U.S. patent application number 10/505079 was filed with the patent office on 2005-10-13 for precise breeding.
This patent application is currently assigned to J.R. Simplot Company. Invention is credited to Brinkerhoff, W. Leigh, Menendez-Humara, Jaime, Richael, Craig, Rommens, Caius, Swords, Kathy M. M., Yan, Hua, Ye, Jingson.
Application Number | 20050229267 10/505079 |
Document ID | / |
Family ID | 27760470 |
Filed Date | 2005-10-13 |
United States Patent
Application |
20050229267 |
Kind Code |
A1 |
Rommens, Caius ; et
al. |
October 13, 2005 |
Precise breeding
Abstract
The present invention relates to a new plant breeding process.
The process improves the agronomic performance of crop plants by
using genetic material that is also used in classical breeding.
Instead of sexually recombining entire genomes at random, as is
done in classical breeding, specific genetic elements are
rearranged in vitro and inserted back into individual plant cells.
Plants obtained through this new plant breeding process do not
contain foreign nucleic acid but only contain nucleic acid from the
plant species selected for transformation or plants that are
sexually compatible with the selected plant species. Plants
developed through this new plant breeding process are provided. In
particular, potato plants displaying improved tuber storage and
health characteristics are provided.
Inventors: |
Rommens, Caius; (Boise,
ID) ; Ye, Jingson; (Boise, ID) ; Yan, Hua;
(Boise, ID) ; Swords, Kathy M. M.; (Bosie, ID)
; Menendez-Humara, Jaime; (Boise, ID) ;
Brinkerhoff, W. Leigh; (Meridian, ID) ; Richael,
Craig; (Meridian, ID) |
Correspondence
Address: |
FOLEY AND LARDNER
SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
J.R. Simplot Company
|
Family ID: |
27760470 |
Appl. No.: |
10/505079 |
Filed: |
March 7, 2005 |
PCT Filed: |
February 20, 2003 |
PCT NO: |
PCT/US03/04947 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60357661 |
Feb 20, 2002 |
|
|
|
60377602 |
May 6, 2002 |
|
|
|
Current U.S.
Class: |
800/278 ;
435/468; 536/23.6; 800/294 |
Current CPC
Class: |
C12N 15/8245 20130101;
C12N 15/8216 20130101; C12N 9/0059 20130101; C12N 15/821 20130101;
C12N 15/8273 20130101; C07K 14/415 20130101; C12N 9/1051 20130101;
C12N 15/825 20130101; A01H 1/00 20130101; C12N 9/1294 20130101;
C12N 15/8202 20130101; C12N 15/8209 20130101; C12N 15/8205
20130101; C12N 15/8226 20130101; C12N 15/8218 20130101; A23L 19/18
20160801; A23L 5/11 20160801; A23L 19/12 20160801; C12N 15/8243
20130101; A01H 1/04 20130101 |
Class at
Publication: |
800/278 ;
800/294; 435/468; 536/023.6 |
International
Class: |
C07H 021/04; A01H
001/00; C12N 015/82 |
Claims
What is claimed is:
1. A method of modifying a trait of a selected plant comprising: a.
stably transforming cells from said selected plant with a desired
polynucleotide, wherein said desired polynucleotide consists
essentially of a nucleic acid sequence that is native to said
selected plant, native to a plant from the same species, or is
native to a plant that is sexually interfertile with said selected
plant, b. obtaining a stably transformed plant from said
transformed plant cells wherein said transformed plant contains
said desired polynucleotide stably integrated into the genome and
wherein said desired polynucleotide modifies said trait.
2. The method according to claim 1, further comprising
co-transfecting said plant cells with a selectable marker gene that
is transiently expressed in said plant cells, and identifying
transformed plant cells, and transformed plants obtained from said
transformed plant cells, wherein said selectable marker gene is not
stably integrated and said desired polynucleotide is stably
integrated into the genome.
3. The method of claim 1, wherein the plant is a monocotyledenous
plant.
4. The method of claim 3, wherein said monocotyledenous plant is
selected from the group consisting of wheat, turf, turf grass,
cereal, maize, rice, oat, wheat, barley, sorghum, orchid, iris,
lily, onion, banana, sugarcane, sorghum, and palm.
5. The method of claim 1, where in the plant is a dicotyledenous
plant.
6. The method of claim 5, wherein said dicotyledenous plant is
selected from the group consisting of potato, tobacco, tomato,
sugarbeet, broccoli, cassava, sweet potato, pepper, cotton,
poinsetta, legumes, alfalfa, soybean, carrot, strawberry, lettuce,
oak, maple, walnut, rose, mint, squash, daisy, and cactus.
7. The method of claim 1, wherein said trait is selected from the
group consisting of enhanced health and nutritional
characteristics, improved storage, enhanced yield, enhanced salt
tolerance, enhanced heavy metal tolerance, increased drought
tolerance, increased disease tolerance, increased insect tolerance,
increased water-stress tolerance, enhanced cold and frost
tolerance, enhanced color, enhanced sweetness, improved vigor,
improved taste, improved texture, decreased phosphate content,
increased germination, increased micronutrient uptake, improved
starch composition, improved flower longevity.
8. The method of claim 1, wherein said desired polynucleotide
comprises a P- DNA, GBSS promoter, Ubi7 promoter, Ubi3 promoter,
PIP promoter, modified PPO gene, invertase inhibitor gene, salt
tolerance gene, R1-associated leader, phosphorylase-associated
leader, R1-associated trailer, SBE-associated trailers, Ubi-intron,
GBSS spacer, UbiT.
9. The method of claim 1, wherein said plant cells are transformed
via Agrobacterium-mediated transformation.
10. The method of claim 9, wherein Agrobacterium-mediated
transformation relies on the use of at least one binary vector.
11. The method of claim 10, wherein the Agrobacterium-mediated
transformation method uses a first binary vector and a second
binary vector.
12. The method of claim 11, wherein the first binary vector
contains said desired polynucleotide and the second binary vector
contains a functional selectable marker gene, wherein said
functional selectable marker gene is operably linked to a promoter
and a terminator.
13. A plant made by the method of claim 1.
14. A method of modifying a trait in a selected plant comprising:
(a) identifying the trait to be modified; (b) constructing a first
polynucleotide consisting essentially of native genetic elements
isolated from said selected plant, a plant from the same species,
or a plant that is sexually interfertile with said selected plant,
wherein said native genetic elements are capable of modifying the
expression of a functional gene that controls said trait (c)
constructing a second polynucleotide comprising a functional
selectable marker gene; (d) co-transfecting plant cells from said
selected plant with said first and second polynucleotides; (e)
selecting for the transient expression of said functional
selectable marker gene; (f) screening for plant cells stably
transformed with said first polynucleotide but do not contain said
second polynucleotide integrated into the genome; and (g) obtaining
a stably transformed plant from said transformed plant cells that
exhibit modified expression of said trait.
15. The method of claim 14, wherein in the plant is a
monocotyledenous plant.
16. The method of claim 15, wherein said monocotyledenous plant is
selected from the group consisting of wheat, turf, turf grass,
cereal, maize, rice, oat, wheat, barley, sorghum, orchid, iris,
lily, onion, banana, sugarcane, sorghum, and palm.
17. The method of claim 14, where in the plant is a dicotyledenous
plant.
18. The method of claim 17, wherein said dicotyledenous plant is
selected from the group consisting of avocado, potato, tobacco,
tomato, sugarbeet, broccoli, cassava, sweet potato, pepper, cotton,
poinsetta, legumes, alfalfa, soybean, carrot, strawberry, lettuce,
oak, maple, walnut, rose, mint, squash, daisy, and cactus.
19. The method of claim 14, wherein said trait is selected from the
group consisting of enhanced health and nutritional
characteristics, improved storage, enhanced yield, enhanced salt
tolerance, enhanced heavy metal tolerance, increased drought
tolerance, increased disease tolerance, increased insect tolerance,
increased water-stress tolerance, enhanced cold and frost
tolerance, enhanced color, enhanced sweetness, improved vigor,
improved taste, improved texture, decreased phosphate content,
increased germination, increased micronutrient uptake, improved
starch composition, improved flower longevity.
20. The method of claim 14, wherein said genetic elements comprise
at least one of a promoter, sequence of interest, terminator,
enhancer, intron, spacer, or regulatory elements.
21. The method of claim 14, wherein said plant cells are
transformed via Agrobacterium-mediated transformation.
22. The method of claim 21, wherein Agrobacterium-mediated
transformation relies on the use of at least one binary vector.
23. The method of claim 22, wherein the Agrobacterium-mediated
transformation method uses a first binary vector and a second
binary vector.
24. The method of claim 23, wherein the first binary vector carries
said first polynucleotide and the second binary vector carries said
second polynucleotide.
25. A method of modifying the expression of a functional gene in a
selected plant comprising: (a) constructing a first polynucleotide
consisting essentially of native genetic elements isolated from
said selected plant, a plant of the same species as said selected
plant, or a plant that is sexually interfertile with said selected
plant, wherein said-native genetic elements are capable of
modifying the expression of said functional gene; (b) constructing
a second polynucleotide comprising a selectable marker gene
operably linked to a promoter and terminator; (c) co-transfecting
plant cells from said selected plant with said first and second
poylnucleotides; (d) selecting for the transient expression of said
selectable marker gene; (e) screening for plant cells stably
transformed with said first polynucleotide but do not contain said
second polynucleotide integrated into the genome; and (f) obtaining
a transformed plant from said transformed plant cells that exhibit
modified expression of said gene.
26. The method of claim 25, wherein said plant is a
monocotyledenous plant.
27. The method of claim 26, wherein said monocotyledenous plant is
selected from the group consisting of wheat, turf, turf grass,
cereal, maize, rice, oat, wheat, barley, sorghum, orchid, iris,
lily, onion, banana, sugarcane, sorghum, and palm.
28. The method of claim 25, where in the plant is a dicotyledenous
plant.
29. The method of claim 28, wherein said dicotyledenous plant is
selected from the group consisting of potato, tobacco, tomato,
sugarbeet, broccoli, cassava, sweet potato, pepper, cotton,
poinsetta, legumes, alfalfa, soybean, carrot, strawberry, lettuce,
oak, maple, walnut, rose, mint, squash, daisy, and cactus.
30. The method of claim 25, wherein said plant cells are
transfected via Agrobacterium-mediated transformation.
31. The method of claim 30, wherein Agrobacterium-mediated
transformation relies on the use of at least one binary vector.
32. The method of claim 31,, wherein the Agrobacterium-mediated
transformation method uses a first binary vector and a second
binary vector.
33. The method of claim 32, wherein the first binary vector carries
said first polynucleotide and the second binary vector carries said
second polynucleotide.
34. The method of claim 25, wherein said first polynucleotide
comprises at least one of a P-DNA, GBSS promoter, Ubi7 promoter,
Ubi3 promoter, PIP promoter, modified PPO gene, PPO-associated
trailer, invertase inhibitor gene, salt tolerance gene,
R1-associated leader, phosphorylase-associated leader,
R1-associated trailer, SBE-associated trailers, Ubi-intron, GBSS
spacer, UbiT.
35. The method of claim 25, wherein said second polynucleotide
comprises at least one of a selectable marker gene, an
omega-mutated virD2 polynucleotide, a codA polynucleotide, and a
codA::upp fusion polynucleotide.
36. A plant made by the method of claim 25.
37. A transgenic plant exhibiting modified expression of a trait
compared to the non-trasgenic plant from which it was derived,
wherein said transgenic plant is stably transformed with a desired
polynucleotide consisting essentially of native genetic elements
isolated from said plant, a plant in the same species, or a plant
that is sexually interfertile with said plant, and wherein said
polynucleotide modifies the expression of said trait.
38. The plant according to claim 37, wherein said plant is a
monocotyledenous plant.
39. The plant according to claim 38, wherein said monocotyledenous
plant is selected from the group consisting of wheat, turf, turf
grass, cereal, maize, rice, oat, wheat, barley, sorghum, orchid,
iris, lily, onion, banana, sugarcane, sorghum, and palm.
40. The plant according to claim 37, wherein said plant is a
dicotyledenous plant.
41. The plant according to claim 40, wherein said dicotyledenous
plant is selected from the group consisting of-potato, tobacco,
tomato, sugarbeet, broccoli, cassava, sweet potato, pepper, cotton,
poinsetta, legumes, alfalfa, soybean, carrot, strawberry, lettuce,
oak, maple, walnut, rose, mint, squash, daisy, and cactus.
42. The trait according to claim 37, wherein said trait is selected
from the group consisting of enhanced health and nutritional
characteristics, improved storage, enhanced yield, enhanced salt
tolerance, enhanced heavy metal tolerance, increased drought
tolerance, increased disease tolerance, increased insect tolerance,
increased water-stress tolerance, enhanced cold and frost
tolerance, enhanced color, enhanced sweetness, improved vigor,
improved taste, improved texture, decreased phosphate content,
increased germination, increased micronutrient uptake, improved
starch composition, improved flower longevity.
43. The desired polynucleotide according to claim 37, wherein said
polynucleotide comprises at least one of a P-DNA, GBSS promoter,
Ubi7 promoter, Ubi3 promoter, PIP promoter, modified PPO gene,
PPO-associated trailer, invertase inhibitor gene, salt tolerance
gene, R1-associated leader, phosphorylase-associated leader,
R1-associated trailer, SBE-associated trailers, Ubi-intron, GBSS
spacer, UbiT.
44. An isolated, border-like nucleotide sequence ranging in size
from 20 to 100 bp that shares between 52% and 96% sequence identity
with a T-DNA border sequence from Agrobacterium tumafaciens.
45. The isolated nucleotide sequence of claim 44 wherin said
nucleotide sequence is isolated from a monocotyledenous plant.
46. The isolated nucleotide of claim 45, wherein said
monotcotyledenous plant is selected from the group consisting of
wheat, turf, turf grass, cereal, maize, rice, oat, wheat, barley,
sorghum, orchid, iris, lily, onion, banana, sugarcane, sorghum, and
palm.
47. The isolated nucleotide sequence of claim 44, wherein said
nucleotide sequence is isolated from a dicotyledenous plant.
48. The isolated nucleotide sequence of claim 47, wherein said
dicotyledenous plant is selected from the group consisting of
potato, tobacco, tomato, sugarbeet, broccoli, cassava, sweet
potato, pepper, cotton, poinsetta, legumes, alfalfa, soybean,
carrot, strawberry, lettuce, oak, maple, walnut, rose, mint,
squash, daisy, and cactus.
49. The nucleotide sequence of claim 44, isolated from potato,
which has a nucleotide sequence shown in either SEQ ID NO. 54 or
55.
50. The nucleotide sequence of claim 44, isolated from wheat, which
has a nucleotide sequence shown in either SEQ ID NO. 94 or 95.
51. A method of making a plant stably transformed with a desired
polynucleotide comprising: (a) isolating a P-DNA that is flanked by
border-like sequences from said plant wherein said border-like
sequences share between 52% and 96% sequence identity with an
Agrobacterium tumafaciens T-DNA border sequence; (b) inserting said
desired polynucleotide between said P-DNA border-like sequences to
form a P-DNA construct; and (c) transforming a plant cell from said
plant with said P-DNA construct; and (d) recovering a plant from
said transformed plant cell stably transformed with said P-DNA
construct.
52. The method according to claim 51, wherein said P-DNA construct
is carried on a vector comprised of a backbone integration marker
gene and transformed plant cells are selected that do not contain
said backone integration marker gene.
53. The method according to claim 52, wherein said backbone
integration marker gene is selected from the group consisting of is
a cytokinin gene, and wherein plant shoots are not selected that
exhibit a cytokinin-overproducing phenotype.
54. The method according to claim 53, wherein said backnone
integraton marker gene is the IPT gene, and plant shoots are not
selected that exhibit an abnormal phenotype or cannot develop
roots.
55. The method of claim 52, wherein said plant cells are from a
monocotyledenous plant.
56. The method of claim 55, wherein said monocotyledenous plant is
selected from the group consisting of wheat, turf grass, cereal,
maize, rice, oat, wheat, barley, sorghum, orchid, iris, lily,
onion, banana, sugarcane, sorghum, and palm.
57. The method of claim 52, where in the plant cells are from a
dicotyledenous plant.
58. The method of claim 57, wherein said dicotyledenous plant is
selected from the group consisting of avocado, potato, tobacco,
tomato, sugarbeet, broccoli, cassava, sweet potato, pepper, cotton,
poinsetta, legumes, alfalfa, soybean, carrot, strawberry, lettuce,
oak, maple, walnut, rose, mint, squash, daisy, and cactus.
59. The method of claim 51, wherein said plant cells are
transfected via Agrobacterium-mediated transformation.
60. The method of claim 59, wherein Agrobacterium-mediated
transformation relies on the use of at least one binary vector.
61. The method of claim 60, wherein the Agrobacterium-mediated
transformation method uses a first binary vector and a second
binary vector.
62. The method of claim 61, wherein the first binary vector carries
said P-DNA construct.
63. The method of claim 61, wherein the second binary vector
comprises at least one of a negative selectable marker gene and an
omega-mutated virD2 gene, wherein the negative selectable marker
gene is positioned within the right T-DNA border and the left T-DNA
border, and wherein the omega-mutated virD2 gene is positioned
within the backbone of the second binary vector.
64. A vector comprising the nucleotide sequence of claim 44.
65. A P-DNA consisting essentially of, in the 5'- to 3'-direction,
a first T-DNA border-like sequence, a promoter, a desired
polynucleotide sequence operably linked to the promoter, a
terminator, and a second T-DNA border-like sequence, wherein the
border-like sequences have less than 100% sequence identity with
T-DNA border sequences.
66. The P-DNA of claim 65, wherein said T-DNA border-like
sequences, said promoter, said desired polynucleotide, and said
terminator, are all isolated from the same plant, the same plant
species, or plants that are sexually interfertile.
67. The P-DNA of claim 65, further consisting essentially of a
selectable marker gene.
68. The P-DNA of claim 67, wherein said T-DNA border-like
sequences, said promoter, said desired polynucleotide, said
terminator and said selectable marker gene, are all isolated from
the same plant, the same plant species, or plants that are sexually
interfertile.
69. The P-DNA of claim 65, wherein the desired polynucleotide
sequence is a sequence upstream or downstream of the coding region
of a gene, wherein the upstream sequence is a leader sequence, and
wherein the downstream sequence is a trailer sequence.
70. The P-DNA of claim 69, wherein said T-DNA border-like
sequences, said promoter, said leader sequence, said trailer
sequence, said terminator and said selectable marker gene are all
isolated from the same plant, the same plant species, or plants
that are sexually interfertile.
71. An isolated nucleotide sequence comprising the GBSS promoter
isolated from S. tuberosum.
72. The isolated nucleotide sequence of claim 71, which has the
nucleotide sequence that is SEQ ID. NO. 6 or 13.
73. A vector comprising the P-DNA of claim 65.
74. A vector according to claim 74, wherein the promoter is a
regulatable promoter.
75. A vector according to claim 74, wherein the regulatable
promoter is sensitive to temperature.
76. A vector according to claim 75, wherein the regulatable
promoter is a wheat wcs120 promoter.
77. A vector according to claim 74, wherein the promoter is under
temporal regulation.
78. A vector according to claim 77, wherein the promoter is a
carboxylase promoter.
79. A vector according to claim 78, wherein the carboxylase
promoter is a maize carboxylase promoter.
80. A vector according to claim 74, wherein the promoter is
regulated by any one of abscisic acid, wounding, methyl jasmonate
or gibberellic acid.
81. A vector according to claim 80, wherein the promoter is a
promoter selected from either a Rab 16A gene promoter, an a-amylase
gene promoter or a pin2 gene promoter.
82. A vector according to claim 73, wherein the promoter is a
tissue-specific promoter.
83. A vector according to claim 69, wherein the leader sequence is
a part of a 5'-untranslated region associated with a gene that is
endogenous to a cell of the selected plant species.
84. A vector according to claim 69, wherein the 5'-untranslated
region is upstream of a start codon of a gene that is selected from
the group consisting of a PPO gene, an R1 gene, a HOS1 gene, a
S-adenosylhomocysteine hydrolase gene, a class II cinnamate
4-hydroxylase gene, a cinnamoyl-coenzyme A reductase gene, a
cinnamoyl alcohol dehydrogenase gene, a caffeoyl coenzyme A
O-methyltransferase gene, an actin depolymerizing factor gene, a
Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase
gene, an ADP-glucose pyrophosphorylase gene, a proline
dehydrogenase gene, an endo-1,4-beta-glucanase gene, a zeaxanthin
epoxidase gene, and a 1-aminocyclopropane-1-carboxylate synthase
gene.
85. A vector according to claim 69, wherein the trailer sequence is
a part of the 3'-untranslated region associated with a gene that is
downstream of a termination codon of a gene selected from the group
consisting of a PPO gene, an R1 gene, a HOS1 gene, a
S-adenosylhomocysteine hydrolase gene, a class II cinnamate
4-hydroxylase gene, a cinnamoyl-coenzyme A reductase gene, a
cinnamoyl alcohol dehydrogenase gene, a caffeoyl coenzyme A
O-methyltransferase gene, an actin depolymerizing factor gene, a
Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase
gene, an ADP-glucose pyrophosphorylase gene, a proline
dehydrogenase gene, an endo-1,4-beta-glucanase gene, a zeaxanthin
epoxidase gene, and a 1-aminocyclopropane-1-carboxylate synthase
gene.
86. A vector according to claim 65, further comprising a spacer
element that is either an Ubi intron sequence or a GBSS spacer
sequence.
87. A vector according to claim 65, wherein the terminator is a
Ubi3 terminator sequence or a 3'-untranslated region of an
endogenous plant gene.
88. A vector according to claim 65, further comprising a selectable
marker gene operably linked to a constitutive promoter and a Cre
gene operably linked to an inducible promoter, wherein the
selectable marker gene and the Cre gene are flanked by a first
recombinase recognition site and a second recombinase recognition
site.
89. A vector according to claim 88, wherein the first recombinase
recognition site and the second recombinase recognition site are
lox sites.
90. A vector according to claim 88, wherein the inducible promoter
is a temperature-sensitive promoter, a chemically-induced promoter,
or a temporal promoter.
91. A vector according to claim 88, wherein the inducible promoter
is a Ha hsp17.7 G4 promoter, a wheat wcs120 promoter, a Rab 16A
gene promoter, an .alpha.-amylase gene promoter, a pin2 gene
promoter, a carboxylase promoter.
92. A vector according to claim 65, further comprising a
plant-derived marker gene.
93. A vector according to claim 92, wherein the plant-derived
marker gene is an enolpyruvul-3-phosphoshikimic acid synthase gene,
a salt-tolerance gene, or the PST1 gene, the PST2 gene, or the PST3
gene.
94. A method for modifying a plant cell, comprising integrating a
P-DNA sequence into the genome of a plant cell, wherein the P-DNA
consists essentially of, in the 5'- to 3'-direction, a first T-DNA
border-like sequence, a promoter, a desired polynucleotide sequence
operably linked to the promoter, a terminator, and a second T-DNA
border-like sequence, wherein the border-like sequences have less
than 100% sequence identity with T-DNA border sequences, and
wherein the T-DNA border-like sequences, the promoter, the desired
polynucleotide, and terminator, are all isolated from or native to
the genome of the plant cell, wherein the desired polynucleotide
comprises sense and antisense seqeunces of a leader sequence or
trailer sequence that are associated with the upstream or
downstream non-coding regions of a gene in the plant, and wherein
expression of the desired polynucleotide produces a double-stranded
RNA transcript that targets the gene associated with the desired
polynucleotide, thereby modifying the plant cell.
95. A method for modifying a plant, comprising: (i) transfecting at
least one cell in the plant with the vector of claim 88; (ii)
selecting a cell expressing the selectable marker; (iii) isolating
the cell expressing the selectable marker; (iii) inducing the
expression of the Cre gene in the isolated cell; (iv) culturing the
isolated cell; and (ii) observing the phenotype of cultured cells;
wherein a phenotype that is different to an untransfected plant
cell indicates that the target plant cell has been modified.
96. A method according to claim 14 or 95, wherein the selecting
step is performed by identifying which cells are resistant to an
antibiotic.
97. A method for identifying a target plant cell whose genome
contains a P-DNA, comprising co-transfecting a plant target cell
with the vector of claim 65 and a second Agrobacterium-derived
vector that comprises a marker gene flanked by a T-DNA borders or
T-DNA border-like sequences and a omega-mutated virD2 gene, wherein
the P-DNA of the vector of claim 65 is integrated into the genome
of the plant target cell, and wherein no part of the second
Agrobacterium-derived vector is integrated into the genome of the
plant target cell, and wherein the omega-mutated virD2 gene is in
the backbone.
98. A method according to claim 97, wherein the marker in the
second Agrobacterium-derived vector is a neomycin
phosphotransferase gene.
99. A method for identifying a target plant cell whose genome
contains at least a part of an integration cassette according to
claim 98, further comprising selecting cells that survive temporary
growth on a kanamycin-containing media, wherein the genomes of the
selected cells contain only the integration cassette.
100. A method according to any one of claims 94, 95, or 97, wherein
the target plant cell is within a plant.
101. A plant comprising at least one cell whose genome comprises a
P-DNA according to claim 65.
102. A plant comprising at least one cell whose genome is
artificially manipulated to contain only plant-derived nucleic
acids, wherein no cells of the plant contain foreign nucleic acids
integrated into the cell genome.
103. The plant of claim 102, wherein the cell is capable of
expressing at least one of the plant-derived nucleic acids, which
expression modifies a trait associated with the plant.
104. A method for reducing black spot bruising in a selected plant
species, comprising (i) integrating into a genome of a selected
plant species, a P-DNA, delineated by border-like sequences,
comprised only of polynucleotides native to, or isolated from the
selected plant species, or comprised of polynucleotides native to,
or isolated from a plant species that is sexually compatible with
the selected plant species, wherein the P-DNA consists essentially
of, in the 5'- to 3'-direction, a promoter; a sense-orientated
leader nucleotide sequence from a PPO gene; an antisense-oriented
sequence of the leader nucleotide sequence; and a termination
sequence, wherein the promoter produces a double-stranded RNA
molecule, and wherein the double-stranded RNA molecule brings about
a reduction in the expression of the endogenous PPO gene, thereby
reducing black spot bruising in the plant.
105. A method for reducing black spot bruising in a selected plant
species, comprising integrating into a genome of a selected plant
species a P-DNA, delineated by border-like sequences, comprised
only of nucleotide sequences native to, or isolated from the
selected plant species or comprised of polynucleotides native to,
or isolated from a plant species that is sexually compatible with
the selected plant species, wherein the P-DNA consists essentially
of, in the 5'- to 3'-direction, a promoter; a sense-orientated
trailer nucleotide sequence from a PPO gene; an antisense-oriented
sequence of the trailer nucleotide sequence; and a termination
sequence, wherein the promoter produces a double-stranded RNA
molecule, and wherein the double-stranded RNA molecule brings about
a reduction in the expression of the PPO gene, thereby reducing
black spot bruising in the plant.
106. A method for reducing cold-induced sweetening in a selected
plant species, comprising integrating into a genome of a selected
plant species a P-DNA, delineated by border-like sequences,
comprised only of nucleotide sequences isolated from the selected
plant species or or comprised of polynucleotides native to, or
isolated from a plant species that is sexually compatible with the
selected plant species, wherein the P-DNA consists essentially of,
in the 5'- to 3'-direction, a promoter; a sense-orientated leader
nucleotide sequence associated with an R1 gene; an
antisense-oriented sequence of the leader nucleotide sequence; and
a termination sequence, wherein the promoter produces a
double-stranded RNA molecule, and wherein the double-stranded RNA
molecule reduces the expression of the R1 gene, thereby reducing
cold-induced sweetening in the plant.
107. A method for reducing cold-induced sweetening in a selected
plant species, comprising integrating into a genome of a selected
plant species an P-DNA, delineated by border-like sequences,
comprised only of nucleotide sequences isolated from the selected
plant species or comprised of polynucleotides native to, or
isolated from a plant species that is sexually compatible with the
selected plant species, wherein the P-DNA consists essentially of,
in the 5'- to 3'-direction, a promoter; a sense-orientated trailer
nucleotide sequence associated with an R1 gene; an
antisense-oriented sequence of the trailer nucleotide sequence; and
a termination sequence, wherein the promoter produces a
double-stranded RNA molecule, and wherein the double-stranded RNA
molecule reduces the expression of the R1 gene, thereby reducing
cold-induced sweetening in the plant.
108. The method of claim 8, wherein the sequence of interest is a
gene.
109. The method of claim 108, wherein the gene is a modified
polyphenol oxidase, polyphenol oxidase gene, or a modified R1 gene,
or an R1 gene.
110. The method of claim 8, wherein the promoter is an inducible
promoter.
111. The method of claim 8, wherein the terminator is a yeast ADH
terminator sequence.
112. The method of claim 8, wherein the sequence of interest is a
leader or trailer sequence, wherein the leader or trailer sequence
represents a sequence upstream or downstream of a gene that is
native to the plant cell.
113. The method of claim 112, wherein the sequence of interest
comprises a sense-oriented leader sequence operably linked to an
antisense leader sequence.
114. The method of claim 112, wherein the sequence of interest
comprises a sense-oriented trailer sequence operably linked to an
antisense trailer sequence.
115. The method of claim 113, wherein the leader construct
comprises in 5'- to 3'-direction, a promoter, a sense-oriented
leader sequence, the antisense sequence of the leader, and a
terminator, wherein expression of the leader construct produces a
double-stranded RNA molecule that facilitates the down-regulation
of expression of the gene to which it is associated.
116. The method of claim 115, wherein the leader sequence is
associated with, and located upstream of, the coding region of the
PPO gene, the R1 gene, an L-type phosphorylase gene, or an alpha
glucan phosphorylase gene.
117. The method of claim 113, wherein the trailer construct
comprises in 5'- to 3'-direction, a promoter, a sense-oriented
trailer sequence, the antisense sequence of the trailer, and a
terminator, wherein expression of the trailer construct produces a
double-stranded RNA molecule that facilitates the down-regulation
of expression of the gene to which it is associated.
118. The method of claim 117, wherein the trailer sequence is
associated with, and located downstream of, the coding region of
the PPO gene, the R1 gene, an L-type phosphorylase gene, or an
alpha glucan phosphorylase gene.
119. The method of claim 9, further comprising exposing the plant
cell to a second vector that comprises a marker element, wherein
the marker is transiently expressed in the transformed plant and is
not stably integrated into the genome of the transformed plant.
120. The method of claim 119, wherein the marker is a herbicide
resistance gene.
121. The method of claim 120, wherein the cytokinin gene is an
antibiotic resistance gene.
122. The method of claim 119, wherein the marker is a NPTII.
123. A polynucleotide comprising the polynucleotide sequence of SEQ
ID NO. 93, wherein the polynucleotide is between 20 and 80
nucleotides in length.
124. The polynucleotide of claim 123, wherein the polynucleotide is
between 21 and 70 nucleotides in length.
125. The polynucleotide of claim 123, wherein the polynucleotide is
between 22 and 50 nucleotides in length.
126. The polynucleotide of claim 123, wherein the polynucleotide is
between 23 and 40 nucleotides in length.
127. The polynucleotide of claim 123, wherein the polynucleotide is
between 24 and 30 nucleotides in length.
128. The method of claim 4, wherein the plant cells are transfected
with the first polynucleotide before the second polynucleotide.
129. A tuber-specific promoter as shown in SEQ ID NO. 40.
130. An,Agrobacterium-based method of making transgenic plant cells
that do not contain a selectable marker gene stably integrated in
nuclear DNA comprising: a. constructing a first binary vector
comprised of a polynucleotide consisting essentially of a desired
gene -operably linked to T-DNA borders or T-DNA border-like
sequences at the 5' and 3' ends of said desired gene; b.
constructing a second binary vector comprised of a selectable
marker gene operably linked to T-DNA borders or T-DNA border-like
sequences at the 5' and 3' ends of said selectable marker gene; C.
incubating plants cells with: i. an Agrobacterium strain carrying
said first and said second binary vectors; or ii. a first
Agrobacterium strain carrying said first binary vector and a second
Agrobacterium strain carrying said second binary vector; d.
selecting plant cells wherein said desired gene is integrated into
plant nuclear DNA without integration of said selectable marker
gene into plant nuclear DNA following incubation for an appropriate
time period on a medium containing an appropriate selection
agent.
131. The method according to claim 130, wherein said selectable
marker gene is a herbicide resistance gene or an antibiotic
resistance gene.
132. The method according to claim 131, wherein said antibiotic
resistance gene is the nptII gene.
133. The method according to claim 132, wherein said antibiotic
resistance gene is the npt II structural gene operably linked to
the promoter from the Ubiquitin-7 gene and the termninator from
yeast alcohol dehydrogenase 1 (ADH1) gene.
134. The method according to claim 130, wherein said plant cells
are first incubated with said first Agrobacterium strain and then
subsequently incubated with said second Agrobacterium strain or
vice versa.
135. The method according to claim 130, wherein said first binary
vector further comprises a binary integration marker gene that can
be used to detect plant cells stably transformed with binary vector
backbone sequences.
136. The method according to claim 135, wherein said binary vector
integration marker gene is selected from the group consisting of a
herbicide resistance gene, antibiotic resistance gene, or
NPTII.
137. The method according to claim 130, wherein said second binary
vector further comprises a gene fusion between the bacterial
cytosine deaminase (codA) and uracil phophoribsyltransferase (upp)
genes, which is inserted between the T-DNA or T-DNA border-like
sequences, and plant cells are exposed to 5-fluorocytosine
following incubation with said first and second Agrobacterium
strains in order to select against those plant cells transformed
with said second binary vector.
138. The method according to claim 130, wherein said secondary
binary vector further comprises the omega-mutated virD2 gene,
wherein said omega-mutated virD2 gene reduces the frequency of
integration of said selectable marker gene into said plant nuclear
DNA.
139. The isolated, border-like nucleotide sequence of claim 44,
wherein the sequence is 25 nucleotides in length.
140. The method of claim 61, wherein the second binary vector
comprises at least one of a negative selectable marker gene and a
gene that impairs integration, wherein the negative selectable
marker gene is positioned within the right T-DNA border and the
left T-DNA border, and wherein the gene that impairs integration is
positioned within the backbone of the second binary vector.
141. The method of claim 99, wherein the temporary growth is from 1
to 5 days.
Description
FIELD OF THE INVENTION
[0001] This application claims priority to U.S. provisional
application Ser. numbers 60/357,661 and 60/377,602, which are
incorporated herein by reference. The present invention relates to
methods for improving the nutritional, health, and agronomic
characteristics of a plant by modifying specific,
well-characterized DNA in the plant's genome. As opposed to
classical plant breeding, the inventive process does not introduce
unknown or potentially toxic genes into the plant genetic make-up.
Furthermore, the inventive method, unlike conventional genetic
engineering strategies, does not incorporate nucleic acids from
foreign species, i.e., species that are not inter-fertile with the
plant to be modified by genetic engineering, into the plant genome.
Plants developed through the inventive plant breeding process
display improved agronomic characteristics. Particularly preferred
plants of the present invention include potatoes that exhibit
improved health and tuber storage characteristics, and turfgrasses
that exhibit improved disease and drought tolerance.
BACKGROUND
[0002] The agronomic performance of plants has typically been
improved by either classical plant breeding or genetic engineering.
Classical breeding typically results in the transfer of unknown
nucleic acids from one plant to another. Genetic engineering
techniques introduce foreign nucleic acids into the plant genome,
i.e., DNA that is not from a plant or that is not from a plant that
is naturally interfertile with the plant to be modified by genetic
engineering. For example, genetic engineering introduces non-plant
nucleic acids into a plant genome. Both classical breeding and
genetic engineering strategies create plant genomes that contain
undesirable and unwanted genetic material, and the resultant
cross-bred or transgenic plants can exhibit unfavorable traits. The
inadequacies of both strategies can prove harmful to the transgenic
plants, as well as to the animals and humans who consume such
products.
[0003] Conventional Breeding Relies on the Transfer of Unknown
DNA
[0004] Plant breeding typically relies on the random recombination
of plant chromosomes to create varieties that have new and improved
characteristics. Thus, by screening large populations of progeny
that result from plant crosses, breeders can identify those plants
that display a desired trait, such as an increase in yield,
improved vigor, enhanced resistance to diseases and insects, or
greater ability to survive under drought conditions. However,
classical breeding methods are laborious and time-consuming, and
new varieties typically display only relatively modest
improvements.
[0005] Furthermore, classical plant breeding typically results in
the transfer of hundreds of unknown genes into a plant genome. It
is likely that some of those transferred genes encode potentially
harms allergens, such as patatin, lectins, chitinases, proteases,
thaumatin-like proteins, lipid transfer proteins, amylases, trypsin
inhibitors, and seed storage proteins (Breiteneder et al., J
Allergy Clin Immunol 106: 27-36).
[0006] Similarly, introgressed genes can be involved in the
biosynthesis of toxins including lathyrogens, hydrazines,
glucosinolates and goitrogens, cumarins, saponins, alkaloids,
glycoalkaloids, biogenic amines, enzyme inhibitors, such as lectins
(haemagglutinins), trypsin inhibitors, chelating substances such as
phytates and oxalates, ribotoxins, antimicrobial peptides, amino
acids such as beta-N-oxalylamino-L-alanine, atractyloside,
oleandrine, taxol, and isoquinoline (Pokorny, Cas Lek Cesk 136:
267-20 70, 1997). The risk of inadvertently introducing such
poisons into human and animal food supplies is further increased
through efforts to "untap" the genetic diversity of wild crop
relatives that have not been used before for food consumption
(Hoisington et al., Proc Natl Acad Sci USA 96: 593743, 1999).
[0007] Although classical plant breeding can easily introduce genes
involved in undesirable anti-nutritional compounds into food crops
and plants, it cannot easily remove them. For instance, it took
about 15 years to reduce harmful phytate levels in corn and rice by
inactivating Lpa genes (Raboy, J Nutr 132: 503S-505S, 2002). The
long timeframe for realizing positive results is not practical,
especially since there is an urgent need for methods that more
effectively and efficiently improve the quality of food crops. One
example of a gene that only recently was found to be associated
with the synthesis of anti-nutritional compounds is the polyphenol
oxidase (PPO) gene, which oxidizes certain phenolic compounds to
produce mutagenic, carcinogenic and cytotoxic agents like phenoxyl
radicals and quinoid derivatives (Kagan et al., Biochemistry 33:
9651-60, 1994). The presence of multiple copies of this gene in the
genome of plants such as potato makes it particularly difficult to
reduce PPO activity through breeding.
[0008] Even more time is needed for the removal of anti-nutritional
compounds if little or nothing is known about their genetic basis.
For instance, no genes have been linked to the accumulation of high
concentrations of acrylamide, a potent neurotoxin and mutagen, in
some potatoes that are heated to 160.degree. C. or higher (Tareke
et al., J Agric Food Chem. 50: 4998-5006, 2002). It is therefore
very difficult to efficiently develop new potato varieties that
produce less acrylamide during processing using conventional
breeding. Thus, there is a need to grow potatoes and other
carbohydrate-rich foods, such as wheat, with reduced levels of such
dangerous compounds, but without the use of unknown or foreign
nucleic acids.
[0009] Other anti-nutritional compounds that can accumulate during
processing and are difficult to minimize or eliminate through
breeding include the Maillard-reaction products
N-Nitroso-N-(3-keto-1,2-butanediol- )-3'-nitrotyramine (Wang et
al., Arch Toxicol 70: 10-5, 1995), and 5-hydroxymethyl-2-furfural
(Janzowski et al., Food Chem Toxicol 38: 801-9, 2000). Additional
Maillard reaction products that have not been well characterized
are also known to display mutagenic properties (Shibamoto, Prog
Clin Biol Res 304: 359-76, 1989).
[0010] It can be equally difficult to rapidly increase levels of
positive nutritional compounds in food crops due to the inherent
imprecision of conventional plant breeding. For instance, it would
be desirable to increase levels of "resistant starch" (Topping et
al., Physiol Rev 81: 1031-64, 2001) in a variety of crops. Such
starch is ultimately responsible for promoting immune responses,
suppressing potential pathogens, and reducing the incidence of
diseases including colorectal cancer (Bird et al., Curr Issues
Intest Microbiol 1: 25-37, 2000). However, the only available
plants with increased levels of resistant starch are low-yielding
varieties like maize mutants "amylose extender", "dull", and
"sugary-2." Creation of new high resistant starch sources, such as
potato, would enable broader dietary incorporation of this
health-promoting component.
[0011] The inability to safely manipulate the genotypes of plants
often leads to the use of external chemicals to induce a desired
phenotype. Despite numerous breeding programs to delay tuber
sprouting, for example, no potato varieties are available
commercially that can be stored for months without treatment with
sprout inhibitors. The latter, such as
isopropyl-N-chlorophenyl-carbamate (CIPC), is linked to acute
toxicity and tumor development, and can be present in processed
potato foods at concentrations between 1 mg/kg and 5 mg/kg.
[0012] Genetic Engineering Relies on the Transfer of Foreign
DNA
[0013] Genetic engineering can be used to modify, produce, or
remove certain traits from plants. While there has been limited
progress in improving the nutritional value and health
characteristics of plants, most improvements target plant traits
that promote ease of crop cultivation. Thus, certain plants are
resistant to the glyphosate herbicide because they contain the
bacterial gene 5-enolpyruvylshikimate-- 3-phosphate synthase
(Padgette et al., Arch Biochem Biophys. 258: 564-73, 1987).
Similarly, genetic engineering has produced insect-, viral-, and
fungal-resistant plant varieties (Shah et al., Trends in
Biotechnology 13: 362-368, 1995; Gao et al., Nat Biotechnol. 18:
1307-10, 2000; Osusky et al., Nat Biotechnol. 18: 1162-6, 2000),
but few with enhanced nutrition or health benefits.
[0014] According to standard, well-known techniques, genetic
"expression cassettes," comprising genes and regulatory elements,
are inserted within the borders of Agrobacterium-isolated transfer
DNAs ("T-DNAs") and integrated into plant genomes. Thus,
Agrobacterium-mediated transfer of T-DNA material typically
comprises the following standard procedures: (1) in vitro
recombination of genetic elements, at least one of which is of
foreign origin, to produce an expression cassette for selection of
transformation, (2) insertion of this expression cassette, often
together with at least one other expression cassette containing
foreign DNA, into a T-DNA region of a binary vector, which usually
consists of several hundreds of basepairs of Agrobacterium DNA
flanked by T-DNA border sequences, (3) transfer of the sequences
located between the T-DNA borders, often accompanied with some or
all of the additional binary vector sequences from Agrobacterium to
the plant cell, and (4) selection of stably transformed plant
cells. See, e.g., U.S. Pat. Nos. 4,658,082, 6,051,757, 6,258,999,
5,453,367, 5,767,368, 6,403,865, 5,629,183, 5,464,763, 6,201,169,
5,990,387, 4,693,976, 5,886,244, 5,221,623, 5,736,369, 4,940,838,
6,153,812, 6,100,447, 6,140,553, 6,051,757, 5,731,179, 5,149,645
and EP 0 120,516, EP 0 257,472, EP 0 561,082, 1,009,842A1, 0
853,675A1, 0 486,233B1, 0 554,273A1, 0 270,822A1, 0 174,166A1, and
WO 01/25459.
[0015] Thus, genetic engineering methods rely on the introduction
of foreign nucleic acids into the food supply. Those techniques
transfer complex fusions of a few to more than 20 genetic elements
isolated from viruses, bacteria, and plants, that are not
indigenous to the transformed plant species. Such foreign elements
include regulatory elements such as promoters and terminators, and
genes that are involved in the expression of a new trait or
function as markers to identify or select for transformation
events. Despite the testing of foods containing foreign DNA for
safety prior to regulatory approval, many consumers are concerned
about the long-term effects of eating foods that express foreign
proteins, which are produced by genes obtained from other,
non-plant species.
[0016] One commonly used regulatory element is the 35S "super"
promoter of cauliflower mosaic virus (CaMV), which is typically
used in plant engineering to induce high levels of expression of
transgenes to which it is directly linked. However, the 35S
promoter also can enhance the expression of native genes in its
vicinity (Weigel et al., Plant Physiol., 122: 1003-13, 2000). Such
promoters may thus induce unpredictable alterations in the
expression of endogenous genes, possibly resulting in undesirable
effects such as increased alkaloid production. Preferred "strong"
promoters are generally those isolated from viruses, such as rice
tungro bacilliform virus, maize streak virus, cassava vein virus,
mirabilis virus, peanut chlorotic streak caulimovirus, figwort
mosaic virus and chlorella virus. Other frequently used promoters
are cloned from bacterial species and include the promoters of the
nopaline synthase and octopine synthase gene.
