U.S. patent application number 10/789273 was filed with the patent office on 2005-11-10 for humanized antibodies that recognize beta amyloid peptide.
Invention is credited to Basi, Guriq, Schenk, Dale B..
Application Number | 20050249725 10/789273 |
Document ID | / |
Family ID | 26748211 |
Filed Date | 2005-11-10 |
United States Patent
Application |
20050249725 |
Kind Code |
A1 |
Schenk, Dale B. ; et
al. |
November 10, 2005 |
Humanized antibodies that recognize beta amyloid peptide
Abstract
The invention provides improved agents and methods for treatment
of diseases associated with amyloid deposits of A.beta. in the
brain of a patient. Preferred agents include humanized
antibodies.
Inventors: |
Schenk, Dale B.;
(Burlingame, CA) ; Basi, Guriq; (Palo Alto,
CA) |
Correspondence
Address: |
LAHIVE & COCKFIELD, LLP.
28 STATE STREET
BOSTON
MA
02109
US
|
Family ID: |
26748211 |
Appl. No.: |
10/789273 |
Filed: |
February 27, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10789273 |
Feb 27, 2004 |
|
|
|
10388389 |
Mar 12, 2003 |
|
|
|
10388389 |
Mar 12, 2003 |
|
|
|
10010942 |
Dec 6, 2001 |
|
|
|
10388389 |
Mar 12, 2003 |
|
|
|
09580015 |
May 26, 2000 |
|
|
|
09580015 |
May 26, 2000 |
|
|
|
09322289 |
May 28, 1999 |
|
|
|
09322289 |
May 28, 1999 |
|
|
|
09201430 |
Nov 30, 1998 |
|
|
|
6787523 |
|
|
|
|
60251892 |
Dec 6, 2000 |
|
|
|
60080970 |
Apr 7, 1998 |
|
|
|
Current U.S.
Class: |
424/141.1 ;
424/146.1 |
Current CPC
Class: |
A61K 9/0019 20130101;
A61K 2039/605 20130101; A61P 25/28 20180101; A61K 2039/55566
20130101; A61K 9/2031 20130101; A61K 2039/6037 20130101; A61P 25/00
20180101; A61K 38/1709 20130101; A61K 38/193 20130101; A61K
2039/55505 20130101; A61P 43/00 20180101; C07K 14/4711 20130101;
A61K 2039/505 20130101; A61K 9/2009 20130101; A61K 2039/55572
20130101; A61K 9/2054 20130101; C07K 2317/24 20130101; C07K 2319/00
20130101; A61K 39/00 20130101; A61K 31/00 20130101; A61K 2300/00
20130101; A61K 38/193 20130101; A61K 47/646 20170801; A61P 37/00
20180101; C07K 16/18 20130101; A61K 2039/53 20130101; A61K 9/4866
20130101; A61K 9/7023 20130101; A61K 39/0007 20130101; A61K
2039/55577 20130101; A61K 31/739 20130101; A61K 2039/55555
20130101; C07K 2317/567 20130101 |
Class at
Publication: |
424/141.1 ;
424/146.1 |
International
Class: |
A61K 039/395 |
Claims
We claim:
1. A method for effecting improvement of cognition in a subject
having a condition or disease related to A.beta., comprising
administering to the subject an effective amount of an anti-A.beta.
antibody.
2. The method of claim 1, wherein the subject is human.
3. The method of claim 2, wherein the condition or disease is
Alzheimer's disease, Down's syndrome, or mild cognitive
impairment.
4. The method of claim 3, wherein the disease is Alzheimer's
disease.
5. The method of claim 3, wherein the disease or condition is
Down's syndrome.
6. The method of claim 3, wherein the disease or condition is mild
cognitive impairment.
7. The method of any one of claims 1-6, wherein the antibody binds
A.beta. with an affinity of at least 10.sup.-9 M.
8. The method of any one of claims 1-6, wherein the antibody binds
A.beta. with an affinity of at least 10.sup.-10 M.
9. The method of any one of claims 1-8, wherein the antibody is a
humanized or human antibody.
10. The method of claim 9, wherein the antibody is a humanized 266
antibody, or an analog thereof.
11. The method of any one of claims 1-10, wherein the anti-A.beta.
antibody recognizes the same epitope that antibody 266 recognizes
or competes with antibody 266 for binding to soluble A.beta..
12. The method of any one of claims 1-11, wherein the affinity is
measured with respect to either A.beta.1-40 or A.beta.1-42.
13. The method of any one of claims 1-12, additionally comprising
measuring cognition in the subject before administering the
antibody
14. The method of claim 13, additionally comprising measuring
cognition in the subject after administering the antibody.
15. The method of claim 14, wherein the measure of cognition after
administering the antibody shows a significant improvement in
cognition compared with the measure of cognition before
administering the antibody.
16. The method of any one of claims 1-15, additionally comprising
measuring cognition in the subject after administrating the
antibody.
17. The use of an anti-A.beta. antibody to prepare a medicament for
any one of the methods of claims 1-16.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of prior-filed
application U.S. Ser. No. 10/010,942 filed Dec. 6, 2001 entitled
"Humanized Antibodies that Recognize Beta Amyloid Peptide"
(pending) which, in turn, claims the benefit of prior-filed
provisional patent application U.S. Ser. No. 60/251,892 (filed Dec.
6, 2000) entitled "Humanized Antibodies That Recognize Beta-Amyloid
Peptide" (expired). The entire content of the above-referenced
applications is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Alzheimer's disease (AD) is a progressive disease resulting
in senile dementia. See generally Selkoe, TINS 16:403 (1993); Hardy
et al., WO 92/13069; Selkoe, J. Neuropathol. Exp. Neurol. 53:438
(1994); Duff et al., Nature 373:476 (1995); Games et al., Nature
373:523 (1995). Broadly speaking, the disease falls into two
categories: late onset, which occurs in old age (65+years) and
early onset, which develops well before the senile period, i.e.,
between 35 and 60 years. In both types of disease, the pathology is
the same but the abnormalities tend to be more severe and
widespread in cases beginning at an earlier age. The disease is
characterized by at least two types of lesions in the brain,
neurofibrillary tangles and senile plaques. Neurofibrillary tangles
are intracellular deposits of microtubule associated tau protein
consisting of two filaments twisted about each other in pairs.
Senile plaques (i.e., amyloid plaques) are areas of disorganized
neuropil up to 150 .mu.m across with extracellular amyloid deposits
at the center which are visible by microscopic analysis of sections
of brain tissue. The accumulation of amyloid plaques within the
brain is also associated with Down's syndrome and other cognitive
disorders.
[0003] The principal constituent of the plaques is a peptide termed
A.beta. or .beta.-amyloid peptide. A.beta. peptide is a 4-kDa
internal fragment of 39-43 amino acids of a larger transmembrane
glycoprotein named protein termed amyloid precursor protein (APP).
As a result of proteolytic processing of APP by different secretase
enzymes, A.beta. is primarily found in both a short form, 40 amino
acids in length, and a long form, ranging from 42-43 amino acids in
length. Part of the hydrophobic transmembrane domain of APP is
found at the carboxy end of A.beta., and may account for the
ability of A.beta. to aggregate into plaques, particularly in the
case of the long form. Accumulation of amyloid plaques in the brain
eventually leads to neuronal cell death. The physical symptoms
associated with this type of neural deterioration characterize
Alzheimer's disease.
[0004] Several mutations within the APP protein have been
correlated with the presence of Alzheimer's disease. See, e.g.,
Goate et al., Nature 349:704) (1991) (valine.sup.717 to
isoleucine); Chartier Harlan et al. Nature 353:844 (1991))
(valine.sup.717 to glycine); Murrell et al., Science 254:97 (1991)
(valine.sup.717 to phenylalanine); Mullan et al., Nature Genet.
1:345 (1992) (a double mutation changing
lysine.sup.595-methionine.sup.596 to
asparagine.sup.595-leucine.sup.596). Such mutations are thought to
cause Alzheimer's disease by increased or altered processing of APP
to A.beta., particularly processing of APP to increased amounts of
the long form of A.beta. (i.e., A.beta.1-42 and A.beta.1-43).
Mutations in other genes, such as the presenilin genes, PS1 and
PS2, are thought indirectly to affect processing of APP to generate
increased amounts of long form A.beta. (see Hardy, TINS 20: 154
(1997)).
[0005] Mouse models have been used successfully to determine the
significance of amyloid plaques in Alzheimer's (Games et al.,
supra, Johnson-Wood et al., Proc. Natl. Acad. Sci. USA 94:1550
(1997)). In particular, when PDAPP transgenic mice, (which express
a mutant form of human APP and develop Alzheimer's disease at a
young age), are injected with the long form of A.beta., they
display both a decrease in the progression of Alzheimer's and an
increase in antibody titers to the A.beta. peptide (Schenk et al.,
Nature 400, 173 (1999)). The observations discussed above indicate
that A.beta., particularly in its long form, is a causative element
in Alzheimer's disease.
[0006] McMichael, EP 526,511, proposes administration of
homeopathic dosages (less than or equal to 10.sup.-2 mg/day) of
A.beta. to patients with preestablished AD. In a typical human with
about 5 liters of plasma, even the upper limit of this dosage would
be expected to generate a concentration of no more than 2 pg/ml.
The normal concentration of A.beta. in human plasma is typically in
the range of 50-200 pg/ml (Seubert et al., Nature 359:325 (1992)).
Because EP 526,511's proposed dosage would barely alter the level
of endogenous circulating A.beta. and because EP 526,511 does not
recommend use of an adjuvant, as an immunostimulant, it seems
implausible that any therapeutic benefit would result.
[0007] Accordingly, there exists the need for new therapies and
reagents for the treatment of Alzheimer's disease, in particular,
therapies and reagents capable of effecting a therapeutic benefit
at physiologic (e.g., non-toxic) doses.
SUMMARY OF THE INVENTION
[0008] The present invention features new immunological reagents,
in particular, therapeutic antibody reagents for the prevention and
treatment of amyloidogenic disease (e.g., Alzheimer's disease). The
invention is based, at least in part, on the identification and
characterization of two monoclonal antibodies that specifically
bind to A.beta. peptide and are effective at reducing plaque burden
and/or reducing the neuritic dystrophy associated with
amyloidogenic disorders. Structural and functional analysis of
these antibodies leads to the design of various humanized
antibodies for prophylactic and/or therapeutic use. In particular,
the invention features humanization of the variable regions of
these antibodies and, accordingly provides for humanized
immunoglobulin or antibody chains, intact humanized immunoglobulins
or antibodies, and functional immunoglobulin or antibody fragments,
in particular, antigen binding fragments, of the featured
antibodies.
[0009] Polypeptides comprising the complementarity determining
regions of the featured monoclonal antibodies are also disclosed,
as are polynucleotide reagents, vectors and host suitable for
encoding said polypeptides.
[0010] Methods of treatment of amyloidogenic diseases or disorders
(e.g., Alzheimer's disease) are disclosed, as are pharmaceutical
compositions and kits for use in such applications.
[0011] Also featured are methods of identifying residues within the
featured monoclonal antibodies which are important for proper
immunologic function and for identifying residues which are
amenable to substitution in the design of humanized antibodies
having improved binding affinities and/or reduced immunogenicity,
when used as therapeutic reagents.
[0012] Also featured are antibodies (e.g., humanized antibodies)
having altered effector functions, and therapeutic uses
thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 depicts an alignment of the amino acid sequences of
the light chain of mouse 3D6, humanized 3D6, Kabat ID 109230 and
germline A19 antibodies. CDR regions are indicated by arrows. Bold
italics indicate rare murine residues. Bold indicates packing
(VH+VL) residues. Solid fill indicates canonical/CDR interacting
residues. Asterisks indicate residues selected for backmutation in
humanized 3D6, version 1.
[0014] FIG. 2 depicts an alignment of the amino acid sequences of
the heavy chain of mouse 3D6, humanized 3D6, Kabat ID 045919 and
germline VH3-23 antibodies. Annotation is the same as for FIG.
1.
[0015] FIG. 3 graphically depicts the A.beta. binding properties of
3D6, chimeric 3D6 and 10D5. FIG. 3A is a graph depicting binding of
A.beta. to chimeric 3D6 (PK1614) as compared to murine 3D6. FIG. 3B
is a graph depicting competition of biotinylated 3D6 versus
unlabeled 3D6, PK1614 and 10D5 for binding to A.beta..
[0016] FIG. 4 depicts a homology model of 3D6 VH and VL, showing
.alpha.-carbon backbone trace. VH is shown in as a stippled line,
and VL is shown as a solid line. CDR regions are indicated in
ribbon form.
[0017] FIG. 5 graphically depicts the A.beta. binding properties of
chimeric 3D6 and humanized 3D6. FIG. 5A depicts ELISA results
measuring the binding of humanized 3D6v1 and chimeric 3D6 to
aggregated A.beta.. FIG. 5B depicts ELISA results measuring the
binding of humanized 3D6v1 and humanized 3D6v2 to aggregated
A.beta..
[0018] FIG. 6 is a graph quantitating the binding of humanized 3D6
and chimeric 3D6 to A.beta. plaques from brain sections of PDAPP
mice.
[0019] FIG. 7 is a graph showing results of a competitive binding
assay testing the ability of humanized 3D6 versions 1 and 2,
chimeric 3D6, murine 3D6, and 10D5 to compete with murine 3D6 for
binding to A.beta..
[0020] FIG. 8 graphically depicts of an ex vivo phagocytosis assay
testing the ability of humanized 3D6v2, chimeric 3D6, and human IgG
to mediate the uptake of A.beta. by microglial cells.
[0021] FIG. 9 depicts an alignment of the 10D5 VL and 3D6 VL amino
acid sequences. Bold indicates residues that match 10D5
exactly.
[0022] FIG. 10 depicts an alignment of the 10D5 VH and 3D6 VH amino
acid sequences. Bold indicates residues that match 10D5
exactly.
DETAILED DESCRIPTION OF THE INVENTION
[0023] The present invention features new immunological reagents
and methods for preventing or treating Alzheimer's disease or other
amyloidogenic diseases. The invention is based, at least in part,
on the characterization of two monoclonal immunoglobulins, 3D6 and
10D5, effective at binding beta amyloid protein (A.beta.) (e.g.,
binding soluble and/or aggregated A.beta.), mediating phagocytosis
(e.g., of aggregated A.beta.), reducing plaque burden and/or
reducing neuritic dystrophy (e.g., in patient). The invention is
further based on the determination and structural characterization
of the primary and secondary structure of the variable light and
heavy chains of these immunoglobulins and the identification of
residues important for activity and immunogenicity.
[0024] Immunoglobulins are featured which include a variable light
and/or variable heavy chain of the preferred monoclonal
immunoglobulins described herein. Preferred immunoglobulins, e.g.,
therapeutic immunoglobulins, are featured which include a humanized
variable light and/or humanized variable heavy chain. Preferred
variable light and/or variable heavy chains include a
complementarity determining region (CDR) from the monoclonal
immunoglobulin (e.g., donor immunoglobulin) and variable framework
regions substantially from a human acceptor immunoglobulin. The
phrase "substantially from a human acceptor immunoglobulin" means
that the majority or key framework residues are from the human
acceptor sequence, allowing however, for substitution of residues
at certain positions with residues selected to improve activity of
the humanized immunoglobulin (e.g., alter activity such that it
more closely mimics the activity of the donor immunoglobulin) or
selected to decrease the immunogenicity of the humanized
immunoglobulin.
[0025] In one embodiment, the invention features a humanized
immunoglobulin light or heavy chain that includes 3D6 variable
region complementarity determining regions (CDRs) (i.e., includes
one, two or three CDRs from the light chain variable region
sequence set forth as SEQ ID NO:2 or includes one, two or three
CDRs from the heavy chain variable region sequence set forth as SEQ
ID NO:4), and includes a variable framework region substantially
from a human acceptor immunoglobulin light or heavy chain sequence,
provided that at least one residue of the framework residue is
backmutated to a corresponding murine residue, wherein said
backmutation does not substantially affect the ability of the chain
to direct A.beta. binding.
[0026] In another embodiment, the invention features a humanized
immunoglobulin light or heavy chain that includes 3D6 variable
region complementarity determining regions (CDRs) (e.g., includes
one, two or three CDRs from the light chain variable region
sequence set forth as SEQ ID NO:2 and/or includes one, two or three
CDRs from the heavy chain variable region sequence set forth as SEQ
ID NO:4), and includes a variable framework region substantially
from a human acceptor immunoglobulin light or heavy chain sequence,
provided that at least one framework residue is substituted with
the corresponding amino acid residue from the mouse 3D6 light or
heavy chain variable region sequence, where the framework residue
is selected from the group consisting of (a) a residue that
non-covalently binds antigen directly; (b) a residue adjacent to a
CDR; (c) a CDR-interacting residue (e.g., identified by modeling
the light or heavy chain on the solved structure of a homologous
known immunoglobulin chain); and (d) a residue participating in the
VL-VH interface.
[0027] In another embodiment, the invention features a humanized
immunoglobulin light or heavy chain that includes 3D6 variable
region CDRs and variable framework regions from a human acceptor
immunoglobulin light or heavy chain sequence, provided that at
least one framework residue is substituted with the corresponding
amino acid residue from the mouse 3D6 light or heavy chain variable
region sequence, where the framework residue is a residue capable
of affecting light chain variable region conformation or function
as identified by analysis of a three-dimensional model of the
variable region, for example a residue capable of interacting with
antigen, a residue proximal to the antigen binding site, a residue
capable of interacting with a CDR, a residue adjacent to a CDR, a
residue within 6 .ANG. of a CDR residue, a canonical residue, a
vernier zone residue, an interchain packing residue, an unusual
residue, or a glycoslyation site residue on the surface of the
structural model.
[0028] In another embodiment, the invention features a humanized
immunoglobulin light chain that includes 3D6 variable region CDRs
(e.g., from the 3D6 light chain variable region sequence set forth
as SEQ ID NO:2), and includes a human acceptor immunoglobulin
variable framework region, provided that at least one framework
residue selected from the group consisting of L1, L2, L36 and L46
(Kabat numbering convention) is substituted with the corresponding
amino acid residue from the mouse 3D6 light chain variable region
sequence. In another embodiment, the invention features a humanized
immunoglobulin heavy chain that includes 3D6 variable region CDRs
(e.g., from the 3D6 heavy chain variable region sequence set forth
as SEQ ID NO:4), and includes a human acceptor immunoglobulin
variable framework region, provided that at least one framework
residue selected from the group consisting of H49, H93 and H94
(Kabat numbering convention) is substituted with the corresponding
amino acid residue from the mouse 3D6 heavy chain variable region
sequence.
[0029] Preferred light chains include kappa II framework regions of
the subtype kappa II (Kabat convention), for example, framework
regions from the acceptor immunoglobulin Kabat ID 019230, Kabat ID
005131, Kabat ID 005058, Kabat ID 005057, Kabat ID 005059, Kabat ID
U21040 and Kabat ID U41645. Preferred heavy chains include
framework regions of the subtype III (Kabat convention), for
example, framework regions from the acceptor immunoglobulin Kabat
ID 045919, Kabat ID 000459, Kabat ID 000553, Kabat ID 000386 and
Kabat ID M23691.
[0030] In one embodiment, the invention features a humanized
immunoglobulin light or heavy chain that includes 10D5 variable
region complementarity determining regions (CDRs) (i.e., includes
one, two or three CDRs from the light chain variable region
sequence set forth as SEQ ID NO:14 or includes one, two or three
CDRs from the heavy chain variable region sequence set forth as SEQ
ID NO:16), and includes a variable framework region substantially
from a human acceptor immunoglobulin light or heavy chain sequence,
provided that at least one residue of the framework residue is
backmutated to a corresponding murine residue, wherein said
backmutation does not substantially affect the ability of the chain
to direct A.beta. binding.
[0031] In another embodiment, the invention features a humanized
immunoglobulin light or heavy chain that includes 10D5 variable
region complementarity determining regions (CDRs) (e.g., includes
one, two or three CDRs from the light chain variable region
sequence set forth as SEQ ID NO:14 and/or includes one, two or
three CDRs from the heavy chain variable region sequence set forth
as SEQ ID NO:16), and includes a variable framework region
substantially from a human acceptor immunoglobulin light or heavy
chain sequence, provided that at least one framework residue is
substituted with the corresponding amino acid residue from the
mouse 3D6 light or heavy chain variable region sequence, where the
framework residue is selected from the group consisting of (a) a
residue that non-covalently binds antigen directly; (b) a residue
adjacent to a CDR; (c) a CDR-interacting residue (e.g., identified
by modeling the light or heavy chain on the solved structure of a
homologous known immunoglobulin chain); and (d) a residue
participating in the VL-VH interface.
[0032] In another embodiment, the invention features a humanized
immunoglobulin light or heavy chain that includes 10D5 variable
region CDRs and variable framework regions from a human acceptor
immunoglobulin light or heavy chain sequence, provided that at
least one framework residue is substituted with the corresponding
amino acid residue from the mouse 10D5 light or heavy chain
variable region sequence, where the framework residue is a residue
capable of affecting light chain variable region conformation or
function as identified by analysis of a three-dimensional model of
the variable region, for example a residue capable of interacting
with antigen, a residue proximal to the antigen binding site, a
residue capable of interacting with a CDR, a residue adjacent to a
CDR, a residue within 6 .ANG. of a CDR residue, a canonical
residue, a vernier zone residue, an interchain packing residue, an
unusual residue, or a glycoslyation site residue on the surface of
the structural model.
[0033] In another embodiment, the invention features, in addition
to the substitutions described above, a substitution of at least
one rare human framework residue. For example, a rare residue can
be substituted with an amino acid residue which is common for human
variable chain sequences at that position. Alternatively, a rare
residue can be substituted with a corresponding amino acid residue
from a homologous germline variable chain sequence (e.g., a rare
light chain framework residue can be substituted with a
corresponding germline residue from an A1, A17, A18, A2, or A19
germline immunoglobulin sequence or a rare heavy chain framework
residue can be substituted with a corresponding germline residue
from a VH3-48, VH3-23, VH3-7, VH3-21 or VH3-11 germline
immunoglobulin sequence.
[0034] In another embodiment, the invention features a humanized
immunoglobulin that includes a light chain and a heavy chain, as
described above, or an antigen-binding fragment of said
immunoglobulin. In an exemplary embodiment, the humanized
immunoglobulin binds (e.g., specifically binds) to beta amyloid
peptide (A.beta.) with a binding affinity of at least 10.sup.7
M.sup.-1, 10.sup.8 M.sup.-1, or 10.sup.9 M.sup.-1. In another
embodiment, the immunoglobulin or antigen binding fragment includes
a heavy chain having isotype .gamma.1. In another embodiment, the
immunoglobulin or antigen binding fragment binds (e.g.,
specifically binds) to both soluble beta amyloid peptide (A.beta.)
and aggregated A.beta.. In another embodiment, the immunoglobulin
or antigen binding fragment mediates phagocytosis (e.g., induces
phagocytosis) of beta amyloid peptide (A.beta.). In yet another
embodiment, the immunoglobulin or antigen binding fragment crosses
the blood-brain barrier in a subject. In yet another embodiment,
the immunoglobulin or antigen binding fragment reduces both beta
amyloid peptide (A.beta.) burden and neuritic dystrophy in a
subject.
[0035] In another embodiment, the invention features chimeric
immunoglobulins that include 3D6 variable regions (e.g., the
variable region sequences set forth as SEQ ID NO:2 or SEQ ID NO:4).
As used herein, an antibody or immunoglobulin sequence comprising a
VL and/or VH sequence as set forth in, for example, SEQ ID NO:2 or
SEQ ID NO:4 can comprise either the full VL or VH sequence or can
comprise the mature VL or VH sequence (i.e., mature peptide without
the signal or leader peptide). In yet another embodiment, the
invention features an immunoglobulin, or antigen-binding fragment
thereof, including a variable heavy chain region as set forth in
SEQ ID NO:8 and a variable light chain region as set forth in SEQ
ID NO:5. In yet another embodiment, the invention features an
immunoglobulin, or antigen-binding fragment thereof, including a
variable heavy chain region as set forth in SEQ ID NO:12 and a
variable light chain region as set forth in SEQ ID NO:11. In
another embodiment, the invention features chimeric immunoglobulins
that include 10D5 variable regions (e.g., the variable region
sequences set forth as SEQ ID NO:14 or SEQ ID NO:16). In yet
another embodiment, the immunoglobulin, or antigen-binding fragment
thereof, further includes constant regions from IgG1.
[0036] The immunoglobulins described herein are particularly suited
for use in therapeutic methods aimed at preventing or treating
amyloidogenic diseases. In one embodiment, the invention features a
method of preventing or treating an amyloidogenic disease (e.g.,
Alzheimer's disease) that involves administering to the patient an
effective dosage of a humanized immunoglobulin as described herein.
In another embodiment, the invention features pharmaceutical
compositions that include a humanized immunoglobulin as described
herein and a pharmaceutical carrier. Also featured are isolated
nucleic acid molecules, vectors and host cells for producing the
immunoglobulins or immunoglobulin fragments or chains described
herein, as well as methods for producing said immunoglobulins,
immunoglobulin fragments or immunoglobulin chains
[0037] The present invention further features a method for
identifying 3D6 or 10D5 residues amenable to substitution when
producing a humanized 3D6 or 10D5 immunoglobulin, respectively. For
example, a method for identifying variable framework region
residues amenable to substitution involves modeling the
three-dimensional structure of the 3D6 or 10D5 variable region on a
solved homologous immunoglobulin structure and analyzing said model
for residues capable of affecting 3D6 or 10D5 immunoglobulin
variable region conformation or function, such that residues
amenable to substitution are identified. The invention further
features use of the variable region sequence set forth as SEQ ID
NO:2 or SEQ ID NO:4, or any portion thereof, in producing a
three-dimensional image of a 3D6 immunoglobulin, 3D6 immunoglobulin
chain, or domain thereof. Also featured is the use of the variable
region sequence set forth as SEQ ID NO:14 or SEQ ID NO:16, or any
portion thereof, in producing a three-dimensional image of a 10D5
immunoglobulin, 10D5 immunoglobulin chain, or domain thereof.
[0038] The present invention further features immunoglobulins
having altered effector function, such as the ability to bind
effector molecules, for example, complement or a receptor on an
effector cell. In particular, the immunoglobulin of the invention
has an altered constant region, e.g., Fc region, wherein at least
one amino acid residue in the Fc region has been replaced with a
different residue or side chain. In one embodiment, the modified
immunoglobulin is of the IgG class, comprises at least one amino
acid residue replacement in the Fc region such that the
immunoglobulin has an altered effector function, e.g., as compared
with an unmodified immunoglobulin. In particular embodiments, the
immunoglobulin of the invention has an altered effector function
such that it is less immunogenic (e.g., does not provoke undesired
effector cell activity, lysis, or complement binding), has improved
amyloid clearance properties, and/or has a desirable half-life.
[0039] Prior to describing the invention, it may be helpful to an
understanding thereof to set forth definitions of certain terms to
be used hereinafter.
[0040] The term "immunoglobulin" or "antibody" (used
interchangeably herein) refers to an antigen-binding protein having
a basic four-polypeptide chain structure consisting of two heavy
and two light chains, said chains being stabilized, for example, by
interchain disulfide bonds, which has the ability to specifically
bind antigen. Both heavy and light chains are folded into domains.
The term "domain" refers to a globular region of a heavy or light
chain polypeptide comprising peptide loops (e.g., comprising 3 to 4
peptide loops) stabilized, for example, by .beta.-pleated sheet
and/or intrachain disulfide bond. Domains are further referred to
herein as "constant" or "variable", based on the relative lack of
sequence variation within the domains of various class members in
the case of a "constant" domain, or the significant variation
within the domains of various class members in the case of a
"variable" domain. "Constant" domains on the light chain are
referred to interchangeably as "light chain constant regions",
"light chain constant domains", "CL" regions or "CL" domains).
"Constant" domains on the heavy chain are referred to
interchangeably as "heavy chain constant regions", "heavy chain
constant domains", "CH" regions or "CH" domains). "Variable"
domains on the light chain are referred to interchangeably as
"light chain variable regions", "light chain variable domains",
"VL" regions or "VL" domains). "Variable" domains on the heavy
chain are referred to interchangeably as "heavy chain constant
regions", "heavy chain constant domains", "CH" regions or "CH"
domains).
[0041] The term "region" refers to a part or portion of an antibody
chain and includes constant or variable domains as defined herein,
as well as more discrete parts or portions of said domains. For
example, light chain variable domains or regions include
"complementarity determining regions" or "CDRs" interspersed among
"framework regions" or "FRs", as defined herein.
[0042] Immunoglobulins or antibodies can exist in monomeric or
polymeric form. The term "antigen-binding fragment" refers to a
polypeptide fragment of an immunoglobulin or antibody binds antigen
or competes with intact antibody (i.e., with the intact antibody
from which they were derived) for antigen binding (i.e., specific
binding). The term "conformation" refers to the tertiary structure
of a protein or polypeptide (e.g., an antibody, antibody chain,
domain or region thereof). For example, the phrase "light (or
heavy) chain conformation" refers to the tertiary structure of a
light (or heavy) chain variable region, and the phrase "antibody
conformation" or "antibody fragment conformation" refers to the
tertiary structure of an antibody or fragment thereof.
[0043] "Specific binding" of an antibody mean that the antibody
exhibits appreciable affinity for antigen or a preferred epitope
and, preferably, does not exhibit significant crossreactivity.
"Appreciable" or preferred binding include binding with an affinity
of at least 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9 M.sup.-1, or
10.sup.10 M.sup.-1. Affinities greater than 10.sup.7 M.sup.-1,
preferably greater than 10.sup.8 M.sup.-1 are more preferred.
Values intermediate of those set forth herein are also intended to
be within the scope of the present invention and a preferred
binding affinity can be indicated as a range of affinities, for
example, 10.sup.6 to 10.sup.10 M.sup.-1, preferably 10.sup.7 to
10.sup.10 M.sup.-1, more preferably 10.sup.8 to 10.sup.10 M.sup.-1.
An antibody that "does not exhibit significant crossreactivity" is
one that will not appreciably bind to an undesirable entity (e.g.,
an undesirable proteinaceous entity). For example, an antibody that
specifically binds to A.beta. will appreciably bind A.beta. but
will not significantly react with non-A.beta. proteins or peptides
(e.g., non-A.beta. proteins or peptides included in plaques). An
antibody specific for a preferred epitope will, for example, not
significantly crossreact with remote epitopes on the same protein
or peptide. Specific binding can be determined according to any
art-recognized means for determining such binding. Preferably,
specific binding is determined according to Scatchard analysis
and/or competitive binding assays.
[0044] Binding fragments are produced by recombinant DNA
techniques, or by enzymatic or chemical cleavage of intact
immunoglobulins. Binding fragments include Fab, Fab', F(ab').sub.2,
Fabc, Fv, single chains, and single-chain antibodies. Other than
"bispecific" or "bifunctional" immunoglobulins or antibodies, an
immunoglobulin or antibody is understood to have each of its
binding sites identical. A "bispecific" or "bifunctional antibody"
is an artificial hybrid antibody having two different heavy/light
chain pairs and two different binding sites. Bispecific antibodies
can be produced by a variety of methods including fusion of
hybridomas or linking of Fab' fragments. See, e.g., Songsivilai
& Lachmann, Clin. Exp. Immunol. 79:315-321 (1990); Kostelny et
al., J. Immunol. 148, 1547-1553 (1992).
[0045] The term "humanized immunoglobulin" or "humanized antibody"
refers to an immunoglobulin or antibody that includes at least one
humanized immunoglobulin or antibody chain (i.e., at least one
humanized light or heavy chain). The term "humanized immunoglobulin
chain" or "humanized antibody chain" (i.e., a "humanized
immunoglobulin light chain" or "humanized immunoglobulin heavy
chain") refers to an immunoglobulin or antibody chain (i.e., a
light or heavy chain, respectively) having a variable region that
includes a variable framework region substantially from a human
immunoglobulin or antibody and complementarity determining regions
(CDRs) (e.g., at least one CDR, preferably two CDRs, more
preferably three CDRs) substantially from a non-human
immunoglobulin or antibody, and further includes constant regions
(e.g., at least one constant region or portion thereof, in the case
of a light chain, and preferably three constant regions in the case
of a heavy chain). The term "humanized variable region" (e.g.,
"humanized light chain variable region" or "humanized heavy chain
variable region") refers to a variable region that includes a
variable framework region substantially from a human immunoglobulin
or antibody and complementarity determining regions (CDRs)
substantially from a non-human immunoglobulin or antibody.
[0046] The phrase "substantially from a human immunoglobulin or
antibody" or "substantially human" means that, when aligned to a
human immunoglobulin or antibody amino sequence for comparison
purposes, the region shares at least 80-90%, preferably 90-95%,
more preferably 95-99% identity (i.e., local sequence identity)
with the human framework or constant region sequence, allowing, for
example, for conservative substitutions, consensus sequence
substitutions, germline substitutions, backmutations, and the like.
The introduction of conservative substitutions, consensus sequence
substitutions, germline substitutions, backmutations, and the like,
is often referred to as "optimization" of a humanized antibody or
chain. The phrase "substantially from a non-human immunoglobulin or
antibody" or "substantially non-human" means having an
immunoglobulin or antibody sequence at least 80-95%, preferably
90-95%, more preferably, 96%, 97%, 98%, or 99% identical to that of
a non-human organism, e.g., a non-human mammal.
[0047] Accordingly, all regions or residues of a humanized
immunoglobulin or antibody, or of a humanized immunoglobulin or
antibody chain, except possibly the CDRs, are substantially
identical to the corresponding regions or residues of one or more
native human immunoglobulin sequences. The term "corresponding
region" or "corresponding residue" refers to a region or residue on
a second amino acid or nucleotide sequence which occupies the same
(i.e., equivalent) position as a region or residue on a first amino
acid or nucleotide sequence, when the first and second sequences
are optimally aligned for comparison purposes.
[0048] The terms "humanized immunoglobulin" or "humanized antibody"
are not intended to encompass chimeric immunoglobulins or
antibodies, as defined infra. Although humanized immunoglobulins or
antibodies are chimeric in their construction (i.e., comprise
regions from more than one species of protein), they include
additional features (i.e., variable regions comprising donor CDR
residues and acceptor framework residues) not found in chimeric
immunoglobulins or antibodies, as defined herein.
[0049] The term "significant identity" means that two polypeptide
sequences, when optimally aligned, such as by the programs GAP or
BESTFIT using default gap weights, share at least 50-60% sequence
identity, preferably 60-70% sequence identity, more preferably
70-80% sequence identity, more preferably at least 80-90% identity,
even more preferably at least 90-95% identity, and even more
preferably at least 95% sequence identity or more (e.g., 99%
sequence identity or more). The term "substantial identity" means
that two polypeptide sequences, when optimally aligned, such as by
the programs GAP or BESTFIT using default gap weights, share at
least 80-90% sequence identity, preferably 90-95% sequence
identity, and more preferably at least 95% sequence identity or
more (e.g., 99% sequence identity or more). For sequence
comparison, typically one sequence acts as a reference sequence, to
which test sequences are compared. When using a sequence comparison
algorithm, test and reference sequences are input into a computer,
subsequence coordinates are designated, if necessary, and sequence
algorithm program parameters are designated. The sequence
comparison algorithm then calculates the percent sequence identity
for the test sequence(s) relative to the reference sequence, based
on the designated program parameters. The terms "sequence identity"
and "sequence identity" are used interchangeably herein.
