus).
[0230] 4b) In vivo cDNA Synthesis Using STEM3
[0231] The retron system was evaluated regarding the size of novel
DNA sequence that could be placed into the msd region and still
enable cDNA synthesis in vivo. It is possible that the retron has a
size limit regarding novel DNA sequence that can be tolerated.
Exceeding this limit could impair the correct folding of the RNA
retron elements and inhibit recruitment of reverse transcriptase
and or reverse transcription of the msd region including a novel
sequence encoding a gene targeting sequence. Using a
computer-based, nucleic acid-folding modeling program [1689], the
tolerance of STEM3 for insertion seqeuences was evaluated. As shown
in FIG. 5, the overall predicted structure of STEM3 including
either a 50 bp or 500 bp insert is not markedly different from
STEM3 without insert. Thus, one may predict in vivo synthesis of at
least a 500 bp cDNA could be achieved using STEM3. This capability
was evaluated in prokaryotic and eukaryotic cells using E. coli and
S. cerevisiae as respective model systems.
[0232] To evaluate the capability of the STEM3 system to produce
cDNAs in vivo in prokaryotes, E. coli DH5% was transformed with
pMW7, capable of expressing Ec86 reverse transcriptase, in
combination with one of several STEM3-derived constructs with
insert sequences of 0 bp (pMW16), 15 bp (pMW161), 25 bp (pMW162),
35 bp (pMW198), 50 bp (pMW163), 100 bp (pMW199), or 250 bp
(pMW200). The strains were cultured overnight as outlined above
with the appropriate selection agents plus 0.2 mM IPTG. DNA was
isolated as outlined above and approximately equal amounts were
resolved by gel electrophoresis on a 2% agarose gel. The cDNA was
then detected by staining the gel with ethidium bromide or after
Southern blotting and probing with a .sup.32P-labelled DNA fragment
encoding Ec86 msr-msd.
[0233] As illustrated in FIG. 6, the production of detectable
levels of cDNA in E. coli was depended upon co-expression of both
the STEM3 component and the reverse transcriptase. It is also
demonstrated that increasing the size of insert within the msd
element of the retron can severely impair cDNA production. For
example, STEM3 with a 15 or 25 bp insert still results in
production of cDNA when reverse transcriptase is coexpressed,
albeit at a much lower level than STEM3 without insert. However,
STEM3 with 50 bp insert did not produce sufficient amounts of cDNA
to be detected by staining with ethidium bromide. Rather, the much
more sensitive Southern blotting technique was required to detect
the cDNA from STEM3 with 50 bp insert. Note that the high molecular
weight bands detected on the Southern blot represent the parental
plasmids encoding the STEM3 components which also hybridise to the
radio-labeled probe. This experiment further showed that a 100 bp
insert in the msd region of the retron severly impaired production
of a detectable level of cDNA and that an insert of 250 bp may
prohibit cDNA production. Collectively, this data demonstrates that
in some embodiments DNA sequences placed into the msd region of a
retron can impair cDNA production in a manner dependent upon the
size of insert. This experiment using a prokaryotic host suggests
that a maximum size limit, in this embodiment, of about 100 bp may
be tolerated by the retron for cDNA production. Accordingly, in
alternative embodiments, insert size may be varied to affect
functionality of retrons in vivo.
[0234] To evaluate the capability of the STEM3 system to produce
cDNAs in vivo in eukaryotic cells, S. cerevisiae strain RK2575-URA
was transformed with pMW27, capable of expressing NLS-RT from Ec86,
in combination with one of several constructs capable of expressing
STEM3 with inserts of 0 bp (pMW166), 15 bp (pMW167), 25 bp
(pMW168), 35 bp (pMW202), 50 bp (pMW169), 100 bp (pMW203), 250 bp
(pMW204), 320 bp (pMW211), 500 bp (pMW212), or 1000 bp (pMW213).
The strains were cultured overnight and DNA was extracted as
described above. Samples of DNA were resolved by gel
electrophoresis on a 2% agarose gel, Southern blotted and probed
with a .sup.32P-labeled DNA fragment encoding Ec86 msr-msd.
[0235] FIG. 7 illustrates the production of cDNA in eukaryotic
cells using the STEM3 system. Note that the high MW bands detected
on the Southern blot represent the parental constructs encoding the
STEM3 components which also hybridise to the radio-labeled probe.
As observed in prokaryotic cells, the production of detectable
amounts of cDNA was dependent upon the co-expression of the STEM3
component and the cognate reverse transcriptase. Surprisingly, the
effect of insert size on cDNA production in eukaryotic cells was
not as severe as that observed in prokaryotic cells. This
experiment demonstrates that in some embodiments inserts of at
least 500 bp can be tolerated by the STEM3 system and may be
converted to abundant levels of cDNA in eukaryotic cells.
Accordingly, the cDNA length capability of a retron-based system of
the invention may be greater in eukaryotic cells than in
prokaryotic cells.
[0236] 4c) Application of STEM3 to Gene Targeting in Eukaryotic
Cells
[0237] FIG. 8 highlights one possible mechanism how the STEM3
system may be used to modify eukaryotic chromosomal loci. In this
example, the chromosomal URA3 locus of the model eukaryote S.
cerevisiae is used as representative of any chromosomal locus in
eukaryotic cells. In this example, the RTase is expressed from one
promoter episome and the STEM3 assembly is expressed from another
promoter episome. In some other embodiments the RTase and STEM3
assembly may be expressed from a single episome, two different
episomes, or from genetically linked or unlinked loci encoded by a
chromosome.
[0238] In this example, 500 bp of the ura3.sup.Bsp allele was
cloned into STEM3 and placed in a yeast vector with the TRP1
selectable marker adjacent to a promoter (i.e pMW266). The NLS-RT
of Ec86 was encoded adjacent to a promoter on a yeast vector with
the LEU2 selectable marker (i.e. pMW27).
[0239] To evaluate the STEM3-based gene targeting system,
RK2575-URA was transformed with pMW266 alone or in combination with
pMW27 as per Geitz et al., 1995 [Gietz, R D, Schiestl, R H,
Willems, A R, Woods, R A: Studies on the transformation of intact
yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11: 355-360
(1995)]. The double-transformed yeast cells possessing both pMW266
and pMW27 thus require culture on the medium SC-LEU-TRP [324] Adams
[200]. Therefore to keep growth medium composition uniform for all
treatments in the experiment, the strains transformed with the
single experimental construct (i.e. pMW266 into a separate strain
instead of in combination with pMW27) was also transformed with an
empty vector (i.e. YCplac111Tet2x) solely for the purpose of
supplying the complementary selectable marker as present in the
experimental double-transformants. In this manner all strains could
be cultured in the same SC-LEU-TRP medium.
[0240] RK2575-URA cells were transformed with the above mentioned
plasmid combinations as per Geitz et al. (1995) [212] [323] and the
cells were plated on SC-LEU-TRP. The plates were incubated at 30 C
until colony diameter was 3-4 mm. Eleven colonies from each
treatment were individually collected and disbursed in 1 ml sterile
distilled water (SDW). An aliquot of these cells was used to
prepare serial dilutions in SDW and plated on YPD medium (per
litre: 10 g Bacto-yeast extract, 20 g Bacto-peptone, 20 g glucose,
20 g Bacto-agar; [200] [325]) to determine viable cell number.
Additional aliquots were plated on FOA selection medium [200)
[324]. The plates were incubated 2-5 days and the colonies were
then counted. The data of viable cell number and number of
FOA-resistant cells was compiled, taking into consideration the
dilution factors, and analysed by the method of the median [1008]
[327] with statistical analysis as described by Dixon and Massey
(1969) [962] [328]. The FOA-resistant cells represent genetic
events where the chromosomal URA3 locus is converted to a mutant
allele as encoded. by the gene targeting cassette encoding a
fragment of the ura3.sup.Bsp allele (i.e. pMW266).
[0241] As shown in Table 2, the exemplified embodiments demonstrate
modification of a specific target locus in a eukaryotic chromosome
can be achieved by employing components involved in reverse
transcription as part of a gene targeting system as embodied here.
The genetic evidence demonstrates that conversion of a target locus
in a eukaryotic chromosome to an alternate allele can be promoted
by employing a reverse transcriptase to create cDNA molecules in
vivo which may act as gene targeting substrates which may interact
with and alter the sequence of a chromosomal target locus.
5TABLE 2 Analysis of gene targeting systems employing reverse
transcription Gene Targeting Gene Events/ Gene Con- Cell Division
Targeting System Components structs (.times.10.sup.7).sup.a
Frequency.sup.b Experiment 1 STEM3:: 500 bp ura3.sup.Bsp-SENSE
PMW266 3.1 NLS-RT + STEM3:: 500 bp ura3.sup.Bsp-SENSE PMW27 4.2 40%
pMW266 STOP-stem:: 500 bp ura3.sup.Bsp-SENSE PMW267 3.2 NLS-RT +
STOP-stem:: 500 bp ura3.sup.Bsp-SENSE PMW27 4.1 30% pMW267
STOP-stem:: 500 bp ura3.sup.Pvu-SENSE PMW269 1.6 NLS-RT +
STOP-stem:: 500 bp ura3.sup.Pvu-SENSE PMW27 2.7 70% pMW269
Experiment 2 STOP-stem:: 500 bp ura3.DELTA. .sup.PstEcoRV-SENSE
PMW252 2.4 NLS-RT + STOP-stem:: 500 bp ura3.DELTA. .sup.PstEcoRV
-SENSE PMW27 5.4 130% pMW252 STOP-stem:: 500 bp ura3.DELTA.
.sup.PstEcoRV-AntiSENSE PMW253 2.4 NLS-RT + STOP-stem:: 500 bp
ura3.DELTA. .sup.PstEcoRV -AntiSENSE PMW27 6.3 160% pMW253
Experiment 3 3' recruitment:: 500 bp ura3.DELTA.
.sup.PstEcoRV-SENSE PMW249 0.7 NLS-RT + 3' recruitment::500 bp
ura3.DELTA. .sup.PstEcoRV -SENSE PMW27 1.9 170% pMW249 3'
recruitment:: 500 bp ura3.DELTA..sup.PstEcoRV -AntiSENSE PMW248 0
NLS-RT + 3' recruitment::500 bp ura3.DELTA. .sup.PstEcoRV
-AntiSENSE PMW27 1.9 190% pMW248 .sup.aRepresents conversion of the
chromosomal URA3 locus in RK2575-URA to ura3 as detected by
FOA-resistance .sup.bRepresents the percent increase in the number
of gene targeting events observed when the reverse transcriptase
was combined with the gene targeting cassette vs. that observed
with the gene targeting cassette alone.
[0242] The data in Table 2 from Experiment 1 demonstrates that the
STEM3 system employing elements from the retron Ec86 is effective
at facilitating genetic alteration of a eukaryotic chromosomal
locus. The control strain (i.e. RK2575-URA/pMW266) reflects the
background of homologous recombination events which occur between
homologous sequences carried in the same cell (i.e. the gene
targeting cassette encoding ura3Bsp present on pMW266 and the
chromosomal URA3 locus) under the growth conditions used. However,
the rate of converting the chromosomal URA3 locus to a mutant
allele is greatly increased over the background level when the
RTase is expressed in a cell also possessing the STEM3 gene
targeting cassette. This is demonstrated by the 40% increase in the
occurrence of FOA-resistant cells in a strain expressing the STEM3
gene targeting cassette and expressing a RTase (i.e.
RK2575-URA/pMW27/pMW266). Thus the gene targeting systems embodied
here can be applied to efficiently alter eukaryotic chromosomal
loci.
[0243] The data demonstrate that the gene targeting systems of the
invention may be adapted to be used to facilitate modification of a
eukaryotic chromosomal target locus at relatively high frequency.
The data further demonstrates that gene targeting systems of the
invention can be developed using available components that
facilitate reverse transcription in vivo. These components may for
example be derived from prokaryotic or eukaryotic origin. The data
further demonstrate that a RTase of prokaryotic origin, capable of
functioning in eukaryotes, can be used in the context of the
present invention to facilitate gene targeting. Accordingly, in
various aspects of the invention, a selected RTase, or derivatives
thereof (including those engineered to encode an NLS), can be used
with its cognate recognition sequence (required to recruit the
RTase to an RNA to facilitate cDNA synthesis) can be used to
facilitate gene targeting in a variety of eukaryotic species.
Example 5
STOPstem
[0244] 5a) Overview
[0245] The design of the STOPstem (FIG. 9) derivative of the
msr-msd elements is essentially the same as STEM3 (FIG. 4).
However, the STOPstem derivative encodes two 23 bp inverted repeat
sequences (i.e. S1, S2) within the 5' end of the msd element.
Likewise to STEM3 a DNA sequence encoding homology to a target
locus and the genetic change to be transferred to the target locus
can be cloned into the msd element within the STOPstem at the
unique XbaI and EcoRV sites. This is then placed behind a promoter
which is functional in the host cell. The STOPstem gene targeting
assembly is then introduced into a host eukaryotic cell which is
also capable of expressing RTase. As illustrated in FIG. 9, the RNA
transcript of the STOPstem gene targeting assembly may fold in a
manner capable of recruiting the RTase and encode a gene targeting
cassette within an extended loop region within the msd element,
similar to that for STEM3. However, the additional S1 and S2
inverted repeat sequences in the STOPstem may anneal to each other
to form a stem-and-loop structure not found in STEM3. The
nucleotide composition of the S1 and S2 stem-and-loop is designed
to have a sufficiently high dissociation constant as to impair
progression of RTase through it. Thus RTase can be recruited to a
transcript of the STOPstem assembly and reverse transcribe the msd
sequence and resident gene targeting cassette as per STEM3.
However, when the RTase encounters the S1-S2 stem-and-loop
structure termination of reverse transcription would be promoted.
With appropriate placement of the S 1-S2 stem-and-loop, the
termination of reverse transcription could result in cDNA molecules
which have at the 3' end absolute homology, or minimal
non-homology, to the target locus. The presence of non-homology at
the 3' end of recombination substrates has been demonstrated to
suppress homologous recombination [368]. Thus the method described
here to minimise non-homology at the 3' end of gene targeting
substrates may be adopted in some embodiments to enhance gene
targeting frequency. In the absence of an RNaseH-like activity, an
extended loop of RNA/DNA hybrid molecule may be created whereby the
loop region encodes the gene targeting substrate but the cDNA may
not encode any retron sequences at its 3' end due to the reverse
transcription termination activity of the S1-S2 stem-and-loop
structure. In the presence of an RNaseH-like activity a molecule
with an extended ssDNA sequence may be created which encodes the
gene targeting substrate and may not encode any retron sequences at
its 3' end due to the reverse transcription termination activity of
the S1-S2 stem-and-loop structure. As a result of repeated
transcription of the STOPstem assembly and consequent reverse
transcription by reverse trancriptase, multiple copies of the gene
targeting substrate may be made with this system. This gene
targeting substrate may then be acted upon by host DNA
recombination and repair processes to pair with the target
chromosomal locus and genetically alter it.
[0246] To demonstrate the effectiveness of the STOPstem system for
modifying eukaryotic chromosomal loci, the chromosomal URA3 locus
of the model eukaryote S. cerevisiae was employed as representative
of any chromosomal locus in eukaryotic cells. In this example, the
chromosomal URA3 locus of the model eukaryote S. cerevisiae is used
as representative of any chromosomal locus in eukaryotic cells. In
this example, the RTase is expressed from one promoter episome and
the STOPstem assembly is expressed from another promoter episome.
In other embodiments the RTase and STOPstem assembly may be
expressed from a single episome, two separate episomes, or from
genetically linked or unlinked loci encoded by a chromosome. In one
example, 500 bp of the ura3.sup.Bsp allele was cloned into STOPstem
and placed adjacent to a promoter in a yeast vector with the TRP1
selectable marker (i.e pMW267). In another example, 500 bp of the
ura3.sup.Pvu allele was cloned into STOPstem and placed adjacent to
a promoter in a yeast vector with the TRP1 selectable marker (i.e
pMW269). In another example, 500 bp of the ura3.DELTA..sup.PstEcoRV
allele was cloned into STOPstem and placed adjacent to a promoter
in a yeast vector with the TRP1 selectable marker (i.e pMW252). In
another example, 500 bp of the ura3.DELTA..sup.PstEcoRV allele was
cloned into STOPstem in an antisense orientation and placed
adjacent to a promoter in a yeast vector with the TRP1 selectable
marker (i.e pMW253). The NLS-RT of Ec86 was encoded adjacent to a
promoter on a yeast vector with the LEU2 selectable marker (i.e.
pMW27).
[0247] 5b) In vivo cDNA Synthesis Using STOPstem
[0248] The STOPstem derivative of Ec86 msr-msd was evaluated for
its capability to enable in vivo cDNA synthesis in eukaryotic
cells. S. cerevisiae was used as a representative eukaryotic cell.
S. cerevisiae strain RK2575-URA was transformed with pMW256,
capable of expressing STOPstem containing an insert of 500 bp, in
combination with pMW27, capable of expressing NLS-RT from Ec86, or
YCplac111-Tet2x, the parental vector of pMW27. The strains were
cultured and processed as outlined above for the evaluation of the
STEM3 system in S. cerevisiae. Samples of DNA from the strains were
resolved by gel electrophoresis on a 2% agarose gel, Southern
blotted and probed with a .sup.32P-labeled DNA fragment encoding
Ec86 msr-msd.
[0249] FIG. 10 illustrates production of cDNA in eukaryotic cells
using the STOPstem system. Note that the high molecular weight
bands detected on the Southern blot represent the parental
constructs encoding the STEM3 components which also hybridise to
the radio-labelled probe. The low molecular weight signal
represents the cDNA produced by reverse transcription of the
STOPstem::500 bp RNA. Detection of the cDNA is dependent upon
co-expression of the NLS-RT and the STOPstem::500 bp RNA. This
experiment demonstrates the capability of the STOPstem system to
produce cDNAs from inserts of at least 500 nucleotides in vivo in
eukaryotic cells. One aspect of the invention is the use of new
sequences, such as the S1 and S2 inverted repeats, capable of
terminating reverse transcription in retron-like systems of the
invention.
[0250] 5c) Application of STOPstem to Gene Targeting in Eukaryotic
Cells
[0251] To demonstrate application of the STOPstem-based gene
targeting system, RK2575-URA was transformed by the method of Geitz
et al., 1995 [217] [323] with: pMW267 alone or in combination with
pMW27; pMW269 alone or in combination with pMW27; pMW252 alone or
in combination with pMW27; or pMW253 alone or in combination with
pMW27. The double-transformed yeast cells possessing either pMW267,
pMW.sup.269, pMW252 or pMW253 and pMW27 thus require culture on the
medium SC-LEU-TRP. Therefore to keep media composition uniform for
all treatments in the experiment, the strains transformed with the
single experimental constructs (i.e. pMW267, pMW269, pMW252, or
pMW253 into separate strains instead of in combination with pMW27)
were also transformed with an empty vector (i.e. YCplac111Tet2x,
the base vector of pMW27) solely for the purpose of supplying the
complementary selectable marker as present in the experimental
double-transformants. In this manner all strains could be cultured
in the same SC-LEU-TRP medium.
[0252] RK2575-URA cells were transformed with the above mentioned
plasmid combinations as per Geitz et al. (1995) [212] [323] and the
cells were plated on SC-LEU-TRP. The plates were incubated at 30 C
until colony diameter was 3-4 mm. Eleven colonies from each
treatment were individually collected and disbursed in 1 ml sterile
distilled water (SDW). An aliquot of these cells was used to
prepare serial dilutions in SDW and plated on YPD medium to
determine viable cell number. Additional aliquots were plated on
FOA selection medium. The plates were incubated 2-5 days and the
colonies were then counted. The data of viable cell number and
number of FOA-resistant cells was compiled, taking into
consideration the dilution factors, and analysed by the method of
the median [1007] [327] with statistical analysis as described by
Dixon and Massey (1969) [962] [328]. The FOA-resistant cells
represent genetic events where the chromosomal URA3 locus is
converted to a mutant allele as encoded by the gene targeting
cassette encoding a fragment of the ura3Bsp allele (i.e. pMW267),
the ura3Pvu allele (pMW269), or the ura3.quadrature.PstEcoRV allele
(pMW252, pMW253).
[0253] As shown in Table 2, the exemplified embodiments demonstrate
modification of a specific target locus in a eukaryotic chromosome
can be achieved by employing components involved in reverse
transcription as part of a gene targeting system as embodied here.
The genetic evidence demonstrates that conversion of a target locus
in a eukaryotic chromosome to an alternate allele can be promoted
by employing a reverse transcriptase to create cDNA molecules in
vivo to act as gene targeting substrates which can interact with
and alter the sequence of a chromosomal target locus.
[0254] The data in Table 2 from Experiments 1 and 2 demonstrates
that the STOPstem system employing elements of the retron Ec86 is
effective at facilitating genetic alteration of a eukaryotic
chromosomal locus. The respective control strains (i.e.
RK2575-URA/pMW267; RK2575-URA/pMW269; RK2575-URA/pMW252;
[0255] RK2575-URA/pMW253) reflect the background of homologous
recombination events which occur between homologous sequences
carried in the same cell (i.e. the gene targeting cassette encoding
ura3Bsp, ura3Pvu or ura3.quadrature.PstEcoRV, present on pMW267,
pMW269, pMW252 and pMW253, respectively and the chromosomal URA3
locus) under the growth conditions used. However, the rate of
converting the chromosomal URA3 locus to a mutant allele is greatly
increased over the background level when the RTase is expressed in
a cell also expressing the STOPstem gene targeting system. This is
demonstrated by the 30%-130% increase in the occurrence of
FOA-resistant cells in a strain expressing the STOPstem gene
targeting cassette and expressing RTase (i.e.
RK2575-URA/pMW267/pMW27; RK2575-URA/pMW269/pMW27;
RK2575-URA/pMW252/pMW27- ; RK2575-URA/pMW253/pMW27). Thus the gene
targeting systems embodied here can be applied to efficiently alter
eukaryotic chromosomal loci.
[0256] These results further show that the invention may be adapted
so that a wide variety of genetic alterations may be made at a
eukaryotic chromosomal target locus. These alterations may for
example include: single-base pair changes; alteration of short
contiguous sequences of at least 8 bp; and alteration of long
contiguous sequences, for example of at least 50, 100, 150, 200,
208 or 250 bp.
[0257] These results additionally illustrate that genetic
alteration of an eukaryotic chromosomal target locus can be
achieved with the reverse transcription-based gene targeting system
when the cDNA is designed to pair with either the sense or
antisense strand of a target locus.
Example 6
3'-Recruitment System
[0258] 6a) Overview
[0259] An additional derivative of the msr-msd elements exemplified
here as being an effective gene targeting system is referred to as
the 3'-recruitment system (FIG. 11). The 3'-recruitment system
incorporates the msr, msd, and a1' and a2' elements as per STEM3
(FIG. 4). However, the order of the elements is rearranged. As
illustrated in FIG. 11, in the 3'-recruitment system the msd
element is 5' of the msr element and the a1' and a2' inverted
repeat sequences are adjacent to each other between the msd and msr
elements. Likewise to STEM3, a DNA sequence encoding homology to a
target locus and the genetic change to be transferred to the target
locus can be cloned into the msd element within the 3'-recruitment
system at the unique XbaI and EcoRV sites. This is then placed
behind a promoter which is functional in the host cell. The
3'-recruitment system gene targeting assembly is then introduced
into a host eukaryotic cell which is also capable of expressing
RTase.
[0260] As illustrated in FIG. 11, the configuration of the
components of the 3'-recruitment system is such that the RNA
transcript of the 3'-recruitment gene targeting assembly will fold
in a conformation mimicking that of STEM3 (FIG. 4) and the wild
type msr-msd elements (FIG. 1). The significant difference between
STEM3 and the wild type msr-msd versus the 3' recruitment system is
that the loop region within the msd element is not formed in the
3'-recruitment system. Although this loop region is not created,
the annealing of the a1' and a2' inverted repeat sequences and
repeat sequences within the msd and msr regions are still capable
of occurring (FIG. 11). Thus formation of the appropriate RNA
structure in the msr region to recruit RTase and place it in the
correct context to initiate reverse transcription of the msd region
and convert the gene targeting sequence to cDNA may still occur.
This cDNA can then act as a gene targeting substrate. As a result
of repeated transcription of the 3'-recruitment assembly and
consequent reverse transcription by reverse transcriptase, multiple
copies of the gene targeting substrate may be made with this
system. This gene targeting substrate may then be acted upon by
host DNA recombination and repair processes to pair with the target
chromosomal locus and genetically alter it. In the absence of an
RNaseH-like activity, reverse transcription of the 3'-recruitment
assembly may form a RNA/DNA hybrid molecule encoding the gene
targeting substrate. In the presence of an RNaseH-like activity a
molecule with an extensive ssDNA region may be created encoding the
gene targeting substrate.
[0261] A significant advantage of the 3'-recruitment structure is
that it may bypass structural constraints which may exist in the
STEM3 system as a result of creating a large loop structure in the
msd element. The amount of novel DNA sequence placed within the msd
element may affect the folding of the retron elements and impair
cDNA synthesis. For example, in the STEM3 system a size limit may
exist regarding the amount of DNA placed in the msd element and
tolerated with respect to proper folding of the retron to enable
efficient reverse transcription. This size limit may also be
dependent upon the composition of the novel sequence place in the
msd element. Exceeding this size limit or sequence composition may
inhibit formation of the appropriate secondary and tertiary
structures in the msr and msd region of STEM3. This in turn may
inhibit recruitment of RTase and or reverse transcription of the
msd region encoding the gene targeting cassette. Because the
3'-recruitment system does not form this msd loop structure,
interference by the gene targeting sequence length or composition
on the folding of the msr and msd elements may be minimised. As a
result, the size of cDNAs or cDNA sequence composition types
capable of being synthesized by the retron system using the
3'-recruitment configuration may be greatly increased over that
possible using the STEM3 or other possible configurations of retron
components.
[0262] In some embodiments retron and cognate RTase versions are
used which have high processivity so as to increase the length of
cDNAs synthesized with the 3' recruitment system. Novel versions of
RT may be developed, for example, by in vitro evolution techniques
such as, for example, gene shuffling using RTases from various
sources.
[0263] In some embodiments mutant versions of RTase are developed
which have increased processivity and used as part of the
3'-recruitment system so as to increase the length of cDNAs
synthesized with the 3' recruitment system.
[0264] In some embodiments the 3'-recruitment system is expressed
using the promoter of the target gene. With this arrangement the 5'
region of the RNA to create the gene targeting substrate may be
identical to the target gene. As a result, the 3' region of the
cognate cDNA created by the 3'-recruitment system may maximise
homology to the target locus. This high degree of homology at the
3' end of the gene targeting substrate may increase gene targeting
frequency.
[0265] In some embodiments the 3'-recruitment system incorporates a
sequence which is capable of terminating reverse transcription at a
specific site. One example of such a sequence is the S1-S2 inverted
repeat described above for the STOPstem system. Incorporating such
a termination sequence at an appropriate position in the gene
targeting sequence within the 3'-recruitment system may create cDNA
molecules with a high degree of homology at the 3' end of the
resultant cDNA gene targeting substrate which may thus increase
gene targeting frequency.
[0266] 6b) In vivo cDNA Synthesis Using the 3'-Recruitment
System
[0267] The 3'-recruitment derivative of Ec86 msr-msd was evaluated
for its capability to enable in vivo cDNA synthesis in prokaryotic
and eukaryotic cells using E. coli and S. cerevisiae as respective
model systems. To evaluate the system in E. coli, the strain
DH5.alpha. was transformed with pMW120, capable of expressing
NLS-RT derived from Ec86, in combination with one of several
constructs, capable of expressing the 3'-recruitment element plus
inserts of: 100 bp (pMW159); 250 bp (pMW164); or 500 bp (pMW165).
As a control to demonstrate dependence of cDNA production on a
reverse transcriptase, a derivative of pMW159 was created which had
the msr region responsible for recruiting reverse transcriptase and
priming reverse transcription deleted (i.e. pMW171). These
constructs were transformed into E. coli DH5-alpha in combination
with pMW120. The strains were cultured and processed as outlined
above for the evaluation of the STEM3 system in E. coli. DNA
samples were resolved by gel electrophoresis on a 2% agarose gel
and detected by staining with ethidium bromide.
[0268] As illustrated in FIG. 12, the 3'-recruitment system is
effective for in vivo production of cDNAs. A sequence of at least
500 bp can be reverse transcribed using the 3'-recrutiment system.
The dependence on production of the cDNAs on a reverse
transcriptase was demonstrated by the absence of detectable cDNA
accumulation when the reverse transcriptase recruitment and priming
sequence was deleted (i.e. pMW171). The results highlight the
finding disclosed herein that release of structural constraints in
the msr-msd region of a retron can significantly increase the
capacity of the construct for producing cDNAs of increased length
using retron-derived systems of the invention. For example, using
the STEM3 system, sequences of .about.100 bp appear to be the
maximum for cDNA synthesis (FIG. 6). However, with the
3'-recruitment system, sequences of at least 500 bp can be used for
cDNA sysnthesis in vivo. This demonstrates the facility of the
3'-recruitement system to adapt retrons to produce relatively
lengthy cDNAs in vivo. The invention accordingly provides methods
for modifying structural constraints inherent in the msr-msd
sequences so as to increase tolerance of an insertion sequence in a
gene targeting construct, to facilitate reverse transcription of a
gtRNA to produce a GTS.
[0269] To evaluate the capability of the 3'-recruitment system to
produce cDNAs in vivo in eukaryotic cells, S. cerevisiae RK2575-URA
was transformed with pMW221, capable of expressing the
3'-recruitment element containing an insert of 500 bp, in
combination with pMW27, capable of expressing NLS-RT from Ec86, or
YCplacIII-Tet2x, the parental vector of pMW27. The strains were
cultured and processed as outlined above for the evaluation of the
STEM3 system in S. cerevisiae. Samples of DNA from the strains were
resolved by gel electrophoresis on a 2% agarose gel, Southern
blotted and probed with a .sup.32P-labeled DNA fragment encoding
Ec86 msr-msd.
[0270] FIG. 13 illustrates production of cDNA in eukaryotic cells
using the 3'-recruitment system. Note the high molecular weight
bands detected on the Southern blot represent the parental
constructs encoding the 3'-recruitment components which also
hybridise to the radioactively-labelled probe. The low molecular
weight signal represents the cDNA produced by reverse transcription
of the 3'-recrutiment::500 bp RNA. Detection of the cDNA is
dependent upon co-expression of the NLS-RT and the
3'-recrutiment::500 bp RNA. This embodiment demonstrates the
capability of the 3'-recrutiment system to produce cDNAs encoding
at least 500 nucleotides in vivo in eukaryotic cells. The
rearrangement of retron msr-msd sequences to modify structural
constraints and promote an open conformation to promote reverse
transcription of lengthy insertion sequences is an aspect of the
present invention.
[0271] 6c) Application of 3'-Recruitment to Gene Targeting in
Eukaryotic Cells
[0272] To demonstrate application of the 3'-recruitment system for
modifying eukaryotic chromosomal loci the chromosomal URA3 locus of
the model eukaryote S. cerevisiae was employed as representative of
any chromosomal locus in eukaryotic cells. In this example, the
RTase is expressed from one episome and the 3'-recruitment system
assembly is expressed from another episome. In other embodiments
the RTase and 3'-recruitment system assembly may be expressed from
a single episome or from genetically linked or unlinked loci
encoded by a chromosome. In one example, 500 bp of the
ura3.DELTA..sup.PstEcoRV allele was cloned into the 3'-recruitment
system in a sense orientation and placed adjacent to a promoter in
a yeast vector with the TRP1 selectable marker (i.e pMW249). In
another example, 500 bp of the ura3.DELTA..sup.PstEcoRV allele was
cloned into the 3'-recruitment system in an antisense orientation
and placed adjacent to a promoter in a yeast vector with the TRP1
selectable marker (i.e pMW248). The NLS-RT of Ec86 was encoded
adjacent to a promoter on a yeast vector with the LEU2 selectable
marker (i.e. pMW27).
[0273] To evaluate the 3'-recruitment system-based gene targeting
system, RK2575-URA was transformed by the method of Geitz et al.,
1995 [212] [323] with: pMW249 alone or in combination with pMW27;
or pMW248 alone or in combination with pMW27. The
double-transformed yeast cells possessing either pMW249 or pMW248
and pMW27 thus require culture on the medium SC-LEU-TRP. Therefore
to keep medium composition uniform for all treatments in the
experiment, the strains transformed with the single experimental
constructs (i.e. pMW249 or pMW248 into separate strains instead of
in combination with pMW27) were also transformed with an empty
vector (i.e. YCplac111Tet2x, the base vector of pMW27) solely for
the purpose of supplying the complementary selectable marker as
present in the experimental double-transformants. In this manner
all strains could be cultured in the same SC-LEU-TRP medium.