[0017] To obtain appropriate termination of gene translation,
terminator sequences are fused to the 3 '-end of transgenes and
include genetic elements from the nopaline synthase and octopine
synthase genes from Agrobacterium. Other genetic elements may be
used to further enhance gene expression or target the expressed
protein to certain cell compartments. These elements include
introns to boost transgene expression and signal peptide sequences
to target the foreign gene to certain cellular compartments, often
derived from foreign plant species.
[0018] Certain genes involved in expression of a new trait are most
frequently derived from foreign sources. If native genes are used,
they are often inverted to silence the expression of that gene in
transgenic plants and co-transformed with foreign DNA such as a
selectable marker. The main disadvantage of this "antisense"
technology is that the inverted DNA usually contains new and
uncharacterized open reading frames inserted between a promoter and
terminator. Thus, potato plants that were genetically modified with
antisense constructs derived from the starch related gene R1
(Kossmann et al., U.S. Pat. No. 6,207,880), the L- and H-type
glucan phosphorylase genes (Kawchuk et al., U.S. Pat. No.
5,998,701, 1999), the polyphenol oxidase gene (Steffens, U.S. Pat.
No. 6,160,204, 2000), and genes for starch branching enzymes I and
II (Schwall et al., Nature Biotechnology 18: 551-554, 2000) all
potentially express new peptides consisting of at least 50 amino
acids (Table 1). These new peptides may interfere with plant
development and/or reduce the nutritional value of potato, and are
therefore undesirable.
[0019] Conventional marker genes are incorporated into genetic
constructs and used to select for transformation events. They
confer either antibiotic or herbicide resistance (U.S. Pat. No.
6,174,724), a metabolic advantage (U.S. Pat. No. 5,767,378), or a
morphologically abnormal phenotype (U.S. Pat. No. 5,965,791) to the
transformed plant. Such markers are typically derived from
bacterial sources. Furthermore, because of the infidelity of T-DNA
transfer, about 75% of transformation events in plants such as
tomato, tobacco, and potato contain plasmid "backbone" sequences in
addition to the T-DNA (Kononov et al., Plant J. 11: 945-57, 1997).
The presence of such backbone sequences is undesirable because they
are foreign and typically contain origins of replication and
antibiotic resistance gene markers.
[0020] There do exist various methods for removing elements like
foreign marker genes, but few are easily applicable to plant
genetic engineering. According to one such method, the marker gene
and desired gene or nucleotide sequence are placed on different
vectors. The infection of plants with either a single Agrobacterium
strain carrying both vectors (U.S. Pat. No. 6,265,638) or two
Agrobacterium strains each of which carries one of the vectors can
occasionally result in unlinked integration events, which may be
separated genetically through outbreeding. The main disadvantage of
this method is that the genetic separation of loci can be very
laborious and time-consuming, especially if T-DNA integration
events are linked. Furthermore, this method is not widely
applicable in apomictic plants, which reproduce asexually, such as
Kentucky bluegrass, or vegetatively propagated crops such as
potato, which cannot be readily bred due to inbreeding depression,
high levels of heterozygosity, and low fertility levels.
[0021] Another method for removing foreign genetic elements relies
on inserting the foreign gene, like the selectable marker, into a
transposable element. The modified transposable element may then be
spliced out from the genome at low frequencies. Traditional crosses
with untransformed plants must then be performed to separate the
transposed element from the host (U.S. Pat. No. 5,482,852). As
described for the previous method, this alternative method cannot
be used for vegetatively propagated or apomictic plant systems.
[0022] A third method of removing a marker gene uses the Cre/lox
site-specific recombination system of bacteriophage P1 (Dale &
Ow, Proc. Natl. Acad. Sci. USA, 88: 10558-62, 1991). Insertion of a
marker gene together with the Cre recombinase gene and a chimeric
gene involved in induction of Cre (both with their own promoters
and terminators) between two lox sites leads to excision of the
region delineated by the lox sites during the regeneration process
(Zuo et al., Nat. Biotechnol., 19: 157-61, 2001). This complicated
process is inefficient and not reliable, and may cause genome
instability.
[0023] Recent studies report that some plant genes themselves may
be used as transformation markers. Examples of such plant markers
include Pga22 (Zuo et al., Curr Opin Biotechnol. 13: 173-80, 2002),
Cki1 (Kakimoto, Science 274: 982-985, 1996) and Esr1 (Banno et al.,
Plant Cell 13: 2609-18, 2001). All of the genes, however, trigger
cytokinin responses, which confer an undesirable phenotype to the
transformed plant. Furthermore, such plant markers would still need
to be removed upon transformation by any of the methods described
above.
[0024] Alternative methods to transform plants are also based on
the in vitro recombination of foreign genetic elements, and rely on
bacterial plasmid sequences for maintenance in E. coli, parts of
which are co-integrated during the transformation process. Examples
of such methods to transform plants with foreign DNA are described
in U.S. Pat. Nos. 5,591,616, 6,051,757, 4,945,050, 6,143,949,
4,743,548, 5,302,523, and 5,284,253.
[0025] Marker-free transgenic plants may also be obtained by
omitting any selection procedures prior to regeneration. A
disadvantage of this method is that most events generated through
this method will represent untransformed or chimeric plants because
they will usually not be derived from single transformed plant
cells. It is extremely difficult and laborious to use a marker-free
procedure for the identification of transgenic plants that contain
the same DNA insertion(s) in all their cells.
[0026] Thus, there is a very important need to improve plants
beyond that which can be accomplished through the classical
breeding crosses and conventional genetic engineering techniques,
and which does not rely on the insertion of unknown or foreign
nucleic acid into a plant genome. Accordingly, the present
invention provides methods and compositions for precisely modifying
a plant's own genetic material. Thus, the inventive "precise
breeding" strategy does not induce undesirable phenotypes and does
not introduce unknown or foreign nucleic acid into a plant
genome.
SUMMARY
[0027] The present invention provides methods of genetically
enhancing the nutritional value and agronomic performance of a
plant without the permanent or stable incorporation of either
unknown or foreign DNA into the genome of that plant. According to
the methods of the present invention, specific, well-characterized
nucleic acids, gene elements, and genes are isolated from a desired
plant species or from a plant species that is sexually compatible
with the desired plant, modified, and then reinserted back into the
genome of the desired plant species. The modification may entail
mutating the isolated nucleic acid sequence, deleting parts of the
isolated nucleic acid, or simply joining the isolated nucleic acid
to another polynucleotide, such as subcloning the isolated nucleic
acid into a plasmid vector.
[0028] Accordingly, transgenic plants produced by the inventive
methodology do not possess genomes that comprise any foreign
species' nucleic acids. Thus, the methods of the present invention
produces a transgenic plant whose genome does not comprise a
non-plant species promoter, does not comprise a non-plant species
terminator, does not comprise a non-plant species 5'-untranslated
region, does not comprise a non-plant species 3'-untranslated
region, does not comprise a non-plant species marker gene, does not
comprise a non-plant species regulatory element, does not comprise
a non-plant species gene, and does not comprise any other
polynucleotide that is obtained from a non-plant species
genome.
[0029] Thus, the present invention provides a method for producing
a stable transgenic plant that exhibits a modified phenotype that
is not exhibited by the non-transformed plant, comprising (a)
transforming plant cells with a desired polynucleotide; (b) growing
plants from the transformed cells; and (c) selecting a plant stably
transformed with said desired polynucleotide which exhibits a new
phenotype that is not exhibited by plants grown from the
corresponding non-transformed plant cells. Preferably, the desired
polynucleotide consists essentially of (i) nucleic acid sequences
that are isolated from and/or native to the genome of the plant
cells, or to other plants of the same species, or are isolated from
and/or native to the genome of a plant species that is sexually
compatible with the plant from which the plant cells were isolated;
and (ii) at least one DNA sequence that is a border-like sequence
that has a sequence that is native to the genome of said plant
cells or is native to the genome of plant cells of the same
species, or is native to a plant that is sexually compatible with
the plant from which the plant cells were isolated, and wherein the
border-like sequence is capable of stably integrating the desired
polynucleotide into the genome of said plant cells.
[0030] A preferred method of the present invention entails
producing a transgenic plant that exhibits a modified phenotype
that is not exhibited by the non-transformed plant, comprising (a)
infecting explants with Agrobacterium carrying (i) a "P-DNA"
vector, which contains a desired polynucleotide that is native to
the transgenic plant, and (ii) a "LifeSupport" vector that contains
an expression cassette containing a selectable marker gene; (b)
selecting for transient expression of the selectable marker gene,
preferably for 1-10 days, for 3-7 days, or for 4-5 days; (c)
transferring explants to regeneration media to allow shoot
formation; (d) screening populations of shoots to determine which
comprise at least one copy of the desired polynucleotide in their
genomes and, of those, which shoots do not contain any foreign
nucleic acids, such as the selectable marker gene, in their
genomes; and (e) allowing shoots which contain the desired
polynucleotide in their genomes but not any marker gene DNA, to
develop into whole plants, wherein the resultant whole plants
exhibit a modified phenotype that is not exhibited by plants grown
from non-transformed plant cells of the same species.
[0031] According to such a method, the desired polynucleotide (i)
consists essentially of only elements that are isolated from and/or
native to the genome of the plant cell species or sexually
compatible species thereof; (ii) comprises at least one border
element that has a sequence that is isolated from, or native to,
the genome of the plant cell species or sexually compatible species
thereof, and is capable of stably integrating the desired
polynucleotide into the genome of a plant cell exposed to the
vector; and (iii) is stably integrated into the genome of the
transformed plant; wherein the method does not integrate non-plant
species or foreign DNA into the genome of the transformed
plant.
[0032] Furthermore, any selectable marker gene may be used as an
indicator of successful transformation. For instance, a "neomycin
phosphotransferase" marker gene, or an "hpt" marker gene may be
used to confer resistance to the aminoglycoside antibiotics,
kanamycin and hygromycin respectively. Other marker genes include
the "bar" marker gene, which confers resistance to herbicide
phosphinothricin; the "DHFR" marker gene, which confers resistance
to methotrexate; and the "ESPS" marker gene, which confers
resistance to Round-up herbicide. It is well known in the art how
to follow expression of such marker genes to determine whether or
not the marker gene has been stably expressed into the genome of a
transformed plant cell. Accordingly, the skilled artisan knows how
to follow expression of the marker gene to determine that the
marker gene is only transiently expressed in the transformed plant
cell.
[0033] In another aspect of the invention, there is provided a
method of making a stably transformed plant comprising the steps
of: (1) identifying a target gene; (2) isolating a leader or
trailer DNA sequence associated with said target gene; (3)
optionally modifying said isolated leader or trailer DNA; (4)
operably linking said leader or trailer DNA to native regulatory
elements to form an expression cassette; (5) inserting said
expression cassette into a P-DNA that is located on a binary
vector, wherein the binary vector also carries an operable
cytokinin gene such that the inadvertent insertion of additional
binary vector sequences, which are of foreign origin, are detected
by expression of the cytokinin gene; (6) introducing the modified
binary vector into Agrobacterium; (7) stably integrating the
rearranged native DNA into the genomes of plant cells using
LifeSupport-mediated transformation; (8) regenerating plant cells
that contain the rearranged native DNA; (9) discarding plants that
display a cytokinin-overproducing phenotype and do not fully
regenerate; and (10) maintaining for further analysis the desirable
plants that are indistinguishable from untransformed plants.
[0034] In another aspect of the instant invention, a method of
modifying the expression of a trait in a selected plant species is
provided. In one embodiment, the method comprises (1) identifying
the trait to be modified; (2) constructing a recombinant DNA
molecule consisting essentially of genetic elements isolated from,
or native to, the selected plant species, wherein the recombinant
DNA molecule, when integrated into the genome of the selected plant
species, modifies the expression of the trait in the transformed
plant species; (3) stably integrating the recombinant DNA molecule
into cells of the selected plant species using LifeSupport-mediated
transformation; and (4) identifying transformed plants exhibiting
modified expression of the trait.
[0035] In a preferred embodiment, polynucleotide that is native to
a desired plant is inserted into the desired plant's genome by
infecting explants with two different Agrobacterium strains. A
first Agrobacterium strain is capable of transferring the native
DNA from P-DNA vectors to plant cells; a second strain can transfer
a T-DNA carrying an expression cassette for a selectable marker
gene to plant cells. Examples of the latter vector include the
so-called, "LifeSupport" vectors described herein. By preferably
selecting plants that transiently express the marker gene for 1-10
days, for 3-7 days, or for 4-5 days, and subsequently transferring
explants to regeneration media, a population of events is obtained,
part of which represents plants that contain at least one copy of
the polynucleotide, but which lack any copies of the T-DNA or
marker gene.
[0036] In another embodiment, a single Agrobacterium strain is used
that carries both a P-DNA vector, which houses the desired, native
gene of interest or polynucleotide between P-DNA border-like
sequences, and a LifeSupport vector, which contains a marker gene.
The marker gene may, or may not, be inserted between P-DNA
border-like sequences, T-DNA border sequences, or other T-DNA-like
border sequences.
[0037] Thus, in another preferred embodiment, the P-DNA vector
contains at least two expression cassettes, one of which comprises
a native screenable or selectable marker gene driven by a native
promoter and followed by a native terminator.
[0038] By preferably selecting for at least 2 days and more
preferably for at least 5 days for native marker gene expression
and subsequently transferring explants to regeneration media, a
population of events is obtained that represent plants containing
at least one copy of the introduced DNA stably integrated into
their genomes. In preferred embodiments, the plant-derived marker
gene encodes a mutant 5-enolpyruvul-3-phosphoshikimic acid synthase
or tryptophan decarboxylase. In a more preferred embodiment, the
selectable marker encodes for salt tolerance. In a most preferred
embodiment, the salt tolerance gene has the nucleotide sequence
shown in SEQ ID 35 and is used to select for transformation events
in potato.
[0039] In yet another embodiment, the modified expression of the
trait is characterized by an increase in expression, a decrease in
expression, or in undetectable expression.
[0040] In another aspect of the instant invention, a plant made by
the method of (1) identifying the trait to be modified; (2)
constructing a recombinant DNA molecule consisting essentially of
genetic elements isolated from the selected plant species, wherein
the recombinant DNA molecule when integrated into the genome of the
selected plant species modifies the expression of the trait in the
transformed plant species; (3) stably integrating the recombinant
DNA molecule into cells of the selected plant species through
LifeSupport-mediated transformation; and (4) identifying
transformed plants exhibiting modified expression of the trait, is
provided.
[0041] In a further aspect, a method of modifying expression of a
trait in a selected plant species is provided. This method
comprises (1) identifying the trait to be modified; (2)
constructing a recombinant DNA molecule consisting essentially of
(a) genetic elements isolated from the selected plant species,
wherein the genetic elements when integrated into the genome of the
selected plant species modifies the expression of the trait in the
transformed plant species; and (b) a selectable marker gene that is
isolated from the same plant species; (3) stably integrating the
recombinant DNA molecule into cells of the selected plant species
through LifeSupport-mediated transformation; (4) detecting the
selectable marker gene; and (5) identifying transformed plants
exhibiting modified expression of the trait.
[0042] In yet one other aspect, a plant exhibiting a modified
expression of a trait is provided. In one embodiment, the plant has
stably integrated into its genome a recombinant DNA molecule
consisting essentially of genetic elements isolated from a plant of
the same species, or from a plant that is sexually compatible with
that species, wherein the recombinant DNA molecule modifies the
expression of the trait.
[0043] In another aspect of the present invention, an isolated
nucleotide sequence referred to as "plant-DNA" ("P-DNA") is
provided. In a preferred embodiment, the P-DNA itself lacks any
genes or parts thereof and is delineated by terminal, T-DNA
"border-like" sequences that share at least 50%, at least 75%, at
least 90% or at least 95% sequence identity with the nucleotide
sequence of the T-DNA borders of any virulent Agrobacterium strain,
and which support an efficient transfer of the entire P-DNA from
Agrobacterium to plant cells.
[0044] In a preferred embodiment a "border-like" sequence promotes
and facilitates the integration of a polynucleotide to which it is
linked. In another preferred embodiment, each terminal sequence of
the modified P-DNA is between 5-100 bp in length, 10-80 bp in
length, 15-75 bp in length, 15-60 bp in length, 15-50 bp in length,
15-40 bp in length, 15-30 bp in length, 16-30 bp in length, 20-30
bp in length, 21-30 bp in length, 22-30 bp in length, 23-30 bp in
length, 24-30 bp in length, 25-30 bp in length, or 26-30 bp in
length. More preferably, the border-like sequence is between 20 and
28 nucleotides in length.
[0045] In a preferred embodiment, the P-DNA left and right border
sequences of the present invention are isolated from and/or are
native to the genome of a plant that is to be modified and are not
identical in nucleotide sequence to any known Agrobacterium-derived
T-DNA border sequence. Thus, in one embodiment, a P-DNA border
sequence may possess 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, or more nucleotides that are different from
a T-DNA border sequence from an Agrobacterium species, such as
Agrobacterium tumefaciens or Agrobacterium rhizogenes.
Alternatively, in another embodiment, a P-DNA border, or a
border-like sequence of the present invention has at least 95%, at
least 90%, at least 80%, at least 75%, at least 70%, at least 60%
or at least 50% sequence identity with a T-DNA border sequence from
an Agrobacterium species, such as Agrobacterium tumefaciens or
Agrobacterium rhizogenes. More preferably, a native plant P-DNA
border sequence that shares greater than or equal to 99%, 98%, 97%,
96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%,
83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%,
70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% nucleotide
sequence identity with anAgrobacterium T-DNA border sequence.
[0046] In another preferred embodiment, a border-like sequence can
be isolated from a plant genome and then modified or mutated to
change the efficiency by which they are capable of integrating a
nucleotide sequence into another nucleotide sequence. In another
embodiment, other polynucleotide sequences may be added to or
incorporated within a border-like sequence of the present
invention. Thus, in yet another embodiment, a P-DNA left border or
a P-DNA right border may be modified so as to possess 5'- and
3'-multiple cloning sites, or additional restriction sites. In a
further embodiment, a P-DNA border sequence may be modified to
increase the likelihood that backbone DNA from the accompanying
vector is not integrated into the plant genome.
[0047] In an even more preferred embodiment, the P-DNAs are
isolated from any plant by using degenerate primers in a polymerase
chain reaction. In one preferred embodiment, the P-DNA is derived
from potato, is delineated by 25-bp termini with 80 and 88%
identity to conventional T-DNA borders, respectively, and has the
nucleotide sequence shown in SEQ ID NO. 1. In another most
preferred embodiment, the P-DNA is derived from wheat, is
delineated by 25-bp termini with 72% and 92% identity with
conventional T-DNA borders, respectively, and contains the
nucleotide sequence shown in SEQ ID NO. 34.
[0048] Such a P-DNA may be modified so as to comprise other
polynucleotides positioned between the border-like sequences. In a
preferred embodiment, the modified P-DNA consists essentially of,
in the 5'- to 3'-direction, a first border-like sequence that
promotes DNA transfer, a promoter, a desired polynucleotide that is
operably linked to the promoter, a terminator and a second
border-like sequence that also promotes DNA transfer. In one other
embodiment, the desired polynucleotide represents one or several
copies of a leader, a trailer or a gene in sense and/or antisense
orientations. In a more preferred embodiment, the modified P-DNA
contains expression cassettes for both a mutant PPO gene and an
invertase inhibitor gene.
[0049] Thus, in a preferred embodiment, the desired polynucleotide
comprises a sense and antisense sequence of a leader sequence. In a
more preferred embodiment, the leader sequence is associated with a
gene that is endogenous to a cell of the selected plant species. In
yet a more preferred embodiment, the leader is associated with a
gene that is selected from the group consisting of a PPO gene, an
R1 gene, a type L or H alpha glucan phosphorylase gene, an UDP
glucose glucosyltransferase gene, a HOS1 gene, a
S-adenosylhomocysteine hydrolase gene, a class II cinnamate
4-hydroxylase gene, a cinnamoyl-coenzyme A reductase gene, a
cinnamoyl alcohol dehydrogenase gene, a caffeoyl coenzyme A
O-methyltransferase gene, an actin depolymerizing factor gene, a
Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase
gene, an ADP-glucose pyrophosphorylase gene, a proline
dehydrogenase gene, an endo-1,4-beta-glucanase gene, a zeaxanthin
epoxidase gene, and a 1-aminocyclopropane-1-carboxylate synthase
gene.
[0050] In yet another preferred embodiment, the desired
polynucleotide sequence comprises a sense and antisense sequence of
a trailer sequence. In a preferred embodiment, the trailer sequence
is associated with a gene selected from the group consisting of a
PPO gene, an R1 gene, a type L or H alpha glucan phosphorylase
gene, an UDP glucose glucosyltransferase gene, a HOS1 gene, a
S-adenosylhomocysteine hydrolase gene, a class II cinnamate
4-hydroxylase gene, a cinnamoyl-coenzyme A reductase gene, a
cinnamoyl alcohol dehydrogenase gene, a caffeoyl coenzyme A
O-methyltransferase gene, an actin depolymerizing factor gene, a
Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase
gene, an ADP-glucose pyrophosphorylase gene, a proline
dehydrogenase gene, an endo-1,4-beta-glucanase gene, a zeaxanthin
epoxidase gene, and a 1-aminocyclopropane-1-carboxylate synthase
gene.
[0051] In a preferred embodiment, the desired polynucleotide, such
as a gene, is isolated from, and/or is native to the plant that is
to be transformed. In another preferred embodiment, the desired
polynucleotide is modified or mutated. In one embodiment, a
mutation to the isolated polynucleotide may render the desired
nucleotide greater than or equal to 99%, 98%, 97%, 96%, 95%, 94%,
93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%,
80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%,
67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% dissimilar to its
unmutated form.
[0052] In a preferred embodiment of the present invention, the
promoter of an expression cassette located within a P-DNA is a
constitutive promoter. In a more preferred embodiment the
constitutive promoter is the promoter of the Ubiquitin-3 gene of
potato. In an even more preferred embodiment the constitutive
promoter is the promoter of the Ubiquitin-7 gene of potato.
[0053] In another embodiment, the promoter of an expression
cassette located within a P-DNA is a regulatable promoter. In a
more preferred embodiment, the regulatablepromoter is sensitive to
temperature. In an even more preferred embodiment, the regulatable
promoter is a ci21A promoter or a C17 promoter, each isolated from
potato (Schneider et al., Plant Physiol. 113: 335-45, 1997; Kirch
et al., Plant Mol Biol 33: 897-909, 1997).
[0054] In another embodiment, the promoter of an expression
cassette located within a P-DNA can be regulated in a temporal
fashion. In a preferred embodiment, the promoter is an rbcS
promoter (Ueda et al., Plant Cell 1: 217-27, 1989).
[0055] In yet another embodiment, the promoter of an expression
cassette located within a P-DNA is regulated by any one of abscisic
acid, wounding, methyl jasmonate or gibberellic acid. In a further
embodiment, this promoter is a promoter selected from either a Rab
16A gene promoter, an .alpha.-amylase gene promoter or a pin2 gene
promoter.
[0056] In another embodiment, the promoter of an expression
cassette located within a P-DNA is a tissue-specific promoter. In a
particularly preferred embodiment, this promoter is a GBSS promoter
isolated from S. tuberosum.
[0057] In one embodiment, the present invention provides a P-DNA
vector that is capable of replication in both E.coli and
Agrobacterium, and contains either a P-DNA or a modified P-DNA. In
a preferred embodiment, this vector also contains an expression
cassette for a cytokinin gene in its backbone to enable the
selection against backbone integration events.
[0058] In another preferred embodiment, the desired nucleotide
sequence further comprises a spacer element. In a more preferred
embodiment, the spacer element is a Ubi intron sequence or a GBSS
spacer sequence.
[0059] In another preferred embodiment, the desired nucleotide
sequence comprises a mutated native gene encoding a functionally
inactive protein, which reduces the overall activity of that
protein if expressed in transgenic plants. In yet a more preferred
embodiment, this mutated gene encodes a functionally inactive
polyphenol oxidase lacking a copper binding domain.
[0060] In another preferred embodiment, the desired nucleotide
sequence comprises a native gene encoding a functionally active
protein. In yet a more preferred embodiment, this gene encodes for
a protein with homology to the tobacco vacuolar invertase
inhibitor.
[0061] In another embodiment, the terminator of an expression
cassette located within a P-DNA is a Ubi3 terminator sequence or a
3'-untranslated region of a gene of a selected plant species.
[0062] In another aspect of the instant invention, a method for
modifying a target plant cell is provided. In one embodiment, the
method comprises: (1) inserting a modified P-DNA into the genome of
at least one cell in the target plant cell using
LifeSupport-mediated transformation; and (2) observing if there is
a phenotypic change in the target plant cell; wherein the promoter
in the modified P-DNA transcribes the sense and/or antisense
untranslated sequences associated with a native gene to reduce
expression of that native gene, thereby modifying the target plant
cell. In another preferred embodiment, the promoter in the modified
P-DNA transcribes a gene to overexpress that gene in the target
plant cell.
[0063] In yet another aspect, there is provided a method of making
a transgenic plant cell of a selected plant species that contains a
modified P-DNA. The method comprises - co-transfecting a plant cell
of the selected plant species with a P-DNA vector and a LifeSupport
vector that comprises a marker gene flanked by a T-DNA left border
and a T-DNA right border and a mutant virD2 gene inserted into the
vector backbone, and selecting for a plant cell that transiently
expresses the marker gene, and isolating a plant cell that contains
the modified P-DNA integrated into its genome but does not contain
any nucleotides from the LifeSupport vector. In a preferred
embodiment, the marker gene confers resistance to kanamycin. In a
most preferred embodiment the yeast ADH terminator follows the
kanamycin resistance gene.
[0064] In a preferred embodiment, the plant cell of the selected
plant species targeted for transformation is in culture. In another
preferred embodiment, the plant cell of the selected plant species
targeted for transformation is within a plant.
[0065] The present invention also provides a plant of the selected
species that comprises at least one cell with a genome that
contains a modified P-DNA. In a preferred embodiment, the modified
P-DNA consists essentially of, in the 5'- to 3'-direction, a first
terminus that functions like a T-DNA border followed by P-DNA
sequences, a promoter, a desired nucleotide sequence operably
linked to both a promoter, a terminator and additional P-DNA
sequences delineated by a second terminus. In another embodiment,
the desired polynucleotide represents one or several copies of a
leader, a trailer and a gene in the sense and/or antisense
orientation.
[0066] In another embodiment, a plant that comprises at least one
cell with a genome that contains a modified P-DNA is
envisioned.
[0067] In another aspect of the invention, a method for reducing
the expression of a gene in a selected plant species is provided.
The method comprises the LifeSupport-mediated transformation of a
plant cell from a selected plant species with a P-DNA vector,
wherein the modified P-DNA of this vector is stably integrated into
the genome of the plant cell. In another aspect of the invention,
the modified P-DNA comprises a desired polynucleotide that reduces
expression of an endogenous gene from the selected plant
species.
[0068] In another aspect of the instant invention, a gene native to
the selected plant species may be mutated and reintroduced into the
plant using the inventive methods. Preferably, the mutated gene,
for instance a mutated PPO gene, is integrated into the plant cell
genome using a P-DNA vector.
[0069] The present invention also provides a method for reducing
the undesirable expression of the polyphenol oxidase gene in a
selected plant species. In a preferred embodiment, the method
comprises integrating into a genome of a selected plant species a
modified P-DNA comprised only of nucleotide sequences isolated from
the selected plant species or from a plant that is sexually
compatible with the selected plant species, consisting essentially
of, in the 5'- to 3'-direction, a first P-DNA terminus that
functions like a T-DNA border followed by flanking P-DNA sequences;
a promoter; a desired nucleotide which is a sense-oriented trailer
nucleotide sequence associated with a specific PPO gene; an
antisense-oriented sequence of the trailer nucleotide sequence from
the specific PPO gene; a termination sequence, and additional P-DNA
sequences delineated by a second terminus that functions like a
T-DNA border, wherein the promoter produces a double-stranded RNA
molecule that reduces the expression of the specific PPO gene,
thereby reducing black spot bruising in specific tissues of the
plant. In another embodiment, the sense- and antisense-oriented
nucleotide sequences from the leader nucleotide sequences are
obtained from the 5'-untranslated region preceding the specific PPO
gene. In a further embodiment, the sense- and antisense-oriented
leader or trailer sequence associated with the PPO gene may be
separated by another polynucleotide sequence, referred to herein,
as either an intron or a "spacer." In a preferred embodiment, the
leader or trailer sequence is associated with a potato PPO gene. In
a more preferred embodiment, the leader or trailer sequence is
associated with a potato PPO gene that is expressed in potato
tubers. In a most preferred embodiment, the leader or trailer
sequence is associated with a potato PPO gene that is expressed in
all parts of the potato tuber except for the epidermis.
[0070] The present invention also provides a method for reducing
acrylamide production, sprout-induction during storage, phosphate
accumulation, and/or cold-induced sweetening in tubers of a
selected plant species.
[0071] In a preferred embodiment, the method comprises the
LifeSupport-mediated transformation of a selected plant species
with a modified P-DNA comprised only of nucleotide sequences
isolated from the selected plant species, or from plants that are
sexually compatible with the selected plant species, consisting
essentially of, in the 5'- to 3'-direction, a first P-DNA with a
left border-like sequence, a promoter, a desired nucleotide
sequence, which is a sense-oriented nucleotide sequence from the
leader sequence associated with the R1 gene, an antisense-oriented
sequence from this leader sequence, a termination sequence, and a
right border-like sequence. Upon expression, a leader-RNA duplex is
produced that reduces expression of the R1 gene, thereby reducing
cold-induced sweetening in the plant. In another embodiment, the
desired sense- and antisense-oriented nucleotide sequences
represent the trailer associated with the R1 gene. In a further
embodiment, the sense- and antisense-oriented leader or trailer
associated with R1 may be separated by another polynucleotide
sequence, referred to herein, as either an intron or a
"spacer."
[0072] In another preferred embodiment, the method comprises the
LifeSupport-mediated transformation of a selected plant species
with a modified P-DNA that is similar to the one described above
but contains a leader- or trailer sequence associated with an alpha
glucan phosphorylase gene.
[0073] In yet another preferred embodiment, the method comprises
the LifeSupport-mediated transformation of a selected plant species
with a modified P-DNA that contains an invertase inhibitor
gene.
[0074] In another preferred embodiment, the modified P-DNA
described in the preceding paragraphs are used to reduce the
accumulation of additional undesirable products of the Maillard
reaction, which occurs during the heating of carbohydrate-rich
foods such as potato tubers. These undesirable products include
advanced glycation end products (AGEs) that have been associated
with various pathologies.
[0075] The present invention also provides a method for increasing
resistant starch levels in the storage organs of plants and food
crops.
[0076] In a preferred embodiment, the method comprises the
LifeSupport-mediated transformation of a selected plant species
with a modified P-DNA that contains an expression cassette for a
fusion of the trailer sequences associated with the starch
branching enzyme I and II genes.
[0077] The present invention also provides isolated nucleotide
sequences comprising the promoters of the potato GBSS gene and the
potato proteinase inhibitor gene, which are predominantly expressed
in tubers. The isolated promoters have the nucleotide sequence
shown in SEQ ID NO.: 6 and SEQ ID NO.:40, respectively.
[0078] In one aspect, the present invention provides a method of
modifying a trait of a selected plant comprising:
[0079] a. stably transforming cells from the selected plant with a
desired polynucleotide, wherein the desired polynucleotide consists
essentially of a nucleic acid sequence that is native to the
selected plant, native to a plant from the same species, or is
native to a plant that is sexually interfertile with the selected
plant,
[0080] b. obtaining a stably transformed plant from the transformed
plant cells wherein the transformed plant contains the desired
polynucleotide stably integrated into the genome and wherein the
desired polynucleotide modifies the trait.
[0081] In a preferred embodiment, the method further comprises
co-transfecting the plant cells with a selectable marker gene that
is transiently expressed in the plant cells, and identifying
transformed plant cells, and transformed plants obtained from the
transformed plant cells, wherein the selectable marker gene is not
stably integrated and the desired polynucleotide is stably
integrated into the genome.
[0082] In a preferred embodiment, the desired polynucleotide
comprises a P-DNA, GBSS promoter, Ubi7 promoter, Ubi3 promoter, PIP
promoter, modified PPO gene, invertase inhibitor gene, salt
tolerance gene, R1-associated leader, phosphorylase-associated
leader, R1-associated trailer, SBE-associated trailers, Ubi-intron,
GBSS spacer, UbiT.
[0083] In another preferred embodiment, a "plant" of the present
invention is a monocotyledenous plant, selected from the group
consisting of wheat, turf, turf grass, cereal, maize, rice, oat,
wheat, barley, sorghum, orchid, iris, lily, onion, banana,
sugarcane, sorghum, and palm.
[0084] In yet another embodiment, a "plant" of the present
invention is a dicotyledenous plant, selected from the group
consisting of avacado, potato, tobacco, tomato, sugarbeet,
broccoli, cassava, sweet potato, pepper, cotton, poinsetta,
legumes, alfalfa, soybean, carrot, strawberry, lettuce, oak, maple,
walnut, rose, mint, squash, daisy, and cactus.
[0085] In yet another embodiment, plants and plant cells of the
present inventive methods are transformed via
Agrobacterium-mediated transformation. Preferably, the
Agrobacterium-mediated transformation relies on the use of at least
one binary vector. In yet another embodiment, the
Agrobacterium-mediated transformation method uses a first binary
vector and a second binary vector. In a preferred embodiment the
first binary vector contains the desired polynucleotide and the
second binary vector contains a selectable marker gene, wherein the
selectable marker gene is operably linked to a promoter and a
terminator.
[0086] According to the present methods, the trait that is modified
is selected from the group consisting of enhanced health and
nutritional characteristics, improved storage, enhanced yield,
enhanced salt tolerance, enhanced heavy metal tolerance, increased
drought tolerance, increased disease tolerance, increased insect
tolerance, increased water-stress tolerance, enhanced cold and
frost tolerance, enhanced color, enhanced sweetness, improved
vigor, improved taste, improved texture, decreased phosphate
content, increased germination, increased micronutrient uptake,
improved starch composition, improved flower longevity.
[0087] The present invention also encompasses a plant made by the
present methods.
[0088] In another aspect, the present invention provides a method
of modifying a trait in a selected plant comprising:
[0089] (a) identifying the trait to be modified;
[0090] (b) constructing a first polynucleotide consisting
essentially of native genetic elements isolated from the selected
plant, a plant from the same species, or a plant that is sexually
interfertile with the selected plant, wherein the native genetic
elements are capable of modifying the expression of a gene that
controls the trait
[0091] (c) constructing a second polynucleotide comprising a
selectable marker gene that is operably linked to a promoter and a
terminator;
[0092] (d) co-transfecting plant cells from the selected plant with
the first and second polynucleotides;
[0093] (e) selecting for the transient expression of the selectable
marker gene;
[0094] (f) screening for plant cells stably transformed with the
first polynucleotide but do not contain the second DNA molecule
integrated into the genome; and
[0095] (g) obtaining a stably transformed plant from the
transformed plant cells that exhibit a modified expression of the
trait.
[0096] In one embodiment, the genetic elements comprise at least
one of a promoter, sequence of interest, terminator enhancer,
intron, spacer, or regulatory elements. In another embodiment,
method of claim 4, wherein the plant cells are transfected with the
first polynucleotide before the second polynucleotide or vice
versa.
[0097] In one embodiment, the sequence of interest is a gene. In
another embodiment, the gene is a mutated or wild-type polyphenol
oxidase gene or a mutated or wild-type R1 gene. In one other
embodiment, the sequence of interest is a leader or trailer
sequence, wherein the leader or trailer sequence represents a
sequence upstream or downstream of a gene that is native to the
plant cell. In yet another embodiment, the sequence of interest
comprises a sense-oriented leader sequence operably linked to an
antisense leader sequence. In another embodiment, the sequence of
interest comprises a sense-oriented trailer sequence operably
linked to an antisense trailer sequence. In another embodiment, the
promoter is an inducible promoter. In another embodiment, the
terminator is a yeast ADH terminator sequence.
[0098] According to the present invention, a leader construct
comprises in 5'-to 3'-direction, a promoter, a sense-oriented
leader sequence, the antisense sequence of the leader, and a
terminator, wherein expression of the leader construct produces a
double-stranded RNA molecule that facilitates the down-regulation
of expression of the gene to which it is associated. In one other
embodiment, the leader sequence is associated with, and located
upstream of, the coding region of the PPO gene, the R1 gene, an
L-type phosphorylase gene, or an alpha glucan phosphorylase
gene.
[0099] In another embodiment, the trailer construct comprises in
5'-to 3'-direction, a promoter, a sense-oriented trailer sequence,
the antisense sequence of the trailer, and a terminator, wherein
expression of the trailer construct produces a double-stranded RNA
molecule that facilitates the down-regulation of expression of the
gene to which it is associated. In a preferred embodiment, the
trailer sequence is associated with, and located downstream of, the
coding region of the PPO gene, the R1 gene, an L-type phosphorylase
gene, or an alpha glucan phosphorylase gene.
[0100] The method further comprises exposing the plant cell to a
second vector that comprises a marker element, wherein the marker
is transiently expressed in the transformed plant and is not stably
integrated into the genome of the transformed plant. In one
embodiment, the marker is a herbicide resistance gene, an
antibiotic resistance gene, or NPTII.
[0101] Preferably, the plant cells are transformed via
Agrobacterium-mediated transformation. In one embodiment, the
Agrobacterium-mediated transformation relies on the use of at least
one binary vector. In yet another embodiment, the
Agrobacterium-mediated transformation method uses a first binary
vector and a second binary vector. In one other embodiment, the
first binary vector carries the first polynucleotide and the second
binary vector carries the second polynucleotide.
[0102] The present invention provides another method of modifying
the expression of a gene in a selected plant comprising:
[0103] (a) identifying the functional gene;
[0104] (b) constructing a first polynucleotide consisting
essentially of native genetic elements isolated from the selected
plant, a plant of the same species as the selected plant, or a
plant that is sexually interfertile with the selected plant,
wherein the native genetic elements are capable of modifying the
expression of the gene;
[0105] (c) constructing a second polynucleotide comprising a
functional selectable marker gene;
[0106] (d) co-transfecting plant cells from the selected plant with
the first and second poylnucleotides;
[0107] (e) selecting for the transient expression of the selectable
marker gene;
[0108] (f) screening for plant cells stably transformed with the
first polynucleotide but do not contain the second polynucleotide
integrated into the genome; and
[0109] (g) obtaining a transformed plant from the transformed plant
cells that exhibit modified expression of the gene.
[0110] Preferably, the plant cells are transformed via
Agrobacterium-mediated transformation. In one embodiment, the
Agrobacterium-mediated transformation relies on the use of at least
one binary vector. In yet another embodiment, the
[0111] Agrobacterium-mediated transformation method uses a first
binary vector and a second binary vector. In one other embodiment,
the first binary vector carries the first polynucleotide and the
second binary vector carries the second polynucleotide.
[0112] In another embodiment, the first polynucleotide comprises at
least one of a P-DNA, GBSS promoter, Ubi7 promoter, Ubi3 promoter,
PIP promoter, modified PPO gene, invertase inhibitor gene, salt
tolerance gene, R1-associated leader, phosphorylase-associated
leader, R1-associated trailer, SBE-associated trailers, Ubi-intron,
GBSS spacer, UbiT.
[0113] In another embodiment, the second polynucleotide comprises
at least one of a selectable marker gene, an omega-mutated virD2
polynucleotide, a codA polynucleotide, and a codA::upp fusion
polynucleotide.
[0114] The present invention also encompases a plant made by such
method.
[0115] In one other embodiment, a transgenic plant is provided
which exhibits a modified expression of a trait compared to the
non-trasgenic plant from which it was derived, wherein the
transgenic plant is stably transformed with a desired
polynucleotide consisting essentially of native genetic elements
isolated from the plant, a plant in the same species, or a plant
that is sexually interfertile with the plant, and wherein the
polynucleotide modifies the expression of the trait.
[0116] In another preferred embodiment, the "plant" of the present
invention is a monocotyledenous plant, selected from the group
consisting of wheat, turf, turf grass, cereal, maize, rice, oat,
wheat, barley, sorghum, orchid, iris, lily, onion, banana,
sugarcane, sorghum, and palm.
[0117] In yet another embodiment, the "plant" of the present
invention is a dicotyledenous plant, selected from the group
consisting of avacado, potato? tobacco, tomato, sugarbeet,
broccoli, cassava, sweet potato, pepper, cotton, poinsetta,
legumes, alfalfa, soybean, carrot, strawberry, lettuce, oak, maple,
walnut, rose, mint, squash, daisy, and cactus.
[0118] In another embodiment, the trait is selected from the group
consisting of enhanced health and nutritional characteristics,
improved storage, enhanced yield, enhanced salt tolerance, enhanced
heavy metal tolerance, increased drought tolerance, increased
disease tolerance, increased insect tolerance, increased
water-stress tolerance, enhanced cold and frost tolerance, enhanced
color, enhanced sweetness, improved vigor, improved taste, improved
texture, decreased phosphate content, increased germination,
increased micronutrient uptake, improved starch composition,
improved flower longevity.
[0119] In another embodiment, the desired polynucleotide comprises
at least one of a P-DNA, GBSS promoter, Ubi7 promoter, Ubi3
promoter, PIP promoter, modified PPO gene, invertase inhibitor
gene, salt tolerance gene, R1-associated leader,
phosphorylase-associated leader, R1-associated trailer,
SBE-associated trailers, Ubi-intron, GBSS spacer, UbiT.
[0120] The present invention also encompasses an isolated,
border-like nucleotide sequence ranging in size from 20 to 100 bp
that shares between 52% and 96% sequence identity with a T-DNA
border sequence from Agrobacterium tumafaciens. In a preferred
embodiment, the isolated nucleotide sequence is isolated from a
monocotyledenous plant, selected from the group consisting of
wheat, turf, turf grass, cereal, maize, rice, oat, wheat, barley,
sorghum, orchid, iris, lily, onion, banana, sugarcane, sorghum, and
palm. In another embodiment, the nucleotide sequence is isolated
from a dicotyledenous plant selected from the group consisting of
potato, tobacco, tomato, sugarbeet, broccoli, cassava, sweet
potato, pepper, cotton, poinsetta, legumes, alfalfa, soybean,
carrot, strawberry, lettuce, oak, maple, walnut, rose, mint,
squash, daisy, and cactus.
[0121] In yet another embodiment, the isolated nucleotide sequence
is isolated from potato, and has a nucleotide sequence shown in
either SEQ ID NO. 94 or 95. In a preferred embodiment, the isolated
nucleotide sequence shares 52% sequence identity with a T-DNA
border sequence from Agrobacterium tumafaciens. The present
invention encompasses a vector that comprises such nucleotide
sequences.
[0122] The present invention also provides method of making a plant
stably transformed with a desired polynucleotide comprising:
[0123] (a) isolating a P-DNA that is flanked by border-like
sequences from the plant wherein the border-like sequences share
between 52% and 96% sequence identity with an Agrobacterium
tumafaciens T-DNA border sequence;
[0124] (b) inserting the desired polynucleotide between the P-DNA
border-like sequences to form a P-DNA construct ; and
[0125] (c) transforming aa plant cell from the plant with the P-DNA
construct; and
[0126] (d) recovering a plant from the transformed plant cell
stably transformed with the P-DNA construct.
[0127] In one embodiment, the P-DNA construct is carried on a
vector comprised of a backbone integration marker gene and
transformed plant cells are selected that do not contain the
backone integration marker gene. In another embodiment, the
backbone integration marker gene is a cytokinin gene. In another
embodiment, plant shoots are not selected that exhibit a
cytokinin-overproducing phenotype. In yet another embodiment, the
backnone integraton marker gene is the IPT gene, and plant shoots
are not selected that exhibit an abnormal phenotype or cannot
develop roots.
[0128] In one other embodiment, the plant cells are from a
monocotyledenous plant selected from the group consisting of wheat,
turf, turf grass, cereal, maize, rice, oat, wheat, barley, sorghum,
orchid, iris, lily, onion, banana, sugarcane, sorghum, and
palm.
[0129] In another embodiment, the plant cells are from a
dicotyledenous plant selected from the group consisting of potato,
tobacco, tomato, sugarbeet, broccoli, cassava, sweet , potato,
pepper, cotton, poinsetta, legumes, alfalfa, soybean, carrot,
strawberry, lettuce, oak, maple, walnut, rose, mint, squash, daisy,
and cactus.