[0050] Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by visual
inspection (see generally Ausubel et al., Current Protocols in
Molecular Biology). One example of algorithm that is suitable for
determining percent sequence identity and sequence similarity is
the BLAST algorithm, which is described in Altschul et al., J. Mol.
Biol. 215:403 (1990). Software for performing BLAST analyses is
publicly available through the National Center for Biotechnology
Information (publicly accessible through the National Institutes of
Health NCBI internet server). Typically, default program parameters
can be used to perform the sequence comparison, although customized
parameters can also be used. For amino acid sequences, the BLASTP
program uses as defaults a wordlength (W) of 3, an expectation (E)
of 10, and the BLOSUM62 scoring matrix (see Henikoff &
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).
[0051] Preferably, residue positions which are not identical differ
by conservative amino acid substitutions. For purposes of
classifying amino acids substitutions as conservative or
nonconservative, amino acids are grouped as follows: Group I
(hydrophobic sidechains): leu, met, ala, val, leu, ile; Group II
(neutral hydrophilic side chains): cys, ser, thr; Group III (acidic
side chains): asp, glu; Group IV (basic side chains): asn, gln,
his, lys, arg; Group V (residues influencing chain orientation):
gly, pro; and Group VI (aromatic side chains): trp, tyr, phe.
Conservative substitutions involve substitutions between amino
acids in the same class. Non-conservative substitutions constitute
exchanging a member of one of these classes for a member of
another.
[0052] Preferably, humanized immunoglobulins or antibodies bind
antigen with an affinity that is within a factor of three, four, or
five of that of the corresponding non-human antibody. For example,
if the nonhuman antibody has a binding affinity of 10.sup.9
M.sup.-1, humanized antibodies will have a binding affinity of at
least 3.times.10.sup.9 M.sup.-1, 4.times.10.sup.9 M.sup.-1 or
10.sup.9 M.sup.-1. When describing the binding properties of an
immunoglobulin or antibody chain, the chain can be described based
on its ability to "direct antigen (e.g., A.beta.) binding". A chain
is said to "direct antigen binding" when it confers upon an intact
immunoglobulin or antibody (or antigen binding fragment thereof) a
specific binding property or binding affinity. A mutation (e.g., a
backmutation) is said to substantially affect the ability of a
heavy or light chain to direct antigen binding if it affects (e.g.,
decreases) the binding affinity of an intact immunoglobulin or
antibody (or antigen binding fragment thereof) comprising said
chain by at least an order of magnitude compared to that of the
antibody (or antigen binding fragment thereof) comprising an
equivalent chain lacking said mutation. A mutation "does not
substantially affect (e.g., decrease) the ability of a chain to
direct antigen binding" if it affects (e.g., decreases) the binding
affinity of an intact immunoglobulin or antibody (or antigen
binding fragment thereof) comprising said chain by only a factor of
two, three, or four of that of the antibody (or antigen binding
fragment thereof) comprising an equivalent chain lacking said
mutation.
[0053] The term "chimeric immunoglobulin" or antibody refers to an
immunoglobulin or antibody whose variable regions derive from a
first species and whose constant regions derive from a second
species. Chimeric immunoglobulins or antibodies can be constructed,
for example by genetic engineering, from immunoglobulin gene
segments belonging to different species.
[0054] An "antigen" is an entity (e.g., a protenaceous entity or
peptide) to which an antibody specifically binds.
[0055] The term "epitope" or "antigenic determinant" refers to a
site on an antigen to which an immunoglobulin or antibody (or
antigen binding fragment thereof) specifically binds. Epitopes can
be formed both from contiguous amino acids or noncontiguous amino
acids juxtaposed by tertiary folding of a protein. Epitopes formed
from contiguous amino acids are typically retained on exposure to
denaturing solvents whereas epitopes formed by tertiary folding are
typically lost on treatment with denaturing solvents. An epitope
typically includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
or 15 amino acids in a unique spatial conformation. Methods of
determining spatial conformation of epitopes include, for example,
x-ray crystallography and 2-dimensional nuclear magnetic resonance.
See, e.g., Epitope Mapping Protocols in Methods in Molecular
Biology, Vol. 66, G. E. Morris, Ed. (1996).
[0056] Antibodies that recognize the same epitope can be identified
in a simple immunoassay showing the ability of one antibody to
block the binding of another antibody to a target antigen, i.e., a
competitive binding assay. Competitive binding is determined in an
assay in which the immunoglobulin under test inhibits specific
binding of a reference antibody to a common antigen, such as
A.beta.. Numerous types of competitive binding assays are known,
for example: solid phase direct or indirect radioimmunoassay (RIA),
solid phase direct or indirect enzyme immunoassay (EIA), sandwich
competition assay (see Stahli et al., Methods in Enzymology 9:242
(1983)); solid phase direct biotin-avidin EIA (see Kirkland et al.,
J. Immunol. 137:3614 (1986)); solid phase direct labeled assay,
solid phase direct labeled sandwich assay (see Harlow and Lane,
Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1988));
solid phase direct label RIA using I-125 label (see Morel et al.,
Mol. Immunol. 25(1):7 (1988)); solid phase direct biotin-avidin EIA
(Cheung et al., Virology 176:546 (1990)); and direct labeled RIA.
(Moldenhauer et al., Scand J. Immunol. 32:77 (1990)). Typically,
such an assay involves the use of purified antigen bound to a solid
surface or cells bearing either of these, an unlabeled test
immunoglobulin and a labeled reference immunoglobulin. Competitive
inhibition is measured by determining the amount of label bound to
the solid surface or cells in the presence of the test
immunoglobulin. Usually the test immunoglobulin is present in
excess. Usually, when a competing antibody is present in excess, it
will inhibit specific binding of a reference antibody to a common
antigen by at least 50-55%, 55-60%, 60-65%, 65-70% 70-75% or
more.
[0057] An epitope is also recognized by immunologic cells, for
example, B cells and/or T cells. Cellular recognition of an epitope
can be determined by in vitro assays that measure antigen-dependent
proliferation, as determined by .sup.3H-thymidine incorporation, by
cytokine secretion, by antibody secretion, or by antigen-dependent
killing (cytotoxic T lymphocyte assay).
[0058] Exemplary epitopes or antigenic determinants can be found
within the human amyloid precursor protein (APP), but are
preferably found within the A.beta. peptide of APP. Multiple
isoforms of APP exist, for example APP.sup.695 APP.sup.751 and
APP.sup.770. Amino acids within APP are assigned numbers according
to the sequence of the APP.sup.770 isoform (see e.g., GenBank
Accession No. PO5067, also set forth as SEQ ID NO:38). A.beta.
(also referred to herein as beta amyloid peptide and A-beta)
peptide is a 4-kDa internal fragment of 39-43 amino acids of APP
(A.beta.39, A.beta.40, A.beta.41, A.beta.42 and A.beta.43).
A.beta.40, for example, consists of residues 672-711 of APP and
A.beta.42 consists of residues 673-713 of APP. As a result of
proteolytic processing of APP by different secretase enzymes iv
vivo or in situ, A.beta. is found in both a "short form", 40 amino
acids in length, and a "long form", ranging from 42-43 amino acids
in length. Preferred epitopes or antigenic determinants, as
described herein, are located within the N-terminus of the A.beta.
peptide and include residues within amino acids 1-10 of A.beta.,
preferably from residues 1-3, 1-4, 1-5, 1-6, 1-7 or 3-7 of
A.beta.42. Additional referred epitopes or antigenic determinants
include residues 2-4, 5, 6, 7 or 8 of A.beta., residues 3-5, 6, 7,
8 or 9 of A.beta.P or residues 4-7, 8, 9 or 10 of A.beta.42.
[0059] The term "amyloidogenic disease" includes any disease
associated with (or caused by) the formation or deposition of
insoluble amyloid fibrils. Exemplary amyloidogenic diseases
include, but are not limited to systemic amyloidosis, Alzheimer's
disease, mature onset diabetes, Parkinson's disease, Huntington's
disease, fronto-temporal dementia, and the prion-related
transmissible spongiform encephalopathies (kuru and
Creutzfeldt-Jacob disease in humans and scrapie and BSE in sheep
and cattle, respectively). Different amyloidogenic diseases are
defined or characterized by the nature of the polypeptide component
of the fibrils deposited. For example, in subjects or patients
having Alzheimer's disease, .beta.-amyloid protein (e.g.,
wild-type, variant, or truncated .beta.-amyloid protein) is the
characterizing polypeptide component of the amyloid deposit.
Accordingly, Alzheimer's disease is an example of a "disease
characterized by deposits of A.beta." or a "disease associated with
deposits of A.beta.", e.g., in the brain of a subject or patient.
The terms ".beta.-amyloid protein", ".beta.-amyloid peptide",
".beta.-amyloid", "A.beta." and "A.beta. peptide" are used
interchangeably herein.
[0060] The term "effective dose" or "effective dosage" is defined
as an amount sufficient to achieve or at least partially achieve
the desired effect. The term "therapeutically effective dose" is
defined as an amount sufficient to cure or at least partially
arrest the disease and its complications in a patient already
suffering from the disease. Amounts effective for this use will
depend upon the severity of the infection and the general state of
the patient's own immune system.
[0061] The term "patient" includes human and other mammalian
subjects that receive either prophylactic or therapeutic
treatment.
[0062] "Soluble" or "dissociated" A.beta. refers to non-aggregating
or disaggregated A.beta. polypeptide. "Insoluble" A.beta. refers to
aggregating A.beta. polypeptide, for example, A.beta. held together
by noncovalent bonds. A.beta. (e.g., A.beta.42) is believed to
aggregate, at least in part, due to the presence of hydrophobic
residues at the C-terminus of the peptide (part of the
transmembrane domain of APP). One method to prepare soluble A.beta.
is to dissolve lyophilized peptide in neat DMSO with sonication.
The resulting solution is centrifuged to remove any insoluble
particulates.
[0063] The term "effector function" refers to an activity that
resides in the Fc region of an antibody (e.g., an IgG antibody) and
includes, for example, the ability of the antibody to bind effector
molecules such as complement and/or Fc receptors, which can control
several immune functions of the antibody such as effector cell
activity, lysis, complement-mediated activity, antibody clearance,
and antibody half-life.
[0064] The term "effector molecule" refers to a molecule that is
capable of binding to the Fc region of an antibody (e.g., an IgG
antibody) including, but not limited to, a complement protein or a
Fc receptor.
[0065] The term "effector cell" refers to a cell capable of binding
to the Fc portion of an antibody (e.g., an IgG antibody) typically
via an Fc receptor expressed on the surface of the effector cell
including, but not limited to, lymphocytes, e.g., antigen
presenting cells and T cells.
[0066] The term "Fc region" refers to a C-terminal region of an IgG
antibody, in particular, the C-terminal region of the heavy
chain(s) of said IgG antibody. Although the boundaries of the Fc
region of an IgG heavy chain can vary slightly, a Fc region is
typically defined as spanning from about amino acid residue Cys226
to the carboxyl-terminus of an IGg heavy chain(s).
[0067] The term "Kabat numbering" unless otherwise stated, is
defined as the numbering of the residues in, e.g., an IgG heavy
chain antibody using the EU index as in Kabat et al. (Sequences of
Proteins of Immunological Interest, 5th Ed. Public Health Service,
National Institutes of Health, Bethesda, Md. (1991)), expressly
incorporated herein by reference.
[0068] The term "Fc receptor" or "FcR" refers to a receptor that
binds to the Fc region of an antibody. Typical Fc receptors which
bind to an Fc region of an antibody (e.g., an IgG antibody)
include, but are not limited to, receptors of the Fc.gamma.RI,
Fc.gamma.RII, and Fc.gamma.RIII subclasses, including allelic
variants and alternatively spliced forms of these receptors. Fc
receptors are reviewed in Ravetch and Kinet, Annu. Rev. Immunol
9:457-92 (1991); Capel et al., Immunomethods 4:25-34 (1994); and de
Haas et al., J. Lab. Clin. Med. 126:330-41 (1995).
[0069] I. Immunological and Therapeutic Reagents
[0070] Immunological and therapeutic reagents of the invention
comprise or consist of immunogens or antibodies, or functional or
antigen binding fragments thereof, as defined herein. The basic
antibody structural unit is known to comprise a tetramer of
subunits. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kDa) and
one "heavy" chain (about 50-70 kDa). The amino-terminal portion of
each chain includes a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
carboxy-terminal portion of each chain defines a constant region
primarily responsible for effector function.
[0071] Light chains are classified as either kappa or lambda and
are about 230 residues in length. Heavy chains are classified as
gamma (.gamma.), mu (.mu.), alpha (.alpha.), delta (.delta.), or
epsilon (.epsilon.), are about 450-600 residues in length, and
define the antibody's isotype as IgG, IgM, IgA, IgD and IgE,
respectively. Both heavy and light chains are folded into domains.
The term "domain" refers to a globular region of a protein, for
example, an immunoglobulin or antibody. Immunoglobulin or antibody
domains include, for example, 3 or four peptide loops stabilized by
.beta.-pleated sheet and an interchain disulfide bond. Intact light
chains have, for example, two domains (V.sub.L and C.sub.L) and
intact heavy chains have, for example, four or five domains
(V.sub.H, C.sub.H1, C.sub.H2, and C.sub.H3).
[0072] Within light and heavy chains, the variable and constant
regions are joined by a "J" region of about 12 or more amino acids,
with the heavy chain also including a "D" region of about 10 more
amino acids. (See generally, Fundamental Immunology (Paul, W., ed.,
2nd ed. Raven Press, N.Y. (1989), Ch. 7, incorporated by reference
in its entirety for all purposes).
[0073] The variable regions of each light/heavy chain pair form the
antibody binding site. Thus, an intact antibody has two binding
sites. Except in bifunctional or bispecific antibodies, the two
binding sites are the same. The chains all exhibit the same general
structure of relatively conserved framework regions (FR) joined by
three hypervariable regions, also called complementarity
determining regions or CDRs. Naturally-occurring chains or
recombinantly produced chains can be expressed with a leader
sequence which is removed during cellular processing to produce a
mature chain. Mature chains can also be recombinantly produced
having a non-naturally occurring leader sequence, for example, to
enhance secretion or alter the processing of a particular chain of
interest.
[0074] The CDRs of the two mature chains of each pair are aligned
by the framework regions, enabling binding to a specific epitope.
From N-terminal to C-terminal, both light and heavy chains comprise
the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. "FR4" also is
referred to in the art as the D/J region of the variable heavy
chain and the J region of the variable light chain. The assignment
of amino acids to each domain is in accordance with the definitions
of Kabat, Sequences of Proteins of Immunological Interest (National
Institutes of Health, Bethesda, Md., 1987 and 1991). An alternative
structural definition has been proposed by Chothia et al., J. Mol.
Biol. 196:901 (1987); Nature 342:878 (1989); and J. Mol. Biol.
186:651 (1989) (hereinafter collectively referred to as "Chothia et
al." and incorporated by reference in their entirety for all
purposes).
[0075] A. A.beta. Antibodies
[0076] Therapeutic agents of the invention include antibodies that
specifically bind to A.beta. or other component of amyloid plaques.
Such antibodies can be monoclonal or polyclonal. Some such
antibodies bind specifically to the aggregated form of A.beta.
without binding to the soluble form. Some bind specifically to the
soluble form without binding to the aggregated form. Some bind to
both aggregated and soluble forms. Some such antibodies bind to a
naturally occurring short form of A.beta. (i.e., A.beta.39, 40 or
41) without binding to a naturally occurring long form of A.beta.
(i.e., A.beta.42 and A.beta.43). Some antibodies bind to a long
form of A.beta. without binding to a short form. Some antibodies
bind to A.beta. without binding to full-length amyloid precursor
protein. Antibodies used in therapeutic methods preferably have an
intact constant region or at least sufficient of the constant
region to interact with an Fc receptor. Human isotype IgG1 is
preferred because of it having highest affinity of human isotypes
for the FcRI receptor on phagocytic cells. Bispecific Fab fragments
can also be used, in which one arm of the antibody has specificity
for A.beta., and the other for an Fc receptor. Preferred antibodies
bind to A.beta. with a binding affinity greater than (or equal to)
about 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, or 10.sup.10 M.sup.-1
(including affinities intermediate of these values).
[0077] Polyclonal sera typically contain mixed populations of
antibodies binding to several epitopes along the length of A.beta..
However, polyclonal sera can be specific to a particular segment of
A.beta., such as A.beta.1-10. Monoclonal antibodies bind to a
specific epitope within A.beta. that can be a conformational or
nonconformational epitope. Prophylactic and therapeutic efficacy of
antibodies can be tested using the transgenic animal model
procedures described in the Examples. Preferred monoclonal
antibodies bind to an epitope within residues 1-10 of A.beta. (with
the first N terminal residue of natural A.beta. designated 1). Some
preferred monoclonal antibodies bind to an epitope within amino
acids 1-5, and some to an epitope within 5-10. Some preferred
antibodies bind to epitopes within amino acids 1-3, 1-4, 1-5, 1-6,
1-7 or 3-7. Some preferred antibodies bind to an epitope starting
at resides 1-3 and ending at residues 7-11 of A.beta.. Less
preferred antibodies include those binding to epitopes with
residues 10-15, 15-20, 25-30, 10-20, 20, 30, or 10-25 of A.beta..
It is recommended that such antibodies be screened for activity in
the mouse models described in the Examples before use. For example,
it has been found that certain antibodies to epitopes within
residues 10-18, 16-24, 18-21 and 33-42 lack activity (e.g., lack
the ability to reduce plaque burden and/or resolve the neuritic
pathology associated with Alzheimer's disease). In some methods,
multiple monoclonal antibodies having binding specificities to
different epitopes are used. Such antibodies can be administered
sequentially or simultaneously. Antibodies to amyloid components
other than A.beta. can also be used (e.g., administered or
co-administered). For example, antibodies can be directed to the
amyloid associated protein synuclein.
[0078] When an antibody is said to bind to an epitope within
specified residues, such as A.beta.1-5 for example, what is meant
is that the antibody specifically binds to a polypeptide containing
the specified residues (i.e., A.beta.1-5 in this an example). Such
an antibody does not necessarily contact every residue within
A.beta.1-5. Nor does every single amino acid substitution or
deletion with in A.beta.1-5 necessarily significantly affect
binding affinity. Epitope specificity of an antibody can be
determined, for example, by forming a phage display library in
which different members display different subsequences of A.beta..
The phage display library is then selected for members specifically
binding to an antibody under test. A family of sequences is
isolated. Typically, such a family contains a common core sequence,
and varying lengths of flanking sequences in different members. The
shortest core sequence showing specific binding to the antibody
defines the epitope bound by the antibody. Antibodies can also be
tested for epitope specificity in a competition assay with an
antibody whose epitope specificity has already been determined. For
example, antibodies that compete with the 3D6 antibody for binding
to A.beta. bind to the same or similar epitope as 3D6, i.e., within
residues A.beta.1-5. Likewise antibodies that compete with the 10D5
antibody bind to the same or similar epitope, i.e., within residues
A.beta.3-7. Screening antibodies for epitope specificity is a
useful predictor of therapeutic efficacy. For example, an antibody
determined to bind to an epitope within residues 1-7 of A.beta. is
likely to be effective in preventing and treating Alzheimer's
disease according to the methodologies of the present
invention.
[0079] Monoclonal or polyclonal antibodies that specifically bind
to a preferred segment of A.beta. without binding to other regions
of A.beta. have a number of advantages relative to monoclonal
antibodies binding to other regions or polyclonal sera to intact
A.beta.. First, for equal mass dosages, dosages of antibodies that
specifically bind to preferred segments contain a higher molar
dosage of antibodies effective in clearing amyloid plaques. Second,
antibodies specifically binding to preferred segments can induce a
clearing response against amyloid deposits without inducing a
clearing response against intact APP polypeptide, thereby reducing
the potential side effects.
[0080] 1. Production of Nonhuman Antibodies
[0081] The present invention features non-human antibodies, for
example, antibodies having specificity for the preferred A.beta.
epitopes of the invention. Such antibodies can be used in
formulating various therapeutic compositions of the invention or,
preferably, provide complementarity determining regions for the
production of humanized or chimeric antibodies (described in detail
below). The production of non-human monoclonal antibodies, e.g.,
murine, guinea pig, primate, rabbit or rat, can be accomplished by,
for example, immunizing the animal with A.beta.. A longer
polypeptide comprising A.beta. or an immunogenic fragment of
A.beta. or anti-idiotypic antibodies to an antibody to A.beta. can
also be used. See Harlow & Lane, supra, incorporated by
reference for all purposes). Such an immunogen can be obtained from
a natural source, by peptide synthesis or by recombinant
expression. Optionally, the immunogen can be administered fused or
otherwise complexed with a carrier protein, as described below.
Optionally, the immunogen can be administered with an adjuvant. The
term "adjuvant" refers to a compound that when administered in
conjunction with an antigen augments the immune response to the
antigen, but when administered alone does not generate an immune
response to the antigen. Adjuvants can augment an immune response
by several mechanisms including lymphocyte recruitment, stimulation
of B and/or T cells, and stimulation of macrophages. Several types
of adjuvant can be used as described below. Complete Freund's
adjuvant followed by incomplete adjuvant is preferred for
immunization of laboratory animals.
[0082] Rabbits or guinea pigs are typically used for making
polyclonal antibodies. Exemplary preparation of polyclonal
antibodies, e.g., for passive protection, can be performed as
follows. 125 non-transgenic mice are immunized with 100 .mu.g
A.beta.1-42, plus CFA/IFA adjuvant, and euthanized at 4-5 months.
Blood is collected from immunized mice. IgG is separated from other
blood components. Antibody specific for the immunogen may be
partially purified by affinity chromatography. An average of about
0.5-1 mg of immunogen-specific antibody is obtained per mouse,
giving a total of 60-120 mg.
[0083] Mice are typically used for making monoclonal antibodies.
Monoclonals can be prepared against a fragment by injecting the
fragment or longer form of A.beta. into a mouse, preparing
hybridomas and screening the hybridomas for an antibody that
specifically binds to A.beta.. Optionally, antibodies are screened
for binding to a specific region or desired fragment of A.beta.
without binding to other nonoverlapping fragments of A.beta.. The
latter screening can be accomplished by determining binding of an
antibody to a collection of deletion mutants of an A.beta. peptide
and determining which deletion mutants bind to the antibody.
Binding can be assessed, for example, by Western blot or ELISA. The
smallest fragment to show specific binding to the antibody defines
the epitope of the antibody. Alternatively, epitope specificity can
be determined by a competition assay is which a test and reference
antibody compete for binding to A.beta.. If the test and reference
antibodies compete, then they bind to the same epitope or epitopes
sufficiently proximal such that binding of one antibody interferes
with binding of the other. The preferred isotype for such
antibodies is mouse isotype IgG2a or equivalent isotype in other
species. Mouse isotype IgG2a is the equivalent of human isotype
IgG1.
[0084] 2. Chimeric and Humanized Antibodies
[0085] The present invention also features chimeric and/or
humanized antibodies (i.e., chimeric and/or humanized
immunoglobulins) specific for beta amyloid peptide. Chimeric and/or
humanized antibodies have the same or similar binding specificity
and affinity as a mouse or other nonhuman antibody that provides
the starting material for construction of a chimeric or humanized
antibody.
[0086] A. Production of Chimeric Antibodies
[0087] The term "chimeric antibody" refers to an antibody whose
light and heavy chain genes have been constructed, typically by
genetic engineering, from immunoglobulin gene segments belonging to
different species. For example, the variable (V) segments of the
genes from a mouse monoclonal antibody may be joined to human
constant (C) segments, such as IgG1 and IgG4. Human isotype IgG1 is
preferred. A typical chimeric antibody is thus a hybrid protein
consisting of the V or antigen-binding domain from a mouse antibody
and the C or effector domain from a human antibody.
[0088] B. Production of Humanized Antibodies
[0089] The term "humanized antibody" refers to an antibody
comprising at least one chain comprising variable region framework
residues substantially from a human antibody chain (referred to as
the acceptor immunoglobulin or antibody) and at least one
complementarity determining region substantially from a
mouse-antibody, (referred to as the donor immunoglobulin or
antibody). See, Queen et al., Proc. Natl. Acad. Sci. USA
86:10029-10033 (1989), U.S. Pat. No. 5,530,101, U.S. Pat. No.
5,585,089, U.S. Pat. No. 5,693,761, U.S. Pat. No. 5,693,762, Selick
et al., WO 90/07861, and Winter, U.S. Pat. No. 5,225,539
(incorporated by reference in their entirety for all purposes). The
constant region(s), if present, are also substantially or entirely
from a human immunoglobulin.
[0090] The substitution of mouse CDRs into a human variable domain
framework is most likely to result in retention of their correct
spatial orientation if the human variable domain framework adopts
the same or similar conformation to the mouse variable framework
from which the CDRs originated. This is achieved by obtaining the
human variable domains from human antibodies whose framework
sequences exhibit a high degree of sequence identity with the
murine variable framework domains from which the CDRs were derived.
The heavy and light chain variable framework regions can be derived
from the same or different human antibody sequences. The human
antibody sequences can be the sequences of naturally occurring
human antibodies or can be consensus sequences of several human
antibodies. See Kettleborough et al., Protein Engineering 4:773
(1991); Kolbinger et al., Protein Engineering 6:971 (1993) and
Carter et al., WO 92/22653.
[0091] Having identified the complementarity determining regions of
the murine donor immunoglobulin and appropriate human acceptor
immunoglobulins, the next step is to determine which, if any,
residues from these components should be substituted to optimize
the properties of the resulting humanized antibody. In general,
substitution of human amino acid residues with murine should be
minimized, because introduction of murine residues increases the
risk of the antibody eliciting a human-anti-mouse-antibody (HAMA)
response in humans. Art-recognized methods of determining immune
response can be performed to monitor a HAMA response in a
particular patient or during clinical trials. Patients administered
humanized antibodies can be given an immunogenicity assessment at
the beginning and throughout the administration of said therapy.
The HAMA response is measured, for example, by detecting antibodies
to the humanized therapeutic reagent, in serum samples from the
patient using a method known to one in the art, including surface
plasmon resonance technology (BIACORE) and/or solid-phase ELISA
analysis.
[0092] Certain amino acids from the human variable region framework
residues are selected for substitution based on their possible
influence on CDR conformation and/or binding to antigen. The
unnatural juxtaposition of murine CDR regions with human variable
framework region can result in unnatural conformational restraints;
which, unless corrected by substitution of certain amino acid
residues, lead to loss of binding affinity.
[0093] The selection of amino acid residues for substitution is
determined, in part, by computer modeling. Computer hardware and
software are described herein for producing three-dimensional
images of immunoglobulin molecules. In general, molecular models
are produced starting from solved structures for immunoglobulin
chains or domains thereof. The chains to be modeled are compared
for amino acid sequence similarity with chains or domains of solved
three-dimensional structures, and the chains or domains showing the
greatest sequence similarity is/are selected as starting points for
construction of the molecular model. Chains or domains sharing at
least 50% sequence identity are selected for modeling, and
preferably those sharing at least 60%, 70%, 80%, 90% sequence
identity or more are selected for modeling. The solved starting
structures are modified to allow for differences between the actual
amino acids in the immunoglobulin chains or domains being modeled,
and those in the starting structure. The modified structures are
then assembled into a composite immunoglobulin. Finally, the model
is refined by energy minimization and by verifying that all atoms
are within appropriate distances from one another and that bond
lengths and angles are within chemically acceptable limits.
[0094] The selection of amino acid residues for substitution can
also be determined, in part, by examination of the characteristics
of the amino acids at particular locations, or empirical
observation of the effects of substitution or mutagenesis of
particular amino acids. For example, when an amino acid differs
between a murine variable region framework residue and a selected
human variable region framework residue, the human framework amino
acid should usually be substituted by the equivalent framework
amino acid from the mouse antibody when it is reasonably expected
that the amino acid:
[0095] (1) noncovalently binds antigen directly,
[0096] (2) is adjacent to a CDR region,
[0097] (3) otherwise interacts with a CDR region (e.g., is within
about 3-6 .ANG. of a CDR region as determined by computer
modeling), or
[0098] (4) participates in the VL-VH interface.
[0099] Residues which "noncovalently bind antigen directly" include
amino acids in positions in framework regions which are have a good
probability of directly interacting with amino acids on the antigen
according to established chemical forces, for example, by hydrogen
bonding, Van der Waals forces, hydrophobic interactions, and the
like.
[0100] CDR and framework regions are as defined by Kabat et al. or
Chothia et al., supra. When framework residues, as defined by Kabat
et al., supra, constitute structural loop residues as defined by
Chothia et al., supra, the amino acids present in the mouse
antibody may be selected for substitution into the humanized
antibody. Residues which are "adjacent to a CDR region" include
amino acid residues in positions immediately adjacent to one or
more of the CDRs in the primary sequence of the humanized
immunoglobulin chain, for example, in positions immediately
adjacent to a CDR as defined by Kabat, or a CDR as defined by
Chothia (See e.g., Chothia and Lesk J M B 196:901 (1987)). These
amino acids are particularly likely to interact with the amino
acids in the CDRs and, if chosen from the acceptor, to distort the
donor CDRs and reduce affinity. Moreover, the adjacent amino acids
may interact directly with the antigen (Amit et al., Science,
233:747 (1986), which is incorporated herein by reference) and
selecting these amino acids from the donor may be desirable to keep
all the antigen contacts that provide affinity in the original
antibody.
[0101] Residues that "otherwise interact with a CDR region" include
those that are determined by secondary structural analysis to be in
a spatial orientation sufficient to effect a CDR region. In one
embodiment, residues that "otherwise interact with a CDR region"
are identified by analyzing a three-dimensional model of the donor
immunoglobulin (e.g., a computer-generated model). A
three-dimensional model, typically of the original donor antibody,
shows that certain amino acids outside of the CDRs are close to the
CDRs and have a good probability of interacting with amino acids in
the CDRs by hydrogen bonding, Van der Waals forces, hydrophobic
interactions, etc. At those amino acid positions, the donor
immunoglobulin amino acid rather than the acceptor immunoglobulin
amino acid may be selected. Amino acids according to this criterion
will generally have a side chain atom within about 3 angstrom units
(A) of some atom in the CDRs and must contain an atom that could
interact with the CDR atoms according to established chemical
forces, such as those listed above.
[0102] In the case of atoms that may form a hydrogen bond, the 3
.ANG. is measured between their nuclei, but for atoms that do not
form a bond, the 3 .ANG. is measured between their Van der Waals
surfaces. Hence, in the latter case, the nuclei must be within
about 6 .ANG. (3 .ANG. plus the sum of the Van der Waals radii) for
the atoms to be considered capable of interacting. In many cases
the nuclei will be from 4 or 5 to 6 .ANG. apart. In determining
whether an amino acid can interact with the CDRs, it is preferred
not to consider the last 8 amino acids of heavy chain CDR 2 as part
of the CDRs, because from the viewpoint of structure, these 8 amino
acids behave more as part of the framework.
[0103] Amino acids that are capable of interacting with amino acids
in the CDRs, may be identified in yet another way. The solvent
accessible surface area of each framework amino acid is calculated
in two ways: (1) in the intact antibody, and (2) in a hypothetical
molecule consisting of the antibody with its CDRs removed. A
significant difference between these numbers of about 10 square
angstroms or more shows that access of the framework amino acid to
solvent is at least partly blocked by the CDRs, and therefore that
the amino acid is making contact with the CDRs. Solvent accessible
surface area of an amino acid may be calculated based on a
three-dimensional model of an antibody, using algorithms known in
the art (e.g., Connolly, J. Appl. Cryst. 16:548 (1983) and Lee and
Richards, J. Mol. Biol. 55:379 (1971), both of which are
incorporated herein by reference). Framework amino acids may also
occasionally interact with the CDRs indirectly, by affecting the
conformation of another framework amino acid that in turn contacts
the CDRs.
[0104] The amino acids at several positions in the framework are
known to be capable of interacting with the CDRs in many antibodies
(Chothia and Lesk, supra, Chothia et al., supra and Tramontano et
al., J. Mol. Biol. 215:175 (1990), all of which are incorporated
herein by reference). Notably, the amino acids at positions 2, 48,
64 and 71 of the light chain and 26-30, 71 and 94 of the heavy
chain (numbering according to Kabat) are known to be capable of
interacting with the CDRs in many antibodies. The amino acids at
positions 35 in the light chain and 93 and 103 in the heavy chain
are also likely to interact with the CDRs. At all these numbered
positions, choice of the donor amino acid rather than the acceptor
amino acid (when they differ) to be in the humanized immunoglobulin
is preferred. On the other hand, certain residues capable of
interacting with the CDR region, such as the first 5 amino acids of
the light chain, may sometimes be chosen from the acceptor
immunoglobulin without loss of affinity in the humanized
immunoglobulin.
[0105] Residues which "participate in the VL-VH interface" or
"packing residues" include those residues at the interface between
VL and VH as defined, for example, by Novotny and Haber, Proc.
Natl. Acad. Sci. USA, 82:4592-66 (1985) or Chothia et al, supra.
Generally, unusual packing residues should be retained in the
humanized antibody if they differ from those in the human
frameworks.
[0106] In general, one or more of the amino acids fulfilling the
above criteria is substituted. In some embodiments, all or most of
the amino acids fulfilling the above criteria are substituted.
Occasionally, there is some ambiguity about whether a particular
amino acid meets the above criteria, and alternative variant
immunoglobulins are produced, one of which has that particular
substitution, the other of which does not. Alternative variant
immunoglobulins so produced can be tested in any of the assays
described herein for the desired activity, and the preferred
immunoglobulin selected.
[0107] Usually the CDR regions in humanized antibodies are
substantially identical, and more usually, identical to the
corresponding CDR regions of the donor antibody. Although not
usually desirable, it is sometimes possible to make one or more
conservative amino acid substitutions of CDR residues without
appreciably affecting the binding affinity of the resulting
humanized immunoglobulin. By conservative substitutions is intended
combinations such as gly, ala; val, ile, leu; asp, glu; asn, gln;
ser, thr; lys, arg; and phe, tyr.
[0108] Additional candidates for substitution are acceptor human
framework amino acids that are unusual or "rare" for a human
immunoglobulin at that position. These amino acids can be
substituted with amino acids from the equivalent position of the
mouse donor antibody or from the equivalent positions of more
typical human immunoglobulins. For example, substitution may be
desirable when the amino acid in a human framework region of the
acceptor immunoglobulin is rare for that position and the
corresponding amino acid in the donor immunoglobulin is common for
that position in human immunoglobulin sequences; or when the amino
acid in the acceptor immunoglobulin is rare for that position and
the corresponding amino acid in the donor immunoglobulin is also
rare, relative to other human sequences. These criterion help
ensure that an atypical amino acid in the human framework does not
disrupt the antibody structure. Moreover, by replacing an unusual
human acceptor amino acid with an amino acid from the donor
antibody that happens to be typical for human antibodies, the
humanized antibody may be made less immunogenic.
