U.S. patent application number 10/999760 was filed with the patent office on 2005-10-13 for double stranded linear nucleic acid probe and uses thereof.
Invention is credited to Abravaya, Klara X., Hackett, John R. JR., Huang, Shihai X., Luk, Ka-Cheung X., Morrison, Larry E., Salituro, John A..
Application Number | 20050227257 10/999760 |
Document ID | / |
Family ID | 34710048 |
Filed Date | 2005-10-13 |
United States Patent
Application |
20050227257 |
Kind Code |
A1 |
Abravaya, Klara X. ; et
al. |
October 13, 2005 |
Double stranded linear nucleic acid probe and uses thereof
Abstract
A double-stranded nucleic acid hybridization probe and methods
of using the same are described. The probe described is
particularly suited for real-time RT-PCR reactions and has high
tolerance to mismatches.
Inventors: |
Abravaya, Klara X.;
(KenilWorth, IL) ; Hackett, John R. JR.;
(Libertyville, IL) ; Huang, Shihai X.; (Evanston,
IL) ; Luk, Ka-Cheung X.; (Lake Bluff, IL) ;
Salituro, John A.; (Union Grove, WI) ; Morrison,
Larry E.; (Glen Ellyn, IL) |
Correspondence
Address: |
ROBERT DEBERARDINE
ABBOTT LABORATORIES
100 ABBOTT PARK ROAD
DEPT. 377/AP6A
ABBOTT PARK
IL
60064-6008
US
|
Family ID: |
34710048 |
Appl. No.: |
10/999760 |
Filed: |
November 30, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60526480 |
Dec 3, 2003 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
536/24.3 |
Current CPC
Class: |
C12Q 1/6832 20130101;
C12Q 1/6851 20130101; C12Q 1/6818 20130101; C12Q 1/6832 20130101;
C12Q 1/6818 20130101; C12Q 2537/137 20130101; C12Q 2561/113
20130101; C12Q 2525/107 20130101; C12Q 2537/137 20130101; C12Q
2565/101 20130101; C12Q 2561/113 20130101; C12Q 2565/101 20130101;
C12Q 2565/525 20130101; C12Q 1/6851 20130101 |
Class at
Publication: |
435/006 ;
536/024.3 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Claims
What is claimed is:
1. A nucleic acid probe comprising a first oligonucleic acid and a
second oligonucleic acid, wherein (a) the first oligonucleic acid
(i) is substantially complementary to a nucleic acid of interest,
and (ii) comprises a fluorophore, (b) the second oligonucleic acid
comprises a quencher (c) the first oligonucleic acid and second
oligonucleic acid are substantially complementary to each other
such that the first oligonucleic acid and second oligonucleic acid
can bind together to form a double-stranded nucleic acid, (d) when
the first oligonucleic acid is bound to the second oligonucleic
acid the fluorescent emission of the fluorophore attached to the
first oligonucleic acid is detectably less than the emission of the
same fluorophore when the first oligonucleic acid and second
oligonucleic acid are not bound together in a double-stranded
nucleic acid, (e) said nucleic acid probe characterized in that:
(i) the second oligonucleic acid comprises "n" nucleobases
substantially complementary to the first oligonucleic acid, and the
first oligonucleic acid comprises "m" nucleobases substantially
complementary to a nucleic acid of interest, wherein "m" and "n"
are independently selected integers, and (ii) when m is less than
25, n is equal or less than m/2; when m is 26-29, n is from 8 to
13; when mis 30 to 34, n is from 8 to 15; when mis 35 to 39, n is
from 8 to 20; when m is 40 to 44, n is 9 to 25; when m is 45 to 49,
n is 10 to 30; when m is 50 to 54, n is 10 to 35; when m is 55 to
59, n is 10 to 40; when m is 60 to 64, n is 11 to 45; when m is 65
to 69, n is from 11 to 50; when m is 70 to 75, n is from 15 to
55.
2. The nucleic acid of claim 1, wherein the first and the second
oligonucleic acids further comprise additional nucleobases that are
not complementary to the nucleic acid of interest and the first
oligonucleotide, respectively, at the 5' and 3' ends.
3. The nucleic acid probe of claim 1, wherein the ratio of the
second oligonucleic acid to the first oligonucleic acid is more
than 1.1.
4. The nucleic acid probe of claim 1, wherein the ratio of the
second oligonucleic acid to the first oligonucleic acid is more
than 0.1 and less than 0.9.
5. The nucleic acid probe of claim 1, wherein the first
oligonucleic acid further comprises a quencher.
6. The nucleic acid probe of claim 5, wherein the ratio of the
second oligonucleic acid to the first oligonucleic acid is more
than 0.1 and less than 0.9.
7. The nucleic acid probe of claim 5, wherein the ratio of the
second oligonucleic acid to the first oligonucleic acid is more
than 1.1
8. The nucleic acid probe of claim 1, wherein the first
oligonucleic acid comprises at least two fluorophores to allow the
fluorescence generated by the first oligonucleic acid comprising
two fluorophores when bound to a nucleic acid of interest to be
substantially greater than the fluorescence generated when only one
fluorophore is present.
9. A nucleic acid probe comprising a first oligonucleic acid and a
second oligonucleic acid, wherein (a) the first oligonucleic acid
(i) is substantially complementary to a nucleic acid of interest,
and (ii) comprises a quencher, (b) the second oligonucleic acid
comprises a fluorophore, (c) the first oligonucleic acid and second
oligonucleic acid are substantially complementary to each other
such that the first oligonucleic acid and second oligonucleic acid
can bind together to form a double-stranded nucleic acid, (d) when
the first oligonucleic acid is bound to the second oligonucleic
acid the fluorescent emission of the fluorophore attached to the
second oligonucleic acid is detectably less than the emission of
the same fluorophore when the first oligonucleic acid and second
oligonucleic acid are not bound together in a double-stranded
nucleic acid, (e) said nucleic acid probe characterized in that:
(i) the second oligonucleic acid comprises "n" nucleobases
substantially complementary to the first oligonucleic acid and the
first oligonucleic acid comprises "m" nucleobases substantially
complementary to the nucleic acid of interest, wherein "m" and "n"
are independently selected integers, and (ii) when m is less than
25, n is equal or less than m/2; when m is 26-29, n is from 8 to
13; when m is 30 to 34, n is from 8 to 15; when m is 35 to 39, n is
from 8 to 20; when m is 40 to 44, n is 9 to 25; when m is 45 to 49,
n is 10 to 30; when m is 50 to 54, n is 10 to 35; when m is 55 to
59, n is 10 to 40; when m is 60 to 64, n is 11 to 45; when m is 65
to 69, n is from 11 to 50; when m is 70 to 75, n is from 15 to
55.
10. The nucleic acid of claim 9, wherein the first and the second
oligonucleotides further comprise additional nucleobases that are
not complementary to the nucleic acid of interest and the first
oligonucleotide, respectively, at the 5' and 3' ends.
11. The nucleic acid probe according to claim 9, wherein the ratio
of the first oligonucleic acid to the second oligonucleic acid is
more than 1.1.
12. The nucleic acid probe according to claim 9, wherein the ratio
of the first oligonucleic acid to the second oligonucleic acid is
more than 0.1 and less than 0.9.
13. The nucleic acid probe of claim 9, wherein the second
oligonucleic acid further comprises a quencher.
14. The nucleic acid probe of claim 13, wherein the ratio of the
first oligonucleotide to the second oligonucleotide is more than
0.1 and less than 0.9.
15. The nucleic acid probe of claim 13, wherein the ratio of the
first oligonucleotide to the second oligonucleotide is more than
1.1.
16. A method of detecting a nucleic acid of interest in a test
sample, said method comprising (a) mixing test sample with DNA
amplification reagents, optionally including reverse transcription
reagents and the fluorescent probe of claim 1 to create a mixture
in a reaction vessel, (b) optionally incubating the reaction for a
suitable time and under suitable reverse transcription conditions
to reverse transcribe the RNA into a cDNA, (c) incubating the
reaction for a suitable time and under suitable DNA amplification
conditions to amplify a portion of the nucleic acid of interest,
and (d) measuring fluorescence from the fluorescent probe as an
indication of whether the test sample contains the nucleic acid of
interest, wherein an additional quantity of the oligonucleic acid
comprising a quencher is added to the vessel prior to closing the
vessel to obtain a molar ratio between the second oligonucleotide
and the first oligonucleotide that is greater than 1.1 and less
than 20.
17. A method of detecting a nucleic acid of interest in a test
sample, said method comprising (a) mixing test sample with DNA
amplification reagents, optionally including reverse transcription
reagents and the fluorescent probe of claim 9 to create a mixture
in a reaction vessel, (b) optionally incubating the reaction for a
suitable time and under suitable reverse transcription conditions
to reverse transcribe the RNA into a cDNA, (c) incubating the
reaction for a suitable time and under suitable DNA amplification
conditions to amplify a portion of the nucleic acid of interest,
and (d) measuring fluorescence from the fluorescent probe as an
indication of whether the test sample contains the nucleic acid of
interest, wherein an additional quantity of the oligonucleic acid
comprising a quencher is added to the vessel prior to closing the
vessel to obtain a molar ratio between the first oligonucleotide
and the second oligonucleotide that is greater than 1.1 and less
than 20.