[0130] Preferably, the plant cells are transformed via
Agrobacterium-mediated transformation. In one embodiment, the
Agrobacterium-mediated transformation relies on the use of at least
one binary vector. In yet another embodiment, the
Agrobacterium-mediated transformation method uses a first binary
vector and a second binary vector. In one other embodiment, the
first binary vector carries the first polynucleotide and the second
binary vector carries the second polynucleotide. In one further
embodiment, the second binary vector comprises at least one of a
negative selectable marker gene and an omega-mutated virD2 gene,
wherein the negative selectable marker gene is positioned within
the right T-DNA border and the left T-DNA border, and wherein the
omega-mutated virD2 gene is positioned within the backbone of the
second binary vector. In a preferred embodiment, the second binary
vector comprises both a negative selectable marker gene positioned
within the right T-DNA border and the left T-DNA border, and an
omega-mutated virD2 gene positioned within the backbone of the
second binary vector.
[0131] The present invention also provides a P-DNA consisting
essentially of, in the 5'- to 3'-direction, a first T-DNA
border-like sequence, a promoter, a desired polynucleotide sequence
operably linked to the promoter, a terminator, and a second T-DNA
border-like sequence, wherein the border-like sequences have less
than 100% sequence identity with T-DNA border sequences
[0132] In a preferred embodiment, the T-DNA border-like sequences,
the promoter, the desired polynucleotide, and the terminator, are
all isolated from the same plant, the same plant species, or plants
that are sexually interfertile.
[0133] In another embodiment, the P-DNA further consists
essentially of a selectable marker gene.
[0134] In yet another embodiment, the T-DNA border-like sequences,
the promoter, the desired polynucleotide, the terminator and the
selectable marker gene, are all isolated from the same plant, the
same plant species, or plants that are sexually interfertile.
[0135] In yet another embodiment, the desired polynucleotide
sequence in the P-DNA is a sequence upstream or downstream of the
coding region of a gene, wherein the upstream sequence is a leader
sequence, and wherein the downstream sequence is a trailer
sequence. In this embodiment, the T-DNA border-like sequences, the
promoter, the leader sequence, the trailer sequence, the terminator
and the selectable marker gene are all isolated from the same
plant, the same plant species, or plants that are sexually
interfertile.
[0136] In another embodiment, vectors comprising such P-DNA
constructs are provided by the present invention.
[0137] In another embodiment, the promoter is a regulatable
promoter. In yet another embodiment, the regulatable promoter is
sensitive to temperature. In a preferred embodiment, the
regulatable promoter is a wheat wcs120 promoter. In another
embodiment, the promoter is under temporal regulation. In yet
another embodiment, the promoter is a carboxylase promoter. In a
further embodiment, the carboxylase promoter is a maize carboxylase
promoter.
[0138] The promoter may be regulated by any one of abscisic acid,
wounding, methyl jasmonate or gibberellic acid. In another
embodiment, the promoter is a promoter selected from either a Rab
16A gene promoter, an a-amylase gene promoter or a pin2 gene
promoter. In yet another embodiment, the promoter is a
tissue-specific promoter.
[0139] In one other embodiment, the leader sequence is a part of a
5'-untranslated region of a gene that is endogenous to a cell of
the selected plant species. In another embodiment, the
5'-untranslated region is upstream of a start codon of a gene that
is selected from the group consisting of a PPO gene, an R1 gene, a
HOS 1 gene, a S-adenosylhomocysteine hydrolase gene, a class II
cinnamate 4-hydroxylase gene, a cinnamoyl-coenzyme A reductase
gene, a cinnamoyl alcohol dehydrogenase gene, a caffeoyl coenzyme A
O-methyltransferase gene, an actin depolymerizing factor gene, a
Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase
gene, an ADP-glucose pyrophosphorylase gene, a pr6 line
dehydrogenase gene, an endo-1,4-beta-glucanase gene, a zeaxanthin
epoxidase gene, and a 1-aminocyclopropane-1-carboxylate synthase
gene.
[0140] In another embodiment, the trailer sequence is a part of the
3'-untranslated region of a gene that is downstream of a
termination codon of a gene selected from the group consisting of a
PPO gene, an R1 gene, a HOS1 gene, a S-adenosylhomocysteine
hydrolase gene, a class II cinnamate 4-hydroxylase gene, a
cinnamoyl-coenzyme A reductase gene, a cinnamoyl alcohol
dehydrogenase gene, a caffeoyl coenzyme A O-methyltransferase gene,
an actin depolymerizing factor gene, a Nin88 gene, a Lol p 5 gene,
an allergen gene, a P450 hydroxylase gene, an ADP-glucose
pyrophosphorylase gene, a proline dehydrogenase gene, an
endo-1,4-beta-glucanase gene, a zeaxanthin epoxidase gene, and a
1-aminocyclopropane-1-carboxylate synthase gene.
[0141] The present vector may further comprise a spacer element
that is either an Ubi intron sequence or a GBSS spacer sequence. In
another embodiment, the vector comprises a terminator that is a
Ubi3 terminator sequence or a 3'-untranslated region of an
endogenous plant gene.
[0142] In another embodiment, the vector comprises a selectable
marker gene operably linked to a constitutive promoter and a Cre
gene operably linked to an inducible promoter, wherein the
selectable marker gene and the Cre gene are flanked by a first
recombinase recognition site and a second recombinase recognition
site. In another embodiment, the first recombinase recognition site
and the second recombinase recognition site are lox sites.
[0143] In another embodiment, the inducible promoter is a
temperature-sensitive promoter, a chemically-induced promoter, or a
temporal promoter. In yet another embodiment, the inducible
promoter is a Ha hsp17.7 G4 promoter, a wheat wcs120 promoter, a
Rab 16A gene promoter, an .alpha.-amylase gene promoter, a pin2
gene promoter, a carboxylase promoter. In yet another preferred
embodiment, further comprises a plant-derived marker gene. In
another preferred embodiment, the plant-derived marker gene is an
enolpyruvul-3-phosphoshikimic acid synthase gene.
[0144] In another aspect of the present invention, a method for
modifying a plant cell is provided, comprising integrating a P-DNA
sequence into the genome of a plant cell, wherein the P-DNA
consists essentially of, in the 5'- to 3'-direction, a first T-DNA
border-like sequence, a promoter, a desired polynucleotide sequence
operably linked to the promoter, a terminator, and a second T-DNA
border-like sequence, wherein the border-like sequences have less
than 100% sequence identity with T-DNA border sequences, and
wherein the T-DNA border-like sequences, the promoter, the desired
polynucleotide, and terminator, are all isolated from or native to
the genome of the plant cell, wherein the desired polynucleotide
comprises sense and antisense seqeunces of a leader sequence or
trailer sequence that are associated with the upstream or
downstream non-coding regions of a gene in the plant, and wherein
expression of the desired polynucleotide produces a double-stranded
RNA transcript that targets the gene associated with the desired
polynucleotide, thereby modifying the plant cell.
[0145] The present invention also encompasses a method for
modifying a plant, comprising:
[0146] (i) transfecting at least one cell in the plant with the
vector of the present invention;
[0147] (ii) selecting a cell expressing the functional selectable
marker;
[0148] (iii) isolating the cell expressing the functional
selectable marker;
[0149] (iii) inducing the expression of the functional Cre gene in
the isolated cell;
[0150] (iv) culturing the isolated cell; and
[0151] (ii) observing the phenotype of cultured cells;
[0152] wherein a phenotype that is different to an untransfected
plant cell indicates that the target plant cell has been
modified.
[0153] In a preferred embodiment the selecting step of this and
other methods of the present invention is performed by identifying
which cells are resistant to an antibiotic.
[0154] In another aspect, a method for identifying a target plant
cell whose genome contains a P-DNA, comprises co-transfecting a
plant target cell with the vector of the present invention and a
second Agrobacterium-derived vector that comprises a marker gene
flanked by a T-DNA left border and a T-DNA right border and a
omega-mutated virD2 gene, wherein the P-DNA is integrated into the
genome of the plant target cell, and wherein no part of the second
Agrobacterium-derived vector is integrated into the genome of the
plant target cell. In a preferred embodiment, the marker in the
second Agrobacterium-derived vector is a neomycin
phosphotransferase gene.
[0155] In another aspect, the method for identifying a target plant
cell whose genome contains at least a part of an integration
cassette is provided, further comprises selecting cells that
survive temporary growth on a kanamycin-containing media, wherein
the genomes of the selected cells contain only the integration
cassette. In one embodiment, the target plant cell is within a
plant. A plant comprising at least one cell whose genome comprises
such a P-DNA is also encompassed by the present invention.
[0156] The present invention also encompasses a plant comprising at
least one cell whose genome is artificially manipulated to contain
only plant-derived nucleic acids, wherein no cells of the plant
contain foreign nucleic acids integrated into the cell genome.
[0157] The present invention also encompasses a polynucleotide
comprising the polynucleotide sequence of SEQ ID NO. 93, wherein
the polynucleotide is between 20 and 80 nucleotides in length. In
one embodiment, the polynucleotide is between 21 and 70 nucleotides
in length, between 22 and 50 nucleotides in length, between 23 and
40 nucleotides in length, or between 24 and 30 nucleotides in
length.
[0158] In another aspect, the invention encompasses a
tuber-specific promoter as shown in SEQ ID NO. 40.
[0159] The present invention also encompasses an
Agrobacterium-based method of making transgenic plant cells that do
not contain a selectable marker gene stably integrated in nuclear
DNA comprising:
[0160] a. constructing a first binary vector comprised of a
polynucleotide consisting essentially of a desired functional gene
operably linked to T-DNA borders or T-DNA border-like sequences at
the 5' and 3' ends of the desired functional gene;
[0161] b. constructing a second binary vector comprised of a
functional selectable marker gene operably linked to T-DNA borders
or T-DNA border-like sequences at the 5' and 3' ends of the
functional selectable marker gene;
[0162] C. incubating plants cells with:
[0163] i. an Agrobacterium strain carrying the first and the second
binary vectors; or
[0164] ii. a first Agrobacterium strain carrying the first binary
vector and a second Agrobacterium strain carrying the second binary
vector;
[0165] d. selecting plant cells wherein the desired functional gene
is integrated into plant nuclear DNA without integration of the
selectable marker gene into plant nuclear DNA following incubation
for an appropriate time period on a medium containing an
appropriate selection agent.
[0166] In a preferred embodiment, the selectable marker gene is a
herbicide resistance gene or an antibiotic resistance gene. In
another preferred embodiment, the antibiotic resistance gene is the
nNPTII gene. In another embodiment, the antibiotic resistance gene
is the npt II structural gene operably linked to the promoter from
the Ubiquitin-7 gene and the termninator from yeast alcohol
dehydrogenase 1 (ADH1) gene. According to this method, the plant
cells are first incubated with the first Agrobacterium strain and
then subsequently incubated with the second Agrobacterium strain or
-vice versa.
[0167] In a preferred embodiment, the first binary vector further
comprises a binary integration marker gene that can be used to
detect plant cells stably transformed with binary vector backbone
sequences. In another embodiment, the binary vector integration
marker gene is selected from the group consisting of herbicide
resistance gene, antibiotic resistance gene, or NPTII. In yet
another embodiment, the second binary vector further comprises a
gene fusion between the bacterial cytosine deaminase (coda) and
uracil phophoribsyltransferase (upp) genes, which is inserted
between the T-DNA or T-DNA border-like sequences, and plant cells
are exposed to 5-fluorocytosine following incubation with the first
and second Agrobacterium strains in order to select against those
plant cells transformed with the second binary vector.
[0168] In yet another embodiment, the secondary binary vector
further comprises a gene that reduces the probability of backbone
integration. In one embodiment, such a gene is the omega-mutated
virD2 gene, wherein the omega-mutated virD2 gene reduces the
frequency of integration of the selectable marker gene into the
plant nuclear DNA.
[0169] The present invention also encompasses an isolated
nucleotide sequence comprising the GBSS promoter isolated from S.
tuberosum. In a preferred embodiment, this isolated nucleotide
sequence has the nucleotide sequence that is SEQ ID. NO. 6 or
13.
BRIEF DESCRIPTION OF THE DRAWINGS
[0170] FIG. 1. Schematic illustrations of some P-DNA vectors used
in the present invention. P-DNA region is indicated as grey box.
"ipt"=expression cassette for the ipt gene; "npt"=expression
cassette for the nptII gene; "mPPO"=expression cassette for a
modified PPO gene; "INH"=expression cassette for an invertase
inhibitor gene; "GUS"=expression cassette for the GUS gene;
"LPPO"=expression cassette for a sense and antisense copy of the
leader associated with a PPO gene; "LPH"=expression cassette for a
sense and antisense copy of the leader associated with a
phosphorylase gene; "Alf"=expression cassette for a potato Alfin
homolog. See text for details.
[0171] FIG. 2. Gene-free expression cassettes
[0172] FIG. 3. Alignment of potato and tobacco invertase inhibitor
proteins. "St"=Solanum tuberosum (potato); "Nt"=Nicotiana tabacum
(tobacco)
[0173] FIG. 4. Alignment of trailers associated with various PPO
genes.
[0174] FIG. 5. Schematic illustrations of some LifeSupport vectors
used in the present invention. "codA" is an expression cassette for
the codA gene; "codA::upp" is an expression cassette for the codA
gene fused to upp; ".OMEGA.virD2" is an expression cassette for the
.OMEGA.virD2 gene.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0175] The "precise breeding" strategy of the present invention
improves the agronomic performance, nutritional value, and health
characteristics of plants and crops without introducing unknown
nucleic acid, or nucleic acid from a foreign species into a plant
species genome, and without producing undesirable phenotypes or
harmful side-effects.
[0176] Thus, the present invention provides a transgenic plant, and
methods for making such a plant that do not integrate nucleic acid
from non-plant species into that plant's genome. Nucleic acids,
promoters, regulatory elements, other non-coding gene sequences,
markers, polynucleotides, and genes that are integrated into the
selected plant genome are all preferably isolated from the plant
that is to be transformed, plants of the same species to be
transformed, or plants that are sexually interfertile with the
plant to be transformed. Such "native" nucleic acids can be
mutated, modified or cojoined with other native nucleic acids in an
expression cassette and reintegrated into the selected plant
genome, according to the methods described herein. Accordingly, the
genotype and phenotype of the transgenic plant is altered using
only that selected plant's own nucleic acid, or using nucleic acid
from a plant that is sexually compatible with the selected
plant.
[0177] To facilitate the production of such transgenic plants, the
present invention makes use of the fact that not all T-DNA vectors
used in Agrobacterium-mediated transformation are actually
integrated into the plant genome; i.e., while a vector may be taken
up by the plant cell, an actual integration event may not occur.
According to the present invention, one may use such a vector to
carry a selectable marker gene into a plant cell. Plant cells can
then be screened to determine whether the marker has been stably
integrated into the plant genome by determining for how long the
marker gene is expressed. Accordingly, plant cells that only
transiently express the selectable marker gene are desired because
they represent cells that took up, but did not integrate into their
genomes, the selectable marker gene.
[0178] Thus, by co-transforming a plant with such a "marker vector"
and also with another vector that contains the desired native gene
or polynucleotide, one can select plant cells that took up both
vectors and, from those, determine which cells possess genomes that
contain only the desired gene or polynucleotide. The "marker
vector" can be modified to further reduce the possibility that the
marker will be integrated into the plant genome. The present
invention provides such "marker vectors" in the form of
"LifeSupport" vectors.
[0179] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Generally, the nomenclature used herein, and the laboratory
procedures in cell culture, molecular genetics, and nucleic acid
chemistry and hybridization described herein, are those well known
and commonly employed in the art. Standard techniques are used for
recombinant nucleic acid methods, polynucleotide synthesis,
microbial culture, cell culture, tissue culture, transformation,
transfection, transduction, analytical chemistry, organic synthetic
chemistry, chemical syntheses, chemical analysis, and
pharmaceutical formulation and delivery. Generally, enzymatic
reactions and purification and/or isolation steps are performed
according to the manufacturers' specifications. The techniques and
procedures are generally performed according to conventional
methodology disclosed, for example, in Molecular cloning a
laboratory manual, 2d ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1989), and Current protocols in molecular
biology, John Wiley & So Baltimore, Md. (1989).
[0180] Amino acid sequence: as used herein, includes an
oligopeptide, peptide, polypeptide, or protein and fragments
thereof, that are isolated from, native to, or naturally occurring
in a plant, or are synthetically made but comprise the nucleic acid
sequence of the endogenous counterpart.
[0181] Artificially manipulated: as used herein, "artificially
manipulated" means to move, arrange, operate or control by the
hands or by mechanical means or recombinant means, such as by
genetic engineering techniques, a plant or plant cell, so as to
produce a plant or plant cell that has a different biological,
biochemical, morphological, or physiological phenotype and/or
genotype in comparison to unmanipulated, naturally-occurring
counterpart.
[0182] Asexual propagation: producing progeny by generating an
entire plant from leaf cuttings, stem cuttings, root cuttings,
tuber eyes, stolons, single plant cells protoplasts, callus and the
like, that does not involve fusion of gametes.
[0183] Backbone: nucleic acid sequence of a binary vector that
excludes the T-DNA or P-DNA sequence intended for transfer.
[0184] Border and Border-like sequences: "border sequences" are
specific Agrobacterium-derived sequences. Typically, a left border
sequence and a right border sequence flank a T-DNA and they both
function as recognition sites for virD2-catalyzed nicking
reactions. Such activity releases nucleic acid that is positioned
between such borders. See Table 2 below for examples of border
sequences. The released nucleic acid, complexed with virD2 and
virE2, is targeted to plant cell nuclei where the nucleic acid is
often integrated into the genome of the plant cell. Usually, two
border sequences, a left-border and a right-border, are used to
integrate a nucleotide sequence that is located between them into
another nucleotide sequence. It is also possible to use only one
border, or more than two borders, to accomplish integration of a
desired nucleic acid in such fashion.
[0185] According to the present invention, a "border-like" sequence
is isolated from the selected plant species that is to be modified,
or from a plant that is sexually-compatible with the plant species
to be modified, and functions like the border sequences of
Agrobacterium. That is, a border-like sequence of the present
invention promotes and facilitates the integration of a
polynucleotide to which it is linked. A plant-DNA, i.e., P-DNA, of
the present invention preferably contains border-like
sequences.
[0186] A border-like sequence of a P-DNA is between 5-100 bp in
length, 10-80 bp in length, 15-75 bp in length, 15-60 bp in length,
15-50 bp in length, 15-40 bp in length, 15-30 bp in length, 16-30
bp in length, 20-30 bp in length, 21-30 bp in length, 22-30 bp in
length, 23-30 bp in length, 24-30 bp in length, 25-30 bp in length,
or 26-30 bp in length.
[0187] The border-like sequences of the present invention can be
isolated from any plant, such as from potato and wheat. See SEQ ID
NO. 1 and SEQ ID NO. 34, for sequences which contain, at either
end, the border-like sequences isolated from potato and wheat
respectively. Thus, a P-DNA left and right border sequences of use
for the present invention are isolated from and/or native to the
genome of a plant that is to be modified. A P-DNA border-like
sequence is not identical in nucleotide sequence to any known
Agrobacterium-derived T-DNA border sequence.. Thus, a P-DNA
border-like sequence may possess 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides that are
different from a T-DNA border sequence from an Agrobacterium
species, such as Agrobacterium tumefaciens or Agrobacterium
rhizogenes. That is, a P-DNA border, or a border-like sequence of
the present invention has at least 95%, at least 90%, at least 80%,
at least 75%, at least 70%, at least 60% or at least 50% sequence
identity with a T-DNA border sequence from an Agrobacterium
species, such as Agrobacterium tumefaciens or Agrobacterium
rhizogenes, but not 100% sequence identity. As used herein, the
descriptive terms "P-DNA border" and "P-DNA border-like" are
exchangeable.
[0188] A native P-DNA border sequence is greater than or equal to
99%, 98%, 97%, 96%,
95%,94%,93%,92%,91%,90%,89%,88%,87%,86%,85%,84%,83%,82%, 81%,80%,
79%,78%,77%,76%,75%o, 74%,73%,72%, 71%,70%,69%,68%, 67%, 66%, 65%,
64%, 63%, 62%, 61%, 60%, 59%, 58%, 57%,56%,55%,54%, 53%, 52%, 51%
or 50% similar in nucleotide sequence to aAgrobacterium a T-DNA
border sequence. A border-like sequence can, therefore, be isolated
from a plant genome and be modified or mutated to change the
efficiency by which they are capable of integrating a nucleotide
sequence into another nucleotide sequence. Other polynucleotide
sequences may be added to or incorporated within a border-like
sequence of the present invention. Thus, a P-DNA left border or a
P-DNA right border may be modified so as to possess 5'- and
3'-multiple cloning sites, or additional restriction sites. A P-DNA
border sequence may be modified to increase the likelihood that
backbone DNA from the accompanying vector is not integrated into
the plant genome.
[0189] Table 2 below depicts the sequences of known T-DNA border
sequences and sequences identified herein as border-like sequences.
None of the sequences identified as "border-like" in Table 2 have
been identified previously as having a T-DNA border-like structure.
The potato border-like sequences were isolated by the present
inventive methods using degenerate primers in polymerase chain
reactions from potato genomic DNA. The present invention
encompasses the use of any P-DNA border-like sequence for
transferring a cojoined polynucleotide into the genome of a plant
cell.
[0190] Indeed, the present invention encompasses any border-like
sequence that has the nucleic acid sequence structure of SEQ ID NO.
93: ANGATNTATN6GT (SEQ ID NO. 93), where "N" is any nucleotide,
such as those represented by "A," "G," "C," or "T." This sequence
represents the consensus sequence of border-like nucleic acids
identified by the present invention.
1TABLE 2 "Border" and "Border-Like" sequences Agrobacterium T-DNA
borders TGACAGGATATATTGGCGGGTAAAC (SEQ ID NO.41) Agrobacterium
nopaline strains (RB) TGGCAGGATATATTGTGGTGTAAAC (SEQ ID NO.42)
Agrobacterium nopaline strains (LB) TGGCAGGATATATACCGTTGTAATT (SEQ
ID NO.43) Agrobacterium octopine strains (RB)
CGGCAGGATATATTCAATTGTAATT (SEQ ID NO.44) Agrobacterium octopine
strains (LB) TGGTAGGATATATACCGTTGTAATT (SEQ ID NO.45) LB mutant
TGGCAGGATATATGGTACTGTAATT (SEQ ID NO.46) LB mutant
YGRYAGGATATATWSNVBKGTAAWY (SEQ ID NO.47) Border motif Border-like
sequences CGGCAGGATATATCCTGATGTAAAT (SEQ ID NO.48) R. leguminosarum
TGGCAGGAGTTATTCGAGGGTAAAC (SEQ ID NO.49) T. tengcongensis
TGACAGGATATATCGTGATGTCAAC (SEQ ID NO.50) Arabidopsis thaliana
GGGAAGTACATATTGGCGGGTAAAC (SEQ ID NO.51) A. thaliana CHR1v07142002
TTACAGGATATATTAATATGTATG- A (SEQ ID NO.52) Oryza sativa AC078894
TAACATGATATATTCCCTTGTAAAT (SEQ ID NO.53) Homo sapiens clone HQ0089
TGACAGGATATATGGTAATGTAAAC (SEQ ID NO.54) potato (left border
seguence)* TGGCAGGATATATACCGATGTAAAC (SEQ ID NO.55) potato (right
border seguence)* Y = C or T; R = A or G; K = G or T; M = A or C; W
= A or T; S = C or G; V = A, C, or G; B = C, G, or T. The accession
numbers for the border-like sequences are: Oryza sativa chromosome
10 BAC OSJNBa0096G08 genomic sequence (AC078894.11); Arabidopsis
thaliana chromosome 3 (NM_114337.1); Arabidopsis thaliana
chromosome 1 (NM_105664.1); T. tengcongensis strain MB4T, section
118 of 244 of the complete genome (AE013091.1); Homo sapiens clone
HQ0089 (AF090888.1); Rhizobium Clone: rhiz98e12.qlk. *potato left
and right border sequences were obtained and isolated according to
the presently-described inventive methods.
[0191] Carrier DNA: a "carrier DNA" is a DNA segment that is used
to carry certain genetic elements and deliver them into a plant
cell. In conventional foreign DNA transfer, this carrier DNA is
often the T-DNA of Agrobacterium, delineated by border sequences.
The carrier DNA described here is obtained from the selected plant
species to be modified and contains ends that may be structurally
and functionally different from T-DNA borders but shares with such
T-DNAs the ability to support both DNA transfer from Agrobacterium
to the nuclei of plant cells or certain other eukaryotes and the
subsequent integration of this DNA into the genomes of such
eukaryotes.
[0192] Consisting essentially of: a composition "consisting
essentially of" certain elements is limited to the inclusion of
those elements, as well as to those elements that do not materially
affect the basic and novel characteristics of the inventive
composition. Thus, so long as the composition does not affect the
basic and novel characteristics of the instant invention, that is,
does not contain foreign DNA that is not from the selected plant
species or a plant that is sexually compatible with the selected
plant species, then that composition may be considered a component
of an inventive composition that is characterized by "consisting
essentially of" language.
[0193] Degenerate primer: a "degenerate primer" is an
oligonucleotide that contains sufficient nucleotide variations that
it can accommodate base mismatches when hybridized to sequences of
similar, but not exact, homology.
[0194] Dicotyledon (dicot): a flowering plant whose embryos have
two seed leaves or cotyledons. Examples of dicots include, but are
not limited to, tobacco, tomato, potato, sweet potato, cassava,
legumes including alfalfa and soybean, carrot, strawberry, lettuce,
oak, maple, walnut, rose, mint, squash, daisy, and cactus.
[0195] Regulatory sequences: refers to those sequences which are
standard and known to those in the art, that may be included in the
expression vectors to increase and/or maximize transcription of a
gene of interest or translation of the resulting RNA in a plant
system. These include, but are not limited to, promoters, peptide
export signal sequences, introns, polyadenylation, and
transcription termination sites. Methods of modifying nucleic acid
constructs to increase expression levels in plants are also
generally known in the art (see, e.g. Rogers et al., 260 J. Biol.
Chem. 3731-38, 1985; Cornejo et al., 23 Plant Mol. Biol. 567:
81,1993). In engineering a plant system to affect the rate of
transcription of a protein, various factors known in the art,
including regulatory sequences such as positively or negatively
acting sequences, enhancers and silencers, as well as chromatin
structure may have an impact. The present invention provides that
at least one of these factors may be utilized in engineering plants
to express a protein of interest. The regulatory sequences of the
present invention are native genetic elements, i.e., are isolated
from the selected plant species to be modified.
[0196] Foreign: "foreign," with respect to a nucleic acid, means
that that nucleic acid is derived from non-plant organisms, or
derived from a plant that is not the same species as the plant to
be transformed or is not derived from a plant that is not
interfertile with the plant to be transformed, does not belong to
the species of the target plant.
[0197] According to the present invention, foreign DNA or RNA
represents nucleic acids that are naturally occurring in the
genetic makeup of fungi, bacteria, viruses, mammals, fish or birds,
but are not naturally occurring in the plant that is to be
transformed. Thus, a foreign nucleic acid is one that encodes, for
instance, a polypeptide that is not naturally produced by the
transformed plant. A foreign nucleic acid does not have to encode a
protein product. According to the present invention, a desired
transgenic plant is one that does not contain any foreign nucleic
acids integrated into its genome.
[0198] Native genetic elements, on the other hand, can be
incorporated and integrated into a selected plant species genome
according to the present invention. Native genetic elements are
isolated from plants that belong to the selected plant species or
from plants that are sexually compatible with the selected plant
species. For instance, native DNA incorporated into cultivated
potato (Solanum tuberosum) can be derived from any genotype of S.
tuberosum or any genotype of a wild potato species that is sexually
compatible with S. tuberosum (e.g., S. demissum).
[0199] Gene: "gene" refers to the coding region and does not
include nucleotide sequences that are 5'- or 3'- to that region. A
functional gene is the coding region operably linked to a promoter
or terminator.
[0200] Genetic rearrangement: refers to the reassociation of
genetic elements that can occur spontaneously in vivo as well as in
vitro which introduce a new organization of genetic material. For
instance, the splicing together of polynucleotides at different
chromosomal loci, can occur spontaneously in vivo during both plant
development and sexual recombination. Accordingly, recombination of
genetic elements by non-natural genetic modification techniques in
vitro is akin to recombination events that also can occur through
sexual recombination in vivo.
[0201] In frame: nucleotide triplets (codons) are translated into a
nascent amino acid sequence of the desired recombinant protein in a
plant cell. Specifically, the present invention contemplates a
first nucleic acid linked in reading frame to a second nucleic
acid, wherein the first nucleotide sequence is a gene and the
second nucleotide is a promoter or similar regulatory element.
[0202] Integrate: refers to the insertion of a nucleic acid
sequence from a selected plant species, or from a plant that is
from the same species as the selected plant, or from a plant that
is sexually compatible with the selected plant species, into the
genome of a cell of a selected plant species. "Integration" refers
to the incorporation of only native genetic elements into a plant
cell genome. In order to integrate a native genetic element, such
as by homologous recombination, the present invention may "use"
non-native DNA as a step in such a process. Thus, the present
invention distinguishes between the "use of" a particular DNA
molecule and the "integration" of a particular DNA molecule into a
plant cell genome.
[0203] Introduction: as used herein, refers to the insertion of a
nucleic acid sequence into a cell, by methods including infection,
transfection, transformation or transduction.
[0204] Isolated: "isolated" refers to any nucleic acid or compound
that is physically separated from its normal, native environment.
The isolated material may be maintained in a suitable solution
containing, for instance, a solvent, a buffer, an ion, or other
component, and may be in purified, or unpurified, form.
[0205] Leader: Transcribed but not translated sequence preceding
(or 5' to) a gene.
[0206] LifeSupport Vector: a LifeSupport vector is a construct that
contains an expressable selectable marker gene, such as a neomycin
phosphotransferase marker, that is positioned between T-DNA or
T-DNA-like borders. The LifeSupport vector may be modified to limit
integration of such a marker, as well as other polynucleotides,
that are situated between the border or border-like sequences, into
a plant genome. For instance, a LifeSupport vector may comprise a
mutated virD2, codA::upp fusion, or any combination of such genetic
elements. Thus, a modified virD2 protein will still support T-DNA
transfer to plant nuclei but will limit the efficiency of a
subsequent genomic integration of T-DNAs (Shurvinton et al., Proc
Natl Acad Sci USA, 89: 11837-11841, 1992; Mysore et al., Mol Plant
Microbe Interact, 11: 668-683, 1998). Alternatively, codA::upp gene
fusion can be used as negative selectable marker prior to
regeneration. In one preferred construct, the LifeSupport vector
comprises the npt marker operably linked to the yeast ADH
terminator element.
[0207] Monocotyledon (monocot): a flowering plant whose embryos
have one cotyledon or seed leaf. Examples of monocots include, but
are not limited to turf grass, maize, rice, oat, wheat, barley,
sorghum, orchid, iris, lily, onion, and palm.
[0208] Native: a "native" genetic element refers to a nucleic acid
that naturally exists in, orginates from, or belongs to the genome
of a plant that is to be transformed. Thus, any nucleic acid, gene,
polynucleotide, DNA, RNA, MRNA, or cDNA molecule that is isolated
either from the genome of a plant or plant species that is to be
transformed or is isolated from a plant or species that is sexually
compatible or interfertile with the plant species that is to be
transformed, is "native" to, i.e., indigenous to, the plant
species. In other words, a native genetic element represents all
genetic material that is accessible to plant breeders for the
improvement of plants through classical plant breeding. Any
variants of a native nucleic acid also are considered "native" in
accordance with the present invention. In this respect, a "native"
nucleic acid may also be isolated from a plant or sexually
compatible species thereof and modified or mutated so that the
resultant variant is greater than or equal to 99%, 98%, 97%, 96%,
95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%,
82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%,
69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% similar in
nucleotide sequence to the unmodified, native nucleic acid isolated
from a plant. A native nucleic acid variant may also be less than
about 60%, less than about 55%, or less than about 50% similar in
nucleotide sequence.
[0209] A "native" nucleic acid isolated from a plant may also
encode a variant of the naturally occurring protein product
transcribed and translated from that nucleic acid. Thus, a native
nucleic acid may encode a protein that is greater than or equal to
99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%,
86%, 85 %, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%,
73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or
60% similar in amino acid sequence to the unmodified, native
protein expressed in the plant from which the nucleic acid was
isolated.
[0210] Naturally occurring nucleic acid: this phrase means that the
nucleic acid is found within the genome of a selected plant species
and may be a DNA molecule or an RNA molecule. The sequence of a
restriction site that is normally present in the genome of a plant
species can be engineered into an exogenous DNA molecule, such as a
vector or oligonucleotide, even though that restriction site was
not physically isolated from that genome. Thus, the present
invention permits the synthetic creation of a nucleotide sequence,
such as a restriction enzyme recognition sequence, so long as that
sequence is naturally occurring in the genome of the selected plant
species or in a plant that is sexually compatible with the selected
plant species that is to be transformed.
[0211] Operably linked: combining two or more molecules in such a
fashion that in combination they function properly in a plant cell.
For instance, a promoter is operably linked to a structural gene
when the promoter controls transcription of the structural
gene.
[0212] P-DNA: according to the present invention, P-DNA
("plant-DNA") is isolated from a plant genome and comprises at each
end, or at only one end, a T-DNA border-like sequence. The
border-like sequence preferably shares at least 50%, at least 60%,
at least 70%, at least 75%, at least 80%, at least 90% or at least
95%, but less than 100% sequence identity, with a T-DNA border
sequence from an Agrobacterium species, such as Agrobacterium
tumefaciens or,Agrobacterium rhizogenes. Thus, P-DNAs can be used
instead of T-DNAs to transfer a nucleotide sequence from
Agrobacterium to another polynucleotide sequence. The P-DNA may be
modified to facilitate cloning and should preferably not naturally
encode proteins or parts of proteins. The P-DNA is characterized in
that it contains, at each end, at least one border sequence,
referred to as either a "P-DNA border sequence" or "P-DNA
border-like sequence," which are interexchangeable terms. See the
definition of a "border sequence" and "border-like" above. A P-DNA
may also be regarded as a "T-DNA-like" sequence, see definition
below.
[0213] Plant: includes angiosperms and gymnosperms such as potato,
tomato, tobacco, alfalfa, lettuce, carrot, strawberry, sugarbeet,
cassava, sweet potato, soybean, maize, turf grass, wheat, rice,
barley, sorghum, oat, oak, eucalyptus, walnut, and palm. Thus, a
plant may be a monocot or a dicot. The word "plant," as used
herein, also encompasses plant cells, seed, plant progeny,
propagule whether generated sexually or asexually, and descendents
of any of these, such as cuttings or seed. Plant cells include
suspension cultures, callus, embryos, meristematic regions, callus
tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen,
seeds and microspores. Plants may be at various stages of maturity
and may be grown in liquid or solid culture, or in soil or suitable
media in pots, greenhouses or fields. Expression of an introduced
leader, trailer or gene sequences in plants may be transient or
permanent. A "selected plant species" may be, but is not limited
to, a species of any one of these "plants."
[0214] Precise breeding: refers to the improvement of plants by
stable introduction of nucleic acids, such as native genes and
regulatory elements isolated from the selected plant species, or
from another plant in the same species as the selected plant, or
from species that are sexually compatible with the selected plant
species, into individual plant cells, and subsequent regeneration
of these genetically modified plant cells into whole plants. Since
no unknown or foreign nucleic acid is permanently incorporated into
the plant genome, the inventive technology makes use of the same
genetic material that is also accessible through conventional plant
breeding.
[0215] Plant species: the group of plants belonging to various
officially named plant species that display at least some sexual
compatibility.
[0216] Plant transformation and cell culture: broadly refers to the
process by which plant cells are genetically modified and
transferred to an appropriate plant culture medium for maintenance,
further growth, and/or further development.
[0217] Recombinant: Was used herein, broadly describes various
technologies whereby genes can be cloned, DNA can be sequenced, and
protein products can be produced. As used herein, the term also
describes proteins that have been produced following the transfer
of genes into the cells of plant host systems.
[0218] Selectable marker: a "selectable marker" is typically a gene
that codes for a protein that confers some kind of resistance to an
antibiotic, herbicide or toxic compound, and is used to identify
transformation events. Examples of selectable markers include the
streptomycin phosphotransferase (spt) gene encoding streptomycin
resistance, the phosphomannose isomerase (pmi) gene that converts
mannose-6-phosphate into fructose-6 phosphate; the neomycin
phosphotransferase (nptII) gene encoding kanamycin and geneticin
resistance, the hygromycin phosphotransferase (hpt or aphiv) gene
encoding resistance to hygromycin, acetolactate synthase (als)
genes encoding resistance to sulfonylurea-type herbicides, genes
coding for resistance to herbicides which act to inhibit the action
of glutamine synthase such as phosphinothricin or basta (e.g., the
bar gene), or other similar genes known in the art.
[0219] Sense suppression: reduction in expression of an endogenous
gene by expression of one or more an additional copies of all or
part of that gene in transgenic plants.
[0220] T-DNA-Like: a "T-DNA-like" sequence is a nucleic acid that
is isolated from a selected plant species, or from a plant that is
sexually compatible with the selected plant species, and which
shares at least 75%, 80%, 85%, 90%, or 95%, but not 100%, sequence
identity with Agrobacterium species T-DNA. The T-DNA-like sequence
may contain one or more border or border-like sequences that are
each capable of integrating a nucleotide sequence into another
polynucleotide. A "P-DNA," as used herein, is an example of a
T-DNA-like sequence.
[0221] Trailer: Transcribed but not translated sequence following
(or 3'to) a gene.
[0222] Transcribed DNA: DNA comprising both a gene and the
untranslated leader and trailer sequence that are associated with
that gene, which is transcribed as a single MRNA by the action of
the preceding promoter.
[0223] Transcription and translation terminators: the expression
vectors of the present invention typically have a transcription
termination region at the opposite end from the transcription
initiation regulatory region. The transcription termination region
may be selected, for stability of the MRNA to enhance expression
and/or for the addition of polyadenylation tails added to the gene
transcription product (Alber & Kawasaki, Mol. & Appl.
Genetics 4: 19-34, 1982). Illustrative transcription termination
regions include the E9 sequence of the pea RBCS gene (Mogen et al.,
Mol. Cell Biol., 12: 5406-14, 1992) and the termination signals of
various ubiquitin genes.
[0224] Transformation of plant cells: a process by which DNA is
stably integrated into the genome of a plant cell. "Stably" refers
to the permanent, or non-transient retention and/or expression of a
polynucleotide in and by a cell genome. Thus, a stably integrated
polynucleotide is one that is a fixture within a transformed cell
genome and can be replicated and propagated through successive
progeny of the cell or resultant transformed plant. Transformation
may occur under natural or artificial conditions using various
methods well known in the art. Transformation may rely on any known
method for the insertion of nucleic acid sequences into a
prokaryotic or eukaryotic host cell, including
Agrobacterium-mediated transformation protocols, viral infection,
whiskers, electroporation, heat shock, lipofection, polyethylene
glycol treatment, micro-injection, and particle bombardment.
[0225] Transgene: a gene that will be inserted into a host genome,
comprising a protein coding region. In the context of the instant
invention, the elements comprising the transgene are isolated from
the host genome.
[0226] Transgenic plant: a genetically modified plant which
contains at least one transgene.
[0227] Using/Use of: The present invention envisions the use of
nucleic acid from species other than that of the selected plant
species to be transformed to facilitate the integration of native
genetic elements into a selected plant genome, so long as such
foreign nucleic acid is not stably integrated into the same host
plant genome. For instance, the plasmid, vector or cloning
construct into which native genetic elements are cloned, positioned
or manipulated may be derived from a species different to that from
which the native genetic elements were derived.
[0228] Variant: a "variant," as used herein, is understood to mean
a nucleotide or amino acid sequence that deviates from the
standard, or given, nucleotide or amino acid sequence of a
particular gene or protein. The terms, "isoform," "isotype," and
"analog" also refer to "variant" forms of a nucleotide or an amino
acid sequence. An amino acid sequence that is altered by the
addition, removal or substitution of one or more amino acids, or a
change in nucleotide sequence, may be considered a "variant"
sequence. The variant may have "conservative" changes, wherein a
substituted amino acid has similar structural or chemical
properties, e.g., replacement of leucine with isoleucine. A variant
may have "nonconservative" changes, e.g., replacement of a glycine
with a tryptophan. Analogous minor variations may also include
amino acid deletions or insertions, or both. Guidance in
determining which amino acid residues may be substituted, inserted,
or deleted may be found using computer programs well known in the
art such as Vector NTI Suite (InforMax, MD) software.
[0229] It is understood that the present invention is not limited
to the particular methodology, protocols, vectors, and reagents,
etc., described herein, as these may vary. It is also to be
understood that the terminology used herein is used for the purpose
of describing particular embodiments only, and is not intended to
limit the scope of the present invention. It must be noted that as
used herein and in the appended claims, the singular forms "a,"
"an," and "the" include plural reference unless the context clearly
dictates otherwise. Thus, for example, a reference to "a gene" is a
reference to one or more genes and includes equivalents thereof
known to those skilled in the art and so forth. Indeed, one skilled
in the art can use the methods described herein to express any
native gene (known presently or subsequently) in plant host
systems.
[0230] P-DNA Vectors
[0231] Agrobacterium-mediated transformation methods are the
preferred means of incorporating recombined DNA into plant cells.
According to the present invention, a binary vector was developed
to produce genetically modified potato plants that contain only
native potato nucleic acids. Such a vector is different from
conventional, Agrobacterium-mediated, transformation vectors in
three ways: (1) instead of an Agrobacterium-derived T-DNA sequence
delineated by T-DNA borders, the present vector contains a native
plant DNA (P-DNA) fragment that is flanked by border-like
sequences, which support P-DNA transfer from Agrobacterium to plant
cells although they are structurally and functionally different
from T-DNA borders, (2) the backbone of the present vector may
contain a marker that, if integrated into the plant cell's genome,
prevents these cells from developing into mature plants, and (3)
the present vector does not contain a foreign selectable marker
gene between P-DNA termini.
[0232] The present invention demonstrates, surprisingly, that P-DNA
fragments flanked by border-like sequences support DNA transfer
from Agrobacterium into plant cells. P-DNA can be isolated from the
genome of any plant by using primers that are designed on the basis
of homology between the termini of a potato P-DNA and conventional
T-DNA borders. Such fragments can then be tested and, if
efficacious, used to transform that plant with native DNA
exclusively. It is also possible to search plant genomic databases
for DNA fragments with regions that show homology with T-DNA
borders by using programs such as `blastn` (Altschul et al., J Mol
Biol 215: 403-10, 1990). The identified P-DNAs may then be modified
to increase their utility. For instance, internal fragments of the
isolated P-DNAs may be deleted and restriction sites may be added
to facilitate cloning. It may also be efficacious to introduce
point mutations at the terminal sequences to render the P-DNA more
effective in transferring DNA.
[0233] Any gene expression cassette can be inserted between P-DNA
border-like sequences. For potato transformations, such an
expression cassette could consist of a potato promoter, operably
linked to a potato gene and/or a leader or trailer sequence
associated with that gene, and followed by a potato terminator. The
expression cassette may contain additional potato genetic elements
such as a signal peptide sequence fused in frame to the 5'-end of
the gene, and a potato intron that could, for instance, be placed
between promoter and gene-of-interest to enhance expression. For
transformation of wheat with a modified P-DNA, all genetic elements
that are inserted on the wheat P-DNA, including the P-DNA itself
would be derived from wheat or plant species that are sexually
compatible with wheat.
[0234] Another way to isolate P-DNAs is by generating a library of
Agrobacterium strains that contain random plant DNA fragments
instead of a T-DNA flanking a selectable marker gene. Explants
infected with this library can be placed on proliferation medium
that contains an appropriate selectable agent to identify P-DNAs
that support the transfer of the marker gene from the vector in
Agrobacterium to the plant cell.
[0235] It is possible that not just the native modified P-DNA, but
also additional plasmid sequences are co-transferred from
Agrobacterium to the plant cell during the transformation process.
For the purposes of the present invention, this is an undesirable
process because such plasmid "backbone" sequences represent
non-plant, foreign DNA, such as bacterial DNA. The present
invention prevents transformed plant cells that contain backbone
sequences from developing into mature plants. Thus, the present
invention makes it possible to distinguish backbone-containing and
backbone-free transformation events during the regenerated shoot
phase.
[0236] The method to select or screen against backbone integration
events relies on the presence of an expression cassette for a
marker, such as the isopentenyl phosphotransferase (IPT) gene, in
the vector backbone, outside of the P-DNA. Upon backbone
integration, the accumulation of IPT-induced cytokinin will alter
the shape of transformed shoots, and prevent these shoots to
develop roots. Instead of the IPT gene, any other gene that alters
the shape, texture or color of the transformed plant's leaves,
roots, stem, height or some other morphological feature can be used
to screen and/or select against backbone integration events. Such a
gene is referred to herein as a "backbone integration marker."
Thus, the transformed plant that exhibits an altered morphological
feature attributable to the expression of the backbone integration
marker gene is known to, contain in its genome foreign DNA in
addition to the desired P-DNA. Accordingly, plants that exhibit a
phenotype associated with the backbone integration marker are not
desired.
[0237] The present invention is not limited to the use of only an
IPT gene as a backbone integration marker; other genes can be used
in such fashion. For example, a backbone integration marker may be
an Agrobacterium transzeatine synthase (TZS) gene (Krall et al.,
FEBS Lett 527: 315-8, 2002) or a recessive Arabidopsis gene hod
(Catterou et al., Plant J 30: 273-87,2002). This method can be more
easily applied for use in the present invention than some methods
that insert toxic genes in vector backbone sequences. See, for
instance, EP 1 009,842.
[0238] By positioning a backbone integration marker gene, such as a
functional cytokinin gene upstream or downstream of the P-DNA, it
is straightforward to distinguish between transformation events.
Transformed plants that exhibit an altered morphological feature
are discarded because they contain non-native DNA sequences
integrated into the genome.
[0239] Another strategy for identifying plants that are stably
transformed with only native DNA, is to employ the polymerase chain
reaction. By using primers that are specifically designed to detect
backbone sequences, plants can be identified and discarded that
contain foreign backbone sequences in addition to the P-DNA. Other
primer sets can subsequently be used to confirm the intact transfer
of the P-DNA. Thus, by either using the expression of a gene to
change a morphological feature of a plant, or by screening for
stably integrated foreign DNA in a transformed plant, plants stably
transformed with only native DNA sequences can be identified and
selected.
[0240] Genetic elements from a particular host plant can be
inserted into the P-DNA sequence of a binary vector capable of
replication in both E. coli and Agrobacterium. Introduction of the
resulting vectors into disarmed Agrobacterium strains such as
LBA4404 can be accomplished through electroporation, triparental
mating or heat-shock treatment of chemically competent cells. The
new strains can then be used to transform individual plant cells
through infection of whole plants or explants.
[0241] Genetic elements from a particular host plant can be
inserted into the P-DNA sequence of a binary vector capable of
replication in both E. coli and Agrobacterium. Introduction of the
resulting vectors into Agrobacterium strains such as LBA4404 can be
accomplished through electroporation, triparental mating or
heat-shock treatment of chemically competent cells. The new strains
can then be -used to transform individual plant-cells through
infection of whole plants or explants. LBA4404 contains the
disarmed Ti-plasmid pAL4404, which carries the virulence functions
and a streptomycin resistance gene.
[0242] LifeSupport Vectors
[0243] Although the stable integration of bacterial marker genes
into the genomes of plant cells facilitates the identification of
transformation events, such modifications of plant genomes are
undesirable because marker genes represent foreign DNA. Use of a
foreign marker gene can be avoided by developing new
Agrobacterium-based transformation methods.
[0244] One preferred embodiment is a novel method that relies on
the use of two Agrobacterium strains: one strain containing a
binary vector with a selectable marker gene intended for transient
expression in plant nuclei, and another strain carrying the P-DNA
with the actual sequences of interest intended for stable
integration in plant genome (see Example 7).
[0245] Upon co-infection with the Agrobacterium strains, some plant
cells will receive both a T-DNA with the marker gene and a P-DNA
with the sequences of interest. Instead of subsequently selecting
for stable integration of the marker gene by subjecting the
infected explants for a long period of time to the appropriate
antibiotic, explants are only briefly exposed to the antibiotic. In
this way, all plant cells that transiently express the marker gene
will survive. Because T-DNAs will in most cases degrade due to
endogenous nuclease activities rather than stably integrate into
their host's genome, the majority of plant cells that survived the
transient selection are shown here to develop into shoots lacking a
marker gene. The present invention, furthermore, demonstrates that
a significant proportion of these marker-free shoots contain stably
integrated P-DNAs.
[0246] There are various tools to enhance the efficiency of
marker-free transformation. First, the present invention
demonstrates that this frequency can be increased by sequentially
infecting-explants with two Agrobacterium strains carrying the
T-DNA/marker and P-DNA/sequences-of-interest, respectively.
Explants are first infected with the P-DNA strain, and after about
4 to 6 hours with the T-DNA strain.
[0247] Second, the T-DNA strain can be modified to express an
omega-mutated virD2 gene. The modified virD2 protein will still
support T-DNA transfer to plant nuclei but limit the efficiency of
a subsequent genomic integration of T-DNAs (Shurvinton et al., Proc
Natl Acad Sci USA, 89: 11837-11841, 1992; Mysore et al., Mol Plant
Microbe Interact, 11: 668-683, 1998). The most preferred method of
expressing a modified virD2 gene is by inserting an omega-mutated
virD2 gene driven by the virD promoter in the backbone of the T-DNA
vector.
[0248] Third, stable T-DNA integration can be further impaired by
inserting telomere sequences close to the left- and right-border
sequences of the T-DNA (Chiurazzi & Signer, Plant Mol. Biol.,
26: 923-934, 1994).
[0249] Fourth, the size of the T-DNA region carrying the marker
gene can be increased to enhance the frequency of T-DNAs and P-DNAs
moving together into the plant cell nucleus, and to reduce the
frequency of genomic integration of the T-DNA.
[0250] Fifth, the frequency of T-DNAs and P-DNAs moving together
into the plant cell nucleus can also be enhanced by using a single
Agrobacterium strain carrying two compatible binary vectors with
the T-DNA and P-DNA, respectively. An example of is two compatible
binary vectors are a pSIM 1301-derived vector and a pBI121-derived
vector.
[0251] Because the transiently expressed marker gene will usually
not integrate into the plant genome, it is not necessary that both
this gene and its regulatory sequences represent native DNA. In
fact, it may be advantageous to use foreign regulatory sequences to
promote high levels of transient gene expression in infected plant
cells. A surprising discovery of the present invention is that an
expression cassette containing the GUS gene followed by the
terminator of the yeast alcohol dehydrogenase 1 (ADH1) was
transiently expressed at high levels in potato cells. A similar
construct with the yeast CYC1 terminator, however, did not function
adequately. It may also be possible to enhance transient expression
levels by operably linking a marker gene to a non-native promoter.
Examples of such promoters are, e.g., synthetic promoters such as
glucocorticoid-inducible promoters (Mori et al., Plant J., 27:
79-86, 2001; Bohner et al., Mol. Gen. Genet., 264: 860-70 2001),
and non-native promoters such as the 35S promoters of cauliflower
mosaic virus and figwort mosaic virus, and fungal promoters.
[0252] As an alternative to the two-strain Agrobacterium-mediated
transformation approach described above, plants may also be
transformed with a single strain that contains a P-DNA with both a
native marker gene and the actual sequences of interest. The
present invention demonstrates that it is possible to use salt
tolerance genes as native markers for transformation. Such salt
tolerance genes include crop homologs of the Arabidopsis genes SOS1
(Shi et al., Nat Biotechnol. 2002), AtNHX1 (Apse et al., Science.
285: 1256-8, 1999), Avp1 (Gaxiola et al., Proc Natl Acad Sci USA.
98: 11444-9,2001), and CBF3 Kasuga et al., Nat Biotechnol. 17:
287-91, 1999).
[0253] The rearrangements of genetic elements accomplished through
the inventive Precise Breeding methodology could also occur
spontaneously through the process of genetic recombination. For
instance, all plants contain elements that can transpose from one
to another chromosomal location. By inserting into promoters or
genes, such transposable elements can enhance, alter, and/or reduce
gene expression. For instance, the AMu4 insertion of the maize
Mutator element in the promoter of the transcriptional regulator
gene P-wr causes stripy red pericarps. Insertion of the same
element in the promoter of the leaf-specific MADS-box gene ZMM19
resulted in expression of this gene in the inflorescences of maize,
causing a foliaceous elongation of the glumes and other changes in
male and female inflorescences, resulting in the famous phenotype
of pod corn. Because of its bizarre tassels and ears, pod corn was
of religious significance for certain native American tribes. Many
genes are also rearranged through other transposon-induced
modifications such as inversions, deletions, additions, and ectopic
recombinations (Bennetzen, Plant Mol Biol 42: 251 -69, 2000).
Furthermore, plant DNA rearrangements frequently occur through the
process of intragenic recombination. For instance, by recombining
genes involved in resistance against specific pathogens, plants are
able to develop resistance genes with new specificities and, thus,
co-evolve with their pathogens (Ellis et al., Trends Plant Sci 5:
373-9, 2000). Another example of intragenic recombination relates
to how plants reproduce: plants transition from cross-fertilizing
to self-fertilizing by recombining genes involved in
self-incompatibility (Kusaba et al., Plant Cell 13: 627-43, 2001).
Other processes that promote genome evolution include, for
instance, chromosome breakage and interchromosomal
recombination.
[0254] Enhancing Tie Nutritional Value of Plants and Food Crops
[0255] To modify negative traits such as acrylamide accumulation
during processing, glycoalkaloid accumulation, accumulation of
undesirable advanced glycation products, CIPC accumulation, low
levels of resistant starch, bruise susceptibility, cold-induced
sweetening, disease susceptibility, low yield and low quality in
crop plants through precise breeding, at least one specific
expression cassette is incorporated into a host genome. Three
different methods are used to eliminate negative traits: (1)
overexpression of genes that prevent the occurrence of negative
traits, (2) overexpression of mutated versions of genes associated
with negative traits in order to titrate out the wild-type gene
products with non-functional proteins, and (3) silencing specific
genes that are associated with a negative trait by expressing at
least one copy of a leader or trailer fragment associated with that
gene in the sense and/or antisense orientation.
[0256] One example of an endogenous gene that is associated with a
negative trait in potato and can be modified in vitro so that it
encodes a non-functional protein is the polyphenol oxidase (PPO)
gene. Upon impact injury, the PPO gene product is released from the
plastid into the cytoplasm (Koussevitzky et al., J. Biol. Chem.,
273: 27064-9, 1998), where it will mediate the oxidation of phenols
to create a variety of phenoxyl radicals and quinoid derivatives,
which are toxic and/or ultimately form undesirable polymers that
leave dark discolorations, or "black spots" in the crop.
[0257] Overexpressing a mutant PPO gene that contains a
non-functional copper-binding domain can lower the activity of all
PPO genes that are mainly expressed in tubers and associated organs
such as sprouts. The mutations render the polyphenol oxidase
protein inactive because it is unable to bind copper. The skilled
artisan would know where to make point mutations that would, in
this case, compromise the function of a gene product. The
applicants identified the copper binding domain in potato PPO by
aligning the potato PPO protein sequence with a sweet potato PPO
protein sequence (Klabunde et al., Nat Struct. Biol., 5:1084-90,
1998). Areas of conservation, particularly those containing
conserved histidine residues in copper-binding sites, were targets
for inactivating the transgene product. Because the almost complete
absence of PPO activity in such organs may negatively impact the
plant's ability to resist pathogens, the present invention also
describes an improved method of only lowering a specific PPO gene
that is predominantly expressed in all parts of the mature tuber
except for the epidermis. Silencing of this specific PPO gene by
using a trailer sequence associated with that gene does not reduce
PPO expression in the tuber epidermis, the part of the tuber that
is most directly exposed to pathogens attempting to infect.
[0258] Enzymatic browning induced by the PPO gene not only reduces
the quality of potato tubers; it also negatively affects crop foods
such as wheat, avocado, banana, lettuce, apple, and pears.
[0259] Other genes that are associated with negative traits and can
be silenced by using the leader or trailer sequences associated
with those genes include the potato R1 gene and L-type
phosphorylase genes. Both genes are involved in the degradation of
starch to reducing sugars, such as glucose and fructose, which upon
heating participate in the Maillard reaction to produce toxic
products such as acrylamide. The present invention demonstrates
that a reduction of cold-induced sweetening by lowering R1 or
phosphorylase activity leads to a reduction of both non-enzymatic
browning and acrylamide accumulation during the frying process of
potatoes.
[0260] The invention also demonstrates the utility of
overexpressing certain native genes in genetically modified crops.
Levels of Maillard-reaction products such as acrylamide were
reduced significantly by lowering the conversion of sucrose to
reducing sugars through overexpression of a newly isolated vacuolar
invertase inhibitor gene in potato.
[0261] The present invention also predicts that potato tubers
displaying either an increased level of invertase inhibitor
expression or a reduced level of R1 or phosphorylase expression
will not require the intensive treatment with chemical sprout
inhibitors such as CIPC prior to storage because their lowered
levels of reducing sugars will (1) delay sprouting, and (2) allow
storage at lower temperatures, thus further delaying sprouting. The
highly reduced CIPC-residue levels, or the absence thereof, further
enhances the nutritional value of processed foods derived from
plants containing certain modified P-DNAs described here.
[0262] Thus, French fries or chips derived from tubers that contain
the modified P-DNA will contain strongly reduced CIPC residue
levels, further boosting their nutritional value.
[0263] The effect of simultaneously downregulating the expression
of the PPO and either R1 or phosphorylase genes in potato tubers is
synergistic because reducing sugars are not only required for
non-enzymatic browning through the Maillard reaction but also for
browning mediated by the PPO enzyme. Decreased levels of reducing
sugars in transgenic potato tubers will, therefore, also limit PPO
activity and black spot bruise susceptibility. Thus, PPO, R1, and
phosphorylase genes, and/or the leader or trailer sequences that
are associated with these genes, represent DNA segments of interest
that can be isolated, modified and reintroduced back into the plant
to down-regulate the expression of these genes.
[0264] Apart from developing bruise resistance and reduced
cold-induced sweetening, there are many other traits that can be
introduced through Precise Breeding without using foreign DNA. For
instance, disease resistance genes can be isolated from wild potato
species and inserted into the genomes of disease susceptible
varieties.
[0265] The Environmental Benefits of Modified Plants and Crops
[0266] As described above, reduced levels of either R1 or
phosphorylase result in a reduced phosphorylation of starch. This
reduction in starch phosphorylation results in a 90% decrease in
phosphate content of potato tubers (Vikso-Nielsen,
Biomacromolecules, 2: 83643, 2001). This will result in a reduction
in phosphate levels in wastewaters from potato processing plants,
which are currently about 25-40 mg/L. Thus, the use of
low-phosphate tubers will reduce the release of phosphates into the
environment and help to protect important ecosystems. Furthermore,
low-phosphate potatoes may require less phosphate fertilization for
optimal growth and yield, which would support a more sustainable
agriculture by delaying the depletion of available phosphate
resources.
[0267] Enhancing the Agricultural Performance of Plants and Food
Crops
[0268] Apart from reduced bruise susceptibility and reduced
cold-sweetening, which are two important processing traits, the
present invention also provides salt tolerance, an increasingly
important input trait. Some of the modified P-DNA constructs
described in the present invention contain a salt tolerance gene as
native marker for transformation. Importantly, the utility of this
gene is not limited to a screening step in the transformation
procedure. Overexpression of the salt tolerance gene in potato
plants reduces stress symptoms induced by high salinity soil
levels, and will make it possible to grow new varieties containing
a modified P-DNA on a growing percentage of agricultural lands that
contain salinity levels exceeding the maximum 2 millimhos/cm
electrical conductivity levels that are optimal for growing
conventional varieties.
[0269] Using Regulatory Elements Isolated from a Selected Plant
Species or from a Species Sexually Compatible with the Selected
Plant Species
[0270] Once the leader, gene or trailer has been isolated from the
plant species of interest, and optionally modified, it can be
operably linked to a plant promoter or similar regulatory element
for appropriate expression in plants. Regulatory elements such as
these serve to express untranslated sequences associated with a
gene of interest in specific tissues or at certain levels or at
particular times.
[0271] Dependent on the strategy involved in modifying the trait,
it may be necessary to limit silencing to a particular region of
the plant. The promoter normally driving the expression of the
endogenous gene may not be suitable for tissue-specific expression.
As described in the section above, stable integration of bacterial
or viral regulatory components, such as the cauliflower mosaic
virus 35S "super" promoter, can result in unpredictable and
undesirable events. Thus, one aspect of the present invention uses
promoters that are isolated from the selected host plant
species.
[0272] In a preferred embodiment of the instant invention, for use
in S. tuberosum, the leader or trailer sequences associated with
R1, phosphorylase, and PPO genes are operably linked to the
granule-bound starch synthase gene promoter (Rohde et al., J Gen
& Breed, 44, 311-315, 1990). This promoter has been used
frequently by others to drive gene expression and is particularly
active in potato tubers (van der Steege et al., Plant Mol Biol, 20:
19-30, 1992; Beaujean et al., Biotechnol. Bioeng, 70: 9-16, 2000;
Oxenboll et al., Proc Natl Acad Sci USA, 9: 7639-44, 2000). This
promoter may also be used, in a preferred embodiment, for
expression of the modified leader or trailer sequences of R1,
phosphorylase, and PPO genes.
[0273] Alternatively, other potato promoters can be operably linked
to sequences of interest from potato. Such promoters include the
patatin gene promoter (Bevan et al., Nucleic Acids Res, 14:
4625-38, 1986), or a fragment thereof, that promotes expression in
potato tubers, the potato UDP-glucose pyrophosphorylase gene
promoter (U.S. Pat. No. 5,932,783) and the promoter of the
ubiquitin gene (Garbarino et al., Plant Physiol, 109: 1371-8,
1995).
[0274] The transcription of leaders and/or trailers can also be
regulated by using inducible promoters and regulatory regions that
are operably linked in a construct to a polynucleotide of interest.
Examples of inducible promoters include those that are sensitive to
temperature, such as heat or cold shock promoters. For instance,
the potato ci21A-, and C17-promoters are cold-inducible (Kirch et
al., Plant Mol. Biol, 33: 897-909, 1997; Schneider et al., Plant
Physiol, 113: 335-45, 1997).
[0275] Other inducible promoters may be used that are responsive to
certain substrates like antibiotics, other chemical substances, or
pH. For instance, abscisic acid and gibberellic acid are known to
affect the intracellular pH of plant cells and in so doing,
regulate the Rab 16A gene and the alpha-amylase 1/6-4 promoter
(Heimovaara-Dijkstra et al., Plant Mol Biol, 4 815-20, 1995).
Abscisic acid, wounding and methyl jasmonate are also known to
induce the potato pin2 promoter (Lorberth et al., Plant J, 2:
477-86, 1992).
[0276] In another example, some nucleotide sequences are under
temporal regulation and are activated to express a downstream
sequence only during a certain developmental stage of the plant or
during certain hours of the day. For instance, the potato promoter
of the small subunit of ribulose-1,5-bisphosphate carboxylase
(rbcS) gene can direct cell-specific, light-regulated expression
(Fritz et al., Proc Natl Acad Sci USA, 88: 4458-62, 1991). The
skilled artisan is well versed in these exemplary forms of
inducible promoters and regulatory sequences.
[0277] The use of certain polyadenylation signals may also be
useful in regulating expression, by varying the stability of the
MRNA transcript. In particular, some polyadenylation signals when
operably linked to the '3 end of a polynucleotide cause the mRNA
transcript to become accessible to degradation.
[0278] Thus, it is possible to regulate expression of a gene by
operably linking it with one or more of such promoters, regulatory
sequences, 3' polyadenylation signals, 3' untranslated regions,
signal peptides and the like. According to the instant invention,
DNA sequences and regulatory elements such as those described
herein, and which will ultimately be integrated into a plant
genome, are obtained from DNA of the selected plant species to be
modified by the Precise Breeding process of the present invention.
That is, DNA sequences and regulatory elements that are derived,
isolated and cloned from other species, such as from bacteria,
viruses, microorganisms, mammals, birds, reptiles and sexually
incompatible plant species are not integrated into the genome of
the transformed plant. DNA foreign to the selected plant species
genome may be used in the present invention to create a
transformation construct, so long as that foreign DNA is not
integrated into a plant genome.
[0279] Not only does the present invention provide a method for
transforming a plant species by integrating DNA obtained from the
selected plant species, or from a plant that is sexually-compatible
with the selected plant species, it also provides a means by which
the expression of that DNA can be regulated. Accordingly, it is
possible to optimize the expression of a certain sequence, either
by tissue-specific or some other strategy, as previously
described.
[0280] Using 3' Terminator Sequences Isolated from a Selected Plant
Species
[0281] In addition to regulatory elements that initiate
transcription, the native expression cassette also requires
elements that terminate transcription at the 3'-end from the
transcription initiation regulatory region. The transcription
termination region and the transcription initiation region may be
obtained from the same gene or from different genes. The
transcription termination region may be selected, particularly for
stability of the mRNA to enhance expression.
[0282] This particular element, the so-called "3'-untranslated
region" is important in transporting, stabilizing, localizing and
terminating the gene transcript. In this respect, it is well known
to those in the art, that the 3'-untranslated region can form
certain hairpin loop. Accordingly, the present invention envisions
the possibility of operably linking a 3' untranslated region to the
3' end of a cloned polynucleotide such that the resultant mRNA
transcript may be exposed to factors which act upon sequences and
structures conferred by the 3' untranslated region.
[0283] A 3' sequence of the ubiquitin gene can be subcloned from
the plant species from which the promoter and transgene were
isolated and inserted downstream from a transgene to ensure
appropriate termination of transcription. Both exemplary transgenes
can be fused to the terminator sequence of the potato Ubiquitin
gene (Ubi3) regardless of which promoter is used to drive their
expression.
EXAMPLES
Example 1
Cloning of P-DNAs
[0284] This example demonstrates that T-DNA borders are specific to
Agrobacterium. It also shows that plants contain T-DNA border-like
sequences, and it provides the sequence of DNA fragments isolated
from potato and wheat that are delineated by such border-like
sequences.
[0285] Conventional transformation systems use
Agrobacterium-derived T-DNAs as vehicles for the transfer of
foreign DNA from Agrobacterium to plant cells (Schilperoort et al.,
U.S. Pat. No. 4,940,838, 1990). Although T-DNAs usually comprise
several hundreds of basepairs, delineated by a left-border (LB) and
right-border (RB) repeat, they can also merely consist of such
borders. The T-DNA borders play an essential role in the DNA
transfer process because they function as specific recognition
sites for virD2-catalyzed nicking reaction. The released single
stranded DNA, complexed with Agrobacterial virD2 and virE2, is
transferred to plant cell nuclei where it often integrates
successfully into the plant genome. All T-DNA borders that have
been used for foreign DNA transfer are derived from nopaline and
octopine strains of Agrobacterium tumefaciens and A. rhizogenes
(Table 2). These borders and often some flanking Agrobacterium DNA
are present in thousands of binary vectors including, for example,
pPAM (AY027531), pJawoh1 (AF408413), pYL156 (AF406991), pINDEX
(AF294982), pC1300 (AF294978), pBI121 (AF485783), pLH9000
(AF458478), pAC161 (AJ315956), BinHygTOp (Z37515), pHELLSGATE
(AJ311874), pBAR-35S (AJ251014), pGreen (AJ007829), pBIN19
(X77672), pCAMBIA (AF354046), pX6-GFP (AF330636), pER8 (AF309825),
pBI101 (U12639), pSKI074 (AF218466), pAJ1 (AC138659), pAC161
(AJ315956), pSLJ8313 (Y18556), and pGV4939 (AY147202). Recently,
two homologs of T-DNA borders were identified in the
chrysopine-type Ti plasmid pTiChry5 (Palanichelvam et al., Mol
Plant Microbe Interact 13: 1081-91, 2000). The left border homolog
is identical to an inactive border homolog located in the middle of
the T-DNA of pTi15955. The right border homolog is unusually
divergent from the sequence of functional T-DNA borders. It is
therefore unlikely that these homologs are functionally active in
supporting DNA transfer from pTiChry5 to plant cells.
[0286] Development of a new method that makes it possible to
transform plants with only native DNA requires, in the first place,
a replacement of the T-DNA including LB and RB. Unfortunately,
advanced BLAST searches of public databases including those
maintained by The National Center For Biotechnology Information,
The Institute for Genomic Research, and SANGER failed to identify
any border sequences in plants. It was therefore necessary to
consider plant DNA sequences that are similar but not identical to
T-DNA borders, designated here as "border-like" (border-like).
Examples of plant border-like sequences that were identified in
public databases are shown in Table 2. The challenge in trying to
replace T-DNA borders with border-like sequences is that border
sequences are highly conserved (see Table 2). A large part of these
sequences is also highly conserved in the nick regions of other
bacterial DNA transfer systems such as that of IncP, PC194, and
.phi.X174, indicating that these sequences are essential for
conjugative-like DNA transfer (Waters et al., Proc Natl Acad Sci
88:1456-60, 1991). Because there are no reliable data on border
sequence requirements, the entire border seems therefore important
in the nicking process. A single study that attempted to address
this issue by testing the efficacy of border mutants in supporting
DNA transfer is unreliable because negative controls did not appear
to function appropriately (van Haaren et al., Plant Mol Biol 13:
523-531, 1989). Furthermore, none of the results of this study were
confirmed molecularly. Despite these concerns, two possibly
effective border mutants are shown in Table 2 as well.
[0287] Based on the homology among border sequences, a T-DNA border
motif was identified (Table 2). Although this motif comprises
13,824 variants, many of which may not function--or may be
inadequate--in transferring DNA, it represents the broadest
possible definition of what a T-DNA border sequence is or may be.
This border motif was then used to search publicly available DNA
databases for homologs using the "Motif Alignment and Search Tool"
(Bailey and Gribskov, Bioinformatics 14: 48-54, 1998) and "advanced
BLASTN" ("penalty for nucleotide mismatch"=-1; "expect"=10.sup.5;
Altschul et al., Nucleic Acids Res 25: 3389-3402, 1997). Again,
these searches did not identify any identical matches in organisms
other than Agrobacterium.
[0288] To try and increase the chance of isolating a potato DNA
fragment containing border-like sequences that correspond to the
border motif, DNA was isolated from 100 genetically diverse
accessions (the so-called "core collection," provided by the US
Potato Genebank, WI). This DNA was pooled and used as template for
polymerase chain reactions using a variety of oligonucleotides
designed to anneal to borders or border-like sequences. Amplified
fragments were sequence analyzed, and the sequence was then
confirmed using inverse PCR with nested primers. One of the potato
DNA fragments that was of particular interest contains a novel
sequence without any major open reading frames that is delineated
by border-like sequences (Table 2). One of the border-like
sequences of this fragment contains at least 5 mismatches with
T-DNA borders; the other border-like sequence contains at least 2
mismatches. Although both sequences contain one mismatch with the
border motif, they were tested for their ability to support DNA
transfer. For that purpose, the fragment was first reduced in size
to 0.4-kilo basepairs by carrying out an internal deletion (SEQ ID
NO.: 1). The resulting fragment was designated "P-DNA" (plant DNA)
to distinguish it from the Agrobacterium-derived T-DNA. A similar
fragment was isolated from the genome of the potato variety Russet
Ranger, but has not been used for any further experiments.
[0289] Based on the divergence between P-DNA and T-DNA borders, the
elongase amplification system (Life Technologies) was used with the
following degenerate primers to isolate a P-DNA from wheat:
5'-GTTTACANHNBNATATATCCTGYCA -3' (Bor-F) (SEQ ID NO. 56), and
5'-TGRCAGGATATATNVNDNTGTAAAC -3' (Bor-R) (SEQ ID NO. 57). The
resulting 825-bp fragment is shown in SEQ ID NO.: 2, and was used
to replace the T-DNA of a conventional binary vector. The efficacy
of this construct can be tested by inserting an expression cassette
for the GUS gene between P-DNA termini, and infecting wheat with an
Agrobacterium strain carrying the resulting vector.
Example 2
Tobacco Transformation with P-DNA Vectors
[0290] This Example demonstrates that, despite structural (sequence
divergence) and functional (transformation frequencies) differences
between P-DNA termini and T-DNA borders, a P-DNA can be used in a
similar way as a T-DNA to transfer DNA from Agrobacterium to
tobacco cells.
[0291] A T-DNA-free vector that can be maintained in both E. coli
and A. tumefaciens was obtained by removing the entire T-DNA region
of the conventional binary vector pCAMBIA1301 (Cambia, AU). This
was accomplished by simultaneously ligating a 5.9 kb SacII--SphI
fragment of pSIM1301 with 2 fragments amplified from pCAMBIA1301
using the oligonucleotides pairs: 5'-CCGCGGTGATCACAGGCAGCAAC-3'
(SEQ ID NO. 58) and 5'-AAGCTTCCAGCCAGCCAACAGCTCCCCGAC-3' (SEQ ID
NO. 59), and 5'- AAGCTTGGCTACTAGTGCGAGATCTCTAAGAGAAAAGAGCGTTTA-3'
(SEQ ID NO. 60), and
5'-GCATGCTCGAGATAGGTGACCACATACAAATGGACGAACGG-3' (SEQ ID NO. 61),
respectively.
[0292] To make it possible to screen against backbone integration
events, an expression cassette comprising the Agrobacterium
isopentenyl transferase (IPT) gene driven by the Ubi3 promoter and
followed by the Ubi3 terminator (SEQ ID NO.: 3) was inserted as 2.6
kbp SacII fragment into the backbone of the T-DNA-free vector
described above, yielding pSIM100-OD-IPT. Transformed plant cells
expressing the IPT gene are expected to accumulate cytokinins and
grow into abnormal shoots that cannot develop roots.
[0293] The 0.4 kb P-DNA fragment described in Example 1 was
inserted into pSIM100-OD-IPT to generate pSIM 111 (FIG. 1; SEQ ID
NO.: 4).
[0294] To test whether pSIM111 can be used to obtain transformed
plants carrying P-DNAs (including any sequences located between
P-DNA termini) without the additional vector backbone, a neomycin
phosphotransferase (NPTII) gene expression cassette was inserted
into the P-DNA of pSIM111 to create pSIM108 (FIG. 1).
[0295] The efficacy of P-DNA termini in supporting DNA transfer was
tested by comparing transformation frequencies between pSIM108 and
a control vector that contained a modified P-DNA with conventional
T-DNA borders. This control vector, designated pSIM109, was
generated by amplification of the entire P-DNA containing the NPTII
gene expression cassette with the oligonucleotide pairs:
5'-ACTAGTGTTTACCCGCCAATATATCCTGTCAGAG-3' (SEQ ID NO. 62), and
5'-AAGCTTTGGCAGGATATATTGTGGTGTAAACGAAG-3' (SEQ ID NO. 63). A second
control vector that was used for these experiments is the
conventional binary vector pBI121 (Genbank accession number
AF485783), which contains the same NPTII expression cassette
inserted on a regular T-DNA. The binary vectors were introduced
into Agrobacterium tumefaciens LBA4404 cells as follows. Competent
LB4404 cells (50 uL) were incubated for 5 minutes at 37.degree. C.
in the presence of 1 .mu.g of vector DNA, frozen for about 15
seconds in liquid nitrogen (about -196.degree. C.), and incubated
again at 37.degree. C. for 5 minutes. After adding 1 mL of liquid
broth (LB), the treated cells were grown for 3 hours at 28.degree.
C. and plated on LB/agar containing streptomycin (100 mg/L) and
kanamycin (100 mg/L). The vector DNAs were then isolated from
overnight cultures of individual LBA4404 colonies and examined by
restriction analysis to confirm the presence of intact plasmid
DNA.
[0296] Test transformations of the model plant tobacco were carried
out by growing a 10-fold dilution of overnight-grown
LBA4404::pSIM108 cells for 5-6 hours, precipitating the cells for
15 minutes at 2,800 RPM, washing them with MS liquid medium
(Phytotechnology) supplemented with sucrose (3%, pH 5.7) and
resuspending the cells in the same medium to an OD.sub.600nm of
0.2. The suspension was then used to infect leaf explants of
4-week-old in vitro grown Nicotiana tabacum plants. Infected
tobacco explants were incubated for 2 days on co-culture medium
(1/10 MS salts, 3% sucrose, pH 5.7) containing 6 g/L agar at
25.degree. C. in a Percival growth chamber (16 hrs light) and
subsequently transferred to M401/agar medium containing timentine
(150 mg/L) and kanamycin (100 mg/L). The number of calli per
explant that developed within the next 4 weeks is shown in Table 3.
Our data demonstrate that P-DNAs delineated by either native
termini or conventional T-DNA borders are about 50% more effective
in transforming tobacco than T-DNAs. The increased efficiency of
P-DNA transfer may be due to either its different CG content or
other unknown structural features of the P-DNA.
Example 3
Potato Transformation with P-DNA Vectors
[0297] This Example demonstrates that a P-DNA can be used in a
similar way as a T-DNA to transfer DNA from Agrobacterium to potato
cells.
[0298] Potato transformations were carried out by infecting stem
explants of 4-week-old in vitro grown Russet Ranger plantlets with
Agrobacterium strains according to the following procedure.
Ten-fold dilutions of overnight-grown cultures were grown for 5-6
hours, precipitated for 15 minutes at 2,800 RPM, washed with MS
liquid medium (Phytotechnology) supplemented with sucrose (3%, pH
5.7), and resuspended in the same medium to an OD.sub.600nm of 0.2.
The resuspended cells were then used to infect 0.4-0.6 mm
internodal potato segments. Infected stems were incubated for 2
days on co-culture medium (1/10 MS salts, 3% sucrose, pH 5.7)
containing 6 g/L agar at 22.degree. C. in a Percival growth chamber
(16 hrs light) and subsequently transferred to callus induction
medium (CIM, MS medium supplemented with 3% sucrose 3, 2.5 mg/L of
zeatin riboside, 0.1 mg/L of naphthalene acetic acid, and 6 g/L of
agar) containing timentine (150 mg/L) and kanamycin (100 mg/L).
After 1 month of culture on CIM, explants were transferred to shoot
induction medium (SIM, MS medium supplemented with 3% sucrose, 2.5
mg/L of zeatin riboside, 0.3 mg/L of giberelic acid GA3, and 6 g/L
of agar) containing timentine and kanamycin (150 and 100 mg/L
respectively). After 3-4 weeks, the number of explants developing
transgenic calli and/or shooting was counted. As shown in tobaco,
the number of stem explants infected with pSIM108 that showed calli
was higher than those in control experiments with the conventional
binary vector pBI121 (Table 3). Shoots that subsequently arose from
these calli could be grouped into two different classes. The first
class of shoots was phenotypically indistinguishable from control
shoots transformed with LBA::pBI121. The second class of shoots
displayed an EPT phenotype. Shoots of the latter class were stunted
in growth, contained only very small leaves, displayed a
light-green to yellow color, and were unable to root upon transfer
to hormone-free media. To confirm that shoots with an IPT phenotype
contained the IPT gene stably integrated in their genomes, all
shoots were transferred to Magenta boxes containing MS medium
supplemented with 3% sucrose and timentine 150 mg/L, allowed to
grow for 3 to 4 additional weeks, and used to isolate DNA. This
plant DNA served as template in PCR reactions with an
oligonucleotide pair designed to anneal to the IPT gene: 5'-GTC CAA
CTT GCA CAG GAA AGA C-3', and 5'-CAT GGA TGA AAT ACT CCT GAG C-3'.
As shown in Table 4, the PCR experiment confirmed a strict
correlation between IPT phenotype and presence of the IPT gene. The
presence of backbone DNA was also examined in plants obtained from
a transformation with pBI121. This was done by performing PCR
reactions on DNA isolated from the transformation events with the
`pB121 backbone primers`: 5'-CGGTGTAAGTGAACTGCAGTTGCCATG-3' (SEQ ID
NO. 64), and 5'-CATCGGCCTCACTCATGAGCAGATTG-3' (SEQ ID NO. 65).
Amplification of a 0.7 kbp band is indicative for backbone
integration. By comparing the data presented in Table 4, it can be
concluded that backbone integration frequencies are similar for
P-DNA vectors and T-DNA vectors.
[0299] A second PCR experiment was carried out to test whether
IPT-free plants did not contain any other backbone sequences.
Because the IPT expression cassette is positioned close to the left
border-like sequences, the oligonucleotide pair for this experiment
was designed to anneal to backbone sequences close to the right
border-like sequence: 5'-CACGCTAAGTGCCGGCCGTCCGAG-3' (SEQ IDNO.
66), and 5'-TCCTAATCGACGGCGCACCGGCTG-3' (SEQ ID NO. 67). Data from
this experiment confirm that plants that are positive for the IPT
gene are also positive for this other part of the backbone.
[0300] Similar experiments were carried out with the potato variety
Russet Burbank. Based on an assessment of IPT phenotypes, the
backbone integration frequencies for pSIM108 and pSIM109 were shown
to be comparable to -those in Russet Ranger (see Tables 4 and
5).
Example 4
Potato Invertase Inhibitor Gene
[0301] Using conventional transformation methods, this Example
demonstrates that overexpressing a novel potato invertase inhibitor
gene enhances the processing and health characteristics of potato
tubers.
[0302] The following primers were designed to amplify a new potato
homolog of the tobacco vacuolar invertase inhibitor Nt-inhh1
(Greiner et al., Nature Biotechnology, 17, 708-711, 1999):
5'-AAAGTTGAATTCAAATGAGAAATTTATT- C-3' (SEQ ID NO. 68), and
5'-TTTTAAGCTTTCATAATAACATTCTAAT-3' (SEQ ID NO. 69). The
amplification reaction was performed by mixing the following
components: 4 .mu.l plant DNA, 2 .mu.l forward primer (10 pM/ml), 2
.mu.l reverse primer, 25 .mu.l Hot Start Master Mix (Qiagen Catalog
Nr. 203443), and 17 .mu.l water. This reaction mix was subjected to
the following polymerase chain reaction (PCR) conditions using a
PTC-100 thermocycler (MJ Research): (1) 5 minutes at 95.degree. C.
(1 cycle), (2) 1 minute at 94.degree. C., 1 minute at 45.degree. C.
and 4 minutes at 72.degree. C. (35 cycles), and (3) 10 minutes at
72OC (1 cycle). The total product was loaded on a 0.8% agarose gel,
and a 540 base pair band was purified from gel using QIAquick Gel
Extraction Kit (Qiagen, Calif.). This purified fragment was then
ligated into pGEM-T Easy (Promega, Wis.) and transformed into E.
coli DH5-alpha using Max Efficiency Competent Cells (GibcoBRL, MD).
Sequence analysis of recombinant plasmid DNA isolated from
transformed DH5-alpha revealed the presence of a single open
reading frame consisting of 543 base pairs that encodes for a
putative 181-amino acid protein (SEQ ID NO.: 5); clustal-aligment
revealed 70% homology to Nt-inhh (FIG. 2). This high level of
homology extends to the 15-amino acid N-terminal domain, indicating
that the potato homolog is targeted to the vacuole. Interestingly,
the potato invertase inhibitor homolog, designated St-inh1, shares
only 43% homology with the patented tobacco cell wall invertase
inhibitor designated Nt-inh1 (Patent WO98/04722; FIG. 2).
[0303] Although the St-inh1 gene is present in unmodified potato
tubers, its expression level is inadequate for full inhibition of
invertase and reduced cold-induced sweetening. To increase the
storage characteristics of potato, the St-inh1 gene was fused to a
new tuber-enhanced promoter of the granule-bound starch synthase
(GBSS) gene, which is known to promote high levels of gene
expression in tubers. The GBSS promoter was isolated from the
potato cultivar Russet Ranger by carrying out a PCR reaction using
the forward primer 5'-GAACCATGCATCTCAATC-3' (SEQ ID NO. 70) and the
reverse primer 5'-GTCAGGATCCCTACCAAGCTACAGATGAAC-3' (SEQ ID NO.
71). Sequence analysis of the amplified product cloned in pGEM-T
demonstrated that this new promoter contains 658 basepairs (SEQ ID
NO.: 6). The resulting promoter/gene fusion was then ligated to the
3' regulatory sequence of the potato ubiquitin gene (UbiT; SEQ ID
NO.: 7), thus ensuring appropriate termination of transcription of
the invertase inhibitor gene.
[0304] This expression cassette was inserted between T-DNA borders
of a binary vector, and the resulting vector pSIM320 was used to
transform Russet Ranger as described above. Three cuttings of nine
independent transgenic lines were planted in soil and grown for
four weeks in a growth chamber (11 hrs light; 20.degree. C.). At
least 3 minitubers were then harvested from each line and
transferred to a refrigerator set at 4.degree. C. to induce
cold-sweetening. After 4 weeks, the glucose levels in these
cold-stored minitubers were determined by using either an Accu-Chek
meter and test strips (Roche Diagnostics, IN) or a glucose
oxidase/peroxidase reagent (Megazyme, Ireland). These levels were
compared with the average glucose levels in both 6 untransformed
lines and 6 "vector control" lines transformed with a
pSIM110-derived vector lacking the invertase inhibitor gene. As
shown in Table 6, three transgenic lines accumulated less than 40%
of the glucose in "vector control" lines demonstrating that the
potato invertase inhibitor homolog is functionally active.
[0305] The following experiment showed that the amount of reducing
sugars present in tubers correlates with acrylamide production
during tuber processing. Russet Ranger potato tubers were freshly
harvested from the field and stored at 4.degree. C. to induce
cold-sweetening; control tubers were stored at 18.degree. C. After
4 weeks, glucose levels were determined in both groups of tubers.
Subsequently, tubers were washed, blanched for either 8 minutes or
12 minutes at 165.degree. F., cut into 0.290.times.0.290 shoestring
strips, dipped in a 1% sodium acid pyrophosphate solution at
160.degree. F., dried at 160.degree. F. until 14.+-.2% dryer weight
loss is achieved, fried at 390.degree. F. for 40 seconds to attain
64.+-.2% first fry moisture, and frozen for 20 minutes at
-15.degree. F., shaking the tray 2-3 times in the first 6 minutes.
The resulting French fries were then analyzed for acrylamide levels
by Covance laboratory (WI). As shown in Table 7, the glucose levels
in tubers stored at 18.degree. C. were below the detection level of
0.1 mg/g whereas cold-stored tubers contained on average 3.4 mg/g
glucose. This table also shows that fries produced from the latter
potatoes contain about 10-fold higher levels of acrylamide than
fries produced from potatoes stored at 18.degree. C. Even by using
a shorter blanch time for 18.degree. C.-stored potatoes than for
4.degree. C.-stored potatoes to produce fries with a similar color
(color ids of 78 and 71, respectively), a 5-fold difference in
acrylamide accumulation was obtained (Table 7). Thus, there appears
to be a straight correlation between the amount of reducing sugars
such as glucose in tubers and the accumulation of acrylamide in
fries derived from these tubers.
[0306] To determine whether the reduced glucose levels in pSIM320
lines would limit the processing-induced accumulation of
acrylamide, cold-stored pSIM320 minitubers were processed by
cutting into wedges, blanching for 8 minutes, dipping in 0.5% SAPP
for 30 seconds, drying for 4.5 minutes at 160.degree. F., frying
for 40 seconds at 380.degree. F., freezing for 15 minutes at
-15.degree. F., and finally drying for 3 minutes and 10 seconds at
160.degree. F. The processed material was then shipped to Covance
laboratory for acrylamide determinations. As shown in Table 6,
French fries obtained from minitubers with the lowest amounts of
glucose accumulated the lowest levels of acrylamide. A 40%
reduction in glucose levels in lines "320-2" and "320-4" is
associated with a 5-fold reduction in acrylamide levels.
Example 5
Leader and Trailer Sequences Associated with the Potato R1 Gene
[0307] Using conventional transformation methods, this Example
demonstrates that a novel leader sequence associated with the
potato R1 gene can be used effectively to enhance the processing
and health characteristics of potato tubers. It also predicts that
a novel trailer associated with that same gene can be exploited in
the same way.
[0308] As an alternative to overexpressing the invertase inhibitor
gene, methods were developed to limit acrylamide production without
using any actual gene sequences. One such method is based on
silencing the tuber-expressed R1 gene. Previously, it was shown
that this starch-related gene can be silenced through antisense
expression of a 1.9-kb gene fragment derived from that gene
(Kossmann et al., U.S. Pat. No. 6,207,880). However, the antisense
expression of large DNA fragments is undesirable because such
fragments contain new open reading frames (Table 1). As a safer
approach to the one described above, a small leader sequence
associated with the R1 gene was isolated from potato. This leader
was obtained by performing a rapid amplification of cDNA ends with
the 5' RACE kit supplied by GIBCO BRL on total RNA from the tubers
of Russet Ranger potato plants. Sequence analysis demonstrated that
the R1-associated leader consists of 179 basepairs (SEQ ID NO.: 8).
Both a sense and antisense copy of this leader sequence, separated
by the potato Ubiquitin intron (SEQ ID NO.: 9), were placed between
the GBSS promoter and UbiT. The resulting expression cassette for
the leader sequence associated with R1 is shown in FIG. 3 (SEQ ID
NO.: 10). A similar cassette containing a spacer derived from the
GBSS promoter (SEQ ID NO.: 11)-instead of the Ubi intron-separating
the sense and antisense copies of the R1 trailer is shown in (FIG.
3; SEQ ID NOs.: 12). Additional variants with a longer version of
the GBSS promoter (SEQ ID NO.: 13) are shown in FIG. 3 (SEQ ID
NOs.: 14-15).
[0309] To test the efficacy of the R1-associated leader in limiting
acrylamide production, the expression cassette shown in FIG. 3 was
inserted as KpnI--XbaI fragment between T-DNA borders of a binary
vector. An Agrobacterium LBA4404 strain carrying the resulting
vector pSIM332 was used to transform Russet Ranger potato. To
induce tuber formation, 25 shoots representing independent
transformation events were transferred to soil and placed in a
growth chamber (11 hours light, 25.degree. C.). After three weeks,
at least 3 minitubers/line were stored for 4 weeks at 4.degree. C.
to induce starch mobilization. The glucose levels in these
cold-stored minitubers were subsequently determined as described in
Example 4, and compared with the average glucose levels in
untransformed plants and vector controls. As shown in Table 8,
minitubers derived from all 25 lines displayed reduced levels of
glucose after cold-storage. An approximate 2-fold reduction in
acrylamide levels in expected in French fries derived from
minitubers displaying reduced R1 expression levels compared to
controls. Much stronger effects of down-regulating R1 gene
expression are anticipated in mature tubers.
[0310] As an alternative to the leader-based approach, expression
cassettes that contained both a sense and antisense copy of the
trailer sequence associated with R1 were generated. This trailer
was obtained by performing a reverse transcription polymerase chain
reaction (RT-PCR) on total RNA isolated from microtubers of the
potato cultivar Russet Ranger. Complementary DNA was generated
using the Omniscript RT Kit (Qiagen, Calif.) and then used as a
template for a PCR reaction with Hot start DNA polymerase (Qiagen,
Calif.) with the gene-specific reverse primer R1-1
(5'-GTTCAGACAAGACCACAGATGTGA-3'). Sequence analysis of the
amplified DNA fragment, cloned in pGEM-T demonstrated that the
trailer associated with R1 consists of 333 basepairs (SEQ ID NO.:
16). The sense and antisense copies of the trailer were separated
by either the Ubi intron or the GBSS spacer- and sandwiched between
GBSS promoter and Ubi3 terminator (FIG. 3; SEQ ID NOs.: 17-18).
Similar versions with the larger GBSS promoter are shown in FIG. 3
(SEQ ID NOs.: 19-20).
[0311] Glucose and acrylamide levels can be determined as described
above. Tubers displaying about 50% or greater reductions in glucose
concentrations are expected to also accumulate about 50% less
acrylamide during the frying process. The improved health and
storage characteristics of modified, plants can be confirmed in
mature field-grown tubers.
[0312] Phosphate levels in potato tubers can be determined by using
AOAC Method 995.11 Phosphorus (Total) in Foods (45.1.33 Official
Methods of Analysis of AOAC International, 17th Edition). Samples
are prepared by dry ashing in a muffle furnace followed with an
acid digestion. The dissolved samples are then neutralized and
treated with a molybdate-ascorbic acid solution and compared to a
series of phosphorus standards (treated similarly). A dual beam
spectrophotometer would be used for the calorimetric analysis at
823 nanometers. A significant decrease in phosphate content, which
is beneficial for the environment, is expected.
Example 6
Leader Sequence Associated with the L-Alpha Glucan Phosphorylase
Gene
[0313] Using conventional transformation methods, this Example
demonstrates that a novel leader sequence associated with the
potato L-alpha glucan phosphorylase gene can be used to effectively
enhance the processing and health characteristics of potato
tubers.
[0314] Previously, it was shown that cold-induced sweetening can be
reduced through antisense expression of 0.9-kb fragments derived
from alpha glucan phosphorylase genes (Kawchuk et al., U.S. Pat.
No. 5,998,701, 1999). However, the antisense expression of these
relatively large DNA fragments is undesirable because they contain
new and uncharacterized open reading frames that may impact the
nutritional quality of foods if expressed in transgenic plants
(Table 1).
[0315] As a safer approach to the one described above, small leader
and trailer sequences that are associated with a L-type glucan
phosphorylase gene were isolated from RNA of mature tubers. The
primer pair used for this purpose is:
5'-GGATCCGAGTGTGGGTAAGTAATTAAG-3' (SEQ ID NO. 72), and
5'-GAATTCTGTGCTCTCTATGCAAATCTAGC -3' (SEQ ID NO. 73). The resultant
leader sequence of 273 bp was amplified and is shown in SEQ ID NO.:
21. Similarly, the "direct" primer, 5'-GGAACATTGAAGCTGTGG-3' (SEQ
ID NO. 74), was used -with an oligo-dT primer to amplify a 158 bp
"trailer sequence" that is associated with the L-type phosphorylase
gene (SEQ ID NO.: 22).
[0316] Expression cassettes were then designed using these trailer
or leader sequences to modify the expression of L-type
phosphorylase gene and, in so doing, lowering acrylamide levels in
fried products by limiting starch mobilization. These cassettes
were constructed in a similar way as described in Example 5, and
are depicted in FIG. 3 (SEQ ID Nos.: 23-26). An Agrobacterium
strain containing a binary vector with this expression cassette,
designated pSIM216, was used to infect potato stems, and generate
25 transgenic plants. Minitubers derived from these plants were
stored for 4 weeks at 4.degree. C. to induce cold-sweetening. The
cold-stored minitubers were then analyzed for glucose levels. As
shown in Table 9, minitubers from all transgenic lines displayed
reduced glucose levels.
[0317] Four lines that displayed at least 50% reduced glucose
concentrations (lines 216-2, 216-5,216-10, and 216-21) were used to
assess processing-induced acrylamide levels. Although acrylamide
levels in fried tubers derived from the first three lines were
similar to those of controls, French fries that were derived from
line 216-21 accumulated only 45% of the wild-type acrylamide levels
(136 vs. 305 parts per billion). These results confirm the
experiments described in Example 4 for tubers overexpressing the
potato invertase inhibitor gene, in that relatively large
reductions in glucose (and fructose) concentrations are needed to
limit the heating-induced acrylamide accumulation in cold-stored
minitubers. Because silencing of the phosphorylase gene is expected
to be more effective in mature "216" tubers, reductions in
acrylamide levels are also anticipated to be more pronounced in the
French fries produced from such tubers. The improved health and
storage characteristics of modified plants can be confirmed in
mature tubers.
Example 7
Modified Polyphenol Oxidase Gene
[0318] Using conventional transformation methods, this Example
demonstrates that a modified polyphenol oxidase gene lacking a
functional copper-binding site can be used effectively to reduce
bruise susceptibility in tubers.
[0319] Previously, it was shown that black spot bruise
susceptibility can be reduced through antisense expression of the
1.8-kb PPO gene (Steffens, U.S. Pat. No. 6,160,204, 2000). However,
expression of the reverse complement of this large gene is
undesirable because it contains new and uncharacterized open
reading frames encoding peptides consisting of more than 100 amino
acids, which may potentially impact the nutritional quality of
foods (Table 1). As a safer approach to the one described above,
the PPO gene was modified to encode a non-functional protein.
[0320] The wild-type potato PPO gene was isolated from Russet
Ranger by using a polymerase chain reaction (PCR) method. First,
genomic DNA was isolated from sprouts of Russet Ranger. The potato
PPO gene was then amplified from the potato genomic DNA using DNA
polymerase and oligonucleotide primers: 5':
CGAATTCATGGCAAGCTTGTGCAATAG-3' (PPO-F) (SEQ ID NO. 75), and
5'-CGAATTCTTAACAATCTGCAAGACTGATCG-3' (PPO-R) (SEQ ID NO. 76). These
were designed to complement the 5'- and 3'-ends of the potato PPO
gene. The amplified 1.6 kb fragment was cloned into a pGEM-T EASY
vector (Promega) and confirmed to represent a functional PPO gene
by sequence analysis (SEQ ID NO.: 27).
[0321] The copper binding domain in potato PPO was identified by
aligning this protein with a sweet potato PPO protein that was
shown to contain conserved Cysteine (Cys) residue at position 92,
Glutamine residue (Glu) at position 236, and Histidine (His)
residues at positions 88, 109, 118, 240, 244 and 274 coordinating
the two active site coppers (Klabunde et al., Nature Structural
Biol., 5: 1084-1090, 1998). These Cys, Glu, and His residues are
also present in potato PPO.
[0322] The inactive PPO gene was created by using a PCR mutation
replacement approach. Three fragments were amplified by Proof Start
Taq DNA Polymerase (Qiagen) using 3 pairs of primers and wild-type
Russet Ranger PPO as a template. The sequences of the first pair,
designated P1-F and P2-R, respectively, are:
5'-GAGAGATCTTGATAAGACACAACC -3' (SEQ ID NO. 77), and
5'-CATTACC.sup.1ATAAGCC.sup.2CAC.sup.3TGTATATTAGCTTGTTGC-3' (SEQ ID
NO. 78) (1: "A" to "C" mutation, resulting in Cysteine to Glycine
substitution at position 186; 2: "A" to "C" mutation, resulting in
Cysteine to Tryptophan substitution at position 183; 3: "A" to "C"
mutation, resulting in Histine to Glutamine substitution at
position 182). The sequences of the second pair, designated P3-F
and P4-R, respectively, are 5'-GTGCTTATAGAATTGGTGGC-3' (SEQ ID NO.
79), and 5'-TAGTTCCCGGGAGTTCAGTG-3' (SEQ ID NO. 80). The sequences
of the third pair, designated P5-F and P6-R, respectively, are
5'-CTCCCGGGAACTATAGG.su-
p.4AAACATTCCTCT.sup.5CGGTCCTGTCCACATCTGGTC-3' (SEQ ID NO. 81) and
5'-GTGTGATATCTGTTCTTTTCC-3' (SEQ ID NO. 82) (4: "A" to "G"
mutation, resulting in Glutamine to Glycine substitution at
position 326; 5: "A" to "T" mutation, resulting in Histine to
Leucine substitution at position 330).
[0323] An 80 bp fragment was amplified using primer P1-F and P2-R
and digested with BglII. This fragment contains one sticky end
(BglII) and one blunt end, and carries three mutations in copper
binding site I. A 0.4 kb fragment amplified using primer P3-F and
P4-R and digested with XmaI contains one blunt end and one sticky
end (XmaI). A 0.2 Kb fragment was amplified using primer P5-F and
P6-R and digested with XmaI and EcoRV. This third fragment with a
sticky end (XmaI) and a blunt end EcoRV) has two mutations in
copper binding site II. The BglII and EcoRV fragment from cloned
wild-type potato PPO was then replaced with the above three ligated
PCR amplified fragments. The presence of a total of 5 point
mutations in the modified PPO gene was confirmed by sequence
analysis (SEQ ID NO.: 28). To create an expression cassette for
modified PPO (mPPO), the following four fragments were
simultaneously ligated together: (1) a BamHI-HindIII fragment
containing the GBSS promoter, (2) a HindIII-SacI fragment
containing mutant PPO, (3) a SacI-KpnI fragment containing the
Ubi-3 terminator, and (4) plasmid pBluescript, digested with KpnI
and BamHI. This expression cassette was then inserted between
borders of a binary vector to create pSIM314.
[0324] The efficacy of the mPPO gene expression cassette was
assessed by transforming Russet Ranger stem explants with pSIM314.
Nodal cuttings of transgenic plants containing this expression
cassette were placed on MS medium supplemented with 7% sucrose.
After a 5-week incubation period in the dark at 18.degree. C.,
microtubers were isolated and assayed for PPO activity. For this
purpose, 1 g of potato tubers was pulverized in liquid nitrogen.
This powder was then added to 5 ml of 50 mM MOPS (3-(N-morpholino)
propane-sulfonic acid) buffer (pH 6.5) containing 50 mM catechol,
and incubated at room temperature with rotation for about 1 hour.
The solid fraction was then precipitated, and the supernatant
transferred to another tube to determine PPO activity by measuring
the change of OD-410 over time. As shown in Table 10, rmicrotubers
isolated from some of the transgenic lines displayed a
significantly reduced polyphenol oxidase activity compared to
either untransformed controls or controls transformed with a
construct not containing the mutant PPO gene. The strongest
reduction in PPO activity was observed in lines "314-9", "314-17",
and "314-29". To test whether expression of the mutant PPO gene
also reduced PPO activity in minitubers, rooted plantlets of
transgenic lines were planted in soil and incubated in a growth
chamber for 4 weeks. A PPO assay on isolated minitubers
demonstrated that reduced PPO activity in microtubers correlated in
most cases with reduced activities in minitubers (Table 10).
Transgenic lines displaying a reduced PPO activity can be
propagated and tested both in the greenhouse and the field to
confirm the "low bruise" phenotype in mature tubers. Because micro-
and minitubers express a variety of polyphenol oxidases, some of
which share only limited sequence homology with the targeted
polyphenol oxidase that is predominantly expressed in mature
tubers, an even more profound reduction of PPO activity may be
anticipated in the mature tubers of lines such as "314-9" and
"314-17". The data indicate that overexpression of a functionally
inactive PPO gene can result in reduced bruise susceptibility. The
improved health and storage characteristics of modified plants can
also be confirmed in mature field-grown tubers.
Example 8
Trailer Sequence of a Polyphenol Oxidase Gene that is Specific for
the Non-Epidermal Tissues of Potato Tubers
[0325] Using conventional transformation methods, this Example
demonstrates that a novel trailer sequence associated with the
potato PPO gene can be used effectively to reduce bruise
susceptibility in tubers.
[0326] Reverse transcription PCR was used to also isolate the
trailer sequence associated with the PPO gene expressed in potato
tubers. The primers for the first PCR reaction were PPO-1
(5'-GAATGAGCTTGACAAGGCGGAG-- 3', (SEQ ID NO. 83)) and oligo-dT;
primers for a second nested PCR reaction were PPO-2
(5'-CTGGCGATAACGGAACTGTTG-3', (SEQ ID NO. 84)) and oligo-dT.
Sequence analysis of the amplified DNA fragments cloned into pGEM-T
revealed the presence of a 154-bp trailer (SEQ ID NO.: 29). A sense
and antisense copy of this trailer, separated by the Ubi intron,
was then fused to the GBSS promoter and Ubi3 terminator as
described above to generate an expression cassette shown in FIG. 3
(SEQ ID NO.: 30). An alternative construct containing the trailer
segments separated by a GBSS spacer is shown in FIG. 3 (SEQ ID NO.:
31). Similar versions with the larger GBSS promoter are shown in
FIG. 3 (SEQ ID NOs.: 32-33). Interestingly, the trailer of the PPO
gene that is predominantly expressed in mature tubers (indicated
with P-PPO3 in FIG. 4) is different from the trailer of PPO genes
that are predominantly expressed in other tissues including
microtubers (indicated with PPOM-41 and PPOM-44 in FIG. 4). Because
of the low homology between trailers associated with different PPO
genes, the use of the P-PPO3 trailer will result in a silencing of
the mature tuber-specific PPO gene only. This very specific gene
silencing would be difficult to accomplish with sequences derived
from the PPO gene itself, thus demonstrating the advantage of using
non-coding sequences for gene silencing. To visualize the extend of
PPO activity, 0.5 mL of 50 mM catechol was pipetted on the cut
surfaces of sliced genetically modified minitubers. Compared to
controls, visual browning of the tuber regions was about 5 to
10-fold reduced. Interestingly, though, no reduced browning was
observed in the potato skin. It appears that the trailer sequence
used specifically silenced the PPO gene that is predominantly
expressed in cortex and pith but not in the epidermal skin. This
unexpected finding may be beneficial for tubers to protect
themselves against some pathogens attempting to infect through the
skin because the PPO gene may play some role in certain defense
responses. To quantitatively determine PPO activity, an assay was
performed as described in Example 7. Table 11 shows up to 80%
reduction of PPO activity in transformed minitubers compared to
untransformed controls. The level of reduction is expected to be
even greater in mature tubers because these tubers express the
targeted PPO gene more predominantly than mini- and microtubers.
The improved characteristics of lines such as "217-7" and "217-26"
can be confirmed in mature tubers.
Example 9
An Expression Cassette to Increase Levels of Resistant Starch
[0327] Increasing the amylose/amylopectin ratios in tubers can
further enhance the nutritional value of potato products. One
method that makes it possible to increase amylose content is based
on the antisense expression of genes encoding for the starch
branching enzyme (SBE) I and II (Schwall et al., Nature
Biotechnology 18: 551-554, 2000). The disadvantages of this method
are that (1) the efficiency of simultaneously silencing two
different genes through exploitation of antisense technologies is
very low, (2) the antisense expression of the relatively large
SBE-I and SBE-II gene sequences results in the undesirable
expression of open reading frames (Table 1) (3) corresponding
constructs that harbor the two antisense expression cassettes are
unnecessarily large and complex, thus, increasing chances of
recombination and lowering transformation frequencies.
[0328] Our approach to increase amylose content in potato is based
on the expression of the trailer sequences that are associated
with-both genes. These trailers (SEQ ID No.:34 and 35) were
isolated with the primer pairs 5'-GTCCATGATGTCTTCAGGGTGGTA-3' (SEQ
ID NO. 85), and 5'-CTAATATTTGATATATGTGATTGT-3' (SEQ ID NO. 86), and
5'-ACGAACTTGTGATCGCCITTGAAAG-3' (SEQ ID NO. 87), and
5'-ACTAAGCAAAACCTGCTGAAGCCC-3' (SEQ ID NO. 88). A single promoter
drives expression of a sense and antisense fusion of both trailers,
separated by the Ubiquitin-7 intron, and followed by the
Ubiquitin-3 terminator. The size of the entire expression cassette
is only 2.5-kb.
Example 10
Development of Marker-Free Transformation Methods
[0329] This Example demonstrates that plants can be transformed
effectively without to need for stable integration of selectable
marker genes.
[0330] This method is the first to take advantage of the phenomenon
that DNAs targeted to the nuclei of plant cells often fails to
subsequently integrate into the plant cell's genome. The inventors
made the surprising discovery that it is possible to select for
cells that temporarily express a non-integrating T-DNA containing a
selectable marker gene by placing infected explants for 5 days on a
plant medium with the appropriate selective agent. A second
phenomenon that was applied to develop the current method is that
T-DNAs from different binary vectors often target the same plant
cell nucleus. By using two different binary vectors, one containing
the selectable marker on a T-DNA, and the other one carrying a
T-DNA or P-DNA with the actual sequences of interest, it was
possible to apply a transient selection system and obtain
populations of calli, shoots or plants, a significant portion of
which represents marker-free transformation events.
[0331] A conventional binary vector designated pSIM011 was used to
represent the vector with the "sequence of interest", which is, in
this test case, an expression cassette for the beta glucuronidase
(GUS) gene located oil a conventional T-DNA. The second binary
vector that was used for these experiments contains an expression
cassette comprising the neomycin phosphotransferase (NPTII) gene
driven by the strong promoter of the Ubiquitin-7 gene and followed
by the terminator sequences of the nopaline synthase (nos) gene
between the borders of the T-DNA of a pSIM011-derivative.
[0332] Surprisingly, a strong level of transient NPTII gene
expression levels could also be obtained by replacing the nos
terminator with the terminator of the yeast alcohol dehydrogenase 1
(ADH1) gene (Genbank accession number V01292, SEQ ID NO. 56). This
finding is interesting because the yeast ADH1 terminator does not
share homology with any plant terminator. Importantly, it should be
noted here that many yeast terminators do not function adequately
in plants. For instance, almost no GUS gene expression was observed
in a similar experiment as described above with the GUS gene
followed by the yeast iso-1-cytochrome c (CYC1) terminator (Genbank
accession number SCCYT1). An improved vector carrying the
selectable marker gene NPTII was generated by replacing the nos
terminator with the yeast ADH1 terminator. The binary vector
containing a selectable marker gene for transient transformation is
designated "LifeSupport" (FIG. 5).
[0333] Potato stem explants were simultaneously infected with two
A. tumefaciens LBA4404 strains containing pSIM011 and LifeSupport,
respectively. A 1/10 dilution of overnight-grown cultures of each
strain were grown for 5-6 hours before they were precipitated,
washed and resuspended an OD.sub.600nm of 0.4 as described in
Example 3. The resuspended cells were then used to infect 0.4-0.6
cm internodal potato segments at a final density of each bacteria
of 0.2 (OD.sub.600nm). Infected stems were treated as in Example 3
with a main difference: the selection with kanamycin was limited to
the first 5 days of culture on callus induction medium. Then,
explants were allowed to further develop in fresh CIM and SIM
containing only timentine 150 mg/L but no selective antibiotic.
Within about 3 months from the infection day leaves from shoots
derived from calli developed in 40-60% of the infected stems were
both tested for GUS expression and PCR analyzed to identify events
that contained the sequences of interest but no marker gene. As
shown in Table 12, 11% of shoots represented marker-free
transformation events.
[0334] The two-strain approach described above was also used to
transform tobacco. Shoots that developed within about 2 months were
GUS assayed and PCR analyzed. The high frequency of marker-free
transformation events identified (18%) implies that the developed
method is applicable to plant species other than potato (Table
12).
[0335] Importantly, sequential rather than simultaneous infection
with the two different Agrobacterium strains resulted in an
increase in the efficiency of marker-free transformation. The
surprising effect of sequential infections was discovered by
infecting potato stem explants with the Agrobacterium strain
containing pSIM011, placing the infected explants on co-cultivation
plates for 4 hours, and then re-infecting them with the LifeSupport
vector. The doubly infected explants were treated as previously
described in this example. As shown in Table 13, the lag time of 4
hours between the two different infections resulted in a 2-fold
increased frequency of marker-free transformation events in
potato.
Example 11
Precise Breeding with pSIM340
[0336] This Example demonstrates the efficacy of precise breeding.
The health and agronomic characteristics of potato plants are
enhanced by inserting potato genetic elements (see Examples 1, 4,
and 7) into potato, using marker-free transformation (Example
10).
[0337] A binary vector containing two expression cassettes for the
invertase inhibitor and mutant polyphenol oxidase genes inserted
between P-DNA termini, designated pSIM340 (FIG. 1), was created by
inserting both expression cassettes of mutant PPO and invertase
inhibitor into a binary vector pSIM112'. Potato stem explants were
infected simultaneously with pSIM340 and a further improved
LifeSupport vector. The infected explants were then co-cultivated,
subjected to transient selection, and induced to proliferate and
develop shoots as discussed earlier. After 3 months, small shoots
were transferred to new media and allowed to grow for 3 additional
weeks. Shoots were then phenotypically analyzed, and leaf material
was collected for molecular analyses to determine the presence of
backbone, marker gene and P-DNA with the sequences of interest, as
described in Examples 2 and 3. As shown in Table 14, 1.2% of events
represented a plant that contained the modified P-DNA of pSIM340
without LifeSupport. This frequency of maker-free transformation is
lower than found for a T-DNA, again revealing a functional
difference between P-DNA and T-DNA.
Example 12
Selecting Against Stable Integration of LifeSupport T-DNAs
[0338] This Example demonstrates that the efficiency of precise
breeding methods can be increased by selecting against stable
integration of LifeSupport T-DNAs using the bacterial cytosine
deaminase gene.
[0339] The previous example demonstrates that the efficiency of
marker-free transformation is several-fold lower with a modified
P-DNA than with a conventional T-DNA. To improve the efficiency of
generating shoots only containing a modified P-DNA, an expression
cassette for a suicide gene fusion comprising the bacterial
cytosine deaminase (codA) and uracil phosphoribosyltransferase
(upp) genes (InvivoGen, CA) was inserted between T-DNA borders of
the LifeSupport vector, generating pSIM346 (FIG. 5). Potato stem
explants were infected with one strain carrying pSIM340 and the
other carrying pSIM346, and subsequently placed on the following
media: (1) co-cultivation media for 2 days, (2) CIMTK media to
select for transient marker gene expression for 5 days, (3) CIMT
media to allow proliferation of plant cells that transiently
expressed the marker gene for 30 days, (4) SIMT media with 500 mg/L
of non-toxic 5-fluorocytosine (5-FC), which will be converted by
plant cells expressing codA::upp into the toxic toxic
5-fluorouracil (5-FU), to select against stable integration of the
LifeSupport TDNA. Callus gave rise to shoots on SIMT within 4
weeks. These shoots were transferred to MS media with timentin and
allowed to grow until sufficient tissue was available for PCR
analysis. DNA was then extracted from 100 shoots and used to
determine the presence of P-DNA, LifeSupport and backbone. As shown
in Table 15, none of the shoots analyzed contained a LifeSupport
T-DNA, indicating, for the first time, that the codA::upp gene
fusion can be used as negative selectable marker prior to
regeneration. More importantly, our results demonstrate that a
negative selection against LifeSupport T-DNA integration increases
the frequency of shoots that only contain a modified P-DNA. By
coupling a positive selection for transient marker gene expression
with a negative selection against stable integration of the
codA::upp gene fusion, the frequency of shoots only containing a
modified P-DNA is about 5-fold higher than by only employing the
positive selection for transient marker gene expression (Table
15).
[0340] An even greater increase in the efficiency of marker-free
transformation was obtained by using the LifeSupport vector pSIM350
(FIG. 5), which is similar to pSIM346 but contains the codA gene
instead of the codA::upp gene fusion. Potato stem explants
simultaneously infected with pSIM340 and pSIM350 were treated as
described above, and 51 resulting shoots were molecularly tested
for the occurrence of events only containing-the T-DNA region from
pSIM340. Interestingly, this PCR analysis revealed that some shoots
contained the codA gene (Table 15). This finding demonstrates that
codA is not as tight a negative selectable marker as codA::upp in
plants. More importantly, a large number of shoots (29%) were shown
to represent marker-free transformation events.
[0341] Efficiencies can be further increased by not infecting
explants simultaneously with pSIM340 and pSIM350 but sequentially.
By infecting the explants with pSIM340 and re-infecting them with
pSIM350 after 4 hours, marker-free transformation frequencies are
expected to be approximately 30-40%.
Example 13
Impairing Integration of LifeSupport T-DNAs
[0342] This Example demonstrates that the efficiency of precise
breeding methods can be increased by impairing integration of the
LifeSupport T-DNA into the plant genome using an omega-mutated
virD2 gene.
[0343] It has been shown that the omega domain of the Agrobacterium
protein vird2 is important for the ability of that protein to
support T-DNA integration into plant genomes (Mysore et al., Mol
Plant Microbe Interact 11: 668-83, 1998). Based on this
observation, modified LifeSupport vectors were created that contain
an expression cassette for an omega-mutated virD2 protein inserted
into the SacI site in their backbone sequences. The expression
cassette was obtained by amplifying a 2.2-kb DNA fragment from
plasmid pCS45 (courtesy of Dr. Walt Ream--Oregon State University,
OR, USA-, SEQ ID NO.: 36). A LifeSupport-derivative carrying this
expression cassette, designated pSIM401.OMEGA. (FIG. 5), was used
to support the transformation of potato plants with the modified
P-DNA of pSIM340. After transient selection and shoot induction,
100 shoots were molecularly tested for the presence of transgenes.
As shown in Table 15, 4.4% of shoots only contained the modified
P-DNA, indicating that the use of omega-virD2 increases the
efficiency of marker-free transformation about 4-fold (Table
15).
[0344] Efficiencies are further improved by increasing the size of
the LifeSupport T-DNA from 3.7 kb (in pSIM401.OMEGA.) to 8.1 kb (in
the pSIM401.OMEGA.-derivative designated pSIM341.OMEGA.; FIG. 5).
By regenerating shoots from potato stem explants simultaneously
infected with pSIM340 and pSIM341.OMEGA., 7 of 81 analyzed events
(7%) were shown to represent marker-free transformation events
(Table 15).
[0345] A further improvement can be obtained by infecting explants
sequentially rather than simultaneously with pSIM340 and
LifeSupport. In a similar way as described in Example 10, the
frequency of plants that only contain a modified P-DNA can be about
doubled by infecting the explants with pSIM340 and re-infecting
them with LifeSupport after 4 hours.
Example 14
Development of a 1-Strain Approach
[0346] This Example demonstrates that high frequencies of
marker-free transformation can also be obtained by using a single
Agrobacterium strain that contains both the P-DNA vector and Life
Support
[0347] Two compatible binary vectors were created that can be
maintained simultaneously in Agrobacterium. Instead of using this
system to stably integrate two T-DNAs carrying the DNA-of-interest
and a marker gene, respectively (Komari et al. U.S. Pat. No.
5,731,179, 1998), it is intended for integration of only the
modified P-DNA.
[0348] The first vector, designated pSIM356, contains an expression
cassette comprising the GUS gene driven by the Ubi7 promoter and
followed by UbiT inserted between P-DNA termini. The backbone
portion of this vector contains bacterial origins of replication
from pVS1 and pBR322, a spectinomycin resistance gene for bacterial
selection, and an expression cassette for the IPT gene to enable
selection against backbone integration in plants (FIG. 1). The
second vector, designated pSIM363, contains an expression cassette
comprising the NPTII gene driven by the Ubi7 promoter and followed
by the yeast ADH1 terminator inserted between conventional T-DNA
borders (FIG. 5). The backbone portion of this vector contains
bacterial origins of replication from ColE1 (Genbank number V00268)
and ori V (Genbank number M20134), and a kanamycin resistance gene
for bacterial selection.
[0349] The concept of increasing marker-free transformation
frequencies using pSIM356 and pSIM363 was tested in 100 tobacco
shoots. As shown in Table 16, about 19% of regenerated shoots
contained the DNA of interest without marker gene. An increase in
marker-free transformation efficiency was also found by applying
this 1-strain approach to potato. Nine of 60 independent shoots
tested (15%) contained the pSIM340 T-DNA and lacked the LifeSupport
T-DNA (Table 16).
[0350] The 1-strain approach can be combined with the method
described in Example 12 to couple a positive selection for
transient marker gene expression with a negative selection against
stable integration of the coda gene. For this purpose, the
LifeSupport vector pSIM365 was developed (FIG. 5). An Agrobacterium
strain carrying this vector together with a P-DNA vector can be
used to efficiently develop plants that only contain an expression
cassette-of-interest located within a P-DNA stably integrated in
their genomes.
Example 15
Precise Breeding Method Relying on a Native Marker
[0351] Apart from transforming crop plants with P-DNAs that only
contain the desirable sequences to introduce beneficial traits, the
present invention also provides a method of transforming such
plants with P-DNAs that contain an additional native marker gene.
Our novel and native marker genes of choice are potato homologs of
the Arabidopsis vacuolar Na+/H+ antiporter gene and alfalfa alfin-1
gene. Expression of these genes do not only allow the
identification of transformation events, but also provides salt
tolerance to transformed plants. High salinity levels in an
increasing acreage of agricultural land will therefore less affect
potato plants containing the salt tolerance marker.
[0352] Two versions of a vacuolar Na+/H+antiporter homolog,
designated Pst (Potato salt tolerance) were amplified from cDNA of
a late blight resistant variety obtained from the US Potato Genbank
(WI), designated "LBR4", using the oligonucleotide pair
5'-CCCGGGATGGCTTCTGTGCTGGCT-3' (SEQ ID NO. 89) and
5'-GGTACCTCATGGACCCTGTTCCGT-3' (SEQ ID NO. 90). Their sequences are
shown in SEQ ID NO.:37 and 38. A third gene (SEQ ID NO.:39)with
homology to alfin-1 was amplified from LBR4 potato DNA using the
primers 5'-CCCGGGTATGGAAAATTCGGTACCCAGGACTG-3' (SEQ IDNO. 91) and
5'-ACTAGTTAAACTCTAGCTCTCTTGC -3' (SEQ ID NO. 92). The efficacy of
the Pst genes to function as transformation marker was assessed by
inserting a fusion with the Ubi7 promoter between conventional
T-DNA borders of a modified pSIM341 vector. After a transient
selection period, kanamycin-resistant cells are allowed to
proliferate and develop shoots. These shoots are then transferred
to media that contain 100-150 mM sodium chloride. Salt-tolerant
shoots represent transformation events that contain the T-DNA of
the modified pSIM341.
Example 16
Tuber-Specific Promoter
[0353] A newly isolated tuber-specific promoter can replace the
GBSS promoter used to develop the expression cassettes described in
previous examples. This promoter was isolated from the genome of
Russet Burbank potato plants by using the inverse polymerase chain
reaction with primers specific for a potato proteinase inhibitor
gene (Genbank Accession D17332) (SEQ ID NO. 39). The efficacy of
the PIP promoter was tested by creating a binary vector that
contains the GUS gene driven by this promoter and an expression
cassette for the NPTII marker gene. A similar construct with the
PIP promoter replaced by the GBSS promoter was used as control.
Transformed shoots were obtained by infecting stem explants with
Agrobacterium strains carrying the binary vectors, co-cultivation
for 2 days, and selection on CIMTK medium for 2 months. These
shoots were transferred to new media to induce root formation, and
then planted into soil. Tubers can be assayed for GUS expression
after a 3-month growth period in the green house.
Example 17
Preferred Constructs and Transformation Methods for Precise
Breeding
[0354] Apart from pSIM340, many other vectors can be used to
improve potato plants by transforming them with modified P-DNAs .
Two of such vectors contain an expression cassette for a sense and
antisense copy of the trailer associated with a PPO gene that is
expressed in all tuber tissues except for the epidermis (see
Example 8). Vector pSIM370 contains an additional expression
cassette for a sense and antisense copy of the leader associated
with phosphorylase gene (see Example 6). Vector pSIM371 contains a
third expression cassette for the potato alfin-1 homolog (FIG.
1).
[0355] A third alternative vector, designated pSIM372, contains
both an expression cassette for the potato alfin-1 homolog, and an
expression cassette for a sense and antisense copy of a fusion of
the PPO-associated trailer, R1-associated leader, and
phosphorylase-associated leader.
[0356] The preferred LifeSupport vector for a 1-strain approach is
pSIM365. For a 2-strain approach, the preferred vector is pSIM367,
which contains expression cassettes for both NPTII and coda between
T-DNA borders, and an additional expression cassette for omega
virD2 in the plasmid backbone (FIG. 5).
[0357] Potato stem explants are infected with 1 strain carrying
both pSIM365 and any of the vectors pSIM370, 371, and 372, or
sequentially with 2 strains carrying pSIM366 and any of the
preferred vectors-of-interest, respectively. After a 2-day
co-cultivation and a 5-day transient selection period, the explants
are transferred to media for proliferation/regeneration and
elimination of Agrobacterium. Thirty days later, explants are
transferred again to the same media but now also containing 5-FU to
eliminate events containing LifeSupport T-DNAs. Shoots that
subsequently arise on calli are transferred to regeneration media
that may contain 100-200 mM salt to screen for salt tolerant
events. The IPT-negative shoots are allowed to root and develop
into mature plants. A large proportion of these plants (10%-100%)
are predicted to represent marker-free and backbone-free plants
containing a P-DNA with nucleotide sequences of interest stably
integrated into their genomes.
2TABLE 1 Potentially expressed uncharacterized peptides in
antisense potato lines Gene (size of fragment used) Predicted
peptides encoded by ORFs in reverse-complemented DNA R1 (1.9-kb)
MSSTSNVGQD CLAEVTISYQ WVGRVINYNF FLLIHWYTVV EASTGITFQI FPIGIRSEDD
RSFYEKADRF AWVT MSSESTFSKT PNGRATDVGI PTEEGTFPFR YAILRDLAPT
ISLVNSSADI A MSEGVGFKSK ILPSFAWRSA NILGSKHVAK QTFPFLARTE TCERTSGMSG
VIRATAPSGI SSSPLTDFAT KIVGFS GLTP (1-kb) VCSPALKADK SKSADGTCVD
HSRRLIVVLV LYPGMGTSYA TAFISSPPIQ YLFPSDPVET FP MLGSLVLPKS
PENRKQAVPN PHFQEQHLVP EKPHFLDCGQ GFSKLPQMHQ MVNFLTQGIV DMETAFGSPK
MGGFGKEQFG ACVSRSEMDE SGIGAVMVEQ VCSICSRHFV LSMQI GHTP (0.9-kb)
MLEGSMWPWN QESMKRAFLN HHFLMLHLFP AQRPPQAADP VCLKHQHMHC GCLSFQLHLS
KLAPGDTPLI SSMFALD MKLCSSIILS IIKQKQVEIL RACFGFPETK TISVFSSVSW
NWHIICKSL MTKKPDRKDN IMPYNFPGTK FLQPIFRNFF LPSLCDKLLK KSISVPQAIT
PCWKVQCGHG IKKA PPO (1.8-kb) TILKLDLHTF NGHFFTASFW NQSHRNSIFI
FQSNILQQFS YRQLESNTGN MISITSMNM RQASITPCKL RLIKLICIHS LVHVQRHIEP
YIVPIIIRYF IECQYLLLLI FLLCCP MKGKEKPREM NLQFFTTNFV STVAISTMNI
SLLFKAKRVK GVFIKFPHST RSQLILGYVL LIRRMSRGAD AEFSHRRELV VRNTIDLIGY
RRATTVYYIN TFFYMGSTTR LEIRRWYRCS SR MEWALARNRI PFFYCPNSLR
TSHGKGYDFH RRKRIQSSTN LYLLNPFFSR QLISIHSTSC PHWHGGSKKS DLNRVSRNYP
CLHRFFDEVC HRSRCEPEYE GCFQ SBE A (1.2-kb) MNNITHSPIL IPFLEQLNPF
ISNCHMQPIV KANTPILNGN TKCRHSANIF TNGNCIWEKP MNKIVDQHQI HNSIHISCES
KVFLVVPSES HR MKFRYPSPPN PIVTSLIILC NAIPRSINDV DGLSRAIKSY
ISLSISQNAI VLSPTRA SBE B (2.6-kb) MVNIMTSSSM ATKFPSITVQ CNSVLPWQVT
SNFIPFVCVL WVEVEYKYQV TTFKHNNLII IIHAAYYLFS MAKLVTHEIE VPLSSQGHCE
KMDHLVKRNS SINNRRSICQ ARHARIHLFV H MFETKLNSGV VWNDWLTVNI RNSNTPNTKL
VLLHHVVRTV PSIEIANNFV FLSSRSPFTI DYATIFPVES KF MLYTSLYISY
LSNSMLLPSW TNLHHSYSLN NLSTYLGLPL PGGNQNQFLP QKQAGQGPAY QKHLRQ
[0358]
3TABLE 3 Transformation efficiency Binary Calli/tobacco
Calli/potato vector leaf explant .+-. SE stem explant .+-. SE
pBI121 7.8 .+-. 0.6 0.31 .+-. 0.10 pSIM108 10.2 .+-. 0.6 0.59 .+-.
0.07 pSIM109 12.8 .+-. 0.6 0.47 .+-. 0.05
[0359]
4TABLE 4 Backbone integration resulting from Russet Ranger
transformation Binary PCR.sup.+ PCR.sup.+ for 0.6 kb vector Total
Nr. IPT phenotype for IPT backbone fragment pBI121 98 NA NA 54
(55%) pSIM108 193 138 (71%) 137 (71%) NA pSIM109 133 82 (62%) 80
(60%) NA NA: not applicable
[0360]
5TABLE 5 Backbone integration resulting from Russet Burbank
transformation Binary vector Total Nr. IPT phenotype PSIM108 79 49
(60%) PSIM109 72 60 (84%)
[0361]
6TABLE 6 Acrylamide levels in French fries derived from cold-stored
pSIM320 minitubers glucose mg/g Line (%-reduced) acrylamide (PPB)
Untransformed 10.2 469 Vector control 10.2 NA 320-2 5.4 (47%) 95
320-4 5.8 (43%) 107 320-7 8.7 (14%) 353 320-9 7.4 (27%) 137 320-17
6.0 (41%) 506 320-21 8.5 (16%) 428 320-33 6.6 (35%) 516 NA: not
available
[0362]
7TABLE 7 Acrylamide levels in French fries derived from
untransformed mature tubers Stored at Stored at 18.degree. C.
