U.S. patent application number 11/132285 was filed with the patent office on 2005-11-03 for human tumor necrosis factor receptors tr13 and tr14.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Baker, Kevin P., Ni, Jian, Ruben, Steven M., Young, Paul E..
Application Number | 20050244876 11/132285 |
Document ID | / |
Family ID | 27558288 |
Filed Date | 2005-11-03 |
United States Patent
Application |
20050244876 |
Kind Code |
A1 |
Ni, Jian ; et al. |
November 3, 2005 |
Human tumor necrosis factor receptors TR13 and TR14
Abstract
The present invention relates to two novel proteins, TR13 and
TR14, which are members of the tumor necrosis factor (TNF) receptor
superfamily. In particular, isolated nucleic acid molecules are
provided encoding the human TR13 and TR14 proteins. TR13 and TR14
polypeptides are also provided as are vectors, host cells and
recombinant methods for producing the same. The invention further
relates to screening methods for identifying agonists and
antagonists of TR13 and TR14.
Inventors: |
Ni, Jian; (Germantown,
MD) ; Baker, Kevin P.; (Darnestown, MD) ;
Ruben, Steven M.; (Brookeville, MD) ; Young, Paul
E.; (Gaithersburg, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
27558288 |
Appl. No.: |
11/132285 |
Filed: |
May 19, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11132285 |
May 19, 2005 |
|
|
|
10046433 |
Jan 16, 2002 |
|
|
|
11132285 |
May 19, 2005 |
|
|
|
09618570 |
Jul 14, 2000 |
|
|
|
60261960 |
Jan 17, 2001 |
|
|
|
60144087 |
Jul 16, 1999 |
|
|
|
60149450 |
Aug 18, 1999 |
|
|
|
60149712 |
Aug 20, 1999 |
|
|
|
60153089 |
Sep 10, 1999 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/320.1; 435/325; 435/69.1; 514/18.9; 514/19.4; 514/19.5;
514/19.6; 514/19.8; 530/350; 530/388.22; 536/23.5 |
Current CPC
Class: |
C07K 14/70578 20130101;
C07K 14/7151 20130101; A61K 38/00 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/320.1; 435/325; 514/012; 530/350; 536/023.5;
530/388.22 |
International
Class: |
C12Q 001/68; C07H
021/04; C12N 015/09; C07K 014/705; C07K 016/28 |
Claims
What is claimed is:
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding a polypeptide comprising amino acids from about 1 to about
750 in SEQ ID NO: 1; (b) a nucleotide sequence encoding a
polypeptide comprising amino acids from about 1 to about 750 in SEQ
ID NO:1; (c) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 1 to about 750 in SEQ ID NO:1;
(d) a nucleotide sequence encoding a polypeptide having the amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit
No. PTA-349; (e) a nucleotide sequence encoding the mature TR13
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. PTA-349; (f) a nucleotide
sequence encoding a polypeptide comprising amino acids from about 1
to about 1001 in SEQ ID NO:40; (g) a nucleotide sequence encoding a
polypeptide comprising amino acids from about 2 to about 1001 in
SEQ ID NO:40; (h) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 42 to about 1001 in SEQ ID NO:40;
(i) a nucleotide sequence encoding a polypeptide having the amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit
No. PTA-507; (j) a nucleotide sequence encoding the mature TR13
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. PTA-507; (k) a nucleotide
sequence encoding the TR13 extracellular domain; (l) a nucleotide
sequence encoding the TR13 transmembrane domain; (m) a nucleotide
sequence encoding the TR13 intracellular domain; (n) a nucleotide
sequence encoding the TR13 receptor extracellular and intracellular
domains with all or part of the transmembrane domain deleted; and
(o) a nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) (k),
(l), (m), (n) or (o).
2. An isolated nucleic acid molecule comprising a polynucleotide
which encodes the amino acid sequence of an epitope-bearing portion
of a TR13 receptor having an amino acid sequence in (a), (b), (c),
(d), (e), (f), (g), (h), (i), (j), (k), (l), (m), (n) or (o) of
claim 1.
3. The isolated nucleic acid molecule of claim 2, which encodes an
epitope-bearing portion of a TR13 receptor selected from the group
consisting of: a polypeptide comprising amino acid residues from
about 2 to about 170 in SEQ ID NO:2; a polypeptide comprising amino
acid residues from about 210 to about 318 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 343 to about
480 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 548 to about 592 in SEQ ID NO:2; or a polypeptide
comprising amino acid residues from about 632 to about 742 in SEQ
ID NO:2, or a polypeptide comprising amino acid residues from about
1 to about 262 in SEQ ID NO:40, or a polypeptide comprising amino
acid residues from about 264 to about 423 in SEQ ID NO:40, or a
polypeptide comprising amino acid residues from about 437 to about
789 in SEQ ID NO:40, or a polypeptide comprising amino acid
residues from about 791 to about 1001 in SEQ ID NO:40.
4. A method for making a recombinant vector comprising inserting an
isolated nucleic acid molecule of claim 1 into a vector.
5. A recombinant vector produced by the method of claim 4.
6. A method of making a recombinant host cell comprising
introducing the recombinant vector of claim 5 into a host cell.
7. A recombinant host cell produced by the method of claim 6.
8. A recombinant method for producing a TR13 polypeptide,
comprising culturing the recombinant host cell of claim 7 under
conditions such that said polypeptide is expressed, and recovering
said polypeptide.
9. An isolated TR13 polypeptide having an amino acid sequence at
least 95% identical to a sequence selected from the group
consisting of: (a) amino acids from about 1 to about 750 in SEQ ID
NO:2; (b) amino acids from about 2 to about 750 in SEQ ID NO:2; (c)
amino acids from about 1 to about 1001 in SEQ ID NO:40; (d) amino
acids from about 2 to about 1001 in SEQ ID NO:40; (e) the amino
acid sequence of the TR13 polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
PTA-349, (f) the amino acid sequence of the TR13 polypeptide having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. PTA-507, (g) the amino acid sequence of the mature TR13
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. PTA-349; (h) the amino acid
sequence of the mature TR13 polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
PTA-507; and (i) the amino acid sequence of an epitope-bearing
portion of any one of the polypeptides of (a), (b), (c), (d), (e),
(f), (g), or (h).
10. An isolated polypeptide comprising an epitope-bearing portion
of the TR13 receptor protein, wherein said portion is selected from
the group consisting of: a polypeptide comprising amino acid
residues from about 2 to about 170 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 210 to about 318 in SEQ
ID NO:2; a polypeptide comprising amino acid residues from about
343 to about 480 in SEQ ID NO:2; a polypeptide comprising amino
acid residues from about 545 to about 592 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 632 to about
742 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 1 to about 262 in SEQ ID NO:40; a polypeptide comprising
amino acid residues from about 264 to about 423 in SEQ ID NO:40; a
polypeptide comprising amino acid residues from about 437 to about
789 in SEQ ID NO:40; a polypeptide comprising amino acid residues
from about 791 to about 1001 in SEQ ID NO:40.
11. An isolated antibody that binds specifically to a TR13 receptor
polypeptide of claim 9.
12. A method of treating diseases and disorders associated with the
inhibition of apoptosis comprising administering an effective
amount of an agonist of the polypeptide as claimed in claim 9, to a
patient in need thereof.
13. A method of treating inflammatory diseases and disorders
comprising administering to a patient in need thereof an effective
amount of an antagonist of the polypeptide as claimed in claim
9.
14. A method of treating cancer comprising administering an
effective amount of an agonist of the polypeptide as claimed in
claim 9, to a patient in need thereof.
15. The method of claim 14 wherein the agonist is an anti-TR13
antibody.
16. The method of claim 14 wherein the cancer is a cancer of the
gastrointestinal system.
17. The method of claim 14 wherein the cancer is a cancer of the
reproductive system.
18. The method of claim 14 wherein the cancer is a cancer of the
immune system.
19. A method of inhibiting Fas ligand activity in a patient
comprising administering to said patient an effective amount of the
polypeptide as claimed in claim 9.
Description
CROSS REFERENCE TO A RELATED APPLICATION
[0001] This Application is a division of U.S. application Ser. No.
10/046,433, filed Jan. 16, 2002, which claims benefit under 35
U.S.C. .sctn. 119(e) of U.S. Provisional Application No.
60/261,960, filed Jan. 17, 2001, U.S. application Ser. No.
10/046,433 is a continuation-in-part of U.S. patent application
Ser. No. 09/618,570, filed Jul. 14, 2000 (now abandoned); which
claims benefit under 35 U.S.C. .sctn. 119(e) of U.S. Provisional
Application Nos. 60/144,087, 60/149,450, 60/149,712, and
60/153,089, which were filed on Jul. 16, 1999, Aug. 18, 1999, Aug.
20, 1999, and Sep. 10, 1999, respectively; each of the above
mentioned applications is hereby incorporated by reference in its
entirety.
STATEMENT UNDER 37 C.F.R. .sctn. 1.77(b)(4)
[0002] This application refers to a "Sequence Listing" listed
below, which is provided as an electronic document on two identical
compact discs (CD-R), labeled "Copy 1" and "Copy 2." These compact
discs each contain the file "PF511P1 sequence listing.txt" (95,092
bytes, created Jan. 15, 2002), which is hereby incorporated by
reference in its entirety. The Sequence Listing may be viewed on an
IBM-PC machine running the MS-Windows operating system.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates to two novel members of the
tumor necrosis factor family of receptors. More specifically,
isolated nucleic acid molecules are provided encoding the novel
human tumor necrosis factor receptors, TR13 and TR14. TR13 and TR14
polypeptides are also provided, as are vectors, host cells, and
recombinant methods for producing the same. The invention further
relates to screening methods for identifying agonists and
antagonists of TR13 and/or TR14 activity.
[0005] 2. Related Art
[0006] Many biological actions, for instance, response to certain
stimuli and natural biological processes, are controlled by
factors, such as cytokines. Many cytokines act through receptors by
engaging the receptor and producing an intra-cellular response.
[0007] For example, tumor necrosis factors (TNF) alpha and beta are
cytokines, which act through TNF receptors to regulate numerous
biological processes, including protection against infection and
induction of shock and inflammatory disease. The TNF molecules
belong to the "TNF-ligand" superfamily, and act together with their
receptors or counter-ligands, the "TNF-receptor" superfamily. So
far, nine members of the TNF ligand superfamily have been
identified and ten members of the TNF-receptor superfamily have
been characterized.
[0008] Among the ligands there are included TNF-.alpha.,
lymphotoxin-.alpha. (LT-.alpha., also known as TNF-.beta.),
LT-.beta. (found in complex heterotrimer LT-2-.beta.), FasL, CD40L,
CD27L, CD30L, 4-1BBL, OX40L and nerve growth factor (NGF). The
superfamily of TNF receptors includes the p55TNF receptor, p75TNF
receptor, TNF receptor-related protein, FAS antigen or APO-1, CD40,
CD27, CD30, 4-1BB, OX40, low affinity p75 and NGF-receptor (A.
Meager, Biologicals 22:291-295 (1994)).
[0009] Many members of the TNF-ligand superfamily are expressed by
activated T-cells, implying that they are necessary for T-cell
interactions with other cell types which underlie cell ontogeny and
functions. (A. Meager, supra).
[0010] Considerable insight into the essential functions of several
members of the TNF receptor family has been gained from the
identification and creation of mutants that abolish the expression
of these proteins. For example, naturally occurring mutations in
the FAS antigen and its ligand cause lymphoproliferative disease
(R. Watanabe-Fukunaga et al., Nature 356:314 (1992)), perhaps
reflecting a failure of programmed cell death. Mutations of the
CD40 ligand cause an X-linked immunodeficiency state characterized
by high levels of immunoglobulin M and low levels of immunoglobulin
G in plasma, indicating faulty T-cell-dependent B-cell activation
(R. C. Allen et al, Science 259:990 (1993)). Targeted mutations of
the low affinity nerve growth factor receptor cause a disorder
characterized by faulty sensory innovation of peripheral structures
(K. F. Lee et al., Cell 69:737 (1992)).
[0011] TNF-.alpha. and LT-.alpha. are capable of binding to two TNF
receptors (the 55- and 75-kd TNF receptors). A large number of
biological effects elicited by TNF-.alpha. and LT-.alpha., acting
through their receptors, include hemorrhagic necrosis of
transplanted tumors, cytotoxicity, a role in endotoxic shock,
inflammation, immunoregulation, proliferation and anti-viral
responses, as well as protection against the deleterious effects of
ionizing radiation. TNF-.alpha. and LT-.alpha. are involved in the
pathogenesis of a wide range of diseases, including endotoxic
shock, cerebral malaria, tumors, autoimmune disease, AIDS and
graft-host rejection (B. Beutler and C. Von Huffel, Science
264:667-668 (1994)). Mutations in the p55 receptor cause increased
susceptibility to microbial infection.
[0012] Moreover, an about 80 amino acid domain near the C-terminus
of TNFR1 (p55) and Fas was reported as the "death domain," which is
responsible for transducing signals for programmed cell death
(Tartaglia et al., Cell 74:845 (1993)).
[0013] Apoptosis, or programmed cell death, is a physiologic
process essential to the normal development and homeostasis of
multicellular organisms (H. Steller, Science 267:1445-1449 (1995)).
Derangements of apoptosis contribute to the pathogenesis of several
human diseases including cancer, neurodegenerative disorders, and
acquired immune deficiency syndrome (C. B. Thompson, Science
267:1456-1462 (1995)). Recently, much attention has focused on the
signal transduction and biological function of two cell surface
death receptors, Fas/APO-1 and TNFR-1 (J. L. Cleveland et al., Cell
81:479-482 (1995); A. Fraser et al., Cell 85:781-784 (1996); S.
Nagata et al., Science 267:1449-56 (1995)). Both are members of the
TNF receptor family, which also include TNFR-2, low affinity NGFR,
CD40, and CD30, among others (C. A. Smith et al., Science 248:
1019-23 (1990); M. Tewari et al., in Modular Texts in Molecular and
Cell Biology M. Purton, Heldin, Carl, Ed. (Chapman and Hall,
London, 1995). While family members are defined by the presence of
cysteine-rich repeats in their extracellular domains, Fas/APO-1 and
TNFR-1 also share a region of intracellular homology, appropriately
designated the "death domain," which is distantly related to the
Drosophila suicide gene, reaper (P. Golstein et al., Cell 81:185-6
(1995); K. White et al., Science 264:677-83 (1994)). This shared
death domain suggests that both receptors interact with a related
set of signal transducing molecules that, until recently, remained
unidentified. Activation of Fas/APO-1 recruits the death
domain-containing adapter molecule FADD/MORT1 (A. M. Chinnaiyan et
al., Cell 81:505-512 (1995); M. P. Boldin et al., J. Biol. Chem.
270:7795-8 (1995); F. C. Kischkel et al., EMBO 14:5579-5588
(1995)), which in turn binds and presumably activates FLICE/MACH1,
a member of the ICE/CED-3 family of pro-apoptotic proteases (M.
Muzio et al., Cell 85: 817-827 (1996); M. P. Boldin et al., Cell
85:803-815 (1996)). While the central role of Fas/APO-1 is to
trigger cell death, TNFR-1 can signal an array of diverse
biological activities--many of which stem from its ability to
activate NF-kB (L. A. Tartaglia et al., Immunol Today 13:151-153
(1992)). Accordingly, TNFR-1 recruits the multivalent adapter
molecule TRADD, which like FADD, also contains a death domain (H.
Hsu et al., Cell 81:495-504 (1995); H. Hsu et al., Cell 84:299-308
(1996)). Through its associations with a number of signaling
molecules including FADD, TRAF2, and RIP, TRADD can signal both
apoptosis and NF-kB activation (H. Hsu et al., Cell 84:299-308
(1996); H. Hsu et al., Immunity 4:387-396 (1996)).
[0014] Recently, a new apoptosis inducing TNF ligand has been
discovered. S. R. Wiley et al., Immunity 3:673-682 (1995), named
the new molecule, "TNF-related apoptosis-inducing ligand" or
"TRAIL." R. M. Pitti et al., J. Biol. Chem. 271:12687-12690 (1996),
named the molecule "Apo-2 ligand" or "Apo-2L." This molecule was
also disclosed in co-pending U.S. provisional patent application
No. 60/013,405. For convenience, this molecule will be referred to
herein as TRAIL.
[0015] Unlike FAS ligand, whose transcripts appear to be largely
restricted to stimulated T-cells, significant levels of TRAIL are
detected in many human tissues (e.g., spleen, lung, prostate,
thymus, ovary, small intestine, colon, peripheral blood
lymphocytes, placenta, kidney), and it is constitutively
transcribed by some cell lines. It has been shown that TRAIL acts
independently from the FAS ligand (S. R. Wiley et al., supra). It
has also been shown that TRAIL activates apoptosis rapidly, within
a time frame that is similar to death signaling by Fas/Apo-1L, but
much faster than TNF-induced apoptosis. S. A. Marsters et al.,
Current Biology 6:750-752 (1996). The inability of TRAIL to bind
TNFR-1, Fas, or the recently identified DR3, suggests that TRAIL
may interact with a unique receptor(s).
[0016] Work to date suggests that there are several unique TNF
receptors for TRAIL. In co-pending U.S. provisional patent
application No. 60/035,722, one novel death domain containing
receptor for TRAIL, DR4, was disclosed. See, Pan et al., Science
276:111-113 (April 1997). In co-pending U.S. provisional patent
application No. 60/040,846, a novel death domain containing
receptor, DR5 (TR7), was disclosed. This receptor has now been
shown to bind TRAIL. In co-pending U.S. provisional patent
application No. 60/035,496, another receptor, TR5, was disclosed.
This receptor has also now been shown to bind TRAIL, however, TR5
has been shown to be a non-signaling decoy receptor which
antagonizes apoptosis.
[0017] The effects of TNF family ligands and receptors are varied
and influence numerous functions, both normal and abnormal, in the
biological processes of the mammalian system. There is a clear
need, therefore, for identification and characterization of such
receptors and ligands that influence biological activity, both
normally and in disease states. In particular, there is a need to
isolate and characterize additional novel receptors that bind
TRAIL.
SUMMARY OF THE INVENTION
[0018] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding the TR13 receptor
having the amino acid sequence shown in SEQ ID NO:2 (FIGS. 1A-D),
amino acid sequence shown in SEQ ID NO:40 (FIGS. 7A-E) or the amino
acid sequence encoded by the cDNA clone deposited as American Type
Culture Collection ("ATCC") Deposit No. PTA-349 (HWLHM70) on Jul.
13, 1999, and/or the amino acid sequence encoded by the cDNA clone
deposited as American Type Culture Collection ("ATCC") Deposit No.
PTA-507 (HWLHN83) on Aug. 12, 1999. The ATCC is located at 10801
University Boulevard, Manassas, Va. 20110-2209. It would be
apparent to the skilled artisan that the various methods of use,
including but not limited to diagnostic and therapeutic uses
described herein, for the TR13 receptor polynucleotides and
polypeptides would apply equally to all variants and fragments
thereof (e.g., fragments of the TR13 receptor disclosed and
described herein in FIGS. 1A-D, FIG. 7A-E, SEQ ID NO:1, SEQ ID
NO:2, SEQ ID NO:39, SEQ ID NO:40 and/or contained or encoded by one
or both of the deposited cDNA clones HWLHM70 and HWLHN83).
[0019] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of TR13 polypeptides (e.g., the TR13
polypeptide sequence shown in FIGS. 1A-D and/or FIGS. 7A-E, or a
fragment thereof) by recombinant techniques.
[0020] The invention further provides an isolated TR13 polypeptide
(e.g., the TR13 polypeptide sequence shown in FIGS. 1A-D and/or
FIGS. 7A-E or fragments thereof) having an amino acid sequence
encoded by a polynucleotide described herein (e.g., the
polynucleotide sequence shown in SEQ ID NO:1 and/or SEQ ID NO:39,
or a fragment thereof).
[0021] The present invention also provides diagnostic assays such
as quantitative and diagnostic assays for detecting levels of TR13
polynucleotide and/or protein (e.g., the TR13 protein shown in
FIGS. 1A-D and/or FIGS. 7A-E, or fragments thereof). Thus, for
instance, a diagnostic assay in accordance with the invention for
detecting over-expression of TR13, or soluble form thereof,
compared to normal control tissue samples may be used to detect the
presence of tumors.
[0022] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding the TR14 receptor
having the amino acid sequence shown in SEQ ID NO:61 (FIGS. 10A-H),
and/or the amino acid sequence encoded by the cDNA clone deposited
as American Type Culture Collection ("ATCC") Deposit No. PTA-348
(HMSHK47) on Jul. 13, 1999. While the sequence of SEQ ID NO:61 and
FIGS. 10A-H are preferred embodiments of TR14 receptor protein, the
present invention provides alternative isolated nucleic acid
molecule embodiments comprising a polynucleotide encoding the TR14
receptor having the amino acid sequence shown in SEQ ID NO:5 (FIGS.
4A-E). The sequence of amino acid residues T-78 to M-231 of SEQ ID
NO:61 is identical to the sequence of amino acid residues T-73 to
M-226 of SEQ ID NO:5. It would be apparent to the skilled artisan
that the various methods of use, including, but not limited to,
diagnostic and therapeutic uses described herein, for the TR13
receptor polynucleotides and polypeptides would apply equally to
all variants and fragments thereof (e.g., fragments of the TR14
receptor disclosed and described in FIGS. 10A-H and SEQ ID NOS:60
and 61, or, alternatively, FIGS. 4A-E and SEQ ID NO:4, SEQ ID NO:5
and/or contained or encoded by the deposited cDNA clone
(HMSHK47)).
[0023] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of TR14 polypeptides by recombinant
techniques.
[0024] The invention further provides an isolated TR14 polypeptide
(e.g., the TR14 polypeptide sequence shown in FIGS. 10A-H or,
alternatively, FIGS. 4A-E, or fragments thereof) having an amino
acid sequence encoded by a polynucleotide described herein (e.g.,
the polynucleotide sequence shown in SEQ ID NO:60, or,
alternatively SEQ ID NO:4, or fragments thereof).
[0025] The present invention also provides diagnostic assays such
as quantitative and diagnostic assays for detecting levels of TR14
polynucleotide and/or protein (e.g., the TR14 polypeptide sequence
disclosed in FIGS. 10A-H or 4A-E, or fragments thereof). Thus, for
instance, a diagnostic assay in accordance with the invention for
detecting over-expression of TR14, or soluble form thereof,
compared to normal control tissue samples may be used to detect the
presence of tumors.
[0026] Tumor Necrosis Factor (TNF) family ligands are known to be
among the most pleiotropic cytokines, inducing a large number of
cellular responses, including cell proliferation, cytotoxicity,
anti-viral activity, immunoregulatory activities, hematopoiesis,
and the transcriptional regulation of several genes. Cellular
response to TNF-family ligands include not only normal
physiological responses, but also diseases associated with
increased apoptosis or the inhibition of apoptosis.
Apoptosis-programmed cell death is a physiological mechanism
involved in the deletion of peripheral T lymphocytes of the immune
system, and its dysregulation can lead to a number of different
pathogenic processes. Diseases associated with increased cell
survival, unregulated cell proliferation, or the inhibition of
apoptosis, include cancers, autoimmune disorders, viral infections,
inflammation, graft vs. host disease, acute graft rejection, and
chronic graft rejection. Diseases associated with increased
apoptosis include AIDS, neurodegenerative disorders,
myelodysplastic syndromes, ischemic injury, toxin-induced liver
disease, septic shock, cachexia, and anorexia.
[0027] Thus, the invention further provides a method for inhibiting
TR13 mediated signaling and/or apoptosis induced by a TNF-family
ligand, which involves administering to a cell which expresses the
TR13 polypeptide (i.e., the TR13 polypeptide shown in FIGS. 1A-D
and/or FIGS. 7A-E, or a fragment thereof) an effective amount of a
TR13 antagonist capable of decreasing TR13 mediated apoptosis
and/or decreasing TR13 mediated signaling. Preferably, TR13
mediated signaling is decreased to treat a disease wherein
increased apoptosis is exhibited.
[0028] Thus, the invention further provides a method for promoting
TR13 mediated signalling and/or apoptosis induced by a TNF-family
ligand, which involves administering to a cell which expresses the
TR13 polypeptide (e.g., the TR13 polypeptide shown in FIGS. 1A-D
and/or FIGS. 7A-E, or a fragment thereof) an effective amount of a
TR13 agonist capable of increasing TR13 mediated apoptosis and/or
increasing TR13 mediated signaling. Preferably, TR13 mediated
signaling is increased to treat a disease wherein decreased
apoptosis is exhibited.
[0029] Thus, the invention further provides a method for inhibiting
TR14 mediated signaling and/or apoptosis induced by a TNF-family
ligand, which involves administering to a cell which expresses the
TR14 polypeptide an effective amount of a TR14 antagonist capable
of decreasing TR14 mediated apoptosis and/or capable of decreasing
TR14 mediated signaling. Preferably, TR14 mediated signaling is
decreased to treat a disease wherein increased apoptosis is
exhibited.
[0030] Thus, the invention further provides a method for promoting
TR14 mediated signaling and/or apoptosis induced by a TNF-family
ligand, which involves administering to a cell which expresses the
TR14 polypeptide an effective amount of a TR14 agonist capable of
increasing TR14 mediated apoptosis and/or capable of increasing
TR14 mediated signaling. Preferably, TR14 mediated signaling is
increased to treat a disease wherein decreased apoptosis is
exhibited.
[0031] In a further aspect, the present invention is directed to a
method for enhancing TR13 mediated signaling induced by a
TNF-family ligand (e.g., Fas Ligand and/or AIM-II ("LIGHT")
(International application publication number WO 97/34911,
published Sep. 25, 1997)) which involves administering to a cell
which expresses the TR13 polypeptide (e.g., the polypeptide shown
in FIGS. 1A-D and/or FIGS. 7A-E, or a fragment thereof) an
effective amount of an agonist capable of increasing TR13 mediated
activity. Preferably, TR13 mediated activity is increased to treat
a disease wherein decreased apoptosis is exhibited.
[0032] Whether any candidate "agonist" or "antagonist" of the
present invention can enhance or inhibit TR13 mediated signaling
can be determined using art-known TNF-family ligand/receptor
cellular response assays, including those described in more detail
below. Thus, in a further aspect, a screening method is provided
for determining whether a candidate agonist or antagonist is
capable of enhancing or inhibiting a cellular response to a TR13
TNF-family ligand. The method involves contacting cells which
express the TR13 polypeptide (e.g., the polypeptide shown in FIGS.
1A-D and/or FIGS. 7A-E, or a fragment thereof) with a candidate
compound and a TNF-family ligand (e.g., Fas Ligand and/or AIM-II
(International application publication number WO 97/34911,
published Sep. 25, 1997)), assaying a cellular response, and
comparing the cellular response to a standard cellular response,
the standard being assayed when contact is made with the ligand in
absence of the candidate compound, whereby an increased cellular
response over the standard indicates that the candidate compound is
an agonist of the ligand/receptor signaling pathway and a decreased
cellular response compared to the standard indicates that the
candidate compound is an antagonist of the ligand/receptor
signaling pathway. By the invention, a cell expressing a TR13
polypeptide (e.g., the polypeptide shown in FIGS. 1A-D and/or FIGS.
7A-E, or a fragment thereof) can be contacted with either an
endogenous or exogenously administered TNF-family ligand.
[0033] In a further aspect, the present invention is directed to a
method for enhancing apoptosis TR14 mediated signaling induced by a
TNF-family ligand, which involves administering to a cell which
expresses the TR14 polypeptide (e.g., the polypeptide shown in
FIGS. 10A-H, or, alternatively 4A-E, or a fragment thereof) an
effective amount of an agonist capable of increasing TR14 mediated
activity. Preferably, TR14 mediated activity is increased to treat
a disease wherein decreased apoptosis is exhibited.
[0034] In specific, preferred embodiments, TR14 polynucleotides and
polypeptides, as well as antibodies that agonize TR14 receptor (as
described in the section on Antibodies, above), stimulate
epithelial cell proliferation and/or development to ameliorate the
diseases and disorders described in this section. Members of the
TNF family of proteins are known to signal through the NF-.kappa.B
singaling pathway. NF-.kappa.B is a transcription factor activated
by a wide certain agents to stimulate cell activation and
differentiation. It is believed that the TR14 receptor of the
instant invention signals through the NF-.kappa.B pathway to
activate proliferation and development of cells. Thus, TR14
polynucleotides and polypeptides of the invention as well as
antibodies and peptides that agonize TR14 may be used in accordance
with the invention to stimulate NF-.kappa.B-mediated epithelial
cell proliferation, including but not limited to ectodermal
dysplasia.
[0035] Whether any candidate "agonist" or "antagonist" of the
present invention can enhance or inhibit TR14 mediated signaling
can be determined using art-known TR14 TNF-family ligand/receptor
cellular response assays, including those described in more detail
below. Thus, in a further aspect, a screening method is provided
for determining whether a candidate agonist or antagonist is
capable of enhancing or inhibiting a cellular response to a
TNF-family ligand. The method involves contacting cells which
express the TR14 polypeptide with a candidate compound and a
TNF-family ligand, assaying a cellular response, and comparing the
cellular response to a standard cellular response, the standard
being assayed when contact is made with the ligand in absence of
the candidate compound, whereby an increased cellular response over
the standard indicates that the candidate compound is an agonist of
the ligand/receptor signaling pathway and a decreased cellular
response compared to the standard indicates that the candidate
compound is an antagonist of the ligand/receptor signaling pathway.
By the invention, a cell expressing the TR14 polypeptide (e.g., the
polypeptide shown in FIGS. 10A-H, or, alternatively 4A-E) can be
contacted with either an endogenous or exogenously administered
TNF-family ligand.
BRIEF DESCRIPTION OF THE FIGURES
[0036] FIGS. 1A-D shows the nucleotide (SEQ ID NO:1) and deduced
amino acid sequence (SEQ ID NO:2) of the TR13 receptor. Predicted
amino acids from about 105 to about 170, about 251 to about 265,
about 331 to about 410, and about 580 to about 610 constitute the
cysteine-rich domains (amino acid residues from about 105 to about
170, about 251 to about 265, about 331 to about 410, and about 580
to about 610 in SEQ ID NO:2) and are represented by the underlined
amino acid regions; amino acids from about 139 to about 142, about
140 to about 143, about 153 to about 156, about 293 to about 296,
about 325 to about 328, about 421 to about 424, about 466 to about
469, about 696 to about 699, and about 728 to about 731 constitute
potential sites of N-glycosylation (amino acid residues from about
139 to about 142, about 140 to about 143, about 153 to about 156,
about 293 to about 296, about 325 to about 328, about 421 to about
424, about 466 to about 469, about 696 to about 699, and about 728
to about 731 in SEQ ID NO:2) which are represented by the bolded
amino acids; amino acids from about 312 to about 315, and about 458
to about 461, constitute potential cAMP phosphorylation sites
(amino acid residues from about from about 312 to about 315, and
about 458 to about 461 in SEQ ID NO:2) and are represented by
asterisks (*) above the amino acid residues; amino acids from about
50 to about 53, about 66 to about 69, about 80 to about 83, about
276 to about 279, about 311 to about 314, about 438 to about 441,
about 559 to about 562, about 564 to about 567, about 698 to about
701, and about 725 to about 728 constitute potential sites of
protein kinase C (PKC) phosphorylation (amino acid residues from
about 50 to about 53, about 66 to about 69, about 80 to about 83,
about 276 to about 279, about 311 to about 314, about 438 to about
441, about 559 to about 562, about 564 to about 567, about 698 to
about 701, and about 725 to about 728 in SEQ ID NO:2) and are
represented by the italicized amino acid residues; amino acids from
about 80 to about 83, about 89 to about 92, about 180 to about 183,
about 198 to about 201, about 214 to about 217, about 272 to about
275, about 306 to about 309, about 510 to about 513, about 529 to
about 532, about 584 to about 587, about 609 to about 312, about
642 to about 645, and about 698 to about 701 casein kinase II
phosphorylation sites (amino acid residues from about 80 to about
83, about 89 to about 92, about 180 to about 183, about 198 to
about 201, about 214 to about 217, about 272 to about 275, about
306 to about 309, about 510 to about 513, about 529 to about 532,
about 584 to about 587, about 609 to about 312, about 642 to about
645, and about 698 to about 701 in SEQ ID NO:2) and are represented
by the double underlined amino acids; amino acids from about 69 to
about 74, about 149 to about 154, about 154 to about 159, about 163
to about 168, about 212 to about 217, about 248 to about 253, about
365 to about 370, about 383 to about 388, about 393 to about 398,
about 588 to about 593, about 623 to about 628, about 661 to about
666, and about 665 to about 670 N-myristoylation sites (amino acids
from about 69 to about 74, about 149 to about 154, about 154 to
about 159, about 163 to about 168, about 212 to about 217, about
248 to about 253, about 365 to about 370, about 383 to about 388,
about 393 to about 398, about 588 to about 593, about 623 to about
628, about 661 to about 666, and about 665 to about 670 in SEQ ID
NO:2) and are represented by the strikethrough amino acids (e.g. );
and amino acids from about 456 to about 459 constitute a potential
amidylation site (amino acid residues from about 456 to about 459
of SEQ ID NO:5) and is represented by the lowercase amino
acids.
[0037] FIGS. 2A-D show the regions of similarity between the amino
acid sequences of the TR13 receptor protein (SEQ ID NO:2), and the
OX40 protein (SEQ ID NO:3).
[0038] FIG. 3 shows an analysis of the TR13 amino acid sequence
(SEQ ID NO:2). Alpha, beta, turn and coil regions; hydrophilicity
and hydrophobicity; amphipathic regions; flexible regions;
antigenic index and surface probability are shown. In the
"Antigenic Index--Jameson-Wolf" graph, amino acid residues from
about M1 to about A9, about K12 to about L20, about N47 to about
T55, about H58 to about S66, about D63 to about S71, about P77 to
about F85, about A90 to about Q98, about F136 to about Q144, about
S152 to about C160, about R159 to about A167, about A211 to about
M219, about M235 to about V243, about V266 to about V274, about
W277 to about S285, about I290 to about F298, about A310 to about
V318, about E343 to about C351, about I360 to about H368, about
G391 to about I399, about F409 to about T417, about S436 to about
Y444, about C453 to about S461, about I472 to about S480, about
Y548 to about S556, about C557 to about I565, about V567 to about
V575, about T584 to about G592, about R632 to about G640, about
W680 to about Y688, about Q684 to about K692, about T698 to about
A706, about S726 to about S734, and about S734 to about L742 of SEQ
ID NO:2 (FIGS. 1A-D) correspond to the highly antigenic regions of
the TR13 protein, predicted using the Jameson-Wolf antigenic index
(See FIG. 3 and Table I). These highly antigenic fragments
correspond to the amino acid residues illustrated in FIGS. 1A-D and
in SEQ ID NO:2.
[0039] FIGS. 4A-E shows the nucleotide (SEQ ID NO:4) and deduced
amino acid sequence (SEQ ID NO:5) of the TR14 receptor. The
predicted extracellular domain constitutes amino acids from about 1
to about 133 (amino acid residues from 1 to 133 of SEQ ID NO:5) and
are represented by the underlined amino acids; amino acids from
about 65 to about 85 constitute a conserved cysteine-rich domain
(amino acid residues from about 65 to about 85 of SEQ ID NO:5) and
is represented by the italized amino acid residues; amino acids
from about 134 to about 150 constitute the predicted transmembrane
domain (amino acid residues from about 134 to about 150 in SEQ ID
NO:5) which are represented by the double underlined amino acid
residues; amino acid residues from about 151 to about 226
constitutes the predicted intracellular domain (amino acid residues
from about 151 to about 226 of SEQ ID NO:5) and are represented by
the lower case amino acid residues; amino acids from about 178 to
about 180 constitute potential protein kinase C (PKC)
phosphorylation sites (amino acid residues from about 178 to about
180 of SEQ ID NO:5) and are represented by asterisks (*) above the
amino acid residues; amino acids from about 5 to about 8, about 118
to about 121, about 178 to about 181, and about 193 to about 196
constitute potential sites of casein kinase II phosphorylation
(amino acid residues from about 5 to about 8, about 118 to about
121, about 178 to about 181, about 193 to about 196 of SEQ ID NO:5)
and are represented by the strikethrough amino acid residues; and
amino acids from about 9 to about 14 contitutes a potential
N-myristoylation site (amino acid residues from about 9 to about 14
of SEQ ID NO:5) and is represented by the bold amino acids.
[0040] FIGS. 5A-B show the regions of similarity between the amino
acid sequences of the TR14 receptor protein (SEQ ID NO:5), and the
Tumor Necrosis Factor Receptor protein (SEQ ID NO:6).
[0041] FIG. 6 shows an analysis of the TR14 amino acid sequence
(SEQ ID NO:5). Alpha, beta, turn and coil regions; hydrophilicity
and hydrophobicity; amphipathic regions; flexible regions;
antigenic index and surface probability are shown. In the
"Antigenic Index--Jameson-Wolf" graph, amino acid residues from
about T3 to about S11, from about V16 to about R24, from about Q44
to about M52, from about F85 to about G93, from about T103 to about
V111, from about F161 to about G169, from about V187 to about A195,
from about P218 to about M226 of SEQ ID NO:5 (FIGS. 4A-E)
correspond to the highly antigenic regions of the TR14 protein,
predicted using the Jameson-Wolf antigenic index (See FIG. 6 and
Table II). These highly antigenic fragments correspond to the amino
acid residues illustrated in FIGS. 4A-E and in SEQ ID NO:5.
[0042] FIGS. 7A-E shows the nucleotide (SEQ ID NO:39) and deduced
amino acid sequence (SEQ ID NO:40) of the full-length TR13
receptor. The predicted signal sequence constitutes amino acids
from about 1 to about 41 (amino acid residues from about 1 to about
41 of SEQ ID NO:40) and are represented by the dotted underlined
amino acids; amino acids from about 42 to about 906 constitutes the
predicted extracellular domain (amino acid residues from 42 to 906
of SEQ ID NO:40) and are represented by the single underlined amino
acids; amino acids from about 271 to about 421 and from about 585
to about 595 constitute conserved cysteine-rich domains (amino acid
residues from about 271 to about 421 and from about 585 to about
595 of SEQ ID NO:40) and is represented by the italized amino acid
residues; amino acids from about 907 to about 931 constitute the
predicted transmembrane domain (amino acid residues from about 907
to about 931 in SEQ ID NO:40) which are represented by the double
underlined amino acid residues; amino acid residues from about 932
to about 1001 constitutes the predicted intracellular domain (amino
acid residues from about 932 to about 1001 of SEQ ID NO:40) and are
represented by the lower case amino acid residues; amino acids from
about 11 to about 13, about 18 to about 20, 107 to about 109, about
156 to about 158, about 224 to about 226, about 301 to about 303,
about 317 to about 319, about 331 to about 333, about 527 to about
529, about 562 to about 564, about 689 to about 691, about 810 to
about 812, about 815 to about 817, about 949 to about 951, and
about 976 to about 978 constitute potential protein kinase C (PKC)
phosphorylation sites (amino acid residues from about 11 to about
13, about 18 to about 20, 107 to about 109, about 156 to about 158,
about 224 to about 226, about 301 to about 303, about 317 to about
319, about 331 to about 333, about 527 to about 529, about 562 to
about 564, about 689 to about 691, about 810 to about 812, about
815 to about 817, about 949 to about 951, and about 976 to about
978 of SEQ ID NO:40) and are represented by asterisks (*) above the
amino acid residues; amino acids from about 42 to about 45, about
59 to about 62, about 81 to about 84, about 146 to about 149, about
282 to about 285, about 331 to about 334, about 340 to about 343,
about 431 to about 434, about 449 to about 452, about 465 to about
468, about 523 to about 526, about 557 to about 560, about 761 to
about 764, about 780 to about 783, about 780 to about 783, about
835 to about 838, about 860 to about 863, about 893 to about 896,
and about 949 to about 952 constitute potential sites of casein
kinase II phosphorylation (amino acid residues from about 42 to
about 45, about 59 to about 62, about 81 to about 84, about 146 to
about 149, about 282 to about 285, about 331 to about 334, about
340 to about 343, about 431 to about 434, about 449 to about 452,
about 465 to about 468, about 523 to about 526, about 557 to about
560, about 761 to about 764, about 780 to about 783, about 780 to
about 783, about 835 to about 838, about 860 to about 863, about
893 to about 896, and about 949 to about 952 of SEQ ID NO:40) and
are represented by the strikethrough amino acid residues; amino
acids from about 77 to about 82, about 88 to about 93, about 152 to
about 157, about 268 to about 273, about 288 to about 293, about
320 to about 325, about 400 to about 405, about 414 to about 419,
about 463 to about 468, about 599 to about 604, about 616 to about
621, about 634 to about 639, about 644 to about 649, about 839 to
about 844, about 874 to about 879, about 912 to about 917, and
about 916 to about 921 contitute potential N-myristoylation sites
(amino acid residues from about 77 to about 82, about 88 to about
93, about 152 to about 157, about 268 to about 273, about 288 to
about 293, about 320 to about 325, about 400 to about 405, about
414 to about 419, about 463 to about 468, about 599 to about 604,
about 616 to about 621, about 634 to about 639, about 644 to about
649, about 839 to about 844, about 874 to about 879, about 912 to
about 917, and about 916 to about 921 of SEQ ID NO:40) and are
represented by a plus sign ("+") above the amino acids; amino acids
from about 50 to about 56, and 109 to about 116 constitute
potential tyrosine phosphorylation sites (amino acids from about 50
to about 56, and about 109 to about 116 of SEQ ID NO:40) are
represented by the double strikethrough amino acids; and amino
acids from about 153 to about 156, 390 to about 393, 391 to about
394, about 404 to about 407, about 544 to about 547, about 576 to
about 579, about 672 to about 675, about 717 to about 720, about
947 to about 950, and about 979 to about 982 constitute potential
N-glycosylation sites (amino acids from about 153 to about 156, 390
to about 393, 391 to about 394, about 404 to about 407, about 544
to about 547, about 576 to about 579, about 672 to about 675, about
717 to about 720, about 947 to about 950, and about 979 to about
982 of SEQ ID NO:40) which are represented by the shaded amino
acids.
[0043] FIGS. 8A-D show the regions of similarity between the amino
acid sequences of the full-length TR13 receptor protein (SEQ ID
NO:40), and the Tumor Necrosis Factor Receptor I homolog
(gb.vertline.AAB94382.1) (SEQ ID NO: 41).
[0044] FIG. 9 shows an analysis of the full-length TR13 amino acid
sequence disclosed in FIGS. 7A-E (SEQ ID NO:40). Alpha, beta, turn
and coil regions; hydrophilicity and hydrophobicity; amphipathic
regions; flexible regions; antigenic index and surface probability
are shown. In the "Antigenic Index--Jameson-Wolf" graph, amino acid
residues from about M1 to about H9, about V14 to about I22, about
H47 to about H55, about C61 to about R69, about L82 to about E90,
about D102 to about P110, about K109 to about S117, about F124 to
about H132, about M141 to about E149, about S146 to about C154,
about S157 to about W165, about F168 to about T176, about N182 to
about N190, about Q207 to about A215, about P213 to about M221,
about M221 to about E229, about V233 to about V241, about T253 to
about V261, about T282 to about S290, about N298 to about T306,
about C308 to about Y316, about K315 to about S323, about P328 to
about F336, about A341 to about Q349, about F387 to about Q395,
about S403 to about C411, about T409 to about P417, about F443 to
about N451, about W451 to about Y459, about A462 to about M470,
about G478 to about M486, about A487 to about A495, about V517 to
about V525, about T527 to about Q535, about I541 to about F549,
about A561 to about V569, about E594 to about C602, about I611 to
about H619, about G643 to about I650, about P686 to about K694,
about C704 to about S712, about R722 to about I730, about E727 to
about T735, about P746 to about G754, about D776 to about L784,
about Y799 to about S807, about C808 to about I816, about V818 to
about V826, about T835 to about G843, about R883 to about G891,
about K932 to about K940, about Q935 to about K943, about T949 to
about A957, about S977 to about S985, about S981 to about P989, and
about N986 to about L994 of SEQ ID NO:40 (FIGS. 7A-E) correspond to
the highly antigenic regions of the TR13 protein, predicted using
the Jameson-Wolf antigenic index (See FIG. 9 and Table III). These
highly antigenic fragments correspond to the amino acid residues
illustrated in FIGS. 7A-E and in SEQ ID NO:40.
[0045] FIGS. 10A-H show a preferred nucleotide (SEQ ID NO:60) and
deduced amino acid sequence (SEQ ID NO:61) of the TR14 receptor.
The transmembrane domain from amino acids L-139 to L-155 is
underlined.
[0046] FIG. 11 shows an analysis of the full-length TR14 amino acid
sequence disclosed in FIGS. 10A-H (SEQ ID NO:61). Alpha, beta, turn
and coil regions; hydrophilicity and hydrophobicity; amphipathic
regions; flexible regions; antigenic index and surface probability
are shown. The data are presented in tabular form, amino acid by
amino acid, in Table IV, below.
[0047] FIG. 12 provides experimental results from a HEK 293T cell
survival assay carried out as described in Example 37 below.
Briefly, human embryonic kidney (HEK) 293T cells were transiently
transfected with expression construct DNAs, 48 hours post
transfection viable cells were identified and counted using Trypan
blue staining. TR13 was shown to restrict cell expansion when
compared to a vector control, the extent of growth inhibition being
similar to that caused by the apoptosis inducing receptor and
ligand combination of Fas and Flag-FasL.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0048] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding a TR13 polypeptide
having the amino acid sequence shown in FIGS. 1A-D (SEQ ID NO:2)
and/or FIGS. 7A-E (SEQ ID NO:40) and/or fragments or variants
thereof. The TR13 polypeptide of the present invention shares
sequence homology with the human OX40 homologue (FIGS. 2A-D) and
the tumor necrosis factor receptor II homolog (FIGS. 8A-D). The
nucleotide sequence shown in FIGS. 1A-D (SEQ ID NO:1) was obtained
by sequencing a cDNA clone (HWLHM70), which was deposited on Jul.
13, 1999 at the American Type Culture Collection, and given
Accession Number PTA-349. The nucleotide sequence shown in FIGS.
7A-E (SEQ ID NO:39) was obtained, in part, by sequencing a cDNA
clone (HWLHN83), which was deposited on Aug. 12, 1999 at the
American Type Culture Collection, and given Accession Number
PTA-507. The deposited clone is inserted in the pSport1 clone (Life
Technologies, Rockville, Md.) using the SalI and NotI restriction
endonuclease cleavage sites.
[0049] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding a TR14 polypeptide
having the amino acid sequence shown in FIGS. 10A-H (SEQ ID NO:51),
or, alternatively 4A-E (SEQ ID NO:5) and/or fragments or variants
thereof, which were determined by sequencing a cloned cDNA. The
TR14 polypeptide of the present invention shares sequence homology
with the Tumor Necrosis Factor Receptor (FIGS. 5A-B). The
nucleotide sequence shown in FIGS. 10A-H (SEQ ID NO:60) was
obtained by sequencing a cDNA clone (HMSHK47), which was deposited
on Jul. 13, 1999 at the American Type Culture Collection, and given
Accession Number PTA-348. The deposited clone is inserted in the
pBluescript clone (Life Technologies, Rockville, Md.) using the
EcoRI restriction endonuclease cleavage sites. While SEQ ID NO:60
is a preferred sequence for TR14, an alternative TR14 related
sequence is shown in FIGS. 4A-E (SEQ ID NO:4).
[0050] Nucleic Acid Molecules
[0051] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 3700 and Model
373 from Applied Biosystems, Inc.), and all amino acid sequences of
polypeptides encoded by DNA molecules determined herein were
predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined
by this automated approach, any nucleotide sequence determined
herein may contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more
typically at least about 95% to at least about 99.9% identical to
the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other
approaches including manual DNA sequencing methods well known in
the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual
sequence will cause a frame shift in translation of the nucleotide
sequence such that the predicted amino acid sequence encoded by a
determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or
deletion.
[0052] Using the information provided herein, such as the nucleic
acid sequence set out in SEQ ID NO:1 and/or SEQ ID NO:39, a nucleic
acid molecule of the present invention encoding a TR13 polypeptide
may be obtained using standard cloning and screening procedures,
such as those for cloning cDNAs using mRNA as starting material.
Illustrative of the invention, the nucleic acid molecule described
in SEQ ID NO:1 was discovered in a cDNA library derived from
activated monocytes. Further, illustrative of the invention, the
nucleic acid molecule described in SEQ ID NO:39 was discovered in a
cDNA library derived from normal human colon. TR13 polynucleotides
of the invention have also been identified in cDNA libraries from
the following tissues: pancreas tumor, endometrial tumor, adult
small intestine, colon cancer, breast cancer cell line, resting
T-cell, amygdala, rectum, T-cell helper, pineal gland, apoptotic
T-cell, epididymus, greater omentum, prostate BPH, osteoclastoma,
endometrial stromal cells, stromal cell, substantia nigra,
activated T-cell, tonsil, and testes tissue.
[0053] The determined TR13 nucleotide sequence of SEQ ID NO:1
contains an open reading frame encoding a protein of about 750
amino acid residues, and a deduced molecular weight of about 82
kDa. The amino acid sequence of the predicted TR13 receptor is
shown in SEQ ID NO:2 from amino acid residue about 1 to residue
about 750. Of known members of the TNF receptor family, this TR13
polypeptide shares the greatest degree of homology with human OX40
(See FIGS. 2A-D), including significant sequence homology over
multiple cysteine rich domains.
[0054] The determined TR13 nucleotide sequence of SEQ ID NO:39
contains an open reading frame encoding a protein of about 1001
amino acid residues, with a predicted signal encompassing amino
acids about 1 to about 41, a predicted extracellular domain
encompassing amino acids from about 42 to about 906, a
transmembrane domain encompassing amino acids from about 907 to
about 931, and an intracellular domain encompassing amino acids
from about 932 to 1001, of SEQ ID NO:40, and a deduced molecular
weight of about 110 kDa. The amino acid sequence of the predicted
TR13 receptor is shown in SEQ ID NO:40 from amino acid residue
about 1 to residue about 1001. Of known members of the TNF receptor
family, this TR13 polypeptide shares the greatest degree of
homology with the tumor necrosis factor receptor II homolog (See
FIGS. 8A-D), including significant sequence homology over multiple
cysteine rich domains.
[0055] Using the information provided herein, such as the nucleic
acid sequence set out, preferably, in SEQ ID NO:60, or,
alternatively SEQ ID NO:4, a nucleic acid molecule of the present
invention encoding a TR14 polypeptide may be obtained using
standard cloning and screening procedures, such as those for
cloning cDNAs using mRNA as starting material. Illustrative of the
invention, the nucleic acid molecule contained in deposited clone
HMSHK47 (described in SEQ ID NO:60) was discovered in a cDNA
library derived from colon. The gene of the present invention has
also been identified in cDNA libraries from the following tissues:
activated T-cell, endometrial tumor, thymus, and 12 week early
stage human tissue.
[0056] The determined nucleotide sequence of the TR14 cDNA of SEQ
ID NO:60 contains an open reading frame encoding a protein of about
231 amino acid residues, with a predicted extracellular domain
encompassing amino acids from about 1 to about 138, a transmembrane
domain encompassing amino acids from about 139 to about 155, and an
intracellular domain encompassing amino acids from about 156 to
about 231 of SEQ ID NO:61 and a deduced molecular weight of about
25 kDa.
[0057] The TR14 nucleotide sequence of SEQ ID NO:4 contains an open
reading frame encoding a protein of about 226 amino acid residues,
with a predicted extracellular domain encompassing amino acids from
about 1 to about 133, a transmembrane domain encompassing amino
acids from about 134 to about 150 (from about 139 to about 155 of
SEQ ID NO:61), and an intracellular domain encompassing amino acids
from about 151 to about 226 of SEQ ID NO:4 (acids from about 156 to
about 231 of SEQ ID NO:61) and a deduced molecular weight of about
24.5 kDa. Of known members of the TNF receptor family, the TR14
polypeptide of the SEQ ID NO:5 shares the greatest degree of
homology with tumor necrosis factor receptor (See FIGS. 5A-B).
[0058] As indicated, the present invention also encompasses mature
form(s) of the TR13 and/or TR14 polypeptides of the present
invention. According to the signal hypothesis, proteins secreted by
mammalian cells have a signal or secretory leader sequence which is
cleaved from the mature protein once export of the growing protein
chain across the rough endoplasmic reticulum has been initiated.
Most mammalian cells and even insect cells cleave secreted proteins
with the same specificity. However, in some cases, cleavage of a
secreted protein is not entirely uniform, which results in two or
more mature species on the protein. Further, it has long been known
that the cleavage specificity of a secreted protein is ultimately
determined by the primary structure of the complete protein, that
is, it is inherent in the amino acid sequence of the
polypeptide.
[0059] Therefore, the present invention provides a nucleotide
sequence encoding the mature form of the TR13 polypeptide having
the amino acid sequence encoded by the cDNA clone identified as
ATCC Deposit No. PTA-349 (HWLHM70), and/or of the amino acid
sequence shown in FIGS. 1A-D (SEQ ID NO:2). By the mature form of
TR13 polypeptide having the amino acid sequence encoded by, for
example, the cDNA clone identified as ATCC Deposit No. PTA-349
(HWLHM70) is meant, the mature form(s) of the TR13 receptor
produced by expression in a mammalian cell (e.g., COS cells, as
described below) of the complete open reading frame encoded by the
human DNA sequence of the clone contained in the deposited vector.
As indicated herein, the mature form of the TR13 polypeptide having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. PTA-349 (HWLHM70), may or may not differ from the
predicted mature TR13 protein shown in SEQ ID NO:2 (amino acids
from about 1 to about 750) depending on the accuracy of the
predicted cleavage site based on computer analysis. Polypeptides
encoded by the nucleotide sequences are also encompassed by the
invention.
[0060] Therefore, the present invention provides a nucleotide
sequence encoding the mature form of the TR13 polypeptide having
the amino acid sequence encoded by the cDNA clone identified as
ATCC Deposit No. PTA-507 (HWLHN83), and/or of the amino acid
sequence as shown in FIGS. 7A-E (SEQ ID NO:40). By the mature form
of the TR13 polypeptide having the amino acid sequence encoded by,
for example, the cDNA clone identified as ATCC Deposit No. PTA-507
(HWLHN83), is meant, the mature form(s) of the TR13 receptor
produced by expression in a mammalian cell (e.g., COS cells, as
described below) of the complete open reading frame encoded by the
human DNA sequence of the clone contained in the deposited vector.
As indicated herein, the mature form of the TR13 polypeptide having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. PTA-507 (HWLHN83), may or may not differ from the
predicted mature TR13 protein shown in SEQ ID NO:40 (amino acids
from about 42 to about 1001) depending on the accuracy of the
predicted cleavage site based on computer analysis. Polypeptides
encoded by these nucleotide sequences are also encompassed by the
invention.
[0061] Methods for predicting whether a protein has a secretory
leader as well as the cleavage point for that leader sequence are
available. For instance, the method of McGeoch (Virus Res.
3:271-286 (1985)) and von Heinje (Nucleic Acids Res. 14:4683-4690
(1986)) can be used. The accuracy of predicting the cleavage points
of known mammalian secretory proteins for each of these methods is
in the range of 75-80%. von Heinje, supra. However, the two methods
do not always produce the same predicted cleavage point(s) for a
given protein.
[0062] In the present case, the predicted amino acid sequence of
the TR13 polypeptide of the present invention was analyzed by a
computer program ("PSORT"). See K. Nakai and M. Kanehisa, Genomics
14:897-911 (1992). PSORT is an expert system for predicting the
cellular location of a protein based on the amino acid sequence. As
part of this computational prediction of localization, the methods
of McGeoch and von Heinje are incorporated. Thereafter, the
complete amino acid sequences were further analyzed by visual
inspection, applying a simple form of the (-1,-3) rule of von
Heinje. von Heinje, supra. Thus, the TR13 protein is predicted to
consist of residues from about 1-750 in SEQ ID NO:2, and/or 1-1001
in SEQ ID NO:40. The mature form of the polypeptide sequence
disclosed in SEQ ID NO:40 is predicted to consist of residues from
about 42 to 1001.
[0063] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors, as well as the variability of
cleavage sites for leaders in different known proteins, the
predicted full-length TR13 polypeptide encoded by the deposited
cDNA clones comprises about 1001 amino acids, but may be anywhere
in the range of about 700 to about 1200 amino acids. It will
further be appreciated that, the domains described herein have been
predicted by computer analysis, and accordingly, depending on the
analytical criteria used for identifying various functional
domains, the exact "address" of, for example, the extracelluar
domain, intracelluar domain, cysteine-rich domains, and
transmembrane domain of TR13 may differ slightly (e.g., the address
may "shift" by about 1 to about 20 residues, more likely about 1 to
about 5 residues). For example, the exact location of the TR13
cysteine-rich domains in FIGS. 1A-D (SEQ ID NO:2) and/or FIGS. 7A-E
(SEQ ID NO:40) may vary slightly (e.g., the address may "shift" by
about 1 to about 20 residues, more likely about 1 to about 5
residues) depending on the criteria used to define the motifs. In
any event, as discussed further below, the invention further
provides polypeptides having various residues deleted from the
N-terminus and/or C-terminus of the full-length TR13, including
polypeptides lacking one or more amino acids from the N-termini of
the extracellular domain described herein, which constitute soluble
forms of the extracellular domain of the TR13 polypeptides.
[0064] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors, the preferred predicted
full-length TR14 polypeptide encoded by the deposited cDNA clone
comprises about 231 amino acids as shown in SEQ ID NO:61, but may
be anywhere in the range of 175-275 amino acids. In an alternative
embodiment, predicted full-length TR14 polypeptide comprises about
226 amino acids, but may be anywhere in the range of 175-275 amino
acids, but may be anywhere in the range of about 45 to about 200
amino acids. It will further be appreciated that, the domains
described herein have been predicted by computer analysis, and
accordingly, that depending on the analytical criteria used for
identifying various functional domains, the exact "address" of, for
example, the extracelluar domain, intracelluar domain,
cysteine-rich domains, and transmembrane domain of TR14 may differ
slightly (e.g., the address may "shift" by about 1 to about 20
residues, more likely about 1 to about 5 residues). For example,
the exact location of the TR14 extracellular domain and/or
cysteine-rich domains in FIGS. 10A-H (SEQ ID NO:61) or,
alternatively FIGS. 4A-E (SEQ ID NO:5) may vary slightly (e.g., the
address may "shift" by about 1 to about 20 residues, more likely
about 1 to about 5 residues) depending on the criteria used to
define the domain. Additionally, in the event the polypeptide
sequence of TR14 is longer than the sequence depicted in FIGS.
10A-H or, alternatively FIGS. 4A-E, the skilled artisan would
appreciate that the sequence could affect the ultimate location of
the extracellular, transmembrane, or intracellular domain. In any
event, as discussed further below, the invention further provides
polypeptides having various residues deleted from the N-terminus
and/or C-terminus of the full-length TR14, including polypeptides
lacking one or more amino acids from the N-termini of the
extracellular domain described herein, which constitute soluble
forms of the extracellular domain of the TR14 polypeptides.
[0065] As indicated, nucleic acid molecules of the present
invention may be in the form of RNA, such as mRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA may be double-stranded
or single-stranded. Single-stranded DNA may be the coding strand,
also known as the sense strand, or it may be the non-coding strand,
also referred to as the anti-sense strand.
[0066] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules according to the present invention further include
such molecules produced synthetically. However, a nucleic acid
molecule contained in a clone that is a member of a mixed clone
library (e.g., a genomic or cDNA library) and that has not been
isolated from other clones of the library (e.g., in the form of a
homogeneous solution containing the clone without other members of
the library) or a chromosome isolated or removed from a cell or a
cell lysate (e.g., a "chromosome spread", as in a karyotype), is
not "isolated" for the purposes of this invention.
[0067] Isolated nucleic acid molecules of the present invention
include, for example, DNA molecules comprising, or alternatively
consisting of, an open reading frame (ORF) shown in FIGS. 1A-D (SEQ
ID NO:1), FIGS. 7A-E (SEQ ID NO:39) and/or contained in a deposited
cDNA clone (e.g., HWLHM70 and HWLHN83); DNA molecules comprising,
or alternatively consisting of, the coding sequence for the mature
TR13 protein shown in FIGS. 1A-D (SEQ ID NO:1) and/or FIGS. 7A-E
(SEQ ID NO:39) and/or contained in a deposited cDNA clone (e.g.,
HWLHM70 and HWLHN83); DNA molecules comprising, or alternatively
consisting of, a fragment of the coding sequence for the
full-length TR13 protein disclosed in FIGS. 1A-D and/or FIGS. 7A-E
and/or encoded by a deposited cDNA clone; and DNA molecules which
comprise, or alternatively consist of, a sequence substantially
different from those described above, but which, due to the
degeneracy of the genetic code, still encode TR13 polypeptides
(including fragments of variants thereof). Of course, the genetic
code is well known in the art. Thus, it would be routine for one
skilled in the art to generate such degenerate variants.
[0068] Isolated nucleic acid molecules of the present invention
include, for example, DNA molecules comprising, or alternatively
consisting of, an open reading frame (ORF) shown preferably in
FIGS. 1A-H (SEQ ID NO:60) or, alternatively, in FIGS. 4A-E (SEQ ID
NO:4) and/or contained in the deposited cDNA clone (HMSHK47); DNA
molecules comprising, or alternatively consisting of, the coding
sequence for the mature TR14 protein shown preferably in FIGS.
10A-H (amino acids 1-164 of SEQ ID NO:61), or alternatively, in
FIGS. 4A-E (SEQ ID NO:4) and/or contained in the deposited cDNA
clone (HMSHK47); DNA molecules comprising, or alternatively
consisting of, a fragment of the coding sequence for the
full-length TR14 protein disclosed in preferably in FIGS. 10A-H or,
alternatively, in FIGS. 4A-E and/or encoded by the deposited cDNA
clone (HMSHK47); and DNA molecules which comprise a sequence
substantially different from those described above, but which, due
to the degeneracy of the genetic code, still encode TR14
polypeptides (including fragments or variants thereof). Of course,
the genetic code is well known in the art. Thus, it would be
routine for one skilled in the art to generate such degenerate
variants.
[0069] In another aspect, the invention provides isolated nucleic
acid molecules encoding the TR13 polypeptide having an amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
PTA-349 (HWLHM70). In a further embodiment, nucleic acid molecules
are provided that encode the mature form of the TR13 polypeptide
disclosed in FIGS. 1A-D and/or encoded by the cDNA contained in
ATCC Deposit No. PTA-349. In a further embodiment, nucleic acids
are provided that the full-length TR13 polypeptide disclosed in
FIGS. 1A-D and/or encoded by the deposited cDNA clone, but lacking
the N-terminal methionine. In a further embodiment, nucleic acid
molecules are provided that encode The invention further provides
an isolated nucleic acid molecule having the nucleotide sequence
shown in SEQ ID NO:1 or the nucleotide sequence of the TR13 cDNA
contained in the above-described deposited cDNA clone, or a nucleic
acid molecule having a sequence complementary to one of the above
sequences. Such isolated molecules, particularly DNA molecules, are
useful, for example, as probes for gene mapping by in situ
hybridization with chromosomes, and for detecting expression of the
TR13 gene in human tissue, for instance, by Northern blot
analysis.
[0070] In another aspect, the invention provides isolated nucleic
acid molecules encoding the TR13 polypeptide having an amino acid
sequence as encoded by the cDNA clone contained in ATCC Deposit No.
PTA-507 (HWLHN83). In a further embodiment, nucleic acid molecules
are provided that encode the mature form of the TR13 polypeptide
disclosed in FIGS. 7A-E, and/or encoded by the cDNA contained in
ATCC Deposit No. PTA-507. In a further embodiment, nucleic acid
molecules are provided that encode the full-length TR13 polypeptide
disclosed in FIGS. 7A-E, and/or encoded by the deposited cDNA
clone, but lacking the N-terminal methionine. The invention further
provides an isolated nucleic acid molecule having the nucleotide
sequence shown in SEQ ID NO:39 or the nucleotide sequence of the
TR13 cDNA contained in the above-described deposited cDNA clone, or
a nucleic acid molecule having a sequence complementary to one of
the above sequences. Such isolated molecules, particularly DNA
molecules, are useful, for example, as probes for gene mapping by
in situ hybridization with chromosomes, and for detecting
expression of the TR13 gene in human tissue, for instance, by
Northern blot analysis.
[0071] In another aspect, the invention provides isolated nucleic
acid molecules encoding the TR14 polypeptide having an amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
PTA-348 (HMSHK47). In a further embodiment, nucleic acid molecules
are provided that encode the full-length TR14 polypeptide disclosed
in FIGS. 10A-H or, alternatively, in FIGS. 4A-E, and/or encoded by
the deposited cDNA clone, but lacking the N-terminal methionine.
The invention further provides an isolated nucleic acid molecule
having the nucleotide sequence shown preferably in SEQ ID NO:60 or,
alternatively, in SEQ ID NO:4 or the nucleotide sequence of the
TR14 cDNA contained in the above-described deposited cDNA clone, or
a nucleic acid molecule having a sequence complementary to one of
the above sequences. Such isolated molecules, particularly DNA
molecules, are useful, for example, as probes for gene mapping by
in situ hybridization with chromosomes, and for detecting
expression of the TR14 gene in human tissue, for instance, by
Northern blot analysis.
[0072] In addition, the invention provides nucleic acid molecules
having nucleotide sequences related to extensive portions of SEQ ID
NO:1 which have been determined from the following related cDNA
clones: HETAQ12R (SEQ ID NO:8), HETAK82R (SEQ ID NO:9), HETBH18R
(SEQ ID NO:10), HEPAB26R (SEQ ID NO:11), HETAN38R (SEQ ID NO:12),
HPWDD30R (SEQ ID NO:13), HETAT05R (SEQ ID NO:14), HETDQ39R (SEQ ID
NO:15), HETEM84R (SEQ ID NO:16), and HSIDV42R (SEQ ID NO:17).
[0073] In addition, the invention provides nucleic acid molecules
having nucleotide sequences related to extensive portions of SEQ ID
NO:39 which have been determined from the following related cDNA
clones: HETAQ12R (SEQ ID NO:48), HETAK82R (SEQ ID NO:49), HETBM71R
(SEQ ID NO:50), HETBH18R (SEQ ID NO:51), HEPAB26R (SEQ ID NO:52),
HETAN38R (SEQ ID NO:53), HPWDD30R (SEQ ID NO:54), HETAT05R (SEQ ID
NO:55), HETDQ39R (SEQ ID NO:56), HPWBL93R (SEQ ID NO:57), HETEM84R
(SEQ ID NO:58), and HSIDV42R (SEQ ID NO:59).
[0074] In addition, the invention provides nucleic acid molecules
having nucleotide sequences related to extensive portions of SEQ ID
NOS:60 and 4 which have been determined from the following related
cDNA clones: HSABD50R (SEQ ID NO:18), HTXMX53R (SEQ ID NO:19),
HE2OR74R (SEQ ID NO:20), HMSHK47R (SEQ ID NO:21), and HMSHK59R (SEQ
ID NO:22).
[0075] The present invention is further directed to fragments of
the isolated TR13 nucleic acid molecules described herein. By a
fragment of an isolated DNA molecule having the nucleotide sequence
of a deposited cDNA clone (e.g., HWLHN83 and/or HWLHM70), or the
nucleotide sequence shown in FIGS. 1A-D (SEQ ID NO:1) and/or FIGS.
7A-E (SEQ ID NO:39), or the complementary strand thereto, is
intended DNA fragments at least about 15 nt, and more preferably at
least about 20 nt, or at least 25 nt, still more preferably at
least about 30 nt, or at least 35 nt, and even more preferably, at
least about 40 nt, or at least about 50 nt in length which are
useful, for example, as diagnostic probes and primers as discussed
herein. Of course, larger fragments 50-1500 nt in length are also
useful according to the present invention, as are fragments
corresponding to most, if not all, of the nucleotide sequence of
the deposited cDNA or as shown in SEQ ID NO:1 and/or SEQ ID NO:39.
By a fragment at least 20 nt in length, for example, is intended
fragments which include 20 or more contiguous bases from the
nucleotide sequence of a deposited cDNA clone or the nucleotide
sequence as shown in FIGS. 1A-D (SEQ ID NO:1) and/or FIGS. 7A-E
(SEQ ID NO:39). In this context "about" includes the particularly
recited size, or may be larger or smaller by several (5, 4, 3, 2,
or 1) nucleotides, at either terminus or at both termini.
[0076] The present invention is further directed to fragments of
the isolated TR14 nucleic acid molecules described herein. By a
fragment of an isolated DNA molecule having the nucleotide sequence
of the deposited cDNA clone (HMSHK47), or the nucleotide sequence
shown preferably in FIGS. 10A-H (SEQ ID NO:60) or, alternatively in
FIGS. 4A-E (SEQ ID NO:4), or the complementary strand thereto, is
intended DNA fragments at least about 15 nt, and more preferably at
least about 20 nt, or at least 25 nt, still more preferably at
least about 30 nt, or at least 35 nt, and even more preferably, at
least about 40 nt, or at least 50 nt, in length which are useful,
for example, as diagnostic probes and primers as discussed herein.
Of course, larger fragments 50-1500 nt in length are also useful
according to the present invention, as are fragments corresponding
to most, if not all, of the nucleotide sequence of the deposited
cDNA or as shown preferably in FIGS. 10A-H (SEQ ID NO:60) or,
alternatively in FIGS. 4A-E (SEQ ID NO:4). By a fragment at least
20 nt in length, for example, is intended fragments which include
20 or more contiguous bases from the nucleotide sequence of the
deposited cDNA or the nucleotide sequence as shown in preferably in
SEQ ID NO:60, or, alternatively, in SEQ ID NO:4. In this context
"about" includes the particularly recited size, or may be larger or
smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at both termini.
[0077] Representative examples of TR13 polynucleotide fragments of
the invention include, for example, fragments that comprise, or
alternatively, consist of, a sequence from about nucleotide 1 to
about 50, from about 51 to about 108, from about 109 to about 159,
from about 160 to about 210, from about 211 to about 261, from
about 262 to about 273, from about 274 to about 324, from about 325
to about 375, from about 376 to about 426, from about 427 to about
477, from about 478 to about 528, from about 529 to about 579, from
about 580 to about 630, from about 631 to about 681, from about 682
to about 732, from about 733 to about 744, from about 745 to about
798, from about 799 to about 849, from about 850 to about 900, from
about 901 to about 951, from about 952 to about 1002, from about
1003 to about 1053, from about 1054 to about 1104, from about 1105
to about 1155, from about 1156 to about 1164, from about 1165 to
about 1197, from about 1198 to about 1248, from about 1249 to about
1266, from about 1267 to about 1317, from about 1318 to about 1368,
from about 1369 to about 1419, from about 1420 to about 1470, from
about 1471 to about 1521, from about 1522 to about 1572, from about
1573 to about 1623, from about 1624 to about 1674, from about 1675
to about 1725, from about 1726 to about 1776, from about 1777 to
about 1827, from about 1828 to about 1878, from about 1879 to about
1929, from about 1930 to about 1980, from about 1981 to about 2031,
from about 2032 to about 2082, from about 2083 to about 2133, from
about 2134 to about 2184, from about 2185 to about 2235, from about
2236 to about 2286, from about 2287 to about 2337, from about 2338
to about 2388, from about 2389 to about 2489, from about 2490 to
about 2540, from about 2451 to about 2501, from about 2502 to about
2554 of the polynucleotide sequence shown in FIGS. 1A-D (SEQ ID
NO:1), or the complementary strand thereto, or the cDNA contained
in the deposited clone (HWLHM70). Other representative examples of
polynucleotide fragments of the invention include, for example,
fragments that comprise, or alternatively consist of, a sequence
from about nucleotide 1 to about 362, from about 705 to about 830,
from about 31 to about 2280, from about 343 to 414, from about 415
to about 459, from about 460 to about 540, 343 to about 540, from
about 781 to about 804, from about 805 to about 830, from about 781
to about 822, from about 1021 to about 1260, from about 1768 to
about 1812, from about 1813 to about 1866, from about 1768 to about
1866, from about 31 to about 540, from about 660 to about 984, from
about 1057 to about 1470, from about 1672 to about 1806, and/or
from about 1924 to about 2256 of the polynucleotide sequence shown
in FIGS. 1A-D (SEQ ID NO:1), or the complementary strand thereto.
In this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at
either terminus or at both termini. Polynucleotides which hybridize
to any 1, 2, 3, 4, 5 or more of these polynucleotide fragments are
also encompassed by the invention. Moreover, polypeptides encoded
by these polynucleotides and/or polynucleotide fragments are also
encompassed by the invention.
[0078] Additional representative examples of TR13 polynucleotide
fragments of the invention include, for example, fragments that
comprise, or alternatively, consist of, a sequence from about
nucleotide 1 to about 50, from about 51 to about 108, from about
109 to about 159, from about 160 to about 210, from about 211 to
about 261, from about 262 to about 273, from about 274 to about
324, from about 325 to about 375, from about 376 to about 426, from
about 427 to about 477, from about 478 to about 528, from about 529
to about 579, from about 580 to about 630, from about 631 to about
681, from about 682 to about 732, from about 733 to about 744, from
about 745 to about 798, from about 799 to about 849, from about 850
to about 900, from about 901 to about 951, from about 952 to about
1002, from about 1003 to about 1053, from about 1054 to about 1104,
from about 1105 to about 1155, from about 1156 to about 1164, from
about 1165 to about 1197, from about 1198 to about 1248, from about
1249 to about 1266, from about 1267 to about 1317, from about 1318
to about 1368, from about 1369 to about 1419, from about 1420 to
about 1470, from about 1471 to about 1521, from about 1522 to about
1572, from about 1573 to about 1623, from about 1624 to about 1674,
from about 1675 to about 1725, from about 1726 to about 1776, from
about 1777 to about 1827, from about 1828 to about 1878, from about
1879 to about 1929, from about 1930 to about 1980, from about 1981
to about 2031, from about 2032 to about 2082, from about 2083 to
about 2133, from about 2134 to about 2184, from about 2185 to about
2235, from about 2236 to about 2286, from about 2287 to about 2337,
from about 2338 to about 2388, from about 2389 to about 2489, from
about 2490 to about 2540, from about 2451 to about 2501, from about
2502 to about 2554, about 2600 to about 2650, about 2651 to about
2700, about 2701 to about 2750, about 2751 to about 2800, about
2801 to about 2850, about 2851 to about 2900, about 2901 to about
2950, about 2951 to about 3000, about 3001 to about 3050, about
3051 to about 3100, about 3101 to about 3150, about 3151 to about
3200, about 3201 to about 3250, about 3251 to about 3300, and about
3301 to about 3334 of the polynucleotide sequence shown in FIGS.
7A-E (SEQ ID NO:39), or the complementary strand thereto, or the
cDNA contained in the deposited clone (HWLHN83). Other
representative examples of polynucleotide fragments of the
invention include, for example, fragments that comprise, or
alternatively consist of, a sequence from about nucleotide 1 to
about 42, from about 181 to about 2775, from about 984 to about
1142, from about 1485 to about 1610, from about 2361 to about 2718,
from about 61 to about 3060, from about 58 to about 3060, from
about 58 to about 183, from about 58 to about 2775, from about 2776
to about 2850, from about 2851 to about 3060, from about 868 to
about 1320, from about 868 to about 915, from about 925 to about
957, about 960 to about 1017, about 1042 to about 1140, about 1267
to about 1320, about 870 to about 1320, about 1810 to about 1842,
about 2038 to about 2079, about 2185 to about 2289, about 2995 to
about 3054, about 190 to about 237, about 418 to about 462, about
58 to about 843, about 847 to about 1326, about 1366 to about 2424,
about 1812 to about 1842, about 2776 to about 2850, about 2428 to
about 3060, about 2851 to about 3060, and/or from about 490 to
about 537 of the polynucleotide sequence shown in FIGS. 7A-E (SEQ
ID NO:39), or the complementary strand thereto. In this context
"about" includes the particularly recited ranges, larger or smaller
by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at
both termini. Polynucleotides which hybridize to any 1, 2, 3, 4, 5
or more of these polynucleotide fragments are also encompassed by
the invention. Moreover, polypeptides encoded by these
polynucleotides and/or polynucleotide fragments are also
encompassed by the invention. Moreover, polypeptides encoded by the
polynucleotides and/or polynucleotide fragments are also
encompassed by the invention.
[0079] Preferably, the polynucleotide fragments of the invention
encode a polypeptide which demonstrates a TR13 functional activity.
By a polypeptide demonstrating a TR13 "functional activity" is
meant, a polypeptide capable of displaying one or more known
functional activities associated with a full-length (complete) TR13
protein. Such functional activities include, but are not limited
to, biological activity (e.g., cell proliferation activity, ability
to cause cell death including ability to induce apoptosis),
antigenicity (ability to bind (or compete with a TR13 polypeptide
for binding) to an anti-TR13 antibody), immunogenicity (ability to
generate antibody which binds to a TR13 polypeptide), ability to
form multimers with TR13 polypeptides of the invention, and ability
to bind to a receptor or ligand for a TR13 polypeptide.
[0080] In one embodiment where one is assaying for the ability to
bind or compete with full-length TR13 polypeptide for binding to
anti-TR13 antibody, various immunoassays known in the art can be
used, including but not limited to, competitive and non-competitive
assay systems using techniques such as radioimmunoassays, ELISA
(enzyme linked immunosorbent assay), "sandwich" immunoassays,
immunoradiometric assays, gel diffusion precipitation reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold,
enzyme or radioisotope labels, for example), western blots,
precipitation reactions, agglutination assays (e.g., gel
agglutination assays, hemagglutination assays), complement fixation
assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment, antibody
binding is detected by detecting a label on the primary antibody.
In another embodiment, the primary antibody is detected by
detecting binding of a secondary antibody or reagent to the primary
antibody. In a further embodiment, the secondary antibody is
labeled. Many means are known in the art for detecting binding in
an immunoassay and are within the scope of the present
invention.
[0081] In another embodiment, where a TR13 ligand is identified, or
the ability of a polypeptide fragment, variant or derivative of the
invention to multimerize is being evaluated, binding can be
assayed, e.g., by means well-known in the art, such as, for
example, reducing and non-reducing gel chromatography, protein
affinity chromatography, and affinity blotting. See generally,
Phizicky, E., et al., Microbiol. Rev. 59:94-123 (1995). In another
embodiment, physiological correlates of TR13 binding to its
substrates (signal transduction) can be assayed.
[0082] In addition, assays described herein (see, for example,
Examples 5, and 16-21) and those otherwise known in the art may
routinely be applied to measure the ability of TR13 polypeptides
and fragments, variants derivatives and analogs thereof to elicit a
particular biological activity (e.g., to inhibit Fas ligand and/or
TRAIL induced apoptosis, to enhance Fas ligand induced apoptosis,
to regulate (e.g., inhibit) B cell proliferation (see, e.g.,
Example 33), to regulate proliferation of other cells, and/or to
inhibit hematopoiesis in vitro or in vivo). For example, techniques
known in the art (such as for example assaying for thymidine
incorporation), may be applied or routinely modified to assay for
the ability of the compositions of the invention to regulate (e.g.,
inhibit and/or enhance apoptosis) and/or to regulate (e.g., inhibit
and/or enhance) proliferation of hematopoietic cells. Additionally,
assays desribed herein (see e.g., Example 15 and Example 33) and
otherwise known in the art may be applied or routinely modified to
assay for the ability of the compositions of the invention to
inhibit or stimulate B cell proliferation.
[0083] Representative examples of TR14 polynucleotide fragments of
the invention include, for example, fragments that comprise, or
alternatively, consist of, a sequence from about nucleotide 1 to
about 50, from about 51 to about 108, from about 109 to about 159,
from about 160 to about 210, from about 211 to about 261, from
about 262 to about 273, from about 274 to about 324, from about 325
to about 375, from about 376 to about 426, from about 427 to about
477, from about 478 to about 528, from about 529 to about 579, from
about 580 to about 630, from about 631 to about 681, from about 682
to about 732, from about 733 to about 744, from about 745 to about
798, from about 799 to about 849, from about 850 to about 900, from
about 901 to about 951, from about 952 to about 1002, from about
1003 to about 1053, from about 1054 to about 1104, from about 1105
to about 1155, from about 1156 to about 1164, from about 1165 to
about 1197, from about 1198 to about 1248, from about 1249 to about
1266, from about 1267 to about 1317, from about 1318 to about 1368,
from about 1369 to about 1419, from about 1420 to about 1470, from
about 1471 to about 1521, from about 1522 to about 1572, from about
1573 to about 1623, from about 1624 to about 1674, from about 1675
to about 1725, from about 1726 to about 1776, from about 1777 to
about 1827, from about 1828 to about 1878, from about 1879 to about
1929, from about 1930 to about 1980, from about 1981 to about 2031,
from about 2032 to about 2082, from about 2083 to about 2133, from
about 2134 to about 2184, from about 2185 to about 2235, from about
2236 to about 2286, from about 2287 to about 2337, from about 2338
to about 2388, from about 2389 to about 2489, from about 2490 to
about 2540, from about 2451 to about 2501, from about 2502 to about
2552, from about 2553 to about 2603, from about 2604 to about 2654,
from about 2655 to about 2705, from about 2706 to about 2756, from
about 2806 to about 2856, from about 2857 to about 2907, from about
2908 to about 2958, from about 2959 to about 3009, from about 3010
to about 3060, from about 3061 to about 3111, and/or from about
3112 to about 3152 of the polynucleotide sequence shown in FIGS.
10A-H (SEQ ID NO:60), or the complementary strand thereto, or the
cDNA contained in the deposited clone (HMSHK47). Other
representative examples of polynucleotide fragments of the
invention include, for example, fragments that comprise, or
alternatively, consist of, a sequence from about nucleotide 1 to
about 1451, from about 1761 to about 2251, from about 89 to about
766, from about 89 to about 487, from about 488 to about 538, from
about 539 to about 766, from about 92 to about 160, from about 212
to about 243, from about 281 to about 313, from about 314 to about
343, from about 281 to about 343, from about 325 to about 433,
and/or 550 to about 766 of the polynucleotide sequence shown in
FIGS. 10A-H (SEQ ID NO:60), or the complementary strand thereto. In
this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at
either terminus or at both termini. Polynucleotides which hybridize
to any 1, 2, 3, 4, 5 or more of these polynucleotide fragments are
also encompassed by the invention. Moreover, polypeptides encoded
by these polynucleotides and/or polynucleotide fragments are also
encompassed by the invention.
[0084] Alternative representative examples of TR14 polynucleotide
fragments of the invention include, for example, fragments that
comprise, or alternatively, consist of, a sequence from about
nucleotide 1 to about 50, from about 51 to about 108, from about
109 to about 159, from about 160 to about 210, from about 211 to
about 261, from about 262 to about 273, from about 274 to about
324, from about 325 to about 375, from about 376 to about 426, from
about 427 to about 477, from about 478 to about 528, from about 529
to about 579, from about 580 to about 630, from about 631 to about
681, from about 682 to about 732, from about 733 to about 744, from
about 745 to about 798, from about 799 to about 849, from about 850
to about 900, from about 901 to about 951, from about 952 to about
1002, from about 1003 to about 1053, from about 1054 to about 1104,
from about 1105 to about 1155, from about 1156 to about 1164, from
about 1165 to about 1197, from about 1198 to about 1248, from about
1249 to about 1266, from about 1267 to about 1317, from about 1318
to about 1368, from about 1369 to about 1419, from about 1420 to
about 1470, from about 1471 to about 1521, from about 1522 to about
1572, from about 1573 to about 1623, from about 1624 to about 1674,
from about 1675 to about 1725, from about 1726 to about 1776, from
about 1777 to about 1827, from about 1828 to about 1878, from about
1879 to about 1929, from about 1930 to about 1980, from about 1981
to about 2031, from about 2032 to about 2082, from about 2083 to
about 2133, from about 2134 to about 2184, from about 2185 to about
2235, from about 2236 to about 2286, from about 2287 to about 2337,
from about 2338 to about 2388, from about 2389 to about 2489, from
about 2490 to about 2540, from about 2451 to about 2501, from about
2502 to about 2552, from about 2553 to about 2603, from about 2604
to about 2654, from about 2655 to about 2705, from about 2706 to
about 2756, from about 2806 to about 2856, from about 2857 to about
2907, from about 2908 to about 2958, from about 2959 to about 3009,
from about 3010 to about 3060, from about 3061 to about 3111, from
about 3112 to about 3162, from about 3163 to about 3213, from about
3214 to about 3264, from about 3265 to about 3315, from about 3316
to about 3366, from about 3367 to about 3417, from about 3418 to
about 3468, from about 3469 to about 3519, from about 3520 to about
3566, from about 3567 to about 3599, from about 3600 to about 3649,
from about 3650 to about 3699, from about 3700 to about 3749, from
about 3750 to about 3799, and/or from 3800 to about 3861 of the
polynucleotide sequence shown in FIGS. 4A-E (SEQ ID NO:4), or the
complementary strand thereto, or the cDNA contained in the
deposited clone (HMSHK47). Other representative examples of
polynucleotide fragments of the invention include, for example,
fragments that comprise, or alternatively, consist of, a sequence
from about nucleotide 1 to about 1451, from about 1761 to about
2251, from about 3133 to about 3861, from about 89 to about 766,
from about 89 to about 487, from about 488 to about 538, from about
539 to about 766, from about 92 to about 160, from about 212 to
about 243, from about 281 to about 313, from about 314 to about
343, from about 281 to about 343, from about 325 to about 433,
and/or 550 to about 766 of the polynucleotide sequence shown in
FIGS. 4A-E (SEQ ID NO:4), or the complementary strand thereto. In
this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at
either terminus or at both termini. Polynucleotides which hybridize
to any 1, 2, 3, 4, 5 or more of these polynucleotide fragments are
also encompassed by the invention. Moreover, polypeptides encoded
by these polynucleotides and/or polynucleotide fragments are also
encompassed by the invention.
[0085] Preferably, the polynucleotide fragments of the invention
encode a polypeptide which demonstrates a TR14 functional activity.
By a polypeptide demonstrating a TR14 "functional activity" is
meant, a polypeptide capable of displaying one or more known
functional activities associated with a full-length (complete) TR14
protein. Such functional activities include, but are not limited
to, biological activity, antigenicity (ability to bind (or compete
with a TR14 polypeptide for binding) to an anti-TR14 antibody),
immunogenicity (ability to generate antibody which binds to a TR14
polypeptide), ability to form multimers with TR14 polypeptides of
the invention, and ability to bind to a receptor or ligand for a
TR14 polypeptide.
[0086] In one embodiment where one is assaying for the ability to
bind or compete with full-length TR14 polypeptide for binding to
anti-TR14 antibody, various immunoassays known in the art can be
used, including but not limited to, competitive and non-competitive
assay systems using techniques such as radioimmunoassays, ELISA
(enzyme linked immunosorbent assay), "sandwich" immunoassays,
immunoradiometric assays, gel diffusion precipitation reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold,
enzyme or radioisotope labels, for example), western blots,
precipitation reactions, agglutination assays (e.g., gel
agglutination assays, hemagglutination assays), complement fixation
assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment, antibody
binding is detected by detecting a label on the primary antibody.
In another embodiment, the primary antibody is detected by
detecting binding of a secondary antibody or reagent to the primary
antibody. In a further embodiment, the secondary antibody is
labeled. Many means are known in the art for detecting binding in
an immunoassay and are within the scope of the present
invention.
[0087] In another embodiment, where a TR14 ligand is identified, or
the ability of a polypeptide fragment, variant or derivative of the
invention to multimerize is being evaluated, binding can be
assayed, e.g., by means well-known in the art, such as, for
example, reducing and non-reducing gel chromatography, protein
affinity chromatography, and affinity blotting. See generally,
Phizicky et al., Microbiol. Rev. 59:94-123 (1995). In another
embodiment, physiological correlates of TR14 binding to its
substrates (signal transduction) can be assayed.
[0088] In addition, assays described herein (see, for example,
Examples 5 and 15-21 and 33 and those otherwise known in the art
may routinely be applied to measure the ability of TR14
polypeptides and fragments, variants derivatives and analogs
thereof to elicit a particular biological activity (e.g., to
inhibit TRAIL induced apoptosis, to regulate (e.g., inhibit) B cell
proliferation (see, e.g., Example 33), and/or to inhibit
hematopoiesis in vitro or in vivo). For example, techniques known
in the art (such as for example assaying for thymidine
incorporation), may be applied or routinely modified to assay for
the ability of the compositions of the invention to regulate (e.g.,
inhibit apoptosis) and/or to regulate (e.g., inhibit) proliferation
of hematopoictic cells. Additionally, assays desribed herein (see
e.g., Example 15 and Example 33) and otherwise known in the art may
be applied or routinely modified to assay for the ability of the
compositions of the invention to inhibit or stimulate B cell
proliferation.
[0089] Other methods will be known to the skilled artisan and are
within the scope of the invention.
[0090] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding a member selected from the
group: a polypeptide comprising or alternatively, consisting of any
combination of one, two, three or all four TR13 cysteine rich
domains (amino acid residues from about 105 to about 170, from
about 251 to about 264, from about 331 to about 410 and from about
580 to about 610 in FIGS. 1A-D (amino acids from about 105 to about
170, from about 251 to about 265, from about 331 to about 410 and
from about 580 to about 610 in SEQ ID NO:1). Since, as discussed
above, the location of these domains have been predicted by
computer analysis, one of ordinary skill would appreciate that the
amino acid residues constituting these domains may be the
particularly recited ranges for each domain or may vary slightly
(e.g., by about 1, 2, 3, 4, 5, 10, or 15 residues at either extreme
or at both extremes) depending on the criteria used to define each
domain.
[0091] Additional preferred nucleic acid fragments of the present
invention include nucleic acid molecules encoding a member selected
from the group: a polypeptide comprising or alternatively,
consisting of the TR13 receptor extracellular domain (amino acids 1
to 906 in FIGS. 7A-E); a polypeptide comprising or alternatively,
consisting of, the mature TR13 receptor extracellular domain (amino
acids 42 to 906 in FIGS. 7A-E); a polypeptide comprising or
alternatively, consisting of, one or more of the TR13 cysteine rich
domains disclosed in FIGS. 7A-E (e.g., amino acid residues from
about 271 to about 421, from about 271 to about 286, about 290 to
about 300, about 301 to about 320, about 329 to about 361, about
404 to about 421, and from about 585 to about 595 in FIGS. 7A-E
(amino acid residues from about 271 to about 421, from about 271 to
about 286, about 290 to about 300, about 301 to about 320, about
329 to about 361, about 404 to about 421, and from about 585 to
about 595 in SEQ ID NO:39 and SEQ ID NO:40); a polypeptide
comprising, or alternatively, consisting of the TR13 transmembrane
domain (amino acids 907 to 931 in FIGS. 7A-E); and a polypeptide
comprising, or alternatively consisting of the TR13 intracellular
domain (amino acid 932 to 1001 in FIGS. 7A-E). As above, since the
location of these domains have been predicted by computer analysis,
one of ordinary skill would appreciate that the amino acid residues
constituting these domains may be the particularly recited ranges
for each domain or may vary slightly (e.g., by about 1, 2, 3, 4, 5,
10, or 15 residues at either extreme or at both extremes) depending
on the criteria used to define each domain.
[0092] It is believed that the cysteine rich motifs of TR13
disclosed in FIGS. 1A-D are important for interactions between TR13
and its ligands. Accordingly, specific embodiments of the invention
are directed to polynucleotides encoding polypeptides which
comprise, or alternatively consist of, the amino acid sequence of
amino acid residues from about 105 to about 170, from about 251 to
about 265, from about 331 to about 410, and from about 580 to about
610 of SEQ ID NO:5 (corresponding to amino acid residues from about
105 to about 170, from about 251 to about 265, from about 331 to
about 410, and from abour 580 to about 610 of FIGS. 4A-E). In a
specific embodiment, the polynucleotides encoding TR13 polypeptides
of the invention comprise or alternatively consist of,
polynucleotide sequences encoding any combination of 2, 3, or all
four of the cysteine-rich motifs of TR13. In this context, "about"
includes the particularly recited ranges, larger or smaller by
several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at
both termini. Polypeptides encoded by these polynucleotides are
also encompassed by the invention.
[0093] Further, specific embodiments of the invention are directed
to polynucleotides encoding polypeptides which comprise, or
alternatively consist of, the amino acid sequence of amino acid
residues from about 271 to about 421, from about 271 to about 286,
from about 290 to about 300, from about 301 to about 320, about 329
to about 361, about 404 to about 421, and about 585 to about 595 of
SEQ ID NO:40 (corresponding to amino acid residues from about 271
to about 421, from about 271 to about 286, from about 290 to about
300, from about 301 to about 320, about 329 to about 361, about 404
to about 421, and about 585 to about 595 of FIGS. 7A-E). In a
specific embodiment, the polynucleotides encoding TR13 polypeptides
of the invention comprise or alternatively consist of,
polynucleotide sequences encoding any combination of 2, 3, or all
four of the cysteine-rich motifs of TR13 disclosed in FIGS. 7A-E.
In this context, "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at
either terminus or at both termini. Polypeptides encoded by these
polynucleotides are also encompassed by the invention.
[0094] Preferred nucleic acid fragments of the invention encode a
full-length TR13 polypeptide lacking the nucleotides encoding the
amino terminal methionine (e.g., nucleotides 34-750 in SEQ ID
NO:1), as it is known that the methionine is cleaved naturally and
such sequences may be useful in genetically engineering TR13
expression vectors. Polypeptides encoded by such nucleic acids are
also contemplated by the invention.
[0095] Preferred nucleic acid fragments of the invention encode a
full-length TR13 polypeptide lacking the nucleotides encoding the
amino terminal methionine (e.g., nucleotides 61-1001 in FIGS. 7A-E
and SEQ ID NO:39), as it is known that the methionine is cleaved
naturally and such sequences may be useful in genetically
engineering TR13 expression vectors. Polypeptides encoded by such
nucleic acids are also contemplated by the invention.
[0096] Preferred nucleic acid fragments of the present invention
further include nucleic acid molecules encoding epitope-bearing
portions of the TR13 receptor protein. In particular, such nucleic
acid fragments of the present invention include nucleic acid
molecules encoding: a polypeptide comprising or alternatively
consisting of, amino acid residues from about 1 to about 170 in
FIGS. 1A-D (corresponding to about amino acid 1 to about 170 in SEQ
ID NO:2); a polypeptide comprising or alternatively consisting of,
amino acid residues from about 210 to about 318 in FIGS. 1A-D
(corresponding to about amino acid 210 to about 318 in SEQ ID
NO:2); a polypeptide comprising or alternatively consisting of,
amino acid residues from about 343 to about 480 in FIGS. 1A-D
(corresponding to about amino acid 343 to about 480 in SEQ ID
NO:2); a polypeptide comprising or alternatively consisting of,
amino acid residues from about 548 to about 592 in FIGS. 1A-D
(corresponding to about amino acid 548 to about 592 in SEQ ID
NO:2); and a polypeptide comprising or alternatively consisting of,
amino acid residues from about 632 to about 742 in FIGS. 1A-D
(corresponding to about amino acid 632 to about 742 in SEQ ID
NO:2). The inventors have determined that the above polypeptide
fragments are antigenic regions of the TR13 protein. Methods for
determining other such epitope-bearing portions of the TR13 protein
are described in detail below.
[0097] Preferred nucleic acid fragments of the present invention
further include nucleic acid molecules encoding antigenic fragments
of the TR13 receptor protein. In particular, such nucleic acid
fragments of the present invention include nucleic acid molecules
encoding: a polypeptide comprising or alternatively consisting of,
amino acid residues from about M1 to about A9, about K12 to about
L20, about N47 to about T55, about H58 to about S66, about D63 to
about S71, about P77 to about F85, about A90 to about Q98, about
F136 to about Q144, about S152 to about C160, about R159 to about
A167, about A211 to about M219, about M235 to about V243, about
V266 to about V274, about W277 to about S285, about I290 to about
F298, about A310 to about V318, about E343 to about C351, about
I360 to about H368, about G391 to about I399, about F409 to about
T417, about S436 to about Y444, about C453 to about S461, about
I472 to about S480, about Y548 to about S556, about C557 to about
I565, about V567 to about V575, about T584 to about G592, about
R632 to about G640, about W680 to about Y688, about Q684 to about
K692, about T698 to about A706, about S726 to about S734, and about
S734 to about L742 of SEQ ID NO:2 (FIGS. 1A-D) correspond to the
highly antigenic regions of the TR13 protein, predicted using the
Jameson-Wolf antigenic index (See FIG. 3 and Table I). These highly
antigenic fragments correspond to the amino acid residues
illustrated in FIG. 1A-D and in SEQ ID NO:2. In this context,
"about" includes the particularly recited ranges, larger or smaller
by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at
both termini. Methods for determining other such antigenic
fragments of the TR13 protein are described in detail below.
[0098] Additional preferred nucleic acid fragments of the present
invention further include nucleic acid fragments encoding: a
polypeptide comprising or alternatively consisting of, amino acid
residues from about 1 to about 262 in FIGS. 7A-E (corresponding to
about amino acid 1 to about 262 in SEQ ID NO:40); a polypeptide
comprising or alternatively consisting of, amino acid residues from
about 264 to about 423 in FIGS. 7A-E (corresponding to about amino
acid 264 to about 423 in SEQ ID NO:40); a polypeptide comprising or
alternatively consisting of, amino acid residues from about 437 to
about 789 in FIGS. 7A-E (corresponding to about amino acid 437 to
about 789 in SEQ ID NO:40); and a polypeptide comprising or
alternatively consisting of, amino acid residues from about 791 to
about 1001 in FIGS. 7A-E (corresponding to about amino acid 791 to
about 1001 in SEQ ID NO:40). The inventors have determined that the
above polypeptide fragments are antigenic regions of the TR13
protein. Methods for determining other such epitope-bearing
portions of the TR13 protein are described in detail below.
[0099] Additional preferred nucleic acid fragments of the present
invention encoding antigenic fragments of the TR13 receptor protein
include nucleic acid molecules encoding: a polypeptide comprising
or alternatively consisting of, amino acid residues from about M1
to about H9, about V14 to about I22, about H47 to about H55, about
C61 to about R69, about L82 to about E90, about D102 to about P110,
about K109 to about S117, about F124 to about H132, about M141 to
about E149, about S146 to about C154, about S157 to about W165,
about F168 to about T176, about N182 to about N190, about Q207 to
about A215, about P213 to about M221, about M221 to about E229,
about V233 to about V241, about T253 to about V261, about T282 to
about S290, about N298 to about T306, about C308 to about Y316,
about K315 to about S323, about P328 to about F336, about A341 to
about Q349, about F387 to about Q395, about S403 to about C411,
about T409 to about P417, about F443 to about N451, about W451 to
about Y459, about A462 to about M470, about G478 to about M486,
about A487 to about A495, about V517 to about V525, about T527 to
about Q535, about I541 to about F549, about A561 to about V569,
about E594 to about C602, about I611 to about H619, about G643 to
about I650, about P686 to about K694, about C704 to about S712,
about R722 to about I730, about E727 to about T735, about P746 to
about G754, about D776 to about L784, about Y799 to about S807,
about C808 to about I816, about V818 to about V826, about T835 to
about G843, about R883 to about G891, about K932 to about K940,
about Q935 to about K943, about T949 to about A957, about S977 to
about S985, about S981 to about P989, and about N986 to about L994
of SEQ ID NO:40 (FIGS. 7A-E) correspond to the highly antigenic
regions of the TR13 protein, predicted using the Jameson-Wolf
antigenic index (See FIG. 9 and Table III). These highly antigenic
fragments correspond to the amino acid residues illustrated in FIG.
7A-E and in SEQ ID NO:40. In this context, "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) nucleotides, at either terminus or at both termini.
Methods for determining other such antigenic fragments of the TR13
protein are described in detail below.
[0100] Additionally, it is believed that the extracellular cysteine
rich motif of TR14 disclosed in FIGS. 10A-H or, alternatively,
FIGS. 4A-E is important for interactions between TR14 and its
ligands. Accordingly, specific embodiments of the invention are
directed to nucleic acid molecules encoding polypeptides which
comprise, or alternatively consist of, preferably amino acids
Cys-31 to Cys-104 of FIGS. 10A-B and SEQ ID NO:61, or,
alternatively, the amino acid sequence of amino acid residues from
about 70 to about 90 of FIG. 10A and SEQ ID NO:61 (corresponding to
amino acid residues from about 65 to about 85 of FIGS. 4A-E or SEQ
ID NO:5). In this context, "about" includes the particularly
recited ranges, larger or smaller by several (5, 4, 3, 2, or 1)
nucleotides, at either terminus or at both termini. Polypeptides
encoded by these polynucleotides are also encompassed by the
invention.
[0101] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding a member selected from the
group: a polypeptide comprising or alternatively, consisting of,
the TR14 receptor extracellular domain (preferably amino acid
residues from about 1 to 138 in FIGS. 10A-H or, alternatively, from
about 1 to about 133 in FIGS. 4A-E); a polypeptide comprising or
alternatively, consisting of, the TR14 cysteine rich domain
(preferably amino acid residues from about 31 to about 104 of FIGS.
10A-H, or amino acid residues from about 70 to 90 in FIGS. 10A, or,
alternatively, from about 65 to about 85 in FIGS. 4A-E); a
polypeptide comprising or alternatively, consisting of the TR14
transmembrane domain (preferably amino acid residues from about 139
to 155 in FIGS. 10A-H or, alternatively, 134 to about 150 in FIGS.
4A-E); and a polypeptide comprising or alternatively, consisting
of, the TR14 intracellular domain (preferably amino acid residues
from about 156 to about 231 in FIGS. 10A-H or, alternatively, amino
acid residues from about 151 to about 226 in FIGS. 4A-E). Since the
location of these domains have been predicted by computer analysis,
one of ordinary skill would appreciate that the amino acid residues
constituting these domains may be the particularly recited ranges
for each domain or may vary slightly (e.g., by about 1, 2, 3, 4, 5,
10, or 15 residues at either extreme or at both extremes) depending
on the criteria used to define each domain.
[0102] Preferred nucleic acid fragments of the invention encode a
full-length TR14 polypeptide lacking the nucleotides encoding the
amino terminal methionine (e.g., nucleotides 70-759 of FIGS. 10A-H
or SEQ ID NO:60, or nucleotides 102-765 in SEQ ID NO:4), as it is
known that the methionine is cleaved naturally and such sequences
may be useful in genetically engineering TR14 expression vectors.
Polypeptides encoded by such nucleic acids are also contemplated by
the invention.
[0103] Preferred nucleic acid fragments of the present invention
further include nucleic acid molecules encoding epitope-bearing
portions of the TR14 receptor protein. In particular, preferred
epitope-bearing polypeptides of the present invention comprise, or
alternatively consist of, one, two, three, four, five, six, or all
six of the immunogenic epitopes of the TR14 protein shown in SEQ ID
NO: 61 as residues: Asp-2 to Asp-10, Thr-17 to Asp-38, Pro-45 to
Ser-52, Pro-88 to Arg-95, Thr-108 to Glu-115, Thr-131 to Glu-136,
Phe-166 to Gly-174, Ala-180 to Ala-200, and Gln-224 to Met-231.
Fragments and/or variants of these polypeptides, such as, for
example, fragments and/or variants as described herein, are
encompassed by the invention. Polynucleotides encoding these
polypeptides (including fragments and/or variants) are also
encompassed by the invention, as are antibodies that bind these
polypeptides.
[0104] Alternatively, such nucleic acid fragments of the present
invention include nucleic acid molecules encoding: a polypeptide
comprising or alternatively consisting of, amino acid residues from
about 2 to about 24 in FIGS. 4A-E (corresponding to about amino
acid 2 to about 24 in SEQ ID NO:5); a polypeptide comprising or
alternatively consisting of, amino acid residues from about 42 to
about 52 in FIGS. 4A-E (corresponding to about amino acid 42 to
about 52 in SEQ ID NO:5); a polypeptide comprising or alternatively
consisting of, amino acid residues from about 80 to about 115 in
FIGS. 4A-E (corresponding to about amino acid 80 to about 115 in
SEQ ID NO:5 and about amino acid 85 to about 120 of SEQ ID NO:61);
and a polypeptide comprising or alternatively consisting of, amino
acid residues from about 155 to about 226 in FIGS. 4A-E
(corresponding to about amino acid 155 to about 226 in SEQ ID NO:5
and about amino acid 160 to about amino acid 231 of SEQ ID NO:61).
The inventors have determined that the above polypeptide fragments
are antigenic regions of the TR14 protein. Methods for determining
other such epitope-bearing portions of the TR14 protein are
described in detail below.
[0105] Alternative nucleic acid fragments of the present invention
further include nucleic acid molecules encoding antigenic fragments
of the TR14 receptor protein. In particular, such nucleic acid
fragments of the present invention include nucleic acid molecules
encoding: a polypeptide comprising or alternatively consisting of,
amino acid residues of SEQ ID NO:5 (FIGS. 4A-E) from about T3 to
about S11, from about V16 to about R24, from about Q44 to about
M52, from about F85 to about G93 (about F90 to about G98 of SEQ ID
NO:61), from about T103 to about V111 (about T108 to about V116 of
SEQ ID NO:61), from about F161 to about G169 (about F165 to about
G174 of SEQ ID NO:61), from about V187 to about A195 (from about
V192 to about A200 of SEQ ID NO:61), from about P218 to about M226
(about P223 to about M231 of SEQ ID NO:61) correspond to the highly
antigenic regions of the TR14 protein, predicted using the
Jameson-Wolf antigenic index (See FIG. 11 and Table IV). These
highly antigenic fragments correspond to the amino acid residues
illustrated in FIG. 4A-E and in SEQ ID NO:5 (or FIGS. 10A-H and SEQ
ID NO:61, as indicated above). In this context, "about" includes
the particularly recited ranges, larger or smaller by several (5,
4, 3, 2, or 1) nucleotides, at either terminus or at both termini.
Methods for determining other such antigenic fragments of the TR14
protein are described in detail below.
[0106] The data presented in FIG. 3 are also represented in tabular
form in Table I. The columns in Table I are labeled with the
headings "Res", "Position", and Roman Numerals I-XIV. The column
headings refer to the following features of the amino acid sequence
presented in FIG. 3 and Table I: "Res": amino acid residue of SEQ
ID NO:2 and FIGS. 1A-1C; "Position": position of the corresponding
residue within SEQ ID NO:2 and FIGS. 1A-D; I: Alpha,
Regions--Garnier-Robson; II: Alpha, Regions--Chou-Fasman; III:
Beta, Regions--Garnier-Robson; IV: Beta, Regions--Chou-Fasman; V:
Turn, Regions--Garnier-Robson; VI: Turn, Regions--Chou-Fasman; VII:
Coil, Regions--Garnier-Robson; VIII: Hydrophilicity
Plot--Kyte-Doolittle; IX: Hydrophobicity Plot--Hopp-Woods; X:
Alpha, Amphipathic Regions--Eisenberg; XI: Beta, Amphipathic
Regions--Eisenberg; XII: Flexible Regions--Karplus-Schulz; XIII:
Antigenic Index--Jameson-Wolf; and XIV: Surface Probability
Plot--Emini.
[0107] The data presented in FIG. 9 are also represented in tabular
form in Table III. The columns in Table III are labeled with the
headings "Res", "Position", and Roman Numerals I-XIV. The column
headings refer to the following features of the amino acid sequence
presented in FIG. 9 and Table III: "Res": amino acid residue of SEQ
ID NO:40 and FIGS. 7A-E; "Position": position of the corresponding
residue within SEQ ID NO:40 and FIGS. 7A-E; I: Alpha,
Regions--Garnier-Robson; II: Alpha, Regions--Chou-Fasman; III:
Beta, Regions--Garnier-Robson; IV: Beta, Regions--Chou-Fasman; V:
Turn, Regions--Garnier-Robson; VI: Turn, Regions--Chou-Fasman; VII:
Coil, Regions--Garnier-Robson; VIII: Hydrophilicity
Plot--Kyte-Doolittle; IX: Hydrophobicity Plot--Hopp-Woods; X:
Alpha, Amphipathic Regions--Eisenberg; XI: Beta, Amphipathic
Regions--Eisenberg; XII: Flexible Regions--Karplus-Schulz; XIII:
Antigenic Index--Jameson-Wolf; and XIV: Surface Probability
Plot--Emini.
[0108] In additional embodiments, the nucleic acid molecule of the
invention encodes a polypeptide comprising, or alternatively
consisting of, a functional attribute of TR13. Preferred
embodiments of the invention in this regard include fragments that
comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, flexible regions, surface-forming regions and
high antigenic index regions of TR13.
[0109] The data representing the structural or functional
attributes of TR13 (SEQ ID NO:40) set forth in FIG. 9 and/or Table
III, as described above, was generated using the various modules
and algorithms of the DNA*STAR set on default parameters. In a
preferred embodiment, the data presented in columns VIII, IX, XIII,
and XIV of Table III can be used to determine regions of TR13 which
exhibit a high degree of potential for antigenicity. Regions of
high antigenicity are determined from the data presented in columns
VIII, IX, XIII, and/or XIV by choosing values which represent
regions of the polypeptide which are likely to be exposed on the
surface of the polypeptide in an environment in which antigen
recognition may occur in the process of initiation of an immune
response.
[0110] Certain preferred regions in these regards are set out in
FIG. 3, but may, as shown in Table I, be represented or identified
by using tabular representations of the data presented in FIG. 3.
The DNA*STAR computer algorithm used to generate FIG. 3 (set on the
original default parameters) was used to present the data in FIG. 3
in a tabular format (See Table I). The tabular format of the data
in FIG. 3 may be used to easily determine specific boundaries of a
preferred region.
[0111] Certain preferred regions in these regards are set out in
FIG. 9, but may, as shown in Table III, be represented or
identified by using tabular representations of the data presented
in FIG. 9. The DNA*STAR computer algorithm used to generate FIG. 9
(set on the original default parameters) was used to present the
data in FIG. 9 in a tabular format (See Table III). The tabular
format of the data in FIG. 9 may be used to easily determine
specific boundaries of a preferred region.
[0112] The above-mentioned preferred regions set out in FIG. 3 and
in Table I include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIGS. 1A-D. As set out in FIG. 3 and in Table
I, such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions, Chou-Fasman
alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle
hydrophilic regions and Hopp-Woods hydrophobic regions, Eisenberg
alpha- and beta-amphipathic regions, Karplus-Schulz flexible
regions, Jameson-Wolf regions of high antigenic index and Emini
surface-forming regions.
[0113] The above-mentioned preferred regions set out in FIG. 9 and
in Table III include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIG. 9. As set out in FIG. 9 and in Table III,
such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions, Chou-Fasman
alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle
hydrophilic regions and Hopp-Woods hydrophobic regions, Eisenberg
alpha- and beta-amphipathic regions, Karplus-Schulz flexible
regions, Jameson-Wolf regions of high antigenic index and Emini
surface-forming regions.
[0114] The data presented in FIG. 11 are also represented in
tabular form in Table IV. The columns in Table IV are labeled with
the headings "Res", "Pos", and Roman Numerals I-XIV. The column
headings refer to the following features of the amino acid sequence
presented in FIGS. 10A-H, and 11: "Res": amino acid residue of SEQ
ID NO:61 and FIGS. 10A-H; "Pos": position of the corresponding
residue within SEQ ID NO:61 and FIGS. 10A-H; I: Alpha,
Regions--Garnier-Robson; II: Alpha, Regions--Chou-Fasman; III:
Beta, Regions--Garnier-Robson; IV: Beta, Regions--Chou-Fasman; V:
Turn, Regions--Garnier-Robson; VI: Turn, Regions--Chou-Fasman; VII:
Coil, Regions--Garnier-Robson; VIII: Hydrophilicity
Plot--Kyte-Doolittle; IX: Hydrophobicity Plot--Hopp-Woods; X:
Alpha, Amphipathic Regions--Eisenberg; XI: Beta, Amphipathic
Regions--Eisenberg; XII: Flexible Regions--Karplus-Schulz; XIII:
Antigenic Index--Jameson-Wolf; and XIV: Surface Probability
Plot--Emini.
[0115] The data presented in FIG. 6 are also represented in tabular
form in Table II. As above, the columns in Table II are labeled
with the headings "Res", "Position", and Roman Numerals I-XIV. The
column headings refer to the following features of the amino acid
sequence presented in FIG. 6 and Table II: "Res": amino acid
residue of SEQ ID NO:5 and FIGS. 4A-E; "Position": position of the
corresponding residue within SEQ ID NO:5 and FIGS. 4A-E; I: Alpha,
Regions--Garnier-Robson; II: Alpha, Regions--Chou-Fasman; III:
Beta, Regions--Garnier-Robson; IV: Beta, Regions--Chou-Fasman; V:
Turn, Regions--Garnier-Robson; VI: Turn, Regions--Chou-Fasman; VII:
Coil, Regions--Garnier-Robson; VIII: Hydrophilicity
Plot--Kyte-Doolittle; IX: Hydrophobicity Plot--Hopp-Woods; X:
Alpha, Amphipathic Regions--Eisenberg; XI: Beta, Amphipathic
Regions--Eisenberg; XII: Flexible Regions--Karplus-Schulz; XIII:
Antigenic Index--Jameson-Wolf; and XIV: Surface Probability
Plot--Emini.
[0116] In additional embodiments, the polynucleotides of the
invention encode functional attributes of TR14. Preferred
embodiments of the invention in this regard include fragments that
comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, flexible regions, surface-forming regions and
high antigenic index regions of TR14.
[0117] The data representing the structural or functional
attributes of TR13 (SEQ ID NO:2) set forth in FIG. 3 and/or Table
I, as described above, was generated using the various modules and
algorithms of the DNA*STAR set on default parameters. In a
preferred embodiment, the data presented in columns VIII, IX, XIII,
and XIV of Table I can be used to determine regions of TR13 which
exhibit a high degree of potential for antigenicity. Regions of
high antigenicity are determined from the data presented in columns
VIII, IX, XIII, and/or XIV by choosing values which represent
regions of the polypeptide which are likely to be exposed on the
surface of the polypeptide in an environment in which antigen
recognition may occur in the process of initiation of an immune
response.
[0118] The data representing the structural or functional
attributes of TR14 (SEQ ID NO:61, as set forth in FIG. 11 and/or
Table IV; or, alternatively, SEQ ID NO:5, as set forth in FIG. 6
and/or Table II), as described above, were generated using the
various modules and algorithms of the DNA*STAR set on default
parameters. In a preferred embodiment, the data presented in
columns VII, IX, XIII, and XIV of Table II can be used to determine
regions of TR14 which exhibit a high degree of potential for
antigenicity. Regions of high antigenicity are determined from the
data presented in columns VII, IX, XIII, and/or XIV by choosing
values which represent regions of the polypeptide which are likely
to be exposed on the surface of the polypeptide in an environment
in which antigen recognition may occur in the process of initiation
of an immune response.
[0119] Certain preferred regions in these regards are set out in
FIG. 6, but may, as shown in Table II, be represented or identified
by using tabular representations of the data presented in FIG. 6.
The DNA*STAR computer algorithm used to generate FIG. 6 (set on the
original default parameters) was used to present the data in FIG. 6
in a tabular format (See Table II). The tabular format of the data
in FIG. 6 may be used to easily determine specific boundaries of a
preferred region.
[0120] Certain even more preferred regions in these regards are set
out in FIG. 11, but may, as shown in Table IV, be represented or
identified by using tabular representations of the data presented
in FIG. 11. The DNA*STAR computer algorithm used to generate FIG.
11 (set on the original default parameters) was used to present the
data in FIG. 11 in a tabular format (See Table IV). The tabular
format of the data in FIG. 11 may be used to easily determine
specific boundaries of a preferred region.
[0121] The above-mentioned preferred regions set out in FIG. 11 and
in Table IV include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIGS. 10A-H. As set out in FIG. 11 and in Table
IV, such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions, Chou-Fasman
alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle
hydrophilic regions and Hopp-Woods hydrophobic regions, Eisenberg
alpha- and beta-amphipathic regions, Karplus-Schulz flexible
regions, Jameson-Wolf regions of high antigenic index and Emini
surface-forming regions.
[0122] The above-mentioned preferred regions set out in FIG. 6 and
in Table II include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIGS. 4A-E. As set out in FIG. 6 and in Table
II, such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions, Chou-Fasman
alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle
hydrophilic regions and Hopp-Woods hydrophobic regions, Eisenberg
alpha- and beta-amphipathic regions, Karplus-Schulz flexible
regions, Jameson-Wolf regions of high antigenic index and Emini
surface-forming regions.
1TABLE I Res Pos I II III IV V VI VII VIII IX X XI XII XIII XIV Met
1 . . B . . . . 0.73 -0.31 . . . 1.40 1.44 Asp 2 . . . . T T . 1.12
-0.26 . . . 2.25 1.62 Gln 3 . . . . T T . 0.92 -0.29 * . . 2.50
2.20 Ser 4 . . . . . T C 0.64 -0.21 . . . 2.05 2.24 Thr 5 . . B . .
T . 0.44 -0.26 . . F 1.60 0.72 Gln 6 . A B . . . . 0.70 0.24 . . F
0.35 0.42 Ala 7 . A B . . . . 0.70 0.27 . . . -0.05 0.31 Cys 8 . A
. . T . . 0.74 -0.11 . . . 0.70 0.37 Ala 9 . A . . T . . 1.01 -0.60
. . . 1.00 0.43 Gly 10 . A . . T . . 0.66 -0.50 . . F 0.85 0.58 Glu
11 . A . . T . . 0.62 -0.43 . . F 0.85 0.58 Lys 12 . A . . T . .
1.21 -0.50 . . F 1.10 0.78 His 13 . A . . T . . 1.99 -0.60 . * .
1.65 1.27 Cys 14 . A . . T . . 2.23 -1.03 . . . 1.90 1.43 His 15 .
. . . T . . 2.23 -0.60 . * . 2.20 0.71 Asn 16 . . . . T T . 1.42
-0.17 . * F 2.50 0.52 Arg 17 . . . . T T . 1.34 0.01 * * F 1.65
0.79 Gly 18 . . . . T T . 0.68 -0.06 * * F 2.00 0.79 Gly 19 . . . .
T T . 1.46 0.23 * * F 1.15 0.43 Leu 20 . A . . . . C 0.89 -0.17 * *
. 0.75 0.43 His 21 . A B . . . . 0.08 0.44 * * . -0.60 0.43 Phe 22
. A B . . . . -0.24 0.70 . * . -0.60 0.36 Arg 23 . A B . . . .
-0.71 0.70 . * . -0.60 0.67 Met 24 . A B . . . . -0.37 0.70 . * .
-0.60 0.40 Leu 25 . A B . . . . 0.13 0.60 . * . -0.60 0.81 Pro 26 .
A . . . . C -0.12 0.30 . * . -0.10 0.60 Leu 27 . . . B T . . 0.54
1.21 * . . -0.20 0.63 Gln 28 . . . B T . . -0.42 1.10 . . . -0.05
1.05 Thr 29 . . . B T . . -0.49 1.06 * . . -0.20 0.50 Trp 30 . . B
B . . . 0.43 1.20 * . . -0.60 0.33 His 31 . . B B . . . 0.64 0.51 *
. . -0.60 0.37 Val 32 . . B B . . . 0.87 0.51 * . . -0.60 0.44 Cys
33 . . B B . . . 0.52 0.53 * . . -0.60 0.43 Arg 34 . . B B . . .
0.02 0.04 * . . -0.30 0.31 Gln 35 . . . B T . . -0.50 0.23 * . .
0.10 0.34 Ala 36 . . . B T . . -1.17 0.27 * . . 0.10 0.53 Gly 37 .
. . B T . . -1.12 0.49 * . . -0.20 0.23 Leu 38 . . B B . . . -0.46
1.17 * . . -0.60 0.11 Leu 39 . . B B . . . -0.88 1.17 * . . -0.60
0.19 Phe 40 . . B B . . . -1.69 1.16 * . . -0.60 0.28 Leu 41 . . B
B . . . -1.31 1.41 * . . -0.60 0.28 Gln 42 . . B B . . . -1.27 1.16
. . . -0.60 0.52 Thr 43 . . B B . . . -0.46 0.86 . . F -0.45 0.81
Leu 44 . . B B . . . 0.06 0.47 . . F -0.30 1.57 Pro 45 . . . . . T
C 0.51 0.17 * . F 0.60 1.22 Ser 46 . . . . T T . 1.02 0.53 . . F
0.50 1.32 Asn 47 . . . . T T . 1.02 0.43 . . F 0.84 2.15 Ser 48 . .
. . . T C 1.38 0.14 . . F 1.28 2.24 Tyr 49 . . . . T . . 1.84 -0.29
. . F 2.22 3.34 Ser 50 . . . . . . C 2.06 -0.24 . . F 2.36 2.05 Asn
51 . . . . T T . 2.04 -0.64 . . F 3.40 2.65 Lys 52 . . . . T T .
1.74 -0.54 . . F 3.06 2.44 Gly 53 . . . . T T . 1.38 -0.91 . * F
2.72 2.44 Glu 54 . . . . T T . 1.59 -0.73 * * F 2.23 0.81 Thr 55 .
. . . T T . 1.89 -0.63 * . F 1.89 0.55 Ser 56 . . B . . T . 1.22
-0.23 * . F 0.85 0.97 Cys 57 . . B . . T . 1.18 -0.09 . * . 1.04
0.30 His 58 . . B . . T . 1.31 -0.09 . * . 1.38 0.35 Gln 59 . . . .
T . . 1.31 -0.14 . . . 1.92 0.40 Cys 60 . . . . T . . 1.67 -0.53 .
. . 2.71 1.25 Asp 61 . . . . T T . 1.72 -1.10 . . F 3.40 1.84 Pro
62 . . . . T T . 2.09 -0.84 . . F 3.06 1.66 Asp 63 . . . . T T .
2.12 -0.86 . . F 3.06 4.15 Lys 64 . . . . T T . 2.17 -1.43 * * F
3.06 4.31 Tyr 65 . . B . . T . 2.49 -1.43 * . F 2.66 5.57 Ser 66 .
. B . . T . 2.19 -1.43 * . F 2.66 3.30 Glu 67 . . . . T T . 2.10
-1.04 * . F 3.40 2.21 Lys 68 . . . . T T . 1.80 -0.66 * * F 3.06
1.89 Gly 69 . . . . T . . 1.09 -1.03 * * F 2.52 1.89 Ser 70 . . . .
T T . 1.33 -0.84 . * F 2.23 0.59 Ser 71 . . . . T T . 0.78 -0.44 .
* F 1.59 0.47 Ser 72 . . . . T T . 0.89 0.20 . * F 0.65 0.35 Cys 73
. . . . T T . 0.63 -0.23 . * F 1.25 0.52 Asn 74 . . . . T . . 0.39
-0.19 . * . 0.90 0.60 Val 75 . . B . . . . 0.02 -0.07 * * . 0.50
0.45 Arg 76 . . B . . T . 0.01 0.11 . * . 0.10 0.45 Pro 77 . . B .
. T . 0.31 0.03 . * . 0.44 0.40 Ala 78 . . B . . T . 1.02 -0.37 . *
. 1.38 0.91 Cys 79 . . B . . T . 1.02 -1.01 . * . 2.02 0.93 Thr 80
. . B . . . . 1.63 -1.01 * * F 2.31 1.00 Asp 81 . . . . T T . 0.82
-0.69 * . F 3.40 1.55 Lys 82 . . . . T T . 0.79 -0.40 . . F 2.76
2.50 Asp 83 . . . . T T . 1.07 -0.21 . . F 2.42 2.72 Tyr 84 . . B .
. T . 1.70 -0.21 . . . 1.53 2.35 Phe 85 . . B B . . . 1.70 0.29 . .
. 0.19 1.60 Tyr 86 . . B B . . . 1.11 0.77 . . . -0.45 1.38 Thr 87
. . B B . . . 0.40 1.27 . . . -0.60 0.89 His 88 . . B B . . . 0.40
1.09 . . . -0.60 0.55 Thr 89 . . B B . . . 0.06 0.30 . . . -0.30
0.59 Ala 90 . . B B . . . 0.76 0.04 . * . 0.00 0.41 Cys 91 . . . B
T . . 0.66 -0.04 . * . 1.30 0.49 Asp 92 . . . . T T . 0.97 -0.11 .