[0109] The term "rare", as used herein, indicates an amino acid
occurring at that position in less than about 20% but usually less
than about 10% of sequences in a representative sample of
sequences, and the term "common", as used herein, indicates an
amino acid occurring in more than about 25% but usually more than
about 50% of sequences in a representative sample. For example, all
human light and heavy chain variable region sequences are
respectively grouped into "subgroups" of sequences that are
especially homologous to each other and have the same amino acids
at certain critical positions (Kabat et al., supra). When deciding
whether an amino acid in a human acceptor sequence is "rare" or
"common" among human sequences, it will often be preferable to
consider only those human sequences in the same subgroup as the
acceptor sequence.
[0110] Additional candidates for substitution are acceptor human
framework amino acids that would be identified as part of a CDR
region under the alternative definition proposed by Chothia et al.,
supra. Additional candidates for substitution are acceptor human
framework amino acids that would be identified as part of a CDR
region under the AbM and/or contact definitions. Notably, CDR1 in
the variable heavy chain is defined as including residues
26-32.
[0111] Additional candidates for substitution are acceptor
framework residues that correspond to a rare or unusual donor
framework residue. Rare or unusual donor framework residues are
those that are rare or unusual (as defined herein) for murine
antibodies at that position. For murine antibodies, the subgroup
can be determined according to Kabat and residue positions
identified which differ from the consensus. These donor specific
differences may point to somatic mutations in the murine sequence
which enhance activity. Unusual residues that are predicted to
affect binding are retained, whereas residues predicted to be
unimportant for binding can be substituted.
[0112] Additional candidates for substitution are non-germline
residues occurring in an acceptor framework region. For example,
when an acceptor antibody chain (i.e., a human antibody chain
sharing significant sequence identity with the donor antibody
chain) is aligned to a germline antibody chain (likewise sharing
significant sequence identity with the donor chain), residues not
matching between acceptor chain framework and the germline chain
framework can be substituted with corresponding residues from the
germline sequence.
[0113] Other than the specific amino acid substitutions discussed
above, the framework regions of humanized immunoglobulins are
usually substantially identical, and more usually, identical to the
framework regions of the human antibodies from which they were
derived. Of course, many of the amino acids in the framework region
make little or no direct contribution to the specificity or
affinity of an antibody. Thus, many individual conservative
substitutions of framework residues can be tolerated without
appreciable change of the specificity or affinity of the resulting
humanized immunoglobulin. Thus, in one embodiment the variable
framework region of the humanized immunoglobulin shares at least
85% sequence identity to a human variable framework region sequence
or consensus of such sequences. In another embodiment, the variable
framework region of the humanized immunoglobulin shares at least
90%, preferably 95%, more preferably 96%, 97%, 98% or 99% sequence
identity to a human variable framework region sequence or consensus
of such sequences. In general, however, such substitutions are
undesirable.
[0114] The humanized antibodies preferably exhibit a specific
binding affinity for antigen of at least 10.sup.7, 10.sup.8,
10.sup.9 or 10.sup.10 M.sup.-1. Usually the upper limit of binding
affinity of the humanized antibodies for antigen is within a factor
of three, four or five of that of the donor immunoglobulin. Often
the lower limit of binding affinity is also within a factor of
three, four or five of that of donor immunoglobulin. Alternatively,
the binding affinity can be compared to that of a humanized
antibody having no substitutions (e.g., an antibody having donor
CDRs and acceptor FRs, but no FR substitutions). In such instances,
the binding of the optimized antibody (with substitutions) is
preferably at least two- to three-fold greater, or three- to
four-fold greater, than that of the unsubstituted antibody. For
making comparisons, activity of the various antibodies can be
determined, for example, by BIACORE (i.e., surface plasmon
resonance using unlabelled reagents) or competitive binding
assays.
[0115] C. Production of Humanized 3D6 Antibodies
[0116] A preferred embodiment of the present invention features a
humanized antibody to the N-terminus of A.beta., in particular, for
use in the therapeutic and/or diagnostic methodologies described
herein. A particularly preferred starting material for production
of humanized antibodies is 3D6. 3D6 is specific for the N-terminus
of A.beta. and has been shown to mediate phagocytosis (e.g., induce
phagocytosis) of amyloid plaque (see Examples I-V). The cloning and
sequencing of cDNA encoding the 3D6 antibody heavy and light chain
variable regions is described in Example VI.
[0117] Suitable human acceptor antibody sequences are identified by
computer comparisons of the amino acid sequences of the mouse
variable regions with the sequences of known human antibodies. The
comparison is performed separately for heavy and light chains but
the principles are similar for each. In particular, variable
domains from human antibodies whose framework sequences exhibit a
high degree of sequence identity with the murine VL and VH
framework regions were identified by query of the Kabat Database
using NCBI BLAST (publicly accessible through the National
Institutes of Health NCBI internet server) with the respective
murine framework sequences. In one embodiment, acceptor sequences
sharing greater that 50% sequence identity with murine donor
sequences are selected. Preferably, acceptor antibody sequences
sharing 60%, 70%, 80%, 90% or more are selected.
[0118] A computer comparison of 3D6 revealed that the 3D6 light
chain shows the greatest sequence identity to human light chains of
subtype kappa II, and that the 3D6 heavy chain shows greatest
sequence identity to human heavy chains of subtype III, as defined
by Kabat et al., supra. Thus, light and heavy human framework
regions are preferably derived from human antibodies of these
subtypes, or from consensus sequences of such subtypes. The
preferred light chain human variable regions showing greatest
sequence identity to the corresponding region from 3D6 are from
antibodies having Kabat ID Numbers 019230, 005131, 005058, 005057,
005059, U21040 and U41645, with 019230 being more preferred. The
preferred heavy chain human variable regions showing greatest
sequence identity to the corresponding region from 3D6 are from
antibodies having Kabat ID Numbers 045919, 000459, 000553, 000386
and M23691, with 045919 being more preferred.
[0119] Residues are next selected for substitution, as follows.
When an amino acid differs between a 3D6 variable framework region
and an equivalent human variable framework region, the human
framework amino acid should usually be substituted by the
equivalent mouse amino acid if it is reasonably expected that the
amino acid:
[0120] (1) noncovalently binds antigen directly,
[0121] (2) is adjacent to a CDR region, is part of a CDR region
under the alternative definition proposed by Chothia et al., supra,
or otherwise interacts with a CDR region (e.g., is within about 3 A
of a CDR region) (e.g. amino acids at positions L2, H49 and H94 of
3D6), or
[0122] (3) participates in the VL-VH interface (e.g., amino acids
at positions L36, L46 and H93 of 3D6).
[0123] Computer modeling of the 3D6 antibody heavy and light chain
variable regions, and humanization of the 3D6 antibody is described
in Example VII. Briefly, a three-dimensional model was generated
based on the closest solved murine antibody structures for the
heavy and light chains. For this purpose, an antibody designated
1CR9 (Protein Data Bank (PDB) ID: 1CR9, Kanyo et al., J. Mol. Biol.
293:855 (1999)) was chosen as a template for modeling the 3D6 light
chain, and an antibody designated 1OPG (PDB ID: 1OPG, Kodandapani
et al., J. Biol. Chem. 270:2268 (1995)) was chosen as the template
for modeling the heavy chain. The model was further refined by a
series of energy minimization steps to relieve unfavorable atomic
contacts and optimize electrostatic and van der Walls interactions.
The solved structure of 1qkz (PDB ID: 1QKZ, Derrick et al., J. Mol.
Biol. 293:81 (1999)) was chosen as a template for modeling CDR3 of
the heavy chain as 3D6 and 1OPG did not exhibit significant
sequence homology in this region when aligned for comparison
purposes.
[0124] Three-dimensional structural information for the antibodies
described herein is publicly available, for example, from the
Research Collaboratory for Structural Bioinformatics' Protein Data
Bank (PDB). The PDB is freely accessible via the World Wide Web
internet and is described by Berman et al. (2000) Nucleic Acids
Research, 28:235. Computer modeling allows for the identification
of CDR-interacting residues. The computer model of the structure of
3D6 can in turn serve as a starting point for predicting the
three-dimensional structure of an antibody containing the 3D6
complementarity determining regions substituted in human framework
structures. Additional models can be constructed representing the
structure as further amino acid substitutions are introduced.
[0125] In general, substitution of one, most or all of the amino
acids fulfilling the above criteria is desirable. Accordingly, the
humanized antibodies of the present invention will usually contain
a substitution of a human light chain framework residue with a
corresponding 3D6 residue in at least 1, 2 or 3, and more usually
4, of the following positions: L1, L2, L36 and L46. The humanized
antibodies also usually contain a substitution of a human heavy
chain framework residue with a corresponding 3D6 residue in at
least 1, 2, and sometimes 3, of the following positions: H49, H93
and H94. Humanized antibodies can also contain a substitution of a
heavy chain framework residue with a corresponding germline residue
in at least 1, 2, and sometimes 3, of the following positions: H74,
H77 and H89.
[0126] Occasionally, however, there is some ambiguity about whether
a particular amino acid meets the above criteria, and alternative
variant immunoglobulins are produced, one of which has that
particular substitution, the other of which does not. In instances
where substitution with a murine residue would introduce a residue
that is rare in human immunoglobulins at a particular position, it
may be desirable to test the antibody for activity with or without
the particular substitution. If activity (e.g., binding affinity
and/or binding specificity) is about the same with or without the
substitution, the antibody without substitution may be preferred,
as it would be expected to elicit less of a HAHA response, as
described herein.
[0127] Other candidates for substitution are acceptor human
framework amino acids that are unusual for a human immunoglobulin
at that position. These amino acids can be substituted with amino
acids from the equivalent position of more typical human
immunoglobulins. Alternatively, amino acids from equivalent
positions in the mouse 3D6 can be introduced into the human
framework regions when such amino acids are typical of human
immunoglobulin at the equivalent positions.
[0128] In additional embodiments, when the human light chain
framework acceptor immunoglobulin is Kabat ID Number 019230, the
light chain contains substitutions in at least 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12 or more usually 13, of the following positions:
L7, L10, L12, L15, L17, L39, L45, L63, L78, L83, L85, L100 or L104.
In additional embodiments when the human heavy chain framework
acceptor immunoglobulin is Kabat ID Number 045919, the heavy chain
contains substitutions in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, or more usually 15, of the following positions: H3,
H5, H13, H16, H19, H40, H41, H42, H44, H72, H77, H82A, H83, H84, or
H108. These positions are substituted with the amino acid from the
equivalent position of a human immunoglobulin having a more typical
amino acid residue. Examples of appropriate amino acids to
substitute are shown in FIGS. 1 and 2.
[0129] Other candidates for substitution are non-germline residues
occurring in a framework region. A computer comparison of 3D6 with
known germline sequences revealed that heavy chains showing the
greatest degree of sequence identity include germline variable
region sequences VH3-48, VH3-23, VH3-7, VH3-21 and VH3-11, with
VH3-23 being more preferred. Alignment of Kabat ID 045919 with
VH3-23 reveals that residues H74, H77 and/or H89 may be selected
for substitution with corresponding germline residues (e.g.,
residues H74, H77 and/or H89 when comparing Kabat ID 045919 and
VH3-23). Likewise, germline sequences having the greatest degree of
identity to the 3D6 light chain include A1, A17, A18, A2 and A19,
with A19 being most preferred. Residues not matching between a
selected light chain acceptor framework and one of these germline
sequences could be selected for substitution with the corresponding
germline residue.
[0130] Table 1 summarizes the sequence analysis of the 3D6 VH and
VL regions. Additional mouse and human structures that can be used
for computer modeling of the 3D6 antibody and additional human
antibodies are set forth as well as germline sequences that can be
used in selecting amino acid substitutions. Rare mouse residues are
also set forth in Table 1. Rare mouse residues are identified by
comparing the donor VL and/or VH sequences with the sequences of
other members of the subgroup to which the donor VL and/or VH
sequences belong (according to Kabat) and identifying the residue
positions which differ from the consensus. These donor specific
differences may point to somatic mutations which enhance activity.
Unusual or rare residues close to the binding site may possibly
contact the antigen, making it desirable to retain the mouse
residue. However, if the unusual mouse residue is not important for
binding, use of the corresponding acceptor residue is preferred as
the mouse residue may create immunogenic neoepitopes in the
humanized antibody. In the situation where an unusual residue in
the donor sequence is actually a common residues in the
corresponding acceptor sequence, the preferred residue is clearly
the acceptor residue.
1TABLE 1 Summary of 3D6 V-region sequence Chain Heavy Light Mouse
subgroup IIID (002688) II (005840-005844, 005851-005853, (Kabat seq
ID#) 005857, 005863) Mouse homologs 002727/163.1'CL 005840/1210.7
(Kabat/Genbank) 002711/H35-C6'CL 005843/42.4b.12.2'CL
002733/8-1-12-5-3-1(A2-1)'C- L 005842/BXW-14'CL 002715/ASWA2'CL
005841/42.7B3.2'CL 020669/#14'CL 005851/36-60CRI- Rare amino acids
(% N40 (0.233%) Y1(.035%) frequency of D42 (0.699%) I15 (3.3%)
occurrence in class) D27 (0.867%)-CDR1 I78 (0.677%) L85 (0.625%)
W89 (0.815%)-CDR3 K106A (0.295%) Human Subgroup III (000488-000491,
000503, 000624) II (005046) Chothia canonical H1: class 1 [2fbj]
L1: class 4 [1rmf] CDR groupings [pdb H2: class 3 [1igc] L2: class
1 [1lmk] example] L3: class 1 [1tet] Closest solved mouse PDB ID:
1OPG Kodandapani et al., PDB ID: 1CR9; Kanyo et al., supra;
structures supra; (72% 2 .ANG.) (94%, 2 .ANG.) PDB ID: 1NLD; Davies
et al., Acta Crystallogr. D. Biol. Crystallog. 53: 186 (1997);
(98%, 2.8 .ANG.) Closest solved human 1VH (68%, nmr) 1LVE (57%,
LEN) structures 443560 (65%, IgG, .lambda. myeloma, 1.8 .ANG.)
1B6DA (54%, B-J dimer, 2.8 .ANG.); KOL/2FB4H (60%, myeloma, 3
.ANG.) 1VGEL (54%, autoAb) Germline query (Hu) VH3-48
(4512283/BAA75032.1) A1(x63402) results (top 4) VH3-23
(4512287/BAA75046.1) A17 (x63403) VH3-7 (4512300/BAA75056.1) A18
(X63396) VH3-21 (4512287/BAA75047.1) A2 (m31952) VH3-11
(4152300/BAA75053.1) A19 (x63397) *heavy chain and light chain from
the same antibody (O-81, Hirabayashi et al. NAR 20: 2601).
[0131] Kabat ID sequences referenced herein are publicly available,
for example, from the Northwestern University Biomedical
Engineering Department's Kabat Database of Sequences of Proteins of
Immunological Interest. Three-dimensional structural information
for antibodies described herein is publicly available, for example,
from the Research Collaboratory for Structural Bioinformatics'
Protein Data Bank (PDB). The PDB is freely accessible via the World
Wide Web internet and is described by Berman et al. (2000) Nucleic
Acids Research, p 235-242. Germline gene sequences referenced
herein are publicly available, for example, from the National
Center for Biotechnology Information (NCBI) database of sequences
in collections of Igh, Ig kappa and Ig lambda germline V genes (as
a division of the National Library of Medicine (NLM) at the
National Institutes of Health (NIH)). Homology searching of the
NCBI "Ig Germline Genes" database is provided by IgG BLAST.TM..
[0132] In a preferred embodiment, a humanized antibody of the
present invention contains (i) a light chain comprising a variable
domain comprising murine 3D6 VL CDRs and a human acceptor
framework, the framework having at least one, preferably two, three
or four residues selected from the group consisting of L1, L2, L36,
and L46 substituted with the corresponding 3D6 residue and (ii) a
heavy chain comprising 3D6 VH CDRs and a human acceptor framework,
the framework having at least one, preferably two or three residues
selected from the group consisting of H49, H93 and H94 substituted
with the corresponding 3D6 residue, and, optionally, at least one,
preferably two or three residues selected from the group consisting
of H74, H77 and H89 is substituted with a corresponding human
germline residue.
[0133] In a more preferred embodiment, a humanized antibody of the
present invention contains (i) a light chain comprising a variable
domain comprising murine 3D6 VL CDRs and a human acceptor
framework, the framework having residue 1 substituted with a tyr
(Y), residue 2 substituted with a val (V), residue 36 substituted
with a leu (L) and/or residue 46 substituted with an arg (R), and
(ii) a heavy chain comprising 3D6 VH CDRs and a human acceptor
framework, the framework having residue 49 substituted with an ala
(A), residue 93 substituted with a val (V) and/or residue 94
substituted with an arg (R), and, optionally, having residue 74
substituted with a ser (S), residue 77 substituted with a thr (T)
and/or residue 89 substituted with a val (V).
[0134] In a particularly preferred embodiment, a humanized antibody
of the present invention has structural features, as described
herein, and further has at least one (preferably two, three, four
or all) of the following activities: (1) binds aggregated
A.beta.1-42 (e.g., as determined by ELISA); (2) binds A.beta. in
plaques (e.g., staining of AD and/or PDAPP plaques); (3) binds
A.beta. with two- to three-fold higher binding affinity as compared
to chimeric 3D6 (e.g., 3D6 having murine variable region sequences
and human constant region sequences); (4) mediates phagocytosis of
A.beta. (e.g., in an ex vivo phagocytosis assay, as described
herein); and (5) crosses the blood-brain barrier (e.g.,
demonstrates short-term brain localization, for example, in a PDAPP
animal model, as described herein).
[0135] In another embodiment, a humanized antibody of the present
invention has structural features, as described herein, binds
A.beta. in a manner or with an affinity sufficient to elicit at
least one of the following in vivo effects: (1) reduce A.beta.
plaque burden; (2) prevent plaque formation; (3) reduce levels of
soluble A.beta.; (4) reduce the neuritic pathology associated with
an amyloidogenic disorder; (5) lessens or ameliorate at least one
physiological symptom associated with an amyloidogenic disorder;
and/or (6) improves cognitive function.
[0136] In another embodiment, a humanized antibody of the present
invention has structural features, as described herein, and
specifically binds to an epitope comprising residues 1-5 or 3-7 of
A.beta..
[0137] The activities described above can be determined utilizing
any one of a variety of assays described herein or in the art
(e.g., binding assays, phagocytosis assays, etc.). Activities can
be assayed either in vivo (e.g., using labeled assay components
and/or imaging techniques) or in vitro (e.g., using samples or
specimens derived from a subject). Activities can be assayed either
directly or indirectly. In certain preferred embodiments,
neurological endpoints (e.g., amyloid burden, neuritic burden, etc)
are assayed. Such endpoints can be assayed in living subjects
(e.g., in animal models of Alzheimer's disease or in human
subjects, for example, undergoing immunotherapy) using non-invasive
detection methodologies. Alternatively, such endpoints can be
assayed in subjects post mortem. Assaying such endpoints in animal
models and/or in human subjects post mortem is useful in assessing
the effectiveness of various agents (e.g., humanized antibodies) to
be utilized in similar immunotherapeutic applications. In other
preferred embodiments, behavioral or neurological parameters can be
assessed as indicators of the above neuropathological activities or
endpoints.
[0138] 3. Human Antibodies
[0139] Human antibodies against A.beta. are provided by a variety
of techniques described below. Some human antibodies are selected
by competitive binding experiments, or otherwise, to have the same
epitope specificity as a particular mouse antibody, such as one of
the mouse monoclonals described herein. Human antibodies can also
be screened for a particular epitope specificity by using only a
fragment of A.beta. as the immunogen, and/or by screening
antibodies against a collection of deletion mutants of A.beta..
Human antibodies preferably have human IgG1 isotype
specificity.
[0140] a. Trioma Methodology
[0141] The basic approach and an exemplary cell fusion partner,
SPAZ-4, for use in this approach have been described by Oestberg et
al., Hybridoma 2:361 (1983); Oestberg, U.S. Pat. No. 4,634,664; and
Engleman et al., U.S. Pat. No. 4,634,666 (each of which is
incorporated by reference in its entirety for all purposes). The
antibody-producing cell lines obtained by this method are called
triomas, because they are descended from three cells; two human and
one mouse. Initially, a mouse myeloma line is fused with a human
B-lymphocyte to obtain a non-antibody-producing xenogeneic hybrid
cell, such as the SPAZ-4 cell line described by Oestberg, supra.
The xenogeneic cell is then fused with an immunized human
B-lymphocyte to obtain an antibody-producing trioma cell line.
Triomas have been found to produce antibody more stably than
ordinary hybridomas made from human cells.
[0142] The immunized B-lymphocytes are obtained from the blood,
spleen, lymph nodes or bone marrow of a human donor. If antibodies
against a specific antigen or epitope are desired, it is preferable
to use that antigen or epitope thereof for immunization.
Immunization can be either in vivo or in vitro. For in vivo
immunization, B cells are typically isolated from a human immunized
with A.beta., a fragment thereof, larger polypeptide containing
A.beta. or fragment, or an anti-idiotypic antibody to an antibody
to A.beta.. In some methods, B cells are isolated from the same
patient who is ultimately to be administered antibody therapy. For
in vitro immunization, B-lymphocytes are typically exposed to
antigen for a period of 7-14 days in a media such as RPMI-1640 (see
Engleman, supra) supplemented with 10% human plasma.
[0143] The immunized B-lymphocytes are fused to a xenogeneic hybrid
cell such as SPAZ-4 by well-known methods. For example, the cells
are treated with 40-50% polyethylene glycol of MW 1000-4000, at
about 37 degrees C., for about 5-10 min. Cells are separated from
the fusion mixture and propagated in media selective for the
desired hybrids (e.g., HAT or AH). Clones secreting antibodies
having the required binding specificity are identified by assaying
the trioma culture medium for the ability to bind to A.beta. or a
fragment thereof. Triomas producing human antibodies having the
desired specificity are subcloned by the limiting dilution
technique and grown in vitro in culture medium. The trioma cell
lines obtained are then tested for the ability to bind A.beta. or a
fragment thereof.
[0144] Although triomas are genetically stable they do not produce
antibodies at very high levels. Expression levels can be increased
by cloning antibody genes from the trioma into one or more
expression vectors, and transforming the vector into standard
mammalian, bacterial or yeast cell lines.
[0145] b. Transgenic Non-Human Mammals
[0146] Human antibodies against A.beta. can also be produced from
non-human transgenic mammals having transgenes encoding at least a
segment of the human immunoglobulin locus. Usually, the endogenous
immunoglobulin locus of such transgenic mammals is functionally
inactivated. Preferably, the segment of the human immunoglobulin
locus includes unrearranged sequences of heavy and light chain
components. Both inactivation of endogenous immunoglobulin genes
and introduction of exogenous immunoglobulin genes can be achieved
by targeted homologous recombination, or by introduction of YAC
chromosomes. The transgenic mammals resulting from this process are
capable of functionally rearranging the immunoglobulin component
sequences, and expressing a repertoire of antibodies of various
isotypes encoded by human immunoglobulin genes, without expressing
endogenous immunoglobulin genes. The production and properties of
mammals having these properties are described in detail by, e.g.,
Lonberg et al., WO93/12227 (1993); U.S. Pat. No. 5,877,397, U.S.
Pat. No. 5,874,299, U.S. Pat. No. 5,814,318, U.S. Pat. No.
5,789,650, U.S. Pat. No. 5,770,429, U.S. Pat. No. 5,661,016, U.S.
Pat. No. 5,633,425, U.S. Pat. No. 5,625,126, U.S. Pat. No.
5,569,825, U.S. Pat. No. 5,545,806, Nature 148:1547 (1994), Nature
Biotechnology 14:826 (1996), Kucherlapati, WO 91/10741 (1991) (each
of which is incorporated by reference in its entirety for all
purposes). Transgenic mice are particularly suitable. Anti-A.beta.
antibodies are obtained by immunizing a transgenic nonhuman mammal,
such as described by Lonberg or Kucherlapati, supra, with A.beta.
or a fragment thereof. Monoclonal antibodies are prepared by, e.g.,
fusing B-cells from such mammals to suitable myeloma cell lines
using conventional Kohler-Milstein technology. Human polyclonal
antibodies can also be provided in the form of serum from humans
immunized with an immunogenic agent. Optionally, such polyclonal
antibodies can be concentrated by affinity purification using
A.beta. or other amyloid peptide as an affinity reagent.
[0147] c. Phage Display Methods
[0148] A further approach for obtaining human anti-AD antibodies is
to screen a DNA library from human B cells according to the general
protocol outlined by Huse et al., Science 246:1275-1281 (1989). As
described for trioma methodology, such B cells can be obtained from
a human immunized with A.beta., fragments, longer polypeptides
containing A.beta. or fragments or anti-idiotypic antibodies.
Optionally, such B cells are obtained from a patient who is
ultimately to receive antibody treatment. Antibodies binding to
A.beta. or a fragment thereof are selected. Sequences encoding such
antibodies (or a binding fragments) are then cloned and amplified.
The protocol described by Huse is rendered more efficient in
combination with phage-display technology. See, e.g., Dower et al.,
WO 91/17271, McCafferty et al., WO 92/01047, Herzig et al., U.S.
Pat. No. 5,877,218, Winter et al., U.S. Pat. No. 5,871,907, Winter
et al., U.S. Pat. No. 5,858,657, Holliger et al., U.S. Pat. No.
5,837,242, Johnson et al., U.S. Pat. No. 5,733,743 and Hoogenboom
et al., U.S. Pat. No. 5,565,332 (each of which is incorporated by
reference in its entirety for all purposes). In these methods,
libraries of phage are produced in which members display different
antibodies on their outer surfaces. Antibodies are usually
displayed as Fv or Fab fragments. Phage displaying antibodies with
a desired specificity are selected by affinity enrichment to an
A.beta. peptide or fragment thereof.
[0149] In a variation of the phage-display method, human antibodies
having the binding specificity of a selected murine antibody can be
produced. See Winter, WO 92/20791. In this method, either the heavy
or light chain variable region of the selected murine antibody is
used as a starting material. If, for example, a light chain
variable region is selected as the starting material, a phage
library is constructed in which members display the same light
chain variable region (i.e., the murine starting material) and a
different heavy chain variable region. The heavy chain variable
regions are obtained from a library of rearranged human heavy chain
variable regions. A phage showing strong specific binding for
A.beta. (e.g., at least 10.sup.8 and preferably at least 10.sup.9
M.sup.-1) is selected. The human heavy chain variable region from
this phage then serves as a starting material for constructing a
further phage library. In this library, each phage displays the
same heavy chain variable region (i.e., the region identified from
the first display library) and a different light chain variable
region. The light chain variable regions are obtained from a
library of rearranged human variable light chain regions. Again,
phage showing strong specific binding for A.beta. are selected.
These phage display the variable regions of completely human
anti-A.beta. antibodies. These antibodies usually have the same or
similar epitope specificity as the murine starting material.
[0150] 4. Production of Variable Regions
[0151] Having conceptually selected the CDR and framework
components of humanized immunoglobulins, a variety of methods are
available for producing such immunoglobulins. Because of the
degeneracy of the code, a variety of nucleic acid sequences will
encode each immunoglobulin amino acid sequence. The desired nucleic
acid sequences can be produced by de novo solid-phase DNA synthesis
or by PCR mutagenesis of an earlier prepared variant of the desired
polynucleotide. Oligonucleotide-mediated mutagenesis is a preferred
method for preparing substitution, deletion and insertion variants
of target polypeptide DNA. See Adelman et al., DNA 2:183 (1983).
Briefly, the target polypeptide DNA is altered by hybridizing an
oligonucleotide encoding the desired mutation to a single-stranded
DNA template. After hybridization, a DNA polymerase is used to
synthesize an entire second complementary strand of the template
that incorporates the oligonucleotide primer, and encodes the
selected alteration in the target polypeptide DNA.
[0152] 5. Selection of Constant Regions
[0153] The variable segments of antibodies produced as described
supra (e.g., the heavy and light chain variable regions of
chimeric, humanized, or human antibodies) are typically linked to
at least a portion of an immunoglobulin constant region (Fc),
typically that of a human immunoglobulin. Human constant region DNA
sequences can be isolated in accordance with well known procedures
from a variety of human cells, but preferably immortalized B cells
(see Kabat et al., supra, and Liu et al., WO87/02671) (each of
which is incorporated by reference in its entirety for all
purposes). Ordinarily, the antibody will contain both light chain
and heavy chain constant regions. The heavy chain constant region
usually includes CH1, hinge, CH2, CH3, and CH4 regions. The
antibodies described herein include antibodies having all types of
constant regions, including IgM, IgG, IgD, IgA and IgE, and any
isotype, including IgG1, IgG2, IgG3 and IgG4. The choice of
constant region depends, in part, whether antibody-dependent
complement and/or cellular mediated toxicity is desired. For
example, isotopes IgG1 and IgG3 have complement activity and
isotypes IgG2 and IgG4 do not. When it is desired that the antibody
(e.g., humanized antibody) exhibit cytotoxic activity, the constant
domain is usually a complement fixing constant domain and the class
is typically IgG1. When such cytotoxic activity is not desirable,
the constant domain may be of the IgG2 class. Choice of isotype can
also affect passage of antibody into the brain. Human isotype IgG1
is preferred. Light chain constant regions can be lambda or kappa.
The humanized antibody may comprise sequences from more than one
class or isotype. Antibodies can be expressed as tetramers
containing two light and two heavy chains, as separate heavy
chains, light chains, as Fab, Fab' F(ab')2, and Fv, or as single
chain antibodies in which heavy and light chain variable domains
are linked through a spacer.
[0154] 6. Expression of Recombinant Antibodies
[0155] Chimeric, humanized and human antibodies are typically
produced by recombinant expression. Nucleic acids encoding light
and heavy chain variable regions, optionally linked to constant
regions, are inserted into expression vectors. The light and heavy
chains can be cloned in the same or different expression vectors.
The DNA segments encoding immunoglobulin chains are operably linked
to control sequences in the expression vector(s) that ensure the
expression of immunoglobulin polypeptides. Expression control
sequences include, but are not limited to, promoters (e.g.,
naturally-associated or heterologous promoters), signal sequences,
enhancer elements, and transcription termination sequences.
Preferably, the expression control sequences are eukaryotic
promoter systems in vectors capable of transforming or transfecting
eukaryotic host cells. Once the vector has been incorporated into
the appropriate host, the host is maintained under conditions
suitable for high level expression of the nucleotide sequences, and
the collection and purification of the crossreacting
antibodies.
[0156] These expression vectors are typically replicable in the
host organisms either as episomes or as an integral part of the
host chromosomal DNA. Commonly, expression vectors contain
selection markers (e.g., ampicillin-resistance,
hygromycin-resistance, tetracycline resistance or neomycin
resistance) to permit detection of those cells transformed with the
desired DNA sequences (see, e.g., Itakura et al., U.S. Pat. No.
4,704,362).
[0157] E. coli is one prokaryotic host particularly useful for
cloning the polynucleotides (e.g., DNA sequences) of the present
invention. Other microbial hosts suitable for use include bacilli,
such as Bacillus subtilus, and other enterobacteriaceae, such as
Salmonella, Serratia, and various Pseudomonas species. In these
prokaryotic hosts, one can also make expression vectors, which will
typically contain expression control sequences compatible with the
host cell (e.g., an origin of replication). In addition, any number
of a variety of well-known promoters will be present, such as the
lactose promoter system, a tryptophan (trp) promoter system, a
beta-lactamase promoter system, or a promoter system from phage
lambda. The promoters will typically control expression, optionally
with an operator sequence, and have ribosome binding site sequences
and the like, for initiating and completing transcription and
translation.
[0158] Other microbes, such as yeast, are also useful for
expression. Saccharomyces is a preferred yeast host, with suitable
vectors having expression control sequences (e.g., promoters), an
origin of replication, termination sequences and the like as
desired. Typical promoters include 3-phosphoglycerate kinase and
other glycolytic enzymes. Inducible yeast promoters include, among
others, promoters from alcohol dehydrogenase, isocytochrome C, and
enzymes responsible for maltose and galactose utilization.
[0159] In addition to microorganisms, mammalian tissue cell culture
may also be used to express and produce the polypeptides of the
present invention (e.g., polynucleotides encoding immunoglobulins
or fragments thereof). See Winnacker, From Genes to Clones, VCH
Publishers, N.Y., N.Y. (1987). Eukaryotic cells are actually
preferred, because a number of suitable host cell lines capable of
secreting heterologous proteins (e.g., intact immunoglobulins) have
been developed in the art, and include CHO cell lines, various Cos
cell lines, HeLa cells, preferably, myeloma cell lines, or
transformed B-cells or hybridomas. Preferably, the cells are
nonhuman. Expression vectors for these cells can include expression
control sequences, such as an origin of replication, a promoter,
and an enhancer (Queen et al., Immunol. Rev. 89:49 (1986)), and
necessary processing information sites, such as ribosome binding
sites, RNA splice sites, polyadenylation sites, and transcriptional
terminator sequences. Preferred expression control sequences are
promoters derived from immunoglobulin genes, SV40, adenovirus,
bovine papilloma virus, cytomegalovirus and the like. See Co et
al., J. Immunol. 148:1149 (1992).
[0160] Alternatively, antibody-coding sequences can be incorporated
in transgenes for introduction into the genome of a transgenic
animal and subsequent expression in the milk of the transgenic
animal (see, e.g., Deboer et al., U.S. Pat. No. 5,741,957, Rosen,
U.S. Pat. No. 5,304,489, and Meade et al., U.S. Pat. No.
5,849,992). Suitable transgenes include coding sequences for light
and/or heavy chains in operable linkage with a promoter and
enhancer from a mammary gland specific gene, such as casein or beta
lactoglobulin.
[0161] The vectors containing the polynucleotide sequences of
interest (e.g., the heavy and light chain encoding sequences and
expression control sequences) can be transferred into the host cell
by well-known methods, which vary depending on the type of cellular
host. For example, calcium chloride transfection is commonly
utilized for prokaryotic cells, whereas calcium phosphate
treatment, electroporation, lipofection, biolistics or viral-based
transfection may be used for other cellular hosts. (See generally
Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Press, 2nd ed., 1989) (incorporated by reference in
its entirety for all purposes). Other methods used to transform
mammalian cells include the use of polybrene, protoplast fusion,
liposomes, electroporation, and microinjection (see generally,
Sambrook et al., supra). For production of transgenic animals,
transgenes can be microinjected into fertilized oocytes, or can be
incorporated into the genome of embryonic stem cells, and the
nuclei of such cells transferred into enucleated oocytes.
[0162] When heavy and light chains are cloned on separate
expression vectors, the vectors are co-transfected to obtain
expression and assembly of intact immunoglobulins. Once expressed,
the whole antibodies, their dimers, individual light and heavy
chains, or other immunoglobulin forms of the present invention can
be purified according to standard procedures of the art, including
ammonium sulfate precipitation, affinity columns, column
chromatography, HPLC purification, gel electrophoresis and the like
(see generally Scopes, Protein Purification (Springer-Verlag, N.Y.,
(1982)). Substantially pure immunoglobulins of at least about 90 to
95% homogeneity are preferred, and 98 to 99% or more homogeneity
most preferred, for pharmaceutical uses.
[0163] 7. Antibody Fragments
[0164] Also contemplated within the scope of the instant invention
are antibody fragments. In one embodiment, fragments of non-human,
chimeric and/or human antibodies are provided. In another
embodiment, fragments of humanized antibodies are provided.