[0274] RK2575-URA cells were transformed with the above mentioned
plasmid combinations as per Geitz et al. (1995) [212] [323] and the
cells were plated on SC-LEU-TRP. The plates were incubated at 30 C
until colony diameter was 3-4 mm. Eleven colonies from each
treatment were individually collected and disbursed in 1 ml sterile
distilled water (SDW). An aliquot of these cells was used to
prepare serial dilutions in SDW and plated on YPD medium to
determine viable cell number. Additional aliquots were plated on
FOA selection medium. The plates were incubated 2-5 days and the
colonies were then counted. The data of viable cell number and
number of FOA-resistant cells was compiled, taking into
consideration the dilution factors, and analysed by the method of
the median (1007] [327] with statistical analysis as described by
Dixon and Massey (1969) [962] [328]. The FOA-resistant cells
represent genetic events where the chromosomal URA3 locus is
converted to a mutant allele as encoded by the gene targeting
cassettes encoding a fragment of the ura3APstEcoRV allele (i.e.
pMW249, pMW248).
[0275] As shown in Table 2, the exemplified embodiments demonstrate
modification of a specific target locus in a eukaryotic chromosome
can be achieved by employing components involved in reverse
transcription as part of a gene targeting system as embodied here.
The genetic evidence demonstrates that conversion of a target locus
in a eukaryotic chromosome to an alternate allele can be promoted
by employing a reverse transcriptase to create cDNA molecules in
vivo to act as gene targeting substrates which can interact with
and alter the sequence of a chromosomal target locus.
[0276] The data in Table 2 from Experiment 3 demonstrates that the
3'-recruitment system employing elements of the retron Ec86 is
effective at facilitating genetic alteration of a eukaryotic
chromosomal locus. The respective control strains (i.e.
RK2575-URA/pMW249; RK2575-URA/pMW248) reflect the background of
homologous recombination events which occur between homologous
sequences carried in the same cell (i.e. the gene targeting
cassette encoding ura3.DELTA..sup.PstEcoRV present on pMW248 and
pMW249 and the chromosomal URA3 locus) under the growth conditions
used. However, the rate of converting the chromosomal URA3 locus to
a null allele is greatly increased over the background level when
the RTase is expressed in a cell also expressing the 3'-recruitment
gene targeting system. This is demonstrated by the 170% or greater
increase in the occurrence of FOA-resistant cells in a strain
expressing the 3'-recruitment gene targeting cassette and
expressing RTase (i.e. RK2575-URA/ pMW249/pMW27;
RK2575-URA/pMW248/pMW27). Thus the gene targeting systems embodied
here can be applied to efficiently alter eukaryotic chromosomal
loci.
[0277] These results additionally illustrate that genetic
alteration of an eukaryotic chromosomal target locus can be
achieved with the reverse transcription-based gene targeting system
when the cDNA is designed to pair with either the sense or
antisense strand of a target locus.
Example 7
Development of dsDNA Gene Targeting Substrates In vivo
[0278] In some embodiments, reverse transcriptase is employed to
make gene targeting substrates in vivo which are double-stranded
DNA (dsDNA). In one embodiment, the dsDNA gene targeting substrate
may be synthesized by using a gene targeting cassette that contains
an inverted repeat sequence. One part of this inverted repeat
sequence encodes the genetic change desired to be transferred to
the target locus plus flanking sequences that are homologous to the
target locus and corresponds to the sense strand of the target
locus. The other part of the inverted repeat sequence is like the
first except that it corresponds to the anti-sense strand of the
target locus. These two parts of the inverted repeat sequence may
be linked in a head-to-head or tail-to-tail fashion to create the
gene targeting cassette. The gene targeting cassette is then linked
to a sequence capable of recruiting reverse transcriptase and
priming reverse transcription of the inverted repeat sequence
region of the gene targeting cassette. The inverted repeat
sequences converted to cDNA by action of reverse transcriptase can
then base-pair with each other to create a dsDNA molecule that
encodes regions of homology to the target locus as well as the
genetic change desired to be transferred to the target locus. This
dsDNA molecule can be acted upon by host DNA recombination and
repair processes to facilitate transfer of the genetic change
encoded by the gene targeting substrate to the target locus.
[0279] In some embodiments, a dsDNA gene targeting substrate may be
synthesized in vivo using a reverse transcription-based system by
producing two forms of single-stranded DNA (ssDNA) gene targeting
substrate in the same cell. Both ssDNA gene targeting substrate
forms may encode the genetic change desired to be transferred to
the target locus plus the flanking sequences that are homologous to
the target locus. However, one ssDNA gene targeting substrate type
encodes a sequence representative of the sense strand of the target
locus and the other ssDNA gene targeting substrate type encodes a
sequence representative of the anti-sense strand of the target
locus. When the two forms of ssDNA gene targeting substrates are
both present in a cell, they may base-pair to form a dsDNA gene
targeting substrate that encodes regions of homology to the target
locus as well as the genetic change desired to be transferred to
the target locus. This dsDNA molecule can be acted upon by host DNA
recombination and repair processes to facilitate transfer of the
genetic change encoded by the gene targeting substrate to the
target locus.
[0280] To illustrate the use of dsDNA gene targeting substrates
produced in vivo in eukaryotic cells, S. cerevisiae was used as a
model system. In this example, genetic modification of the
chromosomal URA3 locus of S. cerevisiae was employed as
representative of applying the invention to any chromosomal locus
in eukaryotic cells. In this example, the reverse transcriptase is
expressed from the chromosome and the RNA molecules to be reverse
transcribed into cDNAs encoding the gene targeting substrate are
expressed from episomes. In other examples, the reverse
transcriptase and RNA molecules encoding the gene targeting
substrates may be expressed from a single or multiple episomes, or
from genetically linked or unlinked loci encoded by the host
genome. In one example, 500 bp of the ura3.sup.Pvu allele was
cloned into both the STEM3 and STOPstem derivatives of Ec86 msr-msd
in either the sense or antisense orientation. (i.e. pMW261 and
pNML93 in STEM3 as sense or antisense, respectively; pMW262 and
pNML94 in STOPstem as sense or antisense, respectively). These
elements were then transferred to yeast expression vectors
resulting in the following constructs: pNML91
(STEM3::ura.sup.Pvu-sense); pNML95 (STEM3::ura.sup.Pvu-antisense);
pNML101 (STEM3::ura.sup.WT-sense); pNML103
(STEM3::ura.sup.WT-antisense); pNML92 (STOPstem::ura.sup.Pvu-sens-
e); pNML96 (STOPstem::ura.sup.Pvu-antisense); pNML102
(STOPstem::ura.sup.WT-sense); pNML104
(STOPstem::ura.sup.WT-antisense). NLS-RT was placed into a
chromosomal integration and expression vector (i.e. pWY84). The
resultant strain with NLS-RT integrated at the HO locus of
RK2575-URA was designated RK2575-URA-HO::NLS-RT.
[0281] To illustrate the application of producing dsDNA molecules
in vivo, RK2575-URA and RK2575-URA-HO::NLS-RT were each transformed
as follows: pNML101 and pNML103 (STEM3::URA.sup.WT); pNML91 and
pNML95 (STEM3::ura.sup.Pvu); pNML102 and pNML104
(STOPstem::URA.sup.WT); pNML92 and pNML96
(STOPstem::ura.sup.Pvu).
[0282] In alternative embodiments, yeast cells could be transformed
following the method of Geitz [212] and cells plated on SC-LEU-TRP.
The plates would then be incubated at 30 C until colony diameter
was about 3-4 mm. A number of colonies from each treatment would
then be individually collected and disbursed in 1 ml sterile
distilled water (SDW). An aliquot of these cells would be used to
prepare serial dilutions in SDW and plated on YPD medium to
determine viable cell number. Additional aliquots would be plated
on FOA selection medium. The plates would be incubated 2-5 days and
the colonies counted. The data of viable cell number and number of
FOA-resistant cells would be compiled, taking into consideration
the dilution factors, and analysed by the method of the median
[1007] [327] with statistical analysis as described by Dixon and
Massey (1969) [962] [328]. The FOA-resistant cells would represent
genetic events where the chromosomal URA3 locus is converted to a
mutant allele as encoded by the gene targeting cassettes.
Example 8
Effect of Recombination Potential on Gene Targeting Frequency
[0283] In some embodiments, the frequency of gene targeting in
eukaryotic host cells may be enhanced by elevating the activity of
the homologous recombination machineray in the host cells.
[0284] In other embodiments, the frequency of gene targeting in
eukaryotic host cells may be elevated by suppressing the activity
of host cell processes which promote integration of gene targeting
substrates into the chromosome by non-homology-based recombination
processes such as those involved in non-homologous end-joining
(NHEJ).
[0285] In some embodiments, the eukaryotic host cell is treated so
as to both enhance the activity of homologous recombination
machinery as well as suppress the activity of non-homology-based
recombination processes.
[0286] 8a) Decreased Non-Homologous Recombination Activity
[0287] In some examples, the action of non-homology based
recombination processes is suppressed by reducing the activity of
key proteins involved in this process such as Ku70, Ku80 and DNA
protein kinase (DNA-PK) which are highly conserved in eukaryotes,
[1026, 114, 1020, 1093] from yeast to humans and plants.
[0288] The activity of Ku70, Ku80 and DNA-PK may be reduced by
several means such as: anti-sense RNA; co-suppression; RNAi.
[0289] Alternatively, a dominant-negative approach could be used
whereby a mutant form of a protein is expressed in the wild type
host cell. The mutant form of the protein then inhibits the
function of the endogenous wild type protein by for example,
binding and titrating or sequestering a protein or nucleic acid
substrate or co-factor such that it is no longer readily available
for interaction with the endogenous wild type protein.
[0290] 8b) Gene Targeting in Meiotic Cells
[0291] Meiosis is an important component of sexual reproduction in
eukaryotic cells whereby haploid gametes are produced by diploid
parents. An important aspect of meiosis is the production of
genetic variation through the exchange and mixing of genetic
information between the maternal and paternal genomes. This
exchanging and mixing of the parental genomes is facilitated by the
process of homologous recombination. As a result, many of the
proteins involved in homologous recombination are expressed at an
elevated level in meiotic cells resulting in a greatly increased
potential for homologous recombination in meiotic cells versus
vegetative cells [73]. Delivery of gene targeting substrates to
meiotic cells could thus result in enhanced gene targeting
frequency because of the elevated homologous recombination
potential of these cells.
[0292] In some embodiments of the invention, reverse transcription
is used to generate gene targeting substrates in meiotic cells. In
some embodiments, RNA molecules encoding gene targeting substrates
are expressed in meiotic cells so that an endogenous reverse
transcriptase native to the host genome can reverse transcribe the
RNA to make a cDNA which can act as a gene targeting substrate in
the meiotic cell. Such native reverse transcriptases may be encoded
by retro transposons or retroviruses which are naturally resident
in the host genome. Such genetic elements are known to be more
active during the process of meiosis [763, 764, 761]. Thus
coordinating the production of an RNA encoding a gene targeting
substrate with the elevated level of reverse transcriptase activity
and homologous recombination proteins naturally present in meiotic
cells may increase gene targeting frequency.
[0293] In some embodiments, RNA molecules encoding gene targeting
substrates and a cloned reverse transcriptase capable of reverse
transcribing those RNA molecules into cDNAs which can act as gene
targeting substrates are coordinately produced in meiotic cells. In
some embodiments, the reverse transcriptase is derived from a
retron and the RNA molecules encoding the gene targeting substrate
possess structures capable of recruiting the reverse transcriptase
which facilitates production of the cDNA gene targeting substrate.
Thus coordinating the production of an RNA encoding a gene
targeting substrate and its cognate RTase with the elevated level
of homologous recombination proteins naturally present in meiotic
cells may increase gene targeting frequency.
[0294] To illustrate the use of reverse transcription to produce
gene targeting substrates during meiosis, S. cerevisiae was used as
a model eukaryote. The process of meiosis, including the mechanisms
of homologous recombination, is highly conserved in yeast, humans
and plants [1679,76, 829, 1678, 504]. Therefore, the application of
reverse transcription to achieve gene targeting in yeast cells is
representative of that in higher eukaryotes.
[0295] S. cerevisiae strain RK2575-URA was used as a host to assay
gene targeting. DNA cassettes capable of expressing the RNA
component of the reverse transcription-based system were first
created. Thus, DNA sequences encoding 500 bp of URA3 or the mutant
alleles ura.sup.Bsp or ura.sup.Pvu were cloned into the STEM3 or
STOPstem derivatives of Ec86 msr-msd (i.e. pMW287, pMW259, pMW261,
pMW288, pMW260, pMW262). These assemblies were then transferred
into a chromosomal integration and expression vector (pTK179)
resulting in the constructs pMW303, pMW299, pMW301, pMW304, pMW300
and pMW302.
[0296] The various STEM3 and STOPstem versions of Ec86 msr-msd
incorporating a gene targeting sequence were then transferred to
the HO chromosomal locus, following standard methods [976],
resulting in the strains: RK2575-URA-HO::STEM3+URA3.sup.WT,
RK2575-URA-HO::STEM3+ura3.sup.- Bsp,
RK2575-URA-HO::STEM3+ura3.sup.Pvu,
RK2575-URA-HO::STOPstem+URA3.sup.W- T,
RK2575-URA-HO::STOPstem+ura3.sup.Bsp and
RK2575-URA-HO::STOPstem+ura3.s- up.Pvu. These strains were cultured
in the presence of doxycycline to repress expression of retron
components.
[0297] The above strains with the chromosomally integrated gene
targeting components could be made diploid by mating with a uracil
proficient derivative of the S. cerevisiae strain E134 [276]. E134
was first made to be uracil proficient by replacing the resident
ura3-52 allele with a DNA fragment encoding URA3 as described above
for converting RK2575 to RK2575-URA. The resulting strain was
designated E134-URA. This haploid strain was then mated with the
RK2575-URA-HO derivatives described above encoding the
chromosomally integrated gene targeting components, following
standard methods to produce diploid S. cerevisiae strains. These
strains were cultured in the presence of doxycycline to repress
expression of retron components. The diploid strains could then be
transformed with a vector capable of expressing NLS-RTase (pMW27),
following standard procedures [212]. To create control strains not
expressing NLS-RTase, the yeast cells were transformed with
YLplac111-Tet2X, the parent vector of pMW27. In this manner, the
control and test strains could be cultured with the same selection
medium. All strains were cultured in the presence of doxycycline (5
ug/ml or 10 ug/ml for broth or plate cultures, respectively) to
repress expression of retron components.
[0298] To illustrate the effect of producing gene targeting
substrates in vivo during meiosis, diploid S. cerevisiae strains
capable of producing cDNA-based gene targeting substrates during
meiosis were employed as a eukaryotic model. The S. cerevisiae
cells were proficient for synthesizing uracil and thus could grow
on media lacking uracil. The S. cerevisiae cells were also capable
of expressing RNA molecules which could be reverse transcribed
through the action of reverse transcriptase to produce a cDNA in
vivo which could act as a gene targeting substrate. In this
example, the gene targeting substrate would encode homology to the
chromosomal URA3 gene as well as a mutated sequence which could be
transferred to the chromosomal URA3 gene. Transfer of this genetic
information from the gene targeting substrate to the chromosomal
URA3 gene could convert the URA3 gene to a mutant allele. The
mutated chromosomal allele may confer upon the cell an inability to
produce uracil. As a result, a cell possessing the mutant allele
but not the URA3 allele would not be able to grow on media lacking
a uracil supplement. However, the enzyme encoded by URA3,
orotidine-5' phosphate decarboylase, can catabolyse 5-fluoroorotic
acid (FOA) to form 5-fluorouracil, a toxic substance that inhibits
cell growth. Thus, proliferation of a cell encoding URA3 will be
inhibited in the presence of FOA whereas a cell with a mutated ura3
allele may proliferate in the presence of FOA. This selection
strategy was used to evaluate the gene targeting frequency in the
model system.
[0299] Expression of the reverse transcription-based gene targeting
system was promoted when the yeast cells were undergoing meiosis.
Thus, the cDNA-based gene targeting substrate could be present in
the nucleus to be acted upon by endogenous homologous recombination
functions. In this example, the gene targeting substrate has
homology to the chromosomal URA3 gene present in both the maternal
and paternal genomes within the diploid cell. The homologous
recombination functions can thus mediate transfer of the genetic
information encoded by the gene targeting substrate to either the
maternal URA3 allele, the paternal URA3 allele, or both and thereby
convert the wild type native alleles to mutant alleles. The haploid
products of meiosis could then be cultured in the presence of FOA
to select for those with mutated ura3 alleles. An aliquot of
meiotic products could also be cultured on a complete medium to
determine viable cell number. By relating the number of
FOA-resistant cells to viable cell number, an estimate of the
frequency of the development of an altered chromosomal ura3 allele
could be determined. This frequency could be compared between
various test and control strains to estimate the frequency of gene
targeting. In some examples, the control strain could be a strain
not expressing the reverse transcriptase or a strain producing a
gene targeting substrate encoding a wild type sequence versus a
mutated sequence.
[0300] 8c) Genetic Assay of Gene Targeting During Meiosis
[0301] To assay gene targeting during meiosis in the yeast model
system, single colonies from each test strain could be used to
first inoculate 3 ml of SC-LEU-URA+DOX (i.e. containing doxycycline
at 5 .mu.g/ml) in a 15 ml tube (Falcon) which would then be
incubated at 30 C with shaking (200 RPM) for .about.1.5 d. A number
of cultures would be prepared for each test strain. Cells from 1 ml
of culture would be pelleted by centrifugation at 9000 RPM for 2
min in a standard microcentrifuge (Brinkman) and resuspended in 1
ml of sterile-distilled water (SDW). The cells would be used to
inoculate 5 ml of SC-A pre-meiosis medium (per litre: 1.7 g yeast
nitrogen free base (Difco), 5 g ammonium acetate (Sigma), 20 g
potassium acetate (Sigma), 2 g amino acid drop out mix with
selection for the expression vectors, [200] [134]; and doxycycline
at 5 .mu.g/ml) in a 50 ml tube (Falcon) at a 1:50 dilution. The
cultures would then be incubated at 30 C with shaking (225 RPM) for
2 d. The cells in each culture in pre-meiosis medium would be
pelleted by centrifugation at 4000 RPM for 10 min at 4 C. The
pellet would be resuspended in 5 ml of SC-A pre-meiosis medium and
incubated at room temperature for 4 h to remove doxycycline. These
cells would then be pelleted by centrifugation at 4000 RPM for 10
min at 4 C and resuspended in 4 ml SPM meiosis-induction medium
(0.3% (w/v) potassium acetate, 0.02% (w/v) raffinose, 5 .mu.g/ml
histidine, 5 ug/ml uracil, 7.5 .mu.g/ml lysine, 5 .mu.g/ml
tryptophan, 5 .mu.g/ml adenine). The cells would again be pelleted
by centrifugation at 4000 RPM for 10 min at 4 C and resuspended in
3.5, ml SPM meiosis-induction medium. Cultures would then be
incubated at 30 C with shaking (225 RPM) for 2 d to enable cells to
undergo meiosis. Dilutions of the cells would be made using SDW and
cells then plated on YPD to determine viable cell number, and on
medium containing FOA [200] so as to estimate the number of cells
with a modified URA3 allele after meiosis. Duplicate dilutions and
plating of each culture could be performed. Plates could be
incubated at 30 C for 24 d and then colonies were counted.
Frequency of alteration of the chromosome URA3 allele to ura3 for
each culture could be determined by dividing the number of
FOA-resistant colonies by the viable cell number, taking into
consideration the dilution factors. Mean values for the replicates
of each test strain would be determined. Inclusion of the values
from all replicates in determining the mean could be evaluated by
the Q-test [201] [135] and values from individual replicates
excluded from the final mean if the statistic indicated a
significant deviation from the values of other replicates.
Comparison of means of gene targeting frequency vs. that from test
strains that form control strains could be done to determine the
effect of the test gene construct. Statistical significance of the
differences between these values could be confirmed by evaluation
using the t-test [202] [136].
[0302] 8d) Gene Targeting with Enhanced Homologous Recombination
Potential from Mutant Proteins
[0303] In some examples, the action of homologous recombination
processes is elevated by changing the activity level of enzymatic
or structural proteins which facilitate homologous recombination
events. This may be achieved by over-expressing wild type
homologous recombination-mediator proteins, or mutant versions of
homologous recombination-mediator proteins which have enhanced
activity properties. The beneficial effect on gene targeting
frequency of overexpressing wild type recombinase proteins, such as
RAD51, has been demonstrated. RAD51 is a key protein in HR as it
participates in pairing homologous DNA molecules and initiating the
HR process by catalyzing strand invasion. In some embodiments, a
modified version of RAD51 may be used which has increased
recombinogenic potential.
[0304] One example of such a modified RAD51 is one which may have
enhanced ability to bind and complex ssDNA molecules in vivo. In
vivo ssDNA molecules can be bound by ssDNA-binding proteins. In
eukaryotes, the heterotrimeric complex called RPA binds ssDNA [99].
This coating of ssDNA by RPA may inhibit RAD51 from binding to the
ssDNA and initiating the processes of homology searching and
strand-invasion [ 1692]. RAD52 may act to displace RPA from ssDNA
and promote loading of RAD51 onto the ssDNA [1693]. RAD55 and RAD57
may also aid RAD51 overcome RPA-based-inhibition of RAD51-promoted
strand exchange [1692]. However, in vitro studies have shown that a
mutant version of yeast RAD51, with amino acid residue #345 changed
from isoleucine to threonine (i.e. RAD51.sup.I345T) has elevated
affinity and more stable binding to SSDNA, even in the presence of
RPA, with increased independence from accessory factors [1691].
Thus, overexpression of a modified eukaryotic RAD51 with similar
amino acid changes to promote the proteins ability to complex ssDNA
may increase gene targeting frequency.
[0305] To evaluate the ability of RAD51 with altered ssDNA
complexing capacity to increase gene targeting frequency, S.
cerevisiae was used as a model eukaryote. A gene encoding the
mutant S. cerevisiae RAD51, yRAD51.sup.I134T, was created using the
primers yRAD51-I345T-S and yRAD51-I345T-AS as described above (i.e.
pNML56) In some embodiments, similar mutant forms of RecA-like
proteins may be used which are derived from their native host
species. (e.g. human RAD51 modified to encode the analogous I134T
mutation). To illustrate the applicability of employing a mutant
form of RAD51 to promote gene targeting in plants, the AtRAD51 of
Arabidopsis thaliana was modified and cloned. Sequence alignment
between yRAD51 and AtRAD51, or RAD51 proteins from other species,
can be used to identify amino acids corresponding to I345 in
scRAD51. For AtRAD51, a novel mutation changing amino acid residue
#290 from isoleucine to threonine will confer to it similar
biochemical properties observed for yRAD51.sup.I134T. The mutant
gene encoding AtRAD51.sup.I290T was created and cloned using the
primers AtRAD51-I290T-S and AtRAD51-I290T-AS as described above
(i.e. pNML55). The AtRAD51.sup.I290T gene placed behind a
constitutive promoter, the AtRAD51 promoter (pTK114) or a
cell-cycle specific promoter(pTK159; pNML11) or promoter expressed
during meiosis (e.g. pTK111, pTK65, pJD1) may be cloned into a
plant transformed vector and used to create transgenic plants
capable of expressing AtRAD51.sup.I290T. These plants can be used
as lines with elevated recombination potential for gene
targeting.
[0306] Another RecA-like protein which can be mutated to enhance
its recombination activity is DMC1, a highly-conserved
meiosis-specific protein. Sequence alignments between yRAD51 and
DMC1 proteins from other species can be used to identify amino acid
residues corresponding to I345 in scRAD51. For yDMC1 from S.
cerevisiae, changing amino acid residue #128 from isoleucine to
threonine may confer to it similar biochemical properties as
observed for yRAD.sup.51.sup.I134T. For AtDMCl from Arabidopsis
thaliana, changing amino acid residue #292 from Ala to Thr. will
confer to it similar biochemistry properties observed for
yRAD51.sup.I134T. These proteins, as well as similarly changed DMC1
proteins from other species, ay be used to elevate homologous
recombination potential and gene targeting frequency during
meiosis.
[0307] To illustrate the effect of mutant versions of proteins
involved in homologous recombination on gene targeting frequency in
eukaryotic cells, S. cerevisiae was used as a model system. The S.
cerevisiae strains RK2575-URA-HO::STEM3,
RK2575-URA-HO::STEM3+URA.sup.WT, RK2575-URA-HO::STEM3+ura3.sup.Bsp,
RK2575-URA-HO::STEM3+ura3.sup.Pvu,
RK2575-URA-HO::STOPstem+URA.sup.WT, RK2575-URA-HO::STOPstem
+ura3.sup.Bsp, and RK2575-URA-HO::STOPstem+ura3.sup.Pvu described
above were transformed with pMW27 expressing NLS-RT alone or in
combination with pMW305 expressing yRAD.sub.51.sup.I134T or pAS22,
the parent vector of pMW305. Alternatively, the yeast strains were
transformed with yCplac111-Tet2X, the parental vector of pMW27 and
pAS22, the parental vector of pMW305. In this manner, all strains
could be cultured in the same selective medium. Yeast strains were
cultured in the presence of doxycycline (5 ug/ml) to suppress
expression of retron elements prior to transformation by the method
of Geitz et al. (1995) 212. Transformed cells were plated on
SC-LEU-TRP and incubated at 30 C until colony diameter was 3-4 mm.
Eleven colonies from each treatment were individually collected and
disbursed in 1 ml sterile distilled water (SDW). An aliquot of
these cells was used to prepare serial dilutions in SDW and plated
on YPD medium to determine viable cell number. Additional aliquots
were plated on FOA selection medium [200] [324]. The plates were
incubated 2-5 days and the colonies were then counted. The data of
viable cell number and number of FOA-resistant cells was compiled,
taking into consideration the dilution factors, and analysed by the
method of the median [1007] [327] with statistical analysis as
described by Dixon and Massey (1969) [962] [328]. The FOA-resistant
cells represent genetic events where the chromosomal URA3 locus is
converted to a mutant allele as encoded by the gene targeting
cassettes.
Example 9
Application of Reverse Transcription to Gene Targeting in
Plants
[0308] In some embodiments modification of chromosomal target loci
in plant genomes is achieved with the invention. To exemplify
application of the invention in plants, modification of a native
chromosomal copy of the alcohol dehydrogenase gene in A. thaliana
was employed. In other embodiments, any gene or genomic sequence in
plant or animal genomes may be manipulated using the invention. In
one embodiment, the sequence within the coding region of the A.
thaliana alcohol dehydrogenase (i.e. AtADH) gene residing in its
native chromosomal location is altered. This alteration may cause
inactivation of the gene by, for example, inhibiting formation of
functional mRNA transcripts from the modified allele.
Alternatively, translation of the mRNA transcripts from the
modified allele may result in a truncated or non-functional protein
which is no longer able to perform the normal reaction of the
protein encoded by the target locus (e.g. alcohol dehydrogenase).
Inactive or null alleles of the AtADH gene (i.e. Atadh) enable the
plant to grow in the presence of allyl alcohol [1002] [308] (i.e.
the plants may be considered resistant to allyl alcohol). This is
because a functional alcohol dehydrogenase enzyme normally oxidizes
allyl alcohol to a toxic aldehyde, acrolein [1002] [308]. Thus
Arabidopsis plants with a functional allele of AtADH will die when
cultured in the presence of allyl alcohol (i.e. the plants are
susceptible to allyl alcohol). This phenotype of allyl alcohol
susceptibility and resistance can thus be used as a marker to score
gene targeting events where the ATADH gene is inactivated. In
summary, the assay involves generating gene targeting substrate
designed to inactivate a chromosomal copy of the wild type AtADH
gene in Arabidopsis. Since this plant line is initially wild type
for AtADH, progeny from the line can be assayed for the frequency
of allyl alcohol resistant plants (i.e. Atadh) to gauge the
occurrence of gene targeting events.
[0309] To engineer the gene targeting substrate for this example
assay, the AtADH allele was cloned and modified to create null
alleles. Null alleles were created using PCR to incorporate novel
sequences into AtADH which could impair the functional expression
of this gene. In one example, a novel NheI restriction site was
created at the splice-donor site between the first exon and intron.
This was accomplished by changing bp #31 (with respect to the A of
the ATG start codon of ATADH) from A to T, bp #33 from A to G and
bp #34 from G to C resulting in the allele Atadh.sup.Int1-mu. These
three base pair changes place an in-frame translation stop codon in
the first exon and are predicted to impair RNA splicing-mediated
excision of the first intron. Both events may impair functional
expression of AtADH. In another example, a novel mutant allele was
created which lacked the coding region of the first exon. This was
accomplished by substituting bp `-2` to `+34` (with respect to the
A of the ATG start codon of AtADH), with the sequence GCTAGC, the
recognition sequence for NheI, resulting in the mutant allele
Atadh.sup..DELTA.Ex1. The lack of the protein coding region of the
first exon may impair functional expression of AtADH. In addition,
because the wild type start codon is missing in
Atadh.sup..DELTA.Ex1, an alternative downstream codon may serve to
initiate translation in an incorrect reading frame resulting in
impaired functional expression of the gene.
[0310] To engineer mutant alleles of AtADH the BAC (bacterial
artificial chromosome) F1B15 encoding AtADH from the Columbia
ecotype of Arabidopsis thaliana (obtained from the Arabidopsis
Biological Resource Centre, Ohio State University, 1060 Carmack
Road, Columbus, Ohio, 432101002) was used as a template in PCR
reactions. A clone of the Atadh.sup.Int1 mutant allele is
represented by pnML67. A clone of the Atadh.sup..DELTA.Ex1 mutant
allele is represented by pNML68. Approximately 500 bp fragments of
each of these alleles, as well as of the wild type allele, were
amplified by PCR using the primer combinations of:
adh-Ex1(-250)-sense-5'Bam X ba aad adh-Ex1(+250)-sense-3'RV, or
adh-STOP-Ex1(-250)-sense-5'RI and adh-Ex1(+250)-sense-3'RV using
either pNML67, pNML68 or genomnic DNA from the Columbia ecotype of
A. thaliana as templates. These DNA fragments were cut with XbaI or
EcoRI to be cloned into the Ec86 msr-msd derivatives STEM3 or
STOPstem resulting in: pMW296 encoding STEM3::ADH.sup.WT, pMW275
encoding STEM3::adh.sup.Int-mu, pMW295 encoding
STOPstem:::ADH.sup.WT, pMW294 encoding
STOPstem::adh.sup..DELTA.Ex1, pMW293 encoding
STOPstem::adh.sup.Int-mu. These elements were then
functionally-linked to a transcription promoter (see later) and
expressed in plant cells.
[0311] In some embodiments, in vivo reverse transcription of RNA
molecules encoding gene targeting substrates is facilitated by a
reverse transcriptase. In some embodiments, this reverse
transcriptase may be natively encoded by the host genome such as by
a retrotransposon or retrovirus naturally resident in the host
genome. In some embodiments, the reverse transcriptase may be
encoded by another species and placed in the host genome by a
transformation process. In some embodiments, the reverse
transcriptase may originate from a retron. In some embodiments, the
retron-derived reverse transcriptase may be engineered to encode a
NLS to promote its accumulation in the nucleus of the host cell. In
some embodiments, the gene encoding the reverse transcriptase may
be engineered to optimize codon usage to enhance translation of the
reverse transcriptase in the host cell. In one example, the reverse
transcriptase is derived from the retron Ec86 and modified to
encode a NLS (i.e. pMW22). In one example, the reverse
transcriptase is modified to encode an NLS and an epitope tag to
facilitate detection of the protein by immunological methods (i.e.
pMW23). In one example, the reverse transcriptase is optimized for
codon usage in plants of the cruciferae family (e.g.
pNLS-RT.sup.Rs).
[0312] In some embodiments, expression of the reverse transcriptase
may be coordinated with that of the RNA element encoding the gene
targeting sequence by using similar promoters for each component.
In other embodiments, different types of promoters are used to
express the components of the gene targeting system so that the
components are present in the cell at overlapping temporal and
spatial points.
[0313] Examples of promoters applicable to the invention
include:
[0314] 1. S-phase associated promoters, including those linked to
genes expressed during S-phase, such as DNA-replication proteins.
(e.g. PCNA, replication factor C, proliferating cell nuclear
antigen, mini-chromosome maintenance proteins, DNA polymerase,
helicase, topoisomerase) or regulators and effectors of signal
transduction processes which influence the onset or duration of
cell cycle events (e.g. cyclins, cell division control genes,
checkpoint genes), effectors of DNA topology (e.g. histones), and
promoters regulated by the E2F transcription factor.
[0315] 2. DNA repair associated promoters like those linked to
homologous recombination and which are active during S-phase and
G2-phase of the cell cycle (e.g. RAD51, RAD54, RAD52, MRE11, RAD55,
RAD57, BRCA1, BRCA2, RAD50).
[0316] 3. G2-phase associated promoters like those linked to
regulators and effectors signal transduction controlling the onset
or duration of G2-phase (e.g. cyclins, cell division control genes,
checkpoint genes) or homologous recombination functions (e.g.