* . 2.00 0.33 Ala 93 . . . . . T C 0.69 -0.60 . * F 2.55 0.57 Asn
94 . . . . . T C 1.00 -0.61 . * F 3.00 1.54 Gly 95 . . . . . T C
0.78 -0.79 . * F 2.70 1.60 Glu 96 . A . . . . C 0.84 -0.10 . * F
1.70 1.30 Thr 97 . A B . . . . 0.60 0.01 . * F 0.45 0.80 Gln 98 . A
B . . . . 1.23 0.37 * * F 0.30 1.27 Leu 99 . A B . . . . 0.94 -0.06
* * . 0.45 1.47 Met 100 . A B . . . . 0.70 0.86 * * . -0.45 1.07
Tyr 101 . A B . . . . 0.74 0.87 * * . -0.60 0.62 Lys 102 . A . . T
. . 0.84 0.47 * * . -0.05 1.51 Trp 103 . A . . T . . 0.89 0.21 * *
. 0.25 2.36 Ala 104 . A . . . . C 0.81 -0.40 . * F 0.80 3.01 Lys
105 . A . . . . C 0.74 -0.47 * * F 0.80 1.06 Pro 106 . A . . T . .
0.69 0.10 . * F 0.25 0.54 Lys 107 . . . . T . . 0.64 -0.43 . * F
1.05 0.71 Ile 108 . . B . . . . 0.93 -0.93 . * . 0.80 0.62 Cys 109
. . B . . T . 0.71 -0.93 . * . 1.00 0.67 Ser 110 . . B . . T . 0.67
-0.67 . * F 1.15 0.28 Glu 111 . . B . . T . 0.53 -0.67 * . F 1.15
0.68 Asp 112 A . . . . T . -0.10 -0.93 * * F 1.30 1.26 Leu 113 A A
. . . . . -0.07 -1.00 * * F 0.75 0.95 Glu 114 A A . . . . . 0.64
-0.74 * * F 0.75 0.41 Gly 115 A A . . . . . 0.13 -0.74 * * F 0.75
0.49 Ala 116 . A B . . . . -0.08 -0.06 * * . 0.30 0.49 Val 117 . A
B . . . . -0.67 -0.31 * * . 0.30 0.43 Lys 118 . A B . . . . -0.16
0.19 * * . -0.30 0.44 Leu 119 . A B . . . . -0.50 0.14 * * . -0.30
0.59 Pro 120 . . B . . T . -1.01 0.07 * * . 0.10 0.78 Ala 121 . . .
. T T . -0.38 0.07 * * F 0.65 0.29 Ser 122 . . . . T T . 0.17 0.07
* * F 0.65 0.70 Gly 123 . . . . T T . 0.09 -0.13 * * F 1.25 0.66
Val 124 . . B . . . . 0.23 -0.06 . . F 0.79 0.89 Lys 125 . . B . .
. . 0.23 0.01 . . F 0.33 0.35 Thr 126 . . B . . . . 0.61 0.06 . . F
0.47 0.55 His 127 . . B . . . . 0.24 0.06 * . . 0.61 1.15 Cys 128 .
. B . . T . 0.59 -0.01 . . . 1.40 0.31 Pro 129 . . B . . T . 1.23
0.39 * * F 0.81 0.34 Pro 130 . . . . T T . 0.84 0.33 . . F 1.07
0.39 Cys 131 . . . . T T . 0.46 0.26 . . F 0.93 0.72 Asn 132 . . .
. . T C -0.21 0.47 . . F 0.29 0.40 Pro 133 . . . . T T . 0.50 0.83
. . F 0.35 0.23 Gly 134 . . . . T T . 0.40 0.40 . . . 0.20 0.85 Phe
135 . . B . . T . 0.61 0.31 . . . 0.10 0.76 Phe 136 . . B . . . .
1.28 0.31 . . F 0.30 0.79 Lys 137 . . . . T . . 0.98 0.29 . . F
1.10 1.28 Thr 138 . . . . T . . 0.88 0.24 . . F 1.35 1.99 Asr 139 .
. . . T . . 0.56 -0.06 * . F 2.20 3.31 Asn 140 . . . . T T . 1.26
-0.27 * . F 2.50 0.89 Ser 141 . . . . T T . 1.74 0.13 * * F 1.80
1.06 Thr 142 . . . . T T . 1.03 0.07 . . F 1.55 1.02 Cys 143 . . .
. T T . 1.13 0.24 . . F 1.15 0.34 Gln 144 . . B . . . . 0.89 0.27 .
. F 0.30 0.39 Pro 145 . . B . . . . 0.54 0.64 . . F -0.25 0.43 Cys
146 . . B . . T . 0.54 0.59 . . . -0.20 0.79 Pro 147 . . B . . T .
0.61 0.40 . . . -0.20 0.61 Tyr 148 . . . . T T . 0.98 0.76 . . .
0.20 0.62 Gly 149 . . . . T T . 0.98 0.71 . . . 0.35 1.55 Ser 150 .
. . . T . . 0.84 0.54 . . F 0.30 1.61 Tyr 151 . . . . T T . 1.21
0.54 . . F 0.50 1.02 Ser 152 . . . . T T . 1.42 0.17 . . F 1.11
1.38 Asn 153 . . . . T T . 1.00 -0.26 . . F 2.02 1.71 Gly 154 . . .
. T T . 1.03 -0.07 * . F 2.18 0.59 Ser 155 . . . . T T . 1.44 -0.34
* . F 2.49 0.63 Asp 156 . . . . T T . 1.02 -0.73 * . F 3.10 0.77
Cys 157 . . B . . T . 1.11 -0.56 * * F 2.39 0.42 Thr 158 . . B . .
T . 0.52 -0.56 * * F 2.39 0.48 Arg 159 . . B . . . . 0.52 -0.44 * .
F 1.89 0.29 Cys 160 . . B . . T . 0.51 -0.01 . . . 1.94 0.54 Pro
161 . . . . T T . 0.51 -0.10 . . . 2.34 0.54 Ala 162 . . . . T T .
0.97 -0.59 . * F 3.10 0.47 Gly 163 . . . . . T C 0.69 -0.16 * * F
2.44 1.37 Thr 164 . . . . . . C -0.28 -0.23 . * F 1.78 0.89 Glu 165
. . B . . . . 0.04 -0.01 . . F 1.27 0.66 Pro 166 . . B . . . .
-0.44 -0.09 . * F 0.96 0.66 Ala 167 . . B . . . . 0.14 0.27 . * .
-0.10 0.39 Val 168 . . B . . . . 0.24 -0.21 . * . 0.50 0.39 Gly 169
. . B . . . . 0.60 0.54 . * . -0.40 0.40 Phe 170 . A B . . . . 0.31
0.11 . * . -0.30 0.79 Glu 171 . A B . . . . 0.23 0.53 . * . -0.45
1.12 Tyr 172 . A . . T . . 0.82 0.80 * * . -0.05 1.19 Lys 173 . A .
. T . . 1.37 0.77 * * . -0.05 2.21 Trp 174 . A . . T . . 0.90 0.47
* * . -0.05 1.84 Trp 175 . A . . T . . 1.39 1.16 * * . -0.20 0.97
Asn 176 . . . . . . C 1.08 0.83 * * . -0.20 0.75 Thr 177 . . . . .
. C 1.32 1.31 * . F 0.10 1.03 Leu 178 . . . . . . C 0.68 0.80 * * F
0.10 1.57 Pro 179 . . . . . T C 0.97 0.50 * . F 0.12 0.97 Thr 180 .
. . . . T C 0.94 0.10 * . F 0.54 1.16 Asn 181 . . . . . T C 0.63
0.10 * * F 0.51 2.03 Met 182 . . B . . T . 0.09 -0.10 . * F 0.88
1.90 Glu 183 . . B B . . . 0.09 0.11 . * F -0.30 0.98 Thr 184 . . B
B . . . -0.00 0.31 . . F -0.27 0.50 Thr 185 . . B B . . . -0.03
0.30 * . F -0.24 0.68 Val 186 . . B B . . . -0.92 0.11 * * F -0.21
0.39 Leu 187 . . B B . . . -0.32 0.80 * * F -0.48 0.19 Ser 188 . .
B B . . . -1.02 0.71 . * F -0.45 0.21 Gly 189 . . . B . . C -0.71
1.01 . * . -0.40 0.24 Ile 190 . A B B . . . -0.64 0.37 * * . -0.30
0.51 Asn 191 . A B B . . . 0.26 0.44 * * . -0.60 0.60 Phe 192 . A B
B . . . 0.72 0.06 * * . -0.15 1.21 Glu 193 . A B B . . . 0.42 0.06
* * . -0.15 1.71 Tyr 194 . . B . . T . 0.46 -0.01 * * . 0.85 1.05
Lys 195 . . . . T T . 1.00 0.07 * * F 0.80 1.76 Gly 196 . . . . T T
. 0.71 -0.29 * * F 1.40 1.00 Met 197 . . . . . T C 1.41 0.63 . * F
0.15 0.67 Thr 198 . . . . . . C 0.56 -0.13 . * F 0.85 0.58 Gly 199
. A . . . . C 0.21 0.51 . * . -0.40 0.44 Trp 200 . A B . . . .
-0.18 0.59 * * . -0.42 0.45 Glu 201 . A B . . . . 0.17 0.40 * . .
-0.24 0.31 Val 202 . A B . . . . 0.73 -0.09 * . . 0.84 0.52 Ala 203
. A B . . . . 0.16 -0.01 * . . 1.02 0.67 Gly 204 . . . . T . . 0.26
-0.24 * . . 1.80 0.27 Asp 205 . . . B T . . 0.23 0.51 * . . 0.52
0.57 His 206 . . B B . . . -0.36 0.36 * . . 0.24 0.82 Ile 207 . . B
B . . . -0.09 0.36 . . . 0.06 0.83 Tyr 208 . . B B . . . 0.16 0.43
* . . -0.42 0.50 Thr 209 . . B B . . . -0.09 0.86 . . . -0.60 0.37
Ala 210 . . B B . . . -0.39 0.86 . . . -0.60 0.53 Ala 211 . . B . .
. . -0.36 0.56 . . . -0.12 0.45 Gly 212 . . . . . . C 0.53 -0.20 .
. . 1.26 0.52 Ala 213 . . . . . . C 0.78 -0.29 . . F 1.69 0.83 Ser
214 . . . . . T C 0.39 -0.79 . . F 2.62 1.38 Asp 215 . . . . T T .
0.38 -0.50 . . F 2.80 1.21 Asn 216 . . . . . T C 0.08 -0.31 . . F
2.32 1.18 Asp 217 . . B . . T . -0.39 -0.13 . . F 1.69 0.62 Phe 218
. . B B . . . -0.11 0.17 . . . 0.26 0.30 Met 219 . . B B . . .
-0.62 0.66 . . . -0.32 0.27 Ile 220 . . B B . . . -1.48 0.94 . . .
-0.60 0.14 Leu 221 . . B B . . . -2.33 1.59 . . . -0.60 0.12 Thr
222 . . B B . . . -2.54 1.44 . . . -0.60 0.09 Leu 223 . . B B . . .
-2.19 1.26 . . . -0.60 0.19 Val 224 . . B B . . . -2.29 1.00 * * .
-0.60 0.23 Val 225 . . B B . . . -1.29 1.10 * * . -0.60 0.14 Pro
226 . . B . . . . -0.69 0.61 * * . -0.40 0.33 Gly 227 . . . . T . .
-0.59 0.36 * . F 0.45 0.68 Phe 228 . . B . . . . 0.22 0.14 * . F
0.45 1.42 Arg 229 . . . . . . C 0.78 -0.10 * * F 1.50 1.59 Pro 230
. . . . . T C 0.78 -0.14 * . F 1.95 2.16 Pro 231 . . . . T T . 0.39
0.07 * * F 1.80 1.85 Gln 232 . . . . T T . 0.14 -0.10 * * F 2.50
0.93 Ser 233 . . B . . T . 0.84 0.40 * * F 0.95 0.61 Val 234 . . B
. . . . 0.42 -0.03 * * . 1.55 0.66 Met 235 . . B . . . . 0.63 0.03
. . . 1.00 0.55 Ala 236 . . B . . . . 0.84 -0.37 . * . 1.65 0.71
Asp 237 . . B . . T . 0.89 -0.36 . . F 2.20 1.54 Thr 238 . . . . .
T C 1.19 -1.00 . . F 3.00 3.11 Glu 239 A . . . . T . 1.19 -1.61 . .
F 2.50 5.33 Asn 240 A . . . . T . 1.20 -1.47 * * F 2.20 2.37 Lys
241 A . . . . . . 1.90 -0.97 * * F 1.70 1.66 Glu 242 A . . . . . .
1.01 -1.46 * * F 1.40 1.88 Val 243 A . . B . . . 1.01 -0.77 * * .
0.60 0.82 Ala 244 . . B B . . . 0.31 -0.69 * * . 0.60 0.59 Arg 245
. . B B . . . -0.54 0.10 * * . -0.30 0.29 Ile 246 . . B B . . .
-1.29 0.74 * * . -0.60 0.29 Thr 247 . . B B . . . -1.29 0.89 * * .
-0.60 0.25 Phe 248 . . B B . . . -0.74 0.39 * * . -0.30 0.22 Val
249 . . B B . . . -0.97 0.87 * * . -0.60 0.46 Phe 250 . . B B . . .
-1.74 0.87 * * . -0.60 0.26 Glu 251 . . B B . . . -1.16 0.96 * * .
-0.60 0.16 Thr 252 . . . B T . . -1.70 0.56 * * . -0.20 0.29 Leu
253 . . . B T . . -1.00 0.56 * * . -0.20 0.25 Cys 254 . . . B T . .
-0.81 0.17 * * . 0.10 0.23 Ser 255 . . . . T T . -0.11 0.74 * * .
0.20 0.09 Val 256 . . . . T T . -0.92 0.26 * * . 0.50 0.18 Asn 257
. . B . T T . -0.86 0.26 . * . 0.50 0.28 Cys 258 . . B . . T .
-0.74 0.44 . * . -0.20 0.33 Glu 259 . . B B . . . -0.68 0.84 . * .
-0.60 0.38 Leu 260 . . B B . . . -1.23 0.81 . * . -0.60 0.24 Tyr
261 . . B B . . . -0.72 1.06 . * . -0.60 0.33 Phe 262 . . B B . . .
-1.58 0.91 . * . -0.60 0.19 Met 263 . . B B . . . -0.91 1.56 . * .
-0.60 0.17 Val 264 . . B B . . . -1.21 1.27 . * . -0.60 0.17 Gly
265 . . B B . . . -0.29 0.90 . * . -0.32 0.27 Val 266 . . B B . . .
-0.36 0.11 . * . 0.26 0.53 Asn 267 . . . . . T C 0.34 -0.01 . * F
2.04 1.03 Ser 268 . . . . . T C 0.63 -0.26 . * F 2.32 1.67 Arg 269
. . . . T T . 1.28 -0.20 . * F 2.80 3.24 Thr 270 . . . . T T . 0.77
-0.41 . * F 2.52 3.12 Asn 271 . . . . . . C 1.62 -0.17 * * F 1.84
1.73 Thr 272 . . . . . . C 1.31 -0.56 * * F 1.86 1.53 Pro 273 . . B
. . . . 1.32 -0.07 * * F 1.08 1.53 Val 274 . . B . . . . 1.26 0.36
. * F 0.05 1.00 Glu 275 . . B . . . . 1.22 -0.04 * . F 0.80 1.38
Thr 276 . . B . . . . 0.92 -0.10 * . F 0.99 0.88 Trp 277 . . B . .
. . 1.28 -0.14 . . F 1.48 1.60 Lys 278 . . . . T . . 1.14 -0.79 . .
F 2.52 1.85 Gly 279 . . . . T . . 2.04 -0.36 . . F 2.56 1.27 Ser
280 . . . . T T . 2.04 -0.84 . . F 3.40 2.41 Lys 281 . . . . . T C
2.06 -1.36 . . F 2.86 2.08 Gly 282 . . . . T T . 2.10 -0.97 . . F
2.72 2.82 Lys 283 . . . . T T . 1.74 -0.64 . . F 2.38 3.30 Gln 284
. . . B T . . 1.84 -0.54 * . F 1.64 2.38 Ser 285 . . B B . . . 1.26
0.21 * * F 0.00 3.77 Tyr 286 . . B B . . . 0.32 0.47 * * . -0.45
1.32 Thr 287 . . B B . . . 0.67 1.16 * . . -0.60 0.53 Tyr 288 . . B
B . . . 0.62 0.76 . . . -0.60 0.69 Ile 289 . . B B . . . 0.62 0.37
* . . -0.30 0.76 Ile 290 . . B B . . . 0.61 0.01 . . . -0.04 0.85
Glu 291 . . B B . . . 0.54 0.01 . . F 0.37 0.78 Glu 292 . . B . . .
. 0.54 -0.26 . . F 1.58 1.61 Asn 293 . . . B T . . 0.49 -0.46 . . F
2.04 3.32 Thr 294 . . . B T . . 0.68 -0.76 . . F 2.60 2.57 Thr 295
. . . B . . C 1.26 0.03 . * F 1.24 1.29 Thr 296 . . . B . . C 0.97
0.51 . . F 0.68 1.15 Ser 297 . . . B . . C 0.38 1.03 * * F 0.27
0.84 Phe 298 . . B B . . . -0.32 1.04 * * . -0.34 0.59 Thr 299 . .
B B . . . -0.01 1.34 * . . -0.60 0.35 Trp 300 . . B B . . . 0.41
1.26 * . . -0.60 0.46 Ala 301 . . . B . . C 0.41 0.87 * . . -0.25
1.03 Phe 302 . . . B T . . 0.40 0.57 * * . -0.05 1.03 Gln 303 . . .
B T . . 0.40 0.57 * * . -0.05 1.42 Arg 304 . . . B . . C 0.68 0.44
. . F -0.10 1.21 Thr 305 . . . B . . C 0.97 0.44 . . F -0.10 1.91
Thr 306 . . . B . . C 0.97 -0.34 * . F 0.80 1.91 Phe 307 . . . B .
. C 1.37 -0.24 * * . 0.50 0.98 His 308 . . . B . . C 1.48 0.14 * *
. -0.10 0.91 Glu 309 . . . B . . C 1.41 -0.34 * * . 0.65 1.24 Ala
310 . . . . T . C 1.48 -0.83 * . F 1.84 2.86 Ser 311 . . . . T . .
1.48 -0.86 * . F 2.18 3.30 Arg 312 . . . . T . . 2.18 -0.87 * . F
2.52 2.75 Lys 313 . . . . T . . 2.21 -0.47 * . F 2.56 4.38 Tyr 314
. . . . T T . 1.36 -0.97 * . F 3.40 5.45 Thr 315 . . . . T T . 1.36
-0.71 * . F 3.06 2.07 Asn 316 . . B . . T . 1.70 -0.21 * . F 2.02
1.04 Asp 317 . . B . . T . 0.70 -0.21 * . F 1.68 1.33 Val 318 . . B
B . . . 0.41 -0.29 * . F 0.79 0.65 Ala 319 . . B B . . . 0.36 -0.01
* . . 0.30 0.63 Lys 320 . . B B . . . -0.22 -0.03 * . . 0.30 0.51
Ile 321 . . B B . . . -0.22 0.66 * . . -0.60 0.48 Tyr 322 . . B B .
. . -1.08 0.41 . . . -0.60 0.76 Ser 323 . . B B . . . -0.53 0.56 .
. . -0.60 0.28 Ile 324 . . B B . . . 0.06 1.04 . . . -0.60 0.58 Asn
325 . . B B . . . -0.84 0.76 . . . -0.60 0.60 Val 326 . . B B . . .
-0.56 0.64 . . . -0.60 0.33 Thr 327 . . B B . . . -0.31 0.87 . * .
-0.60 0.47 Asn 328 . . B
B . . . -0.36 0.59 * * . -0.60 0.47 Val 329 . . B . . T . -0.32
0.61 * * . -0.20 0.62 Met 330 . . B . . T . -0.91 0.61 * . . -0.20
0.32 Asn 331 . . B . . T . -0.36 0.63 * . . -0.20 0.20 Gly 332 . .
B . . T . -0.29 0.61 * . . -0.20 0.36 Val 333 . . B . . . . -0.96
0.73 * . . -0.40 0.57 Ala 334 . . B . . T . 0.01 0.69 * . . -0.20
0.19 Ser 335 . . B . . T . 0.40 0.29 * . . 0.10 0.38 Tyr 336 . . B
. . T . -0.27 0.29 * * . 0.10 0.79 Cys 337 . . B . . T . -0.51 0.21
* . . 0.10 0.42 Arg 338 . . B . . T . -0.47 0.21 . . . 0.10 0.32
Pro 339 . . B . . T . 0.12 0.51 . . . -0.20 0.17 Cys 340 . . B . .
T . -0.17 -0.24 . . . 0.70 0.54 Ala 341 . . B . . T . -0.22 -0.31 *
. . 0.70 0.28 Leu 342 . . B . . . . 0.44 0.07 * . . -0.10 0.24 Glu
343 . . B . . . . -0.52 -0.36 * . . 0.75 0.75 Ala 344 . . B . . . .
-0.66 -0.29 . . F 1.15 0.55 Ser 345 . . B . . . . -0.29 -0.36 . . F
1.40 0.66 Asp 346 . . . . T T . 0.00 -0.66 . . F 2.55 0.51 Val 347
. . . . T T . 0.14 -0.27 . . F 2.50 0.68 Gly 348 . . . . T T .
-0.17 -0.20 * . F 2.25 0.27 Ser 349 . . . . T T . 0.12 -0.10 * . F
2.00 0.23 Ser 350 . . . . T . . -0.24 0.29 * . F 0.95 0.42 Cys 351
. . B . . T . -0.46 0.21 . . F 0.50 0.23 Thr 352 . . B . . T .
-0.19 0.21 . . F 0.25 0.26 Ser 353 . . B . . T . -0.19 0.33 . . F
0.25 0.20 Cys 354 . . B . . T . -0.13 0.37 . . . 0.10 0.37 Pro 355
. . B . . T . -0.08 0.56 . . . -0.20 0.40 Ala 356 . . . . T T .
-0.30 0.83 . . . 0.20 0.47 Gly 357 . . B . . T . 0.01 1.13 * . .
-0.20 0.61 Tyr 358 . . B . . T . 0.42 0.56 * . . -0.20 0.66 Tyr 359
. . B B . . . 1.09 0.13 * . . 0.19 1.28 Ile 360 . . B B . . . 1.00
-0.37 * . . 1.13 2.16 Asp 361 . . B B . . . 1.24 -0.41 * . . 1.47
1.84 Arg 362 . . . . T . . 1.28 -0.74 * . F 2.86 1.16 Asp 363 . . .
. T T . 0.86 -1.01 * . F 3.40 2.40 Ser 364 . . . . T T . 1.07 -1.13
* . F 2.91 0.77 Gly 365 . . . . T T . 1.66 -0.63 * . F 2.57 0.53
Thr 366 . . . . T T . 0.99 -0.24 . . F 1.93 0.43 Cys 367 . . . . T
T . 0.67 0.33 . * . 0.84 0.17 His 368 . . . . T T . 0.46 0.37 . . .
0.50 0.27 Ser 369 . . . . T T . 0.76 0.37 . . . 0.50 0.29 Cys 370 .
. B . . T . 0.79 0.29 . . . 0.10 0.86 Pro 371 . . . . . T C 0.21
0.20 . . F 0.45 0.91 Pro 372 . . . . T T . 0.07 0.39 * . F 0.65
0.48 Asn 373 . . . . T T . 0.14 0.69 * * F 0.35 0.74 Thr 374 . . B
. . T . -0.14 0.11 * * F 0.25 0.95 Ile 375 . A B . . . . 0.49 0.19
* . . -0.30 0.62 Leu 376 . A B . . . . 0.70 0.26 * . . -0.30 0.53
Lys 377 . A B . . . . 0.70 0.26 * . . -0.30 0.63 Ala 378 . A B . .
. . 0.46 0.20 * . . -0.15 1.39 His 379 . A B . . . . 0.42 0.27 . .
. -0.15 2.64 Gln 380 . . B . . T . 0.46 0.01 * * F 0.40 1.31 Pro
381 . . . . T T . 1.27 0.66 . * . 0.20 0.96 Tyr 382 . . . . T T .
0.63 0.56 . * . 0.35 1.22 Gly 383 . . . . T T . 0.56 0.56 . * .
0.20 0.71 Val 384 . . B B . . . -0.27 0.73 . * . -0.60 0.25 Gln 385
. . B B . . . -0.48 0.94 . * . -0.60 0.12 Ala 386 . . B B . . .
-0.93 0.61 . * . -0.60 0.18 Cys 387 . . B B . . . -1.03 0.76 . * .
-0.60 0.13 Val 388 . . B B . . . -0.90 0.54 . * . -0.60 0.08 Pro
389 . . B . . . . -0.39 0.57 . * . -0.40 0.12 Cys 390 . . B . . . .
-0.70 0.50 . . . -0.40 0.21 Gly 391 . . B . . T . -0.07 0.41 . . F
0.29 0.42 Pro 392 . . . . T T . 0.60 -0.23 . . F 1.93 0.54 Gly 393
. . . . T T . 1.46 -0.26 . . F 2.42 1.61 Thr 394 . . . . T T . 1.71
-0.43 . . F 2.76 2.62 Lys 395 . . . . T T . 1.49 -0.86 . . F 3.40
3.39 Asn 396 . . . . T T . 1.80 -0.60 . . F 3.06 2.40 Asn 397 . . B
. . T . 1.71 -0.53 . . F 2.32 2.26 Lys 398 . . B . . T . 1.24 -0.63
. . F 1.98 1.52 Ile 399 . . B . . . . 0.89 0.06 . . . 0.24 0.78 His
400 . . B . . T . 0.60 0.23 . . . 0.10 0.26 Ser 401 . . B . . T .
0.60 0.59 . . . -0.20 0.20 Leu 402 . . B . . T . 0.60 0.99 * . .
-0.20 0.47 Cys 403 . . B . . T . -0.11 0.30 * . . 0.10 0.57 Tyr 404
. . . . T . . 0.47 0.37 . . . 0.30 0.23 Asn 405 . . . . T T . -0.20
0.47 . . . 0.20 0.40 Asp 406 . . . . T T . -0.20 0.57 * . . 0.20
0.65 Cys 407 . . B . . T . 0.72 0.39 * . . 0.10 0.55 Thr 408 . . B
. . T . 1.39 -0.37 . . . 0.70 0.67 Phe 409 . . B . . . . 1.32 -0.37
. . . 0.80 0.65 Ser 410 . . . . T T . 1.11 0.11 . . F 1.40 1.75 Arg
411 . . . . T T . 0.80 -0.03 . . F 2.30 1.87 Asn 412 . . . . . T C
1.58 -0.03 . . F 2.40 3.12 Thr 413 . . . . . T C 1.58 -0.81 . . F
3.00 4.55 Pro 414 . . . . . T C 1.58 -0.71 * . F 2.70 3.36 Thr 415
. . . . T T . 1.88 0.07 * . F 1.70 1.81 Arg 416 . . B . . T . 1.52
0.07 * . F 1.00 2.01 Thr 417 . . B . . T . 1.52 0.34 * * F 0.70
2.04 Phe 418 . . B . . . . 1.13 0.31 * * . 0.05 2.27 Asn 419 . . B
. . T . 1.04 0.61 * * . -0.05 1.01 Tyr 420 . . B . . T . 0.77 1.00
* . . -0.20 0.93 Asn 421 . . B . . T . -0.16 1.01 * * . -0.05 1.09
Phe 422 . . B . . T . -0.43 0.91 * * . -0.20 0.56 Ser 423 . A . . .
. C 0.27 1.01 * * . -0.40 0.36 Ala 424 . A . . . . C -0.04 0.66 * *
. -0.40 0.36 Leu 425 . A B . . . . -0.66 0.74 * * . -0.60 0.60 Ala
426 . A B . . . . -0.97 0.60 . * . -0.60 0.33 Asn 427 . A B . . . .
-1.08 0.70 * . . -0.60 0.47 Thr 428 . . B B . . . -1.37 0.89 * . .
-0.60 0.47 Val 429 . . B B . . . -1.12 0.70 . . . -0.60 0.47 Thr
430 . . B B . . . -0.66 0.63 . . . -0.60 0.29 Leu 431 . . B B . . .
-0.28 0.66 . . . -0.60 0.20 Ala 432 . . B B . . . -0.58 0.60 . . .
-0.60 0.42 Gly 433 . . . B . . C -0.97 0.34 . * F 0.05 0.39 Gly 434
. . . . . T C -0.42 0.64 . . F 0.15 0.41 Pro 435 . . . . . T C
-0.41 0.44 . * F 0.15 0.58 Ser 436 . . . . . T C 0.44 0.33 . * F
0.73 0.79 Phe 437 . . B . . T . 0.69 -0.10 . . F 1.56 1.59 Thr 438
. . B . . . . 0.22 -0.10 * . F 1.64 1.02 Ser 439 . . B . . T . 0.61
0.16 * . F 1.37 0.63 Lys 440 . . . . T T . 0.58 -0.23 * . F 2.80
1.45 Gly 441 . . . . T T . 0.18 -0.26 * . F 2.52 1.57 Leu 442 . . .
. . T C 0.84 0.04 * . F 1.44 1.02 Lys 443 . A B . . . . 1.12 0.16 *
. . 0.26 0.69 Tyr 444 . A B . . . . 0.72 0.66 * . . -0.32 0.95 Phe
445 . A B . . . . 0.37 1.01 * * . -0.60 1.00 His 446 . A B . . . .
-0.10 0.81 * * . -0.60 0.72 His 447 . A B . . . . 0.41 1.50 * * .
-0.60 0.38 Phe 448 . A B . . . . -0.44 1.13 * * . -0.60 0.59 Thr
449 . A B . . . . -0.87 1.03 . * . -0.60 0.36 Leu 450 . A . . T . .
-0.51 1.10 . * . -0.20 0.14 Ser 451 . . . B T . . -0.48 1.03 . * .
-0.20 0.16 Leu 452 . . . B T . . -0.44 0.64 . * . 0.14 0.18 Cys 453
. . . B T . . -0.09 0.56 . * . 0.48 0.37 Gly 454 . . . B T . . 0.33
0.30 * . F 1.27 0.28 Asn 455 . . . . T T . 1.19 -0.09 * . F 2.61
0.66 Gln 456 . . . . T T . 0.89 -0.77 * . F 3.40 2.45 Gly 457 . . .
. T T . 1.40 -0.73 * . F 3.06 2.45 Arg 458 . . . . T T . 1.21 -0.77
* . F 2.72 2.04 Lys 459 . . B B . . . 0.89 -0.53 * . F 1.43 0.87
Met 460 . . B B . . . 0.58 -0.36 * . . 0.64 0.47 Ser 461 . . B B .
. . 0.58 -0.30 * . . 0.30 0.35 Val 462 . . B B . . . 0.92 -0.30 * .
. 0.30 0.29 Cys 463 . . B . . T . -0.04 0.10 * . . 0.10 0.47 Thr
464 . . B . . T . -0.40 0.13 * * . 0.10 0.26 Asp 465 . . B . . T .
0.20 0.23 * . F 0.25 0.51 Asn 466 . . B . . T . -0.31 -0.41 * * F
1.00 1.59 Val 467 . . B B . . . 0.66 -0.30 . * F 0.45 0.91 Thr 468
. . B B . . . 0.43 -0.79 . * F 0.90 1.07 Asp 469 . . B B . . . 0.53
-0.10 . * F 0.45 0.46 Leu 470 . . B B . . . 0.53 -0.07 . * F 0.76
0.97 Arg 471 . . B B . . . 0.19 -0.71 . * F 1.52 1.16 Ile 472 . . B
. . T . 1.04 -0.77 . * F 2.08 0.69 Pro 473 . . B . . T . 1.06 -0.77
. * F 2.54 1.44 Glu 474 . . . . T T . 0.71 -1.07 . * F 3.10 0.99
Gly 475 . . . . . T C 0.82 -0.64 . * F 2.74 1.40 Glu 476 . . . . T
T . 0.41 -0.54 * . F 2.48 0.78 Ser 477 . . . . . T C 1.34 -0.59 * .
F 2.10 0.60 Gly 478 . . . . T T . 1.26 -0.59 * . F 2.27 1.22 Phe
479 . . . . T T . 0.37 -0.63 * . F 1.94 0.95 Ser 480 . . . . . T C
0.40 0.06 * . F 0.97 0.49 Lys 481 . . . . T T . -0.19 0.16 * . F
1.30 0.72 Ser 482 . . . . T T . -0.13 0.23 * . F 1.17 0.84 Ile 483
. . B . . T . -0.64 0.20 * . . 0.49 0.98 Thr 484 . . B B . . .
-0.61 0.46 * . . -0.34 0.37 Ala 485 . . B B . . . -0.31 1.03 * . .
-0.47 0.15 Tyr 486 . . B B . . . -0.94 1.04 * . . -0.60 0.36 Val
487 . . B B . . . -1.50 0.86 . . . -0.60 0.25 Cys 488 . . B B . . .
-1.50 1.01 . . . -0.60 0.19 Gln 489 . . B B . . . -2.08 1.20 . . .
-0.60 0.08 Ala 490 . . B B . . . -1.70 1.13 . . . -0.60 0.08 Val
491 . . B B . . . -1.67 0.91 . . . -0.60 0.23 Ile 492 . . B B . . .
-0.81 0.77 . . . -0.60 0.20 Ile 493 . . B B . . . -1.00 0.37 . . .
-0.30 0.35 Pro 494 . . B . . T . -1.31 0.51 . * . -0.20 0.35 Pro
495 . . B . . T . -1.07 0.36 . * F 0.42 0.71 Glu 496 . . B . . T .
-0.46 0.10 . . F 0.74 1.01 Val 497 . . B . . T . 0.48 0.17 . . F
0.91 1.02 Thr 498 . . B . . T . 0.78 -0.26 . * F 1.68 1.32 Gly 499
. . B . . T . 0.64 -0.19 . . F 1.70 0.77 Tyr 500 . . B . . T . 0.00
0.24 . . F 1.08 1.03 Lys 501 . . B . . T . -0.30 0.24 . . F 0.76
0.53 Ala 502 . . B . . . . 0.26 0.14 . * F 0.39 0.71 Gly 503 . . B
. . . . 0.57 0.10 . * F 0.22 0.61 Val 504 . . B . . . . 0.70 -0.26
. * F 0.65 0.53 Ser 505 . . B . . . . 0.09 0.17 . * F 0.05 0.81 Ser
506 . . B . . . . -0.26 0.31 . * F 0.05 0.61 Gln 507 . . B . . . .
-0.48 0.27 . . F 0.20 1.10 Pro 508 . . B . . . . -0.72 0.31 . . F
0.05 0.67 Val 509 . A B . . . . 0.13 0.43 * * F -0.45 0.51 Ser 510
. A B . . . . 0.54 0.04 * * . -0.30 0.49 Leu 511 . A B . . . . 0.03
-0.36 * . . 0.30 0.62 Ala 512 . A B . . . . -0.86 -0.10 * * . 0.30
0.69 Asp 513 . A B B . . . -0.99 -0.06 * * . 0.30 0.36 Arg 514 . A
B B . . . -0.99 -0.01 * * . 0.30 0.43 Leu 515 . . B B . . . -1.00
-0.06 * . . 0.30 0.32 Ile 516 . . B B . . . -0.50 -0.07 * . . 0.30
0.28 Gly 517 . . B B . . . 0.09 0.41 * . . -0.60 0.20 Val 518 . . B
B . . . -0.51 0.41 * . . -0.60 0.41 Thr 519 . . B B . . . -0.93
0.34 * * F -0.15 0.58 Thr 520 . . B B . . . -0.93 0.14 . * F -0.15
0.85 Asp 521 . . B B . . . -0.04 0.40 . * F -0.45 0.94 Met 522 . .
B B . . . -0.04 -0.24 . * F 0.60 1.09 Thr 523 . . B B . . . -0.08
-0.30 . * . 0.30 0.75 Leu 524 . . B B . . . -0.08 -0.10 * * F 0.45
0.31 Asp 525 . . . B T . . -0.07 0.39 * * F 0.25 0.46 Gly 526 . . .
B T . . -0.28 0.16 * * F 0.34 0.42 Ile 527 . . . B . . C -0.27 0.10
* . F 0.23 0.79 Thr 528 . . . B . . C 0.04 -0.09 * * F 0.92 0.48
Ser 529 . . . . . T C 0.04 -0.09 * . F 1.41 0.84 Pro 530 . . . . .
T C -0.66 0.17 * . F 0.90 0.99 Ala 531 . . B . . T . -0.34 0.27 * .
F 0.61 0.59 Glu 532 . . B . . T . -0.27 0.29 . * . 0.37 0.60 Leu
533 . A B . . . . 0.04 0.59 . . . -0.42 0.32 Phe 534 . A B . . . .
0.04 0.16 . . . -0.21 0.55 His 535 . A B . . . . -0.56 0.04 . . .
-0.30 0.43 Leu 536 . A B . . . . -0.31 0.73 . . . -0.60 0.43 Glu
537 . A B . . . . -1.20 0.47 . . . -0.60 0.49 Ser 538 . . . . T . .
-0.60 0.37 . . . 0.30 0.25 Leu 539 . . . . T . . 0.10 0.30 . . .
0.30 0.47 Gly 540 . . . . . . C -0.72 -0.39 . . . 0.70 0.45 Ile 541
. . . B . . C -0.80 0.26 . . F 0.05 0.25 Pro 542 . . B B . . .
-1.50 0.56 . . F -0.45 0.21 Asp 543 . . B B . . . -1.90 0.66 . . .
-0.60 0.19 Val 544 . . B B . . . -1.33 1.01 * * . -0.60 0.23 Ile
545 . . B B . . . -0.88 1.09 * . . -0.60 0.23 Phe 546 . . B B . . .
-0.29 0.66 * * . -0.60 0.27 Phe 547 . . B B . . . -0.08 1.04 . * .
-0.60 0.50 Tyr 548 . . B . . . . -0.08 0.80 . * . 0.09 1.14 Arg 549
. . . . T T . -0.08 0.11 . . F 1.48 2.19 Ser 550 . . . . T T . 0.50
-0.03 . . F 2.42 1.88 Asn 551 . . . . T T . 1.20 -0.33 * . F 2.76
1.73 Asp 552 . . . . T T . 1.60 -0.69 * . F 3.40 1.53 Val 553 . . .
. T . . 1.18 -0.30 . . F 2.56 1.53 Thr 554 . . B . . . . 0.77 -0.11
* . F 1.67 0.51 Gln 555 . . B . . . . 0.77 -0.13 * . F 1.33 0.41
Ser 556 . . B . . . . 0.42 0.26 * * F 0.67 0.74 Cys 557 . . B . . T
. 0.53 0.04 * * F 0.81 0.51 Ser 558 . . . . T T . 1.09 -0.44 * * F
2.09 0.57 Ser 559 . . . . T T . 1.09 -0.46 . * F 2.37 0.57 Gly 560
. . . . T T . 0.78 -0.36 . . F 2.80 1.54 Arg 561 . . . B T . . 0.19
-0.44 . * F 2.12 1.66 Ser 562 . . . B T . . 0.97 -0.14 * * F 1.69
0.87 Thr 563 . . B B . . . 0.41 -0.53 * * F 1.46 1.72 Thr 564 . . B
B . . . 0.82 -0.31 . * F 0.73 0.65 Ile 565 . . B B . . . 0.50 -0.31
. * F 0.45 0.95 Arg 566 . . B B . . . 0.09 -0.13 . * . 0.30 0.35
Val 567 . . B B . . . 0.18 -0.23 . * . 0.64 0.33 Arg 568 . . B B .
. . 0.49 -0.29 . * . 0.98 0.73 Cys 569 . . B B . . . 0.84 -0.57 . *
. 1.62 0.64 Ser 570 . . . . . T C 1.42 -0.57 * * F 2.86 1.73 Pro
571 . . . . T T . 0.46 -0.73 * * F 3.40 1.27 Gln 572 . . . . T T .
1.10 -0.09 * * F 2.76 1.76 Lys 573 . . B . . T . 0.64 -0.23 . * F
2.02 2.03 Thr 574 . . B . . . . 1.01 -0.19 . . F 1.48 1.30 Val 575
. . B . . T . 0.50 -0.23 . . F 1.34 1.01 Pro 576 . . B . . T .
-0.10 0.06 . . F 0.25 0.42 Gly 577 . . B . . T . -0.91 0.74 . . F
-0.05 0.24 Ser 578 . . B . . T . -1.17 0.94 . . F -0.05 0.26 Leu
579 . . B . . . . -1.20 0.73 . * F -0.25 0.26 Leu 580 . . B . . . .
-0.66 0.73 . * F -0.40 0.26 Leu 581 . . B . . T . -1.11 0.79 . . F
-0.05 0.28 Pro 582 . . B . . T . -1.07 0.97 . . F -0.05 0.18 Gly
583 . . . . T T . -0.77 0.67 . . F 0.35 0.30 Thr 584 . . B . . T .
-0.30 -0.01 . . F 1.16 0.61 Cys 585 . . . . T T . 0.20 -0.27 . . F
1.87 0.39 Ser 586 . . . . T T . 0.34 -0.21 . . F 2.18 0.57 Asp 587
. . . . T T . 0.56 -0.07 . . F 2.49 0.21 Gly 588 . . . . T T . 0.56
-0.56 . . F 3.10 0.66 Thr 589 . . . . T . . 0.20 -0.70 * . F 2.59
0.48 Cys 590 . . . . T T . 0.87 -0.51 * . F 2.48 0.16 Asp 591 . . .
. T T . 0.47 -0.11 . . F 1.87 0.25 Gly 592 . . . . T T . 0.43 0.24
. * F 0.96 0.15 Cys 593 . . . . T T . 0.08 0.26 . . . 0.50 0.38 Asn
594 . A B . . . . -0.42 0.47 . . . -0.60 0.20 Phe 595 . A B . . . .
-0.04 1.16 . * . -0.60 0.17 His 596 . A B . . . . -0.04 1.64 . * .
-0.60 0.33 Phe 597 . A B . . . . 0.00 1.07 * * . -0.60 0.35 Leu 598
. A . . T . . 0.08 1.06 . * . -0.20 0.54 Trp 599 . A . . T . .
-0.51 0.77 . * . -0.20 0.40 Glu 600 . A . . T . . -0.40 0.77 . * .
-0.20 0.47 Ser 601 . A . . T . . -1.03 0.49 . . . -0.20 0.58 Ala
602 . A . . T . . -0.54 0.37 . . . 0.10 0.29 Ala 603 . A . . T . .
-0.54 -0.11 . . . 0.70 0.26 Ala 604 . A . . T . . -0.92 0.57 . . .
-0.20 0.16 Cys 605 . . . . . T C -1.22 0.76 . . . 0.00 0.09 Pro 606
. . B . . T . -1.78 0.64 . . . -0.20 0.11 Leu 607 . . B . . T .
-1.78 0.79 * . . -0.20 0.08 Cys 608 . . B . . T . -1.19 0.79 * . .
-0.20 0.16 Ser 609 . . B B . . . -0.84 0.21 . . . -0.30 0.17 Val
610 . . B B . . . -0.21 0.54 . . . -0.60 0.32 Ala 611 . . B B . . .
-0.59 0.36 . . . -0.30 0.82 Asp 612 . . B . . . . -0.67 0.29 . . .
-0.10 0.62 Tyr 613 . . B B . . . -0.86 0.59 . . . -0.60 0.58 His
614 . . B B . . . -0.86 0.59 . . . -0.60 0.43 Ala 615 . . B B . . .
-0.30 0.47 . . . -0.60 0.34 Ile 616 . . B B . . . -0.38 0.86 . * .
-0.60 0.29 Val 617 . . B B . . . -1.23 0.67 . . . -0.60 0.12 Ser
618 . . B B . . . -1.58 0.81 . . . -0.60 0.09 Ser 619 . . B B . . .
-1.89 0.81 . . . -0.60 0.12 Cys 620 . . B B . . . -2.19 0.56 * . .
-0.60 0.16 Val 621 . . B B . . . -1.30 0.60 * . . -0.60 0.09 Ala
622 . . B B . . . -0.40 0.61 * . . -0.60 0.11 Gly 623 . . B B . . .
-0.41 0.23 * . . -0.30 0.41 Ile 624 . . B B . . . -0.42 0.14 * . .
-0.30 0.80 Gln 625 . . B B . . . 0.00 -0.01 . . F 0.60 1.15 Lys 626
. . B B . . . 0.00 0.24 * . F 0.00 1.82 Thr 627 . . B B . . . 0.30
0.46 * * F -0.30 1.92 Thr 628 . . B B . . . 0.76 0.69 * . F -0.30
1.17 Tyr 629 . . B B . . . 1.64 0.29 * . . -0.15 1.14 Val 630 . A B
B . . . 1.43 0.29 * . . -0.15 1.37 Trp 631 . A B B . . . 1.43 0.23
* * . -0.15 1.47 Arg 632 . A B B . . . 0.93 -0.26 * . F 0.60 1.88
Glu 633 . A B B . . . 0.58 -0.33 * . F 0.85 2.09 Pro 634 . A . . T
. . 0.52 -0.40 * . F 1.50 1.06 Lys 635 . A . . T . . 1.03 -0.93 * .
F 1.90 0.73 Leu 636 . A . . T . . 0.98 -0.50 * . F 1.85 0.42 Cys
637 . . . . T T . -0.02 -0.07 * . F 2.50 0.27 Ser 638 . . . . T T .
-0.32 0.19 . * F 1.65 0.09 Gly 639 . . . . T T . -0.92 0.57 * * F
1.10 0.15 Gly 640 . . . . T T . -1.18 0.57 * . F 0.85 0.23 Ile 641
. . . . . . C -0.37 0.43 * . F 0.20 0.27 Ser 642 . . . . . . C 0.30
0.04 . * F 0.25 0.47 Leu 643 . . B . . . . 0.71 0.01 . * F 0.05
0.82 Pro 644 . . B . . . . 0.20 -0.41 . * F 0.80 2.30 Glu 645 . . B
B . . . 0.23 -0.46 . * F 0.60 1.27 Gln 646 . . B B . . . 0.23 -0.36
. * F 0.60 2.23 Arg 647 . . B B . . . -0.13 -0.36 . * F 0.60 1.01
Val 648 . . B B . . . 0.72 -0.21 . * . 0.30 0.31 Thr 649 . . B B .
. . 0.62 -0.21 . * . 0.30 0.36 Ile 650 . . B B . . . -0.27 -0.13 .
* . 0.30 0.27 Cys 651 . . B B . . . -0.27 0.56 . * . -0.60 0.25 Lys
652 . . B B . . . -1.08 -0.09 * * . 0.30 0.29 Thr 653 . . B B . . .
-0.51 0.21 * * . -0.30 0.36 Ile 654 . . B B . . . -1.01 0.44 *
*
. -0.60 0.71 Asp 655 . . B B . . . -0.08 0.56 * * . -0.60 0.29 Phe
656 . . B B . . . -0.27 0.56 * * . -0.60 0.40 Trp 657 . . B B . . .
-0.66 0.71 * * . -0.60 0.43 Leu 658 . . B B . . . -1.23 0.46 * * .
-0.60 0.25 Lys 659 . . B B . . . -0.64 1.14 * * . -0.60 0.20 Val
660 . . . B T . . -1.23 0.74 * * . -0.20 0.26 Gly 661 . . . B T . .
-0.88 0.33 * * . 0.10 0.32 Ile 662 . . . B T . . -0.90 0.07 * * .
0.10 0.16 Ser 663 . . . . . T C -0.76 0.56 * * . 0.00 0.31 Ala 664
. . . . T T . -1.11 0.49 . * F 0.35 0.17 Gly 665 . . . . T T .
-0.84 0.54 . . F 0.35 0.34 Thr 666 . . B . . T . -1.39 0.36 . . F
0.25 0.26 Cys 667 . . B B . . . -1.31 0.66 . . . -0.60 0.18 Thr 668
. . B B . . . -1.82 0.84 . . . -0.60 0.15 Ala 669 . . B B . . .
-1.54 1.10 . . . -0.60 0.09 Ile 670 . . B B . . . -2.06 1.10 . . .
-0.60 0.23 Leu 671 . . B B . . . -2.56 1.17 . . . -0.60 0.12 Leu
672 . . B B . . . -2.20 1.37 . . . -0.60 0.10 Thr 673 . . B B . . .
-2.56 1.36 . . . -0.60 0.20 Val 674 . . B B . . . -2.21 1.24 . . .
-0.60 0.13 Leu 675 . . B B . . . -2.02 1.31 . . . -0.60 0.25 Thr
676 . . B B . . . -1.50 1.41 * . . -0.60 0.15 Cys 677 . . B B . . .
-0.64 1.84 * . . -0.60 0.21 Tyr 678 . . B B . . . -0.29 1.20 . . .
-0.60 0.51 Phe 679 . . . B T . . 0.57 0.51 . . . -0.20 0.70 Trp 680
. . . B T . . 1.38 0.43 * . . 0.29 2.10 Lys 681 . . . . . T C 1.73
0.26 * . F 1.28 2.32 Lys 682 . . . . T T . 1.59 -0.50 * * F 2.42
5.37 Asn 683 . . . . . T C 1.83 -0.60 * * F 2.86 4.21 Gln 684 . . .
. T T . 2.29 -1.51 * * F 3.40 3.65 Lys 685 . . B . . . . 2.62 -0.76
* * F 2.46 2.86 Leu 686 . . B . . . . 2.33 -0.76 * * F 2.32 3.55
Glu 687 . . B . . . . 1.99 -0.40 * * . 1.73 3.21 Tyr 688 . . B . .
T . 2.03 -0.41 * * . 1.79 2.15 Lys 689 . . B . . T . 1.22 -0.41 * *
F 1.80 5.22 Tyr 690 . . B . . T . 0.32 -0.41 * * F 2.00 2.49 Ser
691 . . B . . T . 0.53 0.23 * * F 1.20 1.18 Lys 692 . A B . . . .
0.53 0.09 * * F 0.45 0.58 Leu 693 . A B . . . . 0.19 0.49 * * .
-0.20 0.60 Val 694 . A B . . . . -0.17 0.23 * * . -0.10 0.45 Met
695 . A B . . . . -0.73 0.33 * * . -0.30 0.33 Asn 696 . A B . . . .
-0.39 1.01 . * . -0.60 0.33 Ala 697 . A B . . . . -0.43 0.33 * * .
-0.30 0.88 Thr 698 . A B . . . . -0.29 -0.31 . * . 0.65 1.48 Leu
699 . A B . . . . 0.57 -0.36 * . F 0.85 0.49 Lys 700 . A B . . . .
0.36 -0.76 . * F 1.35 0.82 Asp 701 . . . . T T . 0.14 -0.57 . * F
2.35 0.47 Cys 702 . . B . . T . 0.14 -0.63 . . . 2.00 0.87 Asp 703
. . B . . T . -0.13 -0.81 . . . 1.80 0.44 Leu 704 . . B . . T .
0.68 -0.31 . . . 1.30 0.27 Pro 705 . . B . . . . 0.33 -0.31 . . .
0.90 0.83 Ala 706 . . . . T . . -0.33 -0.50 . * . 1.10 0.67 Ala 707
A . . . . . . -0.26 0.07 . . . -0.10 0.43 Asp 708 A . . . . T .
-1.14 -0.11 . . . 0.70 0.28 Ser 709 . . B . . T . -0.93 0.14 . . .
0.10 0.20 Cys 710 . . B . . T . -0.72 0.26 . . . 0.10 0.19 Ala 711
. . B . . T . -0.48 -0.24 . . . 0.70 0.20 Ile 712 . A B . . . .
0.11 0.19 . . . -0.30 0.15 Met 713 . A B . . . . 0.11 -0.20 . . .
0.30 0.48 Glu 714 . A B . . . . -0.44 -0.77 . . F 0.75 0.79 Gly 715
. A . . . . C 0.22 -0.63 * . F 0.95 0.83 Glu 716 A A . . . . . 0.81
-1.31 * . F 0.90 1.46 Asp 717 A A . . . . . 1.70 -1.93 * . F 0.90
1.41 Val 718 A A . . . . . 1.49 -1.93 * . F 0.90 2.38 Glu 719 A A .
. . . . 0.60 -1.67 * . F 0.90 1.13 Asp 720 A A . . . . . 0.24 -0.99
* . F 0.75 0.48 Asp 721 A A . . . . . -0.07 -0.20 . * F 0.45 0.55
Leu 722 A A . . . . . -0.37 -0.36 * * . 0.30 0.46 Ile 723 A A . . .
. . 0.53 0.03 . * . -0.30 0.37 Phe 724 . A B . . . . 0.53 0.03 . .
. -0.30 0.44 Thr 725 . A B . . . . 0.50 0.43 . . F -0.45 0.87 Ser
726 . . . . . T C 0.20 0.24 . . F 0.60 1.68 Lys 727 . . . . T T .
0.20 -0.06 . . F 1.40 2.60 Asn 728 . . . . . T C 0.74 -0.16 * * F
1.48 1.49 His 729 . . . . . T C 1.56 -0.21 * * F 1.76 1.10 Ser 730
. . . . . . C 1.57 -0.60 . * . 1.99 1.07 Leu 731 . . . . T . . 1.87
-0.21 . * . 2.02 0.90 Gly 732 . . . . T T . 1.79 -0.21 . . F 2.80
1.06 Arg 733 . . . . T T . 0.98 -0.21 * . F 2.52 1.07 Ser 734 . . .
. T T . 0.80 0.09 * . F 1.88 1.07 Asn 735 . . . . T T . 0.89 -0.17
* * F 2.44 1.68 His 736 . . . . . . C 1.81 -0.17 * * F 2.00 1.33
Leu 737 . . . . . . C 1.81 -0.17 * * F 1.96 1.94 Pro 738 . . . . .
T C 0.89 -0.13 * * F 2.40 1.19 Pro 739 . . . . T T . 0.38 0.16 . *
F 1.61 0.72 Arg 740 . . . . T T . -0.22 0.34 . * F 1.37 0.72 Gly
741 . . B . . T . -0.19 0.27 . * F 0.73 0.46 Leu 742 . A B . . . .
-0.19 -0.16 . * . 0.54 0.50 Leu 743 . A B . . . . -0.29 0.10 * . .
-0.30 0.21 Met 744 . A B . . . . -0.08 0.59 * . . -0.60 0.31 Asp
745 . A B . . . . -0.86 0.56 * . . -0.60 0.64 Leu 746 . A B . . . .
-0.40 0.44 . . . -0.60 0.42 Thr 747 . A B . . . . 0.02 -0.24 . * .
0.30 0.83 Gln 748 . A B . . . . 0.44 -0.43 . . F 0.45 0.63 Cys 749
. A B . . . . 0.66 0.00 . . . -0.30 0.98 Arg 750 . A B . . . . 0.27
-0.26 . . . 0.30 0.87
[0123]
2TABLE II Res Pos I II III IV V VI VII VIII IX X XI XII XIII XIV
Met 1 . . B . . . . 0.08 0.20 . . . -0.10 0.71 Ser 2 . . B . . T .
0.47 0.26 . . . 0.10 0.80 Thr 3 . . B . . T . 0.51 0.23 . . . 0.50
1.01 Gly 4 . . . . . T C 0.90 0.23 . * . 0.95 1.01 Thr 5 . . . . T
T . 0.94 -0.39 . . F 2.15 1.26 Asn 6 . . . . . T C 0.69 -0.34 . . F
2.05 0.86 Gly 7 . . . . T T . 0.69 -0.19 . . F 2.50 0.65 Asp 8 . .
. . T T . 0.79 -0.23 . . F 2.25 0.60 Gly 9 . . B . . T . 0.54 -0.29
. . F 1.60 0.58 Val 10 . . B . . . . 0.86 -0.19 . * F 1.15 0.59 Ser
11 . . B . . . . 0.51 -0.21 . . F 0.90 0.57 Pro 12 . . B . . T .
0.00 0.21 * . F 0.25 0.57 Ala 13 . . B . . T . -0.86 0.43 * . F
-0.05 0.57 Asn 14 . . B . . T . -1.32 0.43 * . F -0.05 0.31 Gly 15
. . B . . T . -0.47 0.73 . . . -0.20 0.17 Val 16 . . B B . . .
-0.06 0.30 . . . -0.30 0.28 Val 17 . . B B . . . -0.14 -0.20 . . .
0.60 0.34 Leu 18 . . B B . . . 0.20 -0.21 . . . 0.90 0.46 Asp 19 .
. B . . T . -0.01 0.11 * * F 1.15 0.96 Arg 20 . . B . . T . 0.44
-0.10 * * F 2.20 2.01 Ser 21 . . . . . T C 0.41 -0.74 * * F 3.00
4.77 Tyr 22 . . . . . T C 0.41 -0.74 * * F 2.70 2.00 Pro 23 . . B B
. . . 0.37 -0.10 * * F 1.35 0.76 Arg 24 . . B B . . . -0.23 0.54 *
* . 0.00 0.42 Ile 25 . A B B . . . -0.34 0.77 * * . -0.30 0.27 Val
26 . A B B . . . 0.07 0.01 . * . -0.30 0.30 Val 27 . A B B . . .
-0.54 -0.41 . * . 0.30 0.30 Met 28 . A B B . . . -0.33 0.23 . * .
-0.30 0.31 Glu 29 . A B B . . . -1.04 -0.46 . * . 0.30 0.73 Arg 30
A A . B . . . -0.37 -0.49 . * . 0.30 0.98 Val 31 A A . B . . . 0.18
-0.70 . * . 0.75 1.53 Glu 32 A A . B . . . 0.44 -0.83 * * . 0.75
1.27 Met 33 A A . . . . . 1.04 -0.33 * * . 0.30 0.66 Pro 34 A . . .
. . . 0.83 0.07 * * F 0.20 1.53 Thr 35 A . . . . . . 0.13 -0.14 * *
F 0.80 1.37 Ala 36 A A . . . . . 0.18 0.36 . . F 0.00 1.40 Gln 37 A
A . . . . . -0.63 0.43 . . F -0.45 0.75 Pro 38 A A . . . . . -0.62
0.69 . . F -0.45 0.43 Ala 39 A A . . . . . -1.27 0.70 . . . -0.60
0.43 Leu 40 A A . . . . . -0.96 0.84 * . . -0.60 0.18 Leu 41 A A .
. . . . -0.32 0.84 * . . -0.60 0.20 Ala 42 A A . . . . . -0.32 0.41
* . . -0.60 0.40 Val 43 . A B . . . . -0.92 0.31 * . . -0.30 0.85
Gln 44 . A B . . . . -0.68 0.31 * . . -0.06 0.85 Lys 45 . A B . . .
. -0.08 0.06 * . F 0.33 0.83 Gln 46 . A . . T . . 0.52 -0.01 . . F
1.72 1.74 Leu 47 . A . . T . . 1.11 -0.23 . . F 1.96 1.55 Gly 48 .
. . . . T C 1.37 -0.23 . . F 2.40 1.34 Pro 49 . . . . . T C 0.70
0.39 . . F 1.41 0.77 Pro 50 . . . . T T . 0.77 0.56 * * F 1.07 0.50
Gln 51 . . . . T T . -0.09 -0.13 * * . 1.58 0.99 Met 52 . . B B . .
. 0.13 0.09 * * . -0.06 0.47 Cys 53 . . B B . . . -0.19 0.16 * * .
-0.30 0.31 Arg 54 . . B B . . . -0.29 0.30 * * . -0.30 0.10 Val 55
. . B B . . . -0.74 0.39 * . . -0.30 0.14 Ala 56 . . B B . . .
-1.33 0.34 * * . -0.30 0.14 Cys 57 . . B B . . . -1.59 0.27 * * .
-0.30 0.07 Thr 58 . . B B . . . -1.81 0.91 . * . -0.60 0.07 Cys 59
. . B B . . . -1.92 0.96 * * . -0.60 0.05 Ala 60 . . B B . . .
-0.96 0.86 * . . -0.60 0.15 Val 61 . . B B . . . -1.22 0.29 * * .
-0.30 0.20 Ile 62 . . B B . . . -0.56 0.44 * . . -0.60 0.28 Asn 63
. . B B . . . -0.20 0.27 * . . -0.30 0.48 Arg 64 . . B B . . .
-0.39 -0.23 * . . 0.45 1.30 Val 65 . . B B . . . 0.20 -0.23 * . F
0.60 1.38 Gln 66 . . B B . . . 0.39 -0.51 * . F 0.90 1.38 Lys 67 .
. B B . . . 0.97 -0.34 * . F 0.45 0.38 Val 68 . . B B . . . 0.76
0.14 * . . -0.30 0.73 Asn 69 . . B B . . . 0.33 -0.07 * * . 0.30
0.65 Cys 70 . . B B . . . 0.89 0.01 * * F -0.15 0.47 Thr 71 . . B .
. T . 0.89 0.40 . * F 0.25 0.85 Pro 72 . . . . T T . 0.26 0.16 . *
F 0.65 0.85 Thr 73 . . . . T T . 0.26 0.26 . * F 0.80 1.61 Ser 74 .
. . . T T . -0.41 0.33 . . F 0.65 0.83 Asn 75 . . B . . . . -0.09
0.41 . . F -0.25 0.29 Ala 76 . . B . . . . 0.22 0.41 . . . -0.40
0.20 Val 77 . . B . . . . -0.23 -0.07 . . . 0.50 0.24 Cys 78 . . B
. . T . -0.73 0.11 . . . 0.10 0.08 Gly 79 . . B . . T . -0.64 0.40
* * . 0.10 0.07 Asp 80 . . B . . T . -0.53 0.33 * * . 0.10 0.14 Cys
81 . . B . . T . -0.64 -0.31 * * . 0.70 0.51 Leu 82 . . B . . . .
-0.03 -0.10 * * . 0.50 0.44 Pro 83 . . B . . T . 0.74 0.23 * * .
0.10 0.42 Arg 84 . . B . . T . 1.13 0.23 * * . 0.25 1.52 Phe 85 . .
B . . T . 0.82 -0.34 * * . 0.85 3.69 Tyr 86 . . B . . T . 1.60
-0.54 * * . 1.38 3.44 Arg 87 . . B B . . . 1.52 -0.97 * * F 1.36
3.44 Lys 88 . . B B . . . 1.39 -0.29 * * F 1.29 2.79 Thr 89 . . B B
. . . 0.93 -0.64 * * F 1.82 1.76 Arg 90 . . . B T . . 0.82 -0.97 *
* F 2.30 0.89 Ile 91 . . . B T . . 1.07 -0.29 . . F 1.77 0.37 Gly
92 . . . . T . . 0.96 0.11 . . F 1.14 0.44 Gly 93 . A . . T . .
0.91 -0.37 . * F 1.31 0.38 Leu 94 . A . . . . C 1.22 0.03 * * F
0.28 0.93 Gln 95 . A . . T . . 0.44 -0.66 . * F 1.30 1.62 Asp 96 .
A . . T . . 0.44 -0.51 . . F 1.15 0.88 Gln 97 . A B . . . . 0.58
-0.26 . . F 0.45 0.75 Glu 98 . A B . . . . 0.26 -0.51 . . F 0.75
0.67 Cys 99 . A B . . . . 0.76 -0.34 . . . 0.30 0.21 Ile 100 . . B
. . . . 0.80 0.14 . . . -0.10 0.18 Pro 101 . . . . T . . 0.80 -0.26
. . . 0.90 0.21 Cys 102 . . . . T T . 0.49 0.14 * . . 0.50 0.67 Thr
103 . . . . T T . 0.28 0.06 * . F 1.10 1.37 Lys 104 . . . . T T .
0.63 -0.20 . . F 2.00 1.37 Gln 105 . . . . . T C 1.22 -0.14 . . F
2.10 3.69 Thr 106 . . . . . T C 1.43 -0.33 . . F 2.40 3.43 Pro 107
. . . . . T C 1.24 -0.81 . * F 3.00 2.97 Thr 108 . . . . T T . 1.56
-0.17 . * F 2.60 1.27 Ser 109 . . B . . T . 0.84 -0.17 . * F 1.90
1.53 Glu 110 . A B . . . . 0.26 -0.09 * * F 1.05 0.53 Val 111 . A B
. . . . -0.13 -0.01 * * . 0.60 0.37 Gln 112 . A B . . . . 0.08 0.29
* * . -0.30 0.24 Cys 113 A A . . . . . -0.42 0.30 * * . -0.30 0.24
Ala 114 A A . . . . . -0.42 0.99 * * . -0.60 0.27 Phe 115 A A . . .
. . -1.23 0.73 . * . -0.60 0.21 Gln 116 A A . . . . . -1.23 1.01 .
* . -0.60 0.32 Leu 117 A A . . . . . -1.23 1.09 . * . -0.60 0.23
Ser 118 . A B . . . . -1.16 0.59 . * . -0.60 0.47 Leu 119 . A B . .
. . -0.57 0.30 . * . -0.30 0.27 Val 120 A A . . . . . -0.46 -0.10 .
* . 0.30 0.55 Glu 121 A A . . . . . -0.67 -0.29 . * . 0.30 0.41 Ala
122 A A . . . . . -0.17 -0.24 . . . 0.30 0.78 Asp 123 . A . . T . .
-0.72 -0.44 . . . 0.85 1.51 Ala 124 . A . . . . C -0.12 -0.44 . . F
0.65 0.65 Pro 125 . A . . . . C 0.52 -0.01 . * F 0.65 0.99 Thr 126
. . . . . . C 0.52 -0.09 . . F 0.85 0.92 Val 127 . . . . . . C 1.11
0.31 . . F 0.40 1.57 Pro 128 . . . . . . C 0.52 -0.19 . . F 1.00
1.76 Pro 129 A . . . . . . 0.80 -0.11 . . F 0.80 1.23 Gln 130 A . .
. . . . 0.20 -0.11 . . F 0.80 2.40 Glu 131 A . . . . . . -0.34
-0.07 . . F 0.80 1.28 Ala 132 A . . B . . . -0.08 0.14 . . F -0.15
0.61 Thr 133 A . . B . . . -0.68 0.21 . . . -0.30 0.36 Leu 134 A .
. B . . . -1.32 0.50 . . . -0.60 0.17 Val 135 A . . B . . . -1.62
1.14 . . . -0.60 0.13 Ala 136 A . . B . . . -1.92 1.03 . . . -0.60
0.12 Leu 137 A . . B . . . -2.14 0.93 * . . -0.60 0.19 Val 138 A .
. B . . . -2.64 0.93 * . . -0.60 0.21 Ser 139 A . . B . . . -2.69
0.97 . . . -0.60 0.17 Ser 140 . . B B . . . -2.69 1.11 * . . -0.60
0.15 Leu 141 . . B B . . . -2.80 1.07 * . . -0.60 0.15 Leu 142 . .
B B . . . -2.30 1.21 * . . -0.60 0.10 Val 143 . . B B . . . -2.26
1.31 . . . -0.60 0.11 Val 144 . A B B . . . -2.54 1.61 . * . -0.60
0.11 Phe 145 . A B B . . . -2.94 1.43 . . . -0.60 0.13 Thr 146 . A
B B . . . -2.94 1.53 . . . -0.60 0.15 Leu 147 A A . B . . . -2.48
1.57 . . . -0.60 0.17 Ala 148 A A . B . . . -2.43 1.36 . . . -0.60
0.19 Phe 149 A A . B . . . -2.28 1.26 . . . -0.60 0.11 Leu 150 A A
. B . . . -2.28 1.56 . . . -0.60 0.12 Gly 151 A A . B . . . -2.78
1.66 . . . -0.60 0.10 Leu 152 A A . B . . . -2.21 1.84 . . . -0.60
0.10 Phe 153 A A . B . . . -2.29 1.81 . . . -0.60 0.18 Phe 154 A A
. B . . . -1.54 1.70 * . . -0.60 0.10 Leu 155 A A . B . . . -0.73
1.27 * . . -0.60 0.24 Tyr 156 A A . B . . . -1.09 0.99 * . . -0.60
0.48 Cys 157 . A . B T . . -0.98 0.99 * . . -0.20 0.48 Lys 158 . A
. B T . . -0.28 0.99 * . . -0.20 0.50 Gln 159 . A . B T . . 0.53
0.70 * . . -0.20 0.51 Phe 160 . A . B T . . 1.31 -0.06 * . . 0.85
1.88 Phe 161 . A . B T . . 0.89 -0.13 * . . 1.16 1.28 Asn 162 . . .
. T T . 1.56 0.44 * * . 0.82 0.39 Arg 163 . . . . T T . 1.62 0.44 *
* . 1.13 0.79 His 164 . . . . T T . 1.28 -0.34 * * . 2.49 1.79 Cys
165 . . . . T T . 1.63 -0.70 * * . 3.10 1.10 Gln 166 . . . . T T .
1.52 -0.67 * . F 2.79 0.56 Arg 167 . . . . T T . 0.71 0.01 * * F
1.58 0.34 Gly 168 . . . . T T . 0.60 0.20 * * F 1.27 0.52 Gly 169 .
. . . T T . -0.07 0.03 * . F 0.96 0.52 Leu 170 . A . . . . C 0.60
0.41 . * . -0.40 0.23 Leu 171 . A B . . . . 0.01 0.41 . * . -0.60
0.40 Gln 172 . A B . . . . -0.10 0.49 . * . -0.60 0.41 Phe 173 A A
. . . . . 0.29 0.06 . * . -0.30 0.83 Glu 174 A A . . . . . 0.32
-0.63 . * . 0.75 2.01 Ala 175 A A . . . . . 0.54 -0.83 * * F 0.90
1.67 Asp 176 A A . . . . . 1.40 -0.73 * * F 0.90 1.95 Lys 177 A A .
. . . . 1.40 -1.51 . * F 0.90 2.26 Thr 178 A A . . . . . 2.10 -1.51
* * F 0.90 3.87 Ala 179 A A . . . . . 1.80 -2.01 * . F 0.90 4.01
Lys 180 A A . . . . . 1.58 -1.63 * . F 0.90 2.69 Glu 181 A A . . .
. . 0.88 -0.94 * . F 0.90 1.54 Glu 182 A A . . . . . 0.62 -0.64 . .
F 0.90 1.32 Ser 183 A . . . . . . 0.08 -0.71 . * F 1.10 1.02 Leu
184 . . B . . . . 0.46 -0.07 . * . 0.50 0.44 Phe 185 . . B . . . .
0.20 0.36 . . . 0.20 0.39 Pro 186 . . . . . . C -0.10 0.79 . . .
0.40 0.45 Val 187 . . . . . . C -0.06 0.79 . . F 0.85 0.73 Pro 188
. . . . . T C 0.24 0.10 . . F 1.80 1.69 Pro 189 . . . . . T C 0.74
-0.69 . . F 3.00 1.89 Ser 190 . . . . . T C 1.14 -0.63 . . F 2.70
3.67 Lys 191 . . . . . T C 0.77 -0.89 . . F 2.40 3.18 Glu 192 A A .
. . . . 1.62 -0.81 . . F 1.50 2.08 Thr 193 A A . . . . . 1.53 -1.24
. . F 1.20 2.69 Ser 194 A A . . . . . 1.74 -1.24 . * F 0.90 1.80
Ala 195 A A . . . . . 1.19 -0.84 . * F 0.90 1.80 Glu 196 A A . . .
. . 0.84 -0.20 . * F 0.45 0.93 Ser 197 A . . . . . . 0.56 -0.30 . *
F 0.65 0.93 Gln 198 A . . . . . . 0.28 0.23 . * F 0.05 0.96 Val 199
. . B . . . . 0.37 0.23 . * . -0.10 0.56 Ser 200 . . B . . . . 0.61
0.66 . * . -0.40 0.65 Trp 201 . . . . . . C 0.31 0.70 . * . -0.20
0.37 Ala 202 . . . . . T C -0.20 0.69 . . . 0.00 0.67 Pro 203 . . .
. . T C -0.79 0.73 * . F 0.15 0.41 Gly 204 . . . . T T . 0.07 0.84
* . F 0.35 0.40 Ser 205 . . . . . T C -0.44 0.33 * . F 0.45 0.68
Leu 206 . . B . . . . -0.86 0.51 * . . -0.40 0.36 Ala 207 . . B . .
. . -0.57 0.87 * . . -0.40 0.32 Gln 208 . . B . . . . -1.17 0.83 .
. . -0.40 0.32 Leu 209 . . B . . . . -0.82 1.13 . . . -0.40 0.32
Phe 210 . . B . . . . -0.82 0.44 . . . -0.40 0.52 Ser 211 . . B . .
. . -0.87 0.33 . . . -0.10 0.40 Leu 212 . . B . . . . -0.49 0.57 .
. . -0.40 0.36 Asp 213 . . . . T . . -1.38 0.31 . . F 0.45 0.65 Ser
214 . . . . . . C -0.78 0.21 . . F 0.25 0.34 Val 215 . . . . . . C
-0.08 0.26 . * F 0.25 0.64 Pro 216 . . . . . . C 0.22 -0.03 . . F
0.85 0.66 Ile 217 . . B . . . . 1.03 0.37 . . F 0.05 0.86 Pro 218 .
. B . . . . 1.03 0.39 . . F 0.46 2.00 Gln 219 . . B . . . . 0.99
0.14 . . F 0.72 2.24 Gln 220 . . B . . . . 1.63 0.14 . . F 0.98
3.16 Gln 221 . . . . . . C 1.84 -0.11 . . F 2.04 3.16 Gln 222 . . .
. . . C 2.13 -0.54 . . F 2.60 3.16 Gly 223 . . . . . T C 1.96 -0.33
. . F 2.24 1.80 Pro 224 . . . . . T C 1.57 -0.30 . . F 1.98 1.33
Glu 225 . . B . . T . 1.18 -0.27 . . . 1.22 0.98 Met 226 . . B . .
T . 0.79 -0.24 * . . 1.11 1.27
[0124]
3TABLE III Res Pos I II III IV V VI VII VIII IX X XI XII XIII XIV
Met 1 . . B . . . . 0.20 -0.17 . . . 0.93 1.00 Ala 2 . . B . . . .
0.56 -0.17 . . . 1.06 0.78 Glu 3 . . . . . T C 0.64 -0.10 . . .
1.74 0.83 Pro 4 . . . . . T C 1.00 -0.14 . . . 2.17 1.12 Gly 5 . .
. . T T . 1.36 -0.26 . . F 2.80 1.51 His 6 . . . . . T C 1.14 -0.26
. . . 2.17 1.18 Ser 7 . A . . . . C 1.43 0.43 . . . 0.44 0.63 His 8
. A . . . . C 0.84 0.39 . * . 0.46 0.86 His 9 . A . . . . C 1.17
0.46 * . -0.12 0.64 Leu 10 . A B . . . . 0.66 -0.04 . * . 0.30 0.93
Ser 11 . A B B . . . 0.80 0.21 . * . -0.30 0.51 Ala 12 . A B B . .
. 0.76 -0.29 . * . 0.30 0.73 Arg 13 . A B B . . . 0.90 -0.36 . * .
0.30 0.87 Val 14 . . B B . . . 0.62 -1.04 . * F 1.16 1.28 Arg 15 .
. B B . . . 1.43 -0.94 * * F 1.42 1.83 Gly 16 . . . . T . . 1.84
-1.44 * * F 2.28 1.61 Arg 17 . . B . . . . 2.54 -1.44 * * F 2.14
4.26 Thr 18 . . . . . . C 1.54 -2.09 * * F 2.60 4.26 Glu 19 . . B .
. . . 2.19 -1.40 * * F 2.14 3.02 Arg 20 . . B B . . . 2.19 -1.40 *
* F 1.68 2.38 Arg 21 . . B B . . . 1.72 -1.40 * * F 1.42 3.23 Ile
22 . . B B . . . 1.32 -1.20 * * F 1.16 1.54 Pro 23 . . B B . . .
1.74 -0.29 * . F 0.45 0.83 Arg 24 . . . B T . . 0.93 -0.29 * . F
0.85 0.83 Leu 25 . . B B . . . 0.01 0.40 * . . -0.30 0.97 Trp 26 .
. B B. . . . -0.91 0.40 * * . -0.30 0.52 Arg 27 . . B B . . . -0.31
0.66 * . . -0.60 0.22 Leu 28 . . B B . . . -0.69 1.57 * . . -0.60
0.28 Leu 29 . . B B . . . -1.14 1.39 * . . -0.60 0.27 Leu 30 . . B
B . . . -0.64 0.90 * * . -0.60 0.14 Trp 31 . . . B . . C -0.94 1.39
* * . -0.40 0.24 Ala 32 . . . B . . C -1.76 1.20 * * . -0.40 0.29
Gly 33 . . . B . . C -0.94 1.30 . . . -0.40 0.30 Thr 34 . . . B . .
C -0.99 1.01 . . . -0.40 0.50 Ala 35 . . B B . . . -0.49 0.74 . . .
-0.60 0.37 Phe 36 . . B B . . . -0.20 0.73 . . . -0.60 0.54 Gln 37
. . B B . . . 0.04 0.70 . . . -0.60 0.64 Val 38 . . B B . . . 0.08
0.64 . . . -0.60 0.63 Thr 39 . . B B . . . 0.04 0.63 . . F -0.30
1.05 Gln 40 . . . B T . . 0.42 0.27 . . F 0.25 0.60 Gly 41 . . . .
T . . 1.12 0.30 . . F 0.60 1.25 Thr 42 . . . . . . C 0.31 -0.34 * .
F 1.00 1.50 Gly 43 . . . . . T C 1.13 -0.14 . . F 1.05 0.72 Pro 44
. . . . . T C 0.86 -0.04 . . F 1.05 0.98 Glu 45 . . B . . T . 0.19
0.03 . . F 0.25 0.69 Leu 46 . . B . . T . 0.58 0.11 . . . 0.10 0.37
His 47 . . B . . . . 0.89 -0.31 . . . 0.50 0.48 Ala 48 . . . . . .
C 0.93 -0.74 . . . 1.00 0.48 Cys 49 A . . . . T . 1.14 -0.36 . . .
0.70 0.78 Lys 50 A . . . . T . 0.90 -1.04 . . F 1.15 1.00 Glu 51 A
. . . . T . 1.68 -0.79 . . F 1.30 1.55 Ser 52 . . . . T T . 1.47
-0.79 * . F 1.70 3.93 Glu 53 . A . . T . . 2.06 -0.60 . . F 1.30
3.08 Tyr 54 . A . . T . . 2.48 -0.60 . . . 1.15 3.08 His 55 . A . .
T . . 2.12 0.16 . * . 0.25 3.60 Tyr 56 . A . . T . . 1.53 0.26 . *
. 0.25 3.00 Glu 57 . A B . . . . 1.17 0.76 . . . -0.45 1.93 Tyr 58
. A B . . . . 1.17 0.57 . . . -0.60 0.76 Thr 59 . A B . . . . 1.11
0.07 . . . -0.30 0.81 Ala 60 . A B . . . . 0.83 -0.30 . . . 0.64
0.63 Cys 61 . A B . . . . 0.73 0.19 . . . 0.38 0.58 Asp 62 . A . .
T . . 0.43 -0.14 . . F 1.87 0.40 Ser 63 . . . . T T . 0.79 -0.24 *
. F 2.61 0.53 Thr 64 . . . . T T . 0.81 -0.74 * * F 3.40 1.92 Gly
65 . . . . T T . 1.51 -0.40 . * F 2.76 1.21 Ser 66 . . . . T T .
1.32 -0.40 . * F 2.42 1.77 Arg 67 . . . B T . . 0.73 -0.14 * * F
1.53 0.91 Trp 68 . . B B . . . 0.18 -0.13 . * . 0.64 0.93 Arg 69 .
. B B . . . 0.28 0.09 . * . -0.30 0.51 Val 70 . . B B . . . 0.59
0.13 . * . -0.30 0.41 Ala 71 . . B B . . . 0.58 0.63 . * . -0.60
0.53 Val 72 . . B B . . . 0.26 0.20 . * . -0.30 0.39 Pro 73 . . . .
T . . 0.20 0.63 * * . 0.00 0.81 His 74 . . . . T . . -0.72 0.41 * *
. 0.00 0.79 Thr 75 . . . . . T C -0.53 0.60 . . F 0.15 0.88 Pro 76
. . . . T T . -0.26 0.53 . . F 0.35 0.30 Gly 77 . . . . T T . 0.30
0.59 . . F 0.35 0.32 Leu 78 . . B . . T . -0.30 0.47 . . . -0.20
0.30 Cys 79 . . B . . . . -0.48 0.67 . . . -0.40 0.16 Thr 80 . . B
. . . . -0.17 0.67 . . . -0.40 0.25 Ser 81 . . B . . . . -0.17 0.24
* . F 0.05 0.51 Leu 82 . . B . . T . -0.68 -0.01 * . F 1.30 1.46
Pro 83 . . B . . T . 0.18 0.06 * * F 0.85 0.75 Asp 84 . . . . . T C
0.50 -0.43 * * F 2.10 1.12 Pro 85 . . . . T T . 0.50 -0.39 * . F
2.60 1.34 Val 86 . . . . T . . 0.80 -0.59 * . F 3.00 1.25 Lys 87 .
. B . . . . 0.94 -1.01 * . F 2.30 1.30 Gly 88 . . B . . . . 0.86
-0.44 * . F 1.55 0.45 Thr 89 . . B . . . . 0.16 -0.49 * . F 1.25
0.81 Glu 90 . . B . . . . 0.07 -0.34 . . F 0.95 0.35 Cys 91 . . B .
. T . 0.26 0.04 . * . 0.10 0.48 Ser 92 . . B . . T . 0.21 0.19 . *
. 0.10 0.18 Phe 93 . . B . . T . -0.03 0.10 . * . 0.10 0.16 Ser 94
. . . . T T . -0.07 0.60 . * . 0.20 0.31 Cys 95 . . . . T . . -0.07
0.46 . * . 0.00 0.23 Asn 96 . . . . T T . -0.10 0.07 * . . 0.50
0.46 Ala 97 . . . . . T C -0.61 0.07 * . . 0.30 0.30 Gly 98 . . . .
. T C 0.09 0.37 * . F 0.45 0.46 Glu 99 A . . . . T . -0.21 -0.20 .
* . 0.70 0.47 Phe 100 . A B . . . . 0.50 0.01 . . . -0.30 0.46 Leu
101 . A B . . . . 0.50 -0.49 . . . 0.30 0.94 Asp 102 A A . . . . .
1.09 -0.91 . . . 0.94 0.90 Met 103 . A . . T . . 1.13 -0.51 . . .
1.83 1.81 Lys 104 . A . . T . . 0.47 -0.91 * . F 2.32 2.94 Asp 105
. . . . T T . 1.21 -1.03 * . F 2.91 0.94 Gln 106 . . . . T T . 1.81
-1.03 . * F 3.40 1.90 Ser 107 . . . . T T . 1.14 -1.21 . . F 3.06
1.47 Cys 108 . . . . T T . 1.16 -0.64 . * F 2.57 0.47 Lys 109 . . B
. . T . 1.11 -0.14 . * F 1.53 0.28 Pro 110 . . B . . T . 0.77 -0.54
. * F 1.69 0.36 Cys 111 . . B . . T . 0.88 -0.50 . * . 1.10 0.66
Ala 112 . . B . . T . 0.93 -1.07 . * F 1.75 0.64 Glu 113 . . B . .
. . 1.30 -0.31 . * F 1.45 0.65 Gly 114 . . B . . T . 0.44 -0.36 . *
F 2.00 1.63 Arg 115 . . B . . T . 0.31 -0.24 . * F 1.80 1.33 Tyr
116 . . B . . T . 0.67 -0.31 . * . 1.30 0.76 Ser 117 . . B . . T .
0.91 0.17 . * . 0.65 1.11 Leu 118 . . B B . . . 0.02 0.17 * * .
-0.10 0.56 Gly 119 . . . B T . . 0.48 0.86 * * F -0.05 0.25 Thr 120
. . B B . . . -0.33 0.10 * * F -0.15 0.37 Gly 121 . . B B . . .
-0.09 0.50 * * F -0.45 0.39 IIe 122 . A B B . . . 0.21 -0.19 * * .
0.30 0.65 Arg 123 . A B B . . . 0.73 -0.61 . * . 0.60 0.78 Phe 124
. A B B . . . 1.08 -0.19 . * . 0.30 0.83 Asp 125 . A . B . . C 1.39
-0.61 . * . 0.95 1.97 Glu 126 . A . . T . . 0.92 -1.30 . * F 1.30
1.75 Trp 127 . A . . T . . 1.60 -0.61 . * F 1.30 1.66 Asp 128 . A .
. . . C 1.46 -0.97 . * F 1.10 1.54 Glu 129 . A . . . . C 1.81 -0.47
* . F 0.80 1.21 Leu 130 . . . . . T C 1.11 -0.04 * . . 1.05 1.14
Pro 131 . . . . . T C 0.52 -0.17 * . . 0.90 0.59 His 132 . . . . T
T . 0.51 0.33 * . . 0.50 0.34 Gly 133 . . . . . T C -0.30 0.71 * .
. 0.00 0.56 Phe 134 . A . . . . C -0.60 0.71 * . . -0.40 0.30 Ala
135 . A . . . . C -0.38 0.67 * * . -0.40 0.29 Ser 136 . A . . . . C
-0.17 0.67 . * . -0.40 0.30 Leu 137 . A . . . . C -0.73 0.64 . * .
-0.40 0.56 Ser 138 . . . . . T C -0.39 0.47 . * . 0.00 0.55 Ala 139
. . . . . T C -0.50 -0.03 . * . 0.90 0.71 Asn 140 . . B . . T .
0.09 0.27 . * . 0.10 0.71 Met 141 . . B . . T . 0.39 -0.41 . * .
0.70 0.88 Glu 142 . . B . . . . 0.90 -0.80 . * . 0.95 1.45 Leu 143
A . . . . T . 0.61 -0.91 . * . 1.15 1.21 Asp 144 A . . . . T . 0.61
-0.81 . * F 1.30 1.24 Asp 145 A . . . . T . 0.61 -0.93 . * F 1.15
0.72 Ser 146 A . . . . T . 0.91 -0.93 . . F 1.58 1.51 Ala 147 A . .
. . . . 0.60 -1.23 . . F 1.66 1.22 Ala 148 A . . . . . . 1.07 -0.74
. . F 1.94 1.05 Glu 149 . . . . T . . 1.07 -0.31 . . F 2.17 0.78
Ser 150 . . . . T T . 0.40 -0.30 * . F 2.80 1.23 Thr 151 . . . . T
T . 0.39 -0.23 . . F 2.37 0.66 Gly 152 . . . . T T . 0.68 -0.24 . .
F 2.09 0.55 Asn 153 . . . . T T . 0.97 0.14 . . F 1.21 0.55 Cys 154
. . . . T T . 1.01 0.14 . . F 0.93 0.51 Thr 155 . . . . T T . 1.02
-0.34 . . F 1.40 1.02 Ser 156 . . . . T T . 0.48 0.14 . . F 0.65
0.67 Ser 157 . . . . T T . 0.61 0.39 * * F 0.88 0.93 Lys 158 . . .
. T . . 0.72 0.24 * * F 0.91 0.99 Trp 159 . . B . . . . 1.04 -0.24
* * F 1.49 1.45 Val 160 . . B . . T . 1.36 -0.20 * * F 1.92 1.07
Pro 161 . . B . . T . 1.41 -0.59 * * F 2.30 0.90 Arg 162 . . . . T
T . 0.82 0.17 * * F 1.72 1.33 Gly 163 . . B . . T . 0.19 -0.06 * *
F 1.69 1.26 Asp 164 . . . . T . . -0.22 -0.20 * * F 1.51 0.82 Tyr
165 . . B . . . . 0.63 0.16 * . . 0.13 0.36 Ile 166 . . B . . . .
0.53 0.56 . * . -0.40 0.59 Ala 167 . . B . . . . 0.42 0.61 . * .
-0.40 0.51 Phe 168 . . B . . . . 0.77 0.61 . . . -0.09 0.54 Asn 169
. . B . . T . 0.10 -0.14 . . . 1.47 1.35 Thr 170 . . . . . T C 0.03
-0.26 . . F 1.98 0.71 Asp 171 . . . . T T . 0.33 -0.27 . * F 2.64
1.19 Glu 172 . . . . T T . 0.61 -0.56 . . F 3.10 0.75 Cys 173 . . .
B T . . 0.50 -0.47 . . . 1.94 0.75 Thr 174 . . B B . . . -0.10
-0.27 . . . 1.23 0.37 Ala 175 . . B B . . . -0.03 0.34 . . . 0.32
0.21 Thr 176 . . B B . . . -0.62 1.10 . . . -0.29 0.62 Leu 177 . .
B B . . . -1.48 1.03 * * . -0.60 0.43 Met 178 . . B B . . . -0.81
1.19 . * . -0.60 0.32 Tyr 179 . . B B . . . -1.31 1.09 . * . -0.60
0.35 Ala 180 . . B B . . . -0.68 1.29 . * . -0.60 0.35 Val 181 . .
B B . . . -0.37 0.60 . * . -0.60 0.71 Asn 182 . . B B . . . 0.14
0.39 . * . -0.30 0.79 Leu 183 . . B B . . . 0.40 0.01 . * F 0.21
1.05 Lys 184 . . B B . . . 0.33 -0.06 . * F 1.02 1.40 Gln 185 . . .
. T T . 0.07 -0.21 . * F 2.03 1.25 Ser 186 . . . . . T C 0.92 0.03
. * F 1.44 1.13 Gly 187 . . . . . T C 0.22 -0.26 . * F 2.10 0.91
Thr 188 . . B . . T . 1.03 0.53 . * F 0.79 0.45 Val 189 . . B B . .
. 0.74 0.13 . * F 0.48 0.59 Asn 190 . . B B . . . 0.50 0.50 . * .
-0.18 0.93 Phe 191 . . B B . . . 0.56 0.83 . * . -0.24 1.01 Glu 192
. . B B . . . 0.69 1.10 . * . -0.45 2.13 Tyr 193 . . B B . . . 1.00
0.89 . * . -0.45 2.04 Tyr 194 . . . . T . . 1.56 0.49 . * . 0.15
3.94 Tyr 195 . . . . . T C 1.26 0.09 . * . 0.45 3.05 Pro 196 . . .
. T T . 1.07 0.47 . . F 0.50 2.61 Asp 197 . . . . T T . 0.18 0.40 .
. F 0.50 1.17 Ser 198 . . . . . T C -0.28 0.33 . . F 0.45 0.52 Ser
199 . . B B . . . -0.03 0.36 . * F -0.15 0.29 Ile 200 . . B B . . .
-0.49 -0.07 . * . 0.30 0.30 Ile 201 . . B B . . . -0.98 0.71 . * .
-0.60 0.20 Phe 202 . . B B . . . -1.83 1.11 * * . -0.60 0.13 Glu
203 . . B B . . . -1.53 1.37 . * . -0.60 0.13 Phe 204 . . B B . . .
-1.23 1.09 . * . -0.60 0.33 Phe 205 . . B B . . . -0.34 0.80 * * .
-0.60 0.62 Val 206 . . . B T . . 0.54 0.01 * . . 0.10 0.59 Gln 207
. . . . T T . 0.58 0.41 . * F 0.50 1.19 Asn 208 . . . . T T . 0.58
0.20 . . F 0.65 0.73 Asp 209 . . . . T T . 1.07 -0.19 . . F 1.40
1.71 Gln 210 . . . . T T . 1.77 -0.40 . . F 1.74 1.53 Cys 211 . . .
. T . . 2.03 -0.40 . * F 1.88 1.53 Gln 212 . . B . . T . 2.03 -0.30
. * F 1.87 0.93 Pro 213 . . B . . T . 2.03 -0.30 . * F 2.21 0.89
Asn 214 . . . . T T . 1.73 -0.70 . . F 3.40 2.78 Ala 215 . . . . T
T . 1.84 -0.89 . * F 3.06 2.15 Asp 216 . . . . T . . 2.22 -1.29 . .
F 2.75 2.73 Asp 217 . . . . T T . 1.62 -0.80 * . F 2.84 1.78 Ser
218 . . . . . T C 1.88 -0.59 * . F 2.53 1.75 Arg 219 . . . . T T .
1.57 -1.09 * . F 2.62 2.09 Trp 220 . . B . . T . 1.84 -0.60 * . .
2.30 1.81 Met 221 . A B . . . . 1.84 -0.11 * . . 1.37 1.95 Lys 222
. A B . . . . 1.89 -0.50 * * F 1.29 1.72 Thr 223 . A . . . . C 1.84
-0.50 * . F 1.26 3.27 Thr 224 . A . . . . C 1.44 -0.99 * . F 1.33
3.27 Glu 225 . A . . . . C 1.73 -0.69 * . F 1.10 1.72 Lys 226 . A .
. . . C 1.63 -0.69 * * F 1.10 2.06 Gly 227 . A . . T . . 1.56 -0.39
* . F 1.00 1.24 Trp 228 . A . . . . C 1.57 -0.37 . . . 0.50 0.97
Glu 229 . A . . . . C 1.02 0.01 . . . -0.10 0.65 Phe 230 . A B . .
. . 1.02 0.66 . . . -0.60 0.49 His 231 . A B . . . . 0.17 0.23 . .
. -0.30 0.81 Ser 232 . A B . . . . 0.51 0.00 . . . -0.30 0.38 Val
233 . A B . . . . 0.91 0.40 * . . -0.26 0.71 Glu 234 . A . . . . C
0.57 -0.39 . . . 1.33 1.03 Leu 235 . A . . . . C 1.27 -0.46 . . .
1.52 0.76 Asn 236 . . . . T T . 1.30 -0.44 . . F 2.76 1.64 Arg 237
. . . . T T . 0.74 -0.69 * . F 3.40 1.52 Gly 238 . . . . T T . 0.79
-0.04 * . F 2.76 1.37 Asn 239 . . . . T T . 0.54 -0.04 * . F 2.27
0.70 Asn 240 . . . B . . C 1.07 0.31 * * F 0.73 0.56 Val 241 . . B
B . . . 1.18 1.23 . * . -0.26 0.60 Leu 242 . . B B . . . 0.76 0.80
. * . -0.60 0.73 Tyr 243 . . B B . . . 0.79 0.89 . * . -0.60 0.65
Trp 244 . . B B . . . 0.20 0.97 . * . -0.45 1.27 Arg 245 . . B B .
. . -0.50 0.83 . . . -0.45 1.56 Thr 246 . . B B . . . 0.06 0.93 . .
F -0.45 0.86 Thr 247 . . B B . . . 0.01 0.56 . * . -0.45 1.10 Ala
248 . . B B . . . -0.03 0.29 . . . -0.30 0.42 Phe 249 . . B B . . .
-0.06 1.20 . * . -0.60 0.30 Ser 250 . . B B . . . -0.12 1.20 . * .
-0.60 0.30 Val 251 . . . B T . . -0.67 0.71 * * . -0.20 0.60 Trp
252 . . B B . . . -0.57 0.86 * . . -0.36 0.51 Thr 253 . . B B . . .
0.07 0.50 * . F 0.03 0.59 Lys 254 . . . B . . C 0.56 0.11 * * F
0.92 1.60 Val 255 . . . . . T C -0.00 -0.10 * . F 2.16 2.35 Pro 256
. . . . . T C 0.04 -0.37 * . F 2.40 1.21 Lys 257 . . B . . T .
-0.52 -0.17 * * F 1.81 0.50 Pro 258 . . B . . T . -0.10 0.47 . * F
0.67 0.50 Val 259 . . B B . . . -0.14 -0.17 * . . 0.78 0.63 Leu 260
. . B B . . . -0.18 -0.20 . . . 0.54 0.51 Val 261 . . B B . . .
-0.56 0.49 . . . -0.60 0.23 Arg 262 . . B B . . . -1.49 0.56 . . .
-0.60 0.31 Asn 263 . . B B . . . -1.59 0.60 * . . -0.60 0.27 Ile
264 . . B B . . . -1.08 0.40 . . . -0.60 0.52 Ala 265 . . B B . . .
-1.12 0.19 * . . -0.30 0.26 Ile 266 . . B B . . . -0.86 0.83 * . .
-0.60 0.12 Thr 267 . . B B . . . -1.21 0.93 . . . -0.60 0.17 Gly
268 . . B B . . . -1.52 1.00 . * . -0.60 0.27 Val 269 . . B B . . .
-0.93 0.99 . . . -0.60 0.56 Ala 270 . . B B . . . -0.34 0.69 . . .
-0.60 0.52 Tyr 271 . . B B . . . -0.12 0.20 * . . -0.30 0.90 Thr
272 . . B . . T . -0.51 0.34 . . F 0.25 0.65 Ser 273 . . B . T T .
-0.38 0.49 . . F 0.35 0.56 Glu 274 . . . . T T . -0.19 0.41 . . F
0.35 0.55 Cys 275 . . B . . T . 0.44 0.23 . . . 0.10 0.20 Phe 276 .
. B . . . . 0.48 -0.26 . . . 0.50 0.31 Pro 277 . . . . T . . 0.44
-0.21 . . . 0.90 0.27 Cys 278 . . . . T . . 0.43 0.21 . . . 0.30
0.50 Lys 279 . . . . . T C 0.19 0.13 . . F 0.45 0.84 Pro 280 . . .
. T T . 0.27 0.10 . * F 0.65 0.85 Gly 281 . . . . T T . 0.97 0.17 *
* F 0.80 1.60 Thr 282 . . B . . T . 1.22 -0.40 * . F 1.34 1.34 Tyr
283 . . B . . . . 1.89 -0.40 * . F 1.48 1.73 Ala 284 . . B . . . .
1.50 -0.43 * . F 1.82 3.03 Asp 285 . . B . . T . 1.41 -0.43 * . F
2.36 2.08 Lys 286 . . . . T T . 1.46 -0.53 * . F 3.40 1.78 Gln 287
. . . . T T . 1.07 -0.90 * . F 3.06 2.36 Gly 288 . . . . T T . 0.64
-0.61 * . F 2.72 1.22 Ser 289 . . . . T T . 1.28 -0.04 * . F 1.93
0.33 Ser 290 . . B . T T . 0.47 -0.04 * . F 1.59 0.38 Phe 291 . . B
. . T . -0.24 0.24 * . . 0.10 0.32 Cys 292 . . B . . T . -0.46 0.39
* . . 0.10 0.13 Lys 293 . . B . . . . -0.70 0.43 * . . -0.40 0.15
Leu 294 . . B . . . . -0.40 0.54 . . . -0.40 0.17 Cys 295 . . B . .
. . -0.40 0.16 . . . -0.10 0.51 Pro 296 . . B . . . . 0.06 -0.03 .
. . 0.50 0.34 Ala 297 . . . . T . . 0.42 0.73 . . . 0.00 0.65 Asn
298 . . . . T T . 0.38 0.43 . . F 0.84 1.62 Ser 299 . . . . T T .
1.23 0.26 * . F 1.48 1.69 Tyr 300 . . . . T T . 1.56 -0.17 . . F
2.42 3.34 Ser 301 . . . . . T C 1.77 -0.24 * . F 2.56 2.05 Asn 302
. . . . T T . 2.04 -0.64 * . F 3.40 2.65 Lys 303 . . . . T T . 1.74
-0.54 . . F 3.06 2.44 Gly 304 . . . . T T . 1.38 -0.91 . * F 2.72
2.44 Glu 305 . . . . T T . 1.59 -0.73 * . F 2.23 0.81 Thr 306 . . .
. T T . 1.89 -0.63 * . F 1.89 0.55 Ser 307 . . B . . T . 1.22 -0.23
* . F 0.85 0.97 Cys 308 . . B . . T . 1.18 -0.09 . * . 1.04 0.30
His 309 . . B . . T . 1.31 -0.09 . . . 1.38 0.35 Gln 310 . . . . T
. . 1.31 -0.14 . . . 1.92 0.40 Cys 311 . . . . T . . 1.67 -0.53 . .
. 2.71 1.25 Asp 312 . . . . T T . 1.72 -1.10 . . F 3.40 1.84 Pro
313 . . . . T T . 2.09 -0.84 . . F 3.06 1.66 Asp 314 . . . . T T .
2.12 -0.86 . . F 3.06 4.15 Lys 315 . . . . T T . 2.17 -1.43 * . F
3.06 4.31 Tyr 316 . . B . . T . 2.49 -1.43 * . F 2.66 5.57 Ser 317
. . B . . T . 2.19 -1.43 * . F 2.66 3.30 Glu 318 . . . . T T . 2.10
-1.04 * . F 3.40 2.21 Lys 319 . . . . T T . 1.80 -0.66 * . F 3.06
1.89 Gly 320 . . . . T . . 1.09 -1.03 * * F 2.52 1.89 Ser 321 . . .
. T T . 1.33 -0.84 . * F 2.23 0.59 Ser 322 . . . . T T . 0.78 -0.44
. * F 1.59 0.47 Ser 323 . . . . T T . 0.89 0.20 . * F 0.65 0.35 Cys
324 . . . . T T . 0.63 -0.23 . * F 1.25 0.52 Asn 325 . . . . T . .
0.39 -0.19 . * . 0.90 0.60 Val 326 . . B . . . . 0.02 -0.07 . * .
0.50 0.45 Arg 327 . . B . . T . 0.01 0.11 . * . 0.10 0.45 Pro 328 .
. B . . T . 0.31
0.03 . * . 0.44 0.40 Ala 329 . . B . . T . 1.02 -0.37 . * . 1.38
0.91 Cys 330 . . B . . T . 1.02 -1.01 . * . 2.02 0.93 Thr 331 . . B
. . . . 1.63 -1.01 * * F 2.31 1.00 Asp 332 . . . . T T . 0.82 -0.69
* . F 3.40 1.55 Lys 333 . . . . T T . 0.79 -0.40 . . F 2.76 2.50
Asp 334 . . . . T T . 1.07 -0.21 . . F 2.42 2.72 Tyr 335 . . B . .
T . 1.70 -0.21 . . . 1.53 2.35 Phe 336 . . B B . . . 1.70 0.29 . .
. 0.19 1.60 Tyr 337 . . B B . . . 1.11 0.77 . . . -0.45 1.38 Thr
338 . . B B . . . 0.40 1.27 . . . -0.60 0.89 His 339 . . B B . . .
0.40 1.09 . . . -0.60 0.55 Thr 340 . . B B . . . 0.06 0.30 . . .
-0.30 0.59 Ala 341 . . B B . . . 0.76 0.04 . * . 0.00 0.41 Cys 342
. . . B T . . 0.66 -0.04 . * . 1.30 0.49 Asp 343 . . . . T T . 0.97
-0.11 . * . 2.00 0.33 Ala 344 . . . . . T C 0.69 -0.60 . * F 2.55
0.57 Asn 345 . . . . . T C 1.00 -0.61 . * F 3.00 1.54 Gly 346 . . .
. . T C 0.78 -0.79 . * F 2.70 1.60 Glu 347 . A . . . . C 0.84 -0.10
. * F 1.70 1.30 Thr 348 . A B . . . . 0.60 0.01 . * F 0.45 0.80 Gln
349 . A B . . . . 1.23 0.37 * * F 0.30 1.27 Leu 350 . A B . . . .
0.94 -0.06 * * . 0.45 1.47 Met 351 . A B . . . . 0.70 0.86 * * .
-0.45 1.07 Tyr 352 . A B . . . . 0.74 0.87 * * . -0.60 0.62 Lys 353
. A . . T . . 0.84 0.47 * * . -0.05 1.51 Trp 354 . A . . T . . 0.89
0.21 * * . 0.25 2.36 Ala 355 . A . . . . C 0.81 -0.40 . * F 0.80
3.01 Lys 356 . A . . . . C 0.74 -0.47 * * F 0.80 1.06 Pro 357 . A .
. T . . 0.69 0.10 . * F 0.25 0.54 Lys 358 . . . . T . . 0.64 -0.43
. * F 1.05 0.71 Ile 359 . . B . . . . 0.93 -0.93 . * . 0.80 0.62
Cys 360 . . B . . T . 0.71 -0.93 . * . 1.00 0.67 Ser 361 . . B . .
T . 0.67 -0.67 . * F 1.15 0.28 Glu 362 . . B . . T . 0.53 -0.67 * .
F 1.15 0.68 Asp 363 A . . . . T . -0.10 -0.93 * * F 1.30 1.26 Leu
364 A A . . . . . -0.07 -1.00 * * F 0.75 0.95 Glu 365 A A . . . . .
0.64 -0.74 * * F 0.75 0.41 Gly 366 A A . . . . . 0.13 -0.74 * * F
0.75 0.49 Ala 367 . A B . . . . -0.08 -0.06 * * . 0.30 0.49 Val 368
. A B . . . . -0.67 -0.31 * * . 0.30 0.43 Lys 369 . A B . . . .
-0.16 0.19 * * . -0.30 0.44 Leu 370 . A B . . . . -0.50 0.14 * * .
-0.30 0.59 Pro 371 . . B . . T . -1.01 0.07 * * . 0.10 0.78 Ala 372
. . . . T T . -0.38 0.07 * * F 0.65 0.29 Ser 373 . . . . T T . 0.17
0.07 * * F 0.65 0.70 Gly 374 . . . . T T . 0.09 -0.13 * * F 1.25
0.66 Val 375 . . B . . . . 0.23 -0.06 . . F 0.79 0.89 Lys 376 . . B
. . . . 0.23 0.01 . . F 0.33 0.35 Thr 377 . . B . . . . 0.61 0.06 .
. F 0.47 0.55 His 378 . . B . . . . 0.24 0.06 * . . 0.61 1.15 Cys
379 . . B . . T . 0.59 -0.01 . . . 1.40 0.31 Pro 380 . . B . . T .
1.23 0.39 * * F 0.81 0.34 Pro 381 . . . . T T . 0.84 0.33 . . F
1.07 0.39 Cys 382 . . . . T T . 0.46 0.26 . . F 0.93 0.72 Asn 383 .
. . . . T C -0.21 0.47 . . F 0.29 0.40 Pro 384 . . . . T T . 0.50
0.83 . . F 0.35 0.23 Gly 385 . . . . T T . 0.40 0.40 . . . 0.20
0.85 Phe 386 . . B . . T . 0.61 0.31 . . . 0.10 0.76 Phe 387 . . B
. . . . 1.28 0.31 . . F 0.30 0.79 Lys 388 . . . . T . . 0.98 0.29 .
. F 1.10 1.28 Thr 389 . . . . T . . 0.88 0.24 . . F 1.35 1.99 Asn
390 . . . . T . . 0.56 -0.06 * . F 2.20 3.31 Asn 391 . . . . T T .
1.26 -0.27 * . F 2.50 0.89 Ser 392 . . . . T T . 1.74 0.13 * . F
1.80 1.06 Thr 393 . . . . T T . 1.03 0.07 . . F 1.55 1.02 Cys 394 .
. . . T T . 1.13 0.24 . . F 1.15 0.34 Gln 395 . . B . . . . 0.89
0.27 . . F 0.30 0.39 Pro 396 . . B . . . . 0.54 0.64 . . F -0.25
0.43 Cys 397 . . B . . T . 0.54 0.59 . . . -0.20 0.79 Pro 398 . . B
. . T . 0.61 0.40 . . . -0.20 0.61 Tyr 399 . . . . T T . 0.98 0.76
. . . 0.20 0.62 Gly 400 . . . . T T . 0.98 0.71 . . . 0.35 1.55 Ser
401 . . . . T . . 0.84 0.54 . . F 0.30 1.61 Tyr 402 . . . . T T .
1.21 0.54 . . F 0.50 1.02 Ser 403 . . . . T T . 1.42 0.17 . . F
1.11 1.38 Asn 404 . . . . T T . 1.00 -0.26 . . F 2.02 1.71 Gly 405
. . . . T T . 1.03 -0.07 * . F 2.18 0.59 Ser 406 . . . . T T . 1.44
-0.34 * . F 2.49 0.63 Asp 407 . . . . T T . 1.02 -0.73 * . F 3.10
0.77 Cys 408 . . B . . T . 1.11 -0.56 * * F 2.39 0.42 Thr 409 . . B
. . T . 0.52 -0.56 * * F 2.39 0.48 Arg 410 . . B . . . . 0.52 -0.44
* . F 1.89 0.29 Cys 411 . . B . . T . 0.51 -0.01 . . . 1.94 0.54
Pro 412 . . . . T T . 0.51 -0.10 . . . 2.34 0.54 Ala 413 . . . . T
T . 0.97 -0.59 . * F 3.10 0.47 Gly 414 . . . . . T C 0.69 -0.16 * *
F 2.44 1.37 Thr 415 . . . . . . C -0.28 -0.23 . * F 1.78 0.89 Glu
416 . . B . . . . 0.04 -0.01 . . F 1.27 0.66 Pro 417 . . B . . . .
-0.44 -0.09 . . F 0.96 0.66 Ala 418 . . B . . . . 0.14 0.27 . * .
-0.10 0.39 Val 419 . . B . . . . 0.24 -0.21 . * . 0.50 0.39 Gly 420
. . B . . . . 0.60 0.54 . * . -0.40 0.40 Phe 421 . A B . . . . 0.31
0.11 . * . -0.30 0.79 Glu 422 . A B . . . . 0.23 0.53 . * . -0.45
1.12 Tyr 423 . A . . T . . 0.82 0.80 * * . -0.05 1.19 Lys 424 . A .
. T . . 1.37 0.77 * * . -0.05 2.21 Trp 425 . A . . T . . 0.90 0.47
* * . -0.05 1.84 Trp 426 . A . . T . . 1.39 1.16 * * . -0.20 0.97
Asn 427 . . . . . . C 1.08 0.83 * * . -0.20 0.75 Thr 428 . . . . .
. C 1.32 1.31 * . F 0.10 1.03 Leu 429 . . . . . . C 0.68 0.80 * * F
0.10 1.57 Pro 430 . . . . . T C 0.97 0.50 * . F 0.12 0.97 Thr 431 .
. . . . T C 0.94 0.10 * . F 0.54 1.16 Asn 432 . . . . . T C 0.63
0.10 * * F 0.51 2.03 Met 433 . . B . . T . 0.09 -0.10 . * F 0.88
1.90 Glu 434 . . B B . . . 0.09 0.11 . * F -0.30 0.98 Thr 435 . . B
B . . . -0.00 0.31 . . F -0.27 0.50 Thr 436 . . B B . . . -0.03
0.30 * . F -0.24 0.68 Val 437 . . B B . . . -0.92 0.11 * * F -0.21
0.39 Leu 438 . . B B . . . -0.32 0.80 * * F -0.48 0.19 Ser 439 . .
B B . . . -1.02 0.71 . * F -0.45 0.21 Gly 440 . . . B . . C -0.71
1.01 . * . -0.40 0.24 Ile 441 . A B B . . . -0.64 0.37 * * . -0.30
0.51 Asn 442 . A B B . . . 0.26 0.44 * * . -0.60 0.60 Phe 443 . A B
B . . . 0.72 0.06 * * . -0.15 1.21 Glu 444 . A B B . . . 0.42 0.06
* * . -0.15 1.71 Tyr 445 . . B . . T . 0.46 -0.01 * * . 0.85 1.05
Lys 446 . . . . T T . 1.00 0.07 * * F 0.80 1.76 Gly 447 . . . . T T
. 0.71 -0.29 * * F 1.40 1.00 Met 448 . . . . . T C 1.41 0.63 . * F
0.15 0.67 Thr 449 . . . . . . C 0.56 -0.13 . * F 0.85 0.58 Gly 450
. A . . . . C 0.21 0.51 . * . -0.40 0.44 Trp 451 . A B . . . .
-0.18 0.59 * * . -0.42 0.45 Glu 452 . A B . . . . 0.17 0.40 * . .
-0.24 0.31 Val 453 . A B . . . . 0.73 -0.09 * . . 0.84 0.52 Ala 454
. A B . . . . 0.16 -0.01 * . . 1.02 0.67 Gly 455 . . . . T . . 0.26
-0.24 * . . 1.80 0.27 Asp 456 . . . B T . . 0.23 0.51 * . . 0.52
0.57 His 457 . . B B . . . -0.36 0.36 * . . 0.24 0.82 Ile 458 . . B
B . . . -0.09 0.36 . . . 0.06 0.83 Tyr 459 . . B B . . . 0.16 0.43
* . . -0.42 0.50 Thr 460 . . B B . . . -0.09 0.86 . . . -0.60 0.37
Ala 461 . . B B . . . -0.39 0.86 . . . -0.60 0.53 Ala 462 . . B . .
. . -0.36 0.56 . . . -0.12 0.45 Gly 463 . . . . . . C 0.53 -0.20 .
. . 1.26 0.52 Ala 464 . . . . . . C 0.78 -0.29 . . F 1.69 0.83 Ser
465 . . . . . T C 0.39 -0.79 . . F 2.62 1.38 Asp 466 . . . . T T .
0.38 -0.50 . . F 2.80 1.21 Asn 467 . . . . . T C 0.08 -0.31 . . F
2.32 1.18 Asp 468 . . B . . T . -0.39 -0.13 . . F 1.69 0.62 Phe 469
. . B B . . . -0.11 0.17 . . . 0.26 0.30 Met 470 . . B B . . .
-0.62 0.66 . . . -0.32 0.27 Ile 471 . . B B . . . -1.48 0.94 . . .
-0.60 0.14 Leu 472 . . B B . . . -2.33 1.59 . . . -0.60 0.12 Thr
473 . . B B . . . -2.54 1.44 . . . -0.60 0.09 Leu 474 . . B B . . .
-2.19 1.26 . . . -0.60 0.19 Val 475 . . B B . . . -2.29 1.00 * * .
-0.60 0.23 Val 476 . . B B . . . -1.29 1.10 * . . -0.60 0.14 Pro
477 . . B . . . . -0.69 0.61 * * . -0.40 0.33 Gly 478 . . . . T . .
-0.59 0.36 * . F 0.45 0.68 Phe 479 . . B . . . . 0.22 0.14 * . F
0.45 1.42 Arg 480 . . . . . . C 0.78 -0.10 * * F 1.50 1.59 Pro 481
. . . . . T C 0.78 -0.14 * . F 1.95 2.16 Pro 482 . . . . T T . 0.39
0.07 * * F 1.80 1.85 Gln 483 . . . . T T . 0.14 -0.10 * * F 2.50
0.93 Set 484 . . B . . T . 0.84 0.40 * * F 0.95 0.61 Val 485 . . B
. . . . 0.42 -0.03 * * . 1.55 0.66 Met 486 . . B . . . . 0.63 0.03
. . . 1.00 0.55 Ala 487 . . B . . . . 0.84 -0.37 . * . 1.65 0.71
Asp 488 . . B . . T . 0.89 -0.36 . . F 2.20 1.54 Thr 489 . . . . .
T C 1.19 -1.00 . . F 3.00 3.11 Glu 490 A . . . . T . 1.19 -1.61 . .
F 2.50 5.33 Asn 491 A . . . . T . 1.20 -1.47 * * F 2.20 2.37 Lys
492 A . . . . . . 1.90 -0.97 * * F 1.70 1.66 Glu 493 A . . . . . .
1.01 -1.46 * * F 1.40 1.88 Val 494 A . . B . . . 1.01 -0.77 * * .
0.60 0.82 Ala 495 . . B B . . . 0.31 -0.69 * * . 0.60 0.59 Arg 496
. . B B . . . -0.54 0.10 * * . -0.30 0.29 Ile 497 . . B B . . .
-1.29 0.74 * * . -0.60 0.29 Thr 498 . . B B . . . -1.29 0.89 * * .
-0.60 0.25 Phe 499 . . B B . . . -0.74 0.39 * * . -0.30 0.22 Val
500 . . B B . . . -0.97 0.87 * * . -0.60 0.46 Phe 501 . . B B . . .
-1.74 0.87 * * . -0.60 0.26 Glu 502 . . B B . . . -1.16 0.96 * * .
-0.60 0.16 Thr 503 . . . B T . . -1.70 0.56 * . . -0.20 0.29 Leu
504 . . . B T . . -1.00 0.56 * * . -0.20 0.25 Cys 505 . . . B T . .
-0.81 0.17 * * . 0.10 0.23 Ser 506 . . . . T T . -0.11 0.74 * * .
0.20 0.09 Val 507 . . . . T T . -0.92 0.26 * * . 0.50 0.18 Asn 508
. . B . T T . -0.86 0.26 . * . 0.50 0.28 Cys 509 . . B . . T .
-0.74 0.44 . * . -0.20 0.33 Glu 510 . . B B . . . -0.68 0.84 . * .
-0.60 0.38 Leu 511 . . B B . . . -1.23 0.81 . * . -0.60 0.24 Tyr
512 . . B B . . . -0.72 1.06 . * . -0.60 0.33 Phe 513 . . B B . . .
-1.58 0.91 . * . -0.60 0.19 Met 514 . . B B . . . -0.91 1.56 . * .
-0.60 0.17 Val 515 . . B B . . . -1.21 1.27 . * . -0.60 0.17 Gly
516 . . B B . . . -0.29 0.90 . * . -0.32 0.27 Val 517 . . B B . . .
-0.36 0.11 . * . 0.26 0.53 Asn 518 . . . . . T C 0.34 -0.01 . * F
2.04 1.03 Ser 519 . . . . . T C 0.63 -0.26 . * F 2.32 1.67 Arg 520
. . . . T T . 1.28 -0.20 . * F 2.80 3.24 Thr 521 . . . . T T . 0.77
-0.41 . * F 2.52 3.12 Asn 522 . . . . . . C 1.62 -0.17 * * F 1.84
1.73 Thr 523 . . . . . . C 1.31 -0.56 * * F 1.86 1.53 Pro 524 . . B
. . . . 1.32 -0.07 * * F 1.08 1.53 Val 525 . . B . . . . 1.26 0.36
. * F 0.05 1.00 Glu 526 . . B . . . . 1.22 -0.04 * . F 0.80 1.38
Thr 527 . . B . . . . 0.92 -0.10 * . F 0.99 0.88 Trp 528 . . B . .
. . 1.28 -0.14 . . F 1.48 1.60 Lys 529 . . . . T . . 1.14 -0.79 . .
F 2.52 1.85 Gly 530 . . . . T . . 2.04 -0.36 . . F 2.56 1.27 Ser
531 . . . . T T . 2.04 -0.84 . . F 3.40 2.41 Lys 532 . . . . . T C
2.06 -1.36 . . F 2.86 2.08 Gly 533 . . . . T T . 2.10 -0.97 . . F
2.72 2.82 Lys 534 . . . . T T . 1.74 -0.64 . . F 2.38 3.30 Gln 535
. . . B T . . 1.84 -0.54 * . F 1.64 2.38 Ser 536 . . B B . . . 1.26
0.21 * * F 0.00 3.77 Tyr 537 . . B B . . . 0.32 0.47 * * . -0.45
1.32 Thr 538 . . B B . . . 0.67 1.16 * . . -0.60 0.53 Tyr 539 . . B
B . . . 0.62 0.76 . . . -0.60 0.69 Ile 540 . . B B . . . 0.62 0.37
* . . -0.30 0.76 Ile 541 . . B B . . . 0.61 0.01 . . . -0.04 0.85
Glu 542 . . B B . . . 0.54 0.01 . . F 0.37 0.78 Glu 543 . . B . . .
. 0.54 -0.26 . . F 1.58 1.61 Asn 544 . . . B T . . 0.49 -0.46 . . F
2.04 3.32 Thr 545 . . . B T . . 0.68 -0.76 . . F 2.60 2.57 Thr 546
. . . B . . C 1.26 0.03 . * F 1.24 1.29 Thr 547 . . . B . . C 0.97
0.51 . . F 0.68 1.15 Ser 548 . . . B . . C 0.38 1.03 * * F 0.27
0.84 Phe 549 . . B B . . . -0.32 1.04 * * . -0.34 0.59 Thr 550 . .
B B . . . -0.01 1.34 * . . -0.60 0.35 Trp 551 . . B B . . . 0.41
1.26 * . . -0.60 0.46 Ala 552 . . . B . . C 0.41 0.87 * . . -0.25
1.03 Phe 553 . . . B T . . 0.40 0.57 * * . -0.05 1.03 Gln 554 . . .
B T . . 0.40 0.57 * * . -0.05 1.42 Arg 555 . . . B . . C 0.68 0.44
. . F -0.10 1.21 Thr 556 . . . B . . C 0.97 0.44 . . F -0.10 1.91
Thr 557 . . . B . . C 0.97 -0.34 * . F 0.80 1.91 Phe 558 . . . B .
. C 1.37 -0.24 * * . 0.50 0.98 His 559 . . . B . . C 1.48 0.14 * *
. -0.10 0.91 Glu 560 . . . B . . C 1.41 -0.34 * * . 0.65 1.24 Ala
561 . . . . T . C 1.48 -0.83 * . F 1.84 2.86 Ser 562 . . . . T . .
1.48 -0.86 * . F 2.18 3.30 Arg 563 . . . . T . . 2.18 -0.87 * . F
2.52 2.75 Lys 564 . . . . T . . 2.21 -0.47 * . F 2.56 4.38 Tyr 565
. . . . T T . 1.36 -0.97 * . F 3.40 5.45 Thr 566 . . . . T T . 1.36
-0.71 * . F 3.06 2.07 Asn 567 . . B . . T . 1.70 -0.21 * . F 2.02
1.04 Asp 568 . . B . . T . 0.70 -0.21 * . F 1.68 1.33 Val 569 . . B
B . . . 0.41 -0.29 * . F 0.79 0.65 Ala 570 . . B B . . . 0.36 -0.01
* . . 0.30 0.63 Lys 571 . . B B . . . -0.22 -0.03 * . . 0.30 0.51
Ile 572 . . B B . . . -0.22 0.66 * . . -0.60 0.48 Tyr 573 . . B B .
. . -1.08 0.41 . . . -0.60 0.76 Ser 574 . . B B . . . -0.53 0.56 .
. . -0.60 0.28 Ile 575 . . B B . . . 0.06 1.04 . . . -0.60 0.58 Asn
576 . . B B . . . -0.84 0.76 . . . -0.60 0.60 Val 577 . . B B . . .
-0.56 0.64 . . . -0.60 0.33 Thr 578 . . B B . . . -0.31 0.87 . * .
-0.60 0.47 Asn 579 . . B B . . . -0.36 0.59 * * . -0.60 0.47 Val
580 . . B . . T . -0.32 0.61 * . . -0.20 0.62 Met 581 . . B . . T .
-0.91 0.61 * . . -0.20 0.32 Asn 582 . . B . . T . -0.36 0.63 * . .
-0.20 0.20 Gly 583 . . B . . T . -0.29 0.61 * . . -0.20 0.36 Val
584 . . B . . . . -0.96 0.73 * . . -0.40 0.57 Ala 585 . . B . . T .
0.01 0.69 * . . -0.20 0.19 Ser 586 . . B . . T . 0.40 0.29 * . .
0.10 0.38 Tyr 587 . . B . . T . -0.27 0.29 * * . 0.10 0.79 Cys 588
. . B . . T . -0.51 0.21 * . . 0.10 0.42 Arg 589 . . B . . T .
-0.47 0.21 . . . 0.10 0.32 Pro 590 . . B . . T . 0.12 0.51 . . .
-0.20 0.17 Cys 591 . . B . . T . -0.17 -0.24 . . . 0.70 0.54 Ala
592 . . B . . T . -0.22 -0.31 * . . 0.70 0.28 Leu 593 . . B . . . .
0.44 0.07 * . . -0.10 0.24 Glu 594 . . B . . . . -0.52 -0.36 * . .
0.75 0.75 Ala 595 . . B . . . . -0.66 -0.29 . . F 1.15 0.55 Ser 596
. . B . . . . -0.29 -0.36 . . F 1.40 0.66 Asp 597 . . . . T T .
0.00 -0.66 . . F 2.55 0.51 Val 598 . . . . T T . 0.14 -0.27 . . F
2.50 0.68 Gly 599 . . . . T T . -0.17 -0.20 * . F 2.25 0.27 Ser 600
. . . . T T . 0.12 -0.10 * . F 2.00 0.23 Ser 601 . . . . T . .
-0.24 0.29 * . F 0.95 0.42 Cys 602 . . B . . T . -0.46 0.21 . . F
0.50 0.23 Thr 603 . . B . . T . -0.19 0.21 . . F 0.25 0.26 Ser 604
. . B . . T . -0.19 0.33 . . F 0.25 0.20 Cys 605 . . B . . T .
-0.13 0.37 . . . 0.10 0.37 Pro 606 . . B . . T . -0.08 0.56 . . .
-0.20 0.40 Ala 607 . . . . T T . -0.30 0.83 . . . 0.20 0.47 Gly 608
. . B . . T . 0.01 1.13 * . . -0.20 0.61 Tyr 609 . . B . . T . 0.42
0.56 * . . -0.20 0.66 Tyr 610 . . B B . . . 1.09 0.13 * . . 0.19
1.28 Ile 611 . . B B . . . 1.00 -0.37 * . . 1.13 2.16 Asp 612 . . B
B . . . 1.24 -0.41 * . . 1.47 1.84 Arg 613 . . . . T . . 1.28 -0.74
* . F 2.86 1.16 Asp 614 . . . . T T . 0.86 -1.01 * . F 3.40 2.40
Ser 615 . . . . T T . 1.07 -1.13 * . F 2.91 0.77 Gly 616 . . . . T
T . 1.66 -0.63 * . F 2.57 0.53 Thr 617 . . . . T T . 0.99 -0.24 . .
F 1.93 0.43 Cys 618 . . . . T T . 0.67 0.33 . . . 0.84 0.17 His 619
. . . . T T . 0.46 0.37 . . . 0.50 0.27 Ser 620 . . . . T T . 0.76
0.37 . . . 0.50 0.29 Cys 621 . . B . . T . 0.79 0.29 . . . 0.10
0.86 Pro 622 . . . . . T C 0.21 0.20 . . F 0.45 0.91 Pro 623 . . .
. T T . 0.07 0.39 * . F 0.65 0.48 Asn 624 . . . . T T . 0.14 0.69 *
. F 0.35 0.74 Thr 625 . . B . . T . -0.14 0.11 * * F 0.25 0.95 Ile
626 . A B . . . . 0.49 019 * . . -0.30 0.62 Leu 627 . A B . . . .
0.70 0.26 * . . -0.30 0.53 Lys 628 . A B . . . . 0.70 0.26 * . .
-0.30 0.63 Ala 629 . A B . . . . 0.46 0.20 * . . -0.15 1.39 His 630
. A B . . . . 0.42 0.27 . . . -0.15 2.64 Gln 631 . . B . . T . 0.46
0.01 * . F 0.40 1.31 Pro 632 . . . . T T . 1.27 0.66 . * . 0.20
0.96 Tyr 633 . . . . T T . 0.63 0.56 . * . 0.35 1.22 Gly 634 . . .
. T T . 0.56 0.56 . * . 0.20 0.71 Val 635 . . B B . . . -0.27 0.73
. . . -0.60 0.25 Gln 636 . . B B . . . -0.48 0.94 . * . -0.60 0.12
Ala 637 . . B B . . . -0.93 0.61 . * . -0.60 0.18 Cys 638 . . B B .
. . -1.03 0.76 . * . -0.60 0.13 Val 639 . . B B . . . -0.90 0.54 .
. . -0.60 0.08 Pro 640 . . B . . . . -0.39 0.57 . * . -0.40 0.12
Cys 641 . . B . . . . -0.70 0.50 . . . -0.40 0.21 Gly 642 . . B . .
T . -0.07 0.41 . . F 0.29 0.42 Pro 643 . . . . T T . 0.60 -0.23 . .
F 1.93 0.54 Gly 644 . . . . T T . 1.46 -0.26 . . F 2.42 1.61 Thr
645 . . . . T T . 1.71 -0.43 . . F 2.76 2.62 Lys 646 . . . . T T .
1.49 -0.86 . . F 3.40 3.39 Asn 647 . . . . T T . 1.80 -0.60 . . F
3.06 2.40 Asn 648 . . B . . T . 1.71 -0.53 . . F 2.32 2.26 Lys 649
. . B . . T . 1.24 -0.63 . . F 1.98 1.52 Ile 650 . . B . . . . 0.89
0.06 . . . 0.24 0.78 His 651 . . B . . T . 0.60 0.23 . . . 0.10
0.26 Ser 652 . . B . . T . 0.60 0.59 . . . -0.20 0.20 Leu 653 . . B
. . T . 0.60 0.99 * . . -0.20 0.47 Cys 654 . . B . . T . -0.11 0.30
* . . 0.10 0.57 Tyr 655 . . . . T . . 0.47 0.37 . . . 0.30 0.23
Asn 656 . . . . T T . -0.20 0.47 . . . 0.20 0.40 Asp 657 . . . . T
T . -0.20 0.57 * . . 0.20 0.65 Cys 658 . . B . . T . 0.72 0.39 * .
. 0.10 0.55 Thr 659 . . B . . T . 1.39 -0.37 . . . 0.70 0.67 Phe
660 . . B . . . . 1.32 -0.37 . . . 0.80 0.65 Ser 661 . . . . T T .
1.11 0.11 . . F 1.40 1.75 Arg 662 . . . . T T . 0.80 -0.03 . . F
2.30 1.87 Asn 663 . . . . . T C 1.58 -0.03 . . F 2.40 3.12 Thr 664
. . . . . T C 1.58 -0.81 . . F 3.00 4.55 Pro 665 . . . . . T C 1.58
-0.71 * . F 2.70 3.36 Thr 666 . . . . T T . 1.88 0.07 * . F 1.70
1.81 Arg 667 . . B . . T . 1.52 0.07 * . F 1.00 2.01 Thr 668 . . B
. . T . 1.52 0.34 * * F 0.70 2.04 Phe 669 . . B . . . . 1.13 0.31 *
* . 0.05 2.27 Asn 670 . . B . . T . 1.04 0.61 * * . -0.05 1.01 Tyr
671 . . B . . T . 0.77 1.00 * . . -0.20 0.93 Asn 672 . . B . . T .
-0.16 1.01 * * . -0.05 1.09 Phe 673 . . B . . T . -0.43 0.91 * * .
-0.20 0.56 Ser 674 . A . . . . C 0.27 1.01 * * . -0.40 0.36 Ala 675
. A . . . . C -0.04 0.66 * * . -0.40 0.36 Leu 676 . A B . . . .
-0.66 0.74 * * . -0.60 0.60 Ala 677 . A B . . . . -0.97 0.60 . * .
-0.60 0.33 Asn 678 . A B . . . . -1.08 0.70 * . . -0.60 0.47 Thr
679 . . B B . . . -1.37 0.89 * . . -0.60 0.47 Val 680 . . B B . . .
-1.12 0.70 . . . -0.60 0.47 Thr 681 . . B B . . . -0.66 0.63 . . .
-0.60 0.29 Leu 682 . . B B . . . -0.28 0.66 . . . -0.60 0.20 Ala
683 . . B B . . . -0.58 0.60 . . . -0.60 0.42 Gly 684 . . . B . . C
-0.97 0.34 . . F 0.05 0.39 Gly 685 . . . . . T C -0.42 0.64 . . F
0.15 0.41 Pro 686 . . . . . T C -0.41 0.44 . * F 0.15 0.58 Ser 687
. . . . . T C 0.44 0.33 . * F 0.73 0.79 Phe 688 . . B . . T . 0.69
-0.10 . . F 1.56 1.59 Thr 689 . . B . . . . 0.22 -0.10 * . F 1.64
1.02 Ser 690 . . B . . T . 0.61 0.16 * . F 1.37 0.63 Lys 691 . . .
. T T . 0.58 -0.23 * . F 2.80 1.45 Gly 692 . . . . T T . 0.18 -0.26
* . F 2.52 1.57 Leu 693 . . . . . T C 0.84 0.04 * . F 1.44 1.02 Lys
694 . A B . . . . 1.12 0.16 * . . 0.26 0.69 Tyr 695 . A B . . . .
0.72 0.66 * . . -0.32 0.95 Phe 696 . A B . . . . 0.37 1.01 * * .
-0.60 1.00 His 697 . A B . . . . -0.10 0.81 * * . -0.60 0.72 His
698 . A B . . . . 0.41 1.50 * * . -0.60 0.38 Phe 699 . A B . . . .
-0.44 1.13 * * . -0.60 0.59 Thr 700 . A B . . . . -0.87 1.03 . * .
-0.60 0.36 Leu 701 . A . . T . . -0.51 1.10 . * . -0.20 0.14 Ser
702 . . . B T . . -0.48 1.03 . * . -0.20 0.16 Leu 703 . . . B T . .
-0.44 0.64 . * . 0.14 0.18 Cys 704 . . . B T . . -0.09 0.56 . * .
0.48 0.37 Gly 705 . . . B T . . 0.33 0.30 * . F 1.27 0.28 Asn 706 .
. . . T T . 1.19 -0.09 * . F 2.61 0.66 Gln 707 . . . . T T . 0.89
-0.77 * . F 3.40 2.45 Gly 708 . . . . T T . 1.40 -0.73 * . F 3.06
2.45 Arg 709 . . . . T T . 1.21 -0.77 * . F 2.72 2.04 Lys 710 . . B
B . . . 0.89 -0.53 * . F 1.43 0.87 Met 711 . . B B . . . 0.58 -0.36
* . . 0.64 0.47 Ser 712 . . B B . . . 0.58 -0.30 * . . 0.30 0.35
Val 713 . . B B . . . 0.92 -0.30 * . . 0.30 0.29 Cys 714 . . B . .
T . -0.04 0.10 * . . 0.10 0.47 Thr 715 . . B . . T . -0.40 0.13 * *
. 0.10 0.26 Asp 716 . . B . . T . 0.20 0.23 * . F 0.25 0.51 Asn 717
. . B . . T . -0.31 -0.41 * * F 1.00 1.59 Val 718 . . B B . . .
0.66 -0.30 . * F 0.45 0.91 Thr 719 . . B B . . . 0.43 -0.79 . * F
0.90 1.07 Asp 720 . . B B . . . 0.53 -0.10 . * F 0.45 0.46 Leu 721
. . B B . . . 0.53 -0.07 . * F 0.76 0.97 Arg 722 . . B B . . . 0.19
-0.71 . * F 1.52 1.16 Ile 723 . . B . . T . 1.04 -0.77 . * F 2.08
0.69 Pro 724 . . B . . T . 1.06 -0.77 . * F 2.54 1.44 Glu 725 . . .
. T T . 0.71 -1.07 . * F 3.10 0.99 Gly 726 . . . . . T C 0.82 -0.64
. * F 2.74 1.40 Glu 727 . . . . T T . 0.41 -0.54 * . F 2.48 0.78
Ser 728 . . . . . T C 1.34 -0.59 * . F 2.10 0.60 Gly 729 . . . . T
T . 1.26 -0.59 * . F 2.27 1.22 Phe 730 . . . . T T . 0.37 -0.63 * .
F 1.94 0.95 Ser 731 . . . . . T C 0.40 0.06 * . F 0.97 0.49 Lys 732
. . . . T T . -0.19 0.16 * . F 1.30 0.72 Ser 733 . . . . T T .
-0.13 0.23 * . F 1.17 0.84 Ile 734 . . B . . T . -0.64 0.20 * . .
0.49 0.98 Thr 735 . . B B . . . -0.61 0.46 * . . -0.34 0.37 Ala 736
. . B B . . . -0.31 1.03 * . . -0.47 0.15 Tyr 737 . . B B . . .
-0.94 1.04 * . . -0.60 0.36 Val 738 . . B B . . . -1.50 0.86 . . .
-0.60 0.25 Cys 739 . . B B . . . -1.50 1.01 . . . -0.60 0.19 Gln
740 . . B B . . . -2.08 1.20 . . . -0.60 0.08 Ala 741 . . B B . . .
-1.70 1.13 . . . -0.60 0.08 Val 742 . . B B . . . -1.67 0.91 . . .
-0.60 0.23 Ile 743 . . B B . . . -0.81 0.77 . . . -0.60 0.20 Ile
744 . . B B . . . -1.00 0.37 . . . -0.30 0.35 Pro 745 . . B . . T .
-1.31 0.51 . * . -0.20 0.35 Pro 746 . . B . . T . -1.07 0.36 . * F
0.42 0.71 Glu 747 . . B . . T . -0.46 0.10 . . F 0.74 1.01 Val 748
. . B . . T . 0.48 0.17 . . F 0.91 1.02 Thr 749 . . B . . T. . 0.78
-0.26 . * F 1.68 1.32 Gly 750 . . B . . T . 0.64 -0.19 . . F 1.70
0.77 Tyr 751 . . B . . T . 0.00 0.24 . . F 1.08 1.03 Lys 752 . . B
. . T . -0.30 0.24 . . F 0.76 0.53 Ala 753 . . B . . . . 0.26 0.14
. * F 0.39 0.71 Gly 754 . . B . . . . 0.57 0.10 . * F 0.22 0.61 Val
755 . . B . . . . 0.70 -0.26 . * F 0.65 0.53 Ser 756 . . B . . . .
0.09 0.17 . * F 0.05 0.81 Ser 757 . . B . . . . -0.26 0.31 . * F
0.05 0.61 Gln 758 . . B . . . . -0.48 0.27 . . F 0.20 1.10 Pro 759
. . B . . . . -0.72 0.31 . . F 0.05 0.67 Val 760 . A B . . . . 0.13
0.43 * * F -0.45 0.51 Ser 761 . A B . . . . 0.54 0.04 * * . -0.30
0.49 Leu 762 . A B . . . . 0.03 -0.36 * . . 0.30 0.62 Ala 763 . A B
. . . . -0.86 -0.10 * * . 0.30 0.69 Asp 764 . A B B . . . -0.99
-0.06 * * . 0.30 0.36 Arg 765 . A B B . . . -0.99 -0.01 * * . 0.30
0.43 Leu 766 . . B B . . . -1.00 -0.06 * . . 0.30 0.32 Ile 767 . .
B B . . . -0.50 -0.07 * . . 0.30 0.28 Gly 768 . . B B . . . 0.09
0.41 * . . -0.60 0.20 Val 769 . . B B . . . -0.51 0.41 * . . -0.60
0.41 Thr 770 . . B B . . . -0.93 0.34 * * F -0.15 0.58 Thr 771 . .
B B . . . -0.93 0.14 . * F -0.15 0.85 Asp 772 . . B B . . . -0.04
0.40 . * F -0.45 0.94 Met 773 . . B B . . . -0.04 -0.24 . * F 0.60
1.09 Thr 774 . . B B . . . -0.08 -0.30 . * . 0.30 0.75 Leu 775 . .
B B . . . -0.08 -0.10 * * F 0.45 0.31 Asp 776 . . . B T . . -0.07
0.39 * * F 0.25 0.46 Gly 777 . . . B T . . -0.28 0.16 * * F 0.34
0.42 Ile 778 . . . B . . C -0.27 0.10 * . F 0.23 0.79 Thr 779 . . .
B . . C 0.04 -0.09 * * F 0.92 0.48 Ser 780 . . . . . T C 0.04 -0.09
* . F 1.41 0.84 Pro 781 . . . . . T C -0.66 0.17 * . F 0.90 0.99
Ala 782 . . B . . T . -0.34 0.27 * . F 0.61 0.59 Glu 783 . . B . .
T . -0.27 0.29 . * . 0.37 0.60 Leu 784 . A B . . . . 0.04 0.59 . .
. -0.42 0.32 Phe 785 . A B . . . . 0.04 0.16 . . . -0.21 0.55 His
786 . A B . . . . -0.56 0.04 . . . -0.30 0.43 Leu 787 . A B . . . .
-0.31 0.73 . . . -0.60 0.43 Glu 788 . A B . . . . -1.20 0.47 . . .
-0.60 0.49 Ser 789 . . . . T . . -0.60 0.37 . . . 0.30 0.25 Leu 790
. . . . T . . 0.10 0.30 . . . 0.30 0.47 Gly 791 . . . . . . C -0.72
-0.39 . . . 0.70 0.45 Ile 792 . . . B . . C -0.80 0.26 . . F 0.05
0.25 Pro 793 . . B B . . . -1.50 0.56 . . F -0.45 0.21 Asp 794 . .
B B . . . -1.90 0.66 . . . -0.60 0.19 Val 795 . . B B . . . -1.33
1.01 * * . -0.60 0.23 Ile 796 . . B B . . . -0.88 1.09 * . . -0.60
0.23 Phe 797 . . B B . . . -0.29 0.66 * * . -0.60 0.27 Phe 798 . .
B B . . . -0.08 1.04 . * . -0.60 0.50 Tyr 799 . . B . . . . -0.08
0.80 . . . 0.09 1.14 Arg 800 . . . . T T . -0.08 0.11 . . F 1.48
2.19 Ser 801 . . . . T T . 0.50 -0.03 . . F 2.42 1.88 Asn 802 . . .
. T T . 1.20 -0.33 * . F 2.76 1.73 Asp 803 . . . . T T . 1.60 -0.69
* . F 3.40 1.53 Val 804 . . . . T . . 1.18 -0.30 . . F 2.56 1.53
Thr 805 . . B . . . . 0.77 -0.11 * . F 1.67 0.51 Gln 806 . . B . .
. . 0.77 -0.13 * . F 1.33 0.41 Ser 807 . . B . . . . 0.42 0.26 * *
F 0.67 0.74 Cys 808 . . B . . T . 0.53 0.04 * * F 0.81 0.51 Ser 809
. . . . T T . 1.09 -0.44 * * F 2.09 0.57 Ser 810 . . . . T T . 1.09
-0.46 . * F 2.37 0.57 Gly 811 . . . . T T . 0.78 -0.36 . . F 2.80
1.54 Arg 812 . . . B T . . 0.19 -0.44 . . F 2.12 1.66 Ser 813 . . .
B T . . 0.97 -0.14 * * F 1.69 0.87 Thr 814 . . B B . . . 0.41 -0.53
* * F 1.46 1.72 Thr 815 . . B B . . . 0.82 -0.31 . * F 0.73 0.65
Ile 816 . . B B . . . 0.50 -0.31 . * F 0.45 0.95 Arg 817 . . B B .
. . 0.09 -0.13 . * . 0.30 0.35 Val 818 . . B B . . . 0.18 -0.23 . *
. 0.64 0.33 Arg 819 . . B B . . . 0.49 -0.29 . * . 0.98 0.73 Cys
820 . . B B . . . 0.84 -0.57 . * . 1.62 0.64 Ser 821 . . . . . T C
1.42 -0.57 * * F 2.86 1.73 Pro 822 . . . . T T . 0.46 -0.73 * * F
3.40 1.27 Gln 823 . . . . T T . 1.10 -0.09 * * F 2.76 1.76 Lys 824
. . B . . T . 0.64 -0.23 . * F 2.02 2.03 Thr 825 . . B . . . . 1.01
-0.19 . . F 1.48 1.30 Val 826 . . B . . T . 0.50 -0.23 . . F 1.34
1.01 Pro 827 . . B . . T . -0.10 0.06 . . F 0.25 0.42 Gly 828 . . B
. . T . -0.91 0.74 . . F -0.05 0.24 Ser 829 . . B . . T . -1.17
0.94 . . F -0.05 0.26 Leu 830 . . B . . . . -1.20 0.73 . * F -0.25
0.26 Leu 831 . . B . . . . -0.66 0.73 . * F -0.40 0.26 Leu 832 . .
B . . T . -1.11 0.79 . . F -0.05 0.28 Pro 833 . . B . . T . -1.07
0.97 . . F -0.05 0.18 Gly 834 . . . . T T . -0.77 0.67 . . F 0.35
0.30 Thr 835 . . B . . T . -0.30 -0.01 . . F 1.16 0.61 Cys 836 . .
. . T T . 0.20 -0.27 . . F 1.87 0.39 Ser 837 . . . . T T . 0.34
-0.21 . . F 2.18 0.57 Asp 838 . . . . T T . 0.56 -0.07 . . F 2.49
0.21 Gly 839 . . . . T T . 0.56 -0.56 . . F 3.10 0.66 Thr 840 . . .
. T . . 0.20 -0.70 * . F 2.59 0.48 Cys 841 . . . . T T . 0.87 -0.51
* . F 2.48 0.16 Asp 842 . . . . T T . 0.47 -0.11 . . F 1.87 0.25
Gly 843 . . . . T T . 0.43 0.24 . * F 0.96 0.15 Cys 844 . . . . T T
. 0.08 0.26 . . . 0.50 0.38 Asn 845 . A B . . . . -0.42 0.47 . . .
-0.60 0.20 Phe 846 . A B . . . . -0.04 1.16 . * . -0.60 0.17 His
847 . A B . . . . -0.04 1.64 . * . -0.60 0.33 Phe 848 . A B . . . .
0.00 1.07 * * . -0.60 0.35 Leu 849 . A . . T . . 0.08 1.06 . * .
-0.20 0.54 Trp 850 . A . . T . . -0.51 0.77 . * . -0.20 0.40 Glu
851 . A . . T . . -0.40 0.77 . * . -0.20 0.47 Ser 852 . A . . T . .
-1.03 0.49 . . . -0.20 0.58 Ala 853 . A . . T . . -0.54 0.37 . . .
0.10 0.29 Ala 854 . A . . T . . -0.54 -0.11 . . . 0.70 0.26 Ala 855
. A . . T . . -0.92 0.57 . . . -0.20 0.16 Cys 856 . . . . . T C
-1.22 0.76 . . . 0.00 0.09 Pro 857 . . B . . T . -1.78 0.64 . . .
-0.20 0.11 Leu 858 . . B . . T . -1.78 0.79 * . . -0.20 0.08 Cys
859 . . B . . T . -1.19 0.79 * . . -0.20 0.16 Ser 860 . . B B . . .
-0.84 0.21 . . . -0.30 0.17 Val 861 . . B B . . . -0.21 0.54 . . .
-0.60 0.32 Ala 862 . . B B . . . -0.59 0.36 . . . -0.30 0.82 Asp
863 . . B . . . . -0.67 0.29 . . . -0.10 0.62 Tyr 864 . . B B . . .
-0.86 0.59 . . . -0.60 0.58 His 865 . . B B . . . -0.86 0.59 . . .
-0.60 0.43 Ala 866 . . B B . . . -0.30 0.47 . . . -0.60 0.34 Ile
867 . . B B . . . -0.38 0.86 . . . -0.60 0.29 Val 868 . . B B . . .
-1.23 0.67 . . . -0.60 0.12 Ser 869 . . B B . . . -1.58 0.81 . . .
-0.60 0.09 Ser 870 . . B B . . . -1.89 0.81 . . . -0.60 0.12 Cys
871 . . B B . . . -2.19 0.56 * . . -0.60 0.16 Val 872 . . B B . . .
-1.30 0.60 * . . -0.60 0.09 Ala 873 . . B B . . . -0.40 0.61 * . .
-0.60 0.11 Gly 874 . . B B . . . -0.41 0.23 * . . -0.30 0.41 Ile
875 . . B B . . . -0.42 0.14 * . . -0.30 0.80 Gln 876 . . B B . . .
0.00 -0.01 . . F 0.60 1.15 Lys 877 . . B B . . . 0.00 0.24 * . F
0.00 1.82 Thr 878 . . B B . . . 0.30 0.46 * * F -0.30 1.92 Thr 879
. . B B . . . 0.76 0.69 * . F -0.30 1.17 Tyr 880 . . B B . . . 1.64
0.29 * . . -0.15 1.14 Val 881 . A B B . . . 1.43 0.29 * . . -0.15
1.37 Trp 882 . A B B . . . 1.43 0.23 * * . -0.15 1.47 Arg 883 . A B
B . . . 0.93 -0.26 * . F 0.60 1.88 Glu 884 . A B B . . . 0.58 -0.33
* . F 0.85 2.09 Pro 885 . A . . T . . 0.52 -0.40 * . F 1.50 1.06
Lys 886 . A . . T . . 1.03 -0.93 * . F 1.90 0.73 Leu 887 . A . . T
. . 0.98 -0.50 * . F 1.85 0.42 Cys 888 . . . . T T . -0.02 -0.07 *
. F 2.50 0.27 Ser 889 . . . . T T . -0.32 0.19 . * F 1.65 0.09 Gly
890 . . . . T T . -0.92 0.57 * * F 1.10 0.15 Gly 891 . . . . T T .
-1.18 0.57 * . F 0.85 0.23 Ile 892 . . . . . . C -0.37 0.43 * . F
0.20 0.27 Ser 893 . . . . . . C 0.30 0.04 . . F 0.25 0.47 Leu 894 .
. B . . . . 0.71 0.01 . * F 0.05 0.82 Pro 895 . . B . . . . 0.20
-0.41 . * F 0.80 2.30 Glu 896 . . B B . . . 0.23 -0.46 . * F 0.60
1.27 Gln 897 . . B B . . . 0.23 -0.36 . * F 0.60 2.23 Arg 898 . . B
B . . . -0.13 -0.36 . * F 0.60 1.01 Val 899 . . B B . . . 0.72
-0.21 . * . 0.30 0.31 Thr 900 . . B B . . . 0.62 -0.21 . * . 0.30
0.36 Ile 901 . . B B . . . -0.27 -0.13 . * . 0.30 0.27 Cys 902 . .
B B . . . -0.27 0.56 . * . -0.60 0.25 Lys 903 . . B B . . . -1.08
-0.09 * * . 0.30 0.29 Thr 904 . . B B . . . -0.51 0.21 * * . -0.30
0.36 Ile 905 . . B B . . . -1.01 0.44 * * . -0.60 0.71 Asp 906 . .
B B . . . -0.08 0.56 * * . -0.60 0.29 Phe 907 . . B B . . . -0.27
0.56 * * . -0.60 0.40 Trp 908 . . B B . . . -0.66 0.71 * * . -0.60
0.43 Leu 909 . . B B . . . -1.23 0.46 * * . -0.60 0.25 Lys 910 . .
B B . . . -0.64 1.14 * * . -0.60 0.20 Val 911 . . . B T . . -1.23
0.74 * * . -0.20 0.26 Gly 912 . . . B T . . -0.88 0.33 * * . 0.10
0.32 Ile 913 . . . B T . . -0.90 0.07 * * . 0.10 0.16 Ser 914 . . .
. . T C -0.76 0.56 * * . 0.00 0.31 Ala 915 . . . . T T . -1.11 0.49
. * F 0.35 0.17 Gly 916 . . . . T T . -0.84 0.54 . . F 0.35 0.34
Thr 917 . . B . . T . -1.39 0.36 . . F 0.25 0.26 Cys 918 . . B B .
. . -1.31 0.66 . . . -0.60 0.18 Thr 919 . . B B . . . -1.82 0.84 .
. . -0.60 0.15 Ala 920 . . B B . . . -1.54 1.10 . . . -0.60 0.09
Ile 921 . . B B . . . -2.06 1.10 . . . -0.60 0.23 Leu 922 . . B B .
. . -2.56 1.17 . . . -0.60 0.12 Leu 923 . . B B . . . -2.20 1.37 .
. . -0.60 0.10 Thr 924 . . B B . . . -2.56 1.36 . . . -0.60 0.20
Val 925 . . B B . . . -2.21 1.24 . . . -0.60 0.13 Leu 926 . . B B .
. . -2.02 1.31 . . . -0.60 0.25 Thr 927 . . B B . . . -1.50 1.41 *
. . -0.60 0.15 Cys 928 . . B B . . . -0.64 1.84 * . . -0.60 0.21
Tyr 929 . . B B . . . -0.29 1.20 . . . -0.60 0.51 Phe 930 . . . B T
. . 0.57 0.51 . . . -0.20 0.70 Trp 931 . . . B T . . 1.38 0.43 * .
. 0.29 2.10 Lys 932 . . . . . T C 1.73 0.26 * . F 1.28 2.32 Lys 933
. . . . T T . 1.59 -0.50 * * F 2.42 5.37 Asn 934 . . . . . T C 1.83
-0.60 * * F 2.86 4.21 Gln 935 . . . . T T . 2.29 -1.51 * * F 3.40
3.65 Lys 936 . . B . . . . 2.62 -0.76 * * F 2.46 2.86 Leu 937 . . B
. . . . 2.33 -0.76 * * F 2.32 3.55 Glu 938 . . B . . . . 1.99 -0.40
* * . 1.73 3.21 Tyr 939 . . B . . T . 2.03 -0.41 * * . 1.79 2.15
Lys 940 . . B . . T . 1.22 -0.41 * * F 1.80 5.22 Tyr 941 . . B . .
T . 0.32 -0.41 * * F 2.00 2.49 Ser 942 . . B . . T . 0.53 0.23 * *
F 1.20 1.18 Lys 943 . A B . . . . 0.53 0.09 * * F 0.45 0.58 Leu 944
. A B . . . . 0.19 0.49 * . . -0.20 0.60 Val 945 . A B . . . .
-0.17 0.23 * * . -0.10 0.45 Met 946 . A B . . . . -0.73 0.33 * * .
-0.30 0.33 Asn 947 . A B . . . . -0.39 1.01 . * . -0.60 0.33 Ala
948 . A B . . . . -0.43 0.33 * * . -0.30 0.88 Thr 949 . A B . . . .
-0.29 -0.31 . * . 0.65 1.48 Leu 950 . A B . . . . 0.57 -0.36 * . F
0.85 0.49 Lys 951 . A B . . . . 0.36 -0.76 . * F 1.35 0.82 Asp 952
. . . . T T . 0.14 -0.57 . * F 2.35 0.47 Cys 953 . . B . . T . 0.14
-0.63 . . . 2.00 0.87 Asp 954 . . B . . T . -0.13 -0.81 . . . 1.80
0.44 Leu 955 . . B . . T . 0.68 -0.31 . . . 1.30 0.27 Pro 956 . . B
. . . . 0.33 -0.31 . . . 0.90 0.83 Ala 957 . . . . T . . -0.33
-0.50 . * . 1.10 0.67 Ala 958 A . . . . . . -0.26 0.07 . . . -0.10
0.43 Asp 959 A . . . . T . -1.14 -0.11 . . . 0.70 0.28 Ser 960 . .
B . . T . -0.93 0.14 . . . 0.10 0.20 Cys 961 . . B . . T . -0.72
0.26 . . . 0.10 0.19 Ala 962 . . B . . T . -0.48 -0.24 . . . 0.70
0.20 Ile 963 . A B . . . . 0.11 0.19 . . . -0.30 0.15 Met 964 . A B
. . . . 0.11 -0.20 . . . 0.30 0.48 Glu 965 . A B . . . . -0.44
-0.77 . . F 0.75 0.79 Gly 966 . A . . . . C 0.22 -0.63 * . F 0.95
0.83 Glu 967 A A . . . . . 0.81 -1.31 * . F 0.90 1.46 Asp 968 A A .
. . . . 1.70 -1.93 * . F 0.90 1.41 Val 969 A A . . . . . 1.49 -1.93
* . F 0.90 2.38 Glu 970 A A . . . . . 0.60 -1.67 * . F 0.90 1.13
Asp 971 A A . . . . . 0.24 -0.99 * . F 0.75 0.48 Asp 972 A A . . .
. . -0.07 -0.20 . * F 0.45 0.55 Leu 973 A A . . . . . -0.37 -0.36 *
* . 0.30 0.46 Ile 974 A A . . . . . 0.53 0.03 . * . -0.30 0.37 Phe
975 . A B . . . . 0.53 0.03 . . . -0.30 0.44 Thr 976 . A B . . . .
0.50 0.43 . . F -0.45 0.87 Ser 977 . . . . . T C 0.20 0.24 . . F
0.60 1.68 Lys 978 . . . . T T . 0.20 -0.06 . . F 1.40 2.60 Asn 979
. . . . . T C 0.74 -0.16 * . F 1.48 1.49 His 980 . . . . . T C 1.56
-0.21 * * F 1.76 1.10 Ser 981 . . . . . . C 1.57 -0.60 . * . 1.99
1.07 Leu 982 . . . . T
. . 1.87 -0.21 . . . 2.02 0.90 Gly 983 . . . . T T . 1.79 -0.21 . .
F 2.80 1.06 Arg 984 . . . . T T . 0.98 -0.21 * . F 2.52 1.07 Ser
985 . . . . T T . 0.80 0.09 * . F 1.88 1.07 Asn 986 . . . . T T .
0.89 -0.17 * * F 2.44 1.68 His 987 . . . . . . C 1.81 -0.17 * * F
2.00 1.33 Leu 988 . . . . . . C 1.81 -0.17 * * F 1.96 1.94 Pro 989
. . . . . T C 0.89 -0.13 * * F 2.40 1.19 Pro 990 . . . . T T . 0.38
0.16 . * F 1.61 0.72 Arg 991 . . . . T T . -0.22 0.34 . * F 1.37
0.72 Gly 992 . . B . . T . -0.19 0.27 . * F 0.73 0.46 Leu 993 . A B
. . . . -0.19 -0.16 . * . 0.54 0.50 Leu 994 . A B . . . . -0.29
0.10 * . . -0.30 0.21 Met 995 . A B . . . . -0.08 0.59 * . . -0.60
0.31 Asp 996 . A B . . . . -0.86 0.56 * . . -0.60 0.64 Leu 997 . A
B . . . . -0.40 0.44 . . . -0.60 0.42 Thr 998 . A B . . . . 0.02
-0.24 . . . 0.30 0.83 Gln 999 . A B . . . . 0.44 -0.43 . . F 0.45
0.63 Cys 1000 . A B . . . . 0.66 0.00 . . . -0.30 0.98 Arg 1001 . A
B . . . . 0.27 -0.26 . . . 0.30 0.87
[0125]
4TABLE IV Res Pos I II III IV V VI VII VIII IX X XI XII XIII XIV
Met 1 . A . . . . C 0.68 -0.13 . * . 0.50 0.57 Asp 2 . A . . T . .
1.07 -0.56 . * . 1.00 0.78 Cys 3 . A . . T . . 1.46 -0.59 . . .
1.34 0.98 Gln 4 . A . . T . . 1.60 -1.01 . * . 1.83 1.71 Glu 5 . A
. . T . . 1.70 -0.87 . * F 2.32 1.61 Asn 6 . . . . T T . 2.30 0.04
. * F 2.16 3.15 Glu 7 . . . . T T . 2.30 -0.53 . . F 3.40 3.04 Tyr
8 . . . . T T . 2.68 -0.53 * . F 3.06 3.04 Trp 9 . . . . T T . 2.33
0.39 * * . 1.67 1.99 Asp 10 . . . . T T . 2.44 0.41 * * . 1.03 1.14
Gln 11 . . . . T T . 1.78 0.41 * . F 0.84 1.42 Trp 12 . . . . T T .
0.92 0.23 * . . 0.50 0.72 Gly 13 . . . . T T . 0.86 -0.04 * . .
1.10 0.32 Arg 14 . . . B T . . 0.48 0.44 * . . -0.20 0.27 Cys 15 .
. . B T . . 0.48 0.61 * * . -0.20 0.14 Val 16 . . . B T . . 0.59
0.10 * * . 0.35 0.24 Thr 17 . . . B T . . 0.21 -0.33 * * . 1.20
0.24 Cys 18 . . . . T T . 0.21 0.24 . * . 1.25 0.24 Gln 19 . . . .
T T . -0.11 0.10 . * . 1.50 0.32 Arg 20 . . . . T T . 0.21 -0.11 .
. F 2.50 0.34 Cys 21 . . . . T T . 1.07 -0.17 . . F 2.25 0.63 Gly
22 . . . . . T C 1.38 -0.34 . . F 1.80 0.63 Pro 23 . . . . T T .
1.23 -0.74 . . F 2.05 0.56 Gly 24 . . . . T T . 0.93 -0.06 . . F
1.81 0.86 Gln 25 . . . . T T . 0.87 -0.24 . * F 2.02 1.16 Glu 26 .
. . . T . . 1.53 -0.67 * . F 2.43 1.50 Leu 27 . . . . T . . 1.21
-1.10 * . F 2.74 2.54 Ser 28 . . . . T T . 1.08 -0.96 * . F 3.10
0.79 Lys 29 . . . . T T . 1.18 -0.93 * . F 2.79 0.45 Asp 30 . . . .
T T . 0.83 -0.17 * . F 2.18 0.85 Cys 31 . . . . T T . 0.83 -0.43 .
* F 2.21 0.63 Gly 32 . . . . T . . 1.30 -0.81 . . . 2.19 0.55 Tyr
33 . . . . T . . 1.26 -0.39 . . F 2.07 0.32 Gly 34 . . . . . T C
1.21 0.04 . . F 1.81 0.60 Glu 35 . . . . T T . 0.62 -0.53 . . F
3.40 1.01 Gly 36 . . . . T T . 1.04 -0.46 . . F 2.61 0.65 Gly 37 .
. . . T T . 1.10 -0.46 * . F 2.42 1.03 Asp 38 . . . . T . . 1.31
0.03 * . F 1.13 0.62 Ala 39 . . . . . . C 1.36 0.53 * . . 0.14 0.86
Tyr 40 . . . . T . . 0.54 0.49 * . . 0.15 1.16 Trp 41 . . B . . . .
0.68 0.74 * . . -0.40 0.57 His 42 . . . . . . C 0.72 1.17 * * .
-0.20 0.88 Ser 43 . . . . . . C 0.42 1.06 . . . -0.20 0.75 Leu 44 .
. . . . T C 1.01 0.69 . . F 0.15 0.96 Pro 45 . . . . T T . 1.01
0.17 * * F 1.04 1.22 Ser 46 . . . . T T . 1.34 0.43 * . F 0.98 1.42
Ser 47 . . . . T T . 1.08 0.04 . . F 1.52 3.45 Gln 48 . . . . T . .
1.08 -0.26 . * F 2.16 2.99 Tyr 49 . . . . T . . 1.60 -0.30 . * F
2.40 2.99 Lys 50 . . . . T . . 1.47 0.23 . * F 1.56 2.35 Ser 51 . .
. . T T . 1.73 0.27 . * F 1.52 1.34 Ser 52 . . . . T T . 2.00 0.37
. * F 1.28 1.17 Trp 53 . . . . T T . 2.04 0.11 . * . 0.74 0.79 Gly
54 . . . . T T . 1.62 0.11 . * . 0.87 1.18 His 55 . . . . T . .
1.58 0.30 . * . 0.74 0.47 His 56 . . . . T . . 1.58 0.31 . . . 0.96
0.78 Lys 57 . . . . T . . 1.21 -0.21 . * . 1.93 1.06 Cys 58 . . . .
T T . 0.61 -0.07 . * . 2.20 0.42 Gln 59 . . . . T T . 0.64 0.11 * *
. 1.38 0.21 Ser 60 . . . . T T . 0.01 0.10 * * . 1.16 0.15 Cys 61 .
. . . T T . -0.54 0.67 * * . 0.64 0.15 Ile 62 . . B B . . . -1.44
0.60 * * . -0.38 0.09 Thr 63 . . B B . . . -1.67 0.84 . * . -0.60
0.05 Cys 64 . . B B . . . -1.67 1.14 . . . -0.60 0.07 Ala 65 . . B
B . . . -1.26 0.97 * * . -0.60 0.15 Val 66 . . B B . . . -1.44 0.29
* * . -0.30 0.20 Ile 67 . . B B . . . -0.56 0.44 * * . -0.34 0.28
Asn 68 . . . B T . . -0.20 0.27 * . . 0.62 0.48 Arg 69 . . . B T .
. -0.39 -0.23 * . . 1.63 1.30 Val 70 . . . B T . . 0.20 -0.23 * . F
2.04 1.38 Gln 71 . . . B T . . 0.39 -0.51 * . F 2.60 1.38 Lys 72 .
. . B T . . 0.97 -0.34 * . F 1.89 0.38 Val 73 . . . B T . . 0.76
0.14 * . . 0.88 0.73 Asn 74 . . . B T . . 0.33 -0.07 * * . 1.22
0.65 Cys 75 . . . B T . . 0.89 0.01 * * F 0.51 0.47 Thr 76 . . . .
. T C 0.89 0.40 . * F 0.45 0.85 Pro 77 . . . . T T . 0.26 0.16 . *
F 0.65 0.85 Thr 78 . . . . T T . 0.26 0.26 . * F 0.80 1.61 Ser 79 .
. . . T T . -0.41 0.33 . . F 0.65 0.83 Asn 80 . . . . T . . -0.09
0.41 . . F 0.15 0.29 Ala 81 . . . . T . . 0.22 0.41 . . . 0.00 0.20
Val 82 . . . . T . . -0.23 -0.07 . . . 0.90 0.24 Cys 83 . . . . T T
. -0.73 0.11 . . . 0.50 0.08 Gly 84 . . . . T T . -0.64 0.40 * * .
0.50 0.07 Asp 85 . . . . T T . -0.53 0.33 * * . 0.50 0.14 Cys 86 .
. B . . T . -0.64 -0.31 * * . 0.70 0.51 Leu 87 . . B . . . . -0.03
-0.10 * * . 0.81 0.44 Pro 88 . . . . T T . 0.74 0.23 * * . 1.12
0.42 Arg 89 . . . . T T . 1.13 0.23 * * . 1.58 1.52 Phe 90 . . . .
T T . 0.82 -0.34 * * . 2.49 3.69 Tyr 91 . . . . T T . 1.60 -0.54 *
* . 3.10 3.44 Arg 92 . . . B T . . 1.52 -0.97 * * F 2.54 3.44 Lys
93 . . . B T . . 1.39 -0.29 * * F 1.93 2.79 Thr 94 . . . B T . .
0.93 -0.64 * * F 1.92 1.76 Arg 95 . . . B T . . 0.82 -0.97 * * F
1.46 0.89 Ile 96 . . . B T . . 1.07 -0.29 . . F 0.85 0.37 Gly 97 .
. . . T . . 0.96 0.11 . . F 0.45 0.44 Gly 98 . A . . T . . 0.91
-0.37 . * F 0.85 0.38 Leu 99 . A . . . . C 1.22 0.03 * * F 0.05
0.93 Gln 100 . A . . T . . 0.44 -0.66 . * F 1.30 1.62 Asp 101 . A .
. T . . 0.44 -0.51 . . F 1.15 0.88 Gln 102 . A . . T . . 0.58 -0.26
. . F 0.85 0.75 Glu 103 . A . . T . . 0.26 -0.51 . . F 1.15 0.67
Cys 104 . A . . T . . 0.76 -0.34 . * . 0.70 0.21 Ile 105 . . B . .
. . 0.80 0.14 . . . -0.10 0.18 Pro 106 . . . . T . . 0.80 -0.26 . .
. 0.90 0.21 Cys 107 . . . . T T . 0.49 0.14 * . . 0.50 0.67 Thr 108
. . . . T T . 0.28 0.06 * . F 1.10 1.37 Lys 109 . . . . T T . 0.63
-0.20 . . F 2.00 1.37 Gln 110 . . . . . T C 1.22 -0.14 . . F 2.10
3.69 Thr 111 . . . . . T C 1.43 -0.33 . . F 2.40 3.43 Pro 112 . . .
. . T C 1.24 -0.81 . * F 3.00 2.97 Thr 113 . . . . T T . 1.56 -0.17
. * F 2.60 1.27 Ser 114 . . . . . T C 0.84 -0.17 . * F 2.10 1.53
Glu 115 . A . . T . . 0.26 -0.09 * * F 1.45 0.53 Val 116 . A B . .
. . -0.13 -0.01 * * . 0.60 0.37 Gln 117 . A B . . . . 0.08 0.29 * *
. -0.30 0.24 Cys 118 . A B . . . . -0.42 0.30 * * . -0.30 0.24 Ala
119 A A . . . . . -0.42 0.99 * * . -0.60 0.27 Phe 120 A A . . . . .
-1.23 0.73 . * . -0.60 0.21 Gln 121 A A . . . . . -1.23 1.01 . * .
-0.60 0.32 Leu 122 . A . . . . C -1.23 1.09 . * . -0.40 0.23 Ser
123 . A . . . . C -1.16 0.59 . * . -0.40 0.47 Leu 124 . A . . . . C
-0.57 0.30 . * . -0.10 0.27 Val 125 . A . . . . C -0.46 -0.10 . * .
0.50 0.55 Glu 126 . A . . . . C -0.67 -0.29 . * . 0.50 0.41 Ala 127
. A . . T . . -0.17 -0.24 . . . 0.70 0.78 Asp 128 . A . . T . .
-0.72 -0.44 . . . 0.85 1.51 Ala 129 . A . . . . C -0.12 -0.44 . * F
0.65 0.65 Pro 130 . A . . . . C 0.52 -0.01 . * F 0.85 0.99 Thr 131
. . . . . . C 0.52 -0.09 . . F 1.25 0.92 Val 132 . . . . . . C 1.11
0.31 . . F 1.00 1.57 Pro 133 . . . . . . C 0.52 -0.19 . . F 1.80
1.76 Pro 134 . . . . . . C 0.80 -0.11 . . F 2.00 1.23 Gln 135 . . .
. . . C 0.20 -0.11 . . F 1.80 2.40 Glu 136 A . B . . . . -0.34
-0.07 . . F 1.40 1.28 Ala 137 . . B B . . . -0.08 0.14 . . F 0.25
0.61 Thr 138 . . B B . . . -0.68 0.21 . . . -0.10 0.36 Leu 139 . .
B B . . . -1.32 0.50 . . . -0.60 0.17 Val 140 . . B B . . . -1.62
1.14 . . . -0.60 0.13 Ala 141 . . B B . . . -1.92 1.03 . . . -0.60
0.12 Leu 142 . . B B . . . -2.14 0.93 * . . -0.60 0.19 Val 143 . .
B B . . . -2.64 0.93 * . . -0.60 0.21 Ser 144 . . B B . . . -2.69
0.97 . . . -0.60 0.17 Ser 145 . . B B . . . -2.69 1.11 * . . -0.60
0.15 Leu 146 . . B B . . . -2.80 1.07 * . . -0.60 0.15 Leu 147 . .
B B . . . -2.30 1.21 * . . -0.60 0.10 Val 148 . . B B . . . -2.26
1.31 . . . -0.60 0.11 Val 149 . A B B . . . -2.54 1.61 . * . -0.60
0.11 Phe 150 . A B B . . . -2.94 1.43 . . . -0.60 0.13 Thr 151 . A
B B . . . -2.94 1.53 . . . -0.60 0.15 Leu 152 . A B B . . . -2.48
1.57 . . . -0.60 0.17 Ala 153 A A . B . . . -2.43 1.36 . . . -0.60
0.19 Phe 154 . A . B T . . -2.28 1.26 . . . -0.20 0.11 Leu 155 . A
. B T . . -2.28 1.56 . . . -0.20 0.12 Gly 156 . A . B T . . -2.78
1.66 . . . -0.20 0.10 Leu 157 . A . B T . . -2.21 1.84 . . . -0.20
0.10 Phe 158 . A . B T . . -2.29 1.81 . . . -0.20 0.18 Phe 159 . A
. B T . . -1.54 1.70 * . . -0.20 0.10 Leu 160 . A . B T . . -0.73
1.27 * . . -0.20 0.24 Tyr 161 . A . B T . . -1.09 0.99 * . . -0.20
0.48 Cys 162 . A . B T . . -0.98 0.99 * . . -0.20 0.48 Lys 163 . A
. B T . . -0.28 0.99 * . . -0.20 0.50 Gln 164 . A . B T . . 0.53
0.70 * . . -0.20 0.51 Phe 165 . A . B T . . 1.31 -0.06 * . . 0.85
1.88 Phe 166 . A . B T . . 0.89 -0.13 * . . 1.16 1.28 Asn 167 . . .
. T T . 1.56 0.44 * * . 0.82 0.39 Arg 168 . . . . T T . 1.62 0.44 *
* . 1.13 0.79 His 169 . . . . T T . 1.28 -0.34 * * . 2.49 1.79 Cys
170 . . . . T T . 1.63 -0.70 * * . 3.10 1.10 Gln 171 . . . . T T .
1.52 -0.67 * . F 2.79 0.56 Arg 172 . . . . T T . 0.71 0.01 * * F
1.58 0.34 Gly 173 . . . . T T . 0.60 0.20 * * F 1.27 0.52 Gly 174 .
. . . T T . -0.07 0.03 * * F 0.96 0.52 Leu 175 . A . . . . C 0.60
0.41 * * . -0.40 0.23 Leu 176 . A . . . . C 0.01 0.41 . * . -0.40
0.40 Gln 177 . A B . . . . -0.10 0.49 . * . -0.60 0.41 Phe 178 . A
B . . . . 0.29 0.06 . * . -0.30 0.83 Glu 179 A A . . . . . 0.32
-0.63 . * . 0.75 2.01 Ala 180 A A . . . . . 0.54 -0.83 * * F 0.90
1.67 Asp 181 A A . . . . . 1.40 -0.73 * * F 0.90 1.95 Lys 182 A A .
. . . . 1.40 -1.51 . * F 0.90 2.26 Thr 183 A A . . . . . 2.10 -1.51
* * F 0.90 3.87 Ala 184 A A . . . . . 1.80 -2.01 * * F 1.20 4.01
Lys 185 A A . . . . . 1.58 -1.63 * . F 1.50 2.69 Glu 186 A A . . .
. . 0.88 -0.94 * . F 1.80 1.54 Glu 187 . A . . T . . 0.62 -0.64 . .
F 2.50 1.32 Ser 188 . . . . T . . 0.08 -0.71 . * F 3.00 1.02 Leu
189 . . . . T . . 0.46 -0.07 . * . 2.10 0.44 Phe 190 . . . . . . C
0.20 0.36 . . . 1.00 0.39 Pro 191 . . . . . . C -0.10 0.79 . . .
0.70 0.45 Val 192 . . . . . . C -0.06 0.79 . . F 0.85 0.73 Pro 193
. . . . . T C 0.24 0.10 . . F 1.50 1.69 Pro 194 . . . . . T C 0.74
-0.69 . . F 2.70 1.89 Ser 195 . . . . . T C 1.14 -0.63 . . F 3.00
3.67 Lys 196 . . . . . T C 0.77 -0.89 . . F 2.70 3.18 Glu 197 . A .
. . . C 1.62 -0.81 . . F 2.00 2.08 Thr 198 . A . . . . C 1.53 -1.24
. . F 1.70 2.69 Ser 199 . A . . . . C 1.74 -1.24 . * F 1.40 1.80
Ala 200 . A . . . . C 1.19 -0.84 . * F 1.10 1.80 Glu 201 . A . . T
. . 0.84 -0.20 . * F 0.85 0.93 Ser 202 . . . . . . C 0.56 -0.30 . *
F 0.85 0.93 Gln 203 . . . . T . . 0.28 0.23 . * F 0.45 0.96 Val 204
. . . . . . C 0.37 0.23 . * . 0.10 0.56 Ser 205 . . . . T . . 0.61
0.66 . * . 0.00 0.65 Trp 206 . . . . . . C 0.31 0.70 . * . -0.20
0.37 Ala 207 . . . . . T C -0.20 0.69 . . . 0.00 0.67 Pro 208 . . .
. . T C -0.79 0.73 * . F 0.15 0.41 Gly 209 . . . . T T . 0.07 0.84
* . F 0.35 0.40 Ser 210 . . . . . T C -0.44 0.33 * . F 0.45 0.68
Leu 211 . . . . . . C -0.86 0.51 * . . -0.20 0.36 Ala 212 . . . . .
. C -0.57 0.87 * . . -0.20 0.32 Gln 213 . . B . . . . -1.17 0.83 .
. . -0.40 0.32 Leu 214 . . B . . . . -0.82 1.13 . . . -0.40 0.32
Phe 215 . . B . . . . -0.82 0.44 . . . -0.40 0.52 Ser 216 . . B . .
. . -0.87 0.33 . . . -0.10 0.40 Leu 217 . . . . T . . -0.49 0.57 .
. . 0.00 0.36 Asp 218 . . . . T . . -1.38 0.31 . . F 0.45 0.65 Ser
219 . . . . . . C -0.78 0.21 . . F 0.25 0.34 Val 220 . . . . . . C
-0.08 0.26 . * F 0.25 0.64 Pro 221 . . . . . . C 0.22 -0.03 . . F
0.85 0.66 IIe 222 . . . . . . C 1.03 0.37 . . F 0.25 0.86 Pro 223 .
. . . . . C 1.03 0.39 . . F 0.66 2.00 Gln 224 . . . . T . . 0.99
0.14 . * F 1.12 2.24 Gln 225 . . . . . . C 1.63 0.14 . * F 1.18
3.16 Gln 226 . . . . . . C 1.84 -0.11 . . F 2.04 3.16 Gln 227 . . .
. . . C 2.13 -0.54 . . F 2.60 3.16 Gly 228 . . . . . T C 1.96 -0.33
. . F 2.24 1.80 Pro 229 . . . . . T C 1.57 -0.30 . . . 1.83 1.33
Glu 230 . . . . T T . 1.18 -0.27 . . . 1.62 0.98 Met 231 . . . . .
T C 0.79 -0.24 * . . 1.31 1.27
[0126] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a TR13 nucleic acid molecule of the invention
described above, for instance, the cDNA clone (HWLHM70) contained
in ATCC Deposit No. PTA-349, the nucleic acid sequence disclosed in
FIGS. 1A-D or the complementary strand thereof, and fragments
thereof (e.g., as described herein).
[0127] By "stringent hybridization conditions" is intended
overnight incubation at 42.degree. C. in a solution comprising: 50%
formamide, 5.times.SSC (750 mM NaCl, 75 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA,
followed by washing the filters in 0.1.times.SSC at about
65.degree. C.
[0128] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to molecule of the
invention described above, for instance, the TR13 cDNA clone
(HWLHN83) contained in ATCC Deposit No. PTA-507, the nucleic acid
sequence disclosed in FIGS. 7A-E or the complementary strand
thereto, and fragments thereof (e.g., as described herein).
[0129] By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below. In this
context "about" includes the particularly recited size, larger or
smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at both termini.
[0130] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
cDNA deposited as ATCC Deposit No. PTA-507, or the nucleotide
sequence as shown in SEQ ID NO:39 or the complementary strand
thereto, or a fragment thereof).
[0131] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
cDNA desposited as ATCC Deposit No: PTA-349, or the nucleotide
sequence as shown in SEQ ID NO:1 or the complementary strand
thereto, or a fragment thereof).
[0132] Of course, a polynucleotide which hybridizes only to a poly
A sequence (such as the 3' terminal poly(A) tract of the TR3 cDNA
shown in SEQ ID NO:1 or SEQ ID NO:39), or to a complementary
stretch of T (or U) resides, would not be included in a
polynucleotide of the invention used to hybridize to a portion of a
nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule containing a poly (A)
stretch or the complement thereof (e.g., practically any
double-stranded cDNA clone generated using oligo dT as a
primer).
[0133] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a TR14 nucleic acid molecule of the invention
described above, for instance, a cDNA clone (HMSHK47) contained in
ATCC Deposit No. PTA-348, the nucleic acid sequence disclosed in
preferably in FIGS. 10A-H or, alternatively, in FIGS. 4A-E or the
complementary strand thereto, and fragments thereof (e.g., as
described herein).
[0134] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
cDNA deposited as ATCC Deposit No: PTA-348, or the nucleotide
sequence as shown preferably in SEQ ID NO:60 or, alternatively, in
SEQ ID NO:4 or the complementary strand thereto, or a fragment
thereof).
[0135] Of course, a polynucleotide which hybridizes only to a poly
A sequence (such as the 3' terminal poly(A) tract of the TR14 cDNA
shown preferably in SEQ ID NO:60 or, alternatively, in SEQ ID
NO:4), or to a complementary stretch of T (or U) resides, would not
be included in a polynucleotide of the invention used to hybridize
to a portion of a nucleic acid of the invention, since such a
polynucleotide would hybridize to any nucleic acid molecule
containing a poly (A) stretch or the complement thereof (e.g.,
practically any double-stranded cDNA clone generated using oligo dT
as a primer).
[0136] In specific embodiments, the polynucleotides of the
invention are less than 100000 kb, 50000 kb, 10000 kb, 1000 kb, 500
kb, 400 kb, 350 kb, 300 kb, 250 kb, 200 kb, 175 kb, 150 kb, 125 kb,
100 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, 7.5
kb, or 5 kb in length.
[0137] In further embodiments, nucleic acids of the invention
comprise at least 15, at least 30, at least 50, at least 100, or at
least 250, at least 500, or at least 1000 contiguous nucleotides of
TR13 coding sequence, but consist of less than or equal to 1000 kb,
500 kb, 250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50 kb, 30 kb, 25 kb,
20 kb, 15 kb, 10 kb, or 5 kb of genomic DNA that flanks the 5' or
3' coding nucleotide set forth in FIGS. 1A-D (SEQ ID NO:1) or in
FIGS. 7A-E (SEQ ID NO:39). In further embodiments, nucleic acids of
the invention comprise at least 15, at least 30, at least 50, at
least 100, or at least 250, at least 500, or at least 1000
contiguous nucleotides of TR13 coding sequence, but do not comprise
all or a portion of any TR13 intron. In another embodiment, the
nucleic acid comprising TR13 coding sequence does not contain
coding sequences of a genomic flanking gene (i.e., 5' or 3' to the
TR13 gene in the genome). In other embodiments, the polynucleotides
of the invention do not contain the coding sequence of more than
1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic
flanking gene(s).
[0138] In further, nucleic acids of the invention comprise at least
15, at least 30, at least 50, at least 100, or at least 250, at
least 500, or at least 1000 contiguous nucleotides of TR14 coding
sequence, but consist of less than or equal to 1000 kb, 500 kb, 250
kb, 200 kb, 150 kb, 100 kb, 75 kb, 50 kb, 30 kb, 25 kb, 20 kb, 15
kb, 10 kb, or 5 kb of genomic DNA that flanks the 5' or 3' coding
nucleotide set forth preferably in FIGS. 10A-H (SEQ ID NO:60) or,
alternatively, in FIGS. 4A-E (SEQ ID NO:4). In further embodiments,
nucleic acids of the invention comprise at least 15, at least 30,
at least 50, at least 100, or at least 250, at least 500, or at
least 1000 contiguous nucleotides of TR14 coding sequence, but do
not comprise all or a portion of any TR14 intron. In another
embodiment, the nucleic acid comprising TR14 coding sequence does
not contain coding sequences of a genomic flanking gene (i.e., 5'
or 3' to the TR14 gene in the genome). In other embodiments, the
polynucleotides of the invention do not contain the coding sequence
of more than 1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2,
or 1 genomic flanking gene(s).
[0139] As indicated, nucleic acid molecules of the present
invention which encode a TR13 polypeptide may include, but are not
limited to the coding sequence for the mature polypeptide, by
itself; the coding sequence for the mature polypeptide and
additional sequences, such as those encoding a leader or secretory
sequence, such as a pre-, or pro- or prepro-protein sequence; the
coding sequence of the mature polypeptide, with or without the
aforementioned additional coding sequences, together with
additional, non-coding sequences, including for example, but not
limited to introns and non-coding 5' and 3' sequences, such as the
transcribed, non-translated sequences that play a role in
transcription, mRNA processing--including splicing and
polyadenylation signals, for example--ribosome binding and
stability of mRNA; additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, for instance, the polypeptide may be fused
to a marker sequence, such as a peptide, which facilitates
purification of the fused polypeptide. In certain preferred
embodiments of this aspect of the invention, the marker sequence is
a hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86: 821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. The "HA" tag is
another peptide useful for purification which corresponds to an
epitope derived from the influenza hemagglutinin protein, which has
been described by Wilson et al., Cell 37:767-778 (1984). As
discussed below, other such fusion proteins include, but are not
limited to, the TR13 receptor fused to Fc at the N- or
C-terminus.
[0140] As indicated, nucleic acid molecules of the present
invention which encode a TR14 polypeptide may include, but are not
limited to the coding sequence for the mature polypeptide, by
itself; the coding sequence for the mature polypeptide and
additional sequences, such as those encoding a leader or secretory
sequence, such as a pre-, or pro- or prepro-protein sequence; the
coding sequence of the mature polypeptide, with or without the
aforementioned additional coding sequences, together with
additional, non-coding sequences, including for example, but not
limited to introns and non-coding 5' and 3' sequences, such as the
transcribed, non-translated sequences that play a role in
transcription, mRNA processing--including splicing and
polyadenylation signals, for example--ribosome binding and
stability of mRNA; additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, for instance, the polypeptide may be fused
to a marker sequence, such as a peptide, which facilitates
purification of the fused polypeptide. In certain preferred
embodiments of this aspect of the invention, the marker sequence is
a hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86: 821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. The "HA" tag is
another peptide useful for purification which corresponds to an
epitope derived from the influenza hemagglutinin protein, which has
been described by Wilson et al., Cell 37:767-778 (1984). As
discussed below, other such fusion proteins include, but are not
limited to, the TR14 receptor fused to Fc at the N- or
C-terminus.
[0141] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs, or derivatives of the TR13 receptor. Variants
may occur naturally, such as a natural allelic variant. By an
"allelic variant" is intended one of several alternate forms of a
gene occupying a given locus on a chromosome of an organism. Genes
II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0142] Such variants include those produced by nucleotide
substitutions, deletions or additions which may involve one or more
nucleotides. The variants may be altered in coding or non-coding
regions or both. Alterations in the coding regions may produce
conservative or non-conservative amino acid substitutions,
deletions, or additions. Especially preferred among these are
silent substitutions, additions, and deletions, which do not alter
the properties and activities of the TR13 receptor or portions
thereof. Also especially preferred in this regard are conservative
substitutions.
[0143] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs, or derivatives of the TR14 receptor. Variants
may occur naturally, such as a natural allelic variant. By an
"allelic variant" is intended one of several alternate forms of a
gene occupying a given locus on a chromosome of an organism. Genes
II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0144] Such variants include those produced by nucleotide
substitutions, deletions or additions which may involve one or more
nucleotides. The variants may be altered in coding or non-coding
regions or both. Alterations in the coding regions may produce
conservative or non-conservative amino acid substitutions,
deletions, or additions. Especially preferred among these are
silent substitutions, additions, and deletions, which do not alter
the properties and activities of the TR14 receptor or portions
thereof. Also especially preferred in this regard are conservative
substitutions.
[0145] Further embodiments of the invention include isolated
nucleic acid molecules comprising or alternatively consisting of, a
polynucleotide having a nucleotide sequence at least 90% identical,
and more preferably at least 95%, 96%, 97%, 98%, or 99% identical
to: (a) a nucleotide sequence encoding the polypeptide having the
amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence
encoding the polypeptide having the amino acid sequence in SEQ ID
NO:2, but lacking the amino terminal methionine (amino acid
positions 2-750 of SEQ ID NO:2); (c) a nucleotide sequence encoding
the polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. PTA-349 (HWLHM70); (d) a
nucleotide sequence encoding the mature TR13 polypeptide having the
amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. PTA-349 (HWLHM70); (e) a nucleotide sequence encoding
any combination of one, two, three or all four of the TR13 cysteine
rich domains disclosed in FIGS. 1A-D (amino acids 105 to 170, amino
acids 251 to 265, amino acids 331 to 410, and/or amino acids 580 to
610 of SEQ ID NO:2); (f) a nucleotide sequence encoding the
polypeptide having the amino acid sequence at positions from about
105 to about 170 of SEQ ID NO:2; (g) a nucleotide sequence encoding
the polypeptide having the amino acid sequence at positions from
about 251 to about 265 of SEQ ID NO:2; (h) a nucleotide sequence
encoding the polypeptide having the amino acid sequence at
positions from about 331 to about 410 of SEQ ID NO:2; (i) a
nucleotide sequence encoding the polypeptide having the amino acid
sequence at positions from about 580 to about 610 of SEQ ID NO:2;
and (j) a nucleotide sequence complementary to any of the
nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), or
(i), above. In this context "about" includes the particularly
recited size, larger or smaller by several (5, 4, 3, 2, or 1)
nucleotides, at either terminus or at both termini.
[0146] Further embodiments of the invention include isolated
nucleic acid molecules comprising or alternatively consisting of, a
polynucleotide having a nucleotide sequence at least 90% identical,
and more preferably at least 95%, 96%, 97%, 98%, or 99% identical
to: (a) a nucleotide sequence encoding the polypeptide having the
amino acid sequence in SEQ ID NO:40; (b) a nucleotide sequence
encoding the polypeptide having the amino acid sequence in SEQ ID
NO:40, but lacking the amino terminal methionine (amino acid
positions 2-1001 of SEQ ID NO:40); (c) a nucleotide sequence
encoding the polypeptide having the amino acid sequence encoded by
the cDNA clone contained in ATCC Deposit No. PTA-507 (HWLHN83); (d)
a nucleotide sequence encoding the mature TR13 polypeptide having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. PTA-507 (HWLHN83); (e) a nucleotide sequence encoding
the TR13 receptor mature extracellular domain (amino acid positions
from about 42 to about 906 of SEQ ID NO:40); (f) a nucleotide
sequence encoding the TR13 receptor transmembrane domain (amino
acid positions from about 907 to about 931 of SEQ ID NO:40); (g) a
nucleotide sequence encoding the TR13 receptor intracellular domain
(amino acid positions 932 to about 1001 of SEQ ID NO:40); (h) a
nucleotide seuqence encoding the TR13 receptor extracellular and
intracellular domains with all or a part of the transmembrane
domain deleted (amino acid positions from about 42 to about 96 and
932 to about 1001 of SEQ ID NO:40); (i) a nucleotide sequence
encoding the polypeptide having the amino acid sequence at
positions from about 271 to about 421 of SEQ ID NO:40; (j) a
nucleotide sequence encoding the polypeptide having the amino acid
sequence at positions from about 271 to about 286 of SEQ ID NO:40;
(k) a nucleotide sequence encoding the polypeptide having the amino
acid sequence at positions from about 290 to about 300 of SEQ ID
NO:40; (l) a nucleotide sequence encoding the polypeptide having
the amino acid sequence at positions from about 301 to about 320 of
SEQ ID NO:40; (m) a nucleotide sequence encoding the polypeptide
having the amino acid sequence at positions from about 329 to about
361 of SEQ ID NO:40; (n) a nucleotide sequence encoding the
polypeptide having the amino acid sequence at positions from about
404 to about 421 of SEQ ID NO:40; (o) a nucleotide sequence
encoding the polypeptide having the amino acid sequence at
positions from about 585 to about 595 of SEQ ID NO:40; (p) a
nucleotide sequence encoding any one of the TR13 conserved domains
as shown in FIGS. 7A-E; (q) a nucleotide sequence encoding the
polypeptide having the amino acid sequence at positions from about
661 to about 674 of SEQ ID NO:40; (r) a nucleotide sequence
encoding the polypeptide having the amino acid sequence at
positions from about 710 to about 744 of SEQ ID NO:40; (s) a
nucleotide sequence encoding the polypeptide having the amino acid
sequence at positions from about 980 to about 991 of SEQ ID NO:40;
(t) a nucleotide sequence encoding the polypeptide having the amino
acid sequence at positions from about 45 to about 60 of SEQ ID
NO:40; (u) a nucleotide sequence encoding the polypeptide having
the amino acid sequence at positions from about 121 to about 135 of
SEQ ID NO:40; (v) a nucleotide sequence encoding the polypeptide
having the amino acid sequence at positions from about 145 to about
160 of SEQ ID NO:40; and (w) a nucleotide sequence complementary to
any of the nucleotide sequences in (a), (b), (c), (d), (e), (f),
(g), (h), (i), (j), (k), (l), (m), (n), (o), (p), (q), (r), (s),
(t), (u) or (v) above. In this context "about" includes the
particularly recited size, larger or smaller by several (5, 4, 3,
2, or 1) nucleotides, at either terminus or at both termini.
[0147] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a TR13 polypeptide is intended that the nucleotide
sequence of the polynucleotide is identical to the reference
sequence except that the polynucleotide sequence may include up to
five mismatches per each 100 nucleotides of the reference
nucleotide sequence encoding the TR13 polypeptide. In other words,
to obtain a polynucleotide having a nucleotide sequence at least
95% identical to a reference nucleotide sequence, up to 5% of the
nucleotides in the reference sequence may be deleted or substituted
with another nucleotide, or a number of nucleotides up to 5% of the
total nucleotides in the reference sequence may be inserted into
the reference sequence. These mismatches of the reference sequence
may occur at the 5' or 3' terminal positions of the reference
nucleotide sequence or anywhere between those terminal positions,
interspersed either individually among nucleotides in the reference
sequence or in one or more contiguous groups within the reference
sequence. The reference (query) sequence may be the entire TR13
encoding nucleotide sequence shown in FIGS. 1A-D (SEQ ID NO:1) or
FIGS. 7A-E (SEQ ID NO:39) or any TR13 polynucleotide fragment
(e.g., a polynucleotide encoding the amino acid sequence of any of
the TR13 N- and/or C-terminal deletions described herein), variant,
derivative or analog, as described herein.
[0148] As a practical matter, whether any particular polynucleotide
sequence is at least 90%, 95%, 96%, 97%, 98% or 99% identical to,
for instance, the nucleotide sequence shown in SEQ ID NO:1 or SEQ
ID NO:39 or to the nucleotide sequence of the deposited cDNA clone
(HWLHM70 or HWLHN83) can be determined conventionally using known
computer programs such as the Bestfit program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711).
Bestfit uses the local homology algorithm of Smith and Waterman,
Advances in Applied Mathematics 2: 482-489 (1981), to find the best
segment of homology between two sequences. When using Bestfit or
any other sequence alignment program to determine whether a
particular sequence is, for instance, 95% identical to a reference
sequence according to the present invention, the parameters are
set, of course, such that the percentage of identity is calculated
over the full-length of the reference nucleotide sequence and that
gaps in homology of up to 5% of the total number of nucleotides in
the reference sequence are allowed.
[0149] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98%, or 99% identical to: (a) a nucleotide
sequence encoding the polypeptide having the amino acid sequence in
SEQ ID NO:61; (b) a nucleotide sequence encoding the polypeptide
having the amino acid sequence in SEQ ID NO: 61, but lacking the
amino terminal methionine (amino acid positions 2-231 of SEQ ID
NO:61); (c) a nucleotide sequence encoding the polypeptide having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. HMSHK47; (d) a nucleotide sequence encoding the
polypeptide having the amino acid sequence in SEQ ID NO:5; (e) a
nucleotide sequence encoding the polypeptide having the amino acid
sequence in SEQ ID NO: 5, but lacking the amino terminal methionine
(amino acid positions 2-226 of SEQ ID NO:5); (f) a nucleotide
sequence encoding the TR14 receptor extracellular domain
(preferably preferably amino acid positions from about 1 to about
138 of SEQ ID NO:61 or, alternatively, amino acid positions from
about 1 to about 133 of SEQ ID NO:5); (g) a nucleotide sequence
encoding the TR14 cysteine rich domain (preferably amino acid
positions from about 70 to about 90 of SEQ ID NO:61 or,
alternatively, amino acid positions from about 65 to about 85 of
SEQ ID NO:5); (h) a nucleotide sequence encoding the TR14 receptor
transmembrane domain (preferably, amino acid positions from about
139 to about 155 of SEQ ID NO:61 or, alternatively, amino acid
positions from about 134 to about 150 of SEQ ID NO:5); (i) a
nucleotide sequence encoding the TR14 receptor intracellular domain
(preferably, amino acid positions from about 156 to about 231 of
SEQ ID NO:61 or, alternatively, from about amino acid positions 151
to about 226 of SEQ ID NO:5); (j) a nucleotide sequence encoding
the TR14 receptor extracellular and intracellular domains with all
or part of the transmembrane domain deleted (preferably amino acid
positions from about 1 to about 138 and 156 to about 231 of SEQ ID
NO:61 or, alternatively, amino acid positions from about 1 to about
133 and 151 to about 226 of SEQ ID NO:5); and (k) a nucleotide
sequence complementary to any of the nucleotide sequences in (a),
(b), (c), (d), (e), (f), (g), (h), (i), (j) or (k) above. In this
context "about" includes the particularly recited size, larger or
smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at both termini.
[0150] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a TR14 polypeptide is intended that the nucleotide
sequence of the polynucleotide is identical to the reference
sequence except that the polynucleotide sequence may include up to
five mismatches per each 100 nucleotides of the reference
nucleotide sequence encoding the TR14 polypeptide. In other words,
to obtain a polynucleotide having a nucleotide sequence at least
95% identical to a reference nucleotide sequence, up to 5% of the
nucleotides in the reference sequence may be deleted or substituted
with another nucleotide, or a number of nucleotides up to 5% of the
total nucleotides in the reference sequence may be inserted into
the reference sequence. These mismatches of the reference sequence
may occur at the 5' or 3' terminal positions of the reference
nucleotide sequence or anywhere between those terminal positions,
interspersed either individually among nucleotides in the reference
sequence or in one or more contiguous groups within the reference
sequence. The reference (query) sequence may be the entire TR14
encoding nucleotide sequence shown preferably in FIGS. 10A-H (SEQ
ID NO:60) or, alternatively, in FIGS. 4A-E (SEQ ID NO:4) or any
TR14 polynucleotide fragment (e.g., a polynucleotide encoding the
amino acid sequence of any of the TR14 N- and/or C-terminal
deletions described herein), variant, derivative or analog, as
described herein.
[0151] As a practical matter, whether any particular polynucleotide
sequence is at least 90%, 95%, 96%, 97%, 98% or 99% identical to,
for instance, the nucleotide sequence shown preferably in SEQ ID
NO:60 or, alternatively, in SEQ ID NO:4 or to the nucleotide
sequence of the deposited cDNA clone can be determined
conventionally using known computer programs such as the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, Wis. 53711). Bestfit uses the local homology
algorithm of Smith and Waterman, Advances in Applied Mathematics 2:
482-489 (1981), to find the best segment of homology between two
sequences. When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for
instance, 95% identical to a reference sequence according to the
present invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full-length of the
reference nucleotide sequence and that gaps in homology of up to 5%
of the total number of nucleotides in the reference sequence are
allowed.
[0152] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB alignment of DNA sequences to
calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch
Penalty=1, Joining Penalty=30, Randomization Group Length=0, Cutoff
Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or
the length of the subject nucleotide sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence because of 5' or 3' deletions, not
because of internal deletions, a manual correction is made to the
results to take into consideration the fact that the FASTDB program
does not account for 5' and 3' truncations of the subject sequence
when calculating percent identity. For subject sequences truncated
at the 5' or 3' ends, relative to the query sequence, the percent
identity is corrected by calculating the number of bases of the
query sequence that are 5' and 3' of the subject sequence, which
are not matched/aligned, as a percent of the total bases of the
query sequence. A determination of whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of this
embodiment. Only bases outside the 5' and 3' bases of the subject
sequence, as displayed by the FASTDB alignment, which are not
matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score. For
example, a 90 base subject sequence is aligned to a 100 base query
sequence to determine percent identity. The deletions occur at the
5' end of the subject sequence and therefore, the FASTDB alignment
does not show a matched/alignment of the first 10 bases at 5' end.
The 10 unpaired bases represent 10% of the sequence (number of
bases at the 5' and 3' ends not matched/total number of bases in
the query sequence) so 10% is subtracted from the percent identity
score calculated by the FASTDB program. If the remaining 90 bases
were perfectly matched the final percent identity would be 90%. In
another example, a 90 base subject sequence is compared with a 100
base query sequence. This time the deletions are internal deletions
so that there are no bases on the 5' or 3' of the subject sequence
which are not matched/aligned with the query. In this case the
percent identity calculated by FASTDB is not manually corrected.
Once again, only bases 5' and 3' of the subject sequence which are
not matched/aligned with the query sequence are manually corrected
for. No other manual corrections are made for the purposes of this
embodiment.
[0153] The present application is directed to nucleic acid
molecules comprising a polynucleotide sequence at least 90%, 95%,
96%, 97%, 98%, or 99% identical to the nucleic acid sequence for
example, shown in SEQ ID NO:1 or SEQ ID NO:39, or to the nucleic
acid sequence of the cDNA deposited as ATCC deposit No. PTA-349 or
PTA-507, irrespective of whether they encode a polypeptide having
TR13 receptor activity. This is because even where a particular
nucleic acid molecule does not encode a polypeptide having TR13
functional activity, one of skill in the art would still know how
to use the nucleic acid molecule, for instance, as a hybridization
probe or a polymerase chain reaction (PCR) primer. Uses of the
nucleic acid molecules of the present invention that do not encode
a polypeptide having TR13 receptor activity include, inter alia:
(1) isolating the TR13 receptor gene or allelic variants thereof in
a cDNA library; (2) in situ hybridization (e.g., "FISH") to
metaphase chromosomal spreads to provide precise chromosomal
location of the TR13 receptor gene, as described in Verma et al.,
Human Chromosomes: A Manual of Basic Techniques, Pergamon Press,
New York (1988); and (3) Northern Blot analysis for detecting TR13
receptor mRNA expression in specific tissues.
[0154] Preferred, however, are nucleic acid molecules having
sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to for
example, the nucleic acid sequence shown in SEQ ID NO:1 or SEQ ID
NO:39, or to the nucleic acid sequence of the cDNA deposited as
PTA-349 or PTA-507, which do, in fact, encode a polypeptide having
TR13 receptor functional activity. By "a polypeptide having TR13
functional receptor activity" is intended polypeptides exhibiting
activity similar, but not necessarily identical, to an activity of
the TR13 receptor of the invention (either the full-length protein
or, preferably, the mature protein), as measured, for example, in a
particular biological assay.
[0155] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to, for example, the
nucleic acid sequence of the deposited cDNA or the nucleic acid
sequence shown in SEQ ID NO:1 or SEQ ID NO:39 will encode a
polypeptide "having TR13 receptor functional activity." In fact,
since degenerate variants of these nucleotide sequences all encode
the same polypeptide, this will be clear to the skilled artisan
even without performing the above described comparison assay. It
will be further recognized in the art that, for such nucleic acid
molecules that are not degenerate variants, a reasonable number
will also encode a polypeptide having TR13 receptor activity. This
is because the skilled artisan is fully aware of amino acid
substitutions that are either less likely or not likely to
significantly effect protein function (e.g., replacing one
aliphatic amino acid with a second aliphatic amino acid).
[0156] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in J. U. Bowie et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that proteins are surprisingly tolerant of amino
acid substitutions.
[0157] The present application is directed to nucleic acid
molecules comprising a polynucleotide sequence at least 90%, 95%,
96%, 97%, 98%, or 99% identical to the nucleic acid sequence for
example, shown preferably in SEQ ID NO:60 or, alternatively, in SEQ
ID NO:4, or to the nucleic acid sequence of the cDNA deposited as
ATCC Deposit No. PTA-348, and even more preferably to the
polypeptide coding regions of these sequences, irrespective of
whether they encode a polypeptide having TR14 receptor activity.
This is because even where a particular nucleic acid molecule does
not encode a polypeptide having TR14 functional activity, one of
skill in the art would still know how to use the nucleic acid
molecule, for instance, as a hybridization probe or a polymerase
chain reaction (PCR) primer. Uses of the nucleic acid molecules of
the present invention that do not encode a polypeptide having TR14
receptor activity include, inter alia: (1) isolating the TR14
receptor gene or allelic variants thereof in a cDNA library; (2) in
situ hybridization (e.g., "FISH") to metaphase chromosomal spreads
to provide precise chromosomal location of the TR14 receptor gene,
as described in Verma et al., Human Chromosomes: A Manual of Basic
Techniques, Pergamon Press, New York (1988); and (3) Northern Blot
analysis for detecting TR14 receptor mRNA expression in specific
tissues.
[0158] Preferred, however, are nucleic acid molecules having
sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to for
example, the nucleic acid sequence shown preferably in SEQ ID NO:60
or, alternatively, in SEQ ID NO:4, or to the nucleic acid sequence
of the deposited cDNA, and even more preferably to the polypeptide
coding regions of these sequences, which do, in fact, encode a
polypeptide having TR14 receptor functional activity. By "a
polypeptide having TR14 functional receptor activity" is intended
polypeptides exhibiting activity similar, but not necessarily
identical, to an activity of the TR14 receptor of the invention
(either the full-length protein or, preferably, the mature
protein), as measured, for example, in a particular biological
assay.
[0159] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to, for example, the
nucleic acid sequence of the deposited cDNA or the nucleic acid
sequence shown preferably in SEQ ID NO:60 or, alternatively, in SEQ
ID NO:4 will encode a polypeptide "having TR14 receptor functional
activity." In fact, since degenerate variants of these nucleotide
sequences all encode the same polypeptide, this will be clear to
the skilled artisan even without performing the above described
comparison assay. It will be further recognized in the art that,
for such nucleic acid molecules that are not degenerate variants, a
reasonable number will also encode a polypeptide having TR14
receptor activity. This is because the skilled artisan is fully
aware of amino acid substitutions that are either less likely or
not likely to significantly effect protein function (e.g.,
replacing one aliphatic amino acid with a second aliphatic amino
acid).
[0160] Polynucleotide Assays
[0161] This invention is also related to the use of TR13
polynucleotides to detect complementary polynucleotides such as,
for example, as a diagnostic reagent. Detection of a mutated form
of TR13 polynucleotide associated with a dysfunction will provide a
diagnostic tool that can add or define a diagnosis of a disease or
susceptibility to a disease which results from under-expression
over-expression or altered expression of TR13 or a soluble form
thereof, such as, for example, tumors or autoimmune disease.
[0162] Individuals carrying mutations in the TR13 gene may be
detected at the nucleic acid level by a variety of techniques.
Nucleic acids for diagnosis may be obtained from a patient's cells,
such as from blood, urine, saliva, tissue biopsy and autopsy
material. The genomic DNA may be used directly for detection or may
be amplified enzymatically by using PCR prior to analysis. (Saiki
et al., Nature 324:163-166 (1986)). RNA or cDNA may also be used in
the same ways, or through routine modification of these
polynucleotides. As an example, PCR primers complementary to the
nucleic acid encoding TR13 can be used to identify and analyze TR13
expression and mutations. For example, deletions and insertions can
be detected by a change in size of the amplified product in
comparison to the normal genotype. Point mutations can be
identified using techniques known in the art, for example, by
hybridizing amplified DNA to radiolabeled TR13 RNA or
alternatively, radiolabeled TR13 antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched duplexes by,
for example, RNase A digestion or by differences in melting
temperatures.
[0163] This invention is also related to the use of TR14
polynucleotides to detect complementary polynucleotides such as,
for example, as a diagnostic reagent. Detection of a mutated form
of TR14 polynucleotide associated with a dysfunction will provide a
diagnostic tool that can add or define a diagnosis of a disease or
susceptibility to a disease which results from under-expression
over-expression or altered expression of TR14 or a soluble form
thereof, such as, for example, tumors or autoimmune disease.
[0164] Individuals carrying mutations in the TR14 gene may be
detected at the nucleic acid level by a variety of techniques.
Nucleic acids for diagnosis may be obtained from a patient's cells,
such as from blood, urine, saliva, tissue biopsy and autopsy
material. The genomic DNA may be used directly for detection or may
be amplified enzymatically by using PCR prior to analysis. (Saiki
et al., Nature 324:163-166 (1986)): RNA or cDNA may also be used in
the same ways, or through routine modification of these
polynucleotides. As an example, PCR primers complementary to the
nucleic acid encoding TR14 can be used to identify and analyze TR14
expression and mutations. For example, deletions and insertions can
be detected by a change in size of the amplified product in
comparison to the normal genotype. Point mutations can be
identified by hybridizing amplified DNA to radiolabeled TR14 RNA or
alternatively, radiolabeled TR14 antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched duplexes by,
for example, RNase A digestion or by differences in melting
temperatures.
[0165] Sequence differences between a reference gene and genes
having mutations also may be revealed by direct DNA sequencing. In
addition, cloned DNA segments may be employed as probes to detect
specific DNA segments. The sensitivity of such methods can be
greatly enhanced by appropriate use of PCR or another amplification
method. For example, a sequencing primer is used with
double-stranded PCR product or a single-stranded template molecule
generated by a modified PCR. The sequence determination is
performed by conventional procedures with radiolabeled nucleotide
or by automatic sequencing procedures with fluorescent-tags.
[0166] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels, with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science 230:1242 (1985)).
[0167] Sequence changes at specific locations also may be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., Proc. Natl.
Acad. Sci. USA 85: 4397-4401 (1985)).
[0168] Thus, the detection of a specific DNA sequence may be
achieved by methods such as, for example, hybridization, RNase
protection, chemical cleavage, direct DNA sequencing or the use of
restriction enzymes, (e.g., restriction fragment length
polymorphisms ("RFLP") and Southern blotting of genomic DNA.
[0169] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations also can be detected by in situ analysis.
[0170] Vectors and Host Cells
[0171] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors
and/or nucleic acids of the invention and the production of TR13
polypeptides or fragments thereof by recombinant techniques.
[0172] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors
and/or nucleic acids of the invention and the production of TR14
polypeptides or fragments thereof by recombinant techniques.
[0173] Host cells can be genetically engineered to incorporate
nucleic acid molecules and express polypeptides of the present
invention. The polynucleotides may be introduced alone or with
other polynucleotides. Such other polynucleotides may be introduced
independently, co-introduced or introduced joined to the
polynucleotides of the invention.
[0174] In accordance with the present invention the vector may be,
for example, a clone vector, a single or double-stranded phage
vector, a single or double-stranded RNA or DNA viral vector. Such
vectors may be introduced into cells as polynucleotides, preferably
DNA, by well known techniques for introducing DNA and RNA into
cells. Viral vectors may be replication competent or replication
defective. In the latter case viral propagation generally will
occur only in complementing host cells.
[0175] Preferred among vectors, in certain respects, are those for
expression of polynucleotides and polypeptides of the present
invention. Generally, such vectors comprise cis-acting control
regions effective for expression in a host operatively linked to
the polynucleotide to be expressed. Appropriate trans-acting
factors either are supplied by the host, supplied by a
complementing vector or supplied by the vector itself upon
introduction into the host.
[0176] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a clone
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0177] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac. trp and tac promoters, the SV40 early and late promoters
and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site
for translation. The coding portion of the mature transcripts
expressed by the constructs will preferably include a translation
initiating at the beginning and a termination codon (UAA, UGA or
UAG) appropriately positioned at the end of the polypeptide to be
translated.
[0178] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture and
tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include, but are not limited to, bacterial cells, such as E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes
melanoma cells; and plant cells. Appropriate culture mediums and
conditions for the above-described host cells are known in the
art.
[0179] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript
vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, and
pSport available from Stratagene; and ptrc99a, pKK223-3, pKK233-3,
pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic
vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from
Stratagene; and pSVK3, pBPV, pMSG and pSVL available from
Pharmacia. Other suitable vectors will be readily apparent to the
skilled artisan.
[0180] The present invention also relates to host cells containing
the above-described vector constructs described herein, and
additionally encompasses host cells containing nucleotide sequences
of the invention that are operably associated with one or more
heterologous control regions (e.g., promoter and/or enhancer) using
techniques known of in the art. The host cell can be a higher
eukaryotic cell, such as a mammalian cell (e.g., a human derived
cell), or a lower eukaryotic cell, such as a yeast cell, or the
host cell can be a prokaryotic cell, such as a bacterial cell. The
host strain may be chosen which modulates the expression of the
inserted gene sequences, or modifies and processes the gene product
in the specific fashion desired. Expression from certain promoters
can be elevated in the presence of certain inducers; thus
expression of the genetically engineered polypeptide may be
controlled. Furthermore, different host cells have characteristics
and specific mechanisms for the translational and
post-translational processing and modification (e.g.,
phosphorylation, cleavage) of proteins. Appropriate cell lines can
be chosen to ensure the desired modifications and processing of the
foreign protein expressed.
[0181] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986).
[0182] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., TR13 coding
sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with TR13
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous TR13 polynucleotides. For example,
techniques known in the art may be used to operably associate
heterologous control regions (e.g., promoter and/or enhancer) and
endogenous TR13 polynucleotide sequences via homologous
recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24,
1997; International Publication Number WO 96/29411, published Sep.
26, 1996; International Publication Number WO 94/12650, published
Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); and Zijistra et al., Nature 342:435-438
(1989), the disclosures of each of which are incorporated by
reference in their entireties).
[0183] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., TR14 coding
sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with TR14
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous TR14 polynucleotides. For example,
techniques known in the art may be used to operably associate
heterologous control regions (e.g., promoter and/or enhancer) and
endogenous TR14 polynucleotide sequences via homologous
recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24,
1997; International Publication Number WO 96/29411, published Sep.
26, 1996; International Publication Number WO 94/12650, published
Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); and Zijistra et al., Nature 342:435-438
(1989), the disclosures of each of which are incorporated by
reference in their entireties).
[0184] The TR13 polypeptides of the invention may be expressed in a
modified form, such as a fusion protein (comprising the polypeptide
joined via a peptide bond to a heterologous protein sequence (of a
different protein)), and may include not only secretion signals but
also additional heterologous functional regions. Alternatively,
such a fusion protein can be made by protein synthetic techniques,
e.g., by use of a peptide synthesizer. Thus, a region of additional
amino acids, particularly charged amino acids, may be added to the
N-terminus of the polypeptide to improve stability and persistence
in the host cell, during purification or during subsequent handling
and storage. Also, peptide moieties may be added to the polypeptide
to facilitate purification. Such regions may be removed prior to
final preparation of the polypeptide. The addition of peptide
moieties to polypeptides to engender secretion or excretion, to
improve stability and to facilitate purification, among others, are
familiar and routine techniques in the art. For example, in one
embodiment, polynucleotides encoding TR13 polypeptides of the
invention may be fused to the pelB pectate lyase signal sequence to
increase the efficiency to expression and purification of such
polypeptides in Gram-negative bacteria. See, U.S. Pat. Nos.
5,576,195 and 5,846,818, the contents of which are herein
incorporated by reference in their entireties.
[0185] The TR14 polypeptides of the invention may also be expressed
in a modified form, such as a fusion protein (comprising the
polypeptide joined via a peptide bond to a heterologous protein
sequence (of a different protein)), and may include not only
secretion signals but also additional heterologous functional
regions. Alternatively, such a fusion protein can be made by
protein synthetic techniques, e.g., by use of a peptide
synthesizer. Thus, a region of additional amino acids, particularly
charged amino acids, may be added to the N-terminus of the
polypeptide to improve stability and persistence in the host cell,
during purification or during subsequent handling and storage.
Also, peptide moieties may be added to the polypeptide to
facilitate purification. Such regions may be removed prior to final
preparation of the polypeptide. The addition of peptide moieties to
polypeptides to engender secretion or excretion, to improve
stability and to facilitate purification, among others, are
familiar and routine techniques in the art. For example, in one
embodiment, polynucleotides encoding TR14 polypeptides of the
invention may be fused to the pelB pectate lyase signal sequence to
increase the efficiency to expression and purification of such
polypeptides in Gram-negative bacteria. See, U.S. Pat. Nos.
5,576,195 and 5,846,818, the contents of which are herein
incorporated by reference in their entireties.
[0186] A preferred fusion protein comprises a heterologous region
from immunoglobulin that is useful to solubilize proteins. For
example, EP-A-O 464 533 (Canadian counterpart 2045869) discloses
fusion proteins comprising various portions of constant region of
immunoglobin molecules together with another human protein or part
thereof. In many cases, the Fc part in a fusion protein is
thoroughly advantageous for use in therapy and diagnosis and thus
results, for example, in improved pharmacokinetic properties (EP-A
0232 262). On the other hand, for some uses, it would be desirable
to be able to delete the Fc part after the fusion protein has been
expressed, detected and purified in the advantageous manner
described. This is the case when the Fc portion proves to be a
hindrance to use in therapy and diagnosis, for example, when the
fusion protein is to be used as an antigen for immunizations. In
drug discovery, for example, human proteins, such as the
hIL5-receptor, have been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
See, D. Bennett et al., Journal of Molecular Recognition 8:52-58
(1995) and K. Johanson et al., The Journal of Biological Chemistry
270:16:9459-9471 (1995).
[0187] Polypeptides of the present invention include naturally
purified products, products of chemical synthetic procedures, and
products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed
in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or non-glycosylated. In
addition, polypeptides of the invention may also include an initial
modified methionine residue, in some cases as a result of
host-mediated processes.
[0188] In addition, TR13 polypeptides of the invention can be
chemically synthesized using techniques known in the art (e.g., see
Creighton, Proteins: Structures and Molecular Principles, W.H.
Freeman & Co., N.Y. (1983), and Hunkapiller, et al. Nature
310:105-111 (1984)). For example, a TR13 polypeptide fragment of
the invention can be synthesized by use of a peptide synthesizer.
Furthermore, if desired, nonclassical amino acids or chemical amino
acid analogs can be introduced as a substitution or addition into
the TR13 polypeptide sequence. Non-classical amino acids include,
but are not limited to, to the D-isomers of the common amino acids,
2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric
acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic
acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid,
ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, homocitrulline, cysteic acid, t-butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine,
fluoro-amino acids, designer amino acids such as b-methyl amino
acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid
analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
[0189] In addition, TR14 polypeptides of the invention can be
chemically synthesized using techniques known in the art (e.g., see
Creighton, Proteins: Structures and Molecular Principles, W.H.
Freeman & Co., N.Y. (1983), and Hunkapiller, et al., Nature
310:105-111 (1984)). For example, a TR14 polypeptide fragment of
the invention can be synthesized by use of a peptide synthesizer.
Furthermore, if desired, nonclassical amino acids or chemical amino
acid analogs can be introduced as a substitution or addition into
the TR14 polypeptide sequence. Non-classical amino acids include,
but are not limited to, to the D-isomers of the common amino acids,
2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric
acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic
acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid,
ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, homocitrulline, cysteic acid, t-butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine,
fluoro-amino acids, designer amino acids such as b-methyl amino
acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid
analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
[0190] The invention additionally, encompasses TR13 polypeptides
(proteins) which are differentially modified during or after
translation, e.g., by glycosylation, acetylation, phosphorylation,
amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to an antibody molecule or other
cellular ligand, etc. Any of numerous chemical modifications may be
carried out by known techniques, including but not limited to,
specific chemical cleavage by cyanogen bromide, trypsin,
chymotrypsin, papain, V8 protease, NaBH.sub.4, acetylation,
formylation, oxidation, reduction, metabolic synthesis in the
presence of tunicamycin; etc.
[0191] The invention additionally, encompasses TR14 polypeptides
(proteins) which are differentially modified during or after
translation, e.g., by glycosylation, acetylation, phosphorylation,
amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to an antibody molecule or other
cellular ligand, etc. Any of numerous chemical modifications may be
carried out by known techniques, including but not limited to,
specific chemical cleavage by cyanogen bromide, trypsin,
chymotrypsin, papain, V8 protease, NaBH.sub.4, acetylation,
formylation, oxidation, reduction, metabolic synthesis in the
presence of tunicamycin; etc.
[0192] Additional post-translational modifications encompassed by
the invention include, for example, e.g., N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends),
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic,
fluorescent, isotopic or affinity label to allow for detection and
isolation of the protein.
[0193] Also provided by the invention are chemically modified
derivatives of TR13 polypeptides (proteins) which may provide
additional advantages such as increased solubility, stability and
circulating time of the polypeptide, or decreased immunogenicity
(see U.S. Pat. No. 4,179,337). The chemical moieties for
derivitization may be selected from water soluble polymers such as,
for example, polyethylene glycol, ethylene glycol/propylene glycol
copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and
the like. The polypeptides may be modified at random positions
within the molecule, or at predetermined positions within the
molecule and may include one, two, three or more attached chemical
moieties.
[0194] Also provided by the invention are chemically modified
derivatives of TR14 polypeptides which may provide additional
advantages such as increased solubility, stability and circulating
time of the polypeptide, or decreased immunogenicity (see U.S. Pat.
No. 4,179,337). The chemical moieties for derivitization may be
selected from water soluble polymers such as, for example,
polyethylene glycol, ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
[0195] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog). The polymer may be of
any molecular weight, and may be branched or unbranched. For
polyethylene glycol, the preferred molecular weight is between
about 1 kDa and about 100 kDa (the term "about" indicating that in
preparations of polyethylene glycol, some molecules will weigh
more, some less, than the stated molecular weight) for ease in
handling and manufacturing. Other sizes may be used, depending on
the desired therapeutic profile (e.g., the duration of sustained
release desired, the effects, if any on biological activity, the
ease in handling, the degree or lack of antigenicity and other
known effects of the polyethylene glycol to a therapeutic protein
or analog). For example, the polyethylene glycol may have an
average molecular weight of about 200,500, 1000,
1500,2000,2500,3000, 3500,4000,4500,5000, 5500,6000,6500,7000,
7500,8000,8500,9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000,
12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500,16,000,
16,500, 17,000, 17,500, 18,000, 18,500, 19,000,
19,500,20,000,25,000, 30,000,35,000,40,000, 50,000,55,000,60,000,
65,000,70,000,75,000, 80,000,85,000, 90,000,95,000, or 100,000
kDa.
[0196] As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for
example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl.
Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides
Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug.
Chem. 10:638-646 (1999), the disclosures of each of which are
incorporated herein by reference.
[0197] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the polypeptide (proteins) with
consideration of effects on functional or antigenic domains of the
protein. There are a number of attachment methods available to
those skilled in the art, e.g., EP 0 401 384, herein incorporated
by reference (coupling PEG to G-CSF), see also Malik et al., Exp.
Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using
tresyl chloride). For example, polyethylene glycol may be
covalently bound through amino acid residues via a reactive group,
such as, a free amino or carboxyl group. Reactive groups are those
to which an activated polyethylene glycol molecule may be bound.
The amino acid residues having a free amino group may include
lysine residues and the N-terminal amino acid residues; those
having a free carboxyl group may include aspartic acid residues
glutamic acid residues and the C-terminal amino acid residue.
Sulfhydryl groups may also be used as a reactive group for
attaching the polyethylene glycol molecules. Preferred for
therapeutic purposes is attachment at an amino group, such as
attachment at the N-terminus or lysine group.
[0198] As suggested above, polyethylene glycol may be attached to
proteins via linkage to any of a number of amino acid residues. For
example, polyethylene glycol can be linked to a proteins via
covalent bonds to lysine, histidine, aspartic acid, glutamic acid,
or cysteine residues. One or more reaction chemistries may be
employed to attach polyethylene glycol to specific amino acid
residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or
cysteine) of the protein or to more than one type of amino acid
residue (e.g., lysine, histidine, aspartic acid, glutamic acid,
cysteine and combinations thereof) of the protein.
[0199] One may specifically desire polypeptides (proteins)
chemically modified at the N-terminus. Using polyethylene glycol as
an illustration of the present composition, one may select from a
variety of polyethylene glycol molecules (by molecular weight,
branching, etc.), the proportion of polyethylene glycol molecules
to protein (or peptide) molecules in the reaction mix, the type of
pegylation reaction to be performed, and the method of obtaining
the selected N-terminally pegylated protein. The method of
obtaining the N-terminally pegylated preparation (i.e., separating
this moiety from other monopegylated moieties if necessary) may be
by purification of the N-terminally pegylated material from a
population of pegylated protein molecules. Selective proteins
chemically modified at the N-terminus modification may be
accomplished by reductive alkylation which exploits differential
reactivity of different types of primary amino groups (lysine
versus the N-terminal) available for derivatization in a particular
protein. Under the appropriate reaction conditions, substantially
selective derivatization of the protein at the N-terminus with a
carbonyl group containing polymer is achieved.
[0200] As indicated above, pegylation of the proteins of the
invention may be accomplished by any number of means. For example,
polyethylene glycol may be attached to the protein either directly
or by an intervening linker. Linkerless systems for attaching
polyethylene glycol to proteins are described in Delgado et al.,
Cit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et
al., Intern. J. of Hematol. 68:1-18 (1998); U.S. Pat. No.
4,002,531; U.S. Pat. No. 5,349,052; WO 95/06058; and WO 98/32466,
the disclosures of each of which are incorporated herein by
reference.
[0201] One system for attaching polyethylene glycol directly to
amino acid residues of proteins without an intervening linker
employs tresylated MPEG, which is produced by the modification of
monmethoxy polyethylene glycol (MPEG) using tresylchloride
(ClSO.sub.2CH.sub.2CF.sub.3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine
groups of the protein. Thus, the invention includes
protein-polyethylene glycol conjugates produced by reacting
proteins of the invention with a polyethylene glycol molecule
having a 2,2,2-trifluoreothane sulphonyl group.
[0202] Polyethylene glycol can also be attached to proteins using a
number of different intervening linkers. For example, U.S. Pat. No.
5,612,460, the entire disclosure of which is incorporated herein by
reference, discloses urethane linkers for connecting polyethylene
glycol to proteins. Protein-polyethylene glycol conjugates wherein
the polyethylene glycol is attached to the protein by a linker can
also be produced by reaction of proteins with compounds such as
MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylca- rbonate,
MPEG-p-nitrophenolcarbonate, and various MPEG-succinate
derivatives. A number additional polyethylene glycol derivatives
and reaction chemistries for attaching polyethylene glycol to
proteins are described in WO 98/32466, the entire disclosure of
which is incorporated herein by reference. Pegylated protein
products produced using the reaction chemistries set out herein are
included within the scope of the invention.
[0203] The number of polyethylene glycol moieties attached to each
protein of the invention (i.e., the degree of substitution) may
also vary. For example, the pegylated proteins of the invention may
be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15,
17, 20, or more polyethylene glycol molecules. Similarly, the
average degree of substitution within ranges such as 1-3, 2-4, 3-5,
4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16,
15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per
protein molecule. Methods for determining the degree of
substitution are discussed, for example, in Delgado et al., Crit.
Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
[0204] As mentioned the TR13 and TR14 polypeptides (proteins) of
the invention may be modified by either natural processes, such as
posttranslational processing, or by chemical modification
techniques which are well known in the art. It will be appreciated
that the same type of modification may be present in the same or
varying degrees at several sites in a given TR13 or TR14
polypeptide. TR13 or TR14 polypeptides may be branched, for
example, as a result of ubiquitination, and they may be cyclic,
with or without branching. Cyclic, branched, and branched cyclic
TR13 or TR14 polypeptides may result from posttranslation natural
processes or may be made by synthetic methods. Modifications
include acetylation, acylation, ADP-ribosylation, amidation,
covalent attachment of flavin, covalent attachment of a heme
moiety, covalent attachment of a nucleotide or nucleotide
derivative, covalent attachment of a lipid or lipid derivative,
covalent attachment of phosphotidylinositol, cross-linking,
cyclization, disulfide bond formation, demethylation, formation of
covalent cross-links, formation of cysteine, formation of
pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI
anchor formation, hydroxylation, iodination, methylation,
myristoylation, oxidation, pegylation, proteolytic processing,
phosphorylation, prenylation, racemization, selenoylation,
sulfation, transfer-RNA mediated addition of amino acids to
proteins such as arginylation, and ubiquitination. (See, for
instance, PROTEINS--STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T.
E. Creighton, W. H. Freeman and Company, New York (1993);
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson,
Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al.,
Meth Enzymol 182:626-646 (1990); Rattan et al., Ann NY Acad Sci
663:48-62 (1992)).
[0205] As mentioned the TR14 polypeptides (proteins) of the
invention may be modified by either natural processes, such as
posttranslational processing, or by chemical modification
techniques which are well known in the art. It will be appreciated
that the same type of modification may be present in the same or
varying degrees at several sites in a given TR14 polypeptide. TR14
polypeptides may be branched, for example, as a result of
ubiquitination, and they may be cyclic, with or without branching.
Cyclic, branched, and branched cyclic TR14 polypeptides may result
from posttranslation natural processes or may be made by synthetic
methods. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination. (See, for instance, PROTEINS--STRUCTURE AND
MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and
Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION
OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs.
1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990);
Rattan et al., Ann NY Acad Sci 663:48-62 (1992)).
[0206] The TR13 polypeptides (proteins) of the invention can be
recovered and purified from chemical synthesis and recombinant cell
cultures by standard methods which include, but are not limited to,
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Well known techniques for refolding
protein may be employed to regenerate active conformation when the
polypeptide is denatured during isolation and/or purification.
[0207] The TR14 polypeptides (proteins) of the invention can be
recovered and purified from chemical synthesis and recombinant cell
cultures by standard methods which include, but are not limited to,
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Well known techniques for refolding
protein may be employed to regenerate active conformation when the
polypeptide is denatured during isolation and/or purification.
[0208] TR13 polynucleotides and polypeptides of the present
invention, and agonsits or antogonists thereof, may be used in
accordance with the present invention for a variety of
applications, particularly those that make use of the chemical and
biological properties of TR13. Among these are, for example,
applications in treatment of tumors; resistance to parasites,
bacteria and viruses; to regulate (i.e., induce) proliferation of
T-cells, endothelial cells and hematopoietic cells; to treat
restenosis, and graft vs. host disease; to regulate anti-viral
responses; and to prevent certain autoimmune diseases after
stimulation of TR13 by an agonist. Additional applications relate
to diagnosis and to treatment of disorders of cells, tissues and
organisms. These aspects of the invention are discussed further
below.
[0209] TR14 polynucleotides and polypeptides of the present
invention, and agonsits or antogonists thereof, may be used in
accordance with the present invention for a variety of
applications, particularly those that make use of the chemical and
biological properties of TR14. Among these are, for example,
applications in treatment of tumors; resistance to parasites,
bacteria and viruses; to regulate (i.e., induce) proliferation of
T-cells, endothelial cells and hematopoietic cells; to treat
restenosis, and graft vs. host disease; to regulate anti-viral
responses; and to prevent certain autoimmune diseases after
stimulation of TR14 by an agonist. Additional applications relate
to diagnosis and to treatment of disorders of cells, tissues and
organisms. These aspects of the invention are discussed further
below.
[0210] Transgenics and "Knock-Outs"
[0211] The TR13 polypeptides (proteins) of the invention can also
be expressed in transgenic animals. Animals of any species,
including, but not limited to, mice, rats, rabbits, hamsters,
guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human
primates, e.g., baboons, monkeys, and chimpanzees may be used to
generate transgenic animals. In a specific embodiment, techniques
described herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
[0212] The TR14 polypeptides (proteins) of the invention can also
be expressed in transgenic animals. Animals of any species,
including, but not limited to, mice, rats, rabbits, hamsters,
guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human
primates, e.g., baboons, monkeys, and chimpanzees may be used to
generate transgenic animals. In a specific embodiment, techniques
described herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
[0213] Any technique known in the art may be used to introduce the
transgene (i.e., nucleic acids of the invention) into animals to
produce the founder lines of transgenic animals. Such techniques
include, but are not limited to, pronuclear microinjection
(Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et
al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S.
Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into
germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA
82:6148-6152 (1985)), blastocysts or embryos; gene targeting in
embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, Mol Cell. Biol.
3:1803-1814 (1983)); introduction of the polynucleotides of the
invention using a gene gun (see, e.g., Ulmer et al., Science
259:1745 (1993); introducing nucleic acid constructs into embryonic
pleuripotent stem cells and transferring the stem cells back into
the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell 57:717-723 (1989); etc. For a review of such techniques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989),
which is incorporated by reference herein in its entirety. Further,
the contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety. See also, U.S.
Pat. No. 5,464,764 (Capecchi, et al., Positive-Negative Selection
Methods and Vectors); U.S. Pat. No. 5,631,153 (Capecchi, et al.,
Cells and Non-Human Organisms Containing Predetermined Genomic
Modifications and Positive-Negative Selection Methods and Vectors
for Making Same); U.S. Pat. No. 4,736,866 (Leder, et al.,
Transgenic Non-Human Animals); and U.S. Pat. No. 4,873,191 (Wagner,
et al., Genetic Transformation of Zygotes); each of which is hereby
incorporated by reference in its entirety.
[0214] Any technique known in the art may be used to produce
transgenic clones containing polynucleotides of the invention, for
example, nuclear transfer into enucleated oocytes of nuclei from
cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 (1997)), each of which is herein incorporated by
reference in its entirety).
[0215] The present invention provides for transgenic animals that
carry the transgene in all their cells, as well as animals which
carry the transgene in some, but not all their cells, i.e., mosaic
animals or chimeric animals. The transgene may be integrated as a
single transgene or as multiple copies such as in concatamers,
e.g., head-to-head tandems or head-to-tail tandems. The transgene
may also be selectively introduced into and activated in a
particular cell type by following, for example, the teaching of
Lasko et al. (Proc. Nat. Acad. Sci. USA 89:6232-6236 (1992)). The
regulatory sequences required for such a cell-type specific
activation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. When it is
desired that the polynucleotide transgene be integrated into the
chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous gene are designed for the purpose of integrating, via
homologous recombination with chromosomal sequences, into and
disrupting the function of the nucleotide sequence of the
endogenous gene. The transgene may also be selectively introduced
into a particular cell type, thus inactivating the endogenous gene
in only that cell type, by following, for example, the teaching of
Gu et al. (Science 265:103-106 (1994)). The regulatory sequences
required for such a cell-type specific inactivation will depend
upon the particular cell type of interest, and will be apparent to
those of skill in the art. The contents of each of the documents
recited in this paragraph is herein incorporated by reference in
its entirety.
[0216] Once transgenic animals have been generated, the expression
of the recombinant gene may be assayed utilizing standard
techniques. Initial screening may be accomplished by Southern blot
analysis or PCR techniques to analyze animal tissues to verify that
integration of the transgene has taken place. The level of mRNA
expression of the transgene in the tissues of the transgenic
animals may also be assessed using techniques which include, but
are not limited to, Northern blot analysis of tissue samples
obtained from the animal, in situ hybridization analysis, and
reverse transcriptase-PCR (rt-PCR). Samples of transgenic
gene-expressing tissue may also be evaluated immunocytochemically
or immunohistochemically using antibodies specific for the
transgene product.
[0217] Once the founder animals are produced, they may be bred,
inbred, outbred, or crossbred to produce colonies of the particular
animal. Examples of such breeding strategies include, but are not
limited to: outbreeding of founder animals with more than one
integration site in order to establish separate lines; inbreeding
of separate lines in order to produce compound transgenics that
express the transgene at higher levels because of the effects of
additive expression of each transgene; crossing of heterozygous
transgenic animals to produce animals homozygous for a given
integration site in order to both augment expression and eliminate
the need for screening of animals by DNA analysis; crossing of
separate homozygous lines to produce compound heterozygous or
homozygous lines; and breeding to place the transgene on a distinct
background that is appropriate for an experimental model of
interest.
[0218] Transgenic and "knock-out" animals of the invention have
uses which include, but are not limited to, animal model systems
useful in elaborating the biological function of TR13 polypeptides,
studying conditions and/or disorders associated with aberrant TR13
expression, and in screening for compounds effective in
ameliorating such conditions and/or disorders.
[0219] Transgenic and "knock-out" animals of the invention have
uses which include, but are not limited to, animal model systems
useful in elaborating the biological function of TR14 polypeptides,
studying conditions and/or disorders associated with aberrant TR14
expression, and in screening for compounds effective in
ameliorating such conditions and/or disorders.
[0220] In further embodiments of the invention, cells that are
genetically engineered to express the proteins of the invention, or
alternatively, that are genetically engineered not to express the
proteins of the invention (e.g., knockouts) are administered to a
patient in vivo. Such cells may be obtained from the patient (i.e.,
animal, including human) or an MHC compatible donor and can
include, but are not limited to fibroblasts, bone marrow cells,
blood cells (e.g., lymphocytes), adipocytes, muscle cells,
endothelial cells, etc. The cells are genetically engineered in
vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of clones, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
or inducible promoter or promoter/enhancer to achieve expression,
and preferably secretion, of the polypeptides of the invention. The
engineered cells which express and preferably secrete the
polypeptides of the invention can be introduced into the patient
systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can be incorporated into a matrix and
implanted in the body, e.g., genetically engineered fibroblasts can
be implanted as part of a skin graft; genetically engineered
endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959, each
of which is incorporated by reference herein in its entirety).
[0221] When the cells to be administered are non-autologous or
non-MHC compatible cells, they can be administered using well known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells may be
introduced in an encapsulated form which, while allowing for an
exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized
by the host immune system.
[0222] TR13 Polypeptides
[0223] The TR13 proteins (polypeptides) of the invention may be in
monomers or multimers (i.e., dimers, trimers, tetramers, and higher
multimers). Accordingly, the present invention relates to monomers
and multimers of the TR13 proteins (polypeptides) of the invention,
their preparation, and compositions (preferably, pharmaceutical
compositions) containing them. In specific embodiments, the
polypeptides of the invention are monomers, dimers, trimers or
tetramers. In additional embodiments, the multimers of the
invention are at least dimers, at least trimers, or at least
tetramers.
[0224] Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term TR13 homomer, refers to a
multimer containing only TR13 proteins of the invention (including
TR13 fragments, variants, and fusion proteins, as described
herein). These homomers may contain TR13 proteins having identical
or different polypeptide sequences. In a specific embodiment, a
homomer of the invention is a multimer containing only TR13
proteins having an identical polypeptide sequence. In another
specific embodiment, a homomer of the invention is a multimer
containing TR13 proteins having different polypeptide sequences. In
specific embodiments, the multimer of the invention is a homodimer
(e.g., containing TR13 proteins having identical or different
polypeptide sequences) or a homotrimer (e.g., containing TR13
proteins having identical or different polypeptide sequences). In
additional embodiments, the homomeric multimer of the invention is
at least a homodimer, at least a homotrimer, or at least a
homotetramer.
[0225] As used herein, the term TR13 heteromer refers to a multimer
containing heterologous proteins (i.e., proteins containing only
polypeptide sequences that do not correspond to a polypeptide
sequences encoded by the TR13 gene) in addition to the TR13
proteins of the invention. In a specific embodiment, the multimer
of the invention is a heterodimer, a heterotrimer, or a
heterotetramer. In additional embodiments, the heteromeric multimer
of the invention is at least a heterodimer, at least a
heterotrimer, or at least a heterotetramer.
[0226] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked, by for example, liposome formation. Thus, in one
embodiment, multimers of the invention, such as, for example,
homodimers or homotrimers, are formed when proteins of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example,
heterotrimers or heterotetramers, are formed when proteins of the
invention contact antibodies to the polypeptides of the invention
(including antibodies to the heterologous polypeptide sequence in a
fusion protein of the invention) in solution. In other embodiments,
multimers of the invention are formed by covalent associations with
and/or between the TR13 proteins of the invention. Such covalent
associations may involve one or more amino acid residues contained
in the polypeptide sequence of the protein (e.g., the polypeptide
sequence recited in SEQ ID NO:2 or SEQ ID NO:40 or the polypeptide
encoded by the cDNA deposited in ATCC Deposit No. PTA-349 or ATCC
Deposit No. PTA-507. In one instance, the covalent associations are
cross-linking between cysteine residues located within the
polypeptide sequences of the proteins which interact in the native
(i.e., naturally occurring) polypeptide. In another instance, the
covalent associations are the consequence of chemical or
recombinant manipulation. Alternatively, such covalent associations
may involve one or more amino acid residues contained in the
heterologous polypeptide sequence in a TR13 fusion protein. In one
example, covalent associations are between the heterologous
sequence contained in a fusion protein of the invention (see, e.g.,
U.S. Pat. No. 5,478,925). In a specific example, the covalent
associations are between the heterologous sequence contained in a
TR13-Fc fusion protein of the invention (as described herein). In
another specific example, covalent associations of fusion proteins
of the invention are between heterologous polypeptide sequences
from another TNF family ligand/receptor member that is capable of
forming covalently associated multimers, such as for example,
oseteoprotegerin (see, e.g., International Publication No. WO
98/49305, the contents of which are herein incorporated by
reference in its entirety). In another embodiment, two or more TR13
polypeptides of the invention are joined through synthetic linkers
(e.g., peptide, carbohydrate or soluble polymer linkers). Examples
include those peptide linkers described in U.S. Pat. No. 5,073,627
(hereby incorporated by reference). Proteins comprising multiple
TR13 polypeptides separated by peptide linkers may be produced
using conventional recombinant DNA technology.
[0227] Another method for preparing multimer TR13 polypeptides of
the invention involves use of TR13 polypeptides fused to a leucine
zipper or isoleucine polypeptide sequence. Leucine zipper domains
and isoleucine zipper domains are polypeptides that promote
multimerization of the proteins in which they are found. Leucine
zippers were originally identified in several DNA-binding proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been
found in a variety of different proteins. Among the known leucine
zippers are naturally occurring peptides and derivatives thereof
that dimerize or trimerize. Examples of leucine zipper domains
suitable for producing soluble multimeric TR13 proteins are those
described in PCT application WO 94/10308, hereby incorporated by
reference. Recombinant fusion proteins comprising a soluble TR13
polypeptide fused to a peptide that dimerizes or trimerizes in
solution are expressed in suitable host cells, and the resulting
soluble multimeric TR13 is recovered from the culture supernatant
using techniques known in the art.
[0228] Certain members of the TNF family of proteins are believed
to exist in trimeric form (Beutler and Huffel, Science 264:667,
1994; Banner et al., Cell 73:431, 1993). Thus, trimeric TR13 may
offer the advantage of enhanced biological activity. Preferred
leucine zipper moieties are those that preferentially form trimers.
One example is a leucine zipper derived from lung surfactant
protein D (SPD), as described in Hoppe et al. (FEBS Letters
344:191, (1994)) and in U.S. patent application Ser. No.
08/446,922, hereby incorporated by reference. Other peptides
derived from naturally occurring trimeric proteins may be employed
in preparing trimeric TR13.
[0229] In further preferred embodiments, TR13 polynucleotides of
the invention are fused to a polynucleotide encoding a "FLAG"
polypeptide. Thus, a TR13-FLAG fusion protein is encompassed by the
present invention. The FLAG antigenic polypeptide may be fused to a
TR13 polypeptide of the invention at either or both the amino or
the carboxy terminus. In preferred embodiments, a TR13-FLAG fusion
protein is expressed from a pFLAG-CMV-5a or a pFLAG-CMV-1
expression vector (available from Sigma, St. Louis, Mo., USA). See,
Andersson, S., et al., J. Biol. Chem. 264:8222-29 (1989); Thomsen,
D. R., et al., Proc. Natl. Acad. Sci. USA, 81:659-63 (1984); and
Kozak, M., Nature 308:241 (1984) (each of which is hereby
incorporated by reference). In further preferred embodiments, a
TR13-FLAG fusion protein is detectable by anti-FLAG monoclonal
antibodies (also available from Sigma).
[0230] In another example, proteins of the invention are associated
by interactions between Flag.RTM. polypeptide sequence contained in
Flag.RTM.-TR13 fusion proteins of the invention. In a further
embodiment, associated proteins of the invention are associated by
interactions between heterologous polypeptide sequence contained in
Flag.RTM.-TR13 fusion proteins of the invention and anti-Flag.RTM.
antibody.
[0231] The multimers of the invention may be generated using
chemical techniques known in the art. For example, proteins desired
to be contained in the multimers of the invention may be chemically
cross-linked using linker molecules and linker molecule length
optimization techniques known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the polypeptide sequence of the proteins desired to be
contained in the multimer (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
Further, proteins of the invention may be routinely modified by the
addition of cysteine or biotin to the C terminus or N-terminus of
the polypeptide sequence of the protein and techniques known in the
art may be applied to generate multimers containing one or more of
these modified proteins (see, e.g., U.S. Pat. No. 5,478,925, which
is herein incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the protein components desired to be contained in the
multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
[0232] Alternatively, multimers of the invention may be generated
using genetic engineering techniques known in the art. In one
embodiment, proteins contained in multimers of the invention are
produced recombinantly using fusion protein technology described
herein or otherwise known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). In a specific embodiment, polynucleotides coding for a
homodimer of the invention are generated by ligating a
polynucleotide sequence encoding a polypeptide of the invention to
a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the
polypeptide in the reverse orientation from the original C-terminus
to the N-terminus (lacking the leader sequence) (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, recombinant techniques
described herein or otherwise known in the art are applied to
generate recombinant polypeptides of the invention which contain a
transmembrane domain and which can be incorporated by membrane
reconstitution techniques into liposomes (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety).
[0233] The polypeptides (proteins) of the present invention are
preferably provided in an isolated form. By "isolated polypeptide"
is intended a polypeptide removed from its native environment.
Thus, a polypeptide produced and/or contained within a recombinant
host cell is considered isolated for purposes of the present
invention. Also intended as an "isolated polypeptide" are
polypeptides that have been purified, partially or substantially,
from a recombinant host cell. For example, a recombinantly produced
version of the TR13 polypeptide can be substantially purified by
the one-step method described in Smith and Johnson, Gene 67:31-40
(1988).
[0234] Accordingly, in one embodiment, the invention provides an
isolated TR13 polypeptide having the amino acid sequence encoded by
the cDNA deposited in ATCC Deposit No. PTA-349 or ATCC Deposit No.
PTA-507, or the amino acid sequence in SEQ ID NO:2 or SEQ ID NO:40,
or a peptide or polypeptide comprising a portion of the above
polypeptides.
[0235] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of, an amino
acid sequence contained in SEQ ID NO:2, encoded by the cDNA
contained in the clone deposited as ATCC Deposit No. PTA-349, or
encoded by a nucleic acid which hybridizes (e.g., under stringent
hybridization conditions) to the nucleotide sequence contained in
the deposited clone, or shown in FIGS. 1A-D (SEQ ID NO:1) or the
complementary strand thereto, or polynucleotide fragments thereof
(e.g., as disclosed herein). Protein fragments may be
"free-standing," or comprised within a larger polypeptide of which
the fragment forms a part or region, most preferably as a single
continuous region. Representative examples of polypeptide fragments
of the invention, include, for example, fragments that comprise, or
alternatively consist of, from about amino acid residues: 1 to
50,51 to 100, 101 to 150,151 to 200,201 to 250,251 to 300,301 to
350,351 to 400,401 to 450,451 to 500,501 to 550,551 to 600,601 to
650,651 to 700, and/or 701 to 750 of SEQ ID NO:2. Moreover,
polypeptide fragments can be at least 10, 20, 30, 40, 50, 60, 70,
80, 90, 100, 110, 120, 130, 140, 150, 175 or 200 amino acids in
length. In this context "about" includes the particularly recited
ranges, larger or smaller by several (5, 4, 3, 2, or 1) amino
acids, at either extreme or at both extremes. Polynucleotides
encoding these polypeptide fragments are also encompassed by the
invention.
[0236] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of, an amino
acid sequence contained in SEQ ID NO:40, encoded by the cDNA
contained in the clone deposited as ATCC Deposit No. PTA-507, or
encoded by a nucleic acid which hybridizes (e.g., under stringent
hybridization conditions) to the nucleotide sequence contained in
the deposited clone, or shown in FIGS. 7A-E (SEQ ID NO:40) or the
complementary strand thereto or polynucleotide fragments thereof
(e.g., as disclosed herein). Protein fragments may be
"free-standing," or comprised within a larger polypeptide of which
the fragment forms a part or region, most preferably as a single
continuous region. Representative examples of polypeptide fragments
of the invention, include, for example, fragments that comprise, or
alternatively consist of, from about amino acid residues: 1 to 50,
51 to 100, 101 to 150, 151 to 200, 201 to 250, 251 to 300, 301 to
350, 351 to 400, 401 to 450, 451 to 500, 501 to 550, 551 to 600,
601 to 650, 651 to 700, 701 to 750, 751 to 800, 801 to 850, 851 to
900, 901 to 950, and/or 951 to 1001 of SEQ ID NO:2. Moreover,
polypeptide fragments can be at least 10, 20, 30, 40, 50, 60, 70,
80, 90, 100, 110, 120, 130, 140, 150, 175, 200, 250, 300, 350, 400,
450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1001
amino acids in length. In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptide fragments are also
encompassed by the invention.
[0237] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of from about
amino acid residues: 105 to about 170, from 251 to about 265, from
331 to about 410, from 580 to about 610, from 139 to about 142,
from 140 to about 143, from 153 to about 156, from 293 to about
296, from 325 to about 328, from 421 to about 424, from 466 to
about 469, from 696 to about 699, from 728 to about 731, from 312
to about 315, from 454 to about 461, from 458 to about 461, from 50
to about 53, from 66 to about 69, from 80 to about 83, from 276 to
about 279, from 311 to about 314, from 438 to about 441, from 559
to about 562, from 564 to about 567, from 698 to about 701, from
725 to about 728, from 80 to about 83, from 89 to about 92, from
180 to about 183, from 198 to about 201, from 214 to about 217,
from 272 to about 275, from 306 to about 309, from 510 to about
513, from 529 to about 532, from 584 to about 867, from 609 to
about 612, from 642 to about 645, from 698 to about 701, from 69 to
about 74, from 149 to about 154, from 154 to about 159, from 163 to
about 168, from 212 to about 217, from 248 to about 253, from 365
to about 370, from 383 to about 388, from 393 to about 398, from
588 to about 593, from 623 to about 628, from 661 to about 666,
from 665 to about 670, and/or 456 to about 459 of SEQ ID NO:2. In
this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at
either extreme or at both extremes. Polynucleotides encoding these
polypeptide fragments are also encompassed by the invention.
[0238] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of from about
amino acid residues: 42 to about 906, from 42 to about 1001, from
906 to about 931, from 932 to about 1001, from 271 to about 421,
from 271 to about 286, from 290 to about 300, from 301 to about
320, from 329 to about 361, from 404 to about 421, from 585 to
about 595, from 661 to about 674, from 710 to about 744, from 980
to about 991, from 45 to about 60, from 121 to about 135, from 145
to about 160, from 1 to about 262, from 264 to about 423, from 437
to about 789, from 791 to about 1001, from 310 to about 363, from
477 to about 519, from 769 to about 887, from 153 to about 156,
from 11 to about 13, from about 18 to about 20, from 107 to about
109, from about 156 to about 158, from about 224 to about 226, from
about 301 to about 303, from about 317 to about 319, from about 331
to about 333, from about 527 to about 529, from about 562 to about
564, from about 689 to about 691, from about 810 to about 812, from
about 815 to about 817, from about 949 to about 951, from about 976
to about 978, from 42 to about 45, from about 59 to about 62, from
about 81 to about 84, from about 146 to about 149, from about 282
to about 285, from about 331 to about 334, from about 340 to about
343, from about 431 to about 434, from about 449 to about 452, from
about 465 to about 468, from about 523 to about 526, from about 557
to about 560, from about 761 to about 764, from about 780 to about
783, from about 780 to about 783, from about 835 to about 838, from
about 860 to about 863, from about 893 to about 896, from about 949
to about 952, from from about 77 to about 82, from about 88 to
about 93, from about 152 to about 157, from about 268 to about 273,
from about 288 to about 293, from about 320 to about 325, from
about 400 to about 405, from about 414 to about 419, from about 463
to about 468, from about 599 to about 604, from about 616 to about
621, from about 634 to about 639, from about 644 to about 649, from
about 839 to about 844, from about 874 to about 879, from about 912
to about 917, from about 916 to about 921, from from about 50 to
about 56, from from about 109 to about 116, from from about 153 to
about 156, from 390 to about 393, from 391 to about 394, from about
404 to about 407, from about 544 to about 547, from about 576 to
about 579, from about 672 to about 675, from about 717 to about
720, from about 947 to about 950, from and about 979 to about 982
of SEQ ID NO:40. In this context "about" includes the particularly
recited ranges, larger or smaller by several (5, 4, 3, 2, or 1)
amino acids, at either extreme or at both extremes.
[0239] In additional embodiments, the polypeptide fragments of the
invention comprise, or alternatively consist of, one or more
domains of the TR13 polypeptide disclosed in FIGS. 1A-D. Preferred
polypeptide fragments of the present invention include a member
selected from the group: (a) a polypeptide comprising or
alternatively, consisting of, any combination of one, two, three,
or all four of the TR13 cysteine rich domains disclosed in FIGS.
1A-D (predicted to constitute amino acid residues from about 105 to
about 170, about 251 to about 265, about 331 to about 410, and
about 580 to about 610 of SEQ ID NO:2); (b) a polypeptide
comprising, or alternatively, consisting of, one, two, three, four
or more, epitope bearing portions of the TR13 receptor protein
disclosed in FIGS. 1A-D (for example, those epitope bearing
portions predicted to constitute amino acid residues from about 1
to about 170, or about 210 to about 318, or about 343 to about 480,
or about 548 to about 592, or about 632 to about 742 of SEQ ID
NO:2); (c) any combination of polypeptides (a)-(c). Polynucleotides
encoding these polypeptides are also encompassed by the invention.
In this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at
either extreme or at both extremes. Polynucleotides encoding these
polypeptide fragments are also encompassed by the invention.
[0240] In additional embodiments, the polypeptide fragments of the
invention comprise, or alternatively consist of, one or more
domains of the TR13 polypeptide disclosed in FIG. 7A-E. Preferred
polypeptide fragments of the present invention include a member
selected from the group: (a) a polypeptide comprising, or
alternatively consisting of, amino acids 1 to about 41 of SEQ ID
NO:40; (b) a polypeptide comprising, or alternatively consisting
of, amino acids 42 to about 906 of SEQ ID NO:40; (c) a polypeptide
comprising, or alternatively consisting of, amino acids 907 to
about 931 of SEQ ID NO:40; (d) a polypeptide comprising, or
alternatively consisting of, amino acids 932 to about 1001 of SEQ
ID NO:40; (e) a polypeptide comprising or alternatively, consisting
of, any combination of one, two, three, four or more of the TR13
cysteine rich domains disclosed in FIGS. 7A-E (predicted to
constitute amino acid residues from about 271 to about 421, 271 to
about 286, about 290 to about 300, about 301 to about 320, about
329 to about 361, about 404 to about 421, about 585 to about 595 of
SEQ ID NO:40); (f) a polypeptide comprising, or alternatively,
consisting of, one, two, three, four or more, epitope bearing
portions of the TR13 receptor protein disclosed in FIGS. 7A-E (for
example, these epitope bearing portions predicted to constitute
amino acid residues from about 1 to about 262, or about 264 to
about 423, or about 437 to about 789, or about 791 to about 1001,
of SEQ ID NO:40); and (g) any combination of polypeptides (a)-(f).
In this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at
either extreme or at both extremes. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0241] As discussed above, it is believed that the extracellular
cysteine rich motifs of TR13 are important for interactions between
TR13 and its ligands. Accordingly, in preferred embodiments,
polypeptide fragments of the invention comprise, or alternatively
consist of amino acid residues from about 105 to about 170, about
251 to about 265, about 331 to about 410 and/or about 580 to about
610 of the amino acid sequence disclosed in FIGS. 1A-D (SEQ ID
NO:2). In a specific embodiment the polypeptides of the invention
comprise, or alternatively consist of any combination of one, two,
three or all four extracellular cysteine rich motifs disclosed in
FIGS. 1A-D. In this context "about" includes the particularly
recited ranges, larger or smaller by several (5, 4, 3, 2, or 1)
amino acids, at either extreme or at both extremes. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0242] As discussed above, it is believed that the extracellular
cysteine rich motifs of TR13 are important for interactions between
TR13 and its ligands. Accordingly, in preferred embodiments,
polypeptide fragments of the invention comprise, or alternatively
consist of amino acid residues from about 271 to about 421, or 271
to about 286, or about 290 to about 300, or about 301 to about 320,
or about 329 to about 361, or about 404 to about 421, or about 585
to about 595 of the amino acid sequence disclosed in FIGS. 7A-E
(SEQ ID NO:40). In a specific embodiment the polypeptides of the
invention comprise, or alternatively consist of any combination of
one, two, three, four or more of the extracellular cysteine rich
motifs disclosed in FIGS. 7A-E. In this context "about" includes
the particularly recited ranges, larger or smaller by several (5,
4, 3, 2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0243] Among the especially preferred fragments of the invention
are fragments characterized by structural or functional attributes
of TR13 (SEQ ID NO:2 or SEQ ID NO:40). Such fragments include amino
acid residues that comprise alpha-helix and alpha-helix forming
regions ("alpha-regions"), beta-sheet and beta-sheet-forming
regions ("beta-regions"), turn and turn-forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"),
hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta amphipathic regions, surface forming regions, and
high antigenic index regions (i.e., containing four or more
contiguous amino acids having an antigenic index of greater than or
equal to 1.5, as identified using the default parameters of the
Jameson-Wolf program) of complete (i.e., full-length) TR13 (SEQ ID
NO:2 or SEQ ID NO:40). Certain preferred regions are those set out
in FIG. 3 (Table I) and FIG. 9 (Table III) and include, but are not
limited to, regions of the aforementioned types identified by
analysis of the amino acid sequence depicted in FIGS. 1A-D (SEQ ID
NO:2) or FIGS. 7A-E (SEQ ID NO:40), respectively. Such preferred
regions include; Garnier-Robson predicted alpha-regions,
beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted
alpha-regions, beta-regions, and turn-regions; Kyte-Doolittle
predicted hydrophilic and Hopp-Woods predicted hydrophobic regions;
Eisenberg alpha and beta amphipathic regions; Emini surface-forming
regions; and Jameson-Wolf high antigenic index regions, as
predicted using the default parameters of these computer programs.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0244] As mentioned above, even if deletion of one or more amino
acids from the N-terminus of a protein results in modification of
loss of one or more biological functions of the protein, other
functional activities (e.g., biological activities, ability to
multimerize, ability to bind TR13 ligand) may still be retained.
For example, the ability of shortened TR13 muteins to induce and/or
bind to antibodies which recognize the complete or mature forms of
the polypeptides generally will be retained when less than the
majority of the residues of the complete or mature polypeptide are
removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete polypeptide retains such
immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art. It is not unlikely
that an TR13 mutein with a large number of deleted N-terminal amino
acid residues may retain some biological or immunogenic activities.
In fact, peptides composed of as few as six TR13 amino acid
residues may often evoke an immune response.
[0245] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the TR13 amino acid sequence shown in FIGS. 1A-D, up to
the aspartic acid residue at position number 745 and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues
n1-750 of FIGS. 1A-D, where n1 is an integer from 2 to 745
corresponding to the position of the amino acid residue in FIGS.
1A-D (which is identical to the sequence shown as SEQ ID NO:2). In
a specific embodiment, the present invention provides polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues n1-750 of FIGS. 1A-D, where n1 is an integer from 2 to
610 corresponding to the position of the amino acid residue in
FIGS. 1A-D. Polynucleotides encoding these polypeptides are also
encompassed.
[0246] In one embodiment, N-terminal deletions of the TR13
polypeptides of the invention can be described by the general
formula n.sup.2-750, where n.sup.2 is a number from 2 to 745,
corresponding to the position of amino acid identified in FIGS.
1A-D (SEQ ID NO:2). N-terminal deletions of the TR13 polypeptide of
the invention shown as SEQ ID NO:2 include polypeptides comprising,
or alternatively consisting of, the amino acid sequence of
residues: D-2 to R-750; Q-3 to R-750; S-4 to R-750; T-5 to R-750;
Q-6 to R-750; A-7 to R-750; C-8 to R-750; A-9 to R-750; G-10 to
R-750; E-11 to R-750; K-12 to R-750; H-13 to R-750; C-14 to R-750;
H-15 to R-750; N-16 to R-750; R-17 to R-750; G-18 to R-750; G-19 to
R-750; L-20 to R-750; H-21 to R-750; F-22 to R-750; R-23 to R-750;
M-24 to R-750; L-25 to R-750; P-26 to R-750; L-27 to R-750; Q-28 to
R-750; T-29 to R-750; W-30 to R-750; H-31 to R-750; V-32 to R-750;
C-33 to R-750; R-34 to R-750; Q-35 to R-750; A-36 to R-750; G-37 to
R-750; L-38 to R-750; L-39 to R-750; F-40 to R-750; L-41 to R-750;
Q-42 to R-750; T-43 to R-750; L-44 to R-750; P-45 to R-750; S-46 to
R-750; N-47 to R-750; S-48 to R-750; Y-49 to R-750; S-50 to R-750;
N-51 to R-750; K-52 to R-750; G-53 to R-750; E-54 to R-750; T-55 to
R-750; S-56 to R-750; C-57 to R-750; H-58 to R-750; Q-59 to R-750;
C-60 to R-750; D-61 to R-750; P-62 to R-750; D-63 to R-750; K-64 to
R-750; Y-65 to R-750; S-66 to R-750; E-67 to R-750; K-68 to R-750;
G-69 to R-750; S-70 to R-750; S-71 to R-750; S-72 to R-750; C-73 to
R-750; N-74 to R-750; V-75 to R-750; R-76 to R-750; P-77 to R-750;
A-78 to R-750; C-79 to R-750; T-80 to R-750; D-81 to R-750; K-82 to
R-750; D-83 to R-750; Y-84 to R-750; F-85 to R-750; Y-86 to R-750;
T-87 to R-750; H-88 to R-750; T-89 to R-750; A-90 to R-750; C-91 to
R-750; D-92 to R-750; A-93 to R-750; N-94 to R-750; G-95 to R-750;
E-96 to R-750; T-97 to R-750; Q-98 to R-750; L-99 to R-750; M-100
to R-750; Y-101 to R-750; K-102 to R-750; W-103 to R-750; A-104 to
R-750; K-105 to R-750; P-106 to R-750; K-107 to R-750; I-108 to
R-750; C-109 to R-750; S-110 to R-750; E-111 to R-750; D-112 to
R-750; L-113 to R-750; E-114 to R-750; G-115 to R-750; A-116 to
R-750; V-117 to R-750; K-118 to R-750; L-119 to R-750; P-120 to
R-750; A-121 to R-750; S-122 to R-750; G-123 to R-750; V-124 to
R-750; K-125 to R-750; T-126 to R-750; H-127 to R-750; C-128 to
R-750; P-129 to R-750; P-130 to R-750; C-131 to R-750; N-132 to
R-750; P-133 to R-750; G-134 to R-750; F-135 to R-750; F-136 to
R-750; K-137 to R-750; T-138 to R-750; N-139 to R-750; N-140 to
R-750; S-141 to R-750; T-142 to R-750; C-143 to R-750; Q-144 to
R-750; P-145 to R-750; C-146 to R-750; P-147 to R-750; Y-148 to
R-750; G-149 to R-750; S-150 to R-750; Y-151 to R-750; S-152 to
R-750; N-153 to R-750; G-154 to R-750; S-155 to R-750; D-156 to
R-750; C-157 to R-750; T-158 to R-750; R-159 to R-750; C-160 to
R-750; P-161 to R-750; A-162 to R-750; G-163 to R-750; T-164 to
R-750; E-165 to R-750; P-166 to R-750; A-167 to R-750; V-168 to
R-750; G-169 to R-750; F-170 to R-750; E-171 to R-750; Y-172 to
R-750; K-173 to R-750; W-174 to R-750; W-175 to R-750; N-176 to
R-750; T-177 to R-750; L-178 to R-750; P-179 to R-750; T-180 to
R-750; N-181 to R-750; M-182 to R-750; E-183 to R-750; T-184 to
R-750; T-185 to R-750; V-186 to R-750; L-187 to R-750; S-188 to
R-750; G-189 to R-750; I-190 to R-750; N-191 to R-750; F-192 to
R-750; E-193 to R-750; Y-194 to R-750; K-195 to R-750; G-196 to
R-750; M-197 to R-750; T-198 to R-750; G-199 to R-750; W-200 to
R-750; E-201 to R-750; V-202 to R-750; A-203 to R-750; G-204 to
R-750; D-205 to R-750; H-206 to R-750; I-207 to R-750; Y-208 to
R-750; T-209 to R-750; A-210 to R-750; A-211 to R-750; G-212 to
R-750; A-213 to R-750; S-214 to R-750; D-215 to R-750; N-216 to
R-750; D-217 to R-750; F-218 to R-750; M-219 to R-750; I-220 to
R-750; L-221 to R-750; T-222 to R-750; L-223 to R-750; V-224 to
R-750; V-225 to R-750; P-226 to R-750; G-227 to R-750; F-228 to
R-750; R-229 to R-750; P-230 to R-750; P-231 to R-750; Q-232 to
R-750; S-233 to R-750; V-234 to R-750; M-235 to R-750; A-236 to
R-750; D-237 to R-750; T-238 to R-750; E-239 to R-750; N-240 to
R-750; K-241 to R-750; E-242 to R-750; V-243 to R-750; A-244 to
R-750; R-245 to R-750; I-246 to R-750; T-247 to R-750; F-248 to
R-750; V-249 to R-750; F-250 to R-750; E-251 to R-750; T-252 to
R-750; L-253 to R-750; C-254 to R-750; S-255 to R-750; V-256 to
R-750; N-257 to R-750; C-258 to R-750; E-259 to R-750; L-260 to
R-750; Y-261 to R-750; F-262 to R-750; M-263 to R-750; V-264 to
R-750; G-265 to R-750; V-266 to R-750; N-267 to R-750; S-268 to
R-750; R-269 to R-750; T-270 to R-750; N-271 to R-750; T-272 to
R-750; P-273 to R-750; V-274 to R-750; E-275 to R-750; T-276 to
R-750; W-277 to R-750; K-278 to R-750; G-279 to R-750; S-280 to
R-750; K-281 to R-750; G-282 to R-750; K-283 to R-750; Q-284 to
R-750; S-285 to R-750; Y-286 to R-750; T-287 to R-750; Y-288 to
R-750; I-289 to R-750; I-290 to R-750; E-291 to R-750; E-292 to
R-750; N-293 to R-750; T-294 to R-750; T-295 to R-750; T-296 to
R-750; S-297 to R-750; F-298 to R-750; T-299 to R-750; W-300 to
R-750; A-301 to R-750; F-302 to R-750; Q-303 to R-750; R-304 to
R-750; T-305 to R-750; T-306 to R-750; F-307 to R-750; H-308 to
R-750; E-309 to R-750; A-310 to R-750; S-311 to R-750; R-312 to
R-750; K-313 to R-750; Y-314 to R-750; T-315 to R-750; N-316 to
R-750; D-317 to R-750; V-318 to R-750; A-319 to R-750; K-320 to
R-750; I-321 to R-750; Y-322 to R-750; S-323 to R-750; I-324 to
R-750; N-325 to R-750; V-326 to R-750; T-327 to R-750; N-328 to
R-750; V-329 to R-750; M-330 to R-750; N-331 to R-750; G-332 to
R-750; V-333 to R-750; A-334 to R-750; S-335 to R-750; Y-336 to
R-750; C-337 to R-750; R-338 to R-750; P-339 to R-750; C-340 to
R-750; A-341 to R-750; L-342 to R-750; E-343 to R-750; A-344 to
R-750; S-345 to R-750; D-346 to R-750; V-347 to R-750; G-348 to
R-750; S-349 to R-750; S-350 to R-750; C-351 to R-750; T-352 to
R-750; S-353 to R-750; C-354 to R-750; P-355 to R-750; A-356 to
R-750; G-357 to R-750; Y-358 to R-750; Y-359 to R-750; I-360 to
R-750; D-361 to R-750; R-362 to R-750; D-363 to R-750; S-364 to
R-750; G-365 to R-750; T-366 to R-750; C-367 to R-750; H-368 to
R-750; S-369 to R-750; C-370 to R-750; P-371 to R-750; P-372 to
R-750; N-373 to R-750; T-374 to R-750; I-375 to R-750; L-376 to
R-750; K-377 to R-750; A-378 to R-750; H-379 to R-750; Q-380 to
R-750; P-381 to R-750; Y-382 to R-750; G-383 to R-750; V-384 to
R-750; Q-385 to R-750; A-386 to R-750; C-387 to R-750; V-388 to
R-750; P-389 to R-750; C-390 to R-750; G-391 to R-750; P-392 to
R-750; G-393 to R-750; T-394 to R-750; K-395 to R-750; N-396 to
R-750; N-397 to R-750; K-398 to R-750; I-399 to R-750; H-400 to
R-750; S-401 to R-750; L-402 to R-750; C-403 to R-750; Y-404 to
R-750; N.sub.4O.sub.5 to R-750; D-406 to R-750; C-407 to R-750;
T-408 to R-750; F-409 to R-750; S-410 to R-750; R-411 to R-750;
N-412 to R-750; T-413 to R-750; P-414 to R-750; T-415 to R-750;
R-416 to R-750; T-417 to R-750; F-418 to R-750; N-419 to R-750;
Y-420 to R-750; N-421 to R-750; F-422 to R-750; S-423 to R-750;
A-424 to R-750; L-425 to R-750; A-426 to R-750; N-427 to R-750;
T-428 to R-750; V-429 to R-750; T-430 to R-750; L-431 to R-750;
A-432 to R-750; G-433 to R-750; G-434 to R-750; P-435 to R-750;
S-436 to R-750; F-437 to R-750; T-438 to R-750; S-439 to R-750;
K-440 to R-750; G-441 to R-750; L-442 to R-750; K-443 to R-750;
Y-444 to R-750; F-445 to R-750; H-446 to R-750; H-447 to R-750;
F-448 to R-750; T-449 to R-750; L-450 to R-750; S-451 to R-750;
L-452 to R-750; C-453 to R-750; G-454 to R-750; N-455 to R-750;
Q-456 to R-750; G-457 to R-750; R-458 to R-750; K-459 to R-750;
M-460 to R-750; S-461 to R-750; V-462 to R-750; C-463 to R-750;
T-464 to R-750; D-465 to R-750; N-466 to R-750; V-467 to R-750;
T-468 to R-750; D-469 to R-750; L-470 to R-750; R-471 to R-750;
I-472 to R-750; P-473 to R-750; E-474 to R-750; G-475 to R-750;
E-476 to R-750; S-477 to R-750; G-478 to R-750; F-479 to R-750;
S-480 to R-750; K-481 to R-750; S-482 to R-750; I-483 to R-750;
T-484 to R-750; A-485 to R-750; Y-486 to R-750; V-487 to R-750;
C-488 to R-750; Q-489 to R-750; A-490 to R-750; V-491 to R-750;
I-492 to R-750; I-493 to R-750; P-494 to R-750; P-495 to R-750;
E-496 to R-750; V-497 to R-750; T-498 to R-750; G-499 to R-750;
Y-500 to R-750; K-501 to R-750; A-502 to R-750; G-503 to R-750;
V-504 to R-750; S-505 to R-750; S-506 to R-750; Q-507 to R-750;
P-508 to R-750; V-509 to R-750; S-510 to R-750; L-511 to R-750;
A-512 to R-750; D-513 to R-750; R-514 to R-750; L-515 to R-750;
I-516 to R-750; G-517 to R-750; V-518 to R-750; T-519 to R-750;
T-520 to R-750; D-521 to R-750; M-522 to R-750; T-523 to R-750;
L-524 to R-750; D-525 to R-750; G-526 to R-750; I-527 to R-750;
T-528 to R-750; S-529 to R-750; P-530 to R-750; A-531 to R-750;
E-532 to R-750; L-533 to R-750; F-534 to R-750; H-535 to R-750;
L-536 to R-750; E-537 to R-750; S-538 to R-750; L-539 to R-750;
G-540 to R-750; I-541 to R-750; P-542 to R-750; D-543 to R-750;
V-544 to R-750; I-545 to R-750; F-546 to R-750; F-547 to R-750;
Y-548 to R-750; R-549 to R-750; S-550 to R-750; N-551 to R-750;
D-552 to R-750; V-553 to R-750; T-554 to R-750; Q-555 to R-750;
S-556 to R-750; C-557 to R-750; S-558 to R-750; S-559 to R-750;
G-560 to R-750; R-561 to R-750; S-562 to R-750; T-563 to R-750;
T-564 to R-750; I-565 to R-750; R-566 to R-750; V-567 to R-750;
R-568 to R-750; C-569 to R-750; S-570 to R-750; P-571 to R-750;
Q-572 to R-750; K-573 to R-750; T-574 to R-750; V-575 to R-750;
P-576 to R-750; G-577 to R-750; S-578 to R-750; L-579 to R-750;
L-580 to R-750; L-581 to R-750; P-582 to R-750; G-583 to R-750;
T-584 to R-750; C-585 to R-750; S-586 to R-750; D-587 to R-750;
G-588 to R-750; T-589 to R-750; C-590 to R-750; D-591 to R-750;
G-592 to R-750; C-593 to R-750; N-594 to R-750; F-595 to R-750;
H-596 to R-750; F-597 to R-750; L-598 to R-750; W-599 to R-750;
E-600 to R-750; S-601 to R-750; A-602 to R-750; A-603 to R-750;
A-604 to R-750; C-605 to R-750; P-606 to R-750; L-607 to R-750;
C-608 to R-750; S-609 to R-750; V-610 to R-750; A-611 to R-750;
D-612 to R-750; Y-613 to R-750; H-614 to R-750; A-615 to R-750;
I-616 to R-750; V-617 to R-750; S-618 to R-750; S-619 to R-750;
C-620 to R-750; V-621 to R-750; A-622 to R-750; G-623 to R-750;
I-624 to R-750; Q-625 to R-750; K-626 to R-750; T-627 to R-750;
T-628 to R-750; Y-629 to R-750; V-630 to R-750; W-631 to R-750;
R-632 to R-750; E-633 to R-750; P-634 to R-750; K-635 to R-750;
L-636 to R-750; C-637 to R-750; S-638 to R-750; G-639 to R-750;
G-640 to R-750; I-641 to R-750; S-642 to R-750; L-643 to R-750;
P-644 to R-750; E-645 to R-750; Q-646 to R-750; R-647 to R-750;
V-648 to R-750; T-649 to R-750; I-650 to R-750; C-651 to R-750;
K-652 to R-750; T-653 to R-750; I-654 to R-750; D-655 to R-750;
F-656 to R-750; W-657 to R-750; L-658 to R-750; K-659 to R-750;
V-660 to R-750; G-661 to R-750; I-662 to R-750; S-663 to R-750;
A-664 to R-750; G-665 to R-750; T-666 to R-750; C-667 to R-750;
T-668 to R-750; A-669 to R-750; I-670 to R-750; L-671 to R-750;
L-672 to R-750; T-673 to R-750; V-674 to R-750; L-675 to R-750;
T-676 to R-750; C-677 to R-750; Y-678 to R-750; F-679 to R-750;
W-680 to R-750; K-681 to R-750; K-682 to R-750; N-683 to R-750;
Q-684 to R-750; K-685 to R-750; L-686 to R-750; E-687 to R-750;
Y-688 to R-750; K-689 to R-750; Y-690 to R-750; S-691 to R-750;
K-692 to R-750; L-693 to R-750; V-694 to R-750; M-695 to R-750;
N-696 to R-750; A-697 to R-750; T-698 to R-750; L-699 to R-750;
K-700 to R-750; D-701 to R-750; C-702 to R-750; D-703 to R-750;
L-704 to R-750; P-705 to R-750; A-706 to R-750; A-707 to R-750;
D-708 to R-750; S-709 to R-750; C-710 to R-750; A-711 to R-750;
I-712 to R-750; M-713 to R-750; E-714 to R-750; G-715 to R-750;
E-716 to R-750; D-717 to R-750; V-718 to R-750; E-719 to R-750;
D-720 to R-750; D-721 to R-750; L-722 to R-750; I-723 to R-750;
F-724 to R-750; T-725 to R-750; S-726 to R-750; K-727 to R-750;
N-728 to R-750; H-729 to R-750; S-730 to R-750; L-731 to R-750;
G-732 to R-750; R-733 to R-750; S-734 to R-750; N-735 to R-750;
H-736 to R-750; L-737 to R-750; P-738 to R-750; P-739 to R-750;
R-740 to R-750; G-741 to R-750; L-742 to R-750; L-743 to R-750;
M-744 to R-750; D-745 to R-750; of SEQ ID NO:2. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0247] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the TR13 amino acid sequence shown in FIGS. 7A-E, up to
the aspartic acid residue at position number 996 and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues
n1-1001 of FIGS. 7A-E, where n1 is an integer from 2 to 996
corresponding to the position of the amino acid residue in FIGS.
7A-E (which is identical to the sequence shown as SEQ ID NO:40). In
a specific embodiment, the present invention provides polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues n1-906 of FIGS. 7A-E where n1 is an integer from 42 to
595 corresponding to the position of the amino acid residue in
FIGS. 7A-E. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0248] In another embodiment, N-terminal deletions of the TR13
polypeptide can be described by the general formula n.sup.2-1001,
where n.sup.2 is a number from 2 to 996, corresponding to the
position of amino acid identified in FIGS. 7A-E (SEQ ID NO:40).
N-terminal deletions of the TR13 polypeptide of the invention shown
as SEQ ID NO:40 include polypeptides comprising, or alternatively
consisting of, the amino acid sequence of residues: A-2 to R-1001;
E-3 to R-1001; P-4 to R-1001; G-5 to R-1001; H-6 to R-1001; S-7 to
R-1001; H-8 to R-1001; H-9 to R-1001; L-1001 to R-1001; A-12 to
R-1001; R-13 to R-1001; V-14 to R-1001; R-15 to R-1001; G-16 to
R-1001; R-17 to R-1001; T-18 to R-1001; E-19 to R-1001; R-20 to
R-1001; I-22 to R-1001; R-24 to R-1001; L-25 to R-1001; W-26 to
R-1001; R-27 to R-1001; L-28 to R-1001; L-29 to R-1001; L-30 to
R-1001; W-31 to R-1001; A-32 to R-1001; G-33 to R-1001; T-34 to
R-1001; A-35 to R-1001; F-36 to R-1001; Q-37 to R-1001; V-38 to
R-1001; T-39 to R-1001; Q-40 to R-1001; G-41 to R-1001; T-42 to
R-1001; G-43 to R-1001; P-44 to R-1001; E-45 to R-1001; L-46 to
R-1001; H-47 to R-1001; A-48 to R-1001; C-49 to R-1001; K-50 to
R-1001; E-51 to R-1001; S-52 to R-1001; E-53 to R-1001; Y-54 to
R-1001; H-55 to R-1001; Y-56 to R-1001; E-57 to R-1001; Y-58 to
R-1001; T-59 to R-1001; A-60 to R-1001; C-61 to R-1001; D-62 to
R-1001; S-63 to R-1001; T-64 to R-1001; G-65 to R-1001; S-66 to
R-1001; R-67 to R-1001; W-68 to R-1001; R-69 to R-1001; V-70 to
R-1001; A-71 to R-1001; V-72 to R-1001; P-73 to R-1001; H-74 to
R-1001; T-75 to R-1001; P-76 to R-1001; G-77 to R-1001; L-78 to
R-1001; C-79 to R-1001; T-80 to R-1001; S-81 to R-1001; L-82 to
R-1001; P-83 to R-1001; D-84 to R-1001; P-85 to R-1001; V-86 to
R-1001; K-87 to R-1001; G-88 to R-1001; T-89 to R-1001; E-90 to
R-1001; C-91 to R-1001; S-92 to R-1001; F-93 to R-1001; S-94 to
R-1001; C-95 to R-1001; N-96 to R-1001; A-97 to R-1001; G-98 to
R-1001; E-99 to R-1001; F-100 to R-1001; L-101 to R-1001; D-102 to
R-1001; M-103 to R-1001; K-104 to R-1001; D-105 to R-1001; Q-106 to
R-1001; S-107 to R-1001; C-108 to R-1001; K-109 to R-1001; P-110 to
R-1001; C-111 to R-1001; A-112 to R-1001; E-113 to R-1001; G-114 to
R-1001; R-115 to R-1001; Y-116 to R-1001; S-117 to R-1001; L-118 to
R-1001; G-119 to R-1001; T-120 to R-1001; G-121 to R-1001; I-122 to
R-1001; R-123 to R-1001; F-124 to R-1001; D-125 to R-1001; E-126 to
R-1001; W-127 to R-1001; D-128 to R-1001; E-129 to R-1001; L-130 to
R-1001; P-131 to R-1001; H-132 to R-1001; G-133 to R-1001; F-134 to
R-1001; A-135 to R-1001; S-136 to R-1001; L-137 to R-1001; S-138 to
R-1001; A-139 to R-1001; N-140 to R-1001; M-141 to R-1001; E-142 to
R-1001; L-143 to R-1001; D-144 to R-1001; D-145 to R-1001; S-146 to
R-1001; A-147 to R-1001; A-148 to R-1001; E-149 to R-1001; S-150 to
R-1001; T-151 t-155 to R-1001; S-156 to R-1001; S-157 to R-1001;
K-158 to R-1001; W-159 to R-1001; V-160 to R-1001; P-161 to R-1001;
R-162 to R-1001; G-163 to R-1001; D-164 to R-1001; Y-165 to R-1001;
I-166 to R-1001; A-167 to R-1001; F-168 to R-1001; N-169 to R-1001;
T-170 to R-1001; D-171 to R-1001; E-172 to R-1001; C-173 to R-1001;
T-174 to R-1001; A-175 to R-1001; T-176 to R-1001; L-177 to R-1001;
M-178 to R-1001; Y-179 to R-1001; A-180 to R-1001; V-181 to R-1001;
N-182 to R-1001; L-183 to R-1001; K-184 to R-1001; Q-185 to R-1001;
S-186 to R-1001; G-187 to R-1001; T-188 to R-1001; V-189 to R-1001;
N-190 to R-1001; F-191 to R-1001; E-192 to R-1001; Y-193 to R-1001;
Y-194 to R-1001; Y-195 to R-1001; P-196 to R-1001; D-197 to R-1001;
S-198 to R-1001; S-199 to R-1001; I-200 to R-1001; I-201 to R-1001;
F-202 to R-1001; E-203 to R-1001; F-204 to R-1001; F-205 to R-1001;
V-206 to R-1001; Q-207 to R-1001; N-208 to R-1001; D-209 to R-1001;
Q-210 to R-1001; C-211 to R-1001; Q-212 to R-1001; P-213 to R-1001;
N-214 to R-1001; A-215 to R-1001; D-216 to R-1001; D-217 to R-1001;
S-218 to R-1001; R-219 to R-101; W-220 to R-1001; M-221 to R-1001;
K-222 to R-1001; T-223 to R-1001; T-224 to R-1001; E-225 to R-1001;
K-226 to R-1001; G-227 to R-1001; W-228 to R-1001; E-229 to R-1001;
F-230 to R-1001; H-231 to R-1001; S-232 to R-1001; V-233 to R-1001;
E-234 to R-1001; L-235 to R-1001; N-236 to R-1001; R-237 to R-1001;
G-238 to R-1001; N-239 to R-1001; N-240 to R-1001; V-241 to R-1001;
L-242 to R-1001; Y-243 to R-1001; W-244 to R-1001; R-245 to R-1001;
T-246 to R-1001; T-247 to R-1001; A-248 to R-1001; F-249 to R-1001;
S-250 to R-1001; V-251 to R-1001; W-252 to R-1001; T-253 to R-1001;
K-254 to R-1001; V-255 to R-1001; P-256 to R-1001; K-257 to R-1001;
P-258 to R-1001; V-259 to R-1001; L-260 to R-1001; V-261 to R-1001;
R-262 to R-1001; N-263 to R-1001; I-264 to R-1001; A-265 to R-1001;
I-266 to R-1001; T-267 to R-1001; G-268 to R-1001; V-269 to R-1001;
A-270 to R-1001; Y-271 to R-1001; T-272 to R-1001; S-273 to R-1001;
E-274 to R-1001; C-275 to R-1001; F-276 to R-1001; P-277 to R-1001;
C-278 to R-1001; K-279 to R-1001; P-280 to R-1001; G-281 to R-1001;
T-282 to R-1001; Y-283 to R-1001; A-284 to R-1001; D-285 to R-1001;
K-286 to R-1001; Q-287 to R-1001; G-288 to R-1001; S-289 to R-1001;
S-290 to R-1001; F-291 to R-1001; C-292 to R-1001; K-293 to R-1001;
L-294 to R-1001; C-295 to R-1001; P-296 to R-1001; A-297 to R-1001;
N-298 to R-1001; S-299 to R-1001; Y-300 to R-1001; S-301 to R-1001;
N-302 to R-1001; K-303 to R-1001; G-304 to R-1001; E-305 to R-1001;
T-306 to R-1001; S-307 to R-1001; C-308 to R-1001; H-309 to R-1001;
Q-310 to R-1001; C-311 to R-1001; D-312 to R-1001; P-313 to R-1001;
D-314 to R-1001; K-315 to R-1001; Y-316 to R-1001; S-317 to R-1001;
S-322 to R-1001; S-323 to R-1001; C-324 to R-1001; N-325 to R-1001;
V-326 to R-1001; R-327 to R-1001; P-328 to R-1001; A-329 to R-1001;
C-330 to R-1001; T-331 to R-1001; D-332 to R-1001; K-333 to R-1001;
D-334 to R-1001; Y-335 to R-1001; F-336 to R-1001; Y-337 to R-1001;
T-338 to R-1001; H-339 to R-1001; T-340 to R-1001; A-341 to R-1001;
C-342 to R-1001; D-343 to R-1001; A-344 to R-1001; N-345 to R-1001;
G-346 to R-1001; E-347 to R-1001; T-348 to R-1001; Q-349 to R-1001;
L-350 to R-1001; M-351 to R-1001; Y-352 to R-1001; K-353 to R-1001;
W-354 to R-1001; A-355 to R-1001; K-356 to R-1001; P-357 to R-1001;
K-358 to R-1001; I-359 to R-1001; C-360 to R-1001; S-361 to R-1001;
E-362 to R-1001; D-363 to R-1001; L-364 to R-1001; E-365 to R-1001;
G-366 to R-1001; A-367 to R-1001; V-368 to R-1001; K-369 to R-1001;
L-370 to R-1001; P-371 to R-1001; A-372 to R-1001; S-373 to R-1001;
G-374 to R-1001; V-375 to R-1001; K-376 to R-1001; T-377 to R-1001;
H-378 to R-1001; C-379 to R-1001; P-380 to R-1001; P-381 to R-1001;
C-382 to R-1001; N-383 to R-1001; P-384 to R-1001; G-385 to R-1001;
F-386 to R-1001; F-387 to R-1001; K-388 to R-1001; T-389 to R-1001;
N-390 to R-1001; N-391 to R-1001; S-392 to R-1001; T-393 to R-1001;
C-394 to R-1001; Q-395 to R-1001; P-396 to R-1001; C-397 to R-1001;
P-398 to R-1001; Y-399 to R-1001; G-400 to R-1001; S-401 to R-1001;
Y-402 to R-1001; S-403 to R-1001; N-404 to R-1001; G-405 to R-1001;
S-406 to R-1001; D-407 to R-1001; C-408 to R-1001; T-409 to R-1001;
R-410 to R-1001; C-411 A to R-1001; G-414 to R-1001; T-415 to
R-1001; E-416 to R-1001; P-417 to R-1001; A-418 to R-1001; V-419 to
R-1001; G-420 to R-1001; F-421 to R-1001; E-422 to R-1001; Y-423 to
R-1001; K-424 to R-1001; W-425 to R-1001; W-426 to R-1001; N-427 to
R-1001; T-428 to R-1001; L-429 to R-1001; P-430 to R-1001; T-431 to
R-1001; N-432 to R-1001; M-433 to R-1001; E-434 to R-1001; T-435 to
R-1001; T-436 to R-1001; V-437 to R-1001; L-438 to R-1001; S-439 to
R-1001; G-440 to R-1001; I-441 to R-1001; N-442 to R-1001; F-443 to
R-1001; E-444 to R-1001; Y-445 to R-1001; K-446 to R-1001; G-447 to
R-1001; M-448 to R-1001; T-449 to R-1001; G-450 to R-1001; W-451 to
R-1001; E-452 to R-1001; V-453 to R-1001; A-454 to R-1001; G-455 to
R-1001; D-456 to R-1001; H-457 to R-1001; I-458 to R-1001; Y-459 to
R-1001; T-460 to R-1001; A-461 to R-1001; A-462 to R-1001; G-463 to
R-1001; A-464 to R-1001; S-465 to R-1001; D-466 to R-1001; N-467 to
R-1001; D-468 to R-1001; F-469 to R-1001; M-470 to R-1001; I-471 to
R-1001; L-472 to R-1001; T-473 to R-1001; L-474 to R-1001; V-475 to
R-1001; V-476 to R-1001; P-477 to R-1001; G-478 to R-1001; F-479 to
R-1001; R-480 to R-1001; P-481 to R-1001; P-482 to R-1001; Q-483 to
R-1001; S-484 to R-1001; V-485 to R-1001; M-486 to R-1001; A-487 to
R-1001; D-488 to R-1001; T-489 to R-1001; E-490 to R-1001; N-491 to
R-1001; K-492 to R-1001; E-493 to R-1001; V-494 to R-1001; A-495 to
R-1001; R-496 to R-1001; I-497 to R-1001; T-498 to R-1001; F-499 to
R-1001; V-500 to R-1001; F-501 to R-1001; E-502 to R-1001; T-503 to
R-1001; L-504 to R-1001; C-505 to R-1001; S-506 to R-1001; V-507 to
R-1001; N-508 to R-1001; C-509 to R-1001; E-510 to R-1001; L-511 to
R-1001; Y-512 to R-1001; F-513 to R-1001; M-514 to R-1001; V-515 to
R-1001; G-516 to R-1001; V-517 to R-1001; N-518 to R-1001; S-519 to
R-1001; R-520 to R-1001; T-521 to R-1001; N-522 to R-1001; T-523 to
R-1001; P-524 to R-1001; V-525 to R-1001; E-526 to R-1001; T-527 to
R-1001; W-528 to R-1001; K-529 to R-1001; G-530 to R-1001; S-531 to
R-1001; K-532 to R-1001; G-533 to R-1001; K-534 to R-1001; Q-535 to
R-1001; S-536 to R-1001; Y-537 to R-1001; T-538 to R-1001; Y-539 to
R-1001; I-540 to R-1001; I-541 to R-1001; E-542 to R-1001; E-543 to
R-1001; N-544 to R-1001; T-545 to R-1001; T-546 to R-1001; T-547 to
R-1001; S-548 to R-1001; F-549 to R-1001; T-550 to R-1001; W-551 to
R-1001; A-552 to R-1001; F-553 to R-1001; Q-554 to R-1001; R-555 to
R-1001; T-556 to R-1001; T-557 to R-1001; F-558 to R-1001; H-559 to
R-1001; E-560 to R-1001; A-561 to R-1001; S-562 to R-1001; R-563 to
R-1001; K-564 to R-1001; Y-565 to R-1001; T-566 to R-1001; N-567 to
R-1001; D-568 to R-1001; V-569 to R-1001; A-570 to R-1001; K-571 to
R-1001; I-572 to R-1001; Y-573 to R-1001; S-574 to R-1001; I-575 to
R-1001; N-576 to R-1001; V-577 to R-1001; T-578 to R-1001; N-579 to
R-1001; V-580 to R-1001; M-581 to R-1001; N-582 to R-1001; G-583 to
R-1001; V-584 to R-1001; A-585 to R-1001; S-586 to R-1001; Y-587 to
R-1001; C-588 to R-1001; R-589 to R-1001; P-590 to R-1001; C-591 to
R-1001; A-592 to R-1001; L-593 to R-1001; E-594 to R-1001; A-595 to
R-1001; S-596 to R-1001; D-597 to R-1001; V-598 to R-1001; G-599 to
R-1001; S-600 to R-1001; S-601 to R-1001; C-602 to R-1001; T-603 to
R-1001; S-604 to R-1001; C-605 to R-1001; P-606 to R-1001; A-607 to
R-1001; G-608 to R-1001; Y-609 to R-1001; Y-610 to R-1001; I-611 to
R-1001; D-612 to R-1001; R-613 to R-1001; D-614 to R-1001; S-615 to
R-1001; G-616 to R-1001; T-617 to R-1001; C-618 to R-1001; H-619 to
R-1001; S-620 to R-1001; C-621 to R-1001; P-622 to R-1001; P-623 to
R-1001; N-624 to R-1001; T-625 to R-1001; I-626 to R-1001; L-627 to
R-1001; K-628 to R-1001; A-629 to R-1001; H-630 to R-1001; Q-631 to
R-1001; P-632 to R-1001; Y-633 to R-1001; G-634 to R-1001; V-635 to
R-1001; Q-636 to R-1001; A-637 to R-1001; C-638 to R-1001; V-639 to
R-1001; P-640 to R-1001; C-641 to R-1001; G-642 to R-1001; P-643 to
R-1001; G-644 to R-1001; T-645 to R-1001; K-646 to R-1001; N-647 to
R-1001; N-648 to R-1001; K-649 to R-1001; I-650 to R-1001; H-651 to
R-1001; S-652 to R-1001; L-653 to R-1001; C-654 to R-1001; Y-655 to
R-1001; N-656 to R-1001; D-657 to R-1001; C-658 to R-1001; T-659 to
R-1001; F-660 to R-1001; S-661 to R-1001; R-662 to R-1001; N-663 to
R-1001; T-664 to R-1001; P-665 to R-1001; T-666 to R-1001; R-667 to
R-1001; T-668 to R-1001; F-669 to R-1001; N-670 to R-1001; Y-671 to
R-1001; N-672 to R-1001; F-673 to R-1001; S-674 to R-1001; A-675 to
R-1001; L-676 to R-1001; A-677 to R-1001; N-678 to R-1001; T-679 to
R-1001; V-680 to R-1001; T-681 to R-1001; L-682 to R-1001; A-683 to
R-1001; G-684 to R-1001; G-685 to R-1001; P-686 to R-1001; S-687 to
R-1001; F-688 to R-1001; T-689 to R-1001; S-690 to R-1001; K-691 to
R-1001; G-692 to R-1001; L-693 to R-1101; K-694 to R-1001; Y-695 to
R-1001; F-696 to R-1001; H-697 to R-1001; H-698 to R-1001; F-699 to
R-1001; T-700 to R-1001; L-701 to R-1001; S-702 to R-1001; L-703 to
R-1001; C-704 to R-1001; G-705 to R-1001; N-706 to R-1001; Q-707 to
R-1001; G-708 to R-1001; R-709 to R-1001; K-710 to R-1001; M-711 to
R-1001; S-712 to R-1001; V-713 to R-1001; C-714 to R-1001; T-715 to
R-1001; D-716 to R-1001; N-717 to R-1001; V-718 to R-1001; T-719 to
R-1001; D-720 to R-1001; L-721 to R-1001; R-722 to R-1001; I-723 to
R-1001; P-724 to R-1001; E-725 to R-1001; G-726 to R-1001; E-727 to
R-1001; S-728 to R-1001; G-729 to R-1001; F-730 to R-1001; S-731 to
R-1001; K-732 to R-1001; S-733 to R-1001; I-734 to R-1001; T-735 to
R-1001; A-736 to R-1001; Y-737 to R-1001; V-742 to R-1001; I-743 to
R-1001; I-744 to R-1001; P-745 to R-1001; P-746 to R-1001; E-747 to
R-1001; V-748 to R-1001; T-749 to R-1001; G-750 to R-1001; Y-751 to
R-1001; K-752 to R-1001; A-753 to R-1001; G-754 to R-1001; V-755 to
R-1001; S-756 to R-1001; S-757 to R-1001; Q-758 to R-1001; P-759 to
R-1001; V-760 to R-1001; S-761 to R-1001; L-762 to R-1001; A-763 to
R-1001; D-764 to R-1001; R-765 to R-1001; L-766 to R-1001; I-767 to
R-1001; G-768 to R-1001; V-769 to R-1001; T-770 to R-1001; T-771 to
R-1001; D-772 to R-1001; M-773 to R-1001; T-774 to R-1001; L-775 to
R-1001; D-776 to R-1001; G-777 to R-1001; I-778 to R-1001; T-779 to
R-1001; S-780 to R-1001; P-781 to R-1001; A-782 to R-1001; E-783 to
R-1001; L-784 to R-1001; F-785 to R-1001; H-786 to R-1001; L-787 to
R-1001; E-788 to R-1001; S-789 to R-1001; L-790 to R-1001; G-791 to
R-1001; I-792 to R-1001; P-793 to R-1001; D-794 to R-1001; V-795 to
R-1001; I-796 to R-1001; F-797 to R-1001; F-798 to R-1001; Y-799 to
R-1001; R-800 to R-1001; S-801 to R-1001; N-802 to R-1001; D-803 to
R-1001; V-804 to R-1001; T-805 to R-1001; Q-806 to R-1001; S-807 to
R-1001; C-808 to R-1001; S-809 to R-1001; S-810 to R-1001; G-811 to
R-1001; R-812 to R-1001; S-813 to R-1001; T-814 to R-1001; T-815 to
R-1001; I-816 to R-1001; R-817 to R-1001; V-818 to R-1001; R-819 to
R-1001; C-820 to R-1001; S-821 to R-1001; P-822 to R-1001; Q-823 to
R-1001; K-824 to R-1001; T-825 to R-1001; V-826 to R-1001; P-827 to
R-1001; G-828 to R-1001; S-829 to R-1001; L-830 to R-1001; L-831 to
R-1001; L-832 to R-1001; P-833 to R-1001; G-834 to R-1001; T-835 to
R-1001; C-836 to R-1001; S-837 to R-1001; D-838 to R-1001; G-839 to
R-1001; T-840 to R-1001; C-841 to R-1001; D-842 to R-1001; G-843 to
R-1001; C-844 to R-1001; N-845 to R-1001; F-846 to R-1001; H-847 to
R-1001; F-848 to R-1001; L-849 to R-1001; W-850 to R-1001; E-851 to
R-1001; S-852 to R-1001; A-853 to R-1001; A-854 to R-1001; A-855 to
R-1001; C-856 to R-1001; P-857 to R-1001; L-858 to R-1001; C-859 to
R-1001; S-860 to R-1001; V-861 to R-1001; A-862 to R-1001; D-863 to
R-1001; Y-864 to R-1001; H-865 to R-1001; A-866 to R-1001; I-867 to
R-1001; V-868 to R-1001; S-869 to R-1001; S-870 to R-1001; C-871 to
R-1001; V-872 to R-1001; A-873 to R-1001; G-874 to R-1001; I-875 to
R-1001; Q-876 to R-1001; K-877 to R-1001; T-878 to R-1001; T-879 to
R-1001; Y-880 to R-1001; V-881 to R-1001; W-882 to R-1001; R-883 to
R-1001; E-884 to R-1001; P-885 to R-1001; K-886 to R-1001; L-887 to
R-1001; C-888 to R-1001; S-889 to R-1001; G-890 to R-1001; G-891 to
R-1001; I-892 to R-1001; S-893 to R-1001; L-894 to R-1001; P-895 to
R-1001; E-896 to R-1001; Q-897 to R-1001; R-898 to R-1001; V-899 to
R-1001; T-900 to R-1001; I-901 to R-1001; C-902 to R-1001; K-903 to
R-1001; T-904 to R-1001; I-905 to R-1001; D-906 to R-1001; F-907 to
R-1001; W-908 to R-1001; L-909 to R-1001; K-910 to R-1001; V-91 I
to R-1001; G-912 to R-1001; I-913 to R-1001; S-914 to R-1001; A-915
to R-1001; G-916 to R-1001; T-917 to R-1001; C-918 to R-1001; T-919
to R-1001; A-920 to R-1001; I-921 to R-1001; L-922 to R-1001; L-923
to R-1001; T-924 to R-1001; V-925 to R-1001; L-926 to R-1001; T-927
to R-1001; C-928 to R-1001; K-932 to R-1001; K-933 to R-1001; N-934
to R-1001; Q-935 to R-1001; K-936 to R-1001; L-937 to R-1001; E-938
to R-1001; Y-939 to R-1001; K-940 to R-1001; Y-941 to R-1001; S-942
to R-1001; K-943 to R-1001; L-944 to R-1001; V-945 to R-1001; M-946
to R-1001; N-947 to R-1001; A-948 to R-1001; T-949 to R-1001; L-950
to R-1001; K-951 to R-1001; D-952 to R-1001; C-953 to R-1001; D-954
to R-1001; L-955 to R-1001; P-956 to R-1001; A-957 to R-1001; A-958
to R-1001; D-959 to R-1001; S-960 to R-1001; C-961 to R-1001; A-962
to R-1001; I-963 to R-1001; M-964 to R-1001; E-965 to R-1001; G-966
to R-1001; E-967 to R-1001; D-968 to R-1001; V-969 to R-1001; E-970
to R-1001; D-971 to R-1001; D-972 to R-1001; L-973 to R-1001; I-974
to R-1001; F-975 to R-1001; T-976 to R-1001; S-977 to R-1001; K-978
to R-1001; N-979 to R-1001; H-980 to R-1001; S-981 to R-1001; L-982
to R-1001; G-983 to R-1001; R-984 to R-1001; S-985 to R-1001; N-986
to R-1001; H-987 to R-1001; L-988 to R-1001; P-989 to R-1001; P-990
to R-1001; R-991 to R-1001; G-992 to R-1001; L-993 to R-1001; L-994
to R-1001; M-995 to R-1001; D-996 to R-1001; of SEQ ID NO:40.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0249] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification or loss of one or more biological functions of the
protein, other functional activities (e.g., biological activities,
ability to multimerize, ability to bind TR13 ligand) may still be
retained. For example the ability of the shortened TR13 mutein to
induce and/or bind to antibodies which recognize the complete or
mature forms of the polypeptide generally will be retained when
less than the majority of the residues of the complete or mature
polypeptide are removed from the C-terminus. Whether a particular
polypeptide lacking C-terminal residues of a complete polypeptide
retains such immunologic activities can readily be determined by
routine methods described herein and otherwise known in the art. It
is not unlikely that an TR13 mutein with a large number of deleted
C-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six
TR13 amino acid residues may often evoke an immune response.
[0250] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the carboxy
terminus of the amino acid sequence of the TR13 polypeptide shown
in FIGS. 1A-D (SEQ ID NO:2), up to the glutamine residue at
position number 6, and polynucleotides encoding such polypeptides.
In particular, the present invention provides polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues 1-m.sup.1 of FIGS. 1A-D, where m.sup.1 is an integer
from 6 to 749 corresponding to the position of the amino acid
residue in FIGS. 1A-D.
[0251] Moreover, the invention provides TR13 polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues: Q-6 to C-749; Q-6 to Q-748; Q-6 to T-747; Q-6 to
L-746; Q-6 to D-745; Q-6 to M-744; Q-6 to L-743; Q-6 to L-742; Q-6
to G-741; Q-6 to R-740; Q-6 to P-739; Q-6 to P-738; Q-6 to L-737;
Q-6 to H-736; Q-6 to N-735; Q-6 to S-734; Q-6 to R-733; Q-6 to
G-732; Q-6 to L-731; Q-6 to S-730; Q-6 to H-729; Q-6 to N-728; Q-6
to K-727; Q-6 to S-726; Q-6 to T-725; Q-6 to F-724; Q-6 to I-723;
Q-6 to L-722; Q-6 to D-721; Q-6 to D-720; Q-6 to E-719; Q-6 to
V-718; Q-6 to D-717; Q-6 to E-716; Q-6 to G-715; Q-6 to E-714; Q-6
to M-713; Q-6 to I-712; Q-6 to A-711; Q-6 to C-710; Q-6 to S-709;
Q-6 to D-708; Q-6 to A-707; Q-6 to A-706; Q-6 to P-705; Q-6 to
L-704; Q-6 to D-703; Q-6 to C-702; Q-6 to D-701; Q-6 to K-700; Q-6
to L-699; Q-6 to T-698; Q-6 to A-697; Q-6 to N-696; Q-6 to M-695;
Q-6 to V-694; Q-6 to L-693; Q-6 to K-692; Q-6 to S-691; Q-6 to
Y-690; Q-6 to K-689; Q-6 to Y-688; Q-6 to E-687; Q-6 to L-686; Q-6
to K-685; Q-6 to Q-684; Q-6 to N-683; Q-6 to K-682; Q-6 to K-681;
Q-6 to W-680; Q-6 to F-679; Q-6 to Y-678; Q-6 to C-677; Q-6 to
T-676; Q-6 to L-675; Q-6 to V-674; Q-6 to T-673; Q-6 to L-672; Q-6
to L-671; Q-6 to I-670; Q-6 to A-669; Q-6 to T-668; Q-6 to C-667;
Q-6 to T-666; Q-6 to G-665; Q-6 to A-664; Q-6 to S-663; Q-6 to
I-662; Q-6 to G-661; Q-6 to V-660; Q-6 to K-659; Q-6 to L-658; Q-6
to W-657; Q-6 to F-656; Q-6 to D-655; Q-6 to I-654; Q-6 to T-653;
Q-6 to K-652; Q-6 to C-651; Q-6 to I-650; Q-6 to T-649; Q-6 to
V-648; Q-6 to R-647; Q-6 to Q-646; Q-6 to E-645; Q-6 to P-644; Q-6
to L-643; Q-6 to S-642; Q-6 to I-641; Q-6 to G-640; Q-6 to G-639;
Q-6 to S-638; Q-6 to C-637; Q-6 to L-636; Q-6 to K-635; Q-6 to
P-634; Q-6 to E-633; Q-6 to R-632; Q-6 to W-631; Q-6 to V-630; Q-6
to Y-629; Q-6 to T-628; Q-6 to T-627; Q-6 to K-626; Q-6 to Q-625;
Q-6 to I-624; Q-6 to G-623; Q-6 to A-622; Q-6 to V-621; Q-6 to
C-620; Q-6 to S-619; Q-6 to S-618; Q-6 to V-617; Q-6 to I-616; Q-6
to A-615; Q-6 to H-614; Q-6 to Y-613; Q-6 to D-612; Q-6 to A-611;
Q-6 to V-610; Q-6 to S-609; Q-6 to C-608; Q-6 to L-607; Q-6 to
P-606; Q-6 to C-605; Q-6 to A-604; Q-6 to A-603; Q-6 to A-602; Q-6
to S-601; Q-6 to E-600; Q-6 to W-599; Q-6 to L-598; Q-6 to F-597;
Q-6 to H-596; Q-6 to F-595; Q-6 to N-594; Q-6 to C-593; Q-6 to
G-592; Q-6 to D-591; Q-6 to C-590; Q-6 to T-589; Q-6 to G-588; Q-6
to D-587; Q-6 to S-586; Q-6 to C-585; Q-6 to T-584; Q-6 to G-583;
Q-6 to P-582; Q-6 to L-581; Q-6 to L-580; Q-6 to L-579; Q-6 to
S-578; Q-6 to G-577; Q-6 to P-576; Q-6 to V-575; Q-6 to T-574; Q-6
to K-573; Q-6 to Q-572; Q-6 to P-571; Q-6 to S-570; Q-6 to C-569;
Q-6 to R-568; Q-6 to V-567; Q-6 to R-566; Q-6 to I-565; Q-6 to
T-564; Q-6 to T-563; Q-6 to S-562; Q-6 to R-561; Q-6 to G-560; Q-6
to S-559; Q-6 to S-558; Q-6 to C-557; Q-6 to S-556; Q-6 to Q-555;
Q-6 to T-554; Q-6 to V-553; Q-6 to D-552; Q-6 to N-551; Q-6 to
S-550; Q-6 to R-549; Q-6 to Y-548; Q-6 to F-547; Q-6 to F-546; Q-6
to I-545; Q-6 to V-544; Q-6 to D-543; Q-6 to P-542; Q-6 to I-541;
Q-6 to G-540; Q-6 to L-539; Q-6 to S-538; Q-6 to E-537; Q-6 to
L-536; Q-6 to H-535; Q-6 to F-534; Q-6 to L-533; Q-6 to E-532; Q-6
to A-531; Q-6 to P-530; Q-6 to S-529; Q-6 to T-528; Q-6 to I-527;
Q-6 to G-526; Q-6 to D-525; Q-6 to L-524; Q-6 to T-523; Q-6 to
M-522; Q-6 to D-521; Q-6 to T-520; Q-6 to T-519; Q-6 to V-518; Q-6
to G-517; Q-6 to I-516; Q-6 to L-515; Q-6 to R-514; Q-6 to D-513;
Q-6 to A-512; Q-6 to L-511; Q-6 to S-510; Q-6 to V-509; Q-6 to
P-508; Q-6 to Q-507; Q-6 to S-506; Q-6 to S-505; Q-6 to V-504; Q-6
to G-503; Q-6 to A-502; Q-6 to K-501; Q-6 to Y-500; Q-6 to G-499;
Q-6 to T-498; Q-6 to V-497; Q-6 to E-496; Q-6 to P-495; Q-6 to
P-494; Q-6 to I-493; Q-6 to I-492; Q-6 to V-491; Q-6 to A-490; Q-6
to Q-489; Q-6 to C-488; Q-6 to V-487; Q-6 to Y-486; Q-6 to A-485;
Q-6 to T-484; Q-6 to I-483; Q-6 to S-482; Q-6 to K-481; Q-6 to
S-480; Q-6 to F-479; Q-6 to G-478; Q-6 to S-477; Q-6 to E-476; Q-6
to G-475; Q-6 to E-474; Q-6 to P-473; Q-6 to I-472; Q-6 to R-471;
Q-6 to L-470; Q-6 to D-469; Q-6 to T-468; Q-6 to V-467; Q-6 to
N-466; Q-6 to D-465; Q-6 to T-464; Q-6 to C-463; Q-6 to V-462; Q-6
to S-461; Q-6 to M-460; Q-6 to K-459; Q-6 to R-458; Q-6 to G-457;
Q-6 to Q-456; Q-6 to N-455; Q-6 to G-454; Q-6 to C-453; Q-6 to
L-452; Q-6 to S-451; Q-6 to L-450; Q-6 to T-449; Q-6 to F-448; Q-6
to H-447; Q-6 to H-1446; Q-6 to F-445; Q-6 to Y-444; Q-6 to K-443;
Q-6 to L-442; Q-6 to G-441; Q-6 to K-440; Q-6 to S-439; Q-6 to
T-438; Q-6 to F-437; Q-6 to S-436; Q-6 to P-435; Q-6 to G-434; Q-6
to G-433; Q-6 to A-432; Q-6 to L-431; Q-6 to T-430; Q-6 to V-429;
Q-6 to T-428; Q-6 to N-427; Q-6 to A-426; Q-6 to L-425; Q-6 to
A-424; Q-6 to S-423; Q-6 to F-422; Q-6 to N-421; Q-6 to Y-420; Q-6
to N-419; Q-6 to F-418; Q-6 to T-417; Q-6 to R-416; Q-6 to T-415;
Q-6 to P-414; Q-6 to T-413; Q-6 to N-412; Q-6 to R-411; Q-6 to
S-410; Q-6 to F-409; Q-6 to T-408; Q-6 to C-407; Q-6 to D-406; Q-6
to N.sub.4O.sub.5; Q-6 to Y-404; Q-6 to C-403; Q-6 to L-402; Q-6 to
S-401; Q-6 to H-400; Q-6 to I-399; Q-6 to K-398; Q-6 to N-397; Q-6
to N-396; Q-6 to K-395; Q-6 to T-394; Q-6 to G-393; Q-6 to P-392;
Q-6 to G-391; Q-6 to C-390; Q-6 to P-389; Q-6 to V-388; Q-6 to
C-387; Q-6 to A-386; Q-6 to Q-385; Q-6 to V-384; Q-6 to G-383; Q-6
to Y-382; Q-6 to P-381; Q-6 to Q-380; Q-6 to H-379; Q-6 to A-378;
Q-6 to K-377; Q-6 to L-376; Q-6 to I-375; Q-6 to T-374; Q-6 to
N-373; Q-6 to P-372; Q-6 to P-371; Q-6 to C-370; Q-6 to S-369; Q-6
to H-368; Q-6 to C-367; Q-6 to T-366; Q-6 to G-365; Q-6 to S-364;
Q-6 to D-363; Q-6 to R-362; Q-6 to D-361; Q-6 to I-360; Q-6 to
Y-359; Q-6 to Y-358; Q-6 to G-357; Q-6 to A-356; Q-6 to P-355; Q-6
to C-354; Q-6 to S-353; Q-6 to T-352; Q-6 to C-351; Q-6 to S-350;
Q-6 to S-349; Q-6 to G-348; Q-6 to V-347; Q-6 to D-346; Q-6 to
S-345; Q-6 to A-344; Q-6 to E-343; Q-6 to L-342; Q-6 to A-341; Q-6
to C-340; Q-6 to P-339; Q-6 to R-338; Q-6 to C-337; Q-6 to Y-336;
Q-6 to S-335; Q-6 to A-334; Q-6 to V-333; Q-6 to G-332; Q-6 to
N-331; Q-6 to M-330; Q-6 to V-329; Q-6 to N-328; Q-6 to T-327; Q-6
to V-326; Q-6 to N-325; Q-6 to I-324; Q-6 to S-323; Q-6 to Y-322;
Q-6 to I-321; Q-6 to K-320; Q-6 to A-319; Q-6 to V-318; Q-6 to
D-317; Q-6 to N-316; Q-6 to T-315; Q-6 to Y-314; Q-6 to K-313; Q-6
to R-312; Q-6 to S-311; Q-6 to A-310; Q-6 to E-309; Q-6 to H-308;
Q-6 to F-307; Q-6 to T-306; Q-6 to T-305; Q-6 to R-304; Q-6 to
Q-303; Q-6 to F-302; Q-6 to A-301; Q-6 to W-300; Q-6 to T-299; Q-6
to F-298; Q-6 to S-297; Q-6 to T-296; Q-6 to T-295; Q-6 to T-294;
Q-6 to N-293; Q-6 to E-292; Q-6 to E-291; Q-6 to I-290; Q-6 to
I-289; Q-6 to Y-288; Q-6 to T-287; Q-6 to Y-286; Q-6 to S-285; Q-6
to Q-284; Q-6 to K-283; Q-6 to G-282; Q-6 to K-281; Q-6 to S-280;
Q-6 to G-279; Q-6 to K-278; Q-6 to W-277; Q-6 to T-276; Q-6 to
E-275; Q-6 to V-274; Q-6 to P-273; Q-6 to T-272; Q-6 to N-271; Q-6
to T-270; Q-6 to R-269; Q-6 to S-268; Q-6 to N-267; Q-6 to V-266;
Q-6 to G-265; Q-6 to V-264; Q-6 to M-263; Q-6 to F-262; Q-6 to
Y-261; Q-6 to L-260; Q-6 to E-259; Q-6 to C-258; Q-6 to N-257; Q-6
to V-256; Q-6 to S-255; Q-6 to C-254; Q-6 to L-253; Q-6 to T-252;
Q-6 to E-251; Q-6 to F-250; Q-6 to V-249; Q-6 to F-248; Q-6 to
T-247; Q-6 to I-246; Q-6 to R-245; Q-6 to A-244; Q-6 to V-243; Q-6
to E-242; Q-6 to K-241; Q-6 to N-240; Q-6 to E-239; Q-6 to T-238;
Q-6 to D-237; Q-6 to A-236; Q-6 to M-235; Q-6 to V-234; Q-6 to
S-233; Q-6 to Q-232; Q-6 to P-231; Q-6 to P-230; Q-6 to R-229; Q-6
to F-228; Q-6 to G-227; Q-6 to P-226; Q-6 to V-225; Q-6 to V-224;
Q-6 to L-223; Q-6 to T-222; Q-6 to L-221; Q-6 to I-220; Q-6 to
M-219; Q-6 to F-218; Q-6 to D-217; Q-6 to N-216; Q-6 to D-215; Q-6
to S-214; Q-6 to A-213; Q-6 to G-212; Q-6 to A-211; Q-6 to A-210;
Q-6 to T-209; Q-6 to Y-208; Q-6 to I-207; Q-6 to H-206; Q-6 to
D-205; Q-6 to G-204; Q-6 to A-203; Q-6 to V-202; Q-6 to E-201; Q-6
to W-200; Q-6 to G-199; Q-6 to T-198; Q-6 to M-197; Q-6 to G-196;
Q-6 to K-195; Q-6 to Y-194; Q-6 to E-193; Q-6 to F-192; Q-6 to
N-191; Q-6 to I-190; Q-6 to G-189; Q-6 to S-188; Q-6 to L-187; Q-6
to V-186; Q-6 to T-185; Q-6 to T-184; Q-6 to E-183; Q-6 to M-182;
Q-6 to N-181; Q-6 to T-180; Q-6 to P-179; Q-6 to L-178; Q-6 to
T-177; Q-6 to N-176; Q-6 to W-175; Q-6 to W-174; Q-6 to K-173; Q-6
to Y-172; Q-6 to E-171; Q-6 to F-170; Q-6 to G-169; Q-6 to V-168;
Q-6 to A-167; Q-6 to P-166; Q-6 to E-165; Q-6 to T-164; Q-6 to
G-163; Q-6 to A-162; Q-6 to P-161; Q-6 to C-160; Q-6 to R-159; Q-6
to T-158; Q-6 to C-157; Q-6 to D-156; Q-6 to S-155; Q-6 to G-154;
Q-6 to N-153; Q-6 to S-152; Q-6 to Y-151; Q-6 to S-150; Q-6 to
G-149; Q-6 to Y-148; Q-6 to P-147; Q-6 to C-146; Q-6 to P-145; Q-6
to Q-144; Q-6 to C-143; Q-6 to T-142; Q-6 to S-141; Q-6 to N-140;
Q-6 to N-139; Q-6 to T-138; Q-6 to K-137; Q-6 to F-136; Q-6 to
F-135; Q-6 to G-134; Q-6 to P-133; Q-6 to N-132; Q-6 to C-131; Q-6
to P-130; Q-6 to P-129; Q-6 to C-128; Q-6 to H-127; Q-6 to T-126;
Q-6 to K-125; Q-6 to V-124; Q-6 to G-123; Q-6 to S-122; Q-6 to
A-121; Q-6 to P-120; Q-6 to L-19; Q-6 to K-118; Q-6 to V-117; Q-6
to A-116; Q-6 to G-115; Q-6 to E-114; Q-6 to L-113; Q-6 to D-112;
Q-6 to E-11; Q-6 to S-110; Q-6 to C-109; Q-6 to I-108; Q-6 to
K-107; Q-6 to P-106; Q-6 to K-105; Q-6 to A-104; Q-6 to W-103; Q-6
to K-102; Q-6 to Y-101; Q-6 to M-100; Q-6 to L-99; Q-6 to Q-98; Q-6
to T-97; Q-6 to E-96; Q-6 to G-95; Q-6 to N-94; Q-6 to A-93; Q-6 to
D-92; Q-6 to C-91; Q-6 to A-90; Q-6 to T-89; Q-6 to H-88; Q-6 to
T-87; Q-6 to Y-86; Q-6 to F-85; Q-6 to Y-84; Q-6 to D-83; Q-6 to
K-82; Q-6 to D-81; Q-6 to T-80; Q-6 to C-79; Q-6 to A-78; Q-6 to
P-77; Q-6 to R-76; Q-6 to V-75; Q-6 to N-74; Q-6 to C-73; Q-6 to
S-72; Q-6 to S-71; Q-6 to S-70; Q-6 to G-69; Q-6 to K-68; Q-6 to
E-67; Q-6 to S-66; Q-6 to Y-65; Q-6 to K-64; Q-6 to D-63; Q-6 to
P-62; Q-6 to D-61; Q-6 to C-60; Q-6 to Q-59; Q-6 to H-58; Q-6 to
C-57; Q-6 to S-56; Q-6 to T-55; Q-6 to E-54; Q-6 to G-53; Q-6 to
K-52; Q-6 to N-51; Q-6 to S-50; Q-6 to Y-49; Q-6 to S-48; Q-6 to
N-47; Q-6 to S-46; Q-6 to P-45; Q-6 to L-44; Q-6 to T-43; Q-6 to
Q-42; Q-6 to L-41; Q-6 to F-40; Q-6 to L-39; Q-6 to L-38; Q-6 to
G-37; Q-6 to A-36; Q-6 to Q-35; Q-6 to R-34; Q-6 to C-33; Q-6 to
V-32; Q-6 to H-31; Q-6 to W-30; Q-6 to T-29; Q-6 to Q-28; Q-6 to
L-27; Q-6 to P-26; Q-6 to L-25; Q-6 to M-24; Q-6 to R-23; Q-6 to
F-22; Q-6 to H-21; Q-6 to L-20; Q-6 to G-19; Q-6 to G-18; Q-6 to
R-17; Q-6 to N-16; Q-6 to H-15; Q-6 to C-14; Q-6 to H-13; Q-6 to
K-12; of SEQ ID NO:2. Polynucleotides encoding these polypeptides
are also encompassed by the invention.
[0252] The present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the amino
acid sequence of the TR13 polypeptide shown in FIGS. 7A-E (SEQ ID
NO:40), up to the histidine residue at position number 6, and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues
1-m.sup.1 of FIGS. 7A-E, where m.sup.1 is an integer from 6 to 1001
corresponding to the position of the amino acid residue in FIGS.
7A-E.
[0253] Moreover, the invention provides TR13 polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues: H-6 to C-1000; H-6 to Q-999; H-6 to T-998; H-6 to
L-997; H-6 to D-996; H-6 to M-995; H-6 to L-994; H-6 to L-993; H-6
to G-992; H-6 to R-991; H-6 to P-990; H-6 to P-989; H-6 to L-988;
H-6 to H-987; H-6 to N-986; H-6 to S-985; H-6 to R-984; H-6 to
G-983; H-6 to L-982; H-6 to S-981; H-6 to H-980; H-6 to N-979; H-6
to K-978; H-6 to S-977; H-6 to T-976; H-6 to F-975; H-6 to I-974;
H-6 to L-973; H-6 to D-972; H-6 to D-971; H-6 to E-970; H-6 to
V-969; H-6 to D-968; H-6 to E-967; H-6 to G-966; H-6 to E-965; H-6
to M-964; H-6 to I-963; H-6 to A-962; H-6 to C-961; H-6 to S-960;
H-6 to D-959; H-6 to A-958; H-6 to A-957; H-6 to P-956; H-6 to
L-955; H-6 to D-954; H-6 to C-953; H-6 to D-952; H-6 to K-951; H-6
to L-950; H-6 to T-949; H-6 to A-948; H-6 to N-947; H-6 to M-946;
H-6 to V-945; H-6 to L-944; H-6 to K-943; H-6 to S-942; H-6 to
Y-941; H-6 to K-940; H-6 to Y-939; H-6 to E-938; H-6 to L-937; H-6
to K-936; H-6 to Q-935; H-6 to N-934; H-6 to K-933; H-6 to K-932;
H-6 to W-931; H-6 to F-930; H-6 to Y-929; H-6 to C-928; H-6 to
T-927; H-6 to L-926; H-6 to V-925; H-6 to T-924; H-6 to L-923; H-6
to L-922; H-6 to I-921; H-6 to A-920; H-6 to T-919; H-6 to C-918;
H-6 to T-917; H-6 to G-916; H-6 to A-915; H-6 to S-914; H-6 to
I-913; H-6 to G-912; H-6 to V-911; H-6 to K-910; H-6 to L-909; H-6
to W-908; H-6 to F-907; H-6 to D-906; H-6 to I-905; H-6 to T-904;
H-6 to K-903; H-6 to C-902; H-6 to I-901; H-6 to T-900; H-6 to
V-899; H-6 to R-898; H-6 to Q-897; H-6 to E-896; H-6 to P-895; H-6
to L-894; H-6 to S-893; H-6 to I-892; H-6 to G-891; H-6 to G-890;
H-6 to S-889; H-6 to C-888; H-6 to L-887; H-6 to K-886; H-6 to
P-885; H-6 to E-884; H-6 to R-883; H-6 to W-882; H-6 to V-881; H-6
to Y-880; H-6 to T-879; H-6 to T-878; H-6 to K-877; H-6 to Q-876;
H-6 to I-875; H-6 to G-874; H-6 to A-873; H-6 to V-872; H-6 to
C-871; H-6 to S-870; H-6 to S-869; H-6 to V-868; H-6 to I-867; H-6
to A-866; H-6 to H-865; H-6 to Y-864; H-6 to D-863; H-6 to A-862;
H-6 to V-861; H-6 to S-860; H-6 to C-859; H-6 to L-858; H-6 to
P-857; H-6 to C-856; H-6 to A-855; H-6 to A-854; H-6 to A-853; H-6
to S-852; H-6 to E-851; H-6 to W-850; H-6 to L-849; H-6 to F-848;
H-6 to H-847; H-6 to F-846; H-6 to N-845; H-6 to C-844; H-6 to
G-843; H-6 to D-842; H-6 to C-841; H-6 to T-840; H-6 to G-839; H-6
to D-838; H-6 to S-837; H-6 to C-836; H-6 to T-835; H-6 to G-834;
H-6 to P-833; H-6 to L-832; H-6 to L-831; H-6 to L-830; H-6 to
S-829; H-6 to G-828; H-6 to P-827; H-6 to V-826; H-6 to T-825; H-6
to K-824; H-6 to Q-823; H-6 to P-822; H-6 to S-821; H-6 to C-820;
H-6 to R-819; H-6 to V-818; H-6 to R-817; H-6 to I-816; H-6 to
T-815; H-6 to T-814; H-6 to S-813; H-6 to R-812; H-6 to G-811; H-6
to S-810; H-6 to S-809; H-6 to C-808; H-6 to S-807; H-6 to Q-806;
H-6 to T-805; H-6 to V-804; H-6 to D-803; H-6 to N-802; H-6 to
S-801; H-6 to R-800; H-6 to Y-799; H-6 to F-798; H-6 to F-797; H-6
to I-796; H-6 to V-795; H-6 to D-794; H-6 to P-793; H-6 to I-792;
H-6 to G-791; H-6 to L-790; H-6 to S-789; H-6 to E-788; H-6 to
L-787; H-6 to H-786; H-6 to F-785; H-6 to L-784; H-6 to E-783; H-6
to A-782; H-6 to P-781; H-6 to S-780; H-6 to T-779; H-6 to I-778;
H-6 to G-777; H-6 to D-776; H-6 to L-775; H-6 to T-774; H-6 to
M-773; H-6 to D-772; H-6 to T-771; H-6 to T-770; H-6 to V-769; H-6
to G-768; H-6 to I-767; H-6 to L-766; H-6 to R-765; H-6 to D-764;
H-6 to A-763; H-6 to L-762; H-6 to S-761; H-6 to V-760; H-6 to
P-759; H-6 to Q-758; H-6 to S-757; H-6 to S-756; H-6 to V-755; H-6
to G-754; H-6 to A-753; H-6 to K-752; H-6 to Y-751; H-6 to G-750;
H-6 to T-749; H-6 to V-748; H-6 to E-747; H-6 to P-746; H-6 to
P-745; H-6 to I-744; H-6 to I-743; H-6 to V-742; H-6 to A-741; H-6
to Q-740; H-6 to C-739; H-6 to V-738; H-6 to Y-737; H-6 to A-736;
H-6 to T-735; H-6 to I-734; H-6 to S-733; H-6 to K-732; H-6 to
S-731; H-6 to F-730; H-6 to G-729; H-6 to S-728; H-6 to E-727; H-6
to G-726; H-6 to E-725; H-6 to P-724; H-6 to I-723; H-6 to R-722;
H-6 to L-721; H-6 to D-720; H-6 to T-719; H-6 to V-718; H-6 to
N-717; H-6 to D-716; H-6 to T-715; H-6 to C-714; H-6 to V-713; H-6
to S-712; H-6 to M-711; H-6 to K-710; H-6 to R-709; H-6 to G-708;
H-6 to Q-707; H-6 to N-706; H-6 to G-705; H-6 to C-704; H-6 to
L-703; H-6 to S-702; H-6 to L-701; H-6 to T-700; H-6 to F-699; H-6
to H-698; H-6 to H-697; H-6 to F-696; H-6 to Y-695; H-6 to K-694;
H-6 to L-693; H-6 to G-692; H-6 to K-691; H-6 to S-690; H-6 to
T-689; H-6 to F-688; H-6 to S-687; H-6 to P-686; H-6 to G-685; H-6
to G-684; H-6 to A-683; H-6 to L-682; H-6 to T-681; H-6 to V-680;
H-6 to T-679; H-6 to N-678; H-6 to A-677; H-6 to L-676; H-6 to
A-675; H-6 to S-674; H-6 to F-673; H-6 to N-672; H-6 to Y-671; H-6
to N-670; H-6 to F-669; H-6 to T-668; H-6 to R-667; H-6 to T-666;
H-6 to P-665; H-6 to T-664; H-6 to N-663; H-6 to R-662; H-6 to
S-661; H-6 to F-660; H-6 to T-659; H-6 to C-658; H-6 to D-657; H-6
to N-656; H-6 to Y-655; H-6 to C-654; H-6 to L-653; H-6 to S-652;
H-6 to H-651; H-6 to I-650; H-6 to K-649; H-6 to N-648; H-6 to
N-647; H-6 to K-646; H-6 to T-645; H-6 to G-644; H-6 to P-643; H-6
to G-642; H-6 to C-641; H-6 to P-640; H-6 to V-639; H-6 to C-638;
H-6 to A-637; H-6 to Q-636; H-6 to V-635; H-6 to G-634; H-6 to
Y-633; H-6 to P-632; H-6 to Q-631; H-6 to H-630; H-6 to A-629; H-6
to K-628; H-6 to L-627; H-6 to I-626; H-6 to T-625; H-6 to N-624;
H-6 to P-623; H-6 to P-622; H-6 to C-621; H-6 to S-620; H-6 to
H-619; H-6 to C-618; H-6 to T-617; H-6 to G-616; H-6 to S-615; H-6
to D-614; H-6 to R-613; H-6 to D-612; H-6 to I-611; H-6 to Y-610;
H-6 to Y-609; H-6 to G-608; H-6 to A-607; H-6 to P-606; H-6 to
C-605; H-6 to S-604; H-6 to T-603; H-6 to C-602; H-6 to S-601; H-6
to S-600; H-6 to G-599; H-6 to V-598; H-6 to D-597; H-6 to S-596;
H-6 to A-595; H-6 to E-594; H-6 to L-593; H-6 to A-592; H-6 to
C-591; H-6 to P-590; H-6 to R-589; H-6 to C-588; H-6 to Y-587; H-6
to S-586; H-6 to A-585; H-6 to V-584; H-6 to G-583; H-6 to N-582;
H-6 to M-581; H-6 to V-580; H-6 to N-579; H-6 to T-578; H-6 to
V-577; H-6 to N-576; H-6 to I-575; H-6 to S-574; H-6 to Y-573; H-6
to I-572; H-6 to K-571; H-6 to A-570; H-6 to V-569; H-6 to D-568;
H-6 to N-567; H-6 to T-566; H-6 to Y-565; H-6 to K-564; H-6 to
R-563; H-6 to S-562; H-6 to A-561; H-6 to E-560; H-6 to H-559; H-6
to F-558; H-6 to T-557; H-6 to T-556; H-6 to R-555; H-6 to Q-554;
H-6 to F-553; H-6 to A-552; H-6 to W-551; H-6 to T-550; H-6 to
F-549; H-6 to S-548; H-6 to T-547; H-6 to T-546; H-6 to T-545; H-6
to N-544; H-6 to E-543; H-6 to E-542; H-6 to I-541; H-6 to I-540;
H-6 to Y-539; H-6 to T-538; H-6 to Y-537; H-6 to S-536; H-6 to
Q-535; H-6 to K-534; H-6 to G-533; H-6 to K-532; H-6 to S-531; H-6
to G-530; H-6 to K-529; H-6 to W-528; H-6 to T-527; H-6 to E-526;
H-6 to V-525; H-6 to P-524; H-6 to T-523; H-6 to N-522; H-6 to
T-521; H-6 to R-520; H-6 to S-519; H-6 to N-518; H-6 to V-517; H-6
to G-516; H-6 to V-515; H-6 to M-514; H-6 to F-513; H-6 to Y-512;
H-6 to L-511; H-6 to E-510; H-6 to C-509; H-6 to N-508; H-6 to
V-507; H-6 to S-506; H-6 to C-505; H-6 to L-504; H-6 to T-503; H-6
to E-502; H-6 to F-501; H-6 to V-500; H-6 to F-499; H-6 to T-498;
H-6 to I-497; H-6 to R-496; H-6 to A-495; H-6 to V-494; H-6 to
E-493; H-6 to K-492; H-6 to N-491; H-6 to E-490; H-6 to T-489; H-6
to D-488; H-6 to A-487; H-6 to M-486; H-6 to V-485; H-6 to S-484;
H-6 to Q-483; H-6 to P-482; H-6 to P-481; H-6 to R-480; H-6 to
F-479; H-6 to G-478; H-6 to P-477; H-6 to V-476; H-6 to V-475; H-6
to L-474; H-6 to T-473; H-6 to L-472; H-6 to I-471; H-6 to M-470;
H-6 to F-469; H-6 to D-468; H-6 to N-467; H-6 to D-466; H-6 to
S-465; H-6 to A-464; H-6 to G-463; H-6 to A-462; H-6 to A-461; H-6
to T-460; H-6 to Y-459; H-6 to I-458; H-6 to H-457; H-6 to D-456;
H-6 to G-455; H-6 to A-454; H-6 to V-453; H-6 to E-452; H-6 to
W-451; H-6 to G-450; H-6 to T-449; H-6 to M-448; H-6 to G-447; H-6
to K-446; H-6 to Y-445; H-6 to E-444; H-6 to F-443; H-6 to N-442;
H-6 to I-441; H-6 to G-440; H-6 to S-439; H-6 to L-438; H-6 to
V-437; H-6 to T-436; H-6 to T-435; H-6 to E-434; H-6 to M-433; H-6
to N-432; H-6 to T-431; H-6 to P-430; H-6 to L-429; H-6 to T-428;
H-6 to N-427; H-6 to W-426; H-6 to W-425; H-6 to K-424; H-6 to
Y-423; H-6 to E-422; H-6 to F-421; H-6 to G-420; H-6 to V-419; H-6
to A-418; H-6 to P-417; H-6 to E-416; H-6 to T-415; H-6 to G-414;
H-6 to A-413; H-6 to P-412; H-6 to C-411; H-6 to R-410; H-6 to
T-409; H-6 to C-408; H-6 to D-407; H-6 to S-406; H-6 to G-405; H-6
to N-404; H-6 to S-403; H-6 to Y-402; H-6 to S-401; H-6 to G-400;
H-6 to Y-399; H-6 to P-398; H-6 to C-397; H-6 to P-396; H-6 to
Q-395; H-6 to C-394; H-6 to T-393; H-6 to S-392; H-6 to N-391; H-6
to N-390; H-6 to T-389; H-6 to K-388; H-6 to F-387; H-6 to F-386;
H-6 to G-385; H-6 to P-384; H-6 to N-383; H-6 to C-382; H-6 to
P-381; H-6 to P-380; H-6 to C-379; H-6 to H-378; H-6 to T-377; H-6
to K-376; H-6 to V-375; H-6 to G-374; H-6 to S-373; H-6 to A-372;
H-6 to P-371; H-6 to L-370; H-6 to K-369; H-6 to V-368; H-6 to
A-367; H-6 to G-366; H-6 to E-365; H-6 to L-364; H-6 to D-363; H-6
to E-362; H-6 to S-361; H-6 to C-360; H-6 to I-359; H-6 to K-358;
H-6 to P-357; H-6 to K-356; H-6 to A-355; H-6 to W-354; H-6 to
K-353; H-6 to Y-352; H-6 to M-351; H-6 to L-350; H-6 to Q-349; H-6
to T-348; H-6 to E-347; H-6 to G-346; H-6 to N-345; H-6 to A-344;
H-6 to D-343; H-6 to C-342; H-6 to A-341; H-6 to T-340; H-6 to
H-339; H-6 to T-338; H-6 to Y-337; H-6 to F-336; H-6 to Y-335; H-6
to D-334; H-6 to K-333; H-6 to D-332; H-6 to T-331; H-6 to C-330;
H-6 to A-329; H-6 to P-328; H-6 to R-327; H-6 to V-326; H-6 to
N-325; H-6 to C-324; H-6 to S-323; H-6 to S-322; H-6 to S-321; H-6
to G-320; H-6 to K-319; H-6 to E-318; H-6 to S-317; H-6 to Y-316;
H-6 to K-315; H-6 to D-314; H-6 to P-313; H-6 to D-312; H-6 to
C-311; H-6 to Q-310; H-6 to H-309; H-6 to C-308; H-6 to S-307; H-6
to T-306; H-6 to E-305; H-6 to G-304; H-6 to K-303; H-6 to N-302;
H-6 to S-301; H-6 to Y-300; H-6 to S-299; H-6 to N-298; H-6 to
A-297; H-6 to P-296; H-6 to C-295; H-6 to L-294; H-6 to K-293; H-6
to C-292; H-6 to F-291; H-6 to S-290; H-6 to S-289; H-6 to G-288;
H-6 to Q-287; H-6 to K-286; H-6 to D-285; H-6 to A-284; H-6 to
Y-283; H-6 to T-282; H-6 to G-281; H-6 to P-280; H-6 to K-279; H-6
to C-278; H-6 to P-277; H-6 to F-276; H-6 to C-275; H-6 to E-274;
H-6 to S-273; H-6 to T-272; H-6 to Y-271; H-6 to A-270; H-6 to
V-269; H-6 to G-268; H-6 to T-267; H-6 to I-266; H-6 to A-265; H-6
to I-264; H-6 to N-263; H-6 to R-262; H-6 to V-261; H-6 to L-260;
H-6 to V-259; H-6 to P-258; H-6 to K-257; H-6 to P-256; H-6 to
V-255; H-6 to K-254; H-6 to T-253; H-6 to W-252; H-6 to V-251; H-6
to S-250; H-6 to F-249; H-6 to A-248; H-6 to T-247; H-6 to T-246;
H-6 to R-245; H-6 to W-244; H-6 to Y-243; H-6 to L-242; H-6 to
V-241; H-6 to N-240; H-6 to N-239; H-6 to G-238; H-6 to R-237; H-6
to N-236; H-6 to L-235; H-6 to E-234; H-6 to V-233; H-6 to S-232;
H-6 to H-231; H-6 to F-230; H-6 to E-229; H-6 to W-228; H-6 to
G-227; H-6 to K-226; H-6 to E-225; H-6 to T-224; H-6 to T-223; H-6
to K-222; H-6 to M-221; H-6 to W-220; H-6 to R-219; H-6 to S-218;
H-6 to D-217; H-6 to D-216; H-6 to A-215; H-6 to N-214; H-6 to
P-213; H-6 to Q-212; H-6 to C-211; H-6 to Q-210; H-6 to D-209; H-6
to N-208; H-6 to Q-207; H-6 to V-206; H-6 to F-205; H-6 to F-204;
H-6 to E-203; H-6 to F-202; H-6 to I-201; H-6 to I-200; H-6 to
S-199; H-6 to S-198; H-6 to D-197; H-6 to P-196; H-6 to Y-195; H-6
to Y-194; H-6 to Y-193; H-6 to E-192; H-6 to F-191; H-6 to N-190;
H-6 to V-189; H-6 to T-188; H-6 to G-187; H-6 to S-186; H-6 to
Q-185; H-6 to K-184; H-6 to L-183; H-6 to N-182; H-6 to V-181; H-6
to A-180; H-6 to Y-179; H-6 to M-178; H-6 to L-177; H-6 to T-176;
H-6 to A-175; H-6 to T-174; H-6 to C-173; H-6 to E-172; H-6 to
D-171; H-6 to T-170; H-6 to N-169; H-6 to F-168; H-6 to A-167; H-6
to I-166; H-6 to Y-165; H-6 to D-164; H-6 to G-163; H-6 to R-162;
H-6 to P-161; H-6 to V-160; H-6 to W-159; H-6 to K-158; H-6 to
S-157; H-6 to S-156; H-6 to T-155; H-6 to C-154; H-6 to N-153; H-6
to G-152; H-6 to T-151; H-6 to S-150; H-6 to E-149; H-6 to A-148;
H-6 to A-147; H-6 to S-146; H-6 to D-145; H-6 to D-144; H-6 to
L-143; H-6 to E-142; H-6 to M-141; H-6 to N-140; H-6 to A-139; H-6
to S-138; H-6 to L-137; H-6 to S-136; H-6 to A-135; H-6 to F-134;
H-6 to G-133; H-6 to H-132; H-6 to P-131; H-6 to L-130; H-6 to
E-129; H-6 to D-128; H-6 to W-127; H-6 to E-126; H-6 to D-125; H-6
to F-124; H-6 to R-123; H-6 to I-122; H-6 to G-121; H-6 to T-120;
H-6 to G-119; H-6 to L-118; H-6 to S-117; H-6 to Y-116; H-6 to
R-115; H-6 to G-114; H-6 to E-113; H-6 to A-112; H-6 to C-111; H-6
to P-110; H-6 to K-109; H-6 to C-108; H-6 to S-107; H-6 to Q-106;
H-6 to D-105; H-6 to K-104; H-6 to M-103; H-6 to D-102; H-6 to
L-101; H-6 to F-100; H-6 to E-99; H-6 to G-98; H-6 to A-97; H-6 to
N-96; H-6 to C-95; H-6 to S-94; H-6 to F-93; H-6 to S-92; H-6 to
C-91; H-6 to E-90; H-6 to T-89; H-6 to G-88; H-6 to K-87; H-6 to
V-86; H-6 to P-85; H-6 to D-84; H-6 to P-83; H-6 to L-82; H-6 to
S-81; H-6 to T-80; H-6 to C-79; H-6 to L-78; H-6 to G-77; H-6 to
P-76; H-6 to T-75; H-6 to H-74; H-6 to P-73; H-6 to V-72; H-6 to
A-71; H-6 to V-70; H-6 to R-69; H-6 to W-68; H-6 to R-67; H-6 to
S-66; H-6 to G-65; H-6 to T-64; H-6 to S-63; H-6 to D-62; H-6 to
C-61; H-6 to A-60; H-6 to T-59; H-6 to Y-58; H-6 to E-57; H-6 to
Y-56; H-6 to H-55; H-6 to Y-54; H-6 to E-53; H-6 to S-52; H-6 to
E-51; H-6 to K-50; H-6 to C-49; H-6 to A-48; H-6 to H-47; H-6 to
L-46; H-6 to E-45; H-6 to P-44; H-6 to G-43; H-6 to T-42; H-6 to
G-41; H-6 to Q-40; H-6 to T-39; H-6 to V-38; H-6 to Q-37; H-6 to
F-36; H-6 to A-35; H-6 to T-34; H-6 to G-33; H-6 to A-32; H-6 to
W-31; H-6 to L-30; H-6 to L-29; H-6 to L-28; H-6 to R-27; H-6 to
W-26; H-6 to L-25; H-6 to R-24; H-6 to P-23; H-6 to I-22; H-6 to
R-21; H-6 to R-20; H-6 to E-19; H-6 to T-18; H-6 to R-17; H-6 to
G-16; H-6 to R-15; H-6 to V-14; H-6 to R-13; H-6 to A-12; of SEQ ID
NO:40. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0254] In another embodiment, N-terminal deletions of the predicted
extracellular domain of the predicted mature TR13 protein, with the
amino acid sequence shown in FIGS. 7A-E, can be described by the
general formula n.sup.2-906, where n.sup.2 is a number from 2 to
900, corresponding to the position of amino acid identified in
FIGS. 7A-E (SEQ ID NO:40). N-terminal deletions of the TR13
polypeptide of the invention shown as SEQ ID NO:40 include
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of residues: T-42 to D-906; G-43 to D-906; P-44 to
D-906; E-45 to D-906; L-46 to D-906; H-47 to D-906; A-48 to D-906;
C-49 to D-906; K-50 to D-906; E-51 to D-906; S-52 to D-906; E-53 to
D-906; Y-54 to D-906; H-55 to D-906; Y-56 to D-906; E-57 to D-906;
Y-58 to D-906; T-59 to D-906; A-60 to D-906; C-61 to D-906; D-62 to
D-906; S-63 to D-906; T-64 to D-906; G-65 to D-906; S-66 to D-906;
R-67 to D-906; W-68 to D-906; R-69 to D-906; V-70 to D-906; A-71 to
D-906; V-72 to D-906; P-73 to D-906; H-74 to D-906; T-75 to D-906;
P-76 to D-906; G-77 to D-906; L-78 to D-906; C-79 to D-906; T-80 to
D-906; S-81 to D-906; L-82 to D-906; P-83 to D-906; D-84 to D-906;
P-85 to D-906; V-86 to D-906; K-87 to D-906; G-88 to D-906; T-89 to
D-906; E-90 to D-906; C-91 to D-906; S-92 to D-906; F-93 to D-906;
S-94 to D-906; C-95 to D-906; N-96 to D-906; A-97 to D-906; G-98 to
D-906; E-99 to D-906; F-100 to D-906; L-101 to D-906; D-102 to
D-906; M-103 to D-906; K-104 to D-906; D-105 to D-906; Q-106 to
D-906; S-107 to D-906; C-108 to D-906; K-109 to D-906; P-110 to
D-906; C-111 to D-906; A-112 to D-906; E-113 to D-906; G-114 to
D-906; R-115 to D-906; Y-116 to D-906; S-117 to D-906; L-118 to
D-906; G-119 to D-906; T-120 to D-906; G-121 to D-906; I-122 to
D-906; R-123 to D-906; F-124 to D-906; D-125 to D-906; E-126 to
D-906; W-127 to D-906; D-128 to D-906; E-129 to D-906; L-130 to
D-906; P-131 to D-906; H-132 to D-906; G-133 to D-906; F-134 to
D-906; A-135 to D-906; S-136 to D-906; L-137 to D-906; S-138 to
D-906; A-139 to D-906; N-140 to D-906; M-141 to D-906; E-142 to
D-906; L-143 to D-906; D-144 to D-906; D-145 to D-906; S-146 to
D-906; A-147 to D-906; A-148 to D-906; E-149 to D-906; S-150 to
D-906; T-151 to D-906; G-152 to D-906; N-153 to D-906; C-154 to
D-906; T-155 to D-906; S-156 to D-906; S-157 to D-906; K-158 to
D-906; W-159 to D-906; V-160 to D-906; P-161 to D-906; R-162 to
D-906; G-163 to D-906; D-164 to D-906; Y-165 to D-906; I-166 to
D-906; A-167 to D-906; F-168 to D-906; N-169 to D-906; T-170 to
D-906; D-171 to D-906; E-172 to D-906; C-173 to D-906; T-174 to
D-906; A-175 to D-906; T-176 to D-906; L-177 to D-906; M-178 to
D-906; Y-179 to D-906; A-180 to D-906; V-181 to D-906; N-182 to
D-906; L-183 to D-906; K-184 to D-906; Q-185 to D-906; S-186 to
D-906; G-187 to D-906; T-188 to D-906; V-189 to D-906; N-190 to
D-906; F-191 to D-906; E-192 to D-906; Y-193 to D-906; Y-194 to
D-906; Y-195 to D-906; P-196 to D-906; D-197 to D-906; S-198 to
D-906; S-199 to D-906; I-200 to D-906; I-201 to D-906; F-202 to
D-906; E-203 to D-906; F-204 to D-906; F-205 to D-906; V-206 to
D-906; Q-207 to D-906; N-208 to D-906; D-209 to D-906; Q-210 to
D-906; C-211 to D-906; Q-212 to D-906; P-213 to D-906; N-214 to
D-906; A-215 to D-906; D-216 to D-906; D-217 to D-906; S-218 to
D-906; R-219 to D-906; W-220 to D-906; M-221 to D-906; K-222 to
D-906; T-223 to D-906; T-224 to D-906; E-225 to D-906; K-226 to
D-906; G-227 to D-906; W-228 to D-906; E-229 to D-906; F-230 to
D-906; H-231 to D-906; S-232 to D-906; V-233 to D-906; E-234 to
D-906; L-235 to D-906; N-236 to D-906; R-237 to D-906; G-238 to
D-906; N-239 to D-906; N-240 to D-906; V-241 to D-906; L-242 to
D-906; Y-243 to D-906; W-244 to D-906; R-245 to D-906; T-246 to
D-906; T-247 to D-906; A-248 to D-906; F-249 to D-906; S-250 to
D-906; V-251 to D-906; W-252 to D-906; T-253 to D-906; K-254 to
D-906; V-255 to D-906; P-256 to D-906; K-257 to D-906; P-258 to
D-906; V-259 to D-906; L-260 to D-906; V-261 to D-906; R-262 to
D-906; N-263 to D-906; I-264 to D-906; A-265 to D-906; I-266 to
D-906; T-267 to D-906; G-268 to D-906; V-269 to D-906; A-270 to
D-906; Y-271 to D-906; T-272 to D-906; S-273 to D-906; E-274 to
D-906; C-275 to D-906; F-276 to D-906; P-277 to D-906; C-278 to
D-906; K-279 to D-906; P-280 to D-906; G-281 to D-906; T-282 to
D-906; Y-283 to D-906; A-284 to D-906; D-285 to D-906; K-286 to
D-906; Q-287 to D-906; G-288 to D-906; S-289 to D-906; S-290 to
D-906; F-291 to D-906; C-292 to D-906; K-293 to D-906; L-294 to
D-906; C-295 to D-906; P-296 to D-906; A-297 to D-906; N-298 to
D-906; S-299 to D-906; Y-300 to D-906; S-301 to D-906; N-302 to
D-906; K-303 to D-906; G-304 to D-906; E-305 to D-906; T-306 to
D-906; S-307 to D-906; C-308 to D-906; H-309 to D-906; Q-310 to
D-906; C-31 I to D-906; D-312 to D-906; P-313 to D-906; D-314 to
D-906; K-315 to D-906; Y-316 to D-906; S-317 to D-906; E-318 to
D-906; K-319 to D-906; G-320 to D-906; S-321 to D-906; S-322 to
D-906; S-323 to D-906; C-324 to D-906; N-325 to D-906; V-326 to
D-906; R-327 to D-906; P-328 to D-906; A-329 to D-906; C-330 to
D-906; T-331 to D-906; D-332 to D-906; K-333 to D-906; D-334 to
D-906; Y-335 to D-906; F-336 to D-906; Y-337 to D-906; T-338 to
D-906; H-339 to D-906; T-340 to D-906; A-341 to D-906; C-342 to
D-906; D-343 to D-906; A-344 to D-906; N-345 to D-906; G-346 to
D-906; E-347 to D-906; T-348 to D-906; Q-349 to D-906; L-350 to
D-906; M-351 to D-906; Y-352 to D-906; K-353 to D-906; W-354 to
D-906; A-355 to D-906; K-356 to D-906; P-357 to D-906; K-358 to
D-906; I-359 to D-906; C-360 to D-906; S-361 to D-906; E-362 to
D-906; D-363 to D-906; L-364 to D-906; E-365 to D-906; G-366 to
D-906; A-367 to D-906; V-368 to D-906; K-369 to D-906; L-370 to
D-906; P-371 to D-906; A-372 to D-906; S-373 to D-906; G-374 to
D-906; V-375 to D-906; K-376 to D-906; T-377 to D-906; H-378 to
D-906; C-379 to D-906; P-380 to D-906; P-381 to D-906; C-382 to
D-906; N-383 to D-906; P-384 to D-906; G-385 to D-906; F-386 to
D-906; F-387 to D-906; K-388 to D-906; T-389 to D-906; N-390 to
D-906; N-391 to D-906; S-392 to D-906; T-393 to D-906; C-394 to
D-906; Q-395 to D-906; P-396 to D-906; C-397 to D-906; P-398 to
D-906; Y-399 to D-906; G-400 to D-906; S-401 to D-906; Y-402 to
D-906; S-403 to D-906; N.sub.4O.sub.4 to D-906; G-405 to D-906;
S-406 to D-906; D-407 to D-906; C-408 to D-906; T-409 to D-906;
R-410 to D-906; C-411 to D-906; P-412 to D-906; A-413 to D-906;
G-414 to D-906; T-415 to D-906; E-416 to D-906; P-417 to D-906;
A-418 to D-906; V-419 to D-906; G-420 to D-906; F-421 to D-906;
E-422 to D-906; Y-423 to D-906; K-424 to D-906; W-425 to D-906;
W-426 to D-906; N-427 to D-906; T-428 to D-906; L-429 to D-906;
P-430 to D-906; T-431 to D-906; N-432 to D-906; M-433 to D-906;
E-434 to D-906; T-435 to D-906; T-436 to D-906; V-437 to D-906;
L-438 to D-906; S-439 to D-906; G-440 to D-906; I-441 to D-906;
N-442 to D-906; F-443 to D-906; E-444 to D-906; Y-445 to D-906;
K-446 to D-906; G-447 to D-906; M-448 to D-906; T-449 to D-906;
G-450 to D-906; W-451 to D-906; E-452 to D-906; V-453 to D-906;
A-454 to D-906; G-455 to D-906; D-456 to D-906; H-457 to D-906;
I-458 to D-906; Y-459 to D-906; T-460 to D-906; A-461 to D-906;
A-462 to D-906; G-463 to D-906; A-464 to D-906; S-465 to D-906;
D-466 to D-906; N-467 to D-906; D-468 to D-906; F-469 to D-906;
M-470 to D-906; I-471 to D-906; L-472 to D-906; T-473 to D-906;
L-474 to D-906; V-475 to D-906; V-476 to D-906; P-477 to D-906;
G-478 to D-906; F-479 to D-906; R-480 to D-906; P-481 to D-906;
P-482 to D-906; Q-483 to D-906; S-484 to D-906; V-485 to D-906;
M-486 to D-906; A-487 to D-906; D-488 to D-906; T-489 to D-906;
E-490 to D-906; N-491 to D-906; K-492 to D-906; E-493 to D-906;
V-494 to D-906; A-495 to D-906; R-496 to D-906; I-497 to D-906;
T-498 to D-906; F-499 to D-906; V-500 to D-906; F-501 to D-906;
E-502 to D-906; T-503 to D-906; L-504 to D-906; C-505 to D-906;
S-506 to D-906; V-507 to D-906; N-508 to D-906; C-509 to D-906;
E-510 to D-906; L-51 I to D-906; Y-512 to D-906; F-513 to D-906;
M-514 to D-906; V-515 to D-906; G-516 to D-906; V-517 to D-906;
N-518 to D-906; S-519 to D-906; R-520 to D-906; T-521 to D-906;
N-522 to D-906; T-523 to D-906; P-524 to D-906; V-525 to D-906;
E-526 to D-906; T-527 to D-906; W-528 to D-906; K-529 to D-906;
G-530 to D-906; S-531 to D-906; K-532 to D-906; G-533 to D-906;
K-534 to D-906; Q-535 to D-906; S-536 to D-906; Y-537 to D-906;
T-538 to D-906; Y-539 to D-906; I-540 to D-906; I-541 to D-906;
E-542 to D-906; E-543 to D-906; N-544 to D-906; T-545 to D-906;
T-546 to D-906; T-547 to D-906; S-548 to D-906; F-549 to D-906;
T-550 to D-906; W-551 to D-906; A-552 to D-906; F-553 to D-906;
Q-554 to D-906; R-555 to D-906; T-556 to D-906; T-557 to D-906;
F-558 to D-906; H-559 to D-906; E-560 to D-906; A-561 to D-906;
S-562 to D-906; R-563 to D-906; K-564 to D-906; Y-565 to D-906;
T-566 to D-906; N-567 to D-906; D-568 to D-906; V-569 to D-906;
A-570 to D-906; K-571 to D-906; I-572 to D-906; Y-573 to D-906;
S-574 to D-906; I-575 to D-906; N-576 to D-906; V-577 to D-906;
T-578 to D-906; N-579 to D-906; V-580 to D-906; M-581 to D-906;
N-582 to D-906; G-583 to D-906; V-584 to D-906; A-585 to D-906;
S-586 to D-906; Y-587 to D-906; C-588 to D-906; R-589 to D-906;
P-590 to D-906; C-591 to D-906; A-592 to D-906; L-593 to D-906;
E-594 to D-906; A-595 to D-906; S-596 to D-906; D-597 to D-906;
V-598 to D-906; G-599 to D-906; S-600 to D-906; S-601 to D-906;
C-602 to D-906; T-603 to D-906; S-604 to D-906; C-605 to D-906;
P-606 to D-906; A-607 to D-906; G-608 to D-906; Y-609 to D-906;
Y-610 to D-906; I-611 to D-906; D-612 to D-906; R-613 to D-906;
D-614 to D-906; S-615 to D-906; G-616 to D-906; T-617 to D-906;
C-618 to D-906; H-619 to D-906; S-620 to D-906; C-621 to D-906;
P-622 to D-906; P-623 to D-906; N-624 to D-906; T-625 to D-906;
I-626 to D-906; L-627 to D-906; K-628 to D-906; A-629 to D-906;
H-630 to D-906; Q-631 to D-906; P-632 to D-906; Y-633 to D-906;
G-634 to D-906; V-635 to D-906; Q-636 to D-906; A-637 to D-906;
C-638 to D-906; V-639 to D-906; P-640 to D-906; C-641 to D-906;
G-642 to D-906; P-643 to D-906; G-644 to D-906; T-645 to D-906;
K-646 to D-906; N-647 to D-906; N-648 to D-906; K-649 to D-906;
I-650 to D-906; H-651 to D-906; S-652 to D-906; L-653 to D-906;
C-654 to D-906; Y-655 to D-906; N-656 to D-906; D-657 to D-906;
C-658 to D-906; T-659 to D-906; F-660 to D-906; S-661 to D-906;
R-662 to D-906; N-663 to D-906; T-664 to D-906; P-665 to D-906;
T-666 to D-906; R-667 to D-906; T-668 to D-906; F-669 to D-906;
N-670 to D-906; Y-671 to D-906; N-672 to D-906; F-673 to D-906;
S-674 to D-906; A-675 to D-906; L-676 to D-906; A-677 to D-906;
N-678 to D-906; T-679 to D-906; V-680 to D-906; T-681 to D-906;
L-682 to D-906; A-683 to D-906; G-684 to D-906; G-685 to D-906;
P-686 to D-906; S-687 to D-906; F-688 to D-906; T-689 to D-906;
S-690 to D-906; K-691 to D-906; G-692 to D-906; L-693 to D-906;
K-694 to D-906; Y-695 to D-906; F-696 to D-906; H-697 to D-906;
H-698 to D-906; F-699 to D-906; T-700 to D-906; L-701 to D-906;
S-702 to D-906; L-703 to D-906; C-704 to D-906; G-705 to D-906;
N-706 to D-906; Q-707 to D-906; G-708 to D-906; R-709 to D-906;
K-710 to D-906; M-711 to D-906; S-712 to D-906; V-713 to D-906;
C-714 to D-906; T-715 to D-906; D-716 to D-906; N-717 to D-906;
V-718 to D-906; T-719 to D-906; D-720 to D-906; L-721 to D-906;
R-722 to D-906; I-723 to D-906; P-724 to D-906; E-725 to D-906;
G-726 to D-906; E-727 to D-906; S-728 to D-906; G-729 to D-906;
F-730 to D-906; S-731 to D-906; K-732 to D-906; S-733 to D-906;
I-734 to D-906; T-735 to D-906; A-736 to D-906; Y-737 to D-906;
V-738 to D-906; C-739 to D-906; Q-740 to D-906; A-741 to D-906;
V-742 to D-906; I-743 to D-906; I-744 to D-906; P-745 to D-906;
P-746 to D-906; E-747 to D-906; V-748 to D-906; T-749 to D-906;
G-750 to D-906; Y-751 to D-906; K-752 to D-906; A-753 to D-906;
G-754 to D-906; V-755 to D-906; S-756 to D-906; S-757 to D-906;
Q-758 to D-906; P-759 to D-906; V-760 to D-906; S-761 to D-906;
L-762 to D-906; A-763 to D-906; D-764 to D-906; R-765 to D-906;
L-766 to D-906; I-767 to D-906; G-768 to D-906; V-769 to D-906;
T-770 to D-906; T-771 to D-906; D-772 to D-906; M-773 to D-906;
T-774 to D-906; L-775 to D-906; D-776 to D-906; G-777 to D-906;
I-778 to D-906; T-779 to D-906; S-780 to D-906; P-781 to D-906;
A-782 to D-906; E-783 to D-906; L-784 to D-906; F-785 to D-906;
H-786 to D-906; L-787 to D-906; E-788 to D-906; S-789 to D-906;
L-790 to D-906; G-791 to D-906; I-792 to D-906; P-793 to D-906;
D-794 to D-906; V-795 to D-906; I-796 to D-906; F-797 to D-906;
F-798 to D-906; Y-799 to D-906; R-800 to D-906; S-801 to D-906;
N-802 to D-906; D-803 to D-906; V-804 to D-906; T-805 to D-906;
Q-806 to D-906; S-807 to D-906; C-808 to D-906; S-809 to D-906;
S-810 to D-906; G-811 to D-906; R-812 to D-906; S-813 to D-906;
T-814 to D-906; T-815 to D-906; I-816 to D-906; R-817 to D-906;
V-818 to D-906; R-819 to D-906; C-820 to D-906; S-821 to D-906;
P-822 to D-906; Q-823 to D-906; K-824 to D-906; T-825 to D-906;
V-826 to D-906; P-827 to D-906; G-828 to D-906; S-829 to D-906;
L-830 to D-906; L-831 to D-906; L-832 to D-906; P-833 to D-906;
G-834 to D-906; T-835 to D-906; C-836 to D-906; S-837 to D-906;
D-838 to D-906; G-839 to D-906; T-840 to D-906; C-841 to D-906;
D-842 to D-906; G-843 to D-906; C-844 to D-906; N-845 to D-906;
F-846 to D-906; H-847 to D-906; F-848 to D-906; L-849 to D-906;
W-850 to D-906; E-851 to D-906; S-852 to D-906; A-853 to D-906;
A-854 to D-906; A-855 to D-906; C-856 to D-906; P-857 to D-906;
L-858 to D-906; C-859 to D-906; S-860 to D-906; V-861 to D-906;
A-862 to D-906; D-863 to D-906; Y-864 to D-906; H-865 to D-906;
A-866 to D-906; I-867 to D-906; V-868 to D-906; S-869 to D-906;
S-870 to D-906; C-871 to D-906; V-872 to D-906; A-873 to D-906;
G-874 to D-906; I-875 to D-906; Q-876 to D-906; K-877 to D-906;
T-878 to D-906; T-879 to D-906; Y-880 to D-906; V-881 to D-906;
W-882 to D-906; R-883 to D-906; E-884 to D-906; P-885 to D-906;
K-886 to D-906; L-887 to D-906; C-888 to D-906; S-889 to D-906;
G-890 to D-906; G-891 to D-906; I-892 to D-906; S-893 to D-906;
L-894 to D-906; P-895 to D-906; E-896 to D-906; Q-897 to D-906;
R-898 to D-906; V-899 to D-906; and T-900 to D-906 of SEQ ID NO:40.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0255] The present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the
predicted extracellular domain of the predicted mature TR13
protein, with the amino acid sequence shown in FIGS. 7A-E (SEQ ID
NO:40), up to the alanine residue at position number 48, and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues
42-m.sup.1 of FIGS. 7A-E, where m.sup.1 is an integer from 48 to
906 corresponding to the position of the amino acid residue in
FIGS. 7A-E.
[0256] Thus, the invention provides TR13 polypeptides comprising,
or alternatively consisting of, the amino acid sequence of
residues: T-42 to D-906; T-42 to I-905; T-42 to T-904; T-42 to
K-903; T-42 to C-902; T-42 to I-901; T-42 to T-900; T-42 to V-899;
T-42 to R-898; T-42 to Q-897; T-42 to E-896; T-42 to P-895; T-42 to
L-894; T-42 to S-893; T-42 to I-892; T-42 to G-891; T-42 to G-890;
T-42 to S-889; T-42 to C-888; T-42 to L-887; T-42 to K-886; T-42 to
P-885; T-42 to E-884; T-42 to R-883; T-42 to W-882; T-42 to V-881;
T-42 to Y-880; T-42 to T-879; T-42 to T-878; T-42 to K-877; T-42 to
Q-876; T-42 to I-875; T-42 to G-874; T-42 to A-873; T-42 to V-872;
T-42 to C-871; T-42 to S-870; T-42 to S-869; T-42 to V-868; T-42 to
I-867; T-42 to A-866; T-42 to H-865; T-42 to Y-864; T-42 to D-863;
T-42 to A-862; T-42 to V-861; T-42 to S-860; T-42 to C-859; T-42 to
L-858; T-42 to P-857; T-42 to C-856; T-42 to A-855; T-42 to A-854;
T-42 to A-853; T-42 to S-852; T-42 to E-851; T-42 to W-850; T-42 to
L-849; T-42 to F-848; T-42 to H-847; T-42 to F-846; T-42 to N-845;
T-42 to C-844; T-42 to G-843; T-42 to D-842; T-42 to C-841; T-42 to
T-840; T-42 to G-839; T-42 to D-838; T-42 to S-837; T-42 to C-836;
T-42 to T-835; T-42 to G-834; T-42 to P-833; T-42 to L-832; T-42 to
L-831; T-42 to L-830; T-42 to S-829; T-42 to G-828; T-42 to P-827;
T-42 to V-826; T-42 to T-825; T-42 to K-824; T-42 to Q-823; T-42 to
P-822; T-42 to S-821; T-42 to C-820; T-42 to R-819; T-42 to V-818;
T-42 to R-817; T-42 to I-816; T-42 to T-815; T-42 to T-814; T-42 to
S-813; T-42 to R-812; T-42 to G-81 I; T-42 to S-810; T-42 to S-809;
T-42 to C-808; T-42 to S-807; T-42 to Q-806; T-42 to T-805; T-42 to
V-804; T-42 to D-803; T-42 to N-802; T-42 to S-801; T-42 to R-800;
T-42 to Y-799; T-42 to F-798; T-42 to F-797; T-42 to I-796; T-42 to
V-795; T-42 to D-794; T-42 to P-793; T-42 to I-792; T-42 to G-791;
T-42 to L-790; T-42 to S-789; T-42 to E-788; T-42 to L-787; T-42 to
H-786; T-42 to F-785; T-42 to L-784; T-42 to E-783; T-42 to A-782;
T-42 to P-781; T-42 to S-780; T-42 to T-779; T-42 to I-778; T-42 to
G-777; T-42 to D-776; T-42 to L-775; T-42 to T-774; T-42 to M-773;
T-42 to D-772; T-42 to T-771; T-42 to T-770; T-42 to V-769; T-42 to
G-768; T-42 to I-767; T-42 to L-766; T-42 to R-765; T-42 to D-764;
T-42 to A-763; T-42 to L-762; T-42 to S-761; T-42 to V-760; T-42 to
P-759; T-42 to Q-758; T-42 to S-757; T-42 to S-756; T-42 to V-755;
T-42 to G-754; T-42 to A-753; T-42 to K-752; T-42 to Y-751; T-42 to
G-750; T-42 to T-749; T-42 to V-748; T-42 to E-747; T-42 to P-746;
T-42 to P-745; T-42 to I-744; T-42 to I-743; T-42 to V-742; T-42 to
A-741; T-42 to Q-740; T-42 to C-739; T-42 to V-738; T-42 to Y-737;
T-42 to A-736; T-42 to T-735; T-42 to I-734; T-42 to S-733; T-42 to
K-732; T-42 to S-731; T-42 to F-730; T-42 to G-729; T-42 to S-728;
T-42 to E-727; T-42 to G-726; T-42 to E-725; T-42 to P-724; T-42 to
I-723; T-42 to R-722; T-42 to L-721; T-42 to D-720; T-42 to T-719;
T-42 to V-718; T-42 to N-717; T-42 to D-716; T-42 to T-715; T-42 to
C-714; T-42 to V-713; T-42 to S-712; T-42 to M-711; T-42 to K-710;
T-42 to R-709; T-42 to G-708; T-42 to Q-707; T-42 to N-706; T-42 to
G-705; T-42 to C-704; T-42 to L-703; T-42 to S-702; T-42 to L-701;
T-42 to T-700; T-42 to F-699; T-42 to T-4298; T-42 to T-4297; T-42
to F-696; T-42 to Y-695; T-42 to K-694; T-42 to L-693; T-42 to
G-692; T-42 to K-691; T-42 to S-690; T-42 to T-689; T-42 to F-688;
T-42 to S-687; T-42 to P-686; T-42 to G-685; T-42 to G-684; T-42 to
A-683; T-42 to L-682; T-42 to T-681; T-42 to V-680; T-42 to T-679;
T-42 to N-678; T-42 to A-677; T-42 to L-676; T-42 to A-675; T-42 to
S-674; T-42 to F-673; T-42 to N-672; T-42 to Y-671; T-42 to N-670;
T-42 to F-669; T-42 to T-668; T-42 to R-667; T-42 to T-666; T-42 to
P-665; T-42 to T-664; T-42 to N-663; T-42 to R-662; T-42 to S-661;
T-42 to F-660; T-42 to T-659; T-42 to C-658; T-42 to D-657; T-42 to
N-656; T-42 to Y-655; T-42 to C-654; T-42 to L-653; T-42 to S-652;
T-42 to T-4251; T-42 to I-650; T-42 to K-649; T-42 to N-648; T-42
to N-647; T-42 to K-646; T-42 to T-645; T-42 to G-644; T-42 to
P-643; T-42 to G-642; T-42 to C-641; T-42 to P-640; T-42 to V-639;
T-42 to C-638; T-42 to A-637; T-42 to Q-636; T-42 to V-635; T-42 to
G-634; T-42 to Y-633; T-42 to P-632; T-42 to Q-631; T-42 to T-4230;
T-42 to A-629; T-42 to K-628; T-42 to L-627; T-42 to I-626; T-42 to
T-625; T-42 to N-624; T-42 to P-623; T-42 to P-622; T-42 to C-621;
T-42 to S-620; T-42 to T-4219; T-42 to C-618; T-42 to T-617; T-42
to G-616; T-42 to S-615; T-42 to D-614; T-42 to R-613; T-42 to
D-612; T-42 to I-611; T-42 to Y-610; T-42 to Y-609; T-42 to G-608;
T-42 to A-607; T-42 to P-606; T-42 to C-605; T-42 to S-604; T-42 to
T-603; T-42 to C-602; T-42 to S-601; T-42 to S-600; T-42 to G-599;
T-42 to V-598; T-42 to D-597; T-42 to S-596; T-42 to A-595; T-42 to
E-594; T-42 to L-593; T-42 to A-592; T-42 to C-591; T-42 to P-590;
T-42 to R-589; T-42 to C-588; T-42 to Y-587; T-42 to S-586; T-42 to
A-585; T-42 to V-584; T-42 to G-583; T-42 to N-582; T-42 to M-581;
T-42 to V-580; T-42 to N-579; T-42 to T-578; T-42 to V-577; T-42 to
N-576; T-42 to I-575; T-42 to S-574; T-42 to Y-573; T-42 to I-572;
T-42 to K-571; T-42 to A-570; T-42 to V-569; T-42 to D-568; T-42 to
N-567; T-42 to T-566; T-42 to Y-565; T-42 to K-564; T-42 to R-563;
T-42 to S-562; T-42 to A-561; T-42 to E-560; T-42 to H-559; T-42 to
F-558; T-42 to T-557; T-42 to T-556; T-42 to R-555; T-42 to Q-554;
T-42 to F-553; T-42 to A-552; T-42 to W-551; T-42 to T-550; T-42 to
F-549; T-42 to S-548; T-42 to T-547; T-42 to T-546; T-42 to T-545;
T-42 to N-544; T-42 to E-543; T-42 to E-542; T-42 to I-541; T-42 to
I-540; T-42 to Y-539; T-42 to T-538; T-42 to Y-537; T-42 to S-536;
T-42 to Q-535; T-42 to K-534; T-42 to G-533; T-42 to K-532; T-42 to
S-531; T-42 to G-530; T-42 to K-529; T-42 to W-528; T-42 to T-527;
T-42 to E-526; T-42 to V-525; T-42 to P-524; T-42 to T-523; T-42 to
N-522; T-42 to T-521; T-42 to R-520; T-42 to S-519; T-42 to N-518;
T-42 to V-517; T-42 to G-516; T-42 to V-515; T-42 to M-514; T-42 to
F-513; T-42 to Y-512; T-42 to L-511; T-42 to E-510; T-42 to C-509;
T-42 to N-508; T-42 to V-507; T-42 to S-506; T-42 to C-505; T-42 to
L-504; T-42 to T-503; T-42 to E-502; T-42 to F-501; T-42 to V-500;
T-42 to F-499; T-42 to T-498; T-42 to I-497; T-42 to R-496; T-42 to
A-495; T-42 to V-494; T-42 to E-493; T-42 to K-492; T-42 to N-491;
T-42 to E-490; T-42 to T-489; T-42 to D-488; T-42 to A-487; T-42 to
M-486; T-42 to V-485; T-42 to S-484; T-42 to Q-483; T-42 to P-482;
T-42 to P-481; T-42 to R-480; T-42 to F-479; T-42 to G-478; T-42 to
P-477; T-42 to V-476; T-42 to V-475; T-42 to L-474; T-42 to T-473;
T-42 to L-472; T-42 to I-471; T-42 to M-470; T-42 to F-469; T-42 to
D-468; T-42 to N-467; T-42 to D-466; T-42 to S-465; T-42 to A-464;
T-42 to G-463; T-42 to A-462; T-42 to A-461; T-42 to T-460; T-42 to
Y-459; T-42 to I-458; T-42 to H-457; T-42 to D-456; T-42 to G-455;
T-42 to A-454; T-42 to V-453; T-42 to E-452; T-42 to W-451; T-42 to
G-450; T-42 to T-449; T-42 to M-448; T-42 to G-447; T-42 to K-446;
T-42 to Y-445; T-42 to E-444; T-42 to F-443; T-42 to N-442; T-42 to
I-441; T-42 to G-440; T-42 to S-439; T-42 to L-438; T-42 to V-437;
T-42 to T-436; T-42 to T-435; T-42 to E-434; T-42 to M-433; T-42 to
N-432; T-42 to T-431; T-42 to P-430; T-42 to L-429; T-42 to T-428;
T-42 to N-427; T-42 to W-426; T-42 to W-425; T-42 to K-424; T-42 to
Y-423; T-42 to E-422; T-42 to F-421; T-42 to G-420; T-42 to V-419;
T-42 to A-418; T-42 to P-417; T-42 to E-416; T-42 to T-415; T-42 to
G-414; T-42 to A-413; T-42 to P-412; T-42 to C-411; T-42 to R-410;
T-42 to T-409; T-42 to C-408; T-42 to D-407; T-42 to S-406; T-42 to
G-405; T-42 to N.sub.4O.sub.4; T-42 to S-403; T-42 to Y-402; T-42
to S-401; T-42 to G-400; T-42 to Y-399; T-42 to P-398; T-42 to
C-397; T-42 to P-396; T-42 to Q-395; T-42 to C-394; T-42 to T-393;
T-42 to S-392; T-42 to N-391; T-42 to N-390; T-42 to T-389; T-42 to
K-388; T-42 to F-387; T-42 to F-386; T-42 to G-385; T-42 to P-384;
T-42 to N-383; T-42 to C-382; T-42 to P-381; T-42 to P-380; T-42 to
C-379; T-42 to H-378; T-42 to T-377; T-42 to K-376; T-42 to V-375;
T-42 to G-374; T-42 to S-373; T-42 to A-372; T-42 to P-371; T-42 to
L-370; T-42 to K-369; T-42 to V-368; T-42 to A-367; T-42 to G-366;
T-42 to E-365; T-42 to L-364; T-42 to D-363; T-42 to E-362; T-42 to
S-361; T-42 to C-360; T-42 to I-359; T-42 to K-358; T-42 to P-357;
T-42 to K-356; T-42 to A-355; T-42 to W-354; T-42 to K-353; T-42 to
Y-352; T-42 to M-351; T-42 to L-350; T-42 to Q-349; T-42 to T-348;
T-42 to E-347; T-42 to G-346; T-42 to N-345; T-42 to A-344; T-42 to
D-343; T-42 to C-342; T-42 to A-341; T-42 to T-340; T-42 to H-339;
T-42 to T-338; T-42 to Y-337; T-42 to F-336; T-42 to Y-335; T-42 to
D-334; T-42 to K-333; T-42 to D-332; T-42 to T-331; T-42 to C-330;
T-42 to A-329; T-42 to P-328; T-42 to R-327; T-42 to V-326; T-42 to
N-325; T-42 to C-324; T-42 to S-323; T-42 to S-322; T-42 to S-321;
T-42 to G-320; T-42 to K-319; T-42 to E-318; T-42 to S-317; T-42 to
Y-316; T-42 to K-315; T-42 to D-314; T-42 to P-313; T-42 to D-312;
T-42 to C-31 I; T-42 to Q-310; T-42 to H-309; T-42 to C-308; T-42
to S-307; T-42 to T-306; T-42 to E-305; T-42 to G-304; T-42 to
K-303; T-42 to N-302; T-42 to S-301; T-42 to Y-300; T-42 to S-299;
T-42 to N-298; T-42 to A-297; T-42 to P-296; T-42 to C-295; T-42 to
L-294; T-42 to K-293; T-42 to C-292; T-42 to F-291; T-42 to S-290;
T-42 to S-289; T-42 to G-288; T-42 to Q-287; T-42 to K-286; T-42 to
D-285; T-42 to A-284; T-42 to Y-283; T-42 to T-282; T-42 to G-281;
T-42 to P-280; T-42 to K-279; T-42 to C-278; T-42 to P-277; T-42 to
F-276; T-42 to C-275; T-42 to E-274; T-42 to S-273; T-42 to T-272;
T-42 to Y-271; T-42 to A-270; T-42 to V-269; T-42 to G-268; T-42 to
T-267; T-42 to I-266; T-42 to A-265; T-42 to I-264; T-42 to N-263;
T-42 to R-262; T-42 to V-261; T-42 to L-260; T-42 to V-259; T-42 to
P-258; T-42 to K-257; T-42 to P-256; T-42 to V-255; T-42 to K-254;
T-42 to T-253; T-42 to W-252; T-42 to V-251; T-42 to S-250; T-42 to
F-249; T-42 to A-248; T-42 to T-247; T-42 to T-246; T-42 to R-245;
T-42 to W-244; T-42 to Y-243; T-42 to L-242; T-42 to V-241; T-42 to
N-240; T-42 to N-239; T-42 to G-238; T-42 to R-237; T-42 to N-236;
T-42 to L-235; T-42 to E-234; T-42 to V-233; T-42 to S-232; T-42 to
H-231; T-42 to F-230; T-42 to E-229; T-42 to W-228; T-42 to G-227;
T-42 to K-226; T-42 to E-225; T-42 to T-224; T-42 to T-223; T-42 to
K-222; T-42 to M-221; T-42 to W-220; T-42 to R-219; T-42 to S-218;
T-42 to D-217; T-42 to D-216; T-42 to A-215; T-42 to N-214; T-42 to
P-213; T-42 to Q-212; T-42 to C-211; T-42 to Q-210; T-42 to D-209;
T-42 to N-208; T-42 to Q-207; T-42 to V-206; T-42 to F-205; T-42 to
F-204; T-42 to E-203; T-42 to F-202; T-42 to I-201; T-42 to I-200;
T-42 to S-199; T-42 to S-198; T-42 to D-197; T-42 to P-196; T-42 to
Y-195; T-42 to Y-194; T-42 to Y-193; T-42 to E-192; T-42 to F-191;
T-42 to N-190; T-42 to V-189; T-42 to T-188; T-42 to G-187; T-42 to
S-186; T-42 to Q-185; T-42 to K-184; T-42 to L-183; T-42 to N-182;
T-42 to V-181; T-42 to A-180; T-42 to Y-179; T-42 to M-178; T-42 to
L-177; T-42 to T-176; T-42 to A-175; T-42 to T-174; T-42 to C-173;
T-42 to E-172; T-42 to D-171; T-42 to T-170; T-42 to N-169; T-42 to
F-168; T-42 to A-167; T-42 to I-166; T-42 to Y-165; T-42 to D-164;
T-42 to G-163; T-42 to R-162; T-42 to P-161; T-42 to V-160; T-42 to
W-159; T-42 to K-158; T-42 to S-157; T-42 to S-156; T-42 to T-155;
T-42 to C-154; T-42 to N-153; T-42 to G-152; T-42 to T-151; T-42 to
S-150; T-42 to E-149; T-42 to A-148; T-42 to A-147; T-42 to S-146;
T-42 to D-145; T-42 to D-144; T-42 to L-143; T-42 to E-142; T-42 to
M-141; T-42 to N-140; T-42 to A-139; T-42 to S-138; T-42 to L-137;
T-42 to S-136; T-42 to A-135; T-42 to F-134; T-42 to G-133; T-42 to
H-132; T-42 to P-131; T-42 to L-130; T-42 to E-129; T-42 to D-128;
T-42 to W-127; T-42 to E-126; T-42 to D-125; T-42 to F-124; T-42 to
R-123; T-42 to I-122; T-42 to G-121; T-42 to T-120; T-42 to G-119;
T-42 to L-118; T-42 to S-117; T-42 to Y-116; T-42 to R-115; T-42 to
G-114; T-42 to E-113; T-42 to A-112; T-42 to C-111; T-42 to P-110;
T-42 to K-109; T-42 to C-108; T-42 to S-107; T-42 to Q-106; T-42 to
D-105; T-42 to K-104; T-42 to M-103; T-42 to D-102; T-42 to L-101;
T-42 to F-100; T-42 to E-99; T-42 to G-98; T-42 to A-97; T-42 to
N-96; T-42 to C-95; T-42 to S-94; T-42 to F-93; T-42 to S-92; T-42
to C-91; T-42 to E-90; T-42 to T-89; T-42 to G-88; T-42 to K-87;
T-42 to V-86; T-42 to P-85; T-42 to D-84; T-42 to P-83; T-42 to
L-82; T-42 to S-81; T-42 to T-80; T-42 to C-79; T-42 to L-78; T-42
to G-77; T-42 to P-76; T-42 to T-75; T-42 to H-74; T-42 to P-73;
T-42 to V-72; T-42 to A-71; T-42 to V-70; T-42 to R-69; T-42 to
W-68; T-42 to R-67; T-42 to S-66; T-42 to G-65; T-42 to T-64; T-42
to S-63; T-42 to D-62; T-42 to C-61; T-42 to A-60; T-42 to T-59;
T-42 to Y-58; T-42 to E-57; T-42 to Y-56; T-42 to H-55; T-42 to
Y-54; T-42 to E-53; T-42 to S-52; T-42 to E-51; T-42 to K-50; T-42
to C-49; and T-42 to A-48 of SEQ ID NO:40. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
[0257] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini,
which may be described generally as having residues n.sup.1-m.sup.1
and/or n.sup.2-m.sup.1 of FIGS. 1A-D (i.e., SEQ ID NO:2), where
n.sup.1, n.sup.2, and m.sup.1 are integers as described above.
Thus, any of the above listed N- or C-terminal deletions can be
combined to produce an N- and C-terminal deleted TR13
polypeptide.
[0258] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini,
which may be described generally as having residues n.sup.1-m.sup.1
and/or n.sup.2-m.sup.1 of FIGS. 7A-E (SEQ ID NO:40), where n.sup.1,
n.sup.2, and m.sup.1 are integers as described above. Thus, any of
the above listed N- or C-terminal deletions can be combined to
produce an N- and C-terminal deleted TR13 polypeptide.
[0259] It will be recognized in the art that some amino acid
sequences of TR13 polypeptides can be varied without significant
effect on the structure or function of the protein. If such
differences in sequence are contemplated, it should be remembered
that there will be critical areas on the protein which determine
activity. Thus, the invention further includes variations of the
TR13 polypeptide, which show substantial TR13 activity or which
include regions of TR13 polypeptides, such as the polypeptide
portions discussed herein. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions. As
indicated above, guidance concerning which amino acid changes are
likely to be phenotypically silent can be found in J. U. Bowie et
al., Science 247:1306-1310 (1990).
[0260] Thus, the fragment, derivative, or analog of the polypeptide
of SEQ ID NO:2 or SEQ ID NO:40, or that encoded by the cDNA
deposited at ATCC Deposit No. PTA-349 or ATCC Deposit No. PTA-507,
may be (i) one in which at least one or more of the amino acid
residues are substituted with a conserved or non-conserved amino
acid residue (preferably a conserved amino acid residue(s), and
more preferably at least one but less than ten conserved amino acid
residues) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituent group, or (iii)
one in which the mature polypeptide is fused with another compound,
such as a compound to increase the half-life of the polypeptide
(for example, polyethylene glycol), or (iv) one in which the
additional amino acids are fused to the mature polypeptide, such as
an IgG Fc fusion region peptide or leader or secretory sequence or
a sequence which is employed for purification of the mature
polypeptide or a proprotein sequence. Such fragments, derivatives
and analogs are deemed to be within the scope of those skilled in
the art from the teachings herein.
[0261] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the TR13
polypeptide. The prevention of aggregation is highly desirable.
Aggregation of proteins not only results in a loss of activity but
can also be problematic when preparing pharmaceutical formulations,
because they can be immunogenic. (Pinckard et al., Clin Exp.
Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:838-845
(1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993)).
[0262] The replacement of amino acids can also change the
selectivity of binding to cell surface receptors. Ostade et al.,
Nature 361:266-268 (1993), describes certain mutations resulting in
selective binding of TNF-.alpha. to only one of the two known types
of TNF receptors. Thus, the TR13 polypeptides of the present
invention may include one or more amino acid substitutions,
deletions, or additions, either from natural mutations or human
manipulation.
[0263] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table V).
5TABLE V Conservative Amino Acid Substitutions Aromatic
Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine Isoleucine
Valine Polar Glutamine Asparagine Basic Arginine Lysine Histidine
Acidic Aspartic Acid Glutamic Acid Small Alanine Serine Threonine
Methionine Glycine
[0264] In specific embodiments, the number of substitutions,
additions or deletions in the amino acid sequence of FIGS. 1A-D or
FIGS. 7A-E and/or any of the polypeptide fragments described herein
(e.g., one or more of the cysteine rich domains, the mature
extracellular domain, etc.) is 75,70,60,50,40, 35, 30, 25, 20, 15,
10,9, 8,7,6,5,4, 3,2, 1 or 30-20,20-15,20-10, 15-10, 10-1, 5-10,
1-5, 1-3 or 1-2.
[0265] Amino acids in the TR13 polypeptides of the present
invention that are essential for function can be identified by
methods known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting
mutant molecules are then tested for biological activity such as
receptor binding or in vitro proliferative activity. Sites that are
critical for ligand-receptor binding can also be determined by
structural analysis such as crystallization, nuclear magnetic
resonance or photoaffinity labeling (Smith et al., J. Mol. Biol.
224:899-904 (1992) and de Vos et al. Science 255:306-312
(1992)).
[0266] To improve or alter the characteristics of TR13
polypeptides, protein engineering may be employed. Recombinant DNA
technology known to those skilled in the art can be used to create
novel mutant proteins or "muteins including single or multiple
amino acid substitutions, deletions, additions or fusion proteins.
Such modified polypeptides can show, e.g., enhanced activity or
increased stability. In addition, they may be purified in higher
yields and show better solubility than the corresponding natural
polypeptide, at least under certain purification and storage
conditions.
[0267] Non-naturally occurring variants may be produced using
art-known mutagenesis techniques, which include, but are not
limited to oligonucleotide mediated mutagenesis, alanine scanning,
PCR mutagenesis, site directed mutagenesis (see e.g., Carter et
al., Nucl. Acids Res. 13:4331 (1986); and Zoller et al., Nucl.
Acids Res. 10:6487 (1982)), cassette mutagenesis (see e.g., Wells
et al., Gene 34:315 (1985)), restriction selection mutagenesis (see
e.g., Wells et al., Philos. Trans. R. Soc. London SerA 317:415
(1986)).
[0268] Thus, the invention also encompasses TR13 derivatives and
analogs that have one or more amino acid residues deleted, added,
or substituted to generate TR13 polypeptides that are better suited
for expression, scale up, etc., in the host cells chosen. For
example, cysteine residues can be deleted or substituted with
another amino acid residue in order to eliminate disulfide bridges;
N-linked glycosylation sites can be altered or eliminated to
achieve, for example, expression of a homogeneous product that is
more easily recovered and purified from yeast hosts which are known
to hyperglycosylate N-linked sites. To this end, a variety of amino
acid substitutions at one or both of the first or third amino acid
positions on anyone or more of the glycosylation recognitions
sequences in the TR13 polypeptides of the invention, and/or an
amino acid deletion at the second position of any one or more such
recognition sequences will prevent glycosylation of the TR13 at the
modified tripeptide sequence (see, e.g., Miyajimo et al., EMBO J.
5(6): 1193-1197). Additionally, one or more of the amino acid
residues of the polypeptides of the invention (e.g., arginine and
lysine residues) may be deleted or substituted with another residue
to eliminate undesired processing by proteases such as, for
example, furins or kexins.
[0269] The polypeptides of the present invention include a
polypeptide comprising, or alternatively, consisting of the
polypeptide encoded by the cDNA deposited as ATCC Deposit No.
PTA-349, including the leader; a polypeptide comprising, or
alternatively, consisting of the mature polypeptide encoded by the
deposited cDNA minus the leader (i.e., the mature protein); a
polypeptide comprising, or alternatively, consisting of amino acids
from about 1 to about 750 of SEQ ID NO:2; a polypeptide comprising,
or alternatively, consisting of amino acids from about 2 to about
750 of SEQ ID NO:2; a polypeptide comprising, or alternatively,
consisting of amino acids from about 1 to about 331 in SEQ ID NO:2;
a polypeptide comprising, or alternatively, consisting of any one
or more of the four cysteine rich domains disclosed in FIGS. 1A-D
(predicted to constitute amino acids from about 105 to about 170,
251 to about 265, about 331 to about 410, and about 580 to about
610 of SEQ ID NO:2); as well as polypeptides which are at least 80%
identical, more preferably at least 90% or 95% identical, still
more preferably at least 96%, 97%, 98%, or 99% identical to the
polypeptides described above (e.g., the polypeptide encoded by the
deposited cDNA clone, the polypeptide of FIGS. 1A-D (SEQ ID NO:2)
and polypeptide fragments thereof such as disclosed herein), and
also include portions of such polypeptides with at least 30 amino
acids and more preferably at least 50 amino acids. In this context
"about" includes the particularly recited ranges, larger or smaller
by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0270] The polypeptides of the present invention include a
polypeptide comprising, or alternatively, consisting of the
polypeptide encoded by the cDNA deposited as ATCC Deposit No.
PTA-507, including the leader; a polypeptide comprising, or
alternatively, consisting of the mature polypeptide encoded by the
deposited cDNA minus the leader (i.e., the mature protein); a
polypeptide comprising, or alternatively, consisting of amino acids
from about 1 to about 1001 of SEQ ID NO:40; a polypeptide
comprising, or alternatively, consisting of amino acids from about
2 to about 1001 of SEQ ID NO:40; a polypeptide comprising, or
alternatively, consisting of amino acids from about 1 to about 906
in SEQ ID NO:40; a polypeptide comprising, or alternatively,
consisting of amino acids from about 42 to about 1001 in SEQ ID
NO:40; a polypeptide comprising, or alternatively, consisting of
amino acids from about 42 to about 906 in SEQ ID NO:40; a
polypeptide comprising, or alternatively, consisting of amino acids
from about 907 to about 931 in SEQ ID NO:40; a polypeptide
comprising, or alternatively, consisting of amino acids from about
932 to about 1001 in SEQ ID NO:40; a polypeptide comprising, or
alternatively, consisting of any of the seven cysteine rich domains
disclosed in FIGS. 7A-E (predicted to constitute amino acids from
about 271 to about 421, 271 to about 286, about 290 to about 300,
about 301 to about 320, about 329 to about 361, about 404 to about
421, and about 585 to about 595 of SEQ ID NO:40); as well as
polypeptides which are at least 80% identical, more preferably at
least 90% or 95% identical, still more preferably at least 96%,
97%, 98%, or 99% identical to the polypeptides described above
(e.g., the polypeptide encoded by the deposited cDNA clone, the
polypeptide of FIGS. 7A-E (SEQ ID NO:40) and polypeptide fragments
thereof, such as those disclosed herein), and also include portions
of such polypeptides with at least 30 amino acids and more
preferably at least 50 amino acids. In this context "about"
includes the particularly recited ranges, larger or smaller by
several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0271] By a polypeptide (protein) comprising, or alternatively,
consisting of, an amino acid sequence at least, for example, 95%
"identical" to a reference amino acid sequence of a TR13
polypeptide is intended that the amino acid sequence of the
polypeptide is identical to the reference sequence except that the
polypeptide sequence may include up to five amino acid alterations
per each 100 amino acids of the reference amino acid of the TR13
polypeptide. In other words, to obtain a polypeptide having an
amino acid sequence at least 95% identical to a reference amino
acid sequence, up to 5% of the amino acid residues in the reference
sequence may be deleted or substituted with another amino acid, or
a number of amino acids up to 5% of the total amino acid residues
in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at
the amino or carboxy terminal positions of the reference amino acid
sequence or anywhere between those terminal positions, interspersed
either individually among residues in the reference sequence or in
one or more contiguous groups within the reference sequence.
[0272] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98%, or 99% identical to, for
instance, the amino acid sequence shown in SEQ ID NO:2 or SEQ ID
NO:40, or to the amino acid sequence encoded by the cDNA clone
deposited as ATCC Deposit No. PTA-349 or ATCC Deposit No. PTA-507,
can be determined conventionally using known computer programs such
the Bestfit program (Wisconsin Sequence Analysis Package, Version 8
for Unix, Genetics Computer Group, University Research Park, 575
Science Drive, Madison, Wis. 53711). When using Bestfit or any
other sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full-length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in
the reference sequence are allowed.
[0273] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB amino acid alignment are:
Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20,
Randomization Group Length=0, Cutoff Score=1, Window Size=sequence
length, Gap Penalty-5, Gap Size Penalty=0.05, Window Size=500 or
the length of the subject amino acid sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence due to N- or C-terminal deletions,
not because of internal deletions, a manual correction is made to
the results to take into consideration the fact that the FASTDB
program does not account for N- and C-terminal truncations of the
subject sequence when calculating global percent identity. For
subject sequences truncated at the N- and C-termini, relative to
the query sequence, the percent identity is corrected by
calculating the number of residues of the query sequence that are
N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. A determination of
whether a residue is matched/aligned is determined by results of
the FASTDB sequence alignment. This percentage is then subtracted
from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arrive at a final percent
identity score. This final percent identity score is what is used
for the purposes of this embodiment. Only residues to the N- and
C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query
residue positions outside the farthest N- and C-terminal residues
of the subject sequence. For example, a 90 amino acid residue
subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus
of the subject sequence and therefore, the FASTDB alignment does
not show a matching/alignment of the first 10 residues at the
N-terminus. The 10 unpaired residues represent 10% of the sequence
(number of residues at the N- and C-termini not matched/total
number of residues in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are made for the purposes of this
embodiment.
[0274] The present application is also directed to proteins
comprising, or alternatively consisting of, a polypeptide sequence
at least 90%, 95%, 96%, 97%, 98% or 99% identical to the TR13
polypeptide sequence set forth as n.sup.1-m.sup.1, and/or
n.sup.2-m.sup.1 for polypeptide sequence shown in FIG. 1A-D or FIG.
7A-E herein. In preferred embodiments, the application is directed
to proteins comprising, or alternatively consisting of, a
polypeptide sequence at least 90%, 95%, 96%, 97%, 98% or 99%
identical to polypeptides having the amino acid sequence of the
specific TR13 N- and C-terminal deletions recited herein.
Additional preferred embodiments are directed to fusion proteins
comprising these polypeptide sequences. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
[0275] In another aspect, the invention provides a peptide or
polypeptide comprising an epitope-bearing portion of a polypeptide
of the invention. The epitope of this polypeptide portion is an
immunogenic or antigenic epitope of a polypeptide described herein.
An "immunogenic epitope" is defined as a part of a protein that
elicits an antibody response when the whole protein is the
immunogen. On the other hand, a region of a protein molecule to
which an antibody can bind is defined as an "antigenic epitope."
The number of immunogenic epitopes of a protein generally is less
than the number of antigenic epitopes. See, for instance, Geysen et
al., Proc. Natl. Acad. Sci. USA 81:3998-4002 (1983).
[0276] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
J. G. Sutcliffe et al., "Antibodies That React With Predetermined
Sites on Proteins," Science 219:660-666 (1983). Peptides capable of
eliciting protein-reactive sera are frequently represented in the
primary sequence of a protein, can be characterized by a set of
simple chemical rules, and are confined neither to immunodominant
regions of intact proteins (i.e., immunogenic epitopes) nor to the
amino or carboxyl terminals.
[0277] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful, for example, to raise antibodies,
including monoclonal antibodies, that bind specifically to a
polypeptide of the invention. See, for instance, Wilson et al.,
Cell 37:767-778 (1984) at 777. Antigenic epitope-bearing peptides
and polypeptides of the invention preferably contain a sequence of
at least seven, more preferably at least 9, at least 20, at least
25, at least 30, at least 40, at least 50 and most preferably
between at least about 55 to about 100 amino acids contained within
the amino acid sequence of a polypeptide of the invention. In this
context "about" includes the particularly recited ranges, larger or
smaller by several (5, 4, 3, 2, or 1) amino acids, at either
extreme or at both extremes.
[0278] Non-limiting examples of predicted antigenic polypeptides
that can be used to generate TR13 receptor-specific antibodies
include: a polypeptide comprising, or alternatively consisting of,
amino acid residues from about 1 to about 170 in FIGS. 1A-D
(corresponding to about amino acid 1 to about 170 in SEQ ID NO:2);
a polypeptide comprising amino acid residues from about 210 to
about 318 in FIGS. 1A-D (corresponding to about amino acid 210 to
about 318 in SEQ ID NO:2); a polypeptide comprising amino acid
residues from about 343 to about 480 in FIGS. 1A-D (corresponding
to about amino acid 343 to about 480 in SEQ ID NO:2); a polypeptide
comprising amino acid residues from about 548 to about 592 in FIGS.
1A-D (corresponding to about amino acid 548 to about 592 in SEQ ID
NO:2); and a polypeptide comprising amino acid residues from about
632 to about 742 in FIGS. 1A-D (corresponding to about amino acid
632 to about 742 in SEQ ID NO:2). As indicated above, the inventors
have determined that the above polypeptide fragments are antigenic
regions of the TR13 receptor protein. In this context "about"
includes the particularly recited ranges, larger or smaller by
several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0279] Additional non-limiting examples of predicted antigenic
polypeptides that can be used to generate TR13 receptor-specific
antibodies include: a polypeptide comprising, or alternatively
consisting of, amino acid residues from about M1 to about A9, about
K12 to about L20, about N47 to about T55, about H58 to about S66,
about D63 to about S71, about P77 to about F85, about A90 to about
Q98, about F136 to about Q144, about S152 to about C160, about R159
to about A167, about A211 to about M219, about M235 to about V243,
about V266 to about V274, about W277 to about S285, about I290 to
about F298, about A310 to about V318, about E343 to about C351,
about I360 to about H368, about G391 to about I399, about F409 to
about T417, about S436 to about Y444, about C453 to about S461,
about I472 to about S480, about Y548 to about S556, about C557 to
about I565, about V567 to about V575, about T584 to about G592,
about R632 to about G640, about W680 to about Y688, about Q684 to
about K692, about T698 to about A706, about S726 to about S734, and
about S734 to about L742 of SEQ ID NO:2 (FIGS. 1A-D) correspond to
the highly antigenic regions of the TR13 protein, predicted using
the Jameson-Wolf antigenic index (See FIG. 3 and Table I). These
highly antigenic fragments correspond to the amino acid residues
illustrated in FIG. 1A-D and in SEQ ID NO:2. As indicated above,
the inventors have determined that the above polypeptide fragments
are antigenic regions of the TR13 receptor protein. In this context
"about" includes the particularly recited ranges, larger or smaller
by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0280] Non-limiting examples of predicted antigenic polypeptides
that can be used to generate TR13-specific antibodies include: a
polypeptide comprising, or alternatively consisting of, amino acid
residues from about 1 to about 262 in FIGS. 7A-E (corresponding to
about amino acid 1 to about 262 in SEQ ID NO:40); a polypeptide
comprising amino acid residues from about 264 to about 423 in FIGS.
7A-E (corresponding to about amino acid 264 to about 423 in SEQ ID
NO:40); a polypeptide comprising amino acid residues from about 437
to about 789 in FIGS. 7A-E (corresponding to about amino acid 437
to about 789 in SEQ ID NO:40); and a polypeptide comprising amino
acid residues from about 791 to about 1001 in FIGS. 7A-E
(corresponding to about amino acid 791 to about 1001 in SEQ ID
NO:40). As indicated above, the inventors have determined that the
above polypeptide fragments are antigenic regions of the TR13
receptor protein. In this context "about" includes the particularly
recited ranges, larger or smaller by several (5, 4, 3, 2, or 1)
amino acids, at either extreme or at both extremes. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0281] Additional non-limiting examples of predicted antigenic
polypeptides that can be used to generate TR13 receptor-specific
antibodies include: a polypeptide comprising, or alternatively
consisting of, amino acid residues from about M Ito about H9, about
V14 to about I22, about H47 to about H55, about C61 to about R69,
about L82 to about E90, about D102 to about P110, about K109 to
about S117, about F124 to about H132, about M141 to about E149,
about S146 to about C154, about S157 to about W165, about F168 to
about T176, about N182 to about N190, about Q207 to about A215,
about P213 to about M221, about M221 to about E229, about V233 to
about V241, about T253 to about V261, about T282 to about S290,
about N298 to about T306, about C308 to about Y316, about K315 to
about S323, about P328 to about F336, about A341 to about Q349,
about F387 to about Q395, about S403 to about C411, about T409 to
about P417, about F443 to about N451, about W451 to about Y459,
about A462 to about M470, about G478 to about M486, about A487 to
about A495, about V517 to about V525, about T527 to about Q535,
about I541 to about F549, about A561 to about V569, about E594 to
about C602, about I611 to about H619, about G643 to about I650,
about P686 to about K694, about C704 to about S712, about R722 to
about I730, about E727 to about T735, about P746 to about G754,
about D776 to about L784, about Y799 to about S807, about C808 to
about I816, about V818 to about V826, about T835 to about G843,
about R883 to about G891, about K932 to about K940, about Q935 to
about K943, about T949 to about A957, about S977 to about S985,
about S981 to about P989, and about N986 to about L994 of SEQ ID
NO:40 (FIGS. 7A-E) correspond to the highly antigenic regions of
the TR13 protein, predicted using the Jameson-Wolf antigenic index
(See FIG. 9 and Table III). These highly antigenic fragments
correspond to the amino acid residues illustrated in FIG. 7A-E and
in SEQ ID NO:40. As indicated above, the inventors have determined
that the above polypeptide fragments are antigenic regions of the
TR13 receptor protein. In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0282] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. R. A.
Houghten, "General Method for the Rapid Solid-phase Synthesis of
Large Numbers of Peptides: Specificity of Antigen-Antibody
Interaction at the Level of Individual Amino Acids," Proc. Natl.
Acad. Sci. USA 82:5131-5135 (1985). This "Simultaneous Multiple
Peptide Synthesis (SMPS)" process is further described in U.S. Pat.
No. 4,631,211 to Houghten et al. (1986).
[0283] As one of skill in the art will appreciate, TR13 receptor
polypeptides of the present invention and the epitope-bearing
fragments thereof, described herein (e.g., corresponding to a
portion of the extracellular domain, such as, for example, amino
acid residues 105 to about 170, about 251 to about 265, about 331
to about 410, and/or about 580 to about 610 of SEQ ID NO:2), can be
combined with heterologous polypeptide sequences, for example, the
polypeptides of the present invention may be fused with the
constant domain of immunoglobulins (IgA, IgE, IgG, IgM) or portions
thereof (CH1, CH2, CH3, and any combination thereof, including both
entire domains and portions thereof), resulting in chimeric
polypeptides. By way of another non-limiting example, polypeptides
and/or antibodies of the present invention (including fragments or
variants thereof) may be fused with albumin (including but not
limited to recombinant human serum albumin or fragments or variants
thereof (see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999,
EP Patent 0 413 622, and U.S. Pat. No. 5,766,883, issued Jun. 16,
1998, herein incorporated by reference in their entirety)). In a
preferred embodiment, polypeptides and/or antibodies of the present
invention (including fragments or variants thereof) are fused with
the mature form of human serum albumin (i.e., amino acids 1-585 of
human serum albumin as shown in FIGS. 1 and 2 of EP Patent 0 322
094) which is herein incorporated by reference in its entirety. In
another preferred embodiment, polypeptides and/or antibodies of the
present invention (including fragments or variants thereof) are
fused with polypeptide fragments comprising, or alternatively
consisting of, amino acid residues 1-z of human serum albumin,
where z is an integer from 369 to 419, as described in U.S. Pat.
No. 5,766,883 herein incorporated by reference in its entirety.
Polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) may be fused to either the N- or
C-terminal end of the heterologous protein (e.g., immunoglobulin Fc
polypeptide or human serum albumin polypeptide). Polynucleotides
encoding fusion proteins of the invention are also encompassed by
the invention.
[0284] Such fusion proteins as those described above may facilitate
purification and show an increased half-life in vivo. This has been
shown, e.g., for chimeric proteins consisting of the first two
domains of the human CD4-polypeptide and various domains of the
constant regions of the heavy or light chains of mammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84-86
(1988)). Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding
and neutralizing other molecules than the monomeric TR13 protein or
protein fragment alone (Fountoulakis et al., J. Biochem.
270:3958-3964 (1995)). In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
[0285] As one of skill in the art will appreciate, TR13 receptor
polypeptides of the present invention and the epitope-bearing
fragments thereof, described herein (e.g., corresponding to a
portion of the extracellular domain, such as, for example, amino
acid residues 1 to about 262, about 264 to about 423, about 437 to
about 789, about 271 to about 421, and/or about 585 to 599 of SEQ
ID NO:40), can be combined with heterologous polypeptide sequences,
for example, the polypeptides of the present invention may be fused
with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM) or
portions thereof (CH1, CH2, CH3, and any combination thereof,
including both entire domains and portions thereof), resulting in
chimeric polypeptides. By way of another non-limiting example,
polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) may be fused with albumin (including
but not limited to recombinant human serum albumin or fragments or
variants thereof (see, e.g., U.S. Pat. No. 5,876,969, issued Mar.
2, 1999, EP Patent 0 413 622, and U.S. Pat. No. 5,766,883, issued
Jun. 16, 1998, herein incorporated by reference in their
entirety)). In a preferred embodiment, polypeptides and/or
antibodies of the present invention (including fragments or
variants thereof) are fused with the mature form of human serum
albumin (i.e., amino acids 1-585 of human serum albumin as shown in
FIGS. 1 and 2 of EP Patent 0 322 094) which is herein incorporated
by reference in its entirety. In another preferred embodiment,
polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) are fused with polypeptide fragments
comprising, or alternatively consisting of, amino acid residues 1-z
of human serum albumin, where z is an integer from 369 to 419, as
described in U.S. Pat. No. 5,766,883 herein incorporated by
reference in its entirety. Polypeptides and/or antibodies of the
present invention (including fragments or variants thereof) may be
fused to either the N- or C-terminal end of the heterologous
protein (e.g., immunoglobulin Fc polypeptide or human serum albumin
polypeptide). Polynucleotides encoding fusion proteins of the
invention are also encompassed by the invention.
[0286] Such fusion proteins as those described above may facilitate
purification and show an increased half-life in vivo. This has been
shown, e.g., for chimeric proteins consisting of the first two
domains of the human CD4-polypeptide and various domains of the
constant regions of the heavy or light chains of mammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84-86
(1988)). Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding
and neutralizing other molecules than the monomeric TR13 protein or
protein fragment alone (Fountoulakis et al. J. Biochem.
270:3958-3964 (1995)). In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
[0287] Preferred TR13 Fc fusions of the present invention include,
but are not limited to constructs comprising, or alternatively
consisting of, amino acid residues 1 to 750, 10 to 750,20 to 750,
30 to 750,40 to 750, 1 to 740, 1 to 730, 1 to 720, 1 to 710, 10 to
740, 10 to 730, and/or 10 to 720 of SEQ ID NO:2. Polynucleotides
encoding these TR13 fusions are also encompassed by the
invention.
[0288] Additional preferred TR13 Fc fusions of the present
invention include, but are not limited to constructs comprising, or
alternatively consisting of, amino acid residues 1 to 906, 42 to
906, 271 to 421, 585 to 595, 1 to 1001, 10 to 1001, 20 to 1001, 30
to 1001, 42 to 1001, 42 to 906, 1 to 990, 1 to 980, 1 to 970, 1 to
960, 10 to 990, 10 to 980, and/or 10 to 970 of SEQ ID NO:2.
Polynucleotides encoding these TR13 fusions are also encompassed by
the invention.
[0289] The polypeptides of the present invention have uses which
include, but are not limited to, as sources for generating
antibodies that bind the polypeptides of the invention, and as
molecular weight markers on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0290] TR14 Polypeptides
[0291] The TR14 proteins (polypeptides) of the invention may be in
monomers or multimers (i.e., dimers, trimers, tetramers, and higher
multimers). Accordingly, the present invention relates to monomers
and multimers of the TR14 proteins (polypeptides) of the invention,
their preparation, and compositions (preferably, pharmaceutical
compositions) containing them. In specific embodiments, the
polypeptides of the invention are monomers, dimers, trimers or
tetramers. In additional embodiments, the multimers of the
invention arc at least dimers, at least trimers, or at least
tetramers.
[0292] Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term TR14 homomer, refers to a
multimer containing only TR14 proteins of the invention (including
TR14 fragments, variants, and fusion proteins, as described
herein). These homomers may contain TR14 proteins having identical
or different polypeptide sequences. In a specific embodiment, a
homomer of the invention is a multimer containing only TR14
proteins having an identical polypeptide sequence. In another
specific embodiment, a homomer of the invention is a multimer
containing TR14 proteins having different polypeptide sequences. In
specific embodiments, the multimer of the invention is a homodimer
(e.g., containing TR14 proteins having identical or different
polypeptide sequences) or a homotrimer (e.g., containing TR14
proteins having identical or different polypeptide sequences). In
additional embodiments, the homomeric multimer of the invention is
at least a homodimer, at least a homotrimer, or at least a
homotetramer.
[0293] As used herein, the term TR14 heteromer refers to a multimer
containing heterologous proteins (i.e., proteins containing only
polypeptide sequences that do not correspond to a polypeptide
sequences encoded by the TR14 gene) in addition to the TR14
proteins of the invention. In a specific embodiment, the multimer
of the invention is a heterodimer, a heterotrimer, or a
heterotetramer. In additional embodiments, the heteromeric multimer
of the invention is at least a heterodimer, at least a
heterotrimer, or at least a heterotetramer.
[0294] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked, by for example, liposome formation. Thus, in one
embodiment, multimers of the invention, such as, for example,
homodimers or homotrimers, are formed when proteins of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example,
heterotrimers or heterotetramers, are formed when proteins of the
invention contact antibodies to the polypeptides of the invention
(including antibodies to the heterologous polypeptide sequence in a
fusion protein of the invention) in solution. In other embodiments,
multimers of the invention are formed by covalent associations with
and/or between the TR14 proteins of the invention. Such covalent
associations may involve one or more amino acid residues contained
in the polypeptide sequence of the protein (e.g., the polypeptide
sequence recited preferably in SEQ ID NO:61 or, alternatively, in
SEQ ID NO:5 or the polypeptide encoded by the deposited cDNA
clone). In one instance, the covalent associations are
cross-linking between cysteine residues located within the
polypeptide sequences of the proteins which interact in the native
(i.e., naturally occurring) polypeptide. In another instance, the
covalent associations are the consequence of chemical or
recombinant manipulation. Alternatively, such covalent associations
may involve one or more amino acid residues contained in the
heterologous polypeptide sequence in a TR14 fusion protein. In one
example, covalent associations are between the heterologous
sequence contained in a fusion protein of the invention (see, e.g.,
U.S. Pat. No. 5,478,925). In a specific example, the covalent
associations are between the heterologous sequence contained in a
TR14-Fc fusion protein of the invention (as described herein). In
another specific example, covalent associations of fusion proteins
of the invention are between heterologous polypeptide sequences
from another TNF family ligand/receptor member that is capable of
forming covalently associated multimers, such as for example,
oseteoprotegerin (see, e.g., International Publication No. WO
98/49305, the contents of which are herein incorporated by
reference in its entirety). In another embodiment, two or more TR14
polypeptides of the invention are joined through synthetic linkers
(e.g., peptide, carbohydrate or soluble polymer linkers). Examples
include those peptide linkers described in U.S. Pat. No. 5,073,627
(hereby incorporated by reference). Proteins comprising multiple
TR14 polypeptides separated by peptide linkers may be produced
using conventional recombinant DNA technology.
[0295] Another method for preparing multimer TR14 polypeptides of
the invention involves use of TR14 polypeptides fused to a leucine
zipper or isoleucine polypeptide sequence. Leucine zipper domains
and isoleucine zipper domains are polypeptides that promote
multimerization of the proteins in which they are found. Leucine
zippers were originally identified in several DNA-binding proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been
found in a variety of different proteins. Among the known leucine
zippers are naturally occurring peptides and derivatives thereof
that dimerize or trimerize. Examples of leucine zipper domains
suitable for producing soluble multimeric TR14 proteins are those
described in PCT application WO 94/10308, hereby incorporated by
reference. Recombinant fusion proteins comprising a soluble TR14
polypeptide fused to a peptide that dimerizes or trimerizes in
solution are expressed in suitable host cells, and the resulting
soluble multimeric TR14 is recovered from the culture supernatant
using techniques known in the art.
[0296] Certain members of the TNF family of proteins are believed
to exist in trimeric form (Beutler and Huffel, Science 264:667,
1994; Banner et al., Cell 73:431, 1993). Thus, trimeric TR14 may
offer the advantage of enhanced biological activity. Preferred
leucine zipper moieties are those that preferentially form trimers.
One example is a leucine zipper derived from lung surfactant
protein D (SPD), as described in Hoppe et al. (FEBS Letters
344:191, (1994)) and in U.S. patent application Ser. No.
08/446,922, hereby incorporated by reference. Other peptides
derived from naturally occurring trimeric proteins may be employed
in preparing trimeric TR14.
[0297] In further preferred embodiments, TR14 polynucleotides of
the invention are fused to a polynucleotide encoding a "FLAG"
polypeptide. Thus, a TR14-FLAG fusion protein is encompassed by the
present invention. The FLAG antigenic polypeptide may be fused to a
TR14 polypeptide of the invention at either or both the amino or
the carboxy terminus. In preferred embodiments, a TR14-FLAG fusion
protein is expressed from a pFLAG-CMV-5a or a pFLAG-CMV-1
expression vector (available from Sigma, St. Louis, Mo., USA). See,
Andersson, S., et al., J. Biol. Chem. 264:8222-29 (1989); Thomsen,
D. R., et al., Proc. Natl. Acad. Sci. USA, 81:659-63 (1984); and
Kozak, M., Nature 308:241 (1984) (each of which is hereby
incorporated by reference). In further preferred embodiments, a
TR14-FLAG fusion protein is detectable by anti-FLAG monoclonal
antibodies (also available from Sigma).
[0298] In another example, proteins of the invention are associated
by interactions between Flag.RTM. polypeptide sequence contained in
Flag.RTM.-TR14 fusion proteins of the invention. In a further
embodiment, associated proteins of the invention are associated by
interactions between heterologous polypeptide sequence contained in
Flag.RTM.-TR14 fusion proteins of the invention and anti-Flag.RTM.
antibody.
[0299] The multimers of the invention may be generated using
chemical techniques known in the art. For example, proteins desired
to be contained in the multimers of the invention may be chemically
cross-linked using linker molecules and linker molecule length
optimization techniques known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the polypeptide sequence of the proteins desired to be
contained in the multimer (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
Further, proteins of the invention may be routinely modified by the
addition of cysteine or biotin to the C terminus or N-terminus of
the polypeptide sequence of the protein and techniques known in the
art may be applied to generate multimers containing one or more of
these modified proteins (see, e.g., U.S. Pat. No. 5,478,925, which
is herein incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the protein components desired to be contained in the
multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
[0300] Alternatively, multimers of the invention may be generated
using genetic engineering techniques known in the art. In one
embodiment, proteins contained in multimers of the invention are
produced recombinantly using fusion protein technology described
herein or otherwise known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). In a specific embodiment, polynucleotides coding for a
homodimer of the invention are generated by ligating a
polynucleotide sequence encoding a polypeptide of the invention to
a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the
polypeptide in the reverse orientation from the original C-terminus
to the N-terminus (lacking the leader sequence) (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, recombinant techniques
described herein or otherwise known in the art are applied to
generate recombinant polypeptides of the invention which contain a
transmembrane domain and which can be incorporated by membrane
reconstitution techniques into liposomes (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety).
[0301] The polypeptides (proteins) of the present invention are
preferably provided in an isolated form. By "isolated polypeptide"
is intended a polypeptide removed from its native environment.
Thus, a polypeptide produced and/or contained within a recombinant
host cell is considered isolated for purposes of the present
invention. Also intended as an "isolated polypeptide" are
polypeptides that have been purified, partially or substantially,
from a recombinant host cell. For example, a recombinantly produced
version of the TR14 polypeptide can be substantially purified by
the one-step method described in Smith and Johnson, Gene 67:31-40
(1988).
[0302] Accordingly, in one embodiment, the invention provides an
isolated TR14 polypeptide having the amino acid sequence encoded by
the cDNA deposited as ATCC Deposit No. PTA-348, or the amino acid
sequence shown preferably in SEQ ID NO:61 or, alternatively, in SEQ
ID NO:5, or a polypeptide comprising a portion of the above
polypeptides.
[0303] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and/or contained within a recombinant host
cell is considered isolated for purposes of the present invention.
Also intended as an "isolated polypeptide" are polypeptides that
have been purified, partially or substantially, from a recombinant
host cell. For example, a recombinantly produced version of the
TR14 polypeptide can be substantially purified by the one-step
method described in Smith and Johnson, Gene 67:31-40 (1988).
[0304] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of, an amino
acid sequence contained preferably in SEQ ID NO:61 or,
alternatively, in SEQ ID NO:5, encoded by the cDNA contained in the
clone deposited as ATCC Deposit No. PTA-348, or encoded by a
nucleic acid which hybridizes (e.g., under stringent hybridization
conditions) to the nucleotide sequence contained in the deposited
clone, or shown preferably in FIGS. 10A-H (SEQ ID NO:61) or,
alternatively, in FIGS. 4A-E (SEQ ID NO:4) or the complementary
strand thereto, or polynucleotide fragments thereof (e.g., as
disclosed herein). Protein fragments may be "free-standing," or
comprised within a larger polypeptide of which the fragment forms a
part or region, most preferably as a single continuous region.
Preferred representative examples of polypeptide fragments of the
invention, include, for example, fragments that comprise, or
alternatively consist of, from about amino acid residues: 1 to 50,
51 to 100, 101 to 150, 151 to 200, 201 to 231 of SEQ ID NO:61.
Alternative, less preferred representative examples of polypeptide
fragments of the invention, include, for example, fragments that
comprise, or alternatively consist of, from about amino acid
residues: 1 to 50, 51 to 100, 101 to 150, 151 to 200, 201 to 226 of
SEQ ID NO:5, and the corresponding amino acid residues of SEQ ID
NO:61 (as the sequence of amino acid residues T-78 to M-231 of SEQ
ID NO:61 is identical to the sequence of amino acid residues T-73
to M-226 of SEQ ID NO:5). Moreover, polypeptide fragments can be at
least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140,
150, 175 or 200 amino acids in length. In this context "about"
includes the particularly recited ranges, larger or smaller by
several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0305] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of amino acid
residues from about: 178 to about 180, 118 to about 121, 178 to
about 181, 193 to about 196, 9 to about 14, and/or 65 to about 85
of SEQ ID NO:2. In this context "about" includes the particularly
recited ranges, larger or smaller by several (5, 4, 3, 2, or 1)
amino acids, at either extreme or at both extremes. Polynucleotides
encoding the polypeptide fragments are also encompassed by the
invention.
[0306] In specific embodiments, polypeptide fragments of the
invention comprise, or alternatively consist of, amino acid
residues from about: I to about 138, 139 to about 155, and/or 156
to about 231 as depicted in SEQ ID NO:61; or, alternativley, about
1 to about 133, 134 to about 150, and/or 151 to about 226 as
depicted in SEQ ID NO:5. In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0307] In additional embodiments, the polypeptide fragments of the
invention comprise, or alternatively consist of, one or more TR14
domains. Preferred polypeptide fragments of the present invention
include a member selected from the group: (a) a polypeptide
comprising or alternatively, consisting of, the TR14 extracellular
domain (predicted to constitute preferably amino acid residues from
about 1 to about 138 in FIGS. 10A-H and SEQ ID NO:61, or,
alternatively, from about 1 to about 133 of SEQ ID NO:5 and FIGS.
4A-E, or from about 1 to about 133 of SEQ ID NO:5); (b) a
polypeptide comprising or alternatively, consisting of, the TR14
cysteine rich domain (predicted to constitute preferably amino
acids Cys-31 to Cys-104 of SEQ ID NO:61, or, alternatively, amino
acid residues from about 65 to about 88 of FIGS. 4A-E, or from
about 65 to about 85 in SEQ ID NO:5); (c) a polypeptide comprising
or alternatively, consisting of, the TR14 transmembrane domain
(predicted to constitute amino acid residues from about 139 to
about 155 of FIGS. 10A-H and SEQ ID NO:61 or from about 134 to
about 150 of FIGS. 4A-E and SEQ ID NO:5); (d) a polypeptide
comprising or alternatively, consisting of, the TR14 intracellular
domain (predicted to constitute amino acid residues from about 155
to about 231 of FIGS. 10A-H and SEQ ID NO:61 or amino acid residues
from about 151 to about 226 of FIGS. 4A-E and SEQ ID NO:5); (e) a
polypeptide comprising, or alternatively, consisting of, one, two,
three, four or more, epitope bearing portions of the TR14
polypeptide (predicted to constitute preferably Asp-2 to Asp-10,
Thr-17 to Asp-38, Pro-45 to Ser-52, Pro-88 to Arg-95, Thr-108 to
Glu-115, Thr-131 to Glu-136, Phe-166 to Gly-174, Ala-180 to
Ala-200, and Gln-224 to Met-231 of SEQ ID NO:61, or the
corresponding amino acid sequences in SEQ ID NO:5, as the sequence
of amino acid residues T-78 to M-231 of SEQ ID NO:61 is identical
to the sequence of amino acid residues T-73 to M-226 of SEQ ID
NO:5. Additional epitope bearing TR14 polypeptides comprise or,
alternatively, consist of amino acid residues from about 2 to about
24,42 to about 52, 80 to about 115, and 155 to about 226 of SEQ ID
NO:5 (or the corresponding amino acid sequences in SEQ ID NO:61, as
the sequence of amino acid residues T-78 to M-231 of SEQ ID NO:61
is identical to the sequence of amino acid residues T-73 to M-226
of SEQ ID NO:5); and (f) any combination of polypeptides (a)-(e).
In this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at
either extreme or at both extremes. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0308] As discussed above, it is believed that the extracellular
cysteine rich motifs of TR14 is important for interactions between
TR14 and its ligands. Accordingly, in a specific embodiment,
polypeptide fragments of the invention comprise, or alternatively
consist of amino acid residues 31 to 104 of SEQ ID NO:61 or 65 to
85 of SEQ ID NO:5. Polynucleotides encoding these polypeptides are
also encompassed by the invention.
[0309] Among the especially preferred fragments of the invention
are fragments characterized by structural or functional attributes
of TR14 (preferably SEQ ID NO:61 or, alternatively, SEQ ID NO:5).
Such fragments include amino acid residues that comprise
alpha-helix and alpha-helix forming regions ("alpha-regions"),
beta-sheet and beta-sheet-forming regions ("beta-regions"), turn
and turn-forming regions ("turn-regions"), coil and coil-forming
regions ("coil-regions"), hydrophilic regions, hydrophobic regions,
alpha amphipathic regions, beta amphipathic regions, surface
forming regions, and high antigenic index regions (i.e., containing
four or more contiguous amino acids having an antigenic index of
greater than or equal to 1.5, as identified using the default
parameters of the Jameson-Wolf program) of complete (i.e.,
full-length) TR14 (preferably SEQ ID NO:61 or, alternatively, SEQ
ID NO:5). Certain preferred regions are those set out in FIG. 6 and
Table II and include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence depicted preferably FIGS. 10A-H (SEQ ID NO:61) or,
alternatively, in FIGS. 4A-E (SEQ ID NO:5), such preferred regions
include; Garnier-Robson predicted alpha-regions, beta-regions,
turn-regions, and coil-regions; Chou-Fasman predicted
alpha-regions, beta-regions, and turn-regions; Kyte-Doolittle
predicted hydrophilic and Hopp-Woods predicted hydrophobic regions;
Eisenberg alpha and beta amphipathic regions; Emini surface-forming
regions; and Jameson-Wolf high antigenic index regions, as
predicted using the default parameters of these computer programs.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0310] As mentioned above, even if deletion of one or more amino
acids from the N-terminus of a protein results in modification of
loss of one or more biological functions of the protein, other
functional activities (e.g., biological activities, ability to
multimerize, ability to bind TR14 ligand) may still be retained.
For example, the ability of shortened TR14 muteins to induce and/or
bind to antibodies which recognize the complete or mature forms of
the polypeptides generally will be retained when less than the
majority of the residues of the complete or mature polypeptide are
removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete polypeptide retains such
immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art. It is not unlikely
that an TR14 mutein with a large number of deleted N-terminal amino
acid residues may retain some biological or immunogenic activities.
In fact, peptides composed of as few as six TR14 amino acid
residues may often evoke an immune response.
[0311] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the TR14 amino acid sequence shown depicted preferably
FIGS. 10A-H (SEQ ID NO:61) or, alternatively, in FIGS. 4A-E (SEQ ID
NO:5), up to the methionine residue at position number 231 of SEQ
ID NO:61 (or, number 226 of SEQ ID NO:5) and polynucleotides
encoding such polypeptides. In particular preferred embodiments for
TR14, the present invention provides polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues
n1-231 of FIGS. 10A-H, where n1 is an integer from 1 to 231
corresponding to the position of the amino acid residue in FIGS.
10A-H. In alternative embodiments, the present invention provides
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of residues n1-226 of FIGS. 4A-E, where n1 is an
integer from 1 to 226 corresponding to the position of the amino
acid residue in FIGS. 4A-E.
[0312] In specific embodiments, N-terminal deletions of the TR14
polypeptides of the invention can be described by the general
formula n.sup.2-231, where n.sup.2 is a number from 2 to 226,
corresponding to the position of amino acid identified in FIGS.
10A-H (SEQ ID NO:61). N-terminal deletions of the TR14 polypeptide
of the invention shown as SEQ ID NO:61 include polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues: D-2 to M-231; C-3 to M-231; Q-4 to M-231; E-5 to
M-231; N-6 to M-231; E-7 to M-231; Y-8 to M-231; W-9 to M-231; D-10
to M-231; Q-1 to M-231; W-12 to M-231; G-13 to M-231; R-14 to
M-231; C-15 to M-231; V-16 to M-231; T-17 to M-231; C-18 to M-231;
Q-19 to M-231; R-20 to M-231; C-21 to M-231; G-22 to M-231; P-23 to
M-231; G-24 to M-231; Q-25 to M-231; E-26 to M-231; L-27 to M-231;
S-28 to M-231; K-29 to M-231; D-30 to M-231; C-31 to M-231; G-32 to
M-231; Y-33 to M-231; G-34 to M-231; E-35 to M-231; G-36 to M-231;
G-37 to M-231; D-38 to M-231; A-39 to M-231; Y-40 to M-231; W-41 to
M-231; H-42 to M-231; S-43 to M-231; L-44 to M-231; P-45 to M-231;
S-46 to M-231; S-47 to M-231; Q-48 to M-231; Y-49 to M-231; K-50 to
M-231; S-51 to M-231; S-52 to M-231; W-53 to M-231; G-54 to M-231;
H-55 to M-231; H-56 to M-231; K-57 to M-231; C-58 to M-231; Q-59 to
M-231; S-60 to M-231; C-61 to M-231; I-62 to M-231; T-63 to M-231;
C-64 to M-231; A-65 to M-231; V-66 to M-231; I-67 to M-231; N-68 to
M-231; R-69 to M-231; V-70 to M-231; Q-71 to M-231; K-72 to M-231;
V-73 to M-231; N-74 to M-231; C-75 to M-231; T-76 to M-231; P-77 to
M-231; T-78 to M-231; S-79 to M-231; N-80 to M-231; A-81 to M-231;
V-82 to M-231; C-83 to M-231; G-84 to M-231; D-85 to M-231; C-86 to
M-231; L-87 to M-231; P-88 to M-231; R-89 to M-231; F-90 to M-231;
Y-91 to M-231; R-92 to M-231; K-93 to M-231; T-94 to M-231; R-95 to
M-231; I-96 to M-231; G-97 to M-231; G-98 to M-231; L-99 to M-231;
Q-100 to M-231; D-101 to M-231; Q-102 to M-231; E-103 to M-231;
C-104 to M-231; I-105 to M-231; P-106 to M-231; C-107 to M-231;
T-108 to M-231; K-109 to M-231; Q-110 to M-231; T-111 to M-231;
P-112 to M-231; T-113 to M-231; S-114 to M-231; E-115 to M-231;
V-116 to M-231; Q-117 to M-231; C-118 to M-231; A-119 to M-231;
F-120 to M-231; L-122 to M-231; S-123 to M-231; L-124 to M-231;
V-125 to M-231; E-126 to M-231; A-127 to M-231; D-128 to M-231;
A-129 to M-231; P-130 to M-231; T-131 to M-231; V-132 to M-231;
P-133 to M-231; P-134 to M-231; Q-135 to M-231; E-136 to M-231;
A-137 to M-231; T-138 to M-231; L-139 to M-231; V-140 to M-231;
A-141 to M-231; L-142 to M-231; V-143 to M-231; S-144 to M-231;
S-145 to M-231; L-146 to M-231; L-147 to M-231; V-148 to M-231;
V-149 to M-231; F-150 to M-231; T-151 to M-231; L-152 to M-231;
A-153 to M-231; F-154 to M-231; L-155 to M-231; G-156 to M-231;
L-157 to M-231; F-158 to M-231; F-159 to M-231; L-160 to M-231;
Y-161 to M-231; C-162 to M-231; K-163 to M-231; Q-164 to M-231;
F-165 to M-231; F-166 to M-231; N-167 to M-231; R-168 to M-231;
H-169 to M-231; C-170 to M-231; Q-171 to M-231; R-172 to M-231;
G-173 to M-231; G-174 to M-231; L-175 to M-231; L-176 to M-231;
Q-177 to M-231; F-178 to M-231; E-179 to M-231; A-180 to M-231;
D-181 to M-231; K-182 to M-231; T-183 to M-231; A-184 to M-231;
K-185 to M-231; E-186 to M-231; E-187 to M-231; S-188 to M-231;
L-189 to M-231; F-190 to M-231; P-191 to M-231; V-192 to M-231;
P-193 to M-231; P-194 to M-231; S-195 to M-231; K-196 to M-231;
E-197 to M-231; T-198 to M-231; S-199 to M-231; A-200 to M-231;
E-201 to M-231; S-202 to M-231; Q-203 to M-231; V-204 to M-231;
S-205 to M-231; W-206 to M-231; A-207 to M-231; P-208 to M-231;
G-209 to M-231; S-210 to M-231; L-211 to M-231; A-212 to M-231;
Q-213 to M-231; L-214 to M-231; F-215 to M-231; S-216 to M-231;
L-217 to M-231; D-218 to M-231; S-219 to M-231; V-220 to M-231;
P-221 to M-231; I-222 to M-231; P-223 to M-231; Q-224 to M-231;
Q-225 to M-231 and Q-226 to M-231 of SEQ ID NO:61.
[0313] In additional embodiments, N-terminal deletions of the TR14
polypeptides of the invention can be described by the general
formula n.sup.2-226, where n.sup.2 is a number from 2 to 221,
corresponding to the position of amino acid identified in FIGS.
4A-E (SEQ ID NO:5). N-terminal deletions of the TR14 polypeptide of
the invention shown as SEQ ID NO:5 include polypeptides comprising,
or alternatively consisting of, the amino acid sequence of
residues: S-2 to M-226; T-3 to M-226; G-4 to M-226; T-5 to M-226;
N-6 to M-226; G-7 to M-226; D-8 to M-226; G-9 to M-226; V-10 to
M-226; S-11 to M-226; P-12 to M-226; A-13 to M-226; N-14 to M-226;
G-15 to M-226; V-16 to M-226; V-17 to M-226; L-18 to M-226; D-19 to
M-226; R-20 to M-226; S-21 to M-226; Y-22 to M-226; P-23 to M-226;
R-24 to M-226; I-25 to M-226; V-26 to M-226; V-27 to M-226; M-28 to
M-226; E-29 to M-226; R-30 to M-226; V-31 to M-226; E-32 to M-226;
M-33 to M-226; P-34 to M-226; T-35 to M-226; A-36 to M-226; Q-37 to
M-226; P-38 to M-226; A-39 to M-226; L-40 to M-226; L-41 to M-226;
A-42 to M-226; V-43 to M-226; Q-44 to M-226; K-45 to M-226; Q-46 to
M-226; L-47 to M-226; G-48 to M-226; P-49 to M-226; P-50 to M-226;
Q-51 to M-226; M-52 to M-226; C-53 to M-226; R-54 to M-226; V-55 to
M-226; A-56 to M-226; C-57 to M-226; T-58 to M-226; C-59 to M-226;
A-60 to M-226; V-61 to M-226; I-62 to M-226; N-63 to M-226; R-64 to
M-226; V-65 to M-226; Q-66 to M-226; K-67 to M-226; V-68 to M-226;
N-69 to M-226; C-70 to M-226; T-71 to M-226; P-72 to M-226; T-73 to
M-226; S-74 to M-226; N-75 to M-226; A-76 to M-226; V-77 to M-226;
C-78 to M-226; G-79 to M-226; D-80 to M-226; C-81 to M-226; L-82 to
M-226; P-83 to M-226; R-84 to M-226; F-85 to M-226; Y-86 to M-226;
R-87 to M-226; K-88 to M-226; T-89 to M-226; R-90 to M-226; I-91 to
M-226; G-92 to M-226; G-93 to M-226; L-94 to M-226; Q-95 to M-226;
D-96 to M-226; Q-97 to M-226; E-98 to M-226; C-99 to M-226; I-100
to M-226; P-101 to M-226; C-102 to M-226; T-103 to M-226; K-104 to
M-226; Q-105 to M-226; T-106 to M-226; P-107 to M-226; T-108 to
M-226; S-109 to M-226; E-110 to M-226; V-111 to M-226; Q-112 to
M-226; C-113 to M-226; A-114 to M-226; F-115 to M-226; Q-116 to
M-226; L-117 to M-226; S-118 to M-226; L-119 to M-226; V-120 to
M-226; E-121 to M-226; A-122 to M-226; D-123 to M-226; A-124 to
M-226; P-125 to M-226; T-126 to M-226; V-127 to M-226; P-128 to
M-226; P-129 to M-226; Q-130 to M-226; E-131 to M-226; A-132 to
M-226; T-133 to M-226; L-134 to M-226; V-135 to M-226; A-136 to
M-226; L-137 to M-226; V-138 to M-226; S-139 to M-226; S-140 to
M-226; L-141 to M-226; L-142 to M-226; V-143 to M-226; V-144 to
M-226; F-145 to M-226; T-146 to M-226; L-147 to M-226; A-148 to
M-226; F-149 to M-226; L-150 to M-226; G-151 to M-226; L-152 to
M-226; F-153 to M-226; F-154 to M-226; L-155 to M-226; Y-156 to
M-226; C-157 to M-226; K-158 to M-226; Q-159 to M-226; F-160 to
M-226; F-161 to M-226; N-162 to M-226; R-163 to M-226; H-164 to
M-226; C-165 to M-226; Q-166 to M-226; R-167 to M-226; G-168 to
M-226; G-169 to M-226; L-170 to M-226; L-171 to M-226; Q-172 to
M-226; F-173 to M-226; E-174 to M-226; A-175 to M-226; D-176 to
M-226; K-177 to M-226; T-178 to M-226; A-179 to M-226; K-180 to
M-226; E-181 to M-226; E-182 to M-226; S-183 to M-226; L-184 to
M-226; F-185 to M-226; P-186 to M-226; V-187 to M-226; P-188 to
M-226; P-189 to M-226; S-190 to M-226; K-191 to M-226; E-192 to
M-226; T-193 to M-226; S-194 to M-226; A-195 to M-226; E-196 to
M-226; S-197 to M-226; Q-198 to M-226; V-199 to M-226; S-200 to
M-226; W-201 to M-226; A-202 to M-226; P-203 to M-226; G-204 to
M-226; S-205 to M-226; L-206 to M-226; A-207 to M-226; Q-208 to
M-226; L-209 to M-226; F-210 to M-226; S-211 to M-226; L-212 to
M-226; D-213 to M-226; S-214 to M-226; V-215 to M-226; P-216 to
M-226; I-217 to M-226; P-218 to M-226; Q-219 to M-226; Q-220 to
M-226; Q-221 to M-226; of SEQ ID NO:5. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
[0314] In another embodiment, N-terminal deletions of the
extracellular domain of the TR14 polypeptide can be described by
the general formula n.sup.2-133, where n.sup.2 is a number from 1
to 128, corresponding to the position of amino acids identified in
FIGS. 4A-E. N-terminal deletions of the extracellular domain of the
TR14 polypeptide of the invention shown as SEQ ID NO:7 include
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of residues: S-2 to T-133; T-3 to T-133; G-4 to
T-133; T-5 to T-133; N-6 to T-133; G-7 to T-133; D-8 to T-133; G-9
to T-133; V-10 to T-133; S-11 to T-133; P-12 to T-133; A-13 to
T-133; N-14 to T-133; G-15 to T-133; V-16 to T-133; V-17 to T-133;
L-18 to T-133; D-19 to T-133; R-20 to T-133; S-21 to T-133; Y-22 to
T-133; P-23 to T-133; R-24 to T-133; I-25 to T-133; V-26 to T-133;
V-27 to T-133; M-28 to T-133; E-29 to T-133; R-30 to T-133; V-31 to
T-133; E-32 to T-133; M-33 to T-133; P-34 to T-133; T-35 to T-133;
A-36 to T-133; Q-37 to T-133; P-38 to T-133; A-39 to T-133; L-40 to
T-133; L-41 to T-133; A-42 to T-133; V-43 to T-133; Q-44 to T-133;
K-45 to T-133; Q-46 to T-133; L-47 to T-133; G-48 to T-133; P-49 to
T-133; P-50 to T-133; Q-51 to T-133; M-52 to T-133; C-53 to T-133;
R-54 to T-133; V-55 to T-133; A-56 to T-133; C-57 to T-133; T-58 to
T-133; C-59 to T-133; A-60 to T-133; V-61 to T-133; I-62 to T-133;
N-63 to T-133; R-64 to T-133; V-65 to T-133; Q-66 to T-133; K-67 to
T-133; V-68 to T-133; N-69 to T-133; C-70 to T-133; T-71 to T-133;
P-72 to T-133; T-73 to T-133; S-74 to T-133; N-75 to T-133; A-76 to
T-133; V-77 to T-133; C-78 to T-133; G-79 to T-133; D-80 to T-133;
C-81 to T-133; L-82 to T-133; P-83 to T-133; R-84 to T-133; F-85 to
T-133; Y-86 to T-133; R-87 to T-133; K-88 to T-133; T-89 to T-133;
R-90 to T-133; I-91 to T-133; G-92 to T-133; G-93 to T-133; L-94 to
T-133; Q-95 to T-133; D-96 to T-133; Q-97 to T-133; E-98 to T-133;
C-99 to T-133; I-100 to T-133; P-101 to T-133; C-102 to T-133;
T-103 to T-133; K-104 to T-133; Q-105 to T-133; T-106 to T-133;
P-107 to T-133; T-108 to T-133; S-109 to T-133; E-10 to T-133;
V-111 to T-133; Q-112 to T-133; C-113 to T-133; A-114 to T-133;
F-115 to T-133; Q-116 to T-133; L-117 to T-133; S-118 to T-133;
L-119 to T-133; V-120 to T-133; E-121 to T-133; A-122 to T-133;
D-123 to T-133; A-124 to T-133; P-125 to T-133; T-126 to T-133;
V-127 to T-133; P-128 to T-133; of SEQ ID NO:7 (or the
corresponding amino acid sequences in SEQ ID NO:61, as the sequence
of amino acid residues T-78 to T-138 of SEQ ID NO:61 is identical
to the sequence of amino acid residues T-73 to T-133 of SEQ ID
NO:7). Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0315] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification or loss of one or more biological functions of the
protein, other functional activities (e.g., biological activities),
ability to multimerize, ability to bind TR14 ligand) may still be
retained. For example the ability of the shortened TR14 mutein to
induce and/or bind to antibodies which recognize the complete or
mature forms of the polypeptide generally will be retained when
less than the majority of the residues of the complete or mature
polypeptide are removed from the C-terminus. Whether a particular
polypeptide lacking C-terminal residues of a complete polypeptide
retains such immunologic activities can readily be determined by
routine methods described herein and otherwise known in the art. It
is not unlikely that an TR14 mutein with a large number of deleted
C-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six
TR14 amino acid residues may often evoke an immune response.
[0316] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the carboxy
terminus of the amino acid sequence of the TR14 polypeptide shown
in FIGS. 10A-H (SEQ ID NO:61), up to the glutamic acid residue at
position number 7, and polynucleotides encoding such polypeptides.
In particular, the present invention provides polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues 1-m.sup.1 of FIGS. 10A-H, where m.sup.1 is an integer
from 7 to 231 corresponding to the position of the amino acid
residue in FIGS. 10A-H (which is identical to the sequence shown as
SEQ ID NO:61).
[0317] Moreover, the invention provides polypeptides comprising, or
alternatively consisting of, the amino acid residues: M-1 to E-230;
M-1 to P-229; M-1 to G-228; M-1 to Q-227; M-1 to Q-226; M-1 to
Q-225; M-1 to Q-224; M-1 to P-223; M-1 to 1-222; M-1 to P-221; M-1
to V-220; M-1 to S-219; M-1 to D-218; M-1 to L-217; M-1 to S-216;
M-1 to F-215; M-1 to L-214; M-1 to Q-213; M-1 to A-212; M-1 to
L-211; M-1 to S-210; M-1 to G-209; M-1 to P-208; M-1 to A-207; M-1
to W-206; M-1 to S-205; M-1 to V-204; M-1 to Q-203; M-1 to S-202;
M-1 to E-201; M-1 to A-200; M-1 to S-199; M-1 to T-198; M-1 to
E-197; M-1 to K-196; M-1 to S-195; M-1 to P-194; M-1 to P-193; M-1
to V-192; M-1 to P-191; M-1 to F-190; M-1 to L-189; M-1 to S-188;
M-1 to E-187; M-1 to E-186; M-1 to K-185; M-1 to A-184; M-1 to
T-183; M-1 to K-182; M-1 to D-181; M-1 to A-180; M-1 to E-179; M-1
to F-178; M-1 to Q-177; M-1 to L-176; M-1 to L-175; M-1 to G-174;
M-1 to G-173; M-1 to R-172; M-1 to Q-171; M-1 to C-170; M-1 to
H-169; M-1 to R-168; M-1 to N-167; M-1 to F-166; M-1 to F-165; M-1
to Q-164; M-1 to K-163; M-1 to C-162; M-1 to Y-161; M-1 to L-160;
M-1 to F-159; M-1 to F-158; M-1 to L-157; M-1 to G-156; M-1 to
L-155; M-1 to F-154; M-1 to A-153; M-1 to L-152; M-1 to T-151; M-1
to F-150; M-1 to V-149; M-1 to V-148; M-1 to L-147; M-1 to L-146;
M-1 to S-145; M-1 to S-144; M-1 to V-143; M-1 to L-142; M-1 to
A-141; M-1 to V-140; M-1 to L-139; M-1 to T-138; M-1 to A-137; M-1
to E-136; M-1 to Q-135; M-1 to P-134; M-1 to P-133; M-1 to V-132;
M-1 to T-131; M-1 to P-130; M-1 to A-129; M-1 to D-128; M-1 to
A-127; M-1 to E-126; M-1 to V-125; M-1 to L-124; M-1 to S-123; M-1
to L-122; M-1 to Q-121; M-1 to F-120; M-1 to A-119; M-1 to C-118;
M-1 to Q-117; M-1 to V-116; M-1 to E-15; M-1 to S-114; M-1 to
T-113; M-1 to P-112; M-1 to T-111; M-1 to Q-110; M-1 to K-109; M-1
to T-108; M-1 to C-107; M-1 to P-106; M-1 to I-105; M-1 to C-104;
M-1 to E-103; M-1 to Q-102; M-1 to D-101; M-1 to Q-100; M-1 to
L-99; M-1 to G-98; M-1 to G-97; M-1 to 1-96; M-1 to R-95; M-1 to
T-94; M-1 to K-93; M-1 to R-92; M-1 to Y-91; M-1 to F-90; M-1 to
R-89; M-1 to P-88; M-1 to L-87; M-1 to C-86; M-1 to D-85; M-1 to
G-84; M-1 to C-83; M-1 to V-82; M-1 to A-81; M-1 to N-80; M-1 to
S-79; M-1 to T-78; M-1 to P-77; M-1 to T-76; M-1 to C-75; M-1 to
N-74; M-1 to V-73; M-1 to K-72; M-1 to Q-71; M-1 to V-70; M-1 to
R-69; M-1 to N-68; M-1 to 1-67; M-1 to V-66; M-1 to A-65; M-1 to
C-64; M-1 to T-63; M-1 to 1-62; M-1 to C-61; M-1 to S-60; M-1 to
Q-59; M-1 to C-58; M-1 to K-57; M-1 to H-56; M-1 to H-55; M-1 to
G-54; M-1 to W-53; M-1 to S-52; M-1 to S-51; M-1 to K-50; M-1 to
Y-49; M-1 to Q-48; M-1 to S-47; M-1 to S-46; M-1 to P-45; M-1 to
L-44; M-1 to S-43; M-1 to H-42; M-1 to W-41; M-1 to Y-40; M-1 to
A-39; M-1 to D-38; M-1 to G-37; M-1 to G-36; M-1 to E-35; M-1 to
G-34; M-1 to Y-33; M-1 to G-32; M-1 to C-31; M-1 to D-30; M-1 to
K-29; M-1 to S-28; M-1 to L-27; M-1 to E-26; M-1 to Q-25; M-1 to
G-24; M-1 to P-23; M-1 to G-22; M-1 to C-21; M-1 to R-20; M-1 to
Q-19; M-1 to C-18; M-1 to T-17; M-1 to V-16; M-1 to C-15; M-1 to
R-14; M-1 to G-13; M-1 to W-12; M-1 to Q-11; M-1 to D-10; M-1 to
W-9; M-1 to Y-8 and M-1 to E-7 of SEQ ID NO:61. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0318] Alternatively, the present invention further provides
polypeptides having one or more residues deleted from the carboxy
terminus of the amino acid sequence of the TR14 polypeptide shown
in FIGS. 4A-E (SEQ ID NO:5), up to the asparagine residue at
position number 6, and polynucleotides encoding such polypeptides.
In particular, the present invention provides polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues 1-m.sup.1 of FIGS. 4A-E, where m.sup.1 is an integer
from 6 to 226 corresponding to the position of the amino acid
residue in FIGS. 4A-E (which is identical to the sequence shown as
SEQ ID NO:5).
[0319] Moreover, the invention provides polypeptides comprising, or
alternatively consisting of, the amino acid residues: M-1 to E-225;
M-1 to P-224; M-1 to G-223; M-1 to Q-222; M-1 to Q-221; M-1 to
Q-220; M-1 to Q-219; M-1 to P-218; M-1 to 1-217; M-1 to P-216; M-1
to V-215; M-1 to S-214; M-1 to D-213; M-1 to L-212; M-1 to S-211;
M-1 to F-210; M-1 to L-209; M-1 to Q-208; M-1 to A-207; M-1 to
L-206; M-1 to S-205; M-1 to G-204; M-1 to P-203; M-1 to A-202; M-1
to W-201; M-1 to S-200; M-1 to V-199; M-1 to Q-198; M-1 to S-197;
M-1 to E-196; M-1 to A-195; M-1 to S-194; M-1 to T-193; M-1 to
E-192; M-1 to K-191; M-1 to S-190; M-1 to P-189; M-1 to P-188; M-1
to V-187; M-1 to P-186; M-1 to F-185; M-1 to L-184; M-1 to S-183;
M-1 to E-182; M-1 to E-181; M-1 to K-180; M-1 to A-179; M-1 to
T-178; M-1 to K-177; M-1 to D-176; M-1 to A-175; M-1 to E-174; M-1
to F-173; M-1 to Q-172; M-1 to L-171; M-1 to L-170; M-1 to G-169;
M-1 to G-168; M-1 to R-167; M-1 to Q-166; M-1 to C-165; M-1 to
H-164; M-1 to R-163; M-1 to N-162; M-1 to F-161; M-1 to F-160; M-1
to Q-159; M-1 to K-158; M-1 to C-157; M-1 to Y-156; M-1 to L-155;
M-1 to F-154; M-1 to F-153; M-1 to L-152; M-1 to G-151; M-1 to
L-150; M-1 to F-149; M-1 to A-148; M-1 to L-147; M-1 to T-146; M-1
to F-145; M-1 to V-144; M-1 to V-143; M-1 to L-142; M-1 to L-141;
M-1 to S-140; M-1 to S-139; M-1 to V-138; M-1 to L-137; M-1 to
A-136; M-1 to V-135; M-1 to L-134; M-1 to T-133; M-1 to A-132; M-1
to E-131; M-1 to Q-130; M-1 to P-129; M-1 to P-128; M-1 to V-127;
M-1 to T-126; M-1 to P-125; M-1 to A-124; M-1 to D-123; M-1 to
A-122; M-1 to E-121; M-1 to V-120; M-1 to L-119; M-1 to S-118; M-1
to L-117; M-1 to Q-116; M-1 to F-115; M-1 to A-114; M-1 to C-113;
M-1 to Q-112; M-1 to V-111; M-1 to E-110; M-1 to S-109; M-1 to
T-108; M-1 to P-107; M-1 to T-106; M-1 to Q-105; M-1 to K-104; M-1
to T-103; M-1 to C-102; M-1 to P-101; M-1 to 1-100; M-1 to C-99;
M-1 to E-98; M-1 to Q-97; M-1 to D-96; M-1 to Q-95; M-1 to L-94;
M-1 to G-93; M-1 to G-92; M-1 to 1-91; M-1 to R-90; M-1 to T-89;
M-1 to K-88; M-1 to R-87; M-1 to Y-86; M-1 to F-85; M-1 to R-84;
M-1 to P-83; M-1 to L-82; M-1 to C-81; M-1 to D-80; M-1 to G-79;
M-1 to C-78; M-1 to V-77; M-1 to A-76; M-1 to N-75; M-1 to S-74;
M-1 to T-73; M-1 to P-72; M-1 to T-71; M-1 to C-70; M-1 to N-69;
M-1 to V-68; M-1 to K-67; M-1 to Q-66; M-1 to V-65; M-1 to R-64;
M-1 to N-63; M-1 to 1-62; M-1 to V-61; M-1 to A-60; M-1 to C-59;
M-1 to T-58; M-1 to C-57; M-1 to A-56; M-1 to V-55; M-1 to R-54;
M-1 to C-53; M-1 to M-52; M-1 to Q-51; M-1 to P-50; M-1 to P-49;
M-1 to G-48; M-1 to L-47; M-1 to Q-46; M-1 to K-45; M-1 to Q-44;
M-1 to V-43; M-1 to A-42; M-1 to L-41; M-1 to L-40; M-1 to A-39;
M-1 to P-38; M-1 to Q-37; M-1 to A-36; M-1 to T-35; M-1 to P-34;
M-1 to M-33; M-1 to E-32; M-1 to V-31; M-1 to R-30; M-1 to E-29;
M-1 to M-28; M-1 to V-27; M-1 to V-26; M-1 to 1-25; M-1 to R-24;
M-1 to P-23; M-1 to Y-22; M-1 to S-21; M-1 to R-20; M-1 to D-19;
M-1 to L-18; M-1 to V-17; M-1 to V-16; M-1 to G-15; M-1 to N-14;
M-1 to A-13; M-1 to P-12; M-1 to S-11; M-1 to V-10; M-1 to G-9; M-1
to D-8; M-1 to G-7; M-1 to N-6; of SEQ ID NO:5. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0320] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification or loss of one or more biological functions of the
protein, other functional activities (e.g., biological activities),
ability to multimerize, ability to bind TR14 ligand) may still be
retained. For example the ability of the shortened TR14 mutein to
induce and/or bind to antibodies which recognize the complete or
mature forms of the polypeptide generally will be retained when
less than the majority of the residues of the complete or mature
polypeptide are removed from the C-terminus. Whether a particular
polypeptide lacking C-terminal residues of a complete polypeptide
retains such immunologic activities can readily be determined by
routine methods described herein and otherwise known in the art. It
is not unlikely that an TR14 mutein with a large number of deleted
C-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six
TR14 amino acid residues may often evoke an immune response.
[0321] The present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the amino
acid sequence of the TR14 polypeptide shown in FIGS. 4A-E (SEQ ID
NO:5) and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising,
or alternatively consisting of, the amino acid sequence of residues
133-m.sup.1 of FIGS. 4A-E, where m.sup.1 is an integer from 6 to
132 corresponding to the position of the amino acid residue in
FIGS. 4A-E (which is identical to the sequence shown as SEQ ID
NO:5).
[0322] Moreover, the invention provides TR14 polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues: M-1 to A-132; M-1 to E-131; M-1 to Q-130; M-1 to
P-129; M-1 to P-128; M-1 to V-127; M-1 to T-126; M-1 to P-125; M-1
to A-124; M-1 to D-123; M-1 to A-122; M-1 to E-121; M-1 to V-120;
M-1 to L-119; M-1 to S-118; M-1 to L-117; M-1 to Q-116; M-1 to
F-115; M-1 to A-114; M-1 to C-113; M-1 to Q-112; M-1 to V-111; M-1
to E-10; M-1 to S-109; M-1 to T-108; M-1 to P-107; M-1 to T-106;
M-1 to Q-105; M-1 to K-104; M-1 to T-103; M-1 to C-102; M-1 to
P-101; M-1 to 1-100; M-1 to C-99; M-1 to E-98; M-1 to Q-97; M-1 to
D-96; M-1 to Q-95; M-1 to L-94; M-1 to G-93; M-1 to G-92; M-1 to
1-91; M-1 to R-90; M-1 to T-89; M-1 to K-88; M-1 to R-87; M-1 to
Y-86; M-1 to F-85; M-1 to R-84; M-1 to P-83; M-1 to L-82; M-1 to
C-81; M-1 to D-80; M-1 to G-79; M-1 to C-78; M-1 to V-77; M-1 to
A-76; M-1 to N-75; M-1 to S-74; M-1 to T-73; M-1 to P-72; M-1 to
T-71; M-1 to C-70; M-1 to N-69; M-1 to V-68; M-1 to K-67; M-1 to
Q-66; M-1 to V-65; M-1 to R-64; M-1 to N-63; M-1 to 1-62; M-1 to
V-61; M-1 to A-60; M-1 to C-59; M-1 to T-58; M-1 to C-57; M-1 to
A-56; M-1 to V-55; M-1 to R-54; M-1 to C-53; M-1 to M-52; M-1 to
Q-51; M-1 to P-50; M-1 to P-49; M-1 to G-48; M-1 to L-47; M-1 to
Q-46; M-1 to K-45; M-1 to Q-44; M-1 to V-43; M-1 to A-42; M-1 to
L-41; M-1 to L-40; M-1 to A-39; M-1 to P-38; M-1 to Q-37; M-1 to
A-36; M-1 to T-35; M-1 to P-34; M-1 to M-33; M-1 to E-32; M-1 to
V-31; M-1 to R-30; M-1 to E-29; M-1 to M-28; M-1 to V-27; M-1 to
V-26; M-1 to 1-25; M-1 to R-24; M-1 to P-23; M-1 to Y-22; M-1 to
S-21; M-1 to R-20; M-1 to D-19; M-1 to L-18; M-1 to V-17; M-1 to
V-16; M-1 to G-15; M-1 to N-14; M-1 to A-13; M-1 to P-12; M-1 to
S-11; M-1 to V-10; M-1 to G-9; M-1 to D-8; M-1 to G-7; M-1 to N-6;
of SEQ ID NO:7. Polynucleotides encoding these polypeptides are
also encompassed by the invention.
[0323] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini,
which may be described generally as having residues
n.sup.1-m.sup.1, n.sup.2-m.sup.1, n.sup.1-m.sup.2 and/or
n.sup.2-m.sup.2, where n.sup.1, n.sup.2, m.sup.1, and m.sup.2 are
integers as described above. Thus, any of the above listed N- or
C-terminal deletions can be combined to produce an N- and
C-terminal deleted TR14 polypeptide.
[0324] It will be recognized in the art that some amino acid
sequences of TR14 polypeptides can be varied without significant
effect on the structure or function of the protein. If such
differences in sequence are contemplated, it should be remembered
that there will be critical areas on the protein which determine
activity. Thus, the invention further includes variations of the
TR14 polypeptide, which show substantial TR14 receptor activity or
which include regions of TR14 polypeptides, such as the polypeptide
portions discussed herein. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions. As
indicated above, guidance concerning which amino acid changes are
likely to be phenotypically silent can be found in J. U. Bowie et
al., Science 247:1306-1310 (1990).
[0325] Thus, the fragment, derivative, or analog of the polypeptide
encoded by the cDNA deposited as ATCC Deposit No. PTA-348 or shown,
preferably, in SEQ ID NO:61 or, alternatively, in SEQ ID NO:5, may
be (i) one in which at least one or more of the amino acid residues
are substituted with a conserved or non-conserved amino acid
residue (preferably a conserved amino acid residue(s), and more
preferably at least one but less than ten conserved amino acid
residues) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituent group, or (iii)
one in which the mature polypeptide is fused with another compound,
such as a compound to increase the half-life of the polypeptide
(for example, polyethylene glycol), or (iv) one in which the
additional amino acids are fused to the mature polypeptide, such as
an IgG Fc fusion region peptide or leader or secretory sequence or
a sequence which is employed for purification of the mature
polypeptide or a proprotein sequence. Such fragments, derivatives
and analogs are deemed to be within the scope of those skilled in
the art from the teachings herein.
[0326] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the TR14
polypeptide. The prevention of aggregation is highly desirable.
Aggregation of proteins not only results in a loss of activity but
can also be problematic when preparing pharmaceutical formulations,
because they can be immunogenic. (Pinckard et al., Clin Exp.
Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:838-845
(1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993)).
[0327] The replacement of amino acids can also change the
selectivity of binding to cell surface receptors. Ostade et al.,
Nature 361:266-268 (1993), describes certain mutations resulting in
selective binding of TNF to only one of the two known types of TNF
receptors. Thus, the TR14 receptor of the present invention may
include one or more amino acid substitutions, deletions, or
additions, either from natural mutations or human manipulation.
[0328] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table W).
[0329] In specific embodiments, the number of substitutions,
additions or deletions in the amino acid sequence of FIGS. 1A-H
(SEQ ID NO:61) and/or any of the polypeptide fragments described
herein (e.g., the cysteine-rich domain, the extracellular domain,
or intracellular domain) is 75, 70, 60, 50, 40, 35, 30, 25, 20, 15,
10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 30-20, 20-15, 20-10, 15-10, 10-1,
5-10, 1-5, 1-3 or 1-2.
[0330] In additional embodiments, the number of substitutions,
additions or deletions in the amino acid sequence of FIGS. 4A-E
(SEQ ID NO:5) and/or any of the polypeptide fragments described
herein (e.g., the cysteine-rich domain, the extracellular domain,
or intracellular domain) is 75,70,60,50,40, 35, 30, 25, 20, 15,
10,9,8,7,6,5,4, 3,2, 1 or 30-20,20-15,20-10, 15-10, 10-1, 5-10,
1-5, 1-3 or 1-2.
[0331] Amino acids in the TR14 polypeptides of the present
invention that are essential for function can be identified by
methods known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085(1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting
mutant molecules are then tested for biological activity such as
receptor binding or in vitro proliferative activity. Sites that are
critical for ligand-receptor binding can also be determined by
structural analysis such as crystallization, nuclear magnetic
resonance or photoaffinity labeling (Smith et al., J. Mol. Biol.
224:899-904 (1992) and de Vos et al. Science 255:306-312
(1992)).
[0332] To improve or alter the characteristics of TR14
polypeptides, protein engineering may be employed. Recombinant DNA
technology known to those skilled in the art can be used to create
novel mutant proteins or "muteins including single or multiple
amino acid substitutions, deletions, additions or fusion proteins.
Such modified polypeptides can show, e.g., enhanced activity or
increased stability. In addition, they may be purified in higher
yields and show better solubility than the corresponding natural
polypeptide, at least under certain purification and storage
conditions.
[0333] Non-naturally occurring variants may be produced using
art-known mutagenesis techniques, which include, but are not
limited to oligonucleotide mediated mutagenesis, alanine scanning,
PCR mutagenesis, site directed mutagenesis (see e.g., Carter et
al., Nucl. Acids Res. 13:4331 (1986); and Zoller et al., Nucl.
Acids Res. 10:6487 (1982)), cassette mutagenesis (see e.g., Wells
et al., Gene 34:315 (1985)), restriction selection mutagenesis (see
e.g., Wells et al., Philos. Trans. R. Soc. London SerA 317:415
(1986)).
[0334] Thus, the invention also encompasses TR14 derivatives and
analogs that have one or more amino acid residues deleted, added,
or substituted to generate TR14 polypeptides that are better suited
for expression, scale up, etc., in the host cells chosen. For
example, cysteine residues can be deleted or substituted with
another amino acid residue in order to eliminate disulfide bridges;
N-linked glycosylation sites can be altered or eliminated to
achieve, for example, expression of a homogeneous product that is
more easily recovered and purified from yeast hosts which are known
to hyperglycosylate N-linked sites. To this end, a variety of amino
acid substitutions at one or both of the first or third amino acid
positions on any one or more of the glycosylation recognitions
sequences in the TR14 polypeptides of the invention, and/or an
amino acid deletion at the second position of any one or more such
recognition sequences will prevent glycosylation of the TR14 at the
modified tripeptide sequence (see, e.g., Miyajimo et al., EMBO J
5(6):1193-1197). Additionally, one or more of the amino acid
residues of the polypeptides of the invention (e.g., arginine and
lysine residues) may be deleted or substituted with another residue
to eliminate undesired processing by proteases such as, for
example, furins or kexins.
[0335] The polypeptides of the present invention include a
polypeptide comprising, or alternatively, consisting of the
polypeptide encoded by the cDNA deposited as ATCC Deposit No.
PTA-348; a polypeptide comprising, or alternatively, consisting of
amino acids from 1 to about 231 of SEQ ID NO:61 or from 1 to about
226 of SEQ ID NO:5; a polypeptide comprising, or alternatively,
consisting of amino acids from about from 2 to about 231 of SEQ ID
NO:61 or 2 to about 226 of SEQ ID NO:5; a polypeptide comprising,
or alternatively, consisting of amino acids from 1 to about 138 of
SEQ ID NO:61 or from 1 to about 133 of SEQ ID NO:5; a polypeptide
comprising, or alternatively, consisting of the extracellular
domain of the polypeptide encoded by the cDNA deposited as ATCC
Deposit No. PTA-348; a polypeptide comprising, or alternatively,
consisting of the cysteine rich domain of the polypeptide encoded
by the cDNA deposited as ATCC Deposit No. PTA-348, or as shown in
amino acids about 31 to about 104 of SEQ ID NO:61, or shown in
amino acids from about 65 to about 85 of SEQ ID NO:5; a polypeptide
comprising, or alternatively, consisting of the transmembrane
domain of the polypeptide encoded by the cDNA deposited as ATCC
Deposit No. PTA-348 (predicted to constitute amino acids from about
139 to about 155 of SEQ ID NO:61 or from 134 to about 150 of SEQ ID
NO:5); a polypeptide comprising, or alternatively, consisting of
the intracellular domain (predicted to constitute amino acids from
about 155 to about 231 of SEQ ID NO:61 or from about 151 to about
226 of SEQ ID NO:5); a polypeptide comprising, or alternatively,
consisting of the extracellular and intracellular domains with all
or part of the transmembrane domain deleted; as well as
polypeptides which are at least 80% identical, more preferably at
least 90% or 95% identical, still more preferably at least 96%,
97%, 98%, or 99% identical to the polypeptides described above
(e.g., the polypeptide encoded by the cDNA in ATCC Deposit No.
PTA-348, the polypeptide of FIGS. 10A-H (SEQ ID NO:61); or the
polypeptide of FIGS. 4A-E (SEQ ID NO:5)) or polypeptide fragments
thereof, such as those disclosed herein), and also include portions
of such polypeptides with at least 30 amino acids and more
preferably at least 50 amino acids. In this context "about"
includes the particularly recited ranges, larger or smaller by
several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0336] By a polypeptide (protein) comprising, or alternatively
consisting of, an amino acid sequence at least, for example, 95%
"identical" to a reference amino acid sequence of a TR14
polypeptide is intended that the amino acid sequence of the
polypeptide is identical to the reference sequence except that the
polypeptide sequence may include up to five amino acid alterations
per each 100 amino acids of the reference amino acid of the TR14
polypeptide. In other words, to obtain a polypeptide having an
amino acid sequence at least 95% identical to a reference amino
acid sequence, up to 5% of the amino acid residues in the reference
sequence may be deleted or substituted with another amino acid, or
a number of amino acids up to 5% of the total amino acid residues
in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at
the amino or carboxy terminal positions of the reference amino acid
sequence or any where between those terminal positions,
interspersed either individually among residues in the reference
sequence or in one or more contiguous groups within the reference
sequence.
[0337] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98%, or 99% identical to, for
instance, the amino acid sequence shown in SEQ ID NO:5, or to the
amino acid sequence encoded by the cDNA deposited as ATCC Deposit
No. PTA-348, can be determined conventionally using known computer
programs such the Bestfit program (Wisconsin Sequence Analysis
Package, Version 8 for Unix, Genetics Computer Group, University
Research Park, 575 Science Drive, Madison, Wis. 53711). When using
Bestfit or any other sequence alignment program to determine
whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity
is calculated over the full-length of the reference amino acid
sequence and that gaps in homology of up to 5% of the total number
of amino acid residues in the reference sequence are allowed.
[0338] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB amino acid alignment are:
Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20,
Randomization Group Length=0, Cutoff Score=1, Window Size=sequence
length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or
the length of the subject amino acid sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence due to N- or C-terminal deletions,
not because of internal deletions, a manual correction is made to
the results to take into consideration the fact that the FASTDB
program does not account for N- and C-terminal truncations of the
subject sequence when calculating global percent identity. For
subject sequences truncated at the N- and C-termini, relative to
the query sequence, the percent identity is corrected by
calculating the number of residues of the query sequence that are
N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. A determination of
whether a residue is matched/aligned is determined by results of
the FASTDB sequence alignment. This percentage is then subtracted
from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arrive at a final percent
identity score. This final percent identity score is what is used
for the purposes of this embodiment. Only residues to the N- and
C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query
residue positions outside the farthest N- and C-terminal residues
of the subject sequence. For example, a 90 amino acid residue
subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus
of the subject sequence and therefore, the FASTDB alignment does
not show a matching/alignment of the first 10 residues at the
N-terminus. The 10 unpaired residues represent 10% of the sequence
(number of residues at the N- and C-termini not matched/total
number of residues in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are made for the purposes of this
embodiment.
[0339] The present application is also directed to proteins
cotaining polypeptides at least 90%, 95%, 96%, 97%, 98% or 99%
identical to the TR14 polypeptide sequence set forth as
n.sup.1-m.sup.1, n.sup.2-m.sup.1, n.sup.1-m.sup.2, and/or
n.sup.2-m.sup.2 described herein. In preferred embodiments, the
application is directed to proteins comprising, or alternatively
consisting of, polypeptide sequence at least 90%, 95%, 96%, 97%,
98% or 99% identical to polypeptides having the amino acid sequence
of the specific TR14 N- and C-terminal deletions recited herein.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0340] In certain preferred embodiments, TR14 proteins of the
invention comprise fusion proteins as described above wherein the
TR14 polypeptides are those described as n.sup.1-m.sup.1, and/or
n.sup.2-m.sup.1 herein. In preferred embodiments, the application
is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%,
98% or 99% identical to the nucleic acid sequences encoding
polypeptides having the amino acid sequence of the specific N- and
C-terminal deletions recited herein. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0341] In another aspect, the invention provides a TR14 polypeptide
comprising an epitope-bearing portion of a polypeptide of the
invention. The epitope of this polypeptide portion is an
immunogenic or antigenic epitope of a polypeptide described herein.
An "immunogenic epitope" is defined as a part of a protein that
elicits an antibody response when the whole protein is the
immunogen. On the other hand, a region of a protein molecule to
which an antibody can bind is defined as an "antigenic epitope."
The number of immunogenic epitopes of a protein generally is less
than the number of antigenic epitopes. See, for instance, Geysen et
al., Proc. Natl. Acad. Sc. USA 81:3998-4002 (1983).
[0342] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
J. G. Sutcliffe et al., "Antibodies That React With Predetermined
Sites on Proteins," Science 219:660-666 (1983). Peptides capable of
eliciting protein-reactive sera are frequently represented in the
primary sequence of a protein, can be characterized by a set of
simple chemical rules, and are confined neither to immunodominant
regions of intact proteins (i.e., immunogenic epitopes) nor to the
amino or carboxyl terminals.
[0343] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to a polypeptide of
the invention. See, for instance, Wilson et al., Cell 37:767-778
(1984) at 777. Antigenic epitope-bearing peptides and polypeptides
of the invention preferably contain a sequence of at least seven,
more preferably at least nine, at least 20, at least 25, at least
30, at least 40, at least 50 and most preferably between at least
about 55 to about 100 amino acids contained within the amino acid
sequence of a polypeptide of the invention. In this context "about"
includes the particularly recited ranges, larger or smaller by
several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes.
[0344] Non-limiting examples of predicted antigenic polypeptides
that can be used to generate TR14-specific antibodies include
polypeptides comprising about: Asp-2 to Asp-10, Thr-17 to Asp-38,
Pro-45 to Ser-52, Pro-88 to Arg-95, Thr-108 to Glu-115, Thr-131 to
Glu-136, Phe-166 to Gly-174, Ala-180 to Ala-200, and Gln-224 to
Met-231 of SEQ ID NO:61. Fragments and/or variants of these
polypeptides, such as, for example, fragments and/or variants as
described herein, are encompassed by the invention. Polynucleotides
encoding these polypeptides (including fragments and/or variants)
are also encompassed by the invention, as are antibodies that bind
these polypeptides.
[0345] Additional non-limiting examples of predicted antigenic
polypeptides that can be used to generate TR14-specific antibodies
include: a polypeptide comprising, or alternatively consisting of
amino acid residues from about 2 to about 24 in FIGS. 4A-E
(corresponding to about amino acid 2 to about 24 in SEQ ID NO:5); a
polypeptide comprising amino acid residues from about 42 to about
52 in FIGS. 4A-E (corresponding to about amino acid 42 to about 52
in SEQ ID NO:5); a polypeptide comprising amino acid residues from
about 80 to about 115 in FIGS. 4A-E (corresponding to about amino
acid 80 to about 115 in SEQ ID NO:5); and a polypeptide comprising
amino acid residues from about 155 to about 226 in FIGS. 4A-E
(corresponding to about amino acid 155 to about 226 in SEQ ID
NO:5), and the corresponding amino acid sequences of SEQ ID NO:61,
as the sequence of amino acid residues T-78 to M-231 of SEQ ID
NO:61 is identical to the sequence of amino acid residues T-73 to
M-226 of SEQ ID NO:5. As indicated above, the inventors have
determined that the above polypeptide fragments are antigenic
regions of the TR14 receptor protein. In this context "about"
includes the particularly recited ranges, larger or smaller by
several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0346] Additional non-limiting examples of predicted antigenic
polypeptides that can be used to generate TR14-specific antibodies
include: a polypeptide comprising, or alternatively consisting of,
amino acid residues from about T3 to about S11, from about V16 to
about R24, from about Q44 to about M52, from about F85 to about
G93, from about T103 to about V111, from about F161 to about G169,
from about V187 to about A195, from about P218 to about M226 of SEQ
ID NO:5 (FIGS. 4A-E, and the corresponding amino acid sequences of
SEQ ID NO:61, as the sequence of amino acid residues T-78 to M-231
of SEQ ID NO:61 is identical to the sequence of amino acid residues
T-73 to M-226 of SEQ ID NO:5) correspond to the highly antigenic
regions of the TR14 protein, predicted using the Jameson-Wolf
antigenic index (See FIG. 6 and Table II). These highly antigenic
fragments correspond to the amino acid residues illustrated in FIG.
4A-E and in SEQ ID NO:5. In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0347] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. R. A.
Houghten, "General Method for the Rapid Solid-phase Synthesis of
Large Numbers of Peptides: Specificity of Antigen-Antibody
Interaction at the Level of Individual Amino Acids," Proc. Natl.
Acad. Sci. USA 82:5131-5135 (1985). This "Simultaneous Multiple
Peptide Synthesis (SMPS)" process is further described in U.S. Pat.
No. 4,631,211 to Houghten et al. (1986).
[0348] As one of skill in the art will appreciate, TR14 receptor
polypeptides of the present invention and the epitope-bearing
fragments thereof, described herein (e.g., corresponding to a
portion of the extracellular domain, such as, for example, amino
acid residues 1 to about 149, from about 2 to about 24, from about
42 to about 52, from about 80 to about 115, and/or from about 155
to about 226 of SEQ ID NO:5), can be combined with heterologous
polypeptide sequences, for example, the polypeptides of the present
invention may be fused with the constant domain of immunoglobulins
(IgA, IgE, IgG, IgM) or portions thereof (CH1, CH2, CH3, and any
combination thereof, including both entire domains and portions
thereof), resulting in chimeric polypeptides. By way of another
non-limiting example, polypeptides and/or antibodies of the present
invention (including fragments or variants thereof) may be fused
with albumin (including but not limited to recombinant human serum
albumin or fragments or variants thereof (see, e.g., U.S. Pat. No.
5,876,969, issued Mar. 2, 1999, EP Patent 0 413 622, and U.S. Pat.
No. 5,766,883, issued Jun. 16, 1998, herein incorporated by
reference in their entirety)). In a preferred embodiment,
polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) are fused with the mature form of
human serum albumin (i.e., amino acids 1-585 of human serum albumin
as shown in FIGS. 1 and 2 of EP Patent 0 322 094) which is herein
incorporated by reference in its entirety. In another preferred
embodiment, polypeptides and/or antibodies of the present invention
(including fragments or variants thereof) are fused with
polypeptide fragments comprising, or alternatively consisting of,
amino acid residues 1-z of human serum albumin, where z is an
integer from 369 to 419, as described in U.S. Pat. No. 5,766,883
herein incorporated by reference in its entirety. Polypeptides
and/or antibodies of the present invention (including fragments or
variants thereof) may be fused to either the N- or C-terminal end
of the heterologous protein (e.g., immunoglobulin Fc polypeptide or
human serum albumin polypeptide). Polynucleotides encoding fusion
proteins of the invention are also encompassed by the
invention.
[0349] Such fusion proteins as those described above may facilitate
purification and show an increased half-life in vivo. This has been
shown, e.g., for chimeric proteins consisting of the first two
domains of the human CD4-polypeptide and various domains of the
constant regions of the heavy or light chains of mammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84-86
(1988)). Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding
and neutralizing other molecules than the monomeric TR14 protein or
protein fragment alone (Fountoulakis et al., J. Biochem.
270:3958-3964 (1995)). In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
[0350] Preferred TR14 Fc fusions of the present invention include,
but are not limited to constructs comprising, or alternatively
consisting of, amino acid residues: 1 to 138,50 to 138, 70 to 90, 1
to 231, 10 to 231, 20 to 231, 30 to 231, 40 to 231, 1 to 221, 1 to
211, 1 to 201, 1 to 191, 10 to 221, 10 to 201, and/or 10 to 191 of
SEQ ID NO:61. Polynucleotides encoding these TR14 fusions are also
encompassed by the invention.
[0351] Additonal TR14 Fc fusions of the present invention include,
but are not limited to constructs comprising, or alternatively
consisting of, aminoacid residues: 1 to 133, 50 to 133,65 to 85, 1
to 226, 10 to 226, 20 to 226, 30 to 226, 40 to 226, 1 to 216, 1 to
206, 1 to 196, 1 to 186, 10 to 216, 10 to 206, and/or 10 to 196 of
SEQ ID NO:5. Polynucleotides encoding these TR14 fusions are also
encompassed by the invention.
[0352] The polypeptides of the present invention have uses which
include, but are not limited to, as sources for generating
antibodies that bind the polypeptides of the invention, and as
molecular weight markers on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0353] Diagnostic Assays
[0354] The compounds of the present invention are useful for
diagnosis or treatment of various immune system-related disorders
in mammals, preferably humans. Such disorders include but are not
limited to tumors (e.g., T cell, B cell and monocytic cell
leukemias and lymphomas) and tumor metastasis, infections by
bacteria, viruses and other parasites, immunodeficiencies,
inflammatory diseases, lymphadenopathy, autoimmune diseases, and
graft versus host disease.
[0355] TR13 and TR14 are expressed in immune cells and tissue. For
a number of immune system-related disorders, substantially altered
(increased or decreased) levels TR13 and/or TR14 gene expression
can be detected in immune system tissue or other cells or bodily
fluids (e.g., sera, plasma, urine, synovial fluid or spinal fluid)
taken from an individual having such a disorder, relative to a
"standard" TR13 and/or TR14 gene expression level, that is, the
TR13 and/or TR14 expression level in immune system tissues or
bodily fluids from an individual not having the immune system
disorder. Thus, the invention provides a diagnostic method useful
during diagnosis of an immune system disorder, which involves
measuring the expression level of the gene encoding the TR13 and/or
TR14 polypeptide in immune system tissue or other cells or body
fluid from an individual and comparing the measured gene expression
level with a standard TR13 and/or TR14 gene expression level,
respectively, whereby an increase or decrease in the gene
expression level compared to the standard is indicative of an
immune system disorder or normal activation, proliferation,
differentiation, and/or death.
[0356] In particular, it is believed that certain tissues in
mammals with cancer (such as, for example, cancer of cells or
tissue of the immune, gastrointestinal and or reproductive systems)
express significantly enhanced or reduced levels of normal or
altered TR13 and/or TR14 polypeptide and mRNA encoding the TR13
and/or TR14 polypeptide when compared to a corresponding "standard"
level. Further, it is believed that enhanced or depressed levels of
the TR13 and/or TR14 polypeptide can be detected in certain body
fluids (e.g., sera, plasma, urine, and spinal fluid) or cells or
tissue from mammals with such a cancer when compared to sera from
mammals of the same species not having the cancer.
[0357] For example, polynucleotides of the invention (e.g.,
polynucleotide sequences complementary to all or a portion of TR13
and/or TR14 mRNA) and antibodies (and antibody fragments) directed
against the polypeptides of the invention may be used to quantitate
or qualitate concentrations of cells of T cell lineage and/or B
cell lineage (e.g., B cell leukemia cells) expressing TR13 and/or
TR14 on their cell surfaces. These antibodies additionally have
diagnostic applications in detecting abnormalities in the level of
TR13 and/or TR14 gene expression, or abnormalities in the structure
and/or temporal, tissue, cellular, or subcellular location of TR13
and/or TR14. These diagnostic assays may be performed in vivo or in
vitro, such as, for example, on blood samples, biopsy tissue or
autopsy tissue.
[0358] For example, as disclosed herein, TR13 or TR14 is expressed
in T cells. Accordingly, polynucleotides of the invention (e.g.,
polynucleotide sequences complementary to all or a portion of TR13
or TR14 mRNA) and antibodies (and antibody fragments) directed
against the polypeptides of the invention may be used to quantitate
or qualitate concentrations of cells of T cell lineage (e.g., T
cell leukemia cells) expressing TR13 or TR14 on their cell
surfaces. These polypeptides and antibodies additionally have
diagnostic applications in detecting abnormalities in the level of
TR13 or TR14 gene expression, or abnormalities in the structure
and/or temporal, tissue, cellular, or subcellular location of TR13
or TR14. These diagnostic assays may be performed in vivo or in
vitro, such as, for example, on blood samples, biopsy tissue or
autopsy tissue.
[0359] Thus, the invention provides a diagnostic method useful
during diagnosis of a immune system disorder (including cancers of
this system) and/or cell proliferation disorder (e.g., cancer, such
as a cancer disclosed herein) which involves measuring the
expression level of the gene encoding the TR13 and/or TR14
polypeptide in immune system tissue or other cells or body fluid
from an individual and comparing the measured gene expression level
with a standard TR13 and/or TR14 gene expression level, whereby an
increase or decrease in the gene expression level compared to the
standard is indicative of an immune system disorder and/or cell
proliferation disorder.
[0360] Where a diagnosis of a disorder in the immune system
(including diagnosis of a tumor) and/or diagnosis of a cell
proliferation disorder has already been made according to
conventional methods, the present invention is useful as a
prognostic indicator, whereby patients exhibiting enhanced or
depressed TR13 and/or TR14 gene expression will experience a worse
clinical outcome relative to patients expressing the gene at a
level nearer the standard level.
[0361] By "assaying the expression level of the gene encoding the
TR13 and/or TR14 polypeptide" is intended qualitatively or
quantitatively measuring or estimating the level of the TR13 and/or
TR14 polypeptide or the level of the mRNA encoding the TR13 and/or
TR14 polypeptide in a first biological sample either directly
(e.g., by determining or estimating absolute protein level or mRNA
level) or relatively (e.g., by comparing to the TR13 and/or TR14
polypeptide level or mRNA level in a second biological sample).
Preferably, the TR13 and/or TR14 polypeptide level or mRNA level in
the first biological sample is measured or estimated and compared
to a standard TR13 and/or TR14 polypeptide level or mRNA level, the
standard being taken from a second biological sample obtained from
an individual not having the disorder or being determined by
averaging levels from a population of individuals not having a
disorder of the immune system. As will be appreciated in the art,
once a standard TR13 and/or TR14 polypeptide level or mRNA level is
known, it can be used repeatedly as a standard for comparison.
[0362] By "biological sample" is intended any biological sample
obtained from an individual, cell line, tissue culture, or other
source containing TR13 and/or TR14 receptor protein (including
portions thereof) or mRNA. As indicated, biological samples include
body fluids (such as sera, plasma, urine, synovial fluid and spinal
fluid) which contain free extracellular domains of the TR13 and/or
TR14 polypeptide, immune system tissue, and other tissue sources
found to express complete or free extracellular domain of the TR13
and/or TR14 receptor. Methods for obtaining tissue biopsies and
body fluids from mammals are well known in the art. Where the
biological sample is to include mRNA, a tissue biopsy is the
preferred source.
[0363] Total cellular RNA can be isolated from a biological sample
using any suitable technique such as, for example, the single-step
guanidinium-thiocyanate-phenol-chloroform method described in
Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels
of mRNA encoding the TR13 and/or TR14 polypeptide are then assayed
using any appropriate method. These include Northern blot analysis,
S1 nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in combination with the ligase
chain reaction (RT-LCR).
[0364] The present invention also relates to diagnostic assays such
as quantitative and diagnostic assays for detecting levels of TR13
polypeptide, or the soluble form thereof, in cells and tissues,
including determination of normal and abnormal levels. Thus, for
instance, a diagnostic assay in accordance with the invention for
detecting over-expression of TR13, or soluble form thereof,
compared to normal control tissue samples may be used to detect the
presence of tumors, for example. Assay techniques that can be used
to determine levels of a protein, such as a TR13 polypeptide of the
present invention, or a soluble form thereof, in a biological
sample derived from a host are well-known to those of skill in the
art. Such assay methods include radioimmunoassays,
competitive-binding assays, Western Blot analysis and ELISA assays.
Preferred for assaying TR13 polypeptide levels in a biological
sample are antibody-based techniques. For example, TR13 polypeptide
expression in tissues can be studied with classical
immunohistological methods. (M. Jalkanen et al., J. Cell. Biol.
101:976-985 (1985); M. Jalkanen et al., J. Cell. Biol.
105:3087-3096 (1987)). Other antibody-based methods useful for
detecting TR13 gene expression include immunoassays, such as the
enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay
(RIA).
[0365] The present invention also relates to diagnostic assays such
as quantitative and diagnostic assays for detecting levels of TR14
polypeptide, or the soluble form thereof, in cells and tissues,
including determination of normal and abnormal levels. Thus, for
instance, a diagnostic assay in accordance with the invention for
detecting over-expression of TR14, or soluble form thereof,
compared to normal control tissue samples may be used to detect the
presence of tumors, for example. Assay techniques that can be used
to determine levels of a protein, such as a TR14 polypeptide of the
present invention, or a soluble form thereof, in a biological
sample derived from a host are well-known to those of skill in the
art. Such assay methods include radioimmunoassays,
competitive-binding assays, Western Blot analysis and ELISA assays.
Preferred for assaying TR14 polypeptide levels in a biological
sample are antibody-based techniques. For example, TR14 polypeptide
expression in tissues can be studied with classical
immunohistological methods. (M. Jalkanen et al., J. Cell. Biol.
101:976-985 (1985); M. Jalkanen et al., J. Cell. Biol.
105:3087-3096 (1987)). Other antibody-based methods useful for
detecting TR14 gene expression include immunoassays, such as the
enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay
(RIA).
[0366] Suitable antibody assay labels are known in the art and
include enzyme labels, such as glucose oxidase, and radioisotopes,
such as iodine (.sup.131I, .sup.125I, .sup.123I, .sup.121I), carbon
(.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.115In, .sup.113In, .sup.112In, .sup.111In), and technetium
(.sup.99Tc, .sup.99mTc), thallium (.sup.201Ti), gallium (.sup.68Ga,
.sup.67Ga), palladium (.sup.103Pd), molybdenum (.sup.99Mo), xenon
(.sup.133Xe), fluorine (.sup.18F), .sup.153Sm, .sup.177Lu,
.sup.159Gd, .sup.149 Pm, .sup.140La, .sup.175Yb, .sup.166Ho,
.sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re, .sup.142Pr,
.sup.105Rh, .sup.97Ru; luminescent labels, such as luminol; and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0367] The tissue or cell type to be analyzed will generally
include those which are known, or suspected, to express the TR13
and/or TR14 gene (such as, for example, cells of T cell lineage) or
cells or tissue which are known, or suspected, to express the TR13
ligand and/or TR14 ligand gene (such as, for example, cells of
monocytic lineage and the spleen). The protein isolation methods
employed herein may, for example, be such as those described in
Harlow and Lane (Harlow, E. and Lane, D., 1988, "Antibodies: A
Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.), which is incorporated herein by reference in
its entirety. The isolated cells can be derived from cell culture
or from a patient. The analysis of cells taken from culture may be
a necessary step in the assessment of cells that could be used as
part of a cell-based gene therapy technique or, alternatively, to
test the effect of compounds on the expression of the TR13 and/or
TR14 gene or TR13 ligand and/or TR14 ligand gene.
[0368] For example, antibodies, or fragments of antibodies, such as
those described herein, may be used to quantitatively or
qualitatively detect the presence of TR13 and/or TR14 gene products
or conserved variants or peptide fragments thereof. This can be
accomplished, for example, by immunofluorescence techniques
employing a fluorescently labeled antibody coupled with light
microscopic, flow cytometric, or fluorimetric detection.
[0369] The antibodies (or fragments thereof) or TR13 and/or TR14
polypeptides or TR13 ligand and/or TR14 ligand polypeptides of the
present invention may, additionally, be employed histologically, as
in immunofluorescence, immunoelectron microscopy or
non-immunological assays, for in situ detection of TR13 and/or TR14
gene products or conserved variants or polypeptide fragments
thereof, or for TR13 and/or TR14 binding to TR13 and/or TR14
ligand, respectively. In situ detection may be accomplished by
removing a histological specimen from a patient, and applying
thereto a labeled antibody, TR13 polypeptide, or TR14 polypeptide
of the present invention. The antibody (or fragment) or TR13 and/or
TR14 polypeptide is preferably applied by overlaying the labeled
antibody (or fragment) onto a biological sample. Through the use of
such a procedure, it is possible to determine not only the presence
of the TR13 and/or TR14 gene product, or conserved variants or
peptide fragments, or TR13 and/or TR14 polypeptide binding, but
also its distribution in the examined tissue. Using the present
invention, those of ordinary skill will readily perceive that any
of a wide variety of histological methods (such as staining
procedures) can be modified in order to achieve such in situ
detection.
[0370] Immunoassays and non-immunoassays for TR13 and/or TR14 gene
products or conserved variants or peptide fragments thereof will
typically comprise incubating a sample, such as a biological fluid,
a tissue extract, freshly harvested cells, or lysates of cells
which have been incubated in cell culture, in the presence of a
detectably labeled antibody capable of TR13 and/or TR14 gene
products or conserved variants or peptide fragments thereof, and
detecting the bound antibody by any of a number of techniques
well-known in the art.
[0371] Immunoassays and non-immunoassays for TR13 ligand and/or
TR14 ligand gene products or conserved variants or peptide
fragments thereof will typically comprise incubating a sample, such
as a biological fluid, a tissue extract, freshly harvested cells,
or lysates of cells which have been incubated in cell culture, in
the presence of a detectable or labeled TR13 and/or TR14
polypeptide capable of identifying TR13 ligand and/or TR14 ligand
gene products or conserved variants or polypeptide fragments
thereof, and detecting the bound TR13 and/or TR14 polypeptide by
any of a number of techniques well-known in the art.
[0372] The biological sample may be brought in contact with and
immobilized onto a solid phase support or carrier such as
nitrocellulose, or other solid support which is capable of
immobilizing cells, cell particles or soluble proteins. The support
may then be washed with suitable buffers followed by treatment with
the detectably labeled anti-TR13 and/or TR14 antibody or detectable
TR13 and/or TR14 polypeptide. The solid phase support may then be
washed with the buffer a second time to remove unbound antibody or
polypeptide. Optionally the antibody is subsequently labeled. The
amount of bound label on solid support may then be detected by
conventional means.
[0373] By "solid phase support or carrier" is intended any support
capable of binding an antigen or an antibody. Well-known supports
or carriers include glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified
celluloses, polyacrylamides, gabbros, and magnetite. The nature of
the carrier can be either soluble to some extent or insoluble for
the purposes of the present invention. The support material may
have virtually any possible structural configuration so long as the
coupled molecule is capable of binding to an antigen or antibody.
Thus, the support configuration may be spherical, as in a bead, or
cylindrical, as in the inside surface of a test tube, or the
external surface of a rod. Alternatively, the surface may be flat
such as a sheet, test strip, etc. Preferred supports include
polystyrene beads. Those skilled in the art will know many other
suitable carriers for binding antibody or antigen, or will be able
to ascertain the same by use of routine experimentation.
[0374] Assaying TR13 or TR14 protein levels in a biological sample
can occur using any art-known method.
[0375] The binding activity of a given lot of anti-TR13 and/or
anti-TR14 antibody or TR13 and/or TR14 polypeptide may be
determined according to well known methods. Those skilled in the
art will be able to determine operative and optimal assay
conditions for each determination by employing routine
experimentation.
[0376] In addition to assaying TR13 and/or TR14 polypeptide levels
or polynucleotide levels in a biological sample obtained from an
individual, TR13 and/or TR14 polypeptide or polynucleotide can also
be detected in vivo by imaging. For example, in one embodiment of
the invention, TR13 and/or TR14 polypeptide is used to image
monocytic leukemias or lymphomas. In another embodiment, TR13
and/or TR14 polynucleotides of the invention (e.g., polynucleotides
complementary to all or a portion of TR13 and/or TR14 mRNA) is used
to image T cell leukemias or lymphomas.
[0377] Antibody labels or markers for in vivo imaging of TR13
and/or TR14 polypeptide include those detectable by X-radiography,
NMR, MRI, CAT-scans or ESR. For X-radiography, suitable labels
include radioisotopes such as barium or cesium, which emit
detectable radiation but are not overtly harmful to the subject.
Suitable markers for NMR and ESR include those with a detectable
characteristic spin, such as deuterium, which may be incorporated
into the antibody by labeling of nutrients for the relevant
hybridoma. Where in vivo imaging is used to detect enhanced levels
of TR13 and/or TR14 polypeptide for diagnosis in humans, it may be
preferable to use human antibodies or "humanized" chimeric
monoclonal antibodies. Such antibodies can be produced using
techniques described herein or otherwise known in the art. For
example methods for producing chimeric antibodies are known in the
art. See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).
[0378] Additionally, any TR13 and/or TR14 polypeptide whose
presence can be detected, can be administered. For example, TR13
and/or TR14 polypeptides labeled with a radio-opaque or other
appropriate compound can be administered and visualized in vivo, as
discussed, above for labeled antibodies. Further such TR13 and/or
TR14 polypeptides can be utilized for in vitro diagnostic
procedures.
[0379] A TR13 and/or TR14 polypeptide-specific antibody or antibody
fragment which has been labeled with an appropriate detectable
imaging moiety, such as a radioisotope (for example, 131I,
.sup.112In, .sup.99mTc), a radio-opaque substance, or a material
detectable by nuclear magnetic resonance, is introduced (for
example, parenterally, subcutaneously or intraperitoneally) into
the mammal to be examined for an immune system disorder and/or cell
proliferation disorder. It will be understood in the art that the
size of the subject and the imaging system used will determine the
quantity of imaging moiety needed to produce diagnostic images. In
the case of a radioisotope moiety, for a human subject, the
quantity of radioactivity injected will normally range from about 5
to 20 millicuries of .sup.99mTc. The labeled antibody or antibody
fragment will then preferentially accumulate at the location of
cells which contain TR13 and/or TR14 protein. In vivo tumor imaging
is described in S. W. Burchiel et al., "Immunopharmacokinetics of
Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor
Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and
B. A. Rhodes, eds., Masson Publishing Inc. (1982)).
[0380] With respect to antibodies, one of the ways in which the
anti-TR13 and/or anti-TR14 antibody can be detectably labeled is by
linking the same to an enzyme and using the linked product in an
enzyme immunoassay (EIA) (Voller, A., "The Enzyme Linked
Immunosorbent Assay (ELISA)", 1978, Diagnostic Horizons 2:1-7,
Microbiological Associates Quarterly Publication, Walkersville,
Md.); Voller et al., J. Clin. Pathol. 31:507-520 (1978); Butler, J.
E., Meth. Enzymol. 73:482-523 (1981); Maggio, E. (ed.), 1980,
Enzyme Immunoassay, CRC Press, Boca Raton, Fla.; Ishikawa, E. et
al., (eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo). The
enzyme which is bound to the antibody will react with an
appropriate substrate, preferably a chromogenic substrate, in such
a manner as to produce a chemical moiety which can be detected, for
example, by spectrophotometric, fluorimetric or by visual means.
Enzymes which can be used to detectably label the antibody include,
but are not limited to, malate dehydrogenase, staphylococcal
nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase,
alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase,
horseradish peroxidase, alkaline phosphatase, asparaginase, glucose
oxidase, beta-galactosidase, ribonuclease, urease, catalase,
glucose-6-phosphate dehydrogenase, glucoamylase and
acetylcholinesterase. Additionally, the detection can be
accomplished by colorimetric methods which employ a chromogenic
substrate for the enzyme. Detection may also be accomplished by
visual comparison of the extent of enzymatic reaction of a
substrate in comparison with similarly prepared standards.
[0381] Detection may also be accomplished using any of a variety of
other immunoassays. For example, by radioactively labeling the
antibodies or antibody fragments, it is possible to detect TR13
and/or TR14 through the use of a radioimmunoassay (RIA) (see, for
example, Weintraub, B., Principles of Radioimmunoassays, Seventh
Training Course on Radioligand Assay Techniques, The Endocrine
Society, March, 1986, which is incorporated by reference herein).
The radioactive isotope can be detected by means including, but not
limited to, a gamma counter, a scintillation counter, or
autoradiography.
[0382] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to
light of the proper wave length, its presence can then be detected
due to fluorescence. Among the most commonly used fluorescent
labeling compounds are fluorescein isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, ophthaldehyde and
fluorescamine.
[0383] The antibody can also be detectably labeled using
fluorescence emitting metals such as .sup.152Eu, or others of the
lanthanide series. These metals can be attached to the antibody
using such metal chelating groups as diethylenetriaminepentacetic
acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0384] The antibody also can be detectably labeled by coupling it
to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of particularly useful chemiluminescent
labeling compounds are luminol, isoluminol, theromatic acridinium
ester, imidazole, acridinium salt and oxalate ester.
[0385] Likewise, a bioluminescent compound may be used to label the
antibody of the present invention. Bioluminescence is a type of
chemiluminescence found in biological systems in, which a catalytic
protein increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by detecting
the presence of luminescence. Important bioluminescent compounds
for purposes of labeling are luciferin, luciferase and
aequorin.
[0386] TR13 and TR14 Binding Peptides and Other Molecules
[0387] The invention also encompasses screening methods for
identifying polypeptides and nonpolypeptides that bind TR13 or
TR14, and the TR13 or TR14 binding molecules identified thereby.
These binding molecules are useful, for example, as agonists and
antagonists of the TR13 or TR14 receptor proteins. Such agonists
and antagonists can be used, in accordance with the invention, in
the therapeutic embodiments described in detail, below.
[0388] This method comprises the steps of:
[0389] contacting a TR13 or TR14 protein or TR13 or TR14-like
protein with a plurality of molecules; and
[0390] identifying a molecule that binds the TR13 or TR14 protein
or TR13 or TR14-like protein.
[0391] The step of contacting the TR13 or TR14 protein or TR13 or
TR14-like protein with the plurality of molecules may be effected
in a number of ways. For example, one may contemplate immobilizing
the TR13 or TR14 protein or TR13 or TR14-like protein on a solid
support and bringing a solution of the plurality of molecules in
contact with the immobilized TR13 or TR14 protein or TR13 or
TR14-like protein. Such a procedure would be akin to an affinity
chromatographic process, with the affinity matrix being comprised
of the immobilized TR13 or TR14 protein or TR13 or TR14-like
protein. The molecules having a selective affinity for the TR13 or
TR14 protein or TR13 or TR14-like protein can then be purified by
affinity selection. The nature of the solid support, process for
attachment of the TR13 or TR14 protein or TR13 or TR14-like protein
to the solid support, solvent, and conditions of the affinity
isolation or selection are largely conventional and well known to
those of ordinary skill in the art.
[0392] Alternatively, one may also separate a plurality of
polypeptides into substantially separate fractions comprising a
subset of or individual polypeptides. For instance, one can
separate the plurality of polypeptides by gel electrophoresis,
column chromatography, or like method known to those of ordinary
skill for the separation of polypeptides. The individual
polypeptides can also be produced by a transformed host cell in
such a way as to be expressed on or about its outer surface (e.g.,
a recombinant phage). Individual isolates can then be "probed" by
the TR13 or TR14 protein or TR13 or TR14-like protein, optionally
in the presence of an inducer should one be required for
expression, to determine if any selective affinity interaction
takes place between the TR13 or TR14 protein or TR13 or TR14-like
protein and the individual clone. Prior to contacting the TR13 or
TR14 protein or TR13 or TR14-like protein with each fraction
comprising individual polypeptides, the polypeptides could first be
transferred to a solid support for additional convenience. Such a
solid support may simply be a piece of filter membrane, such as one
mode of nitrocellulose or nylon. In this manner, positive clones
could be identified from a collection of transformed host cells of
an expression library, which harbor a DNA construct encoding a
polypeptide having a selective affinity for TR13 or TR14 protein or
TR13 or TR14-like protein. Furthermore, the amino acid sequence of
the polypeptide having a selective affinity for the TR13 or TR14
protein or TR13 or TR14-like protein can be determined directly by
conventional means or the coding sequence of the DNA encoding the
polypeptide can frequently be determined more conveniently. The
primary sequence can then be deduced from the corresponding DNA
sequence. If the amino acid sequence is to be determined from the
polypeptide itself, one may use microsequencing techniques. The
sequencing technique may include mass spectroscopy.
[0393] In certain situations, it may be desirable to wash away any
unbound TR13 or TR14 protein or TR13 or TR14-like protein, or
alterntatively, unbound polypeptides, from a mixture of the TR13 or
TR14 protein or TR13 or TR14-like protein and the plurality of
polypeptides prior to attempting to determine or to detect the
presence of a selective affinity interaction. Such a wash step may
be particularly desirable when the TR13 or TR14 protein or TR13 or
TR14-like protein or the plurality of polypeptides is bound to a
solid support.
[0394] The plurality of molecules provided according to this method
may be provided by way of diversity libraries, such as random or
combinatorial peptide or nonpeptide libraries which can be screened
for molecules that specifically bind to TR13 or TR14. Many
libraries are known in the art that can be used, e.g., chemically
synthesized libraries, recombinant (e.g., phage display libraries),
and in vitro translation-based libraries. Examples of chemically
synthesized libraries are described in Fodor et al., 1991, Science
251:767-773; Houghten et al., 1991, Nature 354:84-86; Lam et al.,
1991, Nature 354:82-84; Medynski, 1994, Bio/Technology 12:709-710;
Gallop et al., 1994, J. Medicinal Chemistry 37(9):1233-.sup.125I;
Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA 90:10922-10926;
Erb et al., 1994, Proc. Natl. Acad. Sci. USA 91:11422-11426;
Houghten et al., 1992, Biotechniques 13:412; Jayawickreme et al.,
1994, Proc. Natl. Acad. Sci. USA 91:1614-1618; Salmon et al., 1993,
Proc. Natl. Acad. Sci. USA 90:11708-11712; PCT Publication No. WO
93/20242; and Brenner and Lerner, 1992, Proc. Natl. Acad. Sci. USA
89:5381-5383.
[0395] Examples of phage display libraries are described in Scott
and Smith, 1990, Science 249:386-390; Devlin et al., 1990, Science,
249:404-406; Christian, R. B., et al., 1992, J. Mol. Biol.
227:711-718); Lenstra, 1992, J. Immunol. Meth. 152:149-157; Kay et
al., 1993, Gene 128:59-65; and PCT Publication No. WO 94/18318
dated Aug. 18, 1994.
[0396] In vitro translation-based libraries include but are not
limited to those described in PCT Publication No. WO 91/05058 dated
Apr. 18, 1991; and Mattheakis et al., 1994, Proc. Natl. Acad. Sci.
USA 91:9022-9026.
[0397] By way of examples of nonpeptide libraries, a benzodiazepine
library (see e.g., Bunin et al., 1994, Proc. Natl. Acad. Sci. USA
91:4708-4712) can be adapted for use. Peptoid libraries (Simon et
al., 1992, Proc. Natl. Acad. Sci. USA 89:9367-9371) can also be
used. Another example of a library that can be used, in which the
amide functionalities in peptides have been permethylated to
generate a chemically transformed combinatorial library, is
described by Ostresh et al. (1994, Proc. Natl. Acad. Sci. USA
91:11138-11142).
[0398] The variety of non-peptide libraries that are useful in the
present invention is great. For example, Ecker and Crooke, 1995,
Bio/Technology 13:351-360 list benzodiazepines, hydantoins,
piperazinediones, biphenyls, sugar analogs, beta-mercaptoketones,
arylacetic acids, acylpiperidines, benzopyrans, cubanes, xanthines,
aminimides, and oxazolones as among the chemical species that form
the basis of various libraries.
[0399] Non-peptide libraries can be classified broadly into two
types: decorated monomers and oligomers. Decorated monomer
libraries employ a relatively simple scaffold structure upon which
a variety functional groups is added. Often the scaffold will be a
molecule with a known useful pharmacological activity. For example,
the scaffold might be the benzodiazepine structure.
[0400] Non-peptide oligomer libraries utilize a large number of
monomers that are assembled together in ways that create new shapes
that depend on the order of the monomers. Among the monomer units
that have been used are carbamates, pyrrolinones, and morpholinos.
Peptoids, peptide-like oligomers in which the side chain is
attached to the alpha amino group rather than the alpha carbon,
form the basis of another version of non-peptide oligomer
libraries. The first non-peptide oligomer libraries utilized a
single type of monomer and thus contained a repeating backbone.
Recent libraries have utilized more than one monomer, giving the
libraries added flexibility.
[0401] Screening the libraries can be accomplished by any of a
variety of commonly known methods. See, e.g., the following
references, which disclose screening of peptide libraries: Parmley
and Smith, 1989, Adv. Exp. Med. Biol. 251:215-218; Scott and Smith,
1990, Science 249:386-390; Fowlkes et al., 1992; BioTechniques
13:422-427; Oldenburg et al., 1992, Proc. Natl. Acad. Sci. USA
89:5393-5397; Yu et al., 1994, Cell 76:933-945; Staudt et al.,
1988, Science 241:577-580; Bock et al., 1992, Nature 355:564-566;
Tuerk et al., 1992, Proc. Natl. Acad. Sci. USA 89:6988-6992;
Ellington et al., 1992, Nature 355:850-852; U.S. Pat. No.
5,096,815, U.S. Pat. No. 5,223,409, and U.S. Pat. No. 5,198,346,
all to Ladner et al.; Rebar and Pabo, 1993, Science 263:671-673;
and CT Publication No. WO 94/18318.
[0402] In a specific embodiment, screening to identify a molecule
that binds TR13 or TR14 can be carried out by contacting the
library members with a TR13 or TR14 protein or TR13 or TR14-like
protein immobilized on a solid phase and harvesting those library
members that bind to the TR13 or TR14 protein or TR13 or TR14-like
protein. Examples of such screening methods, termed "panning"
techniques are described by way of example in Parmley and Smith,
1988, Gene 73:305-318; Fowlkes et al., 1992, BioTechniques
13:422-427; PCT Publication No. WO 94/18318; and in references
cited herein.
[0403] In another embodiment, the two-hybrid system for selecting
interacting proteins in yeast (Fields and Song, 1989, Nature
340:245-246; Chien et al., 1991, Proc. Natl. Acad. Sci. USA
88:9578-9582) can be used to identify molecules that specifically
bind to TR13 or TR14 or TR13 or TR14-like proteins.
[0404] Where the TR13 or TR14 binding molecule is a polypeptide,
the polypeptide can be conveniently selected from any peptide
library, including random peptide libraries, combinatorial peptide
libraries, or biased peptide libraries. The term "biased" is used
herein to mean that the method of generating the library is
manipulated so as to restrict one or more parameters that govern
the diversity of the resulting collection of molecules, in this
case peptides.
[0405] Thus, a truly random peptide library would generate a
collection of peptides in which the probability of finding a
particular amino acid at a given position of the peptide is the
same for all 20 amino acids. A bias can be introduced into the
library, however, by specifying, for example, that a lysine occur
every fifth amino acid or that positions 4, 8, and 9 of a
decapeptide library be fixed to include only arginine. Clearly,
many types of biases can be contemplated, and the present invention
is not restricted to any particular bias. Furthermore, the present
invention contemplates specific types of peptide libraries, such as
phage displayed peptide libraries and those that utilize a DNA
construct comprising a lambda phage vector with a DNA insert.
[0406] As mentioned above, in the case of a TR13 or TR14 binding
molecule that is a polypeptide, the polypeptide may have about 6 to
less than about 60 amino acid residues, preferably about 6 to about
10 amino acid residues, and most preferably, about 6 to about 22
amino acids. In another embodiment, a TR13 or TR14 binding
polypeptide has in the range of 15-100 amino acids, or 20-50 amino
acids.
[0407] The selected TR13 or TR14 binding polypeptide can be
obtained by chemical synthesis or recombinant expression.
[0408] Epitopes
[0409] The present invention encompasses polypeptides comprising,
or alternatively consisting of, an epitope of the TR13 and TR14
polypeptides described in detail above or encoded by a
polynucleotide that hybridizes to the complement of the sequence of
TR13 and TR14 coding sequences described in detail above, under
stringent hybridization conditions or lower stringency
hybridization conditions as defined supra. The present invention
further encompasses polynucleotide sequences encoding an epitope of
a polypeptide sequence of the, polynucleotide sequences of the
complementary strand of a polynucleotide sequence encoding an
epitope of the invention, and polynucleotide sequences which
hybridize to the complementary strand under stringent hybridization
conditions or lower stringency hybridization conditions defined
supra.
[0410] The term "epitopes," as used herein, refers to portions of a
polypeptide having antigenic or immunogenic activity in an animal,
preferably a mammal, and most preferably in a human. In a preferred
embodiment, the present invention encompasses a polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An "immunogenic epitope," as used herein, is defined
as a portion of a protein that elicits an antibody response in an
animal, as determined by any method known in the art, for example,
by the methods for generating antibodies described infra. (See, for
example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002
(1983)). The term "antigenic epitope," as used herein, is defined
as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic.
[0411] Fragments that function as epitopes may be produced by any
conventional means. (See, e.g., Houghten, Proc. Natl. Acad. Sci.
USA 82:5131-5135 (1985), further described in U.S. Pat. No.
4,631,211).
[0412] In the present invention, antigenic epitopes preferably
contain a sequence of at least 4, at least 5, at least 6, at least
7, more preferably at least 8, at least 9, at least 10, at least
15, at least 20, at least 25, and, most preferably, between about
15 to about 30 amino acids. Preferred polypeptides comprising
immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30,
35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino
acid residues in length. Antigenic epitopes are useful, for
example, to raise antibodies, including monoclonal antibodies, that
specifically bind the epitope. Antigenic epitopes can be used as
the target molecules in immunoassays. (See, for instance, Wilson et
al., Cell 37:767-778 (1984); Sutcliffe et al., Science 219:660-666
(1983)).
[0413] Similarly, immunogenic epitopes can be used, for example, to
induce antibodies according to methods well known in the art. (See,
for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow
et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al.,
J. Gen. Virol. 66:2347-2354 (1985). The polypeptides comprising one
or more immunogenic epitopes may be presented for eliciting an
antibody response together with a carrier protein, such as an
albumin, to an animal system (such as, for example, rabbit or
mouse), or, if the polypeptide is of sufficient length (at least
about 25 amino acids), the polypeptide may be presented without a
carrier. However, immunogenic epitopes comprising as few as 8 to 10
amino acids have been shown to be sufficient to raise antibodies
capable of binding to, at the very least, linear epitopes in a
denatured polypeptide (e.g., in Western blotting).
[0414] Epitope-bearing polypeptides of the present invention may be
used to induce antibodies according to methods well known in the
art including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra, and Bittle et al., J. Gen.
Virol., 66:2347-2354 (1985). If in vivo immunization is used,
animals may be immunized with free peptide; however, anti-peptide
antibody titer may be boosted by coupling the peptide to a
macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or
tetanus toxoid. For instance, peptides containing cysteine residues
may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carriers using a more general linking
agent such as glutaraldehyde. Animals such as, for example,
rabbits, rats, and mice are immunized with either free or
carrier-coupled peptides, for instance, by intraperitoneal and/or
intradermal injection of emulsions containing about 100 micrograms
of peptide or carrier protein and Freund's adjuvant or any other
adjuvant known for stimulating an immune response. Several booster
injections may be needed, for instance, at intervals of about two
weeks, to provide a useful titer of anti-peptide antibody that can
be detected, for example, by ELISA assay using free peptide
adsorbed to a solid surface. The titer of anti-peptide antibodies
in serum from an immunized animal may be increased by selection of
anti-peptide antibodies, for instance, by adsorption to the peptide
on a solid support and elution of the selected antibodies according
to methods well known in the art.
[0415] As one of skill in the art will appreciate, and as discussed
above, the polypeptides of the present invention comprising an
immunogenic or antigenic epitope can be fused to other polypeptide
sequences. For example, the polypeptides of the present invention
may be fused with the constant domain of immunoglobulins (IgA, IgE,
IgG, IgM), or portions thereof (CH1, CH2, CH3, or any combination
thereof and portions thereof) resulting in chimeric polypeptides.
Such fusion proteins may facilitate purification and may increase
half-life in vivo. This has been shown for chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins. See, e.g., EP 394,827;
Traunecker et al., Nature, 331:84-86 (1988). IgG Fusion proteins
that have a disulfide-linked dimeric structure due to the IgG
portion desulfide bonds have also been found to be more efficient
in binding and neutralizing other molecules than monomeric
polypeptides or fragments thereof alone. See, e.g., Fountoulakis et
al., J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the
above epitopes can also be recombined with a gene of interest as an
epitope tag (e.g., the hemagglutinin ("HA") tag or flag tag) to aid
in detection and purification of the expressed polypeptide. For
example, a system described by Janknecht et al. allows for the
ready purification of non-denatured fusion proteins expressed in
human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci.
USA 88:8972-897). In this system, the gene of interest is subcloned
into a vaccinia recombination plasmid such that the open reading
frame of the gene is translationally fused to an amino-terminal tag
consisting of six histidine residues. The tag serves as a
matrix-binding domain for the fusion protein. Extracts from cells
infected with the recombinant vaccinia virus are loaded onto
Ni.sup.2+ nitriloacetic acid-agarose column and histidine-tagged
proteins can be selectively eluted with imidazole-containing
buffers.
[0416] Additional fusion proteins of the invention may be generated
through the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling may be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S.
Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and
5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8:724-33
(1997); Harayama, Trends Biotechnol. 16(2):76-82 (1998); Hansson,
et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco,
Biotechniques 24(2):308-13 (1998) (each of these patents and
publications are hereby incorporated by reference in its entirety).
In one embodiment, alteration of polynucleotides corresponding to
SEQ ID NO:1 or 60 and the polypeptides encoded by these
polynucleotides may be achieved by DNA shuffling. DNA shuffling
involves the assembly of two or more DNA segments by homologous or
site-specific recombination to generate variation in the
polynucleotide sequence. In another embodiment, polynucleotides of
the invention, or the encoded polypeptides, may be altered by being
subjected to random mutagenesis by error-prone PCR, random
nucleotide insertion or other methods prior to recombination. In
another embodiment, one or more components, motifs, sections,
parts, domains, fragments, etc., of a polynucleotide coding a
polypeptide of the invention may be recombined with one or more
components, motifs, sections, parts, domains, fragments, etc. of
one or more heterologous molecules. (each of these patents and
publications are hereby incorporated by reference). In one
embodiment, alteration of TR13 and/or TR14 polynucleotides and
corresponding polypeptides may be achieved by DNA shuffling. DNA
shuffling involves the assembly of two or more DNA segments into a
desired TR13 and/or TR14 molecule by homologous, or site-specific,
recombination. In another embodiment, TR13 and/or TR14
polynucleotides and corresponding polypeptides may be altered by
being subjected to random mutagenesis by error-prone PCR, random
nucleotide insertion or other methods prior to recombination. In
another embodiment, one or more components, motifs, sections,
parts, domains, fragments, etc., of TR13 and/or TR14 may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules. In
preferred embodiments, the heterologous molecules are receptors for
TNF-alpha, TNF-beta, lymphotoxin-alpha, lymphotoxin-beta, FAS
ligand, and APRIL. In further preferred embodiments, the
heterologous molecules are any member of the TNF family.
[0417] Antibodies
[0418] The present invention further relates to antibodies and
T-cell antigen receptors (TCR) which immunospecifically bind a
polypeptide, preferably an epitope, of the present invention (as
determined by immunoassays well known in the art for assaying
specific antibody-antigen binding). Antibodies of the invention
include, but are not limited to, polyclonal, monoclonal,
multispecific, human, humanized or chimeric antibodies, single
chain antibodies, Fab fragments, F(ab') fragments, fragments
produced by a Fab expression library, anti-idiotypic (anti-Id)
antibodies (including, e.g., anti-Id antibodies to antibodies of
the invention), and epitope-binding fragments of any of the above.
The term "antibody," as used herein, refers to immunoglobulin
molecules and immunologically active portions of immunoglobulin
molecules, i.e., molecules that contain an antigen binding site
that immunospecifically binds an antigen. The immunoglobulin
molecules of the invention can be of any type (e.g., IgG, IgE, IgM,
IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and
IgA2) or subclass of immunoglobulin molecule.
[0419] Most preferably the antibodies are human antigen-binding
antibody fragments of the present invention and include, but are
not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-1 inked Fvs (sdFv) and fragments
comprising either a VL or VH domain. Antigen-binding antibody
fragments, including single-chain antibodies, may comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains.
Also included in the invention are antigen-binding fragments also
comprising any combination of variable region(s) with a hinge
region, CH1, CH2, and CH3 domains. The antibodies of the invention
may be from any animal origin including birds and mammals.
Preferably, the antibodies are human, murine, donkey, ship rabbit,
goat, guinea pig, camel, horse, or chicken. As used herein, "human"
antibodies include antibodies having the amino acid sequence of a
human immunoglobulin and include antibodies isolated from human
immunoglobulin libraries or from animals transgenic for one or more
human immunoglobulin and that do not express endogenous
immunoglobulins, as described infra and, for example in, U.S. Pat.
No. 5,939,598 by Kucherlapati et al.
[0420] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553
(1992).
[0421] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of a polypeptide
of the present invention that they recognize or specifically bind.
The epitope(s) or polypeptide portion(s) may be specified as
described herein, e.g., by N-terminal and C-terminal positions, by
size in contiguous amino acid residues, or listed in the Tables and
Figures. Antibodies that specifically bind any epitope or
polypeptide of the present invention may also be excluded.
Therefore, the present invention includes antibodies that
specifically bind polypeptides of the present invention, and allows
for the exclusion of the same.
[0422] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other analog, ortholog, or homolog of a polypeptide of
the present invention are included. Antibodies that bind
polypeptides with at least 95%, at least 90%, at least 85%, at
least 80%, at least 75%, at least 70%, at least 65%, at least 60%,
at least 55%, and at least 50% identity (as calculated using
methods known in the art and described herein) to a polypeptide of
the present invention are also included in the present invention.
Antibodies that do not bind polypeptides with less than 95%, less
than 90%, less than 85%, less than 80%, less than 75%, less than
70%, less than 65%, less than 60%, less than 55%, and less than 50%
identity (as calculated using methods known in the art and
described herein) to a polypeptide of the present invention are
also included in the present invention. Further included in the
present invention are antibodies that bind polypeptides encoded by
polynucleotides which hybridize to a polynucleotide of the present
invention under stringent hybridization conditions (as described
herein). Antibodies of the present invention may also be described
or specified in terms of their binding affinity to a polypeptide of
the invention. Preferred binding affinities include those with a
dissociation constant or Kd less than 5.times.10.sup.-2M,
10.sup.-2M, 5.times.10.sup.-3M, 10.sup.-3M, 5.times.10.sup.-4M,
10.sup.-4M, 5.times.10.sup.-5M, 10.sup.-5M, 5.times.10.sup.-6M,
10.sup.-6M, 5.times.10.sup.-7M, 10.sup.-7M, 5.times.10.sup.-8M,
10.sup.-8M, 5.times.10.sup.-9M, 10.sup.-9M, 5.times.10.sup.-10M,
10.sup.-10M, 5.times.10.sup.-11M, 10.sup.-11M, 5.times.10.sup.-12M,
10.sup.-12M, 5.times.10.sup.-13M, 10.sup.-13M, 5.times.10.sup.-14M,
10.sup.-14M, 5.times.10.sup.-15M, and 10.sup.-15M.
[0423] The invention also provides antibodies that competitively
inhibit binding of an antibody to an epitope of the invention as
determined by any method known in the art for determining
competitive binding, for example, the immunoassays described
herein. In preferred embodiments, the antibody competitively
inhibits binding to the epitope by at least 90%, at least 80%, at
least 70%, at least 60%, or at least 50%.
[0424] Antibodies of the present invention may act as agonists or
antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt
the receptor/ligand interactions with the polypeptides of the
invention either partially or fully. The invention features both
receptor-specific antibodies and ligand-specific antibodies. The
invention also features receptor-specific antibodies which do not
prevent ligand binding but prevent receptor activation. Receptor
activation (i.e., signaling) may be determined by techniques
described herein or otherwise known in the art. For example,
receptor activation can be determined by detecting the
phosphorylation (e.g., tyrosine or serine/threonine) of the
receptor or its substrate by immunoprecipitation followed by
western blot analysis (for example, as described supra). In
specific embodiments, antibodies are provided that inhibit ligand
or receptor activity by at least 90%, at least 80%, at least 70%,
at least 60%, or at least 50% of the activity in absence of the
antibody.
[0425] The invention also features receptor-specific antibodies
which both prevent ligand binding and receptor activation as well
as antibodies that recognize the receptor-ligand complex, and,
preferably, do not specifically recognize the unbound receptor or
the unbound ligand. Likewise, included in the invention are
neutralizing antibodies which bind the ligand and prevent binding
of the ligand to the receptor, as well as antibodies which bind the
ligand, thereby preventing receptor activation, but do not prevent
the ligand from binding the receptor. Further included in the
invention are antibodies which activate the receptor. These
antibodies may act as receptor agonists, i.e., potentiate or
activate either all or a subset of the biological activities of the
ligand-mediated receptor activation. The antibodies may be
specified as agonists, antagonists or inverse agonists for
biological activities comprising the specific biological activities
of the peptides of the invention disclosed herein. The above
antibody agonists can be made using methods known in the art. See,
e.g., PCT publication WO 96/40281; U.S. Pat. No. 5,811,097; Deng et
al., Blood 92(6):1981-1988 (1998); Chen, et al., Cancer Res.
58(16):3668-3678 (1998); Harrop et al., J. Immunol.
161(4):1786-1794 (1998); Zhu et al., Cancer Res. 58(15):3209-3214
(1998); Yoon, et al., J. Immunol. 160(7):3170-3179 (1998); Prat et
al., J. Cell. Sci. 111(Pt2):237-247 (1998); Pitard et al., J.
Immunol. Methods 205(2):177-190 (1997); Liautard et al., Cytokine
9(4):233-241 (1997); Carlson et al., J. Biol. Chem.
272(17):11295-11301 (1997); Taryman et al., Neuron 14(4):755-762
(1995); Muller et al., Structure 6(9):1153-1167 (1998); Bartunek et
al., Cytokine 8(1):14-20 (1996) (which are all incorporated by
reference herein in their entireties).
[0426] Antibodies of the present invention may be used, for
example, but not limited to, to purify, detect, and target the
polypeptides of the present invention, including both in vitro and
in vivo diagnostic and therapeutic methods. For example, the
antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of the polypeptides of the present
invention in biological samples. See, e.g., Harlow et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988) (incorporated by reference herein in its
entirety).
[0427] Agonistic antibodies of the invention may also be used to
target and kill cells, including, for example, cancer cells,
expressing TR13 on their surface and/or cells having TR13 bound to
their surface. TR13 regulates survival and/or proliferation of
epithelial cells as exemplified by HEK 293T cells. See Example 37
and FIG. 12. In specific embodiments agonistic antibodies of the
invention are used to inhibit proliferation and/or survival of
epithelial cells. In further specific embodiments agonistic
antibodies of the invention are used to treat disorders of
epithelial cell proliferation and/or survival, for example, cancer.
Antibodies of the invention may be provided in pharmaceutically
acceptable compositions as known in the art or as described
herein.
[0428] In addition, antagonistic antibodies that bind TR13 so as to
prevent ligand binding without triggering cell signalling may be
used in accordance with the invention to prevent ligand (e.g., FasL
or LIGHT)-induced cell death. TR13 regulates survival and/or
proliferation of epithelial cells as exemplified by HEK 293T cells.
See Example 37 and FIG. 12. In specific embodiments antagonistic
antibodies of the invention are used to stimulate proliferation
and/or survival of epithelial cells. In further specific
embodiments antagonistic antibodies of the invention are used, for
example, to promote wound healing. Antibodies of the invention may
be provided in pharmaceutically acceptable compositions as known in
the art or as described herein.
[0429] As discussed in more detail below, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalently and non-covalently
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays and
effector molecules such as heterologous polypeptides, drugs, or
toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO
89/12624; U.S. Pat. No. 5,314,995; and EP 396,387.
[0430] Agonistic and/or antagonistic antibodies of the present
invention may be used in an assay to identify compounds which can
increase or decrease epithelial cell survival and/or proliferation.
In specific embodiments antibodies of the present invention may be
used to identify TR13 agonists. In further specific embodiments
antibodies of the present invention may be used to identify TR13
antagonists.
[0431] The antibodies of the invention include derivatives that are
modified, i.e, by the covalent attachment of any type of molecule
to the antibody such that covalent attachment does not prevent the
antibody from generating an anti-idiotypic response. For example,
but not by way of limitation, the antibody derivatives include
antibodies that have been modified, e.g., by glycosylation,
acetylation, pegylation, phosphylation, amidation, derivatization
by known protecting/blocking groups, proteolytic cleavage, linkage
to a cellular ligand or other protein, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally, the derivative may contain one or more non-classical
amino acids.
[0432] The antibodies of the present invention may be generated by
any suitable method known in the art. Polyclonal antibodies to an
antigen-of-interest can be produced by various procedures well
known in the art. For example, a polypeptide of the invention can
be administered to various host animals including, but not limited
to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
Such adjuvants are also well known in the art.
[0433] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et
al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier, N.Y., 1981) (said references incorporated by reference
in their entireties). The term "monoclonal antibody" as used herein
is not limited to antibodies produced through hybridoma technology.
The term "monoclonal antibody" refers to an antibody that is
derived from a single clone, including any eukaryotic, prokaryotic,
or phage clone, and not the method by which it is produced.
[0434] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well-known in the art
and are discussed in detail in Example 5, below. Briefly, mice can
be immunized with a polypeptide of the invention or a cell
expressing such peptide. Once an immune response is detected, e.g.,
antibodies specific for the antigen are detected in the mouse
serum, the mouse spleen is harvested and splenocytes isolated. The
splenocytes are then fused by well-known techniques to any suitable
myeloma cells, for example cells from cell line SP20 available from
the ATCC. Hybridomas are selected and cloned by limited dilution.
The hybridoma clones are then assayed by methods known in the art
for cells that secrete antibodies capable of binding a polypeptide
of the invention. Ascites fluid, which generally contains high
levels of antibodies, can be generated by immunizing mice with
positive hybridoma clones.
[0435] Accordingly, the present invention provides methods of
generating monoclonal antibodies as well as antibodies produced by
the method comprising culturing a hybridoma cell secreting an
antibody of the invention wherein, preferably, the hybridoma is
generated by fusing splenocytes isolated from a mouse immunized
with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma
clones that secrete an antibody able to bind a polypeptide of the
invention.
[0436] Antibody fragments that recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab')2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
F(ab')2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
[0437] For example, the antibodies of the present invention can
also be generated using various phage display methods known in the
art. In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In a particular, such phage
can be utilized to display antigen-binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds the
antigen of interest can be selected or identified with antigen,
e.g., using labeled antigen or antigen bound or captured to a solid
surface or bead. Phage used in these methods are typically
filamentous phage including fd and M13 binding domains expressed
from phage with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein. Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al.,
J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur.
J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18 (1997);
Burton et al., Advances in Immunology 57:191-280 (1994); PCT
application No. PCT/GB91/01134; PCT publications WO 90/02809; WO
91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO
95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484;
5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908;
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of
which is incorporated herein by reference in its entirety.
[0438] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2
fragments can also be employed using methods known in the art such
as those disclosed in PCT publication WO 92/22324; Mullinax et al.,
BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34
(1995); and Better et al., Science 240:1041-1043 (1988) (said
references incorporated by reference in their entireties).
[0439] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in
Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993);
and Skerra et al., Science 240:1038-1040 (1988). For some uses,
including in vivo use of antibodies in humans and in vitro
detection assays, it may be preferable to use chimeric, humanized,
or human antibodies. A chimeric antibody is a molecule in which
different portions of the antibody are derived from different
animal species, such as antibodies having a variable region derived
from a murine monoclonal antibody and a human immunoglobulin
constant region. Methods for producing chimeric antibodies are
known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi
et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J.
Immunol. Methods 125:191-202; U.S. Pat. Nos. 5,807,715; 4,816,567;
and 4,816,397, which are incorporated herein by reference in their
entireties. Humanized antibodies are antibody molecules from
non-human species antibody that binds the desired antigen having
one or more complementarity determining regions (CDRS) from the
non-human species and framework regions from a human immunoglobulin
molecule. Often, framework residues in the human framework regions
will be substituted with the corresponding residue from the CDR
donor antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which
are incorporated herein by reference in their entireties.)
Antibodies can be humanized using a variety of techniques known in
the art including, for example, CDR-grafting (EP 239,400; PCT
publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and
5,585,089), veneering or resurfacing (EP 592,106; EP 519,596;
Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et
al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS
91:969-973 (1994)), and chain shuffling (U.S. Pat. No.
5,565,332).
[0440] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
[0441] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring that express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar
(1995, Int. Rev. Immunol. 13:65-93). For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 96/34096; WO 96/33735; U.S. Pat.
Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016;
5,545,806; 5,814,318; and 5,939,598, which are incorporated by
reference herein in their entirety. In addition, companies such as
Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, Calif.)
can be engaged to provide human antibodies directed against a
selected antigen using technology similar to that described
above.
[0442] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope. (Jespers
et al., Bio/technology 12:899-903 (1988)).
[0443] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotype antibodies that
"mimic" polypeptides of the invention using techniques well known
to those skilled in the art. (See, e.g., Greenspan & Bona,
FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol.
147(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively inhibit polypeptide multimerization and/or binding of
a polypeptide of the invention to a ligand can be used to generate
anti-idiotypes that "mimic" the polypeptide multimerization and/or
binding domain and, as a consequence, bind to and neutralize
polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of such anti-idiotypes can be used in therapeutic
regimens to neutralize polypeptide ligand. For example, such
anti-idiotypic antibodies can be used to bind a polypeptide of the
invention and/or to bind its ligands/receptors, and thereby block
its biological activity.
[0444] Polynucleotides Encoding Antibodies
[0445] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an antibody of the invention and
fragments thereof. The invention also encompasses polynucleotides
that hybridize under stringent or lower stringency hybridization
conditions, e.g., as defined supra, to polynucleotides that encode
an antibody, preferably, that specifically binds to a polypeptide
of the invention, preferably, an antibody that binds to TR13 or
TR14 polypeptide of the invention, as described above.
[0446] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligation of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0447] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be obtained from a
suitable source (e.g., an antibody cDNA library, or a cDNA library
generated from, or nucleic acid, preferably poly A+ RNA, isolated
from, any tissue or cells expressing the antibody, such as
hybridoma cells selected to express an antibody of the invention)
by PCR amplification using synthetic primers hybridizable to the 3'
and 5' ends of the sequence or by cloning using an oligonucleotide
probe specific for the particular gene sequence to identify, e.g.,
a cDNA clone from a cDNA library that encodes the antibody.
Amplified nucleic acids generated by PCR may then be cloned into
replicable cloning vectors using any method well known in the
art.
[0448] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties), to generate antibodies having a different amino acid
sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0449] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the complementarity determining regions
(CDRs) by methods that are well know in the art, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described supra. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479
(1998) for a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds a
polypeptide of the invention. Preferably, as discussed supra, one
or more amino acid substitutions may be made within the framework
regions, and, preferably, the amino acid substitutions improve
binding of the antibody to its antigen. Additionally, such methods
may be used to make amino acid substitutions or deletions of one or
more variable region cysteine residues participating in an
intrachain disulfide bond to generate antibody molecules lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within
the skill of the art.
[0450] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad.
Sci. 81:851-855; Neuberger et al., 1984, Nature 312:604-608; Takeda
et al., 1985, Nature 314:452-454) by splicing genes from a mouse
antibody molecule of appropriate antigen specificity together with
genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine mAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0451] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,694,778; Bird, 1988,
Science 242:423-42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA
85:5879-5883; and Ward et al., 1989, Nature 334:544-54) can be
adapted to produce single chain antibodies. Single chain antibodies
are formed by linking the heavy and light chain fragments of the Fv
region via an amino acid bridge, resulting in a single chain
polypeptide. Techniques for the assembly of functional Fv fragments
in E. coli may also be used (Skerra et al., 1988, Science
242:1038-1041).
[0452] Methods of Producing Antibodies
[0453] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or preferably, by recombinant
expression techniques.
[0454] Recombinant expression of an antibody of the invention, or
fragment, derivative or analog thereof, e.g., a heavy or light
chain of an antibody of the invention, requires construction of an
expression vector containing a polynucleotide that encodes the
antibody. Once a polynucleotide encoding an antibody molecule or a
heavy or light chain of an antibody, or portion thereof (preferably
containing the heavy or light chain variable domain), of the
invention has been obtained, the vector for the production of the
antibody molecule may be produced by recombinant DNA technology
using techniques well known in the art. Thus, methods for preparing
a protein by expressing a polynucleotide containing an antibody
encoding nucleotide sequence are described herein. Methods which
are well known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors may include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody may be cloned into such a
vector for expression of the entire heavy or light chain.
[0455] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention, or a heavy or light chain
thereof, operably linked to a heterologous promoter. In preferred
embodiments for the expression of double chained antibodies,
vectors encoding both the heavy and light chains may be
co-expressed in the host cell for expression of the entire
immunoglobulin molecule, as detailed below.
[0456] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express an
antibody molecule of the invention in situ. These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing antibody coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing
promoters derived from the genome of mammalian cells (e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of
whole recombinant antibody molecule, are used for the expression of
a recombinant antibody molecule. For example, mammalian cells such
as Chinese hamster ovary cells (CHO), in conjunction with a vector
such as the major intermediate early gene promoter element from
human cytomegalovirus is an effective expression system for
antibodies (Foecking et al., 1986, Gene 45:101; Cockett et al.,
1990, Bio/Technology 8:2).
[0457] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited, to the E. coli expression vector pUR278
(Ruther et al., 1983, EMBO J. 2:1791), in which the antibody coding
sequence may be ligated individually into the vector in frame with
the lac Z coding region so that a fusion protein is produced; pIN
vectors (Inouye & Inouye, 1985, Nucleic Acids Res.
13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
24:5503-5509); and the like. pGEX vectors may also be used to
express foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to a matrix glutathione-agarose beads followed by elution
in the presence of free glutathione. The pGEX vectors are designed
to include thrombin or factor Xa protease cleavage sites so that
the cloned target gene product can be released from the GST
moiety.
[0458] In an insect system, Autographa californica nuclear
polyhedrosis virus (ACNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter).
[0459] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. (e.g., see Logan & Shenk,
1984, Proc. Natl. Acad. Sci. USA 81:355-359). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bittner et al., 1987, Methods in Enzymol.
153:51-544).
[0460] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERY, BHK, Hela,
COS, MDCK, 293, 3T3, W138, and in particular, breast cancer cell
lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and
normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
[0461] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0462] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., 1977, Cell 11:223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc.
Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase
(Lowy et al., 1980, Cell 22:817) genes can be employed in tk-,
hgprt- or aprt-cells, respectively. Also, antimetabolite resistance
can be used as the basis of selection for the following genes:
dhfr, which confers resistance to methotrexate (Wigler et al.,
1980, Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl.
Acad. Sci. USA 78:1527); gpt, which confers resistance to
mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad.
Sci. USA 78:2072); neo, which confers resistance to the
aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu, 1991,
Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol.
32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and
Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIB TECH
11(5):155-215); and hygro, which confers resistance to hygromycin
(Santerre et al., 1984, Gene 30:147). Methods commonly known in the
art of recombinant DNA technology which can be used are described
in Ausubel et al. (eds.), 1993, Current Protocols in Molecular
Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer
and Expression, A Laboratory Manual, Stockton Press, NY; and in
Chapters 12 and 13, Dracopoli et al. (eds), 1994, Current Protocols
in Human Genetics, John Wiley & Sons, NY.; Colberre-Garapin et
al., 1981, J. Mol. Biol. 150:1, which are incorporated by reference
herein in their entireties.
[0463] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning, Vol.
3. (Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., 1983, Mol. Cell. Biol. 3:257).
[0464] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes both heavy and light chain polypeptides. In such
situations, the light chain should be placed before the heavy chain
to avoid an excess of toxic free heavy chain (Proudfoot, 1986,
Nature 322:52; Kohler, 1980, Proc. Natl. Acad. Sci. USA 77:2197).
The coding sequences for the heavy and light chains may comprise
cDNA or genomic DNA.
[0465] Once an antibody molecule of the invention has been
recombinantly expressed, it may be purified by any method known in
the art for purification of an immunoglobulin molecule, for
example, by chromatography (e.g., ion exchange, affinity,
particularly by affinity for the specific antigen after Protein A,
and sizing column chromatography), centrifugation, differential
solubility, or by any other standard technique for the purification
of proteins.
[0466] Antibody Conjugates
[0467] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalently and
non-covalently conjugations) to a polypeptide (or portion thereof,
preferably at least 10, 20 or 50 amino acids of the polypeptide) of
the present invention to generate fusion proteins. The fusion does
not necessarily need to be direct, but may occur through linker
sequences. The antibodies may be specific for antigens other than
polypeptides (or portion thereof, preferably at least 10, 20 or 50
amino acids of the polypeptide) of the present invention. For
example, antibodies may be used to target the polypeptides of the
present invention to particular cell types, either in vitro or in
vivo, by fusing or conjugating the polypeptides of the present
invention to antibodies specific for particular cell surface
receptors. Antibodies fused or conjugated to the polypeptides of
the present invention may also be used in in vitro immunoassays and
purification methods using methods known in the art. See e.g.,
Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Pat. No.
5,474,981; Gillies et al., PNAS 89:1428-1432 (1992); Fell et al.,
J. Immunol. 146:2446-2452(1991), which are incorporated by
reference in their entireties.
[0468] The present invention further includes compositions
comprising the polypeptides of the present invention fused or
conjugated to antibody domains other than the variable regions. For
example, the polypeptides of the present invention may be fused or
conjugated to an antibody Fc region, or portion thereof. The
antibody portion fused to a polypeptide of the present invention
may comprise the constant region, hinge region, CH1 domain, CH2
domain, and CH3 domain or any combination of whole domains or
portions thereof. The polypeptides may also be fused or conjugated
to the above antibody portions to form multimers. For example, Fc
portions fused to the polypeptides of the present invention can
form dimers through disulfide bonding between the Fc portions.
Higher multimeric forms can be made by fusing the polypeptides to
portions of IgA and IgM. Methods for fusing or conjugating the
polypeptides of the present invention to antibody portions are
known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929;
5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166;
PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc.
Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad.
Sci. USA 89:11337-11341(1992) (said references incorporated by
reference in their entireties).
[0469] As discussed, supra, the polypeptides of the present
invention may be fused or conjugated to the above antibody portions
to increase the in vivo half life of the polypeptides or for use in
immunoassays using methods known in the art. Further, the
polypeptides of the present invention may be fused or conjugated to
the above antibody portions to facilitate purification. One
reported example describes chimeric proteins consisting of the
first two domains of the human CD4-polypeptide and various domains
of the constant regions of the heavy or light chains of mammalian
immunoglobulins. (EP 394,827; Traunecker et al., Nature 331:84-86
(1988). The polypeptides of the present invention fused or
conjugated to an antibody having disulfide-linked dimeric
structures (due to the IgG) may also be more efficient in binding
and neutralizing other molecules, than the monomeric secreted
protein or protein fragment alone. (Fountoulakis et al., J.
Biochem. 270:3958-3964 (1995)). In many cases, the Fc part in a
fusion protein is beneficial in therapy and diagnosis, and thus can
result in, for example, improved pharmacokinetic properties. (EP A
232,262). Alternatively, deleting the Fc part after the fusion
protein has been expressed, detected, and purified, would be
desired. For example, the Fc portion may hinder therapy and
diagnosis if the fusion protein is used as an antigen for
immunizations. In drug discovery, for example, human proteins, such
as hIL-5, have been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
(See, D. Bennett et al., J. Molecular Recognition 8:52-58 (1995);
K. Johanson et al., J. Biol. Chem. 270:9459-9471 (1995)0.
[0470] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitates their purification. In preferred embodiments, the
marker amino acid sequence is a hexa-histidine peptide, such as the
tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311), among others, many of which are
commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine
provides for convenient purification of the fusion protein. Other
peptide tags useful for purification include, but are not limited
to, the "HA" tag, which corresponds to an epitope derived from the
influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984))
and the "flag" tag.
[0471] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically to, for example, monitor
the development or progression of a tumor as part of a clinical
testing procedure to, e.g., determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials,
radioactive materials, positron emitting metals using various
positron emission tomographies, and nonradioactive paramagnetic
metal ions. See, for example, U.S. Pat. No. 4,741,900 for metal
ions which can be conjugated to antibodies for use as diagnostics
according to the present invention. Examples of suitable enzymes
include horseradish peroxidase, alkaline phosphatase,
beta-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic group complexes include streptavidin/biotin and
avidin/biotin; examples of suitable fluorescent materials include
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include iodine (.sup.131I, .sup.125I, .sup.123I,
.sup.121I), carbon (.sup.14C), sulfur (.sup.35S), tritium
(.sup.3H), indium (.sup.115mIn, .sup.113mIn, .sup.112In,
.sup.111In), and technetium (.sup.99Tc, .sup.99mTc), thallium
(.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133 Xe), fluorine
(.sup.18F), .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149 Pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, 105Rh, .sup.97Ru.
[0472] Further, an antibody or fragment thereof may be conjugated
to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or
cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, .sup.213Bi. In specific
embodiments, antibodies of the invention are attached to
macrocyclic chelators useful for conjugating radiometal ions,
including but not limited to, .sup.111In, .sup.177Lu, .sup.90Y,
.sup.166Ho, and .sup.153Sm, to polypeptides. In preferred
embodiments, the radiometal ion associated with the macrocyclic
chelators attached to antibodies of the invention is .sup.111In. In
preferred embodiments, the radiometal ion associated with the
macrocyclic chelators attached to antibodies of the invention is
.sup.90Y. In specific embodiments, the macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N",N'"-tetraacetic acid (DOTA).
In other specific embodiments, the DOTA is attached to the
Neutrokine-alpha and/or Neutrokine-alphaSV polypeptide of the
invention via a linker molecule. Examples of linker molecules
useful for conjugating DOTA to a polypeptide are commonly known in
the art--see, for example, DeNardo et al., Clin Cancer Res.
4(10):2483-90 (1998); Peterson et al., Bioconjug. Chem. 10(4):553-7
(1999); and Zimmerman et al, Nucl. Med. Biol. 26(8):943-50 (1999)
which are hereby incorporated by reference in their entirety. In
addition, U.S. Pat. Nos. 5,652,361 and 5,756,065, which disclose
chelating agents that may be conjugated to antibodies, and methods
for making and using them, are hereby incorporated by reference in
their entireties.
[0473] A cytotoxin or cytotoxic agent includes any agent that is
detrimental to cells. Examples include paclitaxol, cytochalasin B,
gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine, lidocaine, propranolol, and puromycin and analogs or
homologs thereof. Therapeutic agents include, but are not limited
to, antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0474] The conjugates of the invention can be used for modifying a
given biological response, the therapeutic agent or drug moiety is
not to be construed as limited to classical chemical therapeutic
agents. For example, the drug moiety may be a protein or
polypeptide possessing a desired biological activity. Such proteins
may include, for example, a toxin such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor, a-interferon, .beta.-interferon, nerve growth
factor, platelet derived growth factor, tissue plasminogen
activator, a thrombotic agent or an anti-angiogenic agent, e.g.,
angiostatin or endostatin; or, biological response modifiers such
as, for example, lymphokines, interleukin-1 ("IL-1"), interleukin-2
("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophase colony
stimulating factor ("GM-CSF"), granulocyte colony stimulating
factor ("G-CSF"), or other growth factors.
[0475] Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0476] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Amon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62:119-58 (1982).
[0477] Alternatively, an antibody can be conjugated to a second
antibody to form an antibody heteroconjugate as described by Segal
in U.S. Pat. No. 4,676,980, which is incorporated herein by
reference in its entirety.
[0478] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) and/or cytokine(s) can be used as a therapeutic.
[0479] Assays for Antibody Binding
[0480] The antibodies of the invention may be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, protein
A immunoassays, to name but a few. Such assays are routine and well
known in the art (see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York, which is incorporated by reference herein in its
entirety). Exemplary immunoassays are described briefly below (but
are not intended by way of limitation).
[0481] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 14 hours) at
4.degree. C., adding protein A and/or protein G sepharose beads to
the cell lysate, incubating for about an hour or more at 4.degree.
C., washing the beads in lysis buffer and resuspending the beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.16.1.
[0482] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
32P or 125I) diluted in blocking buffer, washing the membrane in
wash buffer, and detecting the presence of the antigen. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected and to reduce the
background noise. For further discussion regarding western blot
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.8.1.
[0483] ELISAs comprise preparing antigen, coating the well of a 96
well microtiter plate with the antigen, adding the antibody of
interest conjugated to a detectable compound such as an enzymatic
substrate (e.g., horseradish peroxidase or alkaline phosphatase) to
the well and incubating for a period of time, and detecting the
presence of the antigen. In ELISAs the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound may be added to the well.
Further, instead of coating the well with the antigen, the antibody
may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the
addition of the antigen of interest to the coated well. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York at 11.2.1.
[0484] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimmunoassay comprising the incubation of labeled
antigen (e.g., 3H or 125I) with the antibody of interest in the
presence of increasing amounts of unlabeled antigen, and the
detection of the antibody bound to the labeled antigen. The
affinity of the antibody of interest for a particular antigen and
the binding off-rates can be determined from the data by scatchard
plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is
incubated with antibody of interest is conjugated to a labeled
compound (e.g., 3H or 125I) in the presence of increasing amounts
of an unlabeled second antibody.
[0485] Therapeutic Uses
[0486] The present invention is further directed to antibody-based
therapies which involve administering antibodies of the invention
to an animal, preferably a mammal, and most preferably a human,
patient for treating one or more of the described disorders.
Therapeutic compounds of the invention include, but are not limited
to, antibodies of the invention (including fragments, analogs and
derivatives thereof as described herein) and nucleic acids encoding
antibodies of the invention (including fragments, analogs and
derivatives thereof as described herein). The antibodies of the
invention may be agonists or antagonists of TR13 and/or TR14. The
antibodies of the invention can be used to treat, inhibit or
prevent diseases and disorders associated with aberrant expression
and/or activity of polypeptides of the invention, including, but
not limited to, cancers and immune disorders. The treatment and/or
prevention of diseases and disorders associated with aberrant
expression and/or activity of a polypeptide of the invention
includes, but is not limited to, alleviating symptoms associated
with those diseases and disorders. Antibodies of the invention may
be provided in pharmaceutically acceptable compositions as known in
the art or as described herein. Antibodies that agonize the TR13
and/or TR14 receptor can be used to ameliorate or treat biological
activities associated with epithelial cell proliferation, tooth
development, growth of mucosal layers, and the growth of epithelial
surfaces, including hair folicles, sweat glands, basal cells, and
dermis. Accordingly, TR13 and/or TR14 agonistic antibodies may be
used in the treatment of diseases and/or disorders relating to the
epithelium (e.g., anhidrotic ectodermal dysplasia, hidrotic
ectodermal dysplasia, sweat gland disorders, venous ulcers,
psoriasis, prickly heat disorder, wounds healing, cancers of
epithelial origins, male pattern baldness, and/or as described
under "Epithelial Cell Proliferation and Wound Healing" below).
Furthermore antibodies that antagonize the TR13 and/or TR14
receptor can be used to ameliorate or treat biological activities
associated with epithelial cell proliferation, tooth development,
growth of mucosal layers, and the growth of epithelial surfaces,
including hair folicles, sweat glands, basal cells, and dermis.
Accordingly, TR13 and/or TR14 antagonistic antibodies may be used
in the treatment of diseases and/or disorders relating to the
epithelium (e.g., anhidrotic ectodermal dysplasia, hidrotic
ectodermal dysplasia, sweat gland disorders, venous ulcers,
psoriasis, prickly heat disorder, wounds healing, cancers of
epithelial origins, male pattern baldness, and/or as described
under "Epithelial Cell Proliferation and Wound Healing" below).
[0487] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0488] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors
(such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number or activity of effector cells which interact
with the antibodies.
[0489] The antibodies of the invention may be administered alone or
in combination with other types of treatments (e.g., radiation
therapy, chemotherapy, hormonal therapy, immunotherapy and
anti-tumor agents). Generally, administration of products of a
species origin or species reactivity (in the case of antibodies)
that is the same species as that of the patient is preferred. Thus,
in a preferred embodiment, human antibodies, fragments derivatives,
analogs, or nucleic acids, are administered to a human patient for
therapy or prophylaxis.
[0490] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of disorders
related to polynucleotides or polypeptides, including fragments
thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or
polypeptides, including fragments thereof. Preferred binding
affinities include those with a dissociation constant or Kd less
than 5.times.10-6 M, 10-6 M, 5.times.10-7 M, 10-7 M, 5.times.10-8
M, and 10-8 M. Even more preferred binding affinities include those
with a dissociation constant or Kd less than 5.times.10-9 M, 10-9
M, 5.times.10-10 M, 10-10 M, 5.times.10-11 M, 10-11 M,
5.times.10-12 M, 10-12 M, 5.times.10-13 M, 10-13 M, 5.times.10-14
M, 10-14 M, 5.times.10-15 M, and 10-15 M.
[0491] Gene Therapy
[0492] In a specific embodiment, nucleic acids comprising sequences
encoding antibodies or functional derivatives thereof, are
administered to treat, inhibit or prevent a disease or disorder
associated with aberrant expression and/or activity of a
polypeptide of the invention, by way of gene therapy. Gene therapy
refers to therapy performed by the administration to a subject of
an expressed or expressible nucleic acid. In this embodiment of the
invention, the nucleic acids produce their encoded protein that
mediates a therapeutic effect.
[0493] Any of the methods for gene therapy available in the art can
be used according to the present invention. Exemplary methods are
described below.
[0494] For general reviews of the methods of gene therapy, see
Goldspiel et al., 1993, Clinical Pharmacy 12:488-505; Wu and Wu,
1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol.
Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and
Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May,
1993, TIBTECH 11(5):155-215). Methods commonly known in the art of
recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), 1993, Current Protocols in Molecular
Biology, John Wiley & Sons, NY; and Kriegler, 1990, Gene
Transfer and Expression, A Laboratory Manual, Stockton Press,
NY.
[0495] In a preferred aspect, the compound comprises nucleic acid
sequences encoding an antibody, said nucleic acid sequences being
part of expression vectors that express the antibody or fragments
or chimeric proteins or heavy or light chains thereof in a suitable
host. In particular, such nucleic acid sequences have promoters
operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue-specific. In
another particular embodiment, nucleic acid molecules are used in
which the antibody coding sequences and any other desired sequences
are flanked by regions that promote homologous recombination at a
desired site in the genome, thus providing for intrachromosomal
expression of the antibody nucleic acids (Koller and Smithies,
1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijistra et al.,
1989, Nature 342:435-438). In specific embodiments, the expressed
antibody molecule is a single chain antibody; alternatively, the
nucleic acid sequences include sequences encoding both the heavy
and light chains, or fragments thereof, of the antibody.
[0496] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0497] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, 1987, J. Biol. Chem. 262:4429-4432) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180 dated Apr. 16, 1992 (Wu et al.); WO 92/22635 dated Dec.
23, 1992 (Wilson et al.); WO92/20316 dated Nov. 26, 1992 (Findeis
et al.); WO93/14188 dated Jul. 22, 1993 (Clarke et al.), WO93/20221
dated Oct. 14, 1993 (Young)). Alternatively, the nucleic acid can
be introduced intracellularly and incorporated within host cell DNA
for expression, by homologous recombination (Koller and Smithies,
1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al.,
1989, Nature 342:435-438).
[0498] In a specific embodiment, viral vectors that contains
nucleic acid sequences encoding an antibody of the invention are
used. For example, a retroviral vector can be used (see Miller et
al., 1993, Meth. Enzymol. 217:581-599). These retroviral vectors
have been to delete retroviral sequences that are not necessary for
packaging of the viral genome and integration into host cell DNA.
The nucleic acid sequences encoding the antibody to be used in gene
therapy are cloned into one or more vectors, which facilitates
delivery of the gene into a patient. More detail about retroviral
vectors can be found in Boesen et al., 1994, Biotherapy 6:291-302,
which describes the use of a retroviral vector to deliver the mdr1
gene to hematopoietic stem cells in order to make the stem cells
more resistant to chemotherapy. Other references illustrating the
use of retroviral vectors in gene therapy are: Clowes et al., 1994,
J. Clin. Invest. 93:644-651; Kiem et al., 1994, Blood 83:1467-1473;
Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-141; and
Grossman and Wilson, 1993, Curr. Opin. in Genetics and Devel.
3:110-114.
[0499] Adenoviruses are other viral vectors that can be used in
gene therapy. Adenoviruses are especially attractive vehicles for
delivering genes to respiratory epithelia. Adenoviruses naturally
infect respiratory epithelia where they cause a mild disease. Other
targets for adenovirus-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. Kozarsky and Wilson, 1993, Current Opinion in Genetics and
Development 3:499-503 present a review of adenovirous-based gene
therapy. Bout et al., 1994, Human Gene Therapy 5:3-10 demonstrated
the use of adenovirus vectors to transfer genes to the respiratory
epithelia of rhesus monkeys. Other instances of the use of
adenoviruses in gene therapy can be found in Rosenfeld et al.,
1991, Science 252:431-434; Rosenfeld et al., 1992, Cell 68:143-155;
Mastrangeli et al., 1993, J. Clin. Invest. 91:225-234; PCT
Publication WO94/12649; and Wang, et al., 1995, Gene Therapy
2:775-783. In a preferred embodiment, adenovirus vectors are
used.
[0500] Adeno-associated virus (AAV) has also been proposed for use
in gene therapy (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med.
204:289-300. Patent No. 5,436,146).
[0501] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0502] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr, 1993, Meth. Enzymol. 217:599-618; Cohen et
al., 1993, Meth. Enzymol. 217:618-644; Cline, 1985, Pharmac. Ther.
29:69-92) and may be used in accordance with the present invention,
provided that the necessary developmental and physiological
functions of the recipient cells are not disrupted. The technique
should provide for the stable transfer of the nucleic acid to the
cell, so that the nucleic acid is expressible by the cell and
preferably heritable and expressible by its cell progeny.
[0503] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0504] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as Tlymphocytes, Blymphocytes,
monocytes, macrophages, neutrophils, cosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0505] In a preferred embodiment, the cell used for gene therapy is
autologous to the patient.
[0506] In an embodiment in which recombinant cells are used in gene
therapy, nucleic acid sequences encoding an antibody are introduced
into the cells such that they are expressible by the cells or their
progeny, and the recombinant cells are then administered in vivo
for therapeutic effect. In a specific embodiment, stem or
progenitor cells are used. Any stem and/or progenitor cells which
can be isolated and maintained in vitro can potentially be used in
accordance with this embodiment of the present invention (see e.g.
PCT Publication WO 94/08598, dated Apr. 28, 1994; Stemple and
Anderson, 1992, Cell 71:973-985; Rheinwald, 1980, Meth. Cell Bio.
21A:229; and Pittelkow and Scott, 1986, Mayo Clinic Proc.
61:771).
[0507] In a specific embodiment, the nucleic acid to be introduced
for purposes of gene therapy comprises an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by controlling the presence or absence
of the appropriate inducer of transcription.
[0508] Demonstration of Therapeutic or Prophylactic Activity
[0509] The compounds or pharmaceutical compositions of the
invention are preferably tested in vitro, and then in vivo for the
desired therapeutic or prophylactic activity, prior to use in
humans. For example, in vitro assays to demonstrate the therapeutic
or prophylactic utility of a compound or pharmaceutical composition
include, the effect of a compound on a cell line or a patient
tissue sample. The effect of the compound or composition on the
cell line and/or tissue sample can be determined utilizing
techniques known to those of skill in the art including, but not
limited to, rosette formation assays and cell lysis assays. In
accordance with the invention, in vitro assays which can be used to
determine whether administration of a specific compound is
indicated, include in vitro cell culture assays in which a patient
tissue sample is grown in culture, and exposed to or otherwise
administered a compound, and the effect of such compound upon the
tissue sample is observed.
[0510] Therapeutic/Prophylactic Administration and Composition
[0511] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of a compound or pharmaceutical composition of the invention,
preferably an antibody of the invention. In a preferred aspect, the
compound is substantially purified (e.g., substantially free from
substances that limit its effect or produce undesired
side-effects). The subject is preferably an animal, including but
not limited to animals such as cows, pigs, horses, chickens, cats,
dogs, etc., and is preferably a mammal, and most preferably
human.
[0512] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid or an
immunoglobulin are described above; additional appropriate
formulations and routes of administration can be selected from
among those described herein below.
[0513] Various delivery systems are known and can be used to
administer a compound of the invention, e.g., encapsulation in
liposomes, microparticles, microcapsules, recombinant cells capable
of expressing the compound, receptor-mediated endocytosis (see,
e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction
of a nucleic acid as part of a retroviral or other vector, etc.
Methods of introduction include but are not limited to intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural, and oral routes. The compounds or
compositions may be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and may be administered together with
other biologically active agents. Administration can be systemic or
local. In addition, it may be desirable to introduce the
pharmaceutical compounds or compositions of the invention into the
central nervous system by any suitable route, including
intraventricular and intrathecal injection; intraventricular
injection may be facilitated by an intraventricular catheter, for
example, attached to a reservoir, such as an Ommaya reservoir.
Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing
agent.
[0514] In a specific embodiment, it may be desirable to administer
the pharmaceutical compounds or compositions of the invention
locally to the area in need of treatment; this may be achieved by,
for example, and not by way of limitation, local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers. Preferably, when
administering a protein, including an antibody, of the invention,
care must be taken to use materials to which the protein does not
absorb.
[0515] In another embodiment, the compound or composition can be
delivered in a vesicle, in particular a liposome (see Langer, 1990,
Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of
Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.),
Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp.
317-327; see generally ibid.)
[0516] In yet another embodiment, the compound or composition can
be delivered in a controlled release system. In one embodiment, a
pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref.
Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek
et al., 1989, N. Engl. J. Med. 321:574). In another embodiment,
polymeric materials can be used (see Medical Applications of
Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton,
Fla. (1974); Controlled Drug Bioavailability, Drug Product Design
and Performance, Smolen and Ball (eds.), Wiley, New York (1984);
Ranger and Peppas, J., 1983, Macromol. Sci. Rev. Macromol. Chem.
23:61; see also Levy et al., 1985, Science 228:190; During et al.,
1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg.
71:105). In yet another embodiment, a controlled release system can
be placed in proximity of the therapeutic target, i.e., the brain,
thus requiring only a fraction of the systemic dose (see, e.g.,
Goodson, in Medical Applications of Controlled Release, supra, vol.
2, pp. 115-138 (1984)).
[0517] Other controlled release systems are discussed in the review
by Langer (1990, Science 249:1527-1533).
[0518] In a specific embodiment where the compound of the invention
is a nucleic acid encoding a protein, the nucleic acid can be
administered in vivo to promote expression of its encoded protein,
by constructing it as part of an appropriate nucleic acid
expression vector and administering it so that it becomes
intracellular, e.g., by use of a retroviral vector (see U.S. Pat.
No. 4,980,286), or by direct injection, or by use of microparticle
bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with
lipids or cell-surface receptors or transfecting agents, or by
administering it in linkage to a homeobox-like peptide which is
known to enter the nucleus (see e.g., Joliot et al., 1991, Proc.
Natl. Acad. Sci. USA 88:1864-1868), etc. Alternatively, a nucleic
acid can be introduced intracellularly and incorporated within host
cell DNA for expression, by homologous recombination.
[0519] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of a compound, and a pharmaceutically acceptable
carrier. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulation can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, etc. Examples of suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
Such compositions will contain a therapeutically effective amount
of the compound, preferably in purified form, together with a
suitable amount of carrier so as to provide the form for proper
administration to the patient. The formulation should suit the mode
of administration.
[0520] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0521] The compounds of the invention can be formulated as neutral
or salt forms. Pharmaceutically acceptable salts include those
formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0522] The amount of the compound of the invention which will be
effective in the treatment, inhibition and prevention of a disease
or disorder associated with aberrant expression and/or activity of
a polypeptide of the invention can be determined by standard
clinical techniques. In addition, in vitro assays may optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or disorder, and
should be decided according to the judgment of the practitioner and
each patient's circumstances. Effective doses may be extrapolated
from dose-response curves derived from in vitro or animal model
test systems.
[0523] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies of the invention may
be reduced by enhancing uptake and tissue penetration (e.g., into
the brain) of the antibodies by modifications such as, for example,
lipidation.
[0524] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
[0525] Diagnosis and Imaging
[0526] Labeled antibodies, and derivatives and analogs thereof,
which specifically bind to a polypeptide of interest can be used
for diagnostic purposes to detect, diagnose, or monitor diseases
and/or disorders associated with the aberrant expression and/or
activity of a polypeptide of the invention. The invention provides
for the detection of aberrant expression of a polypeptide of
interest, comprising (a) assaying the expression of the polypeptide
of interest in cells or body fluid of an individual using one or
more antibodies specific to the polypeptide interest and (b)
comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of aberrant expression.
[0527] The invention provides a diagnostic assay for diagnosising a
disorder, comprising (a) assaying the expression of the polypeptide
of interest in cells or body fluid of an individual using one or
more antibodies specific to the polypeptide interest and (b)
comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of a particular disorder. With
respect to cancer, the presence of a relatively high amount of
transcript in biopsied tissue from an individual may indicate a
predisposition for the development of the disease, or may provide a
means for detecting the disease prior to the appearance of actual
clinical symptoms. A more definitive diagnosis of this type may
allow health professionals to employ preventative measures or
aggressive treatment earlier thereby preventing the development or
further progression of the cancer.
[0528] Antibodies of the invention can be used to assay protein
levels in a biological sample using classical immunohistological
methods known to those of skill in the art (e.g., see Jalkanen, M.,
et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J.
Cell. Biol. 105:3087-3096 (1987)). Other antibody-based methods
useful for detecting protein gene expression include immunoassays,
such as the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase;
radioisotopes, such as iodine (.sup.131I, .sup.125I, .sup.123I,
.sup.121I), carbon (.sup.14C), sulfur (.sup.35S), tritium
(.sup.3H), indium (.sup.115mIn, .sup.113mIn, .sup.112In,
.sup.111In), and technetium (.sup.99Tc, .sup.99mTc), thallium
(.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine
(.sup.18F), .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149 Pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, .sup.97Ru;
luminescent labels, such as luminol; and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
[0529] One aspect of the invention is the detection and diagnosis
of a disease or disorder associated with aberrant expression of a
polypeptide of the interest in an animal, preferably a mammal and
most preferably a human. In one embodiment, diagnosis comprises: a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an effective amount of a labeled
molecule which specifically binds to the polypeptide of interest;
b) waiting for a time interval following the administering for
permitting the labeled molecule to preferentially concentrate at
sites in the subject where the polypeptide is expressed (and for
unbound labeled molecule to be cleared to background level); c)
determining background level; and d) detecting the labeled molecule
in the subject, such that detection of labeled molecule above the
background level indicates that the subject has a particular
disease or disorder associated with aberrant expression of the
polypeptide of interest. Background level can be determined by
various methods including, comparing the amount of labeled molecule
detected to a standard value previously determined for a particular
system.
[0530] It will be understood in the art that the size of the
subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of
a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20
millicuries of 99 mTc. The labeled antibody or antibody fragment
will then preferentially accumulate at the location of cells which
contain the specific protein. In vivo tumor imaging is described in
S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled
Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The
Radiochemical Detection of Cancer, S. W. Burchiel and B. A, Rhodes,
eds., Masson Publishing Inc. (1982).
[0531] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0532] In an embodiment, monitoring of the disease or disorder is
carried out by repeating the method for diagnosing the disease or
disease, for example, one month after initial diagnosis, six months
after initial diagnosis, one year after initial diagnosis, etc.
[0533] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0534] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patent using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
[0535] Kits
[0536] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises an antibody of
the invention, preferably a purified antibody, in one or more
containers. In a specific embodiment, the kits of the present
invention contain a substantially isolated polypeptide comprising
an epitope which is specifically immunoreactive with an antibody
included in the kit. Preferably, the kits of the present invention
further comprise a control antibody which does not react with the
polypeptide of interest. In another specific embodiment, the kits
of the present invention contain a means for detecting the binding
of an antibody to a polypeptide of interest (e.g., the antibody may
be conjugated to a detectable substrate such as a fluorescent
compound, an enzymatic substrate, a radioactive compound or a
luminescent compound, or a second antibody which recognizes the
first antibody may be conjugated to a detectable substrate).
[0537] In another specific embodiment of the present invention, the
kit is a diagnostic kit for use in screening serum containing
antibodies specific against proliferative and/or cancerous
polynucleotides and polypeptides. Such a kit may include a control
antibody that does not react with the polypeptide of interest. Such
a kit may include a substantially isolated polypeptide antigen
comprising an epitope which is specifically immunoreactive with at
least one anti-polypeptide antigen antibody. Further, such a kit
includes means for detecting the binding of said antibody to the
antigen (e.g., the antibody may be conjugated to a fluorescent
compound such as fluorescein or rhodamine which can be detected by
flow cytometry). In specific embodiments, the kit may include a
recombinantly produced or chemically synthesized polypeptide
antigen. The polypeptide antigen of the kit may also be attached to
a solid support.
[0538] In a more specific embodiment the detecting means of the
above-described kit includes a solid support to which said
polypeptide antigen is attached. Such a kit may also include a
non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of the antibody to the polypeptide antigen can
be detected by binding of the said reporter-labeled antibody.
[0539] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing antigens of
the polypeptide of the invention. The diagnostic kit includes a
substantially isolated antibody specifically immunoreactive with
polypeptide or polynucleotide antigens, and means for detecting the
binding of the polynucleotide or polypeptide antigen to the
antibody. In one embodiment, the antibody is attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal
antibody. The detecting means of the kit may include a second,
labeled monoclonal antibody. Alternatively, or in addition, the
detecting means may include a labeled, competing antigen.
[0540] In one diagnostic configuration, test serum is reacted with
a solid phase reagent having a surface-bound antigen obtained by
the methods of the present invention. After binding with specific
antigen antibody to the reagent and removing unbound serum
components by washing, the reagent is reacted with reporter-labeled
anti-human antibody to bind reporter to the reagent in proportion
to the amount of bound anti-antigen antibody on the solid support.
The reagent is again washed to remove unbound labeled antibody, and
the amount of reporter associated with the reagent is determined.
Typically, the reporter is an enzyme which is detected by
incubating the solid phase in the presence of a suitable
fluorometric, luminescent or calorimetric substrate (Sigma, St.
Louis, Mo.).
[0541] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated antigen(s).
[0542] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound
anti-antigen antibody.
[0543] Therapeutics
[0544] The Tumor Necrosis Factor (TNF) family ligands are known to
be among the most pleiotropic cytokines, inducing a large number of
cellular responses, including cytotoxicity, anti-viral activity,
immunoregulatory activities, and the transcriptional regulation of
several genes (D. V. Goeddel et al., "Tumor Necrosis Factors: Gene
Structure and Biological Activities," Symp. Quant. Biol. 51:597-609
(1986), Cold Spring Harbor; B. Beutler and A. Cerami, Annu. Rev.
Biochem. 57:505-518 (1988); L. J. Old, Sci. Am. 258:59-75 (1988);
W. Fiers, FEBS Lett. 285:199-224 (1991)). The TNF-family ligands
induce such various cellular responses by binding to TNF-family
receptors.
[0545] Epithilial Disorder-Related Therapeutic Embodiments for TR13
and/or TR14
[0546] TR13 and/or TR14 polynucleotides or polypeptides, or
agonists or antagonists of the present invention, can be used in
assays to test for one or more biological activities. If these
polynucleotides or polypeptides, or agonists or antagonists of the
present invention, do exhibit activity in a particular assay, it is
likely that these molecules may be involved in the diseases
associated with the biological activity. Thus, the polynucleotides
and polypeptides, and agonists or antagonists could be used to
treat the associated disease.
[0547] TR13 inhibits survival and/or proliferation of epithelial
cells such as, for example, HEK 293T cells. See Example 37 and FIG.
12. Thus, Tr13 polynucleotides, polypeptides, antibodies, and
agonists or antagonists of the present invention may be used to
detect, diagnose, prognose, treat, prevent and/or ameliorate
diseases, disorders, and/or conditions associated with and/or due
to aberrant epithelial cell survival and/or proliferation.
[0548] TR14 polynucleotides and translation products are believed
to be involved in further biological activities associated with
tooth development, growth of mucosal layers, and the growth of
epithelial surfaces, including hair folicles, sweat glands, basal
cells, and dermis. Accordingly, compositions of the invention
(including polynucleotides, polypeptides and antibodies of the
invention, and fragments and variants thereof) may be used in the
diagnosis, detection and/or treatment of diseases and/or disorders
associated with aberrant TR13 and/or TR14 activity. In preferred
embodiments, compositions of the invention (including TR13 and/or
TR14 polynucleotides, polypeptides and TR13 and/or TR14 agonists or
antagonists, including peptides and antibodies of the invention,
and fragments and variants thereof) may be used in the diagnosis,
detection and/or treatment of diseases and/or disorders relating to
the epithelium (e.g., anhidrotic ectodermal dysplasia, hidrotic
ectodermal dysplasia, sweat gland disorders, venous ulcers,
psoriasis, prickly heat disorder, wounds healing, cancers of
epithelial origins, male pattern baldness, and/or as described
under "Epithelial Cell Proliferation and Wound Healing" below).
Thus, polynucleotides, translation products and antibodies of the
invention are useful in the diagnosis, detection and/or treatment
of diseases and/or disorders associated with activities that
include, but are not limited to, diseases and/or disorders of the
epithelium and epithelial cell proliferation diseases and/or
disorders.
[0549] More generally, polynucleotides, translation products and
antibodies corresponding to this gene may be useful for the
diagnosis, detection and/or treatment of diseases and/or disorders
associated with the following systems.
[0550] Epithelial Cell Proliferation and Wound Healing
[0551] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing
polynucleotides or translation products, as well as agonists or
antagonists of the present invention, for therapeutic purposes, for
example, to stimulate epithelial cell proliferation and basal
keratinocytes for the purpose of wound healing, and to stimulate
hair follicle production and healing of dermal wounds.
Polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, may be clinically useful in stimulating
wound healing including surgical wounds, excisional wounds, deep
wounds involving damage of the dermis and epidermis, eye tissue
wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers,
dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis
ulcers, burns resulting from heat exposure or chemicals, and other
abnormal wound healing conditions such as uremia, malnutrition,
vitamin deficiencies and complications associted with systemic
treatment with steroids, radiation therapy and antineoplastic drugs
and antimetabolites. Polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
promote dermal reestablishment subsequent to dermal loss.
[0552] In specific, preferred embodiments, TR13 and/or TR14
polynucleotides and polypeptides, antibodies thereto, as well as
agonists or antagonists thereof (as described in the section on
Antibodies, above), stimulate epithelial cell proliferation and/or
development to ameliorate the diseases and disorders described in
this section. Members of the TNF family of proteins are known to
signal through the NF-.kappa.B singaling pathway. NF-.kappa.B is a
transcription factor activated by a wide certain agents to
stimulate cell activation and differentiation. It is believed that
the TR14 receptor of the instant invention signals through the
NF-.kappa.B pathway to activate proliferation and development of
cells. Thus, TR14 polynucleotides and polypeptides of the invention
as well as antibodies and peptides that agonize TR14 may be used in
accordance with the invention to stimulate NF-.kappa.B-mediated
epithelial cell proliferation, and thereby treat the epithelial
disorders described above.
[0553] It is believed that TR13 and/or TR14 polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention, will also produce changes in hepatocyte proliferation,
and epithelial cell proliferation in the lung, breast, pancreas,
stomach, small intesting, and large intestine. Polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention, could promote proliferation of epithelial cells such as
sebocytes, hair follicles, hepatocytes, type II pneumocytes,
mucin-producing goblet cells, and other epithelial cells and their
progenitors contained within the skin, lung, liver, and
gastrointestinal tract. Polynucleotides or polypeptides, agonists
or antagonists of the present invention, may promote proliferation
of endothelial cells, keratinocytes, and basal keratinocytes.
[0554] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could be used to increase the
adherence of skin grafts to a wound bed and to stimulate
re-epithelialization from the wound bed. The following are types of
grafts that polynucleotides or polypeptides, agonists or
antagonists of the present invention, could be used to increase
adherence to a wound bed: autografts, artificial skin, allografts,
autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown
grafts, bone graft, brephoplastic grafts, cutis graft, delayed
graft, dermic graft, epidermic graft, fascia graft, full thickness
graft, heterologous graft, xenograft, homologous graft,
hyperplastic graft, lamellar graft, mesh graft, mucosal graft,
Ollier-Thiersch graft, omenpal graft, patch graft, pedicle graft,
penetrating graft, split skin graft, thick split graft.
Polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, can be used to promote skin strength and
to improve the appearance of aged skin.
[0555] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could also be used to reduce
the side effects of gut toxicity that result from radiation,
chemotherapy treatments or viral infections. Polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention, may have a cytoprotective effect on the small intestine
mucosa. Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, may also stimulate healing of
mucositis (mouth ulcers) that result from chemotherapy and viral
infections.
[0556] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could further be used in full
regeneration of skin in full and partial thickness skin defects,
including burns, (i.e., repopulation of hair follicles, sweat
glands, and sebaceous glands), treatment of other skin defects such
as psoriasis. Polynucleotides or polypeptides, as well as agonists
or antagonists of the present invention, could be used to treat
epidermolysis bullosa, a defect in adherence of the epidermis to
the underlying dermis which results in frequent, open and painful
blisters by accelerating reepithelialization of these lesions.
Polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, could also be used to treat gastric and
doudenal ulcers and help heal by scar formation of the mucosal
lining and regeneration of glandular mucosa and duodenal mucosal
lining more rapidly. Inflamamatory bowel diseases, such as Crohn's
disease and ulcerative colitis, are diseases which result in
destruction of the mucosal surface of the small or large intestine,
respectively. Thus, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
promote the resurfacing of the mucosal surface to aid more rapid
healing and to prevent progression of inflammatory bowel disease.
Treatment with polynucleotides or polypeptides, agonists or
antagonists of the present invention, is expected to have a
significant effect on the production of mucus throughout the
gastrointestinal tract and could be used to protect the intestinal
mucosa from injurious substances that are ingested or following
surgery. Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could be used to treat
diseases associate with the under expression.
[0557] Moreover, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
prevent and heal damage to the lungs due to various pathological
states. Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, which could stimulate
proliferation and differentiation and promote the repair of alveoli
and brochiolar epithelium to prevent or treat acute or chronic lung
damage. For example, emphysema, which results in the progressive
loss of aveoli, and inhalation injuries, i.e., resulting from smoke
inhalation and burns, that cause necrosis of the bronchiolar
epithelium and alveoli could be effectively treated using
polynucleotides or polypeptides, agonists or antagonists of the
present invention. Also, polynucleotides or polypeptides, as well
as agonists or antagonists of the present invention, could be used
to stimulate the proliferation of and differentiation of type II
pneumocytes, which may help treat or prevent disease such as
hyaline membrane diseases, such as infant respiratory distress
syndrome and bronchopulmonary displasia, in premature infants.
[0558] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could stimulate the
proliferation and differentiation of hepatocytes and, thus, could
be used to alleviate or treat liver diseases and pathologies such
as fulminant liver failure caused by cirrhosis, liver damage caused
by viral hepatitis and toxic substances (i.e., acetaminophen,
carbon tetraholoride and other hepatotoxins known in the art).
[0559] In addition, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used
treat or prevent the onset of diabetes mellitus. In patients with
newly diagnosed Types I and II diabetes, where some islet cell
function remains, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
maintain the islet function so as to alleviate, delay or prevent
permanent manifestation of the disease. Also, polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention, could be used as an auxiliary in islet cell
transplantation to improve or promote islet cell function.
[0560] Additional Therapeutic Embodiments
[0561] TR13 nucleic acids, polypeptides (proteins), agonists and/or
antagonists of the invention may be administered to a patient
(e.g., mammal, preferably human) afflicted with any disease or
disorder mediated (directly or indirectly) by defective, or
deficient levels of, TR13. Alternatively, a gene therapy approach
may be applied to treat such diseases or disorders. In one
embodiment of the invention, TR13 polynucleotide sequences are used
to detect mutein TR13 genes, including defective genes. Mutein
genes may be identified in in vitro diagnostic assays using
techniques known in the art, and by comparison of the TR13
nucleotide sequence disclosed herein with that of a TR13 gene
obtained from a patient suspected of harboring a defect in this
gene. Defective genes may be replaced with normal TR13-encoding
genes using techniques known to one skilled in the art.
[0562] In another embodiment, the TR13 polypeptides, nucleic acids,
agonists and/or antagonists of the present invention are used as
research tools for studying the phenotypic effects that result from
inhibiting TR13/TR13 ligand (e.g., Tr13/Fas ligand and/or
TR13/AIM-II) interactions on various cell types. TR13 polypeptides
and antagonists (e.g. monoclonal antibodies to TR13) also may be
used in in vitro assays for detecting TR13 or TR13 ligand(s) or the
interactions thereof.
[0563] In another embodiment, a purified TR13 polypeptide of the
invention is used to inhibit binding of Fas ligand and/or AIM-II
(i.e., "LIGHT") to endogenous cell surface Fas ligand and/or AIM-II
receptors. Certain ligands of the TNF family (of which Fas ligand
and AIM-II are members) have been reported to bind to more than one
distinct cell surface receptor protein. AIM-II likewise is believed
to bind multiple cell surface proteins. By binding Fas ligand
and/or AIM-II, soluble TR13 polypeptides and TR13 fusion
polypeptides of the present invention may be employed to inhibit
the binding of Fas ligand and/or AIM-II not only to endogenous
TR13, but also to Fas ligand and AIM-II receptor proteins that are
distinct from TR13. Thus, in another embodiment, TR13 and TR13
fusion proteins are used to inhibit a biological activity of Fas
ligand and/or AIM-II, in in vitro or in vivo procedures. By
inhibiting binding of Fas ligand and/or AIM-II to cell surface
receptors, TR13 polypeptides of the invention also inhibit
biological effects that result from the binding of Fas ligand
and/or AIM-II to endogenous receptors. Various forms of TR13 may be
employed, including, for example, the above-described TR13
fragments, derivatives, and variants, including fusion proteins,
that are capable of binding Fas ligand and/or AIM-II. In a
preferred embodiment, a soluble TR13 polypeptide of the invention
is administered to inhibit a biological activity of Fas ligand
and/or AIM-II, e.g., to inhibit Fas ligand-mediated and/or
AIM-II-mediated apoptosis of cells susceptible to such
apoptosis.
[0564] In a further embodiment, a TR13 polypeptide of the invention
is administered to a mammal to treat a Fas ligand-mediated and/or
AIM-II-mediated disorder. Such Fas ligand-mediated and/or
AIM-II-mediated (e.g., a human) disorders include conditions caused
(directly or indirectly) or exacerbated by Fas ligand and/or
AIM-II.
[0565] There are numerous autoimmune diseases in which FasL/Fas
interactions play a role. In patients experiencing GVHD, serum
levels of FasL were abnormally high as was the number of FasL.sup.+
T cells. The CNS plaques from patients with MS have been shown to
express high levels of Fas and FasL. This is particularly
significant since Fas and FasL expression is normally absent in the
mature CNS. As with NOD mice, patients with IDDM have a
superabundance of FasL.sup.+ T cells associated with their islet
cells. As evidence of FasL/Fas mediated cell killing, patients with
chronic renal failure have been reported to have a 50 fold increase
in the number of apoptotic nephrons compared to normal. This has
been ascribed to renal tubule epithelial cell expression of both
FasL and Fas, leading to cellular fratricide. In the joints of
rheumatoid arthritic patients, activated T cells expressing FasL
are seen in conjunction with Fas expressing chondrocytes. In
ulcerative colitis (UC), Fas expression is observed on colonic
epithelial cells, and FasL on lamina propria lymphocytes. This lead
to the observation that FasL positive lymphocytes are present only
in the lamina propria of UC patients with active lesions but not in
tissues from inactive UC patients.
[0566] Two clinical indications in which the role of FasL-mediated
killing is most apparent are myelodisplastic syndrome (MDS) and the
neutropenia associated with large granular lymphocyte (LGL)
leukemia. In MDS, bone marrow hematopoetic cells suffer an
abnormally high level of apoptosis, associated with the
upregulation of bone marrow Fas expression and lymphocyte FasL
expression. The neutropenia seen in patients with LGL leukemia has
been attributed to the high levels of circulating serum FasL. When
leukemic LGL serum was incubated in vitro for 24 hours with normal
neutrophils, the degree of apoptosis significantly increased above
that of cells incubated with normal serum.
[0567] As described in detail in Example 35, below, TR13-Fc may be
administered to inhibit FasL-mediated killing. Thus, the
FasL-associated disorders listed above may be treated and/or
prevented, in accordance with the invention, through administration
of the TR13-containing polypeptides, including TR13-human serim
albumin fusions, and polynucleotides desribed herein.
[0568] Suitable animal models for examining the effectiveness of
TR13 in treating disease include but are not limited to mouse
models of graft versus host disease (GVHD), murine allergic
encephalomyelitis (EAE), an assay used as a central nervous system
(CNS) model of multiple sclerosis (MS); non-obese diabetic (NOD)
mouse model of insulin-dependant diabetes mellitus (IDDM), which is
characterized by FasL+T cell destruction of islet cells, while Fas
NOD mice fail to develop diabetes. NOD mice can also be used to
model Sjogren's disease, since apoptosis in the salivary and
lacrimal glands of these mice has been reported. In a mouse model
of chronic renal failure, ROP-Os/+ mice developed spontaneous
tubular atrophy and renal failure correlated with upregulation of
Fas and FasL in these tissues. The invention encompasses the
treatment and prevention of the human disesases corresonding to
these animal models, through administration of the TR13
polypeptides and polynucleotides of the present invention.
[0569] In addition, TR13 may bind to LIGHT (AIM-II) (International
application publication number WO 97/34911, published Sep. 25,
1997)), a regulator of T cell function. As detailed in Example 36,
below, TR13-Fc may be tested for its ability to ameliorate the
effects of transplantation, including the inhibition of transplant
or graft rejection and the inhibition of graft versus host disease
(GVHD). The methods encompass the treatment of graft rejection or
GVHD wherein the grafted tissue or organ is one or more of a
variety of tissues and/or organs, including, but not limted to,
heart, lung, kidney, liver, pancreas, islet cells, bone marrow, and
skin.
[0570] Other Fas ligand related disorders that may be prevented or
treated by administering soluble TR13 polypeptides of the invention
of TR13 antigonists include, but are not limited to Graft vs. host
disease, multiple sclerosis, rheumatoid arthritis, chronic renal
failure ulcerative colitis, graft rejection (including acute
allograft rejection), chronic hepatitis, chronic active hepatitis
(HBV and HCV associated), fulminant hepatitis, biliary cirrhosis,
alcoholic liver disease, diabetes (IDDM), HIV infection, AIDS
lymphopenia, heart disease, Alzheimer's disease, myclodysplastic
syndrome (MDS), lupus (SLE), pulmonary fibrosis, Sjogren's,
syndrome, toxic epidermal necrolysis, ocular disease,
thyroid-associated opthalmopathy, stroke, Parkinson's disease,
autoimmune gastritis, rheumatoid arthritis, Hashimoto's
thyroiditis, pulmonary injury, chronic congestive heart failure,
ischemic cardiac injury, proliferative glomerulonephritis, chronic
renal failure, thrombotic thombocytopenic purpura (TTP), tumor
growth; as well as prolonging transgene expression of adenovirus
vector.
[0571] TR14 nucleic acids, polypeptides (proteins), agonists and/or
antagonists of the invention may be administered to a patient
(e.g., mammal, preferably human) afflicted with any disease or
disorder mediated (directly or indirectly) by defective, or
deficient levels of, TR14. Alternatively, a gene therapy approach
may be applied to treat such diseases or disorders. In one
embodiment of the invention, TR14 polynucleotide sequences are used
to detect mutein TR14 genes, including defective genes. Mutein
genes may be identified in in vitro diagnostic assays using
techniques known in the art, and by comparison of the TR14
nucleotide sequence disclosed herein with that of a TR14 gene
obtained from a patient suspected of harboring a defect in this
gene. Defective genes may be replaced with normal TR14-encoding
genes using techniques known to one skilled in the art.
[0572] In another embodiment, the TR4 polypeptides, nucleic acids,
agonists and/or antagonists of the present invention are used as
research tools for studying the phenotypic effects that result from
inhibiting TR14/TR14 ligand interactions on various cell types.
TR14 polypeptides and antagonists (e.g. monoclonal antibodies to
TR14) also may be used in in vitro assays for detecting TR14 or
TR14 ligand(s) or the interactions thereof.
[0573] Cells which express the TR13 polypeptide and are believed to
have a potent cellular response to TR13 ligands (e.g., Fas Ligand)
include pancrease tumor, endometrial tumor, adult small intestine,
colon cancer, breast cancer cell line, resting T-cell, amygdala,
rectum, T-cell helper, pineal gland, apoptotic T-cell, epididymus,
greater omentum, prostate BPH, osteoclastoma, endometrial stromal
cells, stromal cell, substantia nigra, activated T-cell, tonsil,
and testes tissue. By "a cellular response to a TNF-family ligand"
is intended any genotypic, phenotypic, and/or morphologic change to
a cell, cell line, tissue, tissue culture or patient that is
induced by a TNF-family ligand (such as, for example, a TNF-ligand
disclosed herein). As indicated, such cellular responses include
not only normal physiological responses to TNF-family ligands, but
also diseases associated with increased apoptosis or the inhibition
of apoptosis. Apoptosis-programmed cell death is a physiological
mechanism involved in the deletion of peripheral T lymphocytes of
the immune system, and its dysregulation can lead to a number of
different pathogenic processes (J. C. Ameisen, AIDS 8:1197-1213
(1994); P. H. Krammer et al., Curr. Opin. Immunol. 6:279-289
(1994)).
[0574] Cells which express TR14 polypeptide and that are believed
to have a potent cellular response to TR14 ligands include
activated T-cell, endometrial, thymus, and 12 week early stage
human tissue. By "a cellular response to a TNF-family ligand" is
intended any genotypic, phenotypic, and/or morphologic change to a
cell, cell line, tissue, tissue culture or patient that is induced
by a TNF-family ligand (such as, for example, a TNF-ligand
described herein). As indicated, such cellular responses include
not only normal physiological responses to TNF-family ligands, but
also diseases associated with dysregulation of these physiological
responses, such as, for example, diseases associated with increased
apoptosis or the inhibition of apoptosis. Apoptosis-programmed cell
death is a physiological mechanism involved in the deletion of
peripheral T lymphocytes of the immune system, and its
dysregulation can lead to a number of different pathogenic
processes (J. C. Ameisen, AIDS 8:1197-1213 (1994); P. H. Krammer et
al., Curr. Opin. Immunol. 6:279-289 (1994)).
[0575] In specific embodiments for treating cancer, including, for
example, when underregulation of Fas ligand leads to excessive
cancer cell growth, agonists of TR13, including antibodies and
peptides that bind TR13, may be used to enhance the anti-tumor
effect of Fas ligand.
[0576] Diseases associated with increased cell survival, or the
inhibition of apoptosis, and that may be treated or prevented by
the TR13 polynucleotides, polypeptides and/or agonists or
antagonists of the invention include, but are not limited to,
cancers (such as endometrial tumors, follicular lymphomas,
carcinomas with p53 mutations, and hormone-dependent tumors, colon
cancer, cardiac tumors, pancreatic cancer, melanoma,
retinoblastoma, glioblastoma, lung cancer, intestinal cancer,
testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma,
lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma,
chondrosarcoma, adenoma, breast cancer, prostrate cancer, Kaposi's
sarcoma and ovarian cancer); autoimmune disorders (such as,
multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis,
biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
rheumatoid arthritis); viral infections (such as herpes viruses,
pox viruses and adenoviruses); inflammation; graft vs. host
disease; acute graft rejection and chronic graft rejection. In
preferred embodiments, TR13 nucleic acids, polypeptides, agonists
and/or antagonists of the invention are used to inhibit growth,
progression, and/or metasis of cancers, in particular those listed
above, or in the paragraphs that follow. In other highly preferred
embodiments, agonistic anti-TR13 antibodies of the invention are
used to inhibit growth, progression, and/or metastasis of cancers,
in particular those listed above, or in the paragraphs that
follow.
[0577] Additional diseases or conditions associated with increased
cell survival and that may be treated or prevented by the TR13
polynucleotides, polypeptides, agonists and/or antagonists of the
invention include, but are not limited to, progression, and/or
metastases of malignancies and related disorders such as leukemia
(including acute leukemias (e.g., acute lymphocytic leukemia, acute
myelocytic leukemia (including myeloblastic, promyelocytic,
myelomonocytic, monocytic, and erythroleukemia)) and chronic
leukemias (e.g., chronic myelocytic (granulocytic) leukemia and
chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g.,
Hodgkin's disease and non-Hodgkin's disease), multiple myeloma,
Waldenstrom's macroglobulinemia, heavy chain disease, and solid
tumors including, but not limited to, sarcomas and carcinomas such
as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma,
osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer,
prostate cancer, squamous cell carcinoma, basal cell carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma,
papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma. In preferred embodiments, TR13 nucleic acids,
polypeptides, agonists and/or antagonists are used to treat the
diseases and disorders listed above.
[0578] In additional embodiments, TR13 nucleic acids, polypeptides,
agonists and/or antagonists are used to treat pancreas tumor,
endometrial tumor, colon cancer, breast cancer, prostate BPH and/or
osteosarcoma.
[0579] Thus, in preferred embodiments TR13 polynucleotides or
polypeptides of the invention and agonists or antagonists thereof,
are used to treat or prevent autoimmune diseases and/or inhibit the
growth, progression, and/or metastasis of cancers, including, but
not limited to, those cancers disclosed herein, such as, for
example, pancreatic cancer, endometrial cancer, colon cancer,
breast cancer, osteocarcoma, and lymphocytic leukemias (including,
for example, MLL and chronic lymphocytic leukemia (CLL)) and
follicular lymphomas. In another embodiment TR13 polynucleotides or
polypeptides of the invention and/or agonists or antagonists
thereof, are used to activate, differentiate or proliferate
cancerous cells or tissue (e.g., T cell lineage related cancers and
B cell lineage related cancers (e.g., CLL and MLL), lymphocytic
leukemia, or lymphoma) and thereby render the cells more vulnerable
to cancer therapy (e.g., chemotherapy or radiation therapy).
[0580] Diseases associated with increased apoptosis and that may be
treated or prevented by the polynucleotides, polypeptides and/or
agonists or antagonists of the invention include, but are not
limited to, AIDS; neurodegenerative disorders (such as Alzheimer's
disease, Parkinson's disease, Amyotrophic lateral sclerosis,
Retinitis pigmentosa, Cerebellar degeneration and brain tumor or
prior associated disease); autoimmune disorders (such as, multiple
sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary
cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
and rheumatoid arthritis); myelodysplastic syndromes (such as
aplastic anemia), graft v. host disease, ischemic injury (such as
that caused by myocardial infarction, stroke and reperfusion
injury), liver injury (such as hepatitis related liver injury,
ischemia/reperfusion injury, cholestosis (bile duct injury) and
liver cancer); toxin-induced liver disease (such as that caused by
alcohol), septic shock, cachexia and anorexia. In preferred
embodiments, TR13 nucleic acids, polypeptides, agonists and/or
antagonists are used to treat the diseases and disorders listed
above. In other highly preferred embodiments, soluble forms of the
extracellular domain of the invention (e.g., amino acids 42-906
fused to an Ig Fc domain) or antagonistic antibodies (e.g.,
antibodies that bind TR13 but do not induce a signal or, antibodies
that bind TR13 which do not induce signal transduction through TR13
and prevent TR13 ligands (e.g., Fas ligand) from binding TR13) are
used to treat diseases and disorders associated with increased
apoptosis.
[0581] Diseases associated with increased cell survival, or the
inhibition of apoptosis, and that may be treated or prevented by
the TR14 polynucleotides, polypeptides and/or agonists or
antagonists of the invention include, but are not limited to,
cancers (such as follicular lymphomas, carcinomas with p53
mutations, and hormone-dependent tumors, including, but not limited
to colon cancer, cardiac tumors, pancreatic cancer, melanoma,
retinoblastoma, glioblastoma, lung cancer, intestinal cancer,
testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma,
lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma,
chondrosarcoma, adenoma, breast cancer, prostrate cancer, Kaposi's
sarcoma and ovarian cancer); autoimmune disorders (such as,
multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis,
biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
rheumatoid arthritis); viral infections (such as herpes viruses,
pox viruses and adenoviruses); inflammation; graft vs. host
disease; acute graft rejection and chronic graft rejection. In
preferred embodiments, TR14 nucleic acids, polypeptides, agonists
and/or antagonists of the invention are used to inhibit growth,
progression, and/or metasis of cancers, in particular those listed
above, or in the paragraphs that follow.
[0582] Additional diseases or conditions associated with increased
cell survival and that may be treated or prevented by the TR14
polynucleotides, polypeptides and/or agonists or antagonists of the
invention include, but are not limited to, progression, and/or
metastases of malignancies and related disorders such as leukemia
(including acute leukemias (e.g., acute lymphocytic leukemia, acute
myelocytic leukemia (including myeloblastic, promyelocytic,
myelomonocytic, monocytic, and erythroleukemia)) and chronic
leukemias (e.g., chronic myelocytic (granulocytic) leukemia and
chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g.,
Hodgkin's disease and non-Hodgkin's disease), multiple mycloma,
Waldenstrom's macroglobulinemia, heavy chain disease, and solid
tumors including, but not limited to, sarcomas and carcinomas such
as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma,
osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer,
prostate cancer, squamous cell carcinoma, basal cell carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma,
papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma. In preferred embodiments, TR14 nucleic acids,
polypeptides, agonists and/or antagonists are used to treat the
diseases and disorders listed above.
[0583] Thus, in preferred embodiments TR14 polynucleotides or
polypeptides of the invention and agonists or antagonists thereof,
are used to treat or prevent autoimmune diseases and/or inhibit the
growth, progression, and/or metastasis of cancers, including, but
not limited to, those cancers disclosed herein, such as, for
example, lymphocytic leukemias (including, for example, MLL and
chronic lymphocytic leukemia (CLL)) and follicular lymphomas. In
another embodiment TR14 polynucleotides or polypeptides of the
invention and/or agonists or antagonists thereof, are used to
activate, differentiate or proliferate cancerous cells or tissue
(e.g., T cell lineage cancers and B cell lineage related cancers
(e.g., CLL and MLL), lymphocytic leukemia, or lymphoma) and thereby
render the cells more vulnerable to cancer therapy (e.g.,
chemotherapy or radiation therapy).
[0584] Diseases associated with increased apoptosis and that may be
treated or prevented by the TR14 polynucleotides, polypeptides
and/or agonists or antagonists of the invention include, but are
not limited to, AIDS; neurodegenerative disorders (such as
Alzheimer's disease, Parkinson's disease, Amyotrophic lateral
sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain
tumor or prior associated disease); autoimmune disorders (such as,
multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis,
biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
and rheumatoid arthritis); myelodysplastic syndromes (such as
aplastic anemia), graft v. host disease, ischemic injury (such as
that caused by myocardial infarction, stroke and reperfusion
injury), liver injury (such as hepatitis related liver injury,
ischemia/reperfusion injury, cholestosis (bile duct injury) and
liver cancer); toxin-induced liver disease (such as that caused by
alcohol), septic shock, cachexia and anorexia. In preferred
embodiments, TR14 nucleic acids, polypeptides, agonists and/or
antagonists are used to treat the diseases and disorders listed
above.
[0585] Many of the pathologies associated with HIV are mediated by
apoptosis, including HIV-induced nephropathy and HIV encephalitis.
Thus, in additional preferred embodiments, TR13 nucleic acids,
polypeptides, and/or TR13 agonists or antagonists of the invention
are used to treat AIDS and pathologies associated with AIDS.
[0586] Many of the pathologies associated with HIV are mediated by
apoptosis, including HIV-induced nephropathy and HIV encephalitis.
Thus, in additional preferred embodiments, TR14 nucleic acids,
polypeptides, and/or TR14 agonists or antagonists of the invention
are used to treat AIDS and pathologies associated with AIDS.
[0587] Another embodiment of the present invention is directed to
the use of TR13 (especially the extracellular soluble domain of
TR13 or fragmnets or variants thereof) to reduce cell death
dependent upon a TNF family member, of T cells in HIV-infected
patients. The state of immunodeficiency that defines AIDS is
secondary to a decrease in the number and function of CD4.sup.+
T-lymphocytes. Recent reports estimate the daily loss of CD4.sup.+
T cells to be between 3.5.times.10.sup.7 and 2.times.10.sup.9 cells
(Wei et al., Nature 373:117-122 (1995)). One cause of CD4.sup.+ T
cell depletion in the setting of HIV infection is believed to be
HIV-induced apoptosis (see, for example, Meyaard et al., Science
257:217-219, 1992; Groux et al., J Exp. Med., 175:331, 1992; and
Oyaizu et al., in Cell Activation and Apoptosis in HIV Infection,
Andrieu and Lu, Eds., Plenum Press, New York, 1995, pp. 101-114).
Indeed, HIV-induced apoptotic cell death has been demonstrated not
only in vitro but also, more importantly, in infected individuals
(J. C. Ameisen, AIDS 8:1197-1213 (1994); T. H. Finkel and N. K.
Banda, Curr. Opin. Immunol. 6:605-615(1995); C. A. Muro-Cacho et
al., J. Immunol. 154:5555-5566 (1995)). Furthermore, apoptosis and
CD4.sup.+ T-lymphocyte depletion is tightly correlated in different
animal models of AIDS (T. Brunner et al., Nature 373:441-444
(1995); M. L. Gougeon et al., AIDS Res. Hum. Retroviruses 9:553-563
(1993)) and, apoptosis is not observed in those animal models in
which viral replication does not result in AIDS. Id. Further data
indicates that uninfected but primed or activated T lymphocytes
from HIV-infected individuals undergo apoptosis after encountering
the TNF-family ligand FasL. Using monocytic cell lines that result
in death following HIV infection, it has been demonstrated that
infection of U937 cells with HIV results in the de novo expression
of FasL and that FasL mediates HIV-induced apoptosis (A. D. Badley
et al., J. Virol. 70:199-206 (1996)). Further, the TNF-family
ligand was detectable in uninfected macrophages and its expression
was upregulated following HIV infection resulting in selective
killing of uninfected CD4 T-lymphocytes. Id. Thus, by the
invention, a method for treating HIV.sup.+ individuals is provided
which involves administering TR13 polynucleotides, polypeptides
and/or TR13 agonists or antagonists of the present invention to
reduce selective killing of CD4.sup.+ T-lymphocytes. Modes of
administration and dosages are discussed in detail below.
[0588] Activated human T cells are induced to undergo programmed
cell death (apoptosis) upon triggering through the CD3/T cell
receptor complex, a process termed activated-induced cell death
(AICD). AICD of CD4.sup.+ T cells isolated from HIV-Infected
asymptomatic individuals has been reported (Groux et al., supra).
Thus, AICD may play a role in the depletion of CD4.sup.+ T cells
and the progression to AIDS in HIV-infected individuals. Thus, the
present invention provides a method of inhibiting a tumor-necrosis
factor family member (e.g. Fas ligand or TRAIL) mediated T cell
death in HIV patients, comprising administering a TR13 polypeptide
of the invention (preferably, a soluble TR13 polypeptide, such as
the extracellular soluble domain) to the patients. In one
embodiment, the patient is asymptomatic when treatment with TR13
commences. If desired, prior to treatment, peripheral blood T cells
may be extracted from an HIV patient, and tested for susceptibility
to cell death mediated by a tumor necrosis factor family member, by
procedures known in the art. In one embodiment, a patient's blood
or plasma is contacted with TR13 ex vivo. The TR13 may be bound to
a suitable chromatography matrix by procedures known in the art.
The patient's blood or plasma flows through a chromatography column
containing TR13 bound to the matrix, before being returned to the
patient. In the event the immobilized TR13 bound to TRAIL, or
another TNF family member(s), TRAIL and/or other TNF family member
protein would be removed from the patient's blood.
[0589] In additional embodiments a TR13 polypeptide,
polynucleotide, and/or agonist or antagonist of the invention is
administered in combination with inhibitors of T cell apoptosis.
For example, Fas-mediated apoptosis and TRAIL-mediated apoptosis
have been implicated in loss of T cells in HIV individuals (See,
e.g., Katsikis et al., J. Exp. Med. 181:2029-2036 (1995)). Thus, a
patient susceptible to both Fas ligand mediated and/or TRAIL
mediated T cell death may be treated by an agent that blocks
Fas-ligand/TR13 interactions, Fas-ligand/Fas interactions and/or an
agent that blocks TRAIL/TRAIL receptor interactions. Suitable
agents for blocking binding of Fas-ligand to TR13 or Fas include,
but are not limited to, soluble TR13 polypeptides, soluble Fas
polypeptides; mulitmeric forms of soluble Fas polypeptides (e.g.,
dimers of sFas/Fc); anti-TR13 antibodies that bind TR13 without
transducing the biological signal that results in apoptosis;
anti-TR13-ligand antibodies that block binding of Fas-ligand to
TR13; anti-Fas antibodies that bind Fas without transducing the
biological signal that results in apoptosis; anti-Fas-ligand
antibodies that block binding of Fas-ligand to Fas; and muteins of
Fas-ligand that bind Fas and/or TR13 but do not transduce the
biological signal that results in apoptosis. Preferably, the
antibodies employed according to this method are monoclonal
antibodies. Examples of suitable agents for blocking Fas-ligand/Fas
interactions, including blocking anti-Fas monoclonal antibodies,
are described in International application publication number WO
95/10540, hereby incorporated by reference.
[0590] Suitable agents, which block binding of TRAIL to a TRAIL
receptor or FAS ligand to FAS that may be administered with the
nucleic acids, polypeptides, and/or agonists or antagonists of the
present invention include, but are not limited to, soluble TRAIL
receptor polypeptides (e.g., a soluble form of OPG, DR4
(International application publication number WO 98/32856); TR5
(International application publication number WO 98/30693); and DR5
(International application publication number WO 98/41629));
multimeric forms of soluble TRAIL receptor polypeptides; and TRAIL
receptor antibodies that bind the TRAIL receptor without
transducing the biological signal that results in apoptosis,
anti-TRAIL antibodies that block binding of TRAIL to one or more
TRAIL receptors, and muteins of TRAIL that bind TRAIL receptors but
do not transduce the biological signal that results in apoptosis.
Preferably, the antibodies employed according to this method are
monoclonal antibodies.
[0591] Another embodiment of the present invention is directed to
the use of TR14 to reduce cell death dependent upon a TNF family
member, of T cells in HIV-infected patients. The state of
immunodeficiency that defines AIDS is secondary to a decrease in
the number and function of CD4.sup.+ T-lymphocytes. Recent reports
estimate the daily loss of CD4.sup.+ T cells to be between
3.5.times.10.sup.7 and 2.times.10.sup.9 cells (Wei et al., Nature
373:117-122 (1995)). One cause of CD4.sup.+ T cell depletion in the
setting of HIV infection is believed to be HIV-induced apoptosis
(see, for example, Meyaard et al., Science 257:217-219, 1992; Groux
et al., J Exp. Med., 175:331, 1992; and Oyaizu et al., in Cell
Activation and Apoptosis in HIV Infection, Andrieu and Lu, Eds.,
Plenum Press, New York, 1995, pp. 101-114). Indeed, HIV-induced
apoptotic cell death has been demonstrated not only in vitro but
also, more importantly, in infected individuals (J. C. Ameisen,
AIDS 8:1197-1213 (1994); T. H. Finkel and N. K. Banda, Curr. Opin.
Immunol. 6:605-615(1995); C. A. Muro-Cacho et al., J. Immunol.
154:5555-5566 (1995)). Furthermore, apoptosis and CD4.sup.+
T-lymphocyte depletion is tightly correlated in different animal
models of AIDS (T. Brunner et al., Nature 373:441-444 (1995); M. L.
Gougeon et al, AIDS Res. Hum. Retroviruses 9:553-563 (1993)) and,
apoptosis is not observed in those animal models in which viral
replication does not result in AIDS. Id. Further data indicates
that uninfected but primed or activated T lymphocytes from
HIV-infected individuals undergo apoptosis after encountering the
TNF-family ligand FasL. Using monocytic cell lines that result in
death following HIV infection, it has been demonstrated that
infection of U937 cells with HIV results in the de novo expression
of FasL and that FasL mediates HIV-induced apoptosis (A. D. Badley
et al., J. Virol. 70:199-206 (1996)). Further, the TNF-family
ligand was detectable in uninfected macrophages and its expression
was upregulated following HIV infection resulting in selective
killing of uninfected CD4 T-lymphocytes. Id. Thus, by the
invention, a method for treating HIV.sup.+ individuals is provided
which involves administering TR14 polynucleotides, polypeptides,
and/or TR14 agonists or antagonists of the present invention to
reduce selective killing of CD4.sup.+ T-lymphocytes. Modes of
administration and dosages are discussed in detail below.
[0592] Activated human T cells are induced to undergo programmed
cell death (apoptosis) upon triggering through the CD3/T cell
receptor complex, a process termed activated-induced cell death
(AICD). AICD of CD4.sup.+ T cells isolated from HIV-Infected
asymptomatic individuals has been reported (Groux et al., supra).
Thus, AICD may play a role in the depletion of CD4.sup.+ T cells
and the progression to AIDS in HIV-infected individuals. Thus, the
present invention provides a method of inhibiting a tumor-necrosis
factor family member-mediated T cell death in HIV patients,
comprising administering a TR14 polypeptide of the invention
(preferably, a soluble TR14 polypeptide) to the patients. In one
embodiment, the patient is asymptomatic when treatment with TR14
commences. If desired, prior to treatment, peripheral blood T cells
may be extracted from an HIV patient, and tested for susceptibility
to cell death mediated by a member of the TNF-family, by procedures
known in the art. In one embodiment, a patient's blood or plasma is
contacted with TR14 ex vivo. The TR14 may be bound to a suitable
chromatography matrix by procedures known in the art. The patient's
blood or plasma flows through a chromatography column containing
TR14 bound to the matrix, before being returned to the patient. In
the event the immobilized TR14 bound to TRAIL, or another TNF
family member(s), TRAIL and/or other TNF family member protein
would be removed from the patient's blood.
[0593] In additional embodiments a TR14 polypeptide,
polynucleotide, and/or agonist or antagonist of the invention is
administered in combination with inhibitors of T cell apoptosis.
For example, TRAIL-mediated apoptosis and Fas-mediated apoptosis
have been implicated in loss of T cells in HIV individuals (See
e.g., Katsikis e al., J. Exp. Med. 181:2029-2036 (1995)). Thus, a
patient susceptible to both Fas ligand mediated and TRAIL mediated
T cell death may be treated as an agent that blocks TRAIL/TRAIL
receptor interactions and/or an agent that blocks Fas-ligand/Fas
interactions. Suitable agents for blocking binding of Fas-ligand to
Fas include, but are not limited to, soluble Fas polypeptides;
mulitmeric forms of soluble Fas polypeptides (e.g., dimers of
sFas/Fc); anti-Fas antibodies that bind Fas without transducing the
biological signal that results in apoptosis; anti-Fas-ligand
antibodies that block binding of Fas-ligand to Fas; and muteins of
Fas-ligand that bind Fas but do not transduce the biological signal
that results in apoptosis. Preferably, the antibodies employed
according to this method are monoclonal antibodies. Examples of
suitable agents for blocking Fas-ligand/Fas interactions, including
blocking anti-Fas monoclonal antibodies, are described in
International application publication number WO 95/10540, hereby
incorporated by reference.
[0594] Suitable agents, which block binding of TRAIL to a TRAIL
receptor or FAS ligand to FAS that may be administered with the
nucleic acids, polypeptides, and/or agonists or antagonists of the
present invention include, but are not limited to, soluble TRAIL
receptor polypeptides (e.g., a soluble form of OPG, DR4
(International application publication number WO 98/32856); TR5
(International application publication number WO 98/30693); and DR5
(International application publication number WO 98/41629));
multimeric forms of soluble TRAIL receptor polypeptides; and TRAIL
receptor antibodies that bind the TRAIL receptor without
transducing the biological signal that results in apoptosis,
anti-TRAIL antibodies that block binding of TRAIL to one or more
TRAIL receptors, and muteins of TRAIL that bind TRAIL receptors but
do not transduce the biological signal that results in apoptosis.
Preferably, the antibodies employed according to this method are
monoclonal antibodies.
[0595] TR13 polypeptides, nucleic acids, and/or agonists or
antagonists of the invention may be used to treat cardiovascular
disorders, including peripheral artery disease, such as limb
ischemia.
[0596] TR14 polypeptides, nucleic acids, and/or agonists or
antagonists of the invention may be used to treat cardiovascular
disorders, including peripheral artery disease, such as limb
ischemia.
[0597] Cardiovascular disorders include cardiovascular
abnormalities, such as arterio-arterial fistula, arteriovenous
fistula, cerebral arteriovenous malformations, congenital heart
defects, pulmonary atresia, and Scimitar Syndrome. Congenital heart
defects include aortic coarctation, cor triatriatum, coronary
vessel anomalies, crisscross heart, dextrocardia, patent ductus
arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic
left heart syndrome, levocardia, tetralogy of fallot, transposition
of great vessels, double outlet right ventricle, tricuspid atresia,
persistent truncus arteriosus, and heart septal defects, such as
aortopulmonary septal defect, endocardial cushion defects,
Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal
defects, and conditions characterized by clotting of small blood
vessels.
[0598] Cardiovascular disorders also include heart disease, such as
arrhythmias, carcinoid heart disease, high cardiac output, low
cardiac output, cardiac tamponade, endocarditis (including
bacterial), heart aneurysm, cardiac arrest, congestive heart
failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac
edema, heart hypertrophy, congestive cardiomyopathy, left
ventricular hypertrophy, right ventricular hypertrophy,
post-infarction heart rupture, ventricular septal rupture, heart
valve diseases, myocardial diseases, myocardial ischemia,
pericardial effusion, pericarditis (including constrictive and
tuberculous), pneumopericardium, postpericardiotomy syndrome,
pulmonary heart disease, rheumatic heart disease, ventricular
dysfunction, hyperemia, cardiovascular pregnancy complications,
Scimitar Syndrome, cardiovascular syphilis, and cardiovascular
tuberculosis.
[0599] Arrhythmias include sinus arrhythmia, atrial fibrillation,
atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome,
bundle-branch block, sinoatrial block, long QT syndrome,
parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type
pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus
syndrome, tachycardias, and ventricular fibrillation. Tachycardias
include paroxysmal tachycardia, supraventricular tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal reentry
tachycardia, ectopic atrial tachycardia, ectopic junctional
tachycardia, sinoatrial nodal reentry tachycardia, sinus
tachycardia, Torsades de Pointes, and ventricular tachycardia.
[0600] Heart valve disease include aortic valve insufficiency,
aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral
valve prolapse, tricuspid valve prolapse, mitral valve
insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary
valve insufficiency, pulmonary valve stenosis, tricuspid atresia,
tricuspid valve insufficiency, and tricuspid valve stenosis.
[0601] Myocardial diseases include alcoholic cardiomyopathy,
congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic
subvalvular stenosis, pulmonary subvalvular stenosis, restrictive
cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis,
endomyocardial fibrosis, Keams Syndrome, myocardial reperfusion
injury, and myocarditis.
[0602] Myocardial ischemias include coronary disease, such as
angina pectoris, coronary aneurysm, coronary arteriosclerosis,
coronary thrombosis, coronary vasospasm, myocardial infarction and
myocardial stunning.
[0603] Cardiovascular diseases also include vascular diseases such
as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis,
Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome,
Sturge-Weber Syndrome, angioneurotic edema, aortic diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular disorders, diabetic angiopathies, diabetic
retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids,
hepatic veno-occlusive disease, hypertension, hypotension,
ischemia, peripheral vascular diseases, phlebitis, pulmonary
veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
vein occlusion, Scimitar syndrome, superior vena cava syndrome,
telangiectasia, atacia telangiectasia, hereditary hemorrhagic
telangiectasia, varicocele, varicose veins, varicose ulcer,
vasculitis, thrombotic microangiopathies (e.g., thrombotic
thrombocytopenic purpura (TTP) and hemolytic-uremic syndrome
(HUS)), and venous insufficiency.
[0604] Aneurysms include dissecting aneurysms, false aneurysms,
infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral
aneurysms, coronary aneurysms, heart aneurysms, and iliac
aneurysms.
[0605] Arterial occlusive diseases include arteriosclerosis,
intermittent claudication, carotid stenosis, fibromuscular
dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal
artery obstruction, retinal artery occlusion, and thromboangiitis
obliterans.
[0606] Cerebrovascular disorders include carotid artery diseases,
cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia,
cerebral arteriosclerosis, cerebral arteriovenous malformation,
cerebral artery diseases, cerebral embolism and thrombosis, carotid
artery thrombosis, sinus thrombosis, Wallenberg's syndrome,
cerebral hemorrhage, epidural hematoma, subdural hematoma,
subaraxhnoid hemorrhage, cerebral infarction, cerebral ischemia
(including transient), subclavian steal syndrome, periventricular
leukomalacia, vascular headache, cluster headache, migraine, and
vertebrobasilar insufficiency.
[0607] Embolisms include air embolisms, amniotic fluid embolisms,
cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary
embolisms, and thromoboembolisms. Thrombosis include coronary
thrombosis, hepatic vein thrombosis, retinal vein occlusion,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome,
and thrombophlebitis.
[0608] Ischemia includes cerebral ischemia, ischemic colitis,
compartment syndromes, anterior compartment syndrome, myocardial
ischemia, reperfusion injuries, and peripheral limb ischemia.
Vasculitis includes aortitis, arteritis, Behcet's Syndrome,
Churg-Strauss Syndrome, mucocutaneous lymph node syndrome,
thromboangiitis obliterans, hypersensitivity vasculitis,
Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and
Wegener's granulomatosis.
[0609] In one embodiment, TR13 polypeptides, polynucleotides and/or
agonists or antagonists of the invention are used to treat or
prevent thrombotic microangiopathies. One such disorder is
thrombotic thrombocytopenic purpura (TTP) (Kwaan, H. C., Semin.
Hematol. 24:71 (1987); Thompson et al., Blood 80:1890 (1992)).
Increasing TTP-associated mortality rates have been reported by the
U.S. Centers for Disease Control (Torok et al., Am. J. Hematol.
50:84 (1995)). Plasma from patients afflicted with TTP (including
HIV+ and HIV- patients) induces apoptosis of human endothelial
cells of dermal microvascular origin, but not large vessel origin
(Laurence et al., Blood 87:3245 (1996)). Plasma of TTP patients
thus is thought to contain one or more factors that directly or
indirectly induce apoptosis. An anti-Fas blocking antibody has been
shown to reduce TTP plasma-mediated apoptosis of microvascular
endothelial cells (Lawrence et al., Blood 87:3245 (1996); hereby
incorporated by reference). Accordingly, Fas ligand present in the
serum of TTP patients is likely to play a role in inducing
apoptosis of microvascular endothelial cells. Another thrombotic
microangiopathy is hemolytic-uremic syndrome (HUS) (Moake, J. L.,
Lancet. 343:393, (1994); Melnyk et al., (Arch. Intern. Med.,
155:2077, (1995); Thompson et al., supra). Thus, in one embodiment,
the invention is directed to use of TR13 to treat or prevent the
condition that is often referred to as "adult HUS" (even though it
can strike children as well). A disorder known as
childhood/diarrhea-associated HUS differs in etiology from adult
HUS. In another embodiment, conditions characterized by clotting of
small blood vessels may be treated using TR13 polypeptides and/or
polynucleotides of the invention. Such conditions include, but are
not limited to, those described herein. For example, cardiac
problems seen in about 5-10% of pediatic AIDS patients are believed
to involve clotting of small blood vessels. Breakdown of the
microvasculature in the heart has been reported in multiple
sclerosis patients. As a further example, treatment of systemic
lupus erythematosus (SLE) is contemplated. In one embodiment, a
patient's blood or plasma is contacted with TR13 polypeptides of
the invention ex vivo. The TR13 may be bound to a suitable
chromatography matrix using techniques known in the art. According
to this embodiment, the patient's blood or plasma flows through a
chromatography column containing TR13 bound to the matrix, before
being returned to the patient. The immobilized TR13 binds Fas
ligand and/or AIM-II, thus removing Fas ligand protein from the
patient's blood. Alternatively, TR13 may be administered in vivo to
a patient afflicted with a thrombotic microangiopathy. In one
embodiment, a TR13 polynucleotide or polypeptide of the invention
is administered to the patient. Thus, the present invention
provides a method for treating a thrombotic microangiopathy,
involving use of an effective amount of a TR13 polypeptide of the
invention. A TR13 polypeptide may be employed in in vivo or ex vivo
procedures, to inhibit Fas ligand-mediated and/or AIM-II-mediated
damage to (e.g., apoptosis of) microvascular endothelial cells.
[0610] TR13 polypeptides and polynucleodies of the invention may be
employed in conjunction with other agents useful in treating a
particular disorder. For example, in an in vitro study reported by
Laurence et al. (Blood 87:3245, 1996), some reduction of TTP
plasma-mediated apoptosis of microvascular endothelial cells was
achieved by using an anti-Fas blocking antibody, aurintricarboxylic
acid, or normal plasma depleted of cryoprecipitate. Thus, a patient
may be treated in combination with an additional agent that
inhibits Fas-ligand-mediated apoptosis of endothelial cells such
as, for example, an agent described above. In one embodiment, TR13
polypeptides of the invention and an anti-FAS blocking antibody are
administered to a patient afflicted with a disorder characterized
by thrombotic microanglopathy, such as TTP or HUS. Examples of
blocking monoclonal antibodies directed against Fas antigen (CD95)
are described in International Application publication number WO
95/10540, hereby incorporated by reference.
[0611] The naturally occurring balance between endogenous
stimulators and inhibitors of angiogenesis is one in which
inhibitory influences predominate. Rastinejad et al., Cell
56:345-355 (1989). In those rare instances in which
neovascularization occurs under normal physiological conditions,
such as wound healing, organ regeneration, embryonic development,
and female reproductive processes, angiogenesis is stringently
regulated and spatially and temporally delimited. Under conditions
of pathological angiogenesis such as that characterizing solid
tumor growth, these regulatory controls fail. Unregulated
angiogenesis becomes pathologic and sustains progression of many
neoplastic and non-neoplastic diseases. A number of serious
diseases are dominated by abnormal neovascularization including
solid tumor growth and metastases, arthritis, some types of eye
disorders, and psoriasis. See, e.g., reviews by Moses et al.,
Biotech. 9:630-634 (1991); Folkman et al., N. Engl. J. Med.,
333:1757-1763 (1995); Auerbach et al., J Microvasc. Res. 29:401-411
(1985); Folkman, Advances in Cancer Research, eds. Klein and
Weinhouse, Academic Press, New York, pp. 175-203 (1985); Patz, Am.
J. Opthalmol. 94:715-743 (1982); and Folkman et al., Science
221:719-725 (1983). In a number of pathological conditions, the
process of angiogenesis contributes to the disease state. For
example, significant data have accumulated which suggest that the
growth of solid tumors is dependent on angiogenesis. Folkman and
Klagsbrun, Science 235:442-447 (1987).
[0612] The present invention provides for treatment of diseases or
disorders associated with neovascularization by administration of
the TR13 nucleic acids and/or polypeptides of the invention
(including TR13 agonists and/or antagonists). Malignant and
metastatic conditions which can be treated with the nucleic acids
and polypeptides of the invention include, but are not limited to
those malignancies, solid tumors, and cancers described herein and
otherwise known in the art (for a review of such disorders, see
Fishman et al., Medicine, 2d Ed., J. B. Lippincott Co.,
Philadelphia (1985)).
[0613] The present invention provides for treatment of diseases or
disorders associated with neovascularization by administration of
the TR14 nucleic acids and/or polypeptides of the invention
(including TR14 agonists and/or antagonists). Malignant and
metastatic conditions which can be treated with the nucleic acids
and polypeptides of the invention include, but are not limited to
those malignancies, solid tumors, and cancers described herein and
otherwise known in the art (for a review of such disorders, see
Fishman et al., Medicine, 2d Ed., J. B. Lippincott Co.,
Philadelphia (1985)).
[0614] Additionally, ocular disorders associated with
neovascularization which can be treated with the TR13 nucleic acids
and polypeptides of the present invention (including TR13 agonists
and TR13 antagonists) include, but are not limited to: neovascular
glaucoma, diabetic retinopathy, retinoblastoma, retrolental
fibroplasia, uveitis, retinopathy of prematurity macular
degeneration, corneal graft neovascularization, as well as other
eye inflammatory diseases, ocular tumors and diseases associated
with choroidal or iris neovascularization. See, e.g., reviews by
Waltman et al., Am. J. Ophthal. 85:704-710 (1978) and Gartner et
al., Surv. Ophthal. 22:291-312 (1978).
[0615] Additionally, disorders which can be treated with the TR13
nucleic acids and polypeptides of the present invention (including
TR13 agonists and TR13 antagonists) include, but are not limited
to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic
plaques, delayed wound healing, granulations, hemophilic joints,
hypertrophic scars, nonunion fractures, Osler-Weber syndrome,
pyogenic granuloma, scleroderma, trachoma, and vascular
adhesions.
[0616] Additionally, ocular disorders associated with
neovascularization which can be treated with the TR14 nucleic acids
and polypeptides of the present invention (including TR14 agonists
and TR14 antagonists) include, but are not limited to: neovascular
glaucoma, diabetic retinopathy, retinoblastoma, retrolental
fibroplasia, uveitis, retinopathy of prematurity macular
degeneration, corneal graft neovascularization, as well as other
eye inflammatory diseases, ocular tumors and diseases associated
with choroidal or iris neovascularization. See, e.g., reviews by
Waltman et al. Am. J. Ophthal. 85:704-710 (1978) and Gartner et
al., Surv. Ophthal. 22:291-312 (1978).
[0617] Additionally, disorders which can be treated with the TR14
nucleic acids and polypeptides of the present invention (including
TR14 agonists and TR14 antagonists) include, but are not limited
to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic
plaques, delayed wound healing, granulations, hemophilic joints,
hypertrophic scars, nonunion fractures, Osler-Weber syndrome,
pyogenic granuloma, scleroderma, trachoma, and vascular
adhesions.
[0618] The TR13 and/or TR14 nucleic acids, polypeptides and/or
agonists or antagonists of the invention can also be employed to
inhibit the proliferation and differentiation of hematopoietic
cells and therefore may be employed to protect bone marrow stem
cells from chemotherapeutic agents during chemotherapy. This
antiproliferative effect may allow administration of higher doses
of chemotherapeutic agents and, therefore, more effective
chemotherapeutic treatment.
[0619] The TR13 and/or TR14 nucleic acids, polypeptides and/or
agonists or antagonists of the invention may also be empolyed for
the expansion of immature hematopoeitic progenitor cells, for
example, granulocytes, macrophages or monocytes (e.g., CD34+,
kit+), by temporarily preventing their differentiation. These bone
marrow cells may be cultured in vitro. Thus, TR13 may be useful as
a modulator of hematopoietic stem cells in vitro for the purpose of
bone marrow transplantation and/or gene therapy. Since stem cells
are rare and are most useful for introducing genes into for gene
therapy, TR13 can be used to isolate enriched populations of stem
cells. Stem cells can be enriched by culturing cells in the
presence of cytotoxins, such as 5-Fu, which kills rapidly dividing
cells, where as the stem cells will be protected by TR13. These
stem cells can be returned to a bone marrow transplant patient or
can then be used for transfection of the desired gene for gene
therapy. In addition, TR13 can be injected into animals which
results in the release of stem cells from the bone marrow of the
animal into the peripheral blood. These stem cells can be isolated
for the purpose of autologous bone marrow transplantation or
manipulation for gene therapy. After the patient has finished
chemotherapy or radiation treatment, the isolated stem cells can be
returned to the patient.
[0620] The TR14 nucleic acids, polypeptides, agonists and/or
antagonists of the invention may also be empolyed for the expansion
of immature hematopoeitic progenitor cells, for example,
granulocytes, macrophages or monocytes (e.g., CD34+, kit+), by
temporarily preventing their differentiation. These bone marrow
cells may be cultured in vitro. Thus, TR14 may be useful as a
modulator of hematopoietic stem cells in vitro for the purpose of
bone marrow transplantation and/or gene therapy. Since stem cells
are rare and are most useful for introducing genes into for gene
therapy, TR14 can be used to isolate enriched populations of stem
cells. Stem cells can be enriched by culturing cells in the
presence of cytotoxins, such as 5-Fu, which kills rapidly dividing
cells, where as the stem cells will be protected by TR14. These
stem cells can be returned to a bone marrow transplant patient or
can then be used for transfection of the desired gene for gene
therapy. In addition, TR14 can be injected into animals which
results in the release of stem cells from the bone marrow of the
animal into the peripheral blood. These stem cells can be isolated
for the purpose of autologous bone marrow transplantation or
manipulation for gene therapy. After the patient has finished
chemotherapy or radiation treatment, the isolated stem cells can be
returned to the patient.
[0621] In a specific embodiment, TR13 and/or TR14 nucleic acids,
polypeptides, and/or agonists or antagonists of the invention
and/or angonists and/or antagonists thereof may be used to increase
the concentration of blood cells in individuals in need of such
increase (i.e., in hematopoietin therapy). Conditions that may be
ameliorated by administering the compositions of the invention
include, but are not limited to, neutropenia, anemia, and
thrombocytopenia.
[0622] In a specific embodiment, the TR13 and/or TR14 nucleic acids
and/or polypeptides of the invention (and/or agonists or
antagonists thereof) are used in erythropoietin therapy, which is
directed toward supplementing the oxygen carrying capacity of
blood. Nucleic acids and/or polypeptides of the invention (and/or
agonists or antagonists thereof) may be used to treat or prevent
diseases or conditions in patients generally requiring blood
transfusions, such as, for example, trauma victims, surgical
patients, dialysis patients, and patients with a variety of blood
composition-affecting disorders, such as, for example, hemophilia,
cystic fibrosis, pregnancy, menstrual disorders, early anemia of
prematurity, spinal cord injury, aging, various neoplastic disease
states, and the like. Examples of patient conditions that require
supplementation of the oxygen carrying capacity of blood and which
are within the scope of this invention, include, but are not
limited to: treatment of blood disorders characterized by low or
defective red blood cell production, anemia associated with chronic
renal failure, stimulation of reticulocyte response, development of
ferrokinetic effects (such as plasma iron turnover effects and
marrow transit time effects), erythrocyte mass changes, stimulation
of hemoglobin C synthesis, and increasing levels of hematocrit in
vertebrates. The invention also provides for treatment to enhance
the oxygen-carrying capacity of an individual, such as for example,
an individual encountering hypoxic environmental conditions.
[0623] TR13 and/or TR14 nucleic acids, polypeptides and/or agonists
or antagonists may also be employed to regulate hematopoiesis, by
regulating the activation and differentiation of various
hematopoietic progenitor cells, for example, to release mature
leukocytes from the bone marrow following chemotherapy, i.e., in
stem cell mobilization. TR13 and/or TR14 nucleic acids,
polypeptides and/or agonists or antagonists may also be employed to
treat sepsis.
[0624] TR13 and/or TR14 nucleic acids, polypeptides and/or agonists
or antagonists may also be employed to inhibit T-cell proliferation
by the inhibition of IL-2 biosynthesis for the treatment of T-cell
mediated auto-immune diseases and lymphocytic leukemias (including,
for example, chronic lymphocytic leukemia (CLL)).
[0625] TR13 and/or TR14 nucleic acids, polypeptides and/or agonists
or antagonists may also be employed to stimulate wound healing,
both via the recruitment of debris clearing and connective tissue
promoting inflammatory cells. In this same manner TR13 and/or TR14
nucleic acids, polypeptides and/or agonists or antagonists may also
be employed to treat other fibrotic disorders, including liver
cirrhosis, osteoarthritis and pulmonary fibrosis.
[0626] TR13 and/or TR14 nucleic acids, polypeptides and/or agonists
or antagonists may also be employed to enhance host defenses
against resistant chronic and acute infections, for example,
myobacterial infections via the attraction and activation of
microbicidal leukocytes.
[0627] TR13 and/or TR14 nucleic acids, polypeptides and/or agonists
or antagonists also increases the presence of eosinophils which
have the distinctive function of killing the larvae of parasites
that invade tissues, as in schistosomiasis, trichinosis and
ascariasis.
[0628] TR13 nucleic acids and/or polypeptides of the invention,
and/or angonists and/or antagonists thereof may be used in
treatment of myeloid leukemias.
[0629] TR13 polynucleotides or polypeptides, or agonists of TR13,
can be used in the treatment of infectious agents. For example, by
increasing the immune response, infectious diseases may be treated.
The immune response may be increased by either enhancing an
existing immune response, or by initiating a new immune response.
Alternatively, TR13 polynucleotides or polypeptides, or agonists or
antagonists of TR13, may also directly inhibit the infectious
agent, without necessarily eliciting an immune response.
[0630] TR14 polynucleotides or polypeptides, or agonists of TR14,
can be used in the treatment of infectious agents. For example, by
increasing the immune response, infectious diseases may be treated.
The immune response may be increased by either enhancing an
existing immune response, or by initiating a new immune response.
Alternatively, TR14 polynucleotides or polypeptides, or agonists or
antagonists of TR14, may also directly inhibit the infectious
agent, without necessarily eliciting an immune response.
[0631] Viruses are one example of an infectious agent that can
cause disease or symptoms that can be treated by TR13 nucleic
acids, polypeptides, and/or agonists or antagonists. Examples of
viruses, include, but are not limited to the following DNA and RNA
viruses and viral families: Arbovirus, Adenoviridae, Arenaviridae,
Arterivirus, Bimaviridae, Bunyaviridae, Caliciviridae,
Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae,
Hepadnaviridae (Hepatitis), Herpesviridae (such as,
Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus
(e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae),
Orthomyxoviridae (e.g., Influenza A, Influenza B, and
parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae,
Picornaviridae, Poxyiridae (such as Smallpox or Vaccinia),
Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-1, HTLV-II,
Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling
within these families can cause a variety of diseases or symptoms,
including, but not limited to: arthritis, bronchiollitis,
respiratory syncytial virus, encephalitis, eye infections (e.g.,
conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A,
B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin,
Chikungunya, Rifl Valley fever, yellow fever, meningitis,
opportunistic infections (e.g., AIDS), pneumonia, Burkitt's
Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps,
Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella,
sexually transmitted diseases, skin diseases (e.g., Kaposi's,
warts), and viremia. TR13 nucleic acids, polypeptides, and/or
agonists or antagonists of TR13, can be used to treat or detect any
of these symptoms or diseases. In specific embodiments, TR13
nucleic acids, polypeptides, and/or agonists or antagonists are
used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g.,
hepatitis B). In an additional specific embodiment TR13 nucleic
acids, polypeptides, and/or agonists or antagonists are used to
treat patients nonresponsive to one or more other commercially
available hepatitis vaccines. In a further specific embodiment,
TR13 nucleic acids, polypeptides, and/or agonists or antagonists
are used to treat AIDS.
[0632] Similarly, bacterial or fungal agents that can cause disease
or symptoms and that can be treated by TR13 nucleic acids or
polypeptides, and/or agonists or antagonists of TR13, include, but
not limited to, the following Gram-Negative and Gram-positive
bacteria and bacterial families and fungi: Actinomycetales (e.g.,
Corynebacterium, Mycobacterium, Norcardia), Cryptococcus
neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax,
Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia
(e.g., Borrelia burgdorferi, Brucellosis, Candidiasis,
Campylobacter, Coccidioidomycosis, Cryptococcosis, Denmatocycoses,
E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E.
coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella
typhi, and Salmonella paratyphi), Serratia, Yersinia),
Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis,
Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerac,
Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Meisseria meningitidis, Pasteurellacea Infections (e.g.,
Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B),
Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis,
Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and
Streptococcal (e.g., Streptococcus pneumoniae and Group B
Streptococcus). These bacterial or fungal families can cause the
following diseases or symptoms, including, but not limited to:
bacteremia, endocarditis, eye infections (conjunctivitis,
tuberculosis, uveitis), gingivitis, opportunistic infections (e.g.,
AIDS related infections), paronychia, prosthesis-related
infections, Reiter's Disease, respiratory tract infections, such as
Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch
Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid,
pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B),
Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis,
Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo,
Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin
diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract
infections, wound infections. TR13 nucleic acids or polypeptides,
and/or agonists or antagonists of TR13, can be used to treat or
detect any of these symptoms or diseases. In specific embodiments,
TR13 nucleic acids, polypeptides, and/or agonists or antagonists
thereof are used to treat: tetanus, Diptheria, botulism, and/or
meningitis type B.
[0633] Moreover, parasitic agents causing disease or symptoms that
can be treated by TR13 nucleic acids or polypeptides, and/or
agonists or antagonists of TR13, include, but not limited to, the
following families or class: Amebiasis, Babesiosis, Coccidiosis,
Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic,
Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis,
Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans
(e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium
malariae and Plasmodium ovale). These parasites can cause a variety
of diseases or symptoms, including, but not limited to: Scabies,
Trombiculiasis, eye infections, intestinal disease (e.g.,
dysentery, giardiasis), liver disease, lung disease, opportunistic
infections (e.g., AIDS related), malaria, pregnancy complications,
and toxoplasmosis. TR13 nucleic acids or polypeptides, and/or
agonists or antagonists of TR13, can be used to treat or detect any
of these symptoms or diseases. In specific embodiments, TR13
nucleic acids, polypeptides, and/or agonists or antagonists thereof
are used to treat malaria. Moreover, parasitic agents causing
disease or symptoms that can be treated by TR13 nucleic acids or
polypeptides, and/or agonists or antagonists of TR13, include, but
not limited to, the following families or class: Amebiasis,
Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis,
Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis,
Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and
Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium,
Plasmodium malaniae and Plasmodium ovale). These parasites can
cause a variety of diseases or symptoms, including, but not limited
to: Scabies, Trombiculiasis, eye infections, intestinal disease
(e.g., dysentery, giardiasis), liver disease, lung disease,
opportunistic infections (e.g., AIDS related), malaria, pregnancy
complications, and toxoplasmosis. TR13 nucleic acids or
polypeptides, and/or agonists or antagonists of TR13, can be used
to treat or detect any of these symptoms or diseases. In specific
embodiments, TR13 nucleic acids, polypeptides, and/or agonists or
antagonists thereof are used to treat malaria.
[0634] Viruses are one example of an infectious agent that can
cause disease or symptoms that can be treated by TR14 nucleic acids
or polypeptides, and/or agonists or antagonists of TR14. Examples
of viruses, include, but are not limited to the following DNA and
RNA viruses and viral families: Arbovirus, Adenoviridae,
Arenaviridae, Arterivirus, Bimaviridae, Bunyaviridae,
Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV,
Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae (such as,
Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus
(e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae),
Orthomyxoviridae (e.g., Influenza A, Influenza B, and
parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae,
Picornaviridae, Poxyiridae (such as Smallpox or Vaccinia),
Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I, HTLV-II,
Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling
within these families can cause a variety of diseases or symptoms,
including, but not limited to: arthritis, bronchiollitis,
respiratory syncytial virus, encephalitis, eye infections (e.g.,
conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A,
B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin,
Chikungunya, Rift Valley fever, yellow fever, meningitis,
opportunistic infections (e.g., AIDS), pneumonia, Burkitt's
Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps,
Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella,
sexually transmitted diseases, skin diseases (e.g., Kaposi's,
warts), and viremia. TR14 nucleic acids or polypeptides, and/or
agonists or antagonists of TR14, can be used to treat or detect any
of these symptoms or diseases. In specific embodiments, TR14
nucleic acids, polypeptides, and/or agonists or antagonists are
used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g.,
hepatitis B). In an additional specific embodiment TR14 nucleic
acids, polypeptides, and/or agonists or antagonists are used to
treat patients nonresponsive to one or more other commercially
available hepatitis vaccines. In a further specific embodiment,
TR14 nucleic acids, polypeptides, and/or agonists or antagonists
are used to treat AIDS.
[0635] Similarly, bacterial or fungal agents that can cause disease
or symptoms and that can be treated by TR14 nucleic acids or
polypeptides, and/or agonists or antagonists of TR14, include, but
not limited to, the following Gram-Negative and Gram-positive
bacteria and bacterial families and fungi: Actinomycetales (e.g.,
Corynebacterium, Mycobacterium, Norcardia), Cryptococcus
neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax,
Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia
(e.g., Borrelia burgdorferi, Brucellosis, Candidiasis,
Campylobacter, Coccidioidomycosis, Cryptococcosis, Dernatocycoses,
E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E.
coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella
typhi, and Salmonella paratyphi), Serratia, Yersinia),
Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis,
Listenia, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae,
Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Meisseria meningitidis, Pasteurellacea Infections (e.g.,
Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B),
Pasturella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis,
Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and
Streptococcal (e.g., Streptococcus pneumoniae and Group B
Streptococcus). These bacterial or fungal families can cause the
following diseases or symptoms, including, but not limited to:
bacteremia, endocarditis, eye infections (conjunctivitis,
tuberculosis, uveitis), gingivitis, opportunistic infections (e.g.,
AIDS related infections), paronychia, prosthesis-related
infections, Reiter's Disease, respiratory tract infections, such as
Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch
Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid,
pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B),
Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis,
Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo,
Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin
diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract
infections, wound infections. TR14 nucleic acids or polypeptides,
and/or agonists or antagonists of TR14, can be used to treat or
detect any of these symptoms or diseases. In specific embodiments,
TR14 nucleic acids, polypeptides, and/or agonist or antagonists
thereof are used to treat: tetanus, Diptheria, botulism, and/or
meningitis type B.
[0636] Moreover, parasitic agents causing disease or symptoms that
can be treated by TR14 nucleic acids or polypeptides, and/or
agonists or antagonists of TR14, include, but not limited to, the
following families or class: Amebiasis, Babesiosis, Coccidiosis,
Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic,
Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis,
Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans
(e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium
malariae and Plasmodium ovale). These parasites can cause a variety
of diseases or symptoms, including, but not limited to: Scabies,
Trombiculiasis, eye infections, intestinal disease (e.g.,
dysentery, giardiasis), liver disease, lung disease, opportunistic
infections (e.g., AIDS related), malaria, pregnancy complications,
and toxoplasmosis. TR14 nucleic acids or polypeptides, and/or
agonists or antagonists of TR14, can be used to treat or detect any
of these symptoms or diseases. In specific embodiments, TR14
nucleic acids, polypeptides, and/or agonists or antagonists thereof
are used to treat malaria., Moreover, parasitic agents causing
disease or symptoms that can be treated by TR14 nucleic acids or
polypeptides, and/or agonists or antagonists or TR14, include, but
not limited to, the following families or class: Amebiasis,
Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis,
Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis,
Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and
Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium,
Plasmodium malariae and Plasmodium ovale). These parasites can
cause a variety of diseases or symptoms, including, but not limited
to: Scabies, Trombiculiasis, eye infections, intestinal disease
(e.g., dysentery, giardiasis), liver disease, lung disease,
opportunistic infections (e.g., AIDS related), malaria, pregnancy
complications, and toxoplasmosis. TR14 nucleic acids or
polypeptides, and/or agonists or antagonists of TR14, can be used
to treat or detect any of these symptoms or diseases. In specific
embodiments, TR14 nucleic acids, polypeptides, and/or agonists or
antagonists thereof are used to treat malaria.
[0637] An additional condition, disease or symptom that can be
treated by TR13 nucleic acids, polypeptides, and/or agonists or
antagonists of TR13, is osteomyelitis.
[0638] An additional condition, disease or symptom that can be
treated by TR14 nucleic acids, polypeptides, and/or agonists or
antagonists of TR14, is osteomyelitis.
[0639] Preferably, treatment using TR13 nucleic acids,
polypeptides, and/or agonists or antagonists of TR13, could either
be by administering an effective amount of TR13 polypeptide to the
patient, or by removing cells from the patient, supplying the cells
with TR13 nucleic acids, and returning the engineered cells to the
patient (ex vivo therapy). Moreover, as further discussed herein,
the TR13 polypeptide or nucleic acids can be used as an adjuvant in
a vaccine to raise an immune response against infectious
disease.
[0640] Preferably, treatment using TR14 nucleic acids,
polypeptides, and/or agonists or antagonists of TR14, could either
be by administering an effective amount of TR14 polypeptide to the
patient, or by removing cells from the patient, supplying the cells
with TR14 nucleic acid, and returning the engineered cells to the
patient (ex vivo therapy). Moreover, as further discussed herein,
the TR14 polypeptide or nucleic acid can be used as an adjuvant in
a vaccine to raise an immune response against infectious
disease.
[0641] Additional preferred embodiments of the invention include,
but are not limited to, the use of TR13 and/or TR14 polypeptides
and/or functional agonists or functional antgonists in the
following applications:
[0642] Administration to an animal (e.g., mouse, rat, rabbit,
hamster, guinea pig, pigs, micro-pig, chicken, camel, goat, horse,
cow, sheep, dog, cat, non-human primate, and human, most preferably
human) to boost the immune system to produce increased quantities
of one or more antibodies (e.g., IgG, IgA, IgM, and IgE), to induce
higher affinity antibody production (e.g., IgG, IgA, IgM, and IgE),
and/or to increase an immune response.
[0643] Administration to an animal (including, but not limited to,
those listed above, and also including transgenic animals)
incapable of producing functional endogenous antibody molecules or
having an otherwise compromised endogenous immune system, but which
is capable of producing human immunoglobulin molecules by means of
a reconstituted or partially reconsituted immune system from
another animal (see, e.g., published PCT Application Nos.
WO98/24893, WO/9634096, WO/9633735, and WO/9110741.
[0644] A vaccine adjuvant that enhances immune responsiveness to
specific antigen. In a specific embodiment, the vaccine adjuvant is
a TR13 and/or TR14 polypeptide described herein. In another
specific embodiment, the vaccine adjuvant is a TR13 and/or TR14
nucleic acid described herein (i.e., the TR13 and/or TR14 nucleic
acid is a genetic vaccine adjuvant). As discussed herein, TR13
and/or TR14 nucleic acids may be administered using techniques
known in the art, including but not limited to, liposomal delivery,
recombinant vector delivery, injection of naked DNA, and gene gun
delivery.
[0645] An adjuvant to enhance tumor-specific immune responses.
[0646] An adjuvant to enhance anti-viral immune responses.
Anti-viral immune responses that may be enhanced using the
compositions of the invention as an adjuvant, include virus and
virus associated diseases or symptoms described herein or otherwise
known in the art. In specific embodiments, the compositions of the
invention are used as an adjuvant to enhance an immune response to
a virus, disease, or Symptom selected from the group consisting of:
AIDS, meningitis, Dengue, EBV, and hepatitis (e.g., hepatitis B).
In another specific embodiment, the compositions of the invention
are used as an adjuvant to enhance an immune response to a virus,
disease, or symptom selected from the group consisting of:
HIV/AIDS, Respiratory syncytial virus, Dengue, Rotavirus, Japanese
B encephalitis, Influenza A and B, Parainfluenza, Measles,
Cytomegalovirus, Rabies, Junin, Chikungunya, Rift Valley fever,
Herpes simplex, and yellow fever. In another specific embodiment,
the compositions of the invention are used as an adjuvant to
enhance an immune response to the HIV gp120 antigen.
[0647] An adjuvant to enhance anti-bacterial or anti-fungal immune
responses. Anti-bacterial or anti-fungal immune responses that may
be enhanced using the compositions of the invention as an adjuvant,
include bacteria or fungus and bacteria or fungus associated
diseases or symptoms described herein or otherwise known in the
art. In specific embodiments, the compositions of the invention are
used as an adjuvant to enhance an immune response to a bacteria or
fungus, disease, or symptom selected from the group consisting of:
tetanus, Diphtheria, botulism, and meningitis type B. In another
specific embodiment, the compositions of the invention are used as
an adjuvant to enhance an immune response to a bacteria or fungus,
disease, or symptom selected from the group consisting of: Vibrio
cholerae, Mycobacterium leprae, Salmonella typhi, Salmonella
paratyphi, Meisseria meningitidis, Streptococcus pneumoniae, Group
B streptococcus, Shigella spp., Enterotoxigenic Escherichia coli,
Enterohemorrhagic E. coli, Borrelia burgdorferi, and Plasmodium
(malaria).
[0648] An adjuvant to enhance anti-parasitic immune responses.
Anti-parasitic immune responses that may be enhanced using the
compositions of the invention as an adjuvant, include parasite and
parasite associated diseases or symptoms described herein or
otherwise known in the art. In specific embodiments, the
compositions of the invention are used as an adjuvant to enhance an
immune response to a parasite. In another specific embodiment, the
compositions of the invention are used as an adjuvant to enhance an
immune response to Plasmodium (malaria).
[0649] As a stimulator of B cell responsiveness to pathogens.
[0650] As an agent that elevates the immune status of an individual
prior to their receipt of immunosuppressive therapies.
[0651] As an agent to induce higher affinity antibodies.
[0652] As an agent to increase serum immunoglobulin
concentrations.
[0653] As an agent to accelerate recovery of immunocompromised
individuals.
[0654] As an agent to boost immunoresponsiveness among aged
populations.
[0655] As an immune system enhancer prior to, during, or after bone
marrow transplant and/or other transplants (e.g., allogeneic or
xenogeneic organ transplantation). With respect to transplantation,
compositions of the invention may be administered prior to,
concomitant with, and/or after transplantation. In a specific
embodiment, compositions of the invention are administered after
transplantation, prior to the beginning of recovery of T-cell
populations. In another specific embodiment, compositions of the
invention are first administered after transplantation after the
beginning of recovery of T cell populations, but prior to full
recovery of B cell populations.
[0656] As an agent to boost immunoresponsiveness among B cell
immunodeficient individuals. B cell immunodeficiencies that may be
ameliorated or treated by administering the TR13 polypeptides or
polynucleotides of the invention, or agonists thereof, include, but
are not limited to, SCID, congenital agammaglobulinemia, common
variable immunodeficiency, Wiskott-Aldrich Syndrome, X-linked
immunodeficiency with hyper IgM, and severe combined
immunodeficiency.
[0657] As an agent to boost immunoresponsiveness among B cell
immunodeficient individuals. B cell immunodeficiencies that may be
ameliorated or treated by administering the TR14 polypeptides or
nucleic acids of the invention, or agonists thereof, include, but
are not limited to, SCID, congenital agammaglobulinemia, common
variable immunodeficiency, Wiskott-Aldrich Syndrome, X-linked
immunodeficiency with hyper IgM, and severe combined
immunodeficiency.
[0658] As an agent to boost immunoresponsiveness among individuals
having an acquired loss of B cell function. Conditions resulting in
an acquired loss of B cell function that may be ameliorated or
treated by administering the TR13 polypeptides or nucleic acids of
the invention, or agonists thereof, include, but are not limited
to, HIV Infection, AIDS, bone marrow transplant, and B cell chronic
lymphocytic leukemia (CLL).
[0659] As an agent to boost immunoresponsiveness among individuals
having a temporary immune deficiency. Conditions resulting in a
temporary immune deficiency that may be ameliorated or treated by
administering the TR13 polypeptides or nucleic acids of the
invention, or agonists thereof, include, but are not limited to,
recovery from viral infections (e.g., influenza), conditions
associated with malnutrition, recovery from infectious
mononucleosis, or conditions associated with stress, recovery from
measles, recovery from blood transfusion, recovery from
surgery.
[0660] As an agent to boost immunoresponsiveness among individuals
having an acquired loss of B cell function. Conditions resulting in
an acquired loss of B cell function that may be ameliorated or
treated by administering the TR14 polypeptides or nucleic acids of
the invention, or agonists thereof, include, but are not limited
to, HIV Infection, AIDS, bone marrow transplant, and B cell chronic
lymphocytic leukemia (CLL).
[0661] As an agent to boost immunoresponsiveness among individuals
having a temporary immune deficiency. Conditions resulting in a
temporary immune deficiency that may be ameliorated or treated by
administering the TR14 polypeptides or nucleic acids of the
invention, or agonists thereof, include, but are not limited to,
recovery from viral infections (e.g., influenza), conditions
associated with malnutrition, recovery from infectious
mononucleosis, or conditions associated with stress, recovery from
measles, recovery from blood transfusion, recovery from
surgery.
[0662] As a regulator of antigen presentation by monocytes,
dendritic cells, and/or B-cells. In one embodiment, TR13 (in
soluble, membrane-bound or transmembrane forms) enhances antigen
presentation or antagonizes antigen presentation in vitro or in
vivo. Moreover, in related embodiments, said enhancement or
antagonization of antigen presentation may be useful as an
anti-tumor treatment or to modulate the immune system.
[0663] As a regulator of antigen presentation by monocytes,
dendritic cells, and/or B-cells. In one embodiment, TR14 (in
soluble, membrane-bound or transmembrane forms) enhances antigen
presentation or antagonizes antigen presentation in vitro or in
vivo. Moreover, in related embodiments, said enhancement or
antagonization of antigen presentation may be useful as an
anti-tumor treatment or to modulate the immune system.
[0664] As an agent to direct an individuals immune system towards
development of a humoral response (i.e. TH2) as opposed to a TH1
cellular response.
[0665] As a means to induce tumor proliferation and thus make it
more susceptible to anti-neoplastic agents. For example, multiple
myeloma is a slowly dividing disease and is thus refractory to
virtually all anti-neoplastic regimens. If these cells were forced
to proliferate more rapidly their susceptibility profile would
likely change.
[0666] As a stimulator of B cell production in pathologies such as
AIDS, chronic lymphocyte disorder and/or Common Variable
Immunodificiency;
[0667] As a therapy for generation and/or regeneration of lymphoid
tissues following surgery, trauma or genetic defect.
[0668] As a gene-based therapy for genetically inherited disorders
resulting in immuno-incompetence such as observed among SCID
patients.
[0669] As an antigen for the generation of antibodies to inhibit or
enhance TR13 mediated responses.
[0670] As an antigen for the generation of antibodies to inhibit or
enhance TR14 mediated responses.
[0671] As a means of activating monocytes/macrophages to defend
against parasitic diseases that effect monocytes such as
Leshmania.
[0672] As a means of activating T cells.
[0673] As pretreatment of bone marrow samples prior to transplant.
Such treatment would increase B cell representation and thus
accelerate recover.
[0674] As a means of regulating secreted cytokines that are
elicited by TR13.
[0675] As a means of regulating secreted cytokines that are
elicited by TR14.
[0676] TR13 polypeptides or nucleic acids of the invention, and/or
agonists or antagonists may be used to modulate IgE concentrations
in vitro or in vivo.
[0677] TR14 polypeptides or nucleic acids of the invention, and/or
agonists or antagonists may be used to modulate IgE concentrations
in vitro or in vivo.
[0678] Additionally, TR13 polypeptides or nucleic acids of the
invention, and/or agonists or antagonists thereof, may be used to
treat or prevent IgE-mediated allergic reactions. Such allergic
reactions include, but are not limited to, asthma, rhinitis, and
eczema.
[0679] Additionally, TR14 polypeptides or nucleic acids of the
invention, and/or agonists or antagonists thereof, may be used to
treat or prevent IgE-mediated allergic reactions. Such allergic
reactions include, but are not limited to, asthma, rhinitis, and
eczema.
[0680] All of the above described applications as they may apply to
veterinary medicine.
[0681] Antagonists of TR13 include binding and/or inhibitory
antibodies, antisense nucleic acids, ribozymes or soluble forms of
the TR13 receptor(s). Antagonists or agonists of TR13 would be
expected to reverse many of the activities of the ligand described
above as well as find clinical or practical application as:
[0682] Antagonists of TR14 include binding and/or inhibitory
antibodies, antisense nucleic acids, ribozymes or soluble forms of
the TR14 receptor(s) Antagonists or agonists of TR14 would be
expected to reverse many of the activities of the ligand described
above as well as find clinical or practical application as:
[0683] A means of blocking various aspects of immune responses to
foreign agents or self. Examples include autoimmune disorders such
as lupus, and arthritis, as well as immunoresponsiveness to skin
allergies, inflammation, bowel disease, injury and pathogens.
[0684] A means of blocking various aspects of immune responses to
foreign agents or self. Examples include autoimmune disorders such
as lupus, and arthritis, as well as immunoresponsiveness to skin
allergies, inflammation, bowel disease, injury and pathogens.
[0685] A therapy for preventing the B cell proliferation and Ig
secretion associated with autoimmune diseases such as idiopathic
thrombocytopenic purpura, systemic lupus erythramatosus and MS.
[0686] An inhibitor of graft versus host disease or transplant
rejection.
[0687] A therapy for B cell malignancies such as ALL, Hodgkins
disease, non-Hodgkins lymphoma, Chronic lymphocyte leukemia,
plasmacytomas, multiple myeloma, Burkitt's lymphoma, and
EBV-transformed diseases.
[0688] A therapy for chronic hypergammaglobulinemeia evident in
such diseases as monoclonalgammopathy of undetermined significance
(MGUS), Waldenstrom's disease, related idiopathic
monoclonalgammopathies, and plasmacytomas.
[0689] A therapy for decreasing cellular proliferation of Large
B-cell Lymphomas.
[0690] A means of decreasing the involvement of B cells and Ig
associated with Chronic Myelogenous Leukemia.
[0691] An immunosuppressive agent(s).
[0692] TR13 polypeptides or nucleic acids of the invention, and/or
agonists or antagonists may be used to modulate IgE concentrations
in vitro or in vivo.
[0693] TR14 polypeptides or nucleic acids s of the invention,
and/or agonists or antagonists may be used to modulate IgE
concentrations in vitro or in vivo.
[0694] In another embodiment, administration of TR13 polypeptides
or nucleic acids of the invention, and/or agonists or antagonists
thereof, may be used to treat or prevent IgE-mediated allergic
reactions including, but not limited to, asthma, rhinitis, and
eczema.
[0695] In another embodiment, administration of TR14 polypeptides
or nucleic acids of the invention, and/or agonists or antagonists
thereof, may be used to treat or prevent IgE-mediated allergic
reactions including, but not limited to, asthma, rhinitis, and
eczema.
[0696] The above-recited applications have uses in a wide variety
of hosts. Such hosts include, but are not limited to, human,
murine, rabbit, goat, guinea pig, camel, horse, mouse, rat,
hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat,
non-human primate, and human. In specific embodiments, the host is
a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig,
sheep, dog or cat. In preferred embodiments, the host is a mammal.
In most preferred embodiments, the host is a human.
[0697] The TR13 and/or TR14 nucleic acids, polypeptides and/or
agonists and antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as described
hererin.
[0698] The TR13 and/or TR14 nucleic acids, polypeptides and/or
agonists or antagonists may be employed for instance to inhibit the
chemotaxis and activation of macrophages and their precursors, and
of neutrophils, basophils, B lymphocytes and some T-cell subsets,
e.g., activated and CD8 cytotoxic T cells and natural killer cells,
in certain auto-immune and chronic inflammatory and infective
diseases. Examples of auto-immune diseases include multiple
sclerosis, and insulin-dependent diabetes. TR13 and/or TR14 nucleic
acids, polypeptides and/or agonists or antagonists may also be
employed to treat infectious diseases including silicosis,
sarcoidosis, idiopathic pulmonary fibrosis by preventing the
recruitment and activation of mononuclear phagocytes. They may also
be employed to treat idiopathic hyper-eosinophilic syndrome by
preventing eosinophil production and migration. Endotoxic shock may
also be treated by the antagonists by preventing the migration of
macrophages and their production of the TR16 polypeptides of the
present invention. The TR13 and/or TR14 nucleic acids, polypeptides
and/or agonists or antagonists may also be employed for treating
TR13 and/or TR14 nucleic acids, polypeptides and/or agonists or
antagonists antagonists may also be employed to treat
histamine-mediated allergic reactions and immunological disorders
including late phase allergic reactions, chronic urticaria, and
atopic dermatitis by inhibiting chemokine-induced mast cell and
basophil degranulation and release of histamine. IgE-mediated
allergic reactions such as allergic asthma, rhinitis, and eczema
may also be treated. The TR13 and/or TR14 nucleic acids,
polypeptides and/or agonists or antagonists may also be employed to
treat chronic and acute inflammation by preventing the attraction
of monocytes to a wound area. They may also be employed to regulate
normal pulmonary macrophage populations, since chronic and acute
inflammatory pulmonary diseases are associated with sequestration
of mononuclear phagocytes in the lung. TR13 and/or TR14 nucleic
acids, polypeptides and/or agonists or antagonists may also be
employed to treat rheumatoid arthritis by preventing the attraction
of monocytes into synovial fluid in the joints of patients.
Monocyte influx and activation plays a significant role in the
pathogenesis of both degenerative and inflammatory arthropathies.
The TR13 and/or TR14 nucleic acids, polypeptides and/or agonists or
antagonists may be employed to interfere with the deleterious
cascades attributed primarily to IL-1 and TNF, which prevents the
biosynthesis of other inflammatory cytokines. In this way, the
antagonists may be employed to prevent inflammation. The TR13
and/or TR14 nucleic acids, polypeptides and/or agonists or
antagonists may also be employed to inhibit
prostaglandin-independent fever induced by TR16. The TR13 and/or
TR14 nucleic acids, polypeptides and/or agonists or antagonists may
also be employed to treat cases of bone marrow failure, for
example, aplastic anemia and myelodysplastic syndrome. The TR13
and/or TR14 nucleic acids, polypeptides and/or agonists or
antagonists may also be employed to treat asthma and allergy by
preventing eosinophil accumulation in the lung. The TR13 and/or
TR14 nucleic acids, polypeptides and/or agonists or antagonists may
also be employed to treat subepithelial basement membrane fibrosis
which is a prominent feature of the asthmatic lung. The TR13 and/or
TR14 nucleic acids, polypeptides and/or agonists or antagonists may
also be employed to treat lymphomas (e.g., one or more of the
extensive, but not limiting, list of lymphomas provided
herein).
[0699] Antibodies against TR13 and/or TR14 may be employed to bind
to and inhibit TR13 and/or TR14 activity to treat ARDS, by
preventing infiltration of neutrophils into the lung after injury.
The antagonists and antagonists of the instant may be employed in a
composition with a pharmaceutically acceptable carrier, e.g., as
described hereinafter.
[0700] In rejection of an allograft, the immune system of the
recipient animal has not previously been primed to respond because
the immune system for the most part is only primed by environmental
antigens. Tissues from other members of the same species have not
been presented in the same way that, for example, viruses and
bacteria have been presented. In the case of allograft rejection,
immunosuppressive regimens are designed to prevent the immune
system from reaching the effector stage. However, the immune
profile of xenograft rejection may resemble disease recurrence more
than allograft rejection. In the case of disease recurrence, the
immune system has already been activated, as evidenced by
destruction of the native islet cells. Therefore, in disease
recurrence, the immune system is already at the effector stage.
Antagonists of the present invention are able to suppress the
immune response to both allografts and xenografts because
lymphocytes activated and differentiated into effector cells will
express the TR13 polypeptide, and thereby are susceptible to
compounds which enhance apoptosis. Thus, the present invention
further provides a method for creating immune privileged
tissues.
[0701] In rejection of an allograft, the immune system of the
recipient animal has not previously been primed to respond because
the immune system for the most part is only primed by environmental
antigens. Tissues from other members of the same species have not
been presented in the same way that, for example, viruses and
bacteria have been presented. In the case of allograft rejection,
immunosuppressive regimens are designed to prevent the immune
system from reaching the effector stage. However, the immune
profile of xenograft rejection may resemble disease recurrence more
than allograft rejection. In the case of disease recurrence, the
immune system has already been activated, as evidenced by
destruction of the native islet cells. Therefore, in disease
recurrence, the immune system is already at the effector stage.
Antagonists of the present invention are able to suppress the
immune response to both allografts and xenografts because
lymphocytes activated and differentiated into effector cells will
express the TR14 polypeptide, and thereby are susceptible to
compounds which enhance apoptosis. Thus, the present invention
further provides a method for creating immune privileged
tissues.
[0702] TR13 polynucleotides, polypeptides, and agonists of the
invention may also be used to suppress immune responses. In one
embodiment, the TR13 polynucleotides, polypeptides, and agonists of
the invention are used to minimize untoward effects associated with
transplantation. In a specific embodiment, the TR13
polynucleotides, polypeptides, and agonists of the invention are
used to suppress Fas mediated immune responses (e.g., in a manner
similar to an immunosuppressant such as, for example, rapamycin or
cyclosporin). In another specific embodiment, the TR13
polynucleotides, polypeptides, and agonists of the invention are
used to suppress AIM-II mediated immune responses.
[0703] Additionally, both graft rejection and graft vs. host
disease are in part triggered by apoptosis. Accordingly, an
additional preferred embodiment, TR13 polynucleotides,
polypeptides, TR13 agonists and/or TR13 antagonists of the
invention are used to treat and prevent and/or reduce graft
rejection. In afurther preferred embodiment, TR13 polynucleotides,
polypeptides, TR13 agonists and/or TR13 antagonists of the
invention are used to treat and prevent and/or reduce graft vs.
host disease.
[0704] Additionally, TR13 polypeptides, polynucleotides, TR13
agonists and/or TR13 antagonists may be used to treat or prevent
graft rejection (e.g., xenograft and allograft rejection (e.g,
acute allograft rejection)) and/or medical conditions associated
with graft rejection. In a specific embodiment, TR13 polypeptides,
polynucleotides, TR13 agonists and/or TR13 antagonists of the
invention are used to treat or prevent acute allograft rejection
and/or medical conditions associated with acute allograft
rejection. In a further specific embodiment, TR13 polypeptides,
polynucleotides, TR13 agonists and/or TR13 antagonists of the
invention are used to treat or prevent acute allograft rejection of
a kidney and/or medical conditions associated with acute allograft
rejection of a kidney.
[0705] Fas ligand is a type II membrane protein that induces
apoptosis by binding to Fas. Fas ligand is expressed in activated T
cells, and works as an effector of cytotoxic lymphocytes. Molecular
and genetic analysis of Fas and Fas ligand have indicated that
mouse lymphoproliferation mutation (lpr) and generalized
lymphoproliferative disease (gld) are mutations of Fas and Fas
ligand respectively. The lpr of gld mice develop lymphadenopathy,
and suffer from autoimmune disease. Based on these phenotypes and
other studies, it is believed that the Fas system is involved in
the apoptotic process during T-cell development, specifically
peripheral clonal deletion or activation-induced apoptosis of
mature T cells. In addition to the activated lymphocytes, Fas is
expressed in the liver, heart and lung. Administration of agonistic
anti-Fas antibody into mice has been shown to induce apoptosis in
the liver and to quickly kill the mice, causing liver damage. These
findings indicate that the Fas system plays a role not only in the
physiological process of lymphocyte development, but also in the
cytotoxic T-lymphocyte-mediated disease such as fulminant hepatitis
and/or hepatitis resulting from viral infection or toxic agents. As
discussed herein, TR13 binds Fas ligand, and thus functions as an
antagonist of Fas-ligand mediated activity. Accordingly, the TR13
polypeptides and/or polynucleotides of the invention, and/or
agonists thereof, may be used to treat or prevent
lymphoproliferative disorders (e.g., lymphadenopathy and others
described herein), autoimmune disorders (e.g., autoimmune diabetes,
systemic lupus erythematosus, Grave's disease, Hashimoto's
thyroiditis, immune-related glomerulonephritis, autoimmune
gastritis, autoimmune thrombocytopenic purpura, multiple sclerosis,
rheumatoid arthritis, and others described herein), and/or liver
disease (e.g., acute and chronic hepatitis, and cirrhosis).
[0706] In a specific embodiment TR13 polynucleotides, polypeptides,
and/or agonists or antagonists of the invention is used to treat or
prevent hepatitis and/or tissue/cell damage or destruction and/or
medical conditions associated with hepatitis. In a specific
embodiment TR13 polynucleotides, polypeptides, and/or agonists or
antagonists of the invention is used to treat or prevent fulminant
hepatitis and/or medical conditions associated with fulminant
hepatitis.
[0707] In a specific embodiment TR13 polynucleotides, polypeptides,
and/or agonists or antagonists of the invention is used to treat or
prevent systemic lupus erythematosus (SLE) and/or tissue/cell
damage or destruction and/or medical conditions associated with
SLE. In a further specific embodiment, TR13 polynucleotides,
polypeptides, and/or agonists or antagonists of the invention are
used to treat or prevent skin lesions in SLE patients.
[0708] In a specific embodiment, TR13 polynucleotides,
polypeptides, and/or agonists or antagonists of the invention is
used to treat or prevent insulin-dependent diabetes mellitus and/or
tissue/cell damage or destruction and/or medical conditions
associated with insulin-dependent diabetes mellitus. In a further
specific embodiment, TR13 polynucleotides, polypeptides, and/or
agonists or antagonists of the invention are prior to, during, or
immediately after the onset of diabetes to reduce or prevent damage
to islet cells and/or to reduce exogenous insulin requirement.
[0709] In a specific embodiment TR13 polynucleotides, polypeptides,
and/or agonists or antagonists of the invention is used to treat or
prevent toxic epidermal necrolysis (TEN) and/or tissue/cell damage
or destruction, and/or medical conditions associated with TEN. In a
further specific embodiment, TR13 polynucleotides, polypeptides,
and/or agonists or antagonists of the invention is used to treat or
prevent Lyell's syndrome.
[0710] Hepatitis virus (e.g., Hepatitis B virus and Hepatitis C
virus) is a major causative agent of chronic liver disease. In
Hepatitis infection, Fas expression in hepatocytes is up-regulated
in accordance with the severity of liver inflammation. When
Hepatitis virus-specific T cells migrate into hepatocytes and
recognize the viral antigen via the T cell receptor, they become
activated and express Fas ligand that can transduce the apoptotic
death signal to Fas-bearing hepatocytes. Thus, the Fas system plays
an important role in liver cell injury by viral hepatitis.
Accordingly, in specific embodiments, the TR13 polypeptides and/or
polynucleotides of the invention and/or agonists or antagonists
thereof, are used to treat or prevent hepatitis resulting from
viral infection (e.g., infection resulting form Hepatitis B virus
or Hepatitis C virus infection). In one embodiment, a patient's
blood or plasma is contacted with TR13 polypeptides of the
invention ex vivo. The TR13 may be bound to a suitable
chromatography matrix by conventional procedures. According to this
embodiment, the patient's blood or plasma flows through a
chromatography column containing TR13 bound to the matrix, before
being returned to the patient. The immobilized TR13 binds
Fas-ligand, thus removing Fas-ligand protein from the patient's
blood.
[0711] In a specific embodiment, TR13 polypeptides,
polynucleotides, and/or agonists or antagonists of the invention
may be used to treat or prevent renal failure (e.g., chronic renal
failure), and/or tissue/cell damage or destruction (e.g., tubular
epithelial cell deletion) and/or medical conditions associated with
renal failure.
[0712] In a specific embodiment, TR13 polypeptides,
polynucleotides, and/or agonists or antagonists of the invention
may be used to regulate (i.e., stimulate or inhibit) bone growth.
In specific embodiments TR13 polypeptides, polynucleotides, and/or
agonists or antagonists of the invention are used to stimulate bone
growth. Specific diseases or conditions that may be treated or
prevented with the compositions of the invention include, but are
not limited to, bone fractures, and defects, and disorders which
result in weakened bones such as osteoporosis, osteomalacia, and
age-related loss of bone mass.
[0713] TR13 nucleic acids, polypeptides and/or agonists or
antagonists of the invention can further be used in the treatment
of inflammatory diseases, such as inflammatory bowel disease,
rheumatoid arthritis, osteoarthritis, psoriasis, and
septicemia.
[0714] TR14 nucleic acids, polypeptides and/or agonists or
antagonists of the invention can further be used in the treatment
of inflammatory diseases, such as inflammatory bowel disease,
rheumatoid arthritis, osteoarthritis, psoriasis, and
septicemia.
[0715] TR13 and/or TR14 nucleic acids and/or polypeptides of the
invention and/or agonists and/or antagonists thereof are useful in
the diagnosis and treatment or prevention of a wide range of
diseases and/or conditions. Such diseases and conditions include,
but are not limited to, cancer (e.g., immune cell related cancers,
breast cancer, prostate cancer, ovarian cancer, follicular
lymphoma, cancer associated with mutation or alteration of p53,
brain tumor, bladder cancer, uterocervical cancer, colon cancer,
colorectal cancer, non-small cell carcinoma of the lung, small cell
carcinoma of the lung, stomach cancer, etc.), lymphoproliferative
disorders (e.g., lymphadenopathy), microbial (e.g., viral,
bacterial, etc.) infection (e.g., HIV-1 infection, HIV-2 infection,
herpesvirus infection (including, but not limited to, HSV-1, HSV-2,
CMV, VZV, HHV-6, HHV-7, EBV), adenovirus infection, poxvirus
infection, human papilloma virus infection, hepatitis infection
(e.g., HAV, HBV, HCV, etc.), Helicobacter pylori infection,
invasive Staphylococcia, etc.), parasitic infection, nephritis,
bone disease (e.g., osteoporosis), atherosclerosis, pain,
cardiovascular disorders (e.g., neovascularization,
hypovascularization or reduced circulation (e.g., ischemic disease
(e.g., myocardial infarction, stroke, etc.))), AIDS, allergy,
inflammation, neurodegenerative disease (e.g., Alzheimer's disease,
Parkinson's disease, amyotrophic lateral sclerosis, pigmentary
retinitis, cerebellar degeneration, etc.), graft rejection (acute
and chronic), graft vs. host disease, diseases due to
osteomyelodysplasia (e.g., aplastic anemia, etc.), joint tissue
destruction in rheumatism, liver disease (e.g., acute and chronic
hepatitis, liver injury, and cirrhosis), autoimmune disease (e.g.,
multiple sclerosis, rheumatoid arthritis, systemic lupus
erythematosus, immune complex glomerulonephritis, autoimmune
diabetes, autoimmune thrombocytopenic purpura, Grave's disease,
Hashimoto's thyroiditis, etc.), cardiomyopathy (e.g., dilated
cardiomyopathy), diabetes, diabetic complications (e.g., diabetic
nephropathy, diabetic neuropathy, diabetic retinopathy), influenza,
asthma, psoriasis, glomerulonephritis, septic shock, and ulcerative
colitis.
[0716] TR13 and/or TR14 nucleic acids and/or polypeptides of the
invention and/or agonists and/or antagonists thereof are useful in
promoting angiogenesis, regulating hematopoiesis and wound healing
(e.g., wounds, burns, and bone fractures).
[0717] TR13 and/or TR14 nucleic acids and/or polypeptides of the
invention and/or agonists and/or antagonists thereof are also
useful as an adjuvant to enhance immune responsiveness to specific
antigen, anti-viral immune responses.
[0718] More generally, TR13 and/or TR14 nucleic acids and/or
polypeptides of the invention and/or agonists and/or antagonists
thereof are useful in regulating (i.e., elevating or reducing)
immune response. For example, nucleic acids and/or polypeptides of
the invention may be useful in preparation or recovery from
surgery, trauma, radiation therapy, chemotherapy, and
transplantation, or may be used to boost immune response and/or
recovery in the elderly and immunocompromised individuals.
Alternatively, TR13 and/or TR14 nucleic acids and/or polypeptides
of the invention and/or agonists and/or antagonists thereof are
useful as immunosuppressive agents, for example in the treatment or
prevention of autoimmune disorders. In specific embodiments,
nucleic acids and/or polypeptides of the invention are used to
treat or prevent chronic inflammatory, allergic or autoimmune
conditions, such as those described herein or are otherwise known
in the art.
[0719] In one aspect, the present invention is directed to a method
for enhancing apoptosis induced and/or TR13 mediated signaling
induced by a TNF-family ligand, which involves administering to a
cell which expresses the TR13 polypeptide an effective amount of
TR13 ligand (e.g., Fas ligand), analog or an agonist capable of
increasing apoptosis and/or TR13 mediated signaling. Preferably,
TR13 mediated signaling is increased to treat a disease wherein
decreased apoptosis or decreased cytokine and adhesion molecule
expression is exhibited. An agonist can include monoclonal
antibodies directed against the TR13 polypeptide.
[0720] In a further aspect, the present invention is directed to a
method for inhibiting apoptosis induced and/or TR13 mediated
signalling induced by a TNF-family ligand (e.g., Fas ligand), which
involves administering to a cell which expresses the TR13
polypeptide an effective amount of an antagonist capable of
decreasing apoptosis and/or TR13 mediated signaling. Preferably,
TR13 mediated signaling is decreased to treat a disease wherein
increased apoptosis or NFkB expression is exhibited. An antagonist
can include soluble forms of TR13 and monoclonal antibodies
directed against the TR13 polypeptide.
[0721] In one aspect, the present invention is directed to a method
for enhancing apoptosis induced and/or TR14 mediated signaling
induced by a TNF-family ligand, which involves administering to a
cell which expresses the TR14 polypeptide an effective amount of
TR14 ligand, analog or an agonist capable of increasing apoptosis
and/or TR14 mediated signaling. Preferably, TR14 mediated signaling
is increased to treat a disease wherein decreased apoptosis or
decreased cytokine and adhesion molecule expression is exhibited.
An agonist can include soluble forms of TR14 and monoclonal
antibodies directed against the TR14 polypeptide.
[0722] In a further aspect, the present invention is directed to a
method for inhibiting apoptosis induced and/or TR14 mediated
signalling induced by a TNF-family ligand, which involves
administering to a cell which expresses the TR14 polypeptide an
effective amount of an antagonist capable of decreasing apoptosis
and/or TR14 mediated signaling. Preferably, TR14 mediated signaling
is decreased to treat a disease wherein increased apoptosis or NFkB
expression is exhibited. An antagonist can include soluble forms of
TR14 and monoclonal antibodies directed against the TR14
polypeptide.
[0723] By "agonist" is intended naturally occurring and synthetic
compounds capable of enhancing or potentiating apoptosis. By
"antagonist" is intended naturally occurring and synthetic
compounds capable of inhibiting apoptosis. Whether any candidate
"agonist" or "antagonist" of the present invention can enhance or
inhibit apoptosis can be determined using art-known TNF-family
ligand/receptor cellular response assays, including those described
in more detail below.
[0724] One such screening procedure involves the use of
melanophores which are transfected to express the receptor of the
present invention. Such a screening technique is described in PCT
WO 92/01810, published Feb. 6, 1992. Such an assay may be employed,
for example, for screening for a compound which inhibits (or
enhances) activation of the receptor polypeptide of the present
invention by contacting the melanophore cells which encode the
receptor with both a TNF-family ligand and the candidate antagonist
(or agonist). Inhibition or enhancement of the signal generated by
the ligand indicates that the compound is an antagonist or agonist
of the ligand/receptor signaling pathway.
[0725] Other screening techniques include the use of cells which
express the receptor (for example, transfected CHO cells) in a
system which measures extracellular pH changes caused by receptor
activation. For example, compounds may be contacted with a cell
which expresses the receptor polypeptide of the present invention
and a second messenger response, e.g., signal transduction or pH
changes, may be measured to determine whether the potential
compound activates or inhibits the receptor.
[0726] Another such screening technique involves introducing RNA
encoding the receptor into Xenopus oocytes to transiently express
the receptor. The receptor oocytes may then be contacted with the
receptor ligand and a compound to be screened, followed by
detection of inhibition or activation of a calcium signal in the
case of screening for compounds which are thought to inhibit
activation of the receptor.
[0727] Another screening technique well known in the art involves
expressing in cells a construct wherein the receptor is linked to a
phospholipase C or D. Exemplary cells include endothelial cells,
smooth muscle cells, embryonic kidney cells, etc. The screening may
be accomplished as hereinabove described by detecting activation of
the receptor or inhibition of activation of the receptor from the
phospholipase signal.
[0728] Another method involves screening for compounds which
inhibit activation of the receptor polypeptide of the present
invention antagonists by determining inhibition of binding of
labeled ligand to cells which have the receptor on the surface
thereof. Such a method involves transfecting a eukaryotic cell with
DNA encoding the receptor such that the cell expresses the receptor
on its surface and contacting the cell with a compound in the
presence of a labeled form of a known ligand. The ligand can be
labeled, e.g., by radioactivity. The amount of labeled ligand bound
to the receptors is measured, e.g., by measuring radioactivity of
the receptors. If the compound binds to the receptor as determined
by a reduction of labeled ligand which binds to the receptors, the
binding of labeled ligand to the receptor is inhibited.
[0729] Further screening assays for agonists and antagonists of the
present invention are described in L. A. Tartaglia and D. V.
Goeddel, J. Biol. Chem. 267:4304-4307(1992).
[0730] Thus, in a further aspect, a screening method is provided
for determining whether a candidate agonist or antagonist is
capable of enhancing or inhibiting a cellular response to a
TNF-family ligand. The method involves contacting cells which
express the TR13 polypeptide with a candidate compound and a
TNF-family ligand (e.g. Fas ligand), assaying a cellular response,
and comparing the cellular response to a standard cellular
response, the standard being assayed when contact is made with the
ligand in absence of the candidate compound, whereby an increased
cellular response over the standard indicates that the candidate
compound is an agonist of the ligand/receptor signaling pathway and
a decreased cellular response compared to the standard indicates
that the candidate compound is an antagonist of the ligand/receptor
signaling pathway. By "assaying a cellular response" is intended
qualitatively or quantitatively measuring a cellular response to a
candidate compound and/or a TNF-family ligand (e.g., quntitating
the amount of apoptosis in a cell population, or determining or
estimating an increase or decrease in T cell proliferation by
tritiated thymidine labeling). By the invention, a cell expressing
the TR13 polypeptide can be contacted with either an endogenous or
exogenously administered TNF-family ligand.
[0731] Thus, in a further aspect, a screening method is provided
for determining whether a candidate agonist or antagonist is
capable of enhancing or inhibiting a cellular response to a
TNF-family ligand. The method involves contacting cells which
express the TR14 polypeptide with a candidate compound and a
TNF-family ligand, assaying a cellular response, and comparing the
cellular response to a standard cellular response, the standard
being assayed when contact is made with the ligand in absence of
the candidate compound, whereby an increased cellular response over
the standard indicates that the candidate compound is an agonist of
the ligand/receptor signaling pathway and a decreased cellular
response compared to the standard indicates that the candidate
compound is an antagonist of the ligand/receptor signaling pathway.
By "assaying a cellular response" is intended qualitatively or
quantitatively measuring a cellular response to a candidate
compound and/or a TNF-family ligand (e.g., determining or
estimating an increase or decrease in T cell proliferation or
tritiated thymidine labeling). By the invention, a cell expressing
the TR14 polypeptide can be contacted with either an endogenous or
exogenously administered TNF-family ligand.
[0732] Antagonist according to the present invention include
naturally occurring and synthetic compounds such as, for example,
TNF family ligand peptide fragments, transforming growth factor,
neurotransmitters (such as glutamate, dopamine,
N-methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells
and antimetabolites)). Further preferred antagonists include, TR13
polypeptide fragments, and polyclonal and monoclonal antibodies
raised against the TR13 polypeptide, or a fragment thereof.
Preferred agonists include chemotherapeutic drugs such as, for
example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside,
nitrogen mustard, methotrexate and vincristine. Others include
ethanol and -amyloid peptide. (Science 267:1457-1458 (1995)).
Further preferred agonists include, TR13 polypeptide fragments, and
polyclonal and monoclonal antibodies raised against the TR13
polypeptide, or a fragment thereof. Such agonist antibodies raised
against a TNF-family receptor are disclosed in L. A. Tartaglia et
al., Proc. Natl. Acad. Sci. USA 88:9292-9296(1991); and L. A.
Tartaglia and D. V. Goeddel, J Biol. Chem. 267:4304-4307(1992).
See, also, PCT Application WO 94/09137.
[0733] Antagonist according to the present invention include
naturally occurring and synthetic compounds such as, for example,
TNF family ligand peptide fragments, transforming growth factor,
neurotransmitters (such as glutamate, dopamine,
N-methyl-aspartate), tumor suppressors (p53), cytolytic T cells and
antimetabolites. Further preferred antagonists include, TR14
polypeptide fragments, and polyclonal and monoclonal antibodies
raised against the TR14 polypeptide, or a fragment thereof.
Preferred agonists include chemotherapeutic drugs such as, for
example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside,
nitrogen mustard, methotrexate and vincristine. Others include
ethanol and -amyloid peptide. (Science 267:1457-1458 (1995)).
Further preferred agonists include, TR14 polypeptide fragments, and
polyclonal and monoclonal antibodies raised against the TR14
polypeptide, or a fragment thereof. Such agonist antibodies raised
against a TNF-family receptor are disclosed in L. A. Tartaglia et
al., Proc. Natl. Acad. Sci. USA 88:9292-9296(1991); and L. A.
Tartaglia and D. V. Goeddel, J Biol. Chem. 267:4304-4307(1992).
See, also, PCT Application WO 94/09137.
[0734] Agonists according to the present invention include
naturally occurring and synthetic compounds such as, for example,
the CD40 ligand, neutral amino acids, zinc, estrogen, androgens,
viral genes (such as Adenovirus EIB, Baculovirus p35 and IAP,
Cowpox virus crmA, Epstein-Barr virus BHRF1, LMP-1, African swine
fever virus LMW5-HL, and Herpesvirus yl 34.5), calpain inhibitors,
cysteine protease inhibitors, and tumor promoters (such as PMA,
Phenobarbital, and .quadrature.Hexachlorocyclohex- ane).
[0735] Other potential antagonists include antisense molecules.
Antisense technology can be used to control gene expression through
antisense DNA or RNA or through triple-helix formation. Antisense
techniques are discussed, for example, in Okano, J. Neurochem.
56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix
formation is discussed in, for instance Lee et al., Nucleic Acids
Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and
Dervan et al. Science 251:1360 (1991). The methods are based on
binding of a polynucleotide to a complementary DNA or RNA.
[0736] In specific embodiments, antagonists according to the
present invention are nucleic acids corresponding to the sequences
contained of TR13 (SEQ ID NO:1) and/or SEQ ID NO:39, or the
complementary strand thereof, and/or to nucleotide sequences
contained in the clone deposited as ATCC Deposit No. PTA-349 and/or
ATCC Deposit No. PTA-507. In one embodiment, antisense sequence is
generated internally by the organism, in another embodiment, the
antisense sequence is separately administered (see, for example,
Okano H. et al., J. Neurochem. 56:560(1991), and
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Antisense technology can be
used to control gene expression through antisense DNA or RNA, or
through triple-helix formation. Antisense techniques are discussed
for example, in Okano, Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance, Lee et al., Nucleic Acids Research
6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1300 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA.
[0737] In specific embodiments, antagonists according to the
present invention are nucleic acids corresponding to the sequences
contained in TR14 (preferably SEQ ID NO:60 or, alternatively SEQ ID
NO:4), or the complementary strand thereof, and/or to nucleotide
sequences contained in the clone deposited as ATCC Deposit No.
PTA-348. In one embodiment, antisense sequence is generated
internally by the organism, in another embodiment, the antisense
sequence is separately administered (see, for example, Okano H. et
al., J. Neurochem. 56:560 (1991), and Oligodeoxynucleotides as
Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton,
Fla. (1988). Antisense technology can be used to control gene
expression through antisense DNA or RNA, or through triple-helix
formation. Antisense techniques are discussed for example, in
Okano, Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988).
Triple helix formation is discussed in, for instance, Lee et al.,
Nucleic Acids Research 6:3073 (1979); Cooney et al., Science
241:456 (1988); and Dervan et al., Science 251:1300 (1991). The
methods are based on binding of a polynucleotide to a complementary
DNA or RNA.
[0738] For example, the 5' coding portion of a polynucleotide that
encodes a mature polypeptide of the present invention may be used
to design an antisense RNA oligonucleotide of from about 10 to 40
base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into receptor
polypeptide. The oligonucleotides described above can also be
delivered to cells such that the antisense RNA or DNA may be
expressed in vivo to inhibit production of the receptor.
[0739] In one embodiment, the TR13 antisense nucleic acid of the
invention is produced intracellularly by transcription from an
exogenous sequence. For example, a vector or a portion thereof, is
transcribed, producing an antisense nucleic acid (RNA) of the
invention. Such a vector would contain a sequence encoding the TR13
antisense nucleic acid. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to
produce the desired antisense RNA. Such vectors can be constructed
by recombinant DNA technology methods standard in the art. Vectors
can be clone, viral, or others know in the art, used for
replication and expression in vertebrate cells. Expression of the
sequence encoding TR13, or fragments thereof, can be by any
promoter known in the art to act in vertebrate, preferably human
cells. Such promoters can be inducible or constitutive. Such
promoters include, but are not limited to, the SV40 early promoter
region (Bemoist and Chambon, Nature 29:304-310 (1981), the promoter
contained in the 3' long terminal repeat of Rous sarcoma virus
(Yamamoto et al., Cell 22:787-797 (1980), the herpes thymidine
promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445
(1981), the regulatory sequences of the metallothionein gene
(Brinster, et al., Nature 296:3942 (1982)), etc.
[0740] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
Nature 372:333-335 (1994). Thus, oligonucleotides complementary to
either the 5'- or 3'-non-translated, non-coding regions of the TR13
shown in FIGS. 1A-D or FIGS. 7A-E could be used in an antisense
approach to inhibit translation of endogenous TR13 mRNA.
Oligonucleotides complementary to the 5' untranslated region of the
mRNA should include the complement of the AUG start codon. While
antisense nucleotides complementary to the TR13 coding region
sequence could be used, those complementary to the transcribed
untranslated region are most preferred.
[0741] Antisense oligonucleotides complementary to mRNA coding
regions are less efficient inhibitors of translation but could be
used in accordance with the invention. Whether designed to
hybridize to the 5'-,3'- or coding region of TR13 mRNA, antisense
nucleic acids should be at least six nucleotides in length, and are
preferably oligonucleotides ranging from 6 to about 50 nucleotides
in length. In specific aspects the oligonucleotide is at least 10
nucleotides, at least 17 nucleotides, at least 25 nucleotides or at
least 50 nucleotides.
[0742] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a TR13 gene. However, absolute complementarity, although
preferred, is not required. A sequence "complementary to at least a
portion of an RNA," referred to herein, means a sequence having
sufficient complementarity to be able to hybridize with the RNA,
forming a stable duplex; in the case of double stranded TR13
antisense nucleic acids, a single strand of the duplex DNA may thus
be tested, or triplex formation may be assayed. The ability to
hybridize will depend on both the degree of complementarity and the
length of the antisense nucleic acid Generally, the larger the
hybridizing nucleic acid, the more base mismatches with a TR13 RNA
it may contain and still form a stable duplex (or triplex as the
case may be). One skilled in the art can ascertain a tolerable
degree of mismatch by use of standard procedures to determine the
melting point of the hybridized complex.
[0743] In one embodiment, the TR14 antisense nucleic acid of the
invention is produced intracellularly by transcription from an
exogenous sequence. For example, a vector or a portion thereof, is
transcribed, producing an antisense nucleic acid (RNA) of the
invention. Such a vector would contain a sequence encoding the TR14
antisense nucleic acid. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to
produce the desired antisense RNA. Such vectors can be constructed
by recombinant DNA technology methods standard in the art. Vectors
can be clone, viral, or others know in the art, used for
replication and expression in vertebrate cells. Expression of the
sequence encoding TR14, or fragments thereof, can be by any
promoter known in the art to act in vertebrate, preferably human
cells. Such promoters can be inducible or constitutive. Such
promoters include, but are not limited to, the SV40 early promoter
region (Bemoist and Chambon, Nature 29:304-310 (1981), the promoter
contained in the 3' long terminal repeat of Rous sarcoma virus
(Yamamoto et al., Cell 22:787-797 (1980), the herpes thymidine
promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445
(1981), the regulatory sequences of the metallothionein gene
(Brinster, et al., Nature 296:3942 (1982)), etc.
[0744] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a TR14 gene. However, absolute complementarity, although
preferred, is not required. A sequence "complementary to at least a
portion of an RNA," referred to herein, means a sequence having
sufficient complementarity to be able to hybridize with the RNA,
forming a stable duplex; in the case of double stranded TR14
antisense nucleic acids, a single strand of the duplex DNA may thus
be tested, or triplex formation may be assayed. The ability to
hybridize will depend on both the degree of complementarity and the
length of the antisense nucleic acid Generally, the larger the
hybridizing nucleic acid, the more base mismatches with a TR14 RNA
it may contain and still form a stable duplex (or triplex as the
case may be). One skilled in the art can ascertain a tolerable
degree of mismatch by use of standard procedures to determine the
melting point of the hybridized complex.
[0745] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
Nature 372:333-335 (1994). Thus, oligonucleotides complementary to
either the 5'- or 3'-non-translated, non-coding regions of the TR14
shown in FIGS. 4A-E could be used in an antisense approach to
inhibit translation of endogenous TR14 mRNA. Oligonucleotides
complementary to the 5' untranslated region of the mRNA should
include the complement of the AUG start codon. While antisense
nucleotides complementary to the TR14 coding region sequence could
be used, those complementary to the transcribed untranslated region
are most preferred.
[0746] Antisense oligonucleotides complementary to mRNA coding
regions are less efficient inhibitors of translation but could be
used in accordance with the invention. Whether designed to
hybridize to the 5'-, 3'- or coding region of TR14 mRNA, antisense
nucleic acids should be at least six nucleotides in length, and are
preferably oligonucleotides ranging from 6 to about 50 nucleotides
in length. In specific aspects the oligonucleotide is at least 10
nucleotides, at least 17 nucleotides, at least 25 nucleotides or at
least 50 nucleotides.
[0747] The nucleic acids of the invention can be DNA or RNA or
chimeric mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556
(1989); Lemaitre et al., Proc. Natl. Acad. Sci. 84:648-652 (1987);
PCT Publication No. WO88/09810, published Dec. 15, 1988) or the
blood-brain barrier (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988), hybridization-triggered cleavage agents.
(See, e.g., Krol et al., BioTechniques 6:958-976 (1988)) or
intercalating agents. (See, e.g., Zon, Pharm. Res. 5:539-549
(1988)). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered
cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0748] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including,
but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomet-
hyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N-6-isopenten- yladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0749] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including, but not
limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0750] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group including, but not limited to, a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester,
and a formacetal or analog thereof.
[0751] In yet another embodiment, the antisense oligonucleotide is
an .alpha.-anomeric oligonucleotide. An .alpha.-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual .beta.-units, the
strands run parallel to each other (Gautier et al., Nucl. Acids
Res. 15:6625-6641 (1987)). The oligonucleotide is a
2'-O-methylribonucleotide (Inoue et al., Nucl. Acids Res.
15:6131-6148 (1987)), or a chimeric RNA-DNA analogue (Inoue et al.,
FEBS Lett. 215:327-330 (1987)).
[0752] Nucleic acids of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(Nucl. Acids Res. 16:3209 (1988)), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., Proc. Natl. Acad. Sci. USA.
85:7448-7451 (1988)), etc.
[0753] Potential antagonists according to the invention also
include catalytic RNA, or a ribozyme (See, e.g., PCT International
Publication WO 90/11364, Sarver et al, Science 247:1222-1225
(1990). While ribozymes that cleave mRNA at site specific
recognition sequences can be used to destroy TR13 mRNAs, the use of
hammerhead ribozymes is preferred. Hammerhead ribozymes cleave
mRNAs at locations dictated by flanking regions that form
complementary base pairs with the target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases:
5'-UG-3'. The construction and production of hammerhead ribozymes
is well known in the art and is described more fully in Haseloff
and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of TR13 in FIGS. 1A-D (SEQ ID NO:1) or FIGS. 7A-E (SEQ ID
NO:39). Preferably, the ribozyme is engineered so that the cleavage
recognition site is located near the 5' end of the TR13 mRNA; i.e.,
to increase efficiency and minimize the intracellular accumulation
of non-functional mRNA transcripts.
[0754] As in the antisense approach, the ribozymes of the invention
can be composed of modified oligonucleotides (e.g., for improved
stability, targeting, etc.) and should be delivered to cells which
express TR13 in vivo. DNA constructs encoding the ribozyme may be
introduced into the cell in the same manner as described above for
the introduction of antisense encoding DNA. A preferred method of
delivery involves using a DNA construct "encoding" the ribozyme
under the control of a strong constitutive promoter, such as, for
example, pol III or pol II promoter, so that transfected cells will
produce sufficient quantities of the ribozyme to destroy endogenous
TR13 messages and inhibit translation. Since ribozymes unlike
antisense molecules, are catalytic, a lower intracellular
concentration is required for efficiency.
[0755] Potential antagonists according to the invention also
include catalytic RNA, or a ribozyme (See, e.g., PCT International
Publication WO 90/11364, Sarver et al, Science 247:1222-1225
(1990). While ribozymes that cleave mRNA at site specific
recognition sequences can be used to destroy TR14 mRNAs, the use of
hammerhead ribozymes is preferred. Hammerhead ribozymes cleave
mRNAs at locations dictated by flanking regions that form
complementary base pairs with the target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases:
5'-UG-3'. The construction and production of hammerhead ribozymes
is well known in the art and is described more fully in Haseloff
and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of TR14 (preferably FIGS. 10A-H (SEQ ID NO:60) or,
alternatively, FIGS. 4A-E (SEQ ID NO:4)). Preferably, the ribozyme
is engineered so that the cleavage recognition site is located near
the 5' end of the TR14 mRNA; i.e., to increase efficiency and
minimize the intracellular accumulation of non-functional mRNA
transcripts.
[0756] As in the antisense approach, the ribozymes of the invention
can be composed of modified oligonucleotides (e.g., for improved
stability, targeting, etc.) and should be delivered to cells which
express TR14 in vivo. DNA constructs encoding the ribozyme may be
introduced into the cell in the same manner as described above for
the introduction of antisense encoding DNA. A preferred method of
delivery involves using a DNA construct "encoding" the ribozyme
under the control of a strong constitutive promoter, such as, for
example, pol III or pol II promoter, so that transfected cells will
produce sufficient quantities of the ribozyme to destroy endogenous
TR14 messages and inhibit translation. Since ribozymes unlike
antisense molecules, are catalytic, a lower intracellular
concentration is required for efficiency.
[0757] Endogenous gene expression can also be reduced by
inactivating or "knocking out" the TR13 gene and/or its promoter
using targeted homologous recombination. (E.g., see Smithies et
al., Nature 317:230-234 (1985); Thomas & Capecchi, Cell
51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989); each of
which is incorporated by reference herein in its entirety). For
example, a mutant, non-functional polynucleotide of the invention
(or a completely unrelated DNA sequence) flanked by DNA homologous
to the endogenous polynucleotide sequence (either the coding
regions or regulatory regions of the gene) can be used, with or
without a selectable marker and/or a negative selectable marker, to
transfect cells that express polypeptides of the invention in vivo.
In another embodiment, techniques known in the art are used to
generate knockouts in cells that contain, but do not express the
gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted
gene. Such approaches are particularly suited in research and
agricultural fields where modifications to embryonic stem cells can
be used to generate animal offspring with an inactive targeted gene
(e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
However this approach can be routinely adapted for use in humans
provided the recombinant DNA constructs are directly administered
or targeted to the required site in vivo using appropriate viral
vectors that will be apparent to those of skill in the art. The
contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety.
[0758] Endogenous gene expression can also be reduced by
inactivating or "knocking out" the TR14 gene and/or its promoter
using targeted homologous recombination. (E.g., see Smithies et
al., Nature 317:230-234(1985); Thomas & Capecchi, Cell
51:503-512(1987); Thompson et al., Cell 5:313-321 (1989); each of
which is incorporated by reference herein in its entirety). For
example, a mutant, non-functional polynucleotide of the invention
(or a completely unrelated DNA sequence) flanked by DNA homologous
to the endogenous polynucleotide sequence (either the coding
regions or regulatory regions of the gene) can be used, with or
without a selectable marker and/or a negative selectable marker, to
transfect cells that express polypeptides of the invention in vivo.
In another embodiment, techniques known in the art are used to
generate knockouts in cells that contain, but do not express the
gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted
gene. Such approaches are particularly suited in research and
agricultural fields where modifications to embryonic stem cells can
be used to generate animal offspring with an inactive targeted gene
(e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
However this approach can be routinely adapted for use in humans
provided the recombinant DNA constructs are directly administered
or targeted to the required site in vivo using appropriate viral
vectors that will be apparent to those of skill in the art. The
contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety.
[0759] The techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling") may be employed to modulate the activities of TR13
thereby effectively generating agonists and antagonists of TR13.
See generally, U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721,
5,834,252, and 5,837,458, and Patten et al., Curr. Opinion
Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol.
16(2):76-82 (1998); Hansson et al., J. Mol. Biol. 287:265-76
(1999); and Lorenzo and Blasco, Biotechniques 24(2):308-13 (1998)
(each of these patents and publications are hereby incorporated by
reference). In one embodiment, alteration of TR13 nucleic acids and
corresponding polypeptides may be achieved by DNA shuffling. DNA
shuffling involves the assembly of two or more DNA segments into a
desired TR13 molecule by homologous, or site-specific,
recombination. In another embodiment, TR13 nucleic acids and
corresponding polypeptides may be alterred by being subjected to
random mutagenesis by error-prone PCR, random nucleotide insertion
or other methods prior to, or more preferrably, during
recombination. In another embodiment, one or more components,
motifs, sections, parts, domains, fragments, etc., of TR13 may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules. In
preferred embodiments, the heterologous molecules include, but are
not limited to, TNF-alpha, lymphotoxin-alpha (LT-alpha, also known
as TNF-beta), LT-beta (found in complex heterotrimer
LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1 BBL, DcR3,
OX40L, TNF-gamma (International Publication No. WO 96/14328),
TRAIL, AIM-II (International Publication No. WO 97/34911), APRIL
(J. Exp. Med. 188(6):1185-1190), endokine-alpha (International
Publication No. WO 98/07880), neutrokine alpha (International
Publication No. WO98/18921), TWEAK, OPG, OX40, and nerve growth
factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-1BB,
TR2 (International Publication No. WO 96/34095), DR3 (International
Publication No. WO 97/33904), DR4 (International Publication No. WO
98/32856), TR5 (International Publication No. WO 98/30693), TR6
(International Publication No. WO 98/30694), TR7 (International
Publication No. WO 98/41629), RANK, TR9 (International Publication
No. WO 98/56892), TR10 (International Publication No. WO 98/30694),
312C2 (International Publication No. WO 9854202), and TR12, and
soluble forms CD154, CD70, and CD153. In further preferred
embodiments, the heterologous molecules are any member of the TNF
family.
[0760] The techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling") may be employed to modulate the activities of TR14
thereby effectively generating agonists and antagonists of TR14.
See generally, U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721,
5,834,252, and 5,837,458, and Patten et al., Curr. Opinion
Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol.
16(2):76-82 (1998); Hansson et al., J. Mol. Biol. 287:265-76
(1999); and Lorenzo and Blasco, Biotechniques 24(2):308-13 (1998)
(each of these patents and publications are hereby incorporated by
reference). In one embodiment, alteration of TR14 nucleic acids and
corresponding polypeptides may be achieved by DNA shuffling. DNA
shuffling involves the assembly of two or more DNA segments into a
desired TR14 molecule by homologous, or site-specific,
recombination. In another embodiment, TR14 nucleic acids and
corresponding polypeptides may be alterred by being subjected to
random mutagenesis by error-prone PCR, random nucleotide insertion
or other methods prior to, or more preferrably, during
recombination. In another embodiment, one or more components,
motifs, sections, parts, domains, fragments, etc., of TR14 may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules. In
preferred embodiments, the heterologous molecules are include, but
are not limited to, TNF-alpha, lymphotoxin-alpha (LT-alpha, also
known as TNF-beta), LT-beta (found in complex heterotrimer
LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1 BBL, DcR3,
OX40L, TNF-gamma (International Publication No. WO 96/14328),
TRAIL, AIM-H (International Publication No. WO 97/34911), APRIL (J.
Exp. Med. 188(6):1185-1190), endokine-alpha (International
Publication No. WO 98/07880), neutrokine alpha (International
Publication No. WO98/18921), TWEAK, OPG, OX40, and nerve growth
factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-1BB,
TR2 (International Publication No. WO 96/34095), DR3 (International
Publication No. WO 97/33904), DR4 (International Publication No. WO
98/32856), TR5 (International Publication No. WO 98/30693), TR6
(International Publication No. WO 98/30694), TR7 (International
Publication No. WO 98/41629), RANK, TR9 (International Publication
No. WO 98/56892), TR10 (International Publication No. WO 98/30694),
312C2 (International Publication No. WO 9854202), and TR12, and
soluble forms CD154, CD70, and CD153. In further preferred
embodiments, the heterologous molecules are any member of the TNF
family.
[0761] In other embodiments, antagonists according to the present
invention include soluble forms of TR13 (e.g., fragments of the
TR13 shown in FIGS. 1A-D (SEQ ID NO:2) or FIGS. 7A-E (SEQ ID
NO:39)) that include the ligand binding domain and/or any
combination of one, two, three, four or more of the cysteine-rich
domains from the extracellular region of the full-length receptor
disclosed in the figures). Such soluble forms of the TR13, which
may be naturally occurring or synthetic, antagonize TR13 mediated
signaling by competing with the cell surface bound forms of the
receptor for binding to TNF-family ligands. Antagonists of the
present invention also include antibodies specific for TNF-family
ligands, antibodies specific for TR13 polypeptides and TR13-Fc
fusion proteins.
[0762] In other embodiments, antagonists according to the present
invention include soluble forms of TR14 (e.g., fragments of the
TR14 shown preferably in FIGS. 10A-H (SEQ ID NO:61) or,
alternatively in FIGS. 4A-E (SEQ ID NO:5) that include the ligand
binding domain, and/or the cysteine-rich domain from the
extracellular region of the full-length receptor). Such soluble
forms of the TR14, which may be naturally occurring or synthetic,
antagonize TR14 mediated signaling by competing with the cell
surface bound forms of the receptor for binding to TNF-family
ligands. Antagonists of the present invention also include
antibodies specific for TNF-family ligands, antibodies specific for
TR14 polypeptides, and TR14-Fc fusion proteins.
[0763] By a "TNF-family ligand" is intended naturally occurring,
recombinant, and synthetic ligands that are capable of binding to a
member of the TNF receptor family and inducing and/or blocking the
ligand/receptor signaling pathway. Members of the TNF ligand family
include, but are not limited to, TNF-alpha, lymphotoxin-alpha
(LT-alpha, also known as TNF-beta), LT-beta (found in complex
heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L,
4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO
96/14328), TRAIL, AIM-II (International Publication No. WO
97/34911), APRIL (J. Exp. Med. 188(6):1185-1190), endokine-alpha
(International Publication No. WO 98/07880), Neutrokine-alpha
(International Publications No. WO98/18921), TWEAK OPG, OX40, and
nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27,
CD40 and 4-1BB, TR2 (International Publication No. WO 96/34095),
DR3 (International Publication No. WO 97/33904), DR4 (International
Publication No. WO 98/32856), TR5 (International Publication No. WO
98/30693), TR6 (International Publication No. WO 98/30694), TR7
(International Publication No. WO 98/41629), RANK, TR9
(International Publication No. WO 98/56892), TR10 (International
Publication No. WO 98/30694), 312C2 (International Publication No.
WO 98/06842), and TR12, and soluble forms CD154, CD70, and
CD153.
[0764] TNF-.alpha. has been shown to protect mice from infection
with herpes simplex virus type 1 (HSV-1). Rossol-Voth et al., J.
Gen. Virol. 72:143-147 (1991). The mechanism of the protective
effect of TNF-.alpha. is unknown but appears to involve neither
interferons nor NK cell killing. One member of the family has been
shown to mediate HSV-1 entry into cells. Montgomery et al., Eur.
Cytokine Newt. 7:159 (1996). Further, antibodies specific for the
extracellular domain of this block HSV-1 entry into cells. Thus,
TR13 antagonists of the present invention include both TR13 amino
acid sequences and antibodies capable of preventing mediated viral
entry into cells. Such sequences and antibodies can function by
either competing with cell surface localized for binding to virus
or by directly blocking binding of virus to cell surface
receptors.
[0765] Antibodies according to the present invention may be
prepared by any of a variety of methods using TR13 immunogens
and/or antigens of the present invention. As indicated, such TR13
immunogens and/or antigens include the full-length TR13 polypeptide
and TR13 polypeptide fragments such as, the extracellular domain,
any one of the four cysteine rich domains disclosed in FIGS. 1A-D
and/or FIGS. 7A-E, the ligand binding domain, or any combination
thereof.
[0766] Polyclonal and monoclonal antibody agonists or antagonists
according to the present invention can be raised according to the
methods disclosed herein and and/or known in the art, such as, for
example, those methods described in Tartaglia and Goeddel, J. Biol.
Chem. 267(7):4304-4307(1992); Tartaglia et al., Cell 73:213-216
(1993), and PCT Application WO 94/09137 (the contents of each of
these three publications are herein incorporated by reference in
their entireties), and are preferably specific to TR13 polypeptides
of the invention having the amino acid sequence of SEQ ID NO:2 or
SEQ ID NO:40.
[0767] TNF has been shown to protect mice from infection with
herpes simplex virus type I (HSV-1). Rossol-Voth et al., J. Gen.
Virol. 72:143-147 (1991). The mechanism of the protective effect of
TNF is unknown but appears to involve neither interferons nor NK
cell killing. One member of the family has been shown to mediate
HSV-1 entry into cells. Montgomery et al., Eur. Cytokine Newt.
7:159 (1996). Further, antibodies specific for the extracellular
domain of this block HSV-1 entry into cells. Thus, TR14 antagonists
of the present invention include both TR14 amino acid sequences and
antibodies capable of preventing mediated viral entry into cells.
Such sequences and antibodies can function by either competing with
cell surface localized for binding to virus or by directly blocking
binding of virus to cell surface receptors.
[0768] Antibodies according to the present invention may be
prepared by any of a variety of methods using TR14 immunogens
and/or antigens of the present invention. As indicated, such TR14
immunogens and/or antigens include the full-length TR14 polypeptide
(which may or may not include the leader sequence) and TR14
polypeptide fragments such as the extracellular domain, the
cysteine rich domain, the ligand binding domain, the transmembrane
domain, and the intracellular domain, or any combination
thereof.
[0769] Polyclonal and monoclonal antibody agonists or antagonists
according to the present invention can be raised according to the
methods disclosed herein and and/or known in the art, such as, for
example, those methods described in Tartaglia and Goeddel, J. Biol.
Chem. 267(7):4304-4307(1992); Tartaglia et al., Cell 73:213-216
(1993), and PCT Application WO 94/09137 (the contents of each of
these three publications are herein incorporated by reference in
their entireties), and are preferably specific to TR14 polypeptides
of the invention having the amino acid sequence of SEQ ID NO:61 or
SEQ ID NO:5.
[0770] Antagonists according to the present invention include
soluble forms of TR13, i.e., TR13 fragments that include the ligand
binding domain, and/or any combination of one, two, three, four or
more of the cysteine-rich domains from the extracellular region of
the TR13 polypeptide sequence shown in FIGS. 1A-D or FIGS. 7A-E.
Such soluble forms of the receptor, which may be naturally
occurring or synthetic, antagonize TR13 mediated signaling by
competing with the cell surface TR13 for binding to TNF-family
ligands (See, for example, Examples 34 and 35). Additionally,
soluble TR13 may bind to apoptosis inducing TNF ligands such as
TRAIL, FasL, or AIM-II and more effectively compete for TRAIL,
FasL, AIM-II, binding, or other TNF family member, reducing the
available TRAIL, FasL, AIM-II, or other TNF family member, for
binding to receptors with functional death domains. Thus, soluble
forms of the receptor that include the ligand binding domain and/or
one or more cysteine rich domains of TR13 are novel cytokines
capable of inhibiting apoptosis induced by TNF-family ligands (See,
for example, Examples 34 and 35). These are preferably expressed as
dimers or trimers, since these have been shown to be superior to
monomeric forms of soluble receptor as antagonists, e.g., IgGFc-TNF
receptor family fusions. Other such cytokines are known in the art
and include Fas B (a soluble form of the mouse Fas receptor) that
acts physiologically to limit apoptosis induced by Fas ligand (D.
P. Hughes and I. N. Crispe, J. Exp. Med. 182:1395-1401 (1995)).
[0771] Antagonists according to the present invention include
soluble forms of TR14, i.e., TR14 fragments that include the ligand
binding domain and/or cysteine rich domain from the extracellular
region of the full-length receptor. Such soluble forms of the
receptor, which may be naturally occurring or synthetic, antagonize
TR14 mediated signaling by competing with the cell surface TR14 for
binding to TNF-family ligands. Additionally, soluble TR14 may bind
to apoptosis inducing TNF ligands such as TRAIL, FasL, or AIM-II
and more effectively compete for TRAIL, FasL, AIM-II binding, or
other TNF family member, reducing the available TRAIL, FasL,
AIM-II, or other TNF family member, for binding to receptors with
functional death domains. Thus, soluble forms of the receptor that
include the ligand binding domain and/or the cysteine rich domain
of TR14 are novel cytokines capable of inhibiting apoptosis induced
by TNF-family ligands. These are preferably expressed as dimers or
trimers, since these have been shown to be superior to monomeric
forms of soluble receptor as antagonists, e.g., IgGFc-TNF receptor
family fusions. Other such cytokines are known in the art and
include Fas B (a soluble form of the mouse Fas receptor) that acts
physiologically to limit apoptosis induced by Fas ligand (D. P.
Hughes and I. N. Crispe, J. Exp. Med. 182:1395-1401 (1995)).
[0772] Proteins and other compounds which bind the TR13 domains are
also candidate agonists and antagonists according to the present
invention. Such binding compounds can be "captured" using the yeast
two-hybrid system (Fields and Song, Nature 340:245-246 (1989)). A
modified version of the yeast two-hybrid system has been described
by Roger Brent and his colleagues (J. Gyuris, Cell 75:791-803
(1993); A. S. Zervos et al. Cell 72:223-232 (1993)). Preferably,
the yeast two-hybrid system is used according to the present
invention to capture compounds which bind to either a TR13 ligand
binding domain, one, two, three, or all four cystein-rich domains,
or to the full-length, or partial-length, TR13 protein. Such
compounds are good candidate agonists and antagonists of the
present invention.
[0773] Proteins and other compounds which bind the TR14 domains are
also candidate agonists and antagonists according to the present
invention. Such binding compounds can be "captured" using the yeast
two-hybrid system (Fields and Song, Nature 340:245-246 (1989)). A
modified version of the yeast two-hybrid system has been described
by Roger Brent and his colleagues (J. Gyuris, Cell 75:791-803
(1993); A. S. Zervos et al. Cell 72:223-232 (1993)). Preferably,
the yeast two-hybrid system is used according to the present
invention to capture compounds which bind to either the TR14 ligand
binding domain, cysteine-rich domain, or to the TR14 intracellular
domain. Such compounds are good candidate agonists and antagonists
of the present invention.
[0774] Modes of Administration
[0775] TR13 nucleic acids, polypeptides, and/or agonist or
antagonists of the invention can be administered in vitro, ex vivo,
or in vivo to cells which express the receptor of the present
invention. By administration of an "effective amount" of an TR13
nucleic acid, polypeptide, and/or agonist or antagonist is intended
an amount of the compound that is sufficient to enhance or inhibit
a cellular response to a TNF-family ligand. In particular, by
administration of an "effective amount" of an TR13 nucleic acid,
polypeptide, and/or agonist or antagonists is intended an amount
effective to enhance or inhibit TR13 mediated signalling and/or
TR13 mediated apoptosis. Of course, where it is desired for
apoptosis to be enhanced, an agonist according to the present
invention can be co-administered with a TNF-family ligand. One of
ordinary skill will appreciate that effective amounts of an agonist
or antagonist can be determined empirically and may be employed in
pure form or in pharmaceutically acceptable salt, ester or prodrug
form. The agonist or antagonist may be administered in compositions
in combination with one or more pharmaceutically acceptable
excipients.
[0776] TR14 nucleic acids, polypeptides, and/or agonist or
antagonists of the invention can be administered in vitro, ex vivo,
or in vivo to cells which express the receptor of the present
invention. By administration of an "effective amount" of an TR14
nucleic acid, polypeptide, and/or agonist or antagonist is intended
an amount of the compound that is sufficient to enhance or inhibit
a cellular response to a TNF-family ligand. In particular, by
administration of an "effective amount" of an TR14 nucleic acids,
polypeptide, and/or agonist or antagonists is intended an amount
effective to enhance or inhibit TR14 mediated signalling and/or
TR14 mediated apoptosis. Of course, where it is desired for
apoptosis to be enhanced, an agonist according to the present
invention can be co-administered with a TNF-family ligand. One of
ordinary skill will appreciate that effective amounts of an agonist
or antagonist can be determined empirically and may be employed in
pure form or in pharmaceutically acceptable salt, ester or prodrug
form. The TR13 and/or TR14 nucleic acid, polypeptide, agonist or
antagonist may be administered in compositions in combination with
one or more pharmaceutically acceptable excipients.
[0777] It will be understood that, when administered to a human
patient, the total daily usage of the compounds and compositions of
the present invention will be decided by the attending physician
within the scope of sound medical judgment. The specific
therapeutically effective dose level for any particular patient
will depend upon factors well known in the medical arts.
[0778] As a general proposition, the total pharmaceutically
effective amount of TR13 polypeptide administered parenterally per
dose will be in the range of about 1 ug/kg/day to 10 mg/kg/day of
patient body weight, although, as noted above, this will be subject
to therapeutic discretion. More preferably, this dose is at least
0.01 mg/kg/day, and most preferably for humans between about 0.01
and 1 mg/kg/day for the hormone. If given continuously, the TR13
polypeptide is typically administered at a dose rate of about 1
ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day
or by continuous subcutaneous infusions, for example, using a
mini-pump. An intravenous bag solution may also be employed.
[0779] As a general proposition, the total pharmaceutically
effective amount of TR14 polypeptide administered parenterally per
dose will be in the range of about 1 ug/kg/day to 10 mg/kg/day of
patient body weight, although, as noted above, this will be subject
to therapeutic discretion. More preferably, this dose is at least
0.01 mg/kg/day, and most preferably for humans between about 0.01
and 1 mg/kg/day for the hormone. If given continuously, the TR14
polypeptide is typically administered at a dose rate of about 1
ug/kg/hour to about 50 ug/kg/hour, either by 14 injections per day
or by continuous subcutaneous infusions, for example, using a
mini-pump. An intravenous bag solution may also be employed.
[0780] Dosaging may also be arranged in a patient specific manner
to provide a predetermined concentration of an agonist or
antagonist in the blood, as determined by the RIA technique. Thus
patient dosaging may be adjusted to achieve regular on-going trough
blood levels, as measured by RIA, on the order of from 50 to 1000
ng/ml, preferably 150 to 500 ng/ml.
[0781] Pharmaceutical compositions containing the TR13
polynucleotide, polypeptide, and/or agonist or antagonist, of the
invention may be administered orally, rectally, parenterally,
intracistemally, intravaginally, intraperitoneally, topically (as
by powders, ointments, drops or transdermal patch), bucally, or as
an oral or nasal spray. By "pharmaceutically acceptable carrier" is
meant a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or formulation auxiliary of any type. The
term "parenteral" as used herein refers to modes of administration
which include intravenous, intramuscular, intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and
infusion.
[0782] Pharmaceutical compositions containing the TR14
polynucleotide, polypeptide, and/or agonist or antagonist of the
invention may be administered orally, rectally, parenterally,
intracistemally, intravaginally, intraperitoneally, topically (as
by powders, ointments, drops or transdermal patch), bucally, or as
an oral or nasal spray. By "pharmaceutically acceptable carrier" is
meant a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or formulation auxiliary of any type. The
term "parenteral" as used herein refers to modes of administration
which include intravenous, intramuscular, intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and
infusion.
[0783] Pharmaceutical compositions of the present invention for
parenteral injection can comprise pharmaceutically acceptable
sterile aqueous or nonaqueous solutions, dispersions, suspensions
or emulsions as well as sterile powders for reconstitution into
sterile injectable solutions or dispersions just prior to use.
[0784] In addition to soluble TR13 polypeptides, TR13 polypeptides
can also be used when appropriately solubilized by including
detergents, such as CHAPS or NP-40, with buffer.
[0785] In addition to soluble TR14 polypeptides, TR14 polypeptides
containing the transmembrane region can also be used when
appropriately solubilized by including detergents, such as CHAPS or
NP-40, with buffer.
[0786] TR13 compositions of the invention are also suitably
administered by sustained-release systems. Suitable examples of
sustained-release compositions include suitable polymeric materials
(such as, for example, semi-permeable polymer matrices in the form
of shaped articles, e.g., films, or mirocapsules), suitable
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, and sparingly soluble derivatives
(such as, for example, a sparingly soluble salt).
[0787] TR14 compositions of the invention are also suitably
administered by sustained-release systems. Suitable examples of
sustained-release compositions include suitable polymeric materials
(such as, for example, semi-permeable polymer matrices in the form
of shaped articles, e.g., films, or mirocapsules), suitable
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, and sparingly soluble derivatives
(such as, for example, a sparingly soluble salt).
[0788] Sustained-release matrices include polylactides (U.S. Pat.
No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and
gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers 22:547-556
(1983)), poly(2-hydroxyethyl methacrylate) (R. Langer et al., J.
Biomed. Mater. Res. 15:167-277 (1981), and R. Langer, Chem. Tech.
12:98-105 (1982)), ethylene vinyl acetate (R. Langer et al., Id.)
or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
[0789] Sustained-release compositions also include liposomally
entrapped compositions of the invention (see generally, Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, New York, pp. 317-327 and 353-365 (1989)).
Liposomes containing TR13 polypeptide may be prepared by methods
known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci.
(USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.
(USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP
143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos.
4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes
are of the small (about 200-800 Angstroms) unilamellar type in
which the lipid content is greater than about 30 mol. percent
cholesterol, the selected proportion being adjusted for the optimal
TR13 polypeptide therapy.
[0790] Sustained-release compositions also include liposomally
entrapped compositions of the invention (see generally, Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, New York, pp. 317-327 and 353-365 (1989)).
Liposomes containing TR14 polypeptide may be prepared by methods
known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci.
(USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.
(USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP
143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos.
4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes
are of the small (about 200-800 Angstroms) unilamellar type in
which the lipid content is greater than about 30 mol. percent
cholesterol, the selected proportion being adjusted for the optimal
TR14 polypeptide therapy.
[0791] In yet an additional embodiment, the compositions of the
invention are delivered by way of a pump (see Langer, supra;
Seflon, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al.,
Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574
(1989)).
[0792] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[0793] The compositions of the invention (e.g., TR13 and/or TR14
nucleic acids, polypeptides, and/or agonists or antagonists) may be
administered alone or in combination with other adjuvants.
Adjuvants that may be administered with the compositions of the
invention include, but are not limited to, alum, alum plus
deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21 (Genentech,
Inc.), BCG, and MPL. In a specific embodiment, compositions of the
invention are administered in combination with alum. In another
specific embodiment, compositions of the invention are administered
in combination with QS-21. Further adjuvants that may be
administered with the compositions of the invention include, but
are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax
100a, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant
technology. Vaccines that may be administered with the compositions
of the invention include, but are not limited to, vaccines directed
toward protection against MMR (measles, mumps, rubella), polio,
varicella, tetanus/diptheria, hepatitis A, hepatitis B, haemophilus
influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease,
rotavirus, cholera, yellow fever, Japanese encephalitis,
poliomyelitis, rabies, typhoid fever, and pertussis. Combinations
may be administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[0794] The compositions of the invention (e.g., TR13 and/or TR14
nucleic acids, polypeptides, and/or agonists or antagonists) may be
administered alone or in combination with other therapeutic agents.
Therapeutic agents that may be administered in combination with the
compositions of the invention, include but are not limited to,
other members of the TNF family, chemotherapeutic agents,
antibiotics, steroidal and non-steroidal anti-inflammatories,
conventional immunotherapeutic agents, cytokines, chemokines and/or
growth factors. Combinations may be administered either
concomitantly, e.g., as an admixture, separately but simultaneously
or concurrently; or sequentially. This includes presentations in
which the combined agents are administered together as a
therapeutic mixture, and also procedures in which the combined
agents are administered separately but simultaneously, e.g., as
through separate intravenous lines into the same individual.
Administration "in combination" further includes the separate
administration of one of the compounds or agents given first,
followed by the second.
[0795] In one embodiment, the compositions of the invention are
administered in combination with other members of the TNF family.
TNF, TNF-related or TNF-like molecules that may be administered
with the compositions of the invention include, but are not limited
to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also
known as TNF-beta), LT-beta (found in complex heterotrimer
LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3,
OX40L, TNF-gamma (International Publication No. WO 96/14328),
TRAIL, AIM-II (International Publication No. WO 97/34911), APRIL
(J. Exp. Med. 188(6):1185-1190), endokine-alpha (International
Publication No. WO 98/07880), Neutrokine-alpha (International
Publication No. WO 9818921), OPG, OX40, and nerve growth factor
(NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-1BB, TR2
(International Publication No. WO 96/34095), DR3 (International
Publication No. WO 97/33904), DR4 (International Publication No. WO
98/32856), TR5 (International Publication No. WO 98/30693), TR6
(International Publication No. WO 98/30694), TR7 (International
Publication No. WO 98/41629), RANK, TR9 (International Publication
No. WO 98/56892), TR10 (International Publication No. WO9854202),
312C2 (International Publication No. WO 98/06842), and TR12, and
soluble forms CD154, CD70, and CD153.
[0796] Conventional nonspecific immunosuppressive agents, that may
be administered in combination with the compositions of the
invention include, but are not limited to, steroids, cyclosporine,
cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other
immunosuppressive agents that act by suppressing the function of
responding T cells.
[0797] In certain embodiments, compositions of the invention are
administered in combination with antiretroviral agents, nucleoside
reverse transcriptase inhibitors, non-nucleoside reverse
transcriptase inhibitors, and/or protease inhibitors. Nucleoside
reverse transcriptase inhibitors that may be administered in
combination with the compositions of the invention, include, but
are not limited to, RETROVIR.TM. (zidovudine/AZI), VIDEX.TM.
(didanosine/ddI), HIVID.TM. (zalcitabine/ddC), ZERIT.TM.
(stavudine/d4T), EPIVIR.TM. (lamivudine/3TC), and COMBIVIR.TM.
(zidovudine/lamivudine). Non-nucleoside reverse transcriptase
inhibitors that may be administered in combination with the
compositions of the invention, include, but are not limited to,
VIRAMUNE.TM. (nevirapine), RESCRIPTOR.TM. (delavirdine), and
SUSTIVA.TM. (efavirenz). Protease inhibitors that may be
administered in combination with the compositions of the invention,
include, but are not limited to, CRIXIVAN.TM. (indinavir),
NORVIR.TM. (ritonavir), INVIRASE.TM. (saquinavir), and VIRACEPT.TM.
(nelfinavir). In a specific embodiment, antiretroviral agents,
nucleoside reverse transcriptase inhibitors, non-nucleoside reverse
transcriptase inhibitors, and/or protease inhibitors may be used in
any combination with compositions of the invention to treat AIDS
and/or to prevent or treat HIV infection.
[0798] In other embodiments, compositions of the invention may be
administered in combination with anti-opportunistic infection
agents. Anti-opportunistic agents that may be administered in
combination with the compositions of the invention, include, but
are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLE.TM., DAPSONE.TM.,
PENTAMIDINE.TM., ATOVAQUONE.TM., ISONIAZID.TM., RIFAMPIN.TM.,
PYRAZINAMIDE.TM., ETHAMBUTOL.TM., RWFABUTIN.TM.,
CLARITHROMYCIN.TM., AZITHROMYCIN.TM., GANCICLOVIR.TM.,
FOSCARNET.TM., CIDOFOVIR.TM., FLUCONAZOLE.TM., ITRACONAZOLE.TM.,
KETOCONAZOLE.TM., ACYCLOVIR.TM., FAMCICOLVIR.TM.,
PYRIMETHAMINE.TM., LEUCOVORIN.TM., NEUPOGEN.TM. (filgrastim/G-CSF),
and LEUKINE.TM. (sargramostim/GM-CSF). In a specific embodiment,
compositions of the invention are used in any combination with
TRIMETHOPRIM-SULFAMETHO- XAZOLE.TM., DAPSONE.TM., PENTAMIDINE.TM.,
and/or ATOVAQUONE.TM. to prophylactically treat or prevent an
opportunistic Pneumocystis carinii pneumonia infection. In another
specific embodiment, compositions of the invention are used in any
combination with ISONIAZLID.TM., RIFAMPIN.TM., PYRAZINAMIDE.TM.,
and/or ETHAMBUTOL.TM. to prophylactically treat or prevent an
opportunistic Mycobacterium avium complex infection. In another
specific embodiment, compositions of the invention are used in any
combination with RIFABUTIN.TM., CLARITHROMYCIN.TM., and/or
AZITHROMYCIN.TM. to prophylactically treat or prevent an
opportunistic Mycobacterium tuberculosis infection. In another
specific embodiment, compositions of the invention are used in any
combination with GANCICLOVIR.TM., FOSCARNET.TM., and/or
CIDOFOVIR.TM. to prophylactically treat or prevent an opportunistic
cytomegalovirus infection. In another specific embodiment,
compositions of the invention are used in any combination with
FLUCONAZOLE.TM., ITRACONAZOLE.TM., and/or KETOCONAZOLE.TM. to
prophylactically treat or prevent an opportunistic fungal
infection. In another specific embodiment, compositions of the
invention are used in any combination with ACYCLOVIR.TM. and/or
FAMCICOLVIR.TM. to prophylactically treat or prevent an
opportunistic herpes simplex virus type I and/or type II infection.
In another specific embodiment, compositions of the invention are
used in any combination with PYRIMETHAMINE.TM. and/or
LEUCOVORIN.TM. to prophylactically treat or prevent an
opportunistic Toxoplasma gondii infection. In another specific
embodiment, compositions of the invention are used in any
combination with LEUCOVORIN.TM. and/or NEUPOGEN.TM. to
prophylactically treat or prevent an opportunistic bacterial
infection.
[0799] In a further embodiment, the compositions of the invention
are administered in combination with an antiviral agent. Antiviral
agents that may be administered with the compositions of the
invention include, but are not limited to, acyclovir, ribavirin,
amantadine, and remantidine.
[0800] In a further embodiment, the compositions of the invention
are administered in combination with an antibiotic agent.
Antibiotic agents that may be administered with the compositions of
the invention include, but are not limited to, amoxicillin,
aminoglycosides, beta-lactam (glycopeptide), beta-lactamases,
Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin,
ciprofloxacin, erythromycin, fluoroquinolones, macrolides,
metronidazole, penicillins, quinolones, rifampin, streptomycin,
sulfonamide, tetracyclines, trimethoprim,
trimethoprim-sulfamthoxazole, and vancomycin.
[0801] Conventional nonspecific immunosuppressive agents, that may
be administered in combination with the compositions of the
invention include, but are not limited to, steroids, cyclosporine,
cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other
immunosuppressive agents that act by suppressing the function of
responding T cells.
[0802] Additional immunosuppressants preparations that may be
administered with the compositions of the invention include, but
are not limited to, ORTHOCLONE.TM. (OKT3),
SANDIMMUNE.TM./NEORAL.TM./SANGDYA.TM. (cyclosporin), PROGRAF.TM.
(tacrolimus), CELLCEPT.TM. (mycophenolate), Azathioprine,
glucorticosteroids, and RAPAMUNE.TM. (sirolimus). In a specific
embodiment, immunosuppressants may be used to prevent rejection of
organ or bone marrow transplantation.
[0803] In an additional embodiment, compositions of the invention
are administered alone or in combination with one or more
intravenous immune globulin preparations. Intravenous immune
globulin preparations that may be administered with the
compositions of the invention include, but not limited to,
GAMMAR.TM., IVEEGAM.TM., SANDOGLOBULIN.TM., GAMMAGARD S/D.TM., and
GAMIMUNE.TM.. In a specific embodiment, compositions of the
invention are administered in combination with intravenous immune
globulin preparations in transplantation therapy (e.g., bone marrow
transplant).
[0804] In an additional embodiment, the compositions of the
invention are administered alone or in combination with an
anti-inflammatory agent. Anti-inflammatory agents that may be
administered with the compositions of the invention include, but
are not limited to, glucocorticoids and the nonsteroidal
anti-inflammatories, aminoarylcarboxylic acid derivatives,
arylacetic acid derivatives, arylbutyric acid derivatives,
arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles,
pyrazolones, salicylic acid derivatives, thiazinecarboxamides,
e-acetamidocaproic acid, S-adenosylmethionine,
3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine,
bucolome, difenpiramide, ditazol, emorfazone, guaiazulene,
nabumetone, nimesulide, orgotein, oxaceprol, paranyline, perisoxal,
pifoxime, proquazone, proxazole, and tenidap.
[0805] In another embodiment, compostions of the invention are
administered in combination with a chemotherapeutic agent.
Chemotherapeutic agents that may be administered with the
compositions of the invention include, but are not limited to,
antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin,
and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites
(e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon
alpha-2b, glutamic acid, plicamycin, mercaptopurine, and
6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNU, cytosine arabinoside, cyclophosphamide,
estramustine, hydroxyurea, procarbazine, mitomycin, busulfan,
cis-platin, and vincristine sulfate); hormones (e.g.,
medroxyprogesterone, estramustine phosphate sodium, ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and
testolactone); nitrogen mustard derivatives (e.g., mephalen,
chorambucil, mechlorethamine (nitrogen mustard) and thiotepa);
steroids and combinations (e.g., bethamethasone sodium phosphate);
and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).
[0806] In a specific embodiment, compositions of the invention are
administered in combination with CHOP (cyclophosphamide,
doxorubicin, vincristine, and prednisone) or any combination of the
components of CHOP. In another embodiment, compositions of the
invention are administered in combination with Rituximab. In a
further embodiment, compositions of the invention are administered
with Rituxmab and CHOP, or Rituxmab and any combination of the
components of CHOP.
[0807] In an additional embodiment, the compositions of the
invention are administered in combination with cytokines. Cytokines
that may be administered with the compositions of the invention
include, but are not limited to, GM-CSF, G-CSF, IL-1 alpha,
IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10,
IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19,
IL-20, IL-21, anti-CD40, CD40L, IFN-gamma and TNF-alpha. In one
embodiment, the compositions of the invention are administered in
combination with one or more chemokines. In specific embodiments,
the compositions of the invention are administered in combination
with an .alpha.(C.times.C) chemokine selected from the group
consisting of gamma-interferon inducible protein-10 (.gamma.IP-10),
interleukin-8 (IL-8), platelet factor-4 (PF4), neutrophil
activating protein (NAP-2), GROG, GRO-.beta., GRO-.gamma.,
neutrophil-activating peptide (ENA-78), granulocyte chemoattractant
protein-2 (GCP-2), and stromal cell-derived factor-1 (SDF-1, or
pre-B cell stimulatory factor (PBSF)); and/or a .beta.(CC) selected
from the group consisting of: RANTES (regulated on activation,
normal T expressed and secreted), macrophage inflammatory protein-1
alpha (MIP-1.alpha.), macrophage inflammatory protein-1 beta
(MIP-1.beta.), monocyte chemotactic protein-1 (MCP-1), monocyte
chemotactic protein-2 (MCP-2), monocyte chemotactic protein-3
(MCP-3), monocyte chemotactic protein-4 (MCP-4) macrophage
inflammatory protein-1 gamma (MIP-1.gamma.), macrophage
inflammatory protein-3alpha (MIP-3.alpha.), macrophage inflammatory
protein-3 beta (MIP-3.beta.), macrophage inflammatory protein-4
(MIP-4/DC-CK-1/PARC), eotaxin, Exodus, and 1-309; and/or the
.gamma.(C) chemokine, lymphotactin.
[0808] In an additional embodiment, the compositions of the
invention are administered in combination with Fibroblast Growth
Factors. Fibroblast Growth Factors that may be administered with
the compositions of the invention include, but are not limited to,
FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9,
FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
[0809] In a preferred embodiment, the compositions of the invention
are administered in combination with Stem Cell Factor or IL-3. In a
most preferred embodiment the compositions of the invention are
administered in combination with Stem Cell Factor and IL-3.
[0810] The invention also encompasses combining the polynucleotides
and/or polypeptides of the invention (and/or agonists or
antagonists thereof) with other proposed or conventional
hematopoietic therapies. Thus, for example, the polynucleotides
and/or polypeptides of the invention (and/or agonists or
antagonists thereof) can be combined with compounds that singly
exhibit erythropoietic stimulatory effects, such as erythropoietin,
testosterone, progenitor cell stimulators, insulin-like growth
factor, prostaglandins, serotonin, cyclic AMP, prolactin, and
triiodothyzonine. Also encompassed are combinations of the
compositions of the invention with compounds generally used to
treat aplastic anemia, such as, for example, methenolene,
stanozolol, and nandrolone; to treat iron-deficiency anemia, such
as, for example, iron preparations; to treat malignant anemia, such
as, for example, vitamin B.sub.12 and/or folic acid; and to treat
hemolytic anemia, such as, for example, adrenocortical steroids,
e.g., corticoids. See e.g., Resegotti et al., Panminerva Medica,
23:243-248 (1981); Kurtz, FEBS Letters, 14a:105-108 (1982);
McGonigle et al., Kidney Int., 25:437-444 (1984); and
Pavlovic-Kantera, Expt. Hematol., 8(supp. 8) 283-291 (1980), the
contents of each of which are hereby incorporated by reference in
their entireties.
[0811] Compounds that enhance the effects of or synergize with
erythropoietin are also useful as adjuvants herein, and include but
are not limited to, adrenergic agonists, thyroid hormones,
androgens, hepatic erythropoietic factors, erythrotropins, and
erythrogenins, See for e.g., Dunn, "Current Concepts in
Erythropoiesis", John Wiley and Sons (Chichester, England, 1983);
Kalmani, Kidney Int., 22:383-391 (1982); Shahidi, New Eng. J. Med.,
289:72-80 (1973); Urabe et al., J. Exp. Med., 149:1314-1325 (1979);
Billat et al., Expt. Hematol., 10:133-140 (1982); Naughton et al.,
Acta Haemat, 69:171-179 (1983); Cognote et al. in abstract 364,
Proceedings 7th Intl. Cong. of Endocrinology (Quebec City, Quebec,
Jul. 1-7, 1984); and Rothman et al., 1982, J. Surg. Oncol.,
20:105-108 (1982). Methods for stimulating hematopoiesis comprise
administering a hematopoietically effective amount (i.e., an amount
which effects the formation of blood cells) of a pharmaceutical
composition containing nucleic acids and/or poylpeptides of the
invention (and/or agonists or antagonists thereof) to a patient.
The nucleic acids and/or polypeptides of the invention and/or
agonists or antagonists thereof is administered to the patient by
any suitable technique, including but not limited to, parenteral,
sublingual, topical, intrapulmonary and intranasal, and those
techniques further discussed herein. The pharmaceutical composition
optionally contains one or more members of the group consisting of
erythropoietin, testosterone, progenitor cell stimulators,
insulin-like growth factor, prostaglandins, serotonin, cyclic AMP,
prolactin, triiodothyzonine, methenolene, stanozolol, and
nandrolone, iron preparations, vitamin B.sub.12, folic acid and/or
adrenocortical steroids.
[0812] In additional prefered embodiments, the compositions of the
invention are administered in combination with hematopoietic growth
factors. Hematopoietic growth factors that may be administered with
the compositions of the invention included, but are not limited to,
LEUKINE.TM. (SARGRAMOSTIM.TM.) and NEUPOGEN.TM.
(FILGIRASTIM.TM.).
[0813] In additional embodiments, the compositions of the invention
are administered in combination with other therapeutic or
prophylactic regimens, such as, for example, radiation therapy.
[0814] Chromosome Assays
[0815] The nucleic acid molecules of the present invention are also
valuable for chromosome identification. The sequence is
specifically targeted to and can hybridize with a particular
location on an individual human chromosome. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0816] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of a TR13 receptor
gene. This can be accomplished using a variety of well known
techniques and libraries, which generally are available
commercially. The genomic DNA is then used for in situ chromosome
mapping using well known techniques for this purpose.
[0817] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of a TR14 receptor
gene. This can be accomplished using a variety of well known
techniques and libraries, which generally are available
commercially. The genomic DNA is then used for in situ chromosome
mapping using well known techniques for this purpose.
[0818] In addition, in some cases, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA. Computer analysis of the 3' untranslated region of the gene
is used to rapidly select primers that do not span more than one
exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic
cell hybrids containing individual human chromosomes.
[0819] Fluorescence in situ hybridization ("FISH") of a cDNA clone
to a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bp. For a review of this technique, see
Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0820] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man, available on
line through Johns Hopkins University, Welch Medical Library. The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0821] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0822] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1
[0823] Expression and Purification of the TR13, TR13-.alpha. and/or
TR14 Polypeptides in E. coli
[0824] The bacterial expression vector pQE60 is used for bacterial
expression in this example. (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311). pQE60 encodes ampicillin antibiotic
resistance ("Amp.sup.r") and contains a bacterial origin of
replication ("ori"), an IPTG inducible promoter, a ribosome binding
site ("RBS"), six codons encoding histidine residues that allow
affinity purification using nickel-nitrilo-tri-acetic acid
("Ni-NTA") affinity resin sold by QIAGEN, Inc., supra, and suitable
single restriction enzyme cleavage sites. These elements are
arranged such that a DNA fragment encoding a polypeptide may be
inserted in such as way as to produce that polypeptide with the six
His residues (i.e., a "6.times.His tag") covalently linked to the
carboxyl terminus of that polypeptide. However, in this example,
the polypeptide coding sequence is inserted such that translation
of the six His codons is prevented and, therefore, the polypeptide
is produced with no 6.times.His tag.
[0825] The DNA sequence encoding the desired portion of the TR13
and/or TR14 protein lacking the hydrophobic leader sequence is
amplified from the deposited cDNA clone using PCR oligonucleotide
primers which anneal to the amino terminal sequences of the desired
portion of the TR13 and/or TR14 protein and to sequences in the
deposited construct 3' to the cDNA coding sequence. Additional
nucleotides containing restriction sites to facilitate cloning in
the pQE60 vector are added to the 5' and 3' sequences,
respectively.
[0826] For cloning a TR13 polypeptide, the 5' primer has the
sequence:
[0827] 5'-CGCCCATGGATGGACCAAAGTACC-3' (SEQ ID NO: 23) containing
the underlined NcoI restriction site followed by nucleotides
complementary to the amino terminal coding sequence of the mature
TR13 sequence in FIGS. 1A-D, respectively. One of ordinary skill in
the art would appreciate, of course, that the point in the protein
coding sequence where the 5' primer begins may be varied to amplify
a desired portion of the complete protein shorter or longer than
the described form.
[0828] For cloning a TR14 polypeptide, the 5' primer has the
sequence:
[0829] 5'-CGCCCATGGATGAGTACTGGGACC-3' (SEQ ID NO: 24) containing
the underlined NcoI restriction site followed by nucleotides
complementary to the amino terminal coding sequence of the mature
TR14 sequence in FIGS. 4A-E, respectively. One of ordinary skill in
the art would appreciate, of course, that the point in the protein
coding sequence where the 5' primer begins may be varied to amplify
a desired portion of the complete protein shorter or longer than
the described form.
[0830] For cloning a TR13 polypeptide, the 5' primer has the
sequence:
[0831] 5'-GCAGCACATATGATGGCTGAGCCTGGGCAC-3' (SEQ ID NO: 42)
containing the underlined NdelI restriction site followed by
nucleotides complementary to the amino terminal coding sequence of
the mature TR13 sequence in FIGS. 7A-E, respectively. One of
ordinary skill in the art would appreciate, of course, that the
point in the protein coding sequence where the 5' primer begins may
be varied to amplify a desired portion of the complete protein
shorter or longer than the described form.
[0832] The 3' TR13 primer has the sequence:
[0833] 5'-GCAGCATCTAGAGCGGCACTGAGTCAAATCCATC-3' (SEQ ID NO:25)
containing the underlined HindIII site followed by nucleotides
complementary to the 3' end of the non-coding sequence in the TR13
sequence in FIG. 1A-D.
[0834] The 3' TR14 primer has the sequence:
[0835] 5'-CGCAAGCTTCATTCAGGCCCCTGCTG-3' (SEQ ID NO:26) containing
the underlined HindIII site followed by nucleotides complementary
to the 3' end of the non-coding sequence in the TR14 DNA sequence
in FIGS. 4A-E.
[0836] The 3' TR13 primer has the sequence:
[0837] 5'-GCAGCATCTAGAGCGGCAGTGAGTCAAATCCATC-3' (SEQ ID NO:43)
containing the underlined HindIII site followed by nucleotides
complementary to the 3' end of the non-coding sequence in the TR13
DNA sequence in FIGS. 7A-E.
[0838] The amplified TR13 and/or TR14 DNA fragments and the vector
pQE60 are digested with NcoI and HindIII and the digested DNAs then
ligated together. Insertion of the TR13 and/or TR14 protein DNA
into the restricted pQE60 vector places the TR13 and/or TR14
protein coding region (including its associated stop codon)
downstream from the.
[0839] IPTG-inducible promoter and in-frame with an initiating AUG.
The associated stop codon prevents translation of the six histidine
codons downstream of the insertion point.
[0840] The ligation mixture is transformed into competent E. coli
cells using standard procedures. Such procedures are described in
Sambrook et. al., Molecular Cloning: a Laboratory Manual, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989). E. coli strain M15/rep4, containing multiple copies of the
clone pREP4, which expresses lac repressor and confers kanamycin
resistance ("Kan.sup.r"), is used in carrying out the illustrative
example described herein. This strain, which is only one of many
that are suitable for expressing TR13 and/or TR14 protein, is
available commercially from Qiagen, Inc., supra.
[0841] Transformants are identified by their ability to grow on LB
plates in the presence of ampicillin and kanamycin. Clone DNA is
isolated from resistant colonies and the identity of the cloned DNA
confirmed by restriction analysis, PCR, and DNA sequencing.
[0842] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 ug/ml) and kanamycin (25 ug/ml). The O/N culture is
used to inoculate a large culture, at a dilution of approximately
1:100 to 1:250. The cells are grown to an optical density at 600 nm
("OD600") of between 0.4 and 0.6.
Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from the lac
repressor sensitive promoter, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation.
[0843] The cells are then stirred for 34 hours at 4.degree. C. in
6M guanidine-HCl, pH8. The cell debris is removed by
centrifugation, and the supernatant containing the TR13 and/or TR14
is loaded onto a nickel-nitrilo-tri-acetic acid ("NiNTA") affinity
resin column (available from QIAGEN, Inc., supra). Proteins with a
6.times.His tag bind to the NI-NTA resin with high affinity and can
be purified in a simple one-step procedure (for details see: The
QIAexpressionist, 1995, QIAGEN, Inc., supra). Briefly the
supernatant is loaded onto the column in 6 M guanidine-HCl, pH8,
the column is first washed with 10 volumes of 6 M guanidine-HCl,
pH8, then washed with 10 volumes of 6 M guanidine-HCl pH6, and
finally the TR13 and/or TR14 is eluted with 6 M guanidine-HCl,
pH5.
[0844] The purified protein is then renatured by dialyzing it
against phosphatebuffered saline (PBS) or 50 mM Na-acetate, pH 6
buffer plus 200 mM NaCl. Alternatively, the protein can be
successfully refolded while immobilized on the Ni-NTA column. The
recommended conditions are as follows: renature using a linear
6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl
pH7.4, containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins can be eluted by the addition of 250 mM immidazole.
Immidazole is removed by a final dialyzing step against PBS or 50
mM sodium acetate pH6 buffer plus 200 mM NaCl. The purified protein
is stored at 4.degree. C. or frozen at -80.degree. C.
Example 2
[0845] Cloning and Expression of TR13 and/or TR14 Polypeptides in a
Baculovirus Expression System
[0846] In this illustrative example, the clone shuttle vector pA2
is used to insert the cloned DNA encoding the complete protein,
including its naturally associated secretary signal (leader)
sequence, into a baculovirus to express the mature TR13 and/or TR14
protein, using standard methods as described in Summers et al., A
Manual of Methods for Baculovirus Vectors and Insect Cell Culture
Procedures, Texas Agricultural Experimental Station Bulletin No.
1555 (1987). This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis virus
(AcMNPV) followed by convenient restriction sites such as BamHI and
Asp718. The polyadenylation site of the simian virus 40 ("SV40") is
used for efficient polyadenylation. For easy selection of
recombinant virus, the clone contains the beta-galactosidase gene
from E. coli under control of a weak Drosophila promoter in the
same orientation, followed by the polyadenylation signal of the
polyhedrin gene. The inserted genes are flanked on both sides by
viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate viable virus that express the
cloned polynucleotide.
[0847] Many other baculovirus vectors could be used in place of the
vector above, such as pAc373, pVL941 and pAcIMI, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39 (1989).
[0848] The cDNA sequence encoding the TR13 and/or TR14 receptor
protein in the deposited clone(s), lacking the AUG initiation codon
and the naturally associated leader sequence shown in FIGS. 1A-D
(SEQ ID NO:2), FIGS. 7A-E (SEQ ID NO:40), and FIGS. 4A-E (SEQ ID
NO:5), and respectively, is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene.
[0849] The 5' TR13 primer has the sequence 5'
CGCGGATCCATGGATGGACCAA AGTACC 3' (SEQ ID NO:27) containing the
underlined BamHI restriction enzyme site, an efficient signal for
initiation of translation in eukaryotic cells, as described by M.
Kozak, J. Mol. Biol. 196:947-950 (1987), followed by bases of the
sequence of the mature TR13 protein shown in FIGS. 1A-D, beginning
with the indicated N-terminus of the mature protein.
[0850] The 5' TR14 primer has the sequence 5'
CGCGGATCCATGGATGAGTACTG GGACC 3' (SEQ ID NO:28) containing the
underlined BamHI restriction enzyme site, an efficient signal for
initiation of translation in eukaryotic cells, as described by M.
Kozak, J. Mol. Biol. 196:947-950 (1987), followed by bases of the
sequence of the TR14 polypeptide shown in FIGS. 4A-E, respectively,
beginning with the indicated N-terminus of the mature protein.
[0851] The 5' TR13 primer has the sequence 5' GCAGCATCTAGACCGCCATC
ATGGCTGAGCCTGGGCACAGCCACCATC 3' (SEQ ID NO:44) containing the
underlined XbaI restriction enzyme site, an efficient signal for
initiation of translation in eukaryotic cells, as described by M.
Kozak, J. Mol. Biol. 196:947-950 (1987), followed by bases of the
sequence of the TR13 polypeptide shown in FIGS. 7A-E, respectively,
beginning with the indicated N-terminus of the mature protein.
[0852] The 3' primer for TR13 has the sequence 5'
CGCGGTACCGCGGCACTGAG TCAAATC 3' (SEQ ID NO:29) containing the
underlined Asp718 restriction site followed by nucleotides
complementary to the 3' noncoding sequence in FIGS. 1A-D.
[0853] The 3' primer for TR14 has the sequence 5'
CGCGGTACCCATTCAGGCCCC TGCTG 3' (SEQ ID NO:30) containing the
underlined Asp718 restriction site followed by nucleotides
complementary to the 3' noncoding sequence in FIGS. 4A-E,
respectively.
[0854] The 3' primer for TR13 has the sequence 5'
GCAGCATCTAGAGCGGCACT GAGTCAAATC 3' (SEQ ID NO:45) containing the
underlined XbaI restriction site followed by nucleotides
complementary to the 3' noncoding sequence in FIGS. 7A-E,
respectively.
[0855] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.) The fragment then is digested with BamHI or Xba I
and Asp718 or XbaI and again is purified on a 1% agarose gel. This
fragment is designated "F1."
[0856] The clone is digested with the restriction enzyme Bam HI or
XbaI and optionally can be dephosphorylated using calf intestinal
phosphatase, using routine procedures known in the art. The DNA is
then isolated from a 1% agarose gel using a commercially available
kit ("Geneclean" BIO 101 Inc., La Jolla, Calif.). The vector DNA is
designated herein "V1."
[0857] Fragment F1 and the dephosphorylated clone V1 are ligated
together with T4 DNA ligase. E. coli HB101 or other suitable E.
coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria are identified that contain the clone
with the human TR13 and/or TR14 nucleic acids using the PCR method,
in which one of the primers that is used to amplify the nucleic
acids and the second primer is from well within the vector so that
only those bacterial colonies containing the TR13 and/or TR14
nucleic acid fragment will show amplification of the DNA. The
sequence of the cloned fragment is confirmed by DNA sequencing.
This clone is designated herein pBacTR13 and/or pBacTR14.
[0858] Five ug of the clone pBacTR13 and/or pBacTR14 is
co-transfected with 1.0 ug of a commercially available linearized
baculovirus DNA ("BaculoGold.TM. baculovirus DNA", Pharmingen, San
Diego, Calif.), using the lipofectin method described by Felgner et
al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987). 1 ug of
BaculoGold.TM. virus DNA and 5 ug of the clone pBacTR13 and/or TR14
are mixed in a sterile well of a microliter plate containing 50 ul
of serum free Grace's medium (Life Technologies, Inc., Rockville,
Md.). Afterwards, 10 ul Lipofectin plus 90 .quadrature.I Grace's
medium are added, mixed, and incubated for 15 minutes at room
temperature. Then, the transfection mixture is added drop-wise to
Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture
plate with 1 ml Grace's medium without serum. The plate is rocked
back and forth to mix the newly added solution. The plate is then
incubated for 5 hours at 27.degree. C. After 5 hours, the
transfection solution is removed from the plate and 1 ml of Grace's
insect medium supplemented with 10% fetal calf serum is added. The
plate is put back into an incubator and cultivation is continued at
27.degree. C. for four days.
[0859] After four days, the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, cited above.
An agarose gel with "Blue Gal" (Life Technologies, Inc., Rockville,
Md.) is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies, Inc., Rockville,
Md., pages 9-10). After appropriate incubation, blue stained
plaques are picked with the tip of a micropipettor (e.g.,
Eppendorf). The agar containing the recombinant viruses is then
resuspended in a microcentrifuge tube containing 200 ul of Grace's
medium and the suspension containing the recombinant baculovirus is
used to infect Sf9 cells seeded in 35 mm dishes. Four days later
the supernatants of these culture dishes are harvested and then
they are stored at 4.degree. C. The recombinant virus is called
V-TR13 and/or V-TR14.
[0860] To verify the expression of the TR13 and/or TR14 nucleic
acid, Sf9 cells are grown in Grace's medium supplemented with 10%
heat inactivated FBS. The cells are infected with the recombinant
baculovirus V-TR13 and/or TR14 at a multiplicity of infection
("MOI") of about 2. Six hours later the medium is removed and is
replaced with SF900 II medium minus methionine and cysteine
(available from Life Technologies, Inc., Rockville, Md.). If
radiolabeled proteins are desired, 42 hours later, 5 uCi of
.sup.35S-methionine and 5 uCi .sup.35S-cysteine (available from
Amersham) are added. The cells are further incubated for 16 hours
and then they are harvested by centrifugation. The proteins in the
supernatant as well as the intracellular proteins are analyzed by
SDS-PAGE followed by autoradiography (if radiolabeled).
Microsequencing of the amino acid sequence of the amino terminus of
purified protein may be used to determine the amino terminal
sequence of the mature protein and thus the cleavage point and
length of the secretory signal peptide.
Example 3
[0861] Cloning and Expression of the TR13 and/or TR14 Polypeptides
in Mammalian Cells
[0862] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from Retroviruses, e.g. RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular signals
can also be used (e.g., the human actin promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as pSVL and pMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and
pBC12MI (ATCC 67109). Mammalian host cells that could be used
include, human Hela 293, H9 and Jurkat cells, mouse NIH3T3 and C127
cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells, and
Chinese hamster ovary (CHO) cells.
[0863] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome.
Co-transfection with a selectable marker such as dhfr, gpt,
neomycin, or hygromycin allows the identification and isolation of
the transfected cells.
[0864] The transfected gene can also be amplified to express large
amounts of the encoded protein. The dihydrofolate reductase (DHFR)
marker is useful to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem. J. 227:277-279 (1991); Bebbington et al.,
Bio/technology 10:169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) cells are often used for the production of
proteins.
[0865] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology 5:438-447 (March 1985)), plus a fragment of
the CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
Example 3A
[0866] Cloning and Expression of the Extracellular Soluble Domain
of TR13, and/or TR14 Polypeptides in COS Cells
[0867] The expression clone, pTR13-HA and/or TR14-HA, is made by
cloning a cDNA encoding TR13 and/or TR14 polypeptides into the
expression vector pcDNAI/Amp or pcDNAIII (which can be obtained
from Invitrogen, Inc.).
[0868] The expression vector pcDNAI/amp contains: (I) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cell; (2) an ampicillin resistance gene for
selection of clone-containing prokaryotic cells; (3) an SV40 origin
of replication for propagation in eukaryotic cells; (4) a CMV
promoter, a polylinker, an SV40 intron, and a polyadenylation
signal arranged so that a cDNA conveniently can be placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker.
[0869] A DNA fragment encoding the entire TR13 and/or TR14
precursor and a HA tag fused in frame to its 3' end is cloned into
the polylinker region of the vector so that recombinant protein
expression is directed by the CMV promoter. The HA tag corresponds
to an epitope derived from the influenza hemagglutinin protein
described by Wilson et al., Cell 37:767 (1984). The fusion of the
HA tag to the target protein allows easy detection of the
recombinant protein with an antibody that recognizes the HA
epitope.
[0870] The clone construction strategy is as follows:
[0871] The TR13 and/or TR14 cDNA of the deposited clone(s) is
amplified using primers that contain convenient restriction sites,
much as described above regarding the construction of expression
vectors for expression of TR13 and/or TR14 polypeptides in E.
coli.
[0872] To facilitate detection, purification and characterization
of the expressed TR13 and/or TR14 polypeptides, one of the primers
contains a hemagglutinin tag ("HA tag") as described above.
[0873] Suitable primers for TR13 and/or TR14 include the following,
which are used in this example:
[0874] The 5' TR13 primer, 5' CGCGGATCCATGGACCAAAGTACCCAA 3' (SEQ
ID NO:31) contains the underlined BamHI site, an ATG start codon
and 5 codons thereafter. The 3' primer for TR13, which contains the
underlined XbaI site, stop codon, hemagglutinin tag, and the last
18 nucleotides of the 3' coding sequence (at the 3' end), has the
following sequence: 5' CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTAT
GGGTAGCGGCACTGAGTCAAATC 3' (SEQ ID NO:32).
[0875] The 5' TR14 primer, 5' CGCGGATCCATGAGTACTGGGACCAAT 3' (SEQ
ID NO:34) contains the underlined BamHI site, an ATG start codon
and 5 codons thereafter. The 3' primer for TR14, which contains the
underlined XbaI site, stop codon, hemagglutinin tag, and the last
18 nucleotides of the 3' coding sequence (at the 3' end), has the
following sequence: 5' CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATG
GGTACATTCAGGCCCCTGCTG 3' (SEQ ID NO:33).
[0876] The 5' TR13 primer of the sequence described in FIGS. 7A-E
(SEQ ID NO:39), 5' CGCGGATCCATGGCTGAGCCTGGGCAC 3' (SEQ ID NO:46)
contains the underlined BamHI site, an ATG start codon and 5 codons
thereafter. The 3' primer for TR, which contains the underlined
XbaI site, stop codon, hemagglutinin tag, and the last 18
nucleotides of the 3' coding sequence (at the 3' end), has the
following sequence:
6 5' CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTAGCGGCACTGAGTCAAATC 3'.
(SEQ ID NO: 47)
[0877] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with BamHI and XbaI and then ligated. The ligation
mixture is transformed into E. coli strain SURE (available from
Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, Calif. 92037) the transformed culture is plated on
ampicillin media plates which then are incubated to allow growth of
ampicillin resistant colonies. Clone DNA is isolated from resistant
colonies and examined by restriction analysis and gel sizing for
the presence of the TR13, and/or TR14-encoding fragment.
[0878] For expression of recombinant TR13 and/or TR14 polypeptides,
COS cells are transfected with an expression vector, as described
above, using DEAE-DEXTRAN, as described, for instance, in Sambrook
el al., Molecular Cloning: a Laboratory Manual, Cold Spring
Laboratory Press, Cold Spring Harbor, N.Y. (1989). Cells are
incubated under conditions for expression of TR13 and/or TR14
polypeptides by the vector.
[0879] Expression of the TR13-HA, and/or TR14-HA fusion protein is
detected by radiolabelling and immunoprecipitation, using methods
described in, for example Harlow et al., Antibodies: a Laboratory
Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1988). To this end, two days after transfection, the
cells are labeled by incubation in media containing
.sup.35S-cysteine for 8 hours. The cells and the media are
collected, and the cells are washed and then lysed with
detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS,
1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et
al. cited above. Proteins are precipitated from the cell lysate and
from the culture media using an HA-specific monoclonal antibody.
The precipitated proteins then are analyzed by SDS-PAGE gels and
autoradiography. An expression product of the expected size is seen
in the cell lysate, which is not seen in negative controls.
Example 3B
[0880] Cloning and Expression of TR13 and/or TR14 Polypeptides
Using the CHO Expression System
[0881] The vector pC4 is used for the expression of the TR13 and/or
TR14 polypeptide. Clone pC4 is a derivative of the clone pSV2-dhfr
(ATCC Accession No. 37146). The clone contains the mouse DHFR gene
under control of the SV40 early promoter. Chinese hamster ovary- or
other cells lacking dihydrofolate activity that are transfected
with these clones can be selected by growing the cells in a
selective medium (alpha minus MEM, Life Technologies, Rockville,
Md.) supplemented with the chemotherapeutic agent methotrexate
(MTX). The amplification of the DHFR genes in cells resistant to
MTX has been well documented (see, e.g., F. W. Alt et al., J. Biol.
Chem. 253:1357-1370 (1978); J. L. Hamlin and C. Ma, Biochem. et
Biophys. Acta 1097:107-143 (1990); M. J. Page M. A. Sydenham,
Biotechnology 9:64-68(1991)). Cells grown in increasing
concentrations of MTX develop resistance to the drug by
overproducing the target enzyme, DHFR, as a result of amplification
of the DHFR gene. If a second gene is linked to the DHFR gene, it
is usually co-amplified and over-expressed. It is known in the art
that this approach may be used to develop cell lines carrying more
than 1,000 copies of the amplified gene(s). Subsequently, when the
methotrexate is withdrawn, cell lines are obtained that contain the
amplified gene integrated into one or more chromosome(s) of the
host cell.
[0882] Clone pC4 contains, for expressing the gene of interest, the
strong promoter of the long terminal repeat (LTR) of the Rous
Sarcoma Virus (Cullen et al., Molecular and Cellular Biology
5:438-447 (March 1985)), plus a fragment isolated from the enhancer
of the immediate early gene of human cytomegalovirus (CMV) (Boshart
et al., Cell 41:521-530 (1985)). Downstream of the promoter are the
following single restriction enzyme cleavage sites that allow the
integration of the genes: BamHI, XbaI, and Asp718. Behind these
cloning sites, the clone contains the 3' intron and the
polyadenylation site of the rat preproinsulin gene. Other high
efficiency promoters can also be used for the expression, e.g., the
human B-actin promoter, the SV40 early or late promoters or the
long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
Clontech's Tet-Off and Tet-On gene expression systems and similar
systems can be used to express the TR13 and/or TR14 polypeptide in
a regulated way in mammalian cells. For the polyadenylation of the
mRNA, other signals, e.g., from the human growth hormone or globin
genes, can be used as well.
[0883] Stable cell lines carrying a gene of interest integrated
into the chromosomes can also be selected upon co-transfection with
a selectable marker such as gpt, G418, or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g., G418 plus methotrexate.
[0884] The clone pC4 is digested with the restriction enzyme BamHI
and then dephosphorylated using calf intestinal phosphates, by
procedures known in the art. The vector is then isolated from a 1%
agarose gel.
[0885] The DNA sequence encoding the complete TR13 and/or TR14
polypeptide is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the desired portion of
the gene.
[0886] The 5' oligonucleotide primer for TR13, containing the
underlined BamHI restriction site, a Kozak sequence, and an AUG
start codon, has the sequence: 5' CGC GGATCCGCCATCATGGACCAAAGTACC
3' (SEQ ID NO:34). The 3' primer for TR13, containing the
underlined Asp718 restriction site, has the sequence:
7 (SEQ ID NO: 35) 5' CGC GGTACCGCGGCACTGAGTCAAATC 3'.
[0887] The 5' oligonucleotide primer for TR14, containing the
underlined BamHI restriction site, a Kozak sequence, and an AUG
start codon, has the sequence: 5' CGC GGATCCATGAGTACTGGGACC 3' (SEQ
ID NO:36). The 3' primer for TR14, containing the underlined Asp718
restriction site, has the sequence:
8 (SEQ ID NO: 37) 5' CGC GGTACCTTCATTCAGGCCCCTGCTG 3'.
[0888] The amplified fragment is digested with BamHI and then
purified again on a 1% agarose gel. The isolated fragment and the
dephosphorylated vector are then ligated with T4 DNA ligase. E.
coli HB101 or XL-1 Blue cells are then transformed and bacteria are
identified that contain the fragment inserted into clone pC4 using,
for instance, restriction enzyme analysis.
[0889] Chinese hamster ovary cells lacking an active DHFR enzyme
are used for transfection. Five ug of the expression clone pC4 are
cotransfected with 0.5 ug of the clone pSVneo using the lipofectin
method (Felgner et al., supra). The clone pSV2-neo contains a
dominant selectable marker, the neo gene from Tn5 encoding an
enzyme that confers resistance to a group of antibiotics including
G418. The cells are seeded in alpha minus MEM supplemented with 1
mg/ml G418. After 2 days, the cells are trypsinized and seeded in
hybridoma cloning plates (Greiner, Germany) in alpha minus MEM
supplemented with 10, 25, or 50 ng/ml of MTX plus 1 mg/ml G418.
After about 10-14 days, single clones are trypsinized and then
seeded in 6-well petri dishes or 10 ml flasks using different
concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800
nM). Clones growing at the highest concentrations of methotrexate
are then transferred to new 6-well plates containing even higher
concentrations of methotrexate (1 uM, 2 uM, 5 uM, 10 uM, 20 uM).
The same procedure is repeated until clones are obtained which grow
at a concentration of 100-200 uM. Expression of the desired gene
product is analyzed, for instance, by Western blot analysis and
SDS-PAGE, or by reversed phase HPLC analysis.
Example 4
[0890] Protein Fusions of TR13 and/or TR14
[0891] TR13 and/or TR14 polypeptides of the invention are
optionally fused to other proteins. These fusion proteins can be
used for a variety of applications. For example, fusion of TR13
and/or TR14 polypeptides to His-tag, HA-tag, protein A, IgG
domains, and maltose binding protein facilitates purification. (See
EP A 394,827; Traunecker, et al., Nature 331:84-86 (1988)).
Similarly, fusion to IgG-1, IgG-3, and albumin increases the
halflife time in vivo. Nuclear localization signals fused to TR13
and/or TR14 polypeptides can target the protein to a specific
subcellular localization, while covalent heterodimer or homodimers
can increase or decrease the activity of a fusion protein. Fusion
proteins can also create chimeric molecules having more than one
function. Finally, fusion proteins can increase solubility and/or
stability of the fused protein compared to the non-fused protein.
All of the types of fusion proteins described above can be made
using techniques known in the art or by using or routinely
modifying the following protocol, which outlines the fusion of a
polypeptide to an IgG molecule.
[0892] Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the
sequence described below (SEQ ID NO:38). These primers also
preferably contain convenient restriction enzyme sites that will
facilitate cloning into an expression vector, preferably a
mammalian expression vector.
[0893] For example, if the pC4 (Accession No. 209646) expression
vector is used, the human Fc portion can be ligated into the BamHI
cloning site. Note that the 3' BamHI site should be destroyed.
Next, the vector containing the human Fc portion is re-restricted
with BamHI, linearizing the vector, and TR13 and/or TR14
polynucleotide, isolated by the PCR protocol described in Example
1, is ligated into this BamHI site. Note that the polynucleotide is
cloned without a stop codon, otherwise a fusion protein will not be
produced.
[0894] If the naturally occurring signal sequence is used to
produce the secreted protein, pC4 does not need a second signal
peptide. Alternatively, if the naturally occurring signal sequence
is not used, the vector can be modified to include a heterologous
signal sequence. (See, e.g., WO 96/34891.)
9 Human IgG Fc region: GGGATCCGGAGCCCAAATCTTCTGACAAAACTCAC-
ACATGCCCACCGTGCCCAGCACCTGAATTCGAGGGTGCACCGTCAGT (SEQ ID NO: 38)
CTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGG-
TGGTGGACGTAAGC CACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCG-
TGGAGGTCCATAATGCCAAGACAAAGCCGCGGGAGGAGC
AGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTA-
CAAGTGCAA GGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCCAA-
AGCCAAAGGGCAGCCCCGAGAACCACAGGTGTAC ACCCTGCCCCCATCCCGGGATGA-
GCTGACCAAGAACCAGGTCAGCCTGACCTCCCTGGTCAAAGGCTTCTATCCAAGCGACA
TCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCG-
ACGGCTCCTT CTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGG-
GGAACGTCTTCTCATGCTCCGTGATGCATGAGGCT
CTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGA-
GGAT
Example 5
[0895] Production of an Antibody Against TR13 or TR14
[0896] Hybridoma Technology
[0897] The antibodies of the present invention can be prepared by a
variety of methods. (See, Current Protocols, Chapter 2.) As one
example of such methods, cells expressing TR13 or TR14 are
administered to an animal to induce the production of sera
containing polyclonal antibodies. In a preferred method, a
preparation of TR13 or TR14 protein is prepared and purified to
render it substantially free of natural contaminants. Such a
preparation is then introduced into an animal in order to produce
polyclonal antisera of greater specific activity.
[0898] Monoclonal antibodies specific for protein TR13 or TR14 are
prepared using hybridoma technology. (Kohler et al., Nature 256:495
(1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et
al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., in:
Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp.
563-681 (1981)). In general, an animal (preferably a mouse) is
immunized with TR13 or TR14 polypeptide or, more preferably, with a
secreted TR13 or TR14 polypeptide-expressing cell. Such
polypeptide-expressing cells are cultured in any suitable tissue
culture medium, preferably in Earle's modified Eagle's medium
supplemented with 10% fetal bovine serum (inactivated at about
56.degree. C.), and supplemented with about 10 g/l of nonessential
amino acids, about 1,000 U/ml of penicillin, and about 100 Mg/ml of
streptomycin.
[0899] The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable mycloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP2O), available
from the ATCC. After fusion, the resulting hybridoma cells are
selectively maintained in HAT medium, and then cloned by limiting
dilution as described by Wands et al. (Gastroenterology 80:225-232
(1981). The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of
binding the TR13 or TR14 polypeptide.
[0900] Alternatively, additional antibodies capable of binding to
TR13 or TR14 polypeptide can be produced in a two-step procedure
using anti-idiotypic antibodies. Such a method makes use of the
fact that antibodies are themselves antigens, and therefore, it is
possible to obtain an antibody which binds to a second antibody. In
accordance with this method, protein specific antibodies are used
to immunize an animal, preferably a mouse. The splenocytes of such
an animal are then used to produce hybridoma cells, and the
hybridoma cells are screened to identify clones which produce an
antibody whose ability to bind to the TR13 or TR14 protein-specific
antibody can be blocked by TR13 or TR14. Such antibodies comprise
anti-idiotypic antibodies to the TR13 or TR14 protein-specific
antibody and are used to immunize an animal to induce formation of
further TR13 or TR14 protein-specific antibodies.
[0901] For in vivo use of antibodies in humans, an antibody is
"humanized". Such antibodies can be produced using genetic
constructs derived from hybridoma cells producing the monoclonal
antibodies described above. Methods for producing chimeric and
humanized antibodies are known in the art and are discussed infra.
(See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).)
[0902] Isolation of Antibody Fragments Directed Against TR13 or
TR14 from a Library of scFvs
[0903] Naturally occurring V-genes isolated from human PBLs are
constructed into a library of antibody fragments which contain
reactivities against TR13 or TR14 to which the donor may or may not
have been exposed (see e.g., U.S. Pat. No. 5,885,793 incorporated
herein by reference in its entirety).
[0904] Rescue of the Library. A library of scFvs is constructed
from the RNA of human PBLs as described in PCT publication WO
92/01047. To rescue phage displaying antibody fragments,
approximately 109 E. coli harboring the phagemid are used to
inoculate 50 ml of 2.times.TY containing 1% glucose and 100 ug/ml
of ampicillin (2.times.TY-AMP-GLU) and grown to an O.D. of 0.8 with
shaking. Five ml of this culture is used to innoculate 50 ml of
2.times.TY-AMP-GLU, 2.times.108 TU of delta gene 3 helper (M13
delta gene III, see PCT publication WO 92/01047) are added and the
culture incubated at 37.degree. C. for 45 minutes without shaking
and then at 37.degree. C. for 45 minutes with shaking. The culture
is centrifuged at 4000 r.p.m. for 10 min. and the pellet
resuspended in 2 liters of 2.times.TY containing 100 pg/ml
ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are
prepared as described in PCT publication WO 92/01047.
[0905] M13 delta gene III is prepared as follows: M13 delta gene
III helper phage does not encode gene III protein, hence the phage
(mid) displaying antibody fragments have a greater avidity of
binding to antigen. Infectious M13 delta gene III particles are
made by growing the helper phage in cells harboring a pUC19
derivative supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking. Cells are spun down (IEC-Centra 8,400 r.p.m. for 10 min),
resuspended in 300 ml 2.times.TY broth containing 100 .mu.g
ampicillin/ml and 25 ug kanamycin/ml (2.times.TY-AMP-KAN) and grown
overnight, shaking at 37.degree. C. Phage particles are purified
and concentrated from the culture medium by two PEG-precipitations
(Sambrook et al., 1990), resuspended in 2 ml PBS and passed through
a 0.45 .mu.m filter (Minisart NML; Sartorius) to give a final
concentration of approximately 1013 transducing units/ml
(ampicillin-resistant clones).
[0906] Panning of the Library. Immunotubes (Nunc) are coated
overnight in PBS with 4 ml of either 100 .mu.g/ml or 10 ug/ml of a
polypeptide of the present invention. Tubes are blocked with 2%
Marvel-PBS for 2 hours at 37.degree. C. and then washed 3 times in
PBS. Approximately 1013 TU of phage is applied to the tube and
incubated for 30 minutes at room temperature tumbling on an over
and under turntable and then left to stand for another 1.5 hours.
Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with
PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and
rotating 15 minutes on an under and over turntable after which the
solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl,
pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TG1
by incubating eluted phage with bacteria for 30 minutes at
37.degree. C. The E. coli are then plated on TYE plates containing
1% glucose and 100 .mu.g/ml ampicillin. The resulting bacterial
library is then rescued with delta gene 3 helper phage as described
above to prepare phage for a subsequent round of selection. This
process is then repeated for a total of 4 rounds of affinity
purification with tube-washing increased to 20 times with PBS, 0.1%
Tween-20 and 20 times with PBS for rounds 3 and 4.
[0907] Characterization of Binders. Eluted phage from the 3rd and
4th rounds of selection are used to infect E. coli HB 2151 and
soluble scFv is produced (Marks, et al., 1991) from single colonies
for assay. ELISAs are performed with microtitre plates coated with
either 10 pg/ml of the polypeptide of the present invention in 50
mM bicarbonate pH 9.6. Clones positive in ELISA are further
characterized by PCR fingerprinting (see, e.g., PCT publication WO
92/01047) and then by sequencing.
Example 6
[0908] Tissue Distribution of TR13 and TR14 mRNA Expression
[0909] Northern blot analysis was carried out to examine TR13
and/or TR14 gene expression in human tissues, using methods
described by, among others, Sambrook et al., cited above. A cDNA
probe containing the entire nucleotide sequence of TR13 (SEQ ID
NO:1) and/or TR14 (HMSHK47) was labeled with .sup.32P using the
rediprime.TM. DNA labeling system (Amersham Life Science),
according to manufacturer's instructions. After labeling, the probe
was purified using a CHROMA SPIN-100 column (Clontech Laboratories,
Inc.), according to manufacturer's protocol number PT1200-1. The
purified labeled TR13 and TR14 probes were then separately used to
examine various human tissues for TR13 and TR14 mRNA,
respectively.
[0910] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) were obtained
from Clontech and were examined with labeled probe using
ExpressHyb.TM. hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots were mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
[0911] Expression of TR13 was detected in pancreas tumor,
endometrial tumor, adult small intestine, colon cancer, breast
cancer cell line, resting T-cell, amygdala, rectum, T-cell helper,
pineal gland, apoptotic T-cell, epididymus, greater omentum,
prostate BPH, osteoclastoma, endometrial stromal cells, stromal
cell, substantia nigra, activated T-cell, tonsil, and testes
tissue.
[0912] Expression of TR14 was detected in activated T-cell,
endometrial tumor, thymus, and 12 week early stage human
tissue.
[0913] Northern Blot Analysis of TR13 and/or TR14 in Various Cell
Lines Cells
[0914] Unless stated otherwise, cell lines are obtained from the
American Type Culture Collection (Rockville, Md.). The myeloid
(Koeffler et al. (1980); Koeffler (1983); Harris and Ralph (1985);
and Tucker et al. (1987) and B-cell lines (Jonak et al. (1922))
studied represent cell types at different stages of the
differentiation pathway. KG1a and PLB 985 cells (Tucker et al.
(1987)) are obtained from H. P. Koeffler (UCLA School of Medicine).
BJA-B is from Z. Jonak (SmithKline Beecham). TF274, a stromal cell
line exhibiting osteoblastic features, is generated from the bone
marrow of a healthy male donor (Z. Jonak and K. B. Tan,
unpublished). Primary carotid artery endothelial cells are
purchased from Clonetics Corp. (San Diego, Calif.) and monocytes
are prepared by differential centrifugation of peripheral blood
mononuclear cells and adhesion to tissue culture dish. CD19+, CD4+
and CD8+ cells (>90% pure) are isolated with cell type specific
immunomagnetic beads (Drynal, Lake Success, N.Y.).
[0915] RNA Analysis
[0916] Total RNA of adult tissues are purchased from Clontech (Palo
Alto, Calif.). Total RNA is extracted from cell lines (in
exponential growth phase) and primary cells with TriReagent
(Molecular Research Center, Inc., Cincinnati, Ohio). 5 to 7.5 ug of
total RNA is fractionated in a 1% agarose gel containing
formaldehyde cast in a Wide Mini-Sub Cell gel tray (Bio-Rad,
Hercules, Calif.) as described (Sambrook, et al.) with slight
modifications. The formaldehyde concentration is reduced to 0.5M
and the RNA is stained prior to electrophoresis with 100
.quadrature.g/ml of ethidium bromide that is added to the loading
buffer. After electrophoresis with continuous buffer recirculation
(60 volts/90 min), the gel is photographed and the RNA is
transferred quantitatively to Zeta-probe nylon membrane (Biorad,
Hercules, Calif.) by vacuum-blotting with 25 mm NaOH for 90 min.
After neutralization for 5-10 min, with 1M Tris-HCl, pH 7.5
containing 3M NaCl, the blots are prehybridized with 50% formamide,
8% dextran sulfate, 6.times.SSPE, 0.1% SDS and 100 ug/ml of sheared
and denatured salmon sperm DNA for at least 30 min at 42.degree. C.
cDNA inserts labeled with .sup.32P-DCTP by random priming
(Stratagene, La Jolla, Calif.), are denatured with 0.25M NaOH (10
min at 37.degree. C.) and added to the prehybridization solution.
After 24-65 hr at 42.degree. C., the blots are wasted under high
stringency conditions (Sambrook, et al.) and exposed to X-ray
films.
Example 7
[0917] Method of Determining Alterations in the TR13 and/or TR14
Gene
[0918] RNA is isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease). cDNA
is then generated from these RNA samples using protocols known in
the art. (See, Sambrook.) The cDNA is then used as a template for
PCR, employing primers surrounding regions of interest in SEQ ID
NO:1 SEQ ID NO:60, and/or SEQ ID NO:4. Suggested PCR conditions
consist of 35 cycles at 95.degree. C. for 30 seconds; 60-120
seconds at 52-58.degree. C.; and 60-120 seconds at 70.degree. C.,
using buffer solutions described in Sidransky, D., et al., Science
252:706 (1991).
[0919] PCR products are then sequenced using primers labeled at
their 5' end with T4 polynucleotide kinase, employing SequiTherm
Polymerase. (Epicentre Technologies). The intron-exon borders of
selected exons of TR13 and/or TR14 are also determined and genomic
PCR products analyzed to confirm the results. PCR products
harboring suspected mutations in TR13 and/or TR14 is then cloned
and sequenced to validate the results of the direct sequencing.
[0920] PCR products of TR13 and/or TR14 are cloned into T-tailed
vectors as described in Holton, T. A. and Graham, M. W., Nucleic
Acids Research, 19:1156 (1991) and sequenced with T7 polymerase
(United States Biochemical). Affected individuals are identified by
mutations in TR13 and/or TR14 not present in unaffected
individuals.
[0921] Genomic rearrangements are also observed as a method of
determining alterations in the TR3 and/or TR14 gene. Genomic clones
isolated using techniques known in the art are nick-translated with
digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), and
FISH performed as described in Johnson, Cg. et al., Methods Cell
Biol. 35:73-99 (1991). Hybridization with the labeled probe is
carried out using a vast excess of human cot-1 DNA for specific
hybridization to the TR13 and/or TR14 genomic locus.
[0922] Chromosomes are counterstained with
4,6-diamino-2-phenylidole and propidium iodide, producing a
combination of C- and R-bands. Aligned images for precise mapping
are obtained using a triple-band filter set (Chroma Technology,
Brattleboro, Vt.) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, Ariz.) and variable excitation
wavelength filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl.,
8:75 (1991).) Image collection, analysis and chromosomal fractional
length measurements are performed using the ISee Graphical Program
System. (Inovision Corporation, Durham, N.C.) Chromosome
alterations of the genomic region of TR13 and/or TR14 (hybridized
by the probe) are identified as insertions, deletions, and
translocations. These TR13 and/or TR14 alterations are used as a
diagnostic marker for an associated disease.
Example 8
[0923] Method of Detecting Abnormal Levels of TR13 and/or TR14
Nucleic Acids in a Biological Sample
[0924] TR13 and/or TR14 polypeptides can be detected in a
biological sample, and if an increased or decreased level of TR13
and/or TR14 is detected, this polypeptide is a marker for a
particular phenotype. Methods of detection are numerous, and thus,
it is understood that one skilled in the art can modify the
following assay to fit their particular needs.
[0925] For example, antibody-sandwich ELISAs are used to detect
TR13 and/or TR14 in a sample, preferably a biological sample. Wells
of a microtiter plate are coated with specific antibodies to TR13
and/or TR14, at a final concentration of 0.2 to 10 ug/ml. The
antibodies are either monoclonal or polyclonal and are produced
using technique known in the art. The wells are blocked so that
non-specific binding of TR13 and/or TR14 to the well is
reduced.
[0926] The coated wells are then incubated for >2 hours at RT
with a sample containing TR13 and/or TR14. Preferably, serial
dilutions of the sample should be used to validate results. The
plates are then washed three times with deionized or distilled
water to remove unbounded TR13 and/or TR14.
[0927] Next, 50 ul of specific antibody-alkaline phosphatase
conjugate, at a concentration of 25-400 ng, is added and incubated
for 2 hours at room temperature. The plates are again washed three
times with deionized or distilled water to remove unbounded
conjugate.
[0928] 75 ul of 4-methylumbelliferyl phosphate (MUP) or
p-nitrophenyl phosphate (NPP) substrate solution is then added to
each well and incubated 1 hour at room temperature to allow
cleavage of the substrate and flourescence. The flourescence is
measured by a microtiter plate reader. A standard curve is
preparded using the experimental results from serial dilutions of a
control sample with the sample concentration plotted on the X-axis
(log scale) and fluorescence or absorbance on the Y-axis (linear
scale). The TR13 and/or TR14 polypeptide concentration in a sample
is then interpolated using the standard curve based on the measured
flourescence of that sample.
Example 9
[0929] Method of Decreasing Levels of TR13 and/or TR14
[0930] The present invention relates to a method for treating an
individual in need of a decreased level of TR13 and/or TR14
biological activity in the body comprising, administering to such
an individual a composition comprising a therapeutically effective
amount of TR13 and/or TR14 antagonist. Preferred antagonists for
use in the present invention are TR13 and/or TR14-specific
antibodies.
[0931] Antisense technology is used to inhibit production of TR13
and/or TR14. This technology is one example of a method of
decreasing levels of TR13 and/or TR14 polypeptide, preferably a
soluble and/or secreted form, due to a variety of etiologies, such
as cancer.
[0932] For example, a patient with decreased levels of TR13 and/or
TR14 polypeptide receives a daily dose 0.1-100 ug/kg of the
polypeptide for six consecutive days. Preferably, the polypeptide
is in a soluble and/or secreted form.
Example 10
[0933] Method of Treating Increased Levels of TR13 and/or TR14
[0934] The present invention also relates to a method for treating
an individual in need of an increased level of TR13 and/or TR14
biological activity in the body comprising administering to such an
individual a composition comprising a therapeutically effective
amount of TR13 and/or TR14 or an agonist thereof.
[0935] Moreover, it will be appreciated that conditions caused by a
decrease in the standard or normal expression level of TR13 and/or
TR14 in an individual can be treated by administering TR13 and/or
TR14, preferably in a soluble and/or secreted form. Thus, the
invention also provides a method of treatment of an individual in
need of an increased level of TR13 and/or TR14 polypeptide
comprising administering to such an individual a pharmaceutical
composition comprising an amount of TR13 and/or TR14 to increase
the biological activity level of TR13 and/or TR14 in such an
individual.
[0936] For example, a patient diagnosed with abnormally increased
levels of TR13 and/or TR14 is administered intravenously antisense
polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21
days. This treatment is repeated after a 7-day rest period if the
is determined to be well tolerated.
Example 11
[0937] Method of Treatment Using Gene Therapy--Ex Vivo
[0938] One method of gene therapy transplants fibroblasts, which
are capable of expressing soluble and/or mature TR13 and/or TR14
polypeptides, onto a patient. Generally, fibroblasts are obtained
from a subject by skin biopsy. The resulting tissue is placed in
tissue-culture medium and separated into small pieces. Small chunks
of the tissue are placed on a wet surface of a tissue culture
flask, approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room temperature
over night. After 24 hours at room temperature, the flask is
inverted and the chunks of tissue remain fixed to the bottom of the
flask and fresh media (e.g., Ham's F12 media, with 10% FBS,
penicillin and streptomycin) is added. The flasks are then
incubated at 37.degree. C. for approximately one week.
[0939] At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in culture, a
monolayer of fibroblasts emerge. The monolayer is trypsinized and
scaled into larger flasks.
[0940] pMV-7 (Kirschmeier, P. T. et al. DNA. 7:219-25 (1988)),
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0941] The cDNA encoding TR13 and/or TR14 can be amplified using
PCR primers which correspond to the 5' and 3' end encoding
sequences respectively. Preferably, the 5' primer contains an EcoRI
site and the 3' primer includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is then used to transform E. coli HB101, which are then plated onto
agar containing kanamycin for the purpose of confirming that the
vector contains properly inserted TR13 and/or TR14.
[0942] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the TR13 and/or TR14 gene
is then added to the media and the packaging cells transduced with
the vector. The packaging cells now produce infectious viral
particles containing the TR13 and/or TR14 nucleic acid (the
packaging cells are now referred to as producer cells).
[0943] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his. Once the
fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine whether TR13 and/or TR14 protein is
produced.
[0944] The engineered fibroblasts are then transplanted onto the
host, either alone or after having been grown to confluence on
cytodex 3 microcarrier beads.
Example 12
[0945] Method of Treatment Using Gene Therapy--In Vivo
[0946] Another aspect of the present invention is using in vivo
gene therapy methods to treat disorders, diseases and conditions.
The gene therapy method relates to the introduction of naked
nucleic acid (DNA, RNA, and antisense DNA or RNA) TR13 and/or TR14
sequences into an animal to increase or decrease the expression of
the TR13 and/or TR14 polypeptide. The TR13 and/or TR14
polynucleotide may be operatively linked to a promoter or any other
genetic elements necessary for the expression of the TR13 and/or
TR14 polypeptide by the target tissue. Such gene therapy and
delivery techniques and methods are known in the art, see, for
example, WO90/11092, WO98/11779; U.S. Pat. Nos. 5,693,622,
5,705,151, 5,580,859; Tabata H. et al., Cardiovasc. Res. 35:470-479
(1997); Chao J. et al., Pharmacol. Res. 35:517-522 (1997); Wolff J.
A. Neuromiscul. Disord. 7:314-318 (1997); Schwartz B. et al., Gene
Ther. 3:405-411 (1996); Tsurumi Y. et al. Circulation 94:3281-3290
(1996) (incorporated herein by reference).
[0947] The TR13 and/or TR14 polynucleotide constructs may be
delivered by any method that delivers injectable materials to the
cells ofan animal, such as, injection into the interstitial space
of tissues (heart, muscle, skin, lung, liver, intestine and the
like). The TR13 and/or TR14 polynucleotide constructs can be
delivered in a pharmaceutically acceptable liquid or aqueous
carrier.
[0948] The term "naked" polynucleotide, DNA or RNA, refers to
sequences that are free from any delivery vehicle that acts to
assist, promote, or facilitate entry into the cell, including viral
sequences, viral particles, liposome formulations, lipofectin or
precipitating agents and the like. However, the TR13 and/or TR14
polynucleotides may also be delivered in liposome formulations
(such as those taught in Felgner P. L., et al. Ann. NY Acad. Sci.
772:126-139 (1995), and Abdallah B., et al. Biol. Cell 85(1):1-7
(1995)) which can be prepared by methods well known to those
skilled in the art.
[0949] The TR13 and/or TR14 polynucleotide vector constructs used
in the gene therapy method are preferably constructs that will not
integrate into the host genome nor will they contain sequences that
allow for replication. Any strong promoter known to those skilled
in the art can be used for driving the expression of DNA. Unlike
other gene therapies techniques, one major advantage of introducing
naked nucleic acid sequences into target cells is the transitory
nature of the polynucleotide synthesis in the cells. Studies have
shown that non-replicating DNA sequences can be introduced into
cells to provide production of the desired polypeptide for periods
of up to six months.
[0950] The TR13 and/or TR14 polynucleotide construct can be
delivered to the interstitial space of tissues within the an
animal, including of muscle, skin, brain, lung, liver, spleen, bone
marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas,
kidney, gall bladder, stomach, intestine, testis, ovary, uterus,
rectum, nervous system, eye, gland, and connective tissue.
Interstitial space of the tissues comprises the intercellular
fluid, mucopolysaccharide matrix among the reticular fibers of
organ tissues, elastic fibers in the walls of vessels or chambers,
collagen fibers of fibrous tissues, or that same matrix within
connective tissue ensheathing muscle cells or in the lacunae of
bone. It is similarly the space occupied by the plasma of the
circulation and the lymph fluid of the lymphatic channels. Delivery
to the interstitial space of muscle tissue is preferred for the
reasons discussed below. They may be conveniently delivered by
injection into the tissues comprising these cells. They are
preferably delivered to and expressed in persistent, non-dividing
cells which are differentiated, although delivery and expression
may be achieved in non-differentiated or less completely
differentiated cells, such as, for example, stem cells of blood or
skin fibroblasts. In vivo muscle cells are particularly competent
in their ability to take up and express polynucleotides.
[0951] For the naked TR13 and/or TR14 polynucleotide injection, an
effective dosage amount of DNA or RNA will be in the range of from
about 0.05 g/kg body weight to about 50 mg/kg body weight.
Preferably the dosage will be from about 0.005 mg/kg to about 20
mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg.
Of course, as the artisan of ordinary skill will appreciate, this
dosage will vary according to the tissue site of injection. The
appropriate and effective dosage of nucleic acid sequence can
readily be determined by those of ordinary skill in the art and may
depend on the condition being treated and the route of
administration. The preferred route of administration is by the
parenteral route of injection into the interstitial space of
tissues. However, other parenteral routes may also be used, such
as, inhalation of an aerosol formulation particularly for delivery
to lungs or bronchial tissues, throat or mucous membranes of the
nose. In addition, naked TR13 and/or TR14 polynucleotide constructs
can be delivered to arteries during angioplasty by the catheter
used in the procedure.
[0952] The dose response effects of injected TR13 and/or TR14
polynucleotide in muscle in vivo is determined as follows. Suitable
TR13 and/or TR14 template DNA for production of mRNA coding for
TR13 and/or TR14 polypeptide is prepared in accordance with a
standard recombinant DNA methodology. The template DNA, which may
be either circular or linear, is either used as naked DNA or
complexed with liposomes. The quadriceps muscles of mice are then
injected with various amounts of the template DNA.
[0953] Five to six week old female and male Balb/C mice are
anesthetized by intraperitoneal injection with 0.3 ml of 2.5%
Avertin. A 1.5 cm incision is made on the anterior thigh, and the
quadriceps muscle is directly visualized. The TR13 and/or TR14
template DNA is injected in 0.1 ml of carrier in a 1 cc syringe
through a 27 gauge needle over one minute, approximately 0.5 cm
from the distal insertion site of the muscle into the knee and
about 0.2 cm deep. A suture is placed over the injection site for
future localization, and the skin is closed with stainless steel
clips.
[0954] After an appropriate incubation time (e.g., 7 days) muscle
extracts are prepared by excising the entire quadriceps. Every
fifth 15 um cross-section of the individual quadriceps muscles is
histochemically stained for TR13 and/or TR14 protein expression. A
time course for TR13 and/or TR14 protein expression may be done in
a similar fashion except that quadriceps from different mice are
harvested at different times. Persistence of TR13 and/or TR14 DNA
in muscle following injection may be determined by Southern blot
analysis after preparing total cellular DNA and HIRT supernatants
from injected and control mice. The results of the above
experimentation in mice can be use to extrapolate proper dosages
and other treatment parameters in humans and other animals using
TR13 and/or TR14 naked DNA.
Example 14
[0955] Gene Therapy Using Endogenous TR13 and/or TR14 Gene
[0956] Another method of gene therapy according to the present
invention involves operably associating the endogenous TR13 and/or
TR14 sequence with a promoter via homologous recombination as
described, for example, in U.S. Pat. No. 5,641,670, issued Jun. 24,
1997; International Publication Number WO 96/29411, published Sep.
26, 1996; International Publication Number WO 94/12650, published
Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); and Zijlstra et al. Nature 342:435-438 (1989).
This method involves the activation of a gene which is present in
the target cells, but which is not expressed in the cells, or is
expressed at a lower level than desired. Polynucleotide constructs
are made which contain a promoter and targeting sequences, which
are homologous to the 5' non-coding sequence of endogenous TR13
and/or TR14, flanking the promoter. The targeting sequence will be
sufficiently near the 5' end of TR13 and/or TR14 so the promoter
will be operably linked to the endogenous sequence upon homologous
recombination. The promoter and the targeting sequences can be
amplified using PCR. Preferably, the amplified promoter contains
distinct restriction enzyme sites on the 5' and 3' ends.
Preferably, the 3' end of the first targeting sequence contains the
same restriction enzyme site as the 5' end of the amplified
promoter and the 5' end of the second targeting sequence contains
the same restriction site as the 3' end of the amplified
promoter.
[0957] The amplified promoter and the amplified targeting sequences
are digested with the appropriate restriction enzymes and
subsequently treated with calf intestinal phosphatase. The digested
promoter and digested targeting sequences are added together in the
presence of T4 DNA ligase. The resulting mixture is maintained
under conditions appropriate for ligation of the two fragments. The
construct is size fractionated on an agarose gel then purified by
phenol extraction and ethanol precipitation.
[0958] In this Example, the polynucleotide constructs are
administered as naked polynucleotides via electroporation. However,
the polynucleotide constructs may also be administered with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, precipitating agents, etc. Such methods
of delivery are known in the art.
[0959] Once the cells are transfected, homologous recombination
will take place which results in the promoter being operably linked
to the endogenous TR13 and/or TR14 sequence. This results in the
expression of TR13 and/or TR14 in the cell. Expression may be
detected by immunological staining, or any other method known in
the art.
[0960] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in DMEM+10% fetal calf serum.
Exponentially growing or early stationary phase fibroblasts are
trypsinized and rinsed from the plastic surface with nutrient
medium. An aliquot of the cell suspension is removed for counting,
and the remaining cells are subjected to centrifugation. The
supernatant is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the
supernatant aspirated, and the cells resuspended in electroporation
buffer containing 1 mg/ml acetylated bovine serum albumin. The
final cell suspension contains approximately 3.times.10.sup.6
cells/ml. Electroporation should be performed immediately following
resuspension.
[0961] Clone DNA is prepared according to standard techniques. For
example, to construct a clone for targeting to the TR13 and/or TR14
locus, clone pUC18 (MBI Fermentas, Amherst, N.Y.) is digested with
HindIII. The CMV promoter is amplified by PCR with an XbaI site on
the 5' end and a BamHI site on the 3' end. Two TR13 and/or TR14
non-coding sequences are amplified via PCR: one TR13 and/or TR14
non-coding sequence (TR13 and/or TR14 fragment 1) is amplified with
a HindIII site at the 5' end and an Xba site at the 3' end; the
other TR13 and/or TR14 non-coding sequence (TR13 and/or TR14
fragment 2) is amplified with a BamHI site at the 5' end and a
HindIII site at the 3' end. The CMV promoter and TR13 and/or TR14
fragments are digested with the appropriate enzymes (CMV
promoter--XbaI and BamHI; TR13 and/or TR14 fragment 1-XbaI; TR13
and/or TR14 fragment 2-BamHI) and ligated together. The resulting
ligation product is digested with HindIII, and ligated with the
HindIII-digested pUC18 clone.
[0962] Clone DNA is added to a sterile cuvette with a 0.4 cm
electrode gap (Bio-Rad). The final DNA concentration is generally
at least 120 .mu.g/ml. 0.5 ml of the cell suspension (containing
approximately 1.5.times.10.sup.6 cells) is then added to the
cuvette, and the cell suspension and DNA solutions are gently
mixed. Electroporation is performed with a Gene-Pulser apparatus
(Bio-Rad). Capacitance and voltage are set at 960 pF and 250-300 V,
respectively. As voltage increases, cell survival decreases, but
the percentage of surviving cells that stably incorporate the
introduced DNA into their genome increases dramatically. Given
these parameters, a pulse time of approximately 14-20 mSec should
be observed.
[0963] Electroporated cells are maintained at room temperature for
approximately 5 min, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a 10 cm dish and incubated at 37.degree. C. The following
day, the media is aspirated and replaced with 10 ml of fresh media
and incubated for a further 16-24 hours.
[0964] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. The fibroblasts can then be introduced into a patient as
described above.
Example 15
[0965] Assays to Detect Stimulation or Inhibition of B Cell
Proliferation and Differentiation
[0966] Generation of functional humoral immune responses requires
both soluble and cognate signaling between B-lineage cells and
their microenvironment. Signals may impart a positive stimulus that
allows a B-lineage cell to continue its programmed development, or
a negative stimulus that instructs the cell to arrest its current
developmental pathway. To date, numerous stimulatory and inhibitory
signals have been found to influence B cell responsiveness
including IL-2, IL-4, IL5, IL6, IL-7, IL10, IL-13, IL14 and IL15.
Interestingly, these signals are by themselves weak effectors but
can, in combination with various co-stimulatory proteins, induce
activation, proliferation, differentiation, homing, tolerance and
death among B cell populations. One of the best studied classes of
B-cell co-stimulatory proteins is the TNF-superfamily. Within this
family CD40, CD27, and CD30 along with their respective ligands
CD154, CD70, and CD153 have been found to regulate a variety of
immune responses. Assays which allow for the detection and/or
observation of the proliferation and differentiation of these
B-cell populations and their precursors are valuable tools in
determining the effects various proteins may have on these B-cell
populations in term's of proliferation and differentiation. Listed
below are two assays designed to allow for the detection of the
differentiation, proliferation, or inhibition of B-cell populations
and their precursors.
[0967] Experimental Procedure:
[0968] In Vitro assay--Purified TR13 and/or TR14 protein, or
truncated forms thereof, is assessed for its ability to induce
activation, proliferation, differentiation or inhibition and/or
death in B-cell populations and their precursors. The activity of
TR13 and/or TR14 protein on purified human tonsillar B cells,
measured qualitatively over the dose range from 0.1 to 10,000
ng/mL, is assessed in a standard B-lymphocyte co-stimulation assay
in which purified tonsillar B cells are cultured in the presence of
either formalin-fixed Staphylococcus aureus Cowan I (SAC) or
immobilized anti-human IgM antibody as the priming agent. Second
signals such as IL-2 and IL-15 synergize with SAC and IgM
crosslinking to elicit B cell proliferation as measured by
tritiated-thymidine incorporation. Novel synergizing agents can be
readily identified using this assay. The assay involves isolating
human tonsillar B cells by magnetic bead (MACS) depletion of
CD3-positive cells. The resulting cell population is greater than
95% B cells as assessed by expression of CD45R (B220). Various
dilutions of each sample are placed into individual wells of a
96-well plate to which are added 105 B-cells suspended in culture
medium (RPMI 1640 containing 10% FBS, 5.times.10-5M .beta.ME, 100
U/ml penicillin, 10 ug/ml streptomycin, and 10-5 dilution of SAC)
in a total volume of 150 ul. Proliferation or inhibition is
quantitated by a 20 h pulse (I uCi/well) with 3H-thymidine (6.7
Ci/mM) beginning 72 h post factor addition. The positive and
negative controls are IL2 and medium respectively.
[0969] In Vivo assay--BALB/c mice are injected (i.p.) twice per day
with buffer only, or 2 mg/Kg of TR13 and/or TR14 protein, or
truncated forms thereof. Mice receive this treatment for 4
consecutive days, at which time they are sacrificed and various
tissues and serum collected for analyses. Comparison of H&E
sections from normal and TR13 and/or TR14 protein-treated spleens
identify the results of the activity of TR13 and/or TR14 protein on
spleen cells, such as the diffusion of peri-arterial lymphatic
sheaths, and/or significant increases in the nucleated cellularity
of the red pulp regions, which may indicate the activation of the
differentiation and proliferation of B-cell populations.
Immunohistochemical studies using a B cell marker, anti-CD45R
(B220), are used to determine whether any physiological changes to
splenic cells, such as splenic disorganization, are due to
increased B-cell representation within loosely defined B-cell zones
that infiltrate established T-cell regions.
[0970] Flow cytometric analyses of the spleens from TR13 and/or
TR14 protein-treated mice is used to indicate whether TR13 and/or
TR14 protein specifically increases the proportion of ThB+, CD45R
(B220) dull B cells over that which is observed in control
mice.
[0971] Likewise, a predicted consequence of increased mature B-cell
representation in vivo is a relative increase in serum Ig titers.
Accordingly, serum IgM and IgA levels are compared between buffer
and TR13 and/or TR14 protein-treated mice.
[0972] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 16
[0973] T Cell Proliferation Assay
[0974] A CD3-induced proliferation assay is performed on PBMCs and
is measured by the uptake of .sup.3H-thymidine. The assay is
performed as follows. Ninety-six well plates are coated with 100
.mu.l/well of mAb to CD3 (HIT3a, Pharmingen) or isotype-matched
control mAb (B33.1) overnight at 4.degree. C. (1 .mu.g/ml in 0.05M
bicarbonate buffer, pH 9.5), then washed three times with PBS. PBMC
are isolated by F/H gradient centrifugation from human peripheral
blood and added to quadruplicate wells (5.times.10.sup.4/well) of
mAb coated plates in RPMI containing 10% FCS and P/S in the
presence of varying concentrations of TR13 and/or TR14 protein
(total volume 200 .mu.l). Relevant protein buffer and medium alone
are controls. After 48 hr. culture at 37.degree. C., plates are
spun for 2 min. at 1000 rpm and 100 .mu.l of supernatant is removed
and stored -20.degree. C. for measurement of IL-2 (or other
cytokines) if effect on proliferation is observed. Wells are
supplemented with 100 .mu.l of medium containing 0.5 .mu.Ci of
.sup.3H-thymidine and cultured at 37.degree. C. for 18-24 hr. Wells
are harvested and incorporation of .sup.3H-thymidine used as a
measure of proliferation. Anti-CD3 alone is the positive control
for proliferation. IL-2 (100 U/ml) is also used as a control which
enhances proliferation. Control antibody which does not induce
proliferation of T cells is used as the negative controls for the
effects of TR13 and/or TR14 proteins.
[0975] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 17
[0976] Effect of TR13 and/or TR14 on the Expression of MHC Class
II, Costimulatory and Adhesion Molecules and Cell Differentiation
of Monocytes and Monocyte-Derived Human Dendritic Cells
[0977] Dendritic cells are generated by the expansion of
proliferating precursors found in the peripheral blood: adherent
PBMC or elutriated monocytic fractions are cultured for 7-10 days
with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells
have the characteristic phenotype of immature cells (expression of
CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with
activating factors, such as TNF, causes a rapid change in surface
phenotype (increased expression of MHC class I and II,
costimulatory and adhesion molecules, downregulation of
FC.gamma.RII, upregulation of CD83). These changes correlate with
increased antigen-presenting capacity and with functional
maturation of the dendritic cells.
[0978] FACS analysis of surface antigens is performed as follows.
Cells are treated 1-3 days with increasing concentrations of TR13
and/or TR14 or LPS (positive control), washed with PBS containing
1% BSA and 0.02 mM sodium azide, and then incubated with 1:20
dilution of appropriate FITC- or PE-labeled monoclonal antibodies
for 30 minutes at 4.degree. C. After an additional wash, the
labeled cells are analyzed by flow cytometry on a FACScan (Becton
Dickinson).
[0979] Effect on the Production of Cytokines.
[0980] Cytokines generated by dendritic cells, in particular IL-12,
are important in the initiation of T-cell dependent immune
responses. IL-12 strongly influences the development of Th1 helper
T-cell immune response, and induces cytotoxic T and NK cell
function. An ELISA is used to measure the IL-12 release as follows.
Dendritic cells (10.sup.6/ml) are treated with increasing
concentrations of TR13 and/or TR14 for 24 hours. LPS (100 ng/ml) is
added to the cell culture as positive control. Supernatants from
the cell cultures are then collected and analyzed for IL-12 content
using commercial ELISA kit (e.g., R & D Systems (Minneapolis,
Minn.)). The standard protocols provided with the kits are
used.
[0981] Effect on the expression of MHC Class II, costimulatory and
adhesion molecules. Three major families of cell surface antigens
can be identified on monocytes: adhesion molecules, molecules
involved in antigen presentation, and Fc receptor. Modulation of
the expression of MHC class II antigens and other costimulatory
molecules, such as B7 and ICAM-1, may result in changes in the
antigen presenting capacity of monocytes and ability to induce T
cell activation. Increase expression of Fc receptors may correlate
with improved monocyte cytotoxic activity, cytokine release and
phagocytosis.
[0982] FACS analysis is used to examine the surface antigens as
follows. Monocytes are treated 1-5 days with increasing
concentrations of TR13 and/or TR14 or LPS (positive control),
washed with PBS containing 1% BSA and 0.02 mM sodium azide, and
then incubated with 1:20 dilution of appropriate FITC- or
PE-labeled monoclonal antibodies for 30 minutes at 4.degree. C.
After an additional wash, the labeled cells are analyzed by flow
cytometry on a FACScan (Becton Dickinson).
[0983] Monocyte Activation and/or Increased Survival
[0984] Assays for molecules that activate (or alternatively,
inactivate) monocytes and/or increase monocyte survival (or
alternatively, decrease monocyte survival) are known in the art and
may routinely be applied to determine whether a molecule of the
invention functions as an inhibitor or activator of monocytes. TR13
and/or TR14, agonists, or antagonists of TR13 and/or TR14 can be
screened using the three assays described below. For each of these
assays, Peripheral blood mononuclear cells (PBMC) are purified from
single donor leukopacks (American Red Cross, Baltimore, Md.) by
centrifugation through a Histopaque gradient (Sigma). Monocytes are
isolated from PBMC by counterflow centrifugal elutriation.
[0985] 1. Monocyte Survival Assay. Human peripheral blood monocytes
progressively lose viability when cultured in absence of serum or
other stimuli. Their death results from internally regulated
process (apoptosis). Addition to the culture of activating factors,
such as TNF-alpha dramatically improves cell survival and prevents
DNA fragmentation. Propidium iodide (PI) staining is used to
measure apoptosis as follows. Monocytes are cultured for 48 hours
in polypropylene tubes in serum-free medium (positive control), in
the presence of 100 ng/ml TNF-alpha (negative control), and in the
presence of varying concentrations of the compound to be tested.
Cells are suspended at a concentration of 2.times.10.sup.6/ml in
PBS containing PI at a final concentration of 5 .mu.g/ml, and then
incubated at room temperature for 5 minutes before FAC Scan
analysis. PI uptake has been demonstrated to correlate with DNA
fragmentation in this experimental paradigm.
[0986] 2. Effect on cytokine release. An important function of
monocytes/macrophages is their regulatory activity on other
cellular populations of the immune system through the release of
cytokines after stimulation. An ELISA to measure cytokine release
is performed as follows. Human monocytes are incubated at a density
of 5.times.10.sup.5 cells/ml with increasing concentrations of TR13
and/or TR14 and under the same conditions, but in the absence of
TR13 and/or TR14. For IL-12 production, the cells are primed
overnight with IFN-.quadrature. (100 U/ml) in presence of TR13
and/or TR14. LPS (10 ng/ml) is then added. Conditioned media are
collected after 24 h and kept frozen until use. Measurement of
TNF-.alpha., IL-10, MCP-1 and IL-8 is then performed using a
commercially available ELISA kit (e.g., R & D Systems
(Minneapolis, Minn.)) applying the standard protocols provided with
the kit.
[0987] 3. Oxidative burst. Purified monocytes are plated in 96-well
plate at 2-1.times.10.sup.5 cell/well. Increasing concentrations of
TR13 and/or TR14 are added to the wells in a total volume of 0.2 ml
culture medium (RPMI 1640+10% FCS, glutamine and antibiotics).
After 3 days incubation, the plates are centrifuged and the medium
is removed from the wells. To the macrophage monolayers, 0.2 ml per
well of phenol red solution (140 mM NaCl, 10 mM potassium phosphate
buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19 U/ml of
HRPO) is added, together with the stimulant (200 nM PMA). The
plates are incubated at 37.degree. C. for 2 hours and the reaction
is stopped by adding 20 .mu.l 1N NaOH per well. The absorbance is
read at 610 nm. To calculate the amount of H.sub.2O.sub.2 produced
by the macrophages, a standard curve of a H.sub.2O.sub.2 solution
of known molarity is performed for each experiment.
[0988] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 18
[0989] The Effect of TR13 and/or TR14 on the Growth of Vascular
Endothelial Cells
[0990] On day 1, human umbilical vein endothelial cells (HUVEC) are
seeded at 2-5.times.10.sup.4 cells/35 mm dish density in M199
medium containing 4% fetal bovine serum (FBS), 16 units/ml heparin,
and 50 units/ml endothelial cell growth supplements (ECGS,
Biotechnique, Inc.). On day 2, the medium is replaced with M199
containing 10% FBS, 8 units/ml heparin. TR13 of SEQ ID NO:2 and/or
TR14 protein preferably of SEQ ID NO:61 or, alternatively, SEQ ID
NO:5, respectively, and positive controls, such as VEGF and basic
FGF (bFGF) are added, at varying concentrations. On days 4 and 6,
the medium is replaced. On day 8, cell number is determined with a
Coulter Counter.
[0991] An increase in the number of HUVEC cells indicates that TR13
and/or TR14 may proliferate vascular endothelial cells.
[0992] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 19
[0993] Stimulatory Effect of TR13 and/or TR14 on the Proliferation
of Vascular Endothelial Cells
[0994] For evaluation of mitogenic activity of growth factors, the
colorimetric MTS
(3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-
-2-(4-sulfophenyl).sub.2H-tetrazolium) assay with the electron
coupling reagent PMS (phenazine methosulfate) was performed
(CellTiter 96 AQ, Promega). Cells are seeded in a 96-well plate
(5,000 cells/well) in 0.1 ml serum-supplemented medium and are
allowed to attach overnight. After serum-starvation for 12 hours in
0.5% FBS, conditions (bFGF, VEGF.sub.165 or TR13 and/or TR14 in
0.5% FBS) with or without Heparin (8 U/ml) are added to wells for
48 hours. 20 mg of MTS/PMS mixture (1:0.05) are added per well and
allowed to incubate for 1 hour at 37.degree. C. before measuring
the absorbance at 490 nm in an ELISA plate reader. Background
absorbance from control wells (some media, no cells) is subtracted,
and seven wells are performed in parallel for each condition. See,
Leak et al. In Vitro Cell. Dev. Biol. 30A:512-518 (1994).
[0995] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 20
[0996] Inhibition of PDGF-Induced Vascular Smooth Muscle Cell
Proliferation Stimulatory Effect
[0997] HAoSMC proliferation can be measured, for example, by BrdUrd
incorporation. Briefly, subconfluent, quiescent cells grown on the
4-chamber slides are transfected with CRP or FITC-labeled AT2-3LP.
Then, the cells are pulsed with 10% calf serum and 6 mg/ml BrdUrd.
After 24 h, immunocytochemistry is performed by using BrdUrd
Staining Kit (Zymed Laboratories). In brief, the cells are
incubated with the biotinylated mouse anti-BrdUrd antibody at
4.degree. C. for 2 h after exposing to denaturing solution and then
with the streptavidin-peroxidase and diaminobenzidine. After
counterstaining with hematoxylin, the cells are mounted for
microscopic examination, and the BrdUrd-positive cells are counted.
The BrdUrd index is calculated as a percent of the BrdUrd-positive
cells to the total cell number. In addition, the simultaneous
detection of the BrdUrd staining (nucleus) and the FITC uptake
(cytoplasm) is performed for individual cells by the concomitant
use of bright field illumination and dark field-UV fluorescent
illumination. See, Hayashida et al., J. Biol. Chem.
6:271(36):21985-21992 (1996).
[0998] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or
Example 21
[0999] Stimulation of Endothelial Migration
[1000] This example will be used to explore the possibility that
TR13 and/or TR14 may stimulate lymphatic endothelial cell
migration.
[1001] Endothelial cell migration assays are performed using a 48
well microchemotaxis chamber (Neuroprobe Inc., Cabin John, MD;
Falk, W., Goodwin, R. H. J., and Leonard, E. J. "A 48 well micro
chemotaxis assembly for rapid and accurate measurement of leukocyte
migration." J Immunological Methods 1980;33:239-247).
Polyvinylpyrrolidone-free polycarbonate filters with a pore size of
8 um (Nucleopore Corp. Cambridge, Mass.) are coated with 0.1%
gelatin for at least 6 hours at room temperature and dried under
sterile air. Test substances are diluted to appropriate
concentrations in M199 supplemented with 0.25% bovine serum albumin
(BSA), and 25 ul of the final dilution is placed in the lower
chamber of the modified Boyden apparatus. Subconfluent, early
passage (2-6) HUVEC or BMEC cultures are washed and trypsinized for
the minimum time required to achieve cell detachment. After placing
the filter between lower and upper chamber, 2.5.times.10.sup.5
cells suspended in 50 ul M199 containing 1% FBS are seeded in the
upper compartment. The apparatus is then incubated for 5 hours at
37.degree. C. in a humidified chamber with 5% CO.sub.2 to allow
cell migration. After the incubation period, the filter is removed
and the upper side of the filter with the non-migrated cells is
scraped with a rubber policeman. The filters are fixed with
methanol and stained with a Giemsa solution (Diff-Quick, Baxter,
McGraw Park Ill.). Migration is quantified by counting cells of
three random high-power fields (40.times.) in each well, and all
groups are performed in quadruplicate.
[1002] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 22
[1003] Stimulation of Nitric Oxide Production by Endothelial
Cells
[1004] Nitric oxide released by the vascular endothelium is
believed to be a mediator of vascular endothelium relaxation. Thus,
TR13 and/or TR14 activity can be assayed by determining nitric
oxide production by endothelial cells in response to TR13 and/or
TR14.
[1005] Nitric oxide is measured in 96-well plates of confluent
microvascular endothelial cells after 24 hours starvation and a
subsequent 4 hr exposure to various levels of a positive control
(such as VEGF-1) and TR13 and/or TR14. Nitric oxide in the medium
is determined by use of the Griess reagent to measure total nitrite
after reduction of nitric oxide-derived nitrate by nitrate
reductase. The effect of TR13 and/or TR14 on nitric oxide release
is examined on HUVEC.
[1006] Briefly, NO release from cultured HUVEC monolayer is
measured with a NO-specific polarographic electrode connected to a
NO meter (Iso-NO, World Precision Instruments Inc.).
[1007] Calibration of the NO element is performed according to the
following equation:
2 KNO.sub.2+2KI+2H.sub.2SO.sub.46 2 NO+I.sub.2+2H.sub.2O+2
K.sub.2SO.sub.4
[1008] The standard calibration curve is obtained by adding graded
concentrations of KNO.sub.2 (0, 5, 10, 25, 50, 100, 250, and 500
nmol/L) into the calibration solution containing KI and
H.sub.2SO.sub.4. The specificity of the Iso-NO electrode to NO is
previously determined by measurement of NO from authentic NO gas.
The culture medium is removed and HUVECs are washed twice with
Dulbecco's phosphate buffered saline. The cells are then bathed in
5 ml of filtered Krebs-Henseleit solution in 6-well plates, and the
cell plates are kept on a slide warmer (Lab Line Instruments Inc.)
to maintain the temperature at 37.degree. C. The NO sensor probe is
inserted vertically into the wells, keeping the tip of the
electrode 2 mm under the surface of the solution, before addition
of the different conditions. S-nitroso acetyl penicillamin (SNAP)
is used as a positive control. The amount of released NO is
expressed as picomoles per 1.times.10.sup.6 endothelial cells. All
values reported are means of four to six measurements in each group
(number of cell culture wells). See, Leak et al. Biochem. and
Biophys. Res. Comm. 217:96-105 (1995).
[1009] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 23
[1010] Effect of TR13 and/or TR14 on Cord Formation in
Angiogenesis
[1011] Another step in angiogenesis is cord formation, marked by
differentiation of endothelial cells. This bioassay measures the
ability of microvascular endothelial cells to form capillary-like
structures (hollow structures) when cultured in vitro.
[1012] CADMEC (microvascular endothelial cells) are purchased from
Cell Applications, Inc. as proliferating (passage 2) cells and are
cultured in Cell Applications' CADMEC Growth Medium and used at
passage 5. For the in vitro angiogenesis assay, the wells of a
48-well cell culture plate are coated with Cell Applications'
Attachment Factor Medium (200 .mu.l/well) for 30 min. at 37.degree.
C. CADMEC are seeded onto the coated wells at 7,500 cells/well and
cultured overnight in Growth Medium. The Growth Medium is then
replaced with 300 ug Cell Applications' Chord Formation Medium
containing control buffer or TR13 and/or TR14 (0.1 to 100 ng/ml)
and the cells are cultured for an additional 48 hr. The numbers and
lengths of the capillary-like chords are quantitated through use of
the Boeckeler VIA-170 video image analyzer. All assays are done in
triplicate.
[1013] Commercial (R&D) VEGF (50 ng/ml) is used as a positive
control. b-esteradiol (1 ng/ml) is used as a negative control. The
appropriate buffer (without protein) is also utilized as a
control.
[1014] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 24
[1015] Angiogenic Effect on Chick Clorioallantoic Membrane
[1016] Chick chorioallantoic membrane (CAM) is a well-established
system to examine angiogenesis. Blood vessel formation on CAM is
easily visible and quantifiable. The ability of TR13 and/or TR14 to
stimulate angiogenesis in CAM can be examined.
[1017] Fertilized eggs of the White Leghom chick (Gallus gallus)
and the Japanese quail (Coturnix coturnix) are incubated at
37.8.degree. C. and 80% humidity. Differentiated CAM of 16-day-old
chick and 13-day-old quail embryos is studied with the following
methods.
[1018] On Day 4 of development, a window is made into the egg shell
of chick eggs. The embryos are checked for normal development and
the eggs sealed with cellotape. They are further incubated until
Day 13. Thermanox coverslips (Nunc, Naperville, Ill.) are cut into
disks of about 5 mm in diameter. Sterile and salt-free growth
factors, and the protein to be tested, are dissolved in distilled
water and about 3.3 mg/5 ml are pipetted on the disks. After
air-drying, the inverted disks are applied on CAM. After 3 days,
the specimens are fixed in 3% glutaraldehyde and 2% formaldehyde
and rinsed in 0.12 M sodium cacodylate buffer. They are
photographed with a stereomicroscope [Wild M8] and embedded for
semi- and and ultrathin sectioning as described above. Controls are
performed with carrier disks alone.
[1019] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 25
[1020] Angiogenesis Assay Using a Matrigel Implant in Mouse
[1021] In order to establish an in vivo model for angiogenesis to
test TR13 and/or TR14 protein activities, mice and rats are
implanted subcutaneously with methylcellulose disks containing
either 20 mg of BSA (negative control), 1 mg of TR13 and/or TR14,
or 0.5 mg of VEGF-1 (positive control). The negative control disks
should contain little vascularization, while the positive control
disks should show signs of vessel formation.
[1022] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 26
[1023] Rescue of Ischemia in Rabbit Lower Limb Model
[1024] To study the in vivo effects of TR13 and/or TR14 on
ischemia, a rabbit hindlimb ischemia model is created by surgical
removal of one femoral arteries as described previously (Takeshita,
S. et al., Am J. Pathol 147:1649-1660 (1995)). The excision of the
femoral artery results in retrograde propagation of thrombus and
occlusion of the external iliac artery. Consequently, blood flow to
the ischemic limb is dependent upon collateral vessels originating
from the internal iliac artery (Takeshita, S. et al., Am J. Pathol
147:1649-1660 (1995)). An interval of 10 days is allowed for
post-operative recovery of rabbits and development of endogenous
collateral vessels. At 10 day post-operatively (day 0), after
performing a baseline angiogram, the internal iliac artery of the
ischemic limb is transfected with 500 mg naked TR13 and/or TR14
expression clone by arterial gene transfer technology using a
hydrogel-coated balloon catheter as described (Riessen, R. et al.,
Hum Gene Ther. 4:749-758 (1993); Leclerc, G. et al., J. Clin.
Invest. 90: 936-944 (1992)). When TR13 and/or TR14 is used in the
treatment, a single bolus of 500 mg TR13 and/or TR14 protein or
control is delivered into the internal iliac artery of the ischemic
limb over a period of 1 min. through an infusion catheter. On day
30, various parameters are measured in these rabbits: (a) BP
ratio--The blood pressure ratio of systolic pressure of the
ischemic limb to that of normal limb; (b) Blood Flow and Flow
Reserve--Resting FL: the blood flow during undilated condition and
Max FL: the blood flow during fully dilated condition (also an
indirect measure of the blood vessel amount) and Flow Reserve is
reflected by the ratio of max FL: resting FL; (c) Angiographic
Score--This is measured by the angiogram of collateral vessels. A
score is determined by the percentage of circles in an overlaying
grid that with crossing opacified arteries divided by the total
number m the rabbit thigh; (d) Capillary density--The number of
collateral capillaries determined in light microscopic sections
taken from hindlimbs.
[1025] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 27
[1026] Rat Ischemic Skin Flap Model
[1027] The evaluation parameters include skin blood flow, skin
temperature, and factor VIII immunohistochemistry or endothelial
alkaline phosphatase reaction. TR13 and/or TR14 expression, during
the skin ischemia, is studied using in situ hybridization.
[1028] The study in this model is divided into three parts as
follows:
[1029] Ischemic skin
[1030] Ischemic skin wounds
[1031] Normal wounds
[1032] The experimental protocol includes:
[1033] Raising a 3.times.4 cm, single pedicle full-thickness random
skin flap (myocutaneous flap over the lower back of the
animal).
[1034] An excisional wounding (4-6 mm in diameter) in the ischemic
skin (skin-flap).
[1035] Topical treatment with TR13 and/or TR14 of the excisional
wounds (day 0, 1, 2, 3, 4 post-wounding) at the following various
dosage ranges: 1 mg to 100 mg.
[1036] Harvesting the wound tissues at day 3, 5, 7, 10, 14 and 21
post-wounding for histological, immunohistochemical, and in situ
studies.
[1037] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 28
[1038] Peripheral Arterial Disease Model
[1039] Angiogenic therapy using TR13 and/or TR14 is a novel
therapeutic strategy to obtain restoration of blood flow around the
ischemia in case of peripheral arterial diseases. The experimental
protocol includes:
[1040] One side of the femoral artery is ligated to create ischemic
muscle of the hindlimb, the other side of hindlimb serves as a
control.
[1041] TR13 and/or TR14 protein, in a dosage range of 20 mg-500 mg,
is delivered intravenously and/or intramuscularly 3 times (perhaps
more) per week for 2-3 weeks.
[1042] The ischemic muscle tissue is collected after ligation of
the femoral artery at 1,2, and 3 weeks for the analysis of TR13
and/or TR14 expression and histology. Biopsy is also performed on
the other side of normal muscle of the contralateral hindlimb.
[1043] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 29
[1044] Ischemic Myocardial Disease Model
[1045] TR13 and/or TR14 is evaluated as a potent mitogen capable of
stimulating the development of collateral vessels, and
restructuring new vessels after coronary artery occlusion.
Alteration of TR13 and/or TR14 expression is investigated in situ.
The experimental protocol includes:
[1046] The heart is exposed through a left-side thoracotomy in the
rat. Immediately, the left coronary artery is occluded with a thin
suture (6-0) and the thorax is closed.
[1047] TR13 and/or TR14 protein, in a dosage range of 20 mg-500 mg,
is delivered intravenously and/or intramuscularly 3 times (perhaps
more) per week for 2-4 weeks.
[1048] Thirty days after the surgery, the heart is removed and
cross-sectioned for morphometric and in situ analyzes.
[1049] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 30
[1050] Rat Corneal Wound Healing Model
[1051] This animal model shows the effect of TR13 and/or TR14 on
neovascularization. The experimental protocol includes:
[1052] Making a 1-1.5 mm long incision from the center of cornea
into the stromal layer.
[1053] Inserting a spatula below the lip of the incision facing the
outer corner of the eye.
[1054] Making a pocket (its base is 1-1.5 mm form the edge of the
eye).
[1055] Positioning a pellet, containing 50 ng-5 ug of TR13 and/or
TR14, within the pocket.
[1056] TR13 and/or TR14 treatment can also be applied topically to
the corneal wounds in a dosage range of 20 mg-500 mg (daily
treatment for five days).
[1057] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 31
[1058] Diabetic Mouse and Glucocorticoid-Impaired Wound Healing
Models
[1059] Diabetic db+/db+ Mouse Model
[1060] To demonstrate that TR13 and/or TR14 accelerates the healing
process, the genetically diabetic mouse model of wound healing is
used. The full thickness wound healing model in the db+/db+ mouse
is a well characterized, clinically relevant and reproducible model
of impaired wound healing. Healing of the diabetic wound is
dependent on formation of granulation tissue and
re-epithelialization rather than contraction (Gartner, M. H. et
al., J. Surg. Res. 52:389 (1992); Greenhalgh, D. G. et al., Am. J.
Pathol. 136:1235 (1990)).
[1061] The diabetic animals have many of the characteristic
features observed in Type II diabetes mellitus. Homozygous
(db+/db+) mice are obese in comparison to their normal heterozygous
(db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single
autosomal recessive mutation on chromosome 4 (db+) (Coleman et al.
Proc. Natl. Acad. Sci. USA 77:283-293 (1982)). Animals show
polyphagia, polydipsia and polyuria. Mutant diabetic mice (db+/db+)
have elevated blood glucose, increased or normal insulin levels,
and suppressed cell-mediated immunity (Mandel et al., J. Immunol.
120:1375 (1978); Debray-Sachs, M. et al., Clin. Exp. Immunol.
51(1):1-7 (1983); Leiter et al, Am. J. of Pathol. 114:46-55
(1985)). Peripheral neuropathy, myocardial complications, and
microvascular lesions, basement membrane thickening and glomerular
filtration abnormalities have been described in these animals
(Norido, F. et al., Exp. Neurol. 83(2):221-232 (1984); Robertson et
al., Diabetes 29(1):60-67 (1980); Giacomelli et al., Lab Invest.
40(4):460-473 (1979); Coleman, D. L., Diabetes 31 (Suppl):1-6
(1982)). These homozygous diabetic mice develop hyperglycemia that
is resistant to insulin analogous to human type II diabetes (Mandel
et al., J. Immunol. 120:1375-1377 (1978)).
[1062] The characteristics observed in these animals suggests that
healing in this model may be similar to the healing observed in
human diabetes (Greenhalgh, et al., Am. J. of Pathol. 136:1235-1246
(1990)).
[1063] Genetically diabetic female C57BL/KsJ (db+/db+) mice and
their non-diabetic (db+/+m) heterozygous littermates are used in
this study (Jackson Laboratories). The animals are purchased at 6
weeks of age and were 8 weeks old at the beginning of the study.
Animals are individually housed and received food and water ad
libitum. All manipulations are performed using aseptic techniques.
The experiments are conducted according to the rules and guidelines
of Human Genome Sciences, Inc. Institutional Animal Care and Use
Committee and the Guidelines for the Care and Use of Laboratory
Animals.
[1064] Wounding protocol is performed according to previously
reported methods (Tsuboi, R. and Rifkin, D. B., J. Exp. Med.
172:245-251 (1990)). Briefly, on the day of wounding, animals are
anesthetized with an intraperitoneal injection of Avertin (0.01
mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in
deionized water. The dorsal region of the animal is shaved and the
skin washed with 70% ethanol solution and iodine. The surgical area
is dried with sterile gauze prior to wounding. An 8 mm
full-thickness wound is then created using a Keyes tissue punch.
Immediately following wounding, the surrounding skin is gently
stretched to eliminate wound expansion. The wounds are left open
for the duration of the experiment. Application of the treatment is
given topically for 5 consecutive days commencing on the day of
wounding. Prior to treatment, wounds are gently cleansed with
sterile saline and gauze sponges.
[1065] Wounds are visually examined and photographed at a fixed
distance at the day of surgery and at two day intervals thereafter.
Wound closure is determined by daily measurement on days 1-5 and on
day 8. Wounds are measured horizontally and vertically using a
calibrated Jamerson caliper. Wounds are considered healed if
granulation tissue is no longer visible and the wound is covered by
a continuous epithelium.
[1066] TR13 and/or TR14 is administered using at a range different
doses of TR13 and/or TR14, from 4 mg to 500 mg per wound per day
for 8 days in vehicle. Vehicle control groups received 50 mL of
vehicle solution.
[1067] Animals are euthanized on day 8 with an intraperitoneal
injection of sodium pentobarbital (300 mg/kg). The wounds and
surrounding skin are then harvested for histology and
immunohistochemistry. Tissue specimens are placed in 10% neutral
buffered formalin in tissue cassettes between biopsy sponges for
further processing.
[1068] Three groups of 10 animals each (5 diabetic and 5
non-diabetic controls) are evaluated: 1) Vehicle placebo control,
2) TR13 and/or TR14.
[1069] Wound closure is analyzed by measuring the area in the
vertical and horizontal axis and obtaining the total square area of
the wound. Contraction is then estimated by establishing the
differences between the initial wound area (day 0) and that of post
treatment (day 8). The wound area on day 1 was 64 mm.sup.2, the
corresponding size of the dermal punch. Calculations were made
using the following formula:
[Open area on day 8]-[Open area on day 1]/[Open area on day 1]
[1070] Specimens are fixed in 10% buffered formalin and paraffin
embedded blocks are sectioned perpendicular to the wound surface (5
mm) and cut using a Reichert-Jung microtome. Routine
hematoxylin-eosin (H&E) staining is performed on cross-sections
of bisected wounds. Histologic examination of the wounds are used
to assess whether the healing process and the morphologic
appearance of the repaired skin is altered by treatment with TR13
and/or TR14. This assessment included verification of the presence
of cell accumulation, inflammatory cells, capillaries, fibroblasts,
re-epithelialization and epidermal maturity (Greenhalgh, D. G. et
al., Am. J. Pathol. 136:1235 (1990)). A calibrated lens micrometer
is used by a blinded observer.
[1071] Tissue sections are also stained immunohistochemically with
a polyclonal rabbit anti-human keratin antibody using ABC Elite
detection system. Human skin is used as a positive tissue control
while non-immune IgG is used as a negative control. Keratinocyte
growth is determined by evaluating the extent of
reepithelialization of the wound using a calibrated lens
micrometer.
[1072] Proliferating cell nuclear antigen/cyclin (PCNA) in skin
specimens is demonstrated by using anti-PCNA antibody (1:50) with
an ABC Elite detection system. Human colon cancer served as a
positive tissue control and human brain tissue is used as a
negative tissue control. Each specimen included a section with
omission of the primary antibody and substitution with non-immune
mouse IgG. Ranking of these sections is based on the extent of
proliferation on a scale of 0-8, the lower side of the scale
reflecting slight proliferation to the higher side reflecting
intense proliferation.
[1073] Experimental data are analyzed using an unpaired t test. A p
value of <0.05 is considered significant.
[1074] Steroid Impaired Rat Model
[1075] The inhibition of wound healing by steroids has been well
documented in various in vitro and in vivo systems (Wahl, S. M.
Glucocorticoids and Wound healing. In: Anti-Inflammatory Steroid
Action: Basic and Clinical Aspects. 280-302 (1989); Wahl, S. M. et
al., J. Immunol. 115: 476-481 (1975); Werb, Z. et al., J. Exp. Med.
147:1684-1694 (1978)). Glucocorticoids retard wound healing by
inhibiting angiogenesis, decreasing vascular permeability (Ebert,
R. H., et al., An. Intern. Med. 37:701-705 (1952)), fibroblast
proliferation, and collagen synthesis (Beck, L. S. et al., Growth
Factors. 5: 295-304 (1991); Haynes, B. F. et al., J. Clin. Invest.
61: 703-797 (1978)) and producing a transient reduction of
circulating monocytes (Haynes, B. F., et al., J. Clin. Invest. 61:
703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing",
In: Antiinflammatory Steroid Action: Basic and Clinical Aspects,
Academic Press, New York, pp. 280-302 (1989)). The systemic
administration of steroids to impaired wound healing is a well
establish phenomenon in rats (Beck, L. S. et al., Growth Factors.
5: 295-304 (1991); Haynes, B. F., et al., J. Clin. Invest. 61:
703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing",
In: Antiinflammatory Steroid Action: Basic and Clinical Aspects,
Academic Press, New York, pp. 280-302 (1989); Pierce, G. F. et al.,
Proc. Natl. Acad. Sci. USA 86: 2229-2233 (1989)).
[1076] To demonstrate that TR13 and/or TR14 can accelerate the
healing process, the effects of multiple topical applications of
TR13 and/or TR14 on full thickness excisional skin wounds in rats
in which healing has been impaired by the systemic administration
of methylprednisolone is assessed.
[1077] Young adult male Sprague Dawley rats weighing 250-300 g
(Charles River Laboratories) are used in this example. The animals
are purchased at 8 weeks of age and were 9 weeks old at the
beginning of the study. The healing response of rats is impaired by
the systemic administration of methylprednisolone (17 mg/kg/rat
intramuscularly) at the time of wounding. Animals are individually
housed and received food and water ad libitum. All manipulations
are performed using aseptic techniques. This study is conducted
according to the rules and guidelines of Human Genome Sciences,
Inc. Institutional Animal Care and Use Committee and the Guidelines
for the Care and Use of Laboratory Animals.
[1078] The wounding protocol is followed according to section A,
above. On the day of wounding, animals are anesthetized with an
intramuscular injection of ketamine (50 mg/kg) and xylazine (5
mg/kg). The dorsal region of the animal is shaved and the skin
washed with 70% ethanol and iodine solutions. The surgical area is
dried with sterile gauze prior to wounding. An 8 mm full-thickness
wound is created using a Keyes tissue punch. The wounds are left
open for the duration of the experiment. Applications of the
testing materials are given topically once a day for 7 consecutive
days commencing on the day of wounding and subsequent to
methylprednisolone administration. Prior to treatment, wounds are
gently cleansed with sterile saline and gauze sponges.
[1079] Wounds are visually examined and photographed at a fixed
distance at the day of wounding and at the end of treatment. Wound
closure is determined by daily measurement on days 1-5 and on day
8. Wounds are measured horizontally and vertically using a
calibrated Jameson caliper. Wounds are considered healed if
granulation tissue was no longer visible and the wound is covered
by a continuous epithelium.
[1080] TR13 and/or TR14 is administered using at a range different
doses of TR13 and/or TR14, from 4 mg to 500 mg per wound per day
for 8 days in vehicle. Vehicle control groups received 50 mL of
vehicle solution.
[1081] Animals are euthanized on day 8 with an intraperitoneal
injection of sodium pentobarbital (300 mg/kg). The wounds and
surrounding skin are then harvested for histology. Tissue specimens
are placed in 10% neutral buffered formalin in tissue cassettes
between biopsy sponges for further processing.
[1082] Four groups of 10 animals each (5 with methylprednisolone
and 5 without glucocorticoid) were evaluated: 1) Untreated group 2)
Vehicle placebo control 3) TR13 and/or TR14 treated groups.
[1083] Wound closure is analyzed by measuring the area in the
vertical and horizontal axis and obtaining the total area of the
wound. Closure is then extimated by establishing the differences
between the initial wound area (day 0) and that of post treatment
(day 8). The wound area on day 1 was 64 mm2, the corresponding size
of the dermal punch. Calculations were made using the following
formula:
[Open area on day 8]-[Open area on day 1]/[Open area on day 1]
[1084] Specimens are fixed in 10% buffered formalin and paraffin
embedded blocks are sectioned perpendicular to the wound surface (5
mm) and cut using an Olympus microtome. Routine hematoxylin-eosin
(H&E) staining is performed on cross-sections of bisected
wounds. Histologic examination of the wounds allows assessment of
whether the healing process and the morphologic appearance of the
repaired skin was improved by treatment with TR13 and/or TR14. A
calibrated lens micrometer is used by a blinded observer to
determine the distance of the wound gap.
[1085] Experimental data are analyzed using an unpaired t test. A p
value of <0.05 is considered significant.
[1086] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 32
[1087] Lymphadema Animal Model
[1088] The purpose of this experimental approach is to create an
appropriate and consistent lymphedema model for testing the
therapeutic effects of TR13 and/or TR14 in lymphangiogenesis and
re-establishment of the lymphatic circulatory system in the rat
hind limb. Effectiveness is measured by swelling volume of the
affected limb, quantification of the amount of lymphatic
vasculature, total blood plasma protein, and histopathology. Acute
lymphedema is observed for 7-10 days. Perhaps more importantly, the
chronic progress of the edema is followed for up to 3-4 weeks.
[1089] Prior to beginning surgery, blood sample is drawn for
protein concentration analysis. Male rats weighing approximately
.about.350 g are dosed with Pentobarbital. Subsequently, the right
legs are shaved from knee to hip. The shaved area is swabbed with
gauze soaked in 70% EtOH. Blood is drawn for serum total protein
testing. Circumference and volumetric measurements are made prior
to injecting dye into paws after marking 2 measurement levels (0.5
cm above heel, at mid-pt of dorsal paw). The intradermal dorsum of
both right and left paws are injected with 0.05 ml of 1% Evan's
Blue. Circumference and volumetric measurements are then made
following injection of dye into paws.
[1090] Using the knee joint as a landmark, a mid-leg inguinal
incision is made circumferentially allowing the femoral vessels to
be located. Forceps and hemostats are used to dissect and separate
the skin flaps. After locating the femoral vessels, the lymphatic
vessel that runs along side and underneath the vessel(s) is
located. The main lymphatic vessels in this area are then
electrically coagulated or suture ligated.
[1091] Using a microscope, muscles in back of the leg (near the
semitendinosis and adductors) are bluntly dissected. The popliteal
lymph node is then located.
[1092] The 2 proximal and 2 distal lymphatic vessels and distal
blood supply of the popliteal node are then and ligated by
suturing. The popliteal lymph node, and any accompanying adipose
tissue, is then removed by cutting connective tissues.
[1093] Care is taken to control any mild bleeding resulting from
this procedure. After lymphatics are occluded, the skin flaps are
sealed by using liquid skin (Vetbond) (AJ Buck). The separated skin
edges are sealed to the underlying muscle tissue while leaving a
gap of .about.0.5 cm around the leg. Skin also may be anchored by
suturing to underlying muscle when necessary.
[1094] To avoid infection, animals are housed individually with
mesh (no bedding). Recovering animals are checked daily through the
optimal edematous peak, which typically occurred by day 5-7. The
plateau edematous peak are then observed. To evaluate the intensity
of the lymphedema, the circumference and volumes of 2 designated
places on each paw before operation and daily for 7 days are
measured. The effect plasma proteins on lymphedema is determined
and whether protein analysis is a useful testing perimeter is also
investigated. The weights of both control and edematous limbs are
evaluated at 2 places. Analysis is performed in a blind manner.
[1095] Circumference Measurements: Under brief gas anesthetic to
prevent limb movement, a cloth tape is used to measure limb
circumference. Measurements are done at the ankle bone and dorsal
paw by 2 different people then those 2 readings are averaged.
Readings are taken from both control and edematous limbs.
[1096] Volumetric Measurements: On the day of surgery, animals are
anesthetized with Pentobarbital and are tested prior to surgery.
For daily volumetrics animals are under brief halothane anesthetic
(rapid immobilization and quick recovery), both legs are shaved and
equally marked using waterproof marker on legs. Legs are first
dipped in water, then dipped into instrument to each marked level
then measured by Buxco edema software (ChenNictor). Data is
recorded by one person, while the other is dipping the limb to
marked area.
[1097] Blood-plasma protein measurements: Blood is drawn, spun, and
serum separated prior to surgery and then at conclusion for total
protein and Ca2+ comparison.
[1098] Limb Weight Comparison: After drawing blood, the animal is
prepared for tissue collection. The limbs were amputated using a
quillitine, then both experimental and control legs were cut at the
ligature and weighed. A second weighing is done as the
tibio-cacaneal joint was disarticulated and the foot was
weighed.
[1099] Histological Preparations: The transverse muscle located
behind the knee (popliteal) area is dissected and arranged in a
metal mold, filled with freezegel, dipped into cold methylbutane,
placed into labeled sample bags at -80EC until sectioning. Upon
sectioning, the muscle was observed under fluorescent microscopy
for lymphatics. Other immuno/histological methods are currently
being evaluated.
[1100] The studies described in this example test the activity in
TR13 and/or TR14 protein. However, one skilled in the art could
easily modify the exemplified studies to test the activity of TR13
and/or TR14 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TR13 and/or TR14.
Example 33
[1101] Assay for TR13 and/or TR14 Inhibition of B Cell
Proliferation in an In Vitro Co-Stimulatory Assay
[1102] This example provides a co-stimulatory assay using
Staphylococcus Aureus Cowan I (SAC) as priming agent and
Neutrokine-alpha (International Application Publication No. WO
98/18921) or IL-2 as a second signal to assay for TR13 and/or TR14
polypeptide antagonists of Neutrokine-alpha (or IL-2) mediated B
cell proliferation.
[1103] A soluble TR13 or TR14 polypeptide is prepared (e.g., a
soluble form of TR13 or TR14 corresponding to a portion of the TR13
or TR14 extracellular domain linked to the Fc portion of a human
IgG1 immunogloulin molecule). The ability of this protein to alter
the proliferative response of human B cells is assessed in a
standard co-stimulatory assay. Briefly, human tonsillar B cells are
purified by magnetic bead (MACS) depletion of CD3-positive cells.
The resulting cell population is routinely greater than 95% B cells
as assessed by expression of CD19 and CD20 staining. Various
dilutions of rHuNeutrokine-alpha (Internatioanl Application
Publication No. WO 98/18921) or rHuIL2 are placed into individual
wells of a 96-well plate to which is added 105 B cells suspended in
culture medium (RPMI 1640 containing 10% FBS, 5.times.10-5 M 2ME,
100 U/ml penicillin, 10 ug/ml streptomycin, and 10-5 dilution of
formalin-fixed Staphylococcus aureus Cowan I (SAC) also known as
Pansorbin (Pan)) in a total volume of 150 ul. The TR13 or TR14
polypeptide is then added at various concentrations and the plates
are placed in the incubator (37.degree. C. 5% CO.sub.2, 95%
humidity) for three days. Proliferation is quantitated by a 20 h
pulse (1 .mu.Ci/well) of 3H-thymidine (6.7 Ci/mM) beginning 72 h
post factor addition. The positive and negative controls are SAC
exposed B cells with rHuNeutrokine-alpha (or rHuIL2) and medium (in
the absence of the TR13 or TR14 polypeptide), respectively.
[1104] Antagonists of rHuNeutrokine-alpha (or rHuIL2) mediated B
cell proliferation demonstrate a reduced level of B cell
proliferation in the samples containing the TR13 or TR14
polypeptides when compared to the positive control.
Example 34
[1105] Demonstration that TR13 Binds Fas Ligand
[1106] Fas (CD95/Apol) and Fas ligand (FasL/CD9SL), area pair of
pro-apoptotic mediators of the TNF receptor and ligand family that
induce apoptosis upon receptor/ligand engagement. Fas/FasL-mediated
apoptosis is a normal and important homeostatic mechanism useful in
the down-regulation of hyper-immune responses and the deletion of
activated lymphocytes. Fas/FasL-induced apoptosis is also important
in host protection and surveillance, preventing damage to immune
privileged sites, and eliminating virus-infected or transformed
cells. While necessary for normal physiological processes,
unregulated apoptosis mediated by the Fas/FasL system is implicated
in organ-specific tissue injury both in experimental animal models
and several human disease states.
[1107] To determine the ability of TR13 to bind Fas ligand,
co-transfection experiments were performed. Cells (that do not
express endogenous TR13) were either transfected with expression
vectors containing the TR13 receptor or a soluble form of
flag-tagged Fas ligand, APRIL, or Neutrokine-alpha (ligand vectors)
or cotransfected with TR13 vector and a ligand vector. FACS
analysis, using fluorochrome labelled anti-FLAG antibody (using
streptavidin-PE as a secondary reagent to detect the anti-FLAG
antibody) and propidium iodide staining, was used to evaluate the
ability of the recombinantly expressed TR13 receptor to bind
flag-tagged Fas ligand, APRIL, or Neutrokine-alpha and to evaluate
the viability of the cells.
[1108] Untreated control cells or control cells that were
transfected with ligand vectors alone did not stain with anti-FLAG
antibody and showed minimal cell death by propidium iodide
staining. Cells that were cotransfected with TR13 and APRIL or
Neutrokine-alpha expression vectors also did not stain with
anti-FLAG antibody but propidium iodide staining showed increased
cell death. These results indicate that TR13 does not bind either
APRIL or Neutrokine-alpha and that expression of TR13 induce cell
death. Control cotransfection experiments using the Neutrokine
alpha/APRIL receptor, TACI, instead of TR13, and Neutrokine-alpha
or APRIL expression vectors did however, show staining with the
anti-FLAG antibody and minmal cell death. Cells that were
cotransfected with TR13 and Fas ligand expression vectors did stain
with anti-FLAG antibody indicating that TR13 binds Fas Ligand. In
addition, cells cotransfected with TR13 and Fas ligand expression
vectors showed the greatest amount of cell death, indicating that
Fas ligand/TR13 interactions induce cell death.
[1109] Thus, in accordance with the invention, agonists that bind
TR13, incluidng anti-TR13 antibodies and antibody fragments and
peptides, can be used to selectively kill cells expressing TR13,
inlcuding cancer cells.
Example 35
[1110] In Vitro and In Vivo Inhibition of FasL Mediated Killing by
TR13
[1111] This example describes the synthesis and biological activity
of a fusion protein that can be produced using the full length
coding region of TR13 (or fragment or variant thereof such as amino
acids 1 to 906 of SEQ ID NO:40) and an Fc domain of IgG1.
Biochemical and biological characterization of this TR13-Fc may be
used to determine the ability of TR13-Fc to bind FasL and thereby
inhibit apoptosis in-vitro. TR13-Fc may also be used to assess the
ability of a soluble form of TR13 to block the mortality associated
with iv injection of cross-linked FasL into Fas+ mice. Results from
these such experiments would determine the therapeutic potential of
TR13-Fc in diseases where Fas/FasL is implicated in mediating organ
damage.
[1112] Methods of Example 35
[1113] Animals
[1114] Female Balb/c mice (20-25 g) may be obtained from Charles
River Laboratories (Raleigh, N.C.). Female MLR/Ipr mice (30-35 g)
may be obtained from Jackson Laboratories (Bar Harbor, Me.). Mice
are generally housed five per cage, and kept under standard
conditions for one week before being used in experiments. The
animals are maintained according to National Research Council
standards for the care and use of laboratory animals.
[1115] Human TRJ3-Fc, TR13-non Fc and Fas-Fc Expression vectors
[1116] Cells infected with baculovirus clone encoding the TR13-Fc
fusion protein (e.g., pA2Fc:TR13 (M1-D906)), are grown in media
containing 1% ultra low IgG serum. Conditioned culture supernatant
(20 L) is adjusted to pH 7.0, filtered through 0.22 micron filter
and loaded on a Protein A column (BioSepra Ceramic HyperD)
previously conditioned with 20 mM phosphate buffer with 0.5 M NaCl,
pH7.2. The column is washed with 15 CV of 20 mM phosphate buffer
containing 0.5 M NaCl, pH 7.2, and followed by 5 CV of 0.1 M citric
acid (pH 5.0). TR13-Fc is eluted with 0.1 M citric acid (pH
2.4)/20% glycerol, and fractions are neutralized with 1M Tris-HCl,
pH 9.2. The human TR13-Fc positive fractions are determined by
SDS-PAGE. The peak fractions are pooled and concentrated using an
Amicon concentrator. The TR13-Fc concentrate is then loaded onto a
Superdex 200 column containing PBS containing 0.5 M NaCl
(Pharmacia) and TR13-Fc positive fractions are determined by
non-reducing SDS-PAGE. The TR13-Fc positive fractions eluting as
disulfide-linked dimers are pooled and further concentrated with
CentriPlus 10K cutoff spin concentrators.
[1117] The TR13-Fc protein bound to the Protein A resin may contain
both disulfide-linked Fc dimers and higher disulfide-linked
aggregates. Aggregates may be removed by Superdex 200
size-exclusion chromatography. The yield for TR13-Fc can be
determined using Reverse-Phase HPLC assay and N-terminal sequence
assay. Due to processing of the signal sequence, The N terminus is
predicted to be Thr-42. The biological activity of pure TR13
protein may be assessed using, for example, BIAcore analysis to
determine the properties of the interaction of TR13-Fc with Fas
ligand.
[1118] To confirm purity, TR13-Fc protein may be blotted to a
ProBlott membrane cartridge (PE Biosystems, Inc). After staining
with Ponceau S (0.2% in 4% acetic acid), the membrane is placed in
a "Blot Cartridge", and subjected to N-terminal amino acid sequence
analysis using a model ABI-494 sequencer (PE Biosystems, Inc.) and
the Gas-phase Blot cycles. Proteins are then subjected to
reverse-phase HPLC (Beckmann) analysis to access purity.
[1119] A human Fas(M1-G169)-Fc fusion protein was purified from CHO
conditioned media by capture on a Poros 50 Protein A affinity
column with elution at 0.1M citrate pH 2.0 as described for
TR13-Fc. Further purification was effected by size separation on a
Superdex-200 gel filtration resin in PBS/glycerol. N-terminal
sequence of Fas-Fc was blocked and protein identity was confirmed
post digestion with pyroglutamate aminopeptidase to deblock the
N-terminus and 16% SDS-PAGE, respectively. The protein behaved as
disulfide linked dimer as expected for a Fc fusion protein.
[1120] BIAcore Chip Preparation and Analysis
[1121] BIAcore chip technology provides the opportunity to identify
and characterize ligands that bind to a given receptor, in this
case TR13. The protein ligand can be immobilized and challenged
with TR13 to calculate relative binding units (RU). Conversely, the
TR13 receptor can be immobilized and exposed to various ligands to
identify proteins with an affinity for the TR13 receptor.
[1122] The extra-cellular portion of FasL (Oncogene Research
Products), amino acids 103-281, are dialyzed against 10 mM sodium
acetate buffer, pH 5 and a BIAcore flow cell prepared. TR13-Fc and
Fas-Fc fusion proteins are analyzed at 5 ug/mL in 50 uL HBS buffer
and are injected onto the FasL chip at a flow rate of 15 ul per
minute. After injection of the sample the flow cell is equilibrated
with HBS and the amount of net bound protein is determined.
[1123] In Vitro Soluble Human FasL Mediated Cytotoxicity
[1124] The HT-29 cell line, a human colon adenocarcinoma cell line
obtained from the ATCC (code ATCC HTB-38) is sensitive to FasL
mediated cytotoxicity, presumably through activation of its Fas
receptor. HT-29 cells may be grown in D-MEM/10% FBS/2 mM
Glutamine/pen/strep. To measure FLAG-FasL induced cytotoxicity,
target cells are trypsinized, washed and plated in a 96-well plate
at 50,000 cells/well. HT-29 cells are treated with cross-linked
FLAG-FasL+FLAG antibody (1 ng/ml), or with cross-linked FLAG-FasL
in combination with Fas-Fc, or TR13-Fc. Although uncross-linked
FasL can induce cytotoxity in this assay, antibody cross-linking of
FasL via its FLAG domain significantly enhances the ability of FasL
to mediate apoptosis, and thus the FLAG antibody is included. The
final volume in each well is 200 ul. After 5 days of culture, the
plate is harvested and 20 ul of Alamar Blue reagent added. To
assess final viability, cells are incubated for four hours and the
plate analyzed in a CytoFluor fluorescence plate reader with
excitation of 530 nm and emission of 590 nm. The Jurkat human T
cell line, which also expresses the Fas receptor, and is sensitive
to FasL, may also be tested in an in vitro cytotoxicity assay
similar to that used on HT-29 cells.
[1125] Additionally, Jurkat cells may be evaluated by FACS analysis
in an apoptosis assay. Jurkat cells (RPMI+5% serum) seeded at
50,000 cells per well are treated with FLAG-FasL and anti-FLAG
mouse monoclonal antibody (200 ng/ml) and incubated at 37 C for 16
hrs to induce apoptosis. When TR13-Fc or Fas-Fc is included in the
assay, the Fc protein was pre-incubated with FasL and anti-FLAG
antibody for 15 mins. To determine the degree of apoptosis, cells
are harvested, stained with annexin and propidium iodide and
evaluated using FACS analysis.
[1126] In Vitro Membrane Bound Murine FasL Mediated
Cytotoxicity
[1127] To analyze the in vitro killing of Fas.sup.+ target cells by
murine FasL, murine effector L929 cells (2.5.times.10.sup.5
cells/well) are transfected with murine FasL and incubated with
Fas.sup.+ murine A20 target cells (5.times.10.sup.3 cells/well)
labeled with Eu DTPA. After an 18 hour incubation at an
effector:target cell ratio of 50: 1, cells are centrifuged, and %
release of Eu DTPA is quantified as a measure of cell death.
[1128] In Vivo Cross-Linked FLAG-FasL Induced Mortality
[1129] Soluble human FLAG-FasL was synthesized at HGS. To induce
cross-linking of Fas receptors, FasL is incubated with FLAG
antibody (Sigma, St Louis, Mo.) and injected iv into mice following
a variation of the procedure used by Schneider et al (J. Exp. Med.,
187:1205-13 and Methods Enzymol. 322:32545). Fc-fusion proteins may
be injected iv or sc at various time points prior to FasL
injection, and mortality recorded over time. Liver samples one
centimeter square, are fixed in 10% neutral buffered formalin for
24 hours, then transferred to 70 percent methanol until time for
embedding in paraffin. Sections are stained with H&E, and
evaluated histologically. Blood may be drawn from the heart and
used in the measurement of serum alanine (ALT) and aspartate (AST)
aminotransferase levels. To control that the mortality of mice is
indeed a result of crosslinking of the Fas receptor in these mice,
the same experiments may be performed on MRL/Ipr mice whose Fas
receptor is non-functional, thus crosslinking of the Fas receptor
should not idnduce mortality in these mice.
Example 36
[1130] Modulation of T Cell Responses by TR13: Ability of Soluble
TR13 to Inhibit Alloactivation and Heart Allograft Rejection
[1131] The ability of TR13 to interact with AIM-II (LIGHT)
(International application publication number WO 97/34911,
published Sep. 25, 1997) and the role of TR13 in modulating T cell
activities and immunological responses that may be associated with
AIM-II may be analyzed according to the experiments detailed
below.
[1132] Materials and Methods of Example 36
[1133] Mice
[1134] Twelve week-old female C57BL/6 (B6, H-2.sup.b), BALB/c, and
BALB/c.times.C57BU6 F1 (H-2.sup.bXd) mice may be obtained from
Jackson Laboratory (Bar Harbor, Me.) or Charles River (LaSalle,
Quebec, Canada). 2C TCR transgenic mice are bred in an animal
facility as described in Chen, H., et al., 1996. J. Immunol
157:4297, which is hereby incorporated by reference in its
entirety.
[1135] Expression and Purification of the Human TR13-Fc Fusion
Protein
[1136] Full-length human TR13 cDNA or a fragment or variant thereof
(e.g., a polynucletide encoding amino acids 1 to 906 of SEQ ID
NO:40) is fused to the sequence coding for the Fc domain of human
IgG, and subcloned into a baculovirus expression vector pA2. The
construct is designated pA2-Fc:TR13. Sf9 cells infected pA2-Fc:TR13
may be grown in media (100 L) containing 1% ultra low IgG serum
(100 L). Conditioned culture supernatant from a bioreactor can be
harvested by continuous flow centrifugation. The pH of the
supernatant is adjusted to pH 7.0, filtered through 0.22 um filter
and loaded on to a Protein A column (BioSepra Ceramic HyperD, Life
Technologies, Rockville, Md. 30 ml bed volume) previously
conditioned with 20 mM phosphate buffer, 0.5 M NaCl (pH 7.2). The
column is then washed with 15 column volumes (CV) of 20 mM
phosphate buffer (pH 7.2) containing 0.5 M NaCl followed by 5 CV of
0.1 M sodium citrate (pH 5.0). TR13-Fc can be eluted with 0.1 M
citric acid (pH 2.4), and 2 mL fractions were collected into tubes
containing 0.6 ml Tris-HCl (pH 9.2). The TR13-Fc positive fractions
may then be determined by SDS-PAGE. The peak fractions are pooled
and concentrated with a Protein A column (7 mL bed volume) as
described above. The concentrated TR13-Fc is then loaded onto a
Superdex 200 column (Amersham Pharmacia, Piscataway, N.J. 90 ml bed
volume) and eluted with PBS containing 0.5 M NaCl. TR13-Fc positive
fractions are determined by non-reducing SDS-PAGE. The pooled
positive fractions are then dialyzed against 12.5 mM HEPES buffer,
pH 5.75 containing 50 mM NaCl. The dialysate is then passed through
a 0.2 m filter (Minisart, Sartorius AG, Goettingen, Germany)
followed by a Q15X-anion exchange membrane (Sartobind membrane,
Sartorius AG, Goettingen, Germany).
[1137] Expression and Purification of Full-Length Human TR13
(Without Fc)
[1138] Sf9 cells are infected with the pA2-FC:TR13 viral construct
and the culture supernatant of the infected cells are loaded onto a
Poros HS-50 column (Applied Biosystems, Foster City, Calif.)
equilibrated in a buffer containing 50 mM Tris-HCl, pH 7, and 0.1M
NaCl. The column is washed with 0.1 M NaCl and eluted stepwise with
0.3M, 0.5M, and 10.5M NaCl. The eluted fractions are analyzed by
SDS-PAGE, and the 0.5 M NaCl fraction containing TR13 protein is
diluted and loaded onto a set of Poros HQ-50/CM-20 columns in a
tandem mode. TR13 may be eluted from the CM column with a linear
gradient from 0.2M to 1.0 M NaCl.
[1139] Expression and Purification of Human TR2-Fc, MCIF-Fc, and
Fas-Fc Fusion Proteins
[1140] The cDNA sequences coding for the extracellular domain of
TR2 (aa 1-192), the extracellular domain of Fas (aa 1-169) and a
beta chemokine MCIF (aa 1-92) were fused with the cDNA sequence
coding for the Fc domain of human IgG.sub.1, and cloned into a
eukaryotic expression vector pC4. The construct was stably
transfected into CHO cells. The Fc fusion proteins from the CHO
supernatant were purified with methods described for TR13-Fc.
[1141] Expression and Purification of the Human AIM-II Protein
[1142] The coding sequence of the natural secreted form of AIM-II
(aa 83-240) was cloned into a prokaryotic expression vector pHE4,
and expressed in E. coli. Inclusion bodies from the transformed
bacteria were dissolved for 48-72 hours at 4.degree. C. in 3.5 M
guanidine hydrochloride containing 100 mM Tris-HCl, pH 7.4 and 2 mM
CaCl.sub.2. The solution was quickly diluted with 20-30 volumes of
a buffer containing 50 mM Tris-HCl, pH8 and 150 mM NaCl, adjusted
to pH 6.6 and chromatographed with a strong cation exchange column
(Poros HS-50). The protein was eluted with 3-5 CV of a stepwise
gradient of 300 mM, 700 mM, and 1500 mM NaCl in 50 mM MES at pH
6.6. The fraction eluted with 0.7 M NaCl was diluted 3-fold with
water, and applied to a set of strong anion (Poros HQ-50) and
cation (Poros CM-20) exchange columns in a tandem mode. The CM
column was eluted with 10-20 CV of a linear gradient from 50 mM MES
pH6.6, 150 mM NaCl to 50 mM Tris-HCl pH 8, 500 mM NaCl. Fractions
containing purified AIM-II as analyzed by SDS-PAGE were
combined.
[1143] Quality Control of the Recombinant Proteins
[1144] The endotoxin levels in the purified recombinant proteins
can be determined by the LAL assay on a Limulus Amebocyte Lysate
(LAL)-5000 Automatic Endotoxin Detection System (Associates of Cape
Cod, Inc. Falmouth, Mass.), according to the standard procedure
recommended by the manufacturer. All the recombinant proteins are
subjected to N-terminal sequence using an ABI-494 sequencer (PE
Biosystems, Inc. Foster City, Calif.) for their authenticity. The
proteins are dialyzed against PBS containing 20% (v/v) glycerol for
storage at -80.degree. C. For applications such as CTL, cytokine
secretion and heart transplantation, the proteins are subsequently
dialyzed against PBS to remove the glycerol in the solution.
[1145] BIAcore Analysis
[1146] The binding of human AIM-II to human TR13-Fc may be assessed
by BIAcore analysis (BIAcore Biosensor, Piscataway, N.J.). TR13-Fc
or TR2-Fc fusion proteins are covalently immobilized to the BIAcore
sensor chip (CM5 chip) via amine groups using
N-ethyl-N'-(dimethylaminopropyl)carbodi-
imide/N-hydroxysuccinimide. Various dilutions of AIM-H are passed
through the TR13-Fc- or TR2-Fc-conjugated flow cells at 15
microliters/min for a total volume of 50 microliters. The amount of
bound protein is determined during washing of the flow cell with
HBS buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 3.4 mM EDTA, 0.005%
Surfactant P20). The flow cell surface is regenerated by washing
off the bound proteins with 20 microliters of 10 mM glycine-HCl pH
2.3. For kinetic analysis the flow cells are tested at different
flow rates and with different density of the conjugated TR13-Fc or
TR2-Fc proteins. The on- and off-rates are determined according a
kinetic evaluation program in the BiaEvaluation 3 software using a
1:1 binding model and the global analysis method.
[1147] Generation of Stable Cell Lines that Express Human
AIM-II
[1148] The full-length human AIM-II gene were PCR amplified and
subcloned into pcDNA3.1. The parental vector and the AIM-II
expression vectors were then transfected into 293F cells (Life
Technologies, Grand Island, N.Y.) using Lipofectamine (Life
Technology) and stable clones resistant to 0.5 mg/ml geneticin were
selected.
[1149] Flow Cytometry
[1150] Cells are incubated with Fc-fusion proteins in 100 ul FACS
buffer (d-PBS with 0.1% sodium azide and 0.1% BSA) for 15-20
minutes at room temperature. The cells are washed then once and
reacted with goat F (ab) 2 anti-human IgG (Southern Biotechnology,
Birmingham, Ala.) for 15 minutes at room temperature. After wash,
the cells are resuspended in 0.5 ug/ml propidium iodide, and live
cells are gated and analyzed on a FACScan (BD Biosciences,
Mansfield, Mass.).
[1151] Stimulation of Human T Cells for AIM-II Expression
[1152] Briefly, T cells are purified from human peripheral blood
and stimulated with anti-CD3 in the presence of rhuIL-2 for 5 days.
The cells are then restimulated with PMA (100 ng/ml) and ionomycin
(1 mg/ml) for additional 4 hours. AIM-II expression on the cells
may be assessed by the binding of TR13-Fc, TR2-Fc, or Fas-Fc to the
cells using flow cytometry. If TR13 is shown to bind activated T
cells, the binding can be shown to be specific to AIM-II if control
Fc fusion protein (e.g., Fas-Fc) does not bind to these cells, and
if the binding could be competed off with soluble TR13.
Additionally the specificity of the binding of TR13 for AIM-II, is
demonstrated if the same soluble TR13 protein can also compete off
the binding of TR2-Fc and LTbetaR-Fc from the T cells, TR2 and
LTbetaR being receptors of AIM-II.
[1153] Three-Way MLR of Human PBMC
[1154] It has been shown that soluble AIM-II can enhance a 3-way
MLR, and soluble recombinant TR2-Fc can inhibit the 3-way MLR or
dendritic cells-stimulated alloresponse of the T cells. These
immune regulations are likely via the interaction between soluble
AIM-II and its cell surface receptor TR2. To determine if TR13
could interfere with the interaction between AIM-II and TR2, the
ability of TR13 to alter T cell alloresponses might be analyzed by
testing the effect of TR13 in a three-way human MLR.
[1155] PBMC from human donors are purified by density gradient
using Lymphocyte Separation Medium (LSM, density at 1.0770 g/ml,
Organon Teknika Corporation, West Chester, Pa.). PBMC from three
donors are mixed at a ratio of 2:2:0.2 for a final density of
4.2.times.10.sup.6 cells/ml in RPMI-1640 (Life Technologies)
containing 10% FCS and 2 mM glutamine. The cells are then cultured
for 5-6 days in round-bottomed microtiter plates (200
microliters/well) in triplicate, pulsed with [.sup.3H] thymidine
for the last 16 h of culture, and the thymidine uptake was measured
as describe before (Chen, H., et al., 1996. J. Immunol. 157:4297,
which is hereby incorporated by reference in its entirety).
[1156] One-Way Ex Vivo MLR After In Vivo Stimulation in Mice
[1157] It has been shown previously that T cells stimulated by
alloantigen in vivo have increased spontaneous proliferation ex
vivo, and alloreactive T cells depend on AIM-II for some
costimulation in certain cases. In order to test whether TR13 had
any immune regulatory effects in vivo on alloantigen-stimulated T
cells, the following assy migt be performed.
[1158] The F1 of C57BL/6.times.BALB/c mice (H-2.sup.bxd) are
transfused i.v. with 1.5.times.10.sup.8 spleen cells from C57BL/6
mice (H-2.sup.b) on day 1. TR13-Fc or a control fusion protein is
administered i.v. daily for 9 days at 3 mg/kg/day starting one day
before the transfusion. The spleen cells of the recipient F1 mice
are harvested on day 8 for in vitro proliferation and cytokine
assays.
[1159] Ex Vivo Mouse Splenocyte Proliferation
[1160] Single splenocyte suspensions from normal and transfused F1
mice are cultured in triplicate in 96-well flat-bottomed plates
(4.times.10.sup.5 cells/200 microliters/well) for 2-5 days as with
the human MLR. After removing 100 microliters of supernatants per
well on the day of harvest, 10 microliters alamar Blue (Biosource,
Camarillo, Calif.) is added to each well and the cells are cultured
for additional 4 h. The cell number in each well is assessed
according to OD.sub.590 using a CytoFlu apparatus (PerSeptive
Biosystems, Framingham, Mass.).
[1161] Mouse Cytokine Assays
[1162] Cytokines in the culture supernatants of mouse spleen cells
can be measured with commercial ELISA kits from Endogen (Cambridge,
Mass.) or R & D Systems (Minneapolis, Minn.), for example.
[1163] Mouse Cytotoxic T Lymphocyte (CTL) Assay
[1164] L.sup.d-specific transgenic 2C T cells may be used as a
model system to evaluate the effect of TR13 on the differentiation
of alloantigen-specific CD8 cells into effector cells, since the
CD8 cells are mainly responsible to the alloresponsiveness, and the
high alloreactive CD8 CTL precursors in the 2C mice gives out
elevated read-out signals for easy detection of possible changes
exerted by TR13.
[1165] Transgenic mice carrying L.sup.d-specific TCR (2C mice) are
used in this experiment. In the 2C mice, the majority (about 75%)
of T cells are CD8+, and almost all the CD8' cells express a
clonotypic TCR recognized by mAb 1B2. The 2C mice in our colony are
of an H-2.sup.b background. 2C spleen cells are stimulated with an
equal number of mitomycin C-treated BALB/c spleen cells in 24-well
plates at a final density of 4.times.10.sup.6 cells/2 ml/well.
After 5 days of culture in the presence of 10 U/ml recombinant
human IL-2, the viable cells are counted and assayed for their
H-2.sup.d-specific cytotoxic activity using .sup.51Cr-labeled P815
cells (H-2.sup.d) as targets. A standard 4-h .sup.51Cr release
assay (Chen, H., et al., 1996. J. Immunol. 157:4297, which is
hereby incorporated by reference in its entirety) is carried out in
96-well round-bottomed plates with 0.15.times.10.sup.6 target
cells/well/200 microliters at different ratios of effector/target
cells (10:1, 3:1, 1:1 and 0.3:1). After 4-h incubation, 100
microliters of supernatant are collected from each well and counted
in a gamma-counter. The percentage lysis of the test sample is
calculated as follows: 1 % lysis = cpm of the test sample - cpm of
spontaneous release cpm of maximal release - cpm of spontaneous
release
[1166] where the spontaneous release is derived from 100
microliters supernatant of the target cells cultured alone for 4 h,
and the maximal release is derived from 100 microliters lysate of
0.15.times.10.sup.6 target cells that were lysed by SDS in a total
volume of 200 microliters.
[1167] Mouse Heart Transplantation
[1168] The ability of TR13 to down regulate an allograft rejection
may be assessed with the following assay. Three- to four-month-old
C57BL/6 mice (H-2.sup.b) are used as recipients, and 2- to
3-month-old BALB/c mice (H-2.sup.d) are used as donors. The
procedure of heterotopic heart transplantation was detailed in
Chen, H., et al., 1996. J. Immunol. 157:4297, which is hereby
incorporated by reference in its entirety. The contraction of the
transplanted heart is assessed daily by abdominal palpation. The
duration between the day of the operation and the first day when a
graft totally lost its palpable activity was defined as the graft
survival time. Animals that lose palpable activity of the graft
within three days after transplantation are classified as technical
failures (<5%) and are omitted from the analysis.
Example 37
[1169] HEK 293T Cell Survival Assay
[1170] A human embryonic kidney (HEK) 293T cell survival assay was
performed by measuring numbers of viable cells using a Trypan blue
dye exclusion staining technique. The assay was performed as
follows. HEK 293T cells (3.times.10.sup.5 cells per well) were
transiently transfected with 2 ug of expression construct DNAs. 48
hours post transfection viable cells were counted using Trypan blue
staining. Results from this experiment are presented in FIG. 12 as
described above. The results show that introduction of TR13
restricted cell expansion compared to the vector control pC4. The
extent of growth inhibition was similar to that observed following
transfection of the apoptosis inducing receptor and ligand
combination of Fas and Flag-FasL (the anti-Flag antibody M2 was
included in the media to stimulate FasL driven apoptosis at a final
concentration of 100 ng/ml).
[1171] The studies described in this example were used to test the
activity of TR13 polynucleotides. However, one skilled in the art
could easily modify the exemplified studies to test the activity of
TR14 polynucleotides (e.g., gene therapy), as well as TR13 and/or
TR14 polypeptiodes, and agonists and/or antagonists of TR13 and/or
TR14.
[1172] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples. Numerous modifications and variations of
the present invention are possible in light of the above teachings
and, therefore, are within the scope of the appended claims.
[1173] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts,
laboratory manuals, books, or other disclosures) in the Background
of the Invention, Detailed Description, and Examples is hereby
incorporated herein by reference. This application claims the
benefit of priority under 35 U.S.C. .sctn. 119(e) of U.S.
Provisional Application Nos. 60/144,087, filed Jul. 16, 1999;
60/149,450, filed Aug. 18, 1999; 60/149,712, filed Aug. 20, 1999;
and 60/153,089, filed Sep. 10, 1999; each of which is hereby
incorporated by reference in its entirety.
[1174] Further, the Sequence Listing submitted herewith, in both
computer and paper forms, is hereby incorporated by reference in
its entirety.
* * * * *