18. A method for quantifying RNA in a test sample, the method
comprising (A) mixing test sample with amplification reagents,
reverse transcription reagents and a nucleic acid probe of claim 1
to create a mixture in a reaction vessel, wherein the nucleic acid
probe comprises a first oligonucleic acid and a second oligonucleic
acid, wherein (a) the first oligonucleic acid is substantially
complementary to a nucleic acid of interest, and comprises a
fluorophore, (b) the second oligonucleic acid comprises a quencher,
(c) the first oligonucleic acid and second oligonucleic acid are
substantially complementary to each other such that the first
oligonucleic acid and second oligonucleic acid can bind together to
form a double-stranded nucleic acid, (d) when the first
oligonucleic acid is bound to the second oligonucleic acid the
fluorescent emission of the fluorophore attached to the first
oligonucleic acid is detectably less than the emission of the same
fluorophore when the first oligonucleic acid and second
oligonucleic acid are not bound together in a double-stranded
nucleic acid, (e) said nucleic acid probe characterized in that:
(i) the second oligonucleic acid comprises "n" nucleobases
substantially complementary to the first oligonucleic acid, and the
first oligonucleic acid comprises "m" nucleobases substantially
complementary to a nucleic acid of interest, wherein "m" and "n"
are independently selected integers, and, (ii) when m is less than
25, n is equal or less than m/2; when m is 26-29, n is from 8 to
13; when m is 30 to 34, n is from 8 to 15; when m is 35 to 39, n is
from 8 to 20; when m is 40 to 44, n is 9 to 25; when m is 45 to 49,
n is 10 to 30; when m is 50 to 54, n is 10 to 35; when m is 55 to
59, n is 10 to 40; when m is 60 to 64, n is 11 to 45; when m is 65
to 69, n is from 11 to 50; when m is 70 to 75, n is from 15 to 55,
(B) placing the test sample under conditions permissive of reverse
transcription, which optionally can also be permissive of
amplification, such that a cDNA is produced, (C) thermocycling the
test mixture such that cDNA is amplified, and (D) measuring the
fluorescence of the test mixture during the amplification reaction
as an indication of the quantity of RNA in the test sample.
19. A method for quantifying RNA in a test sample, the method
comprising (A) mixing test sample with amplification reagents,
reverse transcription reagents and a nucleic acid probe of claim 9
to create a mixture in a reaction vessel, wherein the nucleic acid
probe comprises a first oligonucleic acid and a second oligonucleic
acid, wherein (a) the first oligonucleic acid is substantially
complementary to a nucleic acid of interest, and comprises a
quencher, (b) the second oligonucleic acid comprises a fluorophore,
(c) the first oligonucleic acid and second oligonucleic acid are
substantially complementary to each other such that the first
oligonucleic acid and second oligonucleic acid can bind together to
form a double-stranded nucleic acid, (d) when the first
oligonucleic acid is bound to the second oligonucleic acid the
fluorescent emission of the fluorophore attached to the second
oligonucleic acid is detectably less than the emission of the same
fluorophore when the first oligonucleic acid and second
oligonucleic acid are not bound together in a double-stranded
nucleic acid, (e) said nucleic acid probe characterized in that:
(i) the second oligonucleic acid comprises "n" nucleobases
substantially complementary to the first oligonucleic acid, and the
first oligonucleic acid comprises "m" nucleobases substantially
complementary to a nucleic acid of interest, wherein "m" and "n"
are independently selected integers, and, (ii) when m is less than
25, n is equal or less than m/2; when m is 26-29, n is from 8 to
13; when m is 30 to 34, n is from 8 to 15; when m is 35 to 39, n is
from 8 to 20; when m is 40 to 44, n is 9 to 25; when m is 45 to 49,
n is 10 to 30; when m is 50 to 54, n is 10 to 35; when m is 55 to
59, n is 10 to 40; when m is 60 to 64, n is 11 to 45; when m is 65
to 69, n is from 11 to 50; when m is 70 to 75, n is from 15 to 55,
(B) placing the test sample under conditions permissive of reverse
transcription, which optionally can also be permissive of
amplification, such that a cDNA is produced, (C) thermocycling the
test mixture such that cDNA is amplified, and (D) measuring the
fluorescence of the test mixture during the amplification reaction
as an indication of the quantity of RNA in the test sample.
20. The method of claim 18 or 19, wherein the first oligonucleic
acid and the second oligonucleic acid of the nucleic acid probe do
not bind together at the reverse transcription temperature.
21. The method of claim 18 or 19, wherein neither the first
oligonucleic acid nor the second oligonucleic acid bind
substantially to the RNA of interest at the reverse transcription
temperature.
22. A method of detecting a nucleic acid of interest in a test
sample, said method comprising: (i) mixing test sample with DNA
amplification reagents, (ii) incubating the reaction for a suitable
time and under suitable DNA amplification conditions to amplify a
portion of the nucleic acid of interest, (iii) adding a first
oligonucleic acid that is single-stranded, and comprises a
fluorophore and a quencher, (iv) before, after or at the same time
as step (iii) adding a second oligonucleic acid comprising a
quencher, wherein the first oligonucleic acid and second
oligonucleic acid are complementary such that they are capable of
forming a duplex in solution, wherein the ratio of the second
oligonucleic acid to the first oligonucleic acid in the test sample
is more than 0.1 and less than 0.9, (v) measuring the fluorescence
from the fluorescent probe as an indication of whether the test
sample contains the nucleic acid of interest.
Description
[0001] This application claims priority to the provisional
application Ser. No. 60/526,480 filed on Dec. 3, 2003.
FIELD OF INVENTION
[0002] The invention relates generally to the field of nucleic acid
amplification and detection. Additionally, the invention relates to
compositions and methods for performing PCR and probe hybridization
using a single reagent mixture.
BACKGROUND
[0003] DNA-based analyses are used routinely in a wide spectrum of
settings, including clinical hematology, molecular genetics,
microbiology and immunology. Many current techniques rely on PCR
amplification of a polynucleotide of interest (hereinafter "target
molecule") in conjunction with several types of post-amplification
detection techniques. Other non-PCR based amplification techniques
are well known in the art including, but not limited to, oligo
ligation assay (OLA), ligase chain reaction (LCR),
transcription-mediated amplification (TMA), and strand displacement
amplification (SDA). Additionally, these techniques are amenable to
mixing. That is, the product of one amplification reaction can be
used as the target of another amplification reaction, which allows
great sensitivity with an additional step that tends to increase
sensitivity.
[0004] One preferred amplification format is known as a real-time
homogeneous assay. A real-time assay is one that produces data
indicative of the presence or quantity of a target molecule during
the amplification process, as opposed to the end of the
amplification process. A homogeneous assay is one in which the
amplification and detection reagents are mixed together and
simultaneously contacted with a sample, which may contain a target
nucleic acid molecule. Thus, the ability to detect and quantify DNA
targets in real-time homogeneous systems as amplification proceeds
is centered in single-tube assays in which the processes required
for target molecule amplification and detection take place in a
single "close-tube" reaction format. For example, current
techniques that use PCR amplification and have these features are
generally known as Real-Time PCR techniques. Similarly,
non-PCR-based technologies are also within the skill of the
ordinary artisan and are amenable to homogeneous detection
methods.
[0005] In most amplification and detection techniques a probe is
used to detect an amplification product. Several probe systems
known in the art utilize a fluorophore and quencher. For example,
molecular beacon probes are single-stranded oligonucleic acid
probes that can form a hairpin structure in which a fluorophore and
a quencher are usually placed on the opposite ends of the
oligonucleotide. At either end of the probe short complementary
sequences allow for the formation of an intramolecular stem, which
enables the fluorophore and the quencher to come into close
proximity. The loop portion of the molecular beacon is
complementary to a target nucleic acid of interest. Binding of this
probe to its target nucleic acid of interest forms a hybrid that
forces the stem apart. This causes a conformation change that moves
the fluorophore and the quencher away from each other and leads to
a more intense fluorescent signal. Molecular beacon probes are,
however, highly sensitive to small sequence variation in the probe
target (Tyagi S. and Kramer F. R., Nature Biotechnology, Vol. 14,
pages 303-308 (1996); Tyagi et al., Nature Biotechnology, Vol. 16,
pages 49-53(1998); Piatek et al., Nature Biotechnology, Vol. 16,
pages 359-363 (1998); Marras S. et al., Genetic Analysis:
Biomolecular Engineering, Vol. 14, pages 151-156 (1999); Tpp I. et
al, BioTechniques, Vol 28, pages 732-738 (2000)).
[0006] Unlike molecular beacon probes, some single-stranded linear
probes possessing also a quencher and a fluorophore attached at
opposite ends of an oligonucleotide do not form a hairpin
structure. Instead, this kind of linear oligonucleotide probes in
solution behaves like a random coil, its two ends occasionally come
close to one another, resulting in a measurable change in energy
transfer. However, when the probe binds to its target, the
probe-target hybrid forces the two ends of the probe apart,
disrupting the interaction between the two terminal moieties, and
thus restoring the fluorescent signal from the fluorophore. In
addition, single-stranded linear probes can be designed as "TaqMan
probes", that bind to target strands during PCR and thus can be
enzymatically cleaved by the 5''3' exonuclease activity of the Taq
DNA polymerase during the primer extension phase of the PCR cycle
resulting in an increase in fluorescence in each cycle proportional
to the amount of specific product generated. It has been reported
that long single-stranded linear probes suffer from high
"background" signals, while shorter ones are sensitive to
single-base mismatches (Lee L. G. et al., Nucleic Acids Research,
Vol. 21, pages 3761-3766 (1993); Tpp I. et al. (above); U.S. Pat.
No. 6,258,569; U.S. Pat. No. 6,030,787).
[0007] Double-stranded linear probes are also known in the art.
Double-stranded linear probes have two complementary
oligonucleotides. The probes described in the prior art have been
of equal length, in which at least one of the oligonucleotides acts
as a probe for a target sequence in a single-stranded conformation.
The 5' end of one of the oligonucleotides is labeled with a
fluorophore and the 3' end of the other oligonucleotide is labeled
with a quencher, e.g., an acceptor fluorophore, or vice versa. When
these two oligonucleotides are annealed to each other, the two
labels are close to one another, thereby quenching fluorescence.
Target nucleic acids, however, compete for binding to the probe,
resulting in a less than proportional increase of probe
fluorescence with increasing target nucleic acid concentration
(Morrison L. et al., Anal. Biochem., Vol. 183, pages 231-244
(1989); U.S. Pat. No. 5,928,862).
[0008] Double-stranded linear probes modified by shortening one of
the two complementary oligonucleotides by few bases to make a
partially double-stranded linear probe, are also known in the art.
In such double-stranded linear probes in the prior art, the longer
oligonucleotide has been end-labeled with a fluorophore and the
slightly shorter oligonucleotide has been end-labeled with a
quencher. In the double-stranded form, the probe is less
fluorescent due to the close proximity of the fluorophore and the
quencher. In the presence of a target, however, the shorter
quencher oligonucleotide is displaced by the target. As a result,
the longer oligonucleotide (in the form of probe-target hybrid)
becomes substantially more fluorescent.
