U.S. patent application number 11/129003 was filed with the patent office on 2005-10-27 for non-aggregating non-quenching oligomers comprising nucleotide analogs; methods of synthesis and use thereof.
This patent application is currently assigned to Epoch Biosciences, Inc.. Invention is credited to Dempcy, Robert O., Gall, Alexander A., Kutyavin, Igor V., Vermeulen, Nicolaas M.J..
Application Number | 20050239121 11/129003 |
Document ID | / |
Family ID | 23778351 |
Filed Date | 2005-10-27 |
United States Patent
Application |
20050239121 |
Kind Code |
A1 |
Gall, Alexander A. ; et
al. |
October 27, 2005 |
Non-aggregating non-quenching oligomers comprising nucleotide
analogs; methods of synthesis and use thereof
Abstract
The invention provides compositions and methods for improved
hybridization analysis utilizing DNA, RNA, PNA and chimeric
oligomers in which one or more purine bases are substituted by a
pyrazolo[5,4-d]pyrimidine or by a 7-deazapurine purine analogue.
Reduced self-aggregation and reduced fluorescence quenching are
obtained when the oligomers are used in various methods involving
hybridization. Methods of synthesis, as well as novel synthetic
precursors, are also provided.
Inventors: |
Gall, Alexander A.;
(Bothell, WA) ; Kutyavin, Igor V.; (Bothell,
WA) ; Vermeulen, Nicolaas M.J.; (Woodinville, WA)
; Dempcy, Robert O.; (Kirkland, WA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Epoch Biosciences, Inc.
Bothell
WA
|
Family ID: |
23778351 |
Appl. No.: |
11/129003 |
Filed: |
May 13, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11129003 |
May 13, 2005 |
|
|
|
10702007 |
Nov 4, 2003 |
|
|
|
10702007 |
Nov 4, 2003 |
|
|
|
09447936 |
Nov 23, 1999 |
|
|
|
6660845 |
|
|
|
|
Current U.S.
Class: |
435/6.14 ;
514/262.1; 514/265.1; 514/44R; 544/244 |
Current CPC
Class: |
C12Q 1/6832 20130101;
C12Q 2525/101 20130101; C12Q 2525/107 20130101; C07H 21/00
20130101; C07K 14/003 20130101; C12Q 1/6832 20130101; C07D 487/04
20130101; C07K 5/06026 20130101; C07K 5/06139 20130101; A61K 31/519
20130101; C12Q 1/6818 20130101 |
Class at
Publication: |
435/006 ;
514/262.1; 514/265.1; 514/044; 544/244 |
International
Class: |
C12Q 001/68; A61K
031/519; A61K 048/00 |
Claims
1. A composition comprising: 14wherein R.sub.1 and R.sub.2 are
independently --H, --OH, --OR.sub.6, --SH, --NH.sub.2 or
--NHR.sub.7; R.sub.3 is --H--CN, halogen (F, Cl, Br or I), or
--R.sub.12--Y, wherein R.sub.12 is C.sub.1-C.sub.12 alkyl, alkenyl
or alkynyl and Y is --H, --OH, --NH.sub.2 or --SH; R.sub.6 is --H,
--C.sub.6H.sub.5 (benzyl) or a diphenylcarbamoyl (DPC) group;
R.sub.7 is a protecting group selected from the group consisting of
2-N-dimethylvinyl, benzyloxycarbonyl (Cbz), monomethoxytrityl
(MMtr), benzoyl (bz), isobutyryl (iBu), isobutanoyl, acetyl, and
anisoyl (An) groups; and X is .dbd.CH-- or N--.
2. A composition comprising 15wherein R.sub.1 and R.sub.2 are
independently --H, --OH, --OR.sub.6, --SH, --NH.sub.2 or
--NHR.sub.7 R.sub.3 is --H, --CN, halogen (F, Cl, Br or I), or
--R.sub.12--Y, wherein R.sub.12 is C.sub.1-12 alkyl, alkenyl or
alkynyl and Y is --H, --OH, --NH.sub.2 or --SH; X is .dbd.CH-- or
.dbd.N--; R.sub.4 is --H or a protecting, group selected from the
group consisting of tert-butyloxycarbonyl (tBoc),
4-methoxyphenyldiphenylmethyl (MMTr), isobutyryl (iBu) and
9-fluoronylmethyloxycarbonyl (Fmoc); R.sub.5 is --H or
--C.sub.6F.sub.4H (TFP); R.sub.6 is --H, --C.sub.6H.sub.5 (benzyl)
or a diphenylcarbamoyl (DPC) group; and R.sub.7 is a protecting
group selected from the group consisting of 2-N-dimethylvinyl,
benzyloxycarbonyl (Cbz), monomethoxytrityl (MMtr), benzoyl (bz),
isobutyryl (iBu), isobutanoyi, acetyl, and anisoyl (An) groups.
3. The composition of claim 2 wherein: R.sub.1 is --OH; R.sub.2 is
--NHCOCH(CH.sub.3).sub.2; R.sub.3 is --H; R.sub.4 is MMTr; and
R.sub.5 is --H.
4. The composition of claim 2 wherein: R.sub.1 is --OH; R.sub.2, is
--N.dbd.CH--N(CH.sub.3).sub.2; R.sub.3 is --H; R.sub.4 is MMTr; and
R.sub.5 is --H.
5. The composition of claim 2 wherein: R.sub.1 is --NHAn; R.sub.2
is --H; R.sub.3 is --H; R.sub.4 is MMTr; and R.sub.5 is --H.
6. The composition of claim 2 wherein: R.sub.1 is
--N.dbd.CH--N(CH.sub.3).- sub.2; R.sub.2 is --H; R.sub.3 is --H;
R.sub.4 is MMTr; and R.sub.5 is --H.
7. The composition of claim 2 wherein: R.sub.1 is --OH; R.sub.2 is
--H; R.sub.3 is --H; R.sub.4 is MMTr; and R.sub.5 is --H.
8. A method for synthesizing an oligomer, wherein the oligomer
comprises one or more peptide nucleic acid residues, wherein the
method comprises stepwise cycles of monomer addition to a growing
oligomer chain that is optionally attached to a solid support,
wherein he growing oligomer chain contains a blocked growing end,
and wherein one or more of the monomer addition cycles comprises
the following steps: a) treatment of the growing chain under,
conditions that de-block the growing end; b) treatment of the
composition of claim 2 with an activating agent, if R.sub.5 is --H;
c) condensation of the products of steps (a) and (b); d) optionally
repeating the cycle of steps (a)-(c); and e) at the completion of
synthesis of the oligomer, exposure of the completed oligomer to
conditions that remove all blocking groups and, if necessary,
cleave the completed oligomer from the support.
9. The method of claim 8, wherein the oligomer is a peptide nucleic
acid.
10. The method of claim 8, wherein the oligomer is a PNA/DNA
chimera.
11. An oligomer synthesized according. to the method of claim
8.
12. An oligomer according to claim 11, wherein the oligomer is a
peptide nucleic acid.
13. An oligomer according to claim 11, wherein the oligomer, is a
PNA/DNA chimera.
14-26. (canceled)
27. A method for detecting a target sequence in a polynucleotide
wherein the improvement comprises: use of a probe, complementary to
the target sequence, wherein one or more residues in the probe
comprises abase analogue, wherein the base analogue is selected
from the group consisting of pyrazolopyrimidines and deazapurines,
such that the base analogues retain the base-pairing specificity of
the bases for which they are substituted and reduce the tendency of
the probe to self-associate.
28. The method of claim 27 wherein the probe comprises DNA.
29. The method of claim 27 wherein the probe comprises peptide
nucleic acid (PNA).
30. The method of claim 27 wherein the probe comprises a PNA/DNA
chimera.
31. The method of claim 27, wherein the base analogue has the
structure 16wherein R.sub.1 and R.sub.2 are independently --H,
--OH, --SH, or --NH.sub.2; R.sub.3 is --H, --CN, halogen (F, Cl, Br
or I), or --R.sub.12--Y, wherein R.sub.12 is C.sub.1-C.sub.12
alkyl, alkenyl or alkynyl and Y is --H, --OH, --NH.sub.2 or --SH;
and X is .dbd.CH-- or N--.
32. The method of claim 31 wherein one or more guanine bases in the
probe are substituted by PPG.
33. The method of claim 31 wherein one or more adenine bases in the
probe are substituted by PPA.
34. The method of claim 27, wherein the probe further comprises a
minor groove binder.
35. The method of claim 27, wherein the probe further comprises a
fluorophore.
36. The method of claim 35, wherein the probe further comprises a
fluorescence quencher.
37. The method of claim 35, wherein the probe further comprises a
minor groove binder.
38. The method of claim 36, wherein the probe further comprises a
minor groove binder.
39. The method of claim 29, wherein the probe further comprises a
minor groove binder.
40. The method of claim 29, wherein the probe further comprises a
fluorophore.
41. The method of claim 40, wherein the probe further comprises a
fluorescence quencher.
42. The method of claim 40, wherein the probe further comprises a
minor groove binder.
43. The method of claim 41, wherein the probe further comprises a
minor groove binder.
44. A method for the detection of a target sequence in a
polynucleotide using a probe comprising a polymeric portion and a
fluorescent portion, wherein the polymeric portion comprises a
plurality of monomers; the improvement comprising one or more of
the monomers in the probe comprises a base analogue, wherein the
base analogue is selected from the group consisting of
pyrazolopyrimidines and deazapurines; such that the base analogues
retain the base-pairing specificity of the bases f which they. are
substituted and reduce the tendency of the polymeric portion of the
probe to quench emission from the fluorescent portion.
45. The method of claim 44 wherein the polymeric portion of the
probe comprises DNA.
46. The method of claim 44 wherein the polymeric portion of the
probe comprises peptide nucleic acid (PNA).
47. The method of claim 44 wherein the polymeric portion of the
probe comprises a PNA/DNA chimera.
48. The method of claim 44, wherein the base analogue has the
structure 17wherein R.sub.1 and R.sub.2 are independently --H,
--OH, --SH, or --NH.sub.2; R.sub.3 is --H, --CN, halogen (F, Cl, Br
or I), or --R.sub.12--Y, wherein R.sub.12 is C.sub.1-C.sub.12
alkyl, alkenyl or alkynyl and Y is --H, --OH, --NH.sub.2 or --SH;
and X is .dbd.CH-- or .dbd.N--.
49. The method of claim 48 wherein one or more guanine bases in the
polymeric portion of the probe are substituted by PPG.
50. The method of claim 49 wherein three or more consecutive
guanine bases in the polymeric portion of the probe are substituted
by PPG.
51. The method of claim 49, wherein a PPG residue is adjacent to
the fluorescent portion of the probe.
52. The method of claim 44, wherein the probe: further comprises a
quenching portion.
53. The method of claim 51, wherein the probe further comprises a
quenching portion.
54. The method of claim 44, wherein the probe further comprises a
minor groove binder.
55. The method of claim 53, wherein the probe further comprises a
minor groove binder.
56-71. (canceled)
72. A method for detecting a target sequence in an amplification
reaction (hydrolyzable probe assay) wherein the improvement
comprises: the use of the composition of claim 56 as a probe.