RAD51, RAD54, RAD52, MRE11, WRN, BLM, SGS1, RAD55, RAD57, BRCA1,
BRCA2, RAD50)
[0317] 4. Meiosis-associated promoters like those linked to
homologous recombination (e.g. SPO11, MRE1 1, RAD50, XRS2/NBS1,
DMC1, RAD51, Tid1, RAD54, resolvase, WRN, BLM, Sgs1, MSH4,
MSH5).
[0318] 5. Constitutive promoters (e.g. ACT1, ACT2, ACT3, ACT4,
ACT7, ACT8, ACT11, ACT 12, cryptic promoters, viral promoters).
[0319] In some embodiments, expression of the reverse transcriptase
and the RNA element encoding the gene targeting sequence may be
controlled by different promoters, like those listed above, which
may or may not confer overlapping expression patterns.
[0320] In some embodiments, the reverse transcriptase and the RNA
element encoding the gene targeting sequence may be integrated into
the host genome at one locus. Alternatively, these components may
be introduced into the host genome at different times through
separate transformation procedures. Alternatively, these two
components may be brought together in the same nucleus through a
sexual cross or cell or nuclear fusion between two lines expressing
the respective components.
[0321] In some embodiments the expression of NLS-RT or the msr-msd
derivative may be regulated by the AtH4 histone promoter cloned in
pNML11. In some embodiments the expression of NLS-RT or the msr-msd
derivative may be regulated by the AtCycD3 promoter cloned in
pTK159. In some embodiments the expression of NLS-RT or the msr-msd
derivative may be regulated by the EntCUP2 or EntCUP5 promoter
[994,1698] [302]. In some embodiments expression of NLS-RT or the
msr-msd derivative may be regulated by the AtDMCl promoter cloned
in pTK111. In some embodiments the expression of NLS-RT or the
msr-msd derivative may be regulated by the AtSPO11 promoter cloned
in pJD1. In some embodiments the expression of NLS-RT or the
msr-msd derivative may be regulated by the AtMSH4 promoter cloned
in pTK65. In some embodiments the expression of NLS-RT or the
msr-msd derivative may be regulated by the AtRAD51 promoter cloned
in pTK114.
[0322] In one example, plant transformation constructs were
assembled to enable expression of NLS-FLAG-RT derived from Ec86
(i.e. encoded by pMW23) and either the STEM3 or STOPstem derivative
of Ec86 msr-msd incorporating DNA sequences designed to target
AtADH in A. thaliana (i.e. encoded by pMW296, pMW275, pMW295,
pMW293, pMW294). In one example, NLS-FLAG-RT was linked to the
AtCycD3 promoter (pWY66). In another example, NLS-FLAG-RT was
linked to the AtH4 promoter (i.e. pMW271). In another example,
NLS-FLAG-RT was linked to the EntCUP2 promoter (i.e. pWY67). In
another example, NLS-FLAG-RT was linked to the Actin2 promoter
(i.e. pWY81). To facilitate expression in plants of the RNA
component encoding the gene targeting substrate, the STEM3 or
STOPstem element encoding a gene targeting sequence was linked to
the AtH4 promoter or the EntCUP5 promoter.
[0323] In one example, plant transformation constructs were
developed with the gene encoding NLS-FLAG-RT linked to the AtCycD3
promoter and the STEM3 or STOPstem cassette linked to the AtH4
promoter. In this manner, the following plant transformation
constructs were created: pMW284 (encoding STEM3::adh.sup.WT);
pMW309 (encoding STEM3::adh.sup..DELTA.Ex1)- ; pMW278 (encoding
STEM3::adh.sup.Int1mu); pMW291 (encoding STOPstem::adh.sup.WT);
pMW290 (encoding STOPstem:: adh.sup..DELTA.Ex1); and pMW289
(encoding STOPstem::adh.sup.Int1mu).
[0324] In another example, NLS-FLAG-RT was linked to the EntCUP5
promoter [994, 1698] and expression of the RNA component encoding
the gene targeting sequence was controlled by the ACT2 Actin2
promoter [1708].
Example 10
Test Gene Targeting in Plants Using Reverse Transcription
[0325] The plant transformation constructs encoding the gene
targeting system employing the retron-derived components was used
to transform A. thaliana as a representative plant species where
the invention may be applied. The constructs pMW276, pMW284,
pMW278, pMW277, pMW291, pMW289, pMW290 were first introduced into
Agrobacterium tumefaciens C58C1(pMP90) [1000] [309] following
standard microbiological procedures [213] [256]. Arabidopsis plants
were then transformed with the gene targeting constructs using the
`floral-dip` method [772] [310]. Seed was collected from these
plants treated with A. tumefaciens. T.sub.0 plants were selected by
first sterilizing the T.sub.0 seed (5 min in 70% ethanol, followed
by 10 min in 30% commercial bleach plus 0.1% (w/v) TWEEN 20, then 3
washes with SDW). The sterile seeds were plated on 1/2.times.MS
salts (sigma) solidified with 0.8% (w/v) agar contaiing 7.5 ug/ml
phosphinothricin (sigma). The plates were incubated at 22.degree.
C. with 16/8 h. photoperiod. Herbicide-resistant T.sub.0 seedlings
were transferred to soil and allowed to mature and self-cross.
T.sub.1 seed was collected from individual lines. Samples of
T.sub.1 seed from each herbicide resistant line is then plated on
medium containing allyl alcohol as described [308]. Plants that are
homozygous for an inactive Atadh allele will be able to grow in the
presence of allyl alcohol and will reflect the incidence of gene
targeting occurring.
[0326] The application of a retron-based gene targeting system in
plants is illustrated in FIG. 14. To summarise the assay of gene
targeting concerning modification of the AtADH gene as an example,
the plants are transformed with the gene targeting constructs
expressing NLS-RT or NLS-FLAG-RT and the gene targeting cassette
encoding either the STEM3 or STOPstem derivative of msr-msd and
either a fragment of ADH.sup.WT, adh.sup.Int1mu or
adh.sup..DELTA.Ex1. As a control, other plants may be transformed
with the gene targeting constructs encoding a msr-msd derivative
without an intervening sequence (i.e. no Atadh allele). In the case
of where promoters which are functional in vegetative cells are
used to control expression of the reverse transcription components,
gene targeting events may occur as the seeds from the A.
tumefaciens treated plants germinate and develop into the T.sub.0
plants. With each cell division, the targeting substrate may be
produced by the action of reverse transcriptase on the RNA
component encoding the gene targeting substrate. Thus numerous
opportunities occur during plant development for the chromosomal
allele of AtADH to be converted to a new sequence (i.e. Atadh) by
the gene targeting substrates produced by reverse transcription. In
some embodiments, with the possibility of gene conversion occuring
early in development (i.e. from the time of embryo formation),
there may be a high probability that the converted allele will
occur in a cell lineage which leads to gamete formation. If the
converted allele is carried into the germ line in a heterozygous
state, meiosis in the particular flower or flowers derived from the
converted cell lineage may be expected to produce gametes at a 1:1
ratio regarding the wild-type (AtADH) and converted (Atadh) allele.
In the case of the alcohol dehydrogenase locus, selfed progeny from
such a flower may segregate in a Mendelian fashion as 1:2:1 with
25% of the progeny being homozygous for the converted allele and
selected for by allyl alcohol. Efficiency of gene targeting may be
gauged by the frequency of T.sub.0 plants producing progeny
resistant to allyl alcohol. In other embodiments, further
generations (i.e. T.sub.1, T.sub.2, T.sub.n) may be evaluated for
occurrence of gene targeting events. This frequency may also be
compared to that obtained in control plants transformed with the
same gene targeting construct except not having an intervening
sequence (i.e. no Atadh allele) associated with the msr-msd
derivative or a control where the msr-msd derivative encodes a WT
portion of AtADH. Because the gene targeting construct encoding
NLS-RT or NLS-FLAG-RT and the msr-msd derivative encoding the Atadh
reproducible sequence may integrate into a site in the plant genome
distal from the target allele (e.g. AtADH), then through the
process of natural genetic segregation plants may be identified
which encode the modified target locus (e.g. Atadh) but no longer
encode the initial gene targeting construct. As a result this plant
may contain no undesired foreign sequences (e.g. transformation
construct sequences). In addition, this plant line may be
transformed with a new gene targeting construct to modify a second
target locus and the identification of these primary transformants
may use the same selectable marker as used in the initial gene
targeting construct.
[0327] In other embodiments where promoters which are functional in
meiotic cells are used to control expression of reverse
transcription components, gene targeting events may occur as the
T.sub.0 plant undergoes meiosis. In this case, the AtADH gene in
numerous male and female gametes may be converted to Atadh allele.
If this plant is allowed to self-cross, seeds will result that are
either heterozygous for the converted allele (i.e. AtADH/Atadh) or
homozygous for the converted allele (i.e. Atadh/Atadh), as well as
homozygous wild type. Efficiency of gene targeting may be gauged by
the frequency of T.sub.0 plants producing progeny resistant to
allyl alcohol. In other embodiments, further generations (i.e.
T.sub.1, T.sub.2, T.sub.n) may be evaluated for occurrence of gene
targeting events. This frequency may also be compared to that
obtained in control plants transformed with the same gene targeting
construct except not having an intervening reproducible sequence
(i.e. no Atadh allele) associated with the msr-msd derivative or a
control where the msr-msd derivative encodes a WT portion of AtADH
to gauge the efficiency of genetargeting.
[0328] In other embodiments alternative genes encoded in plant or
animal genomes may be modified using the gene targeting system
described here. One example of commercial importance in plants
would be herbicide resistance such as, for example, that associated
with the acetolactate synthase (i.e. ALS) gene. Modification of,
for example, amino acid residue #653 of the ALS protein from
Arabidopsis thaliana corresponding to a serine, or the
corresponding amino acid from ALS proteins from other species,
whereby it is converted to an asparagins, can confer resistance to
a imidazolinone-type herbicide [1004] [311]. An engineered allele
of the ALS gene to create a gene targeting substrate, which can
facilitate such an amino acid change to confer herbicide
resistance, can be used with this system.
Example 11
Retron Expression
[0329] Inserting GTNS Within a Modified msd Hairpin
[0330] An msr-msd cassette containing a variety of restriction
sites was prepared to permit introduction of nucleotide sequences
of interest (GTNS) within msr-msd (FIG. 3A).
[0331] To optimize the prospect of proper folding of the
msr-GTNS-msd product at the 5'-3' termini, regions of homolgy at
the 5' and 3' ends of msr-msd were increased as shown in FIG. 3B
(STEM 3, portion below arrow). This extension isolates the msr-msd
region from 5'UTR and 3' UTR regions associated with the construct
to permit expression within the host. Nucleotide sequences of
interest of varying lengths were also introduced into restriction
sites introduced into the hairpin of stem 3 (FIG. 3B). These
inserts included nucleotide sequences encoding URA3 as a nucleotide
sequence of interest.
[0332] URA3 metabolizes 5' flurouroitic acid (FOA) to a toxic
metabolite, therefore cells expressing URA3 when cultured in FOA
die (FOA sensative, FOA.sup.s, FIG. 8). Cells that are ura3.sup.-
will grow on FOA (FOA resistant, FOA.sup.r). Cells that have been
transformed with an msr-GTNS-msd where the GTNS is ura3.sup.-, and
that exhibit growth on FOA, are indicative of replacement of the
target locus by the gene targeting substrate (FIG. 8).
[0333] As shown in FIGS. 6 (EtBr stain, left hand side and Southern
analysis, ura3 probe, right hand side) and 4E (Southern analysis,
ura3 probe), accumulation of msDNA is observed with inserts of 15
to 500 base pairs in length of ura3 placed within the msd hairpin
loop of msr-GTNS-msd as outlined in FIG. 5. Retron expression is
only observed in the presence of RT. In E coli, msDNA accumulation
is noted for a GTNS up to about 100 base pairs in length, while in
yeast, accumulation is observed for inserts of up to about 500
nucleotides in length.
[0334] Inserting GTNS in an Inverted msr-msd Region
[0335] Alternate strategies for inserting a gene targeting
nucleotide sequence within an msr-msd is outlined in FIG. 11. In
this example, inverted repeats are inserted in the region between
msr-msd so that these regions pair to produce the structure shown
in FIG. 11, middle panel. This structure provides a 5' msd free end
that is spatially separated from the internal rG residue of the RNA
transcript required for priming reverse transcription. Fragments of
ura3 are added to the 5' end of the retron.
[0336] With reference to FIGS. 12 (EtBr stined gels) and 13
(Southern analysis using ura3 as a probe), accumulation of msDNA is
observed with inserts of 100 to 500 base pairs in length placed at
the 5' end of a modified msr-msd as oultined in
[0337] FIG. 11. Retron expression is only observed in the presence
of RT. In both yeast and E coli, msDNA accumulation is noted for a
GTNS up to about 500 base pairs in length.
Example 12
Cloning and Evaluation of Genes
[0338] Genes and genetic elements of interest were cloned using
specific oligonucleotides designed to prime DNA synthesis in a PCR
reaction with either cDNA or genomic DNA (gDNA) from the
appropriate species as template. The primers were designed to
incorporate convenient restriction sites into the amplicon to
facilitate initial cloning of the gene or genetic element and
subsequent subcloning into various expression or analytical
vectors. Genes and genetic elements cloned and the oligonucleotide
primers used to achieve this are not set out herein, but may in
many cases be derived from published sequence information. PCR
conditions were as described [213] [256] or as recommended by the
supplier of the thermostable DNA polymerase Pfu (Stratagene), Pfx
(Gibco BRL) or Taq (Pharmacia). PCR reactions were conducted using
a thermocycler (Perkin-Elmer Model 9700). In some cases specific
restriction fragments known to encode the gene or genetic element
of interest, based on sequence information from genome databases,
were directly cloned from complex mixtures of DNA fragments without
any PCR amplification. In other cases, specific restriction
fragments known to encode the gene or genetic element of interest
based on restriction maps of plasmids encoding the desired
components were subcloned into other vectors for various
applications. DNA sequence of clones was determined at a commercial
sequencing facility (Plant Biotechnology Institute, Saskatoon,
Canada).
[0339] Strains of Escherichia coli were cultured at 37.degree. C.
following standard [200, 213] procedures [213] with noted
exceptions using TYS broth (per litre distilled water: 10 g
Tryptone (Difco); 5 g yeast extract (Difco); 5 g NaCl (Sigma)) or
TYS plates (i.e. TYS medium plus agar (1.5% (w/v); Sigma)) with
appropriate levels of antibiotics (i.e. ampicillin (100 .mu.g/ml);
kanamycin (50 .mu.g/ml); chloramphenicol (20 .mu.g/ml);
tetracycline (12 .mu.g/ml))where necessary to ensure selection and
maintenance of plasmid constructs.
[0340] Strains of Saccharomyces cerevisiae were cultured at
30.degree. C. following standard procedures with noted exceptions
using YPD broth (per litre: 10 g Bacto-yeast extract, 20 g
Bacto-peptone, 20 g glucose) or YPD plates (i.e. YPD medium plus
agar (2% (w/v)), or on minimal medium with appropriate amino acid
supplements to ensure selection of plasmid constructs.
[0341] 12a) Cloning of Reverse Transcriptase and Derivatives
[0342] Reverse transcriptase from retrons was evaluated to
facilitate production of cDNA-based gene targeting substrates in
eukaryotic cells. The strain ECOR 70 [1657] encoding the retron
Ec107 [1664] was obtained from the American Type Culture Collection
(Item #3589). The strain HB8 [1685] encoding the retron Ec86 [1647]
was obtained from the E.coli Genetic Stock Center (Item #2514; Yale
University New Haven, Conn.).
[0343] Template DNA for amplifying the RTase from Ec107 and Ec86
was obtained by isolating genomic DNA from the ECOR 70 and HB8
strains, respectively, following standard procedures [213]. PCR
reactions were performed with approximately 1 .mu.g of genomic DNA
as template, 1.0 pmol each of primers 86RT-5'RI and 86RT-3'Pst, to
amplify the reverse transcriptase from Ec86, or primers 107RT-5'RI
and 107RT-3'Pst, to amplify the reverse transcriptase from Ec107,
0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents
provided by the manufacturer in a volume of 50 .mu.l. The PCR was
performed following standard procedures [213]. After completion of
the cycling, DNA fragments were resolved by agarose electrophoresis
using a 1% gel and following standard procedures [213] [256]. DNA
fragments of .about.1 kilobase pair (kb) expected to correspond to
RTase from Ec86 or Ec107 were excised and the DNA recovered from
the agarose using the Qiaquick Gel Extraction Kit (Qiagen)
following the protocol supplied by the manufacturer. DNA was
digested with EcoRI and PstI following standard procedures [213]
[256]. The plasmid cloning vector pTZ19R [973] was digested with
EcoRI and PstI. The amplicon and vector DNA were purified by
agarose electrophoresis and recovered as descirbed above.
[0344] Amplicon and vector DNA were then mixed in the presence of
T4 DNA ligase (Gibco-BRL) to covalently link the two molecules
following standard procedures [213] [256] in a final volume of 25
.mu.l. After incubating the ligation reaction as described [213]
[256], 1 .mu.l of glycogen (20 mg/ml) was added to the ligation
mixture made up to 100 .mu.l with distilled water. After
precipitation with ethanol [213] [256], the DNA was resuspended in
4 .mu.l of distilled water. An appropriate E. coli strain (e.g.
DH5.alpha. (Gibco-BRL)) was transformed with 2.5 .mu.l of the
concentrated ligation following standard procedures [213] [256] and
plated on sterile TYS medium containing ampicillin. Putative clones
were propagated in TYS broth and ampicillin. Plasmid DNA was
isolated by standard alkaline-lysis "mini-prep" procedure [213]
[256]. The DNA sequence of the resultant clones, pMW3 and pMW4,
encoding RTase from Ec86 and Ec107, respectively were determined at
a commercial sequencing facility (Plant Biotechnology Institute,
Saskatoon, Canada) to confirm they encoded intact copies of the
respective genes. Cloning of all other genes and genetic elements
described in this invention followed the same principles as for
pMW3 and pMW4, with noted exceptions.
[0345] A second version of Ec86 RTase was cloned wherein the ATG
start codon was replaced with a SmaI site as one way of enabling
translational fusion of the RTase with other proteins or peptides.
The modified gene, RT.DELTA.ATG, was created using PCR with pMW3 as
template and the primers 86-Sma and 86RT-3'Pst. The .about.1 kb
amplicon was digested with SmaI and PstI and cloned into the SmaI
and PstI sites of pBluescript II KS- (Stratagene) resulting in the
construct pMW12.
[0346] A third version of Ec86 RTase was cloned which encoded the
FLAG peptide [966] [260] at its N-terminus. The FLAG peptide
encodes a unique amino acid sequence which enables detection of the
fusion protein using commercially available antibodies (Sigma). The
modified gene, FLAG-RT, was created using PCR with pMW3 as template
and the primers 86-Sma-FLAG and 86RT-3'Pst. The .about.1 kb
amplicon was digested with SmaI and PstI and cloned into the SmaI
and PstI sites of pBluescript II KS- (Stratagene) resulting in the
construct pMW14.
[0347] Additional versions of Ec86 RTase were cloned so that the
resultant proteins would encode a nuclear localization sequence
(NLS) at the N-terminus of the protein (i.e. NLS-RT), alone or in
combination with the FLAG peptide. A synthetic oligonucleotide was
created which encoded the nuclear localization sequence
corresponding to that found in simian virus 40 T-antigen [109]
[257]. This NLS has been demonstrated to function in animal, yeast,
and plant cells [109, 1372, 1362, 1363]. In other embodiments,
RTase proteins may be fused to a C-terminal NLS. An example of a
C-terminal NLS is that from the VirD2 protein which is functional
in animal, yeast, and plant cells [968, 967]. The nucleotide
sequence (GGATCCAAAA AAATGGCTCC TAAGAAGAAG AGAAAGGTTG GAGGAGGACC
CGGG) encodes a BamHI site, in-frame start codon, and SmaI site
(underlined). A plasmid containing this cloned NLS sequence and
derived from pBluescript II KS- (Stratagene) was digested with SmaI
and PstI and the DNA fragment corresponding to the vector was
purified. pMW12 and pMW14 were also digested with SmaI and PstI and
the DNA fragments corresponding to the RTase gene (.about.1 kb),
alone or in combination with the N-terminal FLAG peptide, were
cloned onto the NLS sequence. The resulting constructs were
designated pMw22, encoding NLS-RT, and pMW23, encoding NLS-FLAG-RT
where the RTase is derived from Ec86. pMW39 encodes the Ec107 RTase
fused to the NLS of SV40 T-antigen in a similar fashion as
described above for Ec86 RTase.
[0348] The RTase genes of Ec86 and Ec107 were cloned into vectors
capable of expressing the proteins and variants thereof in E. coli
by the tac promoter [1688] [261] which is regulatable by the
gratuitous inducer IPTG. The RTase genes of Ec86 and Ec107 were
cloned into pDKS [972] [262] by using EcoRI and PstI, The resultant
clones were designated pMW7 and pMW8 encoding the wild type RTase
genes of Ec86 and Ec107, respectively. To evaluate the
functionality of retron reverse transcriptase fused to other
peptides constructs for expressing in E. coli modified versions of
Ec86 RTase encoding a NLS with or without the FLAG peptide were
assembled. This was achieved by using SmaI and PstI to subclone the
RTase encoding genes from pMW12 and pMW14 into a derivative of the
expression vector pDK5 [972] [262] which encodes the NLS described
for pMW22 fused to the EcoRI site of pDK5 and having a SmaI site at
the 3' end of the sequence encoding the NLS (i.e. pDK5+NLS). The
resultant constructs were designated pMW17, encoding NLS-RT, and
pMW21, encoding NLS-FLAG-RT. Another construct to express NLS-RT,
pMW120, was assembled by using BamHI and PstI to transfer the
NLS-RT gene from pMW22 to pMW16 (see later).
[0349] Plasmid constructs were assembled to facilitate expression
of retron components and variants therof in eukaryotic yeast using
an expression system developed by Gari et al., (1997) [55] [265].
Briefly, the transcription promoters on these plasmids are a hybrid
system developed by Gari et al. (1997) which permits suppression or
induction of gene expression by varying growth medium constituents.
This transcription control system employs components of the
regulatory system controlling expression of tetracycline resistance
in prokaryotes [55] [265]. As a result, in the presence of
tetracycline or doxycycline, an analogue of tetracycline,
transcription of the target gene is suppressed. Conversely, when
tetracycline or doxycycline is absent efficient transcription of
the target gene can occur. By varying the number of tetO sites in
the promoter from two (i.e. Tet2x promoter) to seven (i.e. Tet7x
promoter), the promoter strength can be increased .about.2-fold
[55] [265]. The combination of vector copy number (i.e. CEN-type
vs. 2u-type with copy numbers of 1-2 plasmids per cell or up to 40
plasmids per cell, respectively [211] [266]) and promoter strength
allows gene expression to be varied .about.5-fold [55] [265]. Yeast
expression plasmids using this system of gene regulation include
pCM188, pCM189 and pCM190 as described by Gari et al., (1997) as
well as derivatives thereof. These derivatives were based on the
plasmids described by Geitz et al., (1997) [977] and were created
by subcloning an EcoRI-HindIII fragment encoding either the Tet2x
(.about.2.6 kb) or Tet7x (.about.2.8 kb) promoter elements from
pCM188 or pCM190, respectively, into the EcoRI-HindIII site of
YEplac112 (i.e. creating YEplac112-Tet7x), or YCplac22 (i.e.
creating YCplac22-Tet2x), or YEplac181 (i.e. creating
YEplacl81-Tet2x) or YCplac111 (i.e. creating YCplac111-Tet2x). In
addition, derivatives of these plasmids were created which
contained the Destination cassette (Gibco BRL). pCM188 and pCM190
were each digested with BamHI and PstI and then treated with T4
polymerase to make the DNA ends blunt before ligation to the
Destination-C cassette (Gibco BRL) to create pAS13 (i.e.
pCM188-DEST) and pAS14 (i.e. pCM190-DEST). Restriction enzyme
analysis demonstrated that the Destination-C cassette in these
vectors was in a sense orientation with regard to the promoter so
that genes transferred into the Destination cassette would be
functionally expressed. pAS13 and pAS14 were then each digested
with XhoI and HindIII to release fragments encoding the Tet2x and
Tet7x promoters, respectively, plus the attached Destination-C
cassette. These fragments were then ligated to either
YCplac22-Tet2x to create pAS22 (i.e. YCplac22-Tet2x-DEST),
YEplac112-Tet7x to create pAS23 (i.e. YEplac112-Tet7x-DEST),
YCplac111-Tet2x to create YCplac111-Tet2x-DEST, or YCplac111-Tet7x
to create YCplac111-Tet7x-DEST.
[0350] The genes encoding Ec86 reverse transcriptase and the NLS-RT
derivative were subcloned into yeast expression vectors. The
wild-type RTase gene originally cloned in pMW3 was first subcloned
into pSPORT2 (Gibco-BRL) using EcoRI and PstI to generate the
construct pMW10. The wild type Ec86 RTase was then subcloned into
the PmeI and PstI sites of YCplac111-Tet2x after digesting pMW10
with SmaI and PstI resulting in the construct designated pMW25. The
NLS-RT gene encoded by pMW22 was cloned into the BamHI and PstI
sites of YCplac111-Tet2x resulting in the construct designated
pMW27. NLS-RT was also cloned into a vector to enable integration
into and expression from the chromosome of eukaryotic yeast cells.
This was achieved using derivatives of the chromosome integration
vector pHO-poly-KanMX4-HO [976] [267] designated pTK178and pTK179.
These vectors have novel FseI and SrfI sites flanking the HO
sequences of pHO-poly-KanMX4-HO and possess either the Tet2X
(pTK178) or the Tet7x (pTK179) promoters derived from pCM188 and
pCM190 [55], respectively, plus the Rfa Destination cassette
(Gibco-BRL). The NLS-RT gene was subcloned from pMW22 into pENTR3C
(Gibco-BRL) using BamHI and EcoRV resulting in pWY83. The NLS-RT
was then transferred from pWY83 to pTK178 using the Clonase
reaction (Gibco-BRL), following the directions of the manufacturer,
resulting in pWY84. After digestion of pWY84 with FseI, the NLS-RT
expression cassette was then integrated into the chromosome of
Saccharomyces cerevisiae strain RK2575-URA following established
procedures [976] [267]. RK2575-URA was created by transforming
RK2575 [281] with the 1.8 kb ClaI-SmaI DNA fragment encoding the
wild-type URA3 gene in pMW107 then selecting for uracil prototrophs
following standard procedures [200]. In a similar fashion the S.
cerevisiae strain RK2558 [281], which is isogenic to RK2575 except
for having a null allele of the mismatch repair gene msh2, was also
converted to uracil prototrophy resulting in the strain designated
RK2558-URA. The RK2575-derived strain expressing NLS-RT from the
chromosomal HO locus was designated RK2575-URA-HO::NLS-RT.
[0351] 12b) Cloning and Modification of RNA Elements to Facilitate
Reverse Transcription
[0352] The msr-msd elements from retrons were evaluated for use in
facilitating production of cDNA-based gene targeting substrates in
eukaryotic cells. These elements were cloned from the retrons Ec107
and Ec86 and derivatives of these elements were created to produce
gene targeting substrates.
[0353] Template DNA for amplifying the msr-msd elements from Ec107
and Ec86 was obtained as described above. PCR amplification of the
msr-msd elements for these retrons was achieved using the primers
86R-5'BamSma and 86D-3'-Pst, to amplify msr-msd from Ec86, or
primers 107R-5'BamSma and 107D-3'Pst, to amplify msr-msd from Ec
107. The amplicons were then digested with BamHI and PstI and
cloned into the BamHI and PstI of pSPORT2 (Gibco-BRL) resulting in
the constructs pMW5 and pMW9 encoding the msr-msd elements from
Ec86 and Ec 107, respectively.
[0354] For expression in E. coli, the msr-msd elements were
transferred into an expression vector derived from pACYC184 [970]
[263] encoding the tac promoter and rrnB terminator from pKK223-3
[975] [264]. This vector was constructed by first ligating the
.about.1.2 kb BamHI-PvuI fragment encoding the tac promoter and
rrnB terminator from pKK223-3 to the .about.3.6 kb HindIII-SalI
fragment of pACYC 184 using a combination of blunting ends with T4
polymerase (New England BioLabs) and restriction site linkers, as
per standard procedures [213] [256]. The msr-msd elements were
transferred from pMW5 and pMW9 into the expression vector using
BamHI and PstI resulting in the constructs pMW16 and pMW18 encoding
the msr-msd elements from Ec86 and Ec107, respectively.
[0355] Derivatives of the Ec86 msr-msd elements were created for
producing cDNA in vivo. One derivative was termed STEM3. STEM3
possesses unique XbaI and EcoRV sites within the loop region
created by annealing of the b1 and b2 inverted repeat sequences
encoded within the msd element. Sequences encoding gene targeting
substrates can be cloned into the XbaI and EcoRV site to enable
their conversion to cDNA by the action of Ec86 RTase. STEM3 was
also modified vis-a-vis the wild type Ec86 msr-msd by extending the
length of the a1 and a2 inverted repeat sequences by 13 bp. These
extended repeat sequences were denoted a1' and a2'. STEM3 was
created by PCR using pMW5 as template in one reaction with the
primers 5'-IRX-BamSma and STEM3-antisense, and a second reaction
with the primers 3'-IRX-NotMsc and STEM3-sense. Aliquots of the two
reactions were then pooled and used as template for a third PCR
reaction with the primers 5'-IRX-BamSma and 3'-IRX-NotMsc. The
resulting amplicon of .about.200 bp was digested with BamHI and
cloned into pENTR2B (Gibco-BRL) digested with XbaI, treated with T4
DNA polymerase to make the end blunt by standard procedures, then
digested with BamHI. The resulting construct was designated
pMW134.
[0356] A second derivative of the Ec86 msr-msd elements was termed
STOP-stem. Sequences encoding gene targeting substrates placed in
this derivative have a novel inverted repeat sequence adjacent to
the b2 sequence in the msd element. This inverted repeat sequence
may form a stem-and-loop structure in an RNA molecule that has a
sufficiently high dissociation constant to inhibit the progression
of RTase. Sequences encoding gene targeting substrates can be
placed into the unique EcoRI and EcoRV sites within the STOP-stem
assembly. To create STOP-stem pMW134 was first digested with XbaI
and EcoRV then treated with calf intestinal phosphatase (New
England Biolabs) following standard methods . This was then used as
template in a PCR reaction with the primers STOP-stem-Ret(Xba) and
Ret-RV-Out. The amplicon was then digested with EcoRI and
self-ligated to create the construct denoted pMW255 in the vector
pENTR2B (Gibco-BRL).
[0357] In one embodiment, the STOP-stem sequence was as
follows:
6 (SEQ ID NO:4) GGATCCCCCGGGCGCCAGCAGTGGCTGCGCACCCTTAGCGAGA- GGTTT
ATCATTAAGGTCAACCTCTGGATGTTGTTTCGGCATCCTGCATTGAATC
TGAGTTACTGTCTGTTTTCCTTGTTGGAACGGAGAGCATCGTCTAGAGG
ATCCGGGTCGCTCGCTGCGTCGCTGCGGAATTCGATATCTGATGCTCTC
CGAGCCAACCAGGAAACCCGTTTTTTCTGACGTAAGGGTGCGCAGCCG
CTGTTGGCGTGGCCAATGCGGCCGC
[0358] A third derivative of the Ec86 msr-msd elements was termed
the 3'-recruitment system. This assembly involves a novel
rearrangement of the inverted repeat sequences of the Ec86 msr-msd
elements to create a structure that does not create a loop
structure at the end of the b1 and b2 inverted repeat sequences but
is still capable of recruiting reverse transcriptase to convert
sequences within the msd region to cDNA. To create the
3'-recruitment system, pMW134 was used as template in a PCR
reaction with the primers 3'CSST-OL3 and 3'CSST-OL4. A .about.150
bp amplicon encoding the msr region including the a2' and b2
sequences was then digested with XbaI and EcoRI. To create a
sequence encoding the a1' and b1 sequences, approximately 100 pmol
each of the oligonucleotides Recruit-XbaRI-sense and
Recruit-XbaRI-antisense were mixed in 10 ul of annealing buffer [40
mM Tris-HCl (pH 7.5), 20 mM MgCl.sub.2, 250 mM NaCl] then heated at
55 C for 5 min. and allowed to anneal at room temperature to form
.about.80 bp fragment encoding the msd region including a1' and b1
sequences. The .about.150 bp amplicon and the .about.80 fragment
were then ligated to pMW149 digested with XbaI and NotI resulting
in the construct designated pMW159. pMW149 encodes .about.100 bp of
sequence from the URA3 gene of S. cerevisiae (see later). This
fragment encodes a mutated version of the URA3 translation start
codon (i.e. ACG vs. ATG) and therefore can be used to illustrate
how creating a single base pair change which modifies gene
translation can be used to modify eukaryotic genes through the
invention. Thus pMW159 encodes .about.100 bp linked to the
3'-recrutiment system. A control to illustrate that reverse
transcription of fragments linked to the 3'-recruitment system
results from this element recruiting reverse transcriptase was
created by digesting pMW159 with NotI and EcoRI then treating the
DNA with T4 polymerase to make the ends blunt and religating the
vector molecule plus the remaining portion of the 3'-recruitment
system to create pMW171. pMW171 therefore is deleted for the msr
element including the a2' and b2 sequences. Thus the RNA transcript
from pMW171 will no longer encode the sequences required to recruit
reverse transcriptase and prime cDNA synthesis. The inability of
pMW171 to facilitate cDNA synthesis vs. its parental construct,
pMW159, can indicate the functionality of the 3'-recruitment system
in facilitating the conversion of linked sequences to cDNA.
