U.S. patent application number 10/498704 was filed with the patent office on 2005-10-06 for antisense modulation of mucin 1, transmembrane expression.
Invention is credited to Dobie, Kenneth W., Fitch, Susan J..
Application Number | 20050222058 10/498704 |
Document ID | / |
Family ID | 21849435 |
Filed Date | 2005-10-06 |
United States Patent
Application |
20050222058 |
Kind Code |
A1 |
Dobie, Kenneth W. ; et
al. |
October 6, 2005 |
Antisense modulation of mucin 1, transmembrane expression
Abstract
Antisense compounds, compositions and methods are provided for
modulating the expression of mucin 1, transmembrane. The
compositions comprise antisense compounds, particularly antisense
oligonucleotides, targeted to nucleic acids encoding mucin 1,
transmembrane. Methods of using these compounds for modulation of
mucin 1, transmembrane expression and for treatment of diseases
associated with expression of mucin 1, transmembrane are
provided.
Inventors: |
Dobie, Kenneth W.; (Del Mar,
CA) ; Fitch, Susan J.; (San Diego, CA) |
Correspondence
Address: |
ISIS PHARMACEUTICALS INC
1896 RUTHERFORD RD.
CARLSBAD
CA
92008
US
|
Family ID: |
21849435 |
Appl. No.: |
10/498704 |
Filed: |
June 14, 2004 |
PCT Filed: |
December 13, 2002 |
PCT NO: |
PCT/US02/39873 |
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
C12N 2310/3341 20130101;
C12N 2310/341 20130101; A61K 38/00 20130101; C12N 2310/321
20130101; Y02P 20/582 20151101; C12N 2310/346 20130101; C12N 15/113
20130101; C12N 2310/321 20130101; C12N 2310/315 20130101; C12N
2310/3525 20130101 |
Class at
Publication: |
514/044 ;
536/023.1 |
International
Class: |
A61K 048/00; C07H
021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 20, 2001 |
US |
10/029517 |
Claims
What is claimed is:
1. A compound 8 to 50 nucleobases in length targeted to a nucleic
acid molecule encoding mucin 1, transmembrane, wherein said
compound specifically hybridizes with said nucleic acid molecule
encoding mucin 1, transmembrane and inhibits the expression of
mucin 1, transmembrane.
2. The compound of claim 1 which is an antisense
oligonucleotide.
3. The compound of claim 2 wherein the antisense oligonucleotide
has a sequence comprising SEQ ID NO: 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 64, 66, 67,
68, 69, 72, 74, 75, 76, 78, 79, 80, 81 88, 89, 90, 91, 93, 94, 96,
97, 98 or 99.
4. The compound of claim 2 wherein the antisense oligonucleotide
comprises at least one modified internucleoside linkage.
5. The compound of claim 4 wherein the modified internucleoside
linkage is a phosphorothioate linkage.
6. The compound of claim 2 wherein the antisense oligonucleotide
comprises at least one modified sugar moiety.
7. The compound of claim 6 wherein the modified sugar moiety is a
2'-O-methoxyethyl sugar moiety.
8. The compound of claim 2 wherein the antisense oligonucleotide
comprises at least one modified nucleobase.
9. The compound of claim 8 wherein the modified nucleobase is a
5-methylcytosine.
10. The compound of claim 2 wherein the antisense oligonucleotide
is a chimeric oligonucleotide.
11. A compound 8 to 50 nucleobases in length which specifically
hybridizes with at least an 8-nucleobase portion of an active site
on a nucleic acid molecule encoding mucin 1, transmembrane.
12. A composition comprising the compound of claim 1 and a
pharmaceutically acceptable carrier or diluent.
13. The composition of claim 12 further comprising a colloidal
dispersion system.
14. The composition of claim 12 wherein the compound is an
antisense oligonucleotide.
15. A method of inhibiting the expression of mucin 1, transmembrane
in cells or tissues comprising contacting said cells or tissues
with the compound of claim 1 so that expression of mucin 1,
transmembrane is inhibited.
16. A method of treating an animal having a disease or condition
associated with mucin 1, transmembrane comprising administering to
said animal a therapeutically or prophylactically effective amount
of the compound of claim 1 so that expression of mucin 1,
transmembrane is inhibited.
17. The method of claim 16 wherein the disease or condition is a
hyperproliferative disorder.
18. The method of claim 16 wherein the disease or disorder is an
inflammatory disorder.
19. The compound of claim 1 targeted to a nucleic acid molecule
encoding mucin 1, transmembrane, wherein said compound specifically
hybridizes with and differentially inhibits the expression of one
of the variants of mucin 1, transmembrane relative to the remaining
variants of of mucin 1, transmembrane.
20. The compound of claim 19 targeted to a nucleic acid molecule
encoding of mucin 1, transmembrane, wherein said compound
hybridizes with and specifically inhibits the expression of a
variant of of mucin 1, transmembrane, wherein said variant is
selected from the group consisting of MUC1, MUC1/Y, MUC1/X, MUC1/D,
MUC1/A, MUC1/REP, MUC1/SEC, MUC1/Z, MUC1/C, MUC1-II, MUC1-III,
MUC1-IV, MUC1-V, MUC1-VI, MUC1-VII, MUC1-VIII, MUC1-IX and MUC1-X.
Description
FIELD OF THE INVENTION
[0001] The present invention provides compositions and methods for
modulating the expression of mucin 1, transmembrane. In particular,
this invention relates to compounds, particularly oligonucleotides,
specifically hybridizable with nucleic acids encoding mucin 1,
transmembrane. Such compounds have been shown to modulate the
expression of mucin 1, transmembrane.
BACKGROUND OF THE INVENTION
[0002] Mucins are high-molecular-weight, heavily glycosylated
proteins found in milk, mammary gland and lactating tissue, as well
as other simple secretory epithelial tissues. Mucins are
constituents of the physical and biological barrier in protective
mucous of respiratory, ductal and glandular epithelia. In humans,
at least 10 distinct epithelial mucin core polypeptide genes have
been identified (MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC6, MUC7,
MUC8, and MUC9), and these mucins share the common features of
bearing tandem repeat domains rich in proline, serine and threonine
residues and forming O-glycans, with N-acetylgalactosamine linkages
at hundreds of sites. Mucins are purported to be the most
polymorphic of all biological macromolecules produced by eukaryotic
organisms (even more so than immunoglobulin and T cell receptors).
Mucin O-glycans serve as epitopes representing blood group and as
related genetically polymorphic antigens (Irimura et al., J.
Biochem. (Tokyo), 1999, 126, 975-985).
[0003] The highly-glycosylated mucin-type glycoproteins present in
human urine and several normal and malignant tissues of epithelial
origin are very antigenic, and in searches for epithelial and
tumor-associated antigens, a large number of monoclonal antibodies
have been produced which bind to the mucins. These antibodies have
been used in cancer diagnosis and therapy, as well as to study the
expression and variation of the PUM (peanut lectin binding urinary
mucins) antigens and to confirm that the PUM locus, a
highly-polymorphic "minisatellite" region of the genome, encodes a
mammary mucin (Karlsson et al., Ann. Hum. Genet., 1983, 47,
263-269; Swallow et al., Nature, 1987, 328, 82-84). A full-length
cDNA encoding mucin 1, transmembrane (also known as MUC1,
episialin, epitectin, polymorphic epithelial mucin, PEM,
peanut-reactive urinary mucin, PUM, epithelial membrane antigen,
EMA, PAS-0, NCRC11, H23 antigen, H23-ETA transmembrane antigen, DF3
antigen, and CD227) was deduced from overlapping clones isolated
from a cDNA library constructed from the BT20 breast cancer cell
line. The mucin 1, transmembrane gene encodes a protein with three
distinct regions: a signal peptide and degenerate tandem repeats at
the N-terminus; the major portion of the protein comprising 60-base
pair repeats which form a variable number tandem repeats (VNTR)
region, length varying with the individual; and a C-terminus
comprising degenerate tandem repeats, a unique transmembrane
sequence and a cytoplasmic tail (Gendler et al., J. Biol. Chem.,
1990, 265, 15286-15293). This VNTR region is expressed, and it
accounts for the polymorphism observed in both the mucin 1,
transmembrane gene and its protein product.
[0004] Concurrently, a monospecific polyclonal antiserum against
deglycosylated human pancreatic tumor mucin was used to clone a
mucin cDNA from an expression library prepared from the HPAF
pancreatic tumor cell line (Lan et al., J. Biol. Chem., 1990, 265,
15294-15299). This cDNA was found to be distinct from intestinal
mucin, but to be 99% homologous to the human breast mucin cDNA
cloned by Gendler, et al., leading to the suggestion that, although
the native forms of the pancreatic and breast mucin proteins are
distinct in size and degree of glycosylation, factors other than
its primary sequence determine these characteristics, and the core
protein (referred to as apomucin by Lan et al.) is encoded by same
gene, hereafter referred to as mucin 1, transmembrane. Northern
analyses of RNA from pancreatic and breast adenocarcinoma and colon
tumor cell lines revealed a 4.4-kilobase (kb) mucin 1,
transmembrane mRNA in 5 of 7 pancreatic tumor cell lines and two of
two breast tumor cell lines, whereas no transcript was detected in
the mucin-producing colon tumor lines tested. In addition to the
4.4 kb transcript, a larger mRNA with heterogeneous sizes greater
than 7 kb was observed in the Colo 357 pancreatic cell line (Lan et
al., J. Biol. Chem., 1990, 265, 15294-15299).
[0005] A series of human-rodent somatic cell hybrids were used to
map the PUM locus to human chromosome 1, and by in situ
hybridization, the mucin 1, transmembrane gene was more finely
mapped to the 1q21-24 region (Swallow et al., Ann. Hum. Genet.,
1987, 51, 289-294). The gene coding for Duffy blood group FY is
closely linked to this same region (Swallow et al., Ann. Hum.
Genet., 1988, 52, 269-271) and close linkage of mucin 1,
transmembrane to alpha-spectrin, a major component of the
erythrocyte membrane, confirms the position of mucin 1,
transmembrane at chromosomal locus 1q21 (Middleton-Price et al.,
Ann. Hum. Genet., 1988, 52, 273-278).
[0006] The extracellular variable tandem repeat domain of mucin 1,
transmembrane protein is highly O-glycosylated, with each 20 amino
acid repeat bearing five potential glycosylation sites. Aberrant
glycosylation has been described in malignancies. Due to the VNTRs,
abberant glycosylation, and alternative splicing, a considerable
number of mucin 1, transmembrane isoforms have been described. To
date, these are: MUC1, the so-called "normal" isoform; MUC1/REP,
expressed in cervical cancer; MUC1/A, the "cancer-specific" isoform
found in thyroid carcinoma tissue; MUC1/SEC, lacking the
transmembrane domain and is a secreted isoform; MUC1/X, MUC1/Y, and
MUC1/Z which lack the VNTR region; and two recently identified
splice variants, MUC1/C, MUC1/D, expressed in cervical carcinoma
(Obermair et al., Gynecol. Oncol., 2001, 83, 343-347).
[0007] In contrast to other mucins such as those secreted by goblet
cells of the inner lining of the intestine, airway, and
reproductive tract, mucin 1, transmembrane is an integral plasma
membrane protein localized to the apical surface of polarized
epithelial cells, including, but not limited to, the uterus,
cervix, and vagina, as well as secretory epithelial cells of the
mammary gland (Mather et al., Cell Tissue Res., 2001, 304, 91-101),
and to both normal and malignant lung epithelial cells (Griffiths
et al., Dis. Markers, 1988, 6, 195-202).
[0008] The cytoplasmic tail of mucin 1, transmembrane protein is
believed to interact with actin filaments of the cytoskeleton, and
its relatively large, highly glycosylated extracellular domain may
present a physical barrier that protects the cell with
anti-invasion characteristics. Mucin 1, transmembrane may help to
frustrate infection in the mammary gland (mastitis) and possibly in
other sites in the body (such as bladder and kidney infections) by
competitively inhibiting the binding of microorganisms. A mucin 1,
transmembrane null mouse has been generated, and these knockout
mice are predisposed to bacterial conjunctivitis and blepharitis,
demonstrating an important role for mucin 1, transmembrane in
ocular mucosal defense (Kardon et al., Invest. Ophthalmol. Vis.
Sci., 1999, 40, 1328-1335).
[0009] Mucin 1, transmembrane may also play a role the immune
response, intracellular signaling, and in suppression of cell
adhesion or wall-to-wall adherence in lumens and ducts, preventing
their closure and preserving the integrity of secretory systems.
Tumor cells tend to express mucin 1, transmembrane aberrantly in a
non-polarized manner, potentially facilitating their tumor invasion
and metastasis to other locations, and consequently, mucin 1,
transmembrane may be associated with biologically aggressive tumors
and a worse prognosis (Patton et al., Biochim. Biophys. Acta, 1995,
1241, 407-423; Rahn et al., Cancer, 2001, 91, 1973-1982). The
multiple functions of mucin 1, transmembrane in carcinoma-host
interactions are believed to be dependent on its polymorphic
nature, particularly its glycosylation status. Many
carcinoma-associated markers are glycoproteins whose expression
undergoes temporal or spatial regulation, and mucin 1,
transmembrane is such a molecule (Rahn et al., Cancer, 2001, 91,
1973-1982). Several data suggest that mucin 1, transmembrane plays
a role in tumor progression and metastasis: an underglycosylated
form of mucin 1, transmembrane is overexpressed in virtually all
invasive breast carcinomas; mucin 1, transmembrane is overexpressed
in advanced stage tumors and metastatic foci from colon carcinoma;
and mucin 1, transmembrane overexpression is inversely correlated
with post-surgical survival of renal cell carcinoma patients
(Irimura et al., J. Biochem. (Tokyo), 1999, 126, 975-985).
Expression of mucin 1, transmembrane is up-regulated in ovarian
cancer cell lines (Hough et al., Cancer Res., 2000, 60, 6281-6287)
and lung adenocarcinomal cell lines (Yu et al., Oncology, 1996, 53,
118-126). Thus, mucin 1, transmembrane is a prime candidate for
therapeutic strategies targeting this carcinoma associated
antigen.
[0010] Mucin 1, transmembrane has been used as an immunotherapeutic
target to elicit both humoral and cellular immunity. A double
transgenic mouse model for pancreatic cancer that overexpresses
large amounts of underglycosylated mucin 1, transmembrane protein
and spontaneously develops mucin 1, transmembrane-expressing tumors
of the pancreas has been used to study the native immune response.
These mice raised low-affinity cytotoxic T-lymphocytes (CTLs)
specific for mucin 1, transmembrane, and these CTLs can be
stimulated to kill mucin 1, transmembrane-expressing cancer cell
lines in vitro, and eradicate injectable tumors upon adoptive
transfer (Mukherjee et al., J. Immunol., 2000, 165, 3451-3460).
Similarly, vaccination of mice with a liposomal formulation that
incorporates synthetic mucin 1, transmembrane-based lipopeptide and
Lipid A into a 1,2-dipalmitoyl-sn-glycero-3-phosphocholin- e
(DPPC)/cholesterol bilayer resulted in production of
interferon-gamma and a peptide-specific immunological response
dependent on cholesterol content (Batenjany et al., Biochim.
Biophys. Acta, 2001, 1514, 280-290). In contrast to the response
observed upon immunization of mice, cynomolgus monkeys immunized
with a peptide fusion of 5 VNTRs of macaque mucin 1, transmembrane
conjugated with oxidized mannan mounted a humoral immune response,
but not a CTL autoimmune response (Vaughan et al., Vaccine, 2000,
18, 3297-3309).
[0011] In human cells, the MA5 monoclonal antibody against mucin 1,
transmembrane protein was used to explore the potential of mucin 1,
transmembrane to serve as an antigenic target for
radioimmunotherapy (RAIT). From these studies, it was concluded
that radiolabelled MA5 demonstrated therapeutic potential in a
majority of the multiple myeloma (MM) cells tested (Burton et al.,
Clin. Cancer Res., 1999, 5, 3065s-3072s).
[0012] A vector expressing the mucin 1, transmembrane cDNA in the
antisense orientation was used to transfect the human pancreatic
tumor cell line, Panc 1, (Batra et al., J. Cell Sci., 1991, 100,
841-849) or the carcinogen-induced hamster pancreatic ductal tumor
cell line, HP-1 (Batra et al., Int. J. Pancreatol., 1992, 12,
271-283), and produce transgenic pancreatic cell lines. Northern
and western blot analyses demonstrated mucin 1, transmembrane mRNA
and protein expression in cells transfected with the cDNA in the
correct orientation with respect to the promoter, but not in
control cells (HP-1 cells transfected with vector alone, or with
the mucin 1, transmembrane cDNA in the antisense orientation).
Ultrastructural analyses of the mucin 1, transmembrane expressing
transgenic human Panc 1 cells demonstrated the formation of dense
core granules and increased amounts of rough endoplasmic reticulum,
representing morphological evidence of potentially increased
secretory activity and cellular differentiation (Batra et al., J.
Cell Sci., 1991, 100, 841-849). The integration of human mucin 1,
transmembrane in hamster HP-1 cells caused no significant change in
the growth rate of HP-1 cells in vitro, but resulted in an enhanced
growth rate for xenografts of mucin 1, transmembrane transfected
HP-1 cells grown in nude mice (Batra et al., Int. J. Pancreatol.,
1992, 12, 271-283).
[0013] An antisense oligonucleotide, 21 nucleotides in length,
corresponding to a portion of the tandemly repeated sequence was
used to as a control in an experiment testing the effect of MUC2
mucin antisense oligonucleotides on the expression of MUC2-related
antigens. The effect of this antisense oligonucleotide on mucin 1,
transmembrane gene expression was not assessed (Bergeron et al., J.
Biol. Chem., 1996, 271, 6933-6940).
[0014] A phosphorothioate antisense oligonucleotide, of unspecified
sequence and length, was purchased from Biognosik GmbH (Gottingen,
Germany) and used to inhibit expression of mucin 1, transmembrane,
resulting in induction of E-cadherin-mediated cell adhesion in the
YMB-S breast cancer cell line (Kondo et al., Cancer Res., 1998, 58,
2014-2019).
[0015] Disclosed and claimed in U.S. Pat. Nos. 5,861,381 and
6,203,795 are a pharmaceutical composition which comprises, as
therapeutic agent, the polypeptide recognized by antibody H23
(which recognizes the mucin 1, transmembrane protein) as well as a
vaccinia virus into the genome of which a DNA fragment coding for
said polypeptide is inserted, said DNA fragment being placed under
the control of suitable transcription and translation signals, said
polypeptide comprising a sequence repeated n times, n being a
number from 1 to 80. Further claimed is a method of treating or
preventing a malignancy characterized by malignant tumors that
express elevated amounts of the antigen recognized by the H23
antibody comprising administering a therapeutically or
prophylactically effective amount of said pharmaceutical
composition (Chambon et al., 2001; Chambon et al., 1999).
[0016] Disclosed and claimed in European Patent EP1103623 is a
nucleic acid fragment comprising at least 17 nucleotide bases the
fragment being hybridizable with at least one of a group of
sequences representing the tandemly-repeated sequences within mucin
1, transmembrane. Also claimed is a nucleic acid fragment
comprising a portion of at least 30 nucleotide bases capable of
hybridizing with at least one of said tandemly-repeated sequences,
a double stranded DNA fragment comprising antiparallel paired
portions having said sequences, said nucleic acid fragments for use
in a method of therapy or diagnosis practiced on the human or
animal body, an antibody or fragment thereof against a human mucin
core protein which antibody or fragment has reduced or
substantially no reaction with fully expressed human mucin
glycoprotein, human polymorphic epithelial mucin core protein, a
polypeptide comprising 5 or more amino acid residues in a sequence
corresponding to a portion of mucin 1, transmembrane protein, and a
diagnostic or therapeutic method practiced on the human or animal
body comprising administering an antibody or fragment thereof, or
human polymorphic epithelial mucin core protein
(Taylor-Papadimitriou et al., 2001).
[0017] To date, investigative strategies aimed at modulating mucin
1, transmembrane function have involved the use of antisense
expression vectors, antisense oligonucleotides, and antibodies.
Currently, however, there are no known therapeutic agents which
effectively inhibit the synthesis of mucin 1, transmembrane.
[0018] Consequently, there remains a long felt need for agents
capable of effectively inhibiting mucin 1, transmembrane
function.
[0019] Antisense technology is emerging as an effective means for
reducing the expression of specific gene products and may therefore
prove to be uniquely useful in a number of therapeutic, diagnostic,
and research applications for the modulation of mucin 1,
transmembrane expression.
[0020] The present invention provides compositions and methods for
modulating mucin 1, transmembrane expression, including modulation
of variants of mucin 1, transmembrane.
SUMMARY OF THE INVENTION
[0021] The present invention is directed to compounds, particularly
antisense oligonucleotides, which are targeted to a nucleic acid
encoding mucin 1, transmembrane, and which modulate the expression
of mucin 1, transmembrane. Pharmaceutical and other compositions
comprising the compounds of the invention are also provided.
Further provided are methods of modulating the expression of mucin
1, transmembrane in cells or tissues comprising contacting said
cells or tissues with one or more of the antisense compounds or
compositions of the invention. Further provided are methods of
treating an animal, particularly a human, suspected of having or
being prone to a disease or condition associated with expression of
mucin 1, transmembrane by administering a therapeutically or
prophylactically effective amount of one or more of the antisense
compounds or compositions of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0022] The present invention employs oligomeric compounds,
particularly antisense oligonucleotides, for use in modulating the
function of nucleic acid molecules encoding mucin 1, transmembrane,
ultimately modulating the amount of mucin 1, transmembrane
produced. This is accomplished by providing antisense compounds
which specifically hybridize with one or more nucleic acids
encoding mucin 1, transmembrane. As used herein, the terms "target
nucleic acid" and "nucleic acid encoding mucin 1, transmembrane"
encompass DNA encoding mucin 1, transmembrane, RNA (including
pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived
from such RNA. The specific hybridization of an oligomeric compound
with its target nucleic acid interferes with the normal function of
the nucleic acid. This modulation of function of a target nucleic
acid by compounds which specifically hybridize to it is generally
referred to as "antisense". The functions of DNA to be interfered
with include replication and transcription. The functions of RNA to
be interfered with include all vital functions such as, for
example, translocation of the RNA to the site of protein
translation, translation of protein from the RNA, splicing of the
RNA to yield one or more mRNA species, and catalytic activity which
may be engaged in or facilitated by the RNA. The overall effect of
such interference with target nucleic acid function is modulation
of the expression of mucin 1, transmembrane. In the context of the
present invention, "modulation" means either an increase
(stimulation) or a decrease (inhibition) in the expression of a
gene. In the context of the present invention, inhibition is the
preferred form of modulation of gene expression and mRNA is a
preferred target.