(color id.*) 4.degree. C. (color id.*) Glucose levels <0.1 mg/g
3.4 mg/g 8-minute blanch 53 PPB (78) 603 PPB (56) 12-minute blanch
28 PPB (84) 244 PPB (71) *a higher value indicates a lighter color
of the finished Fry product
[0363]
8TABLE 8 Glucose levels in cold-stored pSIM332 minitubers Line
glucose mg/g (%-reduced) Untransformed control 11.6 .+-. 0.5 Vector
control 11.5 .+-. 0.5 332-1 5.4 (53%) 332-2 4.8 (58%) 332-4 7.0
(39%) 332-5 5.8 (50%) 332-6 6.9 (40%) 332-7 6.0 (48%) 332-8 6.8
(41%) 332-9 6.6 (43%) 332-10 5.4 (53%) 332-11 6.1 (47%) 332-12 6.4
(44%) 332-13 6.4 (44%) 332-15 7.7 (33%) 332-16 6.5 (43%) 332-17 5.3
(54%) 332-18 7.1 (38%) 332-21 6.3 (46%) 332-22 5.4 (53%) 332-23 4.2
(63%) 332-31 6.0 (48%) 332-34 6.2 (48%) 332-35 6.4 (44%) 332-39 6.7
(41%) 332-40 7.5 (35%) 332-41 5.7 (50%)
[0364]
9TABLE 9 Glucose levels in cold-stored pSIM216 minitubers Line
glucose mg/g (%-reduced) Untransformed control 11.6 .+-. 0.5 Vector
control 11.5 .+-. 0.5 216-2 5.5 (52%) 216-3 8.8 (23%) 216-4 7.4
(36%) 216-5 5.8 (50%) 216-8 8.4 (27%) 216-10 5.1 (56%) 216-11 10.1
(19%) 216-12 9.3 (19%) 216-13 6.4 (44%) 216-15 8.8 (23%) 216-16 9.7
(16%) 216-17 6.4 (44%) 216-19 8.7 (24%) 216-21 3.2 (72%) 216-24 9.4
(18%) 216-26 9.3 (19%) 216-29 7.1 (38%) 216-30 8.2 (29%) 216-32 9.3
(19%) 216-34 7.1 (38%) 216-35 7.8 (32%) 216-38 7.1 (38%) 216-42 8.1
(30%) 216-44 9.4 (18%) 216-45 10.2 (11%)
[0365]
10TABLE 10 PPO activity in potato lines expressing a modified PPO
gene OD-410/gram micro tubers mini-tubers Line (%-reduced)
(%-reduced) Untransformed 24.59 .+-. 2.22 20.07 .+-. 1.21 controls
Vector controls 22.59 .+-. 3.36 19.55 .+-. 1.43 314-1 2.36 (90%)
17.8 (11%) 314-2 41.52 (-76%) 21.3 (-7%) 314-4 18.40 (22%) 5.4
(73%) 314-5 8.49 (64%) 19.1 (4%) 314-7 16.04 (32%) 16 (20%) 314-8
14.86 (37%) 17 (15%) 314-9 5.43 (77%) 4.3 (78%) 314-12 19.35 (18%)
19.6 (2%) 314-13 18.17 (23%) 15.4 (23%) 314-14 18.64 (21%) 17.32
(13%) 314-16 13.92 (41%) 18.2 (9%) 314-17 5.19 (78%) 2.4 (88%)
314-20 26.66 (-13%) 13.2 (34%) 314-21 11.32 (52%) 17.6 (12%) 314-22
13.45 (43%) 18.8 (6%) 314-23 5.19 (78%) 20.4 (-2%) 314-24 15.10
(36%) 19.6 (2%) 314-25 23.12 (2%) 19 (5%) 314-26 13.45 (43%) 17.8
(11%) 314-27 26.42 (-12%) 19.4 (3%) 314-28 31.85 (-35%) 19.4 (3%)
314-29 3.77 (84%) 14.8 (26%) 314-31 23.83 (-1%) 21.2 (-6%) 314-32
28.78 (-22%) 20 (0%)
[0366]
11TABLE 11 PPO activity in potato minitubers expressing a modified
trailer sequence associated with the PPO gene Line OD-410/gram
(%-reduced) Untransformed controls 20.6 .+-. 1.3 Vector controls
17.9 .+-. 2.1 217-1 12.5 (39.4%) 217-4 12.6 (38.6%) 217-5 11.3
(45.0%) 217-6 6.1 (70.4%) 217-7 5.7 (72.5%) 217-9 10.4 (49.6%)
217-10 15.2 (26.3%) 217-11 15.2 (26.3%) 217-12 6.6 (67.9%) 217-14
15.4 (25.4%) 217-15 13.5 (34.6%) 217-16 6.0 (71.0%) 217-17 9.7
(53.0%) 217-19 8.6 (58.4%) 217-21 14.2 (31.1%) 217-22 9.7 (53.0%)
217-23 15.2 (26.3%) 217-24 8.2 (60.1%) 217-25 11.9 (42.2%) 217-26
3.1 (84.8%) 217-27 6.2 (69.9%) 217-29 7.2 (65.1%)
[0367]
12TABLE 12 Marker-free transformation with the LifeSupport vector +
pSIM011 Gene-of- Plant Co-transformed Marker only interest only
Untransformed Potato 0% 33% 11% 56% Tobacco 20% 26% 18% 36%
Co-transformed: PCR-positive for both GUS and NPT Gene-of-interest
only: PCR-positive for GUS Untransformed: Plants are PCR-negative
for both GUS and NPT
[0368]
13TABLE 13 Sequential potato transformation with the LifeSupport
vector and pSIM011 Time Gene-of- window Co-transformed Marker only
interest only Untransformed O hrs 9% 36% 9% 46% 4 hrs 20% 30% 20%
30% Untransformed: Plants are PCR-negative for marker and
gene-of-interest
[0369]
14TABLE 14 Marker-free transformation with the P-DNA vector pSIM340
+ LifeSupport Gene-of- Plant Co-transformed Marker only interest
only Untransformed Potato 17% 52.8% 1.2% 29% Co-transformed:
PCR-positive for both the PPO gene of pSIM340 and the NPT gene from
LifeSupport Untransformed: Plants are PCR-negative for PPO and
NPTII
[0370]
15TABLE 15 Marker-free potato transformation with pSIM340 +
improved LifeSupport vectors LifeSupport Co- Gene-of- vector
transformed Marker only interest only Untransformed PSIM346 0% 0%
4% 96% PSIM350 10% 10% 29% 51% PSIM401.OMEGA. 6% 34% 5% 55%
pSIM341.OMEGA. 16% 23% 7% 54% Co-transformed: PCR-positive for both
the PPO gene of pSIM340 and the NPT gene from LifeSupport
Untransformed: Plants are PCR-negative for PPO and NPTII
[0371]
16TABLE 16 Marker-free potato transformation with a single
Agrobacterium strain carrying both pSIM356 and pSIM363 Gene-of-
Plant Co-transformed Marker only interest only Untransformed
Tobacco 50% 15% 19% 16% Potato 22% 5% 15% 58% Co-transformed:
PCR-positive for both the GUS gene of pSIM356 and the NPT gene from
LifeSupport Untransformed: Plants are PCR-negative for PPO and
NPTII
[0372]
Sequence CWU 1
1
124 1 416 DNA Solanum tuberosum 1 gtttacagta ccatatatcc tgtcagaggt
atagaggcat gactggcatg atcactaaat 60 tgatgcccac agaggagact
tataacctac aggggcacgt agttctagga cttgaaagtg 120 actgaccgta
gtccaactcg gtataaagcc tactcccaac taaatatatg aaatttatag 180
cataactgca gatgagctcg attctagagt aggtaccgag ctcgaattcc ttactcctcc
240 acaaagccgt aactgaagcg acttctattt ttctcaacct tcggacctga
cgatcaagaa 300 tctcaatagg tagttcttca taagtgagac tatccttcat
agctacactt tctaaaggta 360 cgatagattt tggatcaacc acacacactt
cgtttacacc ggtatatatc ctgcca 416 2 824 DNA Triticum sp. 2
tggcaggata tatgagtgtg taaacaacca taatcaggct gtaattatca agagaactaa
60 tgacaagaag cagagcttat caagtgtttc gtccagctgt aacatgggca
caaaagcttg 120 cttgatgcat gtctggcttt tcaaagagca atgtattctc
aggtacctgc acgtttgatc 180 ccctaccacg tacaagacga gcagaaagga
catgtctgca gaaacttaga cacatccatt 240 gcagactcgt tccgaagcat
caggagagta gtcagcaatg gtcatctgct gatgtaaatt 300 aattgattgt
tggtaatcaa attttaacag caatatatat aatatatcaa tagtatattg 360
aactatgaaa gactgtaatc atatataaca gcatacaaat tgtcgtggaa acaagaggag
420 ctcatcaagt gtttagttca gaaatagcta accaagaatg caatataata
ggggtactga 480 gctcccttca aaattactaa cttcagaaat agctaaccaa
gaatgcaatg gcattgcata 540 atttaaacaa ctgtcagcac caatctctga
ctgaaggcag tttacccatt cagaagagca 600 cacattttct gaacgacaac
tctgagcggg gattgttgac agcagcaatt aatctggcct 660 caagatggtt
tccaacaaca tagatcagat acagcactca agcacccaat aatcagccag 720
tactgatctg gttaccactg caattgatta acagatgaac tgtgaaatta agatttaact
780 gacagtaata tataccagtt ggcaggatat atccctctgt aaac 824 3 2595 DNA
Artificial Sequence Description of Artificial Sequence Expression
cassette for the IPT gene 3 ctgcagccaa agcacatact tatcgattta
aatttcatcg aagagattaa tatcgaataa 60 tcatatacat actttaaata
cataacaaat tttaaataca tatatctggt atataattaa 120 ttttttaaag
tcatgaagta tgtatcaaat acacatatgg aaaaaattaa ctattcataa 180
tttaaaaaat agaaaagata catctagtga aattaggtgc atgtatcaaa tacattagga
240 aaagggcata tatcttgatc tagataatta acgattttga tttatgtata
atttccaaat 300 gaaggtttat atctacttca gaaataacaa tatactttta
tcagaacatt caacaaagta 360 acaaccaact agagtgaaaa atacacattg
ttctctaaac atacaaaatt gagaaaagaa 420 tctcaaaatt tagagaaaca
aatctgaatt tctagaagaa aaaaataatt atgcactttg 480 ctattgctcg
aaaaataaat gaaagaaatt agactttttt aaaagatgtt agactagata 540
tactcaaaag ctatcaaagg agtaatattc ttcttacatt aagtatttta gttacagtcc
600 tgtaattaaa gacacatttt agattgtatc taaacttaaa tgtatctaga
atacatatat 660 ttgaatgcat catatacatg tatccgacac accaattctc
ataaaaagcg taatatccta 720 aactaattta tccttcaagt caacttaagc
ccaatataca ttttcatctc taaaggccca 780 agtggcacaa aatgtcaggc
ccaattacga agaaaagggc ttgtaaaacc ctaataaagt 840 ggcactggca
gagcttacac tctcattcca tcaacaaaga aaccctaaaa gccgcagcgc 900
cactgatttc tctcctccag gcgaagatgc agatcttcgt gaagacccta acggggaaga
960 cgatcaccct agaggttgag tcttccgaca ccatcgacaa tgtcaaagcc
aagatccagg 1020 acaaggaagg gattccccca gaccagcagc gtttgatttt
cgccggaaag cagcttgagg 1080 atggtcgtac tcttgccgac tacaacatcc
agaaggagtc aactctccat ctcgtgctcc 1140 gtctccgtgg tggtggatcc
atggacctgc atctaatttt cggtccaact tgcacaggaa 1200 agacgacgac
cgcgatagct cttgcccagc agacagggct tccagtcctt tcgcttgatc 1260
gggtccaatg ctgtcctcaa ctatcaaccg gaagcggacg accaacagtg gaagaactga
1320 aaggaacgac gcgtctctac cttgatgatc ggcctctggt ggagggtatc
atcgcagcca 1380 agcaagctca tcataggctg atcgaggagg tgtataatca
tgaggccaac ggcgggctta 1440 ttcttgaggg aggatccacc tcgttgctca
actgcatggc gcgaaacagc tattggagtg 1500 cagattttcg ttggcatatt
attcgccaca agttacccga ccaagagacc ttcatgaaag 1560 cggccaaggc
cagagttaag cagatgttgc accccgctgc aggccattct attattcaag 1620
agttggttta tctttggaat gaacctcggc tgaggcccat tctgaaagag atcgatggat
1680 atcgatatgc catgttgttt gctagccaga accagatcac ggcagatatg
ctattgcagc 1740 ttgacgcaaa tatggaaggt aagttgatta atgggatcgc
tcaggagtat ttcatccatg 1800 cgcgccaaca ggaacagaaa ttcccccaag
ttaacgcagc cgctttcgac ggattcgaag 1860 gtcatccgtt cggaatgtat
taggttacgc cagccctgcg tcgcacctgt cttcatctgg 1920 ataagatgtt
cgtaattgtt tttggctttg tcctgttgtg gcagggcggc aaatacttcc 1980
gacaatccat cgtgtcttca aactttatgc tggtgaacaa gtcttagttt ccacgaaagt
2040 attatgttaa attttaaaat ttcgatgtat aatgtggcta taattgtaaa
aataaactat 2100 cgtaagtgtg cgtgttatgt ataatttgtc taaatgttta
atatatatca tagaacgcaa 2160 taaatattaa atatagcgct tttatgaaat
ataaatacat cattacaagt tgtttatatt 2220 tcgggtggac tagtttttaa
tgtttagcaa atgtcctatc agttttctct ttttgtcgaa 2280 cggtaattta
gagttttttt tgctatatgg attttcgttt ttgatgtatg tgacaaccct 2340
cgggattgtt gatttatttc aaaactaaga gtttttgctt attgttctcg tctattttgg
2400 atatcaatct tagttttata tcttttctag ttctctacgt gttaaatgtt
caacacacta 2460 gcaatttggc tgcagcgtat ggattatgga actatcaagt
ctgtgggatc gataaatatg 2520 cttctcagga atttgagatt ttacagtctt
tatgctcatt gggttgagta taatatagta 2580 aaaaaatagg aattc 2595 4 9323
DNA Artificial Sequence Description of Artificial Sequence pSIM111
nucleotide sequence 4 agctttggca ggatatatac cggtgtaaac gaagtgtgtg
tggttgatcc aaaatctatc 60 gtacctttag aaagtgtagc tatgaaggat
agtctcactt atgaagaact acctattgag 120 attcttgatc gtcaggtccg
aaggttgaga aaaatagaag tcgcttcagt tacggctttg 180 tggaggagta
agggtaccta ctctagaatc gagctcatcg ttatgctata aatttcatat 240
atttagttgg gagtaggctt tataccgagt tggactacgg tcagtcactt tcaagtccta
300 gaactacgtg cccctgtagg ttataagtct cctctgtggg catcaattta
gtgatcatgc 360 cagtcatgcc tctatacctc tgacaggata tatggtactg
taaacactag ttgtgaataa 420 gtcgctgtgt atgtttgttt gagatctcta
agagaaaaga gcgtttatta gaataacgga 480 tatttaaaag ggcgtgaaaa
ggtttatccg ttcgtccatt tgtatgtggt cacctatctc 540 gagcatgcca
accacagggt tcccctcggg atcaaagtac tttgatccaa cccctccgct 600
gctatagtgc agtcggcttc tgacgttcag tgcagccgtc ttctgaaaac gacatgtcgc
660 acaagtccta agttacgcga caggctgccg ccctgccctt ttcctggcgt
tttcttgtcg 720 cgtgttttag tcgcataaag tagaatactt gcgactagaa
ccggagacat tacgccatga 780 acaagagcgc cgccgctggc ctgctgggct
atgcccgcgt cagcaccgac gaccaggact 840 tgaccaacca acgggccgaa
ctgcacgcgg ccggctgcac caagctgttt tccgagaaga 900 tcaccggcac
caggcgcgac cgcccggagc tggccaggat gcttgaccac ctacgccctg 960
gcgacgttgt gacagtgacc aggctagacc gcctggcccg cagcacccgc gacctactgg
1020 acattgccga gcgcatccag gaggccggcg cgggcctgcg tagcctggca
gagccgtggg 1080 ccgacaccac cacgccggcc ggccgcatgg tgttgaccgt
gttcgccggc attgccgagt 1140 tcgagcgttc cctaatcatc gaccgcaccc
ggagcgggcg cgaggccgcc aaggcccgag 1200 gcgtgaagtt tggcccccgc
cctaccctca ccccggcaca gatcgcgcac gcccgcgagc 1260 tgatcgacca
ggaaggccgc accgtgaaag aggcggctgc actgcttggc gtgcatcgct 1320
cgaccctgta ccgcgcactt gagcgcagcg aggaagtgac gcccaccgag gccaggcggc
1380 gcggtgcctt ccgtgaggac gcattgaccg aggccgacgc cctggcggcc
gccgagaatg 1440 aacgccaaga ggaacaagca tgaaaccgca ccaggacggc
caggacgaac cgtttttcat 1500 taccgaagag atcgaggcgg agatgatcgc
ggccgggtac gtgttcgagc cgcccgcgca 1560 cgtctcaacc gtgcggctgc
atgaaatcct ggccggtttg tctgatgcca agctggcggc 1620 ctggccggcc
agcttggccg ctgaagaaac cgagcgccgc cgtctaaaaa ggtgatgtgt 1680
atttgagtaa aacagcttgc gtcatgcggt cgctgcgtat atgatgcgat gagtaaataa
1740 acaaatacgc aaggggaacg catgaaggtt atcgctgtac ttaaccagaa
aggcgggtca 1800 ggcaagacga ccatcgcaac ccatctagcc cgcgccctgc
aactcgccgg ggccgatgtt 1860 ctgttagtcg attccgatcc ccagggcagt
gcccgcgatt gggcggccgt gcgggaagat 1920 caaccgctaa ccgttgtcgg
catcgaccgc ccgacgattg accgcgacgt gaaggccatc 1980 ggccggcgcg
acttcgtagt gatcgacgga gcgccccagg cggcggactt ggctgtgtcc 2040
gcgatcaagg cagccgactt cgtgctgatt ccggtgcagc caagccctta cgacatatgg
2100 gccaccgccg acctggtgga gctggttaag cagcgcattg aggtcacgga
tggaaggcta 2160 caagcggcct ttgtcgtgtc gcgggcgatc aaaggcacgc
gcatcggcgg tgaggttgcc 2220 gaggcgctgg ccgggtacga gctgcccatt
cttgagtccc gtatcacgca gcgcgtgagc 2280 tacccaggca ctgccgccgc
cggcacaacc gttcttgaat cagaacccga gggcgacgct 2340 gcccgcgagg
tccaggcgct ggccgctgaa attaaatcaa aactcatttg agttaatgag 2400
gtaaagagaa aatgagcaaa agcacaaaca cgctaagtgc cggccgtccg agcgcacgca
2460 gcagcaaggc tgcaacgttg gccagcctgg cagacacgcc agccatgaag
cgggtcaact 2520 ttcagttgcc ggcggaggat cacaccaagc tgaagatgta
cgcggtacgc caaggcaaga 2580 ccattaccga gctgctatct gaatacatcg
cgcagctacc agagtaaatg agcaaatgaa 2640 taaatgagta gatgaatttt
agcggctaaa ggaggcggca tggaaaatca agaacaacca 2700 ggcaccgacg
ccgtggaatg ccccatgtgt ggaggaacgg gcggttggcc aggcgtaagc 2760
ggctgggttg tctgccggcc ctgcaatggc actggaaccc ccaagcccga ggaatcggcg
2820 tgacggtcgc aaaccatccg gcccggtaca aatcggcgcg gcgctgggtg
atgacctggt 2880 ggagaagttg aaggccgcgc aggccgccca gcggcaacgc
atcgaggcag aagcacgccc 2940 cggtgaatcg tggcaagcgg ccgctgatcg
aatccgcaaa gaatcccggc aaccgccggc 3000 agccggtgcg ccgtcgatta
ggaagccgcc caagggcgac gagcaaccag attttttcgt 3060 tccgatgctc
tatgacgtgg gcacccgcga tagtcgcagc atcatggacg tggccgtttt 3120
ccgtctgtcg aagcgtgacc gacgagctgg cgaggtgatc cgctacgagc ttccagacgg
3180 gcacgtagag gtttccgcag ggccggccgg catggccagt gtgtgggatt
acgacctggt 3240 actgatggcg gtttcccatc taaccgaatc catgaaccga
taccgggaag ggaagggaga 3300 caagcccggc cgcgtgttcc gtccacacgt
tgcggacgta ctcaagttct gccggcgagc 3360 cgatggcgga aagcagaaag
acgacctggt agaaacctgc attcggttaa acaccacgca 3420 cgttgccatg
cagcgtacga agaaggccaa gaacggccgc ctggtgacgg tatccgaggg 3480
tgaagccttg attagccgct acaagatcgt aaagagcgaa accgggcggc cggagtacat
3540 cgagatcgag ctagctgatt ggatgtaccg cgagatcaca gaaggcaaga
acccggacgt 3600 gctgacggtt caccccgatt actttttgat cgatcccggc
atcggccgtt ttctctaccg 3660 cctggcacgc cgcgccgcag gcaaggcaga
agccagatgg ttgttcaaga cgatctacga 3720 acgcagtggc agcgccggag
agttcaagaa gttctgtttc accgtgcgca agctgatcgg 3780 gtcaaatgac
ctgccggagt acgatttgaa ggaggaggcg gggcaggctg gcccgatcct 3840
agtcatgcgc taccgcaacc tgatcgaggg cgaagcatcc gccggttcct aatgtacgga
3900 gcagatgcta gggcaaattg ccctagcagg ggaaaaaggt cgaaaaggtc
tctttcctgt 3960 ggatagcacg tacattggga acccaaagcc gtacattggg
aaccggaacc cgtacattgg 4020 gaacccaaag ccgtacattg ggaaccggtc
acacatgtaa gtgactgata taaaagagaa 4080 aaaaggcgat ttttccgcct
aaaactcttt aaaacttatt aaaactctta aaacccgcct 4140 ggcctgtgca
taactgtctg gccagcgcac agccgaagag ctgcaaaaag cgcctaccct 4200
tcggtcgctg cgctccctac gccccgccgc ttcgcgtcgg cctatcgcgg ccgctggccg
4260 ctcaaaaatg gctggcctac ggccaggcaa tctaccaggg cgcggacaag
ccgcgccgtc 4320 gccactcgac cgccggcgcc cacatcaagg caccctgcct
cgcgcgtttc ggtgatgacg 4380 gtgaaaacct ctgacacatg cagctcccgg
agacggtcac agcttgtctg taagcggatg 4440 ccgggagcag acaagcccgt
cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag 4500 ccatgaccca
gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga 4560
gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat gcgtaaggag
4620 aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc
gctcggtcgt 4680 tcggctgcgg cgagcggtat cagctcactc aaaggcggta
atacggttat ccacagaatc 4740 aggggataac gcaggaaaga acatgtgagc
aaaaggccag caaaaggcca ggaaccgtaa 4800 aaaggccgcg ttgctggcgt
ttttccatag gctccgcccc cctgacgagc atcacaaaaa 4860 tcgacgctca
agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc 4920
ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc
4980 cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta
ggtatctcag 5040 ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac
gaaccccccg ttcagcccga 5100 ccgctgcgcc ttatccggta actatcgtct
tgagtccaac ccggtaagac acgacttatc 5160 gccactggca gcagccactg
gtaacaggat tagcagagcg aggtatgtag gcggtgctac 5220 agagttcttg
aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg 5280
cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca
5340 aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc
gcagaaaaaa 5400 aggatctcaa gaagatcctt tgatcttttc tacggggtct
gacgctcagt ggaacgaaaa 5460 ctcacgttaa gggattttgg tcatgcattc
taggtactaa aacaattcat ccagtaaaat 5520 ataatatttt attttctccc
aatcaggctt gatccccagt aagtcaaaaa atagctcgac 5580 atactgttct
tccccgatat cctccctgat cgaccggacg cagaaggcaa tgtcatacca 5640
cttgtccgcc ctgccgcttc tcccaagatc aataaagcca cttactttgc catctttcac
5700 aaagatgttg ctgtctccca ggtcgccgtg ggaaaagaca agttcctctt
cgggcttttc 5760 cgtctttaaa aaatcataca gctcgcgcgg atctttaaat
ggagtgtctt cttcccagtt 5820 ttcgcaatcc acatcggcca gatcgttatt
cagtaagtaa tccaattcgg ctaagcggct 5880 gtctaagcta ttcgtatagg
gacaatccga tatgtcgatg gagtgaaaga gcctgatgca 5940 ctccgcatac
agctcgataa tcttttcagg gctttgttca tcttcatact cttccgagca 6000
aaggacgcca tcggcctcac tcatgagcag attgctccag ccatcatgcc gttcaaagtg
6060 caggaccttt ggaacaggca gctttccttc cagccatagc atcatgtcct
tttcccgttc 6120 cacatcatag gtggtccctt tataccggct gtccgtcatt
tttaaatata ggttttcatt 6180 ttctcccacc agcttatata ccttagcagg
agacattcct tccgtatctt ttacgcagcg 6240 gtatttttcg atcagttttt
tcaattccgg tgatattctc attttagcca tttattattt 6300 ccttcctctt
ttctacagta tttaaagata ccccaagaag ctaattataa caagacgaac 6360
tccaattcac tgttccttgc attctaaaac cttaaatacc agaaaacagc tttttcaaag
6420 ttgttttcaa agttggcgta taacatagta tcgacggagc cgattttgaa
accgcggatc 6480 ctgcagccaa agcacatact tatcgattta aatttcatcg
aagagattaa tatcgaataa 6540 tcatatacat actttaaata cataacaaat
tttaaataca tatatctggt atataattaa 6600 ttttttaaag tcatgaagta
tgtatcaaat acacatatgg aaaaaattaa ctattcataa 6660 tttaaaaaat
agaaaagata catctagtga aattaggtgc atgtatcaaa tacattagga 6720
aaagggcata tatcttgatc tagataatta acgattttga tttatgtata atttccaaat
6780 gaaggtttat atctacttca gaaataacaa tatactttta tcagaacatt
caacaaagta 6840 acaaccaact agagtgaaaa atacacattg ttctctaaac
atacaaaatt gagaaaagaa 6900 tctcaaaatt tagagaaaca aatctgaatt
tctagaagaa aaaaataatt atgcactttg 6960 ctattgctcg aaaaataaat
gaaagaaatt agactttttt aaaagatgtt agactagata 7020 tactcaaaag
ctatcaaagg agtaatattc ttcttacatt aagtatttta gttacagtcc 7080
tgtaattaaa gacacatttt agattgtatc taaacttaaa tgtatctaga atacatatat
7140 ttgaatgcat catatacatg tatccgacac accaattctc ataaaaagcg
taatatccta 7200 aactaattta tccttcaagt caacttaagc ccaatataca
ttttcatctc taaaggccca 7260 agtggcacaa aatgtcaggc ccaattacga
agaaaagggc ttgtaaaacc ctaataaagt 7320 ggcactggca gagcttacac
tctcattcca tcaacaaaga aaccctaaaa gccgcagcgc 7380 cactgatttc
tctcctccag gcgaagatgc agatcttcgt gaagacccta acggggaaga 7440
cgatcaccct agaggttgag tcttccgaca ccatcgacaa tgtcaaagcc aagatccagg
7500 acaaggaagg gattccccca gaccagcagc gtttgatttt cgccggaaag
cagcttgagg 7560 atggtcgtac tcttgccgac tacaacatcc agaaggagtc
aactctccat ctcgtgctcc 7620 gtctccgtgg tggtggatcc atggacctgc
atctaatttt cggtccaact tgcacaggaa 7680 agacgacgac cgcgatagct
cttgcccagc agacagggct tccagtcctt tcgcttgatc 7740 gggtccaatg
ctgtcctcaa ctatcaaccg gaagcggacg accaacagtg gaagaactga 7800
aaggaacgac gcgtctctac cttgatgatc ggcctctggt ggagggtatc atcgcagcca
7860 agcaagctca tcataggctg atcgaggagg tgtataatca tgaggccaac
ggcgggctta 7920 ttcttgaggg aggatccacc tcgttgctca actgcatggc
gcgaaacagc tattggagtg 7980 cagattttcg ttggcatatt attcgccaca
agttacccga ccaagagacc ttcatgaaag 8040 cggccaaggc cagagttaag
cagatgttgc accccgctgc aggccattct attattcaag 8100 agttggttta
tctttggaat gaacctcggc tgaggcccat tctgaaagag atcgatggat 8160
atcgatatgc catgttgttt gctagccaga accagatcac ggcagatatg ctattgcagc
8220 ttgacgcaaa tatggaaggt aagttgatta atgggatcgc tcaggagtat
ttcatccatg 8280 cgcgccaaca ggaacagaaa ttcccccaag ttaacgcagc
cgctttcgac ggattcgaag 8340 gtcatccgtt cggaatgtat taggttacgc
cagccctgcg tcgcacctgt cttcatctgg 8400 ataagatgtt cgtaattgtt
tttggctttg tcctgttgtg gcagggcggc aaatacttcc 8460 gacaatccat
cgtgtcttca aactttatgc tggtgaacaa gtcttagttt ccacgaaagt 8520
attatgttaa attttaaaat ttcgatgtat aatgtggcta taattgtaaa aataaactat
8580 cgtaagtgtg cgtgttatgt ataatttgtc taaatgttta atatatatca
tagaacgcaa 8640 taaatattaa atatagcgct tttatgaaat ataaatacat
cattacaagt tgtttatatt 8700 tcgggtggac tagtttttaa tgtttagcaa
atgtcctatc agttttctct ttttgtcgaa 8760 cggtaattta gagttttttt
tgctatatgg attttcgttt ttgatgtatg tgacaaccct 8820 cgggattgtt
gatttatttc aaaactaaga gtttttgctt attgttctcg tctattttgg 8880
atatcaatct tagttttata tcttttctag ttctctacgt gttaaatgtt caacacacta
8940 gcaatttggc tgcagcgtat ggattatgga actatcaagt ctgtgggatc
gataaatatg 9000 cttctcagga atttgagatt ttacagtctt tatgctcatt
gggttgagta taatatagta 9060 aaaaaatagg aattctatcc gcggtgatca
caggcagcaa cgctctgtca tcgttacaat 9120 caacatgcta ccctccgcga
gatcatccgt gtttcaaacc cggcagctta gttgccgttc 9180 ttccgaatag
catcggtaac atgagcaaag tctgccgcct tacaacggct ctcccgctga 9240
cgccgtcccg gactgatggg ctgcctgtat cgagtggtga ttttgtgccg agctgccggt
9300 cggggagctg ttggctggct gga 9323 5 546 DNA Solanum tuberosum 5
atgagaaatt tattccccat attgatgcta atcaccaatt tggcactcaa caacgataac
60 aacaacaaca acaacaacaa caataattat aatctcatac acgcaacgtg
tagggagacc 120 ccatattact ccctatgtct caccacccta caatccggtc
cacgtagtaa cgaggttgag 180 ggtggtgatg ccatcaccac cctaggcctc
atcatggtgg acgcggtgaa atcaaagtcc 240 atagaaataa tggaaaaaat
aaaagagcta gagaaatcga accctgagtg gcgggcccca 300 cttagccagt
gttacgtggc gtataatgcc gtcctacgag ccgatgtaac ggtagccgtt 360
gaagccttaa agaagggtgc ccccaaattt gctgaagatg gtatggatga tgttgttgct
420 gaagcacaaa cttgtgagta tagttttaat tattataata aattggattt
tccaatttct 480 aatttgagta gggaaataat tgaactatca aaagttgcta
aatccataat tagaatgtta 540 ttatga 546 6 658 DNA Solanum tuberosum 6
gaaccatgca tctcaatctt aatactaaaa aatgcaacaa aattctagtg gagggaccag
60 taccagtaca ttagatatta tcttttatta ctataataat attttaatta
acacgagaca 120 taggaatgtc aagtggtagc ggtaggaggg agttggttca
gttttttaga tactaggaga 180 cagaaccgga ggggcccatt gcaaggccca
agttgaagtc cagccgtgaa tcaacaaaga 240 gagggcccat aatactgtcg
atgagcattt ccctataata cagtgtccac agttgccttc 300 cgctaaggga
tagccacccg ctattctctt gacacgtgtc actgaaacct gctacaaata 360
aggcaggcac ctcctcattc tcacactcac tcactcacac agctcaacaa gtggtaactt
420 ttactcatct cctccaatta tttctgattt catgcatgtt tccctacatt
ctattatgaa 480 tcgtgttatg gtgtataaac gttgtttcat atctcatctc
atctattctg attttgattc 540 tcttgcctac tgaatttgac cctactgtaa
tcggtgataa atgtgaatgc ttcctcttct 600 tcttcttctt ctcagaaatc
aatttctgtt ttgtttttgt tcatctgtag cttggtag 658 7 355 DNA Solanum
tuberosum 7 ttttaatgtt tagcaaatgt cctatcagtt ttctcttttt gtcgaacggt
aatttagagt 60 tttttttgct atatggattt tcgtttttga tgtatgtgac
aaccctcggg attgttgatt 120 tatttcaaaa ctaagagttt ttgcttattg
ttctcgtcta ttttggatat caatcttagt 180 tttatatctt ttctagttct
ctacgtgtta aatgttcaac acactagcaa tttggctgca 240 gcgtatggat
tatggaacta tcaagtctgt gggatcgata aatatgcttc tcaggaattt 300
gagattttac agtctttatg ctcattgggt tgagtataat atagtaaaaa aatag 355 8
179 DNA Solanum tuberosum 8 accttatttc actaccactt tccactctcc
aatccccata ctctctgctc caatcttcat 60 tttgcttcgt gaattcatct
tcatcgaatt tctcgacgct tcttcgctaa tttcctcgtt 120 acttcactaa
aaatcgacgt ttctagctga acttgagtga attaagccag tgggaggat 179 9 569 DNA
Solanum tuberosum 9 gttagaaatc ttctctattt ttggtttttg tctgtttaga
ttctcgaatt agctaatcag 60 gtgctgttat agcccttaat tttgagtttt
ttttcggttg ttttgatgga aaaggcctaa 120 aatttgagtt tttttacgtt
ggtttgatgg aaaaggccta caattggagt tttccccgtt 180 gttttgatga
aaaagcccct agtttgagat tttttttctg tcgattcgat tctaaaggtt 240
taaaattaga gtttttacat ttgtttgatg aaaaaggcct taaatttgag tttttccggt
300 tgatttgatg aaaaagccct agaatttgtg ttttttcgtc ggtttgattc
tgaaggccta 360 aaatttgagt ttctccggct gttttgatga aaaagcccta
aatttgagtt tctccggctg 420 ttttgatgaa aaagccctaa atttgagttt
tttccccgtg ttttagattg tttggtttta 480 attctcgaat cagctaatca
gggagtgtga aaagccctaa aatttgagtt tttttcgttg 540 ttctgattgt
tgtttttatg aatttgcag 569 10 1738 DNA Artificial Sequence
Description of Artificial Sequence Expression cassette for a sense
and antisense copy of the leader associated with the R1 gene 10
ggtaccgaac catgcatctc aatcttaata ctaaaaaatg caacaaaatt ctagtggagg
60 gaccagtacc agtacattag atattatctt ttattactat aataatattt
taattaacac 120 gagacatagg aatgtcaagt ggtagcggta ggagggagtt
ggttcagttt tttagatact 180 aggagacaga accggagggg cccattgcaa
ggcccaagtt gaagtccagc cgtgaatcaa 240 caaagagagg gcccataata
ctgtcgatga gcatttccct ataatacagt gtccacagtt 300 gccttccgct
aagggatagc cacccgctat tctcttgaca cgtgtcactg aaacctgcta 360
caaataaggc aggcacctcc tcattctcac actcactcac tcacacagct caagaaggat
420 ccaccttatt tcactaccac tttccactct ccaatcccca tactctctgc
tccaatcttc 480 attttgcttc gtgaattcat cttcatcgaa tttctcgacg
cttcttcgct aatttcctcg 540 ttacttcact agaaatcgac gtttctagct
gaacttgagt gaattaagcc agtgggagga 600 tgaattcaag gttagaaatc
ttctctattt ttggtttttg tctgtttaga ttctcgaatt 660 agctaatcag
gtgctgttat agcccttaat tttgagtttt ttttcggttg ttttgatgga 720
aaaggcctaa aatttgagtt tttttacgtt ggtttgatgg aaaaggccta caattggagt
780 tttccccgtt gttttgatga aaaagcccct agtttgagat tttttttctg
tcgattcgat 840 tctaaaggtt taaaattaga gtttttacat ttgtttgatg
aaaaaggcct taaatttgag 900 tttttccggt tgatttgatg aaaaagccct
agaatttgtg ttttttcgtc ggtttgattc 960 tgaaggccta aaatttgagt
ttctccggct gttttgatga aaaagcccta aatttgagtt 1020 tctccggctg
ttttgatgaa aaagccctaa atttgagttt tttccccgtg ttttagattg 1080
tttggtttta attctcgaat cagctaatca gggagtgtga aaagccctaa aatttgagtt
1140 tttttcgttg ttctgattgt tgtttttatg aatttgcaga tggatatcat
cctcccactg 1200 gcttaattca ctcaagttca gctagaaacg tcgatttcta
gtgaagtaac gaggaaatta 1260 gcgaagaagc gtcgagaaat tcgatgaaga
tgaattcacg aagcaaaatg aagattggag 1320 cagagagtat ggggattgga
gagtggaaag tggtagtgaa ataaggtaag cttttgattt 1380 taatgtttag
caaatgtcct atcagttttc tctttttgtc gaacggtaat ttagagtttt 1440
ttttgctata tggattttcg tttttgatgt atgtgacaac cctcgggatt gttgatttat
1500 ttcaaaacta agagtttttg cttattgttc tcgtctattt tggatatcaa
tcttagtttt 1560 atatcttttc tagttctcta cgtgttaaat gttcaacaca
ctagcaattt ggctgcagcg 1620 tatggattat ggaactatca agtctgtggg
atcgataaat atgcttctca ggaatttgag 1680 attttacagt ctttatgctc
attgggttga gtataatata gtaaaaaaat agtctaga 1738 11 237 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
spacer sequence 11 gtaactttta ctcatctcct ccaattattt ctgatttcat
gcatgtttcc ctacattcta 60 ttatgaatcg tgttatggtg tataaacgtt
gtttcatatc tcatctcatc tattctgatt 120 ttgattctct tgcctactga
atttgaccct actgtaatcg gtgataaatg tgaatgcttc 180 ctcttcttct
tcttcttctc agaaatcaat ttctgttttg tttttgttca tctgtag 237 12 1406 DNA
Artificial Sequence Description of Artificial Sequence Alternative
expression cassette for a sense and antisense coopy of the leader
associated with the R1 gene 12 ggtaccgaac catgcatctc aatcttaata
ctaaaaaatg caacaaaatt ctagtggagg 60 gaccagtacc agtacattag
atattatctt ttattactat aataatattt taattaacac 120 gagacatagg
aatgtcaagt ggtagcggta ggagggagtt ggttcagttt tttagatact 180
aggagacaga accggagggg cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa
240 caaagagagg gcccataata ctgtcgatga gcatttccct ataatacagt
gtccacagtt 300 gccttccgct aagggatagc cacccgctat tctcttgaca
cgtgtcactg aaacctgcta 360 caaataaggc aggcacctcc tcattctcac
actcactcac tcacacagct caagaaggat 420 ccaccttatt tcactaccac
tttccactct ccaatcccca tactctctgc tccaatcttc 480 attttgcttc
gtgaattcat cttcatcgaa tttctcgacg cttcttcgct aatttcctcg 540
ttacttcact agaaatcgac gtttctagct gaacttgagt gaattaagcc agtgggagga
600 tgaattcgtg gtaactttta ctcatctcct ccaattattt ctgatttcat
gcatgtttcc 660 ctacattcta ttatgaatcg tgttatggtg tataaacgtt
gtttcatatc tcatctcatc 720 tattctgatt ttgattctct tgcctactga
atttgaccct actgtaatcg gtgataaatg 780 tgaatgcttc ctcttcttct
tcttcttctc agaaatcaat ttctgttttg tttttgttca 840 tctgtagctt
gatatcatcc tcccactggc ttaattcact caagttcagc tagaaacgtc 900
gatttctagt gaagtaacga ggaaattagc gaagaagcgt cgagaaattc gatgaagatg
960 aattcacgaa gcaaaatgaa gattggagca gagagtatgg ggattggaga
gtggaaagtg 1020 gtagtgaaat aaggtaagct tttgatttta atgtttagca
aatgtcctat cagttttctc 1080 tttttgtcga acggtaattt agagtttttt
ttgctatatg gattttcgtt tttgatgtat 1140 gtgacaaccc tcgggattgt
tgatttattt caaaactaag agtttttgct tattgttctc 1200 gtctattttg
gatatcaatc ttagttttat atcttttcta gttctctacg tgttaaatgt 1260
tcaacacact agcaatttgg ctgcagcgta tggattatgg aactatcaag tctgtgggat
1320 cgataaatat gcttctcagg aatttgagat tttacagtct ttatgctcat
tgggttgagt 1380 ataatatagt aaaaaaatag tctaga 1406 13 686 DNA
Solanum tuberosum 13 gaaccatgca tctcaatctt aatactaaaa aatgcaacaa
aattctagtg gagggaccag 60 taccagtaca ttagatatta tcttttatta
ctataataat attttaatta acacgagaca 120 taggaatgtc aagtggtagc
ggtaggaggg agttggttca gttttttaga tactaggaga 180 cagaaccgga
ggggcccatt gcaaggccca agttgaagtc cagccgtgaa tcaacaaaga 240
gagggcccat aatactgtcg atgagcattt ccctataata cagtgtccac agttgccttc
300 cgctaaggga tagccacccg ctattctctt gacacgtgtc actgaaacct
gctacaaata 360 aggcaggcac ctcctcattc tcacactcac tcactcacac
agctcaacaa gtggtaactt 420 ttactcatct cctccaatta tttctgattt
catgcatgtt tccctacatt ctattatgaa 480 tcgtgttatg gtgtataaac
gttgtttcat atctcatctc atctattctg attttgattc 540 tcttgcctac
tgaatttgac cctactgtaa tcggtgataa atgtgaatgc ttcctcttct 600
tcttcttctt ctcagaaatc aatttctgtt ttgtttttgt tcatctgtag cttggtagat
660 tccccttttt gtagaccaca catcac 686 14 2046 DNA Artificial
Sequence Description of Artificial Sequence Alternative expression
cassette for a sense and antisense copy of the leader associated
with the R1 gene 14 ggtaccgaac catgcatctc aatcttaata ctaaaaaatg
caacaaaatt ctagtggagg 60 gaccagtacc agtacattag atattatctt
ttattactat aataatattt taattaacac 120 gagacatagg aatgtcaagt
ggtagcggta ggagggagtt ggttcagttt tttagatact 180 aggagacaga
accggagggg cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa 240
caaagagagg gcccataata ctgtcgatga gcatttccct ataatacagt gtccacagtt
300 gccttccgct aagggatagc cacccgctat tctcttgaca cgtgtcactg
aaacctgcta 360 caaataaggc aggcacctcc tcattctcac actcactcac
tcacacagct caagaaggat 420 cctcatattc tagttgtatg ttgttcagag
aagaccacag atgtgatcat attctcattg 480 tatcagatct gtgaccactt
acctgatacc tcccatgaag ttacctgtat gattatacgt 540 gatccaaagc
catcacatca tgttcacctt cagctattgg aggagaagtg agaagtagga 600
attgcaatat gaggaataat aagaaaaact ttgtaaaagc taaattagct gggtatgata
660 tagggagaaa tgtgtaaaca ttgtactata tatagtatat acacacgcat
tatgtattgc 720 attatgcact gaataatacc gcagcatcaa agaaggaatt
caaggttaga aatcttctct 780 atttttggtt tttgtctgtt tagattctcg
aattagctaa tcaggtgctg ttatagccct 840 taattttgag ttttttttcg
gttgttttga tggaaaaggc ctaaaatttg agttttttta 900 cgttggtttg
atggaaaagg cctacaattg gagttttccc cgttgttttg atgaaaaagc 960
ccctagtttg agattttttt tctgtcgatt cgattctaaa ggtttaaaat tagagttttt
1020 acatttgttt gatgaaaaag gccttaaatt tgagtttttc cggttgattt
gatgaaaaag 1080 ccctagaatt tgtgtttttt cgtcggtttg attctgaagg
cctaaaattt gagtttctcc 1140 ggctgttttg atgaaaaagc cctaaatttg
agtttctccg gctgttttga tgaaaaagcc 1200 ctaaatttga gttttttccc
cgtgttttag attgtttggt tttaattctc gaatcagcta 1260 atcagggagt
gtgaaaagcc ctaaaatttg agtttttttc gttgttctga ttgttgtttt 1320
tatgaatttg cagatggata tccttctttg atgctgcggt attattcagt gcataatgca
1380 atacataatg cgtgtgtata tactatatat agtacaatgt ttacacattt
ctccctatat 1440 catacccagc taatttagct tttacaaagt ttttcttatt
attcctcata ttgcaattcc 1500 tacttctcac ttctcctcca atagctgaag
gtgaacatga tgtgatggct ttggatcacg 1560 tataatcata caggtaactt
catgggaggt atcaggtaag tggtcacaga tctgatacaa 1620 tgagaatatg
atcacatctg tggtcttctc tgaacaacat acaactagaa tatgaaagct 1680
tttgatttta atgtttagca aatgtcctat cagttttctc tttttgtcga acggtaattt
1740 agagtttttt ttgctatatg gattttcgtt tttgatgtat gtgacaaccc
tcgggattgt 1800 tgatttattt caaaactaag agtttttgct tattgttctc
gtctattttg gatatcaatc 1860 ttagttttat atcttttcta gttctctacg