73. A method for detecting a target sequence in an amplification
reaction (hydrolyzable probe assay) wherein the improvement
comprises: the use of the composition of claim 58 as a probe.
74. A method for detecting a target sequence in an amplification
reaction (hydrolyzable probe assay) wherein the improvement
comprises: the use of the composition of claim 59 as a probe.
75. An oligomer microarray, comprising one or more oligomers
according to claim 11.
76. An oligomer microarray, comprising one or more oligomers
according to claim 14.
77. A method for detecting a target sequence in a polynucleotide by
hybridization, wherein the improvement comprises: use of the
oligomer of claim 11 as a probe.
78. A method for detecting a target sequence in a polynucleotide by
hybridization, wherein the improvement comprises: use of the
oligomer of claim 14 as a probe.
79. A method for detecting a target sequence in a polynucleotide by
hybridization, wherein the improvement comprises: use of the
composition of claim 56 as a probe.
80. A method for detecting a target sequence. in a polynucleotide
by hybridization, wherein the improvement comprises: use of the
composition of claim 57 as a probe.
81. The method of any of claims 77-80 wherein the target sequence
is distinguished from a-related sequence having a single-nucleotide
mismatch with respect to the target sequence
Description
TECHNICAL FIELD
[0001] The disclosure concerns the use of nucleotide analogues to
provide improved properties to hybridization probes, including DNA
and RNA probes and modified nucleic acid probes, such as peptide
nucleic acids (PNAs), and to chimeric probes containing two or more
types of nucleic acid and/or modified nucleic acid.
BACKGROUND
[0002] Hybridization analysis is central to a variety of techniques
in molecular biology and diagnostics, including gene cloning, gene
identification, forensic analysis, pharmacogenomics and
identification of genetic polymorphisms. Hybridization can be used
as an endpoint of an assay, whereby the presence of hybridized
probe constitutes the readout for the assay; or hybridization can
be used as an initial step in an assay, wherein an event subsequent
to hybridization (such as, for example, extension of a hybridized
primer or hydrolysis of a hybridized probe) is used as the
readout.
[0003] Traditionally, hybridization probes and primers have been
DNA molecules; however, there are certain disadvantages to the use
of DNA as a probe or primer. For example, the base composition of a
DNA molecule can affect its effectiveness as a probe or primer in
several ways. A DNA molecule with a high concentration of G
residues is often difficult to handle (e.g., problems with
aggregation and poor solubility) and can yield high background in
hybridization reactions. It is also well-known that G-rich DNA
molecules are prone to the production of artifacts in the analysis
of DNA sequences by gel electrophoresis, presumably due to the
adoption of secondary structure by such molecules, despite the
denaturing conditions under which such analyses are conducted.
[0004] Various modified forms of DNA and DNA analogues have been
used in attempts to overcome some of the disadvantages of the use
of DNA molecules as probes and primers. Among these are peptide
nucleic acids (PNAs, also known as polyamide nucleic acids).
Nielsen et al. (1991) Science 254:1497-1500. PNAs contain
heterocyclic base units, as found in DNA and RNA, that are linked
by a polyamide backbone, instead of the sugar-phosphate backbone
characteristic of DNA and RNA. PNAs are capable of hybridization to
complementary DNA and RNA target sequences and, in fact, hybridize
more strongly than a corresponding nucleic acid probe. Furthermore,
PNAs are resistant to many types of nuclease which attack the
sugar-phosphate DNA and RNA backbones. Additional advantages of
PNAs include the ability of specifically modified PNAs to cross the
blood-brain-barrier and the observation that PNAs injected
intrathecally can mediate antisense affects in vivo. During et al.
(1999) Nature Biotechnol. 17:753-754.
[0005] The synthesis of PNA oligomers and reactive monomers used in
the synthesis of PNA oligomers have been described in U.S. Pat.
Nos. 5,539,082; 5,714,331; 5,773,571; 5,736,336 and 5,766,855.
Alternate approaches to PNA synthesis and monomers for PNA
synthesis have been summarized. Uhlmann et al. (1998) Angew. Chem.
Int. Ed. 37:2796-2823.
[0006] However, as they become more widely used, disadvantages of
PNAs are also becoming apparent. For example, long PNA oligomers,
depending on their sequence, are prone to aggregation, difficult to
purify and difficult to characterize. In addition, purine-rich PNA
oligomers tend to aggregate and are poorly soluble in aqueous
media. Gangamani et al. (1997) Biochem. Biophys. Res. Comm.
240:778-782; Egholm, Cambridge Healthtech Institute's Seventh
Annual Nucleic Acid-Based Technologies, Jun. 21-23, 1999,
Washington, D.C.; Uhlmann, Cambridge Healthtech Institute's Seventh
Annual Nucleic Acid-Based Technologies, Jun. 21-23, 1999,
Washington, D.C. Consequently, effective use of PNAs in
hybridization is limited to sequences in which there are no more
than 4-5 consecutive purines, no more than 6 purines in any 10-base
portion of the sequence, and/or no more than 3 consecutive G
residues. See, for example,
http://www.resgen.com/perseptivedesign.html. Furthermore, since
PNA-PNA interactions are even stronger than PNA-DNA interactions,
PNA-containing probes and primers containing self-complementary
sequences cannot generally be used for hybridization to a target
sequence. Another consequence of the very strong interaction
between PNAs and complementary DNA and/or RNA molecules is that it
is difficult to obtain single nucleotide mismatch discrimination
using PNA probes. Demidov et al. (1995) Proc. Natl. Acad. Sci. USA
92:2637-2641
[0007] Uhlmann et al., supra reviewed approaches for increasing the
solubility of PNAs, including synthesis of PNA/DNA chimeras and
addition of terminal lysine residues to a PNA oligomer. They did
not disclose the use of nucleotide analogues to increase solubility
and improve hybridization properties of PNA oligomers.
[0008] Similar design constraints are required in the synthesis of
non-PNA-containing oligonucleotide probes and primers. See, for
example, the publication entitled "Sequence Detection Systems
Quantitative Assay Design and Optimization," PE Biosystems, Stock
No. 117MI02-01. In these cases, the G/C content of an oligomer must
be kept within the range of 20-80% and runs of an identical
nucleotide, particularly guanine (G), should be avoided. In
particular, the aforementioned publication advises against
stretches of four or more G residues and against the presence of a
G residue at the 5' end of a 5'-fluorescently labeled probe. In the
case of primers, the five nucleotides at the 3' end should comprise
no more than two G and/or C residues.
[0009] The synthesis of pyrazolo[3,4-d]pyrimidine and 7-deazapurine
nucleosides, as well as their phosphoramidite monomers for use in
oligomer synthesis, have been described. Seela et al. (1985) Nucl.
Acids Res. 13:911-926; Seela et al (1986a) Helv. Chim. Acta
69:1191-1198; Seela et al (1986b) Helv. Chim. Acta 69:1813-1823;
and Seela et al. (1987) Biochem. 26:2232-2238.
Pyrazolo[3,4-d]pyrimidine and 7-deazapurine nucleosides for use in
DNA sequencing and as antiviral agents are disclosed in EP 286 028.
Co-owned PCT publication WO 99/51775 discloses the use of
pyrazolo[3,4-d]pyrimidine containing oligonucleotides for
hybridization and mismatch discrimination. It has been reported
that incorporation of 2'-deoxy-7-deazaguanosine into DNA eliminates
band compression in GC-rich stretches during DNA sequence analysis
by gel electrophoresis (U.S. Pat. No. 5,844,106), decreases
tetraplex formation by G-rich sequences (Murchie et al (1994) EMBO
J. 13:993-1001) and reduces formation of aggregates characteristic
of DNA molecules containing 2'-deoxyguanosine (U.S. Pat. No.
5,480,980). However, substitution of oligonucleotides with either
7-deazaadenosine (in place of A) or 7-deazaguanosine (in place of
G) lowers the T.sub.m of hybrids formed by such substituted
oligonucleotides, with greater than one degree reduction in T.sub.m
per substituted base. Seela et al (1987) supra; and Seela et al
(1986) Nucl. Acids Res. 14:2319-2332.
[0010] On the other hand, stabilization of duplexes by
pyrazolopyrimidine base analogues has been reported. Seela et al.
(1988) Helv. Chim. Acta. 71:1191-1198; Seela et al. (1988) Helv.
Chim. Acta. 71:1813-1823; and Seela et al. (1989) Nucleic Acids
Res. 17:901-910. Oligonucleotides in which one or more purine
residues have been substituted by pyrazolo[3,4-d]pyrimidines
display enhanced duplex- and triplex-forming ability, as disclosed,
for example, in Belousov et al (1998) Nucleic Acids Res.
26:1324-1328; U.S. Pat. No. 5,594,121 and co-owned PCT publication
WO 98/49180. Pyrazolo[3,4-d]pyrimidine residues in oligonucleotides
are also useful as sites for attachment of various pendant groups
to oligonucleotides. See co-owned PCT Publication WO 90/14353, Nov.
29, 1990 and U.S. Pat. No. 5,824,796. None of these references
disclose the use of pyrazolopyrimidines or any other type of base
analogue for reducing aggregation and/or increasing solubility of
an oligomer, or for decreasing quenching of a fluorophore
conjugated to an oligomer.
[0011] Conjugates comprising a minor groove binder (MGB), an
oligonucleotide wherein one or more purine residues are substituted
by a pyrazolo[3,4-d]pyrimidine (PZP) residue, a fluorophore and a
fluorescence quencher have been disclosed in co-owned PCT
publications WO 99/51621 and WO 99/51775. Such conjugates are used,
among other things, as hybridization probes, primers and
hydrolyzable probes in 5'-nuclease-based amplification assays.
Inclusion of a MGB in these conjugates increases the stability of
hybrids formed by the oligonucleotide portion of the conjugate,
allowing the design of shorter probes. In addition, both the MGB
and the PZP contribute to the ability of such conjugates to exhibit
enhanced mismatch discrimination. Neither of the aforementioned
publications disclose the use of PZPs or any other type of base
analogue for reducing aggregation and/or increasing solubility of
an oligomer, or for decreasing quenching of a fluorophore
conjugated to an oligomer.
SUMMARY
[0012] Oligomers wherein at least one of the subunits comprises a
pyrazolopyrimidine and/or a pyrrolopyrimidine base analogue are
provided. The oligomers can comprise DNA, RNA, PNA, or any
combination or chimera thereof. Any number of purine residues in
the oligomer can be substituted by a base analogue. Any of the
above-mentioned oligomers can comprise additional moieties such as
fluorophores, fluorescence quenchers and/or minor groove
binders.
[0013] Oligomers wherein at least one of the subunits comprises a
pyrazolopyrimidine and/or a pyrrolopyrimidine base analogue, when
used for hybridization, are less prone to aggregation and
self-association, are more soluble, are capable of enhanced
mismatch discrimination, and do not quench the emission of
conjugated fluorescent labels.
[0014] Oligomers comprising one or more PNA residues wherein at
least one of the PNA residues comprises a pyrazolopyrimidine and/or
a pyrrolopyrimidine base analogue are also provided. The oligomers
can comprise exclusively PNA residues, or the oligomers can
comprise both PNA and/or DNA and/or RNA nucleotide residues to
constitute a PNA/DNA, PNA/RNA or PNA/DNA/RNA chimera. Any number of
purine residues in the oligomer can be substituted by a base
analogue. Any of the above-mentioned oligomers can comprise
additional moieties such as fluorophores, fluorescence quenchers
and/or minor groove binders.