[0359] In one emodiment, the 3'-recruitment sequence comprised:
7 (SEQ ID NO:5) TCTAGACCCGGGGATGCTCTCCGAGCCAACCAGGAAACCCGTT- TTTTC
TGACGTAAGGGTGCGCAGCCACTGCTGGCGAATTCGCCAGCAGTGGCT
GCGCACCCTTAGCGAGAGGTTTATCATTAAGGTCAACCTCTGGATGTT
GTTTCGGCATCCTGCATTGAATCTGAGTTACTGTCTGTTTTCCTTGTTGG
AACGGAGAGCATCGCGGCCGCCTGCAG
[0360] Constructs with 250 bp and 500 bp linked to the
3'-recruitment system were also created. This was done by using
NotI and XbaI to clone the 3'-recruitment element from pMW149 onto
the 250 bp and 500 bp fragments of the URA3 gene present in pMW150
and pMW159, respectively. The resulting constructs were designated
pMW164 and pMW165 respectively encoding 250 bp and 500 bp linked to
the 3'-recruitment system.
[0361] The `ACG` mutant allele of URA3 was created after first
cloning the URA3 gene from Saccharomyces cerevisiae. Lambda clone
PM-6150 encoding this gene and flanking genomic regions was
obtained from the American Type Culture Collection (Item #70772).
The lambda clone was propagated and DNA isolated following standard
procedures [213] [256]. The lambda clone DNA was digested with ClaI
and SmaI and a .about.1.85 kb fragment was purified by agarose gel
electrophoresis and recovered from the agarose as described above.
Based on the published genomic sequence of S. cerevisiae this
fragment will encode the URA3 gene. The cloning vector pQuantox
(Quantum Biotechnologies) was also digested with ClaI and SmaI and
the DNA fragment corresponding to this vector (.about.5.3 kb) was
purified. The two fragments were ligated together, transformed into
E. coli and putative clones of the assembly identified as described
above. The resultant clone of the .about.1.85 kb fragment encoding
URA3 was denoted pMW41. Variants of the URA3 gene were also created
after first subcloning this .about.1.85 kb fragment into
pBluescript II KS- by digesting both pMW41 and the recipient vector
with NotI and XhoI, purifying the respective fragments and ligating
them together. The resultant clone of the .about.1.85 kb fragment
encoding URA3 in pBluescript II KS- was denoted pMW107. The `ACG`
mutant allele of URA3 was created by PCR using pMW41 as template
with the primers URA-T-C and the T3 primer (Plant Biotechnology
Institute) which binds to the vector. The resulting amplicon was
digested with NcoI and PstI to produce a .about.200 bp fragment was
used to replace the corresponding wild type fragment in pMW107
creating pMW104 encoding the `ACG` mutant allele of URA3. This was
then used as template in three separate PCR reactions using the
primer combinations of URA100-5'RV and URA100-3'XbaBam, URA250-5'RV
and URA250-3'XbaBam, or URA500-5'RV and URA500-3'XbaBam or
URA1000-5'RV and URA1000-3'XbaBam. The amplicons were digested with
BamHI and EcoRV and the resultant 100 bp, 250 bp 500 bp and 1000 bp
fragments were cloned into pBluescript II KS- (Stratagene)
resulting in the constructs pMW149, pMW150, pMW151 and pMW152,
respectively.
[0362] 12c) Expression Constructs for the STEM3 System
[0363] To evaluate expression of STEM3 components in prokaryotic
cells various constructs were made in expression vectors functional
in E. coli. An expression vector was created by first digesting
pMW16 with SmaI and HindIII followed by treatment with T4
polymerase and ligation to the Destination-A cassette (Gibco BRL)
resulting in pMW137. Expression of DNA fragments could thus be
achieved by transferring the appropriate fragments to pMW137 using
Clonase (Gibco BRL) following the directions of the manufacturer.
In this manner various constructs for expression of STEM3 and
derivatives thereof were developed. To evaluate the size of gene
targeting substrate that could be produced using the STEM3 system
various sizes of insert DNA were cloned into the EcoRV and XbaI
sites of STEM3 in pMW134. A 15 bp insert version of the ACG
mutation described above was created by annealing the primers
URA15-XbaRV and URA15-XbaRV-antisense, as described above, then
ligating the fragment into the pMW134 digested with EcoRV and XbaI,
resulting in pMW156. In a similar fashion, a 25 bp insert version
of the ACG mutation was created using the primers URA25-XbaRV-sense
and URA25-XbaRV-antisense, resulting in pMW157. In a similar
fashion, a 35 bp insert version of the ACG mutation was created
using the primers URA35-XbaRV-sense and URA35-XbaRV-antisense,
resulting in pMW193. In a similar fashion, a 50 bp insert version
of the ACG mutation was created using the primers URA50-XbaRV-sense
and URA50-XbaRV-antisense, resulting in pMW158. A 100 bp insert
version of the ACG mutation was created by using XbaI and EcoRV to
subclone the insert from pMW149 into pMW134 resulting in pMW194. A
250 bp insert version of the ACG mutation was created by using XbaI
and EcoRV to subclone the insert from pMW150 into pMW134 resulting
in pMW195. A .about.320 bp insert version was created by digesting
pMW152 with EcoRV and XbaI, purifying the .about.320 bp fragment
and ligating it to pMW134 digested with EcoRV and XbaI, resulting
in pMW207. A 500 bp insert version of the ACG mutation was created
by using pMW104 as template in a PCR reaction with the primers
URA500-5'RV and URA500-3'XbaBam to amplify a 500 bp fragment that
was digested with EcoRV and XbaI then cloned into the EcoRV and
XbaI sites of pMW134 resulting in the construct pMW226. A 1000 bp
insert version of the ACG mutation was created by using pMW104 as
template in a PCR reaction with the primers URA1000-5'RV and
URA1000-3'XbaBam to amplify a 1000 bp fragment that was digested
with EcoRV and XbaI then cloned into the EcoRV and XbaI sites of
pMW134 resulting in the construct pMW227.
[0364] To evaluate the expression in E. coli of the STEM3 system
with insert sequences of different size the various derivatives of
pMW134 described above were transferred to the E. coli expression
vector pMW137 using Clonase (Gibco BRL) following the directions of
the manufacturer. In this manner E. coli expression constructs were
created containing STEM3 encoding insert sequences as follows: 0 bp
by using pMW134 as the donour to create pMW145; 15 bp by using
pMW156 as the donour to create pMW161; 25 bp using pMW157 as the
donour to create pMW162; 35 bp by using pMW193 as donour to create
pMW198; 50 bp by using pMW158 as donour to create pMW163; 100 bp by
using pMW194 as donour to create pMW199; and 250 bp by using pMW195
as donour to create pMW200. Function of the STEM3 system in E. coli
could then be evaluated by co-transforming the strain DH5.alpha.
(Gibro-BRL) with a construct expressing Ec86 reverse transcriptase
or a derivative thereof and one of the various constructs
expressing the msr-msd elements or a derivative thereof with or
without insert.
[0365] The E. coli strains were cultured in the presence of
ampicillin and chloramphenicol to select for the presence of both
expression constructs. After overnight culture in broth medium in
the presence of 0.2 mM IPTG to induce expression of the reverse
transcription components, DNA was isolated by the alkaline
`mini-prep` method [213], treated with RNase A 0.04ug/ml and
resolved by gel electrophoresis. cDNA products were detected by
staining the DNA with ethidium bromide or by probing Southern blots
with a fragment encoding msr-msd from Ec86, all following standard
methods [213].
[0366] To evaluate the expression msr-msd elements and the various
derivatives thereof for producing cDNA in vivo in eukaryotic cells
constructs were created based on various yeast expression vectors.
An expression construct for evaluating the wild type Ec86 msr-msd
elements in yeast was created by using BamHI and PstI to subclone
the msr-msd sequence from pMW5 into pCM190 resulting in the
construct pMW29. To evaluate the expression in eukaryotic cells of
the STEM3 system with insert sequences of different size the
various derivatives of pMW134 described above were transferred to
the yeast expression vector pAS23 using Clonase (Gibco BRL)
following the directions of the manufacturer. In this manner yeast
expression constructs were created containing STEM3 encoding insert
sequences as follows: 0 bp by using pMW134 as the donour to create
pMW166; 15 bp by using pMW156 as the donour to create pMW167; 25 bp
using pMW157 as the donour to create pMW168; 35 bp by using pMW193
as donour to create pMW202; 50 bp by using pMW158 as donour to
create pMW169; 100 bp by using pMW194 as donour to create pMW203;
250 bp by using pMW195 as donour to create pMW204; 320 bp by using
pMW207 as donour to create pMW21 1; 500 bp by using pMW226 as
donour to create pMW212; and 1000 bp using pMW227 as donour to
create pMW213.
[0367] An additional version of STEM3 encoding 500 bp of an
alternative allele of URA3, denoted ura3.sup.Bsp, was also
developed. This allele was created by using PCR to create 500 bp
fragments of the URA3 gene with a single base pair change of C to A
at nucleotide position #465 of the URA3 open reading frame. This
base pair change creates a novel BspHI restriction enzyme site
within the URA3 locus and creates a premature translation
termination signal which can be expected to prevent functional
expression of the carboxy-terminal 113 amino acid residues encoded
by URA3 whose wild type protein product is 267 amino acid residues
in length. The cassette also encodes .about.250 bp upstream and
downstream of the C to A bp change for a total of .about.500 bp of
homology to the chromosomal URA3 locus. One sense version of this
500 bp fragment was created by using pMW107 as template in two
separate PCR reactions with the primers URA-Bsp(-250)-S-5'BamXba
and URA-Bsp-mu-AS in one reaction and URA-Bsp(+250)-sense-3'RV and
URA-Bsp-mu-S in a second reaction. The 250 bp amplicons from each
reaction have 50 bp of overlapping sequence so that they can anneal
to one another and serve as template in a third PCR reaction with
the primers URA-Bsp(-250)-S-5'BamXb- a and URA-Bsp(+250)-sense-3 RV
to produce a 500 bp fragment. After digestion with XbaI, this
fragment was cloned into pMW134 digested with XbaI and EcoRV
resulting in the construct pMW259 encoding 500 bp of ura3.sup.Bsp
in the sense orientation. A yeast expression construct was created
to express the ura3Bsp fragment in STEM3 by using pMW259 as the
donour in a Clonase (Gibco-BRL) reaction with the yeast expression
vector pAS23 to create pMW266.
[0368] Function of the reverse transcriptase system in eukaryotic
cells could then be evaluated by co-transforming the S. cerevisiae
strain RK2575-URA with a construct expressing Ec86 reverse
transcriptase or a derivative thereof and one of the various
constructs expressing the msr-msd elements or a derivative thereof
with or without insert. The yeast strains were cultured in minimal
medium with amino acid composition to select for the presence of
both expression constructs. To repress expression of the various
components, yeasts cells were cultured in the presence of
doxycycline (5 ug/ml for broth cultures, 10 ug/ml for plate
cultures). After overnight culture in broth medium in the absence
of doxycycline to enable expression of the reverse transcription
components, DNA was isolated by the glass-bead method [213], and
resolved by gel electrophoresis. cDNA products were detected by
probing Southern blots with a fragment encoding msr-msd from Ec86,
following standard methods [213].
[0369] 12d) Expression Constructs for the STOP-stem System
[0370] To evaluate the expression in eukaryotic cells of the
STOP-stem system yeast cells were transformed with constructs to
express NLS-RT from Ec86 and the STOP-stem component linked to a
gene targeting sequence with homology to the chromosomal URA3 gene.
One gene targeting sequence was derived from the
ura3.DELTA..sup.PstEcoRV allele. This allele was created by
digesting pMW107 with PstI and EcoRV then making the ends blunt by
treatment with T4 DNA polymerase and self-ligating the vector
fragment resulting in the construct pMW180. pMW180 thus encodes a
mutant allele whereby .about.20 bp of the promoter region and
.about.190 bp of the open reading frame of URA3 have been deleted.
A 500 bp insert version of the ura3.DELTA..sup.PstEcoRV allele in
the sense orientation was created by using pMW180 as template in a
PCR reaction with the primers STOP-Stem-sense and STOP-Sense-3'RV
to amplify a 500 bp fragment that was digested with EcoRI then
cloned into the EcoRI and EcoRV sites of pBluescript KS- resulting
in the construct pMW250. A 500 bp insert version of the
ura3.DELTA..sup.PstEcoRV allele in the antisense orientation was
created by using pMW180 as template in a PCR reaction with the
primers STOP-Stem-AS and STOP-Stem-AS-3'RV to amplify a 500 bp
fragment that was digested with EcoRI then cloned into the EcoRI
and EcoRV sites of pBluescript KS- resulting in the construct
pMW251. The 500 bp fragments of pMW250 and pMW251 were then cloned
into pMW255 using EcoRI and EcoRV resulting in the constructs
pMW256, encoding 500 bp of the ura3.DELTA..sup.PstEcoRV allele in
the sense orientation, and pMW257 encoding 500 bp of the
ura3.DELTA..sup.PstEcoRV allele in the antisense orientation. Yeast
expression constructs were then created to express the
ura3.DELTA..sup.PstEcoRV fragment in STOP-stem by using pMW256 and
pMW257 as the donours in Clonase (Gibco-BRL) reactions with the
yeast expression vector pAS23 to create pMW252 and pMW253,
respectively.
[0371] Another version of the gene targeting sequence linked to the
STOP-stem system was the ura3.sup.Bsp allele as described above. A
500 bp insert version of the ura3.sup.Bsp allele in the sense
orientation was created in a similar fashion as described above for
the corresponding fragment cloned into the STEM3 system. pMW107 was
used as template in two separate PCR reactions with the primers
URA-STOP-Bsp(-250)-sense-5'RI and URA-Bsp-mu-AS in one reaction and
URA-Bsp(+250)-sense-3'RV and URA-Bsp-mu-S in a second reaction. The
250 bp amplicons from each reaction have 50 bp of overlapping
sequence so that they can anneal to one another and serve as
template in a third PCR reaction with the primers
URA-STOP-Bsp(-250)-sense-5'RI and URA-Bsp(+250)-sense-3 RV to
produce a 500 bp fragment. After digestion with EcoRI, this
fragment was cloned into pMW255 digested with EcoRI and EcoRV
resulting in the construct pMW260 encoding 500 bp of ura3.sup.Bsp
in the sense orientation. A yeast expression construct was created
to express the ura3Bsp fragment in STOP-stem by using pMW260 as the
donour in a Clonase (Gibco-BRL) reaction with the yeast expression
vector pAS23 to create pMW267.
[0372] Another version of the gene targeting sequence linked to the
STOP-stem system was the ura3.sup.Pvu allele. This allele was
created in a similar fashion as that described above for the
ura3.sup.Bsp allele.
[0373] The ura3.sup.Pvu allele encodes a deletion of 8 bp resulting
in loss of base pair #275-284 of the URA3 open reading frame. The
deletion also creates a novel PvuII restriction site and changes
the reading frame of the altered gene to promote premature
termination of translation which can be expected to prevent
functional expression of the carboxy-terminal 176 amino acid
residues encoded by URA3 whose wild type protein product is 267
amino acid residues in length. The cassette also encodes .about.250
bp upstream and downstream of the 8 bp deletion for a total of
.about.500 bp of homology to the chromosomal URA3 locus. A sense
version of this 500 bp fragment was created by using pMW107 as
template in two separate PCR reactions with the primers
URA-STOP-Pvu(-250)-sense-5'RI and URA-Pvu-mu-AS in one reaction and
URA-Pvu(+250)-sense-3'RV and URA-Pvu-mu-S in a second reaction. The
250 bp amplicons from each reaction have 50 bp of overlapping
sequence so that they can anneal to one another and serve as
template in a third PCR reaction with the primers
URA-STOP-Pvu(-250)-sense-5'RI and URA-Pvu(+250)-sense-3'RV to
produce a 500 bp fragment. After digestion with EcoRI, this
fragment was cloned into pMW255 digested with EcoRI and EcoRV
resulting in the construct pMW262 encoding 500 bp of ura3.sup.Pvu
in the sense orientation. A yeast expression construct was created
to express the ura3.sup.Pvu fragment in STOP-stem by using pMW262
as the donour in a Clonase (Gibco-BRL) reaction with the yeast
expression vector pAS23 to create pMW269.
[0374] 12e) Expression Constructs for the 3'-recruitment System
[0375] To evaluate the expression in E. coli of the 3'-recruitment
system with insert sequences of different size E. coli DH5.alpha.
was cotransformed with pMW120 expressing NLS-RT in combination with
either pMW159, pMW164 or pMW165 expressing the 3'-recruitment
element linked to 100 bp, 250 bp or 500 bp, respectively. A control
strain was created by combining pMW120 with pMW171 which is derived
from pMW159 but has the msr element deleted.
[0376] To evaluate the expression in eukaryotic cells of the
3'-recruitment system yeast cells were transformed with constructs
to express NLS-RT from Ec86 and the 3'-recruitment component linked
to a gene targeting sequence with homology to the chromosomal URA3
gene. One gene targeting sequence was derived from the ura3 `ACG`
allele described above. To facilitate expression of `ACG` mutant
containing fragments, the insert of pMW165 was first transferred to
pENTR1A using SalI and NotI resulting in the construct pNML23. A
yeast expression construct was then created using pNML23 as donors
in Clonase (Gibco-BRL) reaction with the yeast expression vector
pAS23 to create pMW221. To facilitate expression of 500 bp
fragments of the ura3.DELTA..sup.PtsEcoRV allele in the sense and
anti-sense orientation, pNML23 was first digested with SmaI and
ClaI then treated with T4 DNA polymerase to make blunt ends before
purifying the fragment encoding the vector and the 3'-recruitment
element. The 500 bp fragment of the ura3.DELTA..sup.PstEcoRV allele
encoded by pMW235 was then isolated after digestion with XbaI and
EcoRV then treated with T4 DNA polymerase to make blunt ends. This
fragment was then ligated into the prepared pNML23-derived
fragment. Clones were then screened by restriction digest to
identify one with the ura3.DELTA..sup.PstEcoRV fragment in the
sense orientation (i.e. pMW249) and the antisense orientation (i.e.
pMW248).
[0377] 12f) Expression Constructs for Generating dsDNA In Vivo
[0378] To generate double-stranded DNA (dsDNA) gene targeting
substrates in vivo reverse transcription of RNA molecules encoding
sense and antisense versions of the gene targeting substrate can be
converted to single-stranded cDNAs in vivo which can then anneal
with one another to form dsDNA gene targeting substrates. To
exemplify this concept in eukaryotic cells S. cerevisiae was used
as a model. Yeast cells were transformed with constructs capable of
co-expressing the NLS-RTase with sense and antisense RNAs encoding
gene targeting substrates with homology to the chromosomal URA3
gene.
[0379] To create a gene targeting substrate encoding a sense
version of the ura.sup.Pvu allele in STEM3, pMW107 was used as
template in two separate PCR reactions with the primers
URA-Pvu(-250)-S-5'BamXba and URA-Pvu-mu-AS in one reaction and
URA-Pvu(+250)-sense-3'RV and URA-Pvu-mu-S in a second reaction. The
250 bp amplicons from each reaction have 50 bp of overlapping
sequence so that they can anneal to one another and serve as
template in a third PCR reaction. with the primers
URA-Pvu(-250)-S-5BamXba and URA-Pvu(+250)-sense-3'RV to produce a
500 bp fragment. After digestion with XbaI, this fragment was
cloned into pMW134 digested with XbaI and EcoRV resulting in the
construct pMW261 encoding 500 bp of ura.sup.Pvu in the sense
orientation. A yeast expression construct was created to express
the uraPvU fragment in STEM3 by using pMW261 as the donour in a
Clonase (Gibco-BRL) reaction with the yeast expression vector pAS23
to create pMW268. A second yeast expression construct for
expressing uraPVu fragment in STEM3 was created by using pMW261 as
the donor in a Clonase reaction with the yeast expression vector
pA525 to create pNML91. Using pMW107 as template in a PCR reaction
with the primers URA-Pvu(-250)-S-5'BamXba and
URA-Pvu(+250)-sense-3'RV can also be used to produce a 500 bp
fragment encoding the corresponding fragment of wild type URA3
which, after cloning into the STEM3 system, can then be used as a
control in genetic assays. In this manner, the construct pNML97 was
created. A yeast expression construct was created to express the
URA.sup.WT fragment in STEM3 by using pNML97 as the donor in a
Clonase reaction with pAS25 to create pNML101.
[0380] To create a gene targeting substrate encoding an antisense
version of the ura.sup.Pvu allele in STEM3 pMW261 was used as
template in a PCR reaction with the primers
URA-Pvu(-250)-AS-5'BamXba and URA-Pvu(-250)-AS-3'RV to produce a
500 bp fragment. After digestion with XbaI, this fragment was
cloned into pMW134 digested with XbaI and EcoRV resulting in the
construct pNML93 encoding 500 bp of ura.sup.Pvu in the antisense
orientation in STEM3. A yeast expression construct was created to
express the antisense ura.sup.Pvu fragment in STEM3 by using pNML93
as the donour in a Clonase (Gibco-BRL) reaction with the yeast
expression vector pWY82 to create pNML95. Using pMW107 as template
in a PCR reaction with the primers URA-Pvu(-250)-AS-5'BamXba and
URA-Pvu(-250)-AS-3'RV can also be used to produce a 500 bp fragment
encoding the corresponding fragment of wild type URA3 which after
cloning into the STEM3 system, can then be used as a control in
genetic assays. In this manner, the construct pNML99 was created. A
yeast expression construct was created to express the antisense
UBA.sup.WT fragment in STEM3 by using pNML99 as the donor in a
Clonase reaction with pWY82 to create pNML103.
[0381] Assembly of a gene targeting substrate encoding a sense
version of the ura.sup.Pvu allele in STOP-stem was described above
(i.e. pMW262; pMW269 for yeast expression) using the primers
URA-STOP-Pvu(-250)-sense-5- 'RI and URA-Pvu(+250)-sense-3'RV. Using
pMW107 as template in a PCR reaction with the primers
URA-STOP-Pvu(-250)-sense-5'RI and URA-Pvu(+250)-sense-3'RV can also
be used to produce a 500 bp fragment encoding the corresponding
sense fragment of wild type URA3 which after cloning into the
STOP-stem system, can then be used as a control in genetic assays.
In this manner, the construct pNML98 was created. A yeast
expression construct was created to express the URA.sup.WT fragment
in STOPstem by using pNML99 as donor in a Clonase reaction with
pAS25 to create pNML102.
[0382] To create a gene targeting substrate encoding an antisense
version of the ura.sup.Pvu allele in STOP-stem pMW261 was used as
template in a PCR reaction with the primers
URA-STOP-Pvu(+250)-AS-5'RI and URA-Pvu(-250)-AS-3'RV to produce a
500 bp fragment. After digestion with EcoRI, this fragment was
cloned into pMW255 digested with EcoRI and EcoRV resulting in the
construct pNML94 encoding 500 bp of ura.sup.Pvu in the antisense
orientation. A yeast expression construct was created to express
the antisense ura.sup.Pvu fragment in STOP-stem by using pNML94 as
the donour in a Clonase (Gibco-BRL) reaction with the yeast
expression vector pWY82 to create pNML96. Using pMW107 as template
in a PCR reaction with the primers URA-STOP-Pvu(+250)-AS-5'RI and
URA-Pvu(-250)-AS-3'RV can also be used to produce a 500 bp fragment
encoding the corresponding antisense fragment of wild type URA3
which after cloning into the STOP-stem system, can then be used as
a control in genetic assays. In this manner, the contruct pNML100
was created. A yeast expression contruct was created to express the
antisense URA.sup.WT fragment in STOPstem by using pNML100 as donor
in a clonase reaction with pWY82 to create pNML104. A second yeast
expression construct for expressing ura.sup.Pvu fragment in
STOPstem was created by using pMW262 as the donor in a Clonase
reaction with the yeast expression vector pAS25 to create
pNML92.
[0383] 12g) Constructs for Assessing the Effect of Elevated
Homologous Recombination Potential on Gene Targeting Frequency.
[0384] To illustrate the effect of enhanced recombination potential
on gene targeting frequency yeast strains were created which may
produce cDNA-derived gene targeting substrates when recombination
proteins are at an elevated level. The S. cerevisiae strains
RK2575-URA and RK2558-URA were used as hosts. The latter strain is
defective for mismatch repair activities and is isogenic to
RK2575-URA. A comparison of gene targeting frequencies occurring in
these strains can thus illustrate the effect that different levels
of mismatch repair activity can have on gene targeting frequency.
The genetic elements encoding the gene targeting substrates were
integrated into the chromosomes of these strains using established
methods 976.
[0385] Gene targeting systems derived from the STEM3 and STOP-stem
systems were evaluated in the yeast model eukaryote. To produce a
STEM3 derivtive encoding a wild type URA3 seqeunce, pMW107 was used
in a PCR reaction with the primers URA-Bsp(-250)-S-5'BamXba and
URA- Bsp (+250)-sense-3'RV to produce a 500 bp fragment of URA3
which encodes a wild type DNA sequence corresponding to the
ura3.sup.Bsp mutant fragment described above for pMW259. After
digestion with XbaI, the PCR fragment was cloned into pMW134
digested with XbaI and EcoRV resulting in the construct pMW287
encoding 500 bp of URA3 in the sense orientation in STEM3. A yeast
expression construct was created to express the URA3 fragment in
STEM3 by using pMW287 as the donour in a Clonase (Gibco-BRL)
reaction with the yeast chromosomal integration and expression
vector pTK179 to create pMW303. In a similar fashion, to produce a
STOPstem derivtive encoding a wild type URA3 seqeunce pMW107 was
used in a PCR reaction with the primers
URA-STOP-Bsp(-250)-sense-5'RI and URA-Bsp(+250)-sense-3'RV to
produce a 500 bp fragment of URA3 which encodes a wild type DNA
sequence corresponding to the ura3.sup.Bsp mutant fragment
described above for pMW260. After digestion with EcoRI, this
fragment was cloned into pMW255 digested with EcoRI and EcoRV
resulting in the construct pMW288 encoding 500 bp of URA3 in the
sense orientation in STOP-stem. A yeast expression construct was
created to express the URA3 fragment in STOP-stem by using pMW288
as the donour in a Clonase (Gibco-BRL) reaction with the yeast
chromosomal integration and expression vector pTK179 to create
pMW304. Test substrates for the STEM3 system were created by using
pMW259 and pMW261 as donours in Clonase (Gibco-BRL) reactions with
the yeast chromosomal integration and expression vector pTK179 to
create pMW299, encoding a 500 bp sense fragment of the ura3.sup.Bsp
allele, and pMW301, encoding a 500 bp fragment of the ura3PVU
allele, respectively. Test substrates for the STOP-stem system were
created by using pMW260 and pMW262 as donours in Clonase
(Gibco-BRL) reactions with the yeast chromosomal integration and
expression vector pTK179 to create pMW300, encoding a 500 bp sense
fragment of the ura3.sup.Bsp allele, and pMW302, encoding a 500 bp
fragment of the ura3.sup.Pvu allele, respectively.
[0386] The components of the gene targeting systems were integrated
into the chromosome of the host strain RK2575-URA and RK2558-URA
following established procedures 976. The plasmids pMW303, pMW299,
pMW301, pMW304, pMW300 and pMW302 were digested with FseI and the
respective integration cassettes were used to transform RK2575-URA
and RK2558-URA. The resultant strains with the STEM3 system
integrated into the host chromosome were designated as follows:
RK2575-URA::HO-STEM3::URA (created using pMW303),
RK2575-URA::HO-STEM3:: ura3.sup.Bsp (created using pMW299);
RK2575-URA::HO-STEM3:: ura3.sup.Pvu (created using pMW301);
RK2558-URA::HO-STEM3::URA (created using pMW303),
RK2558-URA::HO-STEM3:: ura3.sup.Bsp (created using pMW299);
RK2558-URA::HO-STEM3:: ura3.sup.Pvu (created using pMW301). The
resultant strains with the STOP-stem system integrated into the
host chromosome were designated as follows:
RK2575-URA::HO-STOPstem::URA (created using pMW304),
RK2575-URA::HO-STOPstem:: ura3Bsp (created using pMW300);
RK2575-URA::HO-STOPstem:: ura3.sup.Pvu (created using pMW302);
RK2558-URA::HO-STOPstem::URA (created using pMW304),
RK2558-URA::HO-STOPstem:: ura3.sup.Bsp (created using pMW300);
RK2558-URA::HO-STOPstem:: ura3.sup.Pvu (created using pMW302). All
strains were cultured in the presence of doxycycline as described
above until assayed for gene targeting frequency.
[0387] To illustrate the effect of modifying recombination
potential on gene targeting frequency in eukaryotic cells, the
above yeast strains were transformed with pMW27, encoding NLS-RT,
in combination with pMW305, encoding yRAD51.sup.I134T, or pAS22,
the parental vector of pMW305. Another control was created by
transforming with YCplac-Tet2x and pAS22, the parental vectors of
pMW27 and pMW305, respectively. The frequency of converting the
chromosomal URA3 gene to an altered allele in the strains
expressing the STEM3 or STOPstem components from the chromosome in
combination with NLS-RT can show the ability of the components to
function in when expressed from a host chromosome. Comparison of
this with corresponding strains also expressing yRAD51.sup.I134T
can show the effect of modifying recombination potential on gene
targeting frequency. All strains were cultured in the presence of
doxycycline as decribed above until assayed for gene targeting
frequency.
[0388] To illustrate the effect of generating gene targeting
substrates during meiosis on gene targeting frequency in eukaryotic
cells, the RK2575-URA derived strains encoding STEM3 or STOPstem
components integrated in the chromosome described above were first
converted to diploid strains so as to represent meiotic events in
higher eukaryotes and to promote viability of yeast meiotic
products. Diploid strains were created by mating the above strains
to S. cerevisiae strain E134-URA, a derivative of the strain E134
270. E134-URA was created by transforming E134 with the 1.8 kb
ClaI-SmaI DNA fragment encoding the wild-type URA3 gene in pMW107
then selecting for uracil prototrophs following standard procedures
200. After mating E134-URA with the various RK2575-URA derivatives
encoding STEM3 or STOPstem components, diploid strains were
identified by selection for histidine prototrophy, all following
standard methods 200. The resultant diploid strains were designated
as follows:
[0389] The resultant diploid strains with the STEM3 system
integrated into the host chromosome were designated as follows:
E134+RK2575-URA::HO-STEM3- ::URA (created using pMW303),
E134+RK2575-URA::HO-STEM3:: ura3Bsp (created using pMW299);
E134+RK2575-URA::HO-STEM3:: ura3.sup.Pvu (created using pMW301).
The resultant diploid strains with the STOP-stem system integrated
into the host chromosome were designated as follows:
E134+RK2575-URA::HO-STOPstem::URA (created using pMW304),
E134+RK2575-URA::HO-STOPstem:: ura3.sup.Bsp (created using pMW300);
E134+RK2575-URA::HO-STOPstem:: ura3.sup.Pvu (created using pMW302.
All strains were cultured in the presence of doxycycline until
assayed for gene targeting frequency. These diploid strains were
then transformed with either pMW27, encoding NLS-RT, or
YCplac111-Tet2x, the parental expression vector of pMW27. All
strains were cultured in the presence of doxycycline as described
above until assayed for gene targeting frequency.
[0390] 12h) Recombination Proteins
[0391] yRAD51
[0392] The yeast RAD51 (yRAD51) gene was cloned after amplification
by PCR. Template for amplifying yRAD51 was genomic DNA from
Saccharomyces cerevisiae strain AB972 [210] [291] isolated by
standard procedure [213] [256]. Two PCR reactions were performed
with approximately 1 .mu.g of genomic DNA, 1.0 pmol yR51-5'Bam
oligonucleotide and 1.0 pmol yR51-3'Pst oligonucleotide, 0.2 mM
dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents provided
by the manufacturer in a volume of 50 .mu.l. The PCR conditions
were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 58
C and 2.5 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C
or -20 C. The two reactions were pooled and DNA was digested with
BamHI and PstI. The plasmid cloning vector pBluescript II KS-
(Stratagene) was digested with BamHI and PstL DNA fragments of
interest corresponding to yRAD51 (.about.1.2 kb) and the vector
(.about.3 kb) were purified by agarose gel electrophoresis and
recovered from the agarose as described above. The fragments were
ligated together, transformed into E. coli and putative clones of
the gene identified as described above. The DNA sequence of the
resultant clone, pMW35, was determined to confirm it encoded
yRAD51. The yRAD51 gene was then subcloned into pENTR3C using BamHI
and EcoRV resulting in the construct pTK104.