[0023] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multistep
process. The process usually begins with the identification of a
nucleic acid sequence whose function is to be modulated. This may
be, for example, a cellular gene (or mRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious agent.
In the present invention, the target is a nucleic acid molecule
encoding mucin 1, transmembrane. The targeting process also
includes determination of a site or sites within this gene for the
antisense interaction to occur such that the desired effect, e.g.,
detection or modulation of expression of the protein, will result.
Within the context of the present invention, a preferred intragenic
site is the region encompassing the translation initiation or
termination codon of the open reading frame (ORF) of the gene.
Since, as is known in the art, the translation initiation codon is
typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the
corresponding DNA molecule), the translation initiation codon is
also referred to as the "AUG codon," the "start codon" or the "AUG
start codon". A minority of genes have a translation initiation
codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA,
5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the
terms "translation initiation codon" and "start codon" can
encompass many codon sequences, even though the initiator amino
acid in each instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
mucin 1, transmembrane, regardless of the sequence(s) of such
codons.
[0024] It is also known in the art that a translation termination
codon (or "stop codon") of a gene may have one of three sequences,
i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start
codon region" and "translation initiation codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation initiation codon. Similarly, the terms "stop
codon region" and "translation termination codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation termination codon.
[0025] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Other target regions
include the 5' untranslated region (5'UTR), known in the art to
refer to the portion of an mRNA in the 5' direction from the
translation initiation codon, and thus including nucleotides
between the 5' cap site and the translation initiation codon of an
mRNA or corresponding nucleotides on the gene, and the 3'
untranslated region (3'UTR), known in the art to refer to the
portion of an mRNA in the 3' direction from the translation
termination codon, and thus including nucleotides between the
translation termination codon and 3' end of an mRNA or
corresponding nucleotides on the gene. The 5' cap of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap. The
5' cap region may also be a preferred target region.
[0026] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. mRNA
splice sites, i.e., intron-exon junctions, may also be preferred
target regions, and are particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular mRNA splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred targets. It has also been found that
introns can also be effective, and therefore preferred, target
regions for antisense compounds targeted, for example, to DNA or
pre-mRNA.
[0027] It is also known in the art that alternative RNA transcripts
can be produced from the same genomic region of DNA. These
alternative transcripts are generally known as "variants". More
specifically, "pre-mRNA variants" are transcripts produced from the
same genomic DNA that differ from other transcripts produced from
the same genomic DNA in either their start or stop position and
contain both intronic and extronic regions. Upon excision of one or
more exon or intron regions or portions thereof during splicing,
pre-mRNA variants produce smaller "in RNA variants". Consequently,
mRNA variants are processed pre-mRNA variants and each unique
pre-mRNA variant must always produce a unique mRNA variant as a
result of splicing. These mRNA variants are also known as
"alternative splice variants". If no splicing of the pre-mRNA
variant occurs then the pre-mRNA variant is identical to the mRNA
variant.
[0028] It is also known in the art that variants can be produced
through the use of alternative signals to start or stop
transcription and that pre-mRNAs and mRNAs can possess more that
one start codon or stop codon. Variants that originate from a
pre-mRNA or mRNA that use alternative start codons are known as
"alternative start variants" of that pre-mRNA or mRNA. Those
transcripts that use an alternative stop codon are known as
"alternative stop variants" of that pre-mRNA or mRNA. One specific
type of alternative stop variant is the "polyA variant" in which
the multiple transcripts produced result from the alternative
selection of one of the "polyA stop signals" by the transcription
machinery, thereby producing transcripts that terminate at unique
polyA sites.
[0029] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0030] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. "Complementary," as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a DNA or RNA molecule, then the oligonucleotide and the DNA or
RNA are considered to be complementary to each other at that
position. The oligonucleotide and the DNA or RNA are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleotides which can hydrogen
bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity or precise pairing such that stable and
specific binding occurs between the oligonucleotide and the DNA or
RNA target. It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. An antisense
compound is specifically hybridizable when binding of the compound
to the target DNA or RNA molecule interferes with the normal
function of the target DNA or RNA to cause a loss of utility, and
there is a sufficient degree of complementarity to avoid
non-specific binding of the antisense compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, and in the case of in vitro assays, under
conditions in which the assays are performed.
[0031] Antisense and other compounds of the invention which
hybridize to the target and inhibit expression of the target are
identified through experimentation, and the sequences of these
compounds are hereinbelow identified as preferred embodiments of
the invention. The target sites to which these preferred sequences
are complementary are hereinbelow referred to as "active sites" and
are therefore preferred sites for targeting. Therefore another
embodiment of the invention encompasses compounds which hybridize
to these active sites.
[0032] Antisense compounds are commonly used as research reagents
and diagnostics. For example, antisense oligonucleotides, which are
able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes. Antisense compounds are also used, for example,
to distinguish between functions of various members of a biological
pathway. Antisense modulation has, therefore, been harnessed for
research use.
[0033] For use in kits and diagnostics, the antisense compounds of
the present invention, either alone or in combination with other
antisense compounds or therapeutics, can be used as tools in
differential and/or combinatorial analyses to elucidate expression
patterns of a portion or the entire complement of genes expressed
within cells and tissues.
[0034] Expression patterns within cells or tissues treated with one
or more antisense compounds are compared to control cells or
tissues not treated with antisense compounds and the patterns
produced are analyzed for differential levels of gene expression as
they pertain, for example, to disease association, signaling
pathway, cellular localization, expression level, size, structure
or function of the genes examined. These analyses can be performed
on stimulated or unstimulated cells and in the presence or absence
of other compounds which affect expression patterns.
[0035] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE
(serial analysis of gene expression)(Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein
arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (reviewed in (To, Comb.
Chem. High Throughput Screen, 2000, 3, 235-41).
[0036] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotide drugs, including ribozymes, have been
safely and effectively administered to humans and numerous clinical
trials are presently underway. It is thus established that
oligonucleotides can be useful therapeutic modalities that can be
configured to be useful in treatment regimes for treatment of
cells, tissues and animals, especially humans.
[0037] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA) or mimetics thereof. This term includes
oligonucleotides composed of naturally-occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
oligonucleotides having non-naturally-occurring portions which
function similarly. Such modified or substituted oligonucleotides
are often preferred over native forms because of desirable
properties such as, for example, enhanced cellular uptake, enhanced
affinity for nucleic acid target and increased stability in the
presence of nucleases.
[0038] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics such as are described below. The antisense
compounds in accordance with this invention preferably comprise
from about 8 to about 50 nucleobases (i.e. from about 8 to about 50
linked nucleosides). Particularly preferred antisense compounds are
antisense oligonucleotides, even more preferably those comprising
from about 12 to about 30 nucleobases. Antisense compounds include
ribozymes, external guide sequence (EGS) oligonucleotides
(oligozymes), and other short catalytic RNAs or catalytic
oligonucleotides which hybridize to the target nucleic acid and
modulate its expression.
[0039] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn the respective ends of this
linear polymeric structure can be further joined to form a circular
structure, however, open linear structures are generally preferred.
Within the oligonucleotide structure, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0040] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0041] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkyl-phosphonates, thionoalkylphosphotries- ters,
selenophosphates and boranophosphates having normal 3'-5' linkages,
21-5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Preferred oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be a basic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0042] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0043] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0044] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0045] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0046] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-[known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-[wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2-] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0047] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O--, S--, or N-alkyl;
O-, S-, or N-alkenyl; O--, S- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3).sub.2, where n and
m are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples hereinbelow.
[0048] A further prefered modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or
4' carbon atom of the sugar ring thereby forming a bicyclic sugar
moiety. The linkage is preferably a methelyne (--CH.sub.2--).sub.n
group bridging the 2' oxygen atom and the 4' carbon atom wherein n
is 1 or 2. LNAs and preparation thereof are described in WO
98/39352 and WO 99/14226.
[0049] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl
(2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub- .2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0050] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazi- n-2(3H)-one),
phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin--
2(3H)-one), G-clamps such as a substituted phenoxazine cytidine
(e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the oligomeric compounds of
the invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0051] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which is
commonly owned with the instant application and also herein
incorporated by reference.
[0052] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide.
[0053] The compounds of the invention can include conjugate groups
covalently bound to functional groups such as primary or secondary
hydroxyl groups. Conjugate groups of the invention include
intercalators, reporter molecules, polyamines, polyamides,
polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic properties of oligomers, and groups that enhance
the pharmacokinetic properties of oligomers. Typical conjugates
groups include cholesterols, lipids, phospho-lipids, biotin,
phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve oligomer uptake, enhance oligomer
resistance to degradation, and/or strengthen sequence-specific
hybridization with RNA. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve oligomer uptake, distribution, metabolism or excretion.
Representative conjugate groups are disclosed in International
Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire
disclosure of which is incorporated herein by reference. Conjugate
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-5-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et. al., Nucl. Acids
Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides &Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the
invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) which is incorporated herein by reference in its
entirety.
[0054] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0055] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention also includes antisense compounds which are
chimeric compounds. "Chimeric" antisense compounds or "chimeras,"
in the context of this invention, are antisense compounds,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the
oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
oligonucleotide inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter
oligonucleotides when chimeric oligonucleotides are used, compared
to phosphorothioate deoxyoligonucleotides hybridizing to the same
target region. Cleavage of the RNA target can be routinely detected
by gel electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0056] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0057] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0058] The antisense compounds of the invention are synthesized in
vitro and do not include antisense compositions of biological
origin, or genetic vector constructs designed to direct the in vivo
synthesis of antisense molecules.
[0059] The compounds of the invention may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0060] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to prodrugs and
pharmaceutically acceptable salts of the compounds of the
invention, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents.
[0061] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligonucleotides of the
invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate]
derivatives according to the methods disclosed in WO 93/24510 to
Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 and U.S.
Pat. No. 5,770,713 to Imbach et al.
[0062] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0063] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred acid salts are the
hydrochlorides, acetates, salicylates, nitrates and phosphates.
Other suitable pharmaceutically acceptable salts are well known to
those skilled in the art and include basic salts of a variety of
inorganic and organic acids, such as, for example, with inorganic
acids, such as for example hydrochloric acid, hydrobromic acid,
sulfuric acid or phosphoric acid; with organic carboxylic,
sulfonic, sulfo or phospho acids or N-substituted sulfamic acids,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic
acid, glucaric acid, glucuronic acid, citric acid, benzoic acid,
cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfonic acid,
naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0064] For oligonucleotides, preferred examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0065] The antisense compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. For therapeutics, an animal, preferably a human,
suspected of having a disease or disorder which can be treated by
modulating the expression of mucin 1, transmembrane is treated by
administering antisense compounds in accordance with this
invention. The compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of an
antisense compound to a suitable pharmaceutically acceptable
diluent or carrier. Use of the antisense compounds and methods of
the invention may also be useful prophylactically, e.g., to prevent
or delay infection, inflammation or tumor formation, for
example.
[0066] The antisense compounds of the invention are useful for
research and diagnostics, because these compounds hybridize to
nucleic acids encoding mucin 1, transmembrane, enabling sandwich
and other assays to easily be constructed to exploit this fact.
Hybridization of the antisense oligonucleotides of the invention
with a nucleic acid encoding mucin 1, transmembrane can be detected
by means known in the art. Such means may include conjugation of an
enzyme to the oligonucleotide, radiolabelling of the
oligonucleotide or any other suitable detection means. Kits using
such detection means for detecting the level of mucin 1,
transmembrane in a sample may also be prepared.
[0067] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration.
[0068] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful. Preferred
topical formulations include those in which the oligonucleotides of
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Preferred lipids and liposomes
include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and
cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides of the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligonucleotides may be complexed to lipids, in
particular to cationic lipids. Preferred fatty acids and esters
include but are not limited arachidonic acid, oleic acid,
eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic
acid, palmitic acid, stearic acid, linoleic acid, linolenic acid,
dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-10 alkyl ester (e.g. isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed on May 20, 1999 which
is incorporated herein by reference in its entirety.
[0069] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Preferred oral formulations are those in which
oligonucleotides of the invention are administered in conjunction
with one or more penetration enhancers surfactants and chelators.
Preferred surfactants include fatty acids and/or esters or salts
thereof, bile acids and/or salts thereof. Prefered bile acids/salts
include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic
acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid,
glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic
acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusid- ate,
sodium glycodihydrofusidate,. Prefered fatty acids include
arachidonic acid, undecanoic acid, oleic acid, lauric acid,
caprylic acid, capric acid, myristic acid, palmitic acid, stearic
acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a monoglyceride, a diglyceride or a pharmaceutically acceptable
salt thereof (e.g. sodium). Also prefered are combinations of
penetration enhancers, for example, fatty acids/salts in
combination with bile acids/salts. A particularly prefered
combination is the sodium salt of lauric acid, capric acid and
UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
Oligonucleotides of the invention may be delivered orally in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. Oligonucleotide complexing agents
include poly-amino acids; polyimines; polyacrylates;
polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates;
cationized gelatins, albumins, starches, acrylates,
polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates;
DEAE-derivatized polyimines, pollulans, celluloses and starches.
Particularly preferred complexing agents include chitosan,
N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine,
polyspermines, protamine, polyvinylpyridine,
polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g.
p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate),
poly(butylcyanoacrylate), poly(isobutylcyanoacrylate),
poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate,
DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for oligonucleotides
and their preparation are described in detail in U.S. application
Ser. Nos. 08/886,829 (filed Jul. 1, 1997), 09/108,673 (filed Jul.
1, 1998), 09/256,515 (filed Feb. 23, 1999), 09/082,624 (filed May
21, 1998) and 09/315,298 (filed May 20, 1999) each of which is
incorporated herein by reference in their entirety.
[0070] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0071] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0072] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0073] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0074] In one embodiment of the present invention the
pharmaceutical compositions may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product. The
preparation of such compositions and formulations is generally
known to those skilled in the pharmaceutical and formulation arts
and may be applied to the formulation of the compositions of the
present invention.
[0075] Emulsions
[0076] The compositions of the present invention may be prepared
and formulated as emulsions. Emulsions are typically heterogenous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter. (Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.
335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising of two immiscible liquid phases
intimately mixed and dispersed with each other. In general,
emulsions may be either water-in-oil (w/o) or of the oil-in-water
(o/w) variety. When an aqueous phase is finely divided into and
dispersed as minute droplets into a bulk oily phase the resulting
composition is called a water-in-oil (w/o) emulsion. Alternatively,
when an oily phase is finely divided into and dispersed as minute
droplets into a bulk aqueous phase the resulting composition is
called an oil-in-water (o/w) emulsion. Emulsions may contain
additional components in addition to the dispersed phases and the
active drug which may be present as a solution in either the
aqueous phase, oily phase or itself as a separate phase.
Pharmaceutical excipients such as emulsifiers, stabilizers, dyes,
and anti-oxidants may also be present in emulsions as needed.
Pharmaceutical emulsions may also be multiple emulsions that are
comprised of more than two phases such as, for example, in the case
of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w)
emulsions. Such complex formulations often provide certain
advantages that simple binary emulsions do not. Multiple emulsions
in which individual oil droplets of an o/w emulsion enclose small
water droplets constitute a w/o/w emulsion. Likewise a system of
oil droplets enclosed in globules of water stabilized in an oily
continuous provides an o/w/o emulsion.
[0077] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
may be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that may be incorporated into either
phase of the emulsion. Emulsifiers may broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0078] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (Rieger, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic
and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic nature of the surfactant has been termed the
hydrophile/lipophile balance (HLB) and is a valuable tool in
categorizing and selecting surfactants in the preparation of
formulations. Surfactants may be classified into different classes
based on the nature of the hydrophilic group: nonionic, anionic,
cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 285).
[0079] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0080] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0081] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0082] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that may
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used may be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0083] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery have been very widely used because of reasons of ease
of formulation, efficacy from an absorption and bioavailability
standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 199). Mineral-oil base laxatives,
oil-soluble vitamins and high fat nutritive preparations are among
the materials that have commonly been administered orally as o/w
emulsions.
[0084] In one embodiment of the present invention, the compositions
of oligonucleotides and nucleic acids' are formulated as
microemulsions. A microemulsion may be defined as a system of
water, oil and amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically
microemulsions are systems that are prepared by first dispersing an
oil in an aqueous surfactant solution and then adding a sufficient
amount of a fourth component, generally an intermediate
chain-length alcohol to form a transparent system. Therefore,
microemulsions have also been described as thermodynamically
stable, isotropically clear dispersions of two immiscible liquids
that are stabilized by interfacial films of surface-active
molecules (Leung and Shah, in: Controlled Release of Drugs:
Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0085] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0086] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750),
decaglycerol decaoleate (DA0750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions may, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase may typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase may include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0087] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (Constantinides et al., Pharmaceutical Research, 1994, 11,
1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13,
205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (Constantinides
et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form
spontaneously when their components are brought together at ambient
temperature. This may be particularly advantageous when formulating
thermolabile drugs, peptides or oligonucleotides. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of oligonucleotides and nucleic acids from the
gastrointestinal tract, as well as improve the local cellular
uptake of oligonucleotides and nucleic acids within the
gastrointestinal tract, vagina, buccal cavity and other areas of
administration.
[0088] Microemulsions of the present invention may also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
oligonucleotides and nucleic acids of the present invention.
Penetration enhancers used in the microemulsions of the present
invention may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0089] Liposomes
[0090] There are many organized surfactant structures besides
microemulsions that have been studied and used for the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used in the
present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0091] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0092] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0093] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0094] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes. As the merging of the liposome and cell progresses, the
liposomal contents are emptied into the cell where the active agent
may act.
[0095] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for topical administration, liposomes present
several advantages over other formulations. Such advantages include
reduced side-effects related to high systemic absorption of the
administered drug, increased accumulation of the administered drug
at the desired target, and the ability to administer a wide variety
of drugs, both hydrophilic and hydrophobic, into the skin.
[0096] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis.
[0097] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged DNA molecules to form a stable complex. The positively
charged DNA/liposome complex binds to the negatively charged cell
surface and is internalized in an endosome. Due to the acidic pH
within the endosome, the liposomes are ruptured, releasing their
contents into the cell cytoplasm (Wang et al., Biochem. Biophys.
Res. Commun., 1987, 147, 980-985).
[0098] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0099] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0100] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0101] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/po- lyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporin-A into different layers
of the skin (Hu et al. S. T. P. Pharma. Sci., 1994, 4, 6, 466).
[0102] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1 or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0103] Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphat- idylcholine are disclosed in WO
97/13499 (Lim et al.).
[0104] Many liposomes comprising lipids derivatized with one or
more hydrophilic polymers, and methods of preparation thereof, are
known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53,
2778) described liposomes comprising a nonionic detergent,
2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett.,
1984, 167, 79) noted that hydrophilic coating of polystyrene
particles with polymeric glycols results in significantly enhanced
blood half-lives. Synthetic phospholipids modified by the
attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)
are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899).
Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments
demonstrating that liposomes comprising phosphatidylethanolamine
(PE) derivatized with PEG or PEG stearate have significant
increases in blood circulation half-lives. Blume et al. (Biochimica
et Biophysica Acta, 1990, 1029, 91) extended such observations to
other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from
the combination of distearoylphosphatidylethanolamine (DSPE) and
PEG. Liposomes having covalently bound PEG moieties on their
external surface are described in European Patent No. EP 0 445 131
B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20
mole percent of PE derivatized with PEG, and methods of use
thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556
and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and
European Patent No. EP 0 496 813 B1). Liposomes comprising a number
of other lipid-polymer conjugates are disclosed in WO 91/05545 and
U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073
(Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids
are described in WO 96/10391 (Choi et al.). U.S. Pat. Nos.
5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe
PEG-containing liposomes that can be further derivatized with
functional moieties on their surfaces.
[0105] A limited number of liposomes comprising nucleic acids are
known in the art. WO 96/40062 to Thierry et al. discloses methods
for encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes
comprising antisense oligonucleotides targeted to the raf gene.
[0106] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0107] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0108] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0109] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0110] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0111] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0112] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0113] Penetration Enhancers
[0114] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides, to the skin of animals. Most
drugs are present in solution in both ionized and nonionized forms.
However, usually only lipid soluble or lipophilic drugs readily
cross cell membranes. It has been discovered that even
non-lipophilic drugs may cross cell membranes if the membrane to be
crossed is treated with a penetration enhancer. In addition to
aiding the diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs.
[0115] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.
92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail.
[0116] Surfactants: In connection with the present invention,
surfactants (or "surface-active agentsn) are chemical entities
which, when dissolved in an aqueous solution, reduce the surface
tension of the solution or the interfacial tension between the
aqueous solution and another liquid, with the result that
absorption of oligonucleotides through the mucosa is enhanced. In
addition to bile salts and fatty acids, these penetration enhancers
include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p. 92); and perfluorochemical emulsions, such as FC-43.
Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0117] Fatty acids: Various fatty acids and their derivatives which
act as penetration enhancers include, for example, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug
Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm.
Pharmacol., 1992, 44, 651-654).
[0118] Bile salts: The physiological role of bile includes the
facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural
bile salts, and their synthetic derivatives, act as penetration
enhancers. Thus the term "bile salts" includes any of the naturally
occurring components of bile as well as any of their synthetic
derivatives. The bile salts of the invention include, for example,
cholic acid (or its pharmaceutically acceptable sodium salt, sodium
cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic
acid (sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0119] Chelating Agents: Chelating agents, as used in connection
with the present invention, can be defined as compounds that remove
metallic ions from solution by forming complexes therewith, with
the result that absorption of oligonucleotides through the mucosa
is enhanced. With regards to their use as penetration enhancers in
the present invention, chelating agents have the added advantage of
also serving as DNase inhibitors, as most characterized DNA
nucleases require a divalent metal ion for catalysis and are thus
inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618,
315-339). Chelating agents of the invention include but are not
limited to disodium ethylenediaminetetraacetate (EDTA), citric
acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and
homovanilate), N-acyl derivatives of collagen, laureth-9 and
N-amino acyl derivatives of beta-diketones (enamines)(Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page
92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14,
43-51).
