U.S. patent application number 11/108864 was filed with the patent office on 2005-11-03 for histidine-tagged intimin and methods of using intimin to stimulate an immune response and as an antigen carrier with targeting capability.
This patent application is currently assigned to Henry M. Jackson Foundation For the Advancement of Military Medicine. Invention is credited to McKee, Marian L., O'Brien, Alison D., Wachtel, Marian R..
Application Number | 20050244425 11/108864 |
Document ID | / |
Family ID | 26687660 |
Filed Date | 2005-11-03 |
United States Patent
Application |
20050244425 |
Kind Code |
A1 |
McKee, Marian L. ; et
al. |
November 3, 2005 |
Histidine-tagged intimin and methods of using intimin to stimulate
an immune response and as an antigen carrier with targeting
capability
Abstract
The present invention describes the isolation and purification
of histidine-tagged functional portions of intimin (his-tagged
intimin or his-intimin), a protein associated with the ability of
certain strains of pathogenic bacteria to adhere to epithelial
cells. The invention further describes the use of intimin as an
antigen to promote a protective immune response. In addition, the
invention describes the combination of intimin with one or more
other antigens and administration of the combination to promote a
protective immune response against intimin and the one or more
antigens. One aspect of the invention is the administration of
intimin to target specific epithelial cells to promote a protective
immune response to intimin proteins. Additional aspects of the
invention include the use of intimin or intimin combined with one
or more antigens and administration of the combination to target
gastrointestinal mucosa and stimulate an immune response.
Additionally, the invention describes administration of the
combination of intimin combined with drugs, to provide a means for
targeted delivery of drugs to specific epithelial cells. Other
aspects of the invention include the production of antibodies
directed against his-intimin and methods of using such antibodies
to provide passive immune protection, and in an assay system.
Inventors: |
McKee, Marian L.; (Great
Falls, VA) ; O'Brien, Alison D.; (Bethesda, MD)
; Wachtel, Marian R.; (Gaithersburg, MD) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER
LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
Henry M. Jackson Foundation For the
Advancement of Military Medicine
|
Family ID: |
26687660 |
Appl. No.: |
11/108864 |
Filed: |
April 19, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11108864 |
Apr 19, 2005 |
|
|
|
08837459 |
Apr 18, 1997 |
|
|
|
6942861 |
|
|
|
|
60015657 |
Apr 19, 1996 |
|
|
|
60015936 |
Apr 22, 1996 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
435/69.1; 530/350 |
Current CPC
Class: |
A61P 37/00 20180101;
C07K 14/245 20130101; A61K 39/0283 20130101; Y02A 50/484 20180101;
A61P 31/04 20180101; A61K 39/025 20130101; C12N 15/8258 20130101;
A61K 38/00 20130101; A61K 2039/6031 20130101; C07K 16/1228
20130101; C07K 2319/00 20130101; C07K 16/1232 20130101; A61K 47/62
20170801; Y02A 50/30 20180101; Y02A 50/476 20180101; C07K 14/24
20130101 |
Class at
Publication: |
424/190.1 ;
530/350; 435/069.1 |
International
Class: |
A61K 039/02; C12P
021/06; C07K 014/245 |
Goverment Interests
[0001] The invention described herein may be manufactured, licensed
and used for governmental purposes without the payment of any
royalties to us thereon.
Claims
1-14. (canceled)
15. A method of promoting a protective immune response against
bacteria expressing intimin or intimin-like proteins, comprising
administering to a patient intimin, and intimin-like protein, or a
portion thereof which induces antibodies that block binding
activity.
16. A method according to claim 15, wherein said intimin,
intimin-like protein, or portion thereof is purified.
17. A method according to claim 15, wherein said intimin,
intimin-like protein, or portion thereof is enriched.
18. A method according to claim 15, wherein said intimin,
intimin-like protein, or portion thereof is histidine-tagged.
19. A method of promoting a protective immune response against at
least one antigen comprising administering to a patient a
composition comprising at least one antigen chemically, physically
or recombinantly conjugated to intimin, to an intimin-like protein,
or to a portion thereof, wherein said portion retains binding
function.
20. A method according to claim 19, wherein said intimin,
intimin-like protein, or portion thereof is purified.
21. A method according to claim 19, wherein said intimin,
intimin-like protein, or portion thereof is enriched.
22. A method according to claim 19, wherein said intimin,
intimin-like protein, or portion thereof is histidine-tagged.
23. A method of targeting the delivery of at least one antigen, at
least one drug, or a combination thereof to epithelial cells,
comprising administering to a patient a composition comprising at
least one antigen, at least one drug or a combination thereof,
conjugated to intimin, to an intimin-like protein, or to a portion
thereof, wherein said portion retains binding function.
24. A method according to claim 23, wherein said intimin,
intimin-like protein, or portion thereof is purified.
25. A method according to claim 23, wherein said intimin,
intimin-like protein, or portion thereof is enriched.
26. A method according to claim 23, wherein said intimin,
intimin-like protein, or portion thereof is histidine-tagged.
27. A method of providing passive immune protection comprising
administering anti-intimin antibodies to a patient in need
thereof.
28-46. (canceled)
47. A method of promoting a protective immune response against
bacteria expressing intimin or intimin-like proteins, comprising
administering to a patient intimin, and intimin-like protein, or a
portion thereof which retains binding activity.
48. A method according to claim 47, wherein said intimin,
intimin-like protein, or portion thereof is purified.
49. A method according to claim 47, wherein said intimin,
intimin-like protein, or portion thereof is enriched.
50. A method according to claim 47, wherein said intimin,
intimin-like protein, or portion thereof is histidine-tagged.
Description
FIELD OF THE INVENTION
[0002] This invention relates to an isolated, functional bacterial
protein, intimin, and its use as an antigen for protecting against
infection by or transmission of bacteria expressing intimin-like
proteins, such as certain pathogenic strains of Escherichia coli.
The invention also relates to the use of intimin as a means for
promoting an immune response to other antigens, and as a means of
targeting delivery of antigens or medication to specific cells or
locations within the body. The invention also relates to
antibodies, both polyclonal and monoclonal, and their use in the
treatment, diagnosis and prevention of infections by pathogenic E.
coli.
BACKGROUND OF THE INVENTION
[0003] A virulent form of bloody diarrhea is caused by the
Enterohemorrhagic Escherichia coli (EHEC). This pathogen is the
most common infectious cause of bloody diarrhea (also called
hemorrhagic colitis [HC]) in the United States (Centers for Disease
Control and Prevention (executive summary). MMWR. 43(No.RR-5):1-18
(1994; Griffin, P. M. et al. Annals of Internal Med. 109:705
(1988). One serotype in particular, 0157:H7, is the most commonly
isolated serotype of EHEC in the United States, and has been linked
to a significant number of outbreaks of HC beginning in 1982
(Riley, L. W. et al. N.Eng.J. Med. 308:681 (1983)).
[0004] The primary mode of transmission of EHEC occurs through
ingestion of contaminated food, particularly undercooked hamburger
(Doyle, M. P. and Schoeni, J. L. Appl. Environ. Microbiol. 53:2394
(1987); Samadpour, M. et al. Appl. Environ. Microbiol. 60:1038
(1994)). Among people infected by EHEC, as many as 5-10% suffer a
serious complication called Hemolytic Uremic Syndrome (HUS), a
condition caused by the action of Shiga-like toxins that target and
destroy cells lining blood vessels (endothelial cells), such as
those present in the glomeruli of the kidney. (Johnson, W. M. et
al. Lancet. i:76 (1983); O'Brien, A. D. et al. Lancet. i:702
(1983)). HUS can result in permanent kidney damage or even complete
kidney failure.
[0005] Although EHEC can cause very serious illness even in healthy
adults, young children in particular are at greater risk of dying
or suffering permanent damage from the infection. Others for whom
the infection can be particularly dangerous include the elderly and
immuno-compromised. With the prevalence of EHEC in cattle and the
subjective nature of differentiating between cooked and undercooked
hamburger, a convenient stop at a fast food restaurant, or even a
family barbecue, can result in family tragedy.
[0006] One key to the deadly nature of EHEC is the bacteria's
ability to produce attaching/effacing (A/E) intestinal lesions in
the colon, such as those demonstrated in gnotobiotic pigs (Tzipori,
S. et al. Infect. Immun. 57:1142 (1989)). The A/E lesions
demonstrated in pigs are characterized by intimate bacterial
adherence to the mucosal cells of the intestinal lining and
dissolution of microvilli (McKee, M. L. et al. Infect. Immun.
63:3739 (1995); Tzipori, S. et al. Infect. Immun. 57:1142 (1989)).
Similar lesions have been seen in human laryngeal epithelial
(HEp-2)(ATCC # CCL23) cells in tissue culture (McKee, M. L. et al.
Infect. Immun. 63:3739 (1995); Tzipori, S. et al. Infect. Immun.
57:1142 (1989).
[0007] In 1990, Jerse et al. identified a chromosomal gene in a
related diarrheagenic E. coli strain, Enteropathogenic E. coli
(EPEC). That gene, designated eae (formerly known as eaeA), was
found to be required for the bacterium to produce A/E lesions in
tissue culture (Jerse, A. E. et al. Proc. Natl. Acad. Sci. USA.
87:7839 (1990)). The eae gene encoded a 94 kDa outer membrane
protein (intimin), called eae, which is the intimin of EPEC. A
similar protein was demonstrated to be present in an EHEC 0157:H7
strain (Jerse, A. E. and Kaper, J. B. Infect. Immun. 59:4302
(1991)).
[0008] Recently, investigators demonstrated that intimin is
necessary for adherence of EHEC to human epithelial laryngeal
(HEp-2) cells and human ileocecal epithelial (HCT-8) cells (ATCC #
CCL244) (McKee, M. L. et al. Infect. Immun. 63:3739 (1995)) and for
formation of A/E lesions in the piglet intestine (Donnenberg, M. S.
et al. J. Clin. Invest. 92:1418 (1993); McKee, M. L. et al. Infect.
Immun. 63:3739 (1995)). Although human studies with EHEC have not
been conducted, as they are unethical and forbidden, the intimin
protein found in EPEC is strongly associated with the production of
diarrhea and fever in human volunteers (Donnenberg, M. S. et al. J.
Clin. Invest. 92:1412 (1993); Levine, M. M. et al. J. Infect. Dis.
152:550 (1985)).
[0009] Human volunteers (10 out of 10) challenged with EPEC strain
E2348/69 mounted a notable immune response to the 94 kDa protein
after 28 days (Levine et al. J Infect. Dis. 152:550 (1985)). In
these human trials the only volunteer (1 out of 10) who failed to
develop diarrhea after ingestion of E2348/69 was the individual in
this group who had detectable antibody to the 94 kDa protein
intimin before challenge.
[0010] Two other bacterial species capable of inducing A/E lesions
have been shown to contain the eae locus: Hafnia alvei (Albert, M.
J. et al. J. Med. Microbiol. 37:310 (1992)) and Citrobacter
rodentium (formerly known as Citrobacter freundii biotype 4280)
(Schauer, D. B., and Falkow, S. Infect. Immun. 61:2486 (1993)).
Although these bacteria are not generally associated with pathology
in humans, they can cause significant disease in the animal species
with which they are normally associated. For instance, Citrobacter
rodentium is associated with gastrointestinal illness in mice. Mice
often serve as control and test subjects in experiments. Costly and
carefully controlled experiments can be jeopardized by an outbreak
of this disease in an animal care facility. In addition, such
bacterial species may become pathogenic to immuno-compromised
patients, the young and the elderly.
[0011] The pathogens Yersina enterocolitic and Yersina
pseudotuberculosis express a 103 kDa outer membrane protein
(invasin) that allows bacterial penetration of cultured epithelial
cells (Isberg, R. R. et al., Cell 60: 769 et seq. (9187)) and
efficient penetration of the intestinal epithelium in vivo (Pepe,
J. C. and Miller, V. L., Proc. Natl. Acad. Sci. USA 90:6473 et seq.
(1993)). Invasin is also a member of the intimin protein
family.
[0012] Animals, such as cows, infected with bacterial strains
expressing intimin may become ill themselves, in addition to
serving as a source of such infections to others. Eradicating or
even limiting these animal reservoirs of intimin-expressing
bacteria in animals with antibiotic therapy would be prohibitively
expensive. In addition, not only is antibiotic treatment of the
infections in humans or animals costly, but the antibiotics
themselves are associated with side effects that can be dangerous.
As with EHEC, those side effects can be especially dangerous to
young children and the elderly. Consequently, the need exists for
another means of reducing the seriousness of the infections or
preventing them altogether through promotion of protective immune
responses against bacteria expressing intimin.
[0013] A further need is for forms of immunization that are less
time consuming, expensive and painful than immunization through
injection of antigens. Yet another need is for the generation of
protective immune responses in the specific tissues involved at the
point of infection, most often the gastrointestinal mucosa.
[0014] Other organisms infecting gastrointestinal tissue,
including, but not limited to Salmonella sp. and Shigella sp.,
possess antigens against which an immune response could be
generated. A need exists, however, for a means of targeting those
antigens to gastrointestinal mucosa, in order to stimulate a
mucosal immune response, as well as stimulating circulating
antibodies.
[0015] Immuno-compromised individuals are less able to mount a
protective immune response against pathogens, even with prior
exposure to antigens associated with the pathogens. Thus a need
exists to provide passive immune protection to immunocompromised
individuals exposed to the pathogens. A related need is the ability
to identify whether an infection may be protected against by the
presence of antibodies to intimin.
SUMMARY OF THE INVENTION
[0016] The present invention relates to an enriched protein
comprising intimin or a portion of intimin that retains wild-type
binding activity or that induces antibodies that block wild-type
binding activity, as well as to a purified protein comprising
intimin or a portion of intimin that retains wild-type binding
activity or that induces antiboides that block wild-type binding
activity. The invention also relates to a protein, comprising
intimin, an intimin-like protein, or portion thereof, having a
histidine tag. The invention further relates to the above-described
proteins where the intimin, intimin-like protein, or portion
thereof further comprises at least one antigen, at least one drug
or a combination thereof chemically, physically or recombinantly
conjugated with the intimin, intimin-like protein, or portion
thereof.
[0017] Additionally, the present invention relates to a method for
making purified intimin or a purified portion of intimin retaining
binding activity, comprising expressing a protein comprising
intimin having a histidine tag or a portion of intimin having a
histidine tag, and removing the histidine tag from the intimin or
portion of intimin. The invention further relates to a method for
making a purified intimin-like protein or a portion thereof,
comprising expressing a protein comprising an intimin-like protein,
or a portion thereof, having a histidine tag, and removing the
histidine tag from the intimin-like protein, or portion thereof,
before or after the purification.
[0018] The invention still further relates to a method for making
enriched intimin or an enriched portion of intimin, comprising
expressing a protein comprising intimin having a histidine tag or a
portion of intimin having a histidine tag, enriching the intimin or
portion of intimin, and optionally removing the histidine tag from
the enriched intimin or enriched portion of intimin. The invention
similarly relates to a method for making an enriched intimin-like
protein or portion thereof, comprising expressing a protein
comprising an intimin-like protein, or portion thereof, having a
histidine tag, enriching the intimin-like protein or portion
thereof, and optionally removing the histidine tag from the
enriched intimin-like protein or portion thereof.
[0019] The invention also relates to a method of promoting a
protective immune response against bacteria expressing intimin or
intimin-like proteins, comprising administering to a patient
intimin, an intimin-like protein, or portion thereof, wherein said
portion retains wild-type binding activity or induces antibodies
that block wild-type binding activity.
[0020] The invention additionally relates to a method of promoting
a protective immune response against at least one antigen
comprising administering to a patient a composition comprising at
least one antigen chemically, physically or recombinantly
conjugated to intimin, to an intimin-like protein, or to a portion
thereof.
[0021] The invention further relates to a method of targeting the
delivery of at least one antigen, at least one drug, or a
combination thereof to epithelial cells, comprising administering
to a patient a composition comprising at least one antigen, at
least one drug or a combination thereof, conjugated to intimin, to
an intimin-like protein, or to a portion thereof having the ability
to retain binding activity.
[0022] The invention still further relates to a method of providing
passive immune protection comprising administering anti-intimin
antibodies to a patient in need thereof.