[0015] In another embodiment, compositions comprising a polymer and
a fluorophore are provided, wherein one or more purine-containing
residues of the polymer are substituted with a residue comprising a
pyrazolopyrimidine and/or pyrrolopyrimidine base analogue. Polymers
can comprise PNA, DNA, RNA or any, combination or chimera thereof;
and the base analogue can be present in any of the PNA, DNA or RNA
portions of a chimeric polymer. Any number of purine residues in
the polymer can be substituted by a base analogue, in any of the
PNA, DNA and/or RNA portions. The above-mentioned compositions can
optionally comprise a fluorescence quencher and/or a minor groove
binder.
[0016] In the polymer-fluorophore compositions just described,
quenching of the fluorophore by purine residues in the polymer is
reduced when one or more purines are substituted with a base
analogue. Such compositions additionally comprising a fluorescence
quencher are useful, for example, as probes in hydrolyzable probe
assays, in which quenching of the fluorophore by the fluorescence
quencher is relieved by hybridization-dependent hydrolysis of
probe. The reduction in quenching afforded by substitution of a
base analogue for a purine leads to higher fluorescence output
after hydrolysis and, hence, greater sensitivity in such
assays.
[0017] New intermediates for the synthesis of PNA-containing
oligomers comprising base analogues are also provided. In one
embodiment, acetic acid derivatives of pyrazolopyrimidine and
pyrrolopyrimidine base analogues, wherein N.sup.1 of the
pyrazolopyrimidine or pyrrolopyrimidine is linked to C2 of an
acetic acid moiety and functional groups are blocked, are provided.
These derivatives are useful for preparation of monomers for
automated synthesis of substituted PNAs and PNA/DNA chimeras.
Preferred embodiments of these intermediates include
2-{6-[(1E)-1-aza-2-(dimethylamino)vinyl]-4-hydroxypyrazolo[5,4-d]pyrimidi-
nyl}acetic acid;
2-(6-amino-4-hydroxypyrazolo[5,4-d]pyrimidinyl)acetic acid; and
2-(-4-aminopyrazolo[5,4-d]pyrimidinyl)acetic acid.
[0018] Also provided are aminoethylglycyl derivatives of the
aforementioned acetic acid derivatives of pyrazolopyrimidine and
pyrrolopyrimidine base analogues, wherein the .alpha.-amino group
of a blocked glycyl moiety is derivatized to acetic acid C1 of the
acetate and to C2 of an ethylamine moiety. These derivatives are
also known as "PNA monomers." Such compounds are useful for
automated synthesis of the aforementioned oligomers and polymers.
Preferred embodiments of PPG-containing PNA monomers (also known as
PPPG) include
5-[4-hydroxy-6-(2-methylpropanoylamino)pyrazolo[5,4-d]pyrimidinyl]-3-(2-{-
[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)-4-oxopentanoic acid
and
1-{6-[(1E)-aza-2-(dimethylamino)vinyl]4-hydroxypyrzolo[5,4-d]pyrimidinyl}-
-N-(2-{[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)-N-(2-oxypropyl)acetam-
ide. A preferred embodiment of a PPA-containing PNA monomer is
2-[N-(2-{[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)-2-{4-[(4-methoxyph-
enyl)carbonylamino]pyrazolo[5,4-d]pyrimidinyl}acetylamino]acetic
acid.
[0019] Also provided are methods for the synthesis of oligomers
comprising PNA, DNA, RNA and/or chimeras thereof, wherein the
aforementioned PNA monomers are used at one or more steps in the
synthesis. Oligomers synthesized by these methods are also
provided.
[0020] In another embodiment, methods for detecting a target
sequence in a polynucleotide by hybridization to a probe comprising
a DNA, PNA, or PNA/DNA oligomer, wherein one or more residues in
the probe comprises a pyrazolopyrimidine or pyrrolopyrimidine base
analogue, are provided. In the practice of these methods, the probe
can additionally comprise one or more of a ribonucleoside, a
fluorophore, a fluorescence quencher and/or a minor groove
binder.
[0021] In another embodiment, methods for detection of a target
sequence in a polynucleotide utilizing compositions comprising a
polymeric portion (comprising a polymer) and a fluorogenic portion
(comprising one or more fluorophores), wherein one or more
purine-containing residues of the polymer are substituted with a
residue comprising a pyrazolopyrimidine and/or pyrrolopyrimidine
base analogue, are provided. Polymers for use in the method can
comprise PNA, DNA, RNA or chimeras thereof; and the base analogue
can be present in any of the PNA, DNA or RNA portions of a chimeric
polymer. Any number of purine residues in the polymer can be
substituted by a base analogue. In a preferred embodiment, the
method is practiced using a composition in which a purine residue
in the polymeric portion that is directly adjacent to the
fluorogenic portion is substituted with a pyrazolopyrimidine or a
pyrrolopyrimidine. In another preferred embodiment, oligomers
containing three or more consecutive G residues have their
consecutive G residues replaced by PPG. Compositions for use in
this method can optionally comprise a fluorescence quencher and/or
a minor groove binder.
[0022] In additional embodiments, methods for detecting a target
sequence in an amplification reaction, utilizing the compositions
of the invention, are provided. In a preferred embodiment, the
amplification reaction comprises a hydrolyzable probe assay.
[0023] Also provided are oligomer microarrays wherein at least one
of the oligomers described herein is present on the array.
[0024] Methods for detecting a target sequence in a polynucleotide,
wherein the polynucleotide is present in a sample, by hybridization
to a composition as described herein are also provided. In a
preferred embodiment, the target sequence has a single nucleotide
mismatch with respect to a related sequence that is also present in
the sample, and the composition forms a hybrid with the target
sequence but not with the related sequence.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 shows real-time fluorescence analyses of a series of
hydrolyzable probe assays in which probes containing G runs of
between 2 and 9 nucleotides were used as fluorescent probes and
compared to probes in which the G residues were substituted by
PPG.
DETAILED DESCRIPTION
[0026] The practice of the invention will employ, unless otherwise
indicated, conventional techniques in organic chemistry,
biochemistry, oligonucleotide synthesis and modification,
bioconjugate chemistry nucleic acid hybridization, molecular
biology, microbiology, genetics, recombinant DNA, and related
fields as are within the skill of the art. These techniques are
fully explained in the literature. See, for example, Maniatis,
Fritsch & Sambrook, MOLECULAR CLONING: A LABORATORY MANUAL,
Cold Spring Harbor Laboratory Press (1982); Sambrook, Fritsch &
Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition,
Cold Spring Harbor Laboratory Press (1989); Ausubel, et al.,
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons (1987
and annual updates); Gait (ed.), OLIGONUCLEOTIDE SYNTHESIS: A
PRACTICAL APPROACH, IRL Press (1984); Eckstein (ed.),
OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, IRL Press
(1991).
[0027] The disclosures of all publications and patents cited herein
are hereby incorporated by reference in their entirety.
Definitions
[0028] The terms deazapurine and pyrrolopyrimidine are used
interchangeably to indicate a heterocyclic nucleus comprising fused
pyrimidine and pyrrole rings, according to the following general
formula: 1
[0029] The term pyrazolopyrimidine refers to a heterocyclic nucleus
comprising fused pyrimidine and pyrazole rings, according to the
following general formula: 2
[0030] A "monomer" refers to a composition comprising a base or a
base analogue covalently linked to a reactive moiety, such that the
monomer can be incorporated, via the reactive moiety, as part of an
oligomer or polymer. In certain cases, functional groups on the
base/base analogue portion and/or on the reactive moiety are
blocked so as not to be reactive during polymerization. In
preferred embodiments, the reactive moiety is an aminoethylglycine
moiety, in which case the monomer can be denoted a "PNA
monomer."
[0031] An "oligomer" is a polymer comprising linked monomer units.
Oligomers can be synthesized by sequential joining of monomers, via
their reactive moieties, as is known in the art. An oligomer can
comprise a DNA oligomer, a RNA oligomer, a PNA oligomer, or any
chimeric oligomer made up of DNA, RNA, and/or PNA monomers.
[0032] A "blocking group" or "protecting group" is any chemical
moiety capable of preventing reactivity of a N, S or O atom to
which it is attached, under conditions in which such N, S or O atom
might otherwise be reactive. Exemplary protecting groups include,
but are not limited to tert-butyloxycarbonyl (tBoc),
4-methoxyphenyldiphenylmethyl (MMTr), isobutyryl (iBu),
9-fluoronylmethyloxycarbonyl (Fmoc), --C.sub.6H.sub.5 (benzyl),
diphenylcarbamoyl (DPC), 2-N-dimethylvinyl (Dmv), benzyloxycarbonyl
(Cbz), benzoyl (bz), isobutanoyl, acetyl, and anisoyl (An) groups.
These and additional protecting groups useful in the synthesis of
nucleic acid and PNA oligomers are known in the art. Uhlhann et al.
(1998) Angew. Chem. Int. Ed. 37:2796-2823; Green, et al. in
Protective Groups in Organic Synthesis, 2.sup.nd Edition, John
Wiley and Sons, Inc, NY., pp. 441-452. 1991.
[0033] Oligomers
[0034] The invention provides oligomers in which one or more purine
bases are substituted with a base analogue having the same
base-pairing specificity as the purine which it replaces. The
analogues can be pyrazolopyrimidines or pyrrolopyrimidines.
Oligomers can comprise DNA oligonucleotides, RNA oligonucleotides,
PNA oligomers, or chimeras thereof A chimera refers to an oligomer
which comprises more than one type of subunit, e.g., a RNA/DNA
chimera, a PNA/DNA chimera, a RNA/PNA chimera or a PNA/DNA/RNA
chimera. For chimeric oligomers, a base analogue can be present in
any portion of the chimera (i.e., in a DNA portion, a RNA portion
and/or a PNA portion).
[0035] Methods for the synthesis of DNA, RNA and PNA oligomers are
known in the art. See, for example, U.S. Pat. No. 5,419,966; Gait,
supra; Eckstein (ed.) "Oligonucleotides and Analogues: A Practical
Approach," 1991, IRL Press, Oxford; Ogilve et al. (1988) Proc.
Natl. Acad. Sci. USA 85:5746-5748; Nielsen et al. (1991) supra;
Uhlmann et al. (1998) supra; U.S. Pat. Nos. 5,539,082; 5,714,331;
5,773,571; 5,736,336 and 5,766,855. Additional modified DNA and/or
RNA oligomers can also be used. For example, methods for the
synthesis of 2'-O-methyl oligoribonucleotides have been described.
Sproat et al. (11989) Nucleic Acids Res. 17:3373-3386.
[0036] In general, methods for oligomer synthesis comprise stepwise
cycles of monomer addition to a growing oligomer chain that is
optionally attached to a solid support, wherein the growing
oligomer chain optionally contains protected functional groups and
a blocked growing end. Typically, at each cycle of monomer
addition, the support-bound growing chain is first subjected to
conditions that de-block the growing end, then condensed with a
monomer, which monomer is optionally activated for condensation.
De-blocking conditions and reagents, as well as activating
conditions and reagents, are known in the art. The monomer addition
step is repeated as often as necessary, with the identity of the
monomer added at each step corresponding with the desired sequence
of the oligomer. When the desired sequence has been obtained, the
nascent oligomer is subjected to conditions that deprotect
functional groups and/or cleave the completed oligomer from the
support, then purified, if necessary.
[0037] PNA oligomers are often used as substitutes for DNA
oligonucleotides in various hybridization and other techniques.
However, PNA oligomers are prone to aggregation and often exhibit
reduced solubility in aqueous solvents, especially G-rich PNAs. In
a preferred embodiment, a PNA oligomer comprises one or more
residues in which a purine base is substituted by a
pyrazolopyrimidine or pyrrolopyrimidine base analogue; for example,
G is substituted by PPG or 7-deazaguanine, A is substituted by PPA
or 7-deazaadenine, and either G or A is substituted by PPI or
7-deazahypoxanthine. In this way the base analogue retains the
base-pairing specificity of the base for which it is substituted.
In a more preferred embodiment, a PNA oligomer with one or more G
residues substituted by PPG is provided. Such PPG-substituted PNAs
exhibit reduced intermolecular and intramolecular self-association
compared to oligomers containing G. This facilitates purification
and handling of the oligomers and provides improved hybridization
properties (e.g., increased sensitivity), especially for probe
sequences containing three or more consecutive G residues.
[0038] Because a base analogue retains the base-pairing specificity
of the base it replaces, oligomers of the invention are capable of
sequence-specific binding to complementary sequences and can
exhibit enhanced duplex and triplex formation to single- and
double-stranded targets, respectively.
[0039] Without wishing to be bound by any theory, applicants note
that, when compared to naturally-occurring purine bases,
pyrazolopyrimidine and pyrrolopyrimidine base analogues are less
likely to form non-canonical base pairs (such and G-T, and G-G base
pairs), yet retain the ability to form canonical base pairs
characteristic of the purines which they replace (i.e., PPG-C,
7PG-C, PPA-T and 7PA-T base pairs).
[0040] Base Analogues and Their Synthesis
[0041] Base analogues in oligomers and in intermediates for
oligomer synthesis are provided. The base analogues have a
structure as indicated in Formula 1, wherein R.sub.1 and R.sub.2
are independently --H, --OH, --SH, or --NH.sub.2; R.sub.3 is --H,
--CN, halogen (F, Cl, Br or I), or --R.sub.12--Y, wherein R.sub.12
is C.sub.1-C.sub.12 alkyl, alkenyl or alkynyl and Y is --H, --OH,
--NH.sub.2 or --SH; X is .dbd.CH-- or .dbd.N--; and L is the
linkage to an oligomer backbone, such as DNA, RNA, PNA or any
chimera thereof. 3
[0042] When X is .dbd.N--, the base analogues are
pyrazolopyrimidines and when X is .dbd.CH--, the base analogues are
pyrrolopyrimidines (also known as 7-deazapurines). For example,
when X is .dbd.N--, R.sub.1 is --OH, R.sub.2 is --NH.sub.2, and
R.sub.3 is --H, the base analogue is pyrazolopyrimidinylguanine
(PPG). When X is .dbd.N--, R.sub.1 is --NH.sub.2, and R.sub.2 and
R.sub.3 are --H, the base analogue is pyrazolopyrimidinyladenine
(PPA). When X is .dbd.N--, R.sub.1 is --OH, and R.sub.2 and R.sub.3
are --H, the base analogue is pyrazolopyrimidinylhypoxanthine
(PPI).
[0043] When X is .dbd.C--, R.sub.1 is --OH, R.sub.2 is --NH.sub.2,
and R.sub.3 is --H, the base analogue is 7-deazaguanine (7PG). When
X is .dbd.C--, R.sub.1 is --NH.sub.2, and R.sub.2 and R.sub.3 are
--H, the base analogue is 7-deazaadenine (7PA). When X is .dbd.C--,
R.sub.1 is --OH, and R.sub.2 and R.sub.3 are --H, the base analogue
is 7-deazahypoxanthine (7PI).
[0044] PPG and 7-deazaguanine have the same base-pairing properties
as guanine (i.e., base pair with C), while PPA and 7-deazaadenine
have the same base-pairing properties as adenine (i.e., base pair
with T and U). PPI and 7-deazahypoxanthine have base pairing
properties equivalent to both G and A and therefore will pair with
C, T and U.
[0045] Oligonucleotides comprising the base analogues are
synthesized by automated methods that are well-known in the art,
using precursors ("PNA monomers") according to Formula 3. The
monomers are produced using intermediates having the structure
represented in Formula 2. 4
[0046] Allowed functional groups in Formulas 1 and 2 are as
follows.
[0047] R.sub.1 and R.sub.2 are independently --H, --OH, --OR.sub.6,
--SH, --NH.sub.2 or --NHR.sub.7;
[0048] R.sub.3 is --H, --CN, halogen (F, Cl, Br or I), or
--R.sub.12--Y, wherein R.sub.12 is C.sub.1-C.sub.12 alkyl, alkenyl
or alkynyl and Y is --H, --OH, --NH.sub.2 or --SH;
[0049] R.sub.4 is --H or a protecting group selected from the group
consisting of tert-butyloxycarbonyl (tBoc),
4-methoxyphenyldiphenylmethyl (MMTr); isobutyryl (iBu) and
9-fluoronylmethyloxycarbonyl (Fmoc);
[0050] R.sub.5 is --H or --C.sub.6F.sub.4H (TFP);
[0051] R.sub.6 is --H, --C.sub.6H.sub.5 (benzyl) or a
diphenylcarbamoyl (DPC) group;
[0052] R.sub.7 is a protecting group selected from the group
consisting of 2-N-dimethylvinyl (Dmv), benzyloxycarbonyl (Cbz),
monomethoxytrityl (MMtr), benzoyl (bz), isobutyryl (iBu),
isobutanoyl, acetyl, and anisoyl (An) groups; and
[0053] X is .dbd.CH-- or N--.
[0054] These formulas include all isomers and tautomers of the
molecules signified thereby. Preferred embodiments of precursors
for PNA synthesis and intermediates used in the synthesis of these
precursors are as follows. When R.sub.1 is --OH, R.sub.2 is
--NH.sub.2, R.sub.3 is --H and X is .dbd.N-- in Formula 2, the
resulting structure is
2-(6-amino-4-hydroxypyrazolo[5,4-d]pyrimidinyl)acetic acid (PPGA).
When R.sub.1 is --NH.sub.2, R.sub.2 is --H, R.sub.3 is --H and X is
.dbd.N-- in Formula 2, the resulting structure is
2-(4-aminopyrazolo[5,4-d]pyrimid- inyl)acetic acid (PPAA). The
corresponding derivatives of Formula 3, wherein R.sub.4 and R.sub.5
are --H, are abbreviated MPPGA and MPPAA, respectively. Blocked
derivatives of these compounds are also provided, as described
infra.
[0055] The designation "pyrazolo[5,4-d]pyrimidine," as used herein,
refers to the same structures that were designated
pyrazolo[3,4-d]pyrimidines in previous co-owned publications,
patents and patent applications. See, for example, U.S. Pat. No.
5,824,796; PCT WO 99/51621 and PCT WO 99/51775. The reason for this
change in nomenclature is so that the names by which the structures
are identified comply with those assigned to the structures by the
nomenclature programs NamExpert and Nomenclator, provided by
Chemlinnovation Software, San Diego, Calif.
[0056] The synthesis of pyrazolopyrimidine and pyrrolopyrimidine
bases is accomplished by methods known in the art. Seela et al.
(1985) supra; Seela et al. (1986a), supra; Seela et al: (1986b),
supra; and Seela et al. (1987) supra. Using the reactions described
by Uhlmann et al. (1998) supra for the synthesis of 2-substituted
purine acetic acid derivatives, appropriately protected
4-aminopyrazolo[5,4-d]pyrimidine (PPA) and
6-amino-4-hydroxypyrazolo[5,4-d]pyrimidine (PPG) can be reacted
with alkyl 2-bromoacetate to give products of Formula 2. Since
alkylation can occur on both the 1 and 2 nitrogen atoms of
pyrazolopyrimidines, separation of isomers and purification of the
1-substituted isomer is required. In the case of 7-deazapurines and
related pyrrolopyrimidines, reaction with alkyl 2-bromoacetate
yields only the N.sup.1-substituted product.
[0057] Accordingly, PPGA (3) can be synthesized from
4-methoxypyrazolo[5,4-d]pyrimidine-6-ylamine (4) (Seela et al.
(1985) Heterocycles 23:2521-2524) by alkylation with ethyl
2-chloroacetate in the presence of sodium hydride, followed by
separation of the isomers (Reaction Scheme 1). 5
[0058] Another approach to the synthesis of PPGA is shown in
Reaction Scheme 2. In this case,
2-amino-4-6-dichloropyrimidine-5-carboxyaldehyde (1) is reacted
with ethyl 2-(hydrazinol)acetic acetate to give ethyl
2-(6-amino-4-{2-[(ethoxycarbonyl)methyl]hydrazino}pyrazolo[5,4-d]pyrimidi-
nyl)acetate (2). Treatment of (2) with sodium hydroxide followed by
hydrogen peroxide yields the desired product PPGA (3). An advantage
of this synthetic procedure is that it yields only the
N.sup.1-substituted isomer. See Example 1, infra. 6
[0059] For use in automated chemical synthesis of oligomers,
reactive groups on the base analogues, such as amino groups, must
be protected. In one embodiment, blocked derivatives of PPGA are
synthesized as described in Reaction Scheme 3. PPGA (3) is reacted
with isobutanoyl chloride in dimethylformamide and triethylamine to
generate a PPGA derivative with an isobutyryl-blocked amino group
(14). See Example 2, infra. 7
[0060] Methods for the synthesis of aminoethylglycyl derivatives of
PPGA, PPAA, 2-(2-amino-4-hydroxypyrrolo[2,3-d]pyrimidin-7-yl)acetic
acid (7PGA) and 2-(4-aminopyrrolo[2,3-d]pyrimidin-7-yl)acetic acid
(7PAA), for use as monomers in automated oligomer synthesis, are
known in the art. Uhlmann et al., supra. These methods involve
condensation of appropriately protected aminoethylglycine, e.g.,
methyl 2-[(2-{[(4-methoxyphenyl)diphen-
ylmethyl]amino}ethyl)amino]acetate (MMTrAeg, Will et al. (1995)
Tetrahedron 51:12069-12082) with any of PPGA, PPAA, 7PGA or 7PAA
(also protected, if necessary) in the presence of a condensing
reagent such as
(O-7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium
hexafluorophosphate (HATU),
(benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate
(HBTu), or O-[(cyano(tethoxycarbonyl)methylen)amino]--
1,1,3,3-tetramethyluronium tetrafluoroborate (TOTU), as shown in
Reaction Scheme 4. The R.sub.5 protecting group is chosen such that
it can be removed selectively, (i.e., without removing other
blocking groups) to yield a compound 7 in which R.sub.5 is --H and,
for example, R.sub.1 is --NHCbz, R.sub.2, and R.sub.3 are --H and
R.sub.4 is -MMTr. This protected derivative of MPPAA is used in the
synthesis of a PNA oligomer or a PNA/DNA chimera. 8
[0061] Exemplary synthesis of a blocked PPG monomer for PNA
synthesis is accomplished according to Reaction Scheme 5. PPG (15)
is reacted with isobutanoyl chloride to generate an amino-blocked
PPG (16), which is treated with sodium hydride and then reacted
with alkyl bromoacetate to generate, for example, a methyl acetate
derivative (17). Alkaline hydrolysis of methyl ester 17 yields the
acetic acid derivative 18. Further reaction of 18 with methyl
2-[(2-{[(4-methoxyphenyl)diphenylmethy- l]amino}ethyl)amino]acetate
(MMTrAeg) generates an alkyl ester (in this example, the methyl
ester) of an MMTr-blocked aminoethylglycyl derivative with a
MMTr-protected amino group (19), which, after alkaline hydrolysis
of the ester, yields the MMTr-protected aminoethylglycine
derivative 20. See Example 3, infra. 9
[0062] An exemplary method for synthesis of a PNA monomer
comprising the base analogue PPA is shown in Reaction Scheme 6.
4-aminopyrazolo[5,4-d]py- rimidine (PPA, Compound 8) is reacted
with 4-methoxybenzoyl chloride in pyridine to yield the
amino-protected PPA derivative (9). This is reacted with sodium
hydride followed by the 2-bromoacetate methyl ester, and the
N.sup.1-substituted methylacetate derivative (10) is isolated.
Treatment of 10 with sodium hydroxide converts the methyl ester to
the N-Bz-protected acetate derivative of PPAA (Compound 11). See
Example 4 for details. 10
[0063] Continuing with Reaction Scheme 6, conversion of N-Bz PPAA
(11) to a reactive monomer for PNA synthesis proceeds by
condensation of 11 with monomethoxytritylaminoethylaminoacetate
(MMTrAeg=monomethoxytritylaminoet- hylglycine) to form 12, followed
by treatment of 12 with alkali to generate the MMTr-protected
aminoethylglycine derivative 13. See Example 5 for details.
[0064] A preferred PPG monomer is the 2-N-dimethylvinyl protected
MMTr-aminoethylgycine derivative (24), whose synthesis is shown in
Reaction Scheme 7. 4-methoxypyrazolo[5,4]pyrimidine-6-ylamine (21)
was reacted first with KOH in dry methanol, followed by reaction
with methyl bromoacetate to give the methyl acetate derivative
(22). Alkaline hydrolysis to yield the acetic acid derivative 23
was followed by reaction with (dimethoxymethyl)dimethylamine to
give (24). Reaction of (24) with MMTrAeg yielded the protected PPG
monomer 25. 11
[0065] A preferred PPA monomer is the 2-N-dimethylvinyl protected
MMTr-aminoethylgycine derivative (29), whose synthesis is shown in
Reaction Scheme 8. Pyrazolo[5,4]pyrimidin-4-ylamine (8) was reacted
first with KOH in dry methanol followed by reaction with methyl
bromoacetate to give the methyl acetate derivative (26). This was
reacted with (dimethoxymethyl)dimethylamine to give (27), which was
treated with NaOH to yield (28). Reaction of (28) with MMTrAeg
yielded the PPA monomer (29). 12
[0066] Synthesis of reactive derivatives of PPI follows similar
procedures. Pyrazolo[5,4-d]pyrimidin-4-ol (PPI, Tominaga et al.
(1990) J. Heterocycl. Chem. 27:775-783) can be alkylated directly
with methyl bromoacetate, followed by alkaline hydrolysis, to
yield-2-(4-hydroxypyraz- olo[5,4-d]pyrimidinyl)acetic acid, which
can be converted as described (Uhlmann et al. (1998) supra) to the
MMTr-blocked aminoethylglycine derivative. Alternatively, the
hydroxyl group of PPI could be blocked with a diphenylcarbamoyl
group before reaction with methyl bromoacetic acetate.
[0067] The same synthetic approaches used to synthesize reactive
derivatives of pyrazolo[5,4-d]pyrimidines can be used to synthesize
reactive derivatives of 7-deazapurines for use in the synthesis of
PNA-containing oligomers. The basic difference between the
synthesis of these two types of compounds is that in the latter
case only one isomer is generated following alkylation with methyl
bromoacetate.
[0068] Synthesis of PNA-Containing Oligomers
[0069] In addition to the monomers and precursors described supra,
the invention includes PNA oligomers, DNA oligonucleotides and/or
PNA/DNA chimeras comprising at least one monomeric unit of Formula
4, optionally covalently attached to one or more ligands, tail
moieties or pendant groups. A PNA oligomer comprises two or more
PNA monomers that are covalently linked by peptide bonds, as
illustrated in Formula 4, where B is a base (i.e. a heterocyclic
base A, G, C, T or U as are commonly found in nucleic acids or a
modified derivative thereof) or base analogue; k is between 0 and
50, preferably between 0 and 40, more preferably between 0 and 30,
and still more preferably between 0 and 20; and R.sub.21 are
independently --H, --OH, --NH.sub.2, --NHR.sub.22,
--N(R.sub.22).sub.2, a protecting group, a reactive group or an
oligomer, where R.sub.22 is --H or C.sub.1-6 alkyl, alkenyl or
alkynyl. 13
[0070] The synthesis of PNA oligomers from monomeric precursors is
known in the art. See, for example, Uhlmann et al., supra.
Synthesis is begun with a CPG resin or other solid support,
containing a conjugated amino group. An appropriately blocked
monomer (corresponding to the terminal monomer of the desired
oligomer) is covalently coupled to the amino group with the aid of
a coupling reagent. After deprotection of the blocked growing end
of the first monomer, a second monomer is coupled. The process is
repeated until an oligomer of the desired length and sequence is
obtained, at which time the oligomer is cleaved from the solid
support and any base protecting groups are removed.
[0071] In one embodiment, a PNA oligomer contains a --NH.sub.2
group at the end that was cleaved from the solid support, and a
--COOH or --OH group at the opposite end. The terminal functional
groups provide sites for the attachment of additional molecules and
pendant groups to the PNA-containing oligomer.
[0072] Strategies for the synthesis of PNA/DNA chimeric oligomers
are well known in the art. See, for example, Uhlmann et al., supra.
Two principal strategies for the synthesis of PNA/DNA chimeras are
block condensation of presynthesized PNA and DNA oligomers in
solution and stepwise solid phase synthesis with suitably protected
PNA and DNA monomeric precursors. Those skilled in the art will
appreciate that, depending on the method of synthesis, different
connecting groups between the PNA and DNA portions are possible.
Exemplary linkages include, but are not limited to,
N-(2-hydroxyethyl)glycine and 5'-amino-2',5'-dideoxynucleoside
phosphoramidite linkages. Uhlmann et al., supra.
[0073] Coupling reagents (or activating agents) for use in the
condensation of PNA monomers to form a PNA oligomer include, but
are not limited to, benzotriazolyl-1-oxy-trispyrrodinophosphonium
hexafluorophosphate (PyBOP),
O-(7-azabenzotriazol-1-yl)-1,1,3,3-tetrameth- yluronium
hexafluorophosphate (HATU), O-(7-benzotriazol-1-yl)-1,1,3,3-tetr-
amethyluronium hexafluorophosphate (HBTU), dicyclohexylcarbodiimide
(DCC)/1-hydroxybenzotriazole (HOBt), N,N'-diisopropylcarbodiimide
(DIC), bromo tris(pyrrolidino)phosphonium hexafluorophosphate
(ByBrop), and
O-[(cyano(ethoxycarbonyl)methylene)amino}1,1,3,3-tetramethyluronium
tetrafluorborate (TOTU). These and additional activating and
condensing agents are known to those of skill in the art. See, for
example, Uhlmann et al., supra.
[0074] Additional molecules which can be covalently coupled to an
oligomer include, but are not limited to, intercalators, lipophilic
groups, minor groove binders, major groove binders, reporter groups
(including fluorescent, chemiluminescent and radioactive
reporters), proteins, enzymes, antibodies, chelating agents and/or
cross-linking agents. These molecules can be attached internally
and/or at one or both ends of the oligomer. The nature and
attachment of such molecules to oligonucleotides are presently well
known in the art, and are described, for example, in U.S. Pat. Nos.
5,512,667 and 5,419,966 and in PCT publication WO 96/32496, which
are incorporated herein by reference.
[0075] The oligomers of the invention can also have a relatively
low molecular weight tail moiety attached at either or both ends.
By way of example, a tail molecule can be a phosphate, a phosphate
ester, an alkyl group, an aminoalkyl group, a hydrophilic group or
a lipophilic group. The tail moiety can also link an intercalator,
lipophilic group, minor groove binder, reporter group, chelating
agent and/or cross-linking functionality to the oligomers of the
invention. The nature of tail moieties and methods for obtaining
oligonucleotides with various tail moieties are also described in
the above-referenced U.S. Pat. Nos. 5,512,667 and 5,419,966.
[0076] Molecules can be attached to an oligomer of the invention to
modify its solubility in aqueous solvents. Such molecules include,
but are not limited to, saccharides and charged molecules such as
amino acids, charged minor groove binders, and the like.
[0077] In a preferred embodiment, oligomers of the invention
containing PPG substituted for guanine and/or PPA substituted for
adenine also comprise a conjugated minor groove binder (MGB).
Optimal single-nucleotide mismatch discrimination is obtained using
MGB-conjugated oligonucleotides containing PPG in place of guanine,
as disclosed in co-owned PCT publication WO 99/51775. Polar MGBs
are preferred; more preferred MGB moieties include the trimer of
3-carbamoyl-1,2-dihydro-(3H)-pyrrolo[3,2-e]indole-7-carboxylate
(CDPI.sub.3) and the pentamer of N-methylpyrrole-4-carbox-2-amide
(MPCs). Additional MGB moieties that will find use in the practice
of the present invention are disclosed in co-owned U.S. Pat. No.
5,801,155 and co-owned PCT publication WO 99/51621, the disclosures
of which are incorporated herein by reference.
[0078] Oligomers can comprise base analogues in addition to the
purine analogues disclosed herein such as, for example, modified
pyrimidines and pyrimidine analogues.
[0079] Furthermore, the oligomers of the invention can comprise
backbones other than a peptide backbone, or can comprise
heterogeneous backbones made up of mixed peptide and non-peptide
linkages. For example, oligomers with backbones based on glycine
methyl esters, ornithine, proline, diaminocyclohexane and the
phosphoramidite of 2-aminopropanediol can be used. Uhlmann et al.,
supra. In addition, PNAs in which the peptide bond is replaced by a
phosphonic acid bridge, such as N-(2-aminoethyl)phosphon- oglycine
and N-(2-hydroxyethyl)phosphonoglycine, can be used. Peyman et al
(1997) Angew. Chem. Intl. Ed. Engl. 36:2809-2812; Efimov et al.
(1998) Nucl. Acids. Res. 26:566-577. Additional oligomer linkages
will be apparent to those of skill in the art.
[0080] Triplex-Forming Oligomers
[0081] PNA-containing oligomers are useful for detection of both
single-stranded and double-stranded nucleic acid targets. For
detection of double-stranded nucleic acids, an oligomer binds in
the major groove of a double-stranded target via Hoogsteen, reverse
Hoogsteen or equivalent base pairing, as is known in the art. See,
for example, Fresco, U.S. Pat. No. 5,422,251; Hogan, U.S. Pat. No.
5,176,996; and Lampe (1997) Nucleic Acids Res. 25:4123-4131.
Substitution of purines by base analogues in a PNA-containing
oligomer, as disclosed herein, facilitates triplex formation.
Triplex-forming oligonucleotides optionally contain conjugated
groups, such as fluorophores, fluorescent quenchers and any of the
additional molecules described supra. In a preferred embodiment, a
triplex-forming PNA-containing oligomer with one or more purines
substituted by a base analogue comprises a conjugated minor groove
binder. See supra for disclosure of minor groove binders useful in
the oligomers of the invention.
[0082] Fluorophores and Fluorescence Quenchers
[0083] In one embodiment, an attached reporter group is a
fluorescent label or a fluorophore/fluorescent quencher pair. In a
preferred embodiment, the replacement of one or more purine
residues by pyrazolopyrimidine and/or pyrrolopyrimidine base
analogues, in a probe containing a fluorescent label, results in
reduced quenching of the label. Accordingly, fluorescently-labeled
probes comprising one or more purine analogues, optionally
comprising a fluorescence quencher, are provided.
[0084] Fluorescent labels include, but are not limited to, dyes
such as fluoresceins, rhodamines, naphthylamines, coumarins,
xanthenes, acridines, benzoxadiazoles, stilbenes, pyrenes,
cyanines, phycoerythrins, green fluorescent proteins, and the like.
Additional fluorescent labels, and methods for their conjugation to
nucleic acid and PNA probes, are known to those of skill in the
art. See, for example, Haugland (1996) Handbook of Fluorescent
Probes and Research Chemicals, Sixth edition, Molecular Probes,
Inc., Eugene, Oreg. and PCT publication WO 99/40226. In general,
methods for attachment of a fluorescent label and/or a fluorescence
quencher to a PNA oligomer or a PNA portion of a chimeric oligomer
are similar to those used for conjugating a fluorophore and/or
fluorescence quencher to a DNA oligonucleotide. The fluorophore or
quencher is either attached to a tail moiety comprising a reactive
group such as, for example, --OH or --NH.sub.2; or is attached to a
base, for example, at the 5 position of a pyrimidine, the
7-position of a purine, or the 3-position of a pyrazolopyrimidine
or pyrrolopyrimidine.
[0085] In certain embodiments of the present invention, oligomers
comprising both a fluorescent label (fluorophore) and a
fluorescence quencher are used. A fluorescence quencher is also
referred to as a quenching portion of a probe or polymer.
Fluorescence quenchers include those molecules whose absorption
spectrum overlaps the fluorescence emission spectrum of a
particular fluorophore, such that they are capable of absorbing
energy emitted by a fluorophore so as to reduce the amount of
fluorescence emitted (i.e., quench the emission of the fluorescent
label). Different fluorophores are quenched by different quenching
agents. In general, the spectral properties of a particular
fluorophore/quencher pair are such that one or more absorption
wavelengths of the quencher overlaps one or more of the emission
wavelengths of the fluorophore.
[0086] Appropriate fluorophore/quencher pairs, in which emission by
the fluorophore is absorbed by the quencher, are known in the art.
See, for example, Haugland, supra. Exemplary pairs of fluorescence
quencher/fluorophore pairs which can be used in the practice of the
invention are as follows. A preferred fluorophore/quencher pair is
fluorescein and tetramethylrhodamine. Nitrothiazole blue quenches
fluorescence emission of six different dyes, namely 6-FAM, d110,
dR6G, dTMR, dROX and JAZ. Lee et al. (1999) Biotechniques
27:342-349. 6-carboxytetramethylrhodamine (TAMRA) quenches emission
from 6-carboxyfluorescein (FAM) and
6-carboxy-4,7,2',7'-fluorescein-(TET). Lee et al. (1993) Nucl. Acid
Res. 21:3671-3766. 6-(N-[7-nitrobenz-2-oxa-1,3-d-
iazol-4-yl]amino)hexanoic acid quenches fluorescence by
7-dimethylamimocoumarin-4-acetate. Bicket et al. (1994) Ann. NY
Acad. Sci. (September 6) 732:351-355. 6-carboxy-X-rhodamine (ROX)
and erythromycin B quench FAM emission. Li et al. (1999) Bioconj.
Chem. 10:241-245. The 2,4-dinitrophenyl group quenches
(R,S)-2-amino-3-(7-metho- xy-4-coumaryl)propanoic acid. Hawthorne
et al. (1997) Anal. Chem. 253:13-17. Dabcyl is used as a quencher
of dansyl sulfonamide in chemosensors and in fluorogenic peptides
as a quencher for the fluorophore EDANS. Rothman et al. (1999)
Bioorg. Med. Chem. Lett. 22:509-512 and Matayoshi et al. (1990)
Science 247:954-958. QSY-7 is a quencher of tetramethylrhodamine.
Haugland supra. Additional fluorophore/quencher pairs can be
selected by those of skill in the art by comparison of emission and
absorption wavelengths according to the properties set forth
above.
[0087] Although any fluorescent label is useful in the practice of
the invention, preferred fluorophores have emission maxima between
400 and 800 mm. Similarly, although any fluorescence quencher is
useful, preferred fluorescence quenchers have absorption maxima
between 400 and 800 nm.
[0088] In a further embodiment, an oligomer comprises a pair of
fluorophores capable of fluorescence resonance energy transfer
(FRET). In this case, two fluorophores are used in a FRET series.
The first fluorophore (fluorescence donor) has an emission spectrum
that overlaps the excitation spectrum of the second fluorophore
(fluorescence acceptor). Accordingly, irradiation at the excitation
wavelengths of the fluorescence donor results in fluorescence at
the emission wavelength of the acceptor. It is clear that any
number of fluorophores, having appropriate overlap of their
emission and excitation wavelengths, can form a FRET series or
three, four or more fluorophores.
[0089] In one embodiment, a fluorophore is a latent fluorophore, as
disclosed in co-owned U.S. patent application Ser. No. ______,
entitled "Hybridization triggered fluorescent detection of nucleic
acids" (Attorney docket No. 34469-20006.00), filed Oct. 26,
1999.
[0090] Exemplary Advantages
[0091] When an oligomer is used as a probe or primer, substitution
of base analogues for purines reduces aggregation of the
substituted oligomer, both with itself and with other oligomer
molecules. Reduction of aggregation was demonstrated for G-rich
probes as described in Example 6, infra. Consequently, improved
methods for detection of target sequences by hybridization, using
oligomers as probes, are obtained using the oligomers disclosed
herein. Target sequences can comprise DNA, RNA, or any oligo- or
polynucleotide.
[0092] Replacement of purines by base analogues in
fluorescently-labeled probes reduces quenching of the label that
occurs in unsubstituted probes. See Examples 7 and 8, infra. In
particular, the inventors have determined that detection of
amplification-product using probes containing more that three
consecutive G residues adjacent to a fluorescent label is
inefficient and, for probes containing 5 or more consecutive G
residues adjacent to a fluorescent label, no; detection of product
is observed. The inventors have also determined that, when PPG is
substituted for G, fluorescent probes containing up to 9
consecutive PPG residues adjacent to a fluorescent label provide
highly efficient detection of amplification products. Accordingly,
improved methods for detecting a target sequence which utilize
probes comprising a polymeric portion (typically an oligomer,
preferably a PNA oligomer or a PNA/DNA chimera, more preferably a
DNA oligomer) and a fluorescent portion are obtained using the
compositions disclosed herein.
[0093] Thus, DNA, RNA, PNA and chimeric oligomers, comprising
pyrazolopyrimidine and pyrrolopyrimidine base analogues as
disclosed herein, are useful in techniques including, but not
limited to, hybridization, primer extension, hydrolyzable probe
assays, amplification methods (e.g., PCR, SSSR, NASBA), single
nucleotide mismatch discrimination, allele-specific oligonucleotide
hybridization, nucleotide sequence analysis, hybridization to
oligonucleotide arrays, in situ hybridization and related
techniques. Oligomers disclosed herein can be used as immobilized
oligomers in oligomer arrays such as those described in, for
example, U.S. Pat. Nos. 5,492,806; 5,525,464; 5,556,752 and PCT
publications WO 92/10588 and WO 96/17957. Improved specificity and
sensitivity likely result from increased solubility, decreased
tendency for aggregation, reduced quenching of conjugated
fluorogenic labels, and/or some combination of these and other
factors.
[0094] Improved performance of PPG-substituted probes in a
real-time hydrolyzable probe assay is demonstrated in Example 9,
infra.
[0095] In another embodiment of the invention, a PNA-containing
oligomer with one or more purine residues substituted by a base
analogue is used as a pharmaceutical, for example as an antisense
or anti-gene reagent, as a component of a ribozyme, or for gene
therapy. Therapeutic uses include D-loop formation in vivo or ex
vivo.
[0096] The following examples are provided to illustrate, but not
to limit, the invention.
EXAMPLES
Example 1
Synthesis of 2-(6-amino-4-hydroxypyrazolo[5,4-d]pyrimidinyl)acetic
acid (PPGA, Compound 3)
Ethyl-2-(6-amino-4-{2-[ethoxycarbonyl)methyl]hydrazino}pyrazolo[5,4-d]pyri-
midinyl)acetate (Compound 2)
[0097] 2-Amino-4-6-dichloropyrimidine-5-carboxyaldehyde (Compound
1) (10 g; 52 mmole) is treated with a solution of 10.1 g (64.8
mmole) of ethyl 2-(hydrazinol)acetic acetate hydrochloride in 100
ml water. Triethylamine (15 ml; 107 mmole) was added and the
mixture was heated to 60.degree. C. for 10 min, then stirred at
room temperature for 3 days. Although ethyl 2-(hydrazinol)acetic
acetate hydrochloride did not dissolve completely, TLC on SiO.sub.2
(CH.sub.2Cl.sub.2:CH.sub.3OH 10:1) showed the formation of new
product. The mixture was evaporated to dryness, taken up in toluene
(100 ml) and evaporated to dryness. The solid was suspended in
about 300 ml CH.sub.3CN and filtered through a SiO.sub.2 column
(49.times.6 cm), washed with 0.7 l of CH.sub.3CN and about 300 ml
of CHCl.sub.3. The filtrate was evaporated to dryness, dissolved in
120 ml hot CH.sub.3OH and crystallized overnight at 4.degree. C.
The product, a colorless solid (3.2 g) was collected and dried. TLC
and reversed phased HPLC indicated a pure compound and NMR analysis
supported structure 2.
2-(6-amino-4-hydroxypyrazolo[5,4-d]pyrimidinyl)acetic acid
(Compound 2)
[0098] Compound 2 (3.16 g; 9.4 mmole) was dissolved in 100 ml of
hot methanol, then 100 ml of a 2N NaOH solution was added, and the
mixture was refluxed for 6 hours, at which time analysis by TLC
indicated hydrolysis of the ester. Product 3 (PPGA) was formed by
the addition of 2 ml of 30% H.sub.2O.sub.2 (in portions of 0.5 ml)
to the reaction mixture, followed by heating to 80.degree. C.,
until generation of O.sub.2 from degradation of excess
H.sub.2O.sub.2 was complete. Methanol was removed by heating at
100-120.degree. C., followed by cooling to room temperature and
addition of 17 ml of concentrated HCl to give a pH of about 4.
Precipitation of the product initiated at this point, and was
facilitated by the addition of ice. The product was filtered,
washed with cold water and dried over NaOH and P.sub.2O.sub.5
(yield 3.9 g). NMR confirmed the structure and indicated the
presence of about 4-8 molecules of H.sub.2O per molecule of
product.
Example 2
Synthesis of
2-[4-hydroxy-6-(2-methylpropanoylamino)pyrazolo[5,4-d]pyrimid-
inyl]acetic acid (14)
[0099] PPGA (Compound 3, 5.58 g; 20 mmole) is suspended in
anhydrous DMF (40 ml) and triethylamine (4.29 ml; 30.8 mmole).
Isobutanoyl chloride (2.12 g; 19.9 mmole) is added dropwise using a
syringe. The mixture is stirred at 100.degree. C. for 3 hours, then
treated with methanol and evaporated to dryness. The residue is
treated with 20 ml 1N HCl and then with methanol and evaporated to
dryness. The residue is treated with hot isopropanol and the
precipitated product is filtered off and dried in vacuo. The
product (14) is analyzed by TLC and HPLC and, if necessary, is
purified further by chromatography.
Example 3
5-[4-hydroxy-6-(2-methylpropanoylamino)pyrazolo[5,4-d]pyrimidinyl]-3-(2-{[-
(4-methoxyphenyl)diphenylmethyl]amino}ethyl)-4-oxopentanoic acid
(20)
N-(4-hydroxypyrazolo[5,4-d]pyrimidin-6-yl)-2-methylpropanamide
(16)
[0100] Compound 15 (PPG, 3.02 g; 20 mmole) is suspended in
anhydrous DMF (40 ml) and triethylamine (1.45 ml, 10.4 mmole), and
isobutanoyl chloride (2.12 g, 19.9 mmole) is added dropwise using a
syringe. The mixture is stirred at 100.degree. C. for 3 hours. The
reaction mixture is then treated with methanol and evaporated to
dryness. The residue is treated with methanol and evaporated to
dryness. The residue is then treated with hot isopropanol and the
precipitated product (16) is filtered off and dried in vacuo. The
product is analyzed by TLC and HPLC and, if necessary, is further
purified by chromatography.
Methyl
2-[4-hydroxy-6-(2-methylpropanoylamino)pyrazolo[5,4-d]pyrimidinyl]a-
cetate (17)
[0101] Compound 16 (4.42 g; 20 mmole) is suspended in dry DMF (40
ml), sodium hydride (0.5 g; 20.8 mmole) is added in portions, and
the mixture is stirred at room temperature for 60 min. Methyl
bromoacetate (1.9 ml; 20.6 mmole) is then added at room
temperature, by syringe, and stirring is continued at room
temperature. At completion of the reaction (monitored by TLC), the
reaction mixture is treated with a small amount of carbon dioxide
in methanol. The solvent is then evaporated and the residue
dissolved in CH.sub.2Cl.sub.2, washed once with water and then
evaporated to dryness. The product is purified by chromatography to
yield the desired isomer (17).
2-[4-Hydroxy-6-(2-methylpropanoylamino)pyrazolo[5,4-d]pyrimidinyl]acetic
acid (18)
[0102] Compound 17 (4.41 g; 15 mmole) is suspended in 25 ml water,
and a 2N aqueous solution of sodium hydroxide is added drop-wise at
0.degree. C., while maintaining the pH at 11, until the methyl
ester is completely hydrolyzed. The reaction solution is then
filtered, and the filtrate is brought to pH 3 using 2M KHSO.sub.4
solution, then extracted with ethyl acetate. The aqueous phase is
evaporated and the product (18) is purified by chromatography.
Methyl
5-[4-hydroxy-6-(2-methylpropanoylamino)pyrazolo[5,4-d]pyrimidinyl]--
3-(2-{[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)-4-oxopentanoate
(19)
[0103] Methyl
2-[(2-{[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)amino]ac- etate
(MMTrAeg, 1.26 g; 3.1 mmole) is dissolved in DMF (8 ml). To this
solution is added N-ethylmorpholine (1.07 g; 6.28 mmole),
3-hydroxy-4-oxo-3,4-dihyro-1,2,3-benzotrazine (HOObt) (0.505 g; 3.1
mmole), Compound 18 (0.91 g; 3.1 mmole) and diisopropylcarbodiimide
(DIPC) (0.59 g; 3.72 mmole). The reaction mixture is stirred for 48
hours at 4.degree. C., at which time the solvent is evaporated and
the residue dissolved in ethyl acetate. The ethyl acetate solution
is washed with water and washed once with saturated KCl solution.
The organic phase is then dried over Na.sub.2SO.sub.4, filtered and
evaporated. The residue is dissolved in a small volume of ethyl
acetate and cooled on ice to induce crystallization of
diisopropylurea, leaving the product 19 in the aqueous phase.
Alternatively, the diisopropylurea is separated by silica gel
chromatography from compound 19.
5-[4-hydroxy-6-(2-methylpropanoylamino)pyrazolo[5,4-d]pyrimidinyl]-3-(2-{[-
4-methoxyphenyl)diphenylmethyl]amino}ethyl)-4-oxopentanoic acid
(20)
[0104] Compound 19 (1.33 g; 2 mmole) is dissolved in 10 ml dioxane.
This solution is cooled to 0.degree. C. and 1 M aqueous NaOH (8.66
ml) is added drop-wise in 5 aliquots over 2.5 hours. After an
additional 2 hours at room temperature the solution is adjusted to
pH 5 by drop-wise addition of 2M KHSO.sub.4. Precipitated salts are
filtered off and washed with dioxane, and the combined filtrates
are evaporated. The residue is co-evaporated with ethanol and
methanol/CH.sub.2Cl.sub.2, then purified by silica gel
chromatography to yield (20).
Example 4
Synthesis of
2-{4-[4-Methoxyphenyl)carbonylamino]pyrazolo[5,4-d]pyrimidiny-
l}acetic acid (Compound 11, Reaction Scheme 6)
4-(Methoxypheny)-N-pyrazolo[4,5-d]pyrimidin-4-ylcarboxamide (9)
[0105] Pyrazolo[5,4-d]pyrimidine-4-ylamine (8) (13.5 g; 0.10.1
mole) is suspended in dry pyridine (250 ml), and 4-methoxybenzolyl
chloride (17.1 g; 0.1 mole) is added drop-wise using a syringe. The
mixture is heated at 100.degree. C. until TLC shows that the
reaction is complete (about 1 to 3 hours). The cooled reaction is
then treated with methanol and the solvent evaporated. The residue
is co-evaporated twice with toluene and then stirred with hot
isopropanol. This mixture is cooled slowly and the precipitated
product (9) is filtered off and evaluated for purity by TLC and
HPLC. If necessary, the product is further purified by
chromatography.
Methyl
2-{4-[(4-methoxyphenyl)carbonylamino]pyrazolo[5,4-d]pyrimidinyl}ace-
tate (10)
[0106] Compound (9) (6.7 g; 25 mmole) is suspended in 75 ml of dry
DMF. Sodium hydride (0.65 g; 27 mmole) is added in portions, and
the mixture is stirred at room temperature for 30 min. Methyl
bromoacetate (2.44 ml; 26.5 mmole) is added at room temperature
using a syringe. Stirring is continued at room temperature until
analysis by TLC indicates completion of the reaction, at which time
the reaction mixture is treated with a small amount of carbon
dioxide methanol. The solvent is evaporated and the residue is
dissolved in CH.sub.2Cl.sub.2, washed once with water and then
evaporated to dryness. The product is purified by chromatography to
yield the desired isomer (10).
2-{4-[4-Methoxyphenyl)carbonylamino]pyrazolo[5,4-d]pyrimidinyl}acetic
acid (11)
[0107] Compound (10) (5.13 g; 15 mmole) is suspended in 120 ml
water, and 2N aqueous sodium hydroxide solution is added drop-wise
at 0.degree. C. to maintain the pH at 11, until the methyl ester is
completely hydrolyzed. The reaction solution is filtered and the pH
of the filtrate is brought to 3, using 2M KHSO.sub.4 solution,
leading to the precipitation of product (11). The precipitate is
washed with a small amount of water, dried in vacuo, and analyzed
for purity. If necessary, the product (11) is purified further by
chromatography.
Example 5
Synthesis of
2-[N-(2-{[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)-2-{4-[-
(4-methoxyphenyl)carbonylamino]pyrazolo[5,4-d]pyrimidinyl}acetylamino]acet-
ic acid (Compound 13, Reaction Scheme 6)
Methyl
2-[N-(2-{[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)-2-{4-[(4-met-
hoxyphenyl)carbonylamino]pyrazolo[5,4-d]pyrimidinyl}acetylamino]acetate
(12)
[0108] Methyl
2-[(2-{[(4-methoxyphenyl)diphenylmethyl]amino}ethyl)amino]ac- etate
(MMTrAeg, 1.26 g; 3.1 mmole) is dissolved in DMF (8 ml). To this
solution is added N-ethylmorpholine (1.07 g; 6.28 mmole),
3-hydroxy-4-oxo-3,4-dihyro-1,2,3-benzotrazine (HOObt) (0.505 g; 3.1
mmole), Compound 11 (1.01 g; 3.1 mmole) and diisopropylcarbodiimide
(DIPC) (0.59 g; 3.72 mmole). The reaction mixture is stirred for 48
hours at 4.degree. C., then the solvent is removed in vacuo and the
residue is dissolved in ethyl acetate. This solution is washed with
water and washed once with saturated KCl solution. The organic
phase is dried over Na.sub.2SO.sub.4, filtered and evaporated. The
residue is dissolved in a small volume of ethyl acetate, and cooled
in ice to induce crystallization of diisopropylurea, leaving the
product (12) in solution. Alternatively, diisopropylurea is
separated from (12) by silica gel chromatography.
2-[N-(2-{[(4-Methoxyphenyl)diphenylmethyl]amino}ethyl)-2-{4-[(4-methoxyphe-
nyl)carbonylamino]pyrazolo[5,4-d]pyrimidinyl}acetylamino]acetic
acid (13)
[0109] Compound (12) (1.43 g; 2 mmole) is dissolved in dioxane (10
ml). The solution is cooled to 0.degree. C., and 1 M aqueous NaOH
(8.66 ml) is added drop-wise in 5 aliquots over 2.5 hours. After an
additional 2 hours at room temperature, the pH is adjusted to 5 by
drop-wise addition of 2M HKSO.sub.4. Precipitated salts are
filtered off, washed with dioxane, then the combined filtrates are
dried in vacuo. The residue (13) is co-evaporated with ethanol and
methanol/CH.sub.2Cl.sub.2, then purified by silica gel
chromatography.
Example 6
Reduction in Self-Association of PPG-Containing
Oligonucleotides
[0110] In this example, 13-mer and 14-mer oligonucleotide
conjugates, containing between two and nine G residues, were
analyzed by nondenaturing gel electrophoresis and compared with
oligonucleotides of identical sequence except that all G residues
were replaced by PPG. The lengths and sequences of the
oligonucleotides are given in Table 1. Electrophoresis was
conducted in 8% polyacrylamide gels run in 1.times.TBE buffer for
45 min at 40.degree. C. Gels were stained with Daiichi 2D Silver
Stain II.RTM. and R.sub.f values for the stained oligonucleotide
bands were determined using two control oligonucleotides as
standards. Control oligonucleotide A had the sequence
5'-ACCTGTATTCCTTGCC-3' (SEQ ID NO. 22) and control oligonucleotide
B had the sequence 5'-ZTACAZCAAATZZAA-3' (SEQ ID NO. 23), where Z
represents PPG.
1TABLE 1 Oligonucleotide Sequences SEQ ID NO. SEQ ID NO. Sequence*
Length (with G) (with PPG) 5'-CAAATGGGGGGGGG-3' 14 1 9
5'-ACAAATGGGGGGGG-3' 14 2 10 5'-AACAAATGGGGGGG-3' 14 3 11
5'-CAACAAATGGGGGG-3' 14 4 12 5'-ACAACAAATGGGGG-3' 14 5 13
5'-CACAACAAATGGGG-3' 14 6 14 5'-CACAACAAATGGG-3' 13 7 15
5'-AGCACAACAAATGG-3' 14 8 16 *All oligonucleotides contained, at
their 5' ends, a conjugated fluorescein moiety and, conjugated at
their 3' ends, a minor groove binder (CDPI.sub.3) and a quencher
(tetramethylrhodamine). Synthesis of this type of conjugate is
described in co-owned PCT Publication WO 99/51775, the disclosure
of which is incorporated by reference.
[0111] Results of the analysis are, shown in Table 2. R.sub.f
values were measured separately for G- and PPG-containing
oligonucleotides with respect to control oligonucleotides A and B,
respectively. However, the distance migrated by control
oligonucleotides A and B was essentially identical.
Oligonucleotides containing three or more G residues
(oligonucleotides 1-6) show a reduction in R.sub.f when compared to
similar-sized oligonucleotides containing two G residues or less
(e.g., oligonucleotides 7 and 8 and control oligonucleotide A),
indicating aggregation of G-rich oligonucleotides. By contrast,
oligonucleotides containing between two and nine PPG residues have
R.sub.f's that are similar to one another and to a control
oligonucleotide containing two PPG residues. It was also noted that
G-containing oligonucleotides exhibited diffuse bands upon
electrophoresis (the R.sub.f values for these oligonucleotides was
determined by measuring from the center of the band). Furthermore,
comparison of a G-containing oligonucleotide with an
oligonucleotide of the same size and sequence, but with G
substituted by PPG, shows that the reduced R.sub.f characteristic
of oligonucleotides containing three or more G residues is not
observed with PPG-containing oligonucleotides, suggesting little or
no aggregation of oligonucleotides containing up to nine
consecutive PPG residues.
2TABLE 2 Rf values of G- and PPG-containing oligonucleotides SEQ ID
NO # G # PPG R.sub.f A 2 1.00 1 9 0.58 2 8 0.42 3 7 0.37 4 6 0.35 5
5 0.32 6 4 0.29 7 3 0.96 8 2 0.96 B 4 1.00 9 9 0.96 10 8 0.97 11 7
0.95 12 6 0.95 13 5 0.98 14 4 1.03 15 3 0.98 16 2 0.96
Example 7
Reduced Fluorescence Quenching in Fluorescently-Labeled Nucleotides
when PPG is Substituted for G
[0112] Fluorescein was coupled to GMP and to PPGMP (i.e., the
monophosphate derivatives of G and PPG) and the fluorescence of 200
nM solutions of these conjugates was determined. Excitation was at
494 nm and fluorescence emission was measured at 522 nm.
Fluorescence emission of the GMP conjugate was 15,447 units; while
the fluorescence emission of the PPGMP conjugate was 32,767 units.
Thus, quenching of the fluorophore by guanine was relieved when PPG
was substituted for guanine, leading to an increase in fluorescence
yield of the PPGMP conjugate of over two-fold, compared to the G
conjugate.
Example 8
Reduced Fluorescence Quenching in Fluorescently-Labeled
Oligonucleotide Probes when PPG is Substituted for G
[0113] Fluorescein-oligonucleotide conjugates were examined for the
effect, on fluorescence yield, of substituting PPG for G. The
oligonucleotide portion of the conjugates contained a 5'-terminal G
or PPG residue, to which was coupled a fluorescein molecule. The
conjugates optionally contained a covalently coupled CDPI.sub.3
molecule at their 3'-end. Sequences are given in Table 3.
Fluorescence of a 200 nM solution of the conjugates, in 20 mM
Tris-HCl, pH 7, 40 mM NaCl, 5 mM MgCl.sub.2, was measured at room
temperature, with excitation at 494 nm and emission detected at 522
nm. Results are given in Table 3.
3TABLE 3 Effect of PPG substitution on fluorescence yield of
oligonucleotide conjugates SEQ ID No Sequence* F.dagger.
.DELTA.F.dagger-dbl. % increase 18 5'-F1-GTCCTGATTTTAC-MGB-3' 8,650
19 5'-F1-(PPG)TCCTGATTTTAC-MGB-3' 10,739 2,089 24 20
5'-F1-GTCCTGATTTTAC-3' 14,883 21 5'-F1-(PPG)TCCTGATTTTAC-- 3'
23,835 8,952 38 *- F1 denotes fluorescein; MGB denotes a conjugated
minor groove binder (CDPI.sub.3) .dagger.- denotes fluorescence
yield, in arbitrary units .dagger-dbl.- indicates the increase in
fluorescence of a PPG-containing oligonucleotide compared to a
G-containing oligonucleotide
[0114] The results indicated that substitution of PPG for G
increased fluorescence (i.e., reduced quenching) by 24% and 38% for
MGB-conjugated and non-MGB-conjugated oligonucleotides,
respectively.
Example 9
Improved Performance of Probes Containing Multiple Consecutive G
Residues in a Hydrolyzable Probe Assay when PPG is Substituted for
G
[0115] The oligonucleotide conjugates whose sequences are shown in
Table 1 were used as fluorescent probes in a hydrolyzable probe
assay. U.S. Pat. No. 5,210,015; Livak et al. (1995) PCR Meth. App.
4:357-362; Wittwer et al. (1997a) Biotechniques 22:130-138; and
Wittwer et al. (1997b) Biotechniques 22:176-181. The performance of
G-containing probes was compared to that of PPG-containing probes.
Probes contained a conjugated fluorophore at their 5' end, along
with a quencher and a minor groove binder conjugated to the 3' end
of the probe, as described in co-owned PCT publication WO 99/51775.
The target sequence was
5'-CACCTCAGCCTCCCAAGTAACTTTTAACCCCCCCCCATTTGTTGTGCTG
TTTTCATACCTGTAATCCTGGCACTTT-3' (SEQ ID NO. 17). Underlined portions
of the target sequence correspond to the primer sequences.
[0116] Amplification was conducted in an Idaho Technologies LC-24
LightCycler.RTM. with real-time fluorescence monitoring.
Amplification reactions contained 10.sup.5 copies/.mu.l of the
target 76-mer (as above), 100 nM of each primer, 10 nM fluorescent
probe (as above), 20 mM Tris-HCl, pH 7, 40 mM NaCl, 5 mM
MgCl.sub.2, 0.05% bovine serum albumin, 0.5 mM each dNTP, 0.038
Unit/.mu.l Taq polymerase and 0.01 Unit/.mu.l Uracil-N-glycosylase.
The cycling program was one cycle of 50.degree. C. for 3 min. then
95.degree. C. for 2 min, followed by 50 cycles of 95.degree. C. for
2 sec, then 60.degree. C. for 30 sec.
[0117] The results are shown in FIG. 1. In this method, production
of amplification product is indicated by an increase in
fluorescence with time, caused by hydrolysis of the probe
hybridized to the amplification product. The results obtained
herein show that detection of amplification product using probes
containing more that three consecutive G residues was inefficient
and in fact, for probes containing 5 or more consecutive G
residues, no detection of product was observed. By contrast, when
PPG was substituted for G in the fluorescent probe, probes
containing up to 9 consecutive PPG residues provided highly
efficient real-time detection of amplification product.
[0118] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be apparent to those skilled in the art
that various changes and modifications can be practiced without
departing from the spirit of the invention. Therefore the foregoing
descriptions and examples should not be construed as limiting the
scope of the invention.
4TABLE 2 Rf values of G- and PPG-containing oligonucleotides SEQ ID
NO: #G # PPG Rf 22 2 1.00 1 9 0.58 2 8 0.42 3 7 037 4 6 0.35 5 5
0.32 6 4 0.29 7 3 0.96 8 2 0.96 23 4 1.00 9 9 0.96 10 8 0.97 11 7
0.95 12 6 0.95 13 5 0.98 14 4 103 15 3 0.98 16 2 0.96
[0119]
Sequence CWU 1
1
23 1 14 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide conjugate 1 naaatggggg gggn 14 2 14 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide
conjugate 2 ncaaatgggg gggn 14 3 14 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide conjugate 3
nacaaatggg gggn 14 4 14 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide conjugate 4 naacaaatgg gggn 14
5 14 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide conjugate 5 ncaacaaatg gggn 14 6 14 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide
conjugate 6 nacaacaaat gggn 14 7 13 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide conjugate 7
nacaacaaat ggn 13 8 14 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide conjugate 8 ngcacaacaa atgn 14
9 14 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide conjugate 9 naaatnnnnn nnnn 14 10 14 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide
conjugate 10 ncaaatnnnn nnnn 14 11 14 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide conjugate 11
nacaaatnnn nnnn 14 12 14 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide conjugate 12 naacaaatnn nnnn 14
13 14 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide conjugate 13 ncaacaaatn nnnn 14 14 14 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide conjugate 14 nacaacaaat nnnn 14 15 13 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide conjugate 15 nacaacaaat nnn 13 16 14 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide
conjugate 16 ngcacaacaa atnn 14 17 76 DNA Artificial Sequence
Description of Artificial Sequencetarget sequence 17 cacctcagcc
tcccaagtaa cttttaaccc ccccccattt gttgtgctgt tttcatacct 60
gtaatcctgg cacttt 76 18 13 DNA Artificial Sequence Description of
Artificial Sequence oligonucleotide conjugate 18 ntcctgattt tan 13
19 13 DNA Artificial Sequence Description of Artificial Sequence
oligonucleotide conjugate 19 ntcctgattt tan 13 20 13 DNA Artificial
Sequence Description of Artificial Sequence oligonucleotide
conjugate 20 ntcctgattt tac 13 21 13 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide conjugate 21
ntcctgattt tac 13 22 16 DNA Artificial Sequence Description of
Artificial Sequence control oligonucleotide A 22 acctgtattc cttgcc
16 23 15 DNA Artificial Sequence Description of Artificial Sequence
control oligonucleotide B 23 ntacancaaa tnnaa 15
* * * * *
References