[0120] Non-chelating non-surfactants: As used herein, non-chelating
non-surfactant penetration enhancing compounds can be defined as
compounds that demonstrate insignificant activity as chelating
agents or as surfactants but that nonetheless enhance absorption of
oligonucleotides through the alimentary mucosa (Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This
class of penetration enhancers include, for example, unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0121] Agents that enhance uptake of oligonucleotides at the
cellular level may also be added to the pharmaceutical and other
compositions of the present invention. For example, cationic
lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (Lollo et al., PCT Application WO
97/30731), are also known to enhance the cellular uptake of
oligonucleotides.
[0122] Other agents may be utilized to enhance the penetration of
the administered nucleic acids, including glycols such as ethylene
glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and
terpenes such as limonene and menthone.
[0123] Carriers
[0124] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate oligonucleotide in hepatic tissue can be
reduced when it is coadministered with polyinosinic acid, dextran
sulfate, polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et
al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al.,
Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
[0125] Excipients
[0126] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
may be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc.).
[0127] Pharmaceutically acceptable organic or inorganic excipient
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0128] Formulations for topical administration of nucleic acids may
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0129] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
[0130] Other Components
[0131] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0132] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0133] Certain embodiments of the invention provide pharmaceutical
compositions containing (a) one or more antisense compounds and (b)
one or more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate,
irinotecan, topotecan, gemcitabine, teniposide, cisplatin and
diethylstilbestrol (DES). See, generally, The Merck Manual of
Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al.,
eds., Rahway, N.J. When used with the compounds of the invention,
such chemotherapeutic agents may be used individually (e.g., 5-FU
and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide
for a period of time followed by MTX and oligonucleotide), or in
combination with one or more other such chemotherapeutic agents
(e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and
oligonucleotide). Anti-inflammatory drugs, including but not
limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. See, generally, The
Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al.,
eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively).
Other non-antisense chemotherapeutic agents are also within the
scope of this invention. Two or more combined compounds may be used
together or sequentially.
[0134] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Numerous examples of antisense compounds are known in the
art. Two or more combined compounds may be used together or
sequentially.
[0135] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 ug to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 ug to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0136] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same.
EXAMPLES
Example 1
Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and
2'-alkoxy amidites
[0137] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial sources (e.g.
Chemgenes, Needham Mass. or Glen Research, Inc. Sterling Va.).
Other 2'-O-alkoxy substituted nucleoside amidites are prepared as
described in U.S. Pat. No. 5,506,351, herein incorporated by
reference. For oligonucleotides synthesized using 2'-alkoxy
amidites, the standard cycle for unmodified oligonucleotides was
utilized, except the wait step after pulse delivery of tetrazole
and base was increased to 360 seconds.
[0138] Oligonucleotides containing 5-methyl-2'-deoxycytidine
(5-Me-C) nucleotides were synthesized according to published
methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21,
3197-3203] using commercially available phosphoramidites (Glen
Research, Sterling Va. or ChemGenes, Needham Mass.).
2'-Fluoro amidites
2'-Fluorodeoxyadenosine amidites
[0139] 2'-fluoro oligonucleotides were synthesized as described
previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841]
and U.S. Pat. No. 5,670,633, herein incorporated by reference.
Briefly, the protected nucleoside
N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized utilizing
commercially available 9-beta-D-arabinofuranosyladenine as starting
material and by modifying literature procedures whereby the
2'-alpha-fluoro atom is introduced by a S.sub.N2-displacement of a
2'-beta-trityl group. Thus
N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively
protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP)
intermediate. Deprotection of the THP and N6-benzoyl groups was
accomplished using standard methodologies and standard methods were
used to obtain the 5'-dimethoxytrityl-(DMT) and
5'-DMT-3'-phosphoramidite intermediates.
2'-Fluorodeoxyguanosine
[0140] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-beta-D-arabinofuranosylguani- ne as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group was followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation was followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies were used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidi- tes.
2'-Fluorouridine
[0141] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a literature procedure in which
2,2'-anhydro-1-beta-D-ara- binofuranosyluracil was treated with 70%
hydrogen fluoride-pyridine. Standard procedures were used to obtain
the 5'-DMT and 5'-DMT-3'phosphoramidites.
2'-Fluorodeoxycytidine
[0142] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
2'-O-(2-Methoxyethyl) modified amidites
[0143] 2'-O-Methoxyethyl-substituted nucleoside amidites are
prepared as follows, or alternatively, as per the methods of
Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
2,2'-Anhydro 1-(beta-D-arabinofuranosyl)-5-methyluridine]
[0144] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M),
diphenyl-carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g,
0.024 M) were added to DMF (300 mL). The mixture was heated to
reflux, with stirring, allowing the evolved carbon dioxide gas to
be released in a controlled manner. After 1 hour, the slightly
darkened solution was concentrated under reduced pressure. The
resulting syrup was poured into diethylether (2.5 L), with
stirring. The product formed a gum. The ether was decanted and the
residue was dissolved in a minimum amount of methanol (ca. 400 mL).
The solution was poured into fresh ether (2.5 L) to yield a stiff
gum. The ether was decanted and the gum was dried in a vacuum oven
(60.degree. C. at 1 mm Hg for 24 h) to give a solid that was
crushed to a light tan powder (57 g, 85% crude yield). The NMR
spectrum was consistent with the structure, contaminated with
phenol as its sodium salt (ca. 5%). The material was used as is for
further reactions (or it can be purified further by column
chromatography using a gradient of methanol in ethyl acetate
(10-25%) to give a white solid, mp 222-4.degree. C.).
2'-O-Methoxyethyl-5-methyluridine
[0145] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CHCl.sub.2 (250 mL) and adsorbed onto
silica (150 g) prior to loading onto the column. The product was
eluted with the packing solvent to give 160 g (63%) of product.
Additional material was obtained by reworking impure fractions.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0146] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/hexane/acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
3',
-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0147] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by TLC by first quenching the TLC
sample with the addition of MeOH. Upon completion of the reaction,
as judged by TLC, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%). An additional 1.5 g
was recovered from later fractions.
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleurid-
ine
[0148] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10.degree. C., and the
resulting mixture stirred for an additional 2 hours. The first
solution was added dropwise, over a 45 minute period, to the latter
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0149] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxy-trityl-5-
-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (TLC showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0150] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, TLC showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine-3'-amid-
ite
[0151]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine
(74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L). Tetrazole
diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra(isopropyl)-phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (TLC showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1)
as the eluting solvent. The pure fractions were combined to give
90.6 g (87%) of the title compound.
2'-O-(Aminooxyethyl) nucleoside amidites and
2'-O-(dimethylaminooxyethyl) nucleoside amidites
2'-(Dimethylaminooxyethoxy) nucleoside amidites
[0152] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known
in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are
prepared as described in the following paragraphs. Adenosine,
cytidine and guanosine nucleoside amidites are prepared similarly
to the thymidine (5-methyluridine) except the exocyclic amines are
protected with a benzoyl moiety in the case of adenosine and
cytidine and with isobutyryl in the case of guanosine.
5-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
[0153] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese,
Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013
eq, 0.0054 mmol) were dissolved in dry pyridine (500 ml) at ambient
temperature under an argon atmosphere and with mechanical stirring.
tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458
mmol) was added in one portion. The reaction was stirred for 16 h
at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a
complete reaction. The solution was concentrated under reduced
pressure to a thick oil. This was partitioned between
dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1
L) and brine (1 L). The organic layer was dried over sodium sulfate
and concentrated under reduced pressure to a thick oil. The oil was
dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600
mL) and the solution was cooled to
[0154] -10.degree. C. The resulting crystalline product was
collected by filtration, washed with ethyl ether (3.times.200 mL)
and dried (40.degree. C., 1 mm Hg, 24 h) to 149 g (74.8%) of white
solid. TLC and NMR were consistent with pure product.
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[0155] In a 2 L stainless steel, unstirred pressure reactor was
added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the
fume hood and with manual stirring, ethylene glycol (350 mL,
excess) was added cautiously at first until the evolution of
hydrogen gas subsided.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
(149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) were
added with manual stirring. The reactor was sealed and heated in an
oil bath until an internal temperature of 160.degree. C. was
reached and then maintained for 16 h (pressure<100 psig). The
reaction vessel was cooled to ambient and opened. TLC (Rf 0.67 for
desired product and Rf 0.82 for ara-T side product, ethyl acetate)
indicated about 70% conversion to the product. In order to avoid
additional side product formation, the reaction was stopped,
concentrated under reduced pressure (10 to 1 mm Hg) in a warm water
bath (40-100.degree. C.) with the more extreme conditions used to
remove the ethylene glycol. [Alternatively, once the low boiling
solvent is gone, the remaining solution can be partitioned between
ethyl acetate and water. The product will be in the organic phase.]
The residue was purified by column chromatography (2 kg silica gel,
ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate
fractions were combined, stripped and dried to product as a white
crisp foam (84 g, 50%), contaminated starting material (17.4 g) and
pure reusable starting material 20 g. The yield based on starting
material less pure recovered starting material was 58%. TLC and NMR
were consistent with 99% pure product.
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
[0156]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
(20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g,
44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was
then dried over P.sub.2O.sub.5 under high vacuum for two days at
40.degree. C. The reaction mixture was flushed with argon and dry
THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear
solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added
dropwise to the reaction mixture. The rate of addition is
maintained such that resulting deep red coloration is just
discharged before adding the next drop. After the addition was
complete, the reaction was stirred for 4 hrs. By that time TLC
showed the completion of the reaction (ethylacetate:hexane, 60:40).
The solvent was evaporated in vacuum. Residue obtained was placed
on a flash column and eluted with ethyl acetate:hexane (60:40), to
get
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
as white foam (21.819 g, 86%).
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methylurid-
ine
[0157]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne (3.1 g, 4.5 nmol) was dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL)
and methylhydrazine (300 mL, 4.64 mmol) was added dropwise at
-10.degree. C. to 0.degree. C. After 1 h the mixture was filtered,
the filtrate was washed with ice cold CH.sub.2Cl.sub.2 and the
combined organic phase was washed with water, brine and dried over
anhydrous Na.sub.2SO.sub.4. The solution was concentrated to get
2'-O-(aminooxyethyl) thymidine, which was then dissolved in MeOH
(67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1
eq.) was added and the resulting mixture was strirred for 1 h.
Solvent was removed under vacuum; residue chromatographed to get
5'-O-tert-butyldiphenylsilyl-2'-O -[(2-formadoximinooxy)
ethyl]-5-methyluridine as white foam (1.95 g, 78%).
5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]5-methyluridi-
ne
[0158]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1 M
pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium
cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at
10.degree. C. under inert atmosphere. The reaction mixture was
stirred for 10 minutes at 10.degree. C. After that the reaction
vessel was removed from the ice bath and stirred at room
temperature for 2 h, the reaction monitored by TLC (5% MeOH in
C.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) was
added and extracted with ethyl acetate (2.times.20 mL). Ethyl
acetate phase was dried over anhydrous Na.sub.2SO.sub.4, evaporated
to dryness. Residue was dissolved in a solution of 1 M PPTS in MeOH
(30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) was added and
the reaction mixture was stirred at room temperature for 10
minutes. Reaction mixture cooled to 10.degree. C. in an ice bath,
sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and reaction
mixture stirred at 10.degree. C. for 10 minutes. After 10 minutes,
the reaction mixture was removed from the ice bath and stirred at
room temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3
(25 mL) solution was added and extracted with ethyl acetate
(2.times.25 mL). Ethyl acetate layer was dried over anhydrous
Na.sub.2SO.sub.4 and evaporated to dryness. The residue obtained
was purified by flash column chromatography and eluted with 5% MeOH
in CH.sub.2C.sub.12 to get
5'-O-tert-butyldiphenylsilyl-2'-O--[N,N-dimethylaminooxyethyl]-5-methylur-
idine as a white foam (14.6 g, 80%).
2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0159] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was
dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept
over KOH). This mixture of triethylamine-2 HF was then added to
5'-O-tert-butyldiphenylsi-
lyl-2'-O--[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40 g, 2.4
mmol) and stirred at room temperature for 24 hrs. Reaction was
monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Solvent was removed
under vacuum and the residue placed on a flash column and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 to get
2'-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg, 92.5%).
5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0160] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17
mmol) was dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. It was then co-evaporated with anhydrous pyridine (20
mL). The residue obtained was dissolved in pyridine (11 mL) under
argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol),
4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the
mixture and the reaction mixture was stirred at room temperature
until all of the starting material disappeared. Pyridine was
removed under vacuum and the residue chromatographed and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 (containing a few drops of
pyridine) to get 5'-O-DMT-2'-O-(dimethylamino-oxyethyl)-5--
methyluridine (1.13 g, 80%).
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoet-
hyl)-N,N-diisopropylphosphoramidite]
[0161] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08
g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the
residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) was
added and dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. Then the reaction mixture was dissolved in anhydrous
acetonitrile (8.4 mL) and
2-cyanoethyl-N,N,N.sup.1,N.sup.1-tetraisopropylphosphoramidite
(2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at
ambient temperature for 4 hrs under inert atmosphere. The progress
of the reaction was monitored by TLC (hexane:ethyl acetate 1:1).
The solvent was evaporated, then the residue was dissolved in ethyl
acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL).
Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and
concentrated. Residue obtained was chromatographed (ethyl acetate
as eluent) to get 5'-O-DMT-2'-O-(2-N,N-dim-
ethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N-diisopropylphos-
phoramidite] as a foam (1.04 g, 74.9%).
2'-(Aminooxyethoxy) nucleoside amidites
[0162] 2'-(Aminooxyethoxy) nucleoside amidites [also known in the
art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as
described in the following paragraphs. Adenosine, cytidine and
thymidine nucleoside amidites are prepared similarly.
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimeth-
oxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite]
[0163] The 2'-O-aminooxyethyl guanosine analog may be obtained by
selective 2'-O-alkylation of diaminopurine riboside. Multigram
quantities of diaminopurine riboside may be purchased from Schering
A G (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside
along with a minor amount of the 3'-O-isomer. 2'-O-(2-ethylacetyl)
diaminopurine riboside may be resolved and converted to
2'-O-(2-ethylacetyl)guanosine by treatment with adenosine
deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C. J., WO
94/02501 A1 940203.) Standard protection procedures should afford
2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine and
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'--
dimethoxytrityl)guanosine which may be reduced to provide
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-hydroxyethyl)-5'-O-(4,4'-dim-
ethoxytrityl)guanosine. As before the hydroxyl group may be
displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the
protected nucleoside may phosphitylated as usual to yield
2-N-isobutyryl-6-O-diphen-
ylcarbamoyl-2'-O-([2-phthalmidoxy]ethyl)-5'-O-(4,4'-dimethoxytrityl)guanos-
ine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite].
2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites
[0164] 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known
in the art as 2'-O-dimethylaminoethoxyethyl, i.e.,
2'-O--CH.sub.2--O--CH.sub.2-N- (CH).sub.2, or 2'-DMAEOE nucleoside
amidites) are prepared as follows. Other nucleoside amidites are
prepared similarly.
2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine
[0165] 2[2-(Dimethylamino)ethoxy]ethanol (Aldrich, 6.66 g, 50 mmol)
is slowly added to a solution of borane in tetrahydrofuran (1 M, 10
mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen O.sub.2 gas
evolves as the solid dissolves. O.sup.2,2'-anhydro-5-methyluridine
(1.2 g, 5 mmol), and sodium bicarbonate (2.5 mg) are added and the
bomb is sealed, placed in an oil bath and heated to 155.degree. C.
for 26 hours. The bomb is cooled to room temperature and opened.
The crude solution is concentrated and the residue partitioned
between water (200 mL) and hexanes (200 mL). The excess phenol is
extracted into the hexane layer. The aqueous layer is extracted
with ethyl acetate (3.times.200 mL) and the combined organic layers
are washed once with water, dried over anhydrous sodium sulfate and
concentrated. The residue is columned on silica gel using
methanol/methylene chloride 1:20 (which has 2% triethylamine) as
the eluent. As the column fractions are concentrated a colorless
solid forms which is collected to give the title compound as a
white solid.
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methyl
uridine
[0166] To 0.5 g (1.3 mmol) of
2'-O-[2(2-N,N-dimethylamino-ethoxy)ethyl)]-5- -methyl uridine in
anhydrous pyridine (8 mL), triethylamine (0.36 mL) and
dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 eq.) are added and
stirred for 1 hour. The reaction mixture is poured into water (200
mL) and extracted with CHCL.sub.2 (2.times.200 mL). The combined
CH.sub.2Cl.sub.3 layers are washed with saturated NaHCO.sub.3
solution, followed by saturated NaCl solution and dried over
anhydrous sodium sulfate. Evaporation of the solvent followed by
silica gel chromatography using MeOH:CH.sub.2Cl.sub.2:Et.sub.3N
(20:1, v/v, with 1% triethylamine) gives the title compound.
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite
[0167] Diisopropylaminotetrazolide (0.6 g) and
2-cyanoethoxy-N,N-diisoprop- yl phosphoramidite (1.1 mL, 2 eq.) are
added to a solution of
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylamino-ethoxy)ethyl)]-5-methylu-
ridine (2.17 g, 3 mmol) dissolved in CH.sub.2Cl.sub.2 (20 mL) under
an atmosphere of argon. The reaction mixture is stirred overnight
and the solvent evaporated. The resulting residue is purified by
silica gel flash column chromatography with ethyl acetate as the
eluent to give the title compound.
Example 2
Oligonucleotide Synthesis
[0168] Unsubstituted and substituted phosphodiester (P.dbd.O)
oligonucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine.
[0169] Phosphorothioates (P.dbd.S) are synthesized as for the
phosphodiester oligonucleotides except the standard oxidation
bottle was replaced by 0.2 M solution of 3H-1,2-benzodithiole-3-one
1,1-dioxide in acetonitrile for the stepwise thiation of the
phosphite linkages. The thiation wait step was increased to 68 sec
and was followed by the capping step. After cleavage from the CPG
column and deblocking in concentrated ammonium hydroxide at
55.degree. C. (18 h), the oligonucleotides were purified by
precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl
solution. Phosphinate oligonucleotides are prepared as described in
U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0170] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0171] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0172] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0173] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0174] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0175] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0176] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
Example 3
Oligonucleoside Synthesis
[0177] Methylenemethylimino linked oligonucleosides, also
identified as MMI linked oligonucleosides,
methylenedimethyl-hydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0178] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0179] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Patent 5,223,618, herein incorporated by
reference.
Example 4
PRA Synthesis
[0180] Peptide nucleic acids (PNAs) are prepared in accordance with
any of the various procedures referred to in Peptide Nucleic Acids
(PNA): Synthesis, Properties and Potential Applications, Bioorganic
& Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared
in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and
5,719,262, herein incorporated by reference.
Example 5
Synthesis of Chimeric Oligonucleotides
[0181] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[2'-O--Me]--[2'-deoxy]--[2, --O-Me] Chimeric Phosphorothioate
Oligonucleotides
[0182] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligonucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 380B, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
increasing the wait step after the delivery of tetrazole and base
to 600 s repeated four times for RNA and twice for 2'-O-methyl. The
fully protected oligonucleotide is cleaved from the support and the
phosphate group is deprotected in 3:1 ammonia/ethanol at room
temperature overnight then lyophilized to dryness. Treatment in
methanolic ammonia for 24 hrs at room temperature is then done to
deprotect all bases and sample was again lyophilized to dryness.
The pellet is resuspended in 1 M TBAF in THF for 24 hrs at room
temperature to deprotect the 2' positions. The reaction is then
quenched with 1 M TEAA and the sample is then reduced to 1/2 volume
by rotovac before being desalted on a G25 size exclusion column.
The oligo recovered is then analyzed spectrophotometrically for
yield and for purity by capillary electrophoresis and by mass
spectrometry.
[2'-O-(2-Methoxyethyl)]--[2'-deoxy]--[2'-O-(Methoxyethyl)] Chimeric
Phosphorothioate Oligonucleotides
[0183] [2'-O-(2-methoxyethyl)]--[2'-deoxy]--[2'-O-(methoxyethyl)]
chimeric phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl) amidites for the
2'-O-methyl amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]--[2'-deoxy
Phosphoro-thioate]--[2'-O- -(2-Methoxyethyl)
Phosphodiester]Chimeric Oligonucleotides
[0184] [2'-O-(2-methoxyethyl phosphodiester]--[2'-deoxy
phosphoro-thioate]--[2'-O-(methoxyethyl) phosphodiester]
chimeric-oligonucleotides are prepared as per the above procedure
for the 2'-O-methyl chimeric oligonucleotide with the substitution
of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites,
oxidization with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0185] Other chimeric oligonucleotides, chimeric oligonucleosides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 6
Oligonucleotide Isolation
[0186] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides or
oligonucleosides are purified by precipitation twice out of 0.5 M
NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were
analyzed by polyacrylamide gel electrophoresis on denaturing gels
and judged to be at least 85% full length material. The relative
amounts of phosphorothioate and phosphodiester linkages obtained in
synthesis were periodically checked by .sup.31p nuclear magnetic
resonance spectroscopy, and for some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
Oligonucleotide Synthesis--96 Well Plate Format
[0187] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a standard 96 well
format. Phosphodiester internucleotide linkages were afforded by
oxidation with aqueous iodine. Phosphorothioate internucleotide
linkages were generated by sulfurization utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous
acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial vendors (e.g.
PE-Applied Biosystems, Foster City, Calif., or Pharmacia,
Piscataway, N.J.). Non-standard nucleosides are synthesized as per
known literature or patented methods. They are utilized as base
protected beta-cyanoethyldiisopropyl phosphoramidites.
[0188] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis--96 Well Plate Format
[0189] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96 well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition was confirmed by mass analysis of the
compounds utilizing electrospray-mass spectroscopy. All assay test
plates were diluted from the master plate using single and
multi-channel robotic pipettors. Plates were judged to be
acceptable if at least 85% of the compounds on the plate were at
least 85% full length.
Example 9
Cell Culture and Oligonucleotide Treatment
[0190] The effect of antisense compounds on target nucleic acid
expression can be tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. The following 5 cell types are provided for
illustrative purposes, but other cell types can be routinely used,
provided that the target is expressed in the cell type chosen. This
can be readily determined by methods routine in the art, for
example Northern blot analysis, Ribonuclease protection assays, or
RT-PCR.
[0191] T-24 Cells:
[0192] The human transitional cell bladder carcinoma cell line T-24
was obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.)
supplemented with 10% fetal calf serum ((Invitrogen Corporation,
Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin
100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 7000 cells/well for use in
RT-PCR analysis.
[0193] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0194] A549 Cells:
[0195] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (ATCC) (Manassas, Va.). A549
cells were routinely cultured in DMEM basal media (Invitrogen
Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf
serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Invitrogen
Corporation, Carlsbad, Calif.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence.
[0196] NHDF Cells:
[0197] Human neonatal dermal fibroblast (NHDF) were obtained from
the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville, Md.) supplemented as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
[0198] HEK cells:
[0199] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville, Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville, Md.) formulated as recommended by the supplier. Cells
were routinely maintained for up to 10 passages as recommended by
the supplier.
[0200] MCF7:
[0201] The human breast carcinoma cell line MCF-7 was obtained from
the American Type Culture Collection (Manassas, Va.). MCF-7 cells
were routinely cultured in DMEM low glucose (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.). Cells were
routinely passaged by trypsinization and dilution when they reached
90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872.) at a density of 7000 cells/well for use in
RT-PCR analysis.
[0202] For Northern blotting or other analyses, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0203] Treatment with Antisense Compounds:
[0204] When cells reached 70% confluency, they were treated with
oligonucleotide. For cells grown in 96-well plates, wells were
washed once with 100 .mu.L OPTI-MEM.TM.-1 reduced-serum medium
(Invitrogen Corporation, Carlsbad, Calif.) and then treated with
130 .mu.L of OPTI-MEM.TM.-1 containing 3.75 .mu.g/mL LIPOFECTIN.TM.
(Invitrogen Corporation, Carlsbad, Calif.) and the desired
concentration of oligonucleotide. After 4-7 hours of treatment, the
medium was replaced with fresh medium. Cells were harvested 16-24
hours after oligonucleotide treatment.
[0205] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. For human cells the positive control
oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1,
a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with
a phosphorothioate backbone which is targeted to human H-ras. For
mouse or rat cells the positive control oligonucleotide is ISIS
15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl
gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate
backbone which is targeted to both mouse and rat c-raf. The
concentration of positive control oligonucleotide that results in
80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS
15770) mRNA is then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
H-ras or c-raf mRNA is then utilized as the oligonucleotide
screening concentration in subsequent experiments for that cell
line. If 60% inhibition is not achieved, that particular cell line
is deemed as unsuitable for oligonucleotide transfection
experiments.
Example 10
Analysis of Oligonucleotide Inhibition of Mucin 1, Transmembrane
Expression
[0206] Antisense modulation of mucin 1, transmembrane expression
can be assayed in a variety of ways known in the art. For example,
mucin 1, transmembrane mRNA levels can be quantitated by, e.g.,
Northern blot analysis, competitive polymerase chain reaction
(PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is
presently preferred. RNA analysis can be performed on total
cellular RNA or poly(A)+ mRNA. The preferred method of RNA analysis
of the present invention is the use of total cellular RNA as
described in other examples herein. Methods of RNA isolation are
taught in, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John
Wiley & Sons, Inc., 1993. Northern blot analysis is routine in
the art and is taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9,
John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can
be conveniently accomplished using the commercially available ABI
PRISM>7700 Sequence Detection System, available from PE-Applied
Biosystems, Foster City, Calif. and used according to
manufacturer's instructions.
[0207] Protein levels of mucin 1, transmembrane can be quantitated
in a variety of ways well known in the art, such as
immunoprecipitation, Western blot analysis (immunoblotting), ELISA
or fluorescence-activated cell sorting (FACS). Antibodies directed
to mucin 1, transmembrane can be identified and obtained from a
variety of sources, such as the MSRS catalog of antibodies (Aerie
Corporation, Birmingham, Mich.), or can be prepared via
conventional antibody generation methods. Methods for preparation
of polyclonal antisera are taught in, for example, Ausubel, F. M.
et al., Current Protocols in Molecular Biology, Volume 2, pp.
11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of
monoclonal antibodies is taught in, for example, Ausubel, F. M. et
al., Current Protocols in Molecular Biology, Volume 2, pp.
11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.
[0208] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
Example 11
Poly(A)+ mRNA Isolation
[0209] Poly(A)+mRNA was isolated according to Miura et al., Clin.
Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA
isolation are taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1 4.5.3,
John Wiley & Sons, Inc., 1993. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) was added to each well, the plate
was gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated
for 60 minutes at room temperature, washed 3 times with 200 .mu.L
of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
After the final wash, the plate was blotted on paper towels to
remove-excess wash buffer and then air-dried for 5 minutes. 60
.mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to
70.degree. C. was added to each well, the plate was incubated on a
90.degree. C. hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-well plate.
[0210] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Example 12
Total RNA Isolation
[0211] Total RNA was isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia, Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT was
added to each well and the plate vigorously agitated for 20
seconds. 150 .mu.L of 70% ethanol was then added to each well and
the contents mixed by pipetting three times up and down. The
samples were then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum was applied for 1
minute. 500 .mu.L of Buffer RW1 was added to each well of the
RNEASY 96.TM. plate and incubated for 15 minutes and the vacuum was
again applied for 1 minute. An additional 500 .mu.L of Buffer RW1
was added to each well of the RNEASY 96.TM. plate and the vacuum
was applied for 2 minutes. 1 mL of Buffer RPE was then added to
each well of the RNEASY 96.TM. plate and the vacuum applied for a
period of 90 seconds. The Buffer RPE wash was then repeated and the
vacuum was applied for an additional 3 minutes. The plate was then
removed from the QIAVAC.TM. manifold and blotted dry on paper
towels. The plate was then re-attached to the QIAVAC.TM. manifold
fitted with a collection tube rack containing 1.2 mL collection
tubes. RNA was then eluted by pipetting 170 .mu.L water into each
well, incubating 1 minute, and then applying the vacuum for 3
minutes.
[0212] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 13
Real-time Quantitative PCR Analysis of mucin 1, transmezbrane mRNA
Levels
[0213] Quantitation of mucin 1, transmembrane mRNA levels was
determined by real-time quantitative PCR using the ABI PRISM.TM.
7700 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. This is a
closed-tube, non-gel-based, fluorescence detection system which
allows high-throughput quantitation of polymerase chain reaction
(PCR) products in real-time. As opposed to standard PCR, in which
amplification products are quantitated after the PCR is completed,
products in real-time quantitative PCR are quantitated as they
accumulate. This is accomplished by including in the PCR reaction
an oligonucleotide probe that anneals specifically between the
forward and reverse PCR primers, and contains two fluorescent dyes.
A reporter dye (e.g., FAM, obtained from either Operon Technologies
Inc., Alameda, Calif. or Integrated DNA Technologies Inc.,
Coralville, Iowa) is attached to the 5' end of the probe and a
quencher dye (e.g., TAMRA, obtained from either Operon Technologies
Inc., Alameda, Calif. or Integrated DNA Technologies Inc.,
Coralville, Iowa) is attached to the 3' end of the probe. When the
probe and dyes are intact, reporter dye emission is quenched by the
proximity of the 3' quencher dye. During amplification, annealing
of the probe to the target sequence creates a substrate that can be
cleaved by the 5'-exonuclease activity of Taq polymerase. During
the extension phase of the PCR amplification cycle, cleavage of the
probe by Taq polymerase releases the reporter dye from the
remainder of the probe (and hence from the quencher moiety) and a
sequence-specific fluorescent signal is generated. With each cycle,
additional reporter dye molecules are cleaved from their respective
probes, and the fluorescence intensity is monitored at regular
intervals by laser optics built into the ABI PRISM.TM. 7700
Sequence Detection System. In each assay, a series of parallel
reactions containing serial dilutions of mRNA from untreated
control samples generates a standard curve that is used to
quantitate the percent inhibition after antisense oligonucleotide
treatment of test samples.
[0214] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0215] PCR reagents were obtained from Invitrogen, Carlsbad, Calif.
RT-PCR reactions were carried out by adding 20 .mu.L PCR cocktail
(2.5.times.PCR buffer (-MgCl2), 6.6 mM MgCl.sub.2, 375 .mu.M each
of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and
reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25
Units PLATINUM.RTM. Taq, 5 Units MuLV reverse transcriptase, and
2.5.times.ROX dye) to 96 well plates containing 30 .mu.L total RNA
solution. The RT reaction was carried out by incubation for 30
minutes at 48.degree. C. Following a 10 minute incubation at
95.degree. C. to activate the PLATINUM.RTM. Taq, 40 cycles of a
two-step PCR protocol were carried out: 95.degree. C. for 15
seconds (denaturation) followed by 60.degree. C. for 1.5 minutes
(annealing/extension).
[0216] Gene target quantities obtained by real time RT-PCR are
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
from Molecular Probes. Methods of RNA quantification by
RiboGreen.TM. are taught in Jones, L. J., et al, Analytical
Biochemistry, 1998, 265, 368-374.
[0217] In this assay, 170 .mu.L of RiboGreen.TM. working reagent
(RiboGreen.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L
purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE
Applied Biosystems) with excitation at 480 nm and emission at 520
nm.
[0218] Probes and primers to human mucin 1, transmembrane were
designed to hybridize to a human mucin 1, transmembrane sequence,
using published sequence information (GenBank accession number
NM.sub.--002456.1, incorporated herein as SEQ ID NO:3). For human
mucin 1, transmembrane the PCR primers were forward primer:
TGACTCTGGCCTTCCGAGAA (SEQ ID NO: 4) reverse primer:
GCTGCTTCCGTTTTATACTGATTG (SEQ ID NO: 5) and the PCR probe was:
FAM-TACCATCAATGTCCACGACGTGGAGACA-TAMRA (SEQ ID NO: 6) where FAM
(PE-Applied Biosystems, Foster City, Calif.) is the fluorescent
reporter dye) and TAMRA (PE-Applied Biosystems, Foster City,
Calif.) is the quencher dye. For human GAPDH the PCR primers were:
forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO:7) reverse primer:
GAAGATGGTGATGGGATTTC (SEQ ID NO:8) and the PCR probe was: 5'
JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9) where JOE
(PE-Applied Biosystems, Foster City, Calif.) is the fluorescent
reporter dye) and TAMRA (PE-Applied Biosystems, Foster City,
Calif.) is the quencher dye.
Example 14
Northern blot analysis of mucin 1, transmembrane mRNA levels
[0219] Eighteen hours after antisense treatment, cell monolayers
were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared
following manufacturer's recommended protocols. Twenty micrograms
of total RNA was fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the
gel to HYBOND.TM.-N+nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.). RNA transfer was confirmed by UV visualization.
Membranes were fixed by UV cross-linking using a STRATALINKER.TM.
UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then
probed using QUICKHYB.TM. hybridization solution (Stratagene, La
Jolla, Calif.) using manufacturer's recommendations for stringent
conditions.
[0220] To detect human mucin 1, transmembrane, a human mucin 1,
transmembrane specific probe was prepared by PCR using the forward
primer TGACTCTGGCCTTCCGAGAA (SEQ ID NO: 4) and the reverse primer
GCTGCTTCCGTTTTATACTGATTG (SEQ ID NO: 5). To normalize for
variations in loading and transfer efficiency membranes were
stripped and probed for human glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0221] Hybridized membranes were visualized and quantitated using a
PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular
Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels
in untreated controls.
Example 15
Antisense Inhibition of Human Mucin 1, Transmembrane Expression by
chimeric phosphorothioate oligonucleotides having 2'-MOE Wings and
a Deoxy Gap
[0222] In accordance with the present invention, a series of
oligonucleotides were designed to target different regions of the
human mucin 1, transmembrane RNA, using published sequences
(GenBank accession number NM.sub.--002456.1, representing the main
mRNA of mucin 1, transmembrane, incorporated herein as SEQ ID NO:
3; GenBank accession number AF125525.1, representing the variant
MUC1/Y, incorporated herein as SEQ ID NO: 10; GenBank accession
number AF348143.1, representing a variant of mucin 1, transmembrane
herein designated MUC1-II, incorporated herein as SEQ ID NO: 11;
GenBank accession number AI834269.1, representing a variant of
mucin 1, transmembrane herein designated MUC1-III, the complement
of which is incorporated herein as SEQ ID NO: 12; GenBank accession
number AW369441.1, representing a variant of mucin 1, transmembrane
herein designated MUC1-IV, incorporated herein as SEQ ID NO: 14;
GenBank accession number BG774910.1, representing a variant of
mucin 1, transmembrane herein designated MUC1-V, incorporated
herein as SEQ ID NO: 16; GenBank accession number J05581.1,
representing a variant of mucin 1, transmembrane herein designated
MUC1-VI, incorporated herein as SEQ ID NO: 17; GenBank accession
number M31823.1, representing a variant of mucin 1, transmembrane
herein designated MUC1-VII, incorporated herein as SEQ ID NO: 18;
GenBank accession number M61170, representing a genomic sequence of
mucin 1, transmembrane, incorporated herein as SEQ ID NO: 19;
GenBank accession number U60259.1, representing the variant MUC1/X,
incorporated herein as SEQ ID NO: 20; and GenBank accession number
Z17325.1, representing the variant MUC1/D, incorporated herein as
SEQ ID NO: 21). The oligonucleotides are shown in Table 1. "Target
site" indicates the first (5'-most) nucleotide number on the
particular target sequence to which the oligonucleotide binds. All
compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20
nucleotides in length, composed of a central "gap" region
consisting of ten 2'-deoxynucleotides, which is flanked on both
sides (5' and 3' directions) by five-de nucleotide "wings". The
wings are composed of 2'-methoxyethyl (2-'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All cytidine residues are
5-methylcytidines. The compounds were analyzed for their effect on
human mucin 1, transmembrane mRNA levels by quantitative real-time
PCR as described in other herein. Data are averages from two
experiments. If "N.D." indicates two data".
1TABLE 1 Inhibition of human mucin 1, transmembrane mRNA levels by
chimeric phosphorothioate oligonucleotides having 2'-MOE wings and
a deoxy gap TARGET SEQ ID TARGET SEQ ID ISIS # REGION NO SITE
SEQUENCE % INHIB NO 199396 5'UTR 3 8 gaacagattcaagcagccag 0 22
199397 Start 3 49 cccggtgtcatggtggtggt 58 23 Codon 199398 Start 3
52 gtgcccggtgtcatggtggt 58 24 Codon 199399 Coding 3 65
gaaaggagactgggtgcccg 54 25 199400 Coding 3 105 ctgtaacaactgtaagcact
41 26 199401 Coding 3 107 acctgtaacaactgtaagca 53 27 199402 Coding
3 187 tcagtagagctgggcactga 55 28 199403 Coding 3 196
gcattcttctcagtagagct 77 29 199404 Coding 3 197 agcattcttctcagtagagc
50 30 199405 Coding 3 210 tggtcatactcacagcattc 42 31 199406 Coding
3 214 ctgctggtcatactcacagc 56 32 199407 Coding 3 227
gctggagagtacgctgctgg 57 33 199408 Coding 3 344 tgggaccgaggtgacatcct
65 34 199409 Coding 3 694 gtgacattgtggactggagg 55 35 199410 Coding
3 697 gaggtgacattgtggactgg 57 36 199411 Coding 3 704
tgaggccgaggtgacattgt 54 37 199412 Coding 3 829 gtggtaggagtatcagagtg
53 38 199413 Coding 3 835 gcaagggtggtaggagtatc 50 39 199414 Coding
3 860 ggcatcagtcttggtgctat 53 40 199415 Coding 3 940
gagaccccagtagacaactg 24 41 199416 Coding 3 997 tcttccagagaggaattaaa
41 42 199417 Coding 3 1037 aatgtctctctgcagctctt 41 43 199418 Coding
3 1042 tcagaaatgtctctctgcag 54 44 199419 Coding 3 1056
tctgcaaaaacatttcagaa 45 45 199420 Coding 3 1065
gtttataaatctgcaaaaac 39 46 199421 Coding 3 1091
attggagaggcccagaaaac 41 47 199422 Coding 3 1095
taatattggagaggcccaga 50 48 199423 Coding 3 1100
gaacttaatattggagaggc 48 49 199424 Coding 3 1112
agatcctggcctgaacttaa 53 50 199425 Coding 3 1115
cacagatcctggcctgaact 49 51 199426 Coding 3 1168
acgtcgtggacattgatggt 84 52 199427 Coding 3 1217
gttatatcgagaggctgctt 50 53 199428 Coding 3 1225
atcgtcaggttatatcgaga 47 54 199429 Coding 3 1251
gcacatcactcacgctgacg 50 55 199430 Coding 3 1268
ggcagagaaaggaaatggca 46 56 199431 Coding 3 1371
gacagacagccaaggcaatg 47 57 199432 Coding 3 1397
ctgcccgtagttctttcggc 43 58 199433 Coding 3 1412
tggaaagatgtccagctgcc 41 59 199434 Coding 3 1499
gctacgatcggtactgctag 52 60 199435 Coding 3 1540
aggctgctgccaccattacc 59 61 199436 Coding 3 1582
aagttggcagaagtggctgc 42 62 199437 Stop 3 1586 ctacaagttggcagaagtgg
35 63 Codon 199438 Stop 3 1594 acgtgcccctacaagttggc 57 64 Codon
199439 3'UTR 3 1606 gctcagagggcgacgtgccc 36 65 199440 3'UTR 3 1617
ctggccactcagctcagagg 56 66 199441 3'UTR 3 1622 actggctggccactcagctc
55 67 199442 3'UTR 3 1630 ggaatggcactggctggcca 60 68 199443 3'UTR 3
1635 ggagtggaatggcactggct 56 69 199444 Coding 10 141
aggaattaaaagcattcttc 7 70 199445 Coding 11 174 cagtagacaaagcattcttc
40 71 199446 Coding 11 297 gacagacagccatttcagaa 80 72 199447 Exon:
12 49 catcactcactgaacttaat 1 73 Exon Junction 199448 Intron 6 19
5327 tttgggttttccaagtaccc 83 74 199449 Intron 6 19 5436
catagtctcctcccaggcct 44 75 199450 Intron 6 19 5588
cattttgcctctgggtgcaa 49 76 199451 Exon: 14 160 cagccccagacatttcagaa
21 77 Exon Junction 199452 Intron 1 19 3289 ttctctctgcccataggcct 42
78 199453 Intron 1 19 3426 gggtctttatgaaggaaaaa 43 79 199454 Exon:
16 455 acatcactcacatttcagaa 62 80 Exon Junction 199455 3'UTR 17
1776 accacgttttattcagtcca 65 81 199456 Coding 18 115
gctgtggtagctgtaagcac 38 82 199457 Coding 20 175
gtgctgggatagcattcttc 15 83 199458 Coding 20 245
agagtcaattgtaccaccac 2 84 199459 Coding 21 122 ttttctccacctgtaagcac
18 85 199460 Intron: 19 3489 cctgtaacaactgttgcggg 32 86 Exon
Junction 199461 Intron: 19 3498 tgaccagaacctgtaacaac 38 87 Exon
Junction 199462 Exon 2d 19 3530 tctccttttctccacctggg 49 88 199463
Exon 2d 19 3571 ctcagtagagctgggcactg 47 89 199464 Exon 2d 19 3590
tcatactcacagcattcttc 42 90 199465 Exon: 19 3973
agagcctgaggccgaggtga 58 91 Intron Junction 199466 Intron: 19 4201
gaccccagtagacaactggg 20 92 Exon Junction 199467 Intron: 19 4250
aggaattaaactggaggttt 55 93 Exon Junction 199468 Exon 3d 19 4269
gtgctgggatcttccagaga 61 94 199469 Intron: 19 4621
atcctggcctggtcacaggg 39 95 Exon Junction 199470 Exon 5 19 4936
cagccccagactgggcagag 41 96 199471 Intron 6 19 5449
ggcccctttcttccatagtc 55 97 199472 Intron 6 19 5889
ccacctggagtggttttcca 42 98 199473 Intron 6 19 5956
aaagccgagagagggaggtc 51 99
[0223] As shown in Table 1, SEQ ID NOs 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 64, 66, 67,
68, 69, 72, 74, 75, 76, 78, 79, 80, 81, 88, 89, 90, 91, 93, 94, 96,
97, 98 and 99 demonstrated at least 41% inhibition of human mucin
1, transmembrane expression in this assay and are therefore
preferred. The target sites to which these preferred sequences are
complementary are herein referred to as "active sites" and are
therefore preferred sites for targeting by compounds of the present
invention.
Example 16
Western Blot Analysis of Mucin 1, Transmembrane Protein Levels
[0224] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a
16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to mucin 1, transmembrane is used, with a
radiolabelled or fluorescently labeled secondary antibody directed
against the primary antibody species. Bands are visualized using a
PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).
Example 17
Targeting of Individual Oligonucleotides to Specific Variants of
mucin 1, transmembrane
[0225] It is advantageous to selectively inhibit the expression of
one or more variants of mucin 1, transmembrane. Consequently, in
one embodiment of the present invention are oligonucleotides that
selectively target, hybridize to, and specifically inhibit one or
more, but fewer than all of the variants of mucin 1, transmembrane.