[0023] The invention even further relates to a composition
comprising anti-intimin antibodies, wherein the composition is free
of other antibodies specific for an intimin-expressing host
bacteria.
[0024] The invention even further yet relates to a method of
preparing anti-intimin antibodies comprising expressing intimin
having a histidine tag or a portion of intimin having a histidine
tag, administering the intimin or portion of intimin to a patient,
and recovering anti-intimin antibodies. The invention similarly
relates to a method of preparing anti-intimin antibodies comprising
expressing an intimin-like protein or portion thereof having a
histidine tag, administering the intimin-like protein, or portion
thereof, to a patient, and recovering anti-intimin antibodies.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 depicts pEB313, a plasmid encoding RIHisEae. This
plasmid encodes a histidine-tagged intimin that spans 900 out of
935 predicted C-terminal amino acids.
[0026] FIG. 2 depicts the predicted protein sequence of the
complete EHEC 933 eae gene.
[0027] FIG. 3 depicts the DNA sequence from EHEC strain CL8,
sequenced by Beebakhee, G. et al.
[0028] FIG. 4 depicts the DNA sequence from EHEC strain 933,
sequenced by Yu and Kaper.
[0029] FIG. 5 depicts the 3144 bp fragment of eae produced by
polymerase chain reaction amplification, in the region labeled
eae.
[0030] FIG. 6 depicts pEB311, a plasmid encoding EHEC strain 86-24
eae (entire coding sequence) driven by the lac promoter.
[0031] FIG. 7 depicts pEB310, a plasmid encoding EHEC strain 86-24
eae (entire coding sequence) driven by the PT7 promoter.
[0032] FIG. 8 depicts histidine-tag expression plasmids (Qiagen
Inc.).
[0033] FIG. 9 depicts the repressor plasmid (Qiagen Inc.)
(multicopy).
[0034] FIG. 10 depicts pEB312, a plasmid encoding RVHindHis. This
plasmid encodes a histidine-tagged intimin that spans 604 of 935
predicted amino acids.
[0035] FIG. 11 depicts the different fragments of eae cloned into
his-tagged vectors, and the corresponding names of these
plasmids.
[0036] FIG. 12 depicts the different C-terminal fragments of eae
cloned into his-tagged vectors and the corresponding names of these
plasmids.
[0037] FIG. 13 depicts the construction of an eae mutant, 86-24
eae.DELTA.10, by allelic exchange.
[0038] FIG. 14 depicts pEB290, a plasmid encoding most of the eae
structural gene. The 3' 250 bp of eae are not encoded by
pEB290.
[0039] FIG. 15 depicts pEB300, used to construct the deletion
mutant; deleted for the 1275 bp internal Bcl I fragment of eae.
[0040] FIG. 16 depicts pAM450, a suicide vector for introduction of
cloned genes into the bacterial chromosome.
[0041] FIG. 17 depicts pEB305i, a plasmid encoding the deleted eae
gene in pAM450 vector for homologous recombination.
[0042] FIG. 18 depicts the cloning scheme for construction of a
plasmid expressing N-His-IcsA-intimin-C.
DETAILED DESCRIPTION OF THE INVENTION
[0043] The invention is directed to an enriched protein comprising
intimin or a portion of intimin retaining wild-type binding
activity or inducing antibodies that block wild-type binding
activity, as well as to a purified protein comprising intimin or a
portion of intimin retaining wild-type binding activity or inducing
antibodies that block wild-type binding activity. The invention is
also directed to a protein, comprising intimin, a portion of
intimin, or an intimin-like protein, wherein the intimin, the
portion of intimin, or intimin-like protein has a histidine tag.
Preferably the histidine-tagged intimin, histidine-tagged portion
of intimin, or histidine-tagged intimin-like protein is enriched or
purified. It is also preferred that the proteins described above
further comprise at least one antigen, at least one drug or a
combination thereof chemically, physically or recombinantly
conjugated with the intimin, the portion of intimin, or the
intimin-like protein.
[0044] The invention additionally relates to a method for making
purified intimin or a purified portion of intimin, comprising:
[0045] expressing a protein comprising intimin or a portion of
intimin, wherein the intimin or portion of intimin has a histidine
tag,
[0046] purifying the intimin or the portion of intimin, and
[0047] removing the histidine tag from the intimin or portion of
intimin before or after the purification.
[0048] The invention similarly relates to a method for making a
purified intimin-like protein, comprising expressing a protein
comprising an intimin-like protein having a histidine tag,
purifying the intimin-like protein, and removing the histidine tag
from the intimin-like protein before or after the purification.
[0049] The invention further relates to a method for making
purified intimin or an enriched portion of intimin, comprising:
[0050] expressing a protein comprising intimin having a histidine
tag or a portion of intimin having a histidine tag,
[0051] purifying the intimin or the portion of intimin, and
[0052] removing the histidine tag from the purified intimin or
enriched portion of intimin.
[0053] The invention similarly relates to a method for making an
enriched intimin-like protein, comprising expressing a protein
comprising an intimin-like protein having a histidine tag,
enriching the intimin-like protein, and removing the histidine tag
from the enriched intimin-like protein.
[0054] The invention even further relates to a method of promoting
a protective immune response against bacteria expressing intimin or
intimin-like proteins, comprising administering to a patient
intimin, a portion of intimin retaining binding activity, or an
intimin-like protein. Preferably the intimin, portion of intimin or
intimin-like protein is purified or enriched. It is also preferred
that the intimin, portion of intimin, or intimin-like protein has a
histidine tag.
[0055] The invention still further relates to a method of promoting
a protective immune response against at least one antigen
comprising administering to a patient a composition comprising at
least one antigen chemically, physically or recombinantly
conjugated to intimin, to a portion of intimin, or to an
intimin-like protein or portion thereof. Preferably the intimin,
portion of intimin or intimin-like protein or portion thereof is
purified or enriched. It is also preferred that the intimin,
portion of intimin, or intimin-like protein or portion thereof has
a histidine tag.
[0056] The invention even still further relates to a method of
targeting the delivery of at least one antigen, at least one drug,
or a combination thereof to epithelial cells, comprising
administering to a patient a composition comprising at least one
antigen, at least one drug or a combination thereof, conjugated to
intimin, to a portion of intimin, or to an intimin-like protein or
portion thereof. Preferably the intimin, portion of intimin or
intimin-like protein or portion thereof is purified or enriched. It
is also preferred that the intimin, portion of intimin, or
intimin-like protein or portion thereof has a histidine tag.
[0057] The invention even further yet relates to a method of
providing passive immune protection comprising administering
anti-intimin antibodies to a patient in need thereof.
[0058] The invention additionally relates to a composition
comprising anti-intimin antibodies, wherein the composition is free
of other antibodies specific for an intimin-expressing host
bacteria, which, as used herein, refers to any pathogenic or
non-pathogenic bacteria expressing intimin, a portion of intimin,
or an intimin-like protein or portion thereof encoded in the
bacterial genome or in a plasmid. Preferably this host bacteria is
EHEC. The antibodies produced by this method can be monoclonal
antibodies or polyclonal antibodies. Preferably the antibodies
produced by this method are affinity-purified.
[0059] The invention also relates to a method of preparing
anti-intimin antibodies comprising expressing intimin having a
histidine tag or a portion of intimin having a histidine tag,
administering the intimin or portion of intimin to a patient, and
recovering anti-intimin antibodies. This method can also include
removing the histidine tag. Additionally, this method preferably
comprises enriching intimin or said portion of intimin and more
preferably comprises purifying the intimin or the portion of
intimin.
[0060] The invention similarly relates to a method of preparing
anti-intimin antibodies comprising expressing an intimin-like
protein or portion thereof having a histidine tag, administering
the intimin-like protein or portion thereof to a patient, and
recovering anti-intimin antibodies. This method can also include
removing the histidine tag. Additionally, this method preferably
comprises enriching the intimin-like protein or portion thereof,
and more preferably comprises purifying the intimin-like protein or
portion thereof.
[0061] An object of the invention is to purify large quantities of
intimin, preferably EHEC intimin, that retain the ability to bind
epithelial cells. To achieve this object, a portion of eae was
cloned into a Histidine-tag expression vector, expressed and
purified. An additional object of this invention is to administer
his-intimin as an antigen to elicit an immune response. The
specific his-tagged intimin protein described above and those set
forth in the examples below can be used for that purpose; however,
those skilled in the art will recognize that a smaller fragment
that retains binding function may also be desirable.
[0062] Those skilled in the art will also recognize that the size
of the his-tagged intimin to be used may be varied according to the
specific purpose for administering the intimin. For example, if the
his-tagged intimin is to be conjugated with one or more antigens, a
smaller fragment may be selected to enhance stability of the
combined fusion product, although the use of a larger fragment is
by no means precluded. The size or conformation of the other
antigen and the location of its significant epitopes may indicate
that a particular length of his-tagged intimin will bring the
epitopes into close proximity to the mucosa. The desired size will
also vary with the convenience of available restriction sites, in
light of the materials and methods known to those of ordinary skill
in the art. Consequently, the terms his-intimin and his-tagged
intimin, as used herein, mean polypeptides containing at least 900
out of the 935 predicted C-terminal amino acids of intimin with a
histidine tag (full-length intimin). The invention also includes
smaller portions of the his-tagged protein that retain binding
function.
[0063] Conjugates between his-tagged intimin and one or more
antigens may be generated through recombinant technology to
generate a fusion protein comprising intimin in a portion of
intimin and an additional protein antigen. In addition, intimin may
be chemically or physically conjugated to proteins, peptides,
carbohydrates and other antigens by methods known to those skilled
in the art. Methods of chemical conjugation are well known to those
skilled in the art, and include, in part, coupling through
available functional groups (such as amino, carboxyl, thio and
aldehyde groups). See S. S. Wong, Chemistry of Protein Conjugate
and Crosslinking CRC Press (1991); and Brenkeley et al. Brief
Survey of Methods for Preparing Protein Conjugates With Dyes,
Haptens and Cross-linking Agents, Bioconjugate Chemistry 3 #1
(January 1992).
[0064] The retention of binding function means that the intimin,
intimin-like proteins, and/or portions thereof retain the capacity
to bind to epithelial cells or cell lines, such as HEp-2 and HCT-8.
Such binding may be measured using any standard technique in the
art. For example, the binding may be visualized as bacterial
microcolony formation by the microcolony assay (Frankel et al.,
Infect. Immun. 62(5):1835-1842 (1994)), by FAS, (florescence actin
staining), or both (McKee and O'Brien, Infect. Immun.
63(5):2070-2074 (1995), the disclosures of which is incorporated by
reference herein). Additionally, binding may be measured in vivo as
a function of bacterial virulence or pathogenicity, or by
post-mortem histological examination. Examples of each of the above
methods for determining binding function are detailed in Examples
below, including the adherence assay described in Example IV.
[0065] One of the objects of the invention is to administer intimin
or portions thereof, or intimin-like proteins, or portions thereof,
to protect against illness or disease caused by EHEC or other
pathogens having the capacity to bind epithelial cells through
proteins having some degree of homology with the specific intimin
expressed by EHEC. The object is achieved through stimulation of
immune response directed against intimin, thereby blocking the
capability of EHEC and related pathogens to adhere to epithelial
cells. Consequently, the term immunization is used in the
application.
[0066] The intimin, or portions of intimin, intimin-like proteins
or portions thereof, are preferably capable of eliciting antibodies
that block the binding of the corresponding wild-type protein.
These antibodies may be directed against the binding site itself,
or may be directed against any other portion of the linear
polypeptide such that the antibodies block binding through steric
hinderence or conformational changes. Such interference may be
visualized, for example, by the loss of the wild-type binding
pattern in the in vitro bacterial adherence assay of Example
IV.
[0067] The degree of protection will vary with the degree of
homology with intimin as well as the unique attributes of the
patient, particularly as different species will be treated. The
precise degree of protection is unimportant to quantitate in
practicing the invention for any particular pathogen.
[0068] In addition to stimulating an immune response that permits a
patient to avoid infection altogether, immunization as used herein
also means decreasing the ability of the pathogens to colonize the
gastrointestinal tract and decreasing the severity of an infection,
as measured by any of the following indicators: reduced incidences
of death, HUS, or permanent kidney damage; decreased levels of
toxins; reduced fluid loss; or other indicators of illness
regularly used by those ordinarily skilled in the relevant art.
[0069] Unless specified otherwise, the uses and methods set forth
herein are generally applicable to humans and animals. The term
patient is used herein to mean both humans and animals, and animals
are not limited to domesticated animals but also may include
wildlife and laboratory animals as well.
Isolating and Purifying His-tagged Intimin
[0070] It has been shown that a His-intimin fusion, in which the
N-terminal third of the molecule is deleted (RVHindHis), was
capable of complementing adherence of a non-adherent EHEC eae
mutant; i.e., restored binding capability to a strain of EHEC that
lost its binding capability following genetic alterations that
prevented expression of intimin. The pattern of adherence
demonstrated in the restored binding was indistinguishable from
that observed in wild-type strain 86-24 (McKee, M. L. and O'Brien,
A. D. Infect. Immun. In press (1996)). Where measured by the
microcolony assay, noted above, wild-type activity is identified as
a punctate pattern with localized areas of intense staining.
[0071] Purification of the intimin protein, however, was difficult,
in part because intimin is always associated with the outer
membrane of EHEC. The majority of the overexpressed recombinant
intimin remained associated with the bacterial membrane fraction,
even after sonic disruption of the host bacterium and addition of
mild detergent to the extraction buffer. The insolubility of the
intimin protein, combined with the abundance of other native E.
coli proteins in the 97 kDa range, made purification of the native
protein difficult.
[0072] Attempts to make an intimin-maltose binding protein fusion
(MBP) also were unsuccessful because the predicted protein product
had deletions and rearrangements. An attempt by other investigators
had shown a construct of MBP fusions to the C-terminal 280 amino
acids of intimin, but the fusion did not confer EHEC-like binding
function. The diffuse pattern of adherence conferred by the
MBP-intimin fusion protein was clearly different from the pattern
of EHEC binding to HEp-2 cells (Frankel, G. et al. Infect. Immun.
62:1835 (1994)).
[0073] One possible explanation for the failure to obtain a
functional MBP-intimin fusion larger than 280 amino acids is that
overexpression of a piece of eae greater than the last 280 amino
acids is unstable, and thus prone to rearrangements, i.e. it may be
impossible to isolate that clone because it is lethal or
deleterious to the cell when expressed. Alternatively,
overexpression of a piece of MBP-intimin fusion larger than 280
amino acids could plug up the bacterial membrane, which would be
lethal to the cells.
[0074] After trying unsuccessfully to purify intimin using MBP, a
fusion was created using the QIAexpressionist Kit of QIAGEN, Inc.,
which involves attaching a histidine tag to the protein. The
histidine tag is small, non-immunogenic, and binds tightly to a
nickel affinity matrix, which facilitates purification of large
quantities of material for further studies. In addition, the
expression system permits one to maintain tight control of
expression of the His fusion proteins to prevent any possible
lethal effects of the recombinant protein on the E. coli host
strain as a result of overexpression of the protein. Example I
describes the creation of such a fusion protein.
EXAMPLE I
[0075] A. Construction of a Plasmid, pEB313 (FIG. 1), Encoding
His-Tagged Intimin Encompassing 900 out of 935 Predicted Amino
Acids (FIG. 2).
[0076] The eae gene is cloned from EHEC strain 86-24 (serotype
0157:H7), readily obtainable from Griffin, P. M. et al., Ann.
Intern. Med. 109:705-712 (1988), or Phil Tarr (Children's Hospital
and Medical Center, 4800 Sand Point Way NE, Seattle, Wash. 98105,
206-526-2521.) The DNA is extracted according to standard
chromosomal prep techniques (Wilson, K. in Current Protocols in
Molecular Biology, Ausubel, F. M. et al. (eds.) vol
1:2.4.1--"Preparation of Genomic DNA from Bacteria").
[0077] The gene is cloned using the polymerase chain reaction
(PCR), a standard technique in the art, using primers designed from
a composite of the 2 known EHEC eae sequences. Two primers are
constructed: Sn20-CGTTGTTAAGTCAATGGAAAC, a 5' primer, spanning
bases 20-41 of the sequence from the strain CL8, which was
sequenced by Beebakhee, G. et al. FEMS Microbiology. 91:63 (1992)
(FIG. 3); and MM2-TCTAGAGAGAAAACGTGAATGTT- GTCTCT, a 3' primer,
spanning bases 3061-3082 of the sequence from strain 933, sequenced
by Yu, J. and Kaper, J. B. Mol. Microbiol. 6:411 (1992) (FIG. 4).
MM2 was further designed to include an XbaI site at the 3' end.
[0078] The PCR reactions are performed using the AmpliTaq Kit,
according to the instructions of the manufacturer, Perkin Elmer.
The PCR amplification produces a 3144 bp fragment encoding the
entire eae open reading frame (ORF) (FIG. 5, region designated eae)
and includes 186 bp upstream. The PCR product is processed to
create blunt ends and ligated into the EcoRV site of the vector
pBRKS.sup.- (Schmitt et al., J. Bacteriol. 176:368-377 (1994)).
[0079] The gene is cloned in both directions to allow transcription
from either P.sub.lac pEB311 (FIG. 6) and from P.sub.T7 pEB310
(FIG. 7) under the appropriate conditions. The plasmids are
transformed into host strain XL1BlueF'Tn5 lacl.sub.Q, (available
from QIAGEN, Inc., 9600 DeSoto Ave., Chatsworth, Calif. 91311,
1-800-362-7737). The recombinants are maintained under the
constitutive control of the lac repressor, because the previous
failed attempts to clone eae suggested that overexpression of eae
might be lethal to the host E. coli strain. The lower copy number
of pBRKS vector, along with the control conferred by the lac
repressor obviates these problems.
[0080] A his-tagged intimin plasmid is constructed by digesting
pEB310 with EcoRI, filling in with Klenow fragment, digesting with
HindIII, and isolating the resulting 2895 bp fragment. The DNA
fragments are isolated using the Geneclean kit, Biol01 (1070 Joshua
Way, Vista, Calif. 92083, 1-800424-61010). The his-tag expression
plasmid pQE32 (FIG. 8) (available from QIAGEN, Inc.) is digested
with SmaI and HindIII. The 2895 bp fragment is then ligated to
pQE32, creating pEB313 (FIG. 1).
[0081] This plasmid, pEB313, encodes a his-tagged eae fragment of
101 kDa, called RIHisEae, which encodes 900 out of 935 predicted
amino acids. This his-intimin fusion is constructed so that the N
terminal 35 amino acids are deleted, to remove any potential signal
sequence. A signal sequence could target the fusion protein to the
membrane or lead to cleavage of the His tag from the encoded
intimin.
[0082] After the pEB313 construct is made, it is transformed into a
lab strain of E. coli containing the lac repressor (lacl.sub.Q),
such as M15 pREP4 (repressor contained on the multicopy plasmid
pREP4, supplied by QIAGEN, Inc.) (FIG. 9) or XL1BlueF'
Tn5lacl.sub.Q (repressor contained on the single copy F' plasmid,
also available from QIAGEN, Inc.). The transformed E. coli express
the his-intimin fusion protein encoded by pEB313. Purification of
the protein is accomplished as set forth in Example III.
[0083] B. Construction of a Plasmid, pHis-Inv1, Encoding His-Tagged
Yersinia pseudotuberculosis Invasin, and Construction of a Plasmid,
pHis-Inv2, Encoding His-Tagged Yersinia pseudotuberculosis Invasin
with a Deletion of the N-Terminal 40 Amino Acids.
[0084] The plasmid pRI203 contains a 4.6 kb fragment of Yersinia
pseudotuberculosis chromosomal DNA, including the inv gene and
surrounding nucleotide sequences, and is readily obtainable from
Dr. Ralph Isberg (Dept. Of Molecular Biology and Microbiology,
Tufts University School of Medicine, Boston, Mass. 02111; ref. R.
R. Isberg, D. L. Voorhis, and S. Falkow. Cell. 50:769 (1987)). The
pRI203 DNA is extracted from the supplied bacterial strain with the
use of a QIAGEN DNA extraction kit (QIAGEN, Chatsworth, Calif.)
according to the instructions of the manufacturer.
[0085] To construct pHis-Inv1, two primers, Inv1
(=5'GTACGGATCCATGATGGTTTT- CCAGCCAATCAGTGAG 3' and Inv3
(=5'GTACGGTACCTTATATTGACAGCGCACAGAGCGGG 3') are used in a PCR
reaction (as described above in part A) to amplify the desired inv
sequences from pRI203. The resulting 2960 bp inv fragment is
digested with BamHI and KpnI, run on an agarose gel, excised with a
razor, and purified using GeneClean (Bio101, LaJolla, Calif.). The
purified inv fragment is ligated into the His-tag QIAGEN vector
containing the appropriate reading frame corresponding to the
amplified inv sequence (pQE30, 31 or 32, QIAGEN, Chatsworth,
Calif.), digested with BamHI and KpnI. The ligated plasmids are
then transformed into DH5.alpha.F'Tn5lacl.sub.Q, and transformants
checked for the presence of the appropriate size insert.
[0086] The plasmid pHis-Inv2 is constructed in the event that a
signal sequence (and therefore the adjoining His tag) is cleaved
from the protein expressed from pHis-Inv1. To construct pHis-Inv2,
two primers, Inv2 (=5'GTACGGATCCATATGTGGAATGTTCATGGCTGGGG 3') and
Inv3 (=5'GTACGGTACCTTATATTGACAGCGCACAGAGCGGG 3') are used in a PCR
reaction (as described in part A above) to amplify the desired inv
sequences from pRI203. The resulting 2840 bp inv fragment is
purified as above, and ligated into the His-tag QIAGEN vector as
above, and transformed into a similar bacterial host strain.
[0087] Alternatively, similar plasmids are constructed by
restriction enzyme digestion of pRI203, followed by ligation into
the QIAGEN His-tag vector (pQE30, 31 or 32) containing the
appropriate reading frame relative to the 5' end of the invasin
fragment. The preceeding examples are meant to illustrate the
construction of plasmids encoding histidine-tagged invasin from
Yersinia pseudotuberculosis. One of ordinary skill in the art
recognizes that analogous constructs, designed using alternative
vectors and/or other intimin-like proteins can be constructed
according to standard methods in the art. One of ordinary skill in
the art also recognizes that the above his-tagged invasins and
other his-tagged intimin-like proteins may be applied to the
methods disclosed elsewhere herein.
[0088] C. Construction of a Plasmid (pEB312) (FIG. 10) Encoding
His-Tagged Intimin Encompassing 604 Out of 935 Predicted Amino
Acids.
[0089] Digested plasmid pEB310 (obtained as described in part A)
with EcoRV and HindIII, isolating the 1971 bp fragment, and
ligating the fragment into pQE32 digested with SmaI and HindIII.
Restriction enzymes, ligases, Klenow fragment used in protocols are
from New England BioLabs (32 Tozer Rd., Beverly, Mass. 01915-55991,
1-800-NEB-LABS) or Gibco BRL (P.O. Box 681 Grand Island, N.Y.
14072-0068, 1-800-828-8686). The resulting plasmid is designated
pEB312.
[0090] The plasmid pEB312 encodes a his-tagged eae fragment called
RVHindHis, which is about 65 kDa and encodes 604 out of 935
predicted amino acids. This construct contains the C-terminal
two-thirds of the wild-type intimin protein.
[0091] As with the pEB310-expressed intimin, the fusion proteins
remain primarily in the insoluble pellet after sonic disruption of
the host E. coli. Therefore, urea and guanidine HCl are included in
the purification protocol, which allows extraction of the fusion
proteins from the insoluble pellet.
[0092] D. Construction of Additional Plasmids Expressing Different
Fragments of eae.
[0093] Each of these plasmids is tested to ensure that the protein
fragment is capable of adhering to cultured cell lines using an
adherence assay. (See example IV, below). In addition, the
selection of the size of the intimin varies with whether the
protein is expressed alone and whether cross-immunity is desired
with an intimin-like protein of known amino acid sequence. In
addition to intimin expressed from EHEC and EPEC, examples of
intimin-like proteins include, but are not limited to, intimin-like
proteins of Citrobacter rodentium, Hafina alveii, and the invasins
of Yersinia enterocolitica and Yersinia pseudotuberculosis.
[0094] For instance, the larger 900 aa intimin is selected if there
is heightened desire for cross-immunity with Yersinia
pseudotuberculosis, because EHEC intimin shares 31% identical and
51% similar amino acids with the protein of Yersinia
pseudotuberculosis, known as invasin (Yu, J. and Kaper, J. B. Mol.
Microbiol. 6:411 (1992)). A greater degree of homology exists
within the amino terminal two-thirds of the respective
proteins.
[0095] Invasin is a 103 kDa outer membrane protein that allows
bacterial penetration of cultured epithelial cells (Isberg, R. R.
et al. Cell. 60:769 (1987)) and efficient penetration of the
intestinal epithelium in vivo (Pepe. J. C. and V. L. Miller. Proc.
Natl Acad. Sci. USA. 90:6473 (1993)). Cell adhesion receptors on
the intestinal epithelium, which have been identified as integrins,
bind invasin prior to bacterial internalization (Isberg, R. R. and
J. M. Leong. Cell. 50:861 (1990)). The central portion of invasin
is responsible for protein localization to the outer membrane,
while the C-terminus is required for receptor binding (Isberg, R.
R. Mol. Microbiol. 3:1449 (1989)).
[0096] Similarly, a larger 900 aa intimin is selected if there is
heightened desire for cross-immunity with Enteropathogenic
Escherichia coli (EPEC), Citobacter rodentium, or Hafnia alvei.
EPEC intimin shares 83% identity with EHEC intimin over the entire
length of the protein; the N-terminal 75% of the proteins share 94%
identity, while the C-terminal 25% of the proteins share 49%
identity (Yu, J. and Kaper, J. B. Mol. Microbiol. 6:411 (1992)).
Citrobacter rodentium intimin shares 84% nucleotide identity to
EHEC eae within the first 2106 bp, and 57% identity to the 3' 702
bp (Schauer, D. B. and Falkow, S. Infect. Immun. 61:2486
(1993)).
[0097] The plasmids that express different fragments of eae can be
constructed using one of the following techniques: (1) use of a
convenient restriction site within eae, for example, pEB313
digested with SalI and HindIII, isolation of the 1298 bp fragment,
and ligation to pQE30 (QIAGEN, Inc.) digested with SmaI and
HindIII. The resulting plasmid expresses the last 432 amino acids
at the C terminus of eae; (2) deletion of the 5' or the 3' region
of any desired fragment using nuclease BAL-31, Exonuclease III, or
Mung bean nuclease (all available from New England BioLabs, 32
Tozer Rd., Beverly, Mass. 01915); (3) construction of plasmids with
noncontiguous eae fragments, also using the above techniques; and
(4) construction of plasmids encoding desired specific sequences
with the use of PCR primers specifying the 5' and 3' ends of such
sequences, as described in greater detail below.
[0098] With respect to the third technique, a His-tagged middle
third intimin deletion mutant plasmid is constructed (pMW114). The
plasmid pMW106 (described below) is transformed into the dam strain
DM1F'Tn5lacl.sub.Q. DNA is made using the QIAGEN kit (QIAGEN,
Inc.), and is digested with BclI. The DNA is run out on an agarose
gel. The 5178 bp band is cut out, is purified using GeneClean (Bio
101), is ligated, and then transformed into
DH5.alpha.F'Tn5lacl.sub.Q (or other appropriate strain such as
XL1Blue or M15pREP4). Transformants are checked by restriction
digestion of DNA. This description does not preclude the
construction of other plasmids encoding non-contiguous eae
sequences.
[0099] With respect to the fourth technique, PCR can be used to
amplify specific fragments of eae; the fragments are isolated by
restriction enzyme digestion and agarose gel electrophoresis, and
ligated into the appropriate His-tag expression vector (i.e.
p.QE30, 31 or 32; QIAGEN, Inc.).
[0100] For example, clones are constructed encoding various regions
of eae (see FIGS. 11 and 12). The capacity of these clones to
retain adherence function is assessed by either (1) transformation
into the eae mutant, followed by adherence assays with HEp-2 cells
(see Ex III, section C), or (2) addition of exogenous protein to
bacteria (see Ex III, section D). It is important that the fragment
selected retains full or close to full wild type binding activity.
Alternatively, an acceptable clone from potentially any portion of
the molecule is one which, encodes a polypeptide which can elicit
antibodies which block the binding activity of wild-type
intimin.
[0101] It is hypothesized that clones containing the highest
binding activity will include the C-terminal third (the third
third) of the protein, perhaps as little as 150 C-terminal amino
acids. This hypothesis is supported, for example, by the findings
disclosed by Frankel et al., Infection & Immunity, 62:1835
(1994), Frankel et al., Infection & Immunity, 63:4323 (1995),
and Frankel et al., J. Biol. Chem., 271:20359 (1996). Proteins
cannot be thought of as linear arrays of amino acids; rather they
exist in a 3-dimensional structure. It is important to keep in mind
that a single amino acid change or a deletion of a portion of the
protein can perturb this structure. Therefore, full cell binding
activity may require the presence of additional non-contiguous
sequences along with the third third putative binding domain.
[0102] It is further hypothesized that clones containing high
binding activity will include the two C-terminal Cys (encoded at bp
2780 and bp 3002, numbering ref; Beebakhee, G., J. DeAzavedo, and
J. Brunton, FEMS Microbiology Letters 91:63 (1992)) for
hypothesized disulfide bond formation and resulting loop formation.
Additionally, it is hypothesized that clones containing high
binding activity may require one or both aspartate(s) (encoded at
bp 2819 and 2828, numbering ref. Beebakhee). This hypothesis is
supported, for example, by analogy to invasin, as desribed in
Leong, J. M., Embo. J. 14:422 (1995).
[0103] All clones are constructed in a similar manner. PCR primers
are designed which specify the 5' and 3' region of the desired eae
fragment. To facilitate cloning into pQE31, each 5' primer (MW1,
MW3, MW5, MW7, MW8, MW9, MW10) contains a 5' BamHI site, and each
3' primer (MW2, MW4, MW6, MW11, MW12) contains a 5' KpnI site. Each
PCR primer is designed so that the reading frame of the specified
eae sequence is appropriate for insertion into pQE31. The following
His-tagged constructs are cloned using the indicated PCR
primers:
[0104] (1) pMW101--encodes the N-terminal third of eae; 27 kDa
protein (PCR primers: MW1(5' PCR primer)=5'
GTACGGATCCGAATTCATTTGCAAATGGTG 3'; MW2 (3' PCR primer)=5'
GTACGGTACCTGATCAATGAAGACGTTATAG 3');
[0105] (2) pMW102--encodes the middle third of eae; 42 kDa protein
(PCR primers MW3 (5' PCR primer)=5' GTACGGATCCTGATCAGGATTTTTCTGGTG
3'; MW4 (3' PCR primer)=5' GTACGGTACCTGATCAAAAAATATAACCGC 3');
[0106] (3) pMW103--encodes the C-terminal third (282 amino acids)
of eae; 32 kDa protein (PCR primers: MW5 (5' PCR primer)=5'
GTACGGATCCTGATCAAACCAAGGCCAGCATTAC 3'; MW6 (3' PCR primer)=5'
GTACGGTACCTTATTCTACACAAACCGCATAG 3');
[0107] (4) pMW104--encodes the N-terminal two thirds of eae; 69 kDa
protein (PCR primers: MW1 and MW4);
[0108] (5) p MW105--encodes the C-terminal two thirds of eae; 73
kDa protein (PCR primers: MW3 and MW6);
[0109] (6) pMW106--encodes eae with a small N-terminal 35 amino
acid deletion; 100 kDa protein (PCR primers: MW1 and MW6);
[0110] (7) pMW108--encodes the C-terminal 150 amino acids of eae
(PCR primers: MW7 (5' PCR primer)=5'
GTACGGATCCACTGAAAGCAAGCGGTGGTGATg 3'; MW6);
[0111] (8) pMW109--encodes the C-terminal 140 amino acids of eae
(PCR primers: MW8 (5' PCR primer)=5'
GTACGGATCCTTCATGGTATTCAGAAAATAC 3'; MW6);
[0112] (9) pMW110--encodes the C-terminal 130 amino acids of eae
(PCR primers: MW9 (5' PCR primer)=5'
GTACGGATCCGACTGTCGATGCATCAGGGAAAG 3'; MW6);
[0113] (10) pMW111--encodes the C-terminal 120 amino acids of eae
(PCR primers: MW10 (5' PCR primer)=5'
GTACGGATCCGAATGGTAAAGGCAGTGTCG 3'; MW6);
[0114] (11) pMW112--encodes 120 amino acids of eae with the
C-terminus, spanning bp #2560-2923, (numbering refers to eae
sequence of strain CL8 ref. Beebakhee, G., J. DeAzavedo, and J.
Brunton. FEMS Microbiology Letters 91:63)). (PCR primers: MW7; MW11
(3' PCR primer)=5'GTACGGTACCTCCA- GMCGCTGCTCACTAG 3');
[0115] (12) pMW113--encodes the C-terminal 282 amino acids of eae,
Cys at bp 3002 changed to Ser with the use of the PCR primer MW12
(numbering refers to eae sequence of strain CL8 ref. Beebakhee, G.,
J. DeAzavedo, and J. Brunton. FEMS Microbiology Letters 91:63
(1992)) (PCR primers: MW5; MW12 (3' PCR primer)=5'
GTACGGTACCTTATTCTACAGAAACCGCATAG 3').
[0116] All clones are constructed by first diluting lyophilized
primers to 10 .mu.M with dH.sub.2O. Template DNA from strain
XL1blue pEB310 (encoding the entire eae gene) is made using a
QIAGEN prep (QIAGEN, Inc.), is linearized by digestion with a
restriction enzyme that does not cut within or near the coding
region, for example HindIII, and is quantitated using a
spectrophotometer. PCR reactions are conducted by combining 10
.mu.l 10.times. Taq buffer (Perkin Elmer/Roche, Branchburg, N.J.),
10 .mu.l 2 mM dNTP mix (Boehringer Mannheim, Indianapolis, Ind.),
10 .mu.l 10 .mu.M 5' PCR primer, 10 .mu.l 10 .mu.M 3' PCR primer, 6
.mu.l 25 mM MgCl.sub.2 (Perkin Elmer/Roche), 52 .mu.l dH.sub.2O,
and 1 .mu.l (1-10 ng) linear template DNA. Two drops of mineral oil
are applied to the mixture, which is heated to 100.degree. C. for 5
minutes to denature the template. One .mu.l (5U) of AmpliTaq
polymerase (Perkin Elmer/Roche) is added, and the PCR reactions are
begun: 95.degree. C./1 min, 50.degree. C./1 min, 72.degree. C./3
min for 30 cycles, followed by 72.degree. C./10 min, and holding at
4.degree. C. After the PCR reactions are completed, the DNA is
applied to a Wizard PCR clean-up kit (Promega, Madison, Wis.), and
resuspended in 50 .mu.l TE buffer. PCR amplified DNA is digested
with BamHI and KpnI, electrophoresed on an agarose gel, the
appropriate size band cut out, and purified by Gene Clean (Bio101,
LaJolla, Calif.). Digested PCR fragments are then ligated into
pQE31 digested with BamHI and KpnI, transformed into
DH5.alpha.F'Tn5lacl.sub.Q (or other appropriate strain, such as
M15pREP4 or XL1Blue), and transformants checked for the presence of
the appropriate size insert.
[0117] With respect to any of the disclosed protein extraction,
enrichment, and purification techniques, if it is necessary to
later remove the Histidine tag from the purified protein, a
protease cleavage site can be inserted between the 6.times.His
sequence and the N-(N-terminal tag) or C-terminus (C-terminal tag)
of the protein. For example, Enterokinase recognizes the sequence
"DDDK" (Asp.sub.4-Lys), and cleaves after the lysine. A PCR primer
encoding this sequence is designed and used to perform
site-directed mutagenesis of the desired gene fragment.
Alternatively, Carboxypeptidase A can be used for the removal of
C-terminal His tags. This enzyme efficiently removes aromatic
C-terminal residues (Hoculi, E. Chemische Industrie. 12:69 (1989))
until it encounters a basic residue, at which point removal is
terminated. Additionally, PCR can be used to design a primer so
that the protease site is encoded at the N- or C-terminus of the
protein encoded; or PCR can be used to design the vector including
those sites, and the above-techniques can be used to clone into the
aforementioned vector.
[0118] All fragments of intimin expressed from pEB312 or other
constructs are purified using a protocol similar to the protocol
detailed in Example II, for large scale purification of intimin. It
is apparent that those of ordinary skill in the art may select
additional restriction sites or modify the protocol while remaining
within the scope and spirit of the invention.
EXAMPLE II
[0119] Large Scale Enrichment of Histidine-Tagged Intimin
[0120] Growing Large-Scale Expression Cultures
[0121] Inoculate 20 ml LB (Luria-Bertaini) broth containing 100
.mu.g/ml ampicillin and 40 .mu.g/ml kanamycin with a loopful of M15
pREP4 pEB313 (prepared as described in Example I, above). Grow
overnight (15-18 h) at 37.degree. C., shaking vigorously. Inoculate
1L of LB broth containing 100 .mu.g/ml ampicillin and 40 .mu.g/ml
kanamycin with 20 ml of the overnight culture. Grow culture at
37.degree. C. with vigorous shaking until the OD.sub.600=0.7-0.9
(.about.3h). Add IPTG (isopropyl .beta.-D-thiogalactopyranoside,
Sigma Chemical Co., P.O. Box 14508, St. Louis, Mo. 63178,
1-800-325-3010) to a final concentration of 1 mM (0.476 g) and
continue to grow culture for another 3h. Divide supernatant into
500 ml bottles (previously weighed) and centrifuge at 4000.times.g
for 10 minutes. Discard the supernatant, weigh cell pellet, and
store at -70.degree. C., or process immediately.
[0122] Thaw cells for 15 minutes, vortex and resusupend in Buffer A
[6 M GuHCl, 0.1 M NaH.sub.2PO.sub.4, 0.01 M Tris-HCl, pH 8.0] at 5
ml/g wet weight. Stir cells for 1 hour at room temperature.
Centrifuge lysate at 10,000.times.g for 15 min, collect
supernatant. Add 5 ml of a 50% slurry of Ni-NTA resin ( Ni-NTA
slurry from QIAGEN, Inc), previously equilibrated with Buffer A.
Stir at room temperature for 45 minutes, let the slurry settle,
remove the supernatant, add 5 ml Buffer A, let the slurry settle,
remove the supernatant, add 5 ml Buffer A, and load the resin into
a column. The column is washed with 10 column volumes of Buffer A,
followed by washes with Buffer B [8 M urea, 0.1 M
NaH.sub.2PO.sub.4, 0.01 M Tris-HCl, pH 8.0] until the
OD.sub.280.ltoreq.0.01 (at least 5 column volumes). Wash the column
with Buffer C [6M urea, 0.1M NaH.sub.2PO.sub.4, 0.01 M Tris-HCl, pH
6.3] until the OD.sub.280.ltoreq.0.01. The protein is eluted with
Buffer C plus 250 mM imidazole, collecting thirty 1 ml
fractions.
[0123] Record the OD.sub.280 of each fraction. Pool aliquots of the
purified protein containing similarly high OD.sub.280 readings into
dialysis tubing (eg. Spectra/Por Cellulose Ester Membrane MW cut
off=8000; Spectrum Medical Industries, 1100 Rankin Rd. Houston,
Tex. 77073-4716), and equilibrate in cold (4.degree. C.) Buffer C
containing 6M urea (not 8M urea). Adjust the concentration of the
aliquots to .ltoreq.1 mg/ml using a standard commercial protein
quantitation kit (Bio-Rad Microassay, Bio-Rad Labs, 2000 Alfred
Noble Dr., Hercules, Calif. 94547, 1-800-4BIORAD), with BSA diluted
in Buffer C (containing 6M urea) as the standard. Perform step
dialysis of the protein in the cold (4.degree. C.) beginning with
Buffer C (containing 6M urea) and reducing the molarity of the urea
by whole number increments. Dialyze for one hour in each solution,
ending in 1.times. PBS. Analyze the protein by (10%) SDS-PAGE
running .about.2 .mu.l protein per well to verify protein size and
quantity. The molecular weight of RIHisEae is 101 kDa.
[0124] Alternatively, add protein to dialysis tubing, dialyze
straight into 1.times. PBS. Quantitate the protein using a standard
commercial protein quantitation kit (Pierce BCA Protein Assay Kit,
Pierce, P.O. Box 117, Rockford, Ill. 61105), aliquot, and store at
-20.degree. C. As with the first alternative, analyze the protein
by (10%) SDS-PAGE running .about.2 .mu.l protein per well to verify
protein size and quantity.
[0125] Upon enrichment of his-tagged intimin, the material derived
is analyzed for level of purity by SDS-PAGE. A 10% SDS-PAGE gel is
loaded with a 2 .mu.l sample of enriched his-tagged intimin and
electrophoresed at 200 V for one hour. Molecular weight markers are
included on the gel for size comparison. When the gel is stained
with Colloidal Coomasie stain (Sigma, St. Louis, Mo.), the most
prominent band appears at .about.101 kDa. Several other less
prominent high molecular weights bands also appear. When the gel is
stained with silver stain (BioRad, Richmond, Calif.) according to
the instructions of the manufacturer, very slight high molecular
weight bands appear, as well as several more prominent bands at low
molecular weights, the most prominent band appearing around 29 kDa.
The enriched product preferably contains approximately 70-80% of
the full-length (i.e., 900 out of 935 predicted amino acids)
intimin. Preferably the enriched product contains no more than 25%
contaminants (i.e., non-intimin related molecules), more preferably
no more than 20% contaminants, still more preferably no more than
10% contaminants.
EXAMPLE III
[0126] Purification of Enriched Histidine-Tagged Intimin
[0127] An enriched preparation of his-tagged intimin, generated as
described in Example II above, is purified by techniques known to
those skilled in the art, including, but not limited to, high
performance liquid chromatography (HPLC), gel column
chromotography, and SDS-PAGE.
[0128] With the SDS-PAGE method, an enriched preparation of
his-tagged intimin is separated on a 10% polyacrylamide gel and
visualized, for example, by staining an analytical lane with
Colloidal Coomasie strain (Sigma, St. Louis, Mo.). The high
molecular weight full-length intimin band can be excised from the
preparative gel with a razor, and stored at 4.degree. C. prior to
immunization. Less than full-length fragments of intimin, i.e.
portions of intimin, and/or intimin conjugated to one or more
antigens can similarly be excised from the gel.
[0129] Regardless of the method used to purify intimin, or portion
thereof, the purified protein as used herein refers to a population
of polypeptides consisting solely of intimin or portions or
intimin, optionally tagged with histidine. It has been recognized
in the art that the population of polypeptides expressed from a
fragment of DNA containing only one open reading frame encoding
intimin (or intimin-like proteins) can separate into multiple bands
on an SDS-PAGE gel. McKee et al., Infection & Immunity,
64(6):2225-2233 (1996), Jerse et al., Proc. Natl. Acad. Sci. USA
87:7839-7843 (1990), and Isberg, Cell 50:769-778 (1987). Thus,
purified intimin, or portions of intimin or intimin-like proteins
and intimin or intimin-like proteins conjugated with one or more
antigens, may be visualized as multiple bands on an SDS-PAGE
gel.
EXAMPLE IV
[0130] A. Adherence Assay.
[0131] Adherence of E. coli to either HEp-2 or HCT-8 cells is
assessed by a modification of the method of Carvioto et al. Curr.
Microbiol. 3: 95-99 (1979). Specifically, overlay semiconfluent
monolayers of HEp-2 cells on glass coverslips in 24 well tissue
culture dishes or in 8 well Permanox Chamber Slides (Nunc,
Naperville, Ill.) with adherence assay medium (EMEM, or Eagle's
Minimum Essential Medium supplemented with 0.4% sodium bicarbonate
and 1% mannose) which contain 20 .mu.l/ml (v/v) of an overnight
culture of the bacteria to be tested in LB broth.
[0132] Each inoculum contains .gtoreq.10.sup.7 bacteria (described
below) which results in an approximate multiplicity of infection
(MOI) of 100:1. The infected monolayers are incubated at 37.degree.
C. in a 5% CO.sub.2 atmosphere. After three hours, the medium,
which contains the nonadherent bacteria, is aspirated and the
monolayers washed once with sterile 10 mM phosphate buffered
saline, pH 7.4 (PBS: sodium chloride, sodium phosphate dibasic, and
potassium phosphate monobasic).
[0133] Fresh adherence assay medium is added to the cells with
adherent bacteria, and the infected cells are then incubated for an
additional 3 hours. The monolayers are then washed six times with
PBS to remove nonadherent bacteria. Each wash is gently removed by
aspiration in an attempt to avoid disturbing the monolayers. Each
assay is done .gtoreq.2 times and duplicate slides are prepared to
permit both Giemsa and FITC-phalloidin (FAS) staining to visualize
binding and associated sequelae.
[0134] For Giemsa staining, the HEp-2 cells and adherent bacteria
are fixed with 70% (v/v) methanol (glass coverslips) or graded
acetone washes (chamber slides) and stained with 1:10 Giemsa
(Sigma) for 20 minutes. To assess the FAS phenotype, the
FITC-Phalloidin (Sigma) staining procedure of Knutton et al.
Infect. Immun. 57: 1290-1298 (1989) is used. Phalloidin is a
mushroom phallotoxin that specifically binds filamentous, not
globular, actin. FITC-phalloidin-stained preparations are examined
by both phase contrast and fluorescent microscopy using an Olympus
model GHS microscope with a model BH2-RFL reflected light
fluorescence attachment (Olympus Optical Co., Ltd., Tokyo,
Japan).
[0135] Adherence assays with HCT-8 cells are done by the procedure
described above for HEp-2 cells, but the bacteria are allowed to
interact with the HCT-8 cells for 2.5 hours before the first wash
and an additional 2.5 hours before terminating the assay. All
assays with HCT-8 cells are carried out in 8 well permanox Chamber
Slides.
[0136] B. Construction of a Bacteria for Use in the Assay:
[0137] An EHEC eae Mutant.
[0138] To create an in-frame deletion in the chromosomal copy of
the eae gene in a particular strain of EHEC, strain 86-24, the
wild-type copy of the gene is replaced by double homologous
recombination with an internally-deleted copy of eae (FIG. 13).
Plasmid pEB290 (FIG. 14) encloses most of the eae structural gene
and is constructed from a PCR product amplified from the 86-24
chromosome with primer MM1 (MM1=ATAACATGAGTACTCATGGTTG;starts at
the second codon of the eae structural gene and includes a ScaI
restriction site), in combination with primer MM2
(MM2=TCTAGAGAGAAAACGTGAATGTTGTCTCT). The resultant 2,953 base pair
fragment derived by PCR is digested with the ScaI and XbaI and
ligated into pBluescript SK.sup.+ (Stratagene) that is restricted
with SmaI and XbaI. DNA sequencing of the ends of the pEB 290
insert reveals that the 3' 250 base pairs are lost.
[0139] Plasmid pEB290 is transformed into E. coli strain GM119
[dam-6, dcm-3, [Arraj, J. A. and Marinus, M. G. J. Bacteriol.
153:562-565 (1983)] to obtain unmethylated DNA which is sensitive
to the restriction endonuclease BclI. Plasmid DNA is isolated
(Maniatis, et al., Molecular cloning: a laboratory manual. Cold
Spring Harbor (1982)) and restricted with BclI to remove an
internal 1125 bp fragment from the gene. The resulting sticky ends
are ligated to each other to create pEB300 (FIG. 15).
[0140] The deleted eae gene is excised by digesting pEB300 with
XbaI and HindIII, and the fragment containing the eae sequence is
ligated into the BamHI site of the suicide vector, pAM450 (FIG. 16)
to form pEB305. Plasmid pAM450 is a derivative of pMAK705 (Hamilton
et al., J. Bacteriol., 171:4617-4622 (1989)) with three features.
First, it has a temperature sensitive (ts) origin of replication.
Second, the plasmid carries the sacB/R locus from Bacillus
subtilis, rendering the host strain sensitive to sucrose (Gay et
al., J. Bacteriol 164:918-921 (1985)); Lepesant et al., Marburg.
Mol. Gen. Genet. 118:135-160 (1972)). Third, the plasmid encodes
ampicillin resistance. These features allow homologous
recombination and positive selection for a second recombination
event resulting in resolution and loss of vector sequences. The
insertion of the deleted eae gene (from pEB300) into the suicide
vector (pAM450) results in the plasmid called pEB305 (FIG. 17).
[0141] The suicide:eae construct, pEB305i, is transformed into wild
type EHEC strain 86-24 by electroporation (Sizemore, et al.,
Microb. Pathog. 10:493-499 (1991)). Double recombinants that have
been cured of the vector sequences are selected by growth on medium
containing sucrose and then screened for ampicillin sensitivity
(Blomfield et al., Mol. Microbiol., 5:1447-1457 (1991)).
Transformants that have been cured of the suicide vector sequences
are sucrose resistant, ampicillin sensitive, and able to grow
equally well at 30.degree. and 42.degree. C. Deletion of the
chromosomal eae sequences is confirmed by: (i) the reduced size of
the eae fragment after PCR amplification with primers MM1 and MM2;
(ii) Southern blot analysis of the mutated chromosomal DNA; (iii)
loss of restriction sites within the deleted region of the eae
gene; and (iv) the inability of an internal probe to recognize the
mutated chromosome.
[0142] The resulting in-frame deletion mutant of EHEC strain 86-24
strain is designated 86-24eaeAl 0. The mutation is confirmed to be
in frame by in vitro transcription and translation analysis of the
PCR-derived product from 86-24eae.DELTA.10. A truncated protein
product of the predicted size, about 68,000 Da, is identified by
[.sup.35S] methionine labeling of the translation product. The eae
mutant strain is identical to wild type 86-24 in all
characteristics, including: growth in LB broth, agglutination with
O157 and H7 antisera, inability to ferment sorbitol, and growth on
MacConkey agar at 37.degree. C.
[0143] Those of ordinary skill in the art will recognize that other
methods of creating strains of EHEC that are mutated in eae and do
not retain binding ability are possible and may be substituted.
[0144] C. The Role of eae in EHEC Adherence In Vitro.
[0145] The isogenic strains, 86-24, 86-24eae.DELTA.10 and
86-24eae.DELTA.10 carrying pEB310 are tested for adherence to HEp-2
and HCT-8 cells. Wild type 86-24 forms microcolonies when the
bacteria interact with HEp-2 or HCT-8 cells. M. L. McKee & A.
D. O'Brien, Infection & Immunity 63:2070 (1995). This localized
adherence is FAS (fluorescence actin staining) positive which
indicates the polymerization of F-actin at the site of bacterial
attachment (i.e., the expected result). The mutant
86-24eae.DELTA.10 is unable to adhere to HEp-2 cells. When eae is
introduced into 86-24eae.DELTA.10 on either pEB310 or pEB311, the
LA/FAS (LA=localized adherence or microcolony formation) phenotype
is fully restored, an observation which demonstrates that intimin
alone complements the eae mutation. Since both of the clones
complement the eae mutant, the native promoter for eae is present
in the PCR amplified sequences.
[0146] D. Effect of Adding Exogenous His-intimin Fusion
Proteins
[0147] The adherence assay also may be used to evaluate the effect
of exogenously added His-intimin fusion proteins on the binding
capability of 86-24eae.DELTA.10 and the binding capability of
wild-type strain 86-24. In this case, the purified His-intimin
fusion proteins are added to the epithelial cell monolayers before
addition of bacteria as indicated in each experiment.
[0148] HEp-2 cells are incubated with 20ng -20 .mu.g of RIHisEae
for 30 minutes prior to the addition of 86-24 to the monolayer. The
infected monolayers are then washed extensively, stained with
FITC-phalloidin, and observed microscopically. The fusions enhance
binding wild type strain of 86-24 to HEp-2 cells. The size of the
86-24 microcolony as well as the total number of HEp-2 cells with
adherent microcolonies increases as the concentration of RIHisEae
increases. At high doses (20 .mu.g), the fusion protein causes the
HEp-2 cells to show aberrant appendages and processes. For this
reason, 1-2 .mu.g is the most preferred dose for further
studies.
[0149] When added exogenously to HEp-2 cells, RIHisEae complements
the HEp-2-cell binding defect (or restores binding capability) of
86-24eae.DELTA.10. The shorter fusion protein, RVHdHisEae, also
complements for adherence. A similar amino terminal fusion of
histidine residues to mouse dihydrofolate reductase (His-DHFR) does
not enhance the adherence of 86-24. Moreover, the plasmids that
encode the intimin fusion proteins, pEB312 and pEB313, are able to
complement 86-24eae.DELTA.10 for attachment in vitro. Thus, such
studies indicate that the proteins encoded by pEB312 and pEB313 are
sufficient to confer adherence.
[0150] As noted above in Example I, the fusion proteins localize to
the insoluble pellet fraction after sonic disruption of the host
strains, indicating that these proteins are localized to the
membrane. Plasmid pQE16, which encodes the His-DHFR fusion, does
not complement 86-24eae.DELTA.10 (data not shown). That the
irrelevant protein fusion with the histidine residues does not
confer HEp-2 cell adherence on the eae mutant indicates that the
histidine residues added to intimin are not responsible for the
activity observed for the exogenously added His-intimin fusions.
The enhancement or complementation of EHEC binding to HEp-2 cells
observable with exogenous RIHisEae and RVHdHisEae indicates that
intimin interacts with both the bacteria and the epithelial
cell.
EXAMPLE V
[0151] The Role of eae in Vivo--Gnotobiotic Piglet Infection
Model
[0152] The role of intimin in intestinal colonization, A/E lesion
formation, and EHEC-mediated colitis and diarrhea in the
gnotobiotic piglet is evaluated by the method of Francis, et al.
(Francis et al., Infect. Immun., 51:953-956 (1986)). Both pairs of
piglets inoculated with the wild-type parent strain, 86-24 develop
diarrhea and have edema in the mesentery of the spiral colon at
necropsy.
[0153] Histologically, strain 86-24 primarily colonizes the cecum
and spiral colon. Histologically and by culture, no evidence of
bacterial dissemination to the liver, kidney, lung, or brain is
detected. Intimate bacterial adherence and A/E lesions, as
described by Staley (Staley et al., Vet. Pathol. 56:371-392 (1969))
and Moon (Moon et al., Infect. Immun., 41:1340-1351 (1983)) for
EPEC, are evident by both light and EM examination of cecum and
colon of piglets infected with 86-24. A/E lesions include the
accumulation of electron-dense material at the site of attachment.
In some areas, sloughed enterocyte fragments and microvilli with
attached bacteria are noted in the gut lumen. In histologic
sections of the cecum and spiral colon of piglets infected with
86-24, an inflammatory infiltrate is seen. Inflammation is
characterized by scattered neutrophils in the lamina propria and
mild diffuse accumulation of serous fluid and perivascular
lymphocytes and macrophages in the submucosa.
[0154] Both piglets inoculated with the mutant strain,
86-24eae.DELTA.10 have formed feces at necropsy. Histologically and
by EM examination, there is no evidence that strain
86-24eae.DELTA.10 is able to colonize piglet intestine and cause
the A/E lesion. The few bacteria seen by light and EM examination
are in the mucus overlying the mucosal epithelium of the cecum and
spiral colon. One of two piglets inoculated with 86-24eae.DELTA.10
has slight mesocolonic edema, but no other gross or microscopic
lesions are seen in either piglet. See McKee et al., Infection and
Immunity 63: 3739 et seq. (1995) (incorporated herein by
reference).
[0155] Piglets inoculated with 86-24eae.DELTA.10(pEB310) have pasty
feces and mesocolonic edema at necropsy. Strain 86-24eae.DELTA.10
(pEB310) intimately adheres to mucosal enterocytes and causes A/E
lesions in the cecum and spiral colon. Histologically, perivascular
lymphohistiocytic typhlocolitis, similar to that caused by wild
type 86-24 is also seen.
[0156] Similar experiments are conducted in a colostrum-deprived
newborn calf model, showing that intimin is necessary to provoke
A/E lesions in the gut as well as to evoke E. coli O157:H7 strain
86-24-mediated diarrhea. (A. D. O'Brien, M. R. Wachtel, M. L.
McKee, H. W. Moon, B. T. Bosworth, C. Neal Stewart, Jr., and E. A.
Dean-Nystrom. "Intimin: Candidate for an Escherichia coli O157:H7
Anti-Transmission Vaccine". Abstract of the 32nd Joint Conference
on Cholera and Related Diarrheal Diseases, Nagasaki, Japan, Nov.
14-16, 1996, the disclosure of which is incorporated herein by
reference.) These experiments also demonstrate that by 2 days
post-infection the numbers of infecting organisms in the lower
bowel are significantly less in the animals fed the eae mutant or a
non-pathogenic E. coli strain than in the calves fed the wild type
or the eae mutant with the complementing clone.
EXAMPLE VI
[0157] Recognition of EHEC Proteins by HC Patient Sera.
[0158] Convalescent immune sera tested from hemorrhagic colitis
patients (kindly provided by T. Barrett at the Centers for Disease
Control and Prevention, Atlanta, Ga.) react with P.sub.T7-expressed
intimin preparations (i.e., his-intimin expressed by pEB310 and
pEB311) in a Western immunoblot. To decrease reactivity of the
hemorrhagic colitis patients' sera with E. coli proteins in the
expression system, sera samples are adsorbed with whole cell
extracts of DH5.alpha. transformed with pGP1-2 and PBRKS.sup.- (the
expression vector). After adsorption, the normal sera controls
recognize only proteins in the ammonium sulfate concentrated
fraction of the intimin preparations but no longer react with
proteins expressed from pEB310 or the vector control. After
adsorption, the HC patient sera still recognize many E. coli
proteins, but the reaction with intimin remains strong.
EXAMPLE VII
[0159] Administration of His-Intimin to Patients
[0160] The following example provides the administration of
his-intimin to patients in order to stimulate a protective immune
response. A protective immune response is one that elicits
sufficient antibody to permit a patient to avoid infection,
decrease the significance or severity of an infection, or decrease
the ability of bacteria to colonize the gastrointestinal tract.
[0161] Methods of administration of his-intimin include, but are
not limited to, injection (including, but not limited to,
intraperitoneal, intravenous, subcutaneous, and intramuscular) of
his-intimin directly into the patient to elicit an immune response,
ingestion or by gavage of his-intimin alone or with food, and
intra-nasal inoculation with his-intimin, which promotes binding of
intimin to receptors of epithelial cells in the naso-pharynx.
[0162] When the his-intimin is ingested, the protein is contained
within a gel capsule, liposome, or attached to an inert substance
to aid in passage of the inoculum through the stomach. As the
fusion protein is acid stable, it also is ingested by itself or may
be mixed into a food product. A preferred method of administration
is in a fusion protein of his-intimin and SLT (Shiga-like toxin). A
his-intimin-SLT fusion protein is bound to SYNSORB (SynSorb
Biotech, Inc., 1204 Kensington Rd, N.W., Calgary, Alberta, Canada,
T2N3P5), which has a receptor for SLT, via the SLT-receptor
interaction. The SYNSORB construct is mixed with chocolate pudding
and fed to children.
[0163] Purified RiHisEae (His-tagged Eae, 900/935 amino acids), as
well as the third third portion of intimin (encoded by pMW103), are
stable after incubation at pH 2.0 at 37.degree. C. for 24 hr. This
indicates that a His-Eae fusion can pass through the stomach
unharmed or undegraded. Moreover, in nature eae is expressed on the
outer membrane of the bacterium and it still promotes intimate
adherence after passing through the stomach, indicating its
resistance to acidic environments.
[0164] Ingestion or intra-nasal inoculation stimulates local
immunity, which thwarts future colonization by EHEC and EPEC.
Cross-immunity through homology is stimulated to Hafnia alvei and
Citrobacter rodentium, Yersinia sp. and other bacterial species
having intimin-like proteins. Although it is not necessary to
quantitate the degree of cross-immunity conferred by administration
of intimin in order to benefit from a protective immune response to
infection by bacteria other than EHEC that express intimin-related
proteins, an assay for such protection is described in Example IX.
The assay permits assessment of the efficacy of intimin antibodies
on blocking interaction with epithelial cells by pathogens known to
have intimin-like binding proteins.
[0165] In another embodiment, injection of his-intimin into cow
udders leads to an immune response in the cow. Antibodies against
the protein are present in the cow's milk. Calves that drink the
milk are passively immunized until they can be actively immunized
by the method of choice. Alternatively, his-intimin may be fed to
cows or introduced into the cow's feed. The presence of his-intimin
introduced in this way also stimulates an antibody response in the
cows so that antibodies are produced and appear in the cows'
milk.
[0166] Another embodiment involves the administration of nucleic
acid vaccines. His-intimin is injected into a patient as naked eae
DNA, or the DNA is delivered to the body by a carrier system such
as retroviruses, adenoviruses, or other carriers known in the art.
Following administration, the patient mounts an immune response
against transiently expressed foreign antigens.
[0167] Currently nucleic acid vaccines, in general, are nearing
clinical trials. This approach to vaccines involves delivering the
DNA encoding the desired antigen into the host by inserting the
gene into a nonreplicating plasmid vector (Marwick, C. JAMA
273:1403 (1995); reviewed in Vogel, F. R. and N. Sarver. Clin.
Microbiol. Rev. 8:406 (1995)).
[0168] The first published demonstration of the protective efficacy
of such a vaccine has shown that intramuscular injection of plasmid
DNA encoding influenza A virus (A/PR/8/34) nucleoprotein (NP)
elicited protective immune responses in BALB/c mice against a
heterologous strain of influenza virus (A/HK/68) (Ulmer, J. B. et
al. Science 259:1745 (1993)). Immunized animals had reduced virus
titers in their lungs, decreased weight loss, and increased
survival compared with challenged control mice. Both NP-specific
cytotoxic T lymphocytes (CTL's) and NP antibodies were generated.
The NP antibodies were ineffective at conferring protection, but
the CTL's killed virus-infected cells and cells pulsed with the
appropriated major histocompatibility complex class I-restricted
peptide epitope.
[0169] Another study has shown that intramuscular injection of
plasmid DNA encoding influenza virus A/PR/8/34 hemagglutinin
resulted in the generation of neutralizing antibodies that
protected mice against a heterologous lethal influenza virus
challenge (Montgomery, D. L. et al. DNA Cell Biol. 12:777
(1993)).
[0170] Practice of the invention by this method can be accomplished
by reference to the aforementioned articles incorporated herein by
reference, in particular Montgomery, D. L. et al. DNA Cell Biol.
12:777 (1993). The eae locus is described in FIG. 5 according to
restriction sites and according to its sequence in FIG. 3, for
strain CL8, and its sequence in strain 933, shown in FIG. 4.
EXAMPLE VIII
[0171] A. Conjugation of Antigens from Various Pathogens to
His-Intimin to Elicit an Immune Response Against Both eae and the
Conjugated Antigen.
[0172] Antigens (Ag) and haptens from various pathogens are
conjugated to a histidine-tagged intimin molecule. This fusion
protein is used as an inoculum with intimin acting as the carrier
to target binding to intestinal epithelial cells. This conjugate
protein can be designed in any of the following configurations:
N-His-intimin-Ag-C, N-Ag-intimin-His-C, N-His-Ag-intimin-C,
N-intimin-Ag-His-C, N-intimin-His-Ag-C, or N-Ag-His-intimin-C.
[0173] The size of intimin varies with the size of the antigen that
is to be fused, and the number of antigens to which the intimin is
fused as would be recognized by those in the art. The variables to
be considered in the design of such a fusion protein are: (1)
foreign antigen; (2) size of intimin used, which can be of whatever
size that retains binding function as described above; (3) fusion
order N.fwdarw.C; and (4) method of conjugation, such as genetic,
as in cloning and expressing a fusion protein, and chemical,
although additional methods are readily apparent to those
ordinarily skilled in the art. (D. V. Goeddel, "Systems for
Heterologous Gene Expression," Meth. Enzymol., Vol. 185, Academic
Press, New York, 1990.; K. Itakura, "Expression in E. coli of a
chemically synthesized gene for the hormone somatostatin," Science,
198: 1056-1063 (1977); and D. V. Goeddel et al., "Expression of
chemically synthesized genes for human insulin," Proc. Natl. Acad.
Sci. USA, 281: 544-548 (1979)).
[0174] Delivery of this coupled antigen occurs using the same
mechanisms as that of a histidine-tagged intimin alone, as set
forth above in Example VII.
[0175] Haptens and antigens may derive from but are not limited to
bacteria, rickettsiae, fungi, viruses, parasites, drugs, or
chemicals. They may include, for example, small molecules such as
peptides, oligosaccharides, and toxins. Certain antimicrobial drugs
and chemotherapeutic drugs having the capacity of being absorbed on
the mucosal surface may also be coupled to intimin. The antigens
and polysaccharides that may be coupled to intimin and administered
to stimulate a protective immune response may include those shown
below in Table 1.
1TABLE 1 Antigens and/or polysaccharides from: Bordetella pertussis
Borellia burgdorferi Campylobacter sp., including C. jejuni Candida
albicans, other Candida Chlamydi trachomatis and pneumoniae (TWAR)
Citrobacter rodentium Clostridium sp., including C. botulinum, C.
difficile, C. perfringens, C. tetani, (including tetanus toxoid
vaccine) Coronaviruses Corynebacterium diphtheriae, including
diptheria toxoid vaccine Cryptococcus neoformans Entamoeba
histolytica Escherichia coli sp. including ETEC (enterotoxigenic E.
coli), EAgg EC (enteroaggregative E. coli), EPEC (enteropathogenic
E. coli), EHEC (enterohemmorhagic E. coli), EHEC SLT subunits or
toxoid EIEC (enteroinvasive E. coli), UPEC (uropathogenic E. coli),
including E. coli endotoxin, J5 antigen (LPS, Lipid A, Gentabiose),
O poly- saccharides (serotype specific) EHEC Haemophilus influenza,
including H. influenza type b (polyribose phosphate) Hafnia alvei
Helicobacter pylori Hepatitis A, B, A, and others Human
immunodeficiency virus I and II (GP120, GP41, GP160, p24, and
others) Histoplasma capsulatum Klebsiella species, including
polysaccharides (serotype specific) Legionella species, including
L. micdadei, L. pneumophila Listeria monocytogenes Mycobacterium
species, including M. avium, M. kansasii, M. tuberculosis
Mycoplasma Neisseria species, including N. gonorrhoeae, N.
meningitidis (including serotype specific or protein antigens)
Nocardia asteroides Plasmodium species Pneumocystis carinii Polio
virus Pseudomonas aeruginosa, including serotype specific
polysaccharides Rabies virus Rhinovirus Rickettsia Rotavirus
Salmonella sp., including S. cholerasuis, S. enteriditis, S. typhi,
S. typhimurium Shigella species, including S. flexneri, S. sonnei,
S. boydii, S. dysenteriae Staphylococcus sp., including S. aureus,
polysaccharides from types 5 and 8 (serotype specific and common
protective antigens), S. epidermidis, serotype polysaccharide I,
II, and III (and common protective antigens) Streptococcus species,
all serotypes including S. pneumoniae (all serotypes), S. pyogenes,
including group A, group B (serotypes Ia, Ib, II, and III)
Treponema pallidum Varicella zoster Vibrio cholerae Yersinia
species, including Y. pestis, Y. pseudotuberculosis, Y.
enterocolitica
[0176] The sizes of his-intimin and portions of intimin, and
intimin-like proteins and portions thereof, that may be conjugated
to antigens appearing in Table 1 include RIHisEae (900/935 aa,
EcoRI-HindIII fragment of pEB313) and RVHindHis (604/935 aa,
EcoRV-HindIII fragment of pEB313), as set forth above in Example I.
Those of ordinary skill in the art will recognize that additional
fragments of varying lengths having adherence activity may be
selected within the spirit and scope of the invention. The efficacy
of the fragments considered for selection may be assessed according
to the procedures described in Example IV.
[0177] B. Construction of a Plasmid Expressing
N-His-IcsA-intimin-C.
[0178] Shigella flexneri causes bacillary dysentery in humans by
invading epithelial cells of the colonic mucosa (Labrec et al. J.
Becteriol. 88:1503-1518, (1964)). A 120 kDa outer membrane protein,
called IcsA, is necessary for intra- and intercellular spread of
this organism (Bernardini et al. Proc. Natl. Acad. Sci.
USA.86:3867-3871, (1989); Lett et al. J. Bacteriol. 171:353-359,
(1989)). An iscA mutant (SC560) was reasonably well tolerated by
orally infected macaque monkeys and elicited protection against
homologous challenge (Sansonetti et al. Vaccine 9:416-422,
1991).
[0179] The following protocol may be used (FIG. 18):
[0180] Transform pEB313 into a dam.sup.- host, such as DM1 (Gibco
BRL, P.O. Box 68, Grand Island, N.Y. 14072, 1-800-828-6686). Digest
pEB313/ClaI/HindIII, isolate 1796 bp fragment (this fragment
encodes the last 547 amino acids of intimin). Ligate into
pBluescriptSK+/ClaI/HindIII (pBluescriptSK+available from
Stratagene,11011 N. Torrey Pines Rd., La Jolla, Calif. 92037,
1-800-424-5444). Call this plasmid pEae1. Digest pHS3192 with AvaI,
fill in the end with Klenow fragment, digest with ClaI, isolate
2490 bp fragment [this fragment encodes 2923 bp or 974 aa's from
base pair #706-3629; the ORF of icsA spans from bp#574-3880, this
is 3306 bp and encodes 1102 aa's; reference for sequence of icsA is
Left et al., J. Bacteriol. 171:353 (1989)](pHS3192 available from
P. Sansonetti (ref Bernardini, M. L. et al. Proc. Natl. Acad. Sci.
USA. 86:3876 (1989)). Ligate the 2490 bp fragment into pEae1
digested with ClaI and HindIII, producing a plasmid called pEae2.
Using these restriction enzymes, the reading frames of icsA and eae
remain in frame. Digest pEae2 with XhoI and HindIII, isolate the
4286 bp fragment; ligate into pQE 32 (QIAGEN) digested with SmaI
and HindIII. This ligation will maintain the proper reading frame
of both genes with the promoter. The resulting plasmid is called
pIcsA-Eae.
[0181] Alternatively, one could fuse two genes in frame by cloning
with PCR, followed by ligation into the appropriate pQE vector.
This technique is well known to those of ordinary skill in the
art.
[0182] C. Preparation of a Conjugate Vaccine using His-Intimin as
the Protein Carrier.
[0183] While any polysaccharide could be used, in this vaccine the
capsular Vi polysaccharide of Salmonella typhi is used. Purify
His-intimin as in Example II; this would be conjugated to Vi
(purified from S. typhi according to established procedures (Szu et
al. J. Exp. Med. 166:1510 (1987)). The conjugation will proceed
using standard protein-polysaccharide conjugation technology well
known to those in the art. Methods of conjugation are well known to
those of ordinary skill in the art, and include the heteroligation
techniques of Brunswick, M. et al., J. Immunol. 140:3364, 1988. See
also Chemistry of Protein conjugates and Crosslinking, CRC Press,
Boston (1991).
[0184] Techniques to conjugate moieties to primary or secondary
carriers are well known to those skilled in the art, and include,
in part, coupling through available functional groups (such as
amino, carboxyl, thio and aldehyde groups). See S. S. Wong,
Chemistry of Protein Conjugate and Crosslinking CRC Press (1991);
and Brenkeley et al. Brief Survey of Methods for Preparing Protein
Conjugates With Dyes, Haptens and Cross-linking Agents,
Bioconjugate Chemistry 3 #1 (January 1992).
[0185] A vaccine such as that described in this example would
provide a prevention of diarrheal pathogens to include both those
organisms that express intimin (or intimin-like proteins), as well
as a diarrheal pathogen that expresses Vi.
[0186] Any combination of intimin plus other antigens from other
diarrheal pathogens can be combined. In addition, if
polysaccharides were used from organisms that produce other
diseases, such as pneumococcal polysaccharides, the
intimin-polysaccharide vaccine would be useful for prevention of
multiple diseases. Delivery of a vaccine against respiratory
pathogens will preferentially be done directly to the respiratory
tract; ingested pathogens through ingestion.
EXAMPLE IX
[0187] Generation and Testing of Adherence-Blocking Anti-Intimin
Antibodies: Polyclonal and Monoclonal
[0188] High titer polyclonal anti-intimin antisera are elicited
upon intraperitoneal injection of RIHisEae into mice, rabbits, and
goats. Testing of antibody titer and an antibody effectiveness
assay are shown. The generation of monoclonal antibodies is also
described.
[0189] A. Generation of Polyclonal Antibodies
[0190] Various techiques can be used to prepare antibodies against
full-length intimin or various portions thereof in various animals.
Several of these techniques are described below. As would be
recognized by one skilled in the are, polyclonal antibodies can be
generated from intimin and portions of intimin that are not
his-tagged and from intimin-like proteins and portions thereof.
[0191] 1. Generation of Mouse Anti-RIHisEae Polyclonal
Antibodies
[0192] The technique of Harlow, E. and D. Lane (eds) Antibodies--a
Laboratory Man. Cold Spring Harbor, N.Y. (1988) may be followed.
The general procedure is outlined herein. Take pre-bleeds of each
mouse to be immunized: Bleed from the tail vein into an eppendorf
tube. Incubate at 37.degree. C. for 30 min, stir gently with a
sterile toothpick (to loosen the clot), store overnight at
4.degree. C. In the morning, spin 10 min/10,000 rpm in the
microfuge, and collect the serum (i.e., supernatant; red blood
cells are the pellet). Store the serum at -20.degree. C. The sera
obtained will be used as a negative control after the mice are
immunized.
[0193] Inject a BALB/c mouse intraperitoneally with 25 .mu.g of
RIHisEae (using Titremax adjuvant, according to the instructions of
the manufacturer (CytRyx Corp., 154 Technology Pkwy., Norcross, Ga.
30092, 800-345-2987). Wait 2 weeks, boost with an identical shot,
wait 7 days and bleed from the tail vein into an eppendorf tube.
Incubate at 37.degree. C. for 30 min, stir gently with a sterile
toothpick (to loosen the clot), store overnight at 4.degree. C. In
the morning, spin 10 min/10,000 rpm in the microfuge, and collect
the serum. Store the sera at -20.degree. C.
[0194] 2. Generation of Mouse Anti-Third Third Portion of Intimin
Polyclonal Sera:
[0195] Mice are prebled by the tail vein as described above in
Example IX, part A. The third third portion of intimin is enriched
and dialyzed as described above in Example II. Mice are injected
with the third third portion of intimin mixed with TitreMax
adjuvant, as described in Example IX, part A. After 3 boosts, mice
are bled via the retro-orbital sinus, and sera prepared in
described Example IX, part A. Sera is tested by Western blot
analysis, as described for the goat polyclonal sera in section 4
below. Sera is assayed for the capacity to block EHEC adherence to
HEp-2 cells as described above in Example IX, part C.
[0196] 3. Generation of Rabbit Polyclonal Anti-Intimin
Antibodies
[0197] Rabbit polyclonal sera is generated against the (1) first
third, (2) second third, and (3) third third portions of intimin.
Each specific sera is separately assayed in HEp-2 adherence assays
for the capacity to block adherence of EHEC to HEp-2 cells.
[0198] Preparation of First Third Portion of Intimin for Rabbit
Immunization
[0199] Clone pMW101 is transformed into strain
DH5.alpha.F'lacl.sup.Q. Induction of protein expression and
purification of the His-tagged intimin fragment over the Ni-NTA
affinity resin is performed as described in the Qiagen manual that
accompanies their QIAexpressionist Ni-NTA resin purification kit
(Qiagen Inc., Chatsworth, Calif.). Eluted fractions are monitored
for protein content by A.sub.280 and by Bradford analysis, using a
dye reagent from Bio-Rad (Hercules, Calif.). Peak fractions eluted
from the Ni-NTA column (with 250 mM imidazole) are electrophoresed
on 15% polyacrylamide gels with SDS for analysis and purification.
To visualize the proteins on the gels for analysis, both silver
(Bio-Rad) and Coomassie Blue G-250 (Sigma) staining are used.
[0200] To purify the protein for immunization of animals to obtain
antisera, the peak column fractions are run on preparative SDS
polyacrylamide gels, and proteins are visualized with Copper stain
(Bio-Rad). The band of protein corresponding to the intimin
fragment is excised from the gel with a clean razor blade, and the
gel slice is destained according to the instructions provided with
the Copper stain reagent. Protein is then eluted from the gel slice
using an Electro-Eluter Model 422 (Bio-Rad) according to the
manufacturer's instructions. The protein is then concentrated using
a Centricon-10 concentrator from Amicon (Beverly, Mass.). The
majority of the SDS in the eluted protein sample is removed by one
of two methods. The first method involves addition of
phosphate-buffered saline (PBS) to the protein sample, which causes
precipitation of SDS. The majority of the protein does not
precipitate, and the precipitate is not analyzed to determine what
ions may also have precipitated. The SDS is pelleted by
centrifugation; and the supernatant, which contains most of the
protein and possibly some residual SDS, is removed and concentrated
using a Centricon-10 concentrator from Amicon (Beverly, Mass.).
[0201] The second method for removal of SDS involves preparing a
column of Extracti-Gel.sup.RD Detergent Removing Gel, purchased
from Pierce (Rockford, Ill.). The Extracti-Gel.sup.RD Detergent
Removing Gel is used according to the instructions of the
manufacturer. The purified protein is concentrated as described
above. Protein concentrations are determined by Bradford analysis
using dye reagent purchased from Bio-Rad and also by running
different volumes of purified protein on a gel adjacent to aliquots
of varying amounts of the original column fractions to compare the
amounts of proteins visually. Fractions of this purified protein
are analyzed by SDS-PAGE using both silver and Coomassie
staining.
[0202] Preparation of Second Third Portion of Intimin for Rabbit
Immunization
[0203] Purification of the His-tagged middle third fragment of the
intimin protein expressed from clone pMW102 is performed with the
same methods used for the N-terminal third, with the following
instructions. SDS-AGE analysis is done using 12.5% acrylamide gels.
For gel-purification of the protein and electrolution, most of the
preparative gels are stained with Copper stain as above; and one
gel is stained with Coomassie brilliant blue dissolved in water as
described in Harlow, E. and D. Lane (eds.) Antibodies--a Laboratory
Manual. Cold Spring Harbor, N.Y. (1988). Much of the SDS in the
electroeluted protein fractions is precipitated out by addition of
PBS buffer. For concentration of the protein, Amicon Centricon-30
concentrators are used (Amicon).
[0204] Preparation of Third Third Portion of Intimin for Rabbit
Immunization
[0205] The third third intimin protein is enriched and dialyzed as
described above in Example II. One mg of protein is run by SDS-PAGE
on four BioRad MiniProtean II gels. Protein is negatively stained
with copper stain (BioRad, cat # 161-0470, Richmond, Calif.)
according to the instructions of the manufacturer as follows: the
gel is rinsed in dH.sub.2O for 45 seconds, stained in 1.times.
copper stain for 5 minutes, and rinsed in dH.sub.2O for 3 minutes.
The gel is visualized against a black background, and the 37 kDa
protein band is cut from the gel with a razor. Purified gel slices
are then de-stained in buffer (25 mM Tris base, 192 mM glycine,
3.times./10 min), wrapped in plastic wrap and stored at -20.degree.
C. prior to immunization.
[0206] Immunization of Rabbits
[0207] New Zealand white female rabbits (5 to 6 lbs) are immunized
separately with the antigens prepared as described above according
to a schedule that could be readily determined by one skilled in
the art. An example of such a schedule is as follows:
2 DAY PROCEDURE 0 Prebleed/initial Inoculation, 100 .mu.g Ag mixed
with complete Freund's adjuvant 14 Boost, 50 .mu.g mixed with
incomplete Freund's adjuvant 21 Boost, 50 .mu.g mixed with
incomplete Freund's adjuvant 35 Test Bleed 45 Boost, 50 .mu.g mixed
with incomplete Freund's adjuvant 56 Test Bleed
[0208] The route of injection can be subcutaneous and/or
intramuscular at multiple sites. Sera derived from test bleeds is
tested for specific recognition of the antigen by Western Blot
analysis, as described for the goat polyclonal sera in section 4
below. When high titer recognition of the antigen is achieved, as
recognizable by one skilled in the art, the rabbit is exsanguinated
to recover the antibodies. The large volume sample of blood is
verified for specific recognition of the antigen by Western Blot
analysis.
[0209] Affinity Purification of Rabbit Anti-Intimin Polyclonal Sera
by Western Blot
[0210] Rabbit anti-intimin polyclonal sera is affinity purified to
remove cross-reacting antibodies not specific for intimin or
intimin-like proteins from the sera. (Harlowe, E. and D. Lane (eds)
Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y. (1988),
p. 498 or S. H. Lillie and S. S. Brown. Yeast. 3:63 (1987)).
RIHisEae (0.250 mg) is electrophoresed by SDS-PAGE (size: BioRad
MiniProtean II minigel, BioRad, Richmond, Calif.), transferred to
nitrocelullose, and stained with Ponceau S (Sigma, St. Louis, Mo.).
A strip of nitrocellulose containing the full length His-intimin
band (about 100 kDa) is excised with a razor, and the
nitrocellulose strip containing the protein is incubated overnight
at 4.degree. C. in 2% milk/TBS-0.2% Tween, shaking gently. The
nitrocellulose strip is washed briefly in TBS-Tween, and placed in
a container on top of a piece of Parafilm (American National Can,
Greenwich, Conn.). Rabbit sera is pipetted onto the mini-Western
blot (as much volume as will fit, about 400-500 .mu.l), and wet
paper towels are placed over the container, not touching the
nitrocellulose strip, followed by plastic wrap. The blot is shaken
gently for 5 hours, after which the sera (now called "depleted
sera") is removed and saved for analysis. The strip is washed 3
times in PBS for 10 minutes, and glycine buffer (150 mM NaCl, pH
2.3-with HCl) is added (as much volume as will fit onto the strip)
for 30 minutes. Affinity purified antibodies are pipetted off, and
{fraction (1/10)} volume Tris-HCl, pH 8.0 is added. Antibodies so
recovered are then neutralized with 1N NaOH and tested by Western
blot analysis as described below.
[0211] Affinity Purification of Rabbit Anti-Intimin Polyclonal Sera
by Antigen Affinity Column
[0212] Rabbit anti-intimin polyclonal sera is affinity purified to
remove cross-reacting antibodies not specific for intimin from the
sera. Antisera raised against intimin or various portions thereof
is purified using an antigen affinity column using techniques known
to those skilled in the art, such as those described in Harlow, E.
and D. Lane (eds.) Antibodies--a Laboratory Manual. Cold Spring
Harbor, N.Y. (1988).
[0213] The antigens (intimin or portions of intimin) are enriched
as described above in Example II. Antigens may be further purified
by electrophoresis on an acrylamide gel followed by electroelution
from a gel slice containing the protein as described below in part
4. Other methods may be substituted for gel-purification and
electroelution to further purify the protein after elution from the
Ni-NTA resin. These methods may include, but are not limited to,
ion-exchange column chromatography and gel filtration
chromatography. After purification, the intimin protein may need to
be dialyzed into an appropriate buffer for coupling to activated
beads to form the affinity resin for antisera purification.
[0214] Activated beads appropriate for coupling to the antigen are
selected based on several properties: coupling reagent, binding
group or-matrix, ligand attachment, and stability of the final
matrix (as listed in Harlow, E. and D. Lane (eds.) Antibodies--a
Laboratory Manual. Cold Spring Harbor, N.Y. (1988)). For example,
the purified initimin (or portion of intimin) protein antigen is
coupled to Affigel beads (Bio-Rad, Richmond, Calif.) according to
the instructions of the manufacturer. A column of the activated
beads coupled to the antigen is prepared and washed according to
instructions of the manufacturer of the beads. The column is then
washed according to the method described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988).
[0215] Ammonium sulfate precipitation is used to partially purify
the sera in preparation for the affinity column. Ammonium sulfate
precipitation, resuspension of the protein pellet in PBS, dialysis
of the solution versus PBS, and centrifugation to clarify the
solution are performed as described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988).
[0216] Antisera that has been partially purified by ammonium
sulfate precipitation and dialysis versus PBS is passed over the
antigen affinity column as described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988). The antisera may be passed over the column multiple times,
as this may lead to more complete binding of antibodies to the
column. The column is then washed and the affinity-purified
antibodies are eluted and dialyzed against PBS as described in
Harlow, E. and D. Lane (eds.) Antibodies--a Laboratory Manual. Cold
Spring Harbor, N.Y. (1988).
[0217] Adherence Assays
[0218] Affinity purified polyclonal sera is assayed in HEp-2 cell
adherence assays for the capacity to block bacterial binding to
HEp-2 cells using the method described below in Example IX, part
C.
[0219] 4. Generation of Goat Anti-RIHisEae Polyclonal
Antibodies
[0220] Pre-bleeds are taken of potential goats to be immunized.
Blood is collected from the jugular vein with indirect vacuum. Sera
is separated from the whole blood, as described above in Example
IX, section A, and tested by ELISA using RIHisEae as the adsorbent
(as described in Example IX, section B, below for the ELISA and
Example II above for the enrichment of RIHisEae), or by Western
blot analysis as described below. The goat chosen for immunization
has pre-immune sera with both (a) the lowest recognition of intimin
by Western blot analysis and (b) the lowest titer against intimin
by ELISA, and does not have the habit of jumping out of the
pasture.
[0221] Western Blot Analysis of Goat Anti-RIHisEae Polyclonal
Sera
[0222] a. Generation of Whole Cell Lysates
[0223] Desired strains (for example: 86-24, 86-24eae.DELTA.10,
DH5.alpha., M15 pREP4 pEB313) are grown overnight in LB containing
the appropriate antibiotics at 37.degree. C., with shaking. Cells
(4.5 ml) are pelleted in an eppendorf tube, and 500 .mu.l
sonication buffer (50 mM Na-phosphate pH 7.8, 300 mM NaCl) are
added. Cells are sonicated in 15 second pulses on ice, aliquoted
and frozen at -20.degree. C.
[0224] b. Western Blot Analysis
[0225] Whole cell lysates generated as described above (2-5 .mu.l)
or purified RIHisEae (2 .mu.l) are run by SDS-PAGE, transferred to
nitrocellulose, and used for Western blot analysis of goat sera.
The sera (primary antibody) is typically diluted 1:500 or 1:1000
for this purpose. The secondary antibody used is swine anti-goat
IgG conjugated to horseradish peroxidase (Boehringer Mannheim,
Indianapolis, Ind.), diluted 1:2000. Pre-bleeds of goat sera
usually contain several cross-reactive bands that are removed later
by affinity purification.
[0226] Preparation of Purified RIHisEae (Antigen) for Immunization
into Goat
[0227] One mg of RIHisEae, generated as described in Example II
above, is run by preparative SDS-PAGE. A small analytical lane is
stained with Colloidal Coomasie strain (Sigma, St. Louis, Mo.) and
used for comparison to the rest of the preparative gel. The high
molecular weight full-length intimin band (not stained, running at
about 100 kDa) is excised from the preparative gel with a razor,
and stored at 4.degree. C. prior to immunization.
[0228] Immunization of Goats with Antigen
[0229] Female goats (approximately one and a half years old,
purebred Saanan or Saanan.times.LaMANCHA) are immunized separately
with the antigens prepared as described above according to a
schedule that could be readily determined by one skilled in the
art. For example, the goat is given a primary immunization of 500
.mu.g of prepared RIHisEae mixed with Complete Freunds adjuvant. At
two week intervals the goat is boosted with 250 .mu.g Ag mixed with
incomplete Freunds adjuvant. Test bleeds are begun after the goat
has been immunized for a month, and continue until a high
anti-intimin titer is reached, as defined by Western blot analysis,
described above. When the sera recognizes intimin by Western blot,
large blood samples are taken (500 mls, resulting in about 250 mls
sera) per session, with two week intervals between large bleeds.
Resulting large-volume sera samples are verified for recognition of
intimin by Western blot analysis, as described above.
[0230] Affinity Purification of Goat Anti-Intimin Polyclonal sera
by Western Blot
[0231] Goat anti-intimin polyclonal sera is affinity purified to
remove cross-reacting antibodies not specific for intimin from the
sera. (Harlowe, E. and D. Lane (eds) Antibodies--a Laboratory
Manual. Cold Spring Harbor, N.Y. (1988), p. 498 or S. H. Lillie and
S. S. Brown. Yeast. 3:63 (1987)). RIHisEae (0.250 mg) is
electrophoresed by SDS-PAGE (size: BioRad MiniProtean II minigel,
BioRad, Richmond, Calif.), transferred to nitrocelullose, and
stained with Ponceau S (Sigma, St. Louis, Mo.). A strip of
nitrocellulose containing the full length His-intimin band (about
100 kDa) is excised with a razor, and the nitrocellulose strip
containing the protein is incubated overnight at 4.degree. C. in 2%
milk/TBS-0.2% Tween, shaking gently. The nitrocellulose strip is
washed briefly in TBS-Tween, and placed in a container on top of a
piece of Parafilm (American National Can, Greenwich, Conn.). Goat
sera is pipetted onto the mini-Western blot (as much volume as will
fit, about 400-500 .mu.l), and wet paper towels are placed over the
container, not touching the nitrocellulose strip, followed by
plastic wrap. The blot is shaken gently for 5 hours, after which
the sera (now called "depleted sera") is removed and saved for
analysis. The strip is washed 3 times in PBS for 10 minutes, and
glycine buffer (150 mM NaCl, pH 2.3-with Hcl) is added (as much
volume as will fit onto the strip) for 30 minutes. Affinity
purified antibodies are pipetted off, and {fraction (1/10)} volume
Tris-HCl, pH 8.0 is added. Antibodies are then neutralized with 1N
NaOH and tested by Western blot analysis as described above.
[0232] Affinity Purification of Goat Anti-Intimin Polyclonal sera
by Antigen Affinity Column
[0233] Goat anti-intimin polyclonal sera is affinity purified to
remove cross-reacting antibodies not specific for intimin from the
sera. Antisera raised against intimin or various portions thereof
is purified using an antigen affinity column using techniques known
to those skilled in the art, such as those described in Harlow, E.
and D. Lane (eds.) Antibodies--a Laboratory Manual. Cold Spring
Harbor, N.Y. (1988).
[0234] The antigens (intimin or portions of intimin) are enriched
as described above in Example II. Antigens may be further purified
by electrophoresis on an acrylamide gel followed by electroelution
from a gel slice containing the protein as described below in part
4. Other methods may be substituted for gel-purification and
electroelution to further purify the protein after elution from the
Ni-NTA resin. These methods may include, but are not limited to,
ion-exchange column chromatography and gel filtration
chromatography. After purification, the intimin protein may need to
be dialyzed into an appropriate buffer for coupling to activated
beads to form the affinity resin for antisera purification.
[0235] Activated beads appropriate for coupling to the antigen are
selected based on several properties: coupling reagent, binding
group or matrix, ligand attachment, and stability of the final
matrix (as listed in Harlow, E. and D. Lane (eds.) Antibodies--a
Laboratory Manual. Cold Spring Harbor, N.Y. (1988)). For example,
the purified initimin (or portion of intimin) protein antigen is
coupled to Affigel beads (Bio-Rad, Richmond, Calif.) according to
the instructions of the manufacturer. A column of the activated
beads coupled to the antigen is prepared and washed according to
instructions of the manufacturer of the beads. The column is then
washed according to the method described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988).
[0236] Ammonium sulfate precipitation is used to partially purify
the sera in preparation for the affinity column. Ammonium sulfate
precipitation, resuspension of the protein pellet in PBS, and
dialysis of the solution versus PBS and centrifugation to clarify
the solution is performed as described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988).
[0237] The antisera that has been partially purified by ammonium
sulfate precipitation and dialysis versus PBS is passed over the
antigen affinity column as described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988). The antisera may be passed over the column multiple times,
as this may lead to more complete binding of antibodies to the
column. The column is then washed and the affinity-purified
antibodies are eluted and dialyzed against PBS as described in
Harlow, E. and D. Lane (eds.) Antibodies--a Laboratory Manual. Cold
Spring Harbor, N.Y. (1988).
[0238] Adherence assays
[0239] Affinity purified polyclonal sera is assayed in HEp-2 cell
adherence assays for the capacity to block bacterial binding to
HEp-2 cells using the method described below in Example IX, part
C.
[0240] B. ELISA to Test Titer of Antibodies
[0241] The technique of Harlow, E. and D. Lane (eds) Antibodies--a
Laboratory Manual. Cold Spring Harbor, N.Y. (1988) may be followed.
The general procedure is outlined below:
[0242] (1) bind RIHisEae to plastic microtiter plates at 50 ng/well
in PBS. Incubate 2h/RT (room temp) or overnight at 4.degree. C.
[0243] (2) wash plate 2.times. with PBS.
[0244] (3) block wells with 100 .mu.l blocking solution [3% bovine
serum albumin (Sigma Chemical, St. Louis, Mo.), 0.02% sodium azide
(Sigma) in PBS--store stock at 4.degree. C.] for 1-2 h at RT.
[0245] (4) wash plate 2.times. with PBS.
[0246] (5) primary Ab=50 .mu.l test sera diluted in blocking
solution for example, start with 1:50 and do eleven 1:2 dilutions,
or start with 1:50 and do eleven 1:10 dilutions), incubate 2
h/RT.
[0247] (6) wash 4.times. with PBS.
[0248] (7) secondary Ab=goat horseradish-conjugated anti-mouse (or
other animal being tested) Ig, affinity purified (Boehringer
Mannheim Corp., 9115 Hague Rd., P.O. Box 50414, Indianapolis, Ind.
46250, 800-262-1640). Add secondary Ab diluted 1:500 in blocking
solution without azide. Incubate 1h/RT.
[0249] (8) wash 4.times. with PBS.
[0250] (9) add 100 .mu.l TMB Peroxidase substrate to each well
(prepared according to the instructions of the manufacturer, BioRad
Labs, 3300 Regatta Blvd., Richmond, Calif. 94804). Allow blue color
to develop (no more than 10 min). Stop the reaction with 100 .mu.l
H.sub.2SO.sub.4. Read the plate at 450 nm.
[0251] A titer is defined as an absorbance value .gtoreq.0.2 units
above that obtained for mouse pre-immune sera.
[0252] Anti-intimin antibodies may be administered to provide
passive immune protection to a patient in need thereof. Moreover,
anti-intimin antibodies obtained from animals may be used
clinically in humans. In such cases, it is preferable to humanize
the antibody. Such techniques are well known to those of ordinary
skill in the art. See, for example, G. Winter et al., "Man-made
antibodies," Nature, 349: 293-299 (1991); P. T. Jones et al.,
"Replacing the complementarity-determining regions in a human
antibody with those from a mouse," Nature, 321: 522-525 (1986); P.
Carter et al., "Humanization of an anti-p185.sup.HER2 antibody for
human cancer therapy," Proc. Natl. Acad. Sci. USA, 89: 4285-4289
(1992). Such antibodies may be given to the sibling of an infected
patient to reduce the risk of infection of the sibling.
[0253] C. Western Blot Analysis of Anti-RIHisEae Polyclonal
Sera
[0254] Polyclonal sera is assayed by Western blot analysis to
verify recognition of intimin.
[0255] 1. Generation of Whole Cell Lysates
[0256] Desired strains (for example: 86-24, 86-24eae.DELTA.10,
DH5a, M15 pREP4 pEB313) are grown overnight in LB containing the
appropriate antibiotics at 37.degree. C., with shaking. Cells (4.5
ml) are pelleted in an eppendorf tube, and 500 .mu.l sonication
buffer (50 mM Na-phosphate pH 7.8, 300 mM NaCl) are added. Cells
are sonicated in 15 second pulses on ice, aliquoted and frozen at
-20.degree. C.
[0257] 2. Western Blot Analysis
[0258] Whole cell lysates generated as described above (2-5 .mu.l)
or purified RIHisEae (2 .mu.l) are run by SDS-PAGE, transferred to
nitrocellulose, and used for Western blot analysis of sera. The
sera (primary antibody) is typically diluted 1:500 or 1:1000 for
this purpose. The secondary antibody is specific for the animal
that is the source of the primary antibody and is conjugated to
horseradish peroxidase. Pre-bleeds of sera may contain several
cross-reactive bands that are removed later by affinity
purification.
[0259] D. Affinity Purification of Anti-Intimin Polyclonal sera by
Western Blot
[0260] Anti-intimin polyclonal sera is affinity purified to remove
cross-reacting antibodies not specific for intimin from the sera.
(Harlowe, E. and D. Lane (eds) Antibodies--a Laboratory Manual.
Cold Spring Harbor, N.Y. (1988), p. 498 or S. H. Lillie and S. S.
Brown. Yeast. 3:63 (1987)). RIHisEae (0.250 mg) is electrophoresed
by SDS-PAGE (size: BioRad MiniProtean II minigel, BioRad, Richmond,
Calif.), transferred to nitrocelullose, and stained with Ponceau S
(Sigma, St. Louis, Mo.). A strip of nitrocellulose containing the
full length His-intimin band (about 100 kDa) is excised with a
razor, and the nitrocellulose strip containing the protein is
incubated overnight at 4.degree. C. in 2% milk/TBS-0.2% Tween,
shaking gently. The nitrocellulose strip is washed briefly in
TBS-Tween, and placed in a container on top of a piece of Parafilm
(American National Can, Greenwich, Conn.). Sera is pipetted onto
the mini-Western blot (as much volume as will fit, about 400-500
.mu.l), and wet paper towels are placed over the container, not
touching the nitrocellulose strip, followed by plastic wrap. The
blot is shaken gently for 5 hours, after which the sera (now called
"depleted sera") is removed and saved for analysis. The strip is
washed 3 times in PBS for 10 minutes, and glycine buffer (150 mM
NaCl, pH 2.3-with Hcl) is added (as much volume as will fit onto
the strip) for 30 minutes. Affinity purified antibodies are
pipetted off, and {fraction (1/10)} volume Tris-HCl, pH 8.0 is
added. Antibodies are then neutralized with 1 N NaOH and tested by
Western blot analysis as described above.
[0261] E. Affinity Purification of Anti-Intimin Polyclonal Sera by
Antigen Affinity Column
[0262] Rabbit anti-intimin polyclonal sera is affinity purified to
remove cross-reacting antibodies not specific for intimin from the
sera. Antisera raised against intimin or various portions thereof
is purified using an antigen affinity column using techniques known
to those skilled in the art, such as those described in Harlow, E.
and D. Lane (eds.) Antibodies--a Laboratory Manual. Cold Spring
Harbor, N.Y. (1988).
[0263] The antigens (intimin or portions of intimin) are enriched
as described above in Example II. Antigens may be further purified
by electrophoresis on an acrylamide gel followed by electroelution
from a gel slice containing the protein as described below in part
4. Other methods may be substituted for gel-purification and
electroelution to further purify the protein after elution from the
Ni-NTA resin. These methods may include, but are not limited to,
ion-exchange column chromatography and gel filtration
chromatography. After purification, the intimin protein may need to
be dialyzed into an appropriate buffer for coupling to activated
beads to form the affinity resin for antisera purification.
[0264] Activated beads appropriate for coupling to the antigen are
selected based on several properties: coupling reagent, binding
group or matrix, ligand attachment, and stability of the final
matrix (as listed in Harlow, E. and D. Lane (eds.) Antibodies--a
Laboratory Manual. Cold Spring Harbor, N.Y. (1988)). For example,
the purified initimin (or portion of intimin) protein antigen is
coupled to Affigel beads (Bio-Rad, Richmond, Calif.) according to
the instructions of the manufacturer. A column of the activated
beads coupled to the antigen is prepared and washed according to
instructions of the manufacturer of the beads. The column is then
washed according to the method described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988).
[0265] Ammonium sulfate precipitation is used to partially purify
the sera in preparation for the affinity column. Ammonium sulfate
precipitation, resuspension of the protein pellet in PBS, and
dialysis of the solution versus PBS and centrifugation to clarify
the solution is performed as described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988).
[0266] The antisera that has been partially purified by ammonium
sulfate precipitation and dialysis versus PBS is passed over the
antigen affinity column as described in Harlow, E. and D. Lane
(eds.) Antibodies--a Laboratory Manual. Cold Spring Harbor, N.Y.
(1988). The antisera may be passed over the column multiple times,
as this may lead to more complete binding of antibodies to the
column. The column is then washed and the affinity-purified
antibodies are eluted and dialyzed against PBS as described in
Harlow, E. and D. Lane (eds.) Antibodies--a Laboratory Manual. Cold
Spring Harbor, N.Y. (1988).
[0267] F. Assay for Blocking of Bacterial Binding by Antibodies to
Intimin
[0268] To assess the effect of anti-intimin antibodies on EHEC
adherence, mouse, rabbit, or goat anti-intimin antisera (or normal
sera as controls) are added to EHEC bacteria suspended in adherence
media, and the bacteria-antisera mixtures are incubated at
37.degree. C. for thirty minutes prior to infection of HEp-2 cells.
Antisera are maintained in the adherence media throughout the
assay. Adherence and related sequelae are microscopically observed
using GIEMSA and FITC-phalloidin (FAS) staining as described
above.
[0269] To assess the effect of anti-intimin antibodies on adherence
of other bacteria having intimin-like proteins, mouse, rabbit, or
goat anti-intimin antisera (or normal sera as controls) are added
to EHEC bacteria suspended in adherence media, and the
bacteria-antisera mixtures are incubated at 37.degree. C. for
thirty minutes prior to infection of HEp-2 cells.
[0270] Other embodiments of the invention will be apparent to those
skilled in the art from consideration of the specification and
practice of the invention disclosed herein. It is intended that the
specification and examples be considered as exemplary only, with a
true scope and spirit of the invention being indicated by the
following claims.
[0271] G. Raising Monoclonal Antibodies Specific for Intimin
[0272] Monoclonal antibodies directed against intimin are used to
passively protect a patient against colonization by EHEC (or
bacteria expressing intimin-like proteins). Monoclonal antibodies
are generated from mouse cells, and the specificity of these
antibodies are changed for use in humans. G. winter et al.,
"Man-made antibodies," Nature, 349: 293-299 (1991); P. T. Jones et
al., "Replacing the complementarity-determining regions in a human
antibody with those from a mouse," Nature, 321: 522-525 (1986); P.
Carter et al., "Humanization of an anti-p185.sup.HER2 antibody for
human cancer therapy," Proc. Natl. Acad. Sci. USA, 89:
4285-4289(1992). Monoclonal Abs represent a more "pure" antibody
for administration to a patient.
[0273] 1. Generation of Anti-Eae Monoclonal Antibodies
[0274] Two examples of methods for generating anti-intimin
monoclonal antibodies are described below.
[0275] a. Method 1
[0276] Generation of anti-Eae mAbs
[0277] The procedure outlined in Harlow, E. and D. Lane,
Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y. (1988) is
followed with modifications. Nine week old female BALB/c (Harlan
Spraque-Dawley, Indianapolis, Ind.) are used for the production of
monoclonal antibodies. Prior to immunization, a serum sample is
obtained from each mouse via the retro-orbital sinus. The whole
blood is placed into a microfuge tube and allowed to cool at
4.degree. C. for between 4 and 16 hours. Serum is prepared by
centrifugation of the whole blood at 1000-1200.times.g for 15
minutes at 10-15.degree. C. The serum is transferred to new
microfuge tubes using a micropipettor and sterile pipets tips. The
serum is stored at -20.degree. C. until use.
[0278] The antigen is obtained from SDS-PAGE gels of RIHisEae,
obtained as described above in Example II. The high molecular
weight intimin band is excised with a razor, as described above in
Example IX, section A, part 4. One mg of RIHisEae is run onto four
MiniProtean II gels (BioRad, Richmond, Calif.) for this purpose.
Protein excised from the gels are made into a slurry in
approximately 8 mls of phosphate buffered saline (PBS) using a
mortar and pestle. On experimental day 0, a 0.8 ml portion of the
slurry is mixed with 1.2 mls of complete Freund's adjuvant (CFA)
and injected in 0.2 ml aliquots subcutaneously into each of four
mice. A 0.5 ml portion of the slurry is mixed with 0.5 mls of RIBI
T-700 adjuvant (RIBI Immunochem, Hamilton, Montana) and 0.2 mls is
injected into each of four additional mice.
[0279] Mice receive booster injections on experimental days 21 and
42. The antigen is prepared as described above, with the exception
that incomplete Freund's adjuvant (IFA) is used instead of CFA.
[0280] Serum samples are obtained as described above on
experimental days 14, 35 and 49.
[0281] Serum samples are tested by immunoassay (as described
-below) to identify mice producing serum with the strongest
response to Eae, as would be recognized to those skilled in the
art. The reactivity of the serum samples is verified by Western
blot analysis as described above in Example IX, section A, part 4.
Three days prior to fusion (on experimental day 59), the mouse
chosen for fusion is immunized with a 50% mixture of supernatant
from the intimin slurry in PBS. A total of 0.1 mls of this slurry
is injected intravenously via the tail vein.
[0282] Spleen cells from the chosen mouse are fused with SP2/0
myeloma cells (Cat # CRL1581 American Type Culture Collection,
Rockville, Md. 20850, 301-881-2600). A ratio of 10 spleen cells: 1
myeloma is used for the fusion. Fusion is accomplished by the use
of polyethylene glycol (Cat # 783 641 Boehringer-Mannheim Corp.,
9115 Hague Road, PO Box 50414, Indianapolis, Ind. 46250,
800-262-1640). Fused cells are distributed into 96-well tissue
culture dishes for growth. Hybridomas are selected by growth of the
cultures for 10 days in medium containing hypoxanthine, aminopterin
and thymidine. Hybridomas secreting anti-intimin specific
antibodies are identified from the 96-well tissue culture dishes by
immunoassay as described below. Cultures positive for antibodies
reactive with Eae are expanded by transfer to 24-well dishes,
retested for reactivity with Eae by immunoassay and cloned twice by
limiting dilution.
[0283] Immunoassay (ELISA) of Mouse Polyclonal Anti-Intimin Serum
and Hybridoma Supernatants (Anti-Intimin Monoclonal Antibodies)
[0284] A three ml portion of the intimin slurry used for
immunization is centrifuged at approximately 1000.times.g for 15
minutes at room temperature. A sample of the resulting, clarified
supernatant is used to coat immunoassay plates. Briefly, the
intimin-containing supernatant is diluted 1:300 in PBS and used as
a coating antigen. Nunc Maxisorp Stripwells are coated with 100
.mu.l/well of the diluted supernatant for 2-24 hours at room
temperature.
[0285] Unbound material is washed from the wells with four washes
of PBS containing 0.5% Tween-20 (PBS-T). For assays of serum
samples, multiple dilutions of each sample are prepared in PBS-T
and added to replicate wells. For assays of culture supernatants
from 96-well dish cultures, each supernatant is diluted 1:2 in
PBS-T and added to a single well. Supernatants from 24-well dish
cultures are also diluted 1:2 in PBS-T and tested in duplicate.
Assays of serum samples include a buffer control and a known
polyclonal anti-intimin control. Assays of supernatants include a
buffer control, medium control and a known polyclonal anti-intimin
control.
[0286] Serum and supernatants are allowed to incubate in a
draft-free environment at room temperature for 30-60 minutes on the
intimin-coated wells and unbound antibodies and extraneous material
(such as serum proteins) are washed from the wells with four washes
of PBS-T. Each well then receives 100 .mu.l of rabbita anti-mouse
IgG (gamma specific)-HRP (Zymed, South San Francisco, Calif.),
diluted 1:4000 in PBS-T.
[0287] The plates are again allowed to incubate in a draft-free
environment at room temperature for 30-60 minutes. Each well then
receives 100 .mu.l of one-component TMB substrate solution
(Kirkegaard and Perry Labs, Gaithersburg, Md. 20878, 301-948-7755).
The reaction is allowed to proceed for 15 minutes in the dark and
then stopped by the addition of 80 .mu.l/well of TMB stop reagent
(Kirkegaard and Perry Labs, Gaithersburg, Md. 20878,
301-948-7755).
[0288] b. Method 2
[0289] The procedure outlined in Harlow, E. and D. Lane,
Antibodies, A Laboratory Manual. Cold Spring Harbor, N.Y. (1988) is
followed: Five 4- to 5-week old female BALB/cJ mice are prebled,
and immunized intraperitoneally with 25 .mu.g RIHisEae suspended in
100 .mu.l of TiterMax. Mice are boosted twice in two week
intervals, intraperitoneally with 25 .mu.g RIHisEae suspended in
100 .mu.l of TiterMax. Seven days after each boost, blood
(.about.300-500 .parallel.l) is collected from the tail vein. Sera
are assayed for the presence of anti-RIHisEae antibody by ELISA (as
described above).
[0290] Mice producing high titers of anti-RIHisEae antibodies are
boosted both intravenously and intraperitoneally with 25 .mu.g of
RIHisEae in 100 .mu.l of PBS, sacrificed three days later, and sera
collected. Spleen cells are isolated and fused to Sp2/0-Ag mouse
myeloma cells (ATCC #CRL1581) at a ratio of 10 spleen cells to 1
myeloma cell. Fused cells are distributed into microdilution
plates, and culture supernatants are assayed by ELISA after 3-4
weeks of culture for RIHisEae antibodies. Cultures positive for
production of anti-RIHisEae antibodies are expanded and cloned
twice by limiting dilution.
[0291] 2. Determination of Whether Anti-RIHIsEae mAbs Recognize
Conformational or Linear Epitopes
[0292] Reactivities of the mAbs are compared by: 1) ELISA in which
native RIHisEae is used as the adsorbent; and 2) immunoblot of
RIHisEae denatured and separated by SDS-PAGE. Several pools of mAbs
are obtained: 1) those that recognize only conformational epitopes
and react positively by ELISA but not by immunoblot analysis; 2)
those that recognize linear epitopes and react in both assays; and
3) those that recognize linear epitopes and react positively by
immunoblot analysis, but not by ELISA. In addition, colony
immunoblots of unlysed cells are done to determine if the mAbs
recognize Eae expressed on the surface of the wild type strain
86-24.
[0293] 3. Testing of Anti-eae mAbs for Capacity to Block Adherence
of Strain 86-24 to HEp-2 Cells
[0294] Strain 86-24 is subjected to a qualitative adherence assay
on HEp-2 cells and tested in parallel with bacteria that have been
pre-incubated with various dilutions of anti-RIHisEae mAbs.
[0295] Selected adherence-blocking and conformational mAbs are
subjected to isotype determination (Immunopure mAb Typing Kit,
Pierce, Rockford, Ill.). Unique antibodies are then purified by
affinity chromatography on a Protein G Sepharose column (Pharmacia,
Piscataway, N.J.). The resulting affinity-purified mAbs are
re-tested for capacity to block adherence of strain 86-24 to Hep-2
cells to ensure that the antibody remains functional after
purification.
[0296] H. Use of Polyclonal and Monoclonal Anti-Intimin Antibodies
in Diagnostic Kits.
[0297] Diagnostic kits can be used to detect intimin-expressing
bacteria, preferably EHEC. A general description of the preparation
and use of such kits is provided in copending U.S. application Ser.
No. 08/412,231, filed Mar. 10, 1995, the disclosure of which is
incorporated herein by reference.
[0298] Other embodiments of the invention will be apparent to those
skilled in the art from consideration of the specification and
practice of the invention disclosed herein. It is intended that the
specification and examples be considered as exemplary only, with a
true scope and spirit of the invention being indicated by the
following claims.
Sequence CWU 1
1
* * * * *