U.S. patent application number 10/969245 was filed with the patent office on 2005-10-06 for production of monatin and monatin precursors.
This patent application is currently assigned to CARGILL, INC.. Invention is credited to Abraham, Timothy W., Cameron, Douglas C., deSouza, Mervyn L., Gort, Steven J., Hicks, Paula M., McFarlan, Sara C., Rosazza, John, Sanchez-Riera, Fernando A., Zidwick, Mary Jo.
Application Number | 20050221455 10/969245 |
Document ID | / |
Family ID | 34549274 |
Filed Date | 2005-10-06 |
United States Patent
Application |
20050221455 |
Kind Code |
A1 |
McFarlan, Sara C. ; et
al. |
October 6, 2005 |
Production of monatin and monatin precursors
Abstract
Methods and compositions that can be used to make monatin or
salt thereof from glucose, tryptophan, indole-3-lactic acid,
indole-3-pyruvate, and 2-hydroxy 2-(indol-3-ylmethyl)-4-keto
glutaric acid, are provided. Methods are also disclosed for
producing the indole-3-pyruvate and 2-hydroxy
2-(indol-3-ylmethyl)-4-keto glutaric acid intermediates.
Compositions provided include nucleic acid molecules, polypeptides,
chemical structures, and cells. Methods include in vitro and in
vivo processes, and the in vitro methods include chemical
reactions.
Inventors: |
McFarlan, Sara C.; (St.
Paul, MN) ; Hicks, Paula M.; (Eden Prairie, MN)
; Zidwick, Mary Jo; (Wayzata, MN) ; Sanchez-Riera,
Fernando A.; (Eden Prairie, MN) ; Cameron, Douglas
C.; (Plymouth, MN) ; deSouza, Mervyn L.;
(Plymouth, MN) ; Rosazza, John; (Iowa City,
IA) ; Gort, Steven J.; (Brooklyn Center, MN) ;
Abraham, Timothy W.; (Minnetonka, MN) |
Correspondence
Address: |
CARGILL, INCORPORATED
LAW/24
15407 MCGINTY ROAD WEST
WAYZATA
MN
55391
US
|
Assignee: |
CARGILL, INC.
|
Family ID: |
34549274 |
Appl. No.: |
10/969245 |
Filed: |
October 21, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60513406 |
Oct 21, 2003 |
|
|
|
Current U.S.
Class: |
435/121 ;
435/252.3; 435/252.33 |
Current CPC
Class: |
Y02P 20/582 20151101;
C12N 9/88 20130101; C12P 17/10 20130101 |
Class at
Publication: |
435/121 ;
435/252.3; 435/252.33 |
International
Class: |
C12P 017/10; C12N
001/21 |
Claims
What is claimed is:
1. A method of producing monatin or salt thereof, wherein the
method comprises: (a) culturing a microorganism in a culture
medium, wherein the microorganism comprises at least one nucleic
acid encoding an aldolase polypeptide and at least one nucleic acid
encoding an aminotransferase polypeptide; and (b) extracting
monatin or salt thereof from the culture medium or the cultured
microorganism.
2. The method of claim 1, wherein the aldolase polypeptide is
chosen from ProA aldolase (4-hydroxy-4-methyl-2-oxoglutarate
aldolase, EC 4.1.3.17) and KHG aldolase (4-hydroxy-2-oxoglutarate
glyoxylate-lyase, EC 4.1.3.16).
3. The method of claim 1, wherein the microorganism is chosen from
Sinorhizobium meliloti, Comamonas testosteroni, Pseudomonas
straminea, Corynebacterium glutamicum and E. coli.
4. The method of claim 1, wherein the microorganism is chosen from
the genera Corynebacterium and Brevibacterium.
5. The method of claim 3, wherein the microorganism is
Corynebacterium glutamicum.
6. The method of claim 3, wherein the culture medium comprises a
non-ionic detergent, penicillin, a penicillin derivative, or a
combination thereof.
7. The method of claim 6, wherein the non-ionic detergent is chosen
from Tween, Triton X-100 and dodecylammonium acetate.
8. The method of claim 5, wherein the culture medium comprises
biotin in a concentration less than 5 .mu.g/L.
9. The method of claim 6, wherein the penicillin derivative is
ampicillin.
10. The method of claim 3, wherein the pH of the culture medium in
step (a), before the microorganism is cultured, is from about pH 7
to about pH 8.
11. The method of claim 5, wherein the culture medium comprises
molasses, corn steep liquor or a combination thereof.
12. The method of claim 3, wherein the microorganism is E. coli,
and wherein the culture medium comprises Trp-1+glucose medium.
13. The method of claim 1, wherein the microorganism requires
phenylalanine and tyrosine for growth, and wherein the culture
medium comprises phenylalanine and tyrosine.
14. The method of claim 1, wherein the microorganism comprises aspC
and proA genes.
15. The method of claim 5, wherein the Corynebacterium glutamicum
is a strain of Corynebacterium glutamicum that produces and
secretes glutamate.
16. The method of claim 15, wherein the culture medium comprises a
non-ionic detergent, penicillin, a penicillin derivative or a
combination thereof.
17. The method of claim 15, wherein monatin or salt thereof is
secreted from the Corynebacterium glutamicum.
18. A method of producing monatin or salt thereof, wherein the
method comprises: (a) culturing Corynebacterium glutamicum (ATCC
13058) in a culture medium; and (b) extracting monatin or salt
thereof from the culture medium or the cultured microorganism.
19. The method of claim 18, wherein the culture medium comprises
Tween, penicillin, a penicillin derivative or a combination
thereof.
20. The method of claim 1, wherein the culture medium comprises
tryptophan, pyruvic acid, a non-ionic detergent, penicillin, a
penicillin derivative or a combination thereof.
21. The method of claim 20, wherein the non-ionic detergent is
Tween.
22. The method of claim 1, wherein the culture medium comprises
pyruvic acid, Tween, and a penicillin derivative.
23. The method of claim 1, wherein the aminotransferase polypeptide
is chosen from a tryptophan aminotransferase polypeptide (EC
2.6.1.27), an aspartate aminotransferase polypeptide (EC 2.6.1.1),
an aromatic aminotransferase polypeptide (EC 2.6.1.5) and a
D-alanine aminotransferase polypeptide (EC 2.6.1.21).
24. The method of claim 1, wherein the microorganism secretes
monatin or salt thereof.
25. The method of claim 1, wherein the microorganism is cultured in
a fermentor.
26. A microorganism comprising at least one nucleic acid encoding
an aldolase polypeptide and at least one nucleic acid encoding an
aminotransferase polypeptide, wherein the nucleic acids are chosen
from exogenous nucleic acids, recombinant nucleic acids and a
combination thereof, and wherein the microorganism produces monatin
or salt thereof.
27. The microorganism of claim 26, wherein the aldolase polypeptide
is chosen from ProA aldolase (4-hydroxy-4-methyl-2-oxoglutarate
aldolase, EC 4.1.3.17) and KHG aldolase (4-hydroxy-2-oxoglutarate
glyoxylate-lyase, EC 4.1.3.16).
28. The microorganism of claim 26, wherein the aminotransferase
polypeptide is chosen from a tryptophan aminotransferase
polypeptide (EC 2.6.1.27), an aspartate aminotransferase
polypeptide (EC 2.6.1.1), an aromatic aminotransferase polypeptide
(EC 2.6.1.5) and a D-alanine aminotransferase polypeptide (EC
2.6.1.21).
29. The microorganism of claim 26, wherein the microorganism
overproduces pyruvate.
30. The microorganism of claim 29, wherein the microorganism is a
thiamine auxotroph.
31. The microorganism of claim 26, wherein the microorganism is a
phenylalanine and tyrosine auxotroph.
32. The microorganism of claim 29, wherein the microorganism is
chosen from Candida glabrata, Trichosporon cutaneum, Candida
lipolytica, and Saccharomyces cerevisiae.
33. The microorganism of claim 29, wherein the microorganism is a
lipoic acid auxotroph.
34. The microorganism of claim 33, wherein the microorganism
comprises aspc and proA genes.
35. The microorganism of claim 33, wherein the microorganism
comprises aspC and proA genes and at least one tryptophan operon
gene.
36. The microorganism of claim 33, wherein the microorganism is E.
coli.
37. The microorganism of claim 29, wherein the microorganism
comprises a defective F1.sup.-ATPase gene.
38. The microorganism of claim 33, wherein the microorganism
comprises a disruption in an endogenous lipA gene.
39. The microorganism of claim 26, wherein the microorganism
overproduces tryptophan.
40. The microorganism of claim 26, wherein the microorganism
comprises two or more copies of one or more tryptophan biosynthesis
genes.
41. The microorganism of claim 39, wherein the microorganism
comprises a disrupted pheA gene.
42. The microorganism of claim 39, wherein the microorganism
comprises a disrupted endogenous tryptophanase (tna) gene.
43. The microorganism of claim 39, wherein the microorganism
overexpresses a ppsA gene.
44. The microorganism of claim 39, wherein the microorganism is E.
coli or Corynebacterium glutamicum.
45. The microorganism of claim 44 wherein the microorganism has an
increased amount of 3-deoxy-D-arabino-hepatulosonic 7-phosphate
acid (DAHP) synthase activity relative to a corresponding control
microorganism.
46. The microorganism of claim 26, wherein the microorganism
further comprises a nucleic acid encoding a polypeptide having
phosphoenolpyruvate (PEP) synthase activity, wherein the nucleic
acid is chosen from exogenous nucleic acids, recombinant nucleic
acids and a combination thereof.
47. The microorganism of claim 46, wherein the microorganism
further comprises a tkt gene.
48. The microorganism of claim 26, wherein the microorganism
further comprises an exogenous nucleic acid encoding a polypeptide
having tryptophanase activity.
49. The microorganism of claim 26, wherein the microorganism
secretes monatin or salt thereof.
50. The microorganism of claim 49, wherein the microorganism is a
fatty acid auxotroph.
51. The microorganism of claim 26, wherein the microorganism is a
strain of bacteria comprising a nucleic acid expressing an
aldolase, wherein the aldolase expressed from the nucleic acid is
capable of producing a stereoisomerically-enriched monatin
mixture.
52. The microorganism of claim 51, wherein the
stereoisomerically-enriched monatin mixture is predominantly S,S
monatin or salt thereof.
53. The microorganism of claim 51, wherein the
stereoisomerically-enriched monatin mixture is predominantly R,R
monatin or salt thereof.
54. The microorganism of claim 26 wherein the microorganism
overexpresses at least one nucleic acid encoding a tryptophan
uptake polypeptide.
55. A method for producing monatin or salt thereof, wherein the
method comprises: (a) culturing a microorganism that produces
monatin or salt thereof in culture medium under conditions wherein
the monatin or salt thereof is produced, and (b) obtaining the
monatin or salt thereof from the culture medium or the cultured
microorganisms.
56. The method of claim 55, wherein the microorganism secretes the
monatin or salt thereof.
57. The method of claim 55, wherein the microorganism is a fatty
acid auxotroph.
58. A method for identifying a cell capable of synthesizing monatin
or salt thereof, wherein the method comprises: (a) culturing a cell
in the presence of a carbon/energy source chosen from monatin or
salt thereof, 2-hydroxy 2-(indol-3-ylmethyl)-4-keto glutaric acid
or salt thereof, an analog of monatin or salt thereof, an analog of
2-hydroxy-2-(indol-3-ylme- thyl)-4-keto glutaric acid or salt
thereof, and a combination thereof; and (b) testing for growth of
the cell, wherein growth of the cell indicates that the cell
converts the carbon/energy source to pyruvate, thereby indicating
that the cell is capable of synthesizing monatin or salt
thereof.
59. The method of claim 58, wherein the cell is a pyruvate
auxotroph, and pyruvate is produced in the cell by metabolism of
the carbon/energy source
60. The method of claim 59, wherein the cell comprises disruptions
in the pykA and pykF genes.
61. A method for identifying a cell capable of synthesizing monatin
or salt thereof or 2-hydroxy-2-(indol-3-ylmethyl)-4-keto-glutaric
acid or salt thereof, or a combination thereof from tryptophan,
wherein the method comprises: (a) culturing a cell that is a
tryptophan auxotroph in the absence of tryptophan and in the
presence of monatin or salt thereof, 2-hydroxy
2-(indol-3-ylmethyl)-4-keto glutaric acid or salt thereof, or a
combination thereof, and (b) testing for growth of the cell that is
a tryptophan auxotroph, wherein growth of the cell indicates that
the cell synthesizes tryptophan from monatin or salt thereof,
2-hydroxy 2-(indol-3-ylmethyl)-4-keto glutaric acid or salt
thereof, or a combination thereof, thereby indicating that the cell
is capable of synthesizing monatin or salt thereof or
2-hydroxy-2-(indol-3-ylmethyl)-4-- keto-glutaric acid or salt
thereof, or a combination thereof from tryptophan.
62. A method of producing monatin or salt thereof, wherein the
method comprises: (a) culturing a microorganism in a culture
medium, wherein the microorganism is chosen from Sinorhizobium
meliloti, Comamonas testosteroni, Pseudomonas straminea and
Corynebacterium glutamicum; and (b) extracting monatin or salt
thereof from the culture medium or the cultured microorganism.
63. The method of claim 62, wherein the microorganism is not
genetically modified.
64. The method of claim 62, wherein the culture medium comprises
PHB Medium.
65. The method of claim 62, wherein the culture medium further
comprises tryptophan, pyruvate, a non-ionic detergent, penicillin,
a penicillin derivative or a combination thereof.
66. The method of claim 64, wherein the microorganism is
Sinorhizobium meliloti or Comamonas testosteroni.
67. The method of claim 64, wherein the microorganism is Comamonas
testosteroni, and the culture medium further comprises tryptophan
and pyruvate.
68. The method of claim 62, wherein the culture medium comprises TY
medium.
69. The method of claim 68, wherein the culture medium further
comprises tryptophan, pyruvate or a combination thereof.
Description
[0001] This application claims priority of U.S. provisional patent
application No. 60/513,406, filed Oct. 21, 2003, which is
incorporated herein by reference for all purposes.
TECHNICAL FIELD
[0002] This disclosure provides methods and materials that are
useful in the production of indole-3-pyruvate, 2-hydroxy
2-(indol-3ylmethyl)-4-keto glutaric acid and/or monatin.
BACKGROUND
[0003] Indole-3-pyruvate is a strong antioxidant that is believed
to counter act oxidative stress in tissues with high oxygen
concentrations (Politi et al. "Recent advances in Tryptophan
Research", edited by G. A. Filippini et al. Plenum Press, New York,
1996, pp 291-8). Indole pyruvate also is an intermediate in a
pathway to produce indole-acetic acid (IAA), the primary plant
growth hormone auxin (diffusible growth promoting factor). IAA is
active in submicrogram amounts in a range of physiological
processes including apical dominance, tropisms, shoot elongation,
induction of cambial cell division, and root initiation. Synthetic
auxins are used in horticulture to induce rooting and to promote
the set and development of fruit. See, e.g., U.S. Pat. Nos.
5,843,782 and 5,952,231. At high concentrations the synthetic
auxins are effective herbicides against broad-leafed plants.
Natural auxins produced by fermentation may be considered more
environmentally friendly than chemically produced herbicides.
Growth regulators had world sales in 1999 of 0.4 billion pounds
(1.4 billion U.S. dollars). In addition to plant related utilities,
indole acetic acid is useful in pharmaceutical applications. For
example, U.S. Pat. No. 5,173,497 proposes the use of these
compounds in the treatment of memory impairment such as that
associated with Alzheimer's disease and senile dementia. The
mechanism proposed in U.S. Pat. No. 5,173,497 is that these
compounds inhibit acetylcholinesterase and increase acetylcholine
levels in the brain.
[0004] Indole-3-carbinol is produced from indole-3-acetic acid by
peroxidase-catalyzed oxidation, and can easily be converted
into-diindolylmethane. Both compounds are reported to eliminate
toxins and promote the production of hormones beneficial to women's
health. Chlorinated D-tryptophan has been identified as a
nonnutritive sweetener, and there is increasing interest in
pursuing other derivatives as well.
[0005] Monatin (2-hydroxy-2-(indol-3-ylmethyl)-4-aminoglutaric
acid) is a naturally-occurring, sweetener that is similar in
composition to the amino acid tryptophan. It can be extracted from
the bark of the roots of the South African shrub, Sclerochiton
ilicifolius, and has promise in the food and beverage industry as a
high-intensity sweetener. Some examples of patents on monatin
include: U.S. Pat. Nos. 5,994,559; 4,975,298; 5,128,164; and
5,128,482.
SUMMARY
[0006] The present invention involves monatin
(2-hydroxy-2-(indol-3-ylmeth- yl)-4-aminoglutaric acid-also known
as 4-amino-2-hydroxy-2-(1H-indol-3-ylm- ethyl)-pentanedioic acid,
or alternatively, based on an alternate numbering system,
4-hydroxy-4-(3-indolylmethyl) glutamic acid), a compound having the
formula: 1
[0007] Monatin also has the following chemical names:
3-(1-amino-1,3-dicarboxy-3-hydroxy-but-4-yl)-indole;
4-(indole-3-ylmethyl)-4-hydroxy-glutamic acid; and
3-(1-amino-1,3-dicarboxy-3-hydroxybutane-4-yl)-indole.
[0008] Monatin is a naturally-occurring, high intensity sweetener.
Monatin has four stereoisomeric forms: 2R, 4R (the "R,R
stereoisomer" or "R,R monatin"), 2S, 4S (the "S,S stereoisomer" or
"S,S monatin"), 2R, 4S (the "R,S stereoisomer" or "R,S monatin"),
and 2S, 4R (the "S,R stereoisomer" or "S,R monatin"). As used
herein, unless stated otherwise, "monatin" refers to all four
stereoisomers of monatin, as well as any blends of any combination
of monatin stereoisomers (e.g., a blend of the R,R and S,S,
stereoisomers of monatin).
[0009] The invention is based, in part, on the identification of
several biosynthetic routes for making monatin from glucose,
tryptophan, indole-3-lactic acid, and/or through intermediates such
as indole-3-pyruvate and 2-hydroxy 2-(indole-3-ylmethyl)-4-keto
glutaric acid (the monatin precursor, MP, the alpha-keto form of
monatin). Polypeptides and nucleic acid sequences that can be used
to make monatin, indole-3-pyruvate, and MP are disclosed. Because
the organic synthesis of monatin requires the resolution of
isomers, a biochemical route that can utilize inexpensive raw
materials and that can produce only one isomer may be more
economically advantageous.
[0010] Monatin can be produced through indole-3-pyruvate, MP,
indole-3-lactic acid, tryptophan, and/or glucose (FIG. 1). Methods
of producing or making monatin or its intermediates shown in FIGS.
1-3 and 11-13 involve converting a substrate to a first product,
and then converting the first product to a second product, and so
on, until the desired end product is created, are disclosed.
[0011] FIGS. 1-3 and 11-13 show potential intermediate products and
end products in boxes. For example, a conversion from one product
to another, such as glucose to tryptophan, tryptophan to
indole-3-pyruvate, indole-3-pyruvate to MP, MP to monatin, or
indole-3-lactic acid (indole-lactate) to indole-3-pyruvate, can be
performed by using the methods and materials provided herein. These
conversions can be facilitated either chemically or biologically.
The term "convert" refers to the use of either chemical means or
polypeptides in a reaction which changes one product (e.g., a first
intermediate) to another product (e.g., a second intermediate). The
term "chemical conversion" refers to reactions that are not
actively facilitated by polypeptides. The term "biological
conversion" refers to reactions that are actively facilitated by
polypeptides. Conversions can take place in vivo or in vitro. When
biological conversions are used, the polypeptides and/or cells can
be immobilized on supports such as by chemical attachment on
polymer supports. The conversion can be accomplished using any
reactor known to one of ordinary skill in the art, for example in a
batch or a continuous reactor.
[0012] Methods are also provided that include contacting a first
polypeptide with a substrate and making a first product, and then
contacting the first product created with a second polypeptide and
creating a second product, and then contacting the second product
created with a third polypeptide and creating a third product, for
example monatin. The polypeptides used and the products produced
are shown in FIGS. 1-3 and 11-13.