A summary of the target sites of the variants is shown in Table 2
and includes Genbank accession number NM.sub.--002456.1,
representing mucin 1, transmembrane (MUC1), incorporated herein as
SEQ ID NO: 3; Genbank accession number AF125525.1, representing
MUC1/Y, incorporated herein as SEQ ID NO: 10; Genbank accession
number AF348143.1, representing MUC1-II, incorporated herein as SEQ
ID NO: 11; Genbank accession number AI834269.1, representing
MUC1-III, incorporated herein as SEQ ID NO: 12; Genbank accession
number AW369441.1, representing MUC1-IV, incorporated herein as SEQ
ID NO: 14; Genbank accession number BG774910.1, representing
MUC1-V, incorporated herein as SEQ ID NO: 16; Genbank accession
number J05581.1, representing MUC1-VI, incorporated herein as SEQ
ID NO: 17; Genbank accession number M31823.1, representing
MUC1-VII, incorporated herein as SEQ ID NO: 18; Genbank accession
number U60259.1, representing MUC1/X, incorporated herein as SEQ ID
NO: 20; Genbank accession number Z17325.1, representing MUC1/D,
incorporated herein as SEQ ID NO: 21; Genbank accession number
S81781.1, representing the variant MUC1/A, incorporated herein as
SEQ ID NO: 100; Genbank accession number M32738.1, representing the
variant MUC1/REP, incorporated herein as SEQ ID NO: 101; Genbank
accession number M35093.1, representing the variant MUC1/SEC,
incorporated herein as SEQ ID NO: 102; Genbank accession number
U60261.1, representing the variant MUC1/Z, incorporated herein as
SEQ ID NO: 103; Genbank accession number Z17324.1, representing the
variant MUC1/C, incorporated herein as SEQ ID NO: 104; Genbank
accession number BF876382.1, representing a variant of mucin 1,
transmembrane herein designated MUC1-VIII, incorporated herein as
SEQ ID NO: 105; Genbank accession number BG541121.1, representing a
variant of mucin 1, transmembrane herein designated MUC1-IX,
incorporated herein as SEQ ID NO: 106; Genbank accession number
AL046435.1, representing a variant of mucin 1, transmembrane herein
designated MUC1-X, incorporated herein as SEQ ID NO: 107.
2TABLE 2 Targeting of individual oligonucleotides to specific
variants of mucin 1, transmembrane OLIGO SEQ ID TARGET VARIANT SEQ
ISIS # NO. SITE VARIANT ID NO. 199396 22 8 MUC1 3 199397 23 49 MUC1
3 199397 23 16 MUC1-II 11 199397 23 64 MUC1-VI 17 199397 23 58
MUC1-VII 18 199397 23 17 MUC1/X 20 199397 23 65 MUC1/D 21 199397 23
1 MUC1/A 100 199397 23 42 MUC1/REP 101 199397 23 776 MUC1/SEC 102
199397 23 17 MUC1/Z 103 199397 23 65 MUC1/C 104 199397 23 59
MUC1-IX 106 199398 24 52 MUC1 3 199398 24 19 MUC1-II 11 199398 24
67 MUC1-VI 17 199398 24 61 MUC1-VII 18 199398 24 20 MUC1/X 20
199398 24 68 MUC1/D 21 199398 24 4 MUC1/A 100 199398 24 45 MUC1/REP
101 199398 24 779 MUC1/SEC 102 199398 24 20 MUC1/Z 103 199398 24 68
MUC1/C 104 199398 24 62 MUC1-IX 106 199399 25 65 MUC1 3 199399 25 8
MUC1/Y 10 199399 25 32 MUC1-II 11 199399 25 80 MUC1-VI 17 199399 25
74 MUC1-VII 18 199399 25 33 MUC1/X 20 199399 25 81 MUC1/D 21 199399
25 17 MUC1/A 100 199399 25 58 MUC1/REP 101 199399 25 792 MUC1/SEC
102 199399 25 33 MUC1/Z 103 199399 25 81 MUC1/C 104 199399 25 75
MUC1-IX 106 199400 26 105 MUC1 3 199400 26 72 MUC1-II 11 199400 26
120 MUC1-VI 17 199400 26 73 MUC1/X 20 199400 26 73 MUC1/Z 103
199401 27 107 MUC1 3 199401 27 74 MUC1-II 11 199401 27 122 MUC1-VI
17 199401 27 75 MUC1/X 20 199401 27 75 MUC1/Z 103 199402 28 187
MUC1 3 199402 28 121 MUC1/Y 10 199402 28 154 MUC1-II 11 199402 28
202 MUC1-VI 17 199402 28 223 MUC1-VII 18 199402 28 155 MUC1/X 20
199402 28 166 MUC1/A 100 199402 28 207 MUC1/REP 101 199402 28 1413
MUC1/SEC 102 199402 28 155 MUC1/Z 103 199402 28 346 MUC1-VIII 105
199402 28 224 MUC1-IX 106 199403 29 196 MUC1 3 199403 29 130 MUC1/Y
10 199403 29 163 MUC1-II 11 199403 29 211 MUC1-VI 17 199403 29 232
MUC1-VII 18 199403 29 164 MUC1/X 20 199403 29 175 MUC1/A 100 199403
29 216 MUC1/REP 101 199403 29 1422 MUC1/SEC 102 199403 29 164
MUC1/Z 103 199403 29 355 MUC1-VIII 105 199403 29 233 MUC1-IX 106
199404 30 197 MUC1 3 199404 30 131 MUC1/Y 10 199404 30 164 MUC1-II
11 199404 30 212 MUC1-VI 17 199404 30 233 MUC1-VII 18 199404 30 165
MUC1/X 20 199404 30 176 MUC1/A 100 199404 30 217 MUC1/REP 101
199404 30 1423 MUC1/SEC 102 199404 30 165 MUC1/Z 103 199404 30 356
MUC1-VIII 105 199404 30 234 MUC1-IX 106 199405 31 210 MUC1 3 199405
31 225 MUC1-VI 17 199405 31 246 MUC1-VII 18 199405 31 189 MUC1/A
100 199405 31 230 MUC1/REP 101 199405 31 1436 MUC1/SEC 102 199405
31 369 MUC1-VIII 105 199406 32 214 MUC1 3 199406 32 229 MUC1-VI 17
199406 32 250 NUC1-VII 18 199406 32 193 MUC1/A 100 199406 32 234
MUC1/REP 101 199406 32 1440 MUC1/SEC 102 199406 32 373 MUC1-VIII
105 199407 33 227 MUC1 3 199407 33 242 MUC1-VI 17 199407 33 263
MUC1-VII 18 199407 33 206 MUC1/A 100 199407 33 247 MUC1/REP 101
199407 33 1453 MUC1/SEC 102 199407 33 386 MUC1-VIII 105 199408 34
344 MUC1 3 199408 34 359 MUC1-VI 17 199408 34 380 MUC1-VII 18
199408 34 364 MUC1/REP 101 199408 34 1570 MUC1/SEC 102 199409 35
694 MUC1 3 199409 35 93 MUC1-V 16 199409 35 589 MUC1-VI 17 199409
35 1800 MUC1/SEC 102 199410 36 697 MUC1 3 199410 36 96 MUC1-V 16
199410 36 592 MUC1-VI 17 199410 36 1803 MUC1/SEC 102 199411 37 704
MUC1 3 199411 37 103 MUC1-V 16 199411 37 599 MUC1-VI 17 199411 37
1810 MUC1/SEC 102 199412 38 829 MUC1 3 199412 38 228 MUC1-V 16
199412 38 724 MUC1-VI 17 199412 38 1935 MUC1/SEC 102 199413 39 835
MUC1 3 199413 39 234 MUC1-V 16 199413 39 730 MUC1-VI 17 199413 39
1941 MUC1/SEC 102 199414 40 860 MUC1 3 199414 40 259 MUC1-V 16
199414 40 755 MUC1-VI 17 199414 40 1966 MUC1/SEC 102 199415 41 940
MUC1 3 199415 41 44 MUC1-IV 14 199415 41 339 MUC1-V 16 199415 41
835 MUC1-VI 17 199415 41 2046 MUC1/SEC 102 199416 42 997 MUC1 3
199416 42 151 MUC1/Y 10 199416 42 238 MUC1-II 11 199416 42 101
MUC1-IV 14 199416 42 396 MUC1-V 16 199416 42 892 MUC1-VI 17 199416
42 2103 MUC1/SEC 102 199416 42 239 MUC1/Z 103 199416 42 254 MUC1-IX
106 199417 43 1037 MUC1 3 199417 43 191 MUC1/Y 10 199417 43 278
MUC1-II 11 199417 43 141 MUC1-IV 14 199417 43 436 MUC1-V 16 199417
43 932 MUC1-VI 17 199417 43 206 MUC1/X 20 199417 43 2143 MUC1/SEC
102 199417 43 279 MUC1/Z 103 199417 43 294 MUC1-IX 106 199418 44
1042 MUC1 3 199418 44 196 MUC1/Y 10 199418 44 283 MUC1-II 11 199418
44 146 MUC1-IV 14 199418 44 441 MUC1-V 16 199418 44 937 MUC1-VI 17
199418 44 211 MUC1/X 20 199418 44 2148 MUC1/SEC 102 199418 44 284
MUC1/Z 103 199418 44 299 MUC1-IX 106 199419 45 1056 MUC1 3 199419
45 210 MUC1/Y 10 199419 45 951 MUC1-VI 17 199419 45 298 MUC1/Z 103
199419 45 313 MUC1-IX 106 199420 46 1065 MUC1 3 199420 46 219
MUC1/Y 10 199420 46 3 MUC1-III 12 199420 46 960 MUC1-VI 17 199420
46 2270 MUC1/SEC 102 199420 46 307 MUC1/Z 103 199420 46 322 MUC1-IX
106 199421 47 1091 MUC1 3 199421 47 245 MUC1/Y 10 199421 47 29
MUC1-III 12 199421 47 986 MUC1-VI 17 199421 47 2296 MUC1/SEC 102
199421 47 333 MUC1/Z 103 199421 47 348 MUC1-IX 106 199422 48 1095
MUC1 3 199422 48 249 MUC1/Y 10 199422 48 33 MUC1-III 12 199422 48
990 MUC1-VI 17 199422 48 2300 MUC1/SEC 102 199422 48 337 MUC1/Z 103
199422 48 352 MUC1-IX 106 199423 49 1100 MUC1 3 199423 49 254
MUC1/Y 10 199423 49 38 MUC1-III 12 199423 49 995 MUC1-VI 17 199423
49 2305 MUC1/SEC 102 199423 49 342 MUC1/Z 103 199423 49 357 MUC1-IX
106 199424 50 1112 MUC1 3 199424 50 266 MUC1/Y 10 199424 50 1007
MUC1-VI 17 199424 50 354 MUC1/Z 103 199424 50 369 MUC1-IX 106
199425 51 1115 MUC1 3 199425 51 269 MUC1/Y 10 199425 51 1010
MUC1-VI 17 199425 51 357 MUC1/Z 103 199425 51 372 MUC1-IX 106
199426 52 1168 MUC1 3 199426 52 1063 MUC1-VI 17 199426 52 281
MUC1/X 20 199426 52 2524 MUC1/SEC 102 199426 52 410 MUC1/Z 103
199426 52 425 MUC1-IX 106 199427 53 1217 MUC1 3 199427 53 371
MUC1/Y 10 199427 53 1112 MUC1-VI 17 199427 53 330 MUC1/X 20 199427
53 2573 MUC1/SEC 102 199427 53 459 MUC1/Z 103 199427 53 473 MUC1-IX
106 199428 54 1225 MUC1 3 199428 54 379 MUC1/Y 10 199428 54 1120
MUC1-VI 17 199428 54 338 MUC1/X 20 199428 54 2581 MUC1/SEC 102
199428 54 467 MUC1/Z 103 199428 54 481 MUC1-IX 106 199429 55 1251
MUC1 3 199429 55 405 MUC1/Y 10 199429 55 1146 MUC1-VI 17 199429 55
364 MUC1/X 20 199429 55 493 MUC1/Z 103 199429 55 507 MUC1-IX 106
199430 56 1268 MUC1 3 199430 56 422 MUC1/Y 10 199430 56 69 MUC1-III
12 199430 56 474 MUC1-V 16 199430 56 1163 MUC1-VI 17 199430 56 381
MUC1/X 20 199430 56 510 MUC1/Z 103 199431 57 1371 MUC1 3 199431 57
525 MUC1/Y 10 199431 57 250 MUC1-IV 14 199431 57 577 MUC1-V 16
199431 57 1266 MUC1-VI 17 199431 57 484 MUC1/X 20 199431 57 613
MUC1/Z 103 199431 57 76 MUC1-X 107 199432 58 1397 MUC1 3 199432 58
551 MUC1/Y 10 199432 58 276 MUC1-IV 14 199432 58 603 MUC1-V 16
199432 58 1292 MUC1-VI 17 199432 58 510 MUC1/X 20 199432 58 2977
MUC1/SEC 102 199432 58 639 MUC1/Z 103 199432 58 102 MUC1-X 107
199433 59 1412 MUC1 3 199433 59 566 MUC1/Y 10 199433 59 291 MUC1-IV
14 199433 59 618 MUC1-V 16 199433 59 1307 MUC1-VI 17 199433 59 525
MUC1/X 20 199433 59 2992 MUC1/SEC 102 199433 59 654 MUC1/Z 103
199433 59 117 MUC1-X 107 199434 60 1499 MUC1 3 199434 60 653 MUC1/Y
10 199434 60 425 MUC1-II 11 199434 60 378 MUC1-IV 14 199434 60 704
MUC1-V 16 199434 60 1394 MUC1-VI 17 199434 60 612 MUC1/X 20 199434
60 3078 MUC1/SEC 102 199434 60 741 MUC1/Z 103 199434 60 204 MUC1-X
107 199435 61 1540 MUC1 3 199435 61 694 MUC1/Y 10 199435 61 466
MUC1-II 11 199435 61 419 MUC1-IV 14 199435 61 1435 MUC1-VI 17
199435 61 653 MUC1/X 20 199435 61 782 MUC1/Z 103 199436 62 1582
MUC1 3 199436 62 736 MUC1/Y 10 199436 62 508 MUC1-II 11 199436 62
786 MUC1-V 16 199436 62 1477 MUC1-VI 17 199436 62 695 MUC1/X 20
199436 62 824 MUC1/Z 103 199437 63 1586 MUC1 3 199437 63 740 MUC1/Y
10 199437 63 512 MUC1-II 11 199437 63 790 MUC1-V 16 199437 63 1481
MUC1-VI 17 199437 63 699 MUC1/X 20 199437 63 828 MUC1/Z 103 199438
64 1594 MUC1 3 199438 64 520 MUC1-II 11 199438 64 798 MUC1-V 16
199438 64 1489 MUC1-VI 17 199438 64 707 MUC1/X 20 199438 64 836
MUC1/Z 103 199439 65 1606 MUC1 3 199440 66 1617 MUC1 3 199441 67
1622 MUC1 3 199441 67 1517 MUC1-VI 17 199442 68 1630 MUC1 3 199442
68 833 MUC1-V 16 199442 68 1525 MUC1-VI 17 199443 69 1635 MUC1 3
199443 69 514 MUC1-IV 14 199443 69 1530 MUC1-VI 17 199444 70 141
MUC1/Y 10 199444 70 244 MUC1-IX 106 199445 71 174 MUC1-II 11 199445
71 175 MUC1/Z 103 199446 72 297 MUC1-II 11 199447 73 49 MUC1-III 12
199448 74 3171 MUC1/SEC 102 199448 74 298 MUC1-X 107 199449 75 3279
MUC1/SEC 102 199449 75 407 MUC1-X 107 199450 76 559 MUC1-X 107
199451 77 160 MUC1-IV 14 199452 78 1134 MUC1/SEC 102 199452 78 65
MUC1-VIII 105 199453 79 1269 MUC1/SEC 102 199453 79 202 MUC1-VIII
105 199454 80 455 MUC1-V 16 199455 81 1776 MUC1-VI 17 199456 82 115
MUC1-VII 18 199456 82 58 MUC1/A 100 199456 82 99 MUC1/REP 101
199456 82 116 MUC1-IX 106 199457 83 175 MUC1/X 20 199458 84 1132
MUC1 3 199458 84 286 MUC1/Y 10 199458 84 1027 MUC1-VI 17 199458 84
245 MUC1/X 20 199458 84 2488 MUC1/SEC 102 199458 84 374 MUC1/Z 103
199458 84 389 MUC1-IX 106 199459 85 122 MUC1/D 21 199460 86 85
MUC1/A 100 199460 86 126 MUC1/REP 101 199460 86 1332 MUC1/SEC 102
199461 87 115 MUC1 3 199461 87 82 MUC1-II 11 199461 87 130 MUC1-VI
17 199461 87 83 MUC1/X 20 199461 87 94 MUC1/A 100 199461 87 135
MUC1/REP 101 199461 87 1341 MUC1/SEC 102 199461 87 83 MUC1/Z 103
199462 88 147 MUC1 3 199462 88 81 MUC1/Y 10 199462 88 114 MUC1-II
11 199462 88 162 MUC1-VI 17 199462 88 183 MUC1-VII 18 199462 88 115
MUC1/X 20 199462 88 126 MUC1/A 100 199462 88 167 MUC1/REP 101
199462 88 1373 MUC1/SEC 102 199462 88 115 MUC1/Z 103 199462 88 154
MUC1/C 104 199462 88 306 MUC1-VIII 105 199462 88 184 MUC1-IX 106
199463 89 188 MUC1 3 199463 89 122 MUC1/Y 10 199463 89 155 MUC1-II
11 199463 89 203 MUC1-VI 17 199463 89 224 MUC1-VII 18 199463 89 156
MUC1/X 20 199463 89 167 MUC1/A 100 199463 89 208 MUC1/REP 101
199463 89 1414 MUC1/SEC 102 199463 89 156 MUC1/Z 103 199463 89 347
MUC1-VIII 105 199463 89 225 MUC1-IX 106 199464 90 207 MUC1 3 199464
90 222 MUC1-VI 17 199464 90 243 MUC1-VII 18 199464 90 186 MUC1/A
100 199464 90 227 MUC1/REP 101 199464 90 1433 MUC1/SEC 102 199464
90 366 MUC1-VIII 105 199465 91 710 MUC1 3 199465 91 109 MUC1-V 16
199465 91 605 MUC1-VI 17 199465 91 1816 MUC1/SEC 102 199466 92 938
MUC1 3 199466 92 42 MUC1-IV 14 199466 92 337 MUC1-V 16 199466 92
833 MUC1-VI 17 199466 92 2044 MUC1/SEC 102 199467 93 987 MUC1 3
199467 93 228 MUC1-II 11 199467 93 91 MUC1-IV 14 199467 93 386
MUC1-V 16 199467 93 882 MUC1-VI 17 199467 93 2093 MUC1/SEC 102
199467 93 229 MUC1/Z 103 199468 94 1006 MUC1 3 199468 94 160 MUC1/Y
10 199468 94 247 MUC1-II 11 199468 94 110 MUC1-IV 14 199468 94 405
MUC1-V 16 199468 94 901 MUC1-VI 17 199468 94 2112 MUC1/SEC 102
199468 94 248 MUC1/Z 103 199468 94 263 MUC1-IX 106 199469 95 2466
MUC1/SEC 102 199470 96 1281 MUC1 3 199470 96 435 MUC1/Y 10 199470
96 82 MUC1-III 12 199470 96 487 MUC1-V 16 199470 96 1176 MUC1-VI 17
199470 96 394 MUC1/X 20 199470 96 523 MUC1/Z 103 199470 96 538
MUC1-IX 106 199471 97 3292 MUC1/SEC 102 199471 97 420 MUC1-X
107
[0226]
Sequence CWU 1
1
107 1 20 DNA Artificial Sequence Antisense Oligonucleotide 1
tccgtcatcg ctcctcaggg 20 2 20 DNA Artificial Sequence Antisense
Oligonucleotide 2 atgcattctg cccccaagga 20 3 1721 DNA Homo sapiens
CDS (58)...(1605) 3 gaattccctg gctgcttgaa tctgttctgc cccctcccca
cccatttcac caccacc 57 atg aca ccg ggc acc cag tct cct ttc ttc ctg
ctg ctg ctc ctc aca 105 Met Thr Pro Gly Thr Gln Ser Pro Phe Phe Leu
Leu Leu Leu Leu Thr 1 5 10 15 gtg ctt aca gtt gtt aca ggt tct ggt
cat gca agc tct acc cca ggt 153 Val Leu Thr Val Val Thr Gly Ser Gly
His Ala Ser Ser Thr Pro Gly 20 25 30 gga gaa aag gag act tcg gct
acc cag aga agt tca gtg ccc agc tct 201 Gly Glu Lys Glu Thr Ser Ala
Thr Gln Arg Ser Ser Val Pro Ser Ser 35 40 45 act gag aag aat gct
gtg agt atg acc agc agc gta ctc tcc agc cac 249 Thr Glu Lys Asn Ala
Val Ser Met Thr Ser Ser Val Leu Ser Ser His 50 55 60 agc ccc ggt
tca ggc tcc tcc acc act cag gga cag gat gtc act ctg 297 Ser Pro Gly
Ser Gly Ser Ser Thr Thr Gln Gly Gln Asp Val Thr Leu 65 70 75 80 gcc
ccg gcc acg gaa cca gct tca ggt tca gct gcc acc tgg gga cag 345 Ala
Pro Ala Thr Glu Pro Ala Ser Gly Ser Ala Ala Thr Trp Gly Gln 85 90
95 gat gtc acc tcg gtc cca gtc acc agg cca gcc ctg ggc tcc acc acc
393 Asp Val Thr Ser Val Pro Val Thr Arg Pro Ala Leu Gly Ser Thr Thr
100 105 110 ccg cca gcc cac gat gtc acc tca gcc ccg gac aac aag cca
gcc ccg 441 Pro Pro Ala His Asp Val Thr Ser Ala Pro Asp Asn Lys Pro
Ala Pro 115 120 125 ggc tcc acc gcc ccc cca gcc cac ggt gtc acc tcg
gcc ccg gac acc 489 Gly Ser Thr Ala Pro Pro Ala His Gly Val Thr Ser
Ala Pro Asp Thr 130 135 140 agg ccg ccc ccg ggc tcc acc gcc ccc cca
gcc cac ggt gtc acc tcg 537 Arg Pro Pro Pro Gly Ser Thr Ala Pro Pro
Ala His Gly Val Thr Ser 145 150 155 160 gcc ccg gac acc agg ccg ccc
ccg ggc tcc acc gcg ccc gca gcc cac 585 Ala Pro Asp Thr Arg Pro Pro
Pro Gly Ser Thr Ala Pro Ala Ala His 165 170 175 ggt gtc acc tcg gcc
ccg gac acc agg ccg gcc ccg ggc tcc acc gcc 633 Gly Val Thr Ser Ala
Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala 180 185 190 ccc cca gcc
cat ggt gtc acc tcg gcc ccg gac aac agg ccc gcc ttg 681 Pro Pro Ala
His Gly Val Thr Ser Ala Pro Asp Asn Arg Pro Ala Leu 195 200 205 gcg
tcc acc gcc cct cca gtc cac aat gtc acc tcg gcc tca ggc tct 729 Ala
Ser Thr Ala Pro Pro Val His Asn Val Thr Ser Ala Ser Gly Ser 210 215
220 gca tca ggc tca gct tct act ctg gtg cac aac ggc acc tct gcc agg
777 Ala Ser Gly Ser Ala Ser Thr Leu Val His Asn Gly Thr Ser Ala Arg
225 230 235 240 gct acc aca acc cca gcc agc aag agc act cca ttc tca
att ccc agc 825 Ala Thr Thr Thr Pro Ala Ser Lys Ser Thr Pro Phe Ser
Ile Pro Ser 245 250 255 cac cac tct gat act cct acc acc ctt gcc agc
cat agc acc aag act 873 His His Ser Asp Thr Pro Thr Thr Leu Ala Ser
His Ser Thr Lys Thr 260 265 270 gat gcc agt agc act cac cat agc acg
gta cct cct ctc acc tcc tcc 921 Asp Ala Ser Ser Thr His His Ser Thr
Val Pro Pro Leu Thr Ser Ser 275 280 285 aat cac agc act tct ccc cag
ttg tct act ggg gtc tct ttc ttt ttc 969 Asn His Ser Thr Ser Pro Gln
Leu Ser Thr Gly Val Ser Phe Phe Phe 290 295 300 ctg tct ttt cac att
tca aac ctc cag ttt aat tcc tct ctg gaa gat 1017 Leu Ser Phe His
Ile Ser Asn Leu Gln Phe Asn Ser Ser Leu Glu Asp 305 310 315 320 ccc
agc acc gac tac tac caa gag ctg cag aga gac att tct gaa atg 1065
Pro Ser Thr Asp Tyr Tyr Gln Glu Leu Gln Arg Asp Ile Ser Glu Met 325
330 335 ttt ttg cag att tat aaa caa ggg ggt ttt ctg ggc ctc tcc aat
att 1113 Phe Leu Gln Ile Tyr Lys Gln Gly Gly Phe Leu Gly Leu Ser
Asn Ile 340 345 350 aag ttc agg cca gga tct gtg gtg gta caa ttg act
ctg gcc ttc cga 1161 Lys Phe Arg Pro Gly Ser Val Val Val Gln Leu
Thr Leu Ala Phe Arg 355 360 365 gaa ggt acc atc aat gtc cac gac gtg
gag aca cag ttc aat cag tat 1209 Glu Gly Thr Ile Asn Val His Asp
Val Glu Thr Gln Phe Asn Gln Tyr 370 375 380 aaa acg gaa gca gcc tct
cga tat aac ctg acg atc tca gac gtc agc 1257 Lys Thr Glu Ala Ala
Ser Arg Tyr Asn Leu Thr Ile Ser Asp Val Ser 385 390 395 400 gtg agt
gat gtg cca ttt cct ttc tct gcc cag tct ggg gct ggg gtg 1305 Val
Ser Asp Val Pro Phe Pro Phe Ser Ala Gln Ser Gly Ala Gly Val 405 410
415 cca ggc tgg ggc atc gcg ctg ctg gtg ctg gtc tgt gtt ctg gtt gcg
1353 Pro Gly Trp Gly Ile Ala Leu Leu Val Leu Val Cys Val Leu Val
Ala 420 425 430 ctg gcc att gtc tat ctc att gcc ttg gct gtc tgt cag
tgc cgc cga 1401 Leu Ala Ile Val Tyr Leu Ile Ala Leu Ala Val Cys
Gln Cys Arg Arg 435 440 445 aag aac tac ggg cag ctg gac atc ttt cca
gcc cgg gat acc tac cat 1449 Lys Asn Tyr Gly Gln Leu Asp Ile Phe
Pro Ala Arg Asp Thr Tyr His 450 455 460 cct atg agc gag tac ccc acc
tac cac acc cat ggg cgc tat gtg ccc 1497 Pro Met Ser Glu Tyr Pro
Thr Tyr His Thr His Gly Arg Tyr Val Pro 465 470 475 480 cct agc agt
acc gat cgt agc ccc tat gag aag gtt tct gca ggt aat 1545 Pro Ser
Ser Thr Asp Arg Ser Pro Tyr Glu Lys Val Ser Ala Gly Asn 485 490 495
ggt ggc agc agc ctc tct tac aca aac cca gca gtg gca gcc act tct
1593 Gly Gly Ser Ser Leu Ser Tyr Thr Asn Pro Ala Val Ala Ala Thr
Ser 500 505 510 gcc aac ttg tag gggcacgtcg ccctctgagc tgagtggcca
gccagtgcca 1645 Ala Asn Leu 515 ttccactcca ctcagggctc tctgggccag
tcctcctggg agcccccacc acaacacttc 1705 ccaggcatgg aattcc 1721 4 20
DNA Artificial Sequence PCR Primer 4 tgactctggc cttccgagaa 20 5 24
DNA Artificial Sequence PCR Primer 5 gctgcttccg ttttatactg attg 24
6 28 DNA Artificial Sequence PCR Probe 6 taccatcaat gtccacgacg
tggagaca 28 7 19 DNA Artificial Sequence PCR Primer 7 gaaggtgaag
gtcggagtc 19 8 20 DNA Artificial Sequence PCR Primer 8 gaagatggtg
atgggatttc 20 9 20 DNA Artificial Sequence PCR Probe 9 caagcttccc
gttctcagcc 20 10 759 DNA Homo sapiens CDS (1)...(759) 10 atg aca
ccg ggc acc cag tct cct ttc ttc ctg ctg ctg ctc ctc aca 48 Met Thr
Pro Gly Thr Gln Ser Pro Phe Phe Leu Leu Leu Leu Leu Thr 1 5 10 15
gtg ctt aca ggt tct ggt cat gca agc tct acc cca ggt gga gaa aag 96
Val Leu Thr Gly Ser Gly His Ala Ser Ser Thr Pro Gly Gly Glu Lys 20
25 30 gag act tcg gct acc cag aga agt tca gtg ccc agc tct act gag
aag 144 Glu Thr Ser Ala Thr Gln Arg Ser Ser Val Pro Ser Ser Thr Glu
Lys 35 40 45 aat gct ttt aat tcc tct ctg gaa gat ccc agc acc gac
tac tac caa 192 Asn Ala Phe Asn Ser Ser Leu Glu Asp Pro Ser Thr Asp
Tyr Tyr Gln 50 55 60 gag ctg cag aga gac att tct gaa atg ttt ttg
cag att tat aaa caa 240 Glu Leu Gln Arg Asp Ile Ser Glu Met Phe Leu
Gln Ile Tyr Lys Gln 65 70 75 80 ggg ggt ttt ctg ggc ctc tcc aat att
aag ttc agg cca gga tct gtg 288 Gly Gly Phe Leu Gly Leu Ser Asn Ile
Lys Phe Arg Pro Gly Ser Val 85 90 95 gtg gta caa ttg act ctg gcc
ttc cga gaa ggt acc atc aat gtc cac 336 Val Val Gln Leu Thr Leu Ala
Phe Arg Glu Gly Thr Ile Asn Val His 100 105 110 gac atg gag aca cag
ttc aat cag tat aaa acg gaa gca gcc tct cga 384 Asp Met Glu Thr Gln
Phe Asn Gln Tyr Lys Thr Glu Ala Ala Ser Arg 115 120 125 tat aac ctg
acg atc tca gac gtc agc gtg agt gat gtg cca ttt cct 432 Tyr Asn Leu
Thr Ile Ser Asp Val Ser Val Ser Asp Val Pro Phe Pro 130 135 140 ttc
tct gcc cag tct ggg gct ggg gtg cca ggc tgg ggc atc gcg ctg 480 Phe
Ser Ala Gln Ser Gly Ala Gly Val Pro Gly Trp Gly Ile Ala Leu 145 150
155 160 ctg gtg ctg gtc tgt gtt ctg gtt gcg ctg gcc att gtc tat ctc
att 528 Leu Val Leu Val Cys Val Leu Val Ala Leu Ala Ile Val Tyr Leu
Ile 165 170 175 gcc ttg gct gtc tgt cag tgc cgc cga aag aac tac ggg
cag ctg gac 576 Ala Leu Ala Val Cys Gln Cys Arg Arg Lys Asn Tyr Gly
Gln Leu Asp 180 185 190 atc ttt cca gcc cgg gat acc tac cat cct atg
agc gag tac ccc acc 624 Ile Phe Pro Ala Arg Asp Thr Tyr His Pro Met
Ser Glu Tyr Pro Thr 195 200 205 tac cac acc cat ggg cgc tat gtg ccc
cct agc agt acc gat cgt agc 672 Tyr His Thr His Gly Arg Tyr Val Pro
Pro Ser Ser Thr Asp Arg Ser 210 215 220 ccc tat gag aag gtt tct gca
ggt aat ggt ggc agc agc ctc tct tac 720 Pro Tyr Glu Lys Val Ser Ala
Gly Asn Gly Gly Ser Ser Leu Ser Tyr 225 230 235 240 aca aac cca gca
gtg gca gcc act tct gcc aac ttg tag 759 Thr Asn Pro Ala Val Ala Ala
Thr Ser Ala Asn Leu 245 250 11 543 DNA Homo sapiens CDS
(25)...(531) 11 ctccccaccc atttcaccac cacc atg aca ccg ggc acc cag
tct cct ttc 51 Met Thr Pro Gly Thr Gln Ser Pro Phe 1 5 ttc ctg ctg
ctg ctc ctc aca gtg ctt aca gtt gtt aca ggt tct ggt 99 Phe Leu Leu
Leu Leu Leu Thr Val Leu Thr Val Val Thr Gly Ser Gly 10 15 20 25 cat
gca agc tct acc cca ggt gga gaa aag gag act tcg gct acc cag 147 His
Ala Ser Ser Thr Pro Gly Gly Glu Lys Glu Thr Ser Ala Thr Gln 30 35
40 aga agt tca gtg ccc agc tct act gag aag aat gct ttg tct act ggg
195 Arg Ser Ser Val Pro Ser Ser Thr Glu Lys Asn Ala Leu Ser Thr Gly
45 50 55 gtc tct ttc ttt ttc ctg tct ttt cac att tca aac ctc cag
ttt aat 243 Val Ser Phe Phe Phe Leu Ser Phe His Ile Ser Asn Leu Gln
Phe Asn 60 65 70 tcc tct ctg gaa gat ccc agc acc gac tac tac caa
gag ctg cag aga 291 Ser Ser Leu Glu Asp Pro Ser Thr Asp Tyr Tyr Gln
Glu Leu Gln Arg 75 80 85 gac att tct gaa atg gct gtc tgt cag tgc
cgc cga aag aac tac ggg 339 Asp Ile Ser Glu Met Ala Val Cys Gln Cys
Arg Arg Lys Asn Tyr Gly 90 95 100 105 ctg ctg gac atc ttt cca gcc
cgg gat acc tac cat cct atg agc gag 387 Leu Leu Asp Ile Phe Pro Ala
Arg Asp Thr Tyr His Pro Met Ser Glu 110 115 120 tac ccc acc tac cac
acc cat ggg cgc tat gtg ccc cct agc agt acc 435 Tyr Pro Thr Tyr His
Thr His Gly Arg Tyr Val Pro Pro Ser Ser Thr 125 130 135 gat cgt agc
ccc tat gag aag gtt tct gca ggt aat ggt ggc agc agc 483 Asp Arg Ser
Pro Tyr Glu Lys Val Ser Ala Gly Asn Gly Gly Ser Ser 140 145 150 ctc
tct tac aca aac cca gca gtg gca gcc act tct gcc aac ttg tag 531 Leu
Ser Tyr Thr Asn Pro Ala Val Ala Ala Thr Ser Ala Asn Leu 155 160 165
gggcacgtcg cc 543 12 122 DNA Homo sapi ens exonexon junction
(58)...(59) exon 4exon 6 12 atgtttttgc agatttataa acaagggggt
tttctgggcc tctccaatat taagttcagt 60 gagtgatgtg ccatttcctt
tctctgccca gtctggggct ggggtgccag gctggggcat 120 cg 122 13 13 000 14
577 DNA Homo sapiens exonexon junction (169)...(170) exon 3cexon 6b
14 cgtgtcgcga ctgctcacct cctccaatca cagcacttct ccccagttgt
ctactggggt 60 ctctttcttt ttcctgtctt ttcacatttc aaacctccag
tttaattcct ctctggaaga 120 tcccagcacc gactactacc aagagctgca
gagagacatt tctgaaatgt ctggggctgg 180 ggtgccaggc tggggcatcg
cgctgctggt gctggtctgt gttctggttg cgctggccat 240 tgtctatctc
attgccttgg ctgtctgtca gtgccgccga aagaactacg ggcagctgga 300
catctttcca gcccgggata cctaccatcc tatgagcgag taccccacct accacaccca
360 tgggcgctat gtgcccccta gcagtaccga tcgtagcccc tatgagaagg
tttctgcagg 420 taatggtggc agcagcctct cttacacaaa cccagcagtg
gcagccactt cttgcaactt 480 gtaggggcac gtcgcccgct gagctgagta
gccagccagt gccattccac tccactcagg 540 ttcttcaggg ccagagcccc
tgcaccctgt ttgggct 577 15 15 000 16 981 DNA Homo sapiens exonexon
junction (464)...(465) exon 3bexon 4 16 gggacaccag gccggccccg
ggctccaccg cccccccagc ccatggtgtc acctcggccc 60 cggacaacag
gcccgccttg ggctccaccg cccctccagt ccacaatgtc acctcggcct 120
caggctctgc atcaggctca gcttctactc tggtgcacaa cagcacctct gccagggcta
180 ccacaacccc agccagcaag agcactccat tctcaattcc cagccaccac
tctgatactc 240 ctaccaccct tgccagccat agcaccaaga ctgatgccag
tagcactcac catagcacgg 300 tacctcctct cacctcctcc aatcacagca
cttctcccca gttgtctact ggggtctctt 360 tctttttcct gtcttttcac
atttcaaacc tccagtttaa ttcctctctg gaagatccca 420 gcaccgacta
ctaccaagag ctgcagagag acatttctga aatgtgagtg atgtgccatt 480
tcctttctct gcccagtctg gggctggggt gccaggctgg ggcatcgcgc tgctggtgct
540 ggtctgtgtt ctggttgcgc tggccattgt ctatctcatt gccttggctg
tctgtcagtg 600 ccgccgaaag aactacgggc agctggacat ctttccagcc
cgggatacct accatcctat 660 gagcgagtac cccacctacc aacccatggg
cgctatgtgc cccctagcag taccgatcgt 720 agcccctatg agacaggttt
ctgcaggtaa tggtggcagc agctctctta cacaaaccag 780 cagtggcagc
cacttctgcc aacttgtagg ggcacgttgc cgctgacctg agtggccagc 840
cagtgccatt ccacttccac tcagggttct tcaggggcca gagccctgca ccctgtttgg
900 cctggtgagc tggacttcaa ggtgggctgt cacagcctct tcaaaggccc
acaattcttc 960 gacatcctca ggtgtggaag c 981 17 1804 DNA Homo sapiens
CDS (73)...(1500) 17 cgctccacct ctcaagcagc cagcgcctgc ctgaatctgt
tctgccccct ccccacccat 60 ttcaccacca cc atg aca ccg ggc acc cag tct
cct ttc ttc ctg ctg ctg 111 Met Thr Pro Gly Thr Gln Ser Pro Phe Phe
Leu Leu Leu 1 5 10 ctc ctc aca gtg ctt aca gtt gtt aca ggt tct ggt
cat gca agc tct 159 Leu Leu Thr Val Leu Thr Val Val Thr Gly Ser Gly
His Ala Ser Ser 15 20 25 acc cca ggt gga gaa aag gag act tcg gct
acc cag aga agt tca gtg 207 Thr Pro Gly Gly Glu Lys Glu Thr Ser Ala
Thr Gln Arg Ser Ser Val 30 35 40 45 ccc agc tct act gag aag aat gct
gtg agt atg acc agc agc gta ctc 255 Pro Ser Ser Thr Glu Lys Asn Ala
Val Ser Met Thr Ser Ser Val Leu 50 55 60 tcc agc cac agc ccc ggt
tca ggc tcc tcc acc act cag gga cag gat 303 Ser Ser His Ser Pro Gly
Ser Gly Ser Ser Thr Thr Gln Gly Gln Asp 65 70 75 gtc act ctg gcc
ccg gcc acg gaa cca gct tca ggt tca gct gcc acc 351 Val Thr Leu Ala
Pro Ala Thr Glu Pro Ala Ser Gly Ser Ala Ala Thr 80 85 90 tgg gga
cag gat gtc acc tcg gtc cca gtc acc agg cca gcc ctg ggc 399 Trp Gly
Gln Asp Val Thr Ser Val Pro Val Thr Arg Pro Ala Leu Gly 95 100 105
tcc acc acc ccg cca gcc cac gat gtc acc tca gcc ccg gac aac aag 447
Ser Thr Thr Pro Pro Ala His Asp Val Thr Ser Ala Pro Asp Asn Lys 110
115 120 125 cca gcc ccg ggc tcc acc gcc ccc cca gcc cac ggt gtc acc
tcg gcc 495 Pro Ala Pro Gly Ser Thr Ala Pro Pro Ala His Gly Val Thr
Ser Ala 130 135 140 ccg gac acc agg ccg gcc ccg ggc tcc acc gcc ccc
cca gcc cat ggt 543 Pro Asp Thr Arg Pro Ala Pro Gly Ser Thr Ala Pro
Pro Ala His Gly 145 150 155 gtc acc tcg gcc ccg gac aac agg ccc gcc
ttg ggc tcc acc gcc cct 591 Val Thr Ser Ala Pro Asp Asn Arg Pro Ala
Leu Gly Ser Thr Ala Pro 160 165 170 cca gtc cac aat gtc acc tcg gcc
tca ggc tct gca tca ggc tca gct 639 Pro Val His Asn Val Thr Ser Ala
Ser Gly Ser Ala Ser Gly Ser Ala 175 180 185 tct act ctg gtg cac aac
ggc acc tct gcc agg gct acc aca acc cca 687 Ser Thr Leu Val His Asn
Gly Thr Ser Ala Arg Ala Thr Thr Thr Pro 190 195 200 205 gcc agc aag
agc act cca ttc tca att ccc agc cac cac tct gat act 735 Ala Ser Lys
Ser Thr Pro Phe Ser Ile Pro Ser His His Ser Asp Thr 210 215 220 cct
acc acc ctt gcc agc cat agc acc aag act gat gcc agt agc act 783 Pro
Thr Thr Leu Ala Ser His Ser Thr Lys Thr Asp Ala Ser Ser Thr 225 230
235 cac cat agc
acg gta cct cct ctc acc tcc tcc aat cac agc act tct 831 His His Ser
Thr Val Pro Pro Leu Thr Ser Ser Asn His Ser Thr Ser 240 245 250 ccc
cag ttg tct act ggg gtc tct ttc ttt ttc ctg tct ttt cac att 879 Pro
Gln Leu Ser Thr Gly Val Ser Phe Phe Phe Leu Ser Phe His Ile 255 260
265 tca aac ctc cag ttt aat tcc tct ctg gaa gat ccc agc acc gac tac
927 Ser Asn Leu Gln Phe Asn Ser Ser Leu Glu Asp Pro Ser Thr Asp Tyr
270 275 280 285 tac caa gag ctg cag aga gac att tct gaa atg ttt ttg
cag att tat 975 Tyr Gln Glu Leu Gln Arg Asp Ile Ser Glu Met Phe Leu
Gln Ile Tyr 290 295 300 aaa caa ggg ggt ttt ctg ggc ctc tcc aat att
aag ttc agg cca gga 1023 Lys Gln Gly Gly Phe Leu Gly Leu Ser Asn
Ile Lys Phe Arg Pro Gly 305 310 315 tct gtg gtg gta caa ttg act ctg
gcc ttc cga gaa ggt acc atc aat 1071 Ser Val Val Val Gln Leu Thr
Leu Ala Phe Arg Glu Gly Thr Ile Asn 320 325 330 gtc cac gac gtg gag
aca cag ttc aat cag tat aaa acg gaa gca gcc 1119 Val His Asp Val
Glu Thr Gln Phe Asn Gln Tyr Lys Thr Glu Ala Ala 335 340 345 tct cga
tat aac ctg acg atc tca gac gtc agc gtg agt gat gtg cca 1167 Ser
Arg Tyr Asn Leu Thr Ile Ser Asp Val Ser Val Ser Asp Val Pro 350 355
360 365 ttt cct ttc tct gcc cag tct ggg gct ggg gtg cca ggc tgg ggc
atc 1215 Phe Pro Phe Ser Ala Gln Ser Gly Ala Gly Val Pro Gly Trp
Gly Ile 370 375 380 gcg ctg ctg gtg ctg gtc tgt gtt ctg gtt gcg ctg
gcc att gtc tat 1263 Ala Leu Leu Val Leu Val Cys Val Leu Val Ala
Leu Ala Ile Val Tyr 385 390 395 ctc att gcc ttg gct gtc tgt cag tgc
cgc cga aag aac tac ggg cag 1311 Leu Ile Ala Leu Ala Val Cys Gln
Cys Arg Arg Lys Asn Tyr Gly Gln 400 405 410 ctg gac atc ttt cca gcc
cgg gat acc tac cat cct atg agc gag tac 1359 Leu Asp Ile Phe Pro
Ala Arg Asp Thr Tyr His Pro Met Ser Glu Tyr 415 420 425 ccc acc tac
cac acc cat ggg cgc tat gtg ccc cct agc agt acc gat 1407 Pro Thr
Tyr His Thr His Gly Arg Tyr Val Pro Pro Ser Ser Thr Asp 430 435 440
445 cgt agc ccc tat gag aag gtt tct gca ggt aat ggt ggc agc agc ctc
1455 Arg Ser Pro Tyr Glu Lys Val Ser Ala Gly Asn Gly Gly Ser Ser
Leu 450 455 460 tct tac aca aac cca gca gtg gca gcc act tct gcc aac
ttg tag 1500 Ser Tyr Thr Asn Pro Ala Val Ala Ala Thr Ser Ala Asn
Leu 465 470 475 gggcacgtcg cccgctgagc tgagtggcca gccagtgcca
ttccactcca ctcaggttct 1560 tcagggccag agcccctgca ccctgtttgg
gctggtgagc tgggagttca ggtgggctgc 1620 tcacaccgtc cttcagaggc
cccaccaatt tctcggacac ttctcagtgt gtggaagctc 1680 atgtgggccc
ctgaggctca tgcctgggaa gtgttgtggt gggggctccc aggaggactg 1740
gcccagagag ccctgagata gcggggatcc tgaactggac tgaataaaac gtggtctccc
1800 actg 1804 18 572 DNA Homo sapiens CDS (67)...(572) 18