[0009] The double-stranded probes known in the prior art having
oligonucleotides of unequal lengths display complete discrimination
between a perfectly matched target and single nucleotide mismatch
targets. Also, these probes do not have optimal reaction kinetics
especially when low quantities of target nucleic acid are present.
(Li et al., Nucleic Acids Research, Vol. 30, No. 2, e5 (2002))
[0010] The detection of viral RNAs presents certain challenges,
which are not presented by the desire to detect DNAs of interest.
The probes of the prior art are suitable for the detection of viral
RNAs, but could be improved. First, some viral RNA targets are
prone to rapid mutation in the bodies of their hosts. To ensure
that mutated viral RNA sequences are detected along with so-called
"wild-type" sequences, nucleic acid probes used to detect viral
RNAs should be tolerant of mismatches, yet still specific enough to
avoid interaction with non-target nucleic acids. (i.e.,
false-positive results). Many of the probes of the prior art are
sensitive to single-nucleotide changes, and therefore, are not
optimal for the detection of viral nucleic acids.
[0011] Additionally, viral RNAs often must be reverse transcribed
into DNA before amplification of a nucleic acid sequence of
interest. Unfortunately, it has been discovered by the present
inventors that some prior art nucleic acid probes can interfere
with the reverse transcription (i.e., enzymatic copying of RNA
sequences into DNA sequences).
[0012] It is also desirable that nucleic acid probes be capable of
sensitively detecting both small and large quantities of nucleic
acids of interest. Some nucleic acids probes of the prior art are
not well suited to detecting small quantity of nucleic acids of
interest. Other nucleic acids probes of the prior art are not well
suited to the sensitive detection of large quantities of nucleic
acids.
[0013] In view of the above, there is a need for a probe in which:
a) the sequences can be readily manipulated, b) the
oligonucleotides are easy to design without the limitation of being
capable of forming stem or loop, c) there is high tolerance to
mismatches, and/or d) the oligonucleotides are suitable for
real-time RT-PCR reactions.
SUMMARY OF THE INVENTION
[0014] The present invention relates generally to double-stranded
nucleic acid hybridization probes and methods of using the same.
The probe of the present application can be used in any suitable
manner, and is particularly well suited for PCR amplification and
probe hybridization using a single reaction vessel and a single
reagent mixture.
[0015] The present invention provides a nucleic acid probe that
comprises a first oligonucleic acid and a second oligonucleic acid.
The first oligonucleic acid is labeled by a fluorophore and is
substantially complementary to a nucleic acid of interest, such
that when the nucleic acid of interest is present, the first
oligonucleic acid can bind to the nucleic acid of interest. The
second oligonucleic acid has a quencher molecule and is
substantially complementary to the first oligonucleic acid.
Accordingly, the first and second oligonucleic acids can bind
together to form a double-stranded nucleic acid. When the first
oligonucleic acid is bound to the second oligonucleic acid, the
fluorescent emission of the fluorophore attached to the first
oligonucleic acid is quenched (i.e., detectably less than the
emission of the same fluorophore when the first oligonucleic acid
and second oligonucleic acid are not bound together). Binding of
the first oligonucleic acid to the nucleic acid of interest,
therefore, increases the fluorescence in a test system, thereby
indicating whether the nucleic acid of interest is present. The
first oligonucleic acid comprises "m" contiguous nucleobases
substantially complementary to a nucleic acid of interest, and the
second oligonucleic acid comprises "n" contiguous nucleobases
substantially complementary to the first oligonucleic acid, wherein
"m" and "n" are independently selected integers, and when m is less
than 25, n is up to one half of m; when m is 26 to 29, n is from 8
to 13; when m is 30 to 34, n is from 8 to 15; when m is 35 to 39, n
is from 8 to 20; when m is 40 to 44, n is 9 to 25; when m is 45 to
49, n is 10 to 30; when m is 50 to 54, n is 10 to 35; when m is 55
to 59, n is 10 to 40; when m is 60 to 64, n is 11 to 45; when m is
65 to 69, n is from 11 to 50; when m is 70 to 75, n is from 15 to
55.
[0016] The present invention also provides a nucleic acid probe in
which the first and longer oligonucleic acid is substantially
complementary to a nucleic acid of interest and comprises a
quencher. The second, and shorter, oligonucleic acid comprises a
fluorophore. The first oligonucleic acid is substantially
complementary to the second oligonucleic acid, which permits
simultaneous hybridization of the first oligonucleic acid with the
second oligonucleic acid, and quenching of the fluorescence of the
second oligonucleic acid. When the first oligonucleic acid is bound
to a nucleic acid of interest, the second oligonucleic acid is
displaced and the fluorescent emission of the fluorophore is
detectably greater than when it is annealed to the first
oligonucleic acid.
[0017] The present invention also provides a method of detecting or
quantifying a nucleic acid of interest in a test sample using any
embodiment of the nucleic acid probe of the present invention
described herein. For example, the present invention provides a
method of quantifying RNA in a test sample in which the sample is
contacted with nucleic acid amplification reagents and reverse
transcription reagents under conditions permissive of reverse
transcription, and then/also of nucleic acid amplification such
that cDNA is produced and amplified. The mixture is subsequently or
simultaneously contacted with a nucleic acid probe of the present
invention as described herein, wherein the first and second
oligonucleic acids of the probe do not bind together and/or to the
target RNA, at the temperature of the reverse transcription
step.
[0018] The present invention also provides a method of detecting
and/or quantifying a nucleic acid of interest in a test sample in
which the sample is contacted with DNA amplification reagents to
amplify a portion of the nucleic acid of interest, and a first
oligonucleic acid probe that has a fluorophore and a quencher, and
is specific for the amplified nucleic acid. Before, during or after
the addition of the first single-stranded oligonucleic acid, a
second oligonucleic acid comprising a quencher is added in a ratio
so that the second to the first oligonucleic acids in the mixture
can be less than one, and so that the first and second oligonucleic
acids form a duplex in solution.
DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1A-F graphically presents melting curve data of nucleic
acid probes of the present invention without or with mismatched
target oligonucleotides (as denoted next to each curve). (A)
520-20/que-16; (B) 520-20/que-14; (C) 520-20/que-12; (D)
520-31/que-14; (E) 520-20/que-12; (F) 520-31/que-14. "m" indicates
the length of the contiguous nucleobases of the FAM-labeled
oligonucleic acid substantially complementary to the target,
whereas "n" represents the length of the contiguous nucleobases of
the DABCYL-labeled quenching oligonucleic acid substantially
complementary to the FAM-labeled oligonucleic acid.
[0020] FIG. 2A-C illustrates the comparison of real-time RT-PCR
amplification plots of wild type transcript with those of mutated
transcripts (as indicated next to each curve).
[0021] FIG. 3A-B graphically presents real-time measurement of
amplicon synthesis during RT-PCR reactions using the partially
double-stranded linear probe set lin-41/que-23 using (A) HIV wild
type template transcripts and (B) internal control transcript at
100 copies per reaction mixture.
[0022] FIG. 4A-B depicts real-time measurements of amplicon
synthesis during RT-PCR reactions using the probe set lin-41/que-22
with (A) HIV wild type template transcripts and (B) internal
control transcript at 100 copies per reaction mixture.
[0023] FIG. 5A-D graphically presents real-time RT-PCR
amplification plot data of wild type transcript detected by the
1.times.FAM probe (slin-47), the 2.times.FAM probe (dfam-50) or the
3.times.FAM probe (fam-650) (as indicated next to each curve) at
the transcript copy number of 10 copies (A), 10e3 copies (B), 10e5
copies (C) or 10e6 copies (D) per PCR reaction. Each of the three
FAM-labeled linear oligonucleic acid probes was quenched by oligos
sque-15BH and bhq-5015.
[0024] FIG. 6 graphically presents real-time RT-PCR amplification
plot data of transcripts with 0, 2, 3, 4 or 5 mutations (as
indicated next to each curve).
DETAILED DESCRIPTION
[0025] The present invention provides nucleic acid probes as
described below useful to detect the presence of a nucleic acid of
interest (also commonly called a target). Of course, the first
oligonucleic acid can also bind to amplified portions of the
nucleic acid of interest. For ease of description and
understanding, references to nucleic acids of interest or "targets"
refer both to these moieties as found in a test sample and to
amplified copies of portions of these nucleic acids, unless
specifically noted to the contrary.
[0026] The present invention provides a nucleic acid probe that
comprises a first oligonucleic acid and a second oligonucleic acid.
The first oligonucleic acid is labeled by a fluorophore and is
substantially complementary to a nucleic acid of interest, such
that when the nucleic acid of interest is present, the first
oligonucleic acid can bind to the nucleic acid of interest. For
purposes of the present invention, the term "substantially
complementary" means that equal or more than 80% of nucleobases on
one strand of the probe finds its Watson-Crick binding partner on
the other strand of the probe (or in the nucleic acid of interest)
in an alignment such that the corresponding nucleotides can
hybridize to each other. Binding of the first oligonucleic acid to
the nucleic acid of interest prevents the second oligonucleic acid
from binding to the first oligonucleic acid of the probe. The
second oligonucleic acid has a quencher molecule and is also
substantially complementary to the first oligonucleic acid.
Accordingly, the first and second oligonucleic acids can bind
together when the nucleic acid of interest is not present to form a
double-stranded nucleic acid. When the first oligonucleic acid is
bound with the second oligonucleic acid, the fluorescent emission
of the fluorophore attached to the first oligonucleic acid is
quenched (i.e., detectably changed, and preferably lessened,
compared to the emission of the same fluorophore when the first
oligonucleic acid and second oligonucleic acid are not bound
together). Binding of the first oligonucleic acid to the nucleic
acid of interest, therefore, changes and preferably increases the
fluorescence in a test system, thereby indicating whether the
nucleic acid of interest is present. In one embodiment, the first
oligonucleic acid contains 15-75 nucleobases ("m") substantially
complementary to target, and the second oligonucleic acid contains
"n" nucleobases substantially complementary to the first
oligonucleic acid, whereas "n" is significantly shorter than "m".
The second oligonucleic acid can be of any suitable length with the
primary consideration being that when the nucleic acid of interest
is not present, the second oligonucleic acid must bind with the
first oligonucleic acid under temperature and solvent conditions in
which the probe will be used to infer the presence or absence of
the nucleic acid of interest in a test sample.
[0027] Table 1 sets forth preferred and more preferred lengths of
the first and second oligonucleic acids incorporated into
two-stranded probes of this embodiment of the present invention
1 TABLE 1 Second Oligonucleic Acid** First Oligonucleic Acid*
Preferred More Preferred <25 <13 6-10 25-30 8-13 8-10 31-34
8-15 10-14 35-39 8-20 12-18 40-44 9-25 12-22 45-49 10-30 15-28
50-54 10-35 25-32 55-59 10-40 28-35 60-64 11-45 30-40 65-69 11-50
35-45 70-75 15-55 48-50 *Length in nucleobases ("m") substantially
complementary to target. **Length in nucleobases ("n")
substantially complementary to first oligonucleic acid.
[0028] While not desiring to be bound by any particular theory, it
is believed that the long single strand portion of the first
oligonucleic acid strongly favors binding of the first oligonucleic
acid to the target nucleic acid of interest thereby increasing the
sensitivity of the probe and under some conditions improving the
kinetics of the detection reaction. Additionally, the longer length
of the first oligonucleic acid allows the use of hybridization
conditions that permit mismatch hybridization.
[0029] Oligonucleic acids are oligomers of naturally occurring or
modified nucleobases. While guanine, adenine, thymine, uridine,
cytosine, and optionally inosine and/or indole, are among the
preferred nucleobases incorporated in the oligonucleic acids of the
present invention, any suitable nucleobase can be incorporated into
the probes of the present invention. Oligonucleic acids are not
necessarily acids or residues of acids. Rather an oligonucleic acid
as used herein is a polymer of nucleobases or nucleobase analogs
that are capable of specifically binding to a target polynucleotide
by way of a regular pattern of monomer-to-monomer interactions,
such as Watson-Crick type of base pairing, or the like. Most
commonly, the monomers are linked by phosphodiester bonds. Less
commonly, the monomers are linked by analogs of phosphodiester
bonds, such as (deoxyribosyl)phosphonyl polymers or phosphothiorate
polymers. Also less commonly employed are peptide nucleic acids,
commonly referred to in the art as PNAs, in which the nucleobases
are linked in sequence by a polymer containing amide bonds at
regular intervals (Nielsen et al., Science, Vol. 254: 1497-1500
(1991)).
[0030] Methods of synthesizing oligonucleic acids incorporated into
probes of the present invention are well known in the art and any
suitable method of obtaining the oligonucleic acids of the present
invention can be used.
[0031] A fluorophore, or a "fluorescent label", can be any suitable
moiety capable of emitting light. The light can be generated
chemically, biologically, in response to excitational photons, or
from any other suitable cause. Preferably, fluorophores are
fluorescent organic dyes derivatized for attachment to the
oligonucleic acids of the probe via a linking moiety. When ribosyl
or deoxyribosyl polymers are used to link the nucleobases together
the dyes can advantageously be derivatized to link to the terminal
3' carbon or terminal 5' carbon of the polymer.
[0032] Fluorophores suitable in the context of the present
invention include (without limitation) the Violet/Blue dyes
(Em.sub.max 375-491 nm) 7-methoxycoumarin-3-carboxy, AMCA-X
(7-aminocoumarin-X), 6-MI or 6-MAP
(6-methyl-8-(2-deoy-.beta.-D-ribofuranosyl)isoxanthopteridine); the
Green/Yellow dyes (Em.sub.max 492-585 nm) DTAF
(4,6-dichlorotriazinyl)ami- nofluorescein, 6-FAM (fluorescein,
6-carboxyfluorescein), Dansyl-X
(6-((5-dimethtylaminonaphtalene-1-sulfonyl)amino)hexanoate, 6-JOE
(6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), HEX
(hexachlorofluorescein), BODIPY-TMR-X (tetramethylrhodamine
substitute), PyMPO
(1-(3-carboxybenzyl)-4-(5-(4-methoxyphenyl)oxazol-2-yl)pyridinium
bromide), TAMRA-X
(6-(tetramethylrhodamine-5(6)-carboxamido)hexanoate); the Orange
dyes (Em.sub.max 586-647 nm) rhodamine derivatives BODIPY 576/589,
BODIPY 581/591, ROX (carboxyrhodamine), VIC (Applied Biosystems
Inc., Foster City, Calif.), NED (Applied Biosystems Inc., Foster
City, Calif.) and the Red dyes (Em.sub.max 647-700 nm) as
carboxynaphthofluorescein.
[0033] A quencher as used herein is a moiety that decreases the
light emitted by the fluorophore at the wavelength at which signal
is measured, or is a fluorescent moiety that serves to shift the
wavelength of light emitted by the fluorophore of the nucleic acid
probe. Quenchers suitable in the context of the present invention
include (without limitation) DABCYL
(4-(4'-dimethylaminophenylazo)benzoic acid), QSY-7
(9-[2-[[4-[[(2,5-dioxo-1-pyrrolidinyl)oxy]carbonyl]-1-piperidinyl]sulfony-
l]phenyl]-3,6-bis(methylphenylamino)), BHQ-1, BHQ-2, BHQ-3
(Biosearch Technologies Inc., 2003, Cat. Nos. BG5-5041T, BG5-5042T,
and BG5-5043T) and TAMRA
((6-tetramethylrhodamine-5(6)carboxamido)hexanoate). Additionally,
a quencher can be an organic dye, which may or may not be
fluorescent, depending on the embodiment of the invention.
[0034] In yet another embodiment, the present invention comprises a
probe wherein the first and second oligonucleic acids comprise
additional nucleobases that are not complementary to the nucleic
acid of interest or to the first nucleic acid, respectively, at the
5' or the 3' end.
[0035] In another embodiment the present invention comprises a
probe wherein the ratio of the second oligonucleic acid comprising
the quencher to the first oligonucleic acid comprising the
fluorophore may be more than 1.1. Additionally, another embodiment
comprises a probe in which the ratio of the second oligonucleic
acid comprising the quencher to the first oligonucleic acid
comprising the fluorophore may be more than 0.1 and less than
0.9.
[0036] In another embodiment of the present inventive probe the
first oligonucleic acid comprises two label moieties, one
fluorophore and one quencher. The incorporation of a quencher (in
addition to the fluorophore) in the first oligonucleic acid reduces
background fluorescent emission (or background signal) that would
occur when first oligonucleic acid is bound neither to target, nor
to a second oligonucleic acid comprising a quencher. Another
embodiment comprises a probe in which the molar ratio of the second
oligonucleic acid (comprising a quencher) to the first oligonucleic
acid (comprising one fluorophore and one quencher) is more than 0.1
and less than 0.9. Additionally, another embodiment comprises a
probe in which the molar ratio of the second oligonucleic acid to
the first oligonucleic acid (with two label moieties) is more than
1.1.
[0037] To improve the fluorescent signal from the nucleic acid
probe of the present invention, more than one fluorophore may be
linked to the oligonucleic acid that binds to the target. Probes of
the present invention comprising more than one fluorophore
preferably emit substantially more fluorescent signal than
equivalent probes comprising only a single fluorophore.
Unexpectedly, the probes containing at least three fluorophores
have been found to be tolerant of mismatches (i.e., less than
perfect complementarity) with target molecules. This can be
especially advantageous when the target nucleic acid is highly
polymorphic as is the case with portions of HIV-1 and other
retroviruses. Because the mismatch tolerance of the probes of the
present invention is independent of the number of fluorophores
attached to the first oligonucleic acid of the probe, and a probe
with more than one fluorophore shows the same high tolerance for
targets with 2, 3 or 4 mismatches as a probe of similar length with
only one fluorophore, the probes of the present invention are
particularly well suited to the detection and quantitation of viral
target sequences.
[0038] In another embodiment, the nucleic acid probe of the present
invention comprises three oligonucleic acids, the first
oligonucleic acid comprises a fluorophore and the second comprises
a quencher. The third oligonucleic acid preferably also comprises a
quencher. While not desiring to be bound by any particular theory,
it is believed that the incorporation of an additional quencher in
the third oligonucleic acid reduces background fluorescent emission
(or background signal). Generally, background signal is the
emission of fluorescence that is not caused by binding of a
fluorescently labeled oligonucleic acid of the probe to a target
nucleic acid of interest.
[0039] In another embodiment, the longer oligonucleic acid
comprises a quencher and the shorter oligonucleic acid comprises a
fluorophore. Additionally, this embodiment comprises a probe in
which the first and the second oligonucleotides further comprise
additional nucleobases that are not complementary to the nucleic
acid of interest and the first oligonucleotide, respectively, at
the 5' and 3' ends. Additionally, both the first and second
oligonucleic acids can also comprise a plurality of label moieties.
For example, both the first oligonucleic acid and the second
oligonucleic acid can comprise both a fluorophore and a quencher.
Typically, the fluorophore and the quencher are incorporated into
the oligonucleic acids such that when bound to an unlabeled
oligonucleotide sequence (e.g., a target) the fluorophore and the
quencher are separated and the fluorophore can emit light. However,
when the first oligonucleic acid and the second oligonucleic acid
of the probe are bound together the fluorophore of the first
oligonucleic acid is brought into proximity with the quencher of
the second oligonucleic acid, as well as the converse (i.e., the
fluorophore of the second oligonucleic acid is brought into
proximity with the quencher of the first oligonucleic acid). In
this way, both the first and second oligonucleic acids can emit
light in the presence of a target, but are mutually quenched in the
absence of the target. Furthermore, the first and second
oligonucleic acids of this embodiment may comprise additional
nucleobases that are not complimentary to the nucleic acid of
interest or to the first nucleic acid, respectively, at the 5' or
the 3' end.
[0040] Additionally, this embodiment comprises a nucleic acid probe
wherein the ratio of the first oligonucleic acid comprising the
quencher to the second oligonucleic acid comprising the fluorophore
is more than 1.1. In yet another embodiment, the first oligonucleic
acid comprises an additional quencher. This embodiment allows for a
probe in which the ratio of the first oligonucleic acid to the
second oligonucleic acid is more than 0.1 and less than 0.9. Also,
this embodiment allows for a probe in which the ratio of the first
oligonucleic acid to the second oligonucleic acid is more than
1.1.
[0041] In a preferred embodiment, the difference in the
fluorescence signal between the double stranded form when the
fluorophore and quencher are close, and the target-hybridized state
when the fluorophore is separated from the quencher can differ by
as much as a factor of 20. This effect is due to the fact that when
both are in close proximity there is relatively efficient quenching
of the fluorophore, whereas, when the first oligonucleic acid is
annealed to the target nucleic acid, it is separated from the
second oligonucleic acid (comprising a quencher) and the
fluorophore is not quenched anymore. As used herein, the terms
"quenching" refers to any process whereby when a fluorophore
molecule and a quencher molecule are in close proximity, a
substantial loss of fluorescence occurs. Including in the group of
quenchers are non-fluorescent molecules and fluorescent molecules,
which can accept light energy from the fluorophore.
[0042] In a preferred embodiment, the 3' terminal of the first
oligonucleic acid only, or together with the 3' terminal of the
second oligonucleic acid of the probe is/are rendered incapable of
extension by a nucleic acid polymerase, to prevent interference
with the PCR polymerization step thereby to prevent reduction of
the stepwise efficiency of the amplification.
[0043] In another embodiment of the present invention, the first
oligonucleic acid, or the first and second oligonucleic acids of
the double stranded probe are rendered impervious to degradation by
the 5'.fwdarw.3' exonuclease activity of a nucleic acid polymerase.
Preferably, the 5' end of the oligonucleic acid is rendered
resistant to digestion by including one or more modified
internucleotide linkages into the 5' end of the oligonucleic acid.
Minimally, the 5'-terminal internucleotide linkage must be
modified, however, up to all the internucleotide linkages in the
oligonucleotide may be modified. Such internucleotide modifications
may include modified linkages of the type used in the synthesis of
anti-sense oligonucleotides. Examples of such nuclease resistant
linkages include peptide nucleic acid (PNA) linkages, e.g., Nielsen
et al., Science, Vol. 254, pages 1497-1500 (1991), and other like
exonuclease resistant linkages. Alternatively, the 5' end can be
rendered resistant to degradation by the 5'.fwdarw.3' exonuclease
activity by adding a sequence that is not complementary to the
nucleic acid of interest, or by the addition of a derivative moiety
at the 5' end of the oligonucleic acid.
[0044] Advantageously, any of the probes described above, each of
which comprise two oligonucleic acids, can be used in a method of
determining the presence or quantity of a target nucleic acid. In
the following methods, any suitable nucleic acid of interest can be
the target nucleic acid. The target nucleic acid, however, is
preferably RNA, such as a viral RNA or an mRNA. In some
embodiments, the target RNA is preferably reverse transcribed prior
to amplification, which amplification is also preferably carried
out in the same tube and reaction mixture as the reverse
transcription step.
[0045] The present inventive method of detecting, or quantifying, a
nucleic acid of interest in a test sample comprises mixing test
sample with DNA amplification reagents to amplify a portion of the
nucleic acid of interest. The reagents can optionally include
reverse transcription reagents. The mixture of the amplification
reagents and nucleic acid of interest is then incubated under
suitable conditions to reverse transcribe the target RNA into a
target complementary DNA if applicable, and then to amplify the
target DNA. The method also comprises adding a nucleic acid
fluorescent probe comprising a first oligonucleic acid with a
fluorophore and a second oligonucleic acid with a quencher such as
those described above, and measuring fluorescence from the
fluorescent probe as an indication of whether the test sample
contains the nucleic acid of interest. In some embodiments, the
probe is contacted to the nucleic acid of interest before or
substantially simultaneously with the amplification reagents, and
optionally is mixed with the amplification reagents prior to
contacting the amplification reagents to the nucleic acid of
interest. In other embodiments, the probe is contacted to the
nucleic acid of interest after incubating the nucleic acid of
interest and the amplification reagents under suitable
amplification conditions (so as to amplify a portion of the nucleic
acid of interest).
[0046] Amplification reagents refer to the chemicals, apart from
the target nucleic acid sequence, needed to perform the PCR
process. These chemicals can conveniently be classified into four
classes of components: (i) an aqueous buffer, often including
without limitation a magnesium salt, (ii) amplification substrates,
such as four ribonucleotide triphosphates (NTPs) or preferably at
least four deoxyribonucleotide triphosphates (dNTPs) in
polymerization-based amplification or ATP in ligation-based
amplification, (iii) one or more oligonucleotide primers or probes
(normally two primers for each target sequence, the sequences
defining the 5' ends of the two complementary strands of the
double-stranded target sequence when PCR is employed), and (iv) an
amplification enzyme such as a polynucleotide polymerase (for
example, Taq polymerase for PCR or RNA polymerase for TMA), or a
ligase. Additional reagents or additives can also be included at
the discretion of the skilled artisan and selection of these
reagents is within the skill of the ordinary artisan. Of course,
when the amplification reagents are used to cause both reverse
transcription and amplification, then reverse transcription
reagents are also included in the amplification reagents. Selection
of amplification reagents, according to the method of amplification
reaction used, is within the skill of the ordinary artisan.
[0047] In embodiments employing "homogeneous" amplification and
detection steps, i.e., when performing combined amplification and
probe hybridization detection in a single reaction mixture in a
single tube, then: (i) any of the two oligonucleic acids of the
probe preferably do not block or otherwise interfere or participate
in the PCR or other amplification step; (ii) neither oligonucleic
acid of the probe is degraded by the enzyme (e.g., by 5'.fwdarw.3'
exonuclease activity of a polymerase enzyme); and (iii) the
oligonucleic acids of the probe preferably are not extended or
otherwise modified by the enzyme, e.g., the 5'.fwdarw.3'
polymerization activity of the polymerase.
[0048] In another embodiment of the present inventive method, an
additional quantity of the second oligonucleic acid (which
comprises a quencher) is added to the vessel prior to closing the
vessel and incubating the reaction mixture under amplification
conditions so as to obtain a molar ratio of the second oligonucleic
acid comprising a quencher to the first oligonucleic acid
comprising a fluorophore that is greater than 1, optionally not
less than 1.1 or 1.2, and is less than 20, preferably not greater
than 5, more preferably not greater than 2.5, yet more preferably
not greater than 2, and optionally is not greater than 1.5.
[0049] In a preferred embodiment of the inventive method, the probe
is prevented from interfering with, or participating in, the PCR
polymerization step by linking to the 3' terminal end of the
nucleic acid an organic or inorganic moiety capable of blocking
nucleic acid polymerization known in the art. Advantageously, this
polymerization blocking moiety can be a fluorophore or a quencher
molecule and can be attached to one or both of the oligonucleic
acids of the probe by a linking moiety, or by making the
3'-terminal nucleotide a dideoxynucleotide. Similarly, the
oligonucleic acids of the probe can be completely or partially a
PNA such that the oligonucleic acid of the probe cannot prime
enzyme-mediated polymerization. Alternatively, the 3' end of the
oligonucleic acid is rendered impervious to the 5'.fwdarw.3'
extension activity of a polymerase by including one or more
modified polymerase resistant internucleotide linkages into the 3'
end of the oligonucleotide, such as without limitation a
phosphonate or phosphothiorate linkage. Similarly, a
non-complementary sequence to the nucleic acid of interest can be
attached to the 3' end of one or both of the oligonucleic acids of
the probe such that the mismatch impedes or prevents
enzyme-mediated polymerization.
[0050] In another preferred embodiment, oligonucleic acids of the
probe of the present invention can be made resistant or impervious
to exonuclease digestion. Suitable methods of impeding or
preventing exonuclease digestion include (without limitation)
introducing a 5' extension that is not complementary to the nucleic
acid of interest, adding a non-phosphodiester linkage between two
nucleotidyl bases of the oligonucleic acid, and adding an organic
or inorganic blocking moiety known in the art (per se) to the 5'
end of one or both the oligonucleic acids.
[0051] Similarly, enzymatic degradation of the oligonucleic acids
of the probe can be impeded or prevented by using an amplification
enzyme that lacks such activity. In the case of amplification-based
reactions, for example, a polymerase which lacks a 5'.fwdarw.3'
exonuclease activity can be used. Polymerases lacking a
5'.fwdarw.3' exonuclease activity are known in the art and include
without limitation the Klenow fragment of DNA polymerase I, T4 DNA
polymerase, and T7 DNA polymerase, the Stoffel fragment of Taq
polymerase, and other like 5'.fwdarw.3' exonuclease minus DNA
polymerases.
[0052] The polymerase optionally can also be rendered inactive, at
least with respect to its exonuclease activity, during the
hybridization step. Such inactivation can be achieved in a number
of ways including (i) introducing a temperature sensitive inhibitor
into the reaction which will inhibit the 5'.fwdarw.3' exonuclease
activity of the polymerase at the hybridization temperature, e.g.,
a solid adsorbent, a specific antibody molecule, or other like
reversible or irreversible polymerase inhibitors; (ii) using a
polymerase whose activity is greatly reduced at the hybridization
temperature; or (iii) introducing an enzyme deactivation step prior
to the hybridization step which irreversibly deactivates the
polymerase enzyme, i.e., an extended period at high
temperature.
[0053] In certain embodiments, the reverse transcription efficiency
is increased by using a probe comprising an oligonucleic acid that
is complementary to a target RNA of interest that has a T.sub.m
(melting temperature) of the first oligonucleic acid to the second
oligonucleic acid that is lower than the temperature at which the
reaction mixture is incubated during reverse transcription. While
not desiring to be bound by any particular theory, it is believed
that, by carrying out the reverse transcription step at a
temperature above each of the Tm of the probe, the probe does not
compete with the target RNA by competitively binding to the enzyme
mediating reverse transcription.
[0054] Similarly, in embodiments employing reverse transcription in
the presence of the probe, neither (or none) of the oligonucleic
acids of the probe bind to the target RNA at the temperature at
which reverse transcription occurs.
EXAMPLES
[0055] The present invention will be further clarified by the
following examples, which are only intended to illustrate the
present invention and are not intended to limit the scope of the
present invention.
Example 1
Effect of the Length Difference Between the Two Oligonucleic Acids
of a Nucleic Acid Probe on Mismatch Tolerance Evaluated by Melting
Curve Assays
[0056] Melting reactions were performed in a Stratagene Mx4000
multiplex quantitative PCR system with the following cycle
conditions: 1 cycle of denaturation at 95.degree. C. for 3 min; 75
cycles of 1-minute holding at a range of temperatures from
85.degree. C. to 10.degree. C. with an 1.degree. C. decrement per
cycle. Fluorescein (FAM) fluorescence measurements were recorded
during each 1-minute hold of the 75 cycles. At the end of each run,
the data were analyzed and melting curves were generated.
[0057] Table 2 sets forth the sequences of PCR primers and linear
probes used in this and the following examples.
2TABLE 2 Name Sequence PCR Primers FP-29 5' -
ATTCCCTACAATCCCCAAAGTCAAGGAGT - 3' (SEQ ID NO:1) RP-25 5' -
CCCCTGCACTGTACCCCCCAATCCC - 3' (SEQ ID NO:2) RP-24 5' -
CCCCTGCACTGTACCCCCCAATCC - 3' (SEQ ID NO:3) Linear Probes.sup.1
labeled with FAM 520-20 6-FAM- (5') - ACAGCAGTACAAATGGCAGT-
(3')-DABCYL (SEQ ID NO:4) 520-3 1 6-FAM- (5')
-ACAGCAGTACAAATGGCAGTATTCATCCACA-(3')- (SEQ ID NO:5) DABCYL lin-41
6-FAM-(5') - GCTACAGCAGTACAAATGGCAGTATTCATCCACAATTTCCC - (3')- (SEQ
ID NO:6) DABCYL slin-47 6-FAM-(5') -
GCACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAA (SEQ ID NO:7) A-
(3')-DABCYL dfam-50 6-FAM-(5') -
GCACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAA (SEQ ID NO:8) ACGC -
(3')-6-FAM fam-650 6-FAM-(5') - GCACAGCAGTACAAATGGCAGTA-
TTCATCCACAAT(dT- (SEQ ID NO:9) FAM)TTAAAAGAAAACGC - (3')-6-FAM
Quenching Oligos.sup.2 labeled with DABCYL que-12 (5') -
GTATTGTACTGCTGT- (3')-DABCYL (SEQ ID NO:10) que-14 (5') -
CGGATTTGTACTGCTGT- (3')-DABCYL (SEQ ID NO:11) que-16 (5') -
GACCCATTTGTACTGCTGT- (3')-DABCYL (SEQ ID NO:12) que-22 DABCYL-(5')
- GACCCATTTGTACTGCTGTAGC- (3')-DABCYL (SEQ ID NO:13) que-23
DABCYL-(5') - TGAGCCATTTGTACTGCTGTAGC- (3')-DABCYL (SEQ ID NO:14)
sque-15BH 5' -TTTGTACTGCTGTGC- (3')-BHQ-1 (SEQ ID NO:15) bhq-5015
BHQ-1-(5') -GCGTTTTCTTTTAAA- (3')-BHQ-1 (SEQ ID NO:16)
.sup.1Sequences substantially complementary with targets are
underlined ("in"). .sup.2Sequences substantially complementary with
linear FAM probes are underlined ("n").
[0058] In each assay, 100 .mu.l reaction contained
1.25.times.RT-PCR buffer (62.5 mM Bicine, pH 8.05-8.25, 143.75 mM
potassium acetate, 10% glycerol, 0.125 mM EDTA, 0.0125 mg/ml
acetylated bovine serum albumin (acetylated-BSA), 0.078% (v/v)
Tween 20, and 0.025% (w/v) sodium azide), 2.5 mM MnCl.sub.2, 0.2
.mu.M FAM-labeled oligonucleic acid ("oligo"), 0.2 .mu.M
DABCYL-labeled quenching oligo and 1 .mu.M single-stranded
complementary target oligo that was 48 nucleotides long and
comprised 0, 1, 2, 3, or 4 mismatches with the FAM labeled oligo
(oligos were obtained from Sigma-Genosys). The length of the
FAM-labeled oligo was either 20 or 31 nucleotides long, while the
DABCYL-labeled quenching oligo was 12, 14 or 16 nucleotides in
length. FIGS. 1A-F show the melting curves of a series of
double-stranded linear probe sets in the presence or absence of
target oligos with different numbers of mismatches, ranging from 0
to 4. The FAM fluorescence intensity was measured as a function of
temperature. (A) 520-20/que-16; (B) 520-20/que-14; (C)
520-20/que-12; (D) 520-31/que-14; (E) 520-20/que-12; (F)
520-31/que-14. Positions of mismatches ("mis" hereinafter) for
(A)-(C) are as follows: 1 mis is the 12.sup.th nucleotide; 2 mis
are the 12.sup.th and 18.sup.th nucleotides. Positions of
mismatches for (D) are: 1 mis is the 12.sup.th nucleotide; 3 mis
are the 12.sup.th, 18.sup.th and 27.sup.th nucleotides. Positions
of mismatches for (E) are: 1 mis is the 3.sup.rd, 9.sup.th or
12.sup.th; 2 mis are the 9.sup.th and 12.sup.th nucleotides.
Positions of mismatches for (F) are following: 1 mis is the
12.sup.th; 2 mis are the 9.sup.th and 27.sup.th, the 21.sup.st and
27.sup.th, the 24.sup.th and 27.sup.th, the 3.sup.rd and 27.sup.th
or the 9.sup.th and 12.sup.th nucleotides; 3 mis are the 24.sup.th,
25' and 27.sup.th or the 12.sup.th, 21.sup.st and 27.sup.th
nucleotides; 4 mis are the 21.sup.st, 24.sup.th, 25.sup.th and
27.sup.th nucleotides. All mismatched nucleotide positions start
from the 5' end of each respective HIV FAM linear probe.
[0059] At high temperatures, the FAM-labeled oligo and the shorter
complementary DABCYL-labeled quenching oligo of each
double-stranded linear probe set were separated, thus leading to
the restoration of FAM fluorescence. In the absence of target
oligo, these two oligos tended to gradually hybridize with each
other as the incubation temperature decreased and formed a
non-fluorescent duplex due to the close proximity of the
fluorophore FAM and the quencher DABCYL. The Tm's of the quenching
oligos determined the incubation temperatures at which the
non-fluorescent duplexes started to form. The quenching oligo
que-16 carrying a length of 16 complementary nucleotides (Table 2)
began the formation of the non-fluorescent duplexes at about
60.degree. C. (FIG. 1A), whereas the 14-base (que-14; Table 2) and
12-base (que-12; Table 2) quenching oligos started it at around
55.degree. C. and 50.degree. C., respectively (FIGS. 1B and C). In
the presence of target oligos with 0 mismatches, the quenching
oligos, which were shorter and thus had lower Tm than the target
oligos, were unable to compete with the target oligos for binding
to the FAM-labeled oligos, thus resulting in the formation of
probe-target hybrids that fluoresced (FIGS. 1A-F). In the presence
of target oligos with mismatches, the 12-base quenching oligo
que-12 was still unable to compete with the target oligos with 1 or
2 mismatches for binding to the 20-base FAM-labeled oligo 520-20
(Table 2) (FIG. 1C); the 14-base quenching oligo que-14, on the
other hand, was still unable to compete with the target oligo with
1 mismatch but managed to bind to the FAM oligo 520-20 in the
presence of the target oligo with 2 mismatches (FIG. 1B). In
contrast, the 16-base quenching oligo que-16 was able to bind to
520-20 in the presence of 1 mismatch and even more so in the
presence of 2 mismatches (FIG. 1A). These results demonstrate that
extending the length of a quenching oligo reduced the capability of
its complementary FAM-labeled oligo to bind to target oligos with
mismatches. In other words, increasing the length difference
between the FAM-labeled oligo and its complementary DABCYL-labeled
quenching oligo enhances the level of tolerance of the FAM-labeled
oligo to target oligos with mismatches. The same conclusion can be
drawn when comparing the melting curves of linear probe set
520-20/que-14 (FIG. 1B) with those of 520-31/que-14 (FIG. 1D). The
probe set 520-31/que-14 was even able to pick up the target oligo
with 4 mismatches as efficiently as the one with 0 mismatches over
a broad range of hybridization temperatures (FIG. 1F).
Example 2
Effect of the Length Difference Between the Two Oligonucleic Acids
of a Nucleic Acid Probe on Mismatch Tolerance Evaluated by
Quantitative Real-Time RT-PCR Assays
[0060] This example shows the evaluations on three different probe
sets 520-20/que-16, 520-20/que-12 and 520-31/que-14 for their
mismatch tolerances by performing the quantitative real-time RT
(reverse transcription)-PCR assays. Five transcripts carrying
different mutations were employed to test these three probe sets.
In these non-competitive quantitative assays, each 100 .mu.l RT-PCR
reaction contained 1.25.times.RT-PCR buffer (62.5 mM Bicine, pH
8.05-8.25, 143.75 mM potassium acetate, 10% glycerol, 0.125 mM
EDTA, 0.0125 mg/ml acetyl bovine serum albumin (BSA), 0.078% (v/v)
Tween 20, and 0.025% (w/v) sodium azide), 2.5 mM MnCl.sub.2, 0.375
mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP, dTTP),
13.13 units of rTth DNA polymerase (Applied Biosystems), 0.6 .mu.M
HIV forward PCR primer FP-29, 1.6 .mu.M HIV reverse PCR primer
RP-25 (Table 2), 0.1 .mu.M internal control (IC) forward
primer-196, 0.3 .mu.M IC reverse primer-310, 0.2 .mu.M FAM-labeled
oligo probe for detection of the HIV PCR products, 0.2 .mu.M
DABCYL-labeled quenching oligo for quenching fluorescence signal of
the FAM probe, 0.1 .mu.M VIC-labeled beacon probe for detecting the
IC PCR products (all fluorophore-labeled and quencher-labeled
oligos obtained from TriLink), 1.times. FRETROX (Applied
Biosystems) as the reference dye for signal normalization, 5,000
copies of IC transcript and different levels of HIV wild type
transcript standards (0, 4.17.times.10.sup.1, 4.17.times.10.sup.2,
4.17.times.10.sup.3, 4.17.times.10.sup.4 or 4.17.times.10.sup.5
copies per reaction). To quantify the five transcripts by each of
the three probe sets, each transcript at 1.times.10.sup.4
copies/reaction was used to run the assay along with the wild type
transcript standards. Amplification reactions were performed in an
Applied Biosystems 7000 Sequence Detection PCR system with the
following cycle conditions: 1 cycle of reverse transcription at
59.degree. C. 30 min; 2 cycles of low-stringent amplification at
95.degree. C. 1 min and 54.degree. C. 1 min; 10 cycles of
high-stringent amplification at 95.degree. C. 15 sec and 59.degree.
C. 1 min; and 40 amplification and detection cycles of 95.degree.
C. 15 sec and 45.degree. C. 2 min 30 sec. Fluorescence measurements
were recorded during each 45.degree. C. step of the 40 cycles. At
the end of each real-time PCR run, the data was automatically
analyzed by the system and amplification plots were obtained.
Quantities of the five sample transcripts were determined by using
the calibration curve obtained from plotting the log.sub.10 HIV
standard copy numbers against their respective fluorescence
threshold cycles (C.sub.T). FIGS. 2A-C show the amplification plots
of the five transcripts by using the three double-stranded linear
probe sets 520-20/que-16, 520-20/que-12 and 520-31/que-14,
respectively. 1.times.10.sup.4 copies of each transcript were
amplified, and the amount of PCR products generated at each cycle
was detected by one of the three double-stranded linear probe sets:
(A) 520-20/que-16; (B) 520-20/que-12; (C) 520-31/que-14. To the
five transcripts, the FAM-labeled oligo 520-20 encountered 0
mismatches to two of them and 2 mismatches to the remaining three
(Table 4). When paired with the DABCYL-labeled quenching oligo
que-16, the probe 520-20 barely detected the three transcripts with
2 mismatches (FIG. 2A) and thus under-estimated their
concentrations by more than 1 log 10 (Table 3). On the other hand,
when paired with a 4-base shorter quenching oligo que-12, the probe
520-20 was able to detect the three 2-mismatch transcripts at a
higher efficiency (FIG. 2B) and only under-estimated their
quantities by less than 0.5 log 10 (Table 4). These results
confirmed the conclusion from Example 1 that widening the length
difference between the two component oligos (the FAM-labeled oligo
and its complementary DABCYL-labeling quenching oligo) of a
double-stranded linear probe increases the efficiency of the
FAM-labeled oligo to pick up target oligos with mismatches. This
conclusion was further substantiated by the ability of the probe
set 520-31/que-14, with a larger length difference of 17 bases
between the two component oligos, to detect transcripts with
mutations up to 4 almost as efficiently as the wild type transcript
(FIG. 2C). The probe 520-31, which was 11 bases longer than 520-20
and had to identify more mismatches for the same set of the five
transcripts (Table 5), quantified all five transcripts to be
between 1.3.times.10.sup.4 and 3.1.times.10.sup.4 (Table 5); these
determined copy numbers were very close to the expected
1.times.10.sup.4. In the log.sub.10 scale, the highest determined
copy number difference between the mutant and the wild type was 0.4
log.sub.10 that fell within the acceptable 0.5 log.sub.10 (Table
5). In conclusion, partially double-stranded probes can be utilized
to accurately quantify nucleic acid samples, and when designed
appropriately, those probes are able to quantify mutants as
accurately as wild types.
3TABLE 3 Quantifications of transcripts (4.0 log10 per reaction)
with 0 or 2 mismatches by using the double-stranded probe
520-20/que-16 Number of Positions of Quantity Mismatches
Mismatches.sup.1 (log 10 cps/reaction) 0 n/a 4.42 0 n/a 4.41 2 6,
12 3.03 2 9, 12 2.90 2 12, 18 3.37 .sup.1Positions of mismatches
show the positions of mismatched nucleotides starting from the 5'
end of the HIV FAM probe 520-20. n/a: not applicable.
[0061]
4TABLE 4 Quantifications of transcripts (4.0 log10 per reaction)
with 0 or 2 mismatches by using the double-stranded probe
520-20/que-12 Number of Positions of Quantity Mismatches
Mismatches.sup.1 (log 10 cps/reaction) 0 n/a 4.47 0 n/a 4.46 2 6,
12 4.03 2 9, 12 4.13 2 12, 18 4.13 .sup.1Positions of mismatches
show the positions of mismatched nucleotides starting from the 5'
end of the HIV FAM probe 520-20. n/a: not applicable.
[0062]
5TABLE 5 Quantifications of transcripts (4.0 log10 per reaction)
with 0, 2, 3 or 4 mismatches by using the double-stranded probe
520-31/que-14 Number of Positions of Quantity Mismatches
Mismatches.sup.1 (log 10 cps/reaction) 0 n/a 4.50 2 6, 12 4.31 3 9,
12, 22 4.31 3 12, 18, 27 4.11 4 21, 24, 25, 27 4.31 .sup.1Positions
of mismatches show the positions of mismatched nucleotides starting
from the 5' end of the HIV FAM probe 520-31. n/a: not
applicable.
Example 3
Inhibition of RT-PCR by a Quenching Oligonucleotide with a Tm
Higher than the RT Temperature
[0063] To examine the impact of utilizing a quencher probe with a
Tm that is above the incubation temperature of the RT reaction,
performance of the probe combination, lin-41 and que-23 (Table 2),
was evaluated in a quantitative real-time reverse transcription
(RT)-PCR assay. The quenching oligo, que-23, has a Tm of 60.27,
above the 59.degree. C. RT incubation temperature. In this
competitive quantitative assay, each 100 .mu.l RT-PCR reaction was
carried out in the presence of 1.times.EZ buffer (containing 50 mM
Bicine, pH 8.2, 115 mM potassium acetate and 8% glycerol), 2.5 mM
Mn(OAc)2, 0.4 mM of each deoxynucleotide-triphosphate (dATP, dCTP,
dGTP, dTTP), 20 units of RNase inhibitor, 10 units of Tth DNA
polymerase (all from Applied Biosystems), 0.2 .mu.M HIV forward PCR
primer FP-29, 1.0 .mu.M HIV reverse PCR primer RP-24, 0.1 .mu.M
FAM-labeled oligo probe lin-41 for detection of the HIV wild type
PCR products, 0.2 .mu.M DABCYL-labeled quenching oligo que-23 to
quench the FAM probe, 0.1 .mu.M Texas Red-labeled beacon probe
bpic-7 for detecting the internal control (IC) PCR products, 0.04
.mu.g/ml Alexa (Molecular Probes) as the reference dye for signal
normalization, 100 copies of internal control transcript and
different copy numbers of HIV wild type transcript (0, 10,
10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 copies).
Amplification reactions were performed in a Stratagene Mx4000
multiplex quantitative PCR system with the following cycle
conditions: 1 cycle of reverse transcription at 95.degree. C. 5 sec
and 59.degree. C. 30 min; 2 cycles of low-stringent amplification
at 95.degree. C. 30 sec, 54.degree. C. 30 sec and 72.degree. C. 30
sec; 10 cycles of high-stringent amplification at 95.degree. C. 30
sec, 59.degree. C. 30 sec and 72.degree. C. 30 sec; 33
amplification and detection cycles of 95.degree. C. 30 sec,
50.degree. C. 1 min and 72.degree. C. 30 sec. Fluorescence
measurements were recorded during each 50.degree. C. step of the 33
cycles. At the end of each real-time PCR run, the data was
automatically analyzed by the system and amplification plots were
obtained. Amplification curves of the wild type and the internal
control transcripts are shown in FIGS. 3A and B, respectively.
Seven reactions, each initiated with a different number of HIV wild
type template transcripts were incubated simultaneously in a
Stratagene's Mx4000. The concentration of amplicons that were
present after each cycle of amplification was determined by
measuring FAM fluorescence signal emanated from the probe-target
hybrids during the last 21 seconds of the annealing step. The FAM
fluorescence intensity in each reaction was measured as a function
of cycle. Of the wild type transcript input levels ranging from
10.sup.1-10.sup.6, significant amplification was observed only for
the high copy numbers (i.e. from 10.sup.4 to 10.sup.6), whereas no
fluorescence signals were recorded for the low copy numbers from 0
to 10.sup.3. For real-time RT-PCR amplification of control
transcripts, 100 copies of internal control transcripts were used.
The amount of internal control PCR products generated at each cycle
was detected by molecular beacon probe bpic-7 labeled with Texas
Red. The copy number of wild type transcript as indicated next to
each curve was amplified in an RT-PCR reaction together with the
100 copies of internal control transcript. No fluorescence signals
were observed for the 100 copies of internal control transcript.
These data are consistent with a hypothesis that the DABCYL-labeled
quenching oligo que-23 with a Tm of 60.27, higher than the
59.degree. C. RT temperature, hybridized to the FAM-labeled linear
probe lin-41 and that the lin-41/que-23 duplex inhibited reverse
transcription. The inhibition significantly reduced reverse
transcription efficiency of both wild type and internal control
transcripts. No fluorescence signals above baseline were observed
at low copy numbers (0-10.sup.3), while amplification curves for
the high copy numbers (10.sup.4-10.sup.6) had significantly delayed
cycle numbers and reached sub-maximal levels.
Example 4
Elimination of Inhibition by a Quenching Oligonucleic Acid with a
Tm Lower than the RT Temperature in RT-PCR
[0064] To evaluate the relationship between the Tm of the quenching
oligo and RT-PCR assay performance, the FAM-labeled probe, lin-41,
was used in combination with the quenching oligo, que-22 (Table 2).
The oligo, que-22, has a Tm of 55.86.degree. C., below the
59.degree. C. incubation temperature of reverse transcription (RT).
A quantitative real-time RT-PCR assay was performed as described in
Example 3, with the exception that the quenching oligo, que-22, was
substituted for que-23. The resulting data is presented in FIGS. 4A
and 4B. In contrast to results obtained in Example 3, typical
amplification curves were found for both wild type and internal
control transcripts at all copy levels. The wild type amplification
curves at template concentrations of 10.sup.4, 10.sup.5 and
10.sup.6 emerged about 8 cycles earlier and reached to a maximum
level higher than 10,000. Even at 10 copies per reaction, the
lowest template input level examined, significant amplification was
observed (.about.2,000 units). The observed amplification was
significantly above the baseline, demonstrating that the probe
combination, lin-41/que-22, provides high sensitivity. Moreover,
the assay exhibited good linearity with a broad dynamic range;
correlation coefficient (r.sup.2) of 0.998 over six logs (10 to
10.sup.6) of target concentration. For the 100 copies of internal
control transcript, the amplification curves displayed a typical
profile of competitive PCR, in which the internal control
fluorescence signals decreased in response to the increase of wild
type transcript copy numbers. These data demonstrate the utility of
a quenching probe that has a Tm (for the FAM-labeled linear probe)
below the RT incubation step for RT-PCR amplification and
quantification.
Example 5
Signal Enhancements by Using Linear Probes Labeled with More than
One Fluorescent Molecule
[0065] To examine whether fluorescence signals generated in RT-PCR
assays could be enhanced by use of linear probes carrying more than
one fluorescent label, a quantitative real-time RT-PCR assay was
set-up with multiply labeled probes. Three FAM-labeled linear
probes, slin-47, dfam-50 and fam-650 (Table 2) were used, along
with two quenching oligos, sque-15BH and bhq-5015. Both quenching
oligo probes bind to all three FAM-labeled linear probes. Probe
slin-47 carries one FAM (1.times.FAM) at the 5' end and a DABCYL at
the 3' end, while probe dfam-50 has one FAM at both 5' and 3' ends
(2.times.FAM); probe fam-650 possesses an internal FAM in addition
to its two terminal FAMs (3.times.FAM). The RT-PCR reactions in
this competitive quantitative assay were carried out under the
condition similar to that described in Example 3. Each 100 .mu.l
RT-PCR reaction contained 1.times.EZ buffer (containing 50 mM
Bicine, pH 8.2, 115 mM potassium acetate and 8% glycerol), 2.5 mM
Mn(OAc)2, 0.4 mM of each deoxynucleotide-triphosphate (dATP, dCTP,
dGTP, dTTP), 20 units of RNase inhibitor, 10 units of Tth DNA
polymerase (all from Applied Biosystems), 0.1 .mu.M HIV forward PCR
primer FP-29, 1.0 .mu.M HIV reverse PCR primer RP-24, 0.2 .mu.M
FAM-labeled oligo probe (slin-47, dfam-50 or fam-650) for detection
of the HIV wild type PCR products, 0.25 .mu.M BHQ-labeled quenching
oligo sque-15BH to quench the 5' end of the FAM probe, 0.25 .mu.M
BHQ-labeled quenching oligo bhq-5015 to quench the 3' end of the
FAM probe, 0.2 .mu.M Texas Red-labeled beacon probe bpic-7BH for
detecting the internal control (IC) PCR products, 0.04 .mu.g/ml
Alexa as the reference dye for signal normalization, 100 copies of
internal control transcript and different copy numbers of HIV wild
type transcript (0, 10, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 or
10.sup.6 copies). Amplification reactions were performed in a
Stratagene Mx4000 multiplex quantitative PCR system with the
following cycle conditions: 1 cycle of reverse transcription at
59.degree. C. 60 min; 2 cycles of low-stringent amplification at
95.degree. C. 1 min and 54.degree. C. 1 min; 10 cycles of
high-stringent amplification at 95.degree. C. 15 sec and 59.degree.
C. 1 min; 33 amplification and detection cycles of 95.degree. C. 15
sec and 40.degree. C. 2 min 30 sec. Fluorescence measurements were
recorded during each 40.degree. C. step of the 33 cycles. At the
end of each real-time PCR run, the data were automatically analyzed
by the system and amplification plots were obtained. Typical
amplification profiles were observed at all input levels of wild
type transcript by all three FAM-labeled probes. FIG. 5 depicts
amplification plots for wild type transcript at 10 copies/reaction
(A), 10.sup.3 copies/reaction (B), 10.sup.5 copies/reaction (C) and
10.sup.6 copies/reaction (D). At each copy number tested, the
3.times.FAM probe overall generated more fluorescence signal than
the 2.times.FAM probe, which in turn overall emanated more signal
than the 1.times.FAM probe. In addition to an overall higher
fluorescence signal level, increasing assay sensitivity, linear
probes with multiple FAM labels generated amplification curves with
steeper slopes, facilitating determination of the fluorescence
threshold cycle (C.sub.T).
Example 6
Quantification of Transcripts with or without Mutations
[0066] To examine the utility of partially double-stranded probes
for reliably detecting and quantifying templates with mismatches,
probe set fam-650 (3 FAM labels)/sque-15BH+bhq-5015 (Table 2) was
used to quantify transcripts with multiple mutations. Each of five
transcripts carrying 0, 2, 3, 4 or 5 mutations was quantified in a
real-time RT-PCR assay. Transcript copy number was determined by
OD260 measurement. The assay was standardized using different copy
numbers of wild type transcript. The RT-PCR reactions in this
competitive quantitative assay were carried out under the condition
similar to that described in Example 5. Each 100 .mu.l RT-PCR
reaction contained 1.times.EZ buffer (containing 50 mM Bicine, pH
8.2, 115 mM potassium acetate and 8% glycerol), 2.5 mM Mn(OAc)2,
0.4 mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP,
dTTP), 20 units of RNase inhibitor, 10 units of Tth DNA polymerase,
0.1 .mu.M HIV forward PCR primer FP-29, 1.0 .mu.M HIV reverse PCR
primer RP-24, 0.15 .mu.M FAM-labeled oligo probe fam-650 for
detection of the HIV wild type PCR products, 0.25 .mu.M BHQ-labeled
quenching oligo sque-15BH to quench the 5' end of the FAM probe,
0.25 .mu.M BHQ-labeled quenching oligo bhq-5015 to quench the 3'
end of the FAM probe, 0.1 .mu.M Texas Red-labeled linear probe
trp-34 for detecting the internal control (IC) PCR products, 0.1
.mu.M BHQ-labeled quenching oligo ctrp-15bhq to quench the Texas
Red IC, 0.04 .mu.g/ml Alexa as the reference dye for signal
normalization, 200 copies of internal control transcript and
different copy numbers of HIV wild type standard transcript (0, 10,
10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 copies). To
quantify the five transcripts, 8.times.10.sup.3 copies of each
transcript instead of the wild type standard were added into one
RT-PCR reaction and amplified along with the seven HIV standards.
Amplification reactions were performed in a Stratagene Mx4000
multiplex quantitative PCR system with the following cycle
conditions: 1 cycle of reverse transcription at 59.degree. C. 60
min; 2 cycles of low-stringent amplification at 95.degree. C. 1 min
and 54.degree. C. 1 min; 10 cycles of high-stringent amplification
at 95.degree. C. 15 sec and 59.degree. C. 1 min; 33 amplification
and detection cycles of 95.degree. C. 15 sec and 40.degree. C. 2
min 30 sec. Fluorescence measurements were recorded during each
40.degree. C. step of the 33 cycles. At the end of each real-time
PCR run, the data were automatically analyzed by the system and
amplification plots were obtained. FIG. 6 shows the amplification
plots of the five transcripts. All five curves group together and
emerge up at cycle 15. The copy numbers of the five transcripts
determined by this quantitative assay turned out to be
9.6.times.10.sup.3 (0 mismatches), 1.1.times.10.sup.4 (2
mismatches), 7.2.times.10.sup.3 (3 mismatches), 5.6.times.10.sup.3
(4 mismatches) and 6.3.times.10.sup.3 (5 mismatches); these copy
numbers were very close to the expected 8.times.10.sup.3. In the
log.sub.10 scale, the highest difference among these five
determined copy numbers was 0.29 log.sub.10. Thus, the partially
double-stranded linear probe set quantified transcripts with up to
five mutations as accurately as the wild type (0 mismatches). This
demonstrates the tolerance of partially double-stranded probes to
mismatches and demonstrates their utility for quantifying target
regions containing genetic polymorphisms.
Sequence CWU 1
1
16 1 29 DNA Artificial Sequence PCR Primer 1 attccctaca atccccaaag
tcaaggagt 29 2 25 DNA Artificial Sequence PCR Primer 2 cccctgcact
gtacccccca atccc 25 3 24 DNA Artificial Sequence PCR Primer 3
cccctgcact gtacccccca atcc 24 4 20 DNA Artificial Sequence PCR
Primer 4 acagcagtac aaatggcagt 20 5 31 DNA Artificial Sequence PCR
Primer 5 acagcagtac aaatggcagt attcatccac a 31 6 41 DNA Artificial
Sequence PCR Primer 6 gctacagcag tacaaatggc agtattcatc cacaatttcc c
41 7 47 DNA Artificial Sequence PCR Primer 7 gcacagcagt acaaatggca
gtattcatcc acaattttaa aagaaaa 47 8 50 DNA Artificial Sequence PCR
Primer 8 gcacagcagt acaaatggca gtattcatcc acaattttaa aagaaaacgc 50
9 49 DNA Artificial Sequence PCR Primer 9 gcacagcagt acaaatggca
gtattcatcc acaatttaaa agaaaacgc 49 10 15 DNA Artificial Sequence
PCR Primer 10 gtattgtact gctgt 15 11 17 DNA Artificial Sequence PCR
Primer 11 cggatttgta ctgctgt 17 12 19 DNA Artificial Sequence PCR
Primer 12 gacccatttg tactgctgt 19 13 22 DNA Artificial Sequence PCR
Primer 13 gacccatttg tactgctgta gc 22 14 23 DNA Artificial Sequence
PCR Primer 14 tgagccattt gtactgctgt agc 23 15 15 DNA Artificial
Sequence PCR Primer 15 tttgtactgc tgtgc 15 16 15 DNA Artificial
Sequence PCR Primer 16 gcgttttctt ttaaa 15
* * * * *