[0013] Polypeptides, and their coding sequences, that can be used
to perform the conversions shown in FIGS. 1-3 and 11-13 are
disclosed. In some examples, polypeptides having one or more point
mutations that allow the substrate specificity and/or activity of
the polypeptides to be modified, are used to make monatin.
[0014] Isolated and recombinant cells that produce monatin are
disclosed. These cells can be any cell, such as a plant, animal,
bacterial, yeast, algal, archaeal, or fungal cell.
[0015] In a particular example, the disclosed cells include one or
more (e.g., two or more, three or more, four or more, or five or
more) of the following activities: tryptophan aminotransferase (EC
2.6.1.27), tyrosine (aromatic) aminotransferase (EC 2.6.1.5),
multiple substrate aminotransferase (EC 2.6.1.-), aspartate
aminotransferase (EC 2.6.1.1), tryptophan dehydrogenase (EC
1.4.1.19), tryptophan-phenylpyruvate transaminase (EC 2.6.1.28),
L-amino acid oxidase (EC 1.4.3.2), tryptophan oxidase (no EC
number, Hadar et al., J. Bacteriol 125:1096-1104, 1976; and Furuya
et al., Biosci Biotechnol Biochem 64:1486-93, 2000), D-amino acid
dehydrogenase (EC 1.4.99.1), D-amino acid oxidase (EC 1.4.3.3),
D-alanine aminotransferase (EC 2.6.1.21), synthase/lyase (EC
4.1.3.-), such as 4-hydroxy-4-methyl-2-oxoglutarate aldolase (EC
4.1.3.17) or 4-hydroxy-2-oxoglutarate aldolase (EC 4.1.3.16),
synthase/lyase (4.1.2.-), D-tryptophan aminotransferase (Kohiba and
Mito, Proceedings of the 8.sup.th International Symposium on
Vitamin B.sub.6 and Carbonyl Catalysis, Osaka, Japan 1990),
phenylalanine dehydrogenase (EC 1.4.1.20), and/or glutamate
dehydrogenase (EC 1.4.1.2, 1.4.1.3, 1.4.1.4).
[0016] In another example, cells include one or more (e.g., two or
more, three or more, four or more, or five or more) of the
following activities: indolelactate dehydrogenase (EC 1.1.1.10),
R-4-hydroxyphenyllactate dehydrogenase (EC 1.1.1.222),
3-(4)-hydroxyphenylpyruvate reductase (EC 1.1.1.237), lactate
dehydrogenase (EC 1.1.1.27, 1.1.1.28, 1.1.2.3), (3-imidazol-5-yl)
lactate dehydrogenase (EC 1.1.1.11), lactate oxidase (EC 1.1.3.-),
synthase/lyase (4.1.3.-) such as 4-hydroxy-4-methyl-2-oxoglutarate
aldolase (EC 4.1.3.17) or 4-hydroxy-2-oxoglutarate aldolase (EC
4.1.3.16), synthase/lyase (4.1.2.-), tryptophan dehydrogenase (EC
1.4.1.19), tryptophan-phenylpyruvate transaminase (EC 2.6.1.28),
tryptophan aminotransferase (EC 2.6.1.27), tyrosine (aromatic)
aminotransferase (EC 2.6.1.5), multiple substrate aminotransferase
(EC 2.6.1.-), aspartate aminotransferase (EC 2.6.1.1),
phenylalanine dehydrogenase (EC 1.4.1.20), glutamate dehydrogenase
(EC 1.4.1.2, 1.4.1.3, 1.4.1.4 ), D-amino acid dehydrogenase (EC
1.4.99.1), D-tryptophan aminotransferase, and/or D-alanine
aminotransferase (EC 2.6.1.21).
[0017] In addition, the disclosed cells can include one or more
(e.g., two or more, three or more, four or more, or five or more)
of the following activities: tryptophan aminotransferase (EC
2.6.1.27), tyrosine (aromatic) aminotransferase (EC 2.6.1.5),
multiple substrate aminotransferase (EC 2.6.1.-), aspartate
aminotransferase (EC 2.6.1.1), tryptophan dehydrogenase (EC
1.4.1.19), tryptophan-phenylpyruvate transaminase (EC 2.6.1.28),
L-amino acid oxidase (EC 1.4.3.2), tryptophan oxidase (no EC
number), D-amino acid dehydrogenase (EC 1.4.99.1), D-amino acid
oxidase (EC 1.4.3.3), D-alanine aminotransferase (EC 2.6.1.21),
indolelactate dehydrogenase (EC 1.1.1.110),
R-4-hydroxyphenyllactate dehydrogenase (EC 1.1.1.222),
3-(4)-hydroxyphenylpyruvate reductase (EC 1.1.1.237), lactate
dehydrogenase (EC 1.1.1.27, 1.1.1.28, 1.1.2.3), (3-imidazol-5-yl)
lactate dehydrogenase (EC 1.1.1.111), lactate oxidase (EC 1.1.3.-),
synthase/lyase (4.1.3.-) such as 4-hydroxy-4-methyl-2-oxogl-
utarate aldolase (EC 4.1.3.17) or 4-hydroxy-2-oxoglutarate aldolase
(EC 4.1.3.16), synthase/lyase (4.1.2.-), glutamate dehydrogenase
(EC 1.4.1.2, 1.4.1.3, 1.4.1.4), phenylalanine dehydrogenase (EC
1.4.1.20), and/or D-tryptophan aminotransferase.
[0018] Monatin can be produced by a method that includes contacting
tryptophan and/or indole-3-lactic acid with a first polypeptide,
wherein the first polypeptide converts tryptophan and/or
indole-3-lactic acid to indole-3-pyruvate (either the D or the L
form of tryptophan or indole-3-lactic acid can be used as the
substrate that is converted to indole-3-pyruvate; one of skill in
the art will appreciate that the polypeptides chosen for this step
ideally exhibit the appropriate specificity), contacting the
resulting indole-3-pyruvate with a second polypeptide, wherein the
second polypeptide converts the indole-3-pyruvate to MP, and
contacting the MP with a third polypeptide, wherein the third
polypeptide converts MP to monatin. Exemplary polypeptides that can
be used for these conversions are shown in FIGS. 2 and 3.
[0019] Another aspect of the invention provides compositions such
as MP, cells that contain at least two polypeptides, or sometimes
at least three or at least four polypeptides, that are encoded on
at least one exogenous nucleic acid sequence (e.g., at least two,
three, four, five, or more exogenous nucleic acid sequences).
[0020] The methods and materials provided herein can be used to
make products such as monatin, MP, monatin intermediates, and
monatin derivatives. Monatin and some of the intermediates of
monatin described herein can be useful as sweeteners or as
intermediates in the synthesis of monatin derivatives.
[0021] In another aspect, the invention features methods for
producing monatin. In certain embodiments, methods of producing
monatin or salt thereof comprise: (a) culturing a microorganism in
a culture medium, wherein the microorganism comprises at least one
nucleic acid encoding an aldolase polypeptide and at least one
nucleic acid encoding an aminotransferase polypeptide; and (b)
extracting monatin or salt thereof from the culture medium or the
cultured microorganism. In certain embodiments, the aldolase
polypeptide is chosen from ProA aldolase
(4-hydroxy-4-methyl-2-oxoglutarate aldolase, EC 4.1.3.17) and KHG
aldolase (4-hydroxy-2-oxoglutarate glyoxylate-lyase, EC 4.1.3.16).
In other embodiments, the microorganism is chosen from
Sinorhizobium meliloti, Comamonas testosteroni, Pseudomonas
straminea, Corynebacterium glutamicum and E. coli. Alternatively
the microorganism may be chosen from the genera Corynebacterium and
Brevibacterium.
[0022] In other embodiments, the culture medium comprises a
non-ionic detergent, penicillin, a penicillin derivative (such as
ampicillin), or a combination thereof. Non-ionic detergents include
Tween, Triton X-100 or dodecylammonium acetate. In one embodiment,
the culture medium comprises biotin in a concentration less than 5
.mu.g/L. In another embodiment, the pH of the culture medium,
before the microorganism is cultured, is from about pH 7 to about
pH 8. In addition, the culture medium may include molasses, corn
steep liquor or a combination thereof.
[0023] In some embodiments, the microorganism is E. coli , and the
culture medium comprises Trp-1+ glucose medium. In other
embodiments, the microorganism requires phenylalanine and tyrosine
for growth, and the culture medium comprises phenylalanine and
tyrosine. The microorganism may also comprise aspC and proA genes.
In addition, the microorganism may be a strain of Corynebacterium
glutamicum that produces and secretes glutamate. In some
embodiments, monatin or salt thereof is secreted from the
microorganism (e.g., Corynebacterium glutamicum). In another
embodiment, the microorganism is cultured in a fermentor.
[0024] In some embodiments, the culture medium comprises
tryptophan, pyruvic acid, a non-ionic detergent (such as Tween),
penicillin, a penicillin derivative or a combination thereof. In
other embodiments, the aminotransferase polypeptide is chosen from
a tryptophan aminotransferase polypeptide (EC 2.6.1.27), an
aspartate aminotransferase polypeptide (EC 2.6.1.1), an aromatic
aminotransferase polypeptide (EC 2.6.1.5) and a D-alanine
aminotransferase polypeptide (EC 2.6.1.21).
[0025] In addition, the invention features methods of producing
monatin or salt thereof comprising: (a) culturing Corynebacterium
glutamicum (ATCC 13058) in a culture medium; and (b) extracting
monatin or salt thereof from the culture medium or the cultured
microorganism. In some embodiments, the culture medium comprises
Tween, penicillin, a penicillin derivative or a combination
thereof.
[0026] Further, the invention features a microorganism comprising
at least one nucleic acid encoding an aldolase polypeptide and at
least one nucleic acid encoding an aminotransferase polypeptide,
wherein the nucleic acids are chosen from exogenous nucleic acids,
recombinant nucleic acids and a combination thereof, and wherein
the microorganism produces monatin or salt thereof. In some
embodiments, the aldolase polypeptide is chosen from ProA aldolase
(4-hydroxy-4-methyl-2-oxoglutara- te aldolase, EC 4.1.3.17) and KHG
aldolase (4-hydroxy-2-oxoglutarate glyoxylate-lyase, EC 4.1.3.16).
In other embodiments, the aminotransferase polypeptide is chosen
from a tryptophan aminotransferase polypeptide (EC 2.6.1.27), an
aspartate aminotransferase polypeptide (EC 2.6.1.1), an aromatic
aminotransferase polypeptide (EC 2.6.1.5) and a D-alanine
aminotransferase polypeptide (EC 2.6.1.21). The microorganisms may
include those that overproduce pyruvate, and/or are thiamine
auxotrophs, phenylalanine and tyrosine auxotrophs or lipoic acid
auxotrophs.
[0027] In some embodiments, the microorganism is chosen from
Candida glabrata, Trichosporon cutaneum, Candida lipolytica, and
Saccharomyces cerevisiae. In other embodiments, the microorganism
comprises aspC and proA genes. In certain embodiments, the
microorganism comprises aspC and proA genes and at least one
tryptophan operon gene. In other embodiments, the microorganism is
E. coli. In other embodiments, the microorganism comprises a
defective F1.sup.- ATPase gene, a disruption in an endogenous lipA
gene, a disrupted pheA gene, a disrupted endogenous tryptophanase
(tna) gene and/or two or more copies of one or more tryptophan
biosynthesis genes. In some embodiments, the microorganism
overproduces tryptophan. In other embodiments, the microorganism
overexpresses a ppsA gene, has an increased amount of
3-deoxy-D-arabino-hepatulosonic 7-phosphate acid (DAHP) synthase
activity relative to a corresponding control microorganism,
comprises a nucleic acid encoding a polypeptide having
phosphoenolpyruvate (PEP) synthase activity, wherein the nucleic
acid is chosen from exogenous nucleic acids, recombinant nucleic
acids and a combination thereof, and/or a tkt gene. In other
embodiments, the microorganism is E. coli or Corynebacterium
glutamicum.
[0028] In some embodiments, the microorganism further comprises an
exogenous nucleic acid encoding a polypeptide having tryptophanase
activity. In other embodiments, the microorganism secretes monatin
or salt thereof and/or is a fatty acid auxotroph. In other
embodiments, the microorganism is a strain of bacteria comprising a
nucleic acid expressing an aldolase, wherein the aldolase expressed
from the nucleic acid is capable of producing a
stereoisomerically-enriched monatin mixture. In some embodiments,
the stereoisomerically-enriched monatin mixture is predominantly
S,S monatin or salt thereof. Alternatively, the
stereoisomerically-enriched monatin mixture is predominantly R,R
monatin or salt thereof. In one embodiment, the microorganism
overexpresses at least one nucleic acid encoding a tryptophan
uptake polypeptide.
[0029] In another aspect, the invention features a method for
producing monatin or salt thereof comprising: (a) culturing a
microorganism that produces monatin or salt thereof in culture
medium under conditions wherein the monatin or salt thereof is
produced, and (b) obtaining the monatin or salt thereof from the
culture medium or the cultured microorganisms. In some embodiments,
the microorganism secretes the monatin or salt thereo and/or is a
fatty acid auxotroph.
[0030] In addition, the invention also includes a method for
identifying a cell capable of synthesizing monatin or salt thereof
comprising: (a) culturing a cell in the presence of a carbon/energy
source chosen from monatin or salt thereof, 2-hydroxy
2-(indol-3-ylmethyl)-4-keto glutaric acid or salt thereof, an
analog of monatin or salt thereof, an analog of 2-hydroxy
2-(indol-3-ylmethyl)-4-keto glutaric acid or salt thereof, and a
combination thereof; and (b) testing for growth of the cell,
wherein growth of the cell indicates that the cell converts the
carbon/energy source to pyruvate, thereby indicating that the cell
is capable of synthesizing monatin or salt thereof. In one
embodiment, the cell is a pyruvate auxotroph, and pyruvate is
produced in the cell by metabolism of the carbon/energy source. In
other embodiments, the cell comprises disruptions in the pykA and
pykF genes.
[0031] Furthermore, the invention features a method for identifying
a cell capable of synthesizing monatin or salt thereof or
2-hydroxy-2-(indol-3-ylmethyl)-4-keto-glutaric acid or salt
thereof, or a combination thereof from tryptophan, comprising: (a)
culturing a cell that is a tryptophan auxotroph in the absence of
tryptophan and in the presence of monatin or salt thereof,
2-hydroxy 2-(indol-3-ylmethyl)-4-ket- o glutaric acid or salt
thereof, or a combination thereof; and (b) testing for growth of
the cell that is a tryptophan auxotroph, wherein growth of the cell
indicates that the cell synthesizes tryptophan from monatin or salt
thereof, 2-hydroxy 2-(indol-3-ylmethyl)-4-keto glutaric acid or
salt thereof, or a combination thereof, thereby indicating that the
cell is capable of synthesizing monatin or salt thereof or
2-hydroxy-2-(indol-3-ylmethyl)-4-keto-glutaric acid or salt
thereof, or a combination thereof from tryptophan.
[0032] The invention also features a method of producing monatin or
salt thereof comprising: (a) culturing a microorganism in a culture
medium, wherein the microorganism is chosen from Sinorhizobium
meliloti, Comamonas testosteroni, Pseudomonas straminea and
Corynebacterium glutamicum; and (b) extracting monatin or salt
thereof from the culture medium or the cultured microorganism. In
some embodiments, the microorganism is not genetically modified. In
other embodiments, the culture medium comprises PHB Medium. The
culture medium may also include tryptophan, pyruvate, a non-ionic
detergent, penicillin, a penicillin derivative or a combination
thereof. In some embodiments, the microorganism is Sinorhizobium
meliloti or Comamonas testosteroni. In other embodiments, the
microorganism is Comamonas testosteroni, and/or the culture medium
further comprises tryptophan and pyruvate. In other embodiments,
the culture medium comprises TY medium. The culture medium may also
include tryptophan, pyruvate or a combination thereof.
[0033] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used to practice the invention, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict,
the present specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0034] Other features and advantages of the invention will be
apparent from the following detailed description, and from the
claims.
DESCRIPTION OF DRAWINGS
[0035] FIG. 1 shows biosynthetic pathways used to produce monatin
and/or indole-3-pyruvate. One pathway produces indole-3-pyruvate
via tryptophan, while another produces indole-3-pyruvate via
indole-3-lactic acid. Monatin is subsequently produced via a MP
intermediate.
[0036] Compounds shown in boxes are substrates and products
produced in the biosynthetic pathways.
[0037] Compositions adjacent to the arrows are cofactors, or
reactants that can be used during the conversion of a substrate to
a product. The cofactor or reactant used will depend upon the
polypeptide used for the particular step of the biosynthetic
pathway. The cofactor PLP (pyridoxal 5'-phosphate) can catalyze
reactions independent of a polypeptide, and therefore, merely
providing PLP can allow for the progression from substrate to
product.
[0038] FIG. 2 is a more detailed diagram of the biosynthetic
pathway that utilizes the MP intermediate. The substrates for each
step in the pathways are shown in boxes. The polypeptides allowing
for the conversion between substrates are listed adjacent to the
arrows between the substrates. Each polypeptide is described by its
common name and an enzymatic class (EC) number.
[0039] FIG. 3 shows a more detailed diagram of the biosynthetic
pathway of the conversion of indole-3-lactic acid to
indole-3-pyruvate. The substrates are shown in boxes, and the
polypeptides allowing for the conversion between the substrates are
listed adjacent to the arrow between the substrates. Each
polypeptide is described by its common name and an EC number. FIG.
4 shows one possible reaction for making MP via chemical means.
[0040] FIGS. 5A and 5B are chromatograms showing the LC/MS
identification of monatin produced enzymatically.
[0041] FIG. 6 is an electrospray mass spectrum of enzymatically
synthesized monatin.
[0042] FIGS. 7A and 7B are chromatograms of the LC/MS/MS daughter
ion analyses of monatin produced in an enzymatic mixture.
[0043] FIG. 8 is a chromatogram showing the high-resolution mass
measurement of monatin produced enzymatically.
[0044] FIGS. 9A-9C are chromatograms showing the chiral separation
of (A) R-tryptophan, (B) S-tryptophan, and (C) monatin produced
enzymatically.
[0045] FIG. 10 is a bar graph showing the relative amount of
monatin produced in bacterial cells following IPTG induction. The
(-) indicates a lack of substrate addition (no tryptophan or
pyruvate was added).
[0046] FIGS. 11-12 are schematic diagrams showing pathways used to
increase the yield of monatin produced from tryptophan or
indole-3-pyruvate.
[0047] FIG. 13 is a schematic diagram showing a pathway that can be
used to increase the yield of monatin produced from tryptophan or
indole-3-pyruvate.
[0048] FIG. 14 is a graph depicting an increase in pyruvate
production in genetically modified E. coli 7692 and BW25113
cells.
[0049] FIG. 15 is a graph depicting an increase in pyruvate
production in genetically modified E. coli 7692 and BW25113 cells
grown in pyruvate overproduction media.
[0050] FIG. 16 is a nucleic acid sequence listing of a proA gene
cloned from Comamonas testosteroni (ATCC 49249).
[0051] FIG. 17 is an amino acid sequence listing of the ProA
aldolase polypeptide encoded by a proA gene from Comamonas
testosteroni (ATCC 49249).
SEQUENCE LISTING
[0052] The nucleic and amino acid sequences listed in the
accompanying sequence listing are shown using standard letter
abbreviations for nucleotide bases, and three-letter code for amino
acids. Only one strand of each nucleic acid sequence is shown, but
the complementary strand is understood to be included by any
reference to the displayed strand.
[0053] SEQ ID NOS: 1 and 2 set forth the nucleic acid and amino
acid sequences, respectively, of an aminotransferase from
Sinorhizobium meliloti (tatA gene, called a tyrosine or aromatic
aminotransferase in literature).