[0393] A mutant version of yRAD51 was created by PCR using pTK104
as template in a PCR reaction with the primers yRAD51-I134T-S and
yRAD51-I134T-AS. After completion of cycling DpnI was added to the
reaction to digest the template DNA. The amplicon was then digested
with PinA1 and self-ligated. DNA sequencing confirmed the clone
designated pNML56 encodes the mutant protein yRAD51.sup.I134T.
yRA51.sup.I134T can be linked to various promoters to facilitate
expression in eukaryotic cells. In one example, pNML56 was used as
the donour in a Clonase (Gibco-BRL) reaction with the yeast
expression vector pAS22 to create pMW305.
[0394] AtRAD51
[0395] Template for use in amplifying AtRAD51 was obtained from
cDNA generated from RNA isolated from A. thaliana ecotype Columbia
total plant tissues treated with gamma radiation. Plants were grown
in sterile culture as follows. Seeds of A. thaliana ec. Columbia
were surface sterilized by first rinsing in 70% (v/v) ethanol for
one minute followed by washing for 5-7 min with a solution of 50%
(v/v) bleach, 0.05% (w/v) Tween 20 (Sigma). After rinsing three
times with sterile distilled water, the seeds were resuspended in
0.1% (w/v) agarose. Seeds were then dispensed in a grid pattern
(.about.30 seeds/plate) with 1-2 cm spacing on sterile growth
medium (0.5.times.Mirashige and Skoog basal salt media (Sigma)
containing 1% (w/v) sucrose, nicotinic acid (1 .mu.g/ml),
thiamine-HCl (10 .mu.g/ml), pyridoxine-HCl (1 .mu.g/ml),
myo-inositiol (100 .mu.g/ml) and solidified with 1.0% (w/v) agar in
100 mm.times.15 mm or 150 mm.times.15 mm petri plates (Fisher). The
plates were then placed at 4 C for 48 h and transferred to a
controlled environment chamber with temperature of 18-22 C and a
light regime of 16 h light and 8 h dark. After approximately 3
weeks plants were treated with gamma radiation using a Gamma-Cell
40 irradiator with a Co.sup.60 radiation source. Plates containing
plants were placed in the irradiator and left for time periods
corresponding to desired dosages estimated from the calibrated
emission from the radiation source and accounting for decay over
time. Plant tissues were collected after 5-10 min recovery time and
rapidly frozen using liquid N.sub.2. For RNA extraction, plant
tissues were first ground to a fine powder in the presence of
liquid N2 using a mortar and pestle, and then RNA was isolated
using the Rneasy Plant Kit (Qiagen) following the instructions
provided by the manufacturer. cDNA was prepared from total RNA
extracted from the plants exposed to 20 or 40 krad of gamma
radiation using a SuperScript Preamplification System for First
Strand cDNA Synthesis following directions of the manufacturer
(GIBCO-BRL). First strand cDNA from 5-10 .mu.g total RNA from
plants treated with 20 or 40 krad of gamma radiation was primed
using oligo-dT supplied with the kit.
[0396] A primary PCR reaction was performed with 4 .mu.l
first-strand cDNA from either the 20 krad or 40 krad treated
plants, 0.5 pmole AtRAD51-5'Bam oligo, 0.5 pmole AtRAD51-3'X oligo,
0.2 mM dNTP's, 2.5 U Taq (Pharmacia) and Taq buffer constituents
recommended by the manufacturer in a volume of 25 .mu.l. The PCR
conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C,
30 s @ 55 C and 75 s @ 72 C, followed by 10 min @ 72 C and storage
at 4 C or -20 C. Two secondary PCR reactions were then performed
for each of the above reactions using either 5 or 10 .mu.l of the
primary reactions in separate reactions as template with 1.0 pmole
AtRAD51-5'Bam oligo and 1.0 pmole AtRAD51-3'Pst oligo and other
constituents as above except using 5 U Taq and a final volume of 50
.mu.l. Two independent secondary reactions were done for each
template sample with identical PCR conditions as above. The two
respective reaction series were pooled and DNA fragments were
digested with BamHI and PstL The plasmid cloning vector pBluescript
II KS- (Stratagene) was digested with BamHI and PstI. DNA fragments
of interest corresponding to AtRAD51 (.about.1.2kb) and the vector
(.about.3 kb) were purified by agarose gel electrophoresis and
recovered from the agarose as described above. The fragments were
ligated together, transformed into E. coli and putative clones of
the gene identified as described above. Two clones were selected:
pRH2 and pRH7 derived from cDNA from plants treated with 20 or 40
krad of gamma radiation, respectively. Determination of the DNA
sequence of these clones revealed both had mutations at different
positions of the open reading frame. To resynthesize a gene
encoding a wild-type AtRAD51, restriction fragments from pRH2 and
pRH7 were combined as follows: pRH2 was digested with XbaI and
BamHI and a .about.400 bp fragment was purified; pRH7 was digested
with PstI and XbaI and a .about.770 bp fragment was purified; both
fragments were combined and ligated into pBluescript II KS-
(Stratagene) digested with BamHI and PstI. The resulting clone,
pRH15, was sequenced and found to encode a wild-type AtRAD51. The
AtRAD51 gene was then subcloned into pENTR3C using BamHI and XhoI
resulting in the construct pTK113.
[0397] A mutant version of AtRAD51 was created by PCR using pTK113
as template in a PCR reaction with the primers AtRAD51-I290T-S and
AtRAD51-I290T-AS. After completion of cycling DpnI was added to the
reaction to digest the template DNA. The amplicon was then digested
with PinA1 and self-ligated. DNA sequencing confirmed the clone
designated pNML55 encodes the mutant protein AtRAD51.sup.I290T.
AtRAD51.sup.I290T can be linked to various promoters to facilitate
expression in eukaryotic cells.
[0398] ScDMC1
[0399] Template for use in amplifying ScDMC1-cDNA was obtained from
cDNA generated from RNA isolated from S. cerevisiae cells
undergoing meiosis. Strain RK1308 [209] [128]was grown in YPD
liquid medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v)
glucose) to cell density of .about.2.times.10.sup.7 cells/ml at 30
C with shaking at 225 RPM. Cells were collected by centrifugation,
washed and resuspended in SPM medium (0.3% (w/v) potassium acetate,
0.02% (w/v) raffinose, 5 .mu.g/ml uracil, 5 .mu.g/ml histidine, 25
.mu.g/ml leucine) then cultured as above for 2.5 h. Cells from 10
ml of culture were collected by centrifugation, washed with sterile
distilled water (SDW) and resuspended in 1 ml SDW before rapid
freezing in a dry-ice/ methanol bath and stored at -80 C. Total RNA
was extracted from these cells following a standard protocol [213]
[123]. Approximately 4 .mu.g of RNA was used to create cDNA primed
with oligo-dT using the Superscript Preampification System for
First Strand cDNA Synthesis (Gibco/BRL) following directions of the
manufacturer. Two PCR reactions were performed with 3 .mu.l of
first strand cDNA, 1.0 pmol yDMC-5'Bam oligo and 1.0 pmol
yDMC-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu
buffer constituents provided by the manufacturer in a volume of 50
.mu.l. The PCR conditions were 5 min @ 94 C, followed by 25 cycles
of 30 s @ 94 C, 30 s @ 55 C and 2 min @ 72 C, followed by 10 min @
72 C and storage at 4 C or -20 C. The two reactions were pooled and
DNA was digested with PstI. The plasmid cloning vector pBluescript
II KS- (Stratagene) was digested with SmaI and PstI. DNA fragments
of interest corresponding to ScDMC1-cDNA (.about.1.l kb) and the
vector (.about.3 kb) were purified by agarose gel electrophoresis
and recovered from the agarose as described above. The fragments
were ligated together, transformed into E. coli and putative clones
of the gene identified as described above. The DNA sequence of the
resultant clone, pMW19, was determined to confirm it encoded
ScDMC1-cDNA.
[0400] A mutant version of ScDMC1 can be created by PCR using
pMW19as template in a PCR reaction with the primers yDMC1-I282T-S
and yDMC1-I282T-AS. After completion of cycling DpnI may be added
to the reaction to digest the template DNA. The amplicon may then
digested with PinA1 and self-ligated. ScDMC1.sup.I282T may be
linked to various promoters to facilitate expression in eukaryotic
cells.
[0401] AtDMC1
[0402] Template DNA was derived from a commercially available cDNA
library of Arabidopsis thaliana ecotype Columbia in the vector
lambda ZAP II (Stratagene). The library was mass-excised following
the protocol supplied by the manufacture. The resultant phagemid
suspension was concentrated by a combination of precipitation with
polyethylene glycol as described by Ausubel et al. (1998) and
desiccation using a Speed Vac (Savant). In this manner, the
phagemid suspension was concentrated at least 5-fold. One hundred
microlitres of the concentrated phagemid suspension was extracted
with phenol and chloroform following standard procedures to remove
protein and other contaminants from DNA with subsequent
precipitation using ethanol [213] [123]. In this manner, DNA from
approximately 2 ml of phagemid suspension was concentrated and
resuspended in 20 .mu.l of LTE ((1 mM Tris-HCl, 0.1 mM EDTA (pH
8.0)) with RNase A (20 .mu.g/ml)).
[0403] A primary PCR reaction was performed with 1 .mu.l
Arabidopsis cDNA library phagemid, 0.5 pmole OL11434, 0.5 pmole
OL11433,0.2 mM dNTP's (i.e. DATP, dCTP, dGTP, dTTP; Pharmacia),
1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by
the manufacturer in a volume of 25 .mu.l. The PCR conditions were 5
min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 45 s @ 60 C and 2
min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or -20 C.
A secondary PCR was then performed with 2 .mu.l of the above
reaction used as template with 1.0 pmol OL11434 and 1.0 pmol
OL11435 and other constituents as above except using 2.5 U Pfu and
a final volume of 50 .mu.l. Two independent secondary reactions
were done with identical PCR conditions as above. The two reactions
were pooled and DNA fragments were resolved by agarose
electrophoresis using a 1% gel and following standard procedures
[213] [123]. A DNA fragment of .about.1 kilobase pair (kb) expected
to correspond to AtDMC1 was excised and the DNA recovered from the
agarose using the Qiaquick Gel Extraction Kit (Qiagen) and protocol
supplied by the manufacturer. DNA was digested with XhoI and
phosphorylated with T4-polynucleotide kinase following standard
procedures [213] [123]. The plasmid cloning vector pBluescript II
KS- (Stratagene) was digested with EcoRV and XhoI. The amplicon and
vector DNA were purified by agarose electrophoresis and recovered
as above. Amplicon and vector DNA were then mixed in the presence
of T4 DNA ligase (Gibco-BRL) to covalently link the two molecules
following standard procedures [213] [123] in a final volume of 25
.mu.l. After 2 h at room temperature, 1 .mu.l of glycogen (20
mg/ml) was added to the ligation mixture made up to 100 .mu.l with
distilled water. After precipitation with ethanol [213] [123], the
DNA was resuspended in 4 .mu.l of distilled water. E. coli strain
DH5alpha (Gibco-BRL) was transformed with 2.5 .mu.l of the
concentrated ligation following standard procedures [213] [123] and
plated on sterile TYS medium containing ampicillin (100 .mu.g/ml).
Putative clones were propagated in liquid TYS (i.e. without agar)
and ampicillin (100 .mu.g/ml). Plasmid DNA was isolated by standard
alkaline-lysis "mini-prep" procedure [213] [123]. The DNA sequence
of the resultant clone, pKR225, was determined at a commercial
sequencing facility (Plant Biotechnology Institute, Saskatoon,
Canada). Cloning of all other genes in this invention followed the
same principles as for pKR225 with noted exceptions.
[0404] pKR225 was used as template in a PCR reaction with the
primers AtDMC-5'XbaSal and AtDMC-3'Spe and cloned into pDBleu
(Gibco-BRL) resulting in the construct pNH3. The AtDMC1 gene was
then subcloned in pENTR3C using SalI and NotI resulting in the
construct pTK112.
[0405] A mutant version of AtDMC1 may be created by PCR using
pTK112 as template in a PCR reaction with the primers
AtDMC1-A292T-S and AtDMC1-A292T -AS. After completion of cycling
DpnI may be added to the reaction to digest the template DNA. The
amplicon may then be digested with PinA1 and self-ligated.
AtDMC1.sup.A292T may be linked to various plant promoters to
facilitate expression in eukaryotic cells.
[0406] 12i) Plant Promoters
[0407] In some embodiments, the invention enables production of
gene targeting substrates during S-phase of the cell cycle. In some
embodiments this is facilitated by linking the expression of
components of the gene targeting system to a transcription promoter
that is expressed during S-phase. Two examples of such promoters
are those facilitating transcription of the H4 histone and cyclin-D
genes. H4 histone gene expression has been characterised in plants
and analysis of the promoter indicates it is primarily active in
dividing cells [878] [292]. Expression of the cyclin-D family of
genes has also been investigated by evaluating mRNA levels [878,
988, 991] [292-294]. Of the members of the Cyclin-D gene family in
Arabidopsis, CycD3 appears to be expressed at the G1/S boundary
[991] [294].
[0408] A DNA sequence encoding a region of the promoter from the H4
histone gene of Arabidopsis thaliana was cloned. Template for
amplifying the AtH4 promoter by PCR was genomic DNA from
Arabidopsis thaliana ecotype Columbia isolated by standard
procedure [213] [256]. PCR reactions were performed with
approximately 1 .mu.g of genomic DNA, 1.0 pmol H4-Prom-5'KpnSac
oligonucleotide and 1.0 pmol H4-Prom-3'BamXho oligonucleotide, 0.2
mM dNTP's, 2.5 U Pfx (Gibco BRL) and Pfx buffer constituents
provided by the manufacturer in a volume of 50 .mu.l. The PCR
conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C,
30 s @ 58 C and 1 min @ 68 C, followed by 10 min @ 72 C and storage
at 4 C or -20 C. The DNA was digested with KpnI and NcoI. pAVA393,
a plasmid cloning vector derived from pBluescript II SK+ [993]
[295] was digested with KpnI and NcoI. DNA fragments of interest
corresponding to AtH4 promoter (.about.0.9 kb) and the vector
(.about.4 kb) were purified by agarose gel electrophoresis and
recovered from the agarose as described above. The fragments were
ligated together, transformed into E. coli and putative clones of
the gene identified as described above. The DNA sequence of the
resultant clone, pNML8, was determined to confirm it encoded the
promoter region from the Arabidopsis H4 histone gene. pNML8 was
digested with SstI and PstI and the .about.0.9 kb fragment encoding
the AtH4 promoter was cloned into the SstI and PstI site of the
plant transformation vector pCB302 [995] [296] resulting in the
clone denoted pNML12 which enabled analysis and application of the
AtH4 promoter in plants. pNML8 was modified by PCR to incorporate
additional restriction sites for BamHI, SnaBI and NcoI to the 3'
end of the TEV translational enhancer sequence encoded by pAVA393
adjacent to the AtH4 promoter. pNML8 was used as template in a
standard PCR reaction, as described above, with the oligonucleotide
primers H4-Prom-5'KpnSac and TEV-3'NcoSnaBam. The DNA was digested
with KpnI and NcoI as was pAVA393. DNA fragments of interest
corresponding to AtH4 promoter plus TEV sequence (.about.1 kb) and
the vector (.about.4 kb) were purified by agarose gel
electrophoresis, recovered from the agarose, ligated together and
transformed into E. coli, as described above. The resultant clone
was denoted pNML11.
[0409] A DNA sequence encoding a region of the promoter from the
cyclin-D3 (i.e. AtCycD3) of Arabidopsis thaliana. Template for
amplifying the AtCycD3 promoter by PCR was genomic DNA from
Arabidopsis thaliana ecotype Columbia isolated by standard
procedure [213] [256]. PCR reactions were performed with
approximately 1 .mu.g of genomic DNA, 1.0 pmol CycD3-Prom-5'KpnSac
oligonucleotide and 1.0 pmol CycD3-Prom-3'Xho oligonucleotide, 0.2
mM dNTP's, 2.5 U Pfu Turbo (Stratagene) and buffer constituents
provided by the manufacturer in a volume of 50 .mu.l. The PCR
conditions were 5 min @ 94 C, followed by 30 cycles of 30 s @ 94 C,
30 s @ 55 C and 2.5 min @ 72 C, followed by 10 min @ 72 C and
storage at 4 C or -20 C. The DNA was digested with KpnI and NcoI.
pAVA393, a plasmid cloning vector derived from pBluescript II SK+
[993] [295] was digested with KpnI and NcoI. Alternatively, a
primary PCR reaction may be done using the CycD3-Prom-5'X
oligonucleotide and CycD3-Prom-3'X oligonucleotide with Arabidopsis
ecotype Columbia genomic DNA as template. An aliquot of this
reaction may then be used in a secondary PCR reaction with
CycD3-Prom-5'KpnSac oligonucleotide and CycD3-Prom-3'Xho
oligonucleotide. DNA fragments of interest corresponding to AtCycD3
promoter (1.1 kb) and the vector (.about.4. 1 kb) were purified by
agarose gel electrophoresis and recovered from the agarose as
described above. The fragments were ligated together, transformed
into E. coli and putative clones of the gene identified and
sequenced as described above. The resultant clone of the promoter
region from the Arabidopsis AtCycD3 gene was denoted pTK159. The
DNA fragment encoding the AtCycD3 promoter may then be cloned into
a plant transformation vector like pCB302 [993] [296] enabling
analysis and application of the AtCycD3 promoter in plants.
[0410] In some embodiments, the invention enables production of
gene targeting substrates coordinately with the expression of
endogenous proteins facilitating recombination in mitotic and
meiotic cells. In some embodiments this is facilitated by linking
the expression of the gene targeting system components to a
transcription promoter that expresses a gene involved in homologous
recombination. An example of such a promoter is that facilitating
transcription of the RAD51 gene. RAD51 gene expression has been
characterised in plants and analysis of the promoter indicates it
is expressed in vegetative cells, particularly in response to
exposure to DNA damaging agents, in reproductive tissues and in
tissues undergoing cell division [159] [297]. This pattern of
expression is conserved in other eukaryotic species [75] [298].
Template for amplifying the AtRAD51 promoter by PCR was genomic DNA
from Arabidopsis thaliana ecotype Lansberg isolated by standard
procedure [213] [256]. A primary PCR reaction was performed with
approximately 1 .mu.g of genomic DNA as template, 1.0 pmol
AtR51-Prom-5'X oligonucleotide and 1.0 pmol AtR51-Prom-3'EX
oligonucleotide,0.2 mM dNTP's, 2.5 U Pfx (Gibco BRL) and Pfx buffer
constituents provided by the manufacturer in a volume of 50 .mu.l.
The PCR conditions were 5 min @ 94 C, followed by 35 cycles of 30 s
@ 94 C, 30 s @ 56 C and 2 min @ 72 C, followed by 10 min @ 72 C and
storage at 4 C or -20 C. An aliquot of this primary reaction was
then used in a secondary PCR reaction with the oligonucleotide
combination of AtR51-Prom-5'Sac and AtR51-Prom-3'Xho and Pfx
polymerase and reaction conditions as described for the primary
reaction. The DNA was digested with XhoI. pAVA393 [993] [295] was
digested with ApaI, treated with T4 polymerase to make the DNA ends
blunt, and then digested with XhoI. DNA fragments of interest
corresponding to AtRAD51 promoter (.about.1.7 kb) and the vector
(.about.4.1 kb) were purified by agarose gel electrophoresis and
recovered from the agarose as described above. The fragments were
ligated together, transformed into E. coli and putative clones of
the gene identified as described above. The DNA sequence of the
resultant clone, pTK1 14, was determined to confirm it encoded
.about.1.7 kb of the promoter region from the Arabidopsis AtRAD51
gene. In a similar fashion, smaller segments of the AtRAD51
promoter region were cloned using the oligonucleotides
AtR51-Prom-5'Sac (.about.1 kb) and AtR51-Prom-5'Sac (.about.0.7 kb)
to result in the clones pTK126 encoding .about.1.0 kb of the
promoter region from the Arabidopsis AtRAD51 gene, and pTK127
encoding .about.0.7 kb of the promoter region from the Arabidopsis
AtRAD51 gene. To enable analysis and application of the AtRAD51
promoter in plants, the cloned promoter fragments were transferred
to plant transformation vectors. The DNA fragment encoding the
AtRAD51 promoter from pTK114, pTK126 and pTK127 was isolated by
digestion of the plasmids with SmaI and SacI. These fragments were
then individually ligated to the plant transformation vector pCB302
[296] also digested with SmaI and SacI resulting in the clones
pTK139 (encoding the AtRAD51 promoter fragment as in pTK127),
pTK140 (encoding the AtRAD51 promoter fragment as in pTK126), and
pTK141 (encoding the AtRAD51 promoter fragment as in pTK114).
[0411] In some embodiments, the invention enables production of
gene targeting substrates coordinately with the expression of
endogenous proteins facilitating recombination in meiotic cells. In
some embodiments this is facilitated by linking the expression of
the gene targeting system component(s) to a transcription promoter
that expresses a gene involved in homologous recombination in
meiotic cells. Examples of such a promoter are those sequences
facilitating transcription of the DMC1, MSH4 or SPO11 gene. The
pattern of expression of these genes is conserved in eukaryotic
species [123, 122, 126].
[0412] A DNA sequence encoding a region of the promoter from the
DMC1 gene of Arabidopsis thaliana was cloned. Template for
amplifying the AtDMC1-promoter by PCR was genomic DNA from
Arabidopsis thaliana ecotype Lansberg isolated following standard
procedures [213] [256].
[0413] A primary PCR reaction was performed with approximately 1
.mu.g of genomic DNA as template, 1.0 pmol DMC-Prom-5'Kpn-S1268
oligonucleotide and 1.0 pmol DMC-Prom-AS5408 oligonucleotide, 0.2
mM dNTP's, 2.5 U Pfx (Gibco BRL) and Pfx buffer constituents
provided by the manufacturer in a volume of 50 .mu.l. The PCR
conditions were 5 min @ 94 C, followed by 35 cycles of 30 s @ 94
C,30 s @ 63 C and 2 min @ 72 C, followed by 10 min @ 72 C and
storage at 4 C or -20 C. An aliquot of this primary reaction was
then used in a secondary PCR reaction with the oligonucleotide
combination of DMC-Prom-5'Kpn-S1268 and DMC-Prom-Int2-NcoRV and Pfx
polymerase and reaction conditions as described for the primary
reaction except with an annealing temperature of 53 C. The
amplified DNA was digested with KpnI. pBluescript II SK-
(Stratagene) was digested with KpnI and EcoRV. DNA fragments of
interest corresponding to AtDMC1 promoter (.about.1.7 kb) and the
vector (.about.3 kb) were purified by agarose gel electrophoresis
and recovered from the agarose as described above. The fragments
were ligated together, transformed into E. coli and putative clones
of the gene identified as described above. The DNA sequence of the
resultant clone, pTK111, was determined to confirm it encoded
.about.1.7 kb of the promoter region from the Arabidopsis AtDMC1
gene. A region 5' of the promoter sequence represented in pTK111
was also cloned. A PCR reaction was performed with approximately 1
.mu.g of genomic DNA from A. thaliana ecotype Columbia, isolated as
described above, was used as template, 1.0 pmol ADM-Prom-5'Kpn
oligonucleotide and 1.0 pmol AtDMC-Pro-Nde-A1 oligonucleotide, 0.2
mM dNTP's, 2.5 U Pfu (Gibco BRL) and Pfu buffer constituents
provided by the manufacturer in a volume of 50 .mu.l. The PCR
conditions were 5 min @ 94 C, followed by 30 cycles of 30 s @ 94 C,
30 s @ 55 C and 2 min @ 72 C, followed by 10 min @ 72 C and storage
at 4 C or -20 C. The amplified DNA was digested with KpnI.
pBluescript II SK- (Stratagene) was digested with KpnI and EcoRV.
DNA fragments of interest corresponding to this upstream region of
the AtDMC1 promoter (.about.1.4 kb) and the vector (.about.3 kb)
were purified by agarose gel electrophoresis and recovered from the
agarose as described above. The resultant clone was denoted pTK136.
The cloned Arabidopsis DNA fragments of pTK111 and pTK136 could
then be linked, as necessary, to create a .about.3 kb fragment
encoding the promoter region of the AtDMC1 gene.
[0414] A derivative of the AtDMC1 promoter fragment encoded by
pTK111 was created to remove the first intron of the AtDMC1 gene.
pTK111 was used as template in a PCR reaction with oligonucleotides
Universal Primer (Gibco BRL) and AtDMC-Prom-3'BamRVXho in a
standard PCR reaction as described above using PfuTurbo
(Stratagene) as a polymerase and annealing temperature of 55 C with
extension time of 2.5 min for 30 cycles. The resulting DNA was
digested with KpnI and XhoI and the .about.1.2 kb fragment
purified. pNML14 was also digested with KpnI and XhoI and the
vector portion purified. The vector and amplified fragment were
ligated together and the resultant clone was denoted pTK138. The
upstream fragment of the AtDMC1 promoter encoded by pTK136 was
subcloned into pTK138 using KpnI and NdeI to isolate the respective
fragments. The resultant clone was denoted pTK142.
[0415] A DNA sequence encoding a region of the promoter from the
MSH4 gene of Arabidopsis thaliana was cloned. Template for
amplifying the AtMSH4 promoter by PCR was genomic DNA from
Arabidopsis thaliana ecotype Columbia isolated following standard
procedure [213] [256]. A PCR reaction was performed with
approximately 1 .mu.g of genomic DNA as template, 1.0 pmol
AtMSH4-5'X oligonucleotide and 1.0 pmol AtMSH4-3'Bam
oligonucleotide, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu
buffer constituents provided by the manufacturer in a volume of 50
.mu.l. The PCR conditions were 5 min @ 94 C, followed by 35 cycles
of 30 s @ 94 C, 30 s @ 60 C and 4 min @ 72 C, followed by 10 min @
C and storage at 4 C or -20 C. The amplified DNA was digested with
BamHI and KpnI. pBluescript II SK- (Stratagene) was digested with
BamHI and KpnI. DNA fragments of interest corresponding to AtMSH4
promoter (.about.2 kb) and the vector (.about.3 kb) were purified
by agarose gel electrophoresis and recovered from the agarose as
described above. The fragments were ligated together, transformed
into E. coli and putative clones of the gene identified as
described above. The DNA sequence of the resultant clone, pTK65,
was determined to confirm it encoded .about.2 kb of the promoter
region from the Arabidopsis AtMSH4 gene. To enable analysis and
application of the AtMSH4 promoter in plants, the cloned promoter
fragment was transferred to plant transformation vectors. The DNA
fragment encoding the AtMSH4 promoter from pTK65 was isolated by
digestion of the plasmid with KpnI, followed by treatment with T4
polymerase to make the DNA ends blunt, and digested with BamHI.
This fragment was then ligated to the plant transformation vector
pCB308 [995] [296] digested with XbaI, treated with Klenow
polymerase to make the DNA ends blunt, and then digested with
BamHI. The insert and vector fragments were purified and ligated
together, as outlined above, resulting in the clone pTK93.
[0416] A DNA sequence encoding a region of the promoter from a
SPO11 gene of Arabidopsis thaliana was cloned. Template for
amplifying the AtSPO11 promoter by PCR was genomic DNA from
Arabidopsis thaliana ecotype Columbia isolated following standard
procedure [213] [256]. A PCR reaction was performed with
approximately 1 .mu.g of genomic DNA as template, 1.0 pmol
SPO-1-PROM-5'KpnSac oligonucleotide and 1.0 pmol SPO-1-PROM-3'Xho
oligonucleotide , 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu
buffer constituents provided by the manufacturer in a volume of 50
.mu.l. The PCR conditions were 5 min @ 94 C, followed by 35 cycles
of 30 s @ 94 C, 30 s @ 60 C and 4 min @ 72 C, followed by 10 min @
72 C and storage at 4 C or -20 C. The amplified DNA was digested
with KpnI and XhoI and the .about.1.2 kb fragment purified. pNML14
was also digested with KpnI and XhoI and the vector portion
purified. The vector and amplified fragment were ligated together
and the resultant clone of the AtSPO11 promoter region was denoted
pJD1. This fragment can then be cloned into a plant transformation
vector like pCB302 [995] [296] for analysis and applications in
plants.
[0417] In some embodiments, the invention enables production of
gene targeting substrates in all tissues throughout all
developmental stages, during all stages of the cell cycle and in
mitotic and meiotic cells through use of a constitutive promoter.
Alternatively, constitutive promoters with differential expression
amongst tissues, developmental stages, cell cycle stage, or mitotic
or meiotic cells may also be used. In some embodiments, promoters
with elevated expression during S-phase and G-2 phase are used.
These stages of the cell cycle are when homologous recombination
functions have higher activity [1022, 150]. In some embodiments
gene expression patterns as desired is facilitated by linking the
expression of the gene targeting system components to a
constitutive promoter. Examples of constitutive promoters
applicable to the invention and applied in different embodiments of
the invention are cryptic promoters [994, 1698] [302], viral
promoters [249] [303], prokaryote-derived promoters [996, 997, 998,
999, 1708, 1706, 1707, 1709, 1711] [304] or promoters transcribing
various cellular constituents [305-307].
[0418] 12j) Plant Expression Constructs
[0419] To evaluate the expression of msr-msd elements and the
various derivatives thereof for producing cDNA in vivo in plant
cells, plant transformation constructs were assembled to facilitate
expression of a RTase and an RNA molecule encoding the gene
targeting substrate to be converted to cDNA. In some embodiments, a
RTase derived from a retron was employed (e.g. such as that encoded
by Ec86). In some embodiments, a RTase engineered to promote
nuclear localisation by addition of a nuclear localization sequence
is employed, such as that encoded by pMW22. In some embodiments, a
RTase engineered to facilitate detection using immuno-detection
procedures is employed, such as that encoded by pMW23. In some
emobodiments, a RTase engineered to enhance expression in plant
cells is used, such as a RTase gene with a codon composition
optimised for plant cells, as encoded by pNLS-RT.sup.RS. This
encodes a derivative of EC86 RTase that is similar to that of pMW23
encoding the NLS of SV40 T-antigen and the FLAG peptide. However,
the gene of pNLS-RT.sup.RS was resynthesized to optimize for coden
usage in crucifer species.
[0420] The test locus to illustrate application of the gene
targeting system in plants was the ADH locus of Arabidopsis
thaliana ecotype Columbia encoding the enzyme alcohol
dehydrogenase. Mutant alleles of ATADH were created in a similar
fashion as for the S. cerevisiae URA3 locus described above. A
bacterial artificial chromosome (BAC) encoding AtADH (i.e. BAC #F1B
15 obtained from the Arabidopsis Biological Resource Centre, Ohio
State University, 1060 Carmack Road, Columbus, Ohio, 432101002) was
used as template in PCR reactions to generate mutant versions of
AtADH. One PCR reaction used the primers ADH-3'3 kb-5'BamNhe and
ADH-3'3 kb-3'KpnAscMsc to generate an approximately 3 kb amplicon
that was cloned into pBluescript SK+ (Stratagene) using BamHI and
KpnI to create the construct pNML63. A second PCR reaction used the
primers ADH-5'3Kb-5'SacAscHpa and ADH-53 kb-INTRON-3'BamNhe to
generate an approximately 3 kb amplicon that was cloned into
pBluescript SK+ (Stratagene) using SacII and BamHI to create the
construct pNML64. A third PCR reaction used the primers
ADH-5'3Kb-5'SacAscHpa and ADH-5'3 kb-START-3'BamNhe to generate an
approximately 3 kb amplicon that was cloned into pBluescript SK+
(Stratagene) using SacII and BamHI to create the construct pNML65.
The approximately 3 kb insert of pNML63 encoding the 3' portion of
AtADH was then subloned onto the 5' portion of AtADH encoded by
pNML64 using NheI and KpnI to create pNML67. pNML67 thus encodes a
novel mutant allele, designated Atadh.sup.Int-mu, which has a NheI
site at the splice junction site of exon1 and intron 1 of the gene.
In addition, the approximately 3 kb insert of pNML63 encoding the
3' portion of AtADH was subloned onto the 5' portion of AtADH
encoded by pNML65 using NheI and KpnI to create pNML68. pNML68 thus
encodes a novel mutant allele, designated Atadh.sup..DELTA.Ex1,
which is deleted for the first exon of the gene.
[0421] STEM3-based gene targeting components were developed based
on the Atadh.sup.Int-mu and Atadh.sup..DELTA.Ex1 alleles. The STEM3
element was first subcloned into a vector encoding a zeocin
selection marker by using BamHI and PstI to transfer this element
from pMW134 to pTK172 resulting in the construct pMW273. A 500 bp
insert version of the Atadh.sup.Int-mu allele was created using
pNML67 as template in a PCR reaction with the primers
adh-Ex1(-250)-sense-5'BamXba and adh-Ex1(+250)-sense-3'RV. The
approximately 500 bp amplicon was digested with XbaI, and cloned
into pMW273 digested with XbaI and EcoRV resulting in the construct
pMW275 encoding 500 bp of Atadh.sup.Int-mu in STEM3 (i.e.
STEM3::Atadh.sup.Int-mu). In a similar fashion, a 500 bp insert
version of the Atadh.sup..DELTA.Ex1 allele can be created using
pNML68 as template in a PCR reaction with the primers
adh-Ex1(-250)-sense-5'BamXba and adh-Ex1(+250)-sense-3'RV. The
approximately 500 bp amplicon can then be digested with XbaI, and
cloned into pMW273 digested with XbaI and EcoRV to create a
construct encoding 500 bp of Atadh.sup..DELTA.Ex1 in STEM3. In a
similar fashion a 500 bp insert of the wild type AtADH gene was
created. This was achieved by using genomic DNA from A. thaliana
ecotype Columbia as template in a PCR reaction with the primers
adh-Ex1(-250)-sense-5'BamXba and adh-Ex1(+250)-sense-3'RV. The
approximately 500 bp amplicon was digested with XbaI, and cloned
into pMW273 digested with XbaI and EcoRV resulting in the construct
pMW296 encoding 500 bp of AtADH in STEM3 (i.e. STEM3::AtADH).
[0422] STOPstem-based gene targeting components were developed
based on the Atadh.sup.Int-mu and Atadh.sup..DELTA.Ex1 alleles. A
500 bp insert version of the Atadh.sup.Int-mu allele was created
using pNML67 as template in a PCR reaction with the primers
adh-STOP-Ex1(-250)-sense-5'RI and adh-Ex1(+250)-sense-3'RV. The
approximately 500 bp amplicon was digested with EcoRI, and cloned
into pMW255 digested with EcoRI and EcoRV resulting in the
construct pMW279 encoding 500 bp of Atadh.sup.Int-mu in STOPstem
(i.e. STOPstem:: Atadh.sup.Int-mu). A 500 bp insert version of the
Atadh.sup..DELTA.Ex1 allele was created using pNML68 as template in
a PCR reaction with the primers adh-STOP-Ex1(-250)-sense-5'RI and
adh-Ex1(+250)-sense-3'RV. The approximately 500 bp amplicon was
digested with EcoRI, and cloned into pMW255 digested with EcoRI and
EcoRV resulting in the construct pMW280 encoding 500 bp of
Atadh.sup..DELTA.Ex1 in STOPstem (i.e.
STOPstem::Atadh.sup..DELTA.Ex1). A 500 bp insert version of wild
type AtADH was also created. This was achieved by using genomic DNA
from A. thaliana ecotype Columbia as template in a PCR reaction
with the primers adh-STOP-Ex1(-250)-sense-5'RI and
adh-Ex1(+250)-sense-3'RV. The approximately 500 bp amplicon was
digested with EcoRI, and cloned into pMW255 digested with EcoRI and
EcoRV resulting in the construct pMW292 encoding 500 bp of AtADH in
STOPstem (i.e. STOPstem::AtADH). To place these STOPstem components
in a vector with zeomycin selection, the inserts of pMW279, pMW280
and pMW292 were subcloned into the pTK172 using XmnI and PstI to
create the constructs pMW293 (STOPstem::Atadh.sup.Int-mu), pMW294
(STOPstem::Atadh.sup..DELTA.E- x1) and pMW295 (STOPstem::AtADH),
respectively. Another control involved subcloning the STOPstem
element (i.e. without insert) from pMW255 into pTK172 using BamHI
and PstI resulting in the construct pMW274.
[0423] Following the approaches described above, STEM3-based and
STOPstem-based gene targeting components encoding substrates
directed against the AtADH gene of 250 bp or 1000 bp can also be
created using the oligonucleotides adh-STOP-Ex1(-125)-sense-5'RI or
adh-Ex1(-125)-sense-5'B- amXba in combination with
adh-Ex1(+125)-sense-3'RV, or adh-STOP-Ex1(-500)-sense-5'RI or
adh-Ex1(-500)-sense-5'BamXba in combination with
adh-Ex1(+500)-sense-3'RV. Similar approaches can be used to
generate gene targeting systems encoding substrates of various
sizes directed against various genes in various eukaryotic
cells.
[0424] In one example a plant transformation vector was assembled
to express the components of the gene targeting system coordinately
with S-phase of the plant cell cycle. This vector, designated
pWY70, was designed to link the reverse transcriptase with the
AtCycD3 promoter of pTK159 and to link the sequence encoding the
gene targeting substrate to the AtH4 promoter of pNML11.
[0425] To create pWY70, pNML11 encoding the AtH4 promoter was first
digested with NotI then treated with T4 DNA polymerase to make the
ends blunt before digestion with BamHI. The vector plus AtH4
promoter was then ligated to a fragment encoding NLS-FLAG-RT from
pMW23 created by digestion with BamHI and EcoRV. After ligation the
resultant construct was designated pMW254. To link a transcription
terminator to NLS-FLAG-RT, pMW254 was first digested with PstI then
treated with T4 DNA polymerase to make the ends blunt before
digestion with SacII. The transcription terminator from pNML11 was
isolated after digestion with XbaI, followed by treatment with T4
DNA polymerase to make the ends blunt followed by digestion with
SacII. After ligation of these two components the resultant
construct was designated pMW263. To place the NLS-FLAG-RT gene in a
plant transformation construct, pMW263 was digested with SacI then
treated with T4 DNA polymerase before being digested with PstI. The
NLS-FLAG-RT gene fragment was then ligated to p79-632 digested with
SmaI and PstI resulting in pMW271 which encodes the NLS-FLAG-RT
gene linked to the AtH4 promoter in a plant transformation vector
with the PAT selectable marker that confers resistance to PPT
(PAT=Phosphinothricin N-aminotransferase [1713],
PPT=phosphinothricin). To link the AtCycD3 promoter to NLS-FLAG-RT,
pMW271 was digested with StuI and EcoRI and the fragment encoding
the vector plus NLS-FLAG-RT gene was ligated to the AtCycD3
encoding fragment released by digestion of pTK159 with KpnI
followed by treatment with T4 DNA polymerase with subsequent
digestion with EcoRI. The resulting construct was designated pWY66
which encodes the NLS-FLAG-RT gene linked to the AtCycD3 promoter
in a plant transformation vector with the PAT selectable marker
that confers resistance to PPT. The AtH4 promoter was then linked
to the Destination-A cassette (Gibco-BRL). The Destination-A
cassette was first cloned into the EcoRV site of pBluescript SK-
(Stratagene) resulting in pMW138-1 wherein the Destination-A
cassette is in a sense orientation with respect to the lacZ
promoter of pBluescript SK-. The Destination-A cassette of pMW138-1
was linked to the AtH4 promoter pNML11 using XhoI and XbaI,
resulting in the construct pWY68. pWY68 was then digested with
SacII and treated with T4 DNA polymerase to make the ends blunt
before digestion with KpnI. The fragment encoding AtH4 promoter
linked to the Destination-A cassette (Gibco-BRL) was then ligated
to the fragment of pWY66 encoding the AtCycD3 promoter linked to
NLS-FLAG-RT and p79-632 created by digestion with KpnI and EcoRV.
The resultant construct was designated pWY70 which is a plant
transformation construct with the AtCycD3 promoter linked to
NLS-FLAG-RT and the Destination-A cassette (Gibco-BRL) linked to
the AtH4 promoter. By using the Clonase (Gibco-BRL) reaction,
various gene targeting substrates can be linked to the AtH4
promoter of pWY70.
[0426] Plant transformation constructs for creating plant lines
expressing the STEM3 system were assembled. To create a construct
for expressing STEM3 without insert, pMW273 was used as donour in a
Clonase (Gibco-BRL) reaction with pWY70 to create pMW276. To create
a construct for expressing STEM3::Atadh.sup.Int-mu, pMW275 was used
as donour in a Clonase (Gibco-BRL) reaction with pWY70 to create
pMW278 (i.e. encoding STEM3::Atadh.sup.Int-mu). To create a
construct for expressing STEM3::AtADH, pMW296 was used as donour in
a Clonase (Gibco-BRL) reaction with pWY70 to create pMW284 (i.e.
encoding STEM3::AtADH).
[0427] Plant transformation constructs for creating plant lines
expressing the STOPstem system were assembled. To create a
construct for expressing STOPstem without insert, pMW274 was used
as donour in a Clonase (Gibco-BRL) reaction with pWY70 to create
pMW277. To create a construct for expressing
STOPstem::Atadh.sup.Int-mu, pMW293 was used as donour in a Clonase
(Gibco-BRL) reaction with pWY70 to create pMW289 (i.e. encoding
STOPstem::Atadh.sup.Int-mu). To create a construct for expressing
STOPstem::Atadh.sup..DELTA.Ex1, pMW294 was used as donour in a
Clonase (Gibco-BRL) reaction with pWY70 to create pMW290 (i.e
encoding STOPstem::Atadh.sup..DELTA.Ex1). To create a construct for
expressing STOPstem::AtADH, pMW295 was used as donour in a Clonase
(Gibco-BRL) reaction with pWY70 to create pMW291 (i.e. encoding
STOPstem::AtADH).
[0428] References
[0429] The following documents are hereby incorporated by reference
(there is no admission thereby made with respect to whether any of
the documents constitute prior art with respect to any of the
claims):
[0430] 1. Bertling, W: Gene Targeting. In: Vega, M A (ed), Gene
Targeting, pp. 144. CRC Press, Boca Raton (1995).
[0431] 2. Lanzov, V A: Gene targeting for gene therapy: prospects.
Mol. Genet. Metab 68: 276-282 (1999).
[0432] 3. Roth, D B, Wilson, J H: Illegitimate recombination in
mammalian cells. In: Kucherlapati, R. and Smith, G (eds), Genetic
Rcombination, p. 621. American Society for Microbiology,
Washington, D.C. (1988).
[0433] 4. Gheysen, G, Villarroel, R, Van Montagu, M: Illegitimate
recombination in plants: a model for T-DNA integration. Genes Dev.
5: 287-297 (1991).
[0434] 5. Peach, C, Velten, J: Transgene expression variability
(position effect) of CAT and GUS reporter genes driven by linked
divergent T-DNA promoters. Plant Mol Biol 17: 49-60 (1991).
[0435] 6. Mlynarova, L, Keizer, L C P, Stiekema, W J, Nap, J P.
Approaching the lower limits of transgene variability. Plant Cell
8: 1589-1599. (1996).
[0436] 7. Lai, L W, Lien, Y H: Homologous recombination based gene
therapy. Exp Nephrol. 7: 11-14 (1999).
[0437] 8. Meyer, P, Saedler, H. Homology-dependent gene silencing
in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47: 23-48.
1996.
[0438] 9. Mol, J N, van der Krol, A R, van Tunen, A J, van
Blokland, R, de Lange, P, Stuitje, A R: Regulation of plant gene
expression by antisense RNA. FEBS Lett 268: 427-430 (1990).
[0439] 10. Rothstein, R: Targeting, disruption, replacement, and
allele rescue: integrative DNA transformation in yeast. Methods
Enzymol. 194: 281-301 (1991).
[0440] 11. Simon, J R, Moore, P D. Homologous recombination between
single-stranded DNA and chromosomal genes in Saccharomyces
cerevisiae. Mol Cell Biochem 7, pp. 2329-2334. 1987.
[0441] 12. Winzeler, E A, Shoemaker, D D, Astromoff, A, Liang, H,
Anderson, K, Andre, B, Bangham, R, Benito, R, Boeke, J D, Bussey,
H, Chu, A M, Connelly, C, Davis, K, Dietrich, F, Dow, S W, El
Bakkoury, M, Foury, F, Friend, S H, Gentalen, E, Giaever, G,
Hegemann, J H, Jones, T, Laub, M, Liao, H, Davis, R W: Functional
characterization of the S. cerevisiae genome by gene deletion and
parallel analysis. Science 285: 901-906 (1999).
[0442] 13. Broverman, S, MacMorris, M, Blumenthal, T: Alteration of
Caenorhabditis elegans gene expression by targeted transformation.
Proc. Natl. Acad. Sci. U.S.A 90: 43594363 (1993).
[0443] 14. Rong, Y S, Golic, K G: Gene targeting by homologous
recombination in drosophila. Science 288: 2013-2018 (2000).
[0444] 15. Thomas, K R, Capecchi, M R: Site-directed mutagenesis by
gene targeting in mouse embryo-derived stem cells. Cell 51: 503-512
(1987).
[0445] 16. Thomas, K R, Folger, K R, Capecchi, M R: High frequency
targeting of genes to specific sites in the mammalian genome. Cell
44: 419428 (1986).
[0446] 17. Thompson, S, Clarke, A R, Pow, A M, Hooper, M L, Melton,
D W: Germ line transmission and expression of a corrected HPRT gene
produced by gene targeting in embryonic stem cells. Cell 56:
313-321 (1989).
[0447] 18. Shcherbakova, O G, Lanzov, V A, Ogawa, H, Filatov, M V:
Overexpression of bacterial RecA protein stimulates homologous
recombination in somatic mammalian cells. Mutat. Res. 459: 65-71
(2000).
[0448] 19. Yanez, R J, Porter, A C: Gene targeting is enhanced in
human cells overexpressing hRAD51. Gene Either. 6: 1282-1290
(1999).
[0449] 20. Schaefer, D G, Zryd, J P: Efficient gene targeting in
the moss Physcomitrella patens. Plant J. 11: 1195-1206(1997).
[0450] 21. Zhu, T, Mettenburg, K, Peterson, D J, Tagliani, L,
Baszczynski, C L: Engineering herbicide-resistant maize using
chimeric RNA/DNA oligonucleotides. Nat. Biotechnol. 18: 555-558
(2000).
[0451] 22. Zhu, T, Peterson, D J, Tagliani, L, St Clair, G,
Baszczynski, C L, Bowen, B: Targeted manipulation of maize genes in
vivo using chimeric RNA/DNA oligonucleotides. Proc. Natl. Acad.
Sci. U.S.A 96: 8768-8773 (1999).
[0452] 23. Beetham, P R, Kipp, P B, Sawycky, X L, Arntzen, C J,
May, G D: A tool for functional plant genomics: chimeric RNA/DNA
oligonucleotides cause in vivo gene-specific mutations. Proc. Natl.
Acad. Sci. U.S.A 96: 8774-8778 (1999).
[0453] 24. Offringa, R, Franke-van Dijk, M E, De Groot, M J, van
den Elzen, P J, Hooykaas, P J: Nonreciprocal homologous
recombination between Agrobacterium transferred DNA and a plant
chromosomal locus. Proc. Natl. Acad. Sci. U.S.A 90: 7346-7350
(1993).
[0454] 25. Miao, Z H, Lam, E: Targeted disruption of the TGA3 locus
in Arabidopsis thaliana. Plant J. 7: 359-365 (1995).
[0455] 26. Rauth, S, Song, K Y, Ayares, D, Wallace, L, Moore, P D,
Kucherlapati, R: Transfection and homologous recombination
involving single-stranded DNA substrates in mammalian cells and
nuclear extracts. Proc Natl Acad Sci U S A 83: 5587-5591
(1986).
[0456] 27. De Groot, M J, Offringa, R, Does, M P, Hooykaas, P J,
van den Elzen, P J: Mechanisms of intermolecular homologous
recombination in plants as studied with si. Nucleic Acids Res. 20:
2785-2794 (1992).
[0457] 28. Alexeev, V, Igoucheva, O, Domashenko, A, Cotsarelis, G,
Yoon, K: Localized in vivo genotypic and phenotypic correction of
the albino mutation in skin by RNA-DNA oligonucleotide. Nat.
Biotechnol. 18: 43-47 (2000).
[0458] 29. Yoon, K, Cole-Strauss, A, Kmiec, E B: Targeted gene
correction of episomal DNA in mammalian cells mediated by a
chimeric RNA.DNA oligonucleotide. Proc. Natl. Acad. Sci. U.S.A 93:
2071-2076 (1996).
[0459] 30. Cole-Strauss, A, Yoon, K, Xiang, Y, Byrne, B C, Rice, M
C, Gryn, J, Holloman, W K, Kmiec, E B: Correction of the mutation
responsible for sickle cell anemia by an RNA-DNA oligonucleotide.
Science 273: 1386-1389 (1996).
[0460] 31. Yang, X W, Model, P, Heintz, N. Homologous recombination
based modification in Escherichia coli and germline transmission in
transgenic mice of a bacterial artificial chromosome. Nat.
Biotechnol. 15, pp. 859-865. 1997.
[0461] 32. Gamper, H B, Jr., Cole-Strauss, A, Metz, R, Parekh, H,
Kumar, R, Kmiec, E B: A plausible mechanism for gene correction by
chimeric oligonucleotides. Biochemistry 39: 5808-5816 (2000).
[0462] 33. Cole-Strauss, A, Gamper, H, Holloman, W K, Munoz, M,
Cheng, N, Kmiec, E B: Targeted gene repair directed by the chimeric
RNA/DNA oligonucleotide in a mammalian cell-free extract. Nucleic
Acids Res 27: 1323-1330 (1999).
[0463] 34. Kaeppler, S M, Kaeppler, H F, Rhee, Y: Epigenetic
aspects of somaclonal variation in plants. Plant Mol Biol 43:
179-188 (2000).
[0464] 35. Gallego, M E, Sirand-Pugnet, P, White, C I:
Positive-negative selection and T-DNA stability in Arabidopsis
transformation. Plant Mol Biol 39: 83-93 (1999).
[0465] 36. Lin, F L, Sperle, K, Sternberg, N: Recombination in
mouse L cells between DNA introduced into cells and homologous
chromosomal sequences. Proc Natl Acad Sci U S A 82: 1391-1395
(1985).
[0466] 37. Kresn, F A, Molendijk, L, Wullems, G J, Schilperoort, R
A. In vitro transformation of plant protoplasts with Ti-plasmid
DNA. Nature 296:. 72. 1982.
[0467] 38. Deshayes, A, Herrera-Estrella, L, Caboche, M:
Liposome-mediated transformation of tobacco mesophyll protoplasts
by an Escherichia coli plasmid. EMBO J 4: 2731-2737 (1985).
[0468] 39. Brinster, R L, Braun, R E, Lo, D, Avarbock, M R, Oram,
F, Palmiter, R D: Targeted correction of a major histocompatibility
class II E alpha gene by DNA microinjected into mouse eggs. Proc
Natl Acad Sci U S A 86: 7087-7091 (1989).
[0469] 40. Shillito, R D, Saul, M W, Paszkowski, J, Muller, M,
Potrykus, I. High efficiency direct gene transfer to plants.
Bio/technology 3:. 1099. (1985).
[0470] 41. D'Halluin, K, Bonne, E, Bossut, M, De Beuckeleer, M,
Leemans, J: Transgenic maize plants by tissue electroporation.
Plant Cell 4: 1495-1505 (1992).
[0471] 42. Crossway, A, Oakes, J V, Irvine, J M, Ward, B, Knauf, V
C, Shewmaker, C K. Integration of foreign DNA following
microinjection of tobacco mesophyll protoplasts. Mol Gen Genet 202:
179. (1986).
[0472] 43. Yoshida, K, Takegami, T, Katoh, A, Nishikawa, M,
Nishida, T: Construction of a novel conjugative plasmid harboring a
GFP reporter gene and its introduction into animal cells by
transfection and trans-kingdom conjugation. Nucleic Acids Symp Ser.
157-158 (1997).
[0473] 44. Negritto, M T, Wu, X, Kuo, T, Chu, S, Bailis, A M:
Influence of DNA sequence identity on efficiency of targeted gene
replacement. Mol Cell Biol 17: 278-286 (1997).
[0474] 45. Bennett, C B, Lewis, A L, Baldwin, K K, Resnick, M A:
Lethality induced by a single site-specific double-strand break in
a dispensable yeast plasmid. Proc Natl Acad Sci U S A 90: 5613-5617
(1993).
[0475] 46. Cummings, W J, Zolan, M E: Functions of DNA repair genes
during meiosis. Curr. Tpo. Dev. Biol. 37: 117-140 (1998).
[0476] 47. Galli, A, Schiestl, R H: Effects of DNA double-strand
and single-strand breaks on intrachromosomal recombination events
in cell-cycle-arrested yeast cells. Genetics 149: 1235-1250
(1998).
[0477] 48. Lebkowski, J S, DuBridge, R B, Antell, E A, Greisen, K
S, Calos, M P: Transfected DNA is mutated in monkey, mouse, and
human cells. Mol Cell Biol 4: 1951-1960 (1984).
[0478] 49. Wake, C T, Gudewicz, T, Porter, T, White, A, Wilson, J
H: How damaged is the biologically active subpopulation of
transfected DNA? Mol Cell Biol 4: 387-398 (1984).
[0479] 50. Perucho, M, Hanahan, D, Wigler, M: Genetic and physical
linkage of exogenous sequences in transformed cells. Cell 22:
309-317 (1980).
[0480] 51. Deng, C, Capecchi, M R: Reexamination of gene targeting
frequency as a function of the extent of homology between the
targeting vector and the target locus. Mol Cell Biol 12: 3365-3371
(1992).
[0481] 52. Orr-Weaver, T L, Szostak, J W, Rothstein, R J: Yeast
transformation: a model system for the study of recombination. Proc
Natl Acad Sci U S A 78: 6354-6358 (1981).
[0482] 53. Jasin, M, Berg, P: Homologous integration in mammalian
cells without target gene selection. Genes Dev. 2: 1353-1363
(1988).
[0483] 54. Puchta, H, Dujon, B, Hohn, B: Homologous recombination
in plant cells is enhanced by in vivo induction of double strand
breaks into DNA by a site-specific endonuclease. Nucleic Acids Res
21: 5034-5040 (1993).
[0484] 55. Ilyina, T V, Koonin, E V: Conserved sequence motifs in
the initiator proteins for rolling circle DNA replication encoded
by diverse replicons from eubacteria, eucaryotes and
archaebacteria. Nucleic Acids Res 20: 3279-3285 (1992).
[0485] 56. Dujon, B: Group I introns as mobile genetic elements:
facts and mechanistic speculations--a review. Gene 82: 91-114
(1989).
[0486] 57. Colleaux, L, D'Auriol, L, Galibert, F, Dujon, B:
Recognition and cleavage site of the intron-encoded omega
transposase. Proc Natl Acad Sci U S A 85: 6022-6026 (1988).
[0487] 58. Jin, Y, Binkowski, G, Simon, L D, Norris, D: Ho
endonuclease cleaves MAT DNA in vitro by an inefficient
stoichiometric reaction mechanism. J Biol Chem 272: 7352-7359
(1997).
[0488] 59. Nicolas, A L, Munz, P L, Falck-Pedersen, E, Young, C S:
Creation and repair of specific DNA double-strand breaks in vivo
following infection with adenovirus vectors expressing
Saccharomyces cerevisiae HO endonuclease. Virology 266: 211-224
(2000).
[0489] 60. Gasser, C S, Fraley, R T. Genetically engineering plants
for crop improvement. Science 244: 1293. (1989).
[0490] 61. Klein, T M, HarperEC, Svab, Z, Sanford, J C, Fromm, M E,
Maliga, P. Stable genetic transformation of intact Nicotiana cells
by the particle bombardment process. Proc Natl Acad Sci U S A 85:
8502. (1988).
[0491] 62. Wong, E A, Capecchi, M R: Homologous recombination
between coinjected DNA sequences peaks in early to mid-S phase. Mol
Cell Biol 7: 2294-2295 (1987).
[0492] 63. Merrill, G F: Cell synchronization. Methods Cell Biol
57: 229-249 (1998).
[0493] 64. Reichheld, J P, Gigot, C, Chaubet-Gigot, N: Multilevel
regulation of histone gene expression during the cell cycle in
tobacco cells. Nucleic Acids Res 26: 3255-3262 (1998).
[0494] 65. Osley, M A: The regulation of histone synthesis in the
cell cycle. Annu. Rev Biochem 60: 827-861 (1991).
[0495] 66. Huntley, R P, Murray, J A: The plant cell cycle. Curr.
Opin. Plant Biol 2: 440-446 (1999).
[0496] 67. Roeder, G S: Meiotic chromosomes: it takes two to tango.
Genes Dev. 11: 2600-2621 (1997).
[0497] 68. Klimyuk, V I, Jones, J D: AtDMC1-, the Arabidopsis
homologue of the yeast DMC1 gene: characterization,
transposon-induced allelic variation and meiosis-associated
expression. Plant J. 11: 1-14 (1997).
[0498] 69. Ross-Macdonald, P, Roeder, G S: Mutation of a
meiosis-specific MutS homolog decreases crossing over but not
mismatch correction. Cell 79: 1069-1080 (1994).
[0499] 70. Kobayashi, T, Kobayashi, E, Sato, S, Hotta, Y, Miyajima,
N, Tanaka, A, Tabata, S: Characterization of cDNAs induced in
meiotic prophase in lily microsporocytes. DNA Res. 1: 15-26
(1994).
[0500] 71. Chu, S, DeRisi, J, Eisen, M, Mulholland, J, Botstein, D,
Brown, P O, Herskowitz, I: The transcriptional program of
sporulation in budding yeast. Science 282: 699-705 (1998).
[0501] 72. Tsuzuki, T, Fujii, Y, Sakumi, K, Tominaga, Y, Nakao, K,
Sekiguchi, M, Matsushiro, A, Yoshimura, Y, Morita T: Targeted
disruption of the Rad5l gene leads to lethality in embryonic mice.
Proc. Natl. Acad. Sci. U.S.A 93: 6236-6240 (1996).
[0502] 73. Coventry, J, Kott, L, Beversdorf, W: Manual for
microspore culture technique for Brassica napus. University of
Guelph, Guelph (1988).
[0503] 74. Offringa, R, De Groot, M J, Haagsman, H J, Does, M P,
van den Elzen, P J, Hooykaas, P J: Extrachromosomal homologous
recombination and gene targeting in plant cells after Agrobacterium
mediated transformation. EMBO J. 9: 3077-3084 (1990).
[0504] 75. Friedberg, E C, Walker, G C, Siede, W: DNA Repair and
Mutagenesis. American Society for Microbiology, Washington, D.C.
(1995).
[0505] 76. Hoffmann, G R: Induction of genetic recombination:
consequences and model systems. Environ. Mol Mutagen. 23 Suppl 24:
59-66 (1994).
[0506] 77. Schiestl, R H: Nonmutagenic carcinogens induce
intrachromosomal recombination in yeast. Nature 337: 285-288
(1989).
[0507] 78. Basile, G, Aker, M, Mortimer, R K: Nucleotide sequence
and transcriptional regulation of the yeast recombinational repair
gene RAD51. Mol. Cell Biol. 12: 3235-3246 (1992).
[0508] 79. Rozwadowski, K, Kreiser, T, Hasnadka, R, Lydiate, D.
AtMRE11: a component of meiotic recombination and DNA repair in
plants. 10th International Conference on Arabidopsis Research,
Melbourne, Australia, Jul. 4-8, 1999. 1999.
[0509] 80. Ainley, W M, Key, J L: Development of a heat shock
inducible expression cassette for plants: characterization of
parameters for its use in transient expression assays. Plant Mol.
Biol. 14: 949-967 (1990).
[0510] 81. Martinez, A, Sparks, C, Hart, C A, Thompson, J, Jepson,
I: Ecdysone agonist inducible transcription in transgenic tobacco
plants. Plant J. 19: 97-106 (1999).
[0511] 82. Bohner, S, Lenk, L Rieping, M, Herold, M, Gatz, C:
Technical advance: transcriptional activator TGV mediates
dexamethasone-inducible and tetracycline-inactivatable gene
expression. Plant J. 19: 87-95 (1999).
[0512] 83. Gatz, C, Kaiser, A, Wendenburg, R: Regulation of a
modified CaMV 35S promoter by the Tn10-encoded Tet repressor in
transgenic tobacco. Mol. Gen. Genet. 227: 229-237 (1991).
[0513] 84. Weinmann, P, Gossen, M, Hillen, W, Bujard, H, Gatz, C: A
chimeric transactivator allows tetracycline-responsive gene
expression in whole plants. Plant J. 5: 559-569 (1994).
[0514] 85. Mett, V L, Podivinsky, E, Tennant, A M, Lochhead, L P,
Jones, W T, Reynolds, P H: A system for tissue-specific
copper-controllable gene expression in transgenic plants:
nodule-specific antisense of aspartate aminotransferase-P2.
Transgenic Res. 5: 105-113 (1996).
[0515] 86. Mett, V L, Lochhead, L P, Reynolds, P H:
Copper-controllable gene expression system for whole plants. Proc.
Natl. Acad. Sci. U.S.A 90: 4567-4571 (1993).
[0516] 87. Guyer, D, Tuttle, A, Rouse, S, Volrath, S, Johnson, M,
Potter, S, Gorlach, J, Goff, S, Crossland, L, Ward, E: Activation
of latent transgenes in Arabidopsis using a hybrid transcription
factor. Genetics 149: 633-639 (1998).
[0517] 88. Moore, I, Galweiler, L, Grosskopf, D, Schell, J, Palme,
K: A transcription activation system for regulated gene expression
in transgenic plants. Proc. Natl. Acad. Sci. U.S.A 95: 376-381
(1998).
[0518] 89. Labow, M A, Baim, S B, Shenk, T, Levine, A J: Conversion
of the lac repressor into an allosterically regulated
transcriptional activator for mammalian cells. Mol. Cell Biol. 10:
3343-3356 (1990).
[0519] 90. Benton, B M, Eng, W K, Dunn, J J, Studier, F W,
Sternglanz, R, Fisher, P A: Signal-mediated import of bacteriophage
T7 RNA polymerase into the Saccharomyces cerevisiae nucleus and
specific transcription of target genes. Mol. Cell Biol. 10: 353-360
(1990).
[0520] 91. Bechtold, N, Pelletier, G: In planta
Agrobacterium-mediated transformation of adult Arabidopsis thaliana
plants by vacuum infiltration. Methods Mol Biol 82: 259-266
(1998).
[0521] 92. Clough, S J, Bent, A F: Floral dip: a simplified method
for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J 16: 735-743 (1998).
[0522] 93. Scholz, S, Scholthof, K-B G: Plant virus gene vectors
for transient expression of foreign proteins in plants. Annu. Rev.
of Phytopathol. 34: 299-323 (1996).
[0523] 94. Wilmut, L Schnieke, A E, McWhir, J, Kind, A J, Campbell,
K H: Viable offspring derived from fetal and adult mammalian cells.
Nature 385: 810-813 (1997).
[0524] 95. Model, P, Russel, M: Filamentous Bacteriophage. In:
Calendar, R. (ed), The Bacteriophages, pp. 375456. Plenum Press,
New York (1988).
[0525] 96. Hayashi, M, Aoyama, A, Richardson Jr., Dl, Hayashi, M N:
Biology of the bacteriophage phiX174. In: Calendar, R (ed), The
Bacteriophages, pp. 1-71. Plenum Press, New York (1988).
[0526] 97. Chang, T L, Kramer, M G, Ansari, R A, Khan, S A: Role of
individual monomers of a dimeric initiator protein in the
initiation and termination of plasmid rolling circle replication. J
Biol Chem 275: 13529-13534 (2000).
[0527] 98. Novick, R P: Contrasting lifestyles of rolling-circle
phages and plasmids. Trends Biochem Sci 23: 434438 (1998).
[0528] 99. Castellano, M M, Sanz-Burgos, A P, Gutierrez, C:
Initiation of DNA replication in a eukaryotic rolling-circle
replicon: identification of multiple DNA-protein complexes at the
geminivirus origin. J Mol Biol 290: 639-652 (1999).
[0529] 100. Meehan, B M, Creelan, J L, McNulty, M S, Todd, D:
Sequence of porcine circovirus DNA: affinities with plant
circoviruses. J Gen Virol 78: 221-227 (1997).
[0530] 101. Pansegrau, W, Lanka, E. Enzymology of DNA transfer by
conjugative mechanisms. Progress in Nucleic Acid Research and
Molecular Biology 54: 197-251. (1996).
[0531] 102. Cotmore, S F, Tattersall, P: High-mobility group 1/2
proteins are essential for initiating rolling-circle-type DNA
replication at a parvovirus hairpin origin. J Virol 72: 8477-8484
(1998).
[0532] 103. Im, D S, Muzyczka, N: The AAV origin binding protein
Rep68 is an ATP-dependent site-specific endonuclease with DNA
helicase activity. Cell 61: 447-457 (1990).
[0533] 104. Laufs, J, Jupin, L David, C, Schumacher, S,
Heyraud-Nitschke, F, Gronenborn, B: Geminivirus replication:
genetic and biochemical characterization of Rep protein function, a
review. Biochimie 77: 765-773 (1995).
[0534] 105. Sims, J, Capon, D, Dressler, D: dnaG
(primase)-dependent origins of DNA replication. Nucleotide
sequences of the negative strand initiation sites of bacteriophages
St-1, phi K, and alpha 3. J Biol Chem 254: 12615-12628 (1979).
[0535] 106. Heidekamp, F, Baas, P D, Jansz, H S: Nucleotide
sequences at the phi X gene A protein cleavage site in replicative
form I DNAs of bacteriophages U3, G14, and alpha 3. J Virol 42:
91-99 (1982).
[0536] 107. Godson, G N, Barrell, B G, Staden, R, Fiddes, J C:
Nucleotide sequence of bacteriophage G4 DNA. Nature 276: 236-247
(1978).
[0537] 108. Gielow, A, Diederich, L, Messer, W: Characterization of
a phage-plasmid hybrid (phasyl) with two independent origins of
replication isolated from Escherichia coli. J Bacteriol 173: 73-79
(1991).
[0538] 109. Harding, R M, Bums, T M, Hafner, G, Dietzgen, R G,
Dale, J L: Nucleotide sequence of one component of the banana
bunchy top virus genome contains a putative replicase gene. J Gen
Virol 74: 323-328 (1993).
[0539] 110. Hafner, G J, Stafford, M R, Wolter, L C, Harding, R M,
Dale, J L: Nicking and joining activity of banana bunchy top virus
replication protein in vitro. J Gen Virol 78: 1795-1799 (1997).
[0540] 111. Chu, P W, Keese, P, Qiu, B S, Waterhouse, P M, Gerlach,
W L: Putative full-length clones of the genomic DNA segments of
subterranean clover stunt virus and identification of the segment
coding for the viral coat protein. Virus Res 27: 161-171
(1993).
[0541] 112. Rohde, W, Randles, J W, Langridge, P, Hanold, D:
Nucleotide sequence of a circular single-stranded DNA associated
with coconut foliar decay virus. Virology 176: 648-651 (1990).
[0542] 113. Todd, D, Creelan, J L, Mackie, D P, Rixon, F, McNulty,
M S: Purification and biochemical characterization of chicken
anaemia agent. J Gen Virol 71: 819-823 (1990).
[0543] 114. Ritchie, B W, Niagro, F D, Lukert, P D, Steffens, W L,
III, Latimer, K S: Characterization of a new virus from cockatoos
with psittacine beak and feather disease. Virology 171: 83-88
(1989).
[0544] 115. Snyder, R O, Im, D S, Ni, T, Xiao, X, Samulski, R J,
Muzyczka, N: Features of the adeno-associated virus origin involved
in substrate recognition by the viral Rep protein. J Virol 67:
6096-6104 (1993).
[0545] 116. Brister, J R, Muzyczka, N: Mechanism of Rep-mediated
adeno-associated virus origin nicking. J Virol 74: 7762-7771
(2000). 117. Nuesch, J P, Cotmore, S F, Tattersall, P: Sequence
motifs in the replicator protein of parvovirus MVM essential for
nicking and covalent attachment to the viral origin: identification
of the linking tyrosine. Virology 209:122-135.
[0546] 118. Noirot-Gros, M F, Bidnenko, V, Ehrlich, S D: Active
site of the replication protein of the rolling circle plasmid
pC194. EMBO J 13: 4412-4420 (1994).
[0547] 119. Gros, M F, te, R H, Ehrlich, S D: Replication origin of
a single-stranded DNA plasmid pC194. EMBO J 8: 2711-2716
(1989).
[0548] 120. Koepsel, R R, Murray, R W, Rosenblum, W D, Khan, S A:
The replication initiator protein of plasmid pT181 has
sequence-specific endonuclease and topoisomerase-like activities.
Proc Natl Acad Sci U S A 82: 6845-6849 (1985).
[0549] 121. Murray, R W, Koepsel, R R, Khan, S A: Synthesis of
single-stranded plasmid pT181 DNA in vitro. Initiation and
termination of DNA replication. J Biol Chem 264: 1051-1057
(1989).
[0550] 122. Boe, L, Gros, M F, te, R H, Ehrlich, S D, Gruss, A:
Replication origins of single-stranded-DNA plasmid pUB l 10. J
Bacteriol 171: 3366-3372 (1989).
[0551] 123. Yang, X, McFadden, BA: A small plasmid, pCA2.4, from
the cyanobacterium Synechocystis sp. strain PCC 6803 encodes a rep
protein and replicates by a rolling circle mechanism. J Bacteriol
175: 3981-3991 (1993).
[0552] 124. Sozhamannan, S, Dabert, P, Moretto, V, Ehrlich, S D,
Gruss, A: Plus-origin mapping of single-stranded DNA plasmid pE194
and nick site homologies with other plasmids. J Bacteriol 172:
45434548 (1990).
[0553] 125. Yasukawa, H, Hase, T, Sakai, A, Masamune, Y:
Rolling-circle replication of the plasmid pKYM isolated from a
gram-negative bacterium. Proc Natl Acad Sci U S A 88: 10282-10286
(1991).
[0554] 126. Yasukawa, H, Masamune, Y: Rolling-circle plasmid pKYM
re-initiates DNA replication. DNA Res 4: 193-197 (1997).
[0555] 127. Gruss, A, Ehrlich, S D: The family of highly
interrelated single-stranded deoxyribonucleic acid plasmids.
Microbiol Rev 53: 231-241 (1989).
[0556] 128. Espinosa, M, del Solar, G, Rojo, F, Alonso, J C:
Plasmid rolling circle replication and its control. FEMS Microbiol
Lett 130: 111-120 (1995).
[0557] 129. del Solar, G, Giraldo, R, Ruiz-Echevarria, M J,
Espinosa, M, Diaz-Orejas, R: Replication and control of circular
bacterial plasmids. Microbiol Mol Biol Rev 62: 434-464 (1998).
[0558] 130. Matson, S W, Nelson, W C, Morton, B S: Characterization
of the reaction product of the oriT nicking reaction catalyzed by
Escherichia coli DNA helicase I. J Bacteriol 175: 2599-2606
(1993).
[0559] 131. Llosa, M, Bolland, S, de la, C F: Structural and
functional analysis of the origin of conjugal transfer of the
broad-host-range IncW plasmid R388 and comparison with the related
IncN plasmid R46. Mol Gen Genet 226: 473-483 (1991).
[0560] 132. Pansegrau, W, Lanka, E: Mechanisms of initiation and
termination reactions in conjugative DNA processing. Independence
of tight substrate binding and catalytic activity of relaxase
(Tral) of IncPalpha plasmid RP4. J Biol Chem 271: 13068-13076
(1996).
[0561] 133. Furste, J P, Pansegrau, W, Ziegelin, G, Kroger, M,
LankaE: Conjugative transfer of promiscuous IncP plasmids:
interaction of plasmid-encoded products with the transfer origin.
Proc Natl Acad Sci U S A 86: 1771-1775 (1989).
[0562] 134. Scherzinger, E, Ziegelin, G, Barcena, M, Carazo, J M,
Lurz, R, Lanka, E: The RepA protein of plasmid RSF1010 is a
replicative DNA helicase. J Biol Chem 272: 30228-30236 (1997).
[0563] 135. Coupland, G M, Brown, A M, Willetts, N S: The origin of
transfer (oriT) of the conjugative plasmid R46: characterization by
deletion analysis and DNA sequencing. Mol Gen Genet 208: 219-225
(1987).
[0564] 136. Finlay, B B, Frost, L S, Paranchych, W: Origin of
transfer of IncF plasmids and nucleotide sequences of the type II
oriT, traM, and traY alleles from CoIB4-K98 and the type IV traY
allele from R100-1. J Bacteriol 168: 132-139 (1986).
[0565] 137. Furuya, N, Nisioka, T, Komano, T: Nucleotide sequence
and functions of the oriT operon in IncI1 plasmid R64. J Bacteriol
173: 2231-2237 (1991).
[0566] 138. Murphy, C G, Malamy, M H: Requirements for strand- and
sitespecific cleavage within oriT region of Tn4399, a mobilizing
transposon from Bacteroides fragilis. J Bacteriol 177: 3158-3165
(1995).
[0567] 139. Murphy, C G, Malamy, M H: Characterization of a
"mobilization cassette" in transposon Tn4399 from Bacteroides
fragilis. J Bacteriol 175: 5814-5823 (1993).
[0568] 140. Bastia, D: Determination of restriction sites and the
nucleotide sequence surrounding the relaxation site of ColE1. J Mol
Biol 124: 601-639 (1978).
[0569] 141. Roessler, E, Fenwick, R G, Jr., Chinault, A C: Analysis
of mobilization elements in plasmids from Shigella flexneri. J
Bacteriol 161: 1233-1235 (1985).
[0570] 142. Snijders, A, van Putten, A J, Veltkamp, E, Nijkamp, H
J: Localization and nucleotide sequence of the bom region of Clo
DF13. Mol Gen Genet 192: 444451 (1983).
[0571] 143. Bernardi, A, Bernardi, F: Complete sequence of pSC101.
Nucleic Acids Res 12: 9415-9426 (1984).
[0572] 144. Beck, E, Zink, B: Nucleotide sequence and genome
organisation of filamentous bacteriophages fl and fd. Gene 16:
35-58 (1981).
[0573] 145. Sanger, F, Air, G M, Barrell, B G, Brown, N L, Coulson,
A R, Fiddes, C A, Hutchison, C A, Slocombe, P M, Smith, M:
Nucliotide sequence of bacteriophage phi X174 DNA. Nature 265:
687-695 (1977).
[0574] 146. Meyer, T F, Geider, K: Enzymatic synthesis of
bacteriophage fd viral DNA. Nature 296: 828-832 (1982).
[0575] 147. Harth, G, Baumel, I, Meyer, T F, Geider, K:
Bacteriophage fd gene-2 protein. Processing of phage fd viral
strands replicated by phage T7 enzymes. Eur J Biochem 119: 663-668
(1981).
[0576] 148. Shavitt, O, Livneh, Z: Rolling-circle replication of
UV-irradiated duplex DNA in the phi X174
replicative-form--single-strand replication system in vitro. J
Bacteriol 171: 3530-3538 (1989).
[0577] 149. Lin, N S, Pratt, D: Role of bacteriophage M13 gene 2 in
viral DNA replication. J Mol Biol 72: 37-49 (1972).
[0578] 150. Goetz, G S, Hurwitz, J: Studies on the role of the phi
X174 gene A protein in phi X viral strand synthesis. L Replication
of DNA containing an alteration in position 1 of the 30-nucleotide
icosahedral bacteriophage origin. J Biol Chem 263: 16421-16432
(1988).
[0579] 151. Hanai, R, Wang, J C: The mechanism of sequence-specific
DNA cleavage and strand transfer by phi X174 gene A* protein. J
Biol Chem 268: 23830-23836 (1993).
[0580] 152. Higashitani, A, Greenstein, D, Hirokawa, H, Asano, S,
Horiuchi, K: Multiple DNA conformational changes induced by an
initiator protein precede the nicking reaction in a rolling circle
replication origin. J Mol Biol 237: 388-400 (1994).
[0581] 153. Asano, S, Higashitani, A, Horiuchi, K: Filamentous
phage replication initiator protein gpII forms a covalent complex
with the 5' end of the nick it introduced. Nucleic Acids Res 27:
1882-1889 (1999).
[0582] 154. Higashitani, A, Greenstein, D, Horiuchi, K: A single
amino acid substitution reduces the superhelicity requirement of a
replication initiator protein. Nucleic Acids Res 20: 2685-2691
(1992).
[0583] 155. Greenstein, D, Horiuchi, K: Double-strand cleavage and
strand joining by the replication initiator protein of filamentous
phage fl. J Biol Chem 264: 12627-12632 (1989).
[0584] 156. Fluit, A C, Baas, P D, Van Boom, J H, Veeneman, G H,
Jansz, H S: Gene A protein cleavage of recombinant plasmids
containing the phi X174 replication origin. Nucleic Acids Res 12:
6443-6454 (1984).
[0585] 157. van Mansfeld, A D, van Teeffelen, H A, Baas, P D,
Jansz, H S: Two juxtaposed tyrosyl-OH groups participate in phi
X174 gene A protein catalysed cleavage and ligation of DNA. Nucleic
Acids Res 14: 42294238 (1986).
[0586] 158. van Mansfeld, A D, van Teeffelen, H A, Baas, P D,
Veeneman, G H, Van Boom, J H, Jansz, H S: The bond in the
bacteriophage phi X174 gene A protein--DNA complex is a
tyrosyl-5'-phosphate ester. FEBS Lett 173: 351-356 (1984).
[0587] 159. van Mansfeld, A D, Baas, P D, Jansz, H S: Gene A
protein of bacteriophage phi X174 is a highly specific
single-strand nuclease and binds via a tyrosyl residue to DNA after
cleavage. Adv Exp Med Biol 179: 221-230 (1984).
[0588] 160. Dente, L, Cesareni, G, Cortese, R: pEMBL: a new family
of single stranded plasmids. Nucleic Acids Res 11: 1645-1655
(1983).
[0589] 161. Dotto, G P, Enea, V, Zinder, N D: Functional analysis
of bacteriophage fl intergenic region. Virology 114: 463473
(1981).
[0590] 162. Fluit, A C, Baas, P D, Jansz, H S: The complete
30-base-pair origin region of bacteriophage phi X174 in a plasmid
is both required and sufficient for in vivo rolling-circle DNA
replication and packaging. Eur J Biochem 149: 579-584 (1985).
[0591] 163. van der, E A, Teertstra, R, Weisbeek, P J: Initiation
and termination of the bacteriophage phi X174 rolling circle DNA
replication in vivo: packaging of plasmid single-stranded DNA into
bacteriophage phi X174 coats. Nucleic Acids Res 10: 6849-6863
(1982).
[0592] 164. Dotto, G P, Zinder, N D: Increased intracellular
concentration of an initiator protein markedly reduces the minimal
sequence required for initiation of DNA synthesis. Proc Natl Acad
Sci U S A 81: 1336-1340 (1984).
[0593] 165. Goetz, G S, Hurwitz, J: Studies on the role of the phi
X174 gene A protein in phi X174 viral strand synthesis. III.
Replication of DNA containing two viral replication origins. J Biol
Chem 263: 16443-16451 (1988).
[0594] 166. Goetz, G S, Schmidt-Glenewinkel, T, Hu, M H, Belgado,
N, Hurwitz, J: Studies on the role of the phi X174 gene A protein
in phi X viral strand synthesis. II. Effects of DNA replication of
mutations in the 30-nucleotide icosahedral bacteriophage origin. J
Biol Chem 263: 16433-16442 (1988).
[0595] 167. Reinberg, D, Zipursky, S L, Weisbeek, P, Brown, D,
Hurwitz, J: Studies on the phi X174 gene A protein-mediated
termination of leading strand DNA synthesis. J Biol Chem 258:
529-537 (1983).
[0596] 168. Dotto, G P, Horiuchi, K, Zinder, N D: Initiation and
termination of phage fl plus-strand synthesis. Proc Natl Acad Sci U
S A 79: 7122-7126 (1982).
[0597] 169. Short, J M, Fernandez, J M, Sorge, J A, Huse, W D:
Lambda ZAP: a bacteriophage lambda expression vector with in vivo
excision properties. Nucleic Acids Res 16: 7583-7600 (1988).
[0598] 170. Dotto, G P, Horiuchi, K: Replication of a plasmid
containing two origins of bacteriophage. J Mol Biol 153: 169-176
(1981).
[0599] 171. Dotto, G P, Horiuchi, K, Zinder, N D: The functional
origin of bacteriophage fl DNA replication. Its signals and
domains. J Mol Biol 172: 507-521 (1984).
[0600] 172. Meyer, T F, Geider, K: Cloning of bacteriophage fd gene
2 and construction of a plasmid dependent on fd gene 2 protein.
Proc Natl Acad Sci U S A 78: 5416-5420 (1981).
[0601] 173. Strathern, J N, Weinstock, K G, Higgins, D R, McGill, C
B: A novel recombinator in yeast based on gene II protein from
bacteriophage fl. Genetics 127: 61-73 (1991).
[0602] 174. Heyraud-Nitschke, F, Schumacher, S, Laufs, J, Schaefer,
S, Schell, J, Gronenborn, B: Determination of the origin cleavage
and joining domain of geminivirus Rep proteins. Nucleic Acids Res
23: 910-916 (1995).
[0603] 175. Choi, I R, Stenger, D C: Strain-specific determinants
of beet curly top geminivirus DNA replication. Virology 206:
904-912 (1995).
[0604] 176. Laufs, J, Traut, W, Heyraud, F, Matzeit, V, Rogers, S
G, Schell, J, Gronenborn, B: In vitro cleavage and joining at the
viral origin of replication by the replication initiator protein of
tomato yellow leaf curl virus. Proc Natl Acad Sci U S A 92:
3879-3883 (1995).
[0605] 177. Desbiez, C, David, C, Mettouchi, A, Laufs, J,
Gronenborn, B: Rep protein of tomato yellow leaf curl geminivirus
has an ATPase activity required for viral DNA replication. Proc
Natl Acad Sci U S A 92: 5640-5644 (1995).
[0606] 178. Laufs, J, Schumacher, S, Geisler, N, Jupin, L
Gronenborn, B: Identification of the nicking tyrosine of
geminivirus Rep protein. FEBS Lett 377: 258-262 (1995).
[0607] 179. Orozco, B M, Hanley-Bowdoin, L: Conserved sequence and
structural motifs contribute to the DNA binding and cleavage
activities of a geminivirus replication protein. J Biol Chem 273:
24448-24456 (1998).
[0608] 180. Orozco, B M, Kong, L J, Batts, L A, Elledge, S,
Hanley-Bowdoin, L: The multifunctional character of a geminivirus
replication protein is reflected by its complex oligomerization
properties. J Biol Chem 275: 6114-6122 (2000).
[0609] 181. Orozco, B M, Miller, A B, Settlage, S B,
Hanley-Bowdoin, L: Functional domains of a geminivirus replication
protein. J Biol Chem 272: 9840-9846 (1997).
[0610] 182. Lazarowitz, S G, Wu, L C, Rogers, S G, Elmer, J S:
Sequence-specific interaction with the viral AL1 protein identifies
a geminivirus DNA replication origin. Plant Cell 4: 799-809
(1992).
[0611] 183. Jupin, I, Hericourt, F, Benz, B, Gronenborn, B: DNA
replication specificity of TYLCV geminivirus is mediated by the
amino-terminal 116 amino acids of the Rep protein. FEBS Lett 362:
116-120 (1995).
[0612] 184. -Rigden, J E, Dry, I B, Krake, L R, Rezaian, M A: Plant
virus DNA replication processes in Agrobacterium: insight into the
origins of geminiviruses? Proc Natl Acad Sci U S A 93: 10280-10284
(1996).
[0613] 185. Akbar Behjatnia, S A, Dry, I B, Ali, R M:
Identification of the replication-associated protein binding domain
within the intergenic region of tomato leaf curl geminivirus.
Nucleic Acids Res 26: 925-931 (1998).
[0614] 186. Fontes, E P, Eagle, P A, Sipe, P S, Luckow, V A,
Hanley-Bowdoin, L: Interaction between a geminivirus replication
protein and origin DNA is essential for viral replication. J Biol
Chem 269: 8459-8465 (1994).
[0615] 187. Sanz-Burgos, A P, Gutierrez, C: Organization of the
cis-acting element required for wheat dwarf geminivirus DNA
replication and visualization of a rep protein-DNA complex.
Virology 243: 119-129 (1998).
[0616] 188. Woolston, C J, Barker, R, Gunn, H, Boulton, M I,
Mullineaux, P M. Agroinfection and nucleotide sequence of cloned
wheat dwarf virus DNA. Plant Mol. Biol. 11: 35-43, 1988.
[0617] 189. Navot, N, Pichersky, E, Zeidan, M, Zamir, D, Czosnek,
H: Tomato yellow leaf curl virus: a whitefly-transmitted
geminivirus with a single genomic component. Virology 185: 151-161
(1991).
[0618] 190. Dry, I B, Rigden, J E, Krake, L R, Mullineaux, P M,
Rezaian, M A: Nucleotide sequence and genome organization of tomato
leaf curl geminivirus. J Gen Virol 74: 147-151 (1993).
[0619] 191. Mankertz, A, Mankertz, J, Wolf, K, Buhk, H J:
Identification of a protein essential for replication of porcine
circovirus. J Gen Virol 79: 381-384 (1998).
[0620] 192. Mankertz, A, Persson, F, Mankertz, J, Blaess, G, Buhk,
H J: Mapping and characterization of the origin of DNA replication
of porcine circovirus. J Virol 71: 2562-2566 (1997).
[0621] 193. Backert, S, Dorfel, P, Lurz, R, Borner, T:
Rolling-circle replication of mitochondrial DNA in the higher plant
Chenopodium album (L.). Mol Cell Biol 16: 6285-6294 (1996).
[0622] 194. Gros, M F, te, R H, Ehrlich, S D: Rolling circle
replication of single-stranded DNA plasmid pC194. EMBO J 6:
3863-3869 (1987).
[0623] 195. Firth, N, Ippen-Ihler, K, Skurray, R A: Structure and
function of the F factor and mechanism of conjugation. In:
Neidhardt, F (ed), Escherichia coli and Salmonella, pp. 2377-2401.
American Society for Microbiology, (1995).
[0624] 196. Lessl, M, Lanka, E: Common mechanisms in bacterial
conjugation and Ti-mediated T-DNA transfer to plant cells. Cell 77:
321-324 (1994).
[0625] 197. Nishikawa, M, Suzuki, K, Yoshida, K: Structural and
functional stability of IncP plasmids during stepwise transmission
by trans-kingdom mating: promiscuous conjugation of Escherichia
coli and Saccharomyces cerevisiae. Jpn. J Genet 65: 323-334
(1990).
[0626] 198. Byrd, D R, Matson, S W: Nicking by transesterification:
the reaction catalysed by a relaxase. Mol Microbiol 25: 1011-1022
(1997).
[0627] 199. Liosa, M, Grandoso, G, Hernando, M A, de la, C F:
Functional domains in protein TrwC of plasmid R388: dissected DNA
strand transferase and DNA helicase activities reconstitute protein
function. J Mol Biol 264: 56-67 (1996).
[0628] 200. Grandoso, G, Avila, P, Cayon, A, Hernando, M A, Llosa,
M, de la, C F: Two active-site tyrosyl residues of protein TrwC act
sequentially at the origin of transfer during plasmid R388
conjugation. J Mol Biol 295: 1163-1172 (2000).
[0629] 201. Grandoso, G, Llosa, M, Zabala, J C, de la, C F:
Purification and biochemical characterization of TrwC, the helicase
involved in plasmid R388 conjugal DNA transfer. Eur J Biochem 226:
403412 (1994).
[0630] 202. Llosa, M, Grandoso, G, de la, C F: Nicking activity of
TrwC directed against the origin of transfer of the IncW plasmid
R388. J Mol Biol 246: 54-62 (1995).
[0631] 203. Pansegrau, W, Ziegelin, G, Lanka, E: Covalent
association of the traI gene product of plasmid RP4 with the
5'-terminal nucleotide at the relaxation nick site. J Biol Chem
265: 10637-10644 (1990).
[0632] 204. Scherzinger, E, Kruft, V, Otto, S: Purification of the
large mobilization protein of plasmid RSF1010 and characterization
of its site-specific DNA-cleaving/DNA-joining activity. Eur J
Biochem217: 929-938 (1993).
[0633] 205. Scherzinger, E, Lurz, R, Otto, S, Dobrinski, B: In
vitro cleavage of do. Nucleic Acids Res 20: 41-48 (1992).
[0634] 206. Sherman, J A, Matson, S W: Escherichia coli DNA
helicase I catalyzes a sequence-specific cleavage/ligation reaction
at the F plasmid origin of transfer. J Biol Chem 269: 26220-26226
(1994).
[0635] 207. Matson, S W, Morton, B S: Escherichia coli DNA helicase
I catalyzes a. J Biol Chem 266: 16232-16237 (1991).
[0636] 208. Moncalian, G, Grandoso, G, Llosa, M, de la, C F:
oriT-processing and regulatory roles of TrwA protein in plasmid
R388 conjugation. J Mol Biol 270: 188-200 (1997).
[0637] 209. Moncalian, G, Cabezon, E, Alkorta, I, Valle, M, Moro,
F, Valpuesta, J M, Goni, F M, de la, C F: Characterization of ATP
and DNA binding activities of TrwB, the coupling protein essential
in plasmid R388 conjugation. J Biol Chem274: 36117-36124(1999).
[0638] 210. Ziegelin, G, Pansegrau, W, Lurz, R, Lanka, E: TraK
protein of conjugative plasmid RP4 forms a specialized
nucleoprotein complex with the transfer origin. J Biol Chem 267:
17279-17286 (1992).
[0639] 211. Fekete, R A, Frost, L S: Mobilization of chimeric oriT
plasmids by F and R100-1: role of relaxosome formation in defining
plasmid specificity. J Bacteriol 182: 4022-4027 (2000).
[0640] 212. Bravo-Angel, A M, Gloeckler, V, Hohn, B, Tinland, B:
Bacterial conjugation protein MobA mediates integration of complex
DNA structures into plant cells. J Bacteriol 181: 5758-5765
(1999).
[0641] 213. Turlan, C, Chandler, M: Playing second fiddle:
second-strand processing and liberation of transposable elements
from donor DNA. Trends Microbiol 8: 268-274 (2000).
[0642] 214. Stellwagen, A E, Craig, N L: Mobile DNA elements:
controlling transposition with ATP-dependent molecular switches.
Trends Biochem Sci 23: 486-490 (1998).
[0643] 215. Haren, L, Ton-Hoang, B, Chandler, M: Integrating DNA:
transposases and retroviral integrases. Annu. Rev Microbiol 53:
245-281 (1999).
[0644] 216. Whiteley, M, Kassis, J A: Rescue of Drosophila
engrailed mutants with a highly divergent mosquito engrailed cDNA
using a homing, enhancer-trapping transposon. Development 124:
1531-1541 (1997).
[0645] 217. Maes, T, De Keukeleire, P, Gerats, T: Plant tagnology.
Trends Plant Sci 4: 90-96 (1999).
[0646] 218. New England Biolabs: Cleavage of single-stranded DNA.
New England Biolabs 1988/99 Catalogue. Page 262.
[0647] 219. Ziegelin, G, Lanka, E.: Bacteriophage P4 DNA
replication. FEMS Microbiol. Rev. 17: 99-107 (1995).
[0648] 220. Salas, M.: Protein-priming of DNA replication. Annu.
Rev. Biochem. 60:39-71 (1991).
[0649] 221. Gene Targeting Protocols. Kmiec, E B ed. [133]. 2000.
Totowa, N J., Humana Press. Methods in Molecular Biology.
[0650] 222. Smith, A E: Viral vectors in gene therapy. Annu. Rev
Microbiol 49: 807-838 (1995).
[0651] 223. Scott, J R, Churchward, G G: Conjugative transposition.
Annu. Rev Microbiol 49: 367-397 (1995).
[0652] 224. Mahillon, J, Chandler, M: Insertion sequences.
Microbiol Mol Biol Rev 62: 725-774 (1998).
[0653] 225. Tavakoli, N, Comanducci, A, Dodd, H M, Lett, M C,
Albiger, B, Bennett, P: IS1294, a DNA element that transposes by RC
transposition. Plasmid 44: 66-84 (2000).
[0654] 226. Furukawa, K, Hayashida, S, Taira, K: Gene-specific
transposon mutagenesis of the biphenyl/polychlorinated
biphenyl-degradation-controll- ing bph operon in soil bacteria.
Gene 98: 21-28 (1991).
[0655] 227. Norgren, M, Caparon, M G, Scott, J R: A method for
allelic replacement that uses the conjugative transposon Tn916:
deletion of the emm6.1 allele in Streptococcus pyogenes JRS4.
Infect. Immun. 57: 3846-3850 (1989).
[0656] 228. Biswas, L Gruss, A, Ehrlich, S D, Maguin, E:
High-efficiency gene inactivation and replacement system for
gram-positive bacteria. J Bacteriol 175: 3628-3635 (1993).
[0657] 229. Alonso, J C, Ayora, S, Canosa, I, Weise, F, Rojo, F:
Site-specific recombination in gram-positive theta-replicating
plasmids. FEMS Microbiol Lett 142: 1-10 (1996).
[0658] 230. Morel-Deville, F, Ehrlich, S D: Theta-type DNA
replication stimulates homologous recombination in the Bacillus
subtilis chromosome. Mol Microbiol 19: 587-598 (1996).
[0659] 231. Heslip, TR, Hodgetts, R B: Targeted transposition at
the vestigial locus of Drosophila melanogaster. Genetics 138:
1127-1135 (1994).
[0660] 232. Current Protocols in Molecular Biology. Ausubel, F M,
Brent, R, Kingston, R E, Moore, D D, Seidman, J G, Smith, J A,
Struhl, K eds. 1987. John Wiley and Sons, Inc.
[0661] 233. Arezi, B, Kuchta, R D: Eukaryotic DNA primase. Trends
Biochem Sci 25: 572-576 (2000).
[0662] 234. Boulikas, T: Common structural features of replication
origins in all life forms. J Cell Biochem 60: 297-316 (1996).
[0663] 235. Masai, H, Arai, K: Mechanisms of primer RNA synthesis
and D-loop/R-loop-dependent DNA replication in Escherichia coli.
Biochimie 78: 1109-1117 (1996).
[0664] 236. Sandler, S J, Marians, K J: Role of PriA in replication
fork reactivation in Escherichia coli. J Bacteriol 182: 9-13
(2000).
[0665] 237. Haren, L, Ton-Hoang, B, Chandler, M: Integrating DNA:
transposases and retroviral integrases. Annu. Rev Microbiol 53:
245-281 (1999).
[0666] 238. Carles-Kinch, K, Kreuzer, K N: RNA-DNA hybrid formation
at a bacteriophage T4 replication origin. J Mol Biol 266: 915-926
(1997).
[0667] 239. Castellano, M M, Sanz-Burgos, A P, Gutierrez, C:
Initiation of DNA replication in a eukaryotic rolling-circle
replicon: identification of multiple DNA-protein complexes at the
geminivirus origin. J Mol Biol 290: 639-652 (1999).
[0668] 240. Concepts in Eukaryotic DNA Replication. Cold Spring
Harbor Press, Cold Spring Harbor, N.Y. (1999).
[0669] 241. Biological Responses to DNA Damage. Cold Spring Harbor
Press, Cold Spring Harbor, N.Y. (2000).
[0670] 242. Scully, R, Puget, N, Vlasakova, K: DNA polymerase
stalling, sister chromatid recombination and the BRCA genes.
Oncogene 19: 6176-6183 (2000).
[0671] 243. Michel, B: Replication fork arrest and DNA
recombination. Trends Biochem Sci 25: 173-178 (2000).
[0672] 244. Haber, J E: DNA recombination: the replication
connection. Trends Biochem. Sci. 24: 271-275 (1999).
[0673] 245. Huntley, R, Healy, S, Freeman, D, Lavender, P, de
Jager, S, Greenwood, J, Makker, J, Walker, E, Jackman, M, Xie, Q,
Bannister, A J, Kouzarides, T, Gutierrez, C, Doonan, J H, Murray, J
A: The maize retinoblastoma protein homologue ZmRb-1 is regulated
during leaf development and displays conserved interactions with
G1/S regulators and plant cyclin D (CycD) proteins. Plant Mol Biol
37: 155-169 (1998).
[0674] 246. Ludlow, J W: Interactions between SV40 large-tumor
antigen and the growth suppressor proteins pRB and p53. FASEB J 7:
866-871 (1993).
[0675] 247. Moran, E: Mammalian cell growth controls reflected
through protein interactions with the adenovirus E1A gene products.
Semin. Virol. 5: 327-340 (1994).
[0676] 248. Vousden, K: Interactions of human papillomavirus
transforming proteins with the products of tumor suppressor genes.
FASEB J 7: 872-879 (1993).
[0677] 249. Horvath, G V, Pettko-Szandtner, A, Nikovics, K, Bilgin,
M, Boulton, M, Davies, J W, Gutierrez, C, Dudits, D: Prediction of
functional regions of the maize streak virus replication-associated
proteins by protein-protein interaction analysis. Plant Mol Biol
38: 699-712 (1998).
[0678] 25 250. Liu, L, Saunders, K, Thomas, C L, Davies, J W,
Stanley, J: Bean yellow dwarf virus RepA, but not rep, binds to
maize retinoblastoma protein, and the virus tolerates mutations in
the consensus binding motif. Virology 256: 270-279 (1999).
[0679] 251. Ach, R A, Durfee, T, Miller, A B, Taranto, P,
Hanley-Bowdoin, L, Zambryski, P C, Gruissem, W: RRB1 and RRB2
encode maize retinoblastoma-related proteins that interact with a
plant D-type cyclin and geminivirus replication protein. Mol Cell
Biol 17: 5077-5086 (1997).
[0680] 252. Kowalski, D, Eddy, M J: The DNA unwinding element: a
novel, cis-acting component that facilitates opening of the
Escherichia coli replication origin. EMBO J 8: 43354344 (1989).
[0681] 253. Natale, D A, Schubert, A E, Kowalski, D: DNA helical
stability accounts for mutational defects in a yeast replication
origin. Proc Natl Acad Sci U S A 89: 2654-2658 (1992).
[0682] 254. Lin, S, Kowalski, D: DNA helical instability
facilitates initiation at the SV40 replication origin. J Mol Biol
235: 496-507 (1994).
[0683] 255. Natale, D A, Umek, R M, Kowalski, D: Ease of DNA
unwinding is a conserved property of yeast replication origins.
Nucleic Acids Res 21: 555-560 (1993).
[0684] 256. Current Protocols in Molecular Biology. Ausubel, F M,
Brent, R, Kingston, RE, Moore, D D, Seidman, J G, Smith, J A,
Struhl, K eds. 1987-2000. John Wiley and Sons, Inc.
[0685] 257. Kalderon, D, Roberts, B L, Richardson, W D, Smith, A E:
A short amino acid sequence able to specify nuclear location. Cell
39: 499-509 (1984).
[0686] 258. Tinland, B, Koukolikova-Nicola, Z, Hall, M N, Hohn, B:
The T-DNA-linked VirD2 protein contains two distinct functional
nuclear localization signals. Proc Natl Acad Sci U S A 89:
7442-7446 (1992).
[0687] 259. Relic, B, Andjelkovic, M, Rossi, L, Nagamine, Y, Hohn,
B: Interaction of the DNA modifying proteins VirD1 and VirD2 of
Agrobacterium tumefaciens: analysis by subcellular localization in
mammalian cells. Proc Natl Acad Sci U S A 95: 9105-9110 (1998).
[0688] 260. Hopp, T, Prickett, S, Price, V, Libby, R, March, C,
Cerretti, D, Urdal, D, Conlon, P. A short polypeptide marker
sequence useful for recombinant protein identification and
purification. Bio/technology 6: 1204-1210. (1988).
[0689] 261. Russell, D, Bennet, G. Construction and analysis of in
vivo activity of E. coli promoter hybrids and promoter mutants that
alter the -35 to -10 spacing. Gene 20:. 231-243. (1982).
[0690] 262. Kleiner, D, Paul, W, Merrick, M J: Construction of
multicopy expression vectors for regulated over-production of
proteins in KIebsiella pneumoniae and other enteric bacteria. J Gen
Microbiol 134: 1779-1784 (1988).
[0691] 263. Chang, A C, Cohen, S N: Construction and
characterization of amplifiable multicopy DNA cloning vehicles
derived from the PISA cryptic miniplasmid. J Bacteriol 134:
1141-1156 (1978).
[0692] 264. Brosius, J, Holy, A: Regulation of ribosomal RNA
promoters with a synthetic lac operator. Proc Natl Acad Sci U S A
81: 6929-6933 (1984).
[0693] 265. Gari, E, Piedrafita, L, Aldea, M, Herrero, E: A set of
vectors with a tetracycline-regulatable promoter system for
modulated gene expression in Saccharomyces cerevisiae. Yeast 13:
837-848 (1997).
[0694] 266. Schneider, J C, Guarente, L: Vectors for expression of
cloned genes in yeast: regulation, overproduction, and
underproduction. Methods Enzymol. 194: 373-388 (1991).
[0695] 267. Voth, W P, Richards, J D, Shaw, J M, Stillman, D J:
Yeast vectors for integration at the HO locus. Nucleic Acids Res
29: B59-E59 (2001).
[0696] 268. Gietz, R D, Sugino, A: New yeast-Escherichia coli
shuttle vectors constructed with in vitro mutagenized yeast genes
lacking six-base pair restriction sites. Gene 74: 527-534
(1988).
[0697] 269. Mead, D A, Szczesna-Skorupa, E, Kemper, B:
Single-stranded DNA `blue` T7 promoter plasmids: a versatile tandem
promoter system for cloning and protein engineering. Protein Eng 1:
67-74 (1986).
[0698] 270. Dente, L, Cortese, R: pEMBL: a new family of
single-stranded plasmids for sequencing DNA. Methods Enzymol. 155:
111-119 (1987).
[0699] 271. Hanai, R, Wang, J C: The mechanism of sequence-specific
DNA cleavage and strand transfer by phi X174 gene A* protein. J
Biol Chem 268: 23830-23836 (1993).
[0700] 272. Colasanti, J, Denhardt, D T: Expression of the cloned
bacteriophage phi X174 A* gene in Escherichia coli inhibits DNA
replication and cell division. J Virol 53: 807-813 (1985).
[0701] 273. Yoshimatsu, T, Nagawa, F: Control of gene expression by
artificial introns in Saccharomyces cerevisiae. Science 244:
1346-1348 (1989).
[0702] 274. Yanisch-Perron, C, Vieira, J, Messing, J: Improved M13
phage cloning vectors and host strains: nucleotide sequences of the
M13mp18 and pUC19 vectors. Gene 33: 103-119 (1985).
[0703] 275. van der, E A, Teertstra, R, Weisbeek, P J: Initiation
and termination of the bacteriophage phi X174 rolling circle DNA
replication in vivo: packaging of plasmid single-stranded DNA into
bacteriophage phi X174 coats. Nucleic Acids Res 10: 6849-6863
(1982).
[0704] 276. Woolston, C J, Barker, R, Gunn, H, Boulton, M I,
Mullineaux, P M. Agroinfection and nucleotide sequence of cloned
wheat dwarf virus DNA. Plant Mol. Biol. 11: 3543. 1988.
[0705] 277. Schalk, H J, Matzeit, V, Schiller, B, Schell, J,
Gronenborn, B: Wheat dwarf virus, a geminivirus of graminaceous
plants needs splicing for replication. EMBO J 8: 359-364
(1989).
[0706] 278. Arai, N, Kornberg, A: Rep protein as a helicase in an
active, isolatable replication fork of duplex phi X174 DNA. J Biol
Chem 256: 5294-5298 (1981).
[0707] 279. Bialkowska-Hobrzanska, H, Denhardt, D T: The rep
mutation. VII. Cloning and analysis of the functional rep gene of
Escherichia coli K-12. Gene 28: 93-102 (1984).
[0708] 280. Messing, J, Crea, R, Seeburg, P H: A system for shotgun
DNA sequencing. Nucleic Acids Res 9: 309-321 (1981).
[0709] 281. Lee, E C, Yu, D, Martinez, d, V, Tessarollo, L, Swing,
D A, Court, D L, Jenkins, N A, Copeland, N G: A highly efficient
Escherichia coli-based chromosome engineering system adapted for
recombinogenic targeting and subcloning of BAC DNA. Genomics 73:
56-65 (2001).
[0710] 282. Datsenko, K A, Wanner, B L: One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR products. Proc
Natl Acad Sci U S A 97: 6640-6645 (2000).
[0711] 283. Kowalczykowski, S C, Dixon, D A, Eggleston, A K,
Lauder, S D, Rehrauer, W M: Biochemistry of homologous
recombination in Escherichia coli. Microbiol. Rev. 58: 401-465
(1994).
[0712] 284. Paques, F, Haber, J E: Multiple pathways of
recombination induced by double-strand breaks in Saccharomyces
cerevisiae. Microbiol. Mol. Biol. Rev. 63: 349-404 (1999).
[0713] 285. Habu, T, Taki, T, West, A, Nishimune, Y, Morita, T: The
mouse and human homologs of DMC1, the yeast meiosis-specific
homologous recombination gene, have a common unique form of
exon-skipped transcript in meiosis. Nucleic Acids Res. 24: 470-477
(1996).
[0714] 286. Doutriaux, M P, Couteau, F, Bergounioux, C, White, C:
Isolation and characterisation of the RAD51 and DMC1 homologs from
Arabidopsis thaliana. Mol. Gen.Genet. 257: 283-291 (1998).
[0715] 287. Shinohara, A, Ogawa, H, Matsuda, Y, Ushio, N, Ikeo, K,
Ogawa, T: Cloning of human, mouse and fission yeast recombination
genes homologous to RAD51 and recA [published erratum appears in
Nat Genet 1993 Nov.;5(3):312]. Nat. Genet. 4: 239-243 (1993).
[0716] 288. Muris, D F, Bezzubova, O, Buerstedde, J M, Vreeken, K,
Balajee, A S, Osgood, C J, Troelstra, C, Hoeijmakers, J H,
Ostermann, K, Schmidt, H: Cloning of human and mouse genes
homologous to RAD52, a yeast gene involved in DNA repair and
recombination. Mutat. Res. 315: 295-305 (1994).
[0717] 289. Milne, G T, Weaver, D T: Dominant negative alleles of
RAD52 reveal a DNA repair/recombination complex including Rad51 and
Rad52. Genes Dev. 7: 1755-1765 (1993).
[0718] 290. Muyrers, J P, Zhang, Y, Buchholz, F, Stewart, A F:
RecE/RecT and Redalpha/Redbeta initiate double-stranded break
repair by specifically interacting with their respective partners.
Genes Dev. 14: 1971-1982 (2000).
[0719] 291. Link, A J, Olson, M V: Physical map of the
Saccharomyces cerevisiae genome at 110-kilobase resolution.
Genetics 127: 681-698 (1991).
[0720] 292. Atanassova, R, Chaubet, N, Gigot, C: A 126 bp fragment
of a plant histone gene promoter confers preferential expression in
meristems of transgenic Arabidopsis. Plant J 2: 291-300 (1992).
[0721] 293. Soni, R, Carmichael, J P, Shah, Z H, Murray, J A: A
family of cyclin D homologs from plants differentially controlled
by growth regulators and containing the conserved retinoblastoma
protein interaction motif. Plant Cell 7: 85-103 (1995).
[0722] 294. Riou-Khamlichi, C, Menges, M, Healy, J M, Murray, J A:
Sugar control of the plant cell cycle: differential regulation of
Arabidopsis D-type cyclin gene expression. Mol Cell Biol 20:
45134521 (2000).
[0723] 295. von Arnim, A G, Deng, X W, Stacey, M G: Cloning vectors
for the expression of green fluorescent protein fusion proteins in
transgenic plants. Gene 221: 35-43 (1998).
[0724] 296. Xiang, C, Han, P, Lutziger, I, Wang, K, Oliver, D J: A
mini binary vector series for plant transformation. Plant Mol Biol
40: 711-717 (1999).
[0725] 297. Rozwadowski, K, Kreiser, T, Hasnadka, R, Lydiate, D.
AtMRE11: a component of meiotic recombination and DNA repair in
plants. 10th International Conference on Arabidopsis Research,
Melbourne, Australia, Jul. 4-8, 1999.
[0726] 298. Friedberg, E C, Walker, G C, Siede, W: DNA Repair and
Mutagenesis. American Society for Microbiology, Washington, D.C.
(1995).
[0727] 299. Keeney, S, Giroux, C N, KIeckner, N: Meiosis-specific
DNA double-strand breaks are catalyzed by Spo11, a member of a
widely conserved protein family. Cell 88: 375-384 (1997).
[0728] 300. Keeney, S, Baudat, F, Angeles, M, Zhou, Z H, Copeland,
N G, Jenkins, N A, Manova, K, Jasin, M: A mouse homolog of the
Saccharomyces cerevisiae meiotic recombination DNA transesterase
Spo11p. Genomics 61: 170-182 (1999).
[0729] 301. Hartung, F, Puchta, H: Molecular characterisation of
two paralogous SPO11 homologues in Arabidopsis thaliana. Nucleic
Acids Res. 28: 1548-1554 (2000).
[0730] 302. Wu, K, Malik, K, Tian, L, Hu, M, Martin, T, Foster, E,
Brown, D, Miki, B: Enhancers and core promoter elements are
essential for the activity of a cryptic gene activation sequence
from tobacco, tCUP. Mol Genet Genomics 265: 763-770 (2001).
[0731] 303. Odell, J T, Nagy, F, Chua, N H: Identification of DNA
sequences required for activity of the cauliflower mosaic virus 35S
promoter. Nature 313: 810-812 (1985).
[0732] 304. Bevan, M W, Flavell, R B, Chilton, M D: A chimaeric
antibiotic resistance gene as a selectable marker for plant cell
transformation. 1983. Biotechnology 24: 367-370 (1992).
[0733] 305. Callis, J, Raasch, J A, Vierstra, R D: Ubiquitin
extension proteins of Arabidopsis thaliana. Structure,
localization, and expression of their promoters in transgenic
tobacco. J Biol Chem 265: 12486-12493 (1990).
[0734] 306. Mandel, T, Fleming, A J, Krahenbuhl, R, Kuhlemeier, C:
Definition of constitutive gene expression in plants: the
translation initiation factor 4A gene as a model. Plant Mol Biol
29: 995-1004 (1995).
[0735] 307. Zhang, W, McElroy, D, Wu, R: Analysis of rice Act1 5'
region activity in transgenic rice plants. Plant Cell 3: 1155-1165
(1991).
[0736] 308. Jacobs, M, Dolferus, R, Van den, B D: Isolation and
biochemical analysis of ethyl methanesulfonate-induced alcohol
dehydrogenase null mutants of arabidopsis thaliana (L.) Heynh.
Biochem Genet 26: 105-122 (1988).
[0737] 309. Koncz, C, Schell, J. The promoter of TL-DNA gene 5
controls the tissue-specific expression of chimaeric genes carried
by a novel type of Agrobacterium binary vector. Mol. Gen. Genet.
204, pp. 383-396. 1986.
[0738] 310. Bechtold, N, Pelletier, G: In planta
Agrobacterium-mediated transformation of adult Arabidopsis thaliana
plants by vacuum infiltration. Methods Mol Biol 82: 259-266
(1998).
[0739] 311. Sathasivan, K, Haughn, G W, Murai, N: Nucleotide
sequence of a mutant acetolactate synthase gene from an
imidazolinone-resistant Arabidopsis thaliana var. Columbia. Nucleic
Acids Res 18: 2188 (1990).
[0740] 312. Castellano, M M, Sanz-Burgos, A P, Gutierrez, C:
Initiation of DNA replication in a eukaryotic rolling-circle
replicon: identification of multiple DNA-protein complexes at the
geminivirus origin. J Mol Biol 290: 639-652 (1999).
[0741] 313. Leanna, C A, Hannink, M: The reverse two-hybrid system:
a genetic scheme for selection against specific protein/protein
interactions. Nucleic Acids Res 24: 3341-3347 (1996).
[0742] 314. Concepts in Eukaryotic DNA Replication. Cold Spring
Harbor Press, Cold Spring Harbor, N.Y. (1999).
[0743] 315. Biological Responses to DNA Damage. Cold Spring Harbor
Press, Cold Spring Harbor, N.Y. (2000).
[0744] 316. Scully, R, Puget, N, Vlasakova, K: DNA polymerase
stalling, sister chromatid recombination and the BRCA genes.
Oncogene 19: 6176-6183 (2000).
[0745] 317. Michel, B: Replication fork arrest and DNA
recombination. Trends Biochem Sci 25: 173-178 (2000).
[0746] 318. Haber, J E: DNA recombination: the replication
connection. Trends Biochem. Sci. 24: 271-275 (1999).
[0747] 319. Bell, J B, Jones, M E: Purification and
characterization of yeast orotidine 5'-monophosphate decarboxylase
overexpressed from plasmid PGU2. J Biol Chem266:
12662-12667(1991).
[0748] 320. Harris, P, Navarro Poulsen, J C, Jensen, K F, Larsen,
S: Structural basis for the catalytic mechanism of a proficient
enzyme: orotidine 5'-monophosphate decarboxylase. Biochemistry 39:
4217-4224 (2000).
[0749] 321. Marsischky, G T, Filosi, N, Kane, M F, Kolodner, R:
Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in
MSH2-dependent mismatch repair. Genes Dev. 10: 407420 (1996).
[0750] 322. Rose, M, Winston, F: Identification of a Ty insertion
within the coding sequence of the S. cerevisiae URA3 gene. 193:
557-560 (1984).
[0751] 323. Gietz, R D, Schiestl, R H, Willems, A R, Woods, R A:
Studies on the transformation of intact yeast cells by the
LiAc/SS-DNA/PEG procedure. Yeast 11: 355-360 (1995).
[0752] 324. Adams, A, Gottschling, D E, Kaiser, C A, Stearns, T:
Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press,
(1997).
[0753] 325. Kobayashi, T, Hotta, Y, Tabata, S: Isolation and
characterization of a yeast gene that is homologous with a
meiosis-specific cDNA from a plant. Mol. Gen. Genet. 237: 225-232
(1993).
[0754] 326. Devore, J L: Probability and Statistics. Duxbury Press,
(1995).
[0755] 327. Lea, D, Coulson, C. The distribution of the numbers of
mutants in bacterial populations. J. Genet. 49: 264-285. 1948.
[0756] 328. Dixon, W, Massey F.: Introduction to statistical
analysis. McGraw-Hill, Inc., New York (1969).
[0757] Additional Reference List
[0758] An, Y Q, McDowell, J M, Huang, S, McKinney, E C, Chambliss,
S, Meagher, R B: Strong, constitutive expression of the Arabidopsis
ACT2/ACT8 actin subclass in vegetative tissues. Plant J 10: 107-121
(1996). Ref ID: 1708
[0759] An, Y Q, Huang, S, McDowell, J M, McKinney, E C, Meagher, R
B: Conserved expression of the Arabidopsis ACT1 and ACT 3 actin
subclass in organ primordia and mature pollen. Plant Cell 8: 15-30
(1996). Ref ID: 1711
[0760] Bertling, W M, Aigner, T. Evidence for tissue specific
activation of the retrotransposon L1 in mice. J. Cell. Biochem.
suppl. 18B, p. 45. 1994. Ref ID: 761
[0761] Boyer, H. Genetic control of restriction and modification in
Escherichia coli. J Bacteriol 88, pp. 1652-1660. 1964. Ref ID:
1685
[0762] Bratthauer, G L, Fanning, TG: Active LIM-1 retrotransposons
in human testicular cancer. Oncogene 7: 507-510 (1992). Ref ID:
763
[0763] Clark, A B, Cook, M E, Tran, H T, Gordenin, D A, Resnick, M
A, Kunkel, T A: Functional analysis of human MutSalpha and MutSbeta
complexes in yeast. Nucleic Acids Res. 27: 736-742 (1999). Ref ID:
270
[0764] Critchlow, S E, Jackson, S P: DNA end-joining: from yeast to
man. Trends Biochem. Sci. 23: 394-398 (1998). Ref ID: 114
[0765] Dawe, R K: MEIOTIC CHROMOSOME ORGANIZATION AND SEGREGATION
IN PLANTS. standard.dtl Annu. Rev. Plant Physiol. Plant Mol. Biol.
49: 371 (1998). Ref ID: 1679
[0766] de Boer, H A, Comstock, L J, Vasser, M: The tac promoter: a
functional hybrid derived from the trp and lac promoters. Proc.
Natl. Acad. Sci. U.S.A 80: 21-25 (1983). Ref ID: 1688
[0767] Dean, R B, Dixon, w: Simplified statistics for small numbers
of observations. Anal. Chem. 23: 636-638 (1951). Ref ID: 201
[0768] Gietz, R D, Schiestl, R H, Willems, A R, Woods, R A: Studies
on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG
procedure. Yeast 11: 355-360 (1995). Ref ID: 212
[0769] Goldfarb, D S, Gariepy, J, Schoolnik, G, Kornberg, R D:
Synthetic peptides as nuclear localization signals. Nature 322:
641-644 (1986). Ref ID: 1372
[0770] Herzer, P J, Inouye, S, Inouye, M: Retron-Ec107 is inserted
into the Escherichia coli genome by replacing a palindromic 34 bp
intergenic sequence. Mol. Microbiol. 6: 345-354 (1992). Ref ID:
1664
[0771] Hopfher, K P, Putnam, C D, Tainer, J A: DNA double-strand
break repair from head to tail. Curr. Opin. Struct. Biol. 12:
115-122 (2002). Ref ID: 1020
[0772] Huang, S, An, Y Q, McDowell, J M, McKinney, E C, Meagher, R
B: The Arabidopsis thaliana ACT4/ACT12 actin gene subclass is
strongly expressed throughout pollen development. Plant J 10:
189-202 (1996). Ref ID: 1707
[0773] Huang, S, An, Y Q, McDowell, J M, McKinney, E C, Meagher, R
B: The Arabidopsis ACT11 actin gene is strongly expressed in
tissues of the emerging inflorescence, pollen, and developing
ovules. Plant Mol. Biol. 33: 125-139 (1997). Ref ID: 1706
[0774] Inouye, M, Inouye, S: Retrons and multicopy single-stranded
DNA. J. Bacteriol. 174: 2419-2424 (1992). Ref ID: 1648
[0775] Inouye, M, Mao, J R, Shimamoto, T, Inouye, S: In vivo
production of oligodeoxyribonucleotides of specific sequences:
application to antisense DNA. Ciba Found. Symp. 209:224-33;
discussion 233-4.: 224-233 (1997). Ref ID: 1652
[0776] Kleckner, N: Meiosis: how could it work? Proc. Natl. Acad.
Sci. U.S.A 93: 8167-35 8174 (1996). Ref ID: 76
[0777] Lewis, L K, Resnick, M A: Tying up loose ends: nonhomologous
end-joining in Saccharomyces cerevisiae. Mutat. Res. 451: 71-89
(2000). Ref ID: 1026
[0778] Lim, D, Maas, W K: Reverse transcriptase-dependent synthesis
of a covalently linked, branched DNA-RNA compound in E. coli B.
Cell 56: 891-904 (1989). Ref ID: 1647
[0779] Malik, K, Wu, K, Li, X Q, Martin-Heller, T, Hu, M, FosterE,
Tian, L, Wang, C, Ward, K, Jordan, M, Brown, D, Gleddie, S,
Simmonds, D, Zheng, S, Simmonds, J, Miki, B: A constitutive gene
expression system derived from the tCUP cryptic promoter elements.
Theor. Appl. Genet. 105: 505-514 (2002). Ref ID: 1698
[0780] Mao, J R, Shimada, M, Inouye, S, Inouye, M: Gene regulation
by antisense DNA produced in vivo. J. Biol. Chem. 270: 19684-19687
(1995). Ref ID: 1646
[0781] Mathews, D H, Sabina, J, Zuker, M, Turner, D H: Expanded
sequence dependence of thermodynamic parameters improves prediction
of RNA secondary structure. J Mol. Biol. 288: 911-940 (1999). Ref
ID: 1689
[0782] McDowell, J M, An, Y Q, Huang, S, McKinney, E C, Meagher, R
B: The arabidopsis ACT7 actin gene is expressed in rapidly
developing tissues and responds to several external stimuli. Plant
Physiol 111: 699-711 (1996). Ref ID: 1709
[0783] Mirochnitchenko, O, Inouye, S, Inouye, M: Production of
single-stranded DNA in mammalian cells by means of a bacterial
retron. J. Biol. Chem. 269: 2380-2383 (1994). Ref ID: 1650
[0784] Miyata, S, Ohshima, A, Inouye, S, Inouye, M: In vivo
production of a stable single-stranded cDNA in Saccharomyces
cerevisiae by means of a bacterial retron. Proc. Natl. Acad. Sci.
U.S.A 89: 5735-5739 (1992). Ref ID: 1649
[0785] Nelson, M, Silver, P: Context affects nuclear protein
localization in Saccharomyces cerevisiae. Mol. Cell Biol. 9:
384-389 (1989). Ref ID: 1362
[0786] Ochman, H, Selander, R K: Standard reference strains of
Escherichia coli from natural populations. J. Bacteriol. 157:
690-693 (1984). Ref ID: 1657
[0787] Pittman, D L, Schimenti, J C: Recombination in the mammalian
germ line. Curr. Tpo. Dev. Biol 37: 1-35 (1998). Ref ID: 829
[0788] Puchta, H, Hohn, B: From centiMorgans to base pairs:
homologous recombination in plants. Trends in Plant Science 1:
340-348 (1996). Ref ID: 1678
[0789] 64. Song, B, Sung, P: Functional interactions among yeast
Rad51 recombinase, Rad52 mediator, and replication protein A in DNA
strand exchange. J Biol. Chem. 275: 15895-15904 (2000). Ref ID:
1693
[0790] Sung, P: Yeast Rad55 and Rad57 proteins form a heterodimer
that functions with replication protein A to promote DNA strand
exchange by Rad51 recombinase. Genes Dev. 11: 1111-1121 (1997). Ref
ID: 1692
[0791] Symington, L S, Fortin, G S. A novel class of rad51 alleles
that partially bypass the requirement for the yeast RAD51 paralogs
in DNA repair. Marians, K J, Rothstein, R J eds. p. 110. 2002.
Keystone Symposium on Molecular Mechanisms of DNA Replication and
Recombination. 1-7-2002. Ref ID: 1691
[0792] Tamura, K, Adachi, Y, Chiba, K, Oguchi, K, Takahashi, H:
Identification of Ku70 and Ku80 homologues in Arabidopsis thaliana:
evidence for a role in the repair of DNA double-strand breaks.
Plant J. 29: 771-781 (2002). Ref ID: 1093
[0793] Tishkoff, D X, Johnson, A W, Kolodner, R D: Molecular and
genetic analysis of the gene encoding the Saccharomyces cerevisiae
strand exchange protein September 1. Mol. Cell Biol. 11: 2593-2608
(1991). Ref ID: 209
[0794] van der Krol, A R, Chua, N H: The basic domain of plant
B-ZIP proteins facilitates import of a reporter protein into plant
nuclei. Plant Cell 3: 667-675 (1991). Ref ID: 1363
[0795] Wohlleben, W, Arnold, W, Broer, I, Hillemann, D, Strauch, E,
Puhler, A: Nucleotide sequence of the phosphinothricin
N-acetyltransferase gene from Streptomyces viridochromogenes Tu494
and its expression in Nicotiana tabacum. Gene 70: 25-37 (1988). Ref
ID: 1713
[0796] Wold, M S: Replication protein A: a heterotrimeric,
single-stranded DNA-binding protein required for eukaryotic DNA
metabolism. Annu. Rev. Biochem. 66: 61-92 (1997). Ref ID: 99
[0797] Yeom, Y L Abe, K, Bennett, D, Artzt, K:
Testis-/embryo-expressed genes are clustered in the mouse H-2K
region. Proc Natl Acad Sci U S A 89: 773-777 (1992). Ref ID:
764
[0798] Zickler, D, Kleckner, N: The leptotene-zygotene transition
of meiosis. Annu. Rev. Genet. 32: 619-697 (1998). Ref ID:504
[0799] Kanaar, R, Troelstra, C, Swagemakers, S M, Essers, J, Smit,
B, Franssen, J H, Pastink, A, Bezzubova, O Y, Buerstedde, J M,
Clever, B, Heyer, W D, Hoeijmakers, J H: Human and mouse homologs
of the Saccharomyces cerevisiae RAD54 DNA repair gene: evidence for
functional conservation. Curr. Biol. 6: 828-838 (1996). Ref ID:
150
[0800] Hendrickson, E A: Cell-cycle regulation of mammalian DNA
double-strand-break repair. Am. J. Hum. Genet. 61: 795-800 (1997).
Ref ID: 1022
[0801] Yamamoto, A, Taki, T, Yagi, H, Habu, T, Yoshida, K,
Yoshimura, Y, Yamamoto, K, Matsushiro, A, Nishimune, Y, Morita, T:
Cell cycle-dependent expression of the mouse Rad51 gene in
proliferating cells. Mol. Gen. Genet. 251: 1-12 (1996). Ref ID:
1695
[0802] Rajan, J V, Wang, M, Marquis, S T, Chodosh, L A: Brca2 is
coordinately regulated with Brcal during proliferation and
differentiation in mammary epithelial cells. Proc. Natl. Acad. Sci.
U.S.A 93: 13078-13083 (1996). Ref ID: 1696
Sequence CWU 1
1
6 1 1023 DNA Artificial Sequence NLS-RT Sequence 1 ggatccaaaa
aaatggctcc taagaagaag agaaaggttg gaggaggacc cgggaagtcc 60
gctgaatatt tgaacacttt tagattgaga aatctcggcc tacctgtcat gaacaatttg
120 catgacatgt ctaaggcgac tcgcatatct gttgaaacac ttcggttgtt
aatctataca 180 gctgattttc gctataggat ctacactgta gaaaagaaag
gcccagagaa gagaatgaga 240 accatttacc aaccttctcg agaacttaaa
gccttacaag gatgggttct acgtaacatt 300 ttagataaac tgtcgtcatc
tcctttttct attggatttg aaaagcacca atctattttg 360 aataatgcta
ccccgcatat tggggcaaac tttatactga atattgattt ggaggatttt 420
ttcccaagtt taactgctaa caaagttttt ggagtgttcc attctcttgg ttataatcga
480 ctaatatctt cagttttgac aaaaatatgt tgttataaaa atctgctacc
acaaggtgct 540 ccatcatcac ctaaattagc taatctaata tgttctaaac
ttgattatcg tattcagggt 600 tatgcaggta gtcggggctt gatatatacg
agatatgccg atgatctcac cttatctgca 660 cagtctatga aaaaggttgt
taaagcacgt gattttttat tttctataat cccaagtgaa 720 ggattggtta
ttaactcaaa aaaaacttgt attagtgggc ctcgtagtca gaggaaagtt 780
acaggtttag ttatttcaca agagaaagtt gggataggta gagaaaaata taaagaaatt
840 agagcaaaga tacatcatat attttgcggt aagtcttctg agatagaaca
cgttagggga 900 tggttgtcat ttattttaag tgtggattca aaaagccata
ggagattaat aacttatatt 960 agcaaattag aaaaaaaata tggaaagaac
cctttaaata aagcgaagac ctaataactg 1020 cag 1023 2 1106 DNA
Artificial Sequence Resynthesized Version of NLS-RT 2 ggatccaaaa
caatggctcc taagaagaag aggaaggttg gagccggcgg agattacaag 60
gatgatgatg ataagggagt taacggagga ggtggaggag gtggaggtgg aggcgccaag
120 tctgctgagt acctcaacac cttcaggctc aggaacctcg gactccctgt
tatgaacaac 180 ctccacgata tgtctaaggc taccaggatc tctgttgaga
ccctcaggct cctcatctac 240 accgctgatt tcaggtacag gatctacacc
gttgagaaga agggacctga gaagaggatg 300 aggaccatct accaaccttc
tagggaactt aaggctctcc aaggatgggt tctcaggaac 360 atcctcgata
agctctcttc ttctcctttc tctatcggat tcgagaagca ccaatctatc 420
ctcaacaacg ctacccctca catcggagct aacttcatcc tcaacatcga tcttgaagat
480 ttcttccctt ctctcaccgc taacaaggtt ttcggagttt tccactctct
cggatacaac 540 aggctcatct cttctgttct caccaagatc tgctgctaca
agaacctcct ccctcaaggt 600 gctccttctt ctcctaagct cgctaacctc
atctgctcta agctcgatta cagaattcaa 660 ggatacgctg gatctagggg
actcatctac accaggtacg ctgatgatct caccctctct 720 gctcaatcta
tgaagaaggt tgttaaggct agggatttcc tcttctctat catcccttct 780
gagggactcg ttatcaactc taagaagacc tgcatctctg gacctaggtc tcaaaggaag
840 gttaccggac tcgttatctc tcaagagaag gttggaatcg gaagggagaa
gtacaaggag 900 atcagggcta agatccacca catcttctgc ggaaagtctt
ctgagatcga gcacgttagg 960 ggatggctct ctttcatcct ctctgttgat
tctaagtctc acaggaggct catcacctac 1020 atctctaagc ttgaaaagaa
gtacggaaag aaccctctca acaaggctaa gacctaatga 1080 gcggccgcac
tagtgatatc tctaga 1106 3 237 DNA Artificial Sequence STEM3 Sequence
3 ggatcccccg ggcgccagca gtggctgcgc acccttagcg agaggtttat cattaaggtc
60 aacctctgga tgttgtttcg gcatcctgca ttgaatctga gttactgtct
gttttccttg 120 ttggaacgga gagcatcgtc tagacaacga tatctgatgc
tctccgagcc aaccaggaaa 180 cccgtttttt ctgacgtaag ggtgcgcagc
cgctgttggc gtggccaatg cggccgc 237 4 268 DNA Artificial Sequence
STOP-stem Sequence 4 ggatcccccg ggcgccagca gtggctgcgc acccttagcg
agaggtttat cattaaggtc 60 aacctctgga tgttgtttcg gcatcctgca
ttgaatctga gttactgtct gttttccttg 120 ttggaacgga gagcatcgtc
tagaggatcc gggtcgctcg ctgcgtcgct gcggaattcg 180 atatctgatg
ctctccgagc caaccaggaa acccgttttt tctgacgtaa gggtgcgcag 240
ccgctgttgg cgtggccaat gcggccgc 268 5 221 DNA Artificial Sequence
3'-recruitment Sequence 5 tctagacccg gggatgctct ccgagccaac
caggaaaccc gttttttctg acgtaagggt 60 gcgcagccac tgctggcgaa
ttcgccagca gtggctgcgc acccttagcg agaggtttat 120 cattaaggtc
aacctctgga tgttgtttcg gcatcctgca ttgaatctga gttactgtct 180
gttttccttg ttggaacgga gagcatcgcg gccgcctgca g 221 6 54 DNA
Artificial Sequence Cloned NLS Sequence 6 ggatccaaaa aaatggctcc
taagaagaag agaaaggttg gaggaggacc cggg 54
* * * * *
References