tgttaaatgt tcaacacact agcaatttgg 1920 ctgcagcgta tggattatgg
aactatcaag tctgtgggat cgataaatat gcttctcagg 1980 aatttgagat
tttacagtct ttatgctcat tgggttgagt ataatatagt aaaaaaatag 2040 tctaga
2046 15 1714 DNA Artificial Sequence Description of Artificial
Sequence Alternative expression cassette for a sense and antisense
copy of the leader associated with the R1 gene 15 ggtaccgaac
catgcatctc aatcttaata ctaaaaaatg caacaaaatt ctagtggagg 60
gaccagtacc agtacattag atattatctt ttattactat aataatattt taattaacac
120 gagacatagg aatgtcaagt ggtagcggta ggagggagtt ggttcagttt
tttagatact 180 aggagacaga accggagggg cccattgcaa ggcccaagtt
gaagtccagc cgtgaatcaa 240 caaagagagg gcccataata ctgtcgatga
gcatttccct ataatacagt gtccacagtt 300 gccttccgct aagggatagc
cacccgctat tctcttgaca cgtgtcactg aaacctgcta 360 caaataaggc
aggcacctcc tcattctcac actcactcac tcacacagct caagaaggat 420
cctcatattc tagttgtatg ttgttcagag aagaccacag atgtgatcat attctcattg
480 tatcagatct gtgaccactt acctgatacc tcccatgaag ttacctgtat
gattatacgt 540 gatccaaagc catcacatca tgttcacctt cagctattgg
aggagaagtg agaagtagga 600 attgcaatat gaggaataat aagaaaaact
ttgtaaaagc taaattagct gggtatgata 660 tagggagaaa tgtgtaaaca
ttgtactata tatagtatat acacacgcat tatgtattgc 720 attatgcact
gaataatacc gcagcatcaa agaaggaatt cgtggtaact tttactcatc 780
tcctccaatt atttctgatt tcatgcatgt ttccctacat tctattatga atcgtgttat
840 ggtgtataaa cgttgtttca tatctcatct catctattct gattttgatt
ctcttgccta 900 ctgaatttga ccctactgta atcggtgata aatgtgaatg
cttcctcttc ttcttcttct 960 tctcagaaat caatttctgt tttgtttttg
ttcatctgta gcttgatatc cttctttgat 1020 gctgcggtat tattcagtgc
ataatgcaat acataatgcg tgtgtatata ctatatatag 1080 tacaatgttt
acacatttct ccctatatca tacccagcta atttagcttt tacaaagttt 1140
ttcttattat tcctcatatt gcaattccta cttctcactt ctcctccaat agctgaaggt
1200 gaacatgatg tgatggcttt ggatcacgta taatcataca ggtaacttca
tgggaggtat 1260 caggtaagtg gtcacagatc tgatacaatg agaatatgat
cacatctgtg gtcttctctg 1320 aacaacatac aactagaata tgaaagcttt
tgattttaat gtttagcaaa tgtcctatca 1380 gttttctctt tttgtcgaac
ggtaatttag agtttttttt gctatatgga ttttcgtttt 1440 tgatgtatgt
gacaaccctc gggattgttg atttatttca aaactaagag tttttgctta 1500
ttgttctcgt ctattttgga tatcaatctt agttttatat cttttctagt tctctacgtg
1560 ttaaatgttc aacacactag caatttggct gcagcgtatg gattatggaa
ctatcaagtc 1620 tgtgggatcg ataaatatgc ttctcaggaa tttgagattt
tacagtcttt atgctcattg 1680 ggttgagtat aatatagtaa aaaaatagtc taga
1714 16 333 DNA Solanum tuberosum 16 tcatattcta gttgtatgtt
gttcagagaa gaccacagat gtgatcatat tctcattgta 60 tcagatctgt
gaccacttac ctgatacctc ccatgaagtt acctgtatga ttatacgtga 120
tccaaagcca tcacatcatg ttcaccttca gctattggag gagaagtgag aagtaggaat
180 tgcaatatga ggaataataa gaaaaacttt gtaaaagcta aattagctgg
gtatgatata 240 gggagaaatg tgtaaacatt gtactatata tagtatatac
acacgcatta tgtattgcat 300 tatgcactga ataataccgc agcatcaaag aag 333
17 2046 DNA Artificial Sequence Description of Artificial Sequence
Alternative expression cassette for a sense and antisense copy of
the trailer associated with the R1 gene 17 ggtaccgaac catgcatctc
aatcttaata ctaaaaaatg caacaaaatt ctagtggagg 60 gaccagtacc
agtacattag atattatctt ttattactat aataatattt taattaacac 120
gagacatagg aatgtcaagt ggtagcggta ggagggagtt ggttcagttt tttagatact
180 aggagacaga accggagggg cccattgcaa ggcccaagtt gaagtccagc
cgtgaatcaa 240 caaagagagg gcccataata ctgtcgatga gcatttccct
ataatacagt gtccacagtt 300 gccttccgct aagggatagc cacccgctat
tctcttgaca cgtgtcactg aaacctgcta 360 caaataaggc aggcacctcc
tcattctcac actcactcac tcacacagct caagaaggat 420 cctcatattc
tagttgtatg ttgttcagag aagaccacag atgtgatcat attctcattg 480
tatcagatct gtgaccactt acctgatacc tcccatgaag ttacctgtat gattatacgt
540 gatccaaagc catcacatca tgttcacctt cagctattgg aggagaagtg
agaagtagga 600 attgcaatat gaggaataat aagaaaaact ttgtaaaagc
taaattagct gggtatgata 660 tagggagaaa tgtgtaaaca ttgtactata
tatagtatat acacacgcat tatgtattgc 720 attatgcact gaataatacc
gcagcatcaa agaaggaatt caaggttaga aatcttctct 780 atttttggtt
tttgtctgtt tagattctcg aattagctaa tcaggtgctg ttatagccct 840
taattttgag ttttttttcg gttgttttga tggaaaaggc ctaaaatttg agttttttta
900 cgttggtttg atggaaaagg cctacaattg gagttttccc cgttgttttg
atgaaaaagc 960 ccctagtttg agattttttt tctgtcgatt cgattctaaa
ggtttaaaat tagagttttt 1020 acatttgttt gatgaaaaag gccttaaatt
tgagtttttc cggttgattt gatgaaaaag 1080 ccctagaatt tgtgtttttt
cgtcggtttg attctgaagg cctaaaattt gagtttctcc 1140 ggctgttttg
atgaaaaagc cctaaatttg agtttctccg gctgttttga tgaaaaagcc 1200
ctaaatttga gttttttccc cgtgttttag attgtttggt tttaattctc gaatcagcta
1260 atcagggagt gtgaaaagcc ctaaaatttg agtttttttc gttgttctga
ttgttgtttt 1320 tatgaatttg cagatggata tccttctttg atgctgcggt
attattcagt gcataatgca 1380 atacataatg cgtgtgtata tactatatat
agtacaatgt ttacacattt ctccctatat 1440 catacccagc taatttagct
tttacaaagt ttttcttatt attcctcata ttgcaattcc 1500 tacttctcac
ttctcctcca atagctgaag gtgaacatga tgtgatggct ttggatcacg 1560
tataatcata caggtaactt catgggaggt atcaggtaag tggtcacaga tctgatacaa
1620 tgagaatatg atcacatctg tggtcttctc tgaacaacat acaactagaa
tatgaaagct 1680 tttgatttta atgtttagca aatgtcctat cagttttctc
tttttgtcga acggtaattt 1740 agagtttttt ttgctatatg gattttcgtt
tttgatgtat gtgacaaccc tcgggattgt 1800 tgatttattt caaaactaag
agtttttgct tattgttctc gtctattttg gatatcaatc 1860 ttagttttat
atcttttcta gttctctacg tgttaaatgt tcaacacact agcaatttgg 1920
ctgcagcgta tggattatgg aactatcaag tctgtgggat cgataaatat gcttctcagg
1980 aatttgagat tttacagtct ttatgctcat tgggttgagt ataatatagt
aaaaaaatag 2040 tctaga 2046 18 1714 DNA Artificial Sequence
Description of Artificial Sequence Alternative expression cassette
for a sense and antisense copy of the trailer associated with the
R1 gene 18 ggtaccgaac catgcatctc aatcttaata ctaaaaaatg caacaaaatt
ctagtggagg 60 gaccagtacc agtacattag atattatctt ttattactat
aataatattt taattaacac 120 gagacatagg aatgtcaagt ggtagcggta
ggagggagtt ggttcagttt tttagatact 180 aggagacaga accggagggg
cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa 240 caaagagagg
gcccataata ctgtcgatga gcatttccct ataatacagt gtccacagtt 300
gccttccgct aagggatagc cacccgctat tctcttgaca cgtgtcactg aaacctgcta
360 caaataaggc aggcacctcc tcattctcac actcactcac tcacacagct
caagaaggat 420 cctcatattc tagttgtatg ttgttcagag aagaccacag
atgtgatcat attctcattg 480 tatcagatct gtgaccactt acctgatacc
tcccatgaag ttacctgtat gattatacgt 540 gatccaaagc catcacatca
tgttcacctt cagctattgg aggagaagtg agaagtagga 600 attgcaatat
gaggaataat aagaaaaact ttgtaaaagc taaattagct gggtatgata 660
tagggagaaa tgtgtaaaca ttgtactata tatagtatat acacacgcat tatgtattgc
720 attatgcact gaataatacc gcagcatcaa agaaggaatt cgtggtaact
tttactcatc 780 tcctccaatt atttctgatt tcatgcatgt ttccctacat
tctattatga atcgtgttat 840 ggtgtataaa cgttgtttca tatctcatct
catctattct gattttgatt ctcttgccta 900 ctgaatttga ccctactgta
atcggtgata aatgtgaatg cttcctcttc ttcttcttct 960 tctcagaaat
caatttctgt tttgtttttg ttcatctgta gcttgatatc cttctttgat 1020
gctgcggtat tattcagtgc ataatgcaat acataatgcg tgtgtatata ctatatatag
1080 tacaatgttt acacatttct ccctatatca tacccagcta atttagcttt
tacaaagttt 1140 ttcttattat tcctcatatt gcaattccta cttctcactt
ctcctccaat agctgaaggt 1200 gaacatgatg tgatggcttt ggatcacgta
taatcataca ggtaacttca tgggaggtat 1260 caggtaagtg gtcacagatc
tgatacaatg agaatatgat cacatctgtg gtcttctctg 1320 aacaacatac
aactagaata tgaaagcttt tgattttaat gtttagcaaa tgtcctatca 1380
gttttctctt tttgtcgaac ggtaatttag agtttttttt gctatatgga ttttcgtttt
1440 tgatgtatgt gacaaccctc gggattgttg atttatttca aaactaagag
tttttgctta 1500 ttgttctcgt ctattttgga tatcaatctt agttttatat
cttttctagt tctctacgtg 1560 ttaaatgttc aacacactag caatttggct
gcagcgtatg gattatggaa ctatcaagtc 1620 tgtgggatcg ataaatatgc
ttctcaggaa tttgagattt tacagtcttt atgctcattg 1680 ggttgagtat
aatatagtaa aaaaatagtc taga 1714 19 2322 DNA Artificial Sequence
Description of Artificial Sequence Alternative expression cassette
for a sense and antisense copy of the trailer associated with the
R1 gene 19 ggtaccgaac catgcatctc aatcttaata ctaaaaaatg caacaaaatt
ctagtggagg 60 gaccagtacc agtacattag atattatctt ttattactat
aataatattt taattaacac 120 gagacatagg aatgtcaagt ggtagcggta
ggagggagtt ggttcagttt tttagatact 180 aggagacaga accggagggg
cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa 240 caaagagagg
gcccataata ctgtcgatga gcatttccct ataatacagt gtccacagtt 300
gccttccgct aagggatagc cacccgctat tctcttgaca cgtgtcactg aaacctgcta
360 caaataaggc aggcacctcc tcattctcac actcactcac tcacacagct
caacaagtgg 420 taacttttac tcatctcctc caattatttc tgatttcatg
catgtttccc tacattctat 480 tatgaatcgt gttatggtgt ataaacgttg
tttcatatct catctcatct attctgattt 540 tgattctctt gcctactgaa
tttgacccta ctgtaatcgg tgataaatgt gaatgcttcc 600
tcttcttctt cttcttctca gaaatcaatt tctgttttgt ttttgttcat ctgtagcttg
660 gtagattccc ctttttgtag accacacatc acggatcctc atattctagt
tgtatgttgt 720 tcagagaaga ccacagatgt gatcatattc tcattgtatc
agatctgtga ccacttacct 780 gatacctccc atgaagttac ctgtatgatt
atacgtgatc caaagccatc acatcatgtt 840 caccttcagc tattggagga
gaagtgagaa gtaggaattg caatatgagg aataataaga 900 aaaactttgt
aaaagctaaa ttagctgggt atgatatagg gagaaatgtg taaacattgt 960
actatatata gtatatacac acgcattatg tattgcatta tgcactgaat aataccgcag
1020 catcaaagaa ggaattcaag gttagaaatc ttctctattt ttggtttttg
tctgtttaga 1080 ttctcgaatt agctaatcag gtgctgttat agcccttaat
tttgagtttt ttttcggttg 1140 ttttgatgga aaaggcctaa aatttgagtt
tttttacgtt ggtttgatgg aaaaggccta 1200 caattggagt tttccccgtt
gttttgatga aaaagcccct agtttgagat tttttttctg 1260 tcgattcgat
tctaaaggtt taaaattaga gtttttacat ttgtttgatg aaaaaggcct 1320
taaatttgag tttttccggt tgatttgatg aaaaagccct agaatttgtg ttttttcgtc
1380 ggtttgattc tgaaggccta aaatttgagt ttctccggct gttttgatga
aaaagcccta 1440 aatttgagtt tctccggctg ttttgatgaa aaagccctaa
atttgagttt tttccccgtg 1500 ttttagattg tttggtttta attctcgaat
cagctaatca gggagtgtga aaagccctaa 1560 aatttgagtt tttttcgttg
ttctgattgt tgtttttatg aatttgcaga tggatatcct 1620 tctttgatgc
tgcggtatta ttcagtgcat aatgcaatac ataatgcgtg tgtatatact 1680
atatatagta caatgtttac acatttctcc ctatatcata cccagctaat ttagctttta
1740 caaagttttt cttattattc ctcatattgc aattcctact tctcacttct
cctccaatag 1800 ctgaaggtga acatgatgtg atggctttgg atcacgtata
atcatacagg taacttcatg 1860 ggaggtatca ggtaagtggt cacagatctg
atacaatgag aatatgatca catctgtggt 1920 cttctctgaa caacatacaa
ctagaatatg aaagcttttg attttaatgt ttagcaaatg 1980 tcctatcagt
tttctctttt tgtcgaacgg taatttagag ttttttttgc tatatggatt 2040
ttcgtttttg atgtatgtga caaccctcgg gattgttgat ttatttcaaa actaagagtt
2100 tttgcttatt gttctcgtct attttggata tcaatcttag ttttatatct
tttctagttc 2160 tctacgtgtt aaatgttcaa cacactagca atttggctgc
agcgtatgga ttatggaact 2220 atcaagtctg tgggatcgat aaatatgctt
ctcaggaatt tgagatttta cagtctttat 2280 gctcattggg ttgagtataa
tatagtaaaa aaatagtcta ga 2322 20 1714 DNA Artificial Sequence
Description of Artificial Sequence Alternative expression cassette
for a sense and antisense copy of the trailer associated with the
R1 gene 20 ggtaccgaac catgcatctc aatcttaata ctaaaaaatg caacaaaatt
ctagtggagg 60 gaccagtacc agtacattag atattatctt ttattactat
aataatattt taattaacac 120 gagacatagg aatgtcaagt ggtagcggta
ggagggagtt ggttcagttt tttagatact 180 aggagacaga accggagggg
cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa 240 caaagagagg
gcccataata ctgtcgatga gcatttccct ataatacagt gtccacagtt 300
gccttccgct aagggatagc cacccgctat tctcttgaca cgtgtcactg aaacctgcta
360 caaataaggc aggcacctcc tcattctcac actcactcac tcacacagct
caagaaggat 420 cctcatattc tagttgtatg ttgttcagag aagaccacag
atgtgatcat attctcattg 480 tatcagatct gtgaccactt acctgatacc
tcccatgaag ttacctgtat gattatacgt 540 gatccaaagc catcacatca
tgttcacctt cagctattgg aggagaagtg agaagtagga 600 attgcaatat
gaggaataat aagaaaaact ttgtaaaagc taaattagct gggtatgata 660
tagggagaaa tgtgtaaaca ttgtactata tatagtatat acacacgcat tatgtattgc
720 attatgcact gaataatacc gcagcatcaa agaaggaatt cgtggtaact
tttactcatc 780 tcctccaatt atttctgatt tcatgcatgt ttccctacat
tctattatga atcgtgttat 840 ggtgtataaa cgttgtttca tatctcatct
catctattct gattttgatt ctcttgccta 900 ctgaatttga ccctactgta
atcggtgata aatgtgaatg cttcctcttc ttcttcttct 960 tctcagaaat
caatttctgt tttgtttttg ttcatctgta gcttgatatc cttctttgat 1020
gctgcggtat tattcagtgc ataatgcaat acataatgcg tgtgtatata ctatatatag
1080 tacaatgttt acacatttct ccctatatca tacccagcta atttagcttt
tacaaagttt 1140 ttcttattat tcctcatatt gcaattccta cttctcactt
ctcctccaat agctgaaggt 1200 gaacatgatg tgatggcttt ggatcacgta
taatcataca ggtaacttca tgggaggtat 1260 caggtaagtg gtcacagatc
tgatacaatg agaatatgat cacatctgtg gtcttctctg 1320 aacaacatac
aactagaata tgaaagcttt tgattttaat gtttagcaaa tgtcctatca 1380
gttttctctt tttgtcgaac ggtaatttag agtttttttt gctatatgga ttttcgtttt
1440 tgatgtatgt gacaaccctc gggattgttg atttatttca aaactaagag
tttttgctta 1500 ttgttctcgt ctattttgga tatcaatctt agttttatat
cttttctagt tctctacgtg 1560 ttaaatgttc aacacactag caatttggct
gcagcgtatg gattatggaa ctatcaagtc 1620 tgtgggatcg ataaatatgc
ttctcaggaa tttgagattt tacagtcttt atgctcattg 1680 ggttgagtat
aatatagtaa aaaaatagtc taga 1714 21 273 DNA Solanum tuberosum 21
ttagagtgtg ggtaagtaat taagttaggg atttgtggga aatggacaaa tataagagag
60 tgcaggggag tagtgcagga gattttcgtg cttttattga taaataaaaa
aagggtgaca 120 tttaatttcc acaagaggac gcaacacaac acacttaatt
cctgtgtgtg aatcaataat 180 tgacttctcc aatcttcatc aataaaataa
ttcacaatcc tcactctctt atcactctca 240 ttcgaaaagc tagatttgca
tagagagcac aaa 273 22 158 DNA Solanum tuberosum 22 gagggggaag
tgaatgaaaa ataacaaagg cacagtaagt agtttctctt tttatcatgt 60
gatgaaggta tataatgtat gtgtaagagg atgatgttat taccacataa taagagatga
120 agagtctcat tttctgctta aaaaaacaat tcactggc 158 23 1917 DNA
Artificial Sequence Description of Artificial Sequence Expression
cassette for a sense and antisense copy of the leader associated
with the L glucan phosphorylase gene 23 ggtaccgaac catgcatctc
aatcttaata ctaaaaaatg caacaaaatt ctagtggagg 60 gaccagtacc
agtacattag atattatctt ttattactat aataatattt taattaacac 120
gagacatagg aatgtcaagt ggtagcggta ggagggagtt ggttcagttt tttagatact
180 aggagacaga accggagggg cccattgcaa ggcccaagtt gaagtccagc
cgtgaatcaa 240 caaagagagg gcccataata ctgtcgatga gcatttccct
ataatacagt gtccacagtt 300 gccttccgct aagggatagc cacccgctat
tctcttgaca cgtgtcactg aaacctgcta 360 caaataaggc aggcacctcc
tcattctcac actcactcac tcacacagct caagaaggat 420 ccgagtgtgg
gtaagtaatt aagttaggga tttgtgggaa atggacaaat ataagagagt 480
gcaggggagt agtgcaggag attttcgtgc ttttattgat aaataaaaaa agggtgacat
540 ttaatttcca caagaggacg caacacaaca cacttaattc ctgtgtgtga
atcaataatt 600 gacttctcca atcttcatca ataaaataat tcacaatcct
cactctctta tcactctcat 660 tcgaaaagct agatttgcat agagagcaca
gaattcaagg ttagaaatct tctctatttt 720 tggtttttgt ctgtttagat
tctcgaatta gctaatcagg tgctgttata gcccttaatt 780 ttgagttttt
tttcggttgt tttgatggaa aaggcctaaa atttgagttt ttttacgttg 840
gtttgatgga aaaggcctac aattggagtt ttccccgttg ttttgatgaa aaagccccta
900 gtttgagatt ttttttctgt cgattcgatt ctaaaggttt aaaattagag
tttttacatt 960 tgtttgatga aaaaggcctt aaatttgagt ttttccggtt
gatttgatga aaaagcccta 1020 gaatttgtgt tttttcgtcg gtttgattct
gaaggcctaa aatttgagtt tctccggctg 1080 ttttgatgaa aaagccctaa
atttgagttt ctccggctgt tttgatgaaa aagccctaaa 1140 tttgagtttt
ttccccgtgt tttagattgt ttggttttaa ttctcgaatc agctaatcag 1200
ggagtgtgaa aagccctaaa atttgagttt ttttcgttgt tctgattgtt gtttttatga
1260 atttgcagat ggatatctgt gctctctatg caaatctagc ttttcgaatg
agagtgataa 1320 gagagtgagg attgtgaatt attttattga tgaagattgg
agaagtcaat tattgattca 1380 cacacaggaa ttaagtgtgt tgtgttgcgt
cctcttgtgg aaattaaatg tcaccctttt 1440 tttatttatc aataaaagca
cgaaaatctc ctgcactact cccctgcact ctcttatatt 1500 tgtccatttc
ccacaaatcc ctaacttaat tacttaccca cactctaagc ttttgatttt 1560
aatgtttagc aaatgtccta tcagttttct ctttttgtcg aacggtaatt tagagttttt
1620 tttgctatat ggattttcgt ttttgatgta tgtgacaacc ctcgggattg
ttgatttatt 1680 tcaaaactaa gagtttttgc ttattgttct cgtctatttt
ggatatcaat cttagtttta 1740 tatcttttct agttctctac gtgttaaatg
ttcaacacac tagcaatttg gctgcagcgt 1800 atggattatg gaactatcaa
gtctgtggga tcgataaata tgcttctcag gaatttgaga 1860 ttttacagtc
tttatgctca ttgggttgag tataatatag taaaaaaata gtctaga 1917 24 1585
DNA Artificial Sequence Description of Artificial Sequence
Alternative expression cassette for a sense and antisense copy of
the leader associated with the L glucan phosphorylase gene 24
ggtaccgaac catgcatctc aatcttaata ctaaaaaatg caacaaaatt ctagtggagg
60 gaccagtacc agtacattag atattatctt ttattactat aataatattt
taattaacac 120 gagacatagg aatgtcaagt ggtagcggta ggagggagtt
ggttcagttt tttagatact 180 aggagacaga accggagggg cccattgcaa
ggcccaagtt gaagtccagc cgtgaatcaa 240 caaagagagg gcccataata
ctgtcgatga gcatttccct ataatacagt gtccacagtt 300 gccttccgct
aagggatagc cacccgctat tctcttgaca cgtgtcactg aaacctgcta 360
caaataaggc aggcacctcc tcattctcac actcactcac tcacacagct caagaaggat
420 ccgagtgtgg gtaagtaatt aagttaggga tttgtgggaa atggacaaat
ataagagagt 480 gcaggggagt agtgcaggag attttcgtgc ttttattgat
aaataaaaaa agggtgacat 540 ttaatttcca caagaggacg caacacaaca
cacttaattc ctgtgtgtga atcaataatt 600 gacttctcca atcttcatca
ataaaataat tcacaatcct cactctctta tcactctcat 660 tcgaaaagct
agatttgcat agagagcaca gaattcgtgg taacttttac tcatctcctc 720
caattatttc tgatttcatg catgtttccc tacattctat tatgaatcgt gttatggtgt
780 ataaacgttg tttcatatct catctcatct attctgattt tgattctctt
gcctactgaa 840 tttgacccta ctgtaatcgg tgataaatgt gaatgcttcc
tcttcttctt cttcttctca 900 gaaatcaatt tctgttttgt ttttgttcat
ctgtagcttg atatctgtgc tctctatgca 960 aatctagctt ttcgaatgag
agtgataaga gagtgaggat tgtgaattat tttattgatg 1020 aagattggag
aagtcaatta ttgattcaca cacaggaatt aagtgtgttg tgttgcgtcc 1080
tcttgtggaa attaaatgtc accctttttt tatttatcaa taaaagcacg aaaatctcct
1140 gcactactcc cctgcactct cttatatttg tccatttccc acaaatccct
aacttaatta 1200 cttacccaca ctctaagctt ttgattttaa tgtttagcaa
atgtcctatc agttttctct 1260 ttttgtcgaa cggtaattta gagttttttt
tgctatatgg attttcgttt ttgatgtatg 1320 tgacaaccct cgggattgtt
gatttatttc aaaactaaga gtttttgctt attgttctcg 1380 tctattttgg
atatcaatct tagttttata tcttttctag ttctctacgt gttaaatgtt 1440
caacacacta gcaatttggc tgcagcgtat ggattatgga actatcaagt ctgtgggatc
1500 gataaatatg cttctcagga atttgagatt ttacagtctt tatgctcatt
gggttgagta 1560 taatatagta aaaaaatagt ctaga 1585 25 2193 DNA
Artificial Sequence Description of Artificial Sequence Alternative
expression cassette for a sense and antisense copy of the leader
associated with the L glucan phosphorylase gene 25 ggtaccgaac
catgcatctc aatcttaata ctaaaaaatg caacaaaatt ctagtggagg 60
gaccagtacc agtacattag atattatctt ttattactat aataatattt taattaacac
120 gagacatagg aatgtcaagt ggtagcggta ggagggagtt ggttcagttt
tttagatact 180 aggagacaga accggagggg cccattgcaa ggcccaagtt
gaagtccagc cgtgaatcaa 240 caaagagagg gcccataata ctgtcgatga
gcatttccct ataatacagt gtccacagtt 300 gccttccgct aagggatagc
cacccgctat tctcttgaca cgtgtcactg aaacctgcta 360 caaataaggc
aggcacctcc tcattctcac actcactcac tcacacagct caacaagtgg 420
taacttttac tcatctcctc caattatttc tgatttcatg catgtttccc tacattctat
480 tatgaatcgt gttatggtgt ataaacgttg tttcatatct catctcatct
attctgattt 540 tgattctctt gcctactgaa tttgacccta ctgtaatcgg
tgataaatgt gaatgcttcc 600 tcttcttctt cttcttctca gaaatcaatt
tctgttttgt ttttgttcat ctgtagcttg 660 gtagattccc ctttttgtag
accacacatc acggatccga gtgtgggtaa gtaattaagt 720 tagggatttg
tgggaaatgg acaaatataa gagagtgcag gggagtagtg caggagattt 780
tcgtgctttt attgataaat aaaaaaaggg tgacatttaa tttccacaag aggacgcaac
840 acaacacact taattcctgt gtgtgaatca ataattgact tctccaatct
tcatcaataa 900 aataattcac aatcctcact ctcttatcac tctcattcga
aaagctagat ttgcatagag 960 agcacagaat tcaaggttag aaatcttctc
tatttttggt ttttgtctgt ttagattctc 1020 gaattagcta atcaggtgct
gttatagccc ttaattttga gttttttttc ggttgttttg 1080 atggaaaagg
cctaaaattt gagttttttt acgttggttt gatggaaaag gcctacaatt 1140
ggagttttcc ccgttgtttt gatgaaaaag cccctagttt gagatttttt ttctgtcgat
1200 tcgattctaa aggtttaaaa ttagagtttt tacatttgtt tgatgaaaaa
ggccttaaat 1260 ttgagttttt ccggttgatt tgatgaaaaa gccctagaat
ttgtgttttt tcgtcggttt 1320 gattctgaag gcctaaaatt tgagtttctc
cggctgtttt gatgaaaaag ccctaaattt 1380 gagtttctcc ggctgttttg
atgaaaaagc cctaaatttg agttttttcc ccgtgtttta 1440 gattgtttgg
ttttaattct cgaatcagct aatcagggag tgtgaaaagc cctaaaattt 1500
gagttttttt cgttgttctg attgttgttt ttatgaattt gcagatggat atctgtgctc
1560 tctatgcaaa tctagctttt cgaatgagag tgataagaga gtgaggattg
tgaattattt 1620 tattgatgaa gattggagaa gtcaattatt gattcacaca
caggaattaa gtgtgttgtg 1680 ttgcgtcctc ttgtggaaat taaatgtcac
ccttttttta tttatcaata aaagcacgaa 1740 aatctcctgc actactcccc
tgcactctct tatatttgtc catttcccac aaatccctaa 1800 cttaattact
tacccacact ctaagctttt gattttaatg tttagcaaat gtcctatcag 1860
ttttctcttt ttgtcgaacg gtaatttaga gttttttttg ctatatggat tttcgttttt
1920 gatgtatgtg acaaccctcg ggattgttga tttatttcaa aactaagagt
ttttgcttat 1980 tgttctcgtc tattttggat atcaatctta gttttatatc
ttttctagtt ctctacgtgt 2040 taaatgttca acacactagc aatttggctg
cagcgtatgg attatggaac tatcaagtct 2100 gtgggatcga taaatatgct
tctcaggaat ttgagatttt acagtcttta tgctcattgg 2160 gttgagtata
atatagtaaa aaaatagtct aga 2193 26 1861 DNA Artificial Sequence
Description of Artificial Sequence Alternative expression cassette
for a sense and antisense copy of the leader associated with the L
glucan phosphorylase gene 26 ggtaccgaac catgcatctc aatcttaata
ctaaaaaatg caacaaaatt ctagtggagg 60 gaccagtacc agtacattag
atattatctt ttattactat aataatattt taattaacac 120 gagacatagg
aatgtcaagt ggtagcggta ggagggagtt ggttcagttt tttagatact 180
aggagacaga accggagggg cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa
240 caaagagagg gcccataata ctgtcgatga gcatttccct ataatacagt
gtccacagtt 300 gccttccgct aagggatagc cacccgctat tctcttgaca
cgtgtcactg aaacctgcta 360 caaataaggc aggcacctcc tcattctcac
actcactcac tcacacagct caacaagtgg 420 taacttttac tcatctcctc
caattatttc tgatttcatg catgtttccc tacattctat 480 tatgaatcgt
gttatggtgt ataaacgttg tttcatatct catctcatct attctgattt 540
tgattctctt gcctactgaa tttgacccta ctgtaatcgg tgataaatgt gaatgcttcc
600 tcttcttctt cttcttctca gaaatcaatt tctgttttgt ttttgttcat
ctgtagcttg 660 gtagattccc ctttttgtag accacacatc acggatccga
gtgtgggtaa gtaattaagt 720 tagggatttg tgggaaatgg acaaatataa
gagagtgcag gggagtagtg caggagattt 780 tcgtgctttt attgataaat
aaaaaaaggg tgacatttaa tttccacaag aggacgcaac 840 acaacacact
taattcctgt gtgtgaatca ataattgact tctccaatct tcatcaataa 900
aataattcac aatcctcact ctcttatcac tctcattcga aaagctagat ttgcatagag
960 agcacagaat tcgtggtaac ttttactcat ctcctccaat tatttctgat
ttcatgcatg 1020 tttccctaca ttctattatg aatcgtgtta tggtgtataa
acgttgtttc atatctcatc 1080 tcatctattc tgattttgat tctcttgcct
actgaatttg accctactgt aatcggtgat 1140 aaatgtgaat gcttcctctt
cttcttcttc ttctcagaaa tcaatttctg ttttgttttt 1200 gttcatctgt
agcttgatat ctgtgctctc tatgcaaatc tagcttttcg aatgagagtg 1260
ataagagagt gaggattgtg aattatttta ttgatgaaga ttggagaagt caattattga
1320 ttcacacaca ggaattaagt gtgttgtgtt gcgtcctctt gtggaaatta
aatgtcaccc 1380 tttttttatt tatcaataaa agcacgaaaa tctcctgcac
tactcccctg cactctctta 1440 tatttgtcca tttcccacaa atccctaact
taattactta cccacactct aagcttttga 1500 ttttaatgtt tagcaaatgt
cctatcagtt ttctcttttt gtcgaacggt aatttagagt 1560 tttttttgct
atatggattt tcgtttttga tgtatgtgac aaccctcggg attgttgatt 1620
tatttcaaaa ctaagagttt ttgcttattg ttctcgtcta ttttggatat caatcttagt
1680 tttatatctt ttctagttct ctacgtgtta aatgttcaac acactagcaa
tttggctgca 1740 gcgtatggat tatggaacta tcaagtctgt gggatcgata
aatatgcttc tcaggaattt 1800 gagattttac agtctttatg ctcattgggt
tgagtataat atagtaaaaa aatagtctag 1860 a 1861 27 1788 DNA Solanum
tuberosum 27 atggcaagct tgtgcaatag tagtagtaca tctctcaaaa ctccttttac
ttcttcctcc 60 acttctttat cttccactcc taagccctct caacttttca
tccatggaaa acgtaaccaa 120 atgttcaaag tttcatgcaa ggttatcaat
aataacggtg accaaaacgt tgaaacgaat 180 tctgttgatc gaagaaatgt
tcttcttggc ttaggtggtc tttatggtgt tgctaatgct 240 ataccattag
ctgcatccgc tgctccaact ccacctcctg atctctcgtc ttgtagtata 300
gccaggatta acgaaaatca ggtggtgccg tacagttgtt gcgcgcctaa gcctgatgat
360 atggagaaag ttccgtatta caagttccct tctatgacta agctccgtgt
ccgtcagcct 420 gctcatgaag ctaatgagga gtatattgcc aagtacaatc
tggcgattag tcgaatgaga 480 gatcttgata agacacaacc tttaaaccct
attggtttta agcaacaagc taatatacat 540 tgtgcttatt gtaatggtgc
ttatagaatt ggtggcaaag agttacaagt tcataattct 600 tggcttttct
tcccgttcca tagatggtac ttgtacttcc acgagagaat cgtgggaaaa 660
ttcattgatg atccaacttt cgctttgcca tattggaatt gggaccatcc aaagggtatg
720 cgttttcctg ccatgtatga tcgtgaaggg acttcccttt tcgatgtaac
acgtgaccaa 780 agtcaccgaa atggagcagt aatcgatctt ggttttttcg
gcaatgaagt cgaaacaact 840 caactccagt tgatgagcaa taatttaaca
ctaatgtacc gtcaaatggt aactaatgct 900 ccatgtcctc ggatgttctt
tggtgggcct tatgatctcg ggattaacac tgaactcccg 960 ggaactatag
aaaacattcc tcacggtcct gtccacatct ggtctggtac agtgagaggt 1020
tcaactttgc ccaatggtgc aatatcaaac ggtgagaata tgggtcattt ttactcagct
1080 gctttggacc cggttttctt ttgccatcac agcaatgtgg atcggatgtg
gagcgaatgg 1140 aaagcgacag gagggaaaag aacagatatc acacataaag
gttggttgaa ctccgagttc 1200 tttttctatg atgaaaatga aaacccttac
cgtgtgaaag tccgagactg tttggacacg 1260 aagaagatgg ggtatgatta
tgcaccaatg gccaccccgt ggcgtaactt caagccaata 1320 acaaaaacta
cagctgggaa agtgaataca gcttctcttc cgccagctag caatgtattc 1380
ccagtggcta aactcgacaa agcaatttcg ttttccatca ataggccgac ttcgtcaagg
1440 actcaacaag agaaaaatgc acaagaggag atgttgacat tcagtagcat
aagatatgat 1500 aacagagggt acataaggtt cgatgtgttc ctgaacgtgg
acaataatgt gaatgcgaat 1560 gagcttgaca aggcggagtt tgcggggagt
tatactagtt tgccacatgt tcatagagct 1620 ggtgagacta atcatatcgc
gactgttgat ttccagctgg cgataacgga actgttggag 1680 gatattggtt
tggaagatga agatactatt gcggtgactc tggtgccaaa gagaggtggt 1740
gaaggtatct ccattgaaag tgcgacgatc agtcttgcag attgttaa 1788 28 1788
DNA Solanum tuberosum 28 atggcaagct tgtgcaatag tagtagtaca
tctctcaaaa ctccttttac ttcttcctcc 60 acttctttat cttccactcc
taagccctct caacttttca tccatggaaa acgtaaccaa 120 atgttcaaag
tttcatgcaa ggttatcaat aataacggtg accaaaacgt tgaaacgaat 180
tctgttgatc gaagaaatgt tcttcttggc ttaggtggtc tttatggtgt tgctaatgct
240 ataccattag ctgcatccgc tgctccaact ccacctcctg atctctcgtc
ttgtagtata 300 gccaggatta acgaaaatca ggtggtgccg tacagttgtt
gcgcgcctaa gcctgatgat 360 atggagaaag ttccgtatta caagttccct
tctatgacta agctccgtgt ccgtcagcct 420 gctcatgaag ctaatgagga
gtatattgcc aagtacaatc tggcgattag tcgaatgaga 480 gatcttgata
agacacaacc tttaaaccct attggtttta agcaacaagc taatatacag 540
tgggcttatg gtaatggtgc ttatagaatt ggtggcaaag agttacaagt tcataattct
600 tggcttttct tcccgttcca tagatggtac ttgtacttcc
acgagagaat cgtgggaaaa 660 ttcattgatg atccaacttt cgctttgcca
tattggaatt gggaccatcc aaagggtatg 720 cgttttcctg ccatgtatga
tcgtgaaggg acttcccttt tcgatgtaac acgtgaccaa 780 agtcaccgaa
atggagcagt aatcgatctt ggttttttcg gcaatgaagt cgaaacaact 840
caactccagt tgatgagcaa taatttaaca ctaatgtacc gtcaaatggt aactaatgct
900 ccatgtcctc ggatgttctt tggtgggcct tatgatctcg ggattaacac
tgaactcccg 960 ggaactatag gaaacattcc tctcggtcct gtccacatct
ggtctggtac agtgagaggt 1020 tcaactttgc ccaatggtgc aatatcaaac
ggtgagaata tgggtcattt ttactcagct 1080 gctttggacc cggttttctt
ttgccatcac agcaatgtgg atcggatgtg gagcgaatgg 1140 aaagcgacag
gagggaaaag aacagatatc acacataaag gttggttgaa ctccgagttc 1200
tttttctatg atgaaaatga aaacccttac cgtgtgaaag tccgagactg tttggacacg
1260 aagaagatgg ggtatgatta tgcaccaatg gccaccccgt ggcgtaactt
caagccaata 1320 acaaaaacta cagctgggaa agtgaataca gcttctcttc
cgccagctag caatgtattc 1380 ccagtggcta aactcgacaa agcaatttcg
ttttccatca ataggccgac ttcgtcaagg 1440 actcaacaag agaaaaatgc
acaagaggag atgttgacat tcagtagcat aagatatgat 1500 aacagagggt
acataaggtt cgatgtgttc ctgaacgtgg acaataatgt gaatgcgaat 1560
gagcttgaca aggcggagtt tgcggggagt tatactagtt tgccacatgt tcatagagct
1620 ggtgagacta atcatatcgc gactgttgat ttccagctgg cgataacgga
actgttggag 1680 gatattggtt tggaagatga agatactatt gcggtgactc
tggtgccaaa gagaggtggt 1740 gaaggtatct ccattgaaag tgcgacgatc
agtcttgcag attgttaa 1788 29 154 DNA Solanum tuberosum 29 ttagtctcta
ttgaatctgc tgagattaca ctttgatgga tgatgctctg tttttgtttt 60
cttgttctgt tttttcctct gttgaaatca gctttgttgc ttgatttcat tgaagttgtt
120 attcaagaat aaatcagtta caattatgtt tggg 154 30 1691 DNA
Artificial Sequence Description of Artificial Sequence Expression
cassette for a sense and antisense copy of the trailer associated
with a PPO gene 30 ggtaccgaac catgcatctc aatcttaata ctaaaaaatg
caacaaaatt ctagtggagg 60 gaccagtacc agtacattag atattatctt
ttattactat aataatattt taattaacac 120 gagacatagg aatgtcaagt
ggtagcggta ggagggagtt ggttcagttt tttagatact 180 aggagacaga
accggagggg cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa 240
caaagagagg gcccataata ctgtcgatga gcatttccct ataatacagt gtccacagtt
300 gccttccgct aagggatagc cacccgctat tctcttgaca cgtgtcactg
aaacctgcta 360 caaataaggc aggcacctcc tcattctcac actcactcac
tcacacagct caagaaggat 420 ccttagtctc tattgaatct gctgagatta
cactttgatg gatgatgctc tgtttttgtt 480 ttcttgttct gttttttcct
ctgttgaaat cagctttgtt gcttgatttc attgaagttg 540 ttattcaaga
ataaatcagt tacaattatg gaattcaagg ttagaaatct tctctatttt 600
tggtttttgt ctgtttagat tctcgaatta gctaatcagg tgctgttata gcccttaatt
660 ttgagttttt tttcggttgt tttgatggaa aaggcctaaa atttgagttt
ttttacgttg 720 gtttgatgga aaaggcctac aattggagtt ttccccgttg
ttttgatgaa aaagccccta 780 gtttgagatt ttttttctgt cgattcgatt
ctaaaggttt aaaattagag tttttacatt 840 tgtttgatga aaaaggcctt
aaatttgagt ttttccggtt gatttgatga aaaagcccta 900 gaatttgtgt
tttttcgtcg gtttgattct gaaggcctaa aatttgagtt tctccggctg 960
ttttgatgaa aaagccctaa atttgagttt ctccggctgt tttgatgaaa aagccctaaa
1020 tttgagtttt ttccccgtgt tttagattgt ttggttttaa ttctcgaatc
agctaatcag 1080 ggagtgtgaa aagccctaaa atttgagttt ttttcgttgt
tctgattgtt gtttttatga 1140 atttgcagat ggatatcctt ctttgatgct
gatccataat tgtaactgat ttattcttga 1200 ataacaactt caatgaaatc
aagcaacaaa gctgatttca acagaggaaa aaacagaaca 1260 agaaaacaaa
aacagagcat catccatcaa agtgtaatct cagcagattc aatagagact 1320
aagcttttga ttttaatgtt tagcaaatgt cctatcagtt ttctcttttt gtcgaacggt
1380 aatttagagt tttttttgct atatggattt tcgtttttga tgtatgtgac
aaccctcggg 1440 attgttgatt tatttcaaaa ctaagagttt ttgcttattg
ttctcgtcta ttttggatat 1500 caatcttagt tttatatctt ttctagttct
ctacgtgtta aatgttcaac acactagcaa 1560 tttggctgca gcgtatggat
tatggaacta tcaagtctgt gggatcgata aatatgcttc 1620 tcaggaattt
gagattttac agtctttatg ctcattgggt tgagtataat atagtaaaaa 1680
aatagtctag a 1691 31 1359 DNA Artificial Sequence Description of
Artificial Sequence Expression cassette for a sense and antisense
copy of the trailer associated with a PPO gene 31 ggtaccgaac
catgcatctc aatcttaata ctaaaaaatg caacaaaatt ctagtggagg 60
gaccagtacc agtacattag atattatctt ttattactat aataatattt taattaacac
120 gagacatagg aatgtcaagt ggtagcggta ggagggagtt ggttcagttt
tttagatact 180 aggagacaga accggagggg cccattgcaa ggcccaagtt
gaagtccagc cgtgaatcaa 240 caaagagagg gcccataata ctgtcgatga
gcatttccct ataatacagt gtccacagtt 300 gccttccgct aagggatagc
cacccgctat tctcttgaca cgtgtcactg aaacctgcta 360 caaataaggc
aggcacctcc tcattctcac actcactcac tcacacagct caagaaggat 420
ccttagtctc tattgaatct gctgagatta cactttgatg gatgatgctc tgtttttgtt
480 ttcttgttct gttttttcct ctgttgaaat cagctttgtt gcttgatttc
attgaagttg 540 ttattcaaga ataaatcagt tacaattatg gaattcgtgg
taacttttac tcatctcctc 600 caattatttc tgatttcatg catgtttccc
tacattctat tatgaatcgt gttatggtgt 660 ataaacgttg tttcatatct
catctcatct attctgattt tgattctctt gcctactgaa 720 tttgacccta
ctgtaatcgg tgataaatgt gaatgcttcc tcttcttctt cttcttctca 780
gaaatcaatt tctgttttgt ttttgttcat ctgtagcttg atatccttct ttgatgctga
840 tccataattg taactgattt attcttgaat aacaacttca atgaaatcaa
gcaacaaagc 900 tgatttcaac agaggaaaaa acagaacaag aaaacaaaaa
cagagcatca tccatcaaag 960 tgtaatctca gcagattcaa tagagactaa
gcttttgatt ttaatgttta gcaaatgtcc 1020 tatcagtttt ctctttttgt
cgaacggtaa tttagagttt tttttgctat atggattttc 1080 gtttttgatg
tatgtgacaa ccctcgggat tgttgattta tttcaaaact aagagttttt 1140
gcttattgtt ctcgtctatt ttggatatca atcttagttt tatatctttt ctagttctct