[0054] SEQ ID NOS: 3 and 4 set forth the nucleic acid and amino
acid sequences, respectively, of a tyrosine aminotransferase from
Rhodobacter sphaeroides (2.4.1) (by homology with tatA (SEQ ID NOS:
1 and 2)).
[0055] SEQ ID NOS: 5 and 6 set forth the nucleic acid and amino
acid sequences, respectively, of an aminotransferase from
Rhodobacter sphaeroides (35053) (novel, cloned based on 2.4.1
sequence SEQ ID NOS 3 and 4).
[0056] SEQ ID NOS: 7 and 8 set forth the nucleic acid and amino
acid sequences, respectively, of a broad substrate aminotransferase
(bsat) from Leishmania major.
[0057] SEQ ID NOS: 9 and 10 set forth the nucleic acid and amino
acid sequences, respectively, of an aromatic aminotransferase
(araT) from Bacillus subtilis.
[0058] SEQ ID NOS: 11 and 12 set forth novel nucleic acid and amino
acid sequences, respectively, of an aromatic aminotransferase
(araT) from Lactobacillus amylovorus (identified by homology as an
aromatic aminotransferase).
[0059] SEQ ID NOS: 13 and 14 set forth the nucleic acid and amino
acid sequences, respectively, of a multiple substrate
aminotransferase (msa) from R. sphaeroides (35053) (identified as a
multiple substrate aminotransferase by homology to Accession No.
AAAE011000093.1, bp 14743-16155 and Accession No. ZP00005082.
1).
[0060] SEQ ID NOS: 15 and 16 set forth the nucleic acid sequences
of primers used to clone the B. subtilis D-alanine aminotransferase
(dat) gene sequence.
[0061] SEQ ID NOS: 17 and 18 set forth the nucleic acid sequences
of primers used to clone the S. meliloti tatA sequence.
[0062] SEQ ID NOS: 19 and 20 set forth the nucleic acid sequences
of primers used to clone the B. subtilis araT aminotransferase
sequence.
[0063] SEQ ID NOS: 21 and 22 set forth the nucleic acid sequences
of primers used to clone the Rhodobacter sphaeroides (2.4.1 and
35053) multiple substrate aminotransferase sequences.
[0064] SEQ ID NOS: 23 and 24 set forth the nucleic acid sequence of
primers used to clone the Leishmania major bsat sequence.
[0065] SEQ ID NOS: 25 and 26 set forth the nucleic acid sequences
of primers used to clone the Lactobacillus amylovorus araT
sequence.
[0066] SEQ ID NOS: 27 and 28 set forth the nucleic acid sequences
of primers used to clone the R. sphaeroides tatA sequences (both
2.4.1 and 35053).
[0067] SEQ ID NOS: 29 and 30 set forth the nucleic acid sequences
of primers used to clone the E. coli aspC sequence (gene sequence
Genbank Accession No.: AE000195.1, protein sequence Genbank
Accession No.:AAC74014.1).
[0068] SEQ ID NOS: 31 and 32 set forth the nucleic acid and amino
acid sequences, respectively, of aromatic aminotransferase (tyrB)
from E. coli.
[0069] SEQ ID NOS: 33 and 34 set forth the nucleic acid sequences
of primers used to clone the E. coli tyrB sequence.
[0070] SEQ ID NOS: 35-40 set forth the nucleic acid sequences of
primers used to clone polypeptides with 4-hydroxy-2-oxoglutarate
aldolase (KHG) (EC 4.1.3.16) activity.
[0071] SEQ ID NOS: 41 and 42 set forth the nucleic acid sequences
of a tryptophanase (tna) gene from E. coli and a tyrosine
phenol-lyase (tpl) gene from Citrobacter freundii, coding for
proteins P00913 (GI:401195) and P31013 (GI:401201),
respectively.
[0072] SEQ ID NOS: 43-46 set forth the nucleic acid sequences of
primers used to clone tryptophanase polypeptides and
.beta.-tyrosinase (tyrosine phenol-lyase) polypeptides.
[0073] SEQ ID NOS: 47-54 set forth the nucleic acid sequences of
primers used to mutate tryptophanase polypeptides and
.beta.-tyrosinase polypeptides.
[0074] SEQ ID NOS: 55-64 set forth the nucleic acid sequences of
primers used to clone polypeptides with
4-hydroxy-4-methyl-2-oxoglutarate aldolase (EC 4.1.3.17)
activity.
[0075] SEQ ID NOS: 65 and 66 set forth the nucleic acid and amino
acid sequences, respectively of 4-hydroxy-4-methyl-2-oxoglutarate
aldolase (proA) from C. testosteroni.
[0076] SEQ ID NOS: 67-68 set forth the nucleic acid sequences of
the primers used to clone C. testosteroni
4-hydroxy-4-methyl-2-oxoglutarate aldolase (proA) in an operon with
E. coli aspC in pET30 Xa/LIC.
[0077] SEQ ID NOS: 69-72 set forth the nucleic acid sequences of
the primers used to clone E. coli aspC and C. testosteroni proA in
pESC-his.
[0078] SEQ ID NOS: 73-74 set forth the nucleic acid sequences added
to the 5' end of primers used to clone the genes disclosed
herein.
[0079] SEQ ID NOS: 75 and 76 set forth the nucleic acid sequences
of the primers used to shorten the intervening sequence between the
aspC and proA genes.
[0080] SEQ ID NOS: 77 and 78 set forth the nucleic acid sequences
of the primers used to clone E. coli tnaA in pPRONco.
[0081] SEQ ID NOS: 79 and 80 set forth the nucleic acid sequences
of the primers used to clone E. coli tryptophan operon (genes trpE,
trpD, trpC, trpB, trpA) in pPRONco.
[0082] SEQ ID NOS: 81 and 82 set for the nucleic acid and amino
acid sequences, respectively, of the trpE gene of plasmid pGX50
(derived from 5-methyltryptophan resistant cells).
[0083] SEQ ID NOS: 83 and 84 set forth the nucleic acid sequences
of the primers used to clone an operon containing C. testosteroni
4-hydroxy-4-methyl-2-oxoglutarate aldolase (proA) and E. coli aspC
into the Corynebacterium/E. coli shuttle vector pEKEX-2.
[0084] SEQ ID NOS: 85 and 86 set forth the nucleic acid sequences
of the primers used to generate the pykA knockout in E. coli.
[0085] SEQ ID NOS: 87 and 88 set forth the nucleic acid sequences
of the primers used to generate the generate the pykF knockout in
E. coli.
[0086] SEQ ID NO: 89 sets forth the first ten amino acids of an
aromatic aminotransferase (araT) from Lactobacillus amylovorus (SEQ
ID NO: 12).
DETAILED DESCRIPTION
[0087] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art in the practice of the present
disclosure. As used herein, "including" means "comprising." In
addition, the singular forms "a" or "an" or "the" include plural
references unless the context clearly dictates otherwise. For
example, reference to "comprising a protein" includes one or a
plurality of such proteins, and reference to "comprising the cell"
includes reference to one or more cells and equivalents thereof
known to those skilled in the art, and so forth. The term "about"
encompasses the range of experimental error that occurs in any
measurement. Unless otherwise stated, all measurement numbers are
presumed to have the word "about" in front of them even if the word
"about" is not expressly used.
[0088] cDNA (complementary DNA): A piece of DNA lacking internal,
non-coding segments (introns) and regulatory sequences which
determine transcription. cDNA can be synthesized in the laboratory
by reverse transcription from messenger RNA extracted from
cells.
[0089] Conservative substitution: One or more amino acid
substitutions (for example 2, 5, or 10 residues) for amino acid
residues having similar biochemical properties. Typically,
conservative substitutions have little to no impact on the activity
of a resulting polypeptide. For example, ideally, a tryptophan
aminotransferase polypeptide including one or more conservative
substitutions retains tryptophan aminotransferase activity. A
polypeptide can be produced to contain one or more conservative
substitutions by manipulating the nucleotide sequence that encodes
that polypeptide using, for example, standard procedures such as
site-directed mutagenesis or PCR.
[0090] Substitutional variants are those in which at least one
residue in the amino acid sequence has been removed and a different
residue inserted in its place. Examples of amino acids which can be
substituted for an original amino acid in a protein and which are
regarded as conservative substitutions include: Ala substituted
with ser or thr; arg substituted with gln, his, or lys; asn
substituted with glu, gln, lys, his, asp; asp substituted with asn,
glu, or gln; cys substituted with ser or ala; gln substituted with
asn, glu, lys, his, asp, or arg; glu substituted with asn, gln lys,
or asp; gly substituted with pro; his substituted with asn, lys,
gin, arg, tyr; ile substituted with leu, met, val, phe; leu
substituted with ile, met, val, phe; lys substituted with asn, glu,
gln, his, arg; met substituted with ile, leu, val, phe; phe
substituted with trp, tyr, met, ile, or leu; ser substituted with
thr, ala; thr substituted with ser or ala; trp substituted with
phe, tyr; tyr substituted with his, phe, or trp; and val
substituted with met, ile, leu. See, Ben-Bassat et al., (J.
Bacteriol. 169:751-7, 1987), O'Regan et al., (Gene 77:237-51,
1989), Sahin-Toth et al., (Protein Sci. 3:240-7, 1994), Hochuli et
al., (Bio/Technology 6:1321-5, 1988), WO 00/67796 (Curd et al.), or
standard textbooks of genetics and molecular biology for further
information about conservative substitutions.
[0091] Exogenous: The term "exogenous" as used herein with
reference to nucleic acid and a particular cell refers to any
nucleic acid that does not originate from that particular cell as
found in nature. Thus, non-naturally-occurring nucleic acid is
considered to be exogenous to a cell once introduced into the cell.
Nucleic acid that is naturally-occurring also can be exogenous to a
particular cell. For example, an entire chromosome isolated from a
cell of person X is an exogenous nucleic acid with respect to a
cell of person Y once that chromosome is introduced into Y's cell.
An "exogenous" protein results from the expression of an exogenous
nucleic acid in a cell.
[0092] Functionally Equivalent: Having an equivalent function. In
the context of an enzyme, functionally equivalent molecules include
different molecules that retain the function of the enzyme. For
example, functional equivalents can be provided by sequence
alterations in an enzyme sequence, wherein the polypeptide with one
or more sequence alterations retains a function of the unaltered
polypeptide (e.g., enzymatic activity). In a particular example, a
tryptophan aminotransferase functional equivalent retains the
ability to convert tryptophan to indole-3-pyruvate.
[0093] Examples of sequence alterations include, but are not
limited to, conservative substitutions, deletions, mutations,
frameshifts, and insertions. In one example, a given polypeptide
binds an antibody, and a functional equivalent is a polypeptide
that binds the same antibody. Thus a functional equivalent includes
peptides that have the same binding specificity as a polypeptide,
and that can be used as a reagent in place of the polypeptide. In
one example, a functional equivalent includes a polypeptide wherein
the binding sequence is discontinuous, wherein the antibody binds a
linear epitope. Thus, if the peptide sequence is MPELANDLGL (amino
acids 1-10 of SEQ ID NO: 12) (SEQ ID NO: 89), a functional
equivalent includes discontinuous epitopes, which can appear as
follows (**=any number of intervening amino acids):
NH2-**-M**P**E**L**A**N**D**L**G**L-COOH. In this example, the
polypeptide is functionally equivalent to amino acids 1-10 of SEQ
ID NO: 12 if the three dimensional structure of the polypeptide is
such that it can bind a monoclonal antibody that binds amino acids
1-10 of SEQ ID NO: 12.
[0094] Hybridization: The term "hybridization" as used herein
refers to a method of testing for complementarity in the nucleotide
sequence of two nucleic acid molecules, based on the ability of
complementary single-stranded DNA and/or RNA to form a duplex
molecule. Nucleic acid hybridization techniques can be used to
obtain an isolated nucleic acid within the scope of the disclosure.
Briefly, any nucleic acid having homology to the sequence set forth
in SEQ ID NO: 11 or a portion thereof can be used as a probe to
identify a similar nucleic acid by hybridization under conditions
of moderate to high stringency. Once identified, the nucleic acid
then can be purified, sequenced, and analyzed to determine whether
it is within the scope of the present disclosure.
[0095] Hybridization can be done by Southern or Northern analysis
to identify a DNA or RNA sequence, respectively, that hybridizes to
a probe. The probe can be labeled with a biotin, digoxygenin, a
polypeptide, or a radioisotope such as .sup.32P. The DNA or RNA to
be analyzed can be electrophoretically separated on an agarose or
polyacrylamide gel, transferred to nitrocellulose, nylon, or other
suitable membrane, and hybridized with the probe using standard
techniques well known in the art such as those described in
sections 7.39-7.52 of Sambrook et al., (1989) Molecular Cloning,
second edition, Cold Spring Harbor Laboratory, Plainview, N.Y.
Typically, a probe is at least about 20 nucleotides in length. For
example, a probe corresponding to a contiguous 20 nucleotide
sequence set forth in SEQ ID NO: 11 can be used to identify an
identical or similar nucleic acid. In addition, probes longer or
shorter than 20 nucleotides can be used.
[0096] The disclosure also provides isolated nucleic acid sequences
that are at least about 12 bases in length (e.g., at least about
13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 100, 250, 500,
750, 1000, 1500, 2000, 3000, 4000, or 5000 bases in length) and
hybridize, under hybridization conditions, to the sense or
antisense strand of a nucleic acid having the sequence set forth in
SEQ ID NO: 11. The hybridization conditions can be moderately or
highly stringent hybridization conditions. For the purpose of this
disclosure, moderately stringent hybridization conditions mean the
hybridization is performed at about 42.degree. C. in a
hybridization solution containing 25 mM KPO.sub.4 (pH 7.4),
5.times.SSC, 5.times. Denhart's solution, 50 .mu.g/mL denatured,
sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and
1-15 ng/mL probe (about 5.times.10.sup.7 cpm/.mu.g), while the
washes are performed at about 50.degree. C. with a wash solution
containing 2.times.SSC and 0.1% sodium dodecyl sulfate.
[0097] Highly stringent hybridization conditions mean the
hybridization is performed at about 42.degree. C. in a
hybridization solution containing 25 mM KPO.sub.4 (pH 7.4),
5.times.SSC, 5.times. Denhart's solution, 50 .mu.g/mL denatured,
sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and
1-15 ng/mL probe (about 5.times.10.sup.7 cpm/.mu.g), while the
washes are performed at about 65.degree. C. with a wash solution
containing 0.2.times.SSC and 0.1% sodium dodecyl sulfate.
[0098] Isolated: The term "isolated" as used herein with reference
to nucleic acid refers to a naturally-occurring nucleic acid that
is not immediately contiguous with both of the sequences with which
it is immediately contiguous (one on the 5' end and one on the 3'
end) in the naturally-occurring genome of the organism from which
it is derived. For example, an isolated nucleic acid can be,
without limitation, a recombinant DNA molecule of any length,
provided one of the nucleic acid sequences normally found
immediately flanking that recombinant DNA molecule in a
naturally-occurring genome is removed or absent. Thus, an isolated
nucleic acid includes, without limitation, a recombinant DNA that
exists as a separate molecule (e.g., a cDNA or a genomic DNA
fragment produced by PCR or restriction endonuclease treatment)
independent of other sequences as well as recombinant DNA that is
incorporated into a vector, an autonomously replicating plasmid, a
virus (e.g., a retrovirus, adenovirus, or herpes virus), or into
the genomic DNA of a prokaryote or eukaryote. In addition, an
isolated nucleic acid can include a recombinant DNA molecule that
is part of a hybrid or fusion nucleic acid sequence. The term
"isolated" as used herein with reference to nucleic acid also
includes any non-naturally-occurring nucleic acid since
non-naturally-occurring nucleic acid sequences are not found in
nature and do not have immediately contiguous sequences in a
naturally-occurring genome. For example, non-naturally-occurring
nucleic acid such as an engineered nucleic acid is considered to be
isolated nucleic acid. Engineered nucleic acid can be made using
common molecular cloning or chemical nucleic acid synthesis
techniques. Isolated non-naturally-occurring nucleic acid can be
independent of other sequences, or incorporated into a vector, an
autonomously replicating plasmid, a virus (e.g., a retrovirus,
adenovirus, or herpes virus), or the genomic DNA of a prokaryote or
eukaryote. In addition, a non-naturally-occurring nucleic acid can
include a nucleic acid molecule that is part of a hybrid or fusion
nucleic acid sequence.
[0099] A nucleic acid existing among hundreds to millions of other
nucleic acid molecules within, for example, cDNA or genomic
libraries, or gel slices containing a genomic DNA restriction
digest is not to be considered an isolated nucleic acid.
[0100] The term "isolated" as used herein with reference to a
polypeptide refers to a polypeptide that is isolated in some way,
for example, from a cell, or otherwise separated from a previous
environment. An isolated polypeptide can also refer to a
polypeptide that has been purified in some way.
[0101] Nucleic acid: The term "nucleic acid" as used herein
encompasses both RNA and DNA including, without limitation, cDNA,
genomic DNA, and synthetic (e.g., chemically synthesized) DNA. The
nucleic acid can be double-stranded or single-stranded. Where
single-stranded, the nucleic acid can be the sense strand or the
antisense strand. In addition, nucleic acid can be circular or
linear. One or more nucleic acids can be present within a larger
nucleic acid. For example, a nucleic acid encoding an aldolase
polypeptide and a nucleic acid encoding an aminotransferase
polypeptide can be present within in a larger single nucleic acid,
such as genomic DNA or a plasmid vector. Alternatively, a nucleic
acid encoding an aldolase polypeptide and a nucleic acid encoding
an aminotransferase polypeptide can be present on two different
nucleic acids, such as two different plasmid vectors.
[0102] Operably linked: A first nucleic acid sequence is "operably
linked" with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription of the coding sequence. Generally, operably linked
DNA sequences are contiguous and, where necessary to join two
polypeptide-coding regions, in the same reading frame.
[0103] Ovcrexpress: A cell "overexpresses" a particular nucleic
acid or gene if the polypeptide encoded by that nucleic acid or
gene is produced in a cell and/or microorganism at a higher
concentration than that produced in a corresponding wild-type or
native cell and/or microorganism. Cells can overexpress exogenous,
recombinant or naturally occurring (i.e., native) nucleic acids or
genes in a cell. For example, a polypeptide may be produced at a
higher level in a cell by overexpressing a naturally occurring
nucleic acid in the cell, where the nucleic acid encoding the
polypeptide itself is not genetically modified, but a promoter
directing transcription of the nucleic acid sequence is modified or
added. The term "overexpress" can also relate to an overexpressed
protein, i.e., one present in a cell and/or microorganism at a
higher concentration than that present in a corresponding wild-type
or native cell and/or microorganism.
[0104] Polypeptide: A polypeptide refers to a chain of amino acids,
regardless of post-translation modification.
[0105] Polypeptide Modifications: The present disclosure includes
enzymes, as well as synthetic embodiments thereof. In addition,
analogues (non-peptide organic molecules), derivatives (chemically
functionalized polypeptide molecules obtained starting with the
disclosed polypeptide sequences) and variants (homologs) having the
desired enzymatic activity can be utilized in the methods described
herein. The polypeptides disclosed herein include a sequence of
amino acids, that can be either L- and/or D-amino acids, naturally
occurring and otherwise.
[0106] Polypeptides can be modified by a variety of chemical
techniques to produce derivatives having essentially the same
activity as the unmodified polypeptides, and optionally having
other desirable properties. For example, carboxylic acid groups of
the polypeptide, whether carboxyl-terminal or side chain, can be
provided in the form of a salt of a pharmaceutically-acceptable
cation or esterified to form a C1-C16 ester, or converted to an
amide of formula NR.sub.1R.sub.2 wherein R.sub.1 and R.sub.2 are
each independently H or C1-C16 alkyl, or combined to form a
heterocyclic ring, such as a 5- or 6-membered ring. Amino groups of
the polypeptide, whether amino-terminal or side chain, can be in
the form of a pharmaceutically-acceptable acid addition salt, such
as HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric,
and other organic salts, or can be modified to C1_C1 6 alkyl or
dialkyl amino or further converted to an amide.
[0107] Hydroxyl groups of the amino acid side chains can be
converted to C1-C16 alkoxy or to a C1-C16 ester using
well-recognized techniques. Phenyl and phenolic rings of the amino
acid side chains can be substituted with one or more halogen atoms,
such as F, Cl, Br or I, or with C1-C16 alkyl, C1-C16 alkoxy,
carboxylic acids and esters thereof, or amides of such carboxylic
acids. Methylene groups of the amino acid side chains can be
extended to homologous C2-C4 alkylenes. Thiols can be protected
with any one of a number of well-recognized protecting groups, such
as acetamide groups. Those skilled in the art will also recognize
methods for introducing cyclic structures into the polypeptides of
this disclosure to select and provide conformational constraints to
the structure that result in enhanced stability. For example, a C-
or N-terminal cysteine can be added to the polypeptide, so that
when oxidized, the polypeptide will contain a disulfide bond,
generating a cyclic polypeptide. Other polypeptide cyclizing
methods include the formation of thioethers and carboxyl- and
amino-terminal amides and esters.
[0108] Peptidomimetic and organomimetic embodiments are also within
the scope of the present disclosure, whereby the three-dimensional
arrangement of the chemical constituents of such peptido- and
organomimetics mimic the three-dimensional arrangement of the
peptide backbone and component amino acid side chains, resulting in
such peptido- and organomimetics of the polypeptides of this
disclosure having detectable enzyme activity. For computer modeling
applications, a pharmacophore is an idealized, three-dimensional
definition of the structural requirements for biological activity.
Peptido- and organomimetics can be designed to fit each
pharmacophore with current computer modeling software (using
computer assisted drug design or CADD). See, e.g., Walters,
"Computer-Assisted Modeling of Drugs", in Klegerman & Groves
(eds.), Pharmaceutical Biotechnology, 1993, Interpharm Press:
Buffalo Grove, Ill., pp. 165-74 and Ch. 102 in Munson (ed.),
Principles of Pharmacology, 1995, Chapman & Hall, for
descriptions of techniques used in CADD. Also included within the
scope of the disclosure are mimetics prepared using such
techniques. In one example, a mimetic mimics the enzyme activity
generated by an enzyme or a variant, fragment, or fusion
thereof.
[0109] Probes and primers: Nucleic acid probes and primers can be
prepared readily based on the amino acid sequences and nucleic acid
sequences provided herein. A "probe" includes an isolated nucleic
acid containing a detectable label or reporter molecule. Exemplary
labels include, but are not limited to, radioactive isotopes,
ligands, chemiluminescent agents, and polypeptides (e.g., enzymes).
Methods for labeling and guidance in the choice of labels
appropriate for various purposes are discussed in, for example,
Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd
ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989, and Ausubel et al. (ed.) Current Protocols in
Molecular Biology, Greene Publishing and Wiley-Interscience, New
York (with periodic updates), 1987.
[0110] "Primers" are typically nucleic acid molecules having ten or
more nucleotides (e.g., nucleic acid molecules having between about
10 nucleotides and about 100 nucleotides). A primer can be annealed
to a complementary target nucleic acid strand by nucleic acid
hybridization to form a hybrid between the primer and the target
nucleic acid strand, and then extended along the target nucleic
acid strand by, for example, a DNA polymerase polypeptide. Primer
pairs can be used for amplification of a nucleic acid sequence, for
example, by the polymerase chain reaction (PCR) or other
nucleic-acid amplification methods known in the art.
[0111] Methods for preparing and using probes and primers are
described, for example, in references such as Sambrook et al.
(ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989; Ausubel et al. (ed.), Current Protocols in Molecular Biology,
Greene Publishing and Wiley-Interscience, New York (with periodic
updates), 1987; and Innis et al. (eds.), PCR Protocols: A Guide to
Methods and Applications, Academic Press: San Diego, 1990. PCR
primer pairs can be derived from a known sequence, for example, by
using computer programs intended for that purpose such as Primer
(Version 0.5, .COPYRGT. 1991, Whitehead Institute for Biomedical
Research, Cambridge, Mass.). One of skill in the art will
appreciate that the specificity of a particular probe or primer
increases with the length, but that a probe or primer can range in
size from a full-length sequence to sequences as short as five
consecutive nucleotides. Thus, for example, a primer of 20
consecutive nucleotides can anneal to a target with a higher
specificity than a corresponding primer of only 15 nucleotides.
Thus, in order to obtain greater specificity, probes and primers
can be selected that comprise, for example, 10, 20, 25, 30, 35, 40,
50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500,
550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100,
1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650,
1700, 1750, 1800, 1850, 1900, 2000, 2050, 2100, 2150, 2200, 2250,
2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800,
2850, 2900, 3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400,
3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 4000,
4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550,
4600, 4650, 4700, 4750, 4800, 4850, 4900, 5000, 5050, 5100, 5150,
5200, 5250, 5300, 5350, 5400, 5450, or more consecutive
nucleotides.
[0112] Promoter: A nucleic acid control sequence that directs
transcription of a nucleic acid sequence. A promoter includes
necessary nucleic acid sequences near the start site of
transcription, such as, in the case of a polymerase II type
promoter, a TATA element. A promoter can include distal enhancer or
repressor elements which can be located as much as several thousand
base pairs from the start site of transcription.
[0113] Purified: The term "purified" as used herein does not
require absolute purity; rather, it is intended as a relative term.
Thus, for example, a purified polypeptide or nucleic acid
preparation can be one in which the subject polypeptide or nucleic
acid, respectively, is at a higher concentration than the
polypeptide or nucleic acid would be in its natural environment
within an organism. For example, a polypeptide preparation can be
considered purified if the polypeptide content in the preparation
represents at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 98%, or
99% of the total soluble protein content of the preparation.
[0114] Recombinant: A "recombinant" nucleic acid is one having (1)
a sequence that is not naturally occurring in the organism in which
it is expressed or (2) a sequence made by an artificial combination
of two otherwise-separated, shorter sequences. This artificial
combination is often accomplished by chemical synthesis or, more
commonly, by the artificial manipulation of isolated segments of
nucleic acids, e.g., by genetic engineering techniques.
"Recombinant" is also used to describe nucleic acid molecules that
have been artificially manipulated, but contain the same regulatory
sequences and coding regions that are found in the organism from
which the nucleic acid was isolated. A "recombinant" polypeptide is
one that is expressed from a recombinant nucleic acid.
[0115] Sequence identity: The similarity between amino acid
sequences is expressed in terms of the similarity between the
sequences, otherwise referred to as sequence identity. Sequence
identity is frequently measured in terms of percentage identity (or
similarity or homology); the higher the percentage, the more
similar the two sequences are. Homologs or variants of a
polypeptide, such as SEQ ID NO: 12, possess a relatively high
degree of sequence identity when aligned using standard
methods.
[0116] Methods of alignment of sequences for comparison are well
known in the art. Various programs and alignment algorithms are
described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981;
Needleman and Wunsch, J. Mol. Biol. 48:443-53, 1970; Pearson and
Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444-8, 1988; Higgins and
Sharp, Gene 73:237-44, 1988; Higgins and Sharp, CABIOS 5:151-3,
1989; Corpet et al., Nucleic Acids Research 16:10881-90, 1988; and
Altschul et al., Nature Genet. 6:119-29, 1994.
[0117] The NCBI Basic Local Alignment Search Tool (BLAST.TM.)
(Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from
several sources, including the National Center for Biotechnology
Information (NCBI, Bethesda, Md.) and on the Internet, for use in
connection with the sequence analysis programs blastp, blastn,
blastx, tblastn and tblastx.
[0118] Variants of a polypeptide are typically characterized by
possession of at least 50% sequence identity counted over the full
length alignment with the amino acid sequence using the NCBI Blast
2.0, gapped blastp set to default parameters. For comparisons of
amino acid sequences of greater than about 30 amino acids, the
Blast 2 sequences function is employed using the default BLOSUM62
matrix set to default parameters, (gap existence cost of 11, and a
per residue gap cost of 1). When aligning short polypeptides (fewer
than around 30 amino acids), the alignment is performed using the
Blast 2 sequences function, employing the PAM30 matrix set to
default parameters (open gap 9, extension gap 1 penalties).
Polypeptides with even greater similarity to the reference
sequences will show increasing percentage identities when assessed
by this method, such as at least 80%, at least 90%, at least 95%,
at least 98%, or even at least 99% sequence identity. When less
than the entire sequence is being compared for sequence identity,
homologs and variants will typically possess at least 80% sequence
identity over short windows of 10-20 amino acids, and can possess
sequence identities of at least 85%, at least 90%, at least 95%, or
98% depending on their similarity to the reference sequence.
Methods for determining sequence identity over such short windows
are described at the website that is maintained by the National
Center for Biotechnology Information in Bethesda, Maryland. One of
skill in the art will appreciate that these sequence identity
ranges are provided for guidance only; it is entirely possible that
strongly significant homologs could be obtained that fall outside
of the ranges provided.
[0119] Similar methods can be used to determine the percent
sequence identity of a nucleic acid sequence. In a particular
example, a homologous sequence is aligned to a native sequence, and
the number of matches is determined by counting the number of
positions where an identical nucleotide or amino acid residue is
presented in both sequences. The percent sequence identity is
determined by dividing the number of matches either by the length
of the sequence set forth in the identified sequence (e.g., SEQ ID
NO: 11), or by an articulated length (e.g., 100 consecutive
nucleotides or amino acid residues from a sequence set forth in an
identified sequence), followed by multiplying the resulting value
by 100. For example, a nucleic acid sequence that has 882 matches
when aligned with the sequence set forth in SEQ ID NO: 11 is 75.0
percent identical to the sequence set forth in SEQ ID NO: 11 (i.e.,
(882.div.1176)*100=75.0). It is noted that the percent sequence
identity value is rounded to the nearest tenth. For example, 75.11,
75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15,
75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. It is also
noted that the length value will always be an integer.
[0120] Specific binding agent: An agent that is capable of
specifically binding to any of the polypeptides described herein.
Examples include, but are not limited to, polyclonal antibodies,
monoclonal antibodies (including humanized monoclonal antibodies),
and fragments of monoclonal antibodies such as Fab, F(ab').sub.2,
and Fv fragments as well as any other agent capable of specifically
binding to an epitope of such polypeptides.
[0121] Antibodies to the polypeptides provided herein can be used
to purify or identify such polypeptides. The amino acid and nucleic
acid sequences provided herein allow for the production of specific
antibody-based binding agents that recognize the polypeptides
described herein.
[0122] Monoclonal or polyclonal antibodies can be produced to the
polypeptides, portions of the polypeptides, or variants thereof.
Optimally, antibodies raised against one or more epitopes on a
polypeptide antigen will specifically detect that polypeptide. That
is, antibodies raised against one particular polypeptide would
recognize and bind that particular polypeptide, and would not
substantially recognize or bind to other polypeptides. The
determination that an antibody specifically binds to a particular
polypeptide is made by any one of a number of standard immunoassay
methods; for instance, Western blotting (See, e.g., Sambrook et al.
(ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989).
[0123] To determine that a given antibody preparation (such as a
preparation produced in a mouse against a polypeptide having the
amino acid sequence set forth in SEQ ID NO: 12) specifically
detects the appropriate polypeptide (e.g., a polypeptide having the
amino acid sequence set forth in SEQ ID NO: 12) by Western
blotting, total cellular protein can be extracted from cells and
separated by SDS-polyacrylamide gel electrophoresis.
[0124] The separated total cellular protein then can be transferred
to a membrane (e.g., nitrocellulose), and the antibody preparation
incubated with the membrane. After washing the membrane to remove
non-specifically bound antibodies, the presence of specifically
bound antibodies can be detected using an appropriate secondary
antibody (e.g., an anti-mouse antibody) conjugated to a polypeptide
such as alkaline phosphatase since application of
5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results
in the production of a densely blue-colored compound by
immuno-localized alkaline phosphatase.
[0125] Substantially pure polypeptides suitable for use as an
immunogen can be obtained from transfected cells, transformed
cells, or wild-type cells. Polypeptide concentrations in the final
preparation can be adjusted, for example, by concentration on an
Amicon filter device, to the level of a few micrograms per
milliliter. In addition, polypeptides ranging in size from
full-length polypeptides to polypeptides having as few as nine
amino acid residues can be utilized as immunogens. Such
polypeptides can be produced in cell culture, can be chemically
synthesized using standard methods, or can be obtained by cleaving
large polypeptides into smaller polypeptides that can be purified.
Polypeptides having as few as nine amino acid residues in length
can be immunogenic when presented to an immune system in the
context of a Major Histocompatibility Complex (MHC) molecule such
as an MHC class I or MHC class II molecule. Accordingly,
polypeptides having at least 9, 10, 11, 12, 13, 14, 15, 20, 25, 30,
35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350,
400, 450, 500, 550, 600, 650, 700, 750, 800, 900, 1000, 1050, 1100,
1150, 1200, 1250, 1300, 1350, or more consecutive amino acid
residues of any amino acid sequence disclosed herein can be used as
immunogens for producing antibodies.
[0126] Monoclonal antibodies to any of the polypeptides disclosed
herein can be prepared from murine hybridomas according to the
classic method of Kohler & Milstein (Nature 256:495-7, 1975) or
a derivative method thereof.
[0127] Polyclonal antiserum containing antibodies to the
heterogeneous epitopes of any polypeptide disclosed herein can be
prepared by immunizing suitable animals with the polypeptide (or
fragment thereof), which can be unmodified or modified to enhance
immunogenicity. An effective immunization protocol for rabbits can
be found in Vaitukaitis et al. (J. Clin. Endocrinol. Metab.
33:988-91,1971).
[0128] Antibody fragments can be used in place of whole antibodies
and can be readily expressed in prokaryotic host cells. Methods of
making and using immunologically effective portions of monoclonal
antibodies, also referred to as "antibody fragments," are well
known and include those described in Better & Horowitz (Methods
Enzymol. 178:476-96,1989), Glockshuber et al. (Biochemistry
29:1362-7,1990), U.S. Pat. No. 5,648,237 ("Expression of Functional
Antibody Fragments"), U.S. Pat. No. 4,946,778 ("Single Polypeptide
Chain Binding Molecules"), U.S. Pat. No. 5,455,030 ("Immunotherapy
Using Single Chain Polypeptide Binding Molecules"), and references
cited therein.
[0129] Transformed: A "transformed" cell is a cell into which a
nucleic acid molecule has been introduced by, for example,
molecular biology techniques. Transformation encompasses all
techniques by which a nucleic acid molecule can be introduced into
a cell including, without limitation, transfection with a viral
vector, conjugation, transformation with a plasmid vector, and
introduction of naked DNA by electroporation, lipofection, and
particle gun acceleration.
[0130] Variants, fragments, or fusion polypeptides: The disclosed
polypeptides, include variants, fragments, and fusions thereof. DNA
sequences (for example SEQ ID NO: 11) which encode for a
polypeptide (for example SEQ ID NO: 12), fusion polypeptide, or a
fragment or variant of a polypeptide, can be engineered to allow
the polypeptide to be expressed in eukaryotic cells, bacteria,
insects, and/or plants. To obtain expression, the DNA sequence can
be altered and operably linked to other regulatory sequences. The
final product, which contains the regulatory sequences and the
polypeptide-encoding sequence, is referred to as a vector. This
vector can be introduced into eukaryotic, bacteria, insect, and/or
plant cells. Once inside the cell the vector allows the polypeptide
to be produced.
[0131] A fusion polypeptide can include a polypeptide, such as an
aromatic aminotransferase (for example, SEQ ID NO: 12), linked to
other amino acid sequences that do not inhibit the desired activity
of the polypeptide (for example, the ability to convert tryptophan
to indole-3-pyruvate). In one example, the other amino acid
sequences are no more than about 10, 12, 15, 20, 25, 30, or 50
amino acids in length.
[0132] One of ordinary skill in the art will appreciate that a DNA
sequence can be altered in numerous ways without affecting the
biological activity of the encoded polypeptide. For example, PCR
can be used to produce variations in the DNA sequence which encodes
a polypeptide. Such variants can be variants optimized for codon
preference in a host cell used to express the polypeptide, or other
sequence changes that facilitate expression.
[0133] Vector: A nucleic acid molecule as introduced into a cell,
thereby producing a transformed cell. A vector can include nucleic
acid sequences that permit it to replicate in the cell, such as an
origin of replication. A vector can also include one or more
selectable marker genes and other genetic elements known in the
art.
Overview of Biosynthetic Pathways
[0134] As shown in FIGS. 1-3 and 11-13, many biosynthetic pathways
can be used to produce monatin or its intermediates such as
indole-3-pyruvate or MP. For the conversion of each substrate
(e.g., glucose, tryptophan, indole-3-lactic acid,
indole-3-pyruvate, and MP) to each product (e.g., tryptophan,
indole-3-pyruvate, MP and monatin), several different polypeptides
can be used. Moreover, these reactions can be carried out in vivo,
in vitro, or through a combination of in vivo reactions and in
vitro reactions, such as in vitro reactions that include
non-enzymatic chemical reactions. Therefore, FIGS. 1-3 and 11-13
are exemplary, and show multiple different pathways that can be
used to obtain desired products.
[0135] Glucose to Tryptophan
[0136] Many organisms can synthesize tryptophan from glucose. The
construct(s) containing the gene(s) necessary to produce monatin,
MP, and/or indole-3-pyruvate from glucose and/or tryptophan can be
cloned into such organisms. It is shown herein that tryptophan can
be converted into monatin.
[0137] In other examples, an organism can be engineered using known
polypeptides to produce tryptophan, or overproduce tryptophan. For
example, U.S. Pat. No. 4,371,614 describes an E. coli strain
transformed with a plasmid containing a wild type tryptophan
operon. Tryptophan operon genes include tryptophan biosynthesis
genes encoding the polypeptides anthranilate synthase component I
(EC4.1.3.27), anthranilate synthase component II (EC4.1.3.27),
N-(5'-phosphoribosyl)anthranilate isomerase
(EC5.3.1.24)/indole-3-glycerol phosphate synthase (EC4.1.1.48),
tryptophan synthase, alpha subunit (EC4.2.1.20) and tryptophan
synthase, beta subunit (EC4.2.1.20), all of which are involved in
producing tryptophan from chorismate.
[0138] Maximum titers of tryptophan disclosed in U.S. Pat. No.
4,371,614 are about 230 ppm. Similarly, WO 8701130 describes an E.
coli strain that has been genetically engineered to produce
tryptophan and discusses increasing fermentative production of
L-tryptophan. Those skilled in the art will recognize that
organisms capable of producing tryptophan from glucose are also
capable of utilizing other carbon and energy sources that can be
converted to glucose or fructose-6-phosphate, with similar results.
Exemplary carbon and energy sources include, but are not limited
to, sucrose, fructose, starch, cellulose, or glycerol.
[0139] Increasing Tryptophan Production
[0140] Tryptophan production is regulated in most organisms. One
mechanism is via feedback inhibition of certain enzymes in the
pathway. For example, increasing the level of tryptophan can result
in a decrease of the production rate of tryptophan. Thus, when
using a host cell engineered to produce monatin via a tryptophan
intermediate, an organism can be used that is not sensitive to
tryptophan concentrations. For example, a strain of Catharanthus
roseus that is resistant to growth inhibition by various tryptophan
analogs can be selected by repeated exposure to high concentrations
of 5-methyltryptophan as described elsewhere (Schallenberg and
Berlin, Z. Naturforsch, 34:541-5, 1979). The resulting tryptophan
synthase activity of the strain can be less affected by product
inhibition due to mutations in the gene.
[0141] Similar methods can be used to select for strains that have
feedback resistance. For example, E. coli strain #7692 (from the E.
coli Genetic Stock Center, W3110tnaA2trpEfbr19 (Yanofsky et al., J.
Bacteriol., 158: 1018-1024, 1984; and Doolittle and Yanofsky, J.