Typically, these fragments exhibit specific binding to antigen with
an affinity of at least 10.sup.7, and more typically 10.sup.8 or
10.sup.9 M.sup.-1. Humanized antibody fragments include separate
heavy chains, light chains Fab, Fab' F(ab')2, Fabc, and Fv.
Fragments are produced by recombinant DNA techniques, or by
enzymatic or chemical separation of intact immunoglobulins.
[0165] 8. Testing Antibodies for Therapeutic Efficacy in Animal
Models
[0166] Groups of 7-9 month old PDAPP mice each are injected with
0.5 mg in PBS of polyclonal anti-A.beta. or specific anti-A.beta.
monoclonal antibodies. All antibody preparations are purified to
have low endotoxin levels. Monoclonals can be prepared against a
fragment by injecting the fragment or longer form of A.beta. into a
mouse, preparing hybridomas and screening the hybridomas for an
antibody that specifically binds to a desired fragment of A.beta.
without binding to other nonoverlapping fragments of A.beta..
[0167] Mice are injected intraperitoneally as needed over a 4 month
period to maintain a circulating antibody concentration measured by
ELISA titer of greater than 1/1000 defined by ELISA to A.beta.42 or
other immunogen. Titers are monitored and mice are euthanized at
the end of 6 months of injections. Histochemistry, A.beta. levels
and toxicology are performed post mortem. Ten mice are used per
group.
[0168] 9. Screening Antibodies for Clearing Activity
[0169] The invention also provides methods of screening an antibody
for activity in clearing an amyloid deposit or any other antigen,
or associated biological entity, for which clearing activity is
desired. To screen for activity against an amyloid deposit, a
tissue sample from a brain of a patient with Alzheimer's disease or
an animal model having characteristic Alzheimer's pathology is
contacted with phagocytic cells bearing an Fc receptor, such as
microglial cells, and the antibody under test in a medium in vitro.
The phagocytic cells can be a primary culture or a cell line, such
as BV-2, C8-B4, or THP-1. In some methods, the components are
combined on a microscope slide to facilitate microscopic
monitoring. In some methods, multiple reactions are performed in
parallel in the wells of a microtiter dish. In such a format, a
separate miniature microscope slide can be mounted in the separate
wells, or a nonmicroscopic detection format, such as ELISA
detection of A.beta. can be used. Preferably, a series of
measurements is made of the amount of amyloid deposit in the in
vitro reaction mixture, starting from a baseline value before the
reaction has proceeded, and one or more test values during the
reaction. The antigen can be detected by staining, for example,
with a fluorescently labeled antibody to A.beta. or other component
of amyloid plaques. The antibody used for staining may or may not
be the same as the antibody being tested for clearing activity. A
reduction relative to baseline during the reaction of the amyloid
deposits indicates that the antibody under test has clearing
activity. Such antibodies are likely to be useful in preventing or
treating Alzheimer's and other amyloidogenic diseases.
[0170] Analogous methods can be used to screen antibodies for
activity in clearing other types of biological entities. The assay
can be used to detect clearing activity against virtually any kind
of biological entity. Typically, the biological entity has some
role in human or animal disease. The biological entity can be
provided as a tissue sample or in isolated form. If provided as a
tissue sample, the tissue sample is preferably unfixed to allow
ready access to components of the tissue sample and to avoid
perturbing the conformation of the components incidental to fixing.
Examples of tissue samples that can be tested in this assay include
cancerous tissue, precancerous tissue, tissue containing benign
growths such as warts or moles, tissue infected with pathogenic
microorganisms, tissue infiltrated with inflammatory cells, tissue
bearing pathological matrices between cells (e.g., fibrinous
pericarditis), tissue bearing aberrant antigens, and scar tissue.
Examples of isolated biological entities that can be used include
A.beta., viral antigens or viruses, proteoglycans, antigens of
other pathogenic microorganisms, tumor antigens, and adhesion
molecules. Such antigens can be obtained from natural sources,
recombinant expression or chemical synthesis, among other means.
The tissue sample or isolated biological entity is contacted with
phagocytic cells bearing Fc receptors, such as monocytes or
microglial cells, and an antibody to be tested in a medium. The
antibody can be directed to the biological entity under test or to
an antigen associated with the entity. In the latter situation, the
object is to test whether the biological entity is vicariously
phagocytosed with the antigen. Usually, although not necessarily,
the antibody and biological entity (sometimes with an associated
antigen), are contacted with each other before adding the
phagocytic cells. The concentration of the biological entity and/or
the associated antigen remaining in the medium, if present, is then
monitored. A reduction in the amount or concentration of antigen or
the associated biological entity in the medium indicates the
antibody has a clearing response against the antigen and/or
associated biological entity in conjunction with the phagocytic
cells (see, e.g., Example IV).
[0171] 10. Chimeric/Humanized Antibodies Having Altered Effector
Function
[0172] For the above-described antibodies of the invention
comprising a constant region (Fc region), it may also be desirable
to alter the effector function of the molecule. Generally, the
effector function of an antibody resides in the constant or Fc
region of the molecule which can mediate binding to various
effector molecules, e.g., complement proteins or Fc receptors. The
binding of complement to the Fc region is important, for example,
in the opsonization and lysis of cell pathogens and the activation
of inflammatory responses. The binding of antibody to Fc receptors,
for example, on the surface of effector cells can trigger a number
of important and diverse biological responses including, for
example, engulfment and destruction of antibody-coated pathogens or
particles, clearance of immune complexes, lysis of antibody-coated
target cells by killer cells (i.e., antibody-dependent
cell-mediated cytotoxicity, or ADCC), release of inflammatory
mediators, placental transfer of antibodies, and control of
immunoglobulin production.
[0173] Accordingly, depending on a particular therapeutic or
diagnostic application, the above-mentioned immune functions, or
only selected immune functions, may be desirable. By altering the
Fc region of the antibody, various aspects of the effector function
of the molecule, including enhancing or suppressing various
reactions of the immune system, with beneficial effects in
diagnosis and therapy, are achieved.
[0174] The antibodies of the invention can be produced which react
only with certain types of Fc receptors, for example, the
antibodies of the invention can be modified to bind to only certain
Fc receptors, or if desired, lack Fc receptor binding entirely, by
deletion or alteration of the Fc receptor binding site located in
the Fc region of the antibody. Other desirable alterations of the
Fc region of an antibody of the invention are cataloged below.
Typically the Kabat numbering system is used to indicate which
amino acid residue(s) of the Fc region (e.g., of an IgG antibody)
are altered (e.g., by amino acid substitution) in order to achieve
a desired change in effector function. The numbering system is also
employed to compare antibodies across species such that a desired
effector function observed in, for example, a mouse antibody, can
then be systematically engineered into a human, humanized, or
chimeric antibody of the invention.
[0175] For example, it has been observed that antibodies (e.g., IgG
antibodies) can be grouped into those found to exhibit tight,
intermediate, or weak binding to an Fc receptor (e.g., an Fc
receptor on human monocytes (Fc.gamma.RI)). By comparison of the
amino-acid sequences in these different affinity groups, a
monocyte-binding site in the hinge-link region (Leu234-Ser239) has
been identified. Moreover, the human Fc.gamma.RI receptor binds
human IgG1 and mouse IgG2a as a monomer, but the binding of mouse
IgG2b is 100-fold weaker. A comparison of the sequence of these
proteins in the hinge-link region shows that the sequence 234 to
238, i.e., Leu-Leu-Gly-Gly-Pro in the strong binders becomes
Leu-Glu-Gly-Gly-Pro in mouse gamma 2b, i.e., weak binders.
Accordingly, a corresponding change in a human antibody hinge
sequence can be made if reduced Fc.gamma.I receptor binding is
desired. It is understood that other alterations can be made to
achieve the same or similar results. For example, the affinity of
Fc.gamma.RI binding can be altered by replacing the specified
residue with a residue having an inappropriate functional group on
its sidechain, or by introducing a charged functional group (e.g.;
Glu or Asp) or for example an aromatic non-polar residue (e.g.,
Phe, Tyr, or Trp).
[0176] These changes can be equally applied to the murine, human,
and rat systems given the sequence homology between the different
immunoglobulins, it has been shown that for human IgG3, which binds
to the human Fc.gamma.RI receptor, changing Leu 235 to Glu destroys
the interaction of the mutant for the receptor. The binding site
for this receptor can thus be switched on or switched off by making
the appropriate mutation.
[0177] Mutations on adjacent or close sites in the hinge link
region (e.g., replacing residues 234, 236 or 237 by Ala) indicate
that alterations in residues 234, 235, 236, and 237 at least affect
affinity for the Fc.gamma.RI receptor. Accordingly, the antibodies
of the invention can also have an altered Fc region with altered
binding affinity for Fc.gamma.RI as compared with the unmodified
antibody. Such an antibody conveniently has a modification at amino
acid residue 234, 235, 236, or 237.
[0178] Affinity for other Fc receptors can be altered by a similar
approach, for controlling the immune response in different
ways.
[0179] As a further example, the lytic properties of IgG antibodies
following binding of the Cl component of complement can be
altered.
[0180] The first component of the complement system, Cl, comprises
three proteins known as Clq, Clr and Cls which bind tightly
together. It has been shown that Clq is responsible for binding of
the three protein complex to an antibody.
[0181] Accordingly, the Clq binding activity of an antibody can be
altered by providing an antibody with an altered CH 2 domain in
which at least one of the amino acid residues 318, 320, and 322 of
the heavy chain has been changed to a residue having a different
side chain. The numbering of the residues in the heavy chain is
that of the EU index (see Kabat et al., supra). Other suitable
alterations for altering, e.g., reducing or abolishing specific
Clq-binding to an antibody include changing any one of residues 318
(Glu), 320 (Lys) and 322 (Lys), to Ala.
[0182] Moreover, by making mutations at these residues, it has been
shown that Clq binding is retained as long as residue 318 has a
hydrogen-bonding side chain and residues 320 and 322 both have a
positively charged side chain.
[0183] Clq binding activity can be abolished by replacing any one
of the three specified residues with a residue having an
inappropriate functionality on its side chain. It is not necessary
to replace the ionic residues only with Ala to abolish Clq binding.
It is also possible to use other alkyl-substituted non-ionic
residues, such as Gly, Ile, Leu, or Val, or such aromatic non-polar
residues as Phe, Tyr, Trp and Pro in place of any one of the three
residues in order to abolish Clq binding. In addition, it is also
be possible to use such polar non-ionic residues as Ser, Thr, Cys,
and Met in place of residues 320 and 322, but not 318, in order to
abolish Clq binding activity.
[0184] It is also noted that the side chains on ionic or non-ionic
polar residues will be able to form hydrogen bonds in a similar
manner to the bonds formed by the Glu residue. Therefore,
replacement of the 318 (Glu) residue by a polar residue may modify
but not abolish Clq binding activity.
[0185] It is also known that replacing residue 297 (Asn) with Ala
results in removal of lytic activity while only slightly reducing
(about three fold weaker) affinity for Clq. This alteration
destroys the glycosylation site and the presence of carbohydrate
that is required for complement activation. Any other substitution
at this site will also destroy the glycosylation site.
[0186] The invention also provides an antibody having an altered
effector function wherein the antibody has a modified hinge region.
The modified hinge region may comprise a complete hinge region
derived from an antibody of different antibody class or subclass
from that of the CH1 domain. For example, the constant domain (CH1)
of a class IgG antibody can be attached to a hinge region of a
class IgG4 antibody. Alternatively, the new hinge region may
comprise part of a natural hinge or a repeating unit in which each
unit in the repeat is derived from a natural hinge region. In one
example, the natural hinge region is altered by converting one or
more cysteine residues into a neutral residue, such as alanine, or
by converting suitably placed residues into cysteine residues. Such
alterations are carried out using art recognized protein chemistry
and, preferably, genetic engineering techniques, as described
herein.
[0187] In one embodiment of the invention, the number of cysteine
residues in the hinge region of the antibody is reduced, for
example, to one cysteine residue. This modification has the
advantage of facilitating the assembly of the antibody, for
example, bispecific antibody molecules and antibody molecules
wherein the Fc portion has been replaced by an effector or reporter
molecule, since it is only necessary to form a single disulfide
bond. This modification also provides a specific target for
attaching the hinge region either to another hinge region or to an
effector or reporter molecule, either directly or indirectly, for
example, by chemical means.
[0188] Conversely, the number of cysteine residues in the hinge
region of the antibody is increased, for example, at least one more
than the number of normally occurring cysteine residues. Increasing
the number of cysteine residues can be used to stabilize the
interactions between adjacent hinges. Another advantage of this
modification is that it facilitates the use of cysteine thiol
groups for attaching effector or reporter molecules to the altered
antibody, for example, a radiolabel.
[0189] Accordingly, the invention provides for an exchange of hinge
regions between antibody classes, in particular, IgG classes,
and/or an increase or decrease in the number of cysteine residues
in the hinge region in order to achieve an altered effector
function (see for example U.S. Pat. No. 5,677,425 which is
expressly incorporated herein). A determination of altered antibody
effector function is made using the assays described herein or
other art recognized techniques.
[0190] Importantly, the resultant antibody can be subjected to one
or more assays to evaluate any change in biological activity
compared to the starting antibody. For example, the ability of the
antibody with an altered Fc region to bind complement or Fc
receptors can be assessed using the assays disclosed herein as well
as any art recognized assay.
[0191] Production of the antibodies of the invention is carried out
by any suitable technique including techniques described herein as
well as techniques known to those skilled in the art. For example
an appropriate protein sequence, e.g. forming part of or all of a
relevant constant domain, e.g., Fc region, i.e., CH2, and/or CH3
domain(s), of an antibody, and include appropriately altered
residue(s) can be synthesized and then chemically joined into the
appropriate place in an antibody molecule.
[0192] Preferably, genetic engineering techniques are used for
producing an altered antibody. Preferred techniques include, for
example, preparing suitable primers for use in polymerase chain
reaction (PCR) such that a DNA sequence which encodes at least part
of an IgG heavy chain, e.g., an Fc or constant region (e.g., CH2,
and/or CH3) is altered, at one or more residues. The segment can
then be operably linked to the remaining portion of the antibody,
e.g., the variable region of the antibody and required regulatory
elements for expression in a cell.
[0193] The present invention also includes vectors used to
transform the cell line, vectors used in producing the transforming
vectors, cell lines transformed with the transforming vectors, cell
lines transformed with preparative vectors, and methods for their
production.
[0194] Preferably, the cell line which is transformed to produce
the antibody with an altered Fc region (i.e., of altered effector
function) is an immortalized mammalian cell line (e.g., CHO
cell).
[0195] Although the cell line used to produce the antibody with an
altered Fc region is preferably a mammalian cell line, any other
suitable cell line, such as a bacterial cell line or a yeast cell
line, may alternatively be used.
[0196] B. Nucleic Acid Encoding Immunologic and Therapeutic
Agents
[0197] Immune responses against amyloid deposits can also be
induced by administration of nucleic acids encoding antibodies and
their component chains used for passive immunization. Such nucleic
acids can be DNA or RNA. A nucleic acid segment encoding an
immunogen is typically linked to regulatory elements, such as a
promoter and enhancer, that allow expression of the DNA segment in
the intended target cells of a patient. For expression in blood
cells, as is desirable for induction of an immune response,
promoter and enhancer elements from light or heavy chain
immunoglobulin genes or the CMV major intermediate early promoter
and enhancer are suitable to direct expression. The linked
regulatory elements and coding sequences are often cloned into a
vector. For administration of double-chain antibodies, the two
chains can be cloned in the same or separate vectors.
[0198] A number of viral vector systems are available including
retroviral systems (see, e.g., Lawrie and Tumin, Cur. Opin. Genet.
Develop. 3:102-109 (1993)); adenoviral vectors (see, e.g., Bett et
al., J. Virol. 67:5911 (1993)); adeno-associated virus vectors
(see, e.g., Zhou et al., J. Exp. Med. 179:1867 (1994)), viral
vectors from the pox family including vaccinia virus and the avian
pox viruses, viral vectors from the alpha virus genus such as those
derived from Sindbis and Semliki Forest Viruses (see, e.g.,
Dubensky et al., J. Virol. 70:508 (1996)), Venezuelan equine
encephalitis virus (see Johnston et al., U.S. Pat. No. 5,643,576)
and rhabdoviruses, such as vesicular stomatitis virus (see Rose, WO
96/34625) and papillomaviruses (Ohe et al., Human Gene Therapy
6:325 (1995); Woo et al., WO 94/12629 and Xiao & Brandsma,
Nucleic Acids. Res. 24, 2630-2622 (1996)).
[0199] DNA encoding an immunogen, or a vector containing the same,
can be packaged into liposomes. Suitable lipids and related analogs
are described by Eppstein et al., U.S. Pat. No. 5,208,036, Felgner
et al., U.S. Pat. No. 5,264,618, Rose, U.S. Pat. No. 5,279,833, and
Epand et al., U.S. Pat. No. 5,283,185. Vectors and DNA encoding an
immunogen can also be adsorbed to or associated with particulate
carriers, examples of which include polymethyl methacrylate
polymers and polylactides and poly(lactide-co-glycolides), see,
e.g., McGee et al., J. Micro Encap. (1996).
[0200] Gene therapy vectors or naked polypeptides (e.g., DNA) can
be delivered in vivo by administration to an individual patient,
typically by systemic administration (e.g., intravenous,
intraperitoneal, nasal, gastric, intradermal, intramuscular,
subdermal, or intracranial infusion) or topical application (see
e.g., Anderson et al., U.S. Pat. No. 5,399,346). The term "naked
polynucleotide" refers to a polynucleotide not complexed with
colloidal materials. Naked polynucleotides are sometimes cloned in
a plasmid vector. Such vectors can further include facilitating
agents such as bupivacine (Attardo et al., U.S. Pat. No.
5,593,970). DNA can also be administered using a gene gun. See Xiao
& Brandsma, supra. The DNA encoding an immunogen is
precipitated onto the surface of microscopic metal beads. The
microprojectiles are accelerated with a shock wave or expanding
helium gas, and penetrate tissues to a depth of several cell
layers. For example, The Accel.TM. Gene Delivery Device
manufactured by Agacetus, Inc. Middleton Wis. is suitable.
Alternatively, naked DNA can pass through skin into the blood
stream simply by spotting the DNA onto skin with chemical or
mechanical irritation (see Howell et al., WO 95/05853).
[0201] In a further variation, vectors encoding immunogens can be
delivered to cells ex vivo, such as cells explanted from an
individual patient (e.g., lymphocytes, bone marrow aspirates,
tissue biopsy) or universal donor hematopoietic stem cells,
followed by reimplantation of the cells into a patient, usually
after selection for cells which have incorporated the vector.
[0202] II. Prophylactic and Therapeutic Methods
[0203] The present invention is directed inter alia to treatment of
Alzheimer's and other amyloidogenic diseases by administration of
therapeutic immunological reagents (e.g., humanized
immunoglobulins) to specific epitopes within A.beta. to a patient
under conditions that generate a beneficial therapeutic response in
a patient (e.g., induction of phagocytosis of A.beta., reduction of
plaque burden, inhibition of plaque formation, reduction of
neuritic dystrophy, improving cognitive function, and/or reversing,
treating or preventing cognitive decline) in the patient, for
example, for the prevention or treatment of an amyloidogenic
disease. The invention is also directed to use of the disclosed
immunological reagents (e.g., humanized immunoglobulins) in the
manufacture of a medicament for the treatment or prevention of an
amyloidogenic disease.
[0204] The term "treatment" as used herein, is defined as the
application or administration of a therapeutic agent to a patient,
or application or administration of a therapeutic agent to an
isolated tissue or cell line from a patient, who has a disease, a
symptom of disease or a predisposition toward a disease, with the
purpose to cure, heal, alleviate, relieve, alter, remedy,
ameliorate, improve or affect the disease, the symptoms of disease
or the predisposition toward disease.
[0205] In one aspect, the invention provides methods of preventing
or treating a disease associated with amyloid deposits of A.beta.
in the brain of a patient. Such diseases include Alzheimer's
disease, Down's syndrome and cognitive impairment. The latter can
occur with or without other characteristics of an amyloidogenic
disease. Some methods of the invention entail administering an
effective dosage of an antibody that specifically binds to a
component of an amyloid deposit to the patient. Such methods are
particularly useful for preventing or treating Alzheimer's disease
in human patients. Exemplary methods entail administering an
effective dosage of an antibody that binds to A.beta.. Preferred
methods entail administering an effective dosage of an antibody
that specifically binds to an epitope within residues 1-10 of
A.beta., for example, antibodies that specifically bind to an
epitope within residues 1-3 of A.beta., antibodies that
specifically bind to an epitope within residues 1-4 of A.beta.,
antibodies that specifically bind to an epitope within residues 1-5
of A.beta., antibodies that specifically bind to an epitope within
residues 1-6 of A.beta., antibodies that specifically bind to an
epitope within residues 1-7 of A.beta., or antibodies that
specifically bind to an epitope within residues 3-7 of A.beta.. In
yet another aspect, the invention features administering antibodies
that bind to an epitope comprising a free N-terminal residue of
A.beta.. In yet another aspect, the invention features
administering antibodies that bind to an epitope within residues of
1-10 of A.beta. wherein residue 1 and/or residue 7 of A.beta. is
aspartic acid. In yet another aspect, the invention features
administering antibodies that specifically bind to A.beta. peptide
without binding to full-length amyloid precursor protein (APP). In
yet another aspect, the isotype of the antibody is human IgG1.
[0206] In yet another aspect, the invention features administering
antibodies that bind to an amyloid deposit in the patient and
induce a clearing response against the amyloid deposit. For
example, such a clearing response can be effected by Fc receptor
mediated phagocytosis.
[0207] Therapeutic agents of the invention are typically
substantially pure from undesired contaminant. This means that an
agent is typically at least about 50% w/w (weight/weight) purity,
as well as being substantially free from interfering proteins and
contaminants. Sometimes the agents are at least about 80% w/w and,
more preferably at least 90 or about 95% w/w purity. However, using
conventional protein purification techniques, homogeneous peptides
of at least 99% w/w can be obtained.
[0208] The methods can be used on both asymptomatic patients and
those currently showing symptoms of disease. The antibodies used in
such methods can be human, humanized, chimeric or nonhuman
antibodies, or fragments thereof (e.g., antigen binding fragments)
and can be monoclonal or polyclonal, as described herein. In yet
another aspect, the invention features administering antibodies
prepared from a human immunized with A.beta. peptide, which human
can be the patient to be treated with antibody.
[0209] In another aspect, the invention features administering an
antibody with a pharmaceutical carrier as a pharmaceutical
composition. Alternatively, the antibody can be administered to a
patient by administering a polynucleotide encoding at least one
antibody chain. The polynucleotide is expressed to produce the
antibody chain in the patient. Optionally, the polynucleotide
encodes heavy and light chains of the antibody. The polynucleotide
is expressed to produce the heavy and light chains in the patient.
In exemplary embodiments, the patient is monitored for level of
administered antibody in the blood of the patient.
[0210] The invention thus fulfills a longstanding need for
therapeutic regimes for preventing or ameliorating the
neuropathology and, in some patients, the cognitive impairment
associated with Alzheimer's disease.
[0211] A. Patients Amenable to Treatment
[0212] Patients amenable to treatment include individuals at risk
of disease but not showing symptoms, as well as patients presently
showing symptoms. In the case of Alzheimer's disease, virtually
anyone is at risk of suffering from Alzheimer's disease if he or
she lives long enough. Therefore, the present methods can be
administered prophylactically to the general population without the
need for any assessment of the risk of the subject patient. The
present methods are especially useful for individuals who have a
known genetic risk of Alzheimer's disease. Such individuals include
those having relatives who have experienced this disease, and those
whose risk is determined by analysis of genetic or biochemical
markers. Genetic markers of risk toward Alzheimer's disease include
mutations in the APP gene, particularly mutations at position 717
and positions 670 and 671 referred to as the Hardy and Swedish
mutations respectively (see Hardy, supra). Other markers of risk
are mutations in the presenilin genes, PS1 and PS2, and ApoE4,
family history of AD, hypercholesterolemia or atherosclerosis.
Individuals presently suffering from Alzheimer's disease can be
recognized from characteristic dementia, as well as the presence of
risk factors described above. In addition, a number of diagnostic
tests are available for identifying individuals who have AD. These
include measurement of CSF tau and A.beta.42 levels. Elevated tau
and decreased A.beta.42 levels signify the presence of AD.
Individuals suffering from Alzheimer's disease can also be
diagnosed by ADRDA criteria as discussed in the Examples
section.
[0213] In asymptomatic patients, treatment can begin at any age
(e.g., 10, 20, 30). Usually, however, it is not necessary to begin
treatment until a patient reaches 40, 50, 60 or 70. Treatment
typically entails multiple dosages over a period of time. Treatment
can be monitored by assaying antibody levels over time. If the
response falls, a booster dosage is indicated. In the case of
potential Down's syndrome patients, treatment can begin antenatally
by administering therapeutic agent to the mother or shortly after
birth.
[0214] B. Treatment Regimes and Dosages
[0215] In prophylactic applications, pharmaceutical compositions or
medicaments are administered to a patient susceptible to, or
otherwise at risk of, Alzheimer's disease in an amount sufficient
to eliminate or reduce the risk, lessen the severity, or delay the
outset of the disease, including biochemical, histologic and/or
behavioral symptoms of the disease, its complications and
intermediate pathological phenotypes presenting during development
of the disease. In therapeutic applications, compositions or
medicants are administered to a patient suspected of, or already
suffering from such a disease in an amount sufficient to cure, or
at least partially arrest, the symptoms of the disease
(biochemical, histologic and/or behavioral), including its
complications and intermediate pathological phenotypes in
development of the disease.
[0216] In some methods, administration of agent reduces or
eliminates myocognitive impairment in patients that have not yet
developed characteristic Alzheimer's pathology. An amount adequate
to accomplish therapeutic or prophylactic treatment is defined as a
therapeutically- or prophylactically-effective dose. In both
prophylactic and therapeutic regimes, agents are usually
administered in several dosages until a sufficient immune response
has been achieved. The term "immune response" or "immunological
response" includes the development of a humoral (antibody mediated)
and/or a cellular (mediated by antigen-specific T cells or their
secretion products) response directed against an antigen in a
recipient subject. Such a response can be an active response, i.e.,
induced by administration of immunogen, or a passive response,
i.e., induced by administration of immunoglobulin or antibody or
primed T-cells.
[0217] An "immunogenic agent" or "immunogen" is capable of inducing
an immunological response against itself on administration to a
mammal, optionally in conjunction with an adjuvant. Typically, the
immune response is monitored and repeated dosages are given if the
immune response starts to wane.
[0218] Effective doses of the compositions of the present
invention, for the treatment of the above described conditions vary
depending upon many different factors, including means of
administration, target site, physiological state of the patient,
whether the patient is human or an animal, other medications
administered, and whether treatment is prophylactic or therapeutic.
Usually, the patient is a human but non-human mammals including
transgenic mammals can also be treated. Treatment dosages need to
be titrated to optimize safety and efficacy.
[0219] For passive immunization with an antibody, the dosage ranges
from about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg,
of the host body weight. For example dosages can be 1 mg/kg body
weight or 10 mg/kg body weight or within the range of 1-10 mg/kg,
preferably at least 1 mg/kg. Subjects can be administered such
doses daily, on alternative days, weekly or according to any other
schedule determined by empirical analysis. An exemplary treatment
entails administration in multiple dosages over a prolonged period,
for example, of at least six months. Additional exemplary treatment
regimes entail administration once per every two weeks or once a
month or once every 3 to 6 months. Exemplary dosage schedules
include 1-10 mg/kg or 15 mg/kg on consecutive days, 30 mg/kg on
alternate days or 60 mg/kg weekly. In some methods, two or more
monoclonal antibodies with different binding specificities are
administered simultaneously, in which case the dosage of each
antibody administered falls within the ranges indicated.
[0220] Antibody is usually administered on multiple occasions.
Intervals between single dosages can be weekly, monthly or yearly.
Intervals can also be irregular as indicated by measuring blood
levels of antibody to A.beta. in the patient. In some methods,
dosage is adjusted to achieve a plasma antibody concentration of
1-1000 .mu.g/ml and in some methods 25-300 .mu.g/ml. Alternatively,
antibody can be administered as a sustained release formulation, in
which case less frequent administration is required. Dosage and
frequency vary depending on the half-life of the antibody in the
patient. In general, human antibodies show the longest half-life,
followed by humanized antibodies, chimeric antibodies, and nonhuman
antibodies.
[0221] The dosage and frequency of administration can vary
depending on whether the treatment is prophylactic or therapeutic.
In prophylactic applications, compositions containing the present
antibodies or a cocktail thereof are administered to a patient not
already in the disease state to enhance the patient's resistance.
Such an amount is defined to be a "prophylactic effective dose." In
this use, the precise amounts again depend upon the patient's state
of health and general immunity, but generally range from 0.1 to 25
mg per dose, especially 0.5 to 2.5 mg per dose. A relatively low
dosage is administered at relatively infrequent intervals over a
long period of time. Some patients continue to receive treatment
for the rest of their lives.
[0222] In therapeutic applications, a relatively high dosage (e.g.
from about 1 to 200 mg of antibody per dose, with dosages of from 5
to 25 mg being more commonly used) at relatively short intervals is
sometimes required until progression of the disease is reduced or
terminated, and preferably until the patient shows partial or
complete amelioration of symptoms of disease. Thereafter, the
patent can be administered a prophylactic regime.
[0223] Doses for nucleic acids encoding antibodies range from about
10 ng to 1 g, 100 ng to 100 mg, 1 .mu.g to 10 mg, or 30-300 .mu.g
DNA per patient. Doses for infectious viral vectors vary from
10-100, or more, virions per dose.
[0224] Therapeutic agents can be administered by parenteral,
topical, intravenous, oral, subcutaneous, intraarterial,
intracranial, intraperitoneal, intranasal or intramuscular means
for prophylactic and/or therapeutic treatment. The most typical
route of administration of an immunogenic agent is subcutaneous
although other routes can be equally effective. The next most
common route is intramuscular injection. This type of injection is
most typically performed in the arm or leg muscles. In some
methods, agents are injected directly into a particular tissue
where deposits have accumulated, for example intracranial
injection. Intramuscular injection or intravenous infusion are
preferred for administration of antibody. In some methods,
particular therapeutic antibodies are injected directly into the
cranium. In some methods, antibodies are administered as a
sustained release composition or device, such as a Medipad.TM.
device.
[0225] Agents of the invention can optionally be administered in
combination with other agents that are at least partly effective in
treatment of amyloidogenic disease. In the case of Alzheimer's and
Down's syndrome, in which amyloid deposits occur in the brain,
agents of the invention can also be administered in conjunction
with other agents that increase passage of the agents of the
invention across the blood-brain barrier.
[0226] C. Pharmaceutical Compositions
[0227] Agents of the invention are often administered as
pharmaceutical compositions comprising an active therapeutic agent,
i.e., and a variety of other pharmaceutically acceptable
components. See Remington's Pharmaceutical Science (15th ed., Mack
Publishing Company, Easton, Pa. (1980)). The preferred form depends
on the intended mode of administration and therapeutic application.
The compositions can also include, depending on the formulation
desired, pharmaceutically-acceptabl- e, non-toxic carriers or
diluents, which are defined as vehicles commonly used to formulate
pharmaceutical compositions for animal or human administration. The
diluent is selected so as not to affect the biological activity of
the combination. Examples of such diluents are distilled water,
physiological phosphate-buffered saline, Ringer's solutions,
dextrose solution, and Hank's solution. In addition, the
pharmaceutical composition or formulation may also include other
carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic
stabilizers and the like.
[0228] Pharmaceutical compositions can also include large, slowly
metabolized macromolecules such as proteins, polysaccharides such
as chitosan, polylactic acids, polyglycolic acids and copolymers
(such as latex functionalized sepharose.TM.), agarose, cellulose,
and the like), polymeric amino acids, amino acid copolymers, and
lipid aggregates (such as oil droplets or liposomes). Additionally,
these carriers can function as immunostimulating agents (i.e.,
adjuvants).
[0229] For parenteral administration, agents of the invention can
be administered as injectable dosages of a solution or suspension
of the substance in a physiologically acceptable diluent with a
pharmaceutical carrier that can be a sterile liquid such as water
oils, saline, glycerol, or ethanol. Additionally, auxiliary
substances, such as wetting or emulsifying agents, surfactants, pH
buffering substances and the like can be present in compositions.
Other components of pharmaceutical compositions are those of
petroleum, animal, vegetable, or synthetic origin, for example,
peanut oil, soybean oil, and mineral oil. In general, glycols such
as propylene glycol or polyethylene glycol are preferred liquid
carriers, particularly for injectable solutions. Antibodies can be
administered in the form of a depot injection or implant
preparation, which can be formulated in such a manner as to permit
a sustained release of the active ingredient. An exemplary
composition comprises monoclonal antibody at 5 mg/mL, formulated in
aqueous buffer consisting of 50 mM L-histidine, 150 mM NaCl,
adjusted to pH 6.0 with HCl.
[0230] Typically, compositions are prepared as injectables, either
as liquid solutions or suspensions; solid forms suitable for
solution in, or suspension in, liquid vehicles prior to injection
can also be prepared. The preparation also can be emulsified or
encapsulated in liposomes or micro particles such as polylactide,
polyglycolide, or copolymer for enhanced adjuvant effect, as
discussed above (see Langer, Science 249: 1527 (1990) and Hanes,
Advanced Drug Delivery Reviews 28:97 (1997)). The agents of this
invention can be administered in the form of a depot injection or
implant preparation, which can be formulated in such a manner as to
permit a sustained or pulsatile release of the active
ingredient.
[0231] Additional formulations suitable for other modes of
administration include oral, intranasal, and pulmonary
formulations, suppositories, and transdermal applications. For
suppositories, binders and carriers include, for example,
polyalkylene glycols or triglycerides; such suppositories can be
formed from mixtures containing the active ingredient in the range
of 0.5% to 10%, preferably 1%-2%. Oral formulations include
excipients, such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, and
magnesium carbonate. These compositions take the form of solutions,
suspensions, tablets, pills, capsules, sustained release
formulations or powders and contain 10%-95% of active ingredient,
preferably 25%-70%.
[0232] Topical application can result in transdermal or intradermal
delivery. Topical administration can be facilitated by
co-administration of the agent with cholera toxin or detoxified
derivatives or subunits thereof or other similar bacterial toxins
(See Glenn et al., Nature 391, 851 (1998)). Co-administration can
be achieved by using the components as a mixture or as linked
molecules obtained by chemical crosslinking or expression as a
fusion protein.
[0233] Alternatively, transdermal delivery can be achieved using a
skin path or using transferosomes (Paul et al., Eur. J. Immunol.
25:3521 (1995); Cevc et al., Biochem. Biophys. Acta 1368:201-15
(1998)).
[0234] III. Monitoring the Course of Treatment
[0235] The invention provides methods of monitoring treatment in a
patient suffering from or susceptible to Alzheimer's, i.e., for
monitoring a course of treatment being administered to a patient.
The methods can be used to monitor both therapeutic treatment on
symptomatic patients and prophylactic treatment on asymptomatic
patients. In particular, the methods are useful for monitoring
passive immunization (e.g., measuring level of administered
antibody).
[0236] Some methods entail determining a baseline value, for
example, of an antibody level or profile in a patient, before
administering a dosage of agent, and comparing this with a value
for the profile or level after treatment. A significant increase
(i.e., greater than the typical margin of experimental error in
repeat measurements of the same sample, expressed as one standard
deviation from the mean of such measurements) in value of the level
or profile signals a positive treatment outcome (i.e., that
administration of the agent has achieved a desired response). If
the value for immune response does not change significantly, or
decreases, a negative treatment outcome is indicated.
[0237] In other methods, a control value (i.e., a mean and standard
deviation) of level or profile is determined for a control
population. Typically the individuals in the control population
have not received prior treatment. Measured values of the level or
profile in a patient after administering a therapeutic agent are
then compared with the control value. A significant increase
relative to the control value (e.g., greater than one standard
deviation from the mean) signals a positive or sufficient treatment
outcome. A lack of significant increase or a decrease signals a
negative or insufficient treatment outcome. Administration of agent
is generally continued while the level is increasing relative to
the control value. As before, attainment of a plateau relative to
control values is an indicator that the administration of treatment
can be discontinued or reduced in dosage and/or frequency.
[0238] In other methods, a control value of the level or profile
(e.g., a mean and standard deviation) is determined from a control
population of individuals who have undergone treatment with a
therapeutic agent and whose levels or profiles have plateaued in
response to treatment. Measured values of levels or profiles in a
patient are compared with the control value. If the measured level
in a patient is not significantly different (e.g., more than one
standard deviation) from the control value, treatment can be
discontinued. If the level in a patient is significantly below the
control value, continued administration of agent is warranted. If
the level in the patient persists below the control value, then a
change in treatment may be indicated.
[0239] In other methods, a patient who is not presently receiving
treatment but has undergone a previous course of treatment is
monitored for antibody levels or profiles to determine whether a
resumption of treatment is required. The measured level or profile
in the patient can be compared with a value previously achieved in
the patient after a previous course of treatment. A significant
decrease relative to the previous measurement (i.e., greater than a
typical margin of error in repeat measurements of the same sample)
is an indication that treatment can be resumed. Alternatively, the
value measured in a patient can be compared with a control value
(mean plus standard deviation) determined in a population of
patients after undergoing a course of treatment. Alternatively, the
measured value in a patient can be compared with a control value in
populations of prophylactically treated patients who remain free of
symptoms of disease, or populations of therapeutically treated
patients who show amelioration of disease characteristics. In all
of these cases, a significant decrease relative to the control
level (i.e., more than a standard deviation) is an indicator that
treatment should be resumed in a patient.
[0240] The tissue sample for analysis is typically blood, plasma,
serum, mucous fluid or cerebrospinal fluid from the patient. The
sample is analyzed, for example, for levels or profiles of
antibodies to A.beta. peptide, e.g., levels or profiles of
humanized antibodies. ELISA methods of detecting antibodies
specific to A.beta. are described in the Examples section. In some
methods, the level or profile of an administered antibody is
determined using a clearing assay, for example, in an in vitro
phagocytosis assay, as described herein. In such methods, a tissue
sample from a patient being tested is contacted with amyloid
deposits (e.g., from a PDAPP mouse) and phagocytic cells bearing Fc
receptors. Subsequent clearing of the amyloid deposit is then
monitored. The existence and extent of clearing response provides
an indication of the existence and level of antibodies effective to
clear A.beta. in the tissue sample of the patient under test.
[0241] The antibody profile following passive immunization
typically shows an immediate peak in antibody concentration
followed by an exponential decay. Without a further dosage, the
decay approaches pretreatment levels within a period of days to
months depending on the half-life of the antibody administered. For
example the half-life of some human antibodies is of the order of
20 days.
[0242] In some methods, a baseline measurement of antibody to
A.beta. in the patient is made before administration, a second
measurement is made soon thereafter to determine the peak antibody
level, and one or more further measurements are made at intervals
to monitor decay of antibody levels. When the level of antibody has
declined to baseline or a predetermined percentage of the peak less
baseline (e.g., 50%, 25% or 10%), administration of a further
dosage of antibody is administered. In some methods, peak or
subsequent measured levels less background are compared with
reference levels previously determined to constitute a beneficial
prophylactic or therapeutic treatment regime in other patients. If
the measured antibody level is significantly less than a reference
level (e.g., less than the mean minus one standard deviation of the
reference value in population of patients benefiting from
treatment) administration of an additional dosage of antibody is
indicated.
[0243] Additional methods include monitoring, over the course of
treatment, any art-recognized physiologic symptom (e.g., physical
or mental symptom) routinely relied on by researchers or physicians
to diagnose or monitor amyloidogenic diseases (e.g., Alzheimer's
disease). For example, one can monitor cognitive impairment. The
latter is a symptom of Alzheimer's disease and Down's syndrome but
can also occur without other characteristics of either of these
diseases. For example, cognitive impairment can be monitored by
determining a patient's score on the Mini-Mental State Exam in
accordance with convention throughout the course of treatment.
[0244] C. Kits
[0245] The invention further provides kits for performing the
monitoring methods described above. Typically, such kits contain an
agent that specifically binds to antibodies to A.beta.. The kit can
also include a label. For detection of antibodies to A.beta., the
label is typically in the form of labeled anti-idiotypic
antibodies. For detection of antibodies, the agent can be supplied
prebound to a solid phase, such as to the wells of a microtiter
dish. Kits also typically contain labeling providing directions for
use of the kit. The labeling may also include a chart or other
correspondence regime correlating levels of measured label with
levels of antibodies to A.beta.. The term labeling refers to any
written or recorded material that is attached to, or otherwise
accompanies a kit at any time during its manufacture, transport,
sale or use. For example, the term labeling encompasses advertising
leaflets and brochures, packaging materials, instructions, audio or
videocassettes, computer discs, as well as writing imprinted
directly on kits.
[0246] The invention also provides diagnostic kits, for example,
research, detection and/or diagnostic kits (e.g., for performing in
vivo imaging). Such kits typically contain an antibody for binding
to an epitope of A.beta., preferably within residues 1-10.
Preferably, the antibody is labeled or a secondary labeling reagent
is included in the kit. Preferably, the kit is labeled with
instructions for performing the intended application, for example,
for performing an in vivo imaging assay. Exemplary antibodies are
those described herein.
[0247] D. In Vivo Imaging
[0248] The invention provides methods of in vivo imaging amyloid
deposits in a patient. Such methods are useful to diagnose or
confirm diagnosis of Alzheimer's disease, or susceptibility
thereto. For example, the methods can be used on a patient
presenting with symptoms of dementia. If the patient has abnormal
amyloid deposits, then the patient is likely suffering from
Alzheimer's disease. The methods can also be used on asymptomatic
patients. Presence of abnormal deposits of amyloid indicates
susceptibility to future symptomatic disease. The methods are also
useful for monitoring disease progression and/or response to
treatment in patients who have been previously diagnosed with
Alzheimer's disease.
[0249] The methods work by administering a reagent, such as
antibody that binds to A.beta., to the patient and then detecting
the agent after it has bound. Preferred antibodies bind to A.beta.
deposits in a patient without binding to full length APP
polypeptide. Antibodies binding to an epitope of A.beta. within
amino acids 1-10 are particularly preferred. In some methods, the
antibody binds to an epitope within amino acids 7-10 of A.beta..
Such antibodies typically bind without inducing a substantial
clearing response. In other methods, the antibody binds to an
epitope within amino acids 1-7 of A.beta.. Such antibodies
typically bind and induce a clearing response to A.beta.. However,
the clearing response can be avoided by using antibody fragments
lacking a full-length constant region, such as Fabs. In some
methods, the same antibody can serve as both a treatment and
diagnostic reagent. In general, antibodies binding to epitopes
C-terminal to residue 10 of A.beta. do not show as strong a signal
as antibodies binding to epitopes within residues 1-10, presumably
because the C-terminal epitopes are inaccessible in amyloid
deposits. Accordingly, such antibodies are less preferred.
[0250] Diagnostic reagents can be administered by intravenous
injection into the body of the patient, or directly into the brain
by intracranial injection or by drilling a hole through the skull.
The dosage of reagent should be within the same ranges as for
treatment methods. Typically, the reagent is labeled, although in
some methods, the primary reagent with affinity for A.beta. is
unlabelled and a secondary labeling agent is used to bind to the
primary reagent. The choice of label depends on the means of
detection. For example, a fluorescent label is suitable for optical
detection. Use of paramagnetic labels is suitable for tomographic
detection without surgical intervention. Radioactive labels can
also be detected using PET or SPECT.
[0251] Diagnosis is performed by comparing the number, size, and/or
intensity of labeled loci, to corresponding baseline values. The
base line values can represent the mean levels in a population of
undiseased individuals. Baseline values can also represent previous
levels determined in the same patient. For example, baseline values
can be determined in a patient before beginning treatment, and
measured values thereafter compared with the baseline values. A
decrease in values relative to baseline signals a positive response
to treatment.
[0252] The present invention will be more fully described by the
following non-limiting examples.
EXAMPLES
Example I
Therapeutic Efficacy of Anti-A.beta. Antibodies: mAb 2H3, mAb 10D5,
mAb 266, mAb 21F12 and pAb A.beta.1-42
[0253] This example tests the capacity of various monoclonal and
polyclonal antibodies to A.beta. to inhibit accumulation of A.beta.
in the brain of heterozygotic transgenic mice.
[0254] A. Study Design
[0255] Sixty male and female, heterozygous PDAPP transgenic mice,
8.5 to 10.5 months of age were obtained from Charles River
Laboratory. The mice were sorted into six groups to be treated with
various antibodies directed to A.beta.. Animals were distributed to
match the gender, age, parentage and source of the animals within
the groups as closely as possible. Table 2 depicts the Experimental
design.
2TABLE 2 Experimental Design Treatment Treatment Antibody Antibody
Group N.sup.a Antibody Specificity Isotype 1 9 none NA.sup.b NA
(PBS alone) 2 10 Polyclonal A.beta.1-42 mixed 3 0 mAb.sup.d 2H3
A.beta.1-12 IgG1 4 8 mAb 10D5 A.beta.3-7 IgG1 5 6 mAb 266
A.beta.13-28 IgG1 6 8 mAb 21F12 A.beta.33-42 IgG2a .sup.aNumber of
mice in group at termination of the experiment. All groups started
with 10 animals per group. .sup.bNA: not applicable .sup.cmouse
polyclonal: anti-aggregated A.beta.42 .sup.dmAb: monoclonal
antibody
[0256] As shown in Table 2, the antibodies included four murine
A.beta.-specific monoclonal antibodies, 2H3 (directed to A.beta.
residues 1-12), 10D5 (directed to A.beta. residues 3-7), 266
(directed to A.beta. residues 13-28 and binds to soluble but not to
aggregated AN1792), 21F12 (directed to A.beta. residues 33-42). A
fifth group was treated with an A.beta.-specific polyclonal
antibody fraction (raised by immunization with aggregated AN1792).
The negative control group received the diluent, PBS, alone without
antibody.
[0257] B. Monitoring the Course of Treatment
[0258] The monoclonal antibodies were injected at a dose of about
10 mg/kg (assuming that the mice weighed 50 g). Antibody titers
were monitored over the 28 weeks of treatment. Injections were
administered intraperitoneally every seven days on average to
maintain anti-A.beta. titers above 1000. Although lower titers were
measured for mAb 266 since it does not bind well to the aggregated
AN1792 used as the capture antigen in the assay, the same dosing
schedule was maintained for this group. The group receiving
monoclonal antibody 2H3 was discontinued within the first three
weeks since the antibody was cleared too rapidly in vivo.
[0259] For determination of antibody titers, a subset of three
randomly chosen mice from each group were bled just prior to each
intraperitoneal inoculation, for a total of 30 bleeds. Antibody
titers were measured as A.beta.1-42-binding antibody using a
sandwich ELISA with plastic multi-well plates coated with
A.beta.1-42 as described in detail in the General Materials and
Methods. Mean titers for each bleed are set forth in Table 3 for
the polyclonal antibody and the monoclonals 10D5 and 21F12.
3TABLE 3 weeks 21F12 21F12 weeks 10D5 10D5 weeks poly poly 0.15 500
0.15 3000 0.15 1600 0.5 800 0.5 14000 0.5 4000 1 2500 1 5000 1 4500
1.5 1800 1.1 5000 1.5 3000 2 1400 1.2 1300 2 1300 3 6000 2 3000 3
1600 3.5 550 3 4000 3.5 650 4 1600 3.5 500 4 1300 5 925 4 2400 5
450 6 3300 5 925 6 2100 7 4000 6 1700 7 1300 8 1400 7 1600 8 2300 9
1900 8 4000 9 700 10 1700 9 1800 10 600 11 1600 10 1800 11 600 12
1000 11 2300 12 1000 13 1500 12 2100 13 900 14 1300 13 2800 14 1900
15 1000 14 1900 15 1200 16 1700 15 2700 16 700 17 1700 16 1300 17
2100 18 5000 17 2200 18 1800 19 900 18 2200 19 1800 20 300 19 2500
20 1200 22 1750 20 980 22 1000 23 1600 22 2000 23 1200 24 1000 23
1000 24 675 25 1100 24 850 25 850 26 2250 25 600 26 1600 27 1400 26
1100 27 1900 28 27 1450 28 28
[0260] Titers averaged about 1000 over this time period for the
polyclonal antibody preparation and were slightly above this level
for the 10D5- and 21F12-treated animals.
[0261] Treatment was continued over a six-month period for a total
of 196 days. Animals were euthanized one week after the final
dose.
[0262] C. A.beta. and APP Levels in the Brain:
[0263] Following about six months of treatment with the various
anti-A.beta. antibody preparations, brains were removed from the
animals following saline perfusion. One hemisphere was prepared for
immunohistochemical analysis and the second was used for the
quantitation of A.beta. and APP levels. To measure the
concentrations of various forms of beta amyloid peptide and amyloid
precursor protein (APP), the hemisphere was dissected and
homogenates of the hippocampal, cortical, and cerebellar regions
were prepared in 5M guanidine. These were serially diluted and the
level of amyloid peptide or APP was quantitated by comparison to a
series of dilutions of standards of A.beta. peptide or APP of known
concentrations in an ELISA format.
[0264] The levels of total A.beta. and of A.beta.1-42 measured by
ELISA in homogenates of the cortex, and the hippocampus and the
level of total A.beta. in the cerebellum are shown in Tables 4, 5,
and 6, respectively. The median concentration of total A.beta. for
the control group, inoculated with PBS, was 3.6-fold higher in the
hippocampus than in the cortex (median of 63,389 ng/g hippocampal
tissue compared to 17,818 ng/g for the cortex). The median level in
the cerebellum of the control group (30.6 ng/g tissue) was more
than 2,000-fold lower than in the hippocampus. These levels are
similar to those previously reported for heterozygous PDAPP
transgenic mice of this age (Johnson-Wood et al., supra).
[0265] For the cortex, one treatment group had a median A.beta.
level, measured as A.beta.1-42, which differed significantly from
that of the control group (p<0.05), those animals receiving the
polyclonal anti-A.beta. antibody as shown in Table 4. The median
level of A.beta.1-42 was reduced by 65%, compared to the control
for this treatment group. The median levels of A.beta.1-42 were
also significantly reduced by 55% compared to the control in one
additional treatment group, those animals dosed with the mAb 10D5
(=0.0433).
4TABLE 4 CORTEX Medians Total A.beta. A.beta.42 Means Treatment
ELISA ELISA Total A.beta. A.beta.42 Group N.sup.a value.sup.b P
value.sup.c % Change value P value % Change ELISA value ELISA value
PBS 9 17818 NA.sup.d NA 13802 NA NA 16150 +/- 7456.sup.e 12621 +/-
5738 Polyclonal anti- 10 6160 0.0055 -65 4892 0.0071 -65 5912 +/-
4492 4454 +/- 3347 A.beta.42 mAb 10D5 8 7915 0.1019 -56 6214 0.0433
-55 9695 +/- 6929 6943 +/- 3351 mAb 266 6 9144 0.1255 -49 8481
0.1255 -39 9204 +/- 9293 7489 +/- 6921 mAb 21F12 8 15158 0.2898 -15
13578 0.7003 -2 12481 +/- 7082 11005 +/- 6324 Footnotes:
.sup.aNumber of animals per group at the end of the experiment
.sup.bng/g tissue .sup.cMann Whitney analysis .sup.dNA: not
applicable .sup.eStandard Deviation
[0266] In the hippocampus, the median percent reduction of total
A.beta. associated with treatment with polyclonal anti-A.beta.
antibody (50%, p=0.0055) was not as great as that observed in the
cortex (65%) (Table 5). However, the absolute magnitude of the
reduction was almost 3-fold greater in the hippocampus than in the
cortex, a net reduction of 31,683 ng/g tissue in the hippocampus
versus 11,658 ng/g tissue in the cortex. When measured as the level
of the more amyloidogenic form of A.beta., A.beta.1-42, rather than
as total A.beta., the reduction achieved with the polyclonal
antibody was significant (p=0.0025). The median levels in groups
treated with the mAbs 10D5 and 266 were reduced by 33% and 21%,
respectively.
5TABLE 5 HIPPOCAMPUS Medians Total A.beta. A.beta.42 Means
Treatment ELISA P % ELISA P % Total A.beta. A.beta.42 Group N.sup.a
value.sup.b value.sup.c Change value value Change ELISA value ELISA
value PBS 9 63389 NA.sup.d NA 54429 NA NA 58351 +/- 13308.sup.e
52801 +/- 14701 Polyclonal 10 31706 0.0055 -50 27127 0.0025 -50
30058 +/- 22454 24853 +/- 18262 anti-A.beta.42 mAb 10D5 8 46779
0.0675 -26 36290 0.0543 -33 44581 +/- 18632 36465 +/- 17146 mAb 266
6 48689 0.0990 -23 43034 0.0990 -21 36419 +/- 27304 32919 +/- 25372
mAb 21F12 8 51563 0.7728 -19 47961 0.8099 -12 57327 +/- 28927 50305
+/- 23927 .sup.aNumber of animals per group at the end of the
experiment .sup.bng/g tissue .sup.cMann Whitney analysis .sup.dNA:
not applicable .sup.eStandard Deviation
[0267] Total A.beta. was also measured in the cerebellum (Table 6).
Those groups dosed with the polyclonal anti-A.beta. and the 266
antibody showed significant reductions of the levels of total
A.beta. (43% and 46%, p=0.0033 and p=0.0184, respectively) and that
group treated with 10D5 had a near significant reduction (29%,
p=0.0675).
6TABLE 6 CEREBELLUM Medians Total A.beta. Means Treatment ELISA P %
Total A.beta. Group N.sup.a value.sup.b value.sup.c Change ELISA
value PBS 9 30.64 NA.sup.d NA 40.00 +/- 31.89.sup.e Polyclonal 10
17.61 0.0033 -43 18.15 +/- 4.36 anti-A.beta.42 mAb 10D5 8 21.68
0.0675 -29 27.29 +/- 19.43 mAb 266 6 16.59 0.0184 -46 19.59 +/-
6.59 mAb 21F12 8 29.80 >0.9999 -3 32.88 +/- 9.90 .sup.aNumber of
animals per group at the end of the experiment .sup.bng/g tissue
.sup.cMann Whitney analysis .sup.dNA: not applicable .sup.eStandard
Deviation
[0268] APP concentration was also determined by ELISA in the cortex
and cerebellum from antibody-treated and control, PBS-treated mice.
Two different APP assays were utilized. The first, designated
APP-.alpha./FL, recognizes both APP-alpha (.alpha., the secreted
form of APP which has been cleaved within the A.beta. sequence),
and full-length forms (FL) of APP, while the second recognizes only
APP-.alpha.. In contrast to the treatment-associated diminution of
A.beta. in a subset of treatment groups, the levels of APP were
virtually unchanged in all of the treated compared to the control
animals. These results indicate that the immunizations with A.beta.
antibodies deplete A.beta. without depleting APP.
[0269] In summary, A.beta. levels were significantly reduced in the
cortex, hippocampus and cerebellum in animals treated with the
polyclonal antibody raised against AN1792. To a lesser extent
monoclonal antibodies to the amino terminal region of A.beta.1-42,
specifically amino acids 1-16 and 13-28 also showed significant
treatment effects.
[0270] D. Histochemical Analyses:
[0271] The morphology of A.beta.-immunoreactive plaques in subsets
of brains from mice in the PBS, polyclonal A.beta.42, 21F12, 266
and 10D5 treatment groups was qualitatively compared to that of
previous studies in which standard immunization procedures with
A.beta.42 were followed.
[0272] The largest alteration in both the extent and appearance of
amyloid plaques occurred in the animals immunized with the
polyclonal A.beta.42 antibody. The reduction of amyloid load,
eroded plaque morphology and cell-associated A.beta.
immunoreactivity closely resembled effects produced by the standard
immunization procedure. These observations support the ELISA
results in which significant reductions in both total A.beta. and
A.beta.42 were achieved by administration of the polyclonal
A.beta.42 antibody.
[0273] In similar qualitative evaluations, amyloid plaques in the
10D5 group were also reduced in number and appearance, with some
evidence of cell-associated A.beta. immunoreactivity. Relative to
control-treated animals, the polyclonal Ig fraction against A.beta.
and one of the monoclonal antibodies (10D5) reduced plaque burden
by 93% and 81%, respectively (p<0.005). 21F12 appeared to have a
relatively modest effect on plaque burden. Micrographs of brain
after treatment with pAbA.beta..sub.1-42 show diffuse deposits and
absence of many of the larger compacted plaques in the
pAbA.beta..sub.1-42 treated group relative to control treated
animals.
[0274] E. Lymphoproliferative Responses
[0275] A.beta.-dependent lymphoproliferation was measured using
spleen cells harvested eight days following the final antibody
infusion. Freshly harvested cells, 10.sup.5 per well, were cultured
for 5 days in the presence of A.beta.1-40 at a concentration of 5
.mu.M for stimulation. As a positive control, additional cells were
cultured with the T cell mitogen, PHA, and, as a negative control,
cells were cultured without added peptide.
[0276] Splenocytes from aged PDAPP mice passively immunized with
various anti-A.beta. antibodies were stimulated in vitro with
AN1792 and proliferative and cytokine responses were measured. The
purpose of these assays was to determine if passive immunization
facilitated antigen presentation, and thus priming of T cell
responses specific for AN1792. No AN1792-specific proliferative or
cytokine responses were observed in mice passively immunized with
the anti-A.beta. antibodies.
Example II
Therapeutic Efficacy of Anti-A.beta. Antibodies: mAb 2H3, mAb 10D5,
mAb 266, mAb 21F12, mAb 3D6, mAb 16C11 and pAb A.beta.1-42
[0277] In a second study, treatment with 10D5 was repeated and two
additional anti-A.beta. antibodies were tested, monoclonals 3D6
(A.beta.1-5) and 16C11 (A.beta.33-42). Control groups received
either PBS or an irrelevant isotype-matched antibody (TM2a). The
mice were older (11.5-12 month old heterozygotes) than in the
previous study, otherwise the experimental design was the same.
Once again, after six months of treatment, 10D5 reduced plaque
burden by greater than 80% relative to either the PBS or
isotype-matched antibody controls (p=0.003). One of the other
antibodies against A.beta., 3D6, was equally effective, producing
an 86% reduction (p=0.003). In contrast, the third antibody against
the peptide, 16C11, failed to have any effect on plaque burden.
Similar findings were obtained with A.beta.42 ELISA
measurements.
[0278] These results demonstrate that an antibody response against
A.beta. peptide, in the absence of T cell immunity, is sufficient
to decrease amyloid deposition in PDAPP mice, but that not all
anti-A.beta. antibodies are equally efficacious. Antibodies
directed to epitopes comprising amino acids 1-5 or 3-7 of A.beta.
are particularly efficacious. In summary, it can be demonstrated
that passively administered antibodies against A.beta. (i.e.,
passive immunization) reduces the extent of plaque deposition in a
mouse model of Alzheimer's disease.
Example III
Monitoring of Antibody Binding in the CNS
[0279] This Example demonstrates that when held at modest serum
concentrations (25-70 .mu.g/ml), the antibodies gained access to
the CNS at levels sufficient to decorate .beta.-amyloid
plaques.
[0280] To determine whether antibodies against A.beta. could be
acting directly within the CNS, brains taken from saline-perfused
mice at the end of the Example II, were examined for the presence
of the peripherally-administered antibodies. Unfixed cryostat brain
sections were exposed to a fluorescent reagent against mouse
immunoglobulin (goat anti-mouse IgG-Cy3). Plaques within brains of
the 10D5 and 3D6 groups were strongly decorated with antibody,
while there was no staining in the 16C11 group. To reveal the full
extent of plaque deposition, serial sections of each brain were
first immunoreacted with an anti-A.beta. antibody, and then with
the secondary reagent. 10D5 and 3D6, following peripheral
administration, gained access to most plaques within the CNS. The
plaque burden was greatly reduced in these treatment groups
compared to the 16C11 group. Antibody entry into the CNS was not
due to abnormal leakage of the blood-brain barrier since there was
no increase in vascular permeability as measured by Evans Blue in
PDAPP mice. In addition, the concentration of antibody in the brain
parenchyma of aged PDAPP mice was the same as in non-transgenic
mice, representing 0.1% of the antibody concentration in serum
(regardless of isotype).
[0281] These data indicate that peripherally administered
antibodies can enter the CNS where they can directly trigger
amyloid clearance. It is likely that 16C11 also had access to the
plaques but was unable to bind.
Example IV
Ex Vivo Screening Assay for Activity of an Antibody Against Amyloid
Deposits
[0282] To examine the effect of antibodies on plaque clearance, we
established an ex vivo assay in which primary microglial cells were
cultured with unfixed cryostat sections of either PDAPP mouse or
human AD brains. Microglial cells were obtained from the cerebral
cortices of neonate DBA/2N mice (1-3 days). The cortices were
mechanically dissociated in HBSS.sup.--(Hanks' Balanced Salt
Solution, Sigma) with 50 .mu.g/ml DNase I (Sigma). The dissociated
cells were filtered with a 100 .mu.m cell strainer (Falcon), and
centrifuged at 1000 rpm for 5 minutes. The pellet was resuspended
in growth medium (high glucose DMEM, 10% FBS, 25 ng/ml rmGM-CSF),
and the cells were plated at a density of 2 brains per T-75 plastic
culture flask. After 7-9 days, the flasks were rotated on an
orbital shaker at 200 rpm for 2 h at 37.degree. C. The cell
suspension was centrifuged at 1000 rpm and resuspended in the assay
medium.
[0283] 10-.mu.m cryostat sections of PDAPP mouse or human AD brains
(post-mortem interval <3 hr) were thaw mounted onto poly-lysine
coated round glass coverslips and placed in wells of 24-well tissue
culture plates. The coverslips were washed twice with assay medium
consisting of H-SFM (Hybridoma-serum free medium, Gibco BRL) with
1% FBS, glutamine, penicillin/streptomycin, and 5 ng/ml rmGM-CSF
(R&D). Control or anti-A.beta. antibodies were added at a
2.times. concentration (5 .mu.g/ml final) for 1 hour. The
microglial cells were then seeded at a density of
0.8.times.10.sup.6 cells/ml assay medium. The cultures were
maintained in a humidified incubator (37.degree. C., 5% CO.sub.2)
for 24 hr or more. At the end of the incubation, the cultures were
fixed with 4% paraformaldehyde and permeabilized with 0.1%
Triton-X100. The sections were stained with biotinylated 3D6
followed by a streptavidin/Cy3 conjugate (Jackson ImmunoResearch).
The exogenous microglial cells were visualized by a nuclear stain
(DAPI). The cultures were observed with an inverted fluorescent
microscope (Nikon, TE300) and photomicrographs were taken with a
SPOT digital camera using SPOT software (Diagnostic instruments).
For Western blot analysis, the cultures were extracted in 8M urea,
diluted 1:1 in reducing tricine sample buffer and loaded onto a 16%
tricine gel (Novex). After transfer onto immobilon, blots were
exposed to 5 .mu.g/ml of the pabA.beta.42 followed by an
HRP-conjugated anti-mouse antibody, and developed with ECL
(Amersham)
[0284] When the assay was performed with PDAPP brain sections in
the presence of 16C11 (one of the antibodies against A.beta. that
was not efficacious in vivo), .beta.-amyloid plaques remained
intact and no phagocytosis was observed. In contrast, when adjacent
sections were cultured in the presence of 10D5, the amyloid
deposits were largely gone and the microglial cells showed numerous
phagocytic vesicles containing A.beta.. Identical results were
obtained with AD brain sections; 10D5 induced phagocytosis of AD
plaques, while 16C11 was ineffective. In addition, the assay
provided comparable results when performed with either mouse or
human microglial cells, and with mouse, rabbit, or primate
antibodies against AD.
[0285] Table 7 compares A.beta. binding versus phagocytosis for
several different antibody binding specificities. It can be seen
that antibodies binding to epitopes within aa 1-7 both bind and
clear amyloid deposits, whereas antibodies binding to epitopes
within amino acids 4-10 bind without clearing amyloid deposits.
Antibodies binding to epitopes C-terminal to residue 10 neither
bind nor clear amyloid deposits.
7TABLE 7 Analysis of Epitope Specificity Antibody epitope isotype
Staining Phagocytosis N-Term mab 3D6 1-5 IgG2b + + 10D5 3-7 IgG1 +
+ 22C8 3-7 IgG2a + + 6E10 5-10 IgG1 + - 14A8 4-10 rat IgG1 + - aa
13-28 18G11 10-18 rat IgG1 - - 266 16-24 IgG1 - - 22D12 18-21 IgG2b
- - C-Term 2G3 -40 IgG1 - - 16C11 -40/-42 IgG1 - - 21F12 -42 IgG2a
- - Immune serum rabbit (CFA) 1-6 + + mouse (CFA) 3-7 + + mouse
(QS-21) 3-7 + + monkey (QS-21) 1-5 + + mouse (MAP1-7) + +
[0286] Table 8 shows results obtained with several antibodies
against A.beta., comparing their abilities to induce phagocytosis
in the ex vivo assay and to reduce in vivo plaque burden in passive
transfer studies. Although 16C11 and 21F12 bound to aggregated
synthetic A.beta. peptide with high avidity, these antibodies were
unable to react with .beta.-amyloid plaques in unfixed brain
sections, could not trigger phagocytosis in the ex vivo assay, and
were not efficacious in vivo. 10D5, 3D6, and the polyclonal
antibody against A.beta. were active by all three measures. These
results show that efficacy in vivo is due to direct antibody
mediated clearance of the plaques within the CNS, and that the ex
vivo assay is predictive of in vivo efficacy.
8TABLE 8 The ex vivo assay as predictor of in vivo efficacy Avidity
for Binding to aggregated .beta.-amyloid Ex vivo In vivo Antibody
Isotype A.beta. (pM) plaques efficacy efficacy monoclonal 3D6 IgG2b
470 + + + 10D5 IgG1 43 + + + 16C11 IgG1 90 - - - 21F12 IgG2a 500 -
- - TM2a IgG1 -- - - - polyclonal 1-42 mix 600 + + +
[0287] The same assay has been used to test clearing activity of an
antibody against a fragment of synuclein referred to as NAC.
Synuclein has been shown to be an amyloid plaque-associated
protein. An antibody to NAC was contacted with a brain tissue
sample containing amyloid plaques, and microglial cells, as before.
Rabbit serum was used as a control. Subsequent monitoring showed a
marked reduction in the number and size of plaques indicative of
clearing activity of the antibody.
[0288] Confocal microscopy was used to confirm that A.beta. was
internalized during the course of the ex vivo assay. In the
presence of control antibodies, the exogenous microglial cells
remained in a confocal plane above the tissue, there were no
phagocytic vesicles containing A.beta., and the plaques remained
intact within the section. In the presence of 10D5, nearly all
plaque material was contained in vesicles within the exogenous
microglial cells. To determine the fate of the internalized
peptide, 10D5 treated cultures were extracted with 8M urea at
various time-points, and examined by Western blot analysis. At the
one hour time point, when no phagocytosis had yet occurred,
reaction with a polyclonal antibody against A.beta. revealed a
strong 4 kD band (corresponding to the A.beta. peptide). A.beta.
immunoreactivity decreased at day 1 and was absent by day 3. Thus,
antibody-mediated phagocytosis of A.beta. leads to its
degradation.
[0289] To determine if phagocytosis in the ex vivo assay was
Fc-mediated, F(ab')2 fragments of the anti-A13 antibody 3D6 were
prepared. Although the F(ab')2 fragments retained their full
ability to react with plaques, they were unable to trigger
phagocytosis by microglial cells. In addition, phagocytosis with
the whole antibody could be blocked by a reagent against murine Fc
receptors (anti-CD16/32). These data indicate that in vivo
clearance of A.beta. occurs through Fc-receptor mediated
phagocytosis.
Example V
Passage of Antibodies Through the Blood-Brain Barrier
[0290] This example determines the concentration of antibody
delivered to the brain following intravenous injection into a
peripheral tissue of either normal or PDAPP mice. Following
treatment, PDAPP or control normal mice were perfused with 0.9%
NaCl. Brain regions (hippocampus or cortex) were dissected and
rapidly frozen. Brain were homogenized in 0.1% triton+protease
inhibitors. Immunoglobulin was detected in the extracts by ELISA.
F(ab)'2 goat anti-mouse IgG were coated onto an RIA plate as
capture reagent. The serum or the brain extracts were incubated for
1 hr. The isotypes were detected with anti-mouse IgG1-HRP or
IgG2a-HRP or IgG2b-HRP (Caltag). Antibodies, regardless of isotype,
were present in the CNS at a concentration that is 1:1000 that
found in the blood. For example, when the concentration of IgG1 was
three times that of IgG2a in the blood, it was three times IgG2a in
the brain as well, both being present at 0.1% of their respective
levels in the blood. This result was observed in both transgenic
and nontransgenic mice indicating that the PDAPP does not have a
uniquely leak blood brain barrier.
Example VI
Cloning and Sequencing of the Mouse 3D6 Variable Regions
[0291] Cloning and Sequence Analysis of 3D6 VH. The heavy chain
variable VH region of 3D6 was cloned by RT-PCR using mRNA prepared
from hybridoma cells by two independent methods. In the first,
consensus primers were employed to VH region leader peptide
encompassing the translation initiation codon as the 5' primer (DNA
#3818-3829), and a g2b (DNA #3832) constant regions specific 3'
primer. The sequences from PCR amplified product, as well as from
multiple, independently-derived clones, were in complete agreement
with one another. As a further check on the sequence of the 3D6 VH
region, the result was confirmed by sequencing a VH fragment
obtained by 5' RACE RT-PCR methodology and the 3' g2b specific
primer (DNA #3832). Again, the sequence was derived from the PCR
product, as well as multiple, independently-isolated clones. Both
sequences are in complete agreement with one another, (with the
exception of V81 substitution in the leader region from the 5' RACE
product), indicating that the sequences are derived from the mRNA
encoding the VH region of 3D6. The nucleotide (SEQ ID NO:3) and
amino acid sequence (SEQ ID NO:4) of the VH region of 3D6 are set
forth in Table 9A and in FIG. 2, respectively.
9TABLE 9A Mouse 3D6 VH Nucleotide Sequence
ATGAACTTCGGGCTCAGCTTGATTTTCCTTGTCCTTG (SEQ ID NO:3)
TTTTAAAAGGTGTCCAGTGTGAAGTGAAGCTGGTGCA
GTCTGGGGGAGGCTTAGTGAAGCCTGGAGCGTCTCTG
AAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTA
ACTATGGCATGTCTTGGGTTCGCCAGAATTCAGACAA
GAGGCTGGAGTGGGTTGCATCCATTAGGAGTGGTGGT
GGTAGAACCTACTATTCAGACAATGTAAAGGGCCGAT
TCACCATCTCCAGAGAGAATGCCAAGAACACCCTGTA
CCTGCAAATGAGTAGTCTGAAGTCTGAGGACACGGCC
TTGTATTATTGTGTCAGATATGATCACTATAGTGGTA GCTCCGACTACTGGGGCCAGGGCACCACT
*Leader peptide is underlined.
[0292] Cloning and Sequence Analysis of 3D6 VL. The light chain
variable VL region of 3D6 was cloned in an analogous manner as the
VH region. In the first trial, a consensus primer set was designed
for amplification of murine VL regions as follows: 5' primers (DNA
#3806-3816) were designed to hybridize to the VL region
encompassing the translation initiation codon, and a 3' primer
(DNA#3817) was specific for the murine Ck region downstream of the
V-J joining region. DNA sequence analysis of the PCR fragment, as
well as independently-derived clones isolated using this consensus
light chain primer set, revealed that the cDNA obtained was derived
from a non-functionally rearranged message as the sequence
contained a frameshift mutation between the V-J region
junction.
[0293] In a second trial, 5'RACE was employed to clone a second VL
encoding cDNA. DNA sequence analysis of this product (consensus 11)
showed it encoded a functional mRNA. Thus, it can be concluded that
the sequence encodes the correct 3D6 light chain mRNA. The
nucleotide (SEQ ID NO:1) and amino acid sequence (SEQ ID NO:2) of
the VL region of 3D6 are set forth in Table 9B and in FIG. 1,
respectively.
10TABLE 9B Mouse 3D6 VH Nucleotide Sequence
ATGATGAGTCCTGCCCAGTTCCTGTTTCTGTTAGTGC (SEQ ID NO:1)
TCTGGATTCGGGAAACCAACGCTTATGTTGTGATGAC
CCAGACTCCACTCACTTTGTCGGTTACCATTGGACAA
CCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCCTCT
TAGATAGTGATGGAAAGACATATTTGAATTGGTTGTT
ACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTAT
CTGGTGTCTAAACTGGACTCTGGAGTCCCTGACAGGT
TCACTGGCAGTGGATCACGGACAGATTTTACACTGAA
AATCAGCAGAATAGAGGCTGAGGATTTGGGACTTTAT
TATTGCTGGCAAGGTACACATTTTCCTCGGACGTTCG GTGGAGGCACCAACCTGGAAATCAAA
*Leader peptide is underlined
[0294] Primers used for the cloning of the 3D6 VL cDNA are set
forth in
11TABLE 10 Coding DNA Size Strand? DNA Sequence Comments 3806 40
Yes ACT.AGT.CGA.CAT.GAA.GTT.GCC.- TGT.TA mouse kappa variable
G.GCT.GTT.GGT.GCT.G (SEQ ID NO:39) primer 1 MKV PRIMER 1, MRC set;
% A + T = 50.00 [20]; % C + G = 50.00 [20] Davis, Botstein, Roth
Melting Temp C. 72.90 3807 39 Yes
ACT.AGT.CGA.CAT.GGA.GWC.AGA.CAC.AC mouse kappa variable
T.CCT.GYT.ATG.GGT (SEQ ID NO:40) primer 2 MKV PRIMER 2, MRC set % A
+ T = 46.15 [18]; % C + G = 48.72 [19] Davis, Botstein, Roth
Melting Temp C. 72.05 3808 40 Yes
ACT.AGT.CGA.CAT.GAG.TGT.GCT.CAC.TC mouse kappa variable
A.GGT.CCT.GGS.GTT.G (SEQ ID NO:41) primer 3 MKV PRIMER 3, MRC set;
A + T = 45.00 [18]; % C + G 52.50 [21] Davis, Botstein, Roth
Melting Temp C. 73.93 3809 43 Yes
ACT.AGT.CGA.CAT.GAG.GRC.CCC.TGC.TC mouse kappa variable
A.GWT.TYT.TGG.MWT.CTT.G (SEQ ID primer 4 NO:42 MKV PRIMER 4, MRC
set; % A + T = 41.86 [18]; % C + G = 46.51 [20] Davis, Botstein,
Roth Melting Temp C. 72.34 3810 40 Yes
ACT.AGT.CGA.CAT.GGA.TTT.WCA.GGT- .GC mouse kappa variable
A.GAT.TWT.CAG.CTT.C (SEQ ID primer 5 NO:43) MKV PRIMER 5, MRC set %
A + T 52.50 [21]; % C + G 42.50 [17] Davis, Botstein, Roth Melting
Temp C. 69.83 3811 37 Yes ACT.AGT.CGA.CAT.GAG.GTK- .CYY.TGY.TS
mouse kappa variable A.GYT.YCT.GRG.G (SEQ ID NO:44) primer 6 MKV
PRIMER 6, MRC set; % A + T = 37.84 [14]; % C + G 40.54 [15] Davis,
Botstein, Roth Melting Temp C. 68.01 3812 41 Yes
ACT.AGT.CGA.CAT.GGG.CWT.CAA.GAT.GG mouse kappa variable
A.GTC.ACA.KWY.YCW.GG (SEQ ID primer 7 NO:45) MKV PRIMER 7, MRC set;
% A + T = 39.02 [16]; % C + G = 46.34 [19] Davis, Botstein, Roth
Melting Temp C. 71.70 3813 41 Yes
ACT.AGT.CGA.CAT.GTG.GGG.AYC.TKT.TT mouse kappa variable
A.CMM.TTT.TTC.AAT.TG (SEQ ID primer 8 NO:46) MKV PRIMER 8, MRC set;
% A + T = 53.66 [22]; % C + G = 34.15 [14] Davis, Botstein, Roth
Melting Temp C. 66.70 3814 35 Yes
ACT.AGT.CGA.CAT.GGT.RTC.CWC.ASC.TC mouse kappa variable
A.GTT.CCT.TG (SEQ ID NO:47) primer 9 MKV PRIMER 9, MRC set. % A + T
= 45.71 [16]; % C + G = 45.71 [16] Davis, Botstein, Roth Melting
Temp C. 69.36 3815 37 Yes ACT.AGT.CGA.CAT.GTA.TAT.ATG.TTT.GT mouse
kappa variable T.GTC.TAT.TTC.T (SEQ ID NO:48) primer 10 MKV PRIMER
10, MRC set; % A + T = 70.27 [26]; % C + G = 29.73 [11] Davis,
Botstein, Roth Melting Temp C. 63.58 3816 38 Yes
ACT.AGT.CGA.CAT.GGA.AGC- .CCC.AGC.TC mouse kappa variable
A.GCT.TCT.CTT.CC (SEQ ID NO:49) primer 11 MKV PRIMER 11, MRC set; A
+ T = 44.74 [17]; % C + G = 55.26 [21] Davis, Botstein, Roth
Melting Temp C. 74.40 3817 27 No GGA.TCC.CGG.GTG.GAT.GGT.GGG. mouse
kappa light chain AAG.ATG (SEQ ID NO:50) reverse primer, aa 116-
122; Ck constant region primer MRC set + SmaI site; 0 A + T = 47.06
[8]; % C + G 52.94 [9] Davis, Botstein, Roth Melting Temp C. 57.19
3818 37 Yes ACT.AGT.CGA.CAT.GAA.ATG.CAG.CTG.GG mouse heavy variable
T.CAT.STT.CTT.C (SEQ ID NO:51) primer 1 MHV primer 1, MRC set; 3819
36 Yes ACT.AGT.CGA.CAT.GGG.ATG.GAG.CTR.TA mouse heavy variable
T.CAT.SYT.CTT (SEQ ID NO:52) primer 2 MHV primer 2, MRC set; 3820
37 Yes ACT.AGT.CGA.CAT.GAA.GWT.GTG.GTT.AA mouse heavy variable
A.CTG.GGT.TTT.T (SEQ ID NO:53) primer 3 MHV primer 3, MRC set; 3821
35 Yes ACT.AGT.CGA.CAT.GRA.CTT.TGG.GYT.CA mouse heavy variable
G.CTT.GRT.TT (SEQ ID NO:54) primer 4 MHV primer 4, MRC set; 3822 40
Yes ACT.AGT.CGA.CAT.GGA.CTC.CAG.GCT.CA mouse heavy variable
G.TTT.AGT.TTT.CCT.T (SEQ ID primer 5 NO:55) MHV primer 5, MRC set;
3823 37 Yes ACT.AGT.CGA.CAT.GGC.TGT.CYT.RGS.GC mouse heavy variable
T.RCT.CTT.CTG.C (SEQ ID NO:56) MHV primer 6, MRC set; 3824 36 Yes
ACT.AGT.CGA.CAT.GGR.ATG.GAG.CKG.GR mouse heavy variable
T.CTT.TMT.CTT (SEQ ID NO:57) primer 7 MHV primer 7, MRC set; 3825
33 Yes ACT.AGT .CGA.CAT.GAG.AGT.GCT.GAT.TC mouse heavy variable
T.TTT.GTG (SEQ ID NO:58) primer 8 MHV primer 8, MRC set; 3826 40
Yes ACT.AGT.CGA.CAT.GGM.TTG.GGT.GTG.GA mouse heavy variable
M.CTT.GCT.ATT.CCT.G (SEQ ID primer 9 0:59) MHV primer 9, MRC set;
3827 37 Yes ACT.AGT CGA.CAT.GGG.CAG.ACT.TAC.AT mouse heavy variable
T.CTC.ATT.CCT.G (SEQ ID NO:60) primer 10 MHV primer 10, MRC set;
3828 38 Yes ACT.AGT.CGA.CAT.GGA.TTT.TGG.GCT.GA mouse heavy variable
T.TTT.TTT.TAT.TG (SEQ ID NO:61) primer 11 MHV primer 11, MRC set;
3829 37 Yes ACT.AGT.CGA.CAT.GAT.GGT.GTT.AAG.TC mouse heavy variable
T.TCT.GTA.CCT.G (SEQ ID NO:62) primer 12 MHV primer 12, MRC set;
3832 27 No GGA.TCC.CGG.GAG.TGG.ATA.GAC. mouse IgG2b heavy chain
tGA.TG (SEQ ID NO:63) reverse primer aa position 119-124, MRC
set;
[0295] From N-terminal to C-terminal, both light and heavy chains
comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The
assignment of amino acids to each domain is in accordance with the
numbering convention of Kabat et al., supra.
[0296] Expression of Chimeric 3D6 Antibody: The variable heavy and
light chain regions were re-engineered to encode splice donor
sequences downstream of the respective VDJ or VJ junctions, and
cloned into the mammalian expression vector pCMV-h.gamma.1 for the
heavy chain, and pCMV-h.kappa.1 for the light chain. These vectors
encode human .gamma.1 and Ck constant regions as exonic fragments
downstream of the inserted variable region cassette. Following
sequence verification, the heavy chain and light chain expression
vectors were co-transfected into COS cells. Two different heavy
chain clones (H2.2 & H3.2) were independently co-transfected
with 3 different chimeric light chain clones (L3, L4, &L10) to
confirm reproducibility of the result. A chimeric 21.6 antibody
transfection was carried out as a positive control for the vectors.
Conditioned media was collected 48 hrs post transfection and
assayed by western blot analysis for antibody production or ELISA
for A.beta. binding.
[0297] The multiple transfectants all expressed heavy chain+light
chain combinations which are recognized by a goat anti-human IgG
(H+ L) antibody on a western blot.
[0298] Direct binding of 3D6 and chimeric 3D6 (PK1614) antibodies
to A.beta. was tested by ELISA analysis. Chimeric 3D6 was found to
bind to A.beta. with high avidity, similar to that demonstrated by
3D6 (FIG. 3A). Furthermore, an ELISA based competitive inhibition
assay revealed that the chimeric 3D6 and the murine 3D6 antibody
competed equally with biotinylated-3D6 binding to A.beta. (FIG.
3B). The chimeric antibody displayed binding properties
indistinguishable from the 3D6 reference sample.
12 TABLE 11 Conc (.mu.g/ml) 3D6 PK1614 IgG1 0.037 119.3 0.11 118.6
118.9 0.33 99.7 71.25 1 98.63 84.53 134.4
[0299] Moreover, both 3D6 and PK1614 were effective at clearing
A.beta. plaques. The ex vivo assay demonstrates that as the
concentration of antibody increases, the amount of A.beta.
decreases in a similar manner for both murine and chimeric 3D6
antibodies. Hence, it can be concluded that the sequences encode
functional 3D6 heavy chain and light chains respectively.
Example VII
3D6 Humanization
[0300] Homology/Molecular Modeling. In order to identify key
structural framework residues in the murine 3D6 antibody, a
three-dimensional model was generated based on the closest murine
antibodies for the heavy and light chains. For this purpose, an
antibody designated 1CR9 was chosen as a template for modeling the
3D6 light chain (PDB ID: 1CR9, Kanyo et al., supra), and an
antibody designated 1OPG was chosen as the template for modeling
the heavy chain. (PDB ID: 1OPG Kodandapani et al., supra). (See
also Table 1.) Amino acid sequence alignment of 3D6 with the light
chain and heavy chain of these antibodies revealed that, with the
exception of CDR3 of the heavy chain, the 1CR9 and 1OPG antibodies
share significant sequence homology with 3D6. In addition, the CDR
loops of the selected antibodies fall into the same canonical
Chothia structural classes as do the CDR loops of 3D6, again
excepting CDR3 of the heavy chain. Therefore, 1CR9 and 1OPG were
initially selected as antibodies of solved structure for homology
modeling of 3D6.
[0301] A first pass homology model of 3D6 variable region based on
the antibodies noted above was constructed using the Look &
SegMod Modules GeneMine (v3.5) software package. This software was
purchased under a perpetual license from Molecular Applications
Group (Palo Alto, Calif.). This software package, authored by Drs.
Michael Levitt and Chris Lee, facilitates the process of molecular
modeling by automating the steps involved in structural modeling a
primary sequence on a template of known structure based on sequence
homology. Working on a Silicon Graphics IRIS workstation under a
UNIX environment, the modeled structure is automatically refined by
a series of energy minimization steps to relieve unfavorable atomic
contacts and optimize electrostatic and van der Walls
interactions.
[0302] A further refined model was built using the modeling
capability of Quanta.RTM.. A query of the PDB database with CDR3 of
the heavy chain of 3D6 identified 1qkz as most homologous and
having the identical number of residues as 3D6. Hence, CDR3 of the
heavy chain of 3D6 was modeled using the crystal structure of 1qkz
as template. The .alpha.-carbon backbone trace of the 3D6 model is
shown in FIG. 4. The VH domain is shown as a stippled line, and VL
domain is shown as a solid line, and CDR loops are indicated in
ribbon form.
[0303] Selection of Human Acceptor Antibody Sequences. Suitable
human acceptor antibody sequences were identified by computer
comparisons of the amino acid sequences of the mouse variable
regions with the sequences of known human antibodies. The
comparison was performed separately for the 3D6 heavy and light
chains. In particular, variable domains from human antibodies whose
framework sequences exhibited a high degree of sequence identity
with the murine VL and VH framework regions were identified by
query of the Kabat Database using NCBI BLAST (publicly accessible
through the National Institutes of Health NCBI internet server)
with the respective murine framework sequences.
[0304] Two candidate sequences were chosen as acceptor sequences
based on the following criteria: (1) homology with the subject
sequence; (2) sharing canonical CDR structures with the donor
sequence; and (3) not containing any rare amino acid residues in
the framework regions. The selected acceptor sequence for VL is
Kabat ID Number (KABID) 019230 (Genbank Accession No. S40342), and
for VH is KABID 045919 (Genbank Accession No. AF115110). First
versions of humanized 3D6 antibody utilize these selected acceptor
antibody sequences.
[0305] Substitution of Amino Acid Residues. As noted supra, the
humanized antibodies of the invention comprise variable framework
regions substantially from a human immunoglobulin (acceptor
immunoglobulin) and complementarity determining regions
substantially from a mouse immunoglobulin (donor immunoglobulin)
termed 3D6. Having identified the complementarity determining
regions of 3D6 and appropriate human acceptor immunoglobulins, the
next step was to determine which, if any, residues from these
components to substitute to optimize the properties of the
resulting humanized antibody. The criteria described supra were
used to select residues for substitution.
[0306] FIGS. 1 and 2 depict alignments of the original murine 3D6
VL and VH, respectively, with the respective version 1 of the
humanized sequence, the corresponding human framework acceptor
sequence and, lastly, the human germline V region sequence showing
highest homology to the human framework acceptor sequence. The
shaded residues indicate the canonical (solid fill), vernier
(dotted outline), packing (bold), and rare amino acids (bold
italics), and are indicated on the figure. The asterisks indicate
residues backmutated to murine residues in the human acceptor
framework sequence, and CDR regions are shown overlined. A summary
of the changes incorporated into version 1 of humanized 3D6 VH and
VL is presented in Table 12.
13TABLE 12 Summary of changes in humanized 3D6.v1 Changes VL (112
residues) VH (119 residues) Hu->Mu: Framework 4/112 3/119 (1
canon, 1 packing) CDR1 6/16 3/5 CDR2 4/7 7/14 CDR3 5/8 4/10
Hu->Mu 19/112 (17%) 17/119 (14%) Mu->Hu: Framework 13/112
14/119 Backmutation notes 1. I2V which is a canonical 4. S49A
Vernier/beneath the position. CDRs. 2. Y36L which is a packing 5.
A93V which is a packing residue and also lies under the and vernier
zone residue CDRs 6. K94R which is a canonical 3. L46R which is a
packing residue residue and lies beneath the CDRs Acceptor notes 7.
KABID 019230/Genbank 11. KAB1D045919/Genbank Acc#S40342
Acc#AF115110 8. Hu .kappa. LC subgroup II 12. Hu HC subgroup III 9.
CDRs from same canonical 13. CDRs from same canonical structural
group as donor structural group as donor (m3D6) (m3D6) L1 = class 4
H1 = class 1 L2 = class 1 H2 = class3 L3 = class1 14. Recognizes
capsular 10. Unknown specificity polysaccharide of Neisseria
meningitidis Acceptor Germline 15. VH3-23 16. A3 & A19
[0307] Tables 13 and 14 set forth Kabat numbering keys for the
various light and heavy chains, respectively.
14TABLE 13 Key to Kabat Numbering for Light Chain mouse A19- KAB
3D6 HUM KABID Germ- # # TYPE VL 3D6VL 019230 line Comment 1 1 FR1 Y
Y D D Rare mouse, may contact CDR 2 2 V V I I Canonical/ CDR
contact 3 3 V V V V 4 4 M M M M 5 5 T T T T 6 6 Q Q Q Q 7 7 T S S S
8 8 P P P P 9 9 L L L L 10 10 T S S S 11 11 L L L L 12 12 S P P P
13 13 V V V V 14 14 T T T T 15 15 I P P P 16 16 G G G G 17 17 Q F E
E 18 18 P P P P 19 19 A A A A 20 20 S S S S 21 21 I I I I 22 22 S S
S S 23 23 C C C C 24 24 CDRI K K R R 25 25 S S S S 26 26 S S S S 27
27 Q Q Q Q 27A 28 S S S S 27B 29 L L L L 27C 30 L L L L 27D 31 D D
H H 27E 32 S S S S 28 33 D D N N 29 34 G G G G 30 35 K K Y Y 31 36
T T N N 32 37 Y Y Y Y 33 38 L L L L 34 39 N N D D 35 40 FR2 W W W W
36 41 L L Y Y Packing residue 37 42 L L L L 38 43 Q Q Q Q 39 44 R K
K K 40 45 P P P P 41 46 G G G G 42 47 Q Q Q Q 43 48 S S S S 44 49 P
P P P 45 50 K Q Q Q 46 51 R R L L Packing residue 47 52 L L L L 48
53 I I I I 49 54 Y Y Y Y 50 55 CDR2 L L L L 51 56 V V G G 52 57 S S
S S 53 58 K K N N 54 59 L L R R 55 60 D D A A 56 61 S S S S 57 62
FR3 G G G G 58 63 V V V V 59 64 P P P P 60 65 D D D D 61 66 R R R R
62 67 F F F F 63 68 T S S S 64 69 G G G G 65 70 S S S S 66 71 G G G
G 67 72 S S S S 68 73 G G G G 69 74 T T T T 70 75 D D D D 71 76 F F
F F 72 77 T T T T 73 78 L L L L 74 79 K K K K 75 80 I I I I 76 81 S
S S S 77 82 R R R R 78 83 I V V V 79 84 E E E E 80 85 A A A A 81 86
E E E E 82 87 D D D D 83 88 L V V V 84 89 G G G G 85 90 L V V V 86
91 Y Y Y Y 87 92 Y Y Y Y 88 93 C C C C 89 94 CDR3 W W M M 90 95 Q Q
Q Q 91 96 G G A A 92 97 T T L L 93 98 H H Q Q 94 99 F F T T 95 100
P P P P 96 101 R R R 97 102 T T T 98 103 FR4 F F F 99 104 G G G 100
105 G Q Q 101 106 G G G 102 107 T T T 103 108 K K K 104 109 L V V
105 110 E E E 106 111 I I I 106A 112 K K K
[0308]
15TABLE 13 Key to Kabat Numbering for Heavy Chain Mouse VH3-23 KAB
3D6 HUM KABID Germ- # # TYPE VH 3D6 VH 045919 line Comment 1 1 FR1
E E E E 2 2 V V V V 3 3 K Q Q Q 4 4 L L L L 5 5 V L L L 6 6 E E E E
7 7 S S S S 8 8 G G G G 9 9 G G G G 10 10 G G G G 11 11 L L L L 12
12 V V V V 13 13 K Q Q Q 14 14 P P P P 15 15 G G G G 16 16 A G G G
17 17 S S S S 18 18 L L L L 19 19 K R R R 20 20 L L L L 21 21 S S S
S 22 22 C C C C 23 23 A A A A 24 24 A A A A 25 25 S S S S 26 26 G G
G G 27 27 F F F F 28 28 T T T T 29 29 F F F F 30 30 S S S S 31 31
CDR1 N N S S 32 32 Y Y Y Y 33 33 G G A A 34 34 M M V M 35 35 S S S
S 36 36 FR2 W W W W 37 37 V V V V 38 38 R R R R 39 39 Q Q Q Q 40 40
N A A A Rare mouse, replace w/Hum 41 41 S P P P 42 42 D G G G Rare
mouse, replace w/Hum 43 43 K K K K 44 44 R G G G 45 45 L L L L 46
46 E E E E 47 47 W W W W 48 48 V V V V 49 49 A A S S CDR contact/
veneer 50 50 CDR2 S S A A 51 51 I I I I 52 52 R R S S 52A 53 S S G
G 53 54 G G S S 54 55 G G G G 55 56 G G G G 56 57 R R S S 57 58 T T
T T 58 59 Y Y Y Y 59 60 Y Y Y Y 60 61 S S A A 61 62 D D D D 62 63 N
N S S 63 64 V V V V 64 65 K K K K 65 66 G G G G 66 67 FR3 R R R R
67 68 F F F F 68 69 T T T T 69 70 I I I I 70 71 S S S S 71 72 R R R
R 72 73 F D D D 73 74 N N N N 74 75 A A A S 75 76 K K K K 76 77 N N
N N 77 78 T S S T 78 79 L L L L 79 80 Y Y Y Y 80 81 L L L L 81 82 Q
Q Q Q 82 83 M M M M 82A 84 S N N N 82B 85 S S S S 82C 86 L L L L 83
87 K R R R 84 88 S A A A 85 89 E E E E 86 90 D D D D 87 91 T T T T
88 92 A A A A 89 93 L L L V 90 94 Y Y Y Y 91 95 Y Y Y Y 92 96 C C C
C 93 97 V V A A Packing residue, use mouse 94 98 R R K K Canonical,
use mouse 95 99 CDR3 Y Y D 96 100 D D N 97 101 H H Y 98 102 Y Y D
99 103 S S F 100 104 G G W 100A 105 S S S 100B 106 S S C 100C 107
-- -- T 100D 108 -- -- F 101 109 D D D 102 110 Y Y Y 103 111 FR4 W
W W 104 112 G G G 105 113 Q Q Q 106 114 G G G 107 115 T T T 108 116
T L L 109 117 V V V 110 118 T T T 111 119 V V V 112 120 S S S 113
121 S S S
[0309] The humanized antibodies preferably exhibit a specific
binding affinity for A.beta. of at least 10.sup.7, 10.sup.8,
10.sup.9 or 10.sup.10 M.sup.-1. Usually the upper limit of binding
affinity of the humanized antibodies for A.beta. is within a factor
of three, four or five of that of 3D6 (i.e., .about.10.sup.9
M.sup.-1). Often the lower limit of binding affinity is also within
a factor of three, four or five of that of 3D6.
[0310] Assembly and Expression of Humanized 3D6 VH and VL, Version
1 Briefly, for each V region, 4 large single stranded overlapping
oligonucleotides were synthesized. In addition, 4 short PCR primers
were synthesized for each V region to further facilitate assembly
of the particular V region. The DNA sequences of the
oligonucleotides employed for this purpose are shown in Table
15.
16TABLE 15 DNA oligonucleotides DNA# SIZE Coding? Sequence comments
4060 136 Yes tccgc aagct tgccg ccacc hum 3D6VL-A ATGGA CATGC GCGTG
CCCGC CCAGC TGCTG GGCCT GCTGA TGCTG TGGGT GTCCG GCTCC TCCGG CTACG
TGGTG ATGAC CCAGT CCCCC CTGTC CCTGC CCGTG ACCCC CGGCG A (SEQ ID
NO:17) 4061 131 No CTGGG GGGAC TGGCC GGGCT hum 3D6 VL-B TCTGC AGCAG
CCAGT TCAGG TAGGT CTTGC CGTCG GAGTC CAGCA GGGAC TGGGA GGACT TGCAG
GAGAT GGAGG CGGGC TCGCC GGGGG TCACG GGCAG GGACA GGGGG G (SEQ ID
NO:18) 4062 146 Yes ACCTG AACTG GCTGC TGCAG hum 3D6 VL-C AAGCC
CGGCC AGTCC CCCCA GCGCC TGATC TACCT GGTGT CCAAG CTGGA CTCCG GCGTG
CCCGA CCGCT TCTCC GGCTC CGGCT CCGGC ACCGA CTTCA CCCTG AAGAT CTCCC
GCGTG GAGGC C (SEQ ID NO:19) 4063 142 No aattc tagga tccac tcacg
hum 3D6 VL-D CTTGA TCTCC ACCTT GGTGC CCTGG CCGAA GGTGC GGGGG AAGTG
GGTGC CCTGC CAGCA GTAGT ACACG CCCAC GTCCT CGGCC TCCAC GCGGG AGATC
TTCAG GGTGA AGTCG GTGCC GG (SEQIDNO:20) 4064 16 No CTGGG GGGAC
TGGCC G hum 3D6 VL A + B (SEQ ID NO:21) back % A + T = 18.75 [3]; %
C + G = 81.2 [13] Davis,Botstem,Roth Melting Temp C. 66.96 4065 22
Yes ACCTG AACTG GCTGC TGCAG hum 3D6 VL C + D AA (SEQ ID NO:22)
forward % A + T = 45.45 [10]; % C + G = 54.55 [12]
Davis,Botstem,Roth Melting Temp C. 64.54 4066 138 Yes acaga aagct
tgccg ccacc hum 3D6 VH-A ATGGA GTTTG GGCTG AGCTG GCTTT TTCTT GTGGC
TATTT TAAAA GGTGT CCAGT GTGAG GTGCA GCTGC TGGAG TCCGG CGGCG GCCTG
GTGCA GCCCG GCGGC TCCCT GCGCC TGT (SEQ ID NO:23) 4067 135 No GCCGC
CGGAG CGGAT GGAGG hum 3D6 VH-B CCACC CACTC CAGGC CCTTG CCGGG GGCCT
GGCGC ACCCA GGACA TGCCG TAGTT GGAGA AGGTG AAGCC GGAGG CGGCG CAGGA
CAGGC GCAGG GAGCC GCCGG GCTGC ACCAG (SEQ ID NO:24) 4068 142 Yes
CTGGA GTGGG TGGCC TCCAT hum 3D6 VH-C CCGCT CCGGC GGCGG CCGCA CCTAC
TACTC CGACA ACGTG AAGGG CCGCT TCACC ATCTC CCGCG ACAAC GCCAA GAACT
CCCTG TACCT GCAGA TGAAC TCCCT GCGCG CCGAG GACAC CG (SEQ ID NO:25)
4069 144 No ctgca aggat ccact cacaG hum 3D6 VH-D GAGGA CACGG TCACC
AGGGT GCCCT GGCCC CAGTA GTCGG AGGAG CCGGA GTAGT GGTCG TAGCG CACGC
AGTAG TACAG GGCGG TGTCC TCGGC GCGCA GGGAG TTCAT CTGCA GGTAC AGGG
(SEQ ID NO:26) 4070 16 No GCCGC CGGAG CGGAT G hum 3D6 VH A + B (SEQ
ID NO:27) back % A + T = 18.75 [3]; % C + G = 81.25 [13]
Davis,Botstem,Roth Melting Temp C. 66.96 4071 20 Yes CTGGA GTGGG
TGGCC TCCAT hum 3D6 VH C + D (SEQ ID NO:28) forward % A + T = 35.00
[7]; % C + G = 65.00 [13] Davis,Botstem,Roth Melting Temp C. 66.55
4072 19 Yes tcc gca agc ttg ccg Hum 3D6 VL A + B cca c (SEQ ID
NO:29) Forward % A + T = 31.58 [6]; % C + G = 68.42 [13]
Davis,Botstein,Roth Melting Temp C. 66.64 4073 29 No aat tct agg
atc cac tca Hum 3D6 VL C + D cgC TTG ATC TC Back (SEQ ID NO:30) % A
+ T = 55.17 [16]; % C + G = 44.83 [13] Davis,Botstein,Roth Melting
Temp C. 66.04 4074 23 Yes aca gaa agc ttg ccg cca Hum 3D6 VH A + B
ccA TG Forward (SEQ ID NO:31) % A + T = 43.48 [10]; % C + G = 56.52
[13] Davis,Botstein,Roth Melting Temp C. 66.33 4075 22 No ctg caa
gga tcc act cac Hum 3D6 VH C + D cGG A Back (SEQ ID NO:32) % A + T
= 40.91 [9]; % C + G = 59.09 [13] Davis,Botstein,Roth Melting Temp
C. 66.40
[0311] The humanized light chain was assembled using PCR. DNA
sequence analysis of greater than two dozen clones revealed
scattered point mutations and deletions throughout the VL region
with respect to the expected sequence. Analysis of the sequences
indicated that clone 2.3 was amenable to repair of 2 closely spaced
single nucleotide deletions in the amino-terminal region. Hence
site directed mutagenesis was performed on clone pCRShum3D6v12.3
using oligonucleotides to introduce the 2 deleted nucleotides, and
repair of the point mutations was confirmed by DNA sequence
analysis, and the VL insert was cloned into the light chain
expression vector pCMV-cK.
[0312] Assembly of humanized VH using PCR-based methods resulted in
clones with gross deletions in the 5' half of the sequence. Further
efforts to optimize the PCR conditions met with partial success.
The clones assembled via optimized PCR conditions still had 10-20
nt deletions in the region mapping to the overlap of the A+B
fragments. Consequently, an alternate strategy was employed for VH
assembly utilizing DNA polymerase (T4, Klenow, and Sequenase)
mediated overlap extension, followed by T4 DNA ligase to covalently
join the overlapping ends. DNA sequence analysis of a subset of the
clones resulting from VH assembly using the latter approach
revealed scattered point mutations and deletions among the clones.
Analysis of over two dozen clones revealed essentially the same
pattern as illustrated for the clones. The similar results observed
following first pass assembly of VH and VL clones suggests the DNA
sequence errors observed resulted from automated synthesizer errors
during the synthesis of the long DNAs employed for the
assembly.
[0313] Humanized VH clone 2.7 was selected for site-directed
mutagenesis-mediated repair of the 3 nucleotide deletions it was
observed to contain.
Example XIII
Characterization of Humanized 3D6v2 Antibody
[0314] A second version of humanized 3D6 was created having each of
the substitutions indicated for version 1, except for the
D.fwdarw.Y substitution at residue 1. Substitution at this residue
was performed in version 1 because the residue was identified as a
CDR interacting residue. However, substitution deleted a residue
which was rare for human immunoglobulins at that position. Hence, a
version was created without the substitution. Moreover,
non-germline residues in the heavy chain framework regions were
substituted with germline residues, namely, H74=S, H77=T and H89=V.
Kabat numbering for the version 2 light and heavy chains, is the
same as that depicted in Tables 13 and 14, respectively, except
that residue 1 of the version 2 light chain is asp (D), residue 74
of the heavy chain is ser (S), residue 77 of the heavy chain is thr
(T) and residue 89 of the heavy chain is val (V). The nucleotide
sequence of humanized 3D6 version 1 light and heavy chains are set
forth as SEQ ID NOs: 34 and 36, respectively. The nucleotide
sequence of humanized 3D6 version 2 light and heavy chains are set
forth as SEQ ID NOs: 35 and 37, respectively.
Example IX
Functional Testing of Humanized 3D6 Antibodies
[0315] Binding of humanized 3D6v1 to aggregated A.beta.. Functional
testing of humanized 3D6v1 was conducted using conditioned media
from transiently transfected COS cells. The cells were transfected
with fully chimeric antibody, a mixture of either chimeric heavy
chain+humanized light chain, or chimeric light chain+humanized
heavy chain, and lastly, fully humanized antibody. The conditioned
media was tested for binding to aggregated A.beta.1-42 by ELISA
assay. The humanized antibody showed good activity within
experimental error, and displayed binding properties
indistinguishable from the chimeric 3D6 reference sample. The
results are shown in Table 16.
17TABLE 16 hu VH/ ChVH/ Hu VH/ ng/ml Chimeric ChVL HuVL HuVL 690
0.867 600 0.895 260 0.83 230 0.774 200 0.81 190 0.811 87 0.675 77
0.594 67 0.689 63 0.648 29 0.45 25 0.381 22 0.496 21 0.438 9.6
0.251 8.5 0.198 7.4 0.278 7 0.232 3.2 0.129 2.3 0.124
[0316] To compare the binding affinities of humanized 3D6v1 and
3D6v2 antibodies, ELISA analysis was performed using aggregated
A.beta. as the antigen. The results show that both 3D6v1 (H1L1) and
3D6v2 (H2L2) have nearly identical A.beta. binding properties (FIG.
5).
[0317] Replacement NET (rNET) analysis of h3D6v2. The rNET epitope
map assay provides information about the contribution of individual
residues within the epitope to the overall binding activity of the
antibody. rNET analysis uses synthesized systematic single
substituted peptide analogs. Binding of an antibody being tested is
determined against native peptide (native antigen) and against 19
alternative "single substituted" peptides, each peptide being
substituted at a first position with one of 19 non-native amino
acids for that position. A profile is generated reflecting the
effect of substitution at that position with the various non-native
residues. Profiles are likewise generated at successive positions
along the antigenic peptide. The combined profile, or epitope map,
(reflecting substitution at each position with all 19 non-native
residues) can then be compared to a map similarly generated for a
second antibody. Substantially similar or identical maps indicate
that antibodies being compared have the same or similar epitope
specificity.
[0318] This analysis was performed for 3D6 and humanized 3D6,
version 2. Antibodies were tested for binding against the native
A.beta. peptide DAEFRHDSGY (SEQ ID NO:33). Residues 1-8 were
systematically substituted with each of the 19 non-native residues
for that position. Maps were generated accordingly for 3D6 and
h3D6v2. The results are presented in tabular form in Table 17.
18TABLE 17 A.beta.: replacement Net Epitope (rNET) mapping of wt3D6
and humanized 3D6 Wildtype Humanized 3D6 3D6 Substitution [OD] [OD]
Residue 1 = A 0.464 0.643 C 0.450 0.628 D 0.577 0.692 E 0.576 0.700
F 0.034 0.062 G 0.569 0.738 H 0.054 0.117 I 0.048 0.118 K 0.033
0.057 L 0.073 0.148 M 0.039 0.072 N 0.587 0.757 P 0.069 0.144 Q
0.441 0.689 R 0.056 0.155 S 0.569 0.762 T 0.450 0.702 V 0.057 0.190
W 0.031 0.070 Y 0.341 0.498 Residue 2 = A 0.548 0.698 C 0.553 0.694
D 0.119 0.222 E 0.563 0.702 F 0.577 0.717 G 0.527 0.720 H 0.534
0.741 I 0.522 0.722 K 0.548 0.722 L 0.482 0.705 M 0.535 0.705 N
0.525 0.735 P 0.445 0.707 Q 0.567 0.756 R 0.562 0.719 S 0.587 0.705
T 0.552 0.712 V 0.550 0.702 W 0.553 0.701 Y 0.547 0.704 Residue 3 =
A 0.038 0.061 C 0.222 0.410 D 0.019 0.027 E 0.542 0.689 F 0.034
0.060 G 0.016 0.019 H 0.016 0.020 I 0.019 0.024 K 0.053 0.090 L
0.019 0.026 M 0.019 0.027 N 0.024 0.032 P 0.017 0.020 Q 0.153 0.406
R 0.015 0.023 S 0.016 0.021 T 0.015 0.019 V 0.016 0.021 W 0.149
0.304 Y 0.016 0.020 Residue 4 = A 0.016 0.020 C 0.020 0.023 D 0.017
0.020 E 0.016 0.021 F 0.557 0.703 G 0.016 0.020 H 0.470 0.723 I
0.119 0.360 K 0.015 0.018 L 0.559 0.716 M 0.549 0.725 N 0.085 0.089
P 0.030 0.056 Q 0.065 0.110 R 0.016 0.019 S 0.026 0.031 T 0.016
0.021 V 0.213 0.494 W 0.291 0.568 Y 0.529 0.730 Residue 5 = A 0.275
0.435 C 0.359 0.635 D 0.080 0.163 E 0.115 0.187 F 0.439 0.569 G
0.485 0.679 H 0.577 0.680 I 0.510 0.671 K 0.573 0.693 L 0.517 0.691
M 0.418 0.611 N 0.476 0.655 P 0.093 0.198 Q 0.388 0.565 R 0.613
0.702 S 0.487 0.633 T 0.530 0.639 V 0.493 0.562 W 0.393 0.461 Y
0.278 0.230 Residue 6 = A 0.587 0.707 C 0.585 0.703 D 0.584 0.701 E
0.579 0.702 F 0.586 0.704 G 0.592 0.709 H 0.596 0.688 I 0.602 0.708
K 0.585 0.691 L 0.584 0.688 M 0.583 0.687 N 0.580 0.686 P 0.587
0.705 Q 0.570 0.695 R 0.576 0.686 S 0.573 0.689 T 0.573 0.700 V
0.588 0.715 W 0.576 0.696 Y 0.595 0.708 Residue 7 = A 0.580 0.688 C
0.559 0.676 D 0.573 0.681 E 0.565 0.677 F 0.546 0.668 G 0.562 0.679
H 0.557 0.675 I 0.552 0.681 K 0.565 0.685 L 0.566 0.701 M 0.562
0.697 N 0.573 0.688 P 0.582 0.678 Q 0.563 0.679 R 0.551 0.677 S
0.563 0.674 T 0.560 0.685 V 0.563 0.687 W 0.547 0.685 Y 0.560 0.682
Residue 8 = A 0.573 0.687 C 0.583 0.700 D 0.586 0.697 E 0.601 0.701
F 0.586 0.687 G 0.569 0.681 H 0.559 0.683 I 0.568 0.686 K 0.557
0.698 L 0.570 0.686 M 0.571 0.693 N 0.573 0.700 P 0.574 0.694 Q
0.590 0.703 R 0.589 0.699 S 0.599 0.719 T 0.586 0.689 V 0.578 0.688
W 0.567 0.687 Y 0.574 0.680
[0319] Notably, the profiles are virtually identical for 3D6 and
h3D6v2 when one looks at the substitutions at each position (i.e.,
the values fluctuate in an identical manner when comparing the data
in column 1 (3D6) versus column 2 (h3D6v2). These data demonstrate
that the specificity of h3D6v2 is preserved, as the h3D6v2 rNET
epitope map is virtually identical to m3D6 using both A.beta.
residues 1-4 and 5-8.
[0320] Immunohistochemistry on PDAPP brain sections demonstrates
specificity of h3D6v1 antibody. Humanized 3D6v1 antibody recognized
A.beta. in cryostat prepared brain sections from PDAPP mice.
Humanized 3D6v1 and PK1614 both bound to PDAPP plaques in the same
dose response fashion, as measured by the amount of fluorescence
(quantitated in pixels) per slide versus the amount of antibody
used to stain the tissue (FIG. 6). Identical anti-human secondary
antibodies were used in this experiment. Sectioning, staining, and
image procedures were previously described. In identical
experiments, image analysis of h3D6v2 staining on PDAPP and AD
brain sections revealed that h3D6v2 recognizes A.beta. plaques in a
similar manner to 3D6v1 (e.g., highly decorated plaques).
[0321] Competitive binding analysis of h3D6. The ability of h3D6
antibodies v1 and v2 to compete with murine 3D6 was measured by
ELISA using a biotinylated 3D6 antibody. Competitive binding
analysis revealed that h3D6v1, h3D6v2, and chimeric PK1614 can all
compete with m3D6 to bind A.beta. (FIG. 7). h3D6v1 and h3D6v2 were
identical in their ability to compete with 3D6 to A.beta.. The 10D5
antibody was used as a negative control, as it has a different
binding epitope than 3D6. BIAcore analysis also revealed a high
affinity of h3D6v1 and h3D6v2 for A.beta. (Table 18).
19TABLE 18 Affinity Measurements of A.beta. Antibodies Using
BIAcore Technology Antibody ka1 (1/Ms) kd1 (1/s) Kd (nM) Mu 3D6
4.06E+05 3.57E-04 0.88 Chimeric 3D6 4.58E+05 3.86E-04 0.84 Hu 3D6v1
1.85E+05 3.82E-04 2.06 Hu 3D6v2 1.70E+05 3.78E-04 2.24
[0322] In comparison to 3D6, which has a Kd of 0.88 nM, both h3D6v1
and h3D6v2 had about a 2 to 3 fold less binding affinity, measured
at 2.06 nM and 2.24 nM for h3D6v1 and h3D6v2, respectively. The
ELISA competitive binding assay revealed an approximate 6-fold less
binding affinity for h3D6v1 and h3D6v2. Typically humanized
antibodies lose about 3-4 fold in binding affinity in comparison to
their murine counterparts. Therefore, a loss of about 3 fold
(average of ELISA and BIAcore results) for h3D6v1 and h3D6v2 is
within the accepted range.
[0323] Ex vivo assay using h3D6v2 antibody. The ability of h3D6v2
to stimulate microglial cells was tested through an ex vivo
phagocytosis assay (FIG. 8). h3D6v2 was as effective as chimeric
3D6 at inducing phagocytosis of A.beta. aggregates from PDAPP mouse
brain tissue. IgG was used as a negative control in this experiment
because it is incapable of binding A.beta. and therefore cannot
induce phagocytosis.
[0324] In vivo brain localization of h3D6. .sup.125I labeled
h3D6v2, m3D6, and antibody DAE13 were each IV-injected into 14
individual PDAPP mice in separate experiments. Mice were sacrificed
after Day 7 and perfused for further analysis. Their brain regions
were dissected and measured for .sup.125I activity in specific
brain regions. Radiolabel activity in the brain was compared with
activity in serum samples. Results are set forth in Tables 19 and
20, for serum and brain regions, respectively.
20TABLE 19 m3D6 DAE13 Hu3D6 30389.1 17463.9 40963.8 12171 13200.6
24202.2 3418.2 36284.7 12472.4 18678.9 421.3 33851.8 27241 19702
27187.3 26398.8 24855.8 29016.9 27924.8 29287.4 33830.7 12008.4
12733.1 26734.9 29487.8 27722.5 30144.5 25498.6 30460.7 35126.9
9652 23320.1 28414.8 24599.3 7119.1 16956.1 29240 28093.5 18190.7
11922.7 24659.7 25671.4 17443.1 26748.9
[0325]
21TABLE 20 m3D6 DAE13 Hu3D6 (H2L2) cere cort hipp cere cort hipp
cere cort hipp 1991.9 1201.1 4024 1277.5 2522.9 5711.9 2424.6
3759.4 11622 238.9 746.1 2523 502.5 2123.5 6965.8 1509.8 2274.9
7018.2 645.9 603 1241.1 2325 3528.2 7801.6 500 2265.9 5316.3 1000
2508.2 4644.2 232.7 849.8 1891.9 2736.2 5703.7 10395.5 1266.9
3737.9 7975.8 891.6 2621 8245.2 1192.2 3188 10170 1422 2398.7
7731.1 1102.6 2087.5 7292.3 2269.4 3481.4 9621.6 1700.4 2154.4
7124.1 1650.6 3488.4 10284.8 1526.7 3028 8331.3 542.5 812.4 2456.8
712.9 2318.5 6643.3 1538.1 4194.1 11244.8 1309 3010.5 8693.5 1172.9
1953.6 7363 1245.7 1699.4 6831.2 1372.2 997.5 2425.4 1067.9 3697.2
12280.7 2708.8 2789 7887.4 778.6 1291.9 5654.4 1952.2 2120.7 6412.7
2251.3 3897.5 11121.5 1199.3 1683.4 4887.3 1005.2 1852.5 5121.4
1529.6 1772.2 7986.9 1021.8 3234.5 8036.2 961.5 3382.9 8473.1 644.1
1663.4 5056.5 742.1 1056.7 3405.2 852.3 1943.2 6717.4 1516.4 1620.6
9888 1273.7 1320.8 4262.6 997.5 3065.7 10213.1
[0326] The data show that h3D6v2 localized to the brain, and was
particularly concentrated in the hippocampal region where A.beta.
is known to aggregate. Brain counts for m3D6 and DAE13 were
comparable to h3D6v2. All three antibodies were able to cross the
blood barrier as demonstrated by A.beta. plaque binding in
vivo.
Example X
Cloning and Sequencing of the Mouse 10D5 Variable Regions
[0327] Cloning and Sequence Analysis of 10D5 VH. The VH and VL
regions of 10D5 from hybridoma cells were cloned by RT-PCR using 5'
RACE procedures. The nucleotide sequence (SEQ ID NO:13) and deduced
amino acid sequence (SEQ ID NO:14) derived from two independent
cDNA clones encoding the presumed 10D5 VL domain, are set forth in
Table 21 and FIG. 9. The nucleotide sequence (SEQ ID NO:15) and
deduced amino acid sequence (SEQ ID NO:16) derived from two
independent cDNA clones encoding the presumed 10D5 VH domain, are
set forth in Table 22 and FIG. 10. The 10D5 VL and VH sequences
meet the criteria for functional V regions in so far as they
contain a contiguous ORF from the initiator methionine to the
C-region, and share conserved residues characteristic of
immunoglobulin V region genes.
22TABLE 21 Mouse 10D5 VL DNA sequence (SEQ ID NO:13)
ATGAAGTTGCCTGTTAGGCTGTTGGTACTGATGTTCTGGAT- TCCTGCTTC
CAGCAGTGATGTTTTGATGACCCAAACTCCACTCTCCCTGCCTGTCA- GTC
TTGGAGATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAACATTATACAT
AGTAATGGAAACACCTATTTAGAATGGTACCTGCAGAAACCAGGCCAGTC
TCCAAAGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAG
ACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAAG
AAAGTGGAGGCTGAGGATCTGGGAATTTATTACTGCTTTCAAGGTTCACA
TGTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGGAA * Leader peptide
underlined
[0328]
23TABLE 22 Mouse 10D5 VH DNA sequence. (SEQ ID NO:15)
ATGGACAGGCTTACTTCCTCATTCCTGCTGCTGATTGTCC- CTGCATATGT
CCTGTCCCAGCCTACTCTGAAAGAGTCTGGCCCTGGAATATTGCAG- TCCT
CCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACT
TCTGGTATGGGAGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGA
GTGGCTGGCACACATTTACTGGGATGATGACAAGCGCTATAACCCATCCC
TGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAAGCAGGTATTC
CTCAAGATCACCAGTGTGGACCCTGCAGATACTGCCACATACTACTGTGT
TCGAAGGCCCATTACTCCGGTACTAGTCGATGCTATGGACTACTGGGGTC
AAGGAACCTCAGTCACCGTCTCCTCA *Leader peptide underlined.
Example XI
Efficacy of mAb 3D6 on Various Neuropathological Endpoints in PDAPP
Mice
[0329] This Example describes the efficacy of murine mAb 3D6 on
various neuropathological endpoints. A comparison is made between
passive immunization with 3D6 (at varying doses) and active
immunization with an A.beta. peptide.
[0330] Immunizations
[0331] PDAPP mice were passively immunized with mAb 3D6 at three
different doses, 10 mg/kg, 1 mg/kg and 10 mg/kg once a month
(1.times.4). An unrelated IgG.gamma.2a antibody (TY 11/15) and PBS
injections served as controls. Active immunization with A.beta.
peptide served as a comparison. Between 20 and 35 animals were
analyzed in each group.
[0332] The neuropathological endpoints assayed include amyloid
burden and neuritic burden.
[0333] Amyloid Burden
[0334] The extent of the frontal cortex occupied by amyloid
deposits was determined by immunostaining with 3D6 followed by
quantitative image analysis. The results of this analysis are shown
in Table 6. Each of the immunotherapies led to a significant
reduction of amyloid burden.
[0335] Neuritic Burden
[0336] Neuritic burden following passive immunization with 3D6 was
determined in PDAPP mice by immunostaining of brain sections with
anti-APP antibody 8E5 followed by quantitative image analysis.
Neuritic dystrophy is indicated by the appearance of dystrophic
neurites (e.g., neurites with a globular appearance) located in the
immediate vicinity of amyloid plaques. The results of this analysis
are shown in Table 7. 3D6 (IgG.gamma.2a isotype, recognizing
A.beta.1-5) did not significantly reduce neuritic burden as
compared to active immunization with A.beta. peptide. Previously,
it had been observed that 10D5 (IgG.gamma.1 isotype recognizing
A.beta.3-7) was unable to significantly reduce neuritic burden.
24TABLE 23 Frontal Cortex Amyloid Burden PBS TY 11/15 3D6, 10 mg/kg
3D6, 1 mg/kg 3D6, 10 mg/kg/4 wks. Active N 31 30 29 31 32 24 Median
(% AB) 15.182297 13.303288 0.865671 2.286513 1.470956 2.162772
Range 0.160-31.961 0-61.706 0-7.064 0.077-63.362 0-10.688 0-30.715
p Value (*M-W) .9425 ns ***.0001 ***<.0001 ***<.0001 ***.0004
% Change N/A 12% 94% 85% 90% 86%
[0337]
25TABLE 24 Frontal Cortex Neuritic Burden PBS TY 11/15 3D6, 10
mg/kg 3D6, 1 mg/kg 3D6, 10 mg/kg/4 wks. Active N 31 30 29 31 32 24
Median (% NB) 0.3946 0.3958 0.4681 0.3649 0.4228 0.2344 Range
0-1.3828 0-2.6800 0-1.3098 0-1.5760 0-1.8215 0-1.1942 p Value
(*M-W) .8967 ns .9587 ns .6986 ns >.9999 ***.0381 % Change 0% 0%
7% 0% 41%
[0338] The characterization of various neuropathological endpoints
in the PDAPP mouse model of Alzheimer's disease may assist the
skilled artisan in designing appropriate human therapeutic
immunization protocols.
Example XII
Prevention and Treatment of Human Subjects
[0339] A single-dose phase I trial is performed to determine safety
in humans. A therapeutic agent is administered in increasing
dosages to different patients starting from about 0.01 the level of
presumed efficacy, and increasing by a factor of three until a
level of about 10 times the effective mouse dosage is reached.
[0340] A phase II trial is performed to determine therapeutic
efficacy. Patients with early to mid Alzheimer's Disease defined
using Alzheimer's disease and Related Disorders Association (ADRDA)
criteria for probable AD are selected. Suitable patients score in
the 12-26 range on the Mini-Mental State Exam (MMSE). Other
selection criteria are that patients are likely to survive the
duration of the study and lack complicating issues such as use of
concomitant medications that may interfere. Baseline evaluations of
patient function are made using classic psychometric measures, such
as the MMSE, and the ADAS, which is a comprehensive scale for
evaluating patients with Alzheimer's Disease status and function.
These psychometric scales provide a measure of progression of the
Alzheimer's condition. Suitable qualitative life scales can also be
used to monitor treatment. Disease progression can also be
monitored by MRI. Blood profiles of patients can also be monitored
including assays of immunogen-specific antibodies and T-cells
responses.
[0341] Following baseline measures, patients begin receiving
treatment. They are randomized and treated with either therapeutic
agent or placebo in a blinded fashion. Patients are monitored at
least every six months. Efficacy is determined by a significant
reduction in progression of a treatment group relative to a placebo
group.
[0342] A second phase II trial is performed to evaluate conversion
of patients from non-Alzheimer's Disease early memory loss,
sometimes referred to as age-associated memory impairment (AAMI) or
mild cognitive impairment (MCI), to probable Alzheimer's disease as
defined as by ADRDA criteria. Patients with high risk for
conversion to Alzheimer's Disease are selected from a non-clinical
population by screening reference populations for early signs of
memory loss or other difficulties associated with pre-Alzheimer's
symptomatology, a family history of Alzheimer's Disease, genetic
risk factors, age, sex, and other features found to predict
high-risk for Alzheimer's Disease. Baseline scores on suitable
metrics including the MMSE and the ADAS together with other metrics
designed to evaluate a more normal population are collected. These
patient populations are divided into suitable groups with placebo
comparison against dosing alternatives with the agent. These
patient populations are followed at intervals of about six months,
and the endpoint for each patient is whether or not he or she
converts to probable Alzheimer's Disease as defined by ADRDA
criteria at the end of the observation.
[0343] General Materials and Methods
[0344] A. Preparation of Polyclonal and Monoclonal A.beta.
Antibodies
[0345] The anti-A.beta. polyclonal antibody was prepared from blood
collected from two groups of animals. The first group consisted of
100 female Swiss Webster mice, 6 to 8 weeks of age. They were
immunized on days 0, 15, and 29 with 100 .mu.g of AN1792 combined
with CFA/IFA. A fourth injection was given on day 36 with one-half
the dose of AN1792. Animals were exsanguinated upon sacrifice at
day 42, serum was prepared and the sera were pooled to create a
total of 64 ml. The second group consisted of 24 female mice
isogenic with the PDAPP mice but nontransgenic for the human APP
gene, 6 to 9 weeks of age. They were immunized on days 0, 14, 28
and 56 with 100 .mu.g of AN1792 combined with CFA/IFA. These
animals were also exsanguinated upon sacrifice at day 63, serum was
prepared and pooled for a total of 14 ml. The two lots of sera were
pooled. The antibody fraction was purified using two sequential
rounds of precipitation with 50% saturated ammonium sulfate. The
final precipitate was dialyzed against PBS and tested for
endotoxin. The level of endotoxin was less than 1 EU/mg.
[0346] The anti-A.beta. monoclonal antibodies were prepared from
ascites fluid. The fluid was first delipidated by the addition of
concentrated sodium dextran sulfate to ice-cold ascites fluid by
stirring on ice to a reach a final concentration of 0.238%.
Concentrated CaCl.sub.2 was then added with stirring to reach a
final concentration of 64 mM. This solution was centrifuged at
10,000.times.g and the pellet was discarded. The supernatant was
stirred on ice with an equal volume of saturated ammonium sulfate
added dropwise. The solution was centrifuged again at
10,000.times.g and the supernatant was discarded. The pellet was
resuspended and dialyzed against 20 mM Tris-HCl, 0.4 M NaCl, pH
7.5. This fraction was applied to a Pharmacia FPLC Sepharose Q
Column and eluted with a reverse gradient from 0.4 M to 0.275 M
NaCl in 20 mM Tris-HCl, pH 7.5.
[0347] The antibody peak was identified by absorbance at 280 nm and
appropriate fractions were pooled. The purified antibody
preparation was characterized by measuring the protein
concentration using the BCA method and the purity using SDS-PAGE.
The pool was also tested for endotoxin. The level of endotoxin was
less than 1 EU/mg. titers, titers less than 100 were arbitrarily
assigned a titer value of 25.
[0348] B. Measurement of Antibody Titers
[0349] Mice were bled by making a small nick in the tail vein and
collecting about 200 .mu.l of blood into a microfuge tube. Guinea
pigs were bled by first shaving the back hock area and then using
an 18 gauge needle to nick the metatarsal vein and collecting the
blood into microfuge tubes. Blood was allowed to clot for one hr at
room temperature (RT), vortexed, then centrifuged at 14,000.times.g
for 10 min to separate the clot from the serum. Serum was then
transferred to a clean microfuge tube and stored at 4.degree. C.
until titered.
[0350] Antibody titers were measured by ELISA. 96-well microtiter
plates (Costar EIA plates) were coated with 100 .mu.l of a solution
containing either 10 .mu.g/ml either A.beta.42 or SAPP or other
antigens as noted in each of the individual reports in Well Coating
Buffer (0.1 M sodium phosphate, pH 8.5, 0.1% sodium azide) and held
overnight at RT. The wells were aspirated and sera were added to
the wells starting at a 1/100 dilution in Specimen Diluent (0.014 M
sodium phosphate, pH 7.4, 0.15 M NaCl, 0.6% bovine serum albumin,
0.05% thimerosal). Seven serial dilutions of the samples were made
directly in the plates in three-fold steps to reach a final
dilution of 1/218,700. The dilutions were incubated in the
coated-plate wells for one hr at RT. The plates were then washed
four times with PBS containing 0.05% Tween 20. The second antibody,
a goat anti-mouse Ig conjugated to horseradish peroxidase (obtained
from Boehringer Mannheim), was added to the wells as 100 .mu.l of a
1/3000 dilution in Specimen Diluent and incubated for one hr at RT.
Plates were again washed four times in PBS, Tween 20. To develop
the chromogen, 100 .mu.l of Slow TMB (3,3',5,5'-tetramethyl
benzidine obtained from Pierce Chemicals) was added to each well
and incubated for 15 min at RT. The reaction was stopped by the
addition of 25 .mu.l of 2 M H.sub.2SO.sub.4. The color intensity
was then read on a Molecular Devices Vmax at (450 nm-650 nm).
[0351] Titers were defined as the reciprocal of the dilution of
serum giving one half the maximum OD. Maximal OD was generally
taken from an initial 1/100 dilution, except in cases with very
high titers, in which case a higher initial dilution was necessary
to establish the maximal OD. If the 50% point fell between two
dilutions, a linear extrapolation was made to calculate the final
titer. To calculate geometric mean antibody titers, titers less
than 100 were arbitrarily assigned a titer value of 25.
[0352] C. Brain Tissue Preparation
[0353] After euthanasia, the brains were removed and one hemisphere
was prepared for immunohistochemical analysis, while three brain
regions (hippocampus, cortex and cerebellum) were dissected from
the other hemisphere and used to measure the concentration of
various A.beta. proteins and APP forms using specific ELISAs
(Johnson-Wood et al., supra).
[0354] Tissues destined for ELISAs were homogenized in 10 volumes
of ice-cold guanidine buffer (5.0 M guanidine-HCl, 50 mM Tris-HCl,
pH 8.0). The homogenates were mixed by gentle agitation using an
Adams Nutator (Fisher) for three to four hr at RT, then stored at
-20.degree. C. prior to quantitation of A.beta. and APP. Previous
experiments had shown that the analytes were stable under this
storage condition, and that synthetic A.beta. protein (Bachem)
could be quantitatively recovered when spiked into homogenates of
control brain tissue from mouse littermates (Johnson-Wood et al.,
supra).
[0355] D. Measurement of A.beta. Levels
[0356] The brain homogenates were diluted 1:10 with ice cold Casein
Diluent (0.25% casein, PBS, 0.05% sodium azide, 20 .mu.g/ml
aprotinin, 5 mM EDTA pH 8.0, 10 .mu.g/ml leupeptin) and then
centrifuged at 16,000.times.g for 20 min at 4.degree. C. The
synthetic A.beta. protein standards (1-42 amino acids) and the APP
standards were prepared to include 0.5 M guanidine and 0.1% bovine
serum albumin (BSA) in the final composition. The "total" A.beta.
sandwich ELISA utilizes monoclonal antibody monoclonal antibody
266, specific for amino acids 13-28 of A.beta. (Seubert et al.,
supra), as the capture antibody, and biotinylated monoclonal
antibody 3D6, specific for amino acids 1-5 of A.beta. (Johnson-Wood
et al., supra), as the reporter antibody. The 3D6 monoclonal
antibody does not recognize secreted APP or full-length APP, but
detects only A.beta. species with an amino-terminal aspartic acid.
This assay has a lower limit of sensitivity of 50 ng/ml (11 nM) and
shows no cross-reactivity to the endogenous murine A.beta. protein
at concentrations up to 1 ng/ml (Johnson-Wood et al., supra).
[0357] The A.beta.1-42 specific sandwich ELISA employs mA.beta.
21F12, specific for amino acids 33-42 of A.beta. (Johnson-Wood, et
al. supra), as the capture antibody. Biotinylated mA.beta. 3D6 is
also the reporter antibody in this assay which has a lower limit of
sensitivity of about 125 .mu.g/ml (28 .mu.M, Johnson-Wood et al.,
supra). For the A.beta. ELISAs, 100 .mu.l of either mA.beta. 266
(at 10 .mu.g/ml) or mA.beta. 21F12 at (5 .mu.g/ml) was coated into
the wells of 96-well immunoassay plates (Costar) by overnight
incubation at RT. The solution was removed by aspiration and the
wells were blocked by the addition of 200 .mu.l of 0.25% human
serum albumin in PBS buffer for at least 1 hr at RT. Blocking
solution was removed and the plates were stored desiccated at
4.degree. C. until used. The plates were rehydrated with Wash
Buffer [Tris-buffered saline (0.15 M NaCl, 0.01 M Tris-HCl, pH
7.5), plus 0.05% Tween 20] prior to use. The samples and standards
were added in triplicate aliquots of 100 .mu.l per well and then
incubated overnight at 4.degree. C. The plates were washed at least
three times with Wash Buffer between each step of the assay. The
biotinylated mA.beta. 3D6, diluted to 0.5 .mu.g/ml in Casein Assay
Buffer (0.25% casein, PBS, 0.05% Tween 20, pH 7.4), was added and
incubated in the wells for 1 hr at RT. An avidin-horseradish
peroxidase conjugate, (Avidin-HRP obtained from Vector, Burlingame,
Calif.), diluted 1:4000 in Casein Assay Buffer, was added to the
wells for 1 hr at RT. The calorimetric substrate, Slow TMB-ELISA
(Pierce), was added and allowed to react for 15 minutes at RT,
after which the enzymatic reaction was stopped by the addition of
25 .mu.l 2 N H2SO4. The reaction product was quantified using a
Molecular Devices Vmax measuring the difference in absorbance at
450 nm and 650 nm.
[0358] E. Measurement of APP Levels
[0359] Two different APP assays were utilized. The first,
designated APP-.alpha./FL, recognizes both APP-alpha (a) and
full-length (FL) forms of APP. The second assay is specific for
APP-.alpha.. The APP-.alpha./FL assay recognizes secreted APP
including the first 12 amino acids of A.beta.. Since the reporter
antibody (2H3) is not specific to the .alpha.-clip-site, occurring
between amino acids 612-613 of APP.sup.695 (Esch et al., Science
248:1122-1124 (1990)); this assay also recognizes full length APP
(APP-FL). Preliminary experiments using immobilized APP antibodies
to the cytoplasmic tail of APP-FL to deplete brain homogenates of
APP-FL suggest that approximately 30-40% of the APP-.alpha./FL APP
is FL (data not shown). The capture antibody for both the
APP-.alpha.C/FL and APP-.alpha. assays is mAb 8E5, raised against
amino acids 444 to 592 of the APP.sup.695 form (Games et al.,
supra). The reporter mAb for the APP-.alpha./FL assay is mAb 2H3,
specific for amino acids 597-608 of APP.sup.695 (Johnson-Wood et
al., supra) and the reporter antibody for the APP-.alpha. assay is
a biotinylated derivative of mAb 16H9, raised to amino acids 605 to
611 of APP. The lower limit of sensitivity of the APP-.alpha.FL
assay is about 11 ng/ml (150 .rho.M) (Johnson-Wood et al.) and that
of the APP-.alpha. specific assay is 22 ng/ml (0.3 nM). For both
APP assays, mAb 8E5 was coated onto the wells of 96-well EIA plates
as described above for mAb 266. Purified, recombinant secreted
APP-.alpha. was used as the reference standard for the APP-.alpha.
assay and the APP-.alpha./FL assay (Esch et al., supra). The brain
homogenate samples in 5 M guanidine were diluted 1:10 in ELISA
Specimen Diluent (0.014 M phosphate buffer, pH 7.4, 0.6% bovine
serum albumin, 0.05% thimerosal, 0.5 M NaCl, 0.1% NP40). They were
then diluted 1:4 in Specimen Diluent containing 0.5 M guanidine.
Diluted homogenates were then centrifuged at 16,000.times.g for 15
seconds at RT. The APP standards and samples were added to the
plate in duplicate aliquots and incubated for 1.5 hr at RT. The
biotinylated reporter antibody 2H3 or 16H9 was incubated with
samples for 1 hr at RT. Streptavidin-alkaline phosphatase
(Boehringer Mannheim), diluted 1:1000 in specimen diluent, was
incubated in the wells for 1 hr at RT. The fluorescent substrate
4-methyl-umbellipheryl-phosphate was added for a 30-min RT
incubation and the plates were read on a Cytofluor.TM. 2350
fluorimeter (Millipore) at 365 nm excitation and 450 nm
emission.
[0360] F. Immunohistochemistry
[0361] Brains were fixed for three days at 40 C in 4%
paraformaldehyde in PBS and then stored from one to seven days at
4.degree. C. in 1% paraformaldehyde, PBS until sectioned.
Forty-micron-thick coronal sections were cut on a vibratome at RT
and stored in cryoprotectant (30% glycerol, 30% ethylene glycol in
phosphate buffer) at -20.degree. C. prior to immunohistochemical
processing. For each brain, six sections at the level of the dorsal
hippocampus, each separated by consecutive 240 .mu.m intervals,
were incubated overnight with one of the following antibodies: (1)
a biotinylated anti-A.beta. (mAb, 3D6, specific for human A.beta.)
diluted to a concentration of 2 .mu.g/ml in PBS and 1% horse serum;
or (2) a biotinylated mAb specific for human APP, 8E5, diluted to a
concentration of 3 .mu.g/ml in PBS and 1.0% horse serum; or (3) a
mAb specific for glial fibrillary acidic protein (GFAP; Sigma
Chemical Co.) diluted 1:500 with 0.25% Triton X-100 and 1% horse
serum, in Tris-buffered saline, pH 7.4 (TBS); or (4) a mAb specific
for CD11b, MAC-1 antigen, (Chemicon International) diluted 1:100
with 0.25% Triton X-100 and 1% rabbit serum in TBS; or (5) a mAb
specific for MHC II antigen, (Pharmingen) diluted 1:100 with 0.25%
Triton X-100 and 1% rabbit serum in TBS; or (6) a rat mAb specific
for CD 43 (Pharmingen) diluted 1:100 with 1% rabbit serum in PBS or
(7) a rat mAb specific for CD 45RA (Pharmingen) diluted 1:100 with
1% rabbit serum in PBS; or (8) a rat monoclonal A.beta. specific
for CD 45RB (Pharmingen) diluted 1:100 with 1% rabbit serum in PBS;
or (9) a rat monoclonal A.beta. specific for CD 45 (Pharmingen)
diluted 1:100 with 1% rabbit serum in PBS; or (10) a biotinylated
polyclonal hamster A.beta. specific for CD3e (Pharmingen) diluted
1:100 with 1% rabbit serum in PBS or (11) a rat mAb specific for
CD3 (Serotec) diluted 1:200 with 1% rabbit serum in PBS; or with
(12) a solution of PBS lacking a primary antibody containing 1%
normal horse serum.
[0362] Sections reacted with antibody solutions listed in 1, 2 and
6-12 above were pretreated with 1.0% Triton X-100, 0.4% hydrogen
peroxide in PBS for 20 min at RT to block endogenous peroxidase.
They were next incubated overnight at 4.degree. C. with primary
antibody. Sections reacted with 3D6 or 8E5 or CD3e mAbs were then
reacted for one hr at RT with a horseradish
peroxidase-avidin-biotin-complex with kit components "A" and "B"
diluted 1:75 in PBS (Vector Elite Standard Kit, Vector Labs,
Burlingame, Calif.). Sections reacted with antibodies specific for
CD 45RA, CD 45RB, CD 45, CD3 and the PBS solution devoid of primary
antibody were incubated for 1 hour at RT with biotinylated anti-rat
IgG (Vector) diluted 1:75 in PBS or biotinylated anti-mouse IgG
(Vector) diluted 1:75 in PBS, respectively. Sections were then
reacted for one hr at RT with a horseradish
peroxidase-avidin-biotin-complex with kit components "A" and "B"
diluted 1:75 in PBS (Vector Elite Standard Kit, Vector Labs,
Burlingame, Calif.).
[0363] Sections were developed in 0.01% hydrogen peroxide, 0.05%
3,3'-diaminobenzidine (DAB) at RT. Sections destined for incubation
with the GFAP-, MAC-1- AND MHC II-specific antibodies were
pretreated with 0.6% hydrogen peroxide at RT to block endogenous
peroxidase then incubated overnight with the primary antibody at
4.degree. C. Sections reacted with the GFAP antibody were incubated
for 1 hr at RT with biotinylated anti-mouse IgG made in horse
(Vector Laboratories; Vectastain Elite ABC Kit) diluted 1:200 with
TBS. The sections were next reacted for one hr with an
avidin-biotin-peroxidase complex (Vector Laboratories; Vectastain
Elite ABC Kit) diluted 1:1000 with TBS. Sections incubated with the
MAC-1- or MHC II-specific monoclonal antibody as the primary
antibody were subsequently reacted for 1 hr at RT with biotinylated
anti-rat IgG made in rabbit diluted 1:200 with TBS, followed by
incubation for one hr with avidin-biotin-peroxidase complex diluted
1:1000 with TBS. Sections incubated with GFAP-, MAC-1- and MHC
II-specific antibodies were then visualized by treatment at RT with
0.05% DAB, 0.01% hydrogen peroxide, 0.04% nickel chloride, TBS for
4 and 11 min, respectively.
[0364] Immunolabeled sections were mounted on glass slides (VWR,
Superfrost slides), air dried overnight, dipped in Propar (Anatech)
and overlaid with coverslips using Permount (Fisher) as the
mounting medium.
[0365] To counterstain A.beta. plaques, a subset of the
GFAP-positive sections were mounted on Superfrost slides and
incubated in aqueous 1% Thioflavin S (Sigma) for 7 min following
immunohistochemical processing. Sections were then dehydrated and
cleared in Propar, then overlaid with coverslips mounted with
Permount.
[0366] G. Image Analysis
[0367] A Videometric 150 Image Analysis System (Oncor, Inc.,
Gaithersburg, Md.) linked to a Nikon Microphot-FX microscope
through a CCD video camera and a Sony Trinitron monitor was used
for quantification of the immunoreactive slides. The image of the
section was stored in a video buffer and a color- and
saturation-based threshold was determined to select and calculate
the total pixel area occupied by the immunolabeled structures. For
each section, the hippocampus was manually outlined and the total
pixel area occupied by the hippocampus was calculated. The percent
amyloid burden was measured as: (the fraction of the hippocampal
area containing A.beta. deposits immunoreactive with mAb
3D6).times.100. Similarly, the percent neuritic burden was measured
as: (the fraction of the hippocampal area containing dystrophic
neurites reactive with monoclonal antibody 8E5).times.100. The
C-Imaging System (Compix, Inc., Cranberry Township, Pa.) operating
the Simple 32 Software Application program was linked to a Nikon
Microphot-FX microscope through an Optronics camera and used to
quantitate the percentage of the retrospenial cortex occupied by
GFAP-positive astrocytes and MAC-1- and MHC II-positive microglia.
The image of the immunoreacted section was stored in a video buffer
and a monochrome-based threshold was determined to select and
calculate the total pixel area occupied by immunolabeled cells. For
each section, the retrosplenial cortex (RSC) was manually outlined
and the total pixel area occupied by the RSC was calculated. The
percent astrocytosis was defined as: (the fraction of RSC occupied
by GFAP-reactive astrocytes).times.100. Similarly, percent
microgliosis was defined as: (the fraction of the RSC occupied by
MAC-1- or MHC II-reactive microglia).times.100. For all image
analyses, six sections at the level of the dorsal hippocampus, each
separated by consecutive 240 .mu.m intervals, were quantitated for
each animal. In all cases, the treatment status of the animals was
unknown to the observer.
[0368] Although the foregoing invention has been described in
detail for purposes of clarity of understanding, it will be obvious
that certain modifications may be practiced within the scope of the
appended claims. All publications and patent documents cited
herein, as well as text appearing in the figures and sequence
listing, are hereby incorporated by reference in their entirety for
all purposes to the same extent as if each were so individually
denoted.
[0369] From the foregoing it will be apparent that the invention
provides for a number of uses. For example, the invention provides
for the use of any of the antibodies to A.beta. described above in
the treatment, prophylaxis or diagnosis of amyloidogenic disease,
or in the manufacture of a medicament or diagnostic composition for
use in the same.
Sequence CWU 1
1
63 1 396 DNA Mus musculus CDS (1)...(396) sig_peptide (1)...(60) 1
atg atg agt cct gcc cag ttc ctg ttt ctg tta gtg ctc tgg att cgg 48
Met Met Ser Pro Ala Gln Phe Leu Phe Leu Leu Val Leu Trp Ile Arg -20
-15 -10 -5 gaa acc aac ggt tat gtt gtg atg acc cag act cca ctc act
ttg tcg 96 Glu Thr Asn Gly Tyr Val Val Met Thr Gln Thr Pro Leu Thr
Leu Ser 1 5 10 gtt acc att gga caa cca gcc tcc atc tct tgc aag tca
agt cag agc 144 Val Thr Ile Gly Gln Pro Ala Ser Ile Ser Cys Lys Ser
Ser Gln Ser 15 20 25 ctc tta gat agt gat gga aag aca tat ttg aat
tgg ttg tta cag agg 192 Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn
Trp Leu Leu Gln Arg 30 35 40 cca ggc cag tct cca aag cgc cta atc
tat ctg gtg tct aaa ctg gac 240 Pro Gly Gln Ser Pro Lys Arg Leu Ile
Tyr Leu Val Ser Lys Leu Asp 45 50 55 60 tct gga gtc cct gac agg ttc
act ggc agt gga tca ggg aca gat ttt 288 Ser Gly Val Pro Asp Arg Phe
Thr Gly Ser Gly Ser Gly Thr Asp Phe 65 70 75 aca ctg aaa atc agc
aga ata gag gct gag gat ttg gga ctt tat tat 336 Thr Leu Lys Ile Ser
Arg Ile Glu Ala Glu Asp Leu Gly Leu Tyr Tyr 80 85 90 tgc tgg caa
ggt aca cat ttt cct cgg acg ttc ggt gga ggc acc aag 384 Cys Trp Gln
Gly Thr His Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys 95 100 105 ctg
gaa atc aaa 396 Leu Glu Ile Lys 110 2 132 PRT Mus musculus SIGNAL
(1)...(20) 2 Met Met Ser Pro Ala Gln Phe Leu Phe Leu Leu Val Leu
Trp Ile Arg -20 -15 -10 -5 Glu Thr Asn Gly Tyr Val Val Met Thr Gln
Thr Pro Leu Thr Leu Ser 1 5 10 Val Thr Ile Gly Gln Pro Ala Ser Ile
Ser Cys Lys Ser Ser Gln Ser 15 20 25 Leu Leu Asp Ser Asp Gly Lys
Thr Tyr Leu Asn Trp Leu Leu Gln Arg 30 35 40 Pro Gly Gln Ser Pro
Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp 45 50 55 60 Ser Gly Val
Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe 65 70 75 Thr
Leu Lys Ile Ser Arg Ile Glu Ala Glu Asp Leu Gly Leu Tyr Tyr 80 85
90 Cys Trp Gln Gly Thr His Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys
95 100 105 Leu Glu Ile Lys 110 3 414 DNA Mus musculus CDS
(1)...(414) sig_peptide (1)...(57) 3 atg aac ttc ggg ctc agc ttg
att ttc ctt gtc ctt gtt tta aaa ggt 48 Met Asn Phe Gly Leu Ser Leu
Ile Phe Leu Val Leu Val Leu Lys Gly -15 -10 -5 gtc cag tgt gaa gtg
aag ctg gtg gag tct ggg gga ggc tta gtg aag 96 Val Gln Cys Glu Val
Lys Leu Val Glu Ser Gly Gly Gly Leu Val Lys 1 5 10 cct gga gcg tct
ctg aaa ctc tcc tgt gca gcc tct gga ttc act ttc 144 Pro Gly Ala Ser
Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 15 20 25 agt aac
tat ggc atg tct tgg gtt cgc cag aat tca gac aag agg ctg 192 Ser Asn
Tyr Gly Met Ser Trp Val Arg Gln Asn Ser Asp Lys Arg Leu 30 35 40 45
gag tgg gtt gca tcc att agg agt ggt ggt ggt aga acc tac tat tca 240
Glu Trp Val Ala Ser Ile Arg Ser Gly Gly Gly Arg Thr Tyr Tyr Ser 50
55 60 gac aat gta aag ggc cga ttc acc atc tcc aga gag aat gcc aag
aac 288 Asp Asn Val Lys Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys
Asn 65 70 75 acc ctg tac ctg caa atg agt agt ctg aag tct gag gac
acg gcc ttg 336 Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Ser Glu Asp
Thr Ala Leu 80 85 90 tat tat tgt gtc aga tat gat cac tat agt ggt
agc tcc gac tac tgg 384 Tyr Tyr Cys Val Arg Tyr Asp His Tyr Ser Gly
Ser Ser Asp Tyr Trp 95 100 105 ggc cag ggc acc act gtc aca gtc tcc
tca 414 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 110 115 4 138 PRT
Mus musculus SIGNAL (1)...(19) 4 Met Asn Phe Gly Leu Ser Leu Ile
Phe Leu Val Leu Val Leu Lys Gly -15 -10 -5 Val Gln Cys Glu Val Lys
Leu Val Glu Ser Gly Gly Gly Leu Val Lys 1 5 10 Pro Gly Ala Ser Leu
Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 15 20 25 Ser Asn Tyr
Gly Met Ser Trp Val Arg Gln Asn Ser Asp Lys Arg Leu 30 35 40 45 Glu
Trp Val Ala Ser Ile Arg Ser Gly Gly Gly Arg Thr Tyr Tyr Ser 50 55
60 Asp Asn Val Lys Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn
65 70 75 Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr
Ala Leu 80 85 90 Tyr Tyr Cys Val Arg Tyr Asp His Tyr Ser Gly Ser
Ser Asp Tyr Trp 95 100 105 Gly Gln Gly Thr Thr Val Thr Val Ser Ser
110 115 5 132 PRT Artificial Sequence SIGNAL (1)...(20) humanized
3D6 light chain variable region 5 Met Met Ser Pro Ala Gln Phe Leu
Phe Leu Leu Val Leu Trp Ile Arg -20 -15 -10 -5 Glu Thr Asn Gly Tyr
Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro 1 5 10 Val Thr Pro Gly
Glu Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser 15 20 25 Leu Leu
Asp Ser Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Lys 30 35 40
Pro Gly Gln Ser Pro Gln Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp 45
50 55 60 Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe 65 70 75 Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val
Gly Val Tyr Tyr 80 85 90 Cys Trp Gln Gly Thr His Phe Pro Arg Thr
Phe Gly Gln Gly Thr Lys 95 100 105 Val Glu Ile Lys 110 6 125 PRT
Homo sapiens SIGNAL (1)...(13) 6 Met Gly Leu Leu Met Leu Trp Val
Ser Gly Ser Ser Gly Asp Ile Val -10 -5 1 Met Thr Gln Ser Pro Leu
Ser Leu Pro Val Thr Pro Gly Glu Pro Ala 5 10 15 Ser Ile Ser Cys Arg
Ser Ser Gln Ser Leu Leu His Ser Asn Gly Tyr 20 25 30 35 Asn Tyr Leu
Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu 40 45 50 Leu
Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro Asp Arg Phe 55 60
65 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val
70 75 80 Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala Leu
Gln Thr 85 90 95 Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
Lys 100 105 110 7 100 PRT Homo sapiens 7 Asp Ile Val Met Thr Gln
Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10 15 Glu Pro Ala Ser
Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30 Asn Gly
Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45
Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50
55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys
Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys
Met Gln Ala 85 90 95 Leu Gln Thr Pro 100 8 138 PRT Artificial
Sequence Humanized 3D6 heavy chain variable region 8 Met Asn Phe
Gly Leu Ser Leu Ile Phe Leu Val Leu Val Leu Lys Gly -15 -10 -5 Val
Gln Cys Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln 1 5 10
Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 15
20 25 Ser Asn Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu 30 35 40 45 Glu Trp Val Ala Ser Ile Arg Ser Gly Gly Gly Arg Thr
Tyr Tyr Ser 50 55 60 Asp Asn Val Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asn Ala Lys Asn 65 70 75 Ser Leu Tyr Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp Thr Ala Leu 80 85 90 Tyr Tyr Cys Val Arg Tyr Asp
His Tyr Ser Gly Ser Ser Asp Tyr Trp 95 100 105 Gly Gln Gly Thr Leu
Val Thr Val Ser Ser 110 115 9 121 PRT Homo sapiens 9 Glu Val Gln
Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25
30 Ala Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp
Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Lys Asp Asn Tyr Asp Phe Trp
Ser Gly Thr Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr
Val Ser Ser 115 120 10 98 PRT Homo sapiens 10 Glu Val Gln Leu Leu
Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr Tyr Cys 85 90 95 Ala Lys 11 132 PRT Artificial Sequence
SIGNAL (1)...(20) humanized 3D6 light chain variable region 11 Met
Met Ser Pro Ala Gln Phe Leu Phe Leu Leu Val Leu Trp Ile Arg -20 -15
-10 -5 Glu Thr Asn Gly Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu
Pro 1 5 10 Val Thr Pro Gly Glu Pro Ala Ser Ile Ser Cys Lys Ser Ser
Gln Ser 15 20 25 Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn Trp
Leu Leu Gln Lys 30 35 40 Pro Gly Gln Ser Pro Gln Arg Leu Ile Tyr
Leu Val Ser Lys Leu Asp 45 50 55 60 Ser Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Gly Thr Asp Phe 65 70 75 Thr Leu Lys Ile Ser Arg
Val Glu Ala Glu Asp Val Gly Val Tyr Tyr 80 85 90 Cys Trp Gln Gly
Thr His Phe Pro Arg Thr Phe Gly Gln Gly Thr Lys 95 100 105 Val Glu
Ile Lys 110 12 138 PRT Artificial Sequence Humanized 3D6 light
chain variable region 12 Met Asn Phe Gly Leu Ser Leu Ile Phe Leu
Val Leu Val Leu Lys Gly -15 -10 -5 Val Gln Cys Glu Val Gln Leu Leu
Glu Ser Gly Gly Gly Leu Val Gln 1 5 10 Pro Gly Gly Ser Leu Arg Leu
Ser Cys Ala Ala Ser Gly Phe Thr Phe 15 20 25 Ser Asn Tyr Gly Met
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 30 35 40 45 Glu Trp Val
Ala Ser Ile Arg Ser Gly Gly Gly Arg Thr Tyr Tyr Ser 50 55 60 Asp
Asn Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn 65 70
75 Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
80 85 90 Tyr Tyr Cys Val Arg Tyr Asp His Tyr Ser Gly Ser Ser Asp
Tyr Trp 95 100 105 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 110 115
13 393 DNA Mus musculus CDS (1)...(393) sig_peptide (1)...(57) 13
atg aag ttg cct gtt agg ctg ttg gta ctg atg ttc tgg att cct gct 48
Met Lys Leu Pro Val Arg Leu Leu Val Leu Met Phe Trp Ile Pro Ala -15
-10 -5 tcc agc agt gat gtt ttg atg acc caa act cca ctc tcc ctg cct
gtc 96 Ser Ser Ser Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro
Val 1 5 10 agt ctt gga gat caa gcc tcc atc tct tgc aga tct agt cag
aac att 144 Ser Leu Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln
Asn Ile 15 20 25 ata cat agt aat gga aac acc tat tta gaa tgg tac
ctg cag aaa cca 192 Ile His Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr
Leu Gln Lys Pro 30 35 40 45 ggc cag tct cca aag ctc ctg atc tac aaa
gtt tcc aac cga ttt tct 240 Gly Gln Ser Pro Lys Leu Leu Ile Tyr Lys
Val Ser Asn Arg Phe Ser 50 55 60 ggg gtc cca gac agg ttc agt ggc
agt gga tca ggg aca gat ttc aca 288 Gly Val Pro Asp Arg Phe Ser Gly
Ser Gly Ser Gly Thr Asp Phe Thr 65 70 75 ctc aag atc aag aaa gtg
gag gct gag gat ctg gga att tat tac tgc 336 Leu Lys Ile Lys Lys Val
Glu Ala Glu Asp Leu Gly Ile Tyr Tyr Cys 80 85 90 ttt caa ggt tca
cat gtt ccg ctc acg ttc ggt gct ggg acc aag ctg 384 Phe Gln Gly Ser
His Val Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu 95 100 105 gag ctg
gaa 393 Glu Leu Glu 110 14 131 PRT Mus musculus SIGNAL (1)...(19)
14 Met Lys Leu Pro Val Arg Leu Leu Val Leu Met Phe Trp Ile Pro Ala
-15 -10 -5 Ser Ser Ser Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu
Pro Val 1 5 10 Ser Leu Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser
Gln Asn Ile 15 20 25 Ile His Ser Asn Gly Asn Thr Tyr Leu Glu Trp
Tyr Leu Gln Lys Pro 30 35 40 45 Gly Gln Ser Pro Lys Leu Leu Ile Tyr
Lys Val Ser Asn Arg Phe Ser 50 55 60 Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Gly Thr Asp Phe Thr 65 70 75 Leu Lys Ile Lys Lys
Val Glu Ala Glu Asp Leu Gly Ile Tyr Tyr Cys 80 85 90 Phe Gln Gly
Ser His Val Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu 95 100 105 Glu
Leu Glu 110 15 426 DNA Mus musculus CDS (1)...(426) sig_peptide
(1)...(57) 15 atg gac agg ctt act tcc tca ttc ctg ctg ctg att gtc
cct gca tat 48 Met Asp Arg Leu Thr Ser Ser Phe Leu Leu Leu Ile Val
Pro Ala Tyr -15 -10 -5 gtc ctg tcc cag gct act ctg aaa gag tct ggc
cct gga ata ttg cag 96 Val Leu Ser Gln Ala Thr Leu Lys Glu Ser Gly
Pro Gly Ile Leu Gln 1 5 10 tcc tcc cag acc ctc agt ctg act tgt tct
ttc tct ggg ttt tca ctg 144 Ser Ser Gln Thr Leu Ser Leu Thr Cys Ser
Phe Ser Gly Phe Ser Leu 15 20 25 agc act tct ggt atg gga gtg agc
tgg att cgt cag cct tca gga aag 192 Ser Thr Ser Gly Met Gly Val Ser
Trp Ile Arg Gln Pro Ser Gly Lys 30 35 40 45 ggt ctg gag tgg ctg gca
cac att tac tgg gat gat gac aag cgc tat 240 Gly Leu Glu Trp Leu Ala
His Ile Tyr Trp Asp Asp Asp Lys Arg Tyr 50 55 60 aac cca tcc ctg
aag agc cgg ctc aca atc tcc aag gat acc tcc aga 288 Asn Pro Ser Leu
Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Arg 65 70 75 aag cag
gta ttc ctc aag atc acc agt gtg gac cct gca gat act gcc 336 Lys Gln
Val Phe Leu Lys Ile Thr Ser Val Asp Pro Ala Asp Thr Ala 80 85 90
aca tac tac tgt gtt cga agg ccc att act ccg gta cta gtc gat gct 384
Thr Tyr Tyr Cys Val Arg Arg Pro Ile Thr Pro Val Leu Val Asp Ala 95
100 105 atg gac tac tgg ggt caa gga acc tca gtc acc gtc tcc tca 426
Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser 110 115 120
16 142 PRT Mus musculus SIGNAL (1)...(19) 16 Met Asp Arg Leu Thr
Ser Ser Phe Leu Leu Leu Ile Val Pro Ala Tyr -15 -10 -5 Val Leu Ser
Gln Ala Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln 1 5 10 Ser Ser
Gln Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu 15 20 25
Ser Thr Ser Gly Met Gly Val Ser Trp Ile Arg Gln Pro Ser Gly Lys 30
35 40 45 Gly Leu Glu Trp Leu Ala His Ile Tyr Trp
Asp Asp Asp Lys Arg Tyr 50 55 60 Asn Pro Ser Leu Lys Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Arg 65 70 75 Lys Gln Val Phe Leu Lys
Ile Thr Ser Val Asp Pro Ala Asp Thr Ala 80 85 90 Thr Tyr Tyr Cys
Val Arg Arg Pro Ile Thr Pro Val Leu Val Asp Ala 95 100 105 Met Asp
Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser 110 115 120 17 136
DNA Artificial Sequence primer 17 tccgcaagct tgccgccacc atggacatgc
gcgtgcccgc ccagctgctg ggcctgctga 60 tgctgtgggt gtccggctcc
tccggctacg tggtgatgac ccagtccccc ctgtccctgc 120 ccgtgacccc cggcga
136 18 131 DNA Artificial Sequence primer 18 ctggggggac tggccgggct
tctgcagcag ccagttcagg taggtcttgc cgtcggagtc 60 cagcagggac
tgggaggact tgcaggagat ggaggcgggc tcgccggggg tcacgggcag 120
ggacaggggg g 131 19 146 DNA Artificial Sequence primer 19
acctgaactg gctgctgcag aagcccggcc agtcccccca gcgcctgatc tacctggtgt
60 ccaagctgga ctccggcgtg cccgaccgct tctccggctc cggctccggc
accgacttca 120 ccctgaagat ctcccgcgtg gaggcc 146 20 142 DNA
Artificial Sequence primer 20 aattctagga tccactcacg cttgatctcc
accttggtgc cctggccgaa ggtgcggggg 60 aagtgggtgc cctgccagca
gtagtacacg cccacgtcct cggcctccac gcgggagatc 120 ttcagggtga
agtcggtgcc gg 142 21 16 DNA Artificial Sequence primer 21
ctggggggac tggccg 16 22 22 DNA Artificial Sequence primer 22
acctgaactg gctgctgcag aa 22 23 138 DNA Artificial Sequence primer
23 acagaaagct tgccgccacc atggagtttg ggctgagctg gctttttctt
gtggctattt 60 taaaaggtgt ccagtgtgag gtgcagctgc tggagtccgg
cggcggcctg gtgcagcccg 120 gcggctccct gcgcctgt 138 24 135 DNA
Artificial Sequence primer 24 gccgccggag cggatggagg ccacccactc
caggcccttg ccgggggcct ggcgcaccca 60 ggacatgccg tagttggaga
aggtgaagcc ggaggcggcg caggacaggc gcagggagcc 120 gccgggctgc accag
135 25 142 DNA Artificial Sequence primer 25 ctggagtggg tggcctccat
ccgctccggc ggcggccgca cctactactc cgacaacgtg 60 aagggccgct
tcaccatctc ccgcgacaac gccaagaact ccctgtacct gcagatgaac 120
tccctgcgcg ccgaggacac cg 142 26 144 DNA Artificial Sequence primer
26 ctgcaaggat ccactcaccg gaggacacgg tcaccagggt gccctggccc
cagtagtcgg 60 aggagccgga gtagtggtcg tagcgcacgc agtagtacag
ggcggtgtcc tcggcgcgca 120 gggagttcat ctgcaggtac aggg 144 27 16 DNA
Artificial Sequence primer 27 gccgccggag cggatg 16 28 20 DNA
Artificial Sequence primer 28 ctggagtggg tggcctccat 20 29 19 DNA
Artificial Sequence primer 29 tccgcaagct tgccgccac 19 30 29 DNA
Artificial Sequence primer 30 aattctagga tccactcacg cttgatctc 29 31
23 DNA Artificial Sequence primer 31 acagaaagct tgccgccacc atg 23
32 22 DNA Artificial Sequence primer 32 ctgcaaggat ccactcaccg ga 22
33 10 PRT Artificial Sequence native ABeta peptide 33 Asp Ala Glu
Phe Arg His Asp Ser Gly Tyr 1 5 10 34 402 DNA Artificial Sequence
h3D6 version 1 VL 34 atggacatgc gcgtgcccgc ccagctgctg ggcctgctga
tgctgtgggt gtccggctcc 60 tccggctacg tggtgatgac ccagtccccc
ctgtccctgc ccgtgacccc cggcgagccc 120 gcctccatct cctgcaagtc
ctcccagtcc ctgctggact ccgacggcaa gacctacctg 180 aactggctgc
tgcagaagcc cggccagtcc ccccagcgcc tgatctacct ggtgtccaag 240
ctggactccg gcgtgcccga ccgcttctcc ggctccggct ccggcaccga cttcaccctg
300 aagatctccc gcgtggaggc cgaggacgtg ggcgtgtact actgctggca
gggcacccac 360 ttcccccgca ccttcggcca gggcaccaag gtggagatca ag 402
35 402 DNA Artificial Sequence h3D6 version 2 VL 35 atggacatgc
gcgtgcccgc ccagctgctg ggcctgctga tgctgtgggt gtccggctcc 60
tccggcgacg tggtgatgac ccagtccccc ctgtccctgc ccgtgacccc cggcgagccc
120 gcctccatct cctgcaagtc ctcccagtcc ctgctggact ccgacggcaa
gacctacctg 180 aactggctgc tgcagaagcc cggccagtcc ccccagcgcc
tgatctacct ggtgtccaag 240 ctggactccg gcgtgcccga ccgcttctcc
ggctccggct ccggcaccga cttcaccctg 300 aagatctccc gcgtggaggc
cgaggacgtg ggcgtgtact actgctggca gggcacccac 360 ttcccccgca
ccttcggcca gggcaccaag gtggagatca ag 402 36 414 DNA Artificial
Sequence h3D6 version 1 VH 36 atggagtttg ggctgagctg gctttttctt
gtggctattt taaaaggtgt ccagtgtgag 60 gtgcagctgc tggagtccgg
cggcggcctg gtgcagcccg gcggctccct gcgcctgtcc 120 tgcgccgcct
ccggcttcac cttctccaac tacggcatgt cctgggtgcg ccaggccccc 180
ggcaagggcc tggagtgggt ggcctccatc cgctccggcg gcggccgcac ctactactcc
240 gacaacgtga agggccgctt caccatctcc cgcgacaacg ccaagaactc
cctgtacctg 300 cagatgaact ccctgcgcgc cgaggacacc gccctgtact
actgcgtgcg ctacgaccac 360 tactccggct cctccgacta ctggggccag
ggcaccctgg tgaccgtgtc ctcc 414 37 414 DNA Artificial Sequence h3D6
version 2 VH 37 atggagtttg ggctgagctg gctttttctt gtggctattt
taaaaggtgt ccagtgtgag 60 gtgcagctgc tggagtccgg cggcggcctg
gtgcagcccg gcggctccct gcgcctgtcc 120 tgcgccgcct ccggcttcac
cttctccaac tacggcatgt cctgggtgcg ccaggccccc 180 ggcaagggcc
tggagtgggt ggcctccatc cgctccggcg gcggccgcac ctactactcc 240
gacaacgtga agggccgctt caccatctcc cgcgacaact ccaagaacac cctgtacctg
300 cagatgaact ccctgcgcgc cgaggacacc gccgtgtact actgcgtgcg
ctacgaccac 360 tactccggct cctccgacta ctggggccag ggcaccctgg
tgaccgtgtc ctcc 414 38 770 PRT Homo sapiens 38 Met Leu Pro Gly Leu
Ala Leu Leu Leu Leu Ala Ala Trp Thr Ala Arg 1 5 10 15 Ala Leu Glu
Val Pro Thr Asp Gly Asn Ala Gly Leu Leu Ala Glu Pro 20 25 30 Gln
Ile Ala Met Phe Cys Gly Arg Leu Asn Met His Met Asn Val Gln 35 40
45 Asn Gly Lys Trp Asp Ser Asp Pro Ser Gly Thr Lys Thr Cys Ile Asp
50 55 60 Thr Lys Glu Gly Ile Leu Gln Tyr Cys Gln Glu Val Tyr Pro
Glu Leu 65 70 75 80 Gln Ile Thr Asn Val Val Glu Ala Asn Gln Pro Val
Thr Ile Gln Asn 85 90 95 Trp Cys Lys Arg Gly Arg Lys Gln Cys Lys
Thr His Pro His Phe Val 100 105 110 Ile Pro Tyr Arg Cys Leu Val Gly
Glu Phe Val Ser Asp Ala Leu Leu 115 120 125 Val Pro Asp Lys Cys Lys
Phe Leu His Gln Glu Arg Met Asp Val Cys 130 135 140 Glu Thr His Leu
His Trp His Thr Val Ala Lys Glu Thr Cys Ser Glu 145 150 155 160 Lys
Ser Thr Asn Leu His Asp Tyr Gly Met Leu Leu Pro Cys Gly Ile 165 170
175 Asp Lys Phe Arg Gly Val Glu Phe Val Cys Cys Pro Leu Ala Glu Glu
180 185 190 Ser Asp Asn Val Asp Ser Ala Asp Ala Glu Glu Asp Asp Ser
Asp Val 195 200 205 Trp Trp Gly Gly Ala Asp Thr Asp Tyr Ala Asp Gly
Ser Glu Asp Lys 210 215 220 Val Val Glu Val Ala Glu Glu Glu Glu Val
Ala Glu Val Glu Glu Glu 225 230 235 240 Glu Ala Asp Asp Asp Glu Asp
Asp Glu Asp Gly Asp Glu Val Glu Glu 245 250 255 Glu Ala Glu Glu Pro
Tyr Glu Glu Ala Thr Glu Arg Thr Thr Ser Ile 260 265 270 Ala Thr Thr
Thr Thr Thr Thr Thr Glu Ser Val Glu Glu Val Val Arg 275 280 285 Glu
Val Cys Ser Glu Gln Ala Glu Thr Gly Pro Cys Arg Ala Met Ile 290 295
300 Ser Arg Trp Tyr Phe Asp Val Thr Glu Gly Lys Cys Ala Pro Phe Phe
305 310 315 320 Tyr Gly Gly Cys Gly Gly Asn Arg Asn Asn Phe Asp Thr
Glu Glu Tyr 325 330 335 Cys Met Ala Val Cys Gly Ser Ala Met Ser Gln
Ser Leu Leu Lys Thr 340 345 350 Thr Gln Glu Pro Leu Ala Arg Asp Pro
Val Lys Leu Pro Thr Thr Ala 355 360 365 Ala Ser Thr Pro Asp Ala Val
Asp Lys Tyr Leu Glu Thr Pro Gly Asp 370 375 380 Glu Asn Glu His Ala
His Phe Gln Lys Ala Lys Glu Arg Leu Glu Ala 385 390 395 400 Lys His
Arg Glu Arg Met Ser Gln Val Met Arg Glu Trp Glu Glu Ala 405 410 415
Glu Arg Gln Ala Lys Asn Leu Pro Lys Ala Asp Lys Lys Ala Val Ile 420
425 430 Gln His Phe Gln Glu Lys Val Glu Ser Leu Glu Gln Glu Ala Ala
Asn 435 440 445 Glu Arg Gln Gln Leu Val Glu Thr His Met Ala Arg Val
Glu Ala Met 450 455 460 Leu Asn Asp Arg Arg Arg Leu Ala Leu Glu Asn
Tyr Ile Thr Ala Leu 465 470 475 480 Gln Ala Val Pro Pro Arg Pro Arg
His Val Phe Asn Met Leu Lys Lys 485 490 495 Tyr Val Arg Ala Glu Gln
Lys Asp Arg Gln His Thr Leu Lys His Phe 500 505 510 Glu His Val Arg
Met Val Asp Pro Lys Lys Ala Ala Gln Ile Arg Ser 515 520 525 Gln Val
Met Thr His Leu Arg Val Ile Tyr Glu Arg Met Asn Gln Ser 530 535 540
Leu Ser Leu Leu Tyr Asn Val Pro Ala Val Ala Glu Glu Ile Gln Asp 545
550 555 560 Glu Val Asp Glu Leu Leu Gln Lys Glu Gln Asn Tyr Ser Asp
Asp Val 565 570 575 Leu Ala Asn Met Ile Ser Glu Pro Arg Ile Ser Tyr
Gly Asn Asp Ala 580 585 590 Leu Met Pro Ser Leu Thr Glu Thr Lys Thr
Thr Val Glu Leu Leu Pro 595 600 605 Val Asn Gly Glu Phe Ser Leu Asp
Asp Leu Gln Pro Trp His Ser Phe 610 615 620 Gly Ala Asp Ser Val Pro
Ala Asn Thr Glu Asn Glu Val Glu Pro Val 625 630 635 640 Asp Ala Arg
Pro Ala Ala Asp Arg Gly Leu Thr Thr Arg Pro Gly Ser 645 650 655 Gly
Leu Thr Asn Ile Lys Thr Glu Glu Ile Ser Glu Val Lys Met Asp 660 665
670 Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val His His Gln Lys Leu
675 680 685 Val Phe Phe Ala Glu Asp Val Gly Ser Asn Lys Gly Ala Ile
Ile Gly 690 695 700 Leu Met Val Gly Gly Val Val Ile Ala Thr Val Ile
Val Ile Thr Leu 705 710 715 720 Val Met Leu Lys Lys Lys Gln Tyr Thr
Ser Ile His His Gly Val Val 725 730 735 Glu Val Asp Ala Ala Val Thr
Pro Glu Glu Arg His Leu Ser Lys Met 740 745 750 Gln Gln Asn Gly Tyr
Glu Asn Pro Thr Tyr Lys Phe Phe Glu Gln Met 755 760 765 Gln Asn 770
39 40 DNA Artificial Sequence primer 39 actagtcgac atgaagttgc
ctgttaggct gttggtgctg 40 40 39 DNA Artificial Sequence primer 40
actagtcgac atggagwcag acacactcct gytatgggt 39 41 40 DNA Artificial
Sequence primer 41 actagtcgac atgagtgtgc tcactcaggt cctggsgttg 40
42 43 DNA Artificial Sequence primer 42 actagtcgac atgaggrccc
ctgctcagwt tyttggmwtc ttg 43 43 40 DNA Artificial Sequence primer
43 actagtcgac atggatttwc aggtgcagat twtcagcttc 40 44 37 DNA
Artificial Sequence primer 44 actagtcgac atgaggtkcy ytgytsagyt
yctgrgg 37 45 41 DNA Artificial Sequence primer 45 actagtcgac
atgggcwtca agatggagtc acakwyycwg g 41 46 41 DNA Artificial Sequence
primer 46 actagtcgac atgtggggay ctktttycmm tttttcaatt g 41 47 35
DNA Artificial Sequence primer 47 actagtcgac atggtrtccw casctcagtt
ccttg 35 48 37 DNA Artificial Sequence primer 48 actagtcgac
atgtatatat gtttgttgtc tatttct 37 49 38 DNA Artificial Sequence
primer 49 actagtcgac atggaagccc cagctcagct tctcttcc 38 50 27 DNA
Artificial Sequence primer 50 ggatcccggg tggatggtgg gaagatg 27 51
37 DNA Artificial Sequence primer 51 actagtcgac atgaaatgca
gctgggtcat sttcttc 37 52 36 DNA Artificial Sequence primer 52
actagtcgac atgggatgga gctrtatcat sytctt 36 53 37 DNA Artificial
Sequence primer 53 actagtcgac atgaagwtgt ggttaaactg ggttttt 37 54
35 DNA Artificial Sequence primer 54 actagtcgac atgractttg
ggytcagctt grttt 35 55 40 DNA Artificial Sequence primer 55
actagtcgac atggactcca ggctcaattt agttttcctt 40 56 37 DNA Artificial
Sequence primer 56 actagtcgac atggctgtcy trgsgctrct cttctgc 37 57
36 DNA Artificial Sequence primer 57 actagtcgac atggratgga
gckggrtctt tmtctt 36 58 33 DNA Artificial Sequence primer 58
actagtcgac atgagagtgc tgattctttt gtg 33 59 40 DNA Artificial
Sequence primer 59 actagtcgac atggmttggg tgtggamctt gctattcctg 40
60 37 DNA Artificial Sequence primer 60 actagtcgac atgggcagac
ttacattctc attcctg 37 61 38 DNA Artificial Sequence primer 61
actagtcgac atggattttg ggctgatttt ttttattg 38 62 37 DNA Artificial
Sequence primer 62 actagtcgac atgatggtgt taagtcttct gtacctg 37 63
27 DNA Artificial Sequence primer 63 ggatcccggg agtggataga ctgatgg
27
* * * * *