1200 acgtgttaaa tgttcaacac actagcaatt tggctgcagc gtatggatta
tggaactatc 1260 aagtctgtgg gatcgataaa tatgcttctc aggaatttga
gattttacag tctttatgct 1320 cattgggttg agtataatat agtaaaaaaa
tagtctaga 1359 32 1967 DNA Artificial Sequence Description of
Artificial Sequence Expression cassette for a sense and antisense
copy of the trailer associated with a PPO gene 32 ggtaccgaac
catgcatctc aatcttaata ctaaaaaatg caacaaaatt ctagtggagg 60
gaccagtacc agtacattag atattatctt ttattactat aataatattt taattaacac
120 gagacatagg aatgtcaagt ggtagcggta ggagggagtt ggttcagttt
tttagatact 180 aggagacaga accggagggg cccattgcaa ggcccaagtt
gaagtccagc cgtgaatcaa 240 caaagagagg gcccataata ctgtcgatga
gcatttccct ataatacagt gtccacagtt 300 gccttccgct aagggatagc
cacccgctat tctcttgaca cgtgtcactg aaacctgcta 360 caaataaggc
aggcacctcc tcattctcac actcactcac tcacacagct caacaagtgg 420
taacttttac tcatctcctc caattatttc tgatttcatg catgtttccc tacattctat
480 tatgaatcgt gttatggtgt ataaacgttg tttcatatct catctcatct
attctgattt 540 tgattctctt gcctactgaa tttgacccta ctgtaatcgg
tgataaatgt gaatgcttcc 600 tcttcttctt cttcttctca gaaatcaatt
tctgttttgt ttttgttcat ctgtagcttg 660 gtagattccc ctttttgtag
accacacatc acggatcctt agtctctatt gaatctgctg 720 agattacact
ttgatggatg atgctctgtt tttgttttct tgttctgttt tttcctctgt 780
tgaaatcagc tttgttgctt gatttcattg aagttgttat tcaagaataa atcagttaca
840 attatggaat tcaaggttag aaatcttctc tatttttggt ttttgtctgt
ttagattctc 900 gaattagcta atcaggtgct gttatagccc ttaattttga
gttttttttc ggttgttttg 960 atggaaaagg cctaaaattt gagttttttt
acgttggttt gatggaaaag gcctacaatt 1020 ggagttttcc ccgttgtttt
gatgaaaaag cccctagttt gagatttttt ttctgtcgat 1080 tcgattctaa
aggtttaaaa ttagagtttt tacatttgtt tgatgaaaaa ggccttaaat 1140
ttgagttttt ccggttgatt tgatgaaaaa gccctagaat ttgtgttttt tcgtcggttt
1200 gattctgaag gcctaaaatt tgagtttctc cggctgtttt gatgaaaaag
ccctaaattt 1260 gagtttctcc ggctgttttg atgaaaaagc cctaaatttg
agttttttcc ccgtgtttta 1320 gattgtttgg ttttaattct cgaatcagct
aatcagggag tgtgaaaagc cctaaaattt 1380 gagttttttt cgttgttctg
attgttgttt ttatgaattt gcagatggat atccttcttt 1440 gatgctgatc
cataattgta actgatttat tcttgaataa caacttcaat gaaatcaagc 1500
aacaaagctg atttcaacag aggaaaaaac agaacaagaa aacaaaaaca gagcatcatc
1560 catcaaagtg taatctcagc agattcaata gagactaagc ttttgatttt
aatgtttagc 1620 aaatgtccta tcagttttct ctttttgtcg aacggtaatt
tagagttttt tttgctatat 1680 ggattttcgt ttttgatgta tgtgacaacc
ctcgggattg ttgatttatt tcaaaactaa 1740 gagtttttgc ttattgttct
cgtctatttt ggatatcaat cttagtttta tatcttttct 1800 agttctctac
gtgttaaatg ttcaacacac tagcaatttg gctgcagcgt atggattatg 1860
gaactatcaa gtctgtggga tcgataaata tgcttctcag gaatttgaga ttttacagtc
1920 tttatgctca ttgggttgag tataatatag taaaaaaata gtctaga 1967 33
1635 DNA Artificial Sequence Description of Artificial Sequence
Expression cassette for a sense and antisense copy of the trailer
associated with a PPO gene 33 ggtaccgaac catgcatctc aatcttaata
ctaaaaaatg caacaaaatt ctagtggagg 60 gaccagtacc agtacattag
atattatctt ttattactat aataatattt taattaacac 120 gagacatagg
aatgtcaagt ggtagcggta ggagggagtt ggttcagttt tttagatact 180
aggagacaga accggagggg cccattgcaa ggcccaagtt gaagtccagc cgtgaatcaa
240 caaagagagg gcccataata ctgtcgatga gcatttccct ataatacagt
gtccacagtt 300 gccttccgct aagggatagc cacccgctat tctcttgaca
cgtgtcactg aaacctgcta 360 caaataaggc aggcacctcc tcattctcac
actcactcac tcacacagct caacaagtgg 420 taacttttac tcatctcctc
caattatttc tgatttcatg catgtttccc tacattctat 480 tatgaatcgt
gttatggtgt ataaacgttg tttcatatct catctcatct attctgattt 540
tgattctctt gcctactgaa tttgacccta ctgtaatcgg tgataaatgt gaatgcttcc
600 tcttcttctt cttcttctca gaaatcaatt tctgttttgt ttttgttcat
ctgtagcttg 660 gtagattccc ctttttgtag accacacatc acggatcctt
agtctctatt gaatctgctg 720 agattacact ttgatggatg atgctctgtt
tttgttttct tgttctgttt tttcctctgt 780 tgaaatcagc tttgttgctt
gatttcattg aagttgttat tcaagaataa atcagttaca 840 attatggaat
tcgtggtaac ttttactcat ctcctccaat tatttctgat ttcatgcatg 900
tttccctaca ttctattatg aatcgtgtta tggtgtataa acgttgtttc atatctcatc
960 tcatctattc tgattttgat tctcttgcct actgaatttg accctactgt
aatcggtgat 1020 aaatgtgaat gcttcctctt cttcttcttc ttctcagaaa
tcaatttctg ttttgttttt 1080 gttcatctgt agcttgatat ccttctttga
tgctgatcca taattgtaac tgatttattc 1140 ttgaataaca acttcaatga
aatcaagcaa caaagctgat ttcaacagag gaaaaaacag 1200 aacaagaaaa
caaaaacaga gcatcatcca tcaaagtgta atctcagcag attcaataga 1260
gactaagctt ttgattttaa tgtttagcaa atgtcctatc agttttctct ttttgtcgaa
1320 cggtaattta gagttttttt tgctatatgg attttcgttt ttgatgtatg
tgacaaccct 1380 cgggattgtt gatttatttc aaaactaaga gtttttgctt
attgttctcg tctattttgg 1440 atatcaatct tagttttata tcttttctag
ttctctacgt gttaaatgtt caacacacta 1500 gcaatttggc tgcagcgtat
ggattatgga actatcaagt ctgtgggatc gataaatatg 1560 cttctcagga
atttgagatt ttacagtctt tatgctcatt gggttgagta taatatagta 1620
aaaaaatagt ctaga 1635 34 240 DNA Solanum tuberosum 34 gtccatgatg
tcttcagggt ggtagcattg actgatggca tcatagtttt ttttttaaaa 60
gtatttcctc tatgcatatt attagtatcc aataaattta ctggttgttg tacatagaaa
120 aagtgcattt gcatgtatgt gtttctctga aattttcccc agtttttggt
gctttgcctt 180 tggagccaag tctctatatg tataagaaaa ctaagaacaa
tcacatatat caaatattag 240 35 228 DNA Solanum tuberosum 35
acgaacttgt gatcgcgttg aaagatttga acgctacata gagcttcttg acgtatctgg
60 caatattgca tcagtcttgg cggaatttca tgtgacaaca aggtttgcaa
ttctttccac 120 tattagtagt gcaacgatat acgcagagat gaagtgctga
acaaacatat gtaaaatcga 180 tgaatttatg tcgaatgctg ggacgggctt
cagcaggttt tgcttagt 228 36 2204 DNA Artificial Sequence Description
of Artificial Sequence Expression cassette for an omega-mutated
virD2 gene 36 ccgcggtttt ctctccatcg cgtcagaggc cggttttcgt
cggcatcgaa gagggccact 60 cgtttaccgt catttgccaa agcagcgcaa
aggcccatga gtgcggtggt tttgccagca 120 ccccctttga aagagcaaaa
cgtcaaaagt tgcatattct gatcccgcct gtcctgtgaa 180 acggagtgca
tttgtatttt tgttcgtata aatgtttttg tgattatcga tgagtaaaag 240
cgttgttaca ctatttttta tttcaaattc gttataatta aattgcaatt gtagcaatta
300 tattcggttt ttcctgtaaa tatactgttg atttcatatc gagtagggct
agactttaat 360 ctgtctaccc gggcacattt cgtgctggag tattcagacc
ttccgctttt tttggaggaa 420 gctatgtcaa aacacaccag agtcacgtcg
agtgagactg ccatcaacca gcatcgatcc 480 ctgaacgttg aagggtttaa
ggtcgtgagt gcccgtctgc gatcggccga gtatgaaacc 540 ttttcctatc
aagcgcgcct gctgggactt tcggatagta tggcaattcg cgttgcggtg 600
cgtcgcatcg ggggctttct cgaaatagat gcacacaccc gagaaaagat ggaagccata
660 cttcagtcca tcggaatact ctcaagtaat gtatccatgc ttctatctgc
ctacgccgaa 720 gaccctcgat cggatctgga ggctgtgcga gatgaacgta
ttgcttttgg tgaggctttc 780 gccgccctcg atggcctact ccgctccatt
ttgtccgtat cccggcgacg gatcgacggt 840 tgctcgctat tgaaaggtgc
cttgtagcac ttgaccacgc acctgacggg agaaaattgg 900 atgcccgatc
gcgctcaagt aatcattcgc attgtgccag gaggtggaac caagaccctt 960
cagcagataa tcaatcagtt ggagtacctg tcccgtaagg gaaagctgga actgcagcgt
1020 tcagcccggc atctcgatat tcccgttccg ccggatcaaa tccgtgagct
tgcccaaagc 1080 tgggttacgg aggccgggat ttatgacgaa agtcagtcag
acgatgatag gcaacaagac 1140 ttaacaacac acattattgt aagcttcccc
gcaggtaccg accaaaccgc agcttatgaa 1200 gccagccggg aatgggcagc
cgagatgttt gggtcaggat acgggggtgg ccgctataac 1260 tatctgacag
cctaccacgt cgaccgcgat catccacatt tacatgtcgt ggtcaatcgt 1320
cgggaacttc tggggcacgg gtggctgaaa atatccaggc gccatcccca gctgaattat
1380 gacggcttac ggaaaaagat ggcagagatt tcacttcgtc acggcatagt
cctggatgcg 1440 acttcgcgag cagaaagggg aatagcagag cgaccaatca
catatgctga acatcgccgc 1500 cttgagcgga tgcaggctca aaagattcaa
ttcgaagata cagattttga tgagacctcg 1560 cctgaggaag atcgtcggga
cctcagtcaa tcgttcgatc catttcgatc ggacccatct 1620 accggcgaac
cggaccgtgc aacccgacat gacaaacaac cgcttgaaca gcacgcccgt 1680
ttccaggagt ccgccggctc cagcatcaaa gccgacgcac ggatccgcgt atcattggag
1740 agcgagcgga gtgcccaacc atccgcgtcc aaaatccctg taattgggca
tttcgggatt 1800 gagacttcct atgtcgctga agccagcgtg cgcaaacgaa
gcggcatttt cggtacttct 1860 cgcccggtga ctgacgttgc catgcacaca
gtcaagcgcc agcagcgatc aaaacgacgt 1920 aatgacgagg aggcaggtcc
gagcggagca aaccgtaaag gattgaaggc tgcgcaagtt 1980 gattccgagg
caaatgtcgg tgagcaagac actcgcgatg acagcaacaa ggcggctgat 2040
ccggtgtctg cttccatcgg taccgagcaa ccggaagctt ctccaaagcg tccgcgtgac
2100 cgtcacgatg gagaattggg tggacgcaaa cgtgcaagag gtaatcgtcg
ctcgagctcg 2160 agcgggggga cctagagaca ggaaggaccg aataatggcc gcgg
2204 37 1621 DNA Solanum tuberosum 37 atggcttctg tgctggcttc
tctgtttcca aaactgggct ctttgggtac ttcagatcat 60 gcttctgttg
tatccatcaa cctctttgtg gcactccttt gtgcttgcat catcattggt 120
catctcttgg aggagaaccg ctgggttaat gagtccatta ctgccctcat aattggtttg
180 tgtacaggag tggttatctt gctcgtaagt ggtggaaaga gctcacacct
tctggttttc 240 agtgaagatc tctttttcat atatgtactt cctccaatca
tatttaatgc agggtttcag 300 gtaaaaaaga agcaattttt cgtaaacttc
attactataa tgatgttcgg agccattggt 360 accctggtct catgtgccat
tatatcatta ggtgccattc aaactttcaa gaagttggac 420 attgaatttc
tagatattgg ggattatctt gcaattggag caatatttgc tgccacagat 480
tccgtctgca cattgcaggt cctacatcag gatgagacac ccctccttta cagtcttgta
540 tttggagaag gagttgtaaa tgatgctaca tcggtggtgc ttttcaatgc
tattcaaaac 600 ttcgacctta cgagcatgaa tcccagtata gccctcagtt
tccttggcaa cttcttctat 660 ctgttccttg ctagcacttt actgggagca
ggaactggtc ttcttagtgc ttacattatc 720 aagaagctat attttggcag
gcactccaca gatcgtgagg ttgcccttat gatgctcatg 780 gcttacttat
catacttgct ggccgaatta ttctatttga gtgggattct caccgtcttt 840
ttctgtggta ttgtaatgtc tcactacact tggcacaatg tgaccgagag ttcaagagtc
900 actacaaggc acacttttgc aactttgtca tttcttgcag agactttcct
cttcctctat 960 gtcggcatgg atgctttgga tatcgagaag tggaaatttg
ttggtgacag gcctggatta 1020 tcaatttccg tgagttcaat actgatggga
ctaatcttgc ttgggagagc tgcctttgtt 1080 tttccattat cattcttatc
caacttaatg aagaaatcct cggagcaaaa aattaccttt 1140 aggcagcaag
tgataatatg gtgggcaggt ttgatgagag gcgcagtgtc catggcactg 1200
gcatataata agttcactcg tgggggacac actcaactgc aggacaatgc aataatgatt
1260 accagcacga taaccattgt tctattcagc acaatggtat tcggtttaat
gacaaaaccc 1320 cttataagtc tcctgctgcc accacagagg caattgagta
cagtgtcatc aggcgcaaat 1380 actccaaagt ctctaacagc cccactccta
ggcagtcgag aggactctga agttgattta 1440 aatgttccag atcttcctca
cccaccaagt ttgaggatgc tacttaccgc accaagtcat 1500 aaagtgcatc
ggtactggcg caagtttgac gatgcattca tgcgccctat gtttggtggt 1560
cggggatttg ctcctcctgc ccctggttct ccaacggaac agggtccatg aggtaccaat
1620 c 1621 38 1620 DNA Solanum tuberosum 38 atggcttctg tgctggcttc
tctgtttcca aaactgggct ctttgggtac ttcagatcat 60 gcttctgttg
tatccatcaa cctctttgtg gcactccttt gtgcttgcat catcattggt 120
catctcttgg aggagaaccg ctgggttaat gagtccatta ctgccctcat aattggtttg
180 tgtacaggag tggttatctt gctcgtaagt ggtggaaaga actcacacct
tctggttttc 240 agtgaagatc tctttttcat atatgtactt cctccaatca
tatttaatgc agggtttcag 300 gtaaaaaaga agcaattttt cgtgaacttc
attactataa tgatgttcgg agccattggt 360 accctggtct catgtgccat
tatatcatta ggtgcaattc aaactttcaa gaagttggac 420 attgaatttc
tagatattgg ggattatctt gcaattggag caatatttgc tgccacagat 480
tccgtctgca cattgcaggt cctacatcag gatgagacac ccctccttta cagtcttgta
540 tttggagaag gagttgtaaa tgatgctaca tcggtggtgc ttttcaatgc
tattcaaaac 600 tttgacctta cgagcgtgaa tcccagtata gccctcagtt
tccttggcaa cttcttctat 660 ctgttccttg ctagcacttt actgggagca
ggaactggtc ttcttagtgc ttacattatc 720 aagaagctgt attttggcag
gcactccaca gatcgtgagg ttgcccttat gatgctcatg 780 gcttacttat
catacatgct ggctgaacta ttctatttga gtgggattct cactgtattt 840
ttctgtggta ttgtaatgtc tcattacact tggcacaatg tgaccgagag ttcaagagtc
900 actacaaggc acgcttttgc aactttgtca tttcttgcag agactttcct
cttcctctat 960 gtcggcatgg atgctttgga tatcgagaag tggaaatttg
ttggtgacag gcctggatta 1020 tcaatttccg tgagttcaat actgatggga
ttaatcttgc tggggagagc tgcctttgtt 1080 tttccattat cattcttctc
caacttaatg aagaaatcct cggagcaaaa aattaccttt 1140 aggcagcaag
tgataatatg gtgggcaggt ttgatgagag gcgcagtgtc catggcactg 1200
gcatataata agttcactcg tgggggacac actcaactgc aggacaatgc aataatgatt
1260 accagcacga taaccattgt tctattcagc acaatggtat tcggtttaat
gacaaaaccc 1320 cttataagtc tcctgctgcc accacagagg caattgagta
cagtgtcatc aggtgcaaat 1380 actccaaagt ctctaacagc cccactccta
ggcagtcgag aggactctga agttgattta 1440 aatgttccag atcttcctca
cccaccaagt ttgaggatgc tacttaccgc accaagtcat 1500 aaagtgcatc
ggtactggcg caagtttgac gatgcattca tgcgccctat gtttggtggt 1560
cggggatttg ctcctcctgc ccctggttct ccaacggaac agggtccatg aggtacaatc
1620 39 747 DNA Solanum tuberosum 39 atggaaaatt cggtacccag
gactgtagaa gaagtattca
acgatttcaa aggtcgtaga 60 gctggtttaa tcaaagcact aactacagat
gtcgagaagt tttatcaatc gtgtgatcct 120 gaaaaggaga acttgtgtct
ctatgggctt cctaatgaaa catgggaagt aaacctccct 180 gtagaggagg
tgcctccaga acttccggag ccagcattgg gcataaactt cgcacgtgat 240
ggaatgcaag agaaagactg gttatcactt gttgctgttc acagtgattc atggctgctt
300 tctgttgcat tttactttgg tgcaaggttt gggttcggca agagtgaaag
gaagaggctt 360 ttccaaatga taaatgatct cccaacagtg tttgaagttg
ttaccggagc tgctaaacag 420 acacgtgatc cccctcacaa caatagcaac
aaaagcaaat caagtggaaa gcctcgacag 480 ccagagtccc aactcaaggc
agtaaaggtg tctccaccta aaatggagaa cgacagtggg 540 gaggaggaag
aagaagaaga ggatgaacaa ggagcaactc tctgtggagc ttgtggtgat 600
aattatgcca ctgatgaatt ctggatttgc tgtgatattt gtgagagatg gttccatggc
660 aaatgtgtga agattacccc agcaaaagct gagcatatca agcagtacaa
gtgtcctagt 720 tgcagtagca agagagctag agtttaa 747 40 741 DNA Solanum
tuberosum 40 tgacatctgc caataaagcc aagaataatt ggcattaaca tgaccaaaaa
aatggtttgg 60 cagcattaag tcaaataaaa aagctacttt aatataaaat
aatattaaaa tgcttaataa 120 ccaacagttt ataagaaggt taatgttaac
atggatgagg aatgaccaaa aggggaatta 180 tatattaacc tttaaatcaa
tctaattctc tctttttgtt tctagctata tttactcgat 240 agataaactc
tcttacttga cgaatttttt gatacaagaa gacatatttc atcatgattt 300
taattcgtcg tgtcaaattt attaaatagt ttaattttaa tcgtaaattt agatatgaaa
360 tttaaaaaaa aataaatata tacatatttg aagaatacat aaaaagtaca
tataaatcac 420 aaatatttaa taattcaaga tattaaaaca catagaaaaa
taattactta caaagaaatt 480 cttatttgaa tcctctaaat tcgagaagtg
caacacaaac tgagacgaag aaaatgaata 540 atatttgata agaaatttat
tataattgaa tgaccattta agtaattacg ggtaataaca 600 acacaataag
gaactgtagt catttttaat acatggcaag gaatatgaga gtgtgatgag 660
tctataaata gaaggcttca ttagtgtaga ggagtcacaa acaagcaata cacaaataaa
720 attagtagct taaacaagat g 741 41 25 DNA Agrobacterium sp. 41
tgacaggata tattggcggg taaac 25 42 25 DNA Agrobacterium sp. 42
tggcaggata tattgtggtg taaac 25 43 25 DNA Agrobacterium sp. 43
tggcaggata tataccgttg taatt 25 44 25 DNA Agrobacterium sp. 44
cggcaggata tattcaattg taatt 25 45 25 DNA Agrobacterium sp. 45
tggtaggata tataccgttg taatt 25 46 25 DNA Agrobacterium sp. 46
tggcaggata tatggtactg taatt 25 47 25 DNA Artificial Sequence
Description of Artificial Sequence Consensus sequence 47 ygryaggata
tatwsnvbkg taawy 25 48 25 DNA Rhizobium leguminosarum 48 cggcaggata
tatcctgatg taaat 25 49 25 DNA Thermoanaerobacter tengcongensis 49
tggcaggagt tattcgaggg taaac 25 50 25 DNA Arabidopsis thaliana 50
tgacaggata tatcgtgatg tcaac 25 51 25 DNA Arabidopsis thaliana 51
gggaagtaca tattggcggg taaac 25 52 25 DNA Oryza sativa 52 ttacaggata
tattaatatg tatga 25 53 25 DNA Homo sapiens 53 taacatgata tattcccttg
taaat 25 54 25 DNA Solanum tuberosum 54 tgacaggata tatggtaatg taaac
25 55 25 DNA Solanum tuberosum 55 tggcaggata tataccgatg taaac 25 56
292 DNA Saccharomyces cerevisiae 56 ttcttcgcca gaggtttggt
caagtctcca atcaaggttg tcggcttgtc taccttgcca 60 gaaatttacg
aaaagatgga aaagggtcaa atcgttggta gatacgttgt tgacacttct 120
aaataagcga atttcttatg atttatgatt tttattatta aataagttat aaaaaaaata
180 agtgtataca aattttaaag tgactcttag gttttaaaac gaaaattctt
attcttgagt 240 aactctttcc tgtaggtcag gttgctttct caggtatagc
atgaggtcgc tc 292 57 25 DNA Artificial Sequence Description of
Artificial Sequence Primer 57 tgrcaggata tatnvndntg taaac 25 58 23
DNA Artificial Sequence Description of Artificial Sequence Primer
58 ccgcggtgat cacaggcagc aac 23 59 30 DNA Artificial Sequence
Description of Artificial Sequence Primer 59 aagcttccag ccagccaaca
gctccccgac 30 60 45 DNA Artificial Sequence Description of
Artificial Sequence Primer 60 aagcttggct actagtgcga gatctctaag
agaaaagagc gttta 45 61 41 DNA Artificial Sequence Description of
Artificial Sequence Primer 61 gcatgctcga gataggtgac cacatacaaa
tggacgaacg g 41 62 34 DNA Artificial Sequence Description of
Artificial Sequence Primer 62 actagtgttt acccgccaat atatcctgtc agag
34 63 35 DNA Artificial Sequence Description of Artificial Sequence
Primer 63 aagctttggc aggatatatt gtggtgtaaa cgaag 35 64 27 DNA
Artificial Sequence Description of Artificial Sequence Primer 64
cggtgtaagt gaactgcagt tgccatg 27 65 26 DNA Artificial Sequence
Description of Artificial Sequence Primer 65 catcggcctc actcatgagc
agattg 26 66 24 DNA Artificial Sequence Description of Artificial
Sequence Synthetic oligonucleotide 66 cacgctaagt gccggccgtc cgag 24
67 24 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 67 tcctaatcga cggcgcaccg gctg 24 68 29
DNA Artificial Sequence Description of Artificial Sequence Primer
68 aaagttgaat tcaaatgaga aatttattc 29 69 28 DNA Artificial Sequence
Description of Artificial Sequence Primer 69 ttttaagctt tcataataac
attctaat 28 70 18 DNA Artificial Sequence Description of Artificial
Sequence Primer 70 gaaccatgca tctcaatc 18 71 30 DNA Artificial
Sequence Description of Artificial Sequence Primer 71 gtcaggatcc
ctaccaagct acagatgaac 30 72 27 DNA Artificial Sequence Description
of Artificial Sequence Primer 72 ggatccgagt gtgggtaagt aattaag 27
73 29 DNA Artificial Sequence Description of Artificial Sequence
Primer 73 gaattctgtg ctctctatgc aaatctagc 29 74 18 DNA Artificial
Sequence Description of Artificial Sequence Primer 74 ggaacattga
agctgtgg 18 75 27 DNA Artificial Sequence Description of Artificial
Sequence Primer 75 cgaattcatg gcaagcttgt gcaatag 27 76 30 DNA
Artificial Sequence Description of Artificial Sequence Primer 76
cgaattctta acaatctgca agactgatcg 30 77 24 DNA Artificial Sequence
Description of Artificial Sequence Primer 77 gagagatctt gataagacac
aacc 24 78 35 DNA Artificial Sequence Description of Artificial
Sequence Primer 78 cattaccata agcccactgt atattagctt gttgc 35 79 20
DNA Artificial Sequence Description of Artificial Sequence Primer
79 gtgcttatag aattggtggc 20 80 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 80 tagttcccgg gagttcagtg
20 81 50 DNA Artificial Sequence Description of Artificial Sequence
Primer 81 ctcccgggaa ctataggaaa cattcctctc ggtcctgtcc acatctggtc 50
82 21 DNA Artificial Sequence Description of Artificial Sequence
Primer 82 gtgtgatatc tgttcttttc c 21 83 22 DNA Artificial Sequence
Description of Artificial Sequence Primer 83 gaatgagctt gacaaggcgg
ag 22 84 21 DNA Artificial Sequence Description of Artificial
Sequence Primer 84 ctggcgataa cggaactgtt g 21 85 24 DNA Artificial
Sequence Description of Artificial Sequence Primer 85 gtccatgatg
tcttcagggt ggta 24 86 24 DNA Artificial Sequence Description of
Artificial Sequence Primer 86 ctaatatttg atatatgtga ttgt 24 87 24
DNA Artificial Sequence Description of Artificial Sequence Primer
87 acgaacttgt gatcgcgttg aaag 24 88 24 DNA Artificial Sequence
Description of Artificial Sequence Primer 88 actaagcaaa acctgctgaa
gccc 24 89 24 DNA Artificial Sequence Description of Artificial
Sequence Primer 89 cccgggatgg cttctgtgct ggct 24 90 24 DNA
Artificial Sequence Description of Artificial Sequence Primer 90
ggtacctcat ggaccctgtt ccgt 24 91 32 DNA Artificial Sequence
Description of Artificial Sequence Primer 91 cccgggtatg gaaaattcgg
tacccaggac tg 32 92 25 DNA Artificial Sequence Description of
Artificial Sequence Primer 92 actagttaaa ctctagctct cttgc 25 93 18
DNA Artificial Sequence Description of Artificial Sequence Primer
93 angatntatn nnnnntgt 18 94 25 DNA Triticum sp. 94 tggcaggata
tatgagtgtg taaac 25 95 26 DNA Triticum sp. 95 ttggcaggat atatccctct
gtaaac 26 96 74 PRT Solanum tuberosum 96 Met Ser Ser Thr Ser Asn
Val Gly Gln Asp Cys Leu Ala Glu Val Thr 1 5 10 15 Ile Ser Tyr Gln
Trp Val Gly Arg Val Ile Asn Tyr Asn Phe Phe Leu 20 25 30 Leu Ile
His Trp Tyr Thr Val Val Glu Ala Ser Thr Gly Ile Thr Phe 35 40 45
Gln Ile Phe Pro Ile Gly Ile Arg Ser Glu Asp Asp Arg Ser Phe Tyr 50
55 60 Glu Lys Ala Asp Arg Phe Ala Trp Val Thr 65 70 97 51 PRT
Solanum tuberosum 97 Met Ser Ser Glu Ser Thr Phe Ser Lys Thr Pro
Asn Gly Arg Ala Thr 1 5 10 15 Asp Val Gly Ile Pro Thr Glu Glu Gly
Thr Phe Pro Phe Arg Tyr Ala 20 25 30 Ile Leu Arg Asp Leu Ala Pro
Thr Ile Ser Leu Val Asn Ser Ser Ala 35 40 45 Asp Ile Ala 50 98 76
PRT Solanum tuberosum 98 Met Ser Glu Gly Val Gly Phe Lys Ser Lys
Ile Leu Pro Ser Phe Ala 1 5 10 15 Trp Arg Ser Ala Asn Ile Leu Gly
Ser Lys His Val Ala Lys Gln Thr 20 25 30 Phe Pro Phe Leu Ala Arg
Thr Glu Thr Cys Glu Arg Thr Ser Gly Met 35 40 45 Ser Gly Val Ile
Arg Ala Thr Ala Pro Ser Gly Ile Ser Ser Ser Pro 50 55 60 Leu Thr
Asp Phe Ala Thr Lys Ile Val Gly Phe Ser 65 70 75 99 62 PRT Solanum
tuberosum 99 Val Cys Ser Pro Ala Leu Lys Ala Asp Lys Ser Lys Ser
Ala Asp Gly 1 5 10 15 Thr Cys Val Asp His Ser Arg Arg Leu Ile Val
Val Leu Val Leu Tyr 20 25 30 Pro Gly Met Gly Thr Ser Tyr Ala Thr
Ala Phe Ile Ser Ser Pro Pro 35 40 45 Ile Gln Tyr Leu Phe Pro Ser
Asp Pro Val Glu Thr Phe Pro 50 55 60 100 50 PRT Solanum tuberosum
100 Met Leu Gly Ser Leu Val Leu Pro Lys Ser Pro Glu Asn Arg Lys Gln
1 5 10 15 Ala Val Pro Asn Pro His Phe Gln Glu Gln His Leu Val Pro
Glu Lys 20 25 30 Pro His Phe Leu Asp Cys Gly Gln Gly Phe Ser Lys
Leu Pro Gln Met 35 40 45 His Gln 50 101 65 PRT Solanum tuberosum
101 Met Val Asn Phe Leu Thr Gln Gly Ile Val Asp Met Glu Thr Ala Phe
1 5 10 15 Gly Ser Pro Lys Met Gly Gly Phe Gly Lys Glu Gln Phe Gly
Ala Cys 20 25 30 Val Ser Arg Ser Glu Met Asp Glu Ser Gly Ile Gly
Ala Val Met Val 35 40 45 Glu Gln Val Cys Ser Ile Cys Ser Arg His
Phe Val Leu Ser Met Gln 50 55 60 Ile 65 102 77 PRT Solanum
tuberosum 102 Met Leu Glu Gly Ser Met Trp Pro Trp Asn Gln Glu Ser
Met Lys Arg 1 5 10 15 Ala Phe Leu Asn His His Phe Leu Met Leu His
Leu Phe Pro Ala Gln 20 25 30 Arg Pro Pro Gln Ala Ala Asp Pro Val
Cys Leu Lys His Gln His Met 35 40 45 His Cys Gly Cys Leu Ser Phe
Gln Leu His Leu Ser Lys Leu Ala Pro 50 55 60 Gly Asp Thr Pro Leu
Ile Ser Ser Met Phe Ala Leu Asp 65 70 75 103 49 PRT Solanum
tuberosum 103 Met Lys Leu Cys Ser Ser Ile Ile Leu Ser Ile Ile Lys
Gln Lys Gln 1 5 10 15 Val Glu Ile Leu Arg Ala Cys Phe Gly Phe Pro
Glu Thr Lys Thr Ile 20 25 30 Ser Val Phe Ser Ser Val Ser Trp Asn
Trp His Ile Ile Cys Lys Ser 35 40 45 Leu 104 64 PRT Solanum
tuberosum 104 Met Thr Lys Lys Pro Asp Arg Lys Asp Asn Ile Met Pro
Tyr Asn Phe 1 5 10 15 Pro Gly Thr Lys Phe Leu Gln Pro Ile Phe Arg
Asn Phe Phe Leu Pro 20 25 30 Ser Leu Cys Asp Lys Leu Leu Lys Lys
Ser Ile Ser Val Pro Gln Ala 35 40 45 Ile Thr Pro Cys Trp Lys Val
Gln Cys Gly His Gly Ile Lys Lys Ala 50 55 60 105 115 PRT Solanum
tuberosum 105 Thr Ile Leu Lys Leu Asp Leu His Thr Phe Asn Gly His
Phe Phe Thr 1 5 10 15 Ala Ser Phe Trp Asn Gln Ser His Arg Asn Ser
Ile Phe Ile Phe Gln 20 25 30 Ser Asn Ile Leu Gln Gln Phe Ser Tyr
Arg Gln Leu Glu Ser Asn Thr 35 40 45 Gly Asn Met Ile Ser Ile Thr
Ser Met Asn Met Arg Gln Ala Ser Ile 50 55 60 Thr Pro Cys Lys Leu
Arg Leu Ile Lys Leu Ile Cys Ile His Ser Leu 65 70 75 80 Val His Val
Gln Lys His Ile Glu Pro Tyr Ile Val Pro Ile Ile Ile 85 90 95 Arg
Tyr Phe Ile Glu Cys Gln Tyr Leu Leu Leu Leu Ile Phe Leu Leu 100 105
110 Cys Cys Pro 115 106 122 PRT Solanum tuberosum 106 Met Lys Gly
Lys Glu Lys Pro Arg Glu Met Asn Leu Gln Phe Phe Thr 1 5 10 15 Thr
Asn Phe Val Ser Thr Val Ala Ile Ser Thr Met Asn Ile Ser Leu 20 25
30 Leu Phe Lys Ala Lys Arg Val Lys Gly Val Phe Ile Lys Phe Pro His
35 40 45 Ser Thr Arg Ser Gln Leu Ile Leu Gly Tyr Val Leu Leu Ile
Arg Arg 50 55 60 Met Ser Arg Gly Ala Asp Ala Glu Phe Ser His Arg
Arg Glu Leu Val 65 70 75 80 Val Arg Asn Thr Ile Asp Leu Ile Gly Tyr
Arg Arg Ala Thr Thr Val 85 90 95 Tyr Tyr Ile Asn Thr Phe Phe Tyr
Met Gly Ser Thr Thr Arg Leu Glu 100 105 110 Ile Arg Arg Trp Tyr Arg
Cys Ser Ser Arg 115 120 107 104 PRT Solanum tuberosum 107 Met Glu
Trp Ala Leu Ala Arg Asn Arg Ile Pro Phe Phe Tyr Cys Pro 1 5 10 15
Asn Ser Leu Arg Thr Ser His Gly Lys Gly Tyr Asp Phe His Arg Arg 20
25 30 Lys Arg Ile Gln Ser Ser Thr Asn Leu Tyr Leu Leu Asn Pro Phe
Phe 35 40 45 Ser Arg Gln Leu Ile Ser Ile His Ser Thr Ser Cys Pro
His Trp His 50 55 60 Gly Gly Ser Lys Lys Ser Asp Leu Asn Arg Val
Ser Arg Asn Tyr Pro 65 70 75 80 Cys Leu His Arg Phe Phe Asp Glu Val
Cys His Arg Ser Arg Cys Glu 85 90 95 Pro Glu Tyr Glu Gly Cys Phe
Gln 100 108 92 PRT Solanum tuberosum 108 Met Asn Asn Ile Thr His
Ser Pro Ile Leu Ile Pro Phe Leu Glu Gln 1 5 10 15 Leu Asn Pro Phe
Ile Ser Asn Cys His Met Gln Pro Ile Val Lys Ala 20 25 30 Asn Thr
Pro Ile Leu Asn Gly Asn Thr Lys Cys Arg His Ser Ala Asn 35 40 45
Ile Phe Thr Asn Gly Asn Cys Ile Trp Glu Lys Pro Met Asn Lys Ile 50
55 60 Val Asp Gln His Gln Ile His Asn Ser Ile His Ile Ser Cys Glu
Ser 65 70 75 80 Lys Val Phe Leu Val Val Pro Ser Glu Ser His Arg 85
90 109 57 PRT Solanum tuberosum 109 Met Lys Phe Arg Tyr Pro Ser Pro
Pro Asn Pro Ile Val Thr Ser Leu 1 5 10 15 Ile Ile Leu Cys Asn Ala
Ile Pro Arg Ser Ile Asn Asp Val Asp Gly 20 25 30 Leu Ser Arg Ala
Ile Lys Ser Tyr Ile Ser Leu Ser Ile Ser Gln Asn 35 40 45 Ala Ile
Val Leu Ser Pro Thr Arg Ala 50
55 110 70 PRT Solanum tuberosum 110 Met Val Asn Ile Met Thr Ser Ser
Ser Met Ala Thr Lys Phe Pro Ser 1 5 10 15 Ile Thr Val Gln Cys Asn
Ser Val Leu Pro Trp Gln Val Thr Ser Asn 20 25 30 Phe Ile Pro Phe
Val Cys Val Leu Trp Val Glu Val Glu Tyr Lys Tyr 35 40 45 Gln Val
Thr Thr Phe Lys His Asn Asn Leu Ile Ile Ile Ile His Ala 50 55 60
Ala Tyr Tyr Leu Phe Ser 65 70 111 51 PRT Solanum tuberosum 111 Met
Ala Lys Leu Val Thr His Glu Ile Glu Val Pro Leu Ser Ser Gln 1 5 10
15 Gly His Cys Glu Lys Met Asp His Leu Val Lys Arg Asn Ser Ser Ile
20 25 30 Asn Asn Arg Arg Ser Ile Cys Gln Ala Arg His Ala Arg Ile
His Leu 35 40 45 Phe Val His 50 112 72 PRT Solanum tuberosum 112
Met Phe Glu Thr Lys Leu Asn Ser Gly Val Val Trp Asn Asp Trp Leu 1 5
10 15 Thr Val Asn Ile Arg Asn Ser Asn Thr Pro Asn Thr Lys Leu Val
Leu 20 25 30 Leu His His Val Val Arg Thr Val Pro Ser Ile Glu Ile
Ala Asn Asn 35 40 45 Phe Val Phe Leu Ser Ser Arg Ser Pro Phe Thr
Ile Asp Tyr Ala Thr 50 55 60 Ile Phe Pro Val Glu Ser Lys Phe 65 70
113 66 PRT Solanum tuberosum 113 Met Leu Tyr Thr Ser Leu Tyr Ile
Ser Tyr Leu Ser Asn Ser Met Leu 1 5 10 15 Leu Pro Ser Trp Thr Asn
Leu His His Ser Tyr Ser Leu Asn Asn Leu 20 25 30 Ser Thr Tyr Leu
Gly Leu Pro Leu Pro Gly Gly Asn Gln Asn Gln Phe 35 40 45 Leu Pro
Gln Lys Gln Ala Gly Gln Gly Pro Ala Tyr Gln Lys His Leu 50 55 60
Arg Gln 65 114 24 DNA Artificial Sequence Description of Artificial
Sequence Primer 114 gttcagacaa gaccacagat gtga 24 115 181 PRT
Solanum tuberosum 115 Met Arg Asn Leu Phe Pro Ile Leu Met Leu Ile
Thr Asn Leu Ala Leu 1 5 10 15 Asn Asn Asp Asn Asn Asn Asn Asn Asn
Asn Asn Asn Asn Tyr Asn Leu 20 25 30 Ile His Ala Thr Cys Arg Glu
Thr Pro Tyr Tyr Ser Leu Cys Leu Thr 35 40 45 Thr Leu Gln Ser Gly
Pro Arg Ser Asn Glu Val Glu Gly Gly Asp Ala 50 55 60 Ile Thr Thr
Leu Gly Leu Ile Met Val Asp Ala Val Lys Ser Lys Ser 65 70 75 80 Ile
Glu Ile Met Glu Lys Ile Lys Glu Leu Glu Lys Ser Asn Pro Glu 85 90
95 Trp Arg Ala Pro Leu Ser Gln Cys Tyr Val Ala Tyr Asn Ala Val Leu
100 105 110 Arg Ala Asp Val Thr Val Ala Val Glu Ala Leu Lys Lys Gly
Ala Pro 115 120 125 Lys Phe Ala Glu Asp Gly Met Asp Asp Val Val Ala
Glu Ala Gln Thr 130 135 140 Cys Glu Tyr Ser Phe Asn Tyr Tyr Asn Lys
Leu Asp Phe Pro Ile Ser 145 150 155 160 Asn Leu Ser Arg Glu Ile Ile
Glu Leu Ser Lys Val Ala Lys Ser Ile 165 170 175 Ile Arg Met Leu Leu
180 116 172 PRT Nicotiana tabacum 116 Met Arg Asn Leu Phe Pro Ile
Phe Met Leu Ile Thr Asn Leu Ala Phe 1 5 10 15 Asn Asp Asn Asn Asn
Ser Asn Asn Ile Ile Asn Thr Thr Cys Arg Ala 20 25 30 Thr Thr Asn
Tyr Pro Leu Cys Leu Thr Thr Leu His Ser Asp Pro Arg 35 40 45 Thr
Ser Glu Ala Glu Gly Ala Asp Leu Thr Thr Leu Gly Leu Val Met 50 55
60 Val Asp Ala Val Lys Leu Lys Ser Ile Glu Ile Met Lys Ser Ile Lys
65 70 75 80 Lys Leu Glu Lys Ser Asn Pro Glu Leu Arg Leu Pro Leu Ser
Gln Cys 85 90 95 Tyr Ile Val Tyr Tyr Ala Val Leu His Ala Asp Val
Thr Val Ala Val 100 105 110 Glu Ala Leu Lys Arg Gly Val Pro Lys Phe
Ala Glu Asn Gly Met Val 115 120 125 Asp Val Ala Val Glu Ala Glu Thr
Cys Glu Phe Ser Phe Lys Tyr Asn 130 135 140 Gly Leu Val Ser Pro Val
Ser Asp Met Asn Lys Glu Ile Ile Glu Leu 145 150 155 160 Ser Ser Val
Ala Lys Ser Ile Ile Arg Met Leu Leu 165 170 117 181 PRT Solanum
tuberosum 117 Met Arg Asn Leu Phe Pro Ile Leu Met Leu Ile Thr Asn
Leu Ala Leu 1 5 10 15 Asn Asn Asp Asn Asn Asn Asn Asn Asn Asn Asn
Asn Asn Tyr Asn Leu 20 25 30 Ile His Ala Thr Cys Arg Glu Thr Pro
Tyr Tyr Ser Leu Cys Leu Thr 35 40 45 Thr Leu Gln Ser Gly Pro Arg
Ser Asn Glu Val Glu Gly Gly Asp Ala 50 55 60 Ile Thr Thr Leu Gly
Leu Ile Met Val Asp Ala Val Lys Ser Lys Ser 65 70 75 80 Ile Glu Ile
Met Glu Lys Ile Lys Glu Leu Glu Lys Ser Asn Pro Glu 85 90 95 Trp
Arg Ala Pro Leu Ser Gln Cys Tyr Val Ala Tyr Asn Ala Val Leu 100 105
110 Arg Ala Asp Val Thr Val Ala Val Glu Ala Leu Lys Lys Gly Ala Pro
115 120 125 Lys Phe Ala Glu Asp Gly Met Asp Asp Val Val Ala Glu Ala
Gln Thr 130 135 140 Cys Glu Tyr Ser Phe Asn Tyr Tyr Asn Lys Leu Asp
Phe Pro Ile Ser 145 150 155 160 Asn Leu Ser Arg Glu Ile Ile Glu Leu
Ser Lys Val Ala Lys Ser Ile 165 170 175 Ile Arg Met Leu Leu 180 118
166 PRT Nicotiana tabacum 118 Met Lys Asn Leu Ile Phe Leu Thr Met
Phe Leu Thr Ile Leu Leu Gln 1 5 10 15 Thr Asn Ala Asn Asn Leu Val
Glu Thr Thr Cys Lys Asn Thr Pro Asn 20 25 30 Tyr Gln Leu Cys Leu
Lys Thr Leu Leu Ser Asp Lys Arg Ser Ala Thr 35 40 45 Gly Asp Ile
Thr Thr Leu Ala Leu Ile Met Val Asp Ala Ile Lys Ala 50 55 60 Lys
Ala Asn Gln Ala Ala Val Thr Ile Ser Lys Leu Arg His Ser Asn 65 70
75 80 Pro Pro Ala Ala Trp Lys Gly Pro Leu Lys Asn Cys Ala Phe Ser
Tyr 85 90 95 Lys Val Ile Leu Thr Ala Ser Leu Pro Glu Ala Ile Glu
Ala Leu Thr 100 105 110 Lys Gly Asp Pro Lys Phe Ala Glu Asp Gly Met
Val Gly Ser Ser Gly 115 120 125 Asp Ala Gln Glu Cys Glu Glu Tyr Phe
Lys Gly Ser Lys Ser Pro Phe 130 135 140 Ser Ala Leu Asn Ile Ala Val
His Glu Leu Ser Asp Val Gly Arg Ala 145 150 155 160 Ile Val Arg Asn
Leu Leu 165 119 277 DNA Unknown Organism Description of Unknown
Organism P-PPO3 nucleotide sequence 119 ctggcgataa cggaactgtt
ggaggatatt ggtttggaag atgaagatac tattgcggtg 60 actctggtgc
caaagagagg tggtgaaggt atctccattg aaagtgcgac gatcagtctt 120
gcagattgtt aattagtctc tattgaatct gctgagatta cactttgatg gatgatgctc
180 tgtttttgtt ttcttgttct gttttttcct ctgttgaaat cagctttgtt
gcttgatttc 240 attgaagttg ttattcaaga ataaatcagt tacaatt 277 120 300
DNA Unknown Organism Description of Unknown Organism PPOM-41
nucleotide sequence 120 ctggcgataa cggaactgtt ggaggatatt ggattggaag
atgaagatac tattgcggta 60 actttggttc caaaagtagg tggtgaaggt
gtatccattg aaagtgtgga gatcaagctt 120 gaggattgtt aagtcctcat
gagttggtgg ctacggtacc aaattttatg tttaattagt 180 attaatgtgt
gtatgtgttt gattatgttt cggttaaaat gtatcagctg gatagctgat 240
tactagcctt gccagttgtt aatgctatgt atgaaataaa taaataaatg gttgtcttct
300 121 296 DNA Unknown Organism Description of Unknown Organism
PPOM-44 nucleotide sequence 121 ctggcgataa cggaactgtt ggaggataat
ggattggaag atgaaggtac tatngcggta 60 actttggttc caaaagttgg
tggtgaaggt gtatccattg aaagtgcgga gatcaagctt 120 gaggattgtt
aagtcctcat gagttggtgg ctatggtacc aaattntatg tttaattagt 180
attaatgtgt gtgtttgatt atgtttcggt taaaatgtat canctggata gctgattact
240 agccttccca gttgttaatg ctatgtatga aatacataaa taaatggttg tcttcc
296 122 22 DNA Artificial Sequence Description of Artificial
Sequence Primer 122 gtccaacttg cacaggaaag ac 22 123 22 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
oligonucleotide 123 catggatgaa atactcctga gc 22 124 25 DNA
Artificial Sequence Description of Artificial Sequence Primer 124
gtttacanhn bnatatatcc tgyca 25
* * * * *