acctctcaag cagccagcgc ctgcctgaat ctgttctgcc ccctccccac ccatttcacc
60 accacc atg aca ccg ggc acc cag tct cct ttc ttc ctg ctg ctg ctc
108 Met Thr Pro Gly Thr Gln Ser Pro Phe Phe Leu Leu Leu Leu 1 5 10
ctc aca gtg ctt aca gct acc aca gcc cct aaa ccc gca aca gtt gtt 156
Leu Thr Val Leu Thr Ala Thr Thr Ala Pro Lys Pro Ala Thr Val Val 15
20 25 30 acg ggt tct ggt cat gca agc tct acc cca ggt gga gaa aag
gag act 204 Thr Gly Ser Gly His Ala Ser Ser Thr Pro Gly Gly Glu Lys
Glu Thr 35 40 45 tcg gct acc cag aga agt tca gtg ccc agc tct act
gag aag aat gct 252 Ser Ala Thr Gln Arg Ser Ser Val Pro Ser Ser Thr
Glu Lys Asn Ala 50 55 60 gtg agt atg acc agc agc gta ctc tcc agc
cac agc ccc ggt tca ggc 300 Val Ser Met Thr Ser Ser Val Leu Ser Ser
His Ser Pro Gly Ser Gly 65 70 75 tcc tcc acc act cag gga cag gat
gtc act ctg gcc ccg gcc acg gaa 348 Ser Ser Thr Thr Gln Gly Gln Asp
Val Thr Leu Ala Pro Ala Thr Glu 80 85 90 cca gct tca ggt tca gct
gcc acc tgg gga cag gat gtc acc tcg gtc 396 Pro Ala Ser Gly Ser Ala
Ala Thr Trp Gly Gln Asp Val Thr Ser Val 95 100 105 110 cca gtc acc
agg cca gcc ctg ggc tcc acc acc ccg cca gcc cac gat 444 Pro Val Thr
Arg Pro Ala Leu Gly Ser Thr Thr Pro Pro Ala His Asp 115 120 125 gtc
acc tca gcc ccg gac aac aag cca gcc ccg ggc tcc acc gcc ccc 492 Val
Thr Ser Ala Pro Asp Asn Lys Pro Ala Pro Gly Ser Thr Ala Pro 130 135
140 caa gcc cac ggt gtc acc tcg gcc ccg gac acc agg ccg gcc ccg ggc
540 Gln Ala His Gly Val Thr Ser Ala Pro Asp Thr Arg Pro Ala Pro Gly
145 150 155 tcc acc gcc ccc caa gcc cac ggt gtc acc tc 572 Ser Thr
Ala Pro Gln Ala His Gly Val Thr 160 165 19 8 186 DNA Homo sapiens
unsure 6899 unknown 19 gaattcagaa ttttagaccc tttggccttg gggtccatcc
tggagaccct gaggtctaag 60 ctacagcccc tcagccaacc acagaccctt
ctctggctcc caaaaggagt tcagtcccag 120 agggtggtca cccacccttc
agggatgaga agttttcaag gggtattact caggcactaa 180 ccccaggaaa
gatgacagca cattgccata aagttttggt tgttttctaa gccagtgcaa 240
ctgcttattt tagggatttt ccgggatagg gtggggaagt ggaaggaatc ggcgagtaga
300 agagaaagcc tgggagggtg gaagttaggg atctagggga agtttggctg
atttggggat 360 gcgggtgggg gaggtgctgg atggagttaa gtgaaggata
gggtgcctga gggaggatgc 420 ccgaagtcct cccagaccca cttactcacg
gtggcagcgg cgacactcca gtctatcaaa 480 gatccgccgg gatggagagc
caggaggcgg gggctgcccc tgaggtagcg gggaggccgg 540 ggggccgggg
ggcggacggg acgagtgcaa tattggcggg ggaaaaaaca acactgcacc 600
gcgtcccgtc cctcccgccc gcccgggccc ggatcccgct ccccaccgcc tgaagccggc
660 ccgacccgga acccgggccg ctggggagtt gggttcacct tggaggccag
agagacttgg 720 cgcccggaag caaagggaat ggcaaggggg aggggggagg
gagaacggga gtttgcggag 780 tccagaaggc cgctttccga cgcccgggcg
ttgcgcgcgc ttgctcttta agtactcaga 840 ctgcgcggcg cgagccgtcc
gcatggtgac gcgtgtccca gcaaccgaac tgaatggctg 900 ttgcttggca
atgccgggag ttgaggtttg gggccgccca cctagctact cgtgttttct 960
ccggcctgcg agttgggggg ctcccgcctc cccggcccgc tcctgggcgc gctgacgtca
1020 gatgtcccca ccccgcccag cgcctgcccc aagggtctcg ccgcacacaa
agctcggcct 1080 cgggcgccgg cgcgcgggcg agagcggtgg tctctcgcct
gctgatctga tgcgctccaa 1140 tcccgtgcct cgccgaagtg tttttaaagt
gttctttcca acctgtgtct ttggggctga 1200 gaactgtttt ctgaatacag
gcggaactgc ttccgtcggc ctagaggcac gctgcgactg 1260 cgggacccaa
gttccacgtg ctgccgcggc ctgggatagc ttcctcccct cgtgcactgc 1320
tgccgcacac acctcttggc tgtcgcgcat tacgcacctc acgtgtgctt ttgccccccg
1380 ctacgtgcct acctgtcccc aataccactc tgctccccaa aggatagttc
tgtgtccgta 1440 aatcccattc tgtcacccca cctactctct gcccccccct
tttttgtttt gagacggagc 1500 tttgctctgt cgcccaggct ggagtgcaat
ggcgcgatct cggctcactg caacctccgc 1560 ctcccgggtt caagcgattc
tcctgcctca gcctcctgag tagctggggt tacagcgccc 1620 gccaccacgc
tcggctaatt tttgtagttt ttagtagaga cgaggtttca ccatcttggc 1680
caggctggtc ttgaacccct gaccttgtga tccactcgcc tcggccttcc aaagtgttgg
1740 gattacgggc gtgacgaccg tgccacgcat ctgcctctta agtacataac
ggcccacaca 1800 gaacgtgtcc aactcccccg cccacgttcc aacgtcctct
cccacatacc tcggtgcccc 1860 ttccacatac ctcaggaccc cacccgctta
gctccatttc ctccagacgc caccaccacg 1920 cgtcccggag tgccccctcc
taaagctccc agccgtccac catgctgtgc gttcctccct 1980 ccctggccac
ggcagtgacc cttctctccc gggccctgct tccctctcgc gggctctgct 2040
gcctcactta ggcagcgctg cccttactcc tctccgcccg gtccgagcgg cccctcagct
2100 tcggcgccca gccccgcaag gctcccggtg accactagag ggcgggagga
gctcctggcc 2160 agtggtggag agtggcaagg aaggacccta gggttcatcg
gagcccaggt ttactccctt 2220 aagtggaaat ttcttccccc actcctcctt
ggctttctcc aaggagggaa cccaggctgc 2280 tggaaagtcc ggctgggggg
gggactgtgg gttcagggga gaacggggtg tggaacggga 2340 cagggagcgg
ttagaagggt ggggctattc cgggaagtgg tggggggagg gagcccaaaa 2400
ctagcaccta gtccactcat tatccagccc tcttatttct cggccgctct gcttcagtgg
2460 acccggggag ggcggggaag tggagtggga gacctagggg tgggcttccc
gaccttgctg 2520 tacaggacct cgacctagct ggctttgttc cccatcccca
cgttagttgt tgccctgagg 2580 ctaaaactag agcccagggg ccccaagttc
cagactgccc ctcccccctc ccccggagcc 2640 agggagtggt tggtgaaagg
gggaggccag ctggagaaca aacgggtagt cagggggttg 2700 agcgattaga
gcccttgtac cctacccagg aatggttggg gaggaggagg aagaggtagg 2760
aggtagggga gggggcgggg ttttgtcacc tgtcacctgc tcgctgtgcc tagggcgggc
2820 gggcggggag tggggggacc ggtataaagc ggtaggcgcc tgtgcccgct
ccacctctca 2880 agcagccagc gcctgcctga atctgttctg ccccctcccc
acccatttca ccaccaccat 2940 gacaccgggc acccagtctc ctttcttcct
gctgctgctc ctcacagtgc ttacaggtga 3000 ggggcacgag gtggggagtg
ggctgccctg cttaggtggt cttcgtggtc tttctgtggg 3060 ttttgctccc
tggcagatgg caccatgaag ttaaggtaag aattgcagac agaggctgcc 3120
ctgtctgtgc cagaaggagg gagaggctaa ggacaggctg agaagagttg cccccaaccc
3180 tgagagtggg taccaggggc aagcaaatgt cctgtagaga agtctagggg
gaagagagta 3240 gggagaggga aggcttaaga ggggaagaaa tgcaggggcc
atgagccaag gcctatgggc 3300 agagagaagg aggctgctgc agggaaggag
gcttccaacc caggggttac tgaggctgcc 3360 cactccccag tcctcctggt
attatttctc tggtggccag agcttatatt ttcttcttgc 3420 tcttattttt
ccttcataaa gacccaaccc tatgacttta acttcttaca gctaccacag 3480
cccctaaacc cgcaacagtt gttacaggtt ctggtcatgc aagctctacc ccaggtggag
3540 aaaaggagac ttcggctacc cagagaagtt cagtgcccag ctctactgag
aagaatgctg 3600 tgagtatgac cagcagcgta ctctccagcc acagccccgg
ttcaggctcc tccaccactc 3660 agggacagga tgtcactctg gccccggcca
cggaaccagc ttcaggttca gctgccacct 3720 ggggacagga tgtcacctcg
gtcccagtca ccaggccagc cctgggctcc accaccccgc 3780 cagcccacga
tgtcacctca gccccggaca acaagccagc cccgggctcc accgcccccc 3840
cagcccacgg tgtcacctcg gccccggaca ccaggccggc cccgggctcc accgcccccc
3900 cagcccatgg tgtcacctcg gccccggaca acaggcccgc cttgggctcc
accgcccctc 3960 cagtccacaa tgtcacctcg gcctcaggct ctgcatcagg
ctcagcttct actctggtgc 4020 acaacggcac ctctgccagg gctaccacaa
ccccagccag caagagcact ccattctcaa 4080 ttcccagcca ccactctgat
actcctacca cccttgccag ccatagcacc aagactgatg 4140 ccagtagcac
tcaccatagc acggtacctc ctctcacctc ctccaatcac agcacttctc 4200
cccagttgtc tactggggtc tctttctttt tcctgtcttt tcacatttca aacctccagt
4260 ttaattcctc tctggaagat cccagcaccg actactacca agagctgcag
agagacattt 4320 ctgaaatggt gagtatcggc ctttccttcc ccatgctccc
ctgaagcagc catcagaact 4380 gtccacaccc tttgcatcaa gcccgagtcc
tttccctctc accccagttt ttgcagattt 4440 ataaacaagg gggttttctg
ggcctctcca atattaagtt caggtacagt tctgggtgtg 4500 gacccagtgt
ggtggttgga gggttgggtg gtggtcatga ccgtaggagg gactggtgca 4560
cttaaggttg ggggaagagt gctgagccag agctgggacc cgtggctgaa gtgcccattt
4620 ccctgtgacc aggccaggat ctgtggtggt acaattgact ctggccttcc
gagaaggtac 4680 catcaatgtc cacgacgtgg agacacagtt caatcagtat
aaaacggaag cagcctctcg 4740 atataacctg acgatctcag acgtcagcgg
tgaggctact tccctggctg cagccagcac 4800 catgccgggg cccctctcct
tccagtgtct gggtccccgc tctttcctta gtgctggcag 4860 cgggaggggc
gcctcctctg ggagactgcc ctgaccactg cttttccttt tagtgagtga 4920
tgtgccattt cctttctctg cccagtctgg ggctggggtg ccaggctggg gcatcgcgct
4980 gctggtgctg gtctgtgttc tggttgcgct ggccattgtc tatctcattg
ccttggtgag 5040 tgcagtccct ggccctgatc agagcccccc ggtagaaggc
actccatggc ctgccataac 5100 ctcctatctc cccaggctgt ctgtcagtgc
cgccgaaaga actacgggca gctggacatc 5160 tttccagccc gggataccta
ccatcctatg agcgagtacc ccacctacca cacccatggg 5220 cgctatgtgc
cccctagcag taccgatcgt agcccctatg agaaggtgag attggcccca 5280
caggccaggg gaagcagagg gtttggctgg gcaaggattc tgaagggggt acttggaaaa
5340 cccaaagagc ttggaagagg tgagaagtgg cgtgaagtga gcaggggagg
gcctggcaag 5400 gatgaggggc agaggtcaga ggagttttgg gggacaggcc
tgggaggaga ctatggaaga 5460 aaggggcctc aagagggagt ggccccactg
ccagaattcc taaaaagatc attggccgtc 5520 cacattcatg ctggctggcg
ctggctgaac tggtgccacc gtggcagttt tgttttgttt 5580 tgcttttttg
cacccagagg caaaatgggt ggagcactat gcccagggga gcccttcccg 5640
aggagtccag gggtgagcct ctgtgatccc ctaatcaatc tcctaggaat ggagggtaga
5700 ccgagaaaag gctggcatag ggggagtcag tttcccaggt agaagcaaga
agaagtgtca 5760 gcagaccagg tgagcgtggg tgccagtggg gttcttggga
gcttcaagga agcaaggaac 5820 gctccctcct tcctctcctg gtctttctct
atgggaccta gtaaataatt actgcagcca 5880 cctgaggctg gaaaaccact
ccaggtgggg gaggagagag tttagttttc ttgctcctat 5940 tttcctcctc
ctggagacct ccctctctcg gctttacaaa gacacagata caccccgccc 6000
cccaaaacac acacacacac acacacacac acacctcctt aggctggaac agcagagaat
6060 ggagggacaa gggggctgat tagagccaag aagagggagt gaaggagagc
agagggagga 6120 gggcagccct gtttacagtc acctggctgg tggggtggca
ggtgctctct ctgaattaac 6180 cctttgagag ctggccagga ctctggactg
attaccccag cctggggtgg catccagggg 6240 ctctaggagg taccttttgc
tcctcaccct ggatctcttt tccttccacc caggtttctg 6300 caggtaatgg
tggcagcagc ctctcttaca caaacccagc agtggcagcc acttctgcca 6360
acttgtaggg gcacgtcgcc cgctgagctg agtggccagc cagtgccatt ccactccact
6420 caggttcttc agggccagag cccctgcacc ctgtttgggc tggtgagctg
ggagttcagg 6480 tgggctgctc acacgtcctt cagaggcccc accaatttct
cggacacttc tcagtgtgtg 6540 gaagctcatg tgggcccctg aggctcatgc
ctgggaagtg ttgtggtggg ggctcccagg 6600 aggactggcc cagagagccc
tgagatagcg gggatcctga actggactga ataaaacgtg 6660 gtctcccact
ggcgccaact tctgatcttt catctgtgac ccgtgggcag cagggcgtca 6720
gaatgtgtgt gagggggctg ggggaggaga cagggaggcc aggaggcagt aaggagcgag
6780 tttgtttgag aagcaggaga tgtgaggagg aggtgacatt ggggagtagg
ggtggcctga 6840 ggagccacct ctggctaacc ctggcagcac aagaggaagg
aggaaacgaa acccaggcng 6900 gctttggagg gctagcgtga ctgggctccg
tgactgagct ctgtgtgcca gtggctctcc 6960 cctctcctcg cctggcccac
gccctccttg cccctggcat ggtgcccccc aggtggctct 7020 attcttagct
gtccgggtgt gaagtaaatc cttgggcagt gataacagcc cagagtcaac 7080
agggttgaga taagcagagg ctgggtcaga tccgggcgct ggcaccaggc ccagccccct
7140 ccctgacccc ggctncccca ccagcctgct gcccctgggg tggnctccac
aacaccctgg 7200 gaatggggaa gtggttctgg ttccctgacc cctttggccc
aggcacgttg cctgtccctc 7260 gaccgcattc ccccagggcc tgtgctgcag
gcctggaagc cctgattggg gcctgccacc 7320 agcagccaga gagctatgtt
ccctggcagc tgtgatgcgc tcaggccggg ccaggacacg 7380 tgtggcagga
ggcttagagc acctgcctgg ggccttcctc tctcaggcac cagatccatt 7440
ggttgctcct gcctagaacc acagcctagc acccctgctc cctcccgcct accacaccca
7500 gcacagaaac tcacaggaat gattgcgctc agggaaggca gagatgtgcc
tggcatcaca 7560 gtttattgtt tataaaccat gacaataaca gctgttgctc
agcacaggcc tagcagagcc 7620 cactgcaggg ggacggcagc gggcaccaga
ggccttgcct ggcccaaccc aatgggaaca 7680 cccagactca gctgggtccc
caagggagac ttggcacatt ggcatgggtg tgggacaggt 7740 aaagcatgca
agagggagaa gagggacata aggggcatgc ggctgcgggg tgttgggacc 7800
caaataaata aagcaggatg acagggtccc cttcccctca ccaggaatgc ctgacagcgt
7860 ccagccccaa agcctgcctg tcccaaggct gtagttcagc atcaacaggg
cagggagctt 7920 ggcagggcaa gggcagagct ggagatcatg cccagtnttc
caggtgccct ccctcccaat 7980 cagcctgggg ggcacaggac agggatggag
aaggggctct ctccatggct tgggtaacat 8040 gccaaaggca ggtcataggg
cagactcagt gggggtgggg gcctggctaa caagcaatgg 8100 agagaacggg
ggccatccag agaggttggc agaagagagc ccctgggtca agagaaaact 8160
ttggggaaga caagacacgg gagaag 8186 20 730 DNA Homo sapiens CDS
(26)...(718) 20 cctccccacc catttcacca ccacc atg aca ccg ggc acc cag
tct cct ttc 52 Met Thr Pro Gly Thr Gln Ser Pro Phe 1 5 ttc ctg ctg
ctg ctc ctc aca gtg ctt aca gtt gtt aca ggt tct ggt 100 Phe Leu Leu
Leu Leu Leu Thr Val Leu Thr Val Val Thr Gly Ser Gly 10 15 20 25 cat
gca agc tct acc cca ggt gga gaa aag gag act tcg gct acc cag 148 His
Ala Ser Ser Thr Pro Gly Gly Glu Lys Glu Thr Ser Ala Thr Gln 30 35
40 aga agt tca gtg ccc agc tct act gag aag aat gct atc cca gca ccg
196 Arg Ser Ser Val Pro Ser Ser Thr Glu Lys Asn Ala Ile Pro Ala Pro
45 50 55 act act acc aag agc tgc aga gag aca ttt ctg aaa tgg cca
gga tct 244 Thr Thr Thr Lys Ser Cys Arg Glu Thr Phe Leu Lys Trp Pro
Gly Ser 60 65 70 gtg gtg gta caa ttg act ctg gcc ttc cga gaa ggt
acc atc aat gtc 292 Val Val Val Gln Leu Thr Leu Ala Phe Arg Glu Gly
Thr Ile Asn Val 75 80 85 cac gac gtg gag aca cag ttc aat cag tat
aaa acg gaa gca gcc tct 340 His Asp Val Glu Thr Gln Phe Asn Gln Tyr
Lys Thr Glu Ala Ala Ser 90 95 100 105 cga tat aac ctg acg atc tca
gac gtc agc gtg agt gat gtg cca ttt 388 Arg Tyr Asn Leu Thr Ile Ser
Asp Val Ser Val Ser Asp Val Pro Phe 110 115 120 cct ttc tct gcc cag
tct ggg gct ggg gtg cca ggc tgg ggc atc gcg 436 Pro Phe Ser Ala Gln
Ser Gly Ala Gly Val Pro Gly Trp Gly Ile Ala 125 130 135 ctg ctg gtg
ctg gtc tgt gtt ctg gtt gcg ctg gcc att gtc tat ctc 484 Leu Leu Val
Leu Val Cys Val Leu Val Ala Leu Ala Ile Val Tyr Leu 140 145 150 att
gcc ttg gct gtc tgt cag tgc cgc cga aag aac tac ggg cag ctg 532 Ile
Ala Leu Ala Val Cys Gln Cys Arg Arg Lys Asn Tyr Gly Gln Leu 155 160
165 gac atc ttt cca gcc cgg gat acc tac cat cct atg agc gag tac ccc
580 Asp Ile Phe Pro Ala Arg Asp Thr Tyr His Pro Met Ser Glu Tyr Pro
170 175 180 185 acc tac cac acc cat ggg cgc tat gtg ccc cct agc agt
acc gat cgt 628 Thr Tyr His Thr His Gly Arg Tyr Val Pro Pro Ser Ser
Thr Asp Arg 190 195 200 agc ccc tat gag aag gtt tct gca ggt aat ggt
ggc agc agc ctc tct 676 Ser Pro Tyr Glu Lys Val Ser Ala Gly Asn Gly
Gly Ser Ser Leu Ser 205 210 215 tac aca aac cca gca gtg gca
gcc act tct gcc aac ttg tag gggcacgtcg 728 Tyr Thr Asn Pro Ala Val
Ala Ala Thr Ser Ala Asn Leu 220 225 230 cc 730 21 177 DNA Homo
sapiens CDS (74)...(177) 21 ccgctccacc tctcaagcag ccagcgcctg
cctgaatctg ttctgccccc tccccaccca 60 tttcaccacc acc atg aca ccg ggc
acc cag tct cct ttc ttc ctg ctg 109 Met Thr Pro Gly Thr Gln Ser Pro
Phe Phe Leu Leu 1 5 10 ctg ctc ctc aca gtg ctt aca ggt gga gaa aag
gag act tcg gct acc 157 Leu Leu Leu Thr Val Leu Thr Gly Gly Glu Lys
Glu Thr Ser Ala Thr 15 20 25 cag aga agt tca gtg ccc ag 177 Gln Arg
Ser Ser Val Pro 30 22 20 DNA Artificial Sequence Antisense
Oligonucleotide 22 gaacagattc aagcagccag 20 23 20 DNA Artificial
Sequence Antisense Oligonucleotide 23 cccggtgtca tggtggtggt 20 24
20 DNA Artificial Sequence Antisense Oligonucleotide 24 gtgcccggtg
tcatggtggt 20 25 20 DNA Artificial Sequence Antisense
Oligonucleotide 25 gaaaggagac tgggtgcccg 20 26 20 DNA Artificial
Sequence Antisense Oligonucleotide 26 ctgtaacaac tgtaagcact 20 27
20 DNA Artificial Sequence Antisense Oligonucleotide 27 acctgtaaca
actgtaagca 20 28 20 DNA Artificial Sequence Antisense
Oligonucleotide 28 tcagtagagc tgggcactga 20 29 20 DNA Artificial
Sequence Antisense Oligonucleotide 29 gcattcttct cagtagagct 20 30
20 DNA Artificial Sequence Antisense Oligonucleotide 30 agcattcttc
tcagtagagc 20 31 20 DNA Artificial Sequence Antisense
Oligonucleotide 31 tggtcatact cacagcattc 20 32 20 DNA Artificial
Sequence Antisense Oligonucleotide 32 ctgctggtca tactcacagc 20 33
20 DNA Artificial Sequence Antisense Oligonucleotide 33 gctggagagt
acgctgctgg 20 34 20 DNA Artificial Sequence Antisense
Oligonucleotide 34 tgggaccgag gtgacatcct 20 35 20 DNA Artificial
Sequence Antisense Oligonucleotide 35 gtgacattgt ggactggagg 20 36
20 DNA Artificial Sequence Antisense Oligonucleotide 36 gaggtgacat
tgtggactgg 20 37 20 DNA Artificial Sequence Antisense
Oligonucleotide 37 tgaggccgag gtgacattgt 20 38 20 DNA Artificial
Sequence Antisense Oligonucleotide 38 gtggtaggag tatcagagtg 20 39
20 DNA Artificial Sequence Antisense Oligonucleotide 39 gcaagggtgg
taggagtatc 20 40 20 DNA Artificial Sequence Antisense
Oligonucleotide 40 ggcatcagtc ttggtgctat 20 41 20 DNA Artificial
Sequence Antisense Oligonucleotide 41 gagaccccag tagacaactg 20 42
20 DNA Artificial Sequence Antisense Oligonucleotide 42 tcttccagag
aggaattaaa 20 43 20 DNA Artificial Sequence Antisense
Oligonucleotide 43 aatgtctctc tgcagctctt 20 44 20 DNA Artificial
Sequence Antisense Oligonucleotide 44 tcagaaatgt ctctctgcag 20 45
20 DNA Artificial Sequence Antisense Oligonucleotide 45 tctgcaaaaa
catttcagaa 20 46 20 DNA Artificial Sequence Antisense
Oligonucleotide 46 gtttataaat ctgcaaaaac 20 47 20 DNA Artificial
Sequence Antisense Oligonucleotide 47 attggagagg cccagaaaac 20 48
20 DNA Artificial Sequence Antisense Oligonucleotide 48 taatattgga
gaggcccaga 20 49 20 DNA Artificial Sequence Antisense
Oligonucleotide 49 gaacttaata ttggagaggc 20 50 20 DNA Artificial
Sequence Antisense Oligonucleotide 50 agatcctggc ctgaacttaa 20 51
20 DNA Artificial Sequence Antisense Oligonucleotide 51 cacagatcct
ggcctgaact 20 52 20 DNA Artificial Sequence Antisense
Oligonucleotide 52 acgtcgtgga cattgatggt 20 53 20 DNA Artificial
Sequence Antisense Oligonucleotide 53 gttatatcga gaggctgctt 20 54
20 DNA Artificial Sequence Antisense Oligonucleotide 54 atcgtcaggt
tatatcgaga 20 55 20 DNA Artificial Sequence Antisense
Oligonucleotide 55 gcacatcact cacgctgacg 20 56 20 DNA Artificial
Sequence Antisense Oligonucleotide 56 ggcagagaaa ggaaatggca 20 57
20 DNA Artificial Sequence Antisense Oligonucleotide 57 gacagacagc
caaggcaatg 20 58 20 DNA Artificial Sequence Antisense
Oligonucleotide 58 ctgcccgtag ttctttcggc 20 59 20 DNA Artificial
Sequence Antisense Oligonucleotide 59 tggaaagatg tccagctgcc 20 60
20 DNA Artificial Sequence Antisense Oligonucleotide 60 gctacgatcg
gtactgctag 20 61 20 DNA Artificial Sequence Antisense
Oligonucleotide 61 aggctgctgc caccattacc 20 62 20 DNA Artificial
Sequence Antisense Oligonucleotide 62 aagttggcag aagtggctgc 20 63
20 DNA Artificial Sequence Antisense Oligonucleotide 63 ctacaagttg
gcagaagtgg 20 64 20 DNA Artificial Sequence Antisense
Oligonucleotide 64 acgtgcccct acaagttggc 20 65 20 DNA Artificial
Sequence Antisense Oligonucleotide 65 gctcagaggg cgacgtgccc 20 66
20 DNA Artificial Sequence Antisense Oligonucleotide 66 ctggccactc
agctcagagg 20 67 20 DNA Artificial Sequence Antisense
Oligonucleotide 67 actggctggc cactcagctc 20 68 20 DNA Artificial
Sequence Antisense Oligonucleotide 68 ggaatggcac tggctggcca 20 69
20 DNA Artificial Sequence Antisense Oligonucleotide 69 ggagtggaat
ggcactggct 20 70 20 DNA Artificial Sequence Antisense
Oligonucleotide 70 aggaattaaa agcattcttc 20 71 20 DNA Artificial
Sequence Antisense Oligonucleotide 71 cagtagacaa agcattcttc 20 72
20 DNA Artificial Sequence Antisense Oligonucleotide 72 gacagacagc
catttcagaa 20 73 20 DNA Artificial Sequence Antisense
Oligonucleotide 73 catcactcac tgaacttaat 20 74 20 DNA Artificial
Sequence Antisense Oligonucleotide 74 tttgggtttt ccaagtaccc 20 75
20 DNA Artificial Sequence Antisense Oligonucleotide 75 catagtctcc
tcccaggcct 20 76 20 DNA Artificial Sequence Antisense
Oligonucleotide 76 cattttgcct ctgggtgcaa 20 77 20 DNA Artificial
Sequence Antisense Oligonucleotide 77 cagccccaga catttcagaa 20 78
20 DNA Artificial Sequence Antisense Oligonucleotide 78 ttctctctgc
ccataggcct 20 79 20 DNA Artificial Sequence Antisense
Oligonucleotide 79 gggtctttat gaaggaaaaa 20 80 20 DNA Artificial
Sequence Antisense Oligonucleotide 80 acatcactca catttcagaa 20 81
20 DNA Artificial Sequence Antisense Oligonucleotide 81 accacgtttt
attcagtcca 20 82 20 DNA Artificial Sequence Antisense
Oligonucleotide 82 gctgtggtag ctgtaagcac 20 83 20 DNA Artificial
Sequence Antisense Oligonucleotide 83 gtgctgggat agcattcttc 20 84
20 DNA Artificial Sequence Antisense Oligonucleotide 84 agagtcaatt
gtaccaccac 20 85 20 DNA Artificial Sequence Antisense
Oligonucleotide 85 ttttctccac ctgtaagcac 20 86 20 DNA Artificial
Sequence Antisense Oligonucleotide 86 cctgtaacaa ctgttgcggg 20 87
20 DNA Artificial Sequence Antisense Oligonucleotide 87 tgaccagaac
ctgtaacaac 20 88 20 DNA Artificial Sequence Antisense
Oligonucleotide 88 tctccttttc tccacctggg 20 89 20 DNA Artificial
Sequence Antisense Oligonucleotide 89 ctcagtagag ctgggcactg 20 90
20 DNA Artificial Sequence Antisense Oligonucleotide 90 tcatactcac
agcattcttc 20 91 20 DNA Artificial Sequence Antisense
Oligonucleotide 91 agagcctgag gccgaggtga 20 92 20 DNA Artificial
Sequence Antisense Oligonucleotide 92 gaccccagta gacaactggg 20 93
20 DNA Artificial Sequence Antisense Oligonucleotide 93 aggaattaaa
ctggaggttt 20 94 20 DNA Artificial Sequence Antisense
Oligonucleotide 94 gtgctgggat cttccagaga 20 95 20 DNA Artificial
Sequence Antisense Oligonucleotide 95 atcctggcct ggtcacaggg 20 96
20 DNA Artificial Sequence Antisense Oligonucleotide 96 cagccccaga
ctgggcagag 20 97 20 DNA Artificial Sequence Antisense
Oligonucleotide 97 ggcccctttc ttccatagtc 20 98 20 DNA Artificial
Sequence Antisense Oligonucleotide 98 ccacctggag tggttttcca 20 99
20 DNA Artificial Sequence Antisense Oligonucleotide 99 aaagccgaga
gagggaggtc 20 100 336 DNA Homo sapiens 100 accaccacca tgacaccggg
cacccagtct cctttcttcc tgctgctgct cctcacagtg 60 cttacagcta
ccacagcccc taaacccgca acagttgtta caggttctgg tcatgcaagc 120
tctaccccag gtggagaaaa ggagacttcg gctacccaga gaagttcagt gcccagctct
180 actgagaaga atgctgtgag tatgaccagc agcgtactct ccagccacag
ccccggttca 240 ggctcctcca ccactcaggg acaggatgtc actctggccc
cggccacgga accagcttca 300 ggttcagctg ccacctgggg acaggatgtc acctcg
336 101 518 DNA Homo sapiens 101 gcgcctgcct gaatctgttc tgccccctcc
ccacccattt caccaccacc atgacaccgg 60 gcacccagtc tcctttcttc
ctgctgctgc tcctcacagt gcttacagct accacagccc 120 ctaaacccgc
aacagttgtt acaggttctg gtcatgcaag ctctacccca ggtggagaaa 180
aggagacttc ggctacccag agaagttcag tgcccagctc tactgagaag aatgctgtga
240 gtatgaccag cagcgtactc tccagccaca gccccggttc aggctcctcc
accactcagg 300 gacaggatgt cactctggcc ccggccacgg aaccagcttc
aggttcagct gccacctggg 360 gacaggatgt cacctcggtc ccagtcacca
ggccagccct gggctccacc accccgccag 420 cccacgatgt cacctcagcc
ccggacaaca agccagcccc gggctccacc gcccccccag 480 cccacggtgt
cacctcggcc ccggacacca ggccggcc 518 102 3343 DNA Homo sapiens 102
gagctcctgg ccagtggtgg agagtggcaa ggaaggaccc tagggttcat cggagcccag
60 gtttactccc ttaagtggaa atttcttccc ccactcccct ccttggcttt
ctccaaggag 120 ggaaccccag gctgctggaa agtccggctg gggcggggac
tgtgggtttc agggtagaac 180 tgcgtgtgga acgggacagg gagcggttag
aagggtgggg ctattccggg aagtggtggt 240 ggggggaggg agcccaaaac
tagcacctag tccactcatt atccagccct cttatttctc 300 ggccgcctct
gcttcagtgg acccggggag ggcggggaag tggagtggga gacctagggg 360
tgggcttccc gaccttgctg tacaggacct cgacctagct ggctttgttc cccatcccca
420 gttagttgtt gccctgaggc taaaactaga gcccaggggc cccaagttcc
agactgcccc 480 tcccccctcc cccggagcca gggagtggtt ggtgaaaggg
ggaggccagc tggagaagaa 540 acgggtagtc aggggttgca gcattagagc
ccttgtagcc ctagcccagg aatggttgga 600 gagagaagag tagagtaggg
aggggggttt gtcacctgtc acctgctcgg ctgtgcctag 660 ggcgggcggg
ggggagtggg gggaccggta taaagcggta ggcgcctgtg cccgctccac 720
ctctcaagca gccagcgcct gcctgaatct gttctgcccc ctccccaccc atttcaccac
780 caccatgaca ccgggcaccc agtctccttt cttcctgctg ctgctcctca
cagtgcttac 840 aggtgagggg cacgaggtgg ggagtgggct gccctgctta
ggtggtcttc gtggtctttc 900 tgtgggtttt gctccctggc agatggcacc
agaagttaag gtaagaattg cagacagagg 960 ctgccctgtc tgtgccagaa
ggagggagag gctaaggaca ggctgagaag agttgccccc 1020 aaccctgaga
gtgggtacca ggggcaagca aatgtcctgt agagaagtct agggggaaga 1080
gagtagggag agggaaggct taagagggga agaaatgcag gggccatgag ccaaggccta
1140 tgggcagaga gaaggaggct gctgcaggaa ggaggcggcc aacccagggg
ttactgaggc 1200 tgcccactcc ccagtcctcc tggtattatt tctctggtgg
ccaggcttat attttcttct 1260 tgctcttatt tttccttcat aaagacccaa
ccctatgact ttaacttctt acagctacca 1320 cagcccctgg gcccgcaaca
gttgttacag gttctggtca tgcaagctct accccaggtg 1380 gagaaaagga
gacttcggct acccagagaa gttcagtgcc cagctctact gagaagaatg 1440
ctgtgagtat gaccagcagc gtactctcca gccacagccc cggttcaggc tcctccacca
1500 ctcagggaca ggatgtcact ctggccccgg ccacggaacc agcttcaggt
tcagctgcca 1560 cctggggaca ggatgtcacc tcggtcccag tcaccaggcc
agccctgggc tccaccaccc 1620 cgccagccca cgatgtcacc tcagccccgg
acaacaagcc agccccgggc tccaccgccc 1680 ccccagccca gggtgtcacc
tcggccccgg agaccaggcc gcccccgggc tccaccgccc 1740 ccccagccca
tggtgtcacc tcggcgccgg acaacaggcc cgccttggcg tccaccgccc 1800
ctccagtcca caatgtcacc tcggcctcag gctctgcatc aggctcagct tctactctgg
1860 tgcacaacgg cacctctgcc agggctacca caaccccagc cagcaagagc
actccattct 1920 caattcccag ccaccactct gatactccta ccacccttgc
cagccatagc accaagactg 1980 atgccagtag cactcaccat agcacggtac
ctcctctcac ctcctccaat cacagcactt 2040 ctccccagtt gtctactggg
gtctctttct ttttcctgtc ttttcacatt tcaaacctcc 2100 agtttaattc
ctctctggaa gatcccagca ccgactacta ccaagagctg cagagagaca 2160
tttctgaaat ggtgagtatc ggcctttcct tccccatgct cccctgaagc agccatcaga
2220 actgtccaca ccctttgcat caagcctgag tcctttccct ctcaccccag
tttttgcaga 2280 tttataaaca agggggtttt ctgggcctct ccaatattaa
gttcaggtac agttctgggt 2340 gtggacccag tgtggtggtt ggaggggtgg
gtggtggtca tgagccgtag ggagggactg 2400 gtgcacttaa ggttggggga
agagtgctga gccagagctg ggacccgtgg ctgaagtgcc 2460 catttccctg
tgaccaggcc aggatctgtg gtggtacaat tgactctggc cttccgagaa 2520
ggtaccatca atgtccacga cgtggagaca cagttcaatc agtataaaac ggaagcagcc
2580 tctcgatata acctgacgat ctcaagacgt cagcggtgag gctacttccc
tgctgcagcc 2640 agcaccatgc cggggcccct ctccttccag tgtctgggtc
cccgctcttt ccttagtgct 2700 ggcagcggga ggggcgcctc ctctgggaga
ctgccctgac cactgctttt ccttttagtg 2760 agtgatgtgc catttccttt
ctctgaccag tctggggctg gggtgccagg ctggggcatc 2820 gcgctgctgg
tgctggtctg tgttctggtt gcgctggcca ttgtctatct cattgccttg 2880
gtgagtgcag tccctggccc tgatcagagc cccccggtag aaggcactcc atggcctgcc
2940 ataacctcct atctccccag gctgtctgtc agtgccgccg aaagaactac
gggcagctgg 3000 acatctttcc agcccgggat acctaccatc ctatgagcga
gtaccccacc taccacaccc 3060 atgggcgcta tgtgccccta gcagtaccga
tcgtagcccc tatgagaagg tgagattggg 3120 ccccacaggc aggggaagca
gagggtttgg ctgggcaagg attctgaagg gggtacttgg 3180 aaaacccaaa
gagcttggaa gaggtgagaa gtggcgtgaa gtgagcaggg gagggctggc 3240
aaggatgagg ggcagaggtc agaggagttt tgggggacag gcctgggagg agactatgga
3300 agaaaggggc ccctcaaaag ggagtgcccc actgccagaa ttc 3343 103 859
DNA Homo sapiens 103 cctccccacc catttcacca ccaccatgac accgggcacc
cagtctcctt tcttcctgct 60 gctgctcctc acagtgctta cagttgttac
aggttctggt catgcaagct ctaccccagg 120 tggagaaaag gagacttcgg
ctacccagag aagttcagtg cccagctcta ctgagaagaa 180 tgctttgtct
actggggtct ctttcttttt cctgtctttt cacatttcaa acctccagtt 240
taattcctct ctggaagatc ccagcaccga ctactaccaa gagctgcaga gagacatttc
300 tgaaatgttt ttgcagattt ataaacaagg gggttttctg ggcctctcca
atattaagtt 360 caggccagga tctgtggtgg tacaattgac tctggccttc
cgagaaggta ccatcaatgt 420 ccacgacgtg gagacgcagt tcaatcagta
taaaacggaa gcagcctctc gatataacct 480 gacgatctca gacgtcagcg
tgagtgatgt gccatttcct ttctctgccc agtctggggc 540 tggggtgcca
ggctggggca tcgcgctgct ggtgctggtc tgtgttctgg ttgcgctggc 600
cattgtctat ctcattgcct tggctgtctg tcagtgccgc cgaaagaact
acgggcagct 660 ggacatcttt ccagcccggg atacctacca tcctatgagc
gagtacccca cctaccacac 720 ccatgggcgc tatgtgcccc ctagcagtac
cgatcgtagc ccctatgaga cggtttctgc 780 aggtaatggt ggcagcagcc
tctcttacac aaacccagca gtggcagcca cttctgccaa 840 cttgtagggg
cacgtcgcc 859 104 204 DNA Homo sapiens 104 ccgctccacc tctcaagcag
ccagcgcctg cctgaatctg ttctgccccc tccccaccca 60 tttcaccacc
accatgacac cgggcaccca gtctcctttc ttcctgctgc tgctcctcac 120
agtgcttaca ggttctggtc atgcaagctc taccccaggt ggagaaaagg agacttcggc
180 tacccagaga agttcagtgc ccag 204 105 556 DNA Homo sapiens
misc_feature 5 n = A,T,C or G 105 acggnggaag agagtaggga gagggaaggc
ttaagagggg aagaaatgca ggggccatga 60 gccaaggcct atgggcagag
agaaggaggc tgctgcaggg aaggaggcgg ccaacccagg 120 ggttactgag
gctgcccact ccccagtcct cctggtatta tttctctggt ggccagagct 180
tatattttct tcttgctctt atttttcctt cataaagacc caaccctatg actttaactt
240 cttacagcta ccacagcccc taaacccgca acagttgtta cgggttctgg
tcatgcaagc 300 tctaccccag gtggagaaaa ggagacttcg gctacccaga
gaagttcagt gcccagctct 360 actgagaaga atgctgtgag tatgaccagc
agcgtactct ccagccacag ccccggttca 420 ggctcctcca ccactcaggg
acaggatgtc actctggccc cggccacgga accagcttca 480 ggttcaagct
gccacctggg acaggatgtc accttcgtcc cagtcaccag gccagccctg 540
ggctccacca ccccgc 556 106 772 DNA Homo sapiens 106 gacctctcaa
gcagccagcg cctgcctgaa tctgttctgc cccctcccca cccatttcac 60
caccaccatg acaccgggca cccagtctcc tttcttcctg ctgctgctcc tcacagtgct
120 tacagctacc acagccccta aacccgcaac agttgttacg ggttctggtc
atgcaagctc 180 taccccaggt ggagaaaagg agacttcggc tacccagaga
agttcagtgc ccagctctac 240 tgagaagaat gcttttaatt cctctctgga
agatcccagc accgactact accaagagct 300 gcagagagac atttctgaaa
tgtttttgca gatttataaa caagggggtt ttctgggcct 360 ctccaatatt
aagttcaggc caggatctgt ggtggtacaa ttgactctgg ccttccgaga 420
aggtaccatc aatgtccacg acgtggagac acagttcact cagtataaac ggaagcagcc
480 tctcgatata acctgacgat ctcagacgtc agcgtgagtg atgtgccatt
tccttttctc 540 tgcccagtct ggggctgggg ttgccaggct ggggcatcgc
ggctgctggt gctgggtctg 600 tgtcctggtt gcgctggcca ttgtctatct
cattgccttg cgctgtcctg tcagtgccgc 660 ggacagaaca cgggccgctg
gacctctttc ccgcccggga tacctacatc ctttgagggg 720 agtccccact
acacaccatg gggggattgt gccccttagc gttccgatcg ac 772 107 635 DNA Homo
sapiens misc_feature 472, 482 n = A,T,C or G 107 ggctggggtg
ccaggctggg gcatcgcgct gctggtgctg gtctgtgttc tggttgcgct 60
ggccattgtc tatctcattg ccttggctgt ctgtcagtgc cgccgaaaga actacgggca
120 gctggacatc tttccagccc gggataccta ccatcctatg agcgagtacc
ccacctacca 180 cacccatggg cgctatgtgc cccctagcag taccgatcgt
agcccctatg agaaggtgag 240 attgggcccc acaggccagg ggaagcagag
ggtttggctg ggcaaggatt ctgaaggggg 300 tacttggaaa acccaaagag
cttggaagag gtgagaagtg gcgtgaagtg agcaggggag 360 ggcctggcaa
ggatgagggg cagaggtcag aggagttttg ggggacaggc ctgggaggag 420
actatggaag aaaggggccc tcaagaggga gtggccccac tgccagaatt cntaaaagat
480 cnttggccgt ccacattcat gctggctggc gctggctgaa ctggtgccac
cgtggcagtt 540 ttgttttgtt ttgctttttt gcacccagag gcaaaatggg
tggagcacta tgcccagggg 600 agcccttccc gaggagtcca aggggtgagc ttttg
635
* * * * *