Bacteriol., 95:1253, 1968)) can be grown on phenylalanine analogs,
beta-2-thienylalanine, m-fluoro-D,L-phenylalanine, and
p-fluoro-D,L-phenylalanine to select for mutants with a feedback
resistant aroG DAHP (3-deoxy-D-arabinoheptulosonic 7-phosphate
acid) synthase. This E. coli strain #7692 can produce measurable
amounts of tryptophan, and can be used as a starting host for
introducing exogenous nucleic acids such as the nucleic acids
encoding an aldolase and an aminotransferase. E971, another E. coli
strain (ATCC15491), is a prototrophic strain that exhibits elevated
levels of DAHP synthase as well as higher levels of indole and
tryptophan than the parent strain (Lim and Mateles, 1964 J.
Bacteriol., 87: 1051-1055). This strain can be used to obtain
anthranilate synthase (EC5.3.1.24) mutants where the feedback
resistance has been reduced using a 5-methyltryptophan analog in
the growth medium. This strain also can serve as a host to which
the exogenous nucleic acids encoding the aldolase and
aminotransferase are introduced.
[0142] Tryptophan production can be optimized through the use of
directed evolution to evolve polypeptides that are less sensitive
to product inhibition. For example, screening can be performed on
plates containing no tryptophan in the medium, but with high levels
of non-metabolizable tryptophan analogs. U.S. Pat. Nos. 5,756,345;
4,742,007; and 4,371,614 describe methods used to increase
tryptophan productivity in a fermentation organism. The last step
of tryptophan biosynthesis is the addition of serine to indole.
Thus, the availability of serine can be increased to enhance
tryptophan production.
[0143] A control point for tryptophan biosynthesis is the enzyme
DAHP synthase. Three isozymes of this polypeptide are encoded by
the following genes: aroF, aroG, and aroH, which can be feedback
inhibited by tyrosine, phenylalanine, and tryptophan, respectively.
The L-tyrosine feedback inhibited DAHP synthase contributes about
20% of the total enzyme activity, the L-phenylalanine feedback
inhibited DAHP synthase contributes 80% of the total enzyme
activity, and the L-tryptophan inhibited DAHP synthase provides
very little contribution to the overall enzyme activity. Obtaining
mutants whose enzymes are feedback resistant can provide strains
where this control point is deregulated. In general, the major
feedback resistant targets are aroG and aroF.
[0144] One approach to isolate feedback resistant mutants is to use
chemical or ultraviolet mutagenesis and select for organisms that
can grow on amino acid analogs. Feedback insensitive aroG can be
obtained using the analog beta-2-thienylalanine (Duda and
Sasvari-Szekely, (1973) Acta. Biochim. Biophys. Acad. Sci. Hung.
8(2):81-90). The analog m-fluoro-D,L-phenylalanine also can be used
to generate feedback insensitive aroG (Ito et al., (1990) Agric.
Biol. Chem., 54(3):707-713) as well as p-fluorophenylalanine
(Hagino and Nakayama, (1974) Agr. Biol. Chem., 38(1): 157-161).
[0145] One approach for obtaining feedback resistant DAHP synthases
is to use the amino acid analogs and create a strain where the
native gene has been mutated. Another approach is to clone the gene
encoding the feedback resistant enzyme, which provides more
flexibility and, with the use of a different promoter, can reduce
the possibility of transcriptional regulation (Ito et al., (1990)
Agric. Biol. Chem., 54(3):707-713).
[0146] Another regulatory point in tryptophan biosynthesis is the
branch point enzyme, anthranilate synthase, which is a two
component protein coded for by trpE and trpD in E. coli. Mutants
which are released from feedback inhibition by tryptophan can be
obtained using the amino acid analogs 5-fluorotryptophan and
5-methyltryptophan (Shiio et al., (1975) Agr. Biol. Chem.,
39(3):627-635).
[0147] In addition, feedback inhibition of anthranilate
phosphoribosyltransferases and tryptophan synthases by tryptophan
can occur in Brevibacterium lactofermentum. Desensitization of
these enzymes to inhibition, however, can be accomplished (Matsui
et al., (1987) J. Bacteriol., 169: 5330-5332). Such mutants can
exhibit elevated tryptophan levels and, therefore, would be
expected to have increased monatin levels.
[0148] Cells use other methods of controlling the levels of
tryptophan they synthesize, including regulation at the level of
transcription. In Corynebacterium glutamicum, DAHP synthase is
regulated at the level of transcription by tyrosine, and relief of
this regulation by manipulation of the 5' regulatory region can
improve tryptophan biosynthesis (Shiio, 1986 in Biotechnology of
Amino Acid Production, Aida, K., Chibita, L., Nakayama, K.,
Takinami, K. and Yamada, H. Eds. Elsevier). In E. coli, the
tryptophan (trp) operon is regulated at the level of transcription
by both repression and attenuation, with repression responsible for
an 80-fold variation and attenuation for a 6 to 8-fold variation.
Inactivation of the TrpR polypeptide, which is the repressor
protein, can increase levels of trp operon mRNA. The leader peptide
forms an mRNA secondary structure that responds to levels of
charged tRNA.sup.trp. Deletion of the 5'-regulatory attenuation
region can help to overcome this additional level of regulation
(Yanofsky et al., J. Bacteriol., 158: 1018-1024, 1984). An
attenuation mechanism with a trp-RNA-Binding Attenuation Protein
(TRAP) is also observed in B. subtilis, and relief of attenuation
by down-regulation or deletion of the gene encoding it can improve
tryptophan synthesis in this host organism (Babitzke and Gollnick,
2001, J. Bacteriol., 183: 5795-5802). Alternatively, expression of
an anti-TRAP polypeptide can be upregulated.
[0149] Tryptophan production can be increased by overexpressing
polypeptides in a tryptophan pathway, which can improve monatin
levels. For example, overexpression of nucleic acids encoding
transketolase, of aroF.sup.fbr, and of aroL (encodes shikimate
kinase) can improve tryptophan production. Overexpression of these
sequences, however, can cause a metabolic burden on the cells, and
in minimal media, the cells can excrete various intermediates. A
more nutrient rich media can be used to increase the levels of
tryptophan (Kim et al., 2000, J. Microbiol. Biotechnol.,
10(6):789-796). In addition, C. glutamicum cells containing
deregulated DAHP synthase expression, deregulated anthranilate
synthase expression, and a multicopy plasmid encoding a
phosphoribosyl transferase can exhibit increased tryptophan
production to 43 g/L (Katsumata and Ikeda, (1993) Bio/Technology,
11:921-9250).
[0150] Other enzymes in the aromatic amino acid pathways that are
subject to feedback and/or transcriptional control include
shikimate dehydrogenase (encoded by aroE) and shikimate kinaseI/II
(encoded by aroK, aroL). Mutagenesis of the aroE gene can provide
feedback resistant enzymes. AroK and aroL are subject to negative
transcriptional control by tyrosine. Genetic manipulation of the
promoter region or deletion of regulatory genes (trpR and tyrR) can
alleviate the control by tyrosine.
[0151] Phenylalanine and tyrosine are aromatic amino acids whose
biosynthesis can divert carbon from tryptophan, due to the fact
that chorismate is a common precursor for all three aromatic amino
acids, and is a branch point between tryptophan metabolism and
phenylalanine/tyrosine metabolism. The biosynthetic phenylalanine
and tyrosine pathways can be deleted or disrupted to reduce the
consumption of chorismate, this can be accomplished by genetic
knockout of the pheA or tyrA genes coding for chorismate
mutase/prephanate dehydrogenase. The chorismate mutase enzymes
compete with anthranilate synthase (trpD and trpE gene product) for
available chorismate. Exemplary strains that disruption or deletion
of competing aromatic amino acid pathways include E. coli NRRL B
12262 (see Example 15), E. coli NRRL B 12258, E. coli SR250
(Rothman and Kirsch, J. Mol Biol. (2003) 327, 593-603),
C.glutamicum ATCC21847 (see Example 17), C.glutamicum ATCC 21850,
C.glutamicum ATCC21851. Alternatively, rather than deleting the
phenylalanine and tyrosine pathways and requiring amino acid
additions to the medium, the trpE gene (or the entire tryptophan
operon) can be cloned and overexpressed using a heterologous
promoter since anthranilate synthase has a higher affinity for
chorismate than pheA or tyrA (Dopheide et al., (1972) J. Biol.
Chem., 247: 4447-4452). Another method of reducing the carbon flow
to phenylalanine and tyrosine is to modify their transcriptional
control. Further, reducing expression of a tryptophanase
polypeptide, an enzyme that catalyzes the conversion of tryptophan
to indole and pyruvate, can help prevent loss of tryptophan (Aiba
et al., Appl. Environ. Microbiol., 1982, 43:289-297).
[0152] In one embodiment, the central metabolism can be engineered
to increase monatin production. As described herein, to obtain
adequate monatin production, the selected or obtained organisms
should have the capacity to produce tryptophan at a rate than is
increased over wildtype organisms. Given that tryptophan is not an
end product, but an intermediate in the pathway to monatin, it can
be important to develop strains that not only have the ability to
accumulate higher concentrations of tryptophan, but also have an
increased flux to it. Multiple strategies can be used to engineer
the central carbon metabolism to divert carbon into the shikimate
and chorismate pathway such that high levels of monatin can be
produced.
[0153] The first step in the biosynthesis of aromatic compounds
such as tryptophan, tyrosine, and phenylalanine is the condensation
of phophoenolpyruvate (PEP) and erythrose 4-phosphate (E4P) to form
DAHP. Various methods can be used to increase the availability of
each precursor and improve the performance of this first reaction.
The following five methods are possible examples of procedures that
can be used to increase PEP availability.
[0154] First, consumption of PEP through glucose uptake by the
phosphotransferase system (PTS) can be eliminated. Inactivation of
the glucose transport system can result in glucose negative
mutants. PTS.sup.- glucose.sup.+ mutants have been isolated. Some
of them transport and phosphorylate glucose via galactose permease,
glucokinase, and ATP, and do not consume PEP (Flores et al., (1996)
Nat. Biotechnol., 14:620-623; and Chen et al., (1997) Biotechnol.
Prog., 13:768-775). The glucose permease system requires higher
amounts of ATP to phosphorylate glucose. A different glucose
transport and phosphorylation system, which also can result in
increased levels of PEP, can be introduced by the addition of genes
encoding a glucose facilitator (encoded by glf), a glucose
dehydrogenase (encoded by gdhIV), and a gluconate kinase (encoded
by glk) (WO 99/55877). This mechanism can produce gluconate
6-phosphate, which is an intermediate in the pentose phosphate
pathway, and therefore can increase the carbon flux in this pathway
and result in increased levels of E4P.
[0155] Second, PEP consuming enzymes, PEP carboxylase (Ppc), and
pyruvate kinases (e.g., PykA and PykB) can be inactivated to
increase the pool of PEP available (Bongaerts et al., (2001) Met.
Eng., 3, 289-300).
[0156] Third, the pyruvate formed by either the PTS or pyruvate
kinases can be recycled back to PEP by enhancing expression of PEP
synthase (Pps) (Patnaik et al., (1995) Biotechnol. Bioeng.,
46:361-370; and Yi et al., (2002) Biotechnol. Prog.,
18:1141-1148).
[0157] Fourth, the gluconeogenesis regulation can be modified by
disrupting the csrA gene, (carbon storage regulator) which can
increase gluconeogenesis, influence the regulation of several
enzymes that participate in PEP metabolism, decrease glycolysis,
and elevate PEP levels. (Tatarko et al., (2001) Current Microbiol.,
43(1):26-32).
[0158] Fifth, PEP consumption can be lessened by feeding sugars
such as xylose that, unlike glucose, circumvent the PTS system for
transport into the cell.
[0159] To increase the availability of E4P, the tktA gene encoding
transketolase and/or the talB gene encoding transaldolase can be
overexpressed. Expression of a tranketolase can be more effective
in directing carbon flux into the aromatic pathway (Liao at al.,
(1996) Biotechnol. Bioeng., 52:129-140). For example, a
Corynebacterium glutamicum strain with a modified pentose phosphate
pathway can be used to produce tryptophan (KY9218 carrying pKW9901;
Ikeda and Katsumata, Appl. Environ. Microbiol., 1999,
65(6):2497-502).
[0160] Any combination of these methods can be used. For example, a
combination of several of these modifications can be applied to E.
coli strains. In a PTS.sup.- glucose.sup.+, pykA, pykB strain that
overexpressed tktA, an almost 20 fold increase in carbon flux to
the aromatic pathway can be achieved (Gosset et al., (1996) J. Ind.
Microbiol., 17:47-52). In addition, these methods can be combined
with other modifications to reduce bottlenecks that occur later in
the tryptophan biosynthetic pathway (e.g., overexpressing genes in
the tryptophan branch of the aromatic pathway, deleting pheA and
tyrA genes to avoid consumption of chorismate, overexpressing trpE
and trpD to increase the synthesis of anthranilic acid) to increase
tryptophan production. The produced tryptophan need not accumulate
in the cells since it can be further converted to products such as
monatin.
[0161] The production of tryptophan, and subsequently that of
monatin, can benefit from alterations in the pathway leading to the
production of serine. Serine is required in the last step of
production of tryptophan, which encompasses the reaction of serine
with indole-3-glycerolphosphate. This reaction is catalyzed by a
tryptophan synthase polypeptide. Increases in the carbon flow
through the tryptophan pathway can result in imbalances in some
reactions with the appearances of new bottlenecks. As serine is
produced by a separate pathway, its production rate can become a
limiting factor in the production of tryptophan. The carbon flow
through the serine pathway can be increased by overexpression of
the first gene in the pathway, which encodes for 3-phosphoglycerate
dehydrogenase (PDG; Ikeda et al., (1994) Biosci. Biotech. Biochem.,
58(4):674-678).
[0162] Increasing Pyruvate Production
[0163] The amount of monatin produced by an organism can be
enhanced by increasing the amount of pyruvate produced by the host
organism. One pathway for the production of monatin relies on the
reaction of indole-3-pyruvate with pyruvate to form the 4-keto acid
derivative of monatin. To push this reaction forward, an organism
capable of diverting large quantities of carbon to pyruvate is
useful as a host for the production of monatin. Pyruvate
overproducers can be selected, which do not need to be tolerant to
high concentrations of the acid, but rather are deregulated in
their metabolic pathway so that more carbon is diverted to
pyruvate. Certain yeasts, such as Trichosporon cutaneum (Wang et
al., Lett. Appl. Microbiol., 35:338-42, 2002), Candida lypolitica,
Saccharomyces cerevisiae, and Candida glabrata (formerly known as
Torulopsis glabrata) (Li et al., Appl. Microbiol. Biotechnol.,
57:451-9, 2001) overproduce pyruvate from glucose (up to 50 g/L)
and can be used to produce the products described herein.
[0164] Thiamine auxotrophs of these different strains accumulate
pyruvate under thiamine limitation, because the oxidative
decarboxylation of pyruvate is impaired by a decrease in the
activity of the thiamine dependent pyruvate dehydrogenase (PDH).
Lipoic acid is a cofactor of PDH. As such, lipoic acid auxotrophs,
such as E. coli strain W1485lip2 (ATCC25645; Kawasaki et al., J.
Ferment. Bioeng., 82:604-6, 1996) can accumulate pyruvate to a
significant extent (>25 g/L) (Yokota et al., Appl. Microbiol.
Biotechnol., 41:638-643, 1994). The rate and amount of pyruvate
production can be further increased by introducing a F1-ATPase
defective gene into the W1485lip2 strain. This mutation results in
a cell deficient in energy production, which tends to compensate by
increasing the carbon flux through glycolysis and, thus, generating
larger amounts of pyruvic acid (Yokota et al., J. Ferment. Bioeng.,
83:132-138, 1997). A double mutant strain can be used to generate
host strains that overproduce several amino acids including
tryptophan (Kawasaki et al., 1996 supra), leucine and valine (U.S.
Pat. Nos. 5,888,783 and 6,214,591).
[0165] In addition to mutations in the pyruvate-dehyrogenase
complex, further improvements in pyruvate production can be
obtained by deleting or reducing the expression of pyruvate
decarboxylase, pyruvate ferredoxin-oxidoreductase, pyruvate
flavodoxin oxidoreductase, pyruvate-formiate lyase, pyruvate
carboxylase, phosphoenolpyruvate synthetase, and/or pyruvate
oxidase. See, for example, WO 03/000913.
[0166] Overexpression of a tryptophanase gene in a pyruvate
overproducing strain can be used to produce tryptophan from indole
(Kawasaki et al., 1996, supra). The overproduction of pyruvate can
improve the production of tryptophan and also provide increased
substrate levels (both pyruvate and indole-3-pyruvate) for the
formation of the monatin precursor. Alternatively, when using the
tryptophanase gene one can simultaneously feed both pyruvate and
indole in the presence of excess ammonium. Detergents can be
utilized to increase the solubility of indole, or indole can be fed
sequentially to minimize toxicity and precipitation.
Tryptophan to Indole-3-pyruvate
[0167] Several polypeptides can be used to convert tryptophan to
indole-3-pyruvate. Exemplary polypeptides include, without
limitation, members of the enzyme classes (EC) 2.6.1.27, 1.4.1.19,
1.4.99.1, 2.6.1.28, 1.4.3.2, 1.4.3.3, 2.6.1.5, 2.6.1.-, 2.6.1.1,
and 2.6.1.21. These classes include, without limitation,
polypeptides termed tryptophan aminotransferase (also termed
L-phenylalanine-2-oxoglutarate aminotransferase, tryptophan
transaminase, 5-hydroxytryptophan-ketoglutar- ic transaminase,
hydroxytryptophan aminotransferase, L-tryptophan aminotransferase,
L-tryptophan transaminase, and L-tryptophan:2-oxoglutar- ate
aminotransferase) which converts L-tryptophan and 2-oxoglutarate to
indole-3-pyruvate and L-glutamate; D-tryptophan aminotransferase
which converts D-tryptophan and a 2-oxo acid to indole-3-pyruvate
and an amino acid; tryptophan dehydrogenase (also termed
NAD(P)-L-tryptophan dehydrogenase, L-tryptophan dehydrogenase,
L-Trp-dehydrogenase, TDH and L-tryptophan:NAD(P) oxidoreductase
(deaminating)) which converts L-tryptophan and NAD(P) to
indole-3-pyruvate and NH3 and NAD(P)H; D-amino acid dehydrogenase,
which converts D-amino acids and FAD to indole-3-pyruvate and
NH.sub.3 and FADH.sub.2; tryptophan-phenylpyruvate transaminase
(also termed L-tryptophan-.alpha.-ketoisocaproate aminotransferase
and L-tryptophan:phenylpyruvate aminotransferase) which converts
L-tryptophan and phenylpyruvate to indole-3-pyruvate and
L-phenylalanine; L-amino acid oxidase (also termed ophio-amino-acid
oxidase and L-amino-acid:oxygen oxidoreductase (deaminating)) which
converts an L-amino acid and H.sub.2O and O.sub.2 to a 2-oxo acid
and NH.sub.3 and H.sub.2O.sub.2; D-amino acid oxidase (also termed
ophio-amino-acid oxidase and D-amino-acid:oxygen oxidoreductase
(deaminating)) which converts a D-amino acid and H.sub.2O and
O.sub.2 to a 2-oxo acid and NH.sub.3 and H.sub.2O.sub.2; and
tryptophan oxidase which converts L-tryptophan and H.sub.2O and
O.sub.2 to indole-3-pyruvate and NH.sub.3 and H.sub.2O.sub.2. These
classes also contain tyrosine (aromatic) aminotransferase,
aspartate aminotransferase, D-amino acid (or D-alanine)
aminotransferase, and broad (multiple substrate) aminotransferase
which have multiple aminotransferase activities, some of which can
convert tryptophan and a 2-oxo acid to indole-3-pyruvate and an
amino acid.
[0168] Eleven members of the aminotransferase class that have such
activity are described below in Example 1, including a novel
aminotransferase shown in SEQ ID NOS: 11 and 12. Therefore, this
disclosure provides isolated nucleic acid and amino acid sequences
having at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or even at least 99% sequence identity to the sequences
set forth in SEQ ID NOS: 11 and 12, respectively. Also encompassed
by this disclosure are fragments and fusions of the sequences set
forth in SEQ ID NOS: 11 and 12 that encode a polypeptide having
aminotransferase activity or retaining aminotransferase activity.
Exemplary fragments include, but are not limited to, at least 10,
12, 15, 20, 25, 50, 100, 200, 500, or 1000 contiguous nucleotides
of SEQ ID NO: 11 or at least 6, 10, 15, 20, 25, 50, 75, 100, 200,
300 or 350 contiguous amino acids of SEQ ID NO: 12. The disclosed
sequences (and variants, fragments, and fusions thereof) can be
part of a vector. The vector can be used to transform host cells,
thereby producing recombinant cells which can produce
indole-3-pyruvate from tryptophan, and in some examples can further
produce MP and/or monatin.
[0169] L-amino acid oxidases (1.4.3.2) are known, and sequences can
be isolated from several different sources, such as Vipera lebetine
(sp P81375), Ophiophagus hannah (sp P81383), Agkistrodon rhodostoma
(spP81382), Crotalus atrox (sp P56742), Burkholderia cepacia,
Arabidopsis thaliana, Caulobacter cresentus, Chlamydomonas
reinhardtii, Mus musculus, Pseudomonas syringae, and Rhodococcus
str. In addition, tryptophan oxidases are described in the
literature and can be isolated, for example, from Coprinus sp.
SF-1, Chinese cabbage with club root disease, Arabidopsis thaliana,
and mammalian liver.
[0170] Tryptophan dehydrogenases are known, and can be isolated,
for example, from spinach, Pisum sativum, Prosopis juliflora, pea,
mesquite, wheat, maize, tomato, tobacco, Chromobacterium violaceum,
and Lactobacilli. Many D-amino acid dehydrogenase gene sequences
are known.
[0171] As shown in FIGS. 11-13, if an amino acid oxidase, such as
tryptophan oxidase, is used to convert tryptophan to
indole-3-pyruvate, catalase can be added to reduce or even
eliminate the presence of hydrogen peroxide.
Indole-3-lactate to Indole-3-pyruvate
[0172] The reaction that converts indole-3-lactate to
indole-3-pyruvate can be catalyzed by a variety of polypeptides,
such as members of the 1.1.1.110, 1.1.1.27, 1.1.1.28, 1.1.2.3,
1.1.1.222, 1.1.1.237, 1.1.3.-, or 1.1.1.111 classes of
polypeptides. The 1.1.1.110 class of polypeptides includes
indolelactate dehydrogenases (also termed indolelactic acid:
NAD+oxidoreductase). The 1.1.1.27, 1.1.1.28, and 1.1.2.3 classes
include lactate dehydrogenases (also termed lactic acid
dehydrogenases, lactate: NAD.sup.+ oxidoreductase). The 1.1.1.222
class contains (R)-4-hydroxyphenyllactate dehydrogenase (also
termed D-aromatic lactate dehydrogenase, R-aromatic lactate
dehydrogenase, and
R-3-(4-hydroxyphenyl)lactate:NAD(P).sup.+2-oxidoreductase) and the
1.1.1.237 class contains 3-(4-hydroxyphenylpyruvate) reductase
(also termed hydroxyphenylpyruvate reductase and
4-hydroxyphenyllactate: NAD.sup.+ oxidoreductase). The 1.1.3.-class
contains lactate oxidases, and the 1.1.1.111 class contains
(3-imidazol-5-yl) lactate dehydrogenases (also termed
(S)-3-(imidazol-5-yl)lactate:NAD(P).sup.+ oxidoreductase). It is
likely that several of the polypeptides in these classes allow for
the production of indole-3-pyruvate from indole-3-lactic acid.
[0173] Chemical reactions can also be used to convert
indole-3-lactic acid to indole-3-pyruvate. Such chemical reactions
include an oxidation step that can be accomplished using several
methods, for example: air oxidation using a B2 catalyst (China
Chemical Reporter, vol. 13, no. 28, pg. 18(1), 2002), dilute
permanganate and perchlorate, or hydrogen peroxide in the presence
of metal catalysts.
Indole-3-pyruvate to 2-hydroxy 2-(indol-3ylmethyl)-4-keto glutaric
acid (MP)
[0174] Several known polypeptides can be used to convert
indole-3-pyruvate plus a three-carbon source, such as pyruvate, to
MP. Exemplary polypeptide classes include 4.1.3.-, 4.1.3.16,
4.1.3.17, and 4.1.2.-. These classes include carbon-carbon
synthases/lyases, such as aldolases that catalyze the condensation
of two carboxylic acid substrates. Polypeptide class EC4.1.3.- are
synthases/lyases that form carbon-carbon bonds utilizing oxo-acid
substrates (such as indole-3-pyruvate) as the electrophile, while
EC4.1.2.- are synthases/lyases that form carbon-carbon bonds
utilizing aldehyde substrates (such as benzaldehyde) as the
electrophile.
[0175] For example, the polypeptide described in EP 1045-029
(EC4.1.3.16, 4-hydroxy-2-oxoglutarate glyoxylate-lyase also termed
4-hydroxy-2-oxoglutarate aldolase, 2-oxo-4-hydroxyglutarate
aldolase or KHG aldolase) converts glyoxylic acid and pyruvate to
4-hydroxy-2-ketoglutaric acid, and the polypeptide
4-hydroxy-4-methyl-2-oxoglutarate aldolase (EC4.1.3.17, also termed
4-hydroxy-4-methyl-2-oxoglutarate pyruvate-lyase or ProA aldolase),
condenses two keto-acids such as two pyruvates to
4-hydroxy-4-methyl-2-ox- oglutarate. Reactions utilizing these
lyases are described herein.
[0176] FIGS. 1-2 and 11-13 show schematic diagrams of these
reactions in which a 3-carbon (C3) molecule is combined with
indole-3-pyruvate. Many members of EC 4.1.2.- and 4.1.3.-,
particularly PLP-utilizing polypeptides, can utilize C3 molecules
that are amino acids such as serine, cysteine, and alanine, or
derivatives thereof. Aldol condensations catalyzed by
representatives of EC4.1.2.- and 4.1.3.-require the three carbon
molecule of this pathway to be pyruvate or a derivative of
pyruvate. However, other compounds can serve as a C3 carbon source
and be converted to pyruvate. Alanine can be transaminated by many
PLP-utilizing transaminases, including many of those mentioned
above, to yield pyruvate. Pyruvate and ammonia can be obtained by
beta-elimination reactions (such as those catalyzed by,
tryptophanase or .beta.-tyrosinase) of L-serine, L-cysteine, and
derivatives of serine and cysteine with sufficient leaving groups,
such as O-methyl-L-serine, O-benzyl-L-serine, S-methylcysteine,
S-benzylcysteine, S-alkyl-L-cysteine, O-acyl-L-serine, and
3-chloro-L-alanine. Aspartate can serve as a source of pyruvate in
PLP-mediated beta-lyase reactions such as those catalyzed by
tryptophanase (EC4.1.99.1) and/or .beta.-tyrosinase (EC4.1.99.2,
also termed tyrosine-phenol lyase). The rate of beta-lyase
reactions can be increased by performing site-directed mutagenesis
on the (4.1.99.1-2) polypeptides as described by Mouratou et al.
(J. Biol. Chem 274:1320-5, 1999) and in Example 5. These
modifications allow the polypeptides to accept dicarboxylic amino
acid substrates. Lactate can also serve as a source of pyruvate,
and is oxidized to pyruvate by the addition of lactate
dehydrogenase and an oxidized cofactor or lactate oxidase and
oxygen. Examples of these reactions are described below. For
example, as shown in FIG. 2 and FIGS. 11-13, ProA aldolase can be
contacted with indole-3-pyruvate when pyruvate is used as the C3
molecule.
[0177] MP to Monatin
[0178] Conversion of MP to monatin can be catalyzed by one or more
of: tryptophan aminotransferases (2.6.1.27), tryptophan
dehydrogenases (1.4.1.19), D-amino acid dehydrogenases (1.4.99.1),
glutamate dehydrogenases (1.4.1.2-4), phenylalanine dehydrogenase
(EC1.4.1.20), tryptophan-phenylpyruvate transaminases (2.6.1.28),
or more generally members of the aminotransferase family (2.6.1.-)
such as aspartate aminotransferase (EC2.6.1.1), tyrosine (aromatic)
aminotransferase (2.6.1.5), D-tryptophan aminotransferase, or
D-alanine (2.6.1.21) aminotransferase (FIG. 2). Eleven members of
the aminotransferase class are described below (Example 1),
including a novel member of the class shown in SEQ ID NOS: 11 and
12, and reactions demonstrating the activity of aminotransferase
and dehydrogenase enzymes are provided in Example 4.
[0179] This reaction can also be performed using chemical
reactions. Amination of the keto acid (MP) is performed by
reductive amination using ammonia and sodium cyanoborohydride.
[0180] FIGS. 11-13 show additional polypeptides that can be used to
convert MP to monatin, as well as providing increased yields of
monatin from indole-3-pyruvate or tryptophan. For example, if
aspartate is used as the amino donor, aspartate aminotransferase
can be used to convert the aspartate to oxaloacetate (FIG. 11). The
oxaloacetate is converted to pyruvate and carbon dioxide by a
decarboxylase, such as oxaloacetate decarboxylase (FIG. 11). In
addition, if lysine is used as the amino donor, lysine epsilon
aminotransferase can be used to convert the lysine to allysine
(FIG. 12). The allysine is spontaneously converted to 1-piperideine
6-carboxylate (FIG. 12). If a polypeptide capable of catalyzing
reductive amination reactions (e.g., glutamate dehydrogenase) is
used to convert MP to monatin, a polypeptide that can recycle
NAD(P)H and/or produce a volatile product (FIG. 13) can be used,
such as formate dehydrogenase.
[0181] Further Methods for Increasing Monatin Production
[0182] Other examples of strains with genetic modifications that
can be used to increase monatin production include:
[0183] 1) E. coli AGX1757 can be isolated from W3110 (trpAE1, trpR,
tnaA with plasmid pSC101+trpl). NTG mutagenesis can be performed
and 6-fluorotryptophan or 5-methyltryptophan resistance selected.
The addition of Pluronic L-61 can be used to crystallize tryptophan
or monatin in media to increase productivity.
[0184] 2) C. glutamicum KY9225, which was derived from Px-1 15-97,
exhibits phenylalanine and tyrosine double auxotrophy and has an
anthranilate synthase resistant to tryptophan inhibition.
[0185] 3) Brevibacterium lactofermentum 1041 trpE was mutagenized
and desensitized to tryptophan feedback inhbition. The gene was
found to have a serine residue replaced by an arginine. A mutation
of guanine to adenine in the terminator structure within the
putative attenuator was found to relieve transcriptional regulation
as well (Matsui et al., (1987) J. Bacteriology, 16:5330-5332).
[0186] Additional modifications that can be useful in optimizing
availability of precursors and maximizing monatin production
include, without limitation, (1) deleting genes that encode
polypeptides that can facilitate monatin uptake, (2) deleting or
down-regulating genes that encode polypeptides involved in
competing pathways, (3) upregulating aldolase and aminotransferase
polypeptide expression, (4) deleting genes that encode
aminotransferase polypeptides that produce an incorrect form of
monatin, and (5) increasing PLP availability. Genes that encode
polypeptides that can facilitate monatin uptake can include the
Bacillus subtilis aspartate uptake transporter (YveA; Lorca et al.,
2003, J. Bacteriol., 185(10):3218-22), the
Glt-1L-glutamate/L-aspartate/D-aspartat- e uptake polypeptides
(symporters), and the C. glutamicum gluA,B,C,D glutamate uptake
genes. A gene that encodes a polypeptide involved in a competing
pathway can be a tnaA gene (encodes a tryptophanase polypeptide),
unless indole is utilized as a substrate for tryptophan
production.
[0187] Additional Considerations in the Design of the Biosynthetic
Pathways
[0188] Depending on which polypeptides are used to generate
indole-3-pyruvate, MP, and/or monatin, cofactors, substrates,
and/or additional polypeptides can be provided to the production
cell to enhance product formation. In addition, genetic
modification can be designed to enhance production of products such
as indole-3-pyruvate, MP, and/or monatin. Similarly, a host cell
used for monatin production can be optimized.
[0189] As described herein, any organism such as E. coli and other
Enterobacteriaceae (such as Klebsiella, Pantoea, and Erwinia
strains), Corynebacterium glutamicum, Brevibacterium strains,
Bacillus strains, and Saccharomyces strains can be used to produce
a product such as indole-3-pyruvate, MP, and/or monatin. For
example, Bacillus amyloliquefaciens and B. subtilis, which have
been engineered to overproduce tryptophan from anthranilic acid
(resulting in many problematic byproducts), can be modified to
produce products efficiently. Additionally, there are wild-type
Brevibacterium flavum and Corynebacterium glutamicum strains that
produce glutamate, and have been modified to efficiently produce
other amino acids such as lysine. T. Oka, "Amino Acids, Production
Processes" in Encyclopedia of Bioprocess Technology: Fermentation,
Biocatalysis, and Bioseparation. M. C. Flickinger and S. W. Drew,
eds. John Wiley & Sons, Inc. New York, pp. 89-100. In addition,
the organisms described herein can be selected or designed to (1)
have favorable growth kinetics such that they can grow on low-cost
substrates, (2) secrete products such as monatin, and/or (3)
produce increased levels of precursors to monatin such as
tryptophan and pyruvate. Such organisms can be from
well-characterized species with readily available genetics tools
and/or a history of safe use in producing food ingredients.
[0190] 1. Removal of Hydrogen Peroxide
[0191] Hydrogen peroxide (H202) is a product that, if generated,
can be toxic to production cells and can damage polypeptides or
products (e.g., intermediates) produced. The L-amino acid oxidase
described above generates H.sub.2O.sub.2 as a product. Therefore,
if L-amino acid oxidase is used, the resulting H.sub.2O.sub.2 can
be removed or its levels decreased to reduce potential injury to
the cell or product.
[0192] Catalases can be used to reduce the level of H.sub.2O.sub.2
in the cell (FIGS. 11-13). The production cell can express a gene
or cDNA sequence that encodes a catalase (EC 1.11.1.6), which
catalyzes the decomposition of hydrogen peroxide into water and
oxygen gas. For example, a catalase can be expressed from a vector
transfected into the production cell. Examples of catalases that
can be used include, but are not limited to: tr.vertline.Q9EV50
(Staphylococcus xylosus), tr.vertline.Q9KBE8 (Bacillus halodurans),
tr.vertline.Q9URJ7 (Candida albicans), tr.vertline.P77948
(Streptomyces coelicolor), tr.vertline.Q9RBJ5 (Xanthomonas
campestris) (SwissProt Accession Nos.). Biocatalytic reactors
utilizing L-amino acid oxidase, D-amino acid oxidase, or tryptophan
oxidase can also contain a catalase polypeptide.
[0193] 2. Modulation of pyridoxal-5'-phosphate (PLP)
Availability
[0194] As shown in FIG. 1, PLP can be utilized in one or more of
the biosynthetic steps described herein. The concentration of PLP
can be supplemented so that PLP does not become a limitation on the
overall efficiency of the reaction.
[0195] The biosynthetic pathway for vitamin B.sub.6 (the precursor
of PLP) has been thoroughly studied in E. coli, and some of the
proteins have been crystallized (Laber et al., FEBS Letters,
449:45-8, 1999). Two of the genes (epd or gapB and serC) are
required in other metabolic pathways, while three genes (pdxA,
pdxB, and pdxJ) are unique to pyridoxal phosphate biosynthesis. One
of the starting materials in the E. coli pathway is
1-deoxy-D-xylulose-5-phosphate (DXP). Synthesis of this precursor
from common 2 and 3 carbon central metabolites is catalyzed by the
polypeptide 1-deoxy-D-xylulose-5-phosphate synthase (DXS). The
other precursor is a threonine derivative formed from the 4-carbon
sugar, D-erythrose 4-phosphate. The genes required for the
conversion to phospho-4-hydroxyl-L threonine (HTP) are epd, pdxB,
and serC. The last reaction for the formation of PLP is a complex
intramolecular condensation and ring-closure reaction between DXP
and HTP, catalyzed by the gene products of pdxA and pdxJ.
[0196] If PLP becomes a limiting nutrient during the fermentation
to produce monatin, increased expression of one or more of the
pathway genes in a production host cell can be used to increase the
yield of monatin. A host organism can contain multiple copies of
its native pathway genes or copies of non-native pathway genes can
be incorporated into the organism's genome. Additionally, multiple
copies of the salvage pathway genes can be cloned into the host
organism.
[0197] One salvage pathway that is conserved in all organisms
recycles the various derivatives of vitamin B.sub.6 to the active
PLP form. The polypeptides involved in this pathway are pdxK
kinase, pdxH oxidase, and pdxY kinase. Over-expression of one or
more of these genes can increase PLP availability.
[0198] Vitamin B.sub.6 levels can be elevated by elimination or
repression of the metabolic regulation of the native biosynthetic
pathway genes in the host organism. PLP represses polypeptides
involved in the biosynthesis of the precursor threonine derivative
in the bacterium Flavobacterium sp. strain 238-7. This bacterial
strain, freed of metabolic control, overproduces pyridoxal
derivatives and can excrete up to 20 mg/L of PLP. Genetic
manipulation of the host organism producing monatin in a similar
fashion will allow the increased production PLP without
over-expression of the biosynthetic pathway genes.
[0199] 3. Ammonium Utilization
[0200] Tryptophanase reactions can be driven toward the synthetic
direction (production of tryptophan from indole) by making ammonia
more available or by removal of water. Reductive amination
reactions, such as those catalyzed by glutamate dehydrogenase, can
also be driven forward by an excess of ammonium.
[0201] Ammonia can be made available as an ammonium carbonate or
ammonium phosphate salt in a carbonate or phosphate buffered
system. Ammonia can also be provided as ammonium pyruvate or
ammonium formate. Alternatively, ammonia can be supplied if the
reaction is coupled with a reaction that generates ammonia, such as
glutamate dehydrogenase or tryptophan dehydrogenase. Ammonia can be
generated by addition of the natural substrates of
EC4.1.99.-(tyrosine or tryptophan), which will be hydrolyzed to
phenol or indole, pyruvate and NH.sub.3. This also allows for an
increased yield of synthetic product over the normal equilibrium
amount by allowing the enzyme to hydrolyze its preferred
substrate.
[0202] 4. Removal of Products and Byproducts
[0203] The conversion of tryptophan to indole-3-pyruvate via a
tryptophan aminotransferase can adversely affect the production
rate of indole-3-pyruvate because the reaction produces glutamate
and requires the co-substrate 2-oxoglutarate
(.alpha.-ketoglutarate). Glutamate can cause inhibition of the
aminotransferase, and the reaction can consume large amounts of the
co-substrate. Moreover, high glutamate concentrations can be
detrimental to downstream separation processes.
[0204] The polypeptide glutamate dehydrogenase (GLDH) converts
glutamate to 2-oxoglutarate, thereby recycling the co-substrate in
the reaction catalyzed by tryptophan aminotransferase. GLDH also
generates reducing equivalents (NADH or NADPH) that can be used to
generate energy for the cell (ATP) under aerobic conditions. The
utilization of glutamate by GLDH also reduces byproduct formation.
Additionally, the reaction generates ammonia, which can serve as a
nitrogen source for the cell or as a substrate in a reductive
amination for the final step shown in FIG. 1. Therefore, a
production cell that over-expresses a GLDH polypeptide can be used
to increase the yield and reduce the cost of media and/or
separation processes.
[0205] In the tryptophan to monatin pathway, the amino donor of
step three (e.g., glutamate or aspartate) can be converted back to
the amino acceptor required for step 1 (e.g., 2-oxo-glutarate or
oxaloacetate), if an aminotransferase from the appropriate enzyme
classes is used. Utilization of two separate transaminases for this
pathway, in which the substrate of one transaminase does not
competitively inhibit the activity of the other transaminase, can
increase the efficiency of this pathway.
[0206] Many of the reactions in the described pathways are
reversible and can, therefore, reach an equilibrium between
substrates and products. The yield of the pathway can be increased
by continuous removal of the products from the polypeptides. For
example, secretion of monatin into the fermentation broth using a
permease or other transport protein, or selective crystallization
of monatin from a biocatalytic reactor stream with concomitant
recycle of substrates will increase the reaction yield.
[0207] Removal of byproducts via additional enzymatic reactions or
via substitution of amino donor groups is another way to increase
the reaction yield. For example, a byproduct can be produced that
is unavailable to react in the reverse direction, either by phase
change (for example, the precipitation of the end product) or by
spontaneous conversion to a volatile end product, such as carbon
dioxide.
[0208] 5. Modulation of the Substrate Pools
[0209] The indole pool can be modulated by increasing production of
tryptophan precursors and/or altering catabolic pathways involving
indole-3-pyruvate and/or tryptophan. For example, the production of
indole-3-acetic acid from indole-3-pyruvate can be reduced or
eliminated by functionally deleting the gene coding for EC4.1.1.74
in the host cell. Production of indole from tryptophan can be
reduced or eliminated by functionally deleting the gene coding for
EC4.1.99.1 in the host cell. Alternatively, an excess of indole can
be utilized as a substrate in an in vitro or in vivo process in
combination with increased amounts of the gene coding for
EC4.1.99.1 (Kawasaki et al., J. Ferm. and Bioeng., 82:604-6,
1996).
[0210] In addition, genetic modifications can be made to increase
the level of intermediates such as D-erythrose-4-phosphate and
chorismate.
[0211] 6. Controlling Chirality
[0212] The taste profile of monatin can be altered by controlling
its stereochemistry (chirality). For example, different monatin
isomers may be desired in different blends of concentrations for
different food systems. Chirality can be controlled via a
combination of pH and polypeptides. 2
[0213] Racemization at the C-4 position of monatin (see numbered
molecule above) can occur by deprotonation and reprotonation of the
alpha carbon, which can occur by a shift in pH or by reaction with
the cofactor PLP bound to an enzyme such as a racemase or free in
solution. In a microorganism, the pH is unlikely to shift enough to
cause the racemization, but PLP is abundant. Methods to control the
chirality with polypeptides depend upon the biosynthetic route
utilized for monatin production.
[0214] When monatin is formed using the pathway shown in FIG. 2,
the following can be considered. In a biocatalytic reaction, the
chirality of carbon-2 can be determined by an enzyme that converts
indole-3-pyruvate to MP. Multiple enzymes (e.g., from EC4.1.2.-,
4.1.3.-) can convert indole-3-pyruvate to MN, thus, the enzyme that
forms the desired isomer can be chosen. Alternatively, the
enantiospecificity of the enzyme that converts indole-3-pyruvate to
MP can be modified through the use of directed evolution, or
catalytic antibodies can be engineered to catalyze the desired
reaction. Once MP is produced (either enzymatically or by chemical
condensation), the amino group can be added stereospecifically
using a transaminase, such as those described herein. Either the R
or S configuration of carbon-4 can be generated depending on
whether a D- or L-aromatic acid aminotransferase is used. Most
aminotransferases react preferentially with the L-isomer of the
substrate; however, D-tryptophan aminotransferases exist in certain
plants (Kohiba and Mito, Proceedings of the 8th International
Symposium on Vitamin B.sub.6 and Carbonyl Catalysis, Osaka, Japan
1990). Moreover, D-alanine aminotransferases (2.6.1.21),
D-methionine-pyruvate aminotransferases (2.6.1.41), and both
(R)-3-amino-2-methylpropanoate aminotransferase (2.6.1.61) and
(S)-3-amino-2-methylpropanoate aminotransferase (2.6.1.22) have
been identified. Certain aminotransferases may preferentially react
with a substrate having a particular configuration at the C2
carbon. Therefore, even if the conversion to MP is not
stereospecific, the stereochemistry of the final product can be
controlled through the appropriate selection of a transaminase.
Since the reactions are reversible, the unreacted MP (undesired
isomer) can be recycled back to its constituents, and a racemic
mixture of MP can be reformed.
[0215] In fermentation or whole cell biocatalysis production routes
(in vivo), the production of S,S or R,S monatin will be favored due
to the large number of native L-aminotransferases in comparison to
D-aminotransferases. If R,R and/or S,R monatin are the desired
stereoisomers, broad specificity and aromatic L-aminotransferases
such as AspC and TyrB may have to be knocked out as in the strain
SR250 (Rothman and Kirsch, J. Mol Biol. (2003) 327, 593-603). In
doing so, phenylalanine and tyrosine may be required in the growth
medium. An L-tryptophan aminotransferase which preferentially
reacts with the L-isomer of tryptophan can be substituted for
indole-3-pyruvate production in the pathway to produce monatin,
while a D-aminotransferase that preferentially reacts with D-amino
acids (such as D-alanine aminotransferase) will most likely need to
be present in higher amounts than in the wildtype organism to
facilitate production of R,R or S,R monatin.
[0216] In one enbodiment, a stereoisomerically-enriched monatin
mixture is produced in a biosynthetic pathway and/or in a cell.
"Stereoisomerically-enriched monatin mixture" means that the
mixture includes more than one monatin stereoisomer and at least
60% of the monatin stereoisomers in the mixture is a particular
stereoisomer, such as R,R, S,S, S,R or R,S. In other embodiments,
the mixture includes greater than 65%, 70%, 75%, 80%, 85%, 90%,
95%, 98% or 99% of a particular monatin stereoisomer.
"Stereoisomerically-enriched" R,R monatin means that the monatin
comprises at least 60% R,R monatin. "Stereoisomerically-enriched"
S,S monatin means that the monatin comprises at least 60% S,S
monatin. In other embodiments, "stereoisomerically-enriched"
monatin comprises greater than 65%, 70%, 75%, 80%, 85%, 90%, 95%,
98% or 99% of R,R or S,S monatin.
[0217] In other embodiments, predominantly S,S or R,R monatin is
produced in a biosynthetic pathway and/or in a cell.
"Predominantly" means that of the monatin stereoisomers produced in
a biosynthetic pathway and/or in a cell, the monatin contains
greater than 90% of a particular stereoisomer. In some embodiments,
the monatin produced is substantially free of R,S or S,R monatin.
"Substantially free" means that of the monatin stereoisomers
produced in a biosynthetic pathway and/or in a cell, the monatin
stereoisomers include less than 2% of a particular stereoisomer.
Additionally or alternatively, when used to describe monatin
produced in a biosynthetic pathway and/or in a cell, "substantially
free" encompasses the amount of a stereoisomer (e.g., R,S monatin)
produced as a by-product in a biosynthetic pathway involving
chiral-specific enzymes (e.g., D-amino acid dehydrogenases or
D-amino acid aminotransferases) and/or chiral-specific substrates
(e.g., one having a carbon in the R-stereoconfiguration) to produce
a different specific stereoisomer (e.g., R,R monatin).
[0218] 7. Activating Substrates
[0219] Phosphorylated substrates, such as phosphoenolpyruvate
(PEP), can be used in the reactions disclosed herein.
Phosphorylated substrates can be more energetically favorable and,
therefore, can be used to increase the reaction rates and/or
yields. In aldol condensations, the addition of a phosphate group
stabilizes the enol tautomer of the nucleophilic substrate, making
it more reactive. In other reactions, a phosphorylated substrate
can provide a better leaving group. Similarly, substrates can be
activated by conversion to CoA derivatives or pyrophosphate
derivatives.
[0220] 8. Secreting Products
[0221] Microorganisms can produce amino acids. For example,
Corynebacteria and Brevibacteria can produce a variety of amino
acids such as glutamate, histidine, tryptophan, phenylalanine,
tyrosine, serine, threonine, lysine, methionine, valine,
isoleucine, and leucine, while Pantoea, Erwinia, Klebsiella,
Enterobacter agglomerans, and Serratia liquefacience can produce
glutamate. In addition, microorganisms can secrete organic acids
and amino acids. For example, Bacillus and Lactobacillus organisms
can secrete organic acids such as lactic acid and acetic acid,
while Corynebacteria and Brevibacteria organisms can secrete many,
if not all, the amino acids they produce.
[0222] The organisms that can secrete amino acids usually do so for
one of two reasons: (1) they utilize polypeptides as a carbon and
energy source but cannot catabolize a particular amino acid, or
(2), the charged amino acids can be secreted as a stress response
in order to control pH or osmolytic pressure. Glutamate, for
instance, is not constitutively excreted by wildtype
Corynebacteria. Several conditions are likely to be involved in
triggering export of glutamate such as the level of oxoglutarate
dehydrogenase activity, the presence of a specific exporter, the
status of the cell envelope, the inversion of the uptake process by
changes in chemical potential or regulation, and stress.
[0223] The cell envelope status can be influenced by the
composition of the media and growth conditions. In general,
peptidoglycan (cell wall and murein) is not a barrier to transport,
but in the case of Corynebacteria and glutamate there can be an
exception. The addition of penicillin or penicillin derivatives
such as ampicillin or carbenicillin appear to aid in glutamate
efflux, especially in Corynebacteria. Penicillin and penicillin
derivatives, such as ampicillin and carbenicillin, are beta-lactam
antibiotics that inhibit the final stage of synthesis of cell wall
cross-links that is catalyzed by a transpeptidase. They also
inhibit enzymes, called penicillin binding proteins, necessary for
the rod-like structure of E. coli and for septum formation during
division.
[0224] The fluidity of the cell membrane can be involved as well.
For example, the presence of more saturated fatty acids can
decrease the fluidity and the efflux. Fluidity can be influenced by
limiting biotin, and adding surfactants. Increased temperature,
addition of dodecylammonium acetate, oleic acid auxotrophs,
glycerol deficiency in glycerol auxotrophs, addition of detergents
such as Tween 60, addition of local anaesthetics, fatty acid
mutants, use of lysozyme-sensitive mutants, and application of
electrical potential can affect the permeability of the cell
membrane/wall. For example, the proton motive force can be
important for secretion of charged molecules and can be largely
affected by the pH of the media in comparison to intracellular
pH.
[0225] Any method can be used to increase membrane fluidity and
product secretion. For example, isonicotinic acid hydrazide (INH)
can be added to cultures to inhibit mycolic acid synthesis
activity, which can result in increased membrane fluidity and
product secretion. In addition, inactivation of csp1 (PS
1-mycolyltransferase) can decrease the cell-wall bound mycolic acid
content by 50%, and increase the transport of hydrophilic
substrates through the cellular envelope. Since overexpression of
the acp gene (involved in mycolic acid synthesis) can counteract
the benefits of adding Tween 60 to the media, methods that
downregulate this gene can be used to increase monatin secretion
from Corynebacteria strains.
[0226] The major fatty acids of C. glutamicum's cell membrane are
oleate (18:1) and palmitate (16:0), fatty acids with little or no
unsaturation. Different fatty acid synthases from the Brevibacteria
and Corynebacteria have different properties in terms of the ratio
of saturated to unsaturated fatty acids and the length of the fatty
acid. Corynebacteria have both the FAS I (yeast and mammalian
system) and FAS II (E. coli and plant system) enzymes for fatty
acid synthesis. In fact, Corynebacterium glutamicum has two fatty
acid synthase I enzymes. Manipulation of these genes or the
expression of these genes can alter membrane fluidity.
[0227] Biotin can be required for fatty acid synthesis and cell
growth. Limiting biotin levels can lower the oleic acid (or other
fatty acids with little or no unsaturation) level even more than it
affects the highly unsaturated fatty acids, making the cell
membrane more fluid. To improve secretion, acetyl-CoA-carboxylase
polypeptides, which contain biotin and are necessary for
synthesizing phospholipids, can be downregulated or inhibited. In
addition, biotin antagonists can be used rather than limiting
biotin. For example, temperature sensitive biotin inhibitory
polypeptides (dtsR gene products) can confer surfactant resistance
and improve secretion. In addition, nucleic acids encoding
temperature sensitive biotin inhibitory polypeptides can be
transformed into Corynebacteria, which can be used to produce
glutamic acid and lysine (See, e.g., U.S. patent application
Publication No. 20030077765).
[0228] Genes encoding desaturase polypeptides can be added to
organisms to increase membrane fluidity. In C. glutamicum,
overexpression of genes encoding phospholipid biosynthetic
polypeptides such as plsC, cma, and cls can be used to improve
glutamate secretion.
[0229] Eicosapentaenoic acid (EPA) is known to play a significant
role in membrane fluidity (Hashimoto et al., 1999, Lipids,
34:1297-1304), and so overproduction of this polyunsaturated fatty
acid can aid in overall fluidity/transport properties of the host
organism. A 38 kbp genome DNA fragment has been successfully cloned
from a marine bacterium (Shewanella) and expressed in E. coli
resulting in the production of EPA (Yazawa, 1996, Lipids,
31:S297-S300). Shewanella sp. genes for EPA synthesis are available
commercially. Polyketide synthase enzymes are also known to produce
polyunsaturated fatty acids, and enzyme domains for these enzymes
are present in the same open reading frames as are the
above-described FAS-related genes used for EPA production. Cloning
of these gene clusters into the host organism can have a
significant effect on membrane fluidity and subsequent product
efflux.
[0230] The medium can have an effect on the amount of byproducts
and rate of transport. In C. glutamicum, increased amounts of
minerals can favor glutamate production over acetate and lactate
byproducts in a manner that correlates with an increase in NADPH,
H.sup.+ production rates. The choice of carbon source also can
influence the ratio of NADPH to NADP.sup.+ resulting in changes in
byproduct formation and transport rate. The presence of high
H.sup.+ or other positively charged ions in the media such as
sodium and potassium can influence the rate of antiport (efflux) or
symport (uptake).
[0231] Glutamate/glutamine ratios are often an indication of the
availability of nitrogen (ammonia) in the cells. Glutamine is
utilized in some organisms as an ammonia donor for asparagine
production from aspartate. High levels of glutamate can accumulate,
and this can signal the cells to secrete glutamate. Also, glutamate
and other anionic molecules can be transported in and out of the
cells under different conditions of stress.
[0232] The aromatic amino acids can share a common transport system
in C. glutamicum. Finding strains with a defect in uptake of these
amino acids can be used to yield strains with increased production
of amino acids (Ikeda and Katsumata, (1995) Biosci. Biotech.
Biochem., 59:1600-1602).
[0233] In one embodiment, the following steps can be performed to
identify an organism exhibiting glutamate efflux. Strains such as
ATCC13655 and 13058, which have both been reclassified as
Corynebacterium glutamicum, can be obtained. See, e.g., U.S. Pat.
Nos. 3,128,237 and 3,002,889. Organisms can be assessed to
determine the levels of glutamic acid produced. Then, the effects
of various conditions such as the use of Tween, ampicillin (or
penicillin or carbenicillin), and reduced biotin can be measured to
determine the most effective treatment for glutamate efflux. If
glutamate efflux is detected, then the organism can be used obtain
a gene that encodes a polypeptide having transport activity.
[0234] Amino acid efflux polypeptides in bacteria are mainly
proton-motive force driven. Generally, these are proton
antiporters, but other positively charged molecules can be imported
when the amino acid is secreted. Export of negatively charged
molecules should not require a proton to be imported, since it is
already going in the direction of the charge gradient. Therefore, a
glutamate transporter can be a uniporter rather than an
antiporter.
[0235] Any organism can be screened for polypeptides that transport
monatin or glutamate. For example, the following organisms can be
examined for monatin or glutamate transporters: (1) organisms
having a high number of predicted secondary transporters such as E.
coli, B. subtilis, and Ricksettia, (2) organisms that secrete
glutamate such as Corynebacteria and Brevibacteria, (3) plants and
legume containing plants such as soybean, peas, peanuts, and beans,
(4) Rhizobium species, and (5) organisms that have a high
resistance to acids such as lactic acid bacteria, Acetobacter
strains, Kluyveromyces, Saccharomyces cerevisiae, and Aspergillus
niger. Organisms also can be screened for the ability to utilize
glutamate rich synthetic or natural polypeptides (e.g., GLURP, the
glutamate-rich polypeptide from Plasmodium falciparum
orpolyglutamate) as sole nitrogen sources. Such organisms can have
the ability to secrete glutamate, allowing them to survive in the
presence of high levels of intracellular glutamate, which may be
toxic or may adversely affect cellular osmotic potential.
[0236] Transporter polypeptides that do not recognize monatin can
be manipulated to produce transporter polypeptides that recognize
monatin. In particular, techniques such as selection processes can
be used to obtain a transporter polypeptide that recognizes monatin
as a substrate. For example, mutation of phenylalanine and tyrosine
regulatory genes via classical mutagenesis and screening in E. coli
has been shown to result in increased production and secretion of
phenylalanine.
[0237] If polypeptides that facilitate tryptophan secretion are
detected, then the genes encoding these polypeptide can be knocked
out such that tryptophan is readily available inside the cell for
production of monatin and to increase yield. In addition, genes
encoding tryptophan uptake polypeptide can be expressed in host
cells overproducing tryptophan such that tryptophan can be utilized
for monatin production rather than being secreted. Such genes
include MTR permease (tryptophan specific transport protein), TyrP
(tyrosine specific transport protein), TnaB (tryptophan specific
transport protein) (E. coli designations) and AroP (aromatic amino
acid uptake protein).
[0238] 9. Genetic Tools
[0239] In the last two decades, general molecular biology tools
such as cloning vectors and DNA transfer methods have been
developed for amino acid producing Corynebacterium and
Brevibacterium strains. Several of these tools can be used to
manipulate the glutamate and/or tryptophan producing strains of
Corynebacterium glutamicum such that they produce products such as
monatin. For example, monatin can be produced and secreted at high
levels when the proA and aspC genes are overexpressed in a C.
glutamicum strain.
[0240] The research laboratories within Kyowa Hakko Kogyo Co. have
genetically manipulated C. glutamicum strains to increase the
production of tryptophan by overexpressing several genes involved
in aromatic amino acid biosynthesis. One of the shuttle vectors
developed by this company, pCE54, is available from ATCC (catalog
number 39019). It has a multiple cloning site, 3 antibiotic
markers, and the pCG2 replicon for Corynbebacterium/Brevibacterium
and pMB 1 replicon for E. coli. Several other shuttle vectors with
different selectable markers developed at Kyowa Hakko including
pCB101, pEthr1, pCG11, and pCE53 (U.S. Pat. No. 4,710,471; and
Ikeda and Katsumata, (1999) App. Env. Microbiology,
65:2497-2502).
[0241] The groups of Eikmanns and Sahm have constructed a family of
shuttle and expression vectors for C. glutamicum/E.coli (Eikmanns
et al., (1991) Gene, 102:93-98). These are based on the replication
origins of corynbactarial pBL 1 and E. coli ColE 1, have multiple
restriction sites, and carry kanamycin- or
chloramphenicol-resistance genes. Two of these, the 8.2 kb pEKEx1
or pEKEx2 vector are inducible with
isopropyl-.beta.-D-thiogalactoside. Promoter probe vectors also
exist to assay the promoter strengths.
[0242] Sinskey and colleagues have developed vectors for metabolic
engineering in 0Corynebacterium. Their shuttle vectors are based on
the pSR1 (broad host range), pBL1, and pNG2 plasmids originally
isolated from C. glutamicum and C. lactofermentum. They include a
conjugation vector, a vector for transcription analysis, two
expression vectors containing the E. coli tac promoter or both the
tac promoter and a Corynebacaterium promoter obtained from the
fda-gene, and a promoter probe vector (Jetten et al., (1994) Ann.
NY Acad. Sci., 721:12-29; and Jetten and Sinskey, (1995) Crit. Rev.
Biotechnology, 15:73-103).
[0243] Genetic tools are available for fungal species as well. See,
e.g., Zhou et al., (1994) Gene,142:135-40; Willins et al., (2002)
Gene, 292:141-9; Hanic-Joyce and Joyce, (1998) Gene, 211:395-400;
and Barkani et al., (2000) Gene, 246:151-5. Briefly, most
Torulopsis species have been renamed Candida, including T.
glabrata. Candida glabrata is an asexual haploid Ascomycete fungus.
It is in the same order as Saccharomyces cerevisiae, but not all of
the cloning tools are compatible. For instance, the common mu
autonomous replication sequence (ARS) does not replicate in C.
glabrata. Nevertheless, pRS316, a centromere (CEN)-based S.
cerevisiae plasmid, can be used in C. glabrata. In addition, URA3
can be used in C. glabrata as an auxotrophic selection marker, and
integrative plasmids exist for inserting sequences at the URA3
locus via homologous recombination.
[0244] An expression vector that functions in C. glabrata has been
designed by researchers at Genome Therapeutics Corp. (Willins et
al., (2002) Gene 292:141-149), and contains HIS3, ADE2, and LEU2
auxotrophies. This vector also has S. cerevisiae CEN and ARS
regions. The copper-inducible metallothionein I (MT-1) promoter of
C. glabrata and standard neomycin and kanamycin resistance genes
can be used in C. glabrata. Likewise, a high copy-number vector
with the ADE2 gene is functional in C. glabrata and contains a
fragment of S. cerevisiae mitochondrial (mt) DNA that serves as the
ARS (Hanic-Joyce and Joyce, (1998) Gene 11:395-400).
[0245] An E. coli shuttle vector for C. glabrata has been
constructed, containing both the C. glabrata CEN-ARS cassette and
the lacZ coding sequence of E. coli (El Barkani et al., (2000) Gene
246:151-155). The HIS3 gene promoter and ribosome binding site was
used to express lacZ. A MTII gene:lacZ reporter fusion was also
made for differential induction with copper.
[0246] Methods developed for other Candida strains, such as FLP
recombinase of S. cerevisiae, isolation of promoters and selection
markers, UV mutagenesis techniques, and cell permeabilization
methods can be applied to C. glabrata. In addition, lithium acetate
or electroporation techniques can be used to transform Candida
species.
[0247] Monatin Production in Non-Recombinant Organisms and
Screening Methods for Isolation of Organisms Capable of Monatin
Production.
[0248] Sinorhizobium meliloti, Comamonas testosteroni, and
Pseudomonas straminea are prokaryotes that have
4-hydroxy-4-methyl-2-oxoglutarate aldolase as well as aromatic
aminotransferase activities. Because these organisms contain the
enzymes necessary to produce monatin from tryptophan, they do not
require genetic modification for its biosynthesis. The genes that
encode the aldolase and aromatic aminotransferases are inducible
and appropriate growth conditions (for example, growth in the
presence of p-hydroxybenzoate) are required to ensure that they are
induced. The 4-hydroxy-4-methyl-2-oxoglutarate aldolase is part of
a protocatechuate degradation pathway in Pseudomonas and related
species. Corynebacterium glutamicum is also capable of producing
monatin. Although 4-hydroxy-4-methyl-2-oxoglutarate aldolase has
not yet been identified in this organism, it contains other enzymes
involved in protocatechuate degradation.
[0249] Other organisms that carry these genes or can synthesize
monatin by an alternative pathway can be detected by screening for
growth on monatin or the monatin precursor (MP) as the sole carbon
source. The reactions that produce monatin or the monatin precursor
(MP) from tryptophan and pyruvate are all reversible. Therefore,
screening for cells that can convert monatin or monatin precursor
(MP) to tryptophan or pyruvate is a tool that can be employed to
test for cells with enzymes useful for monatin production. The test
can be accomplished by using a tryptophan auxotroph (a cell that is
incapable of producing tryptophan and requires its addition to the
medium for growth) and determining if the cell can grow on monatin
or MP, which would indicate that the cell converted monatin or MP
to tryptophan. Alternatively, the cells can be plated onto minimal
medium where monatin, MP, a monatin analog and/or a MP analog
is/are the primary carbon/energy source (as described below). In
order to survive (and grow into visible colonies), these cells
would have to convert the monatin, MP, monatin analog and/or MP
analog into pyruvate or another component of central metabolism.
Growth of a cell can be tested, for example, by looking for colony
formation on an agar plate, or by looking for evidence of growth in
liquid culture as compared to a negative control (e.g., by looking
for differences in optical density of the liquids). The test cells
can be a pyruvate auxotroph (a cell that is incapable of producing
pyruvate and requires a pyruvate source in the medium for growth)
and determining if the cell can grow on monatin, MP, monatin analog
and/or MP analog. The test cells can be wild-type organisms that
naturallycontain enzymes useful for monatin production. Once
identified as positive test cells by their ability to grow on a
plate, for example, aldolases and/or aminotransferases can be
purified from the positive test cell.
[0250] The test cells can also be recombinant cells that contain
genes that will be expressed to test for the gene product's ability
to convert monatin or MPto tryptophan and/or pyruvate. A cell that
is capable of growth indicates that the exogenous genes encode
enzymes that can convert monatin or MP to tryptophan and/or
pyruvate. Screening by this method requires (1) that the synthetic
pathway be reversible, allowing the product, monatin, to be
metabolized by this route and (2) that the organism has a transport
system that is able to import monatin or MP (or analogs). Titer
improvement in these organisms can be afforded using classical
mutatgenesis techniques.
[0251] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1
[0252] Cloning and Expression of Tryptophan Aminotransferases
[0253] This example describes methods that were used to clone
tryptophan aminotransferases, which can be used to convert
tryptophan to indole-3-pyruvate. The genes were cloned into the pET
30 Xa/LIC vector to generate fusion proteins with cleavable
N-terminal HIS.sub.6-Tag/T7-Tags. The resulting proteins were
purified using immobilized metal affinity chromatography.
[0254] Experimental Overview
[0255] Eleven genes encoding aminotransferases were cloned into E.
coli. These genes were Bacillus subtilis D-alanine aminotransferase
(dat, Genbank Accession No. Y14082.1 bp 28622-29470 and Genbank
Accession No. NP.sub.--388848.1, nucleic acid sequence and amino
acid sequence, respectively), Sinorhizobium meliloti (also termed
Rhizobium meliloti) tyrosine aminotransferase (tatA, SEQ ID NOS: 1
and 2, nucleic acid sequence and amino acid sequence,
respectively), Rhodobacter sphaeroides strain 2.4.1 tyrosine
aminotransferase (tatA asserted by homology, SEQ ID NOS: 3 and 4,
nucleic acid sequence and amino acid sequence, respectively), R.
sphaeroides 35053 tyrosine aminotransferase (asserted by homology,
SEQ ID NOS: 5 and 6, nucleic acid sequence and amino acid sequence,
respectively), Leishmania major broad substrate aminotransferase
(bsat, asserted by homology to peptide fragments from L. mexicana,
SEQ ID NOS: 7 and 8, nucleic acid sequence and amino acid sequence,
respectively), Bacillus subtilis aromatic aminotransferase (araT,
asserted by homology, SEQ ID NOS: 9 and 10, nucleic acid sequence
and amino acid sequence, respectively), Lactobacillus amylovorus
aromatic aminotransferase (araT asserted by homology, SEQ ID NOS:
11 and 12, nucleic acid sequence and amino acid sequence,
respectively), R. sphaeroides 35053 multiple substrate
aminotransferase (asserted by homology, SEQ ID NOS: 13 and 14,
nucleic acid sequence and amino acid sequence, respectively),
Rhodobacter sphaeroides strain 2.4.1 multiple substrate
aminotransferase (msa asserted by homology, Genbank Accession No.
NZ_AAAE01000093.1, bp 14743-16155 and Genbank Accession No.
ZP.sub.--00005082.1, nucleic acid sequence and amino acid sequence,
respectively), Escherichia coli aspartate aminotransferase (aspC,
Genbank Accession No. AE000195.1 bp 2755-1565 and Genbank Accession
No. AAC74014.1, nucleic acid sequence and amino acid sequence,
respectively), and E. coli tyrosine aminotransferase (tyrB, SEQ ID
NOS: 31 and 32, nucleic acid sequence and amino acid sequence,
respectively).
[0256] The genes were cloned, expressed, and tested for activity in
conversion of tryptophan to indole-3-pyruvate, along with
commercially available enzymes. All eleven clones had activity.
[0257] Identification of Bacterial Strains that can Contain
Polypeptides with the Desired Activity
[0258] No genes in the NCBI (National Center for Biotechnology
Information) database were designated as tryptophan
aminotransferases. However, organisms having this enzymatic
activity have been identified. L-tryptophan aminotransferase (TAT)
activity has been measured in cell extracts or from purified
protein from the following sources: Rhizobacterial isolate from
Festuca octoflora, pea mitochondria and cytosol, sunflower crown
gall cells, Rhizobium leguminosarum biovar trifoli, Erwinia
herbicola pv gypsophilae, Pseudomonas syringae pv. savastanoi,
Agrobacterium tumefaciens, Azospirillum lipferum & brasilense,
Enterobacter cloacae, Enterobacter agglomerans, Bradyrhizobium
elkanii, Candida maltosa, Azotobacter vinelandii, rat brain, rat
liver, Sinorhizobium meliloti, Pseudomonas fluorescens CHA0,
Lactococcus lactis, Lactobacillus casei, Lactobacillus helveticus,
wheat seedlings, barley, Phaseolus aureus (mung bean),
Saccharomyces uvarum (carlsbergensis), Leishmania sp., maize,
tomato shoots, pea plants, tobacco, pig, Clostridium sporogenes,
and Streptomyces griseus.
[0259] Isolation of Genomic DNA for Cloning
[0260] S. meliloti (ATCC number 9930) was grown in TY media at
25.degree. C., pH 7.2. Cells were grown to an optical density at
600 nm (OD.sub.600) of 1.85 and a 2% inoculum was used for genomic
DNA preparations. The Qiagen genomic tip 20/G kit (Valencia,
Calif.) was used for genomic DNA isolation.
[0261] Bacillus subtilis 6051 (ATCC) was grown at 30.degree. C. in
Bereto Nutrient Broth (Difco; Detroit, Mich.). The Qiagen genomic
tip 20/G protocol was used to isolate the genomic DNA with the
following changes: the concentrations of proteinase K and lysozyme
were doubled and incubation times were increased 2-3 fold.
[0262] Leishmania major ATCC 50122 genomic DNA was supplied by IDI,
Inc. (Quebec, Canada) in TE buffer pH 8.0, 17 ng/.mu.L.
[0263] Rhodobacter sphaeroides 2.4.1 (provided by Professor Sam
Kaplan, University of Texas, Houston), R. sphaeroides 35053 (ATCC
number), and L. amylovorus genomic DNA was prepared by standard
phenol extraction. Cells were harvested in late log phase,
resuspended in TEN buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 100
mM NaCl), and lysed by the addition of 0.024 mL sodium lauryl
sarcosine per mL cell suspension. After extracting at least three
times with an equal volume of phenol saturated with TE buffer (10
mM Tris-HCl, pH 7.5, 1 mM EDTA), the DNA solution was extracted
once with 9:1 chloroform:octanol and three times with chloroform.
The DNA was precipitated by the addition of 0.1 volume of 3 M
sodium acetate, pH 6.8 and 2 volumes ethanol. The precipitate was
collected by centrifugation and washed once with 70% ethanol.
Finally the DNA was dissolved in 0.10 mL distilled water.
[0264] Escherichia coli genomic DNA was isolated from strain DH10B
(Invitrogen) and prepared using the Qiagen Genomic-tip.TM. (500/G)
kit. From 30 mL of this strain grown in LB to an OD.sub.650 of
1.87, 0.3 mg of purified DNA was obtained. The purified DNA was
dissolved in Qiagen elution buffer (EB) at a concentration of 0.37
.quadrature.g/.mu.L.
[0265] Polymerase Chain Reaction Protocol
[0266] Primers were designed with compatible overhangs for the pET
30 Xa/LIC vector (Novagen, Madison, Wis.). The pET vector has a 12
base single stranded overhang on the 5' side of the Xa/LIC site and
a 15-base single stranded overhang on the 3' side of the Xa/LIC
site. The plasmid is designed for ligation independent cloning,
with N-terminal His and S-tags and an optional C-terminal His-tag.
The Xa protease recognition site (IEGR) sits directly in front of
the start codon of the gene of interest, such that the fusion
protein tags can be removed.
[0267] The following sequences were added to the 5' ends of the
organism specific sequences when designing primers:
1 (SEQ ID NO: 74) forward primer, 5' AGAGGAGAGTTAGAGCC.
[0268]
2 (SEQ ID NO: 73) reverse primer: 5' GGTATTGAGGGTCGC;
[0269] Bacillus subtilis dat primers:
3 (SEQ ID NOS: 15 and 16) N term: 5'-GGTATTGAGGGTCGCATGAAGG-
TTTTAGTCAATGG-3' and C term:
5'-AGAGGAGAGTTAGAGCCTTATGAAATGCTAGCAGCCT-3.'
[0270] Sinorhizobium meliloti tatA primers:
4 (SEQ ID NOS: 17 and 18) N term: 5'-GGTATTGAGGGTCGCATGTTCG-
ACGCCCTCGCCCG and C term: 5'-AGAGGAGAGTTAGAGCCTCAG-
AGACTGGTGAACTTGC.
[0271] Bacillus subtilis araT primers:
5 (SEQ ID NOS: 19 and 20) N term: 5'-GGTATTGAGGGTCGCATGGAAC-
ATTTGCTGAATCC and C term: 5'-AGAGGAGAGTTAGAGCCTTAA-
ACGCCGTTGTTTATCG.
[0272] Rhodobacter sphaeroides msa (both 2.4.1.and 35053):
6 (SEQ ID NOS: 21 and 22) N term: 5'-GGTATTGAGGGTCGCATGCGCG-
AGCCTCTTGCCCT and C term: 5'-AGAGGAGAGTTAGAGCCTCAG-
CCGGGGAAGCTCCGGG.
[0273] Leishmania major bsat:
7 (SEQ ID NOS: 23 and 24) N term: 5'-GGTATTQAGGGTCGCATGTCCA-
CGCAGGCGGCCAT and C term: 5'-AGAGGAGAGTTAGAGCCTCAC-
TCACGATTCACATTGC.
[0274] Lactobacillus amylovorus araT:
8 (SEQ ID NOS: 25 and 26) N term: 5'-GGTATTGAGGGTCGCATGCCAG-
AATTAGCTAATGA and C term: 5'-AGAGGAGAGTTAGAGCCTTAT-
TCGTCCTCTTGTAAAA.
[0275] Rhodobacter sphaeroides tatA (both 2.4.1 and 35053
strains):
9 (SEQ ID NOS: 27 and 28) N term: 5'-GGTATTGAGGGTCGCATGCGCT-
CTACGACGGCTCC and C term: 5'-AGAGGAGAGTTAGAGCCTCAG-
CCGCGCAGCACCTTGG.
[0276] Escherichia coli aspC:
10 (SEQ ID NOS: 29 and 30) N term: 5'-GGTATTGAGGGTCGCATGTTT-
GAGAACATTACCGC-3' and C term:
5'-AGAGGAGAGTTAGAGCCTTACAGCACTGCCACAATCG- 3'.
[0277] Escherichia coli tyrB:
11 (SEQ ID NOS: 33 and 34) N term: 5'-GGTATTGAGGGTCGCGTGTTT-
CAAAAAGTTGACGC and C term: 5'-AGAGGAGAGTTAGAGCCTTA-
CATCACCGCAGCAAACG- 3'.
[0278] The gene derived from S. meliloti (tatA) was amplified using
the following PCR protocol. In a 50 .mu.L reaction 0.1-0.5 .mu.g
template, 1.5 .mu.M of each primer, 0.4 mM each dNTP, 3.5 U Expand
High Fidelity Polymerase (Roche, Indianapolis, Ind.), and 1.times.
Expand.TM. buffer with Mg were used. The thermocycler program used
included a hot start at 96.degree. C. for 5 minutes, followed by 29
repetitions of the following steps: 94.degree. C. for 30 seconds,
55.degree. C. for 2 minutes, and 72.degree. C. for 2.5 minutes.
After the 29 repetitions the sample was maintained at 72.degree. C.
for 10 minutes and then stored at 4.degree. C. This PCR protocol
produced a product of 1199 bp.
[0279] The sequences of the genes derived from R. sphaeroides (msa
and tatA), L. amylovorus araT, and Bacillus araT were amplified
using the following PCR protocol. In a 50 .mu.L reaction, 0.1-0.5
.mu.g template, 1.5 .mu.M of each primer, 0.4 mM each dNTP, 3.5 U
Expand High Fidelity.TM. Polymerase, and 1.times. Expand.TM. buffer
with Mg were added. The thermocycler program used included a hot
start at 96.degree. C. for 5 minutes, followed by 29 repetitions of
the following steps: 94.degree. C. for 30 seconds, 40-60.degree. C.
for 1 minute, 45 seconds (gradient thermocycler) and 72.degree. C.
for 2 minutes, 15 seconds. After the 29 repetitions the sample was
maintained at 72.degree. C. for 10 minutes and then stored at
4.degree. C.
[0280] For each R. sphaeroides msa gene, the 42.degree. C. and
48.degree. C. annealing temperatures produced multiple products,
but a distinct band at approximately 1464 bp. For L. amylovorus
araT, the 42.degree. C., 48.degree. C., and 56.degree. C. annealing
temperatures yielded single products with intense bands at 1173 bp.
For B. subtilis araT, the 40.degree. C., 45.degree. C., 50.degree.
C., 55.degree. C. annealing temperatures generated single intense
products (1173 bp), from both genomic DNA and colonies. For L.
major bsat, the 55.degree. C. annealing temperature gave the
cleanest product (1239 bp). For Rhodobacter tatA genes, the
50-55.degree. C. annealing temperatures gave clean products at the
correct size (1260 bp). For both E. coli genes and the B. subtilis
dat gene, an annealing temperature of 55-60.degree. C. was used,
and the annealing time was shortened to 45 seconds. Clean products
of the correct sizes were obtained (approximately 1.3 kb for the E.
coli genes, 850 bp for the dat gene).
[0281] Cloning
[0282] The PCR products were gel purified from 0.8 or 1%
TAE-agarose gels using the Qiagen gel extraction kit (Valencia,
Calif.). The PCR products were quantified by comparison to
standards on an agarose gel, and then treated with T4 DNA
polymerase following the manufacturer's recommended protocols for
Ligation Independent Cloning (Novagen, Madison, Wis.).
[0283] Briefly, approximately 0.2 pmol of purified PCR product was
treated with 1 U T4 DNA polymerase in the presence of dGTP for 30
minutes at 22.degree. C. The polymerase removes successive bases
from the 3' ends of the PCR product. When the polymerase encounters
a guanine residue, the 5' to 3' polymerase activity of the enzyme
counteracts the exonuclease activity to effectively prevent further
excision. This creates single stranded overhangs that are
compatible with the pET Xa/LIC vector. The polymerase is
inactivated by incubating at 75.degree. C. for 20 minutes.
[0284] The vector and treated insert were annealed as recommended
by Novagen. Approximately 0.02 pmol of treated insert and 0.01 pmol
vector were incubated for 5 minutes at 22.degree. C., 6.25 mM EDTA
(final concentration) was added, and the incubation at 22.degree.
C. was repeated. The annealing reaction (1 .mu.L) was added to
NovaBlue.TM. singles competent cells (Novagen, Madison, Wis.), and
incubated on ice for 5 minutes. After mixing, the cells were
transformed by heat shock for 30 seconds at 42.degree. C. The cells
were placed on ice for 2 minutes, and allowed to recover in 250
.mu.L of room temperature SOC for 30 minutes at 37.degree. C. with
shaking at 225 rpm. Cells were plated on LB plates containing
kanamycin (25-50 .mu.g/mL).
[0285] Plasmid DNA was purified using the Qiagen spin miniprep kit
and screened for the correct inserts by restriction digest with
XhoI and XbaI. The sequences of plasmids that appeared to have the
correct insert were verified by dideoxy chain termination DNA
sequencing.
[0286] SEQ ID NOS:1-14 and 31-32 show nucleotide and corresponding
amino acid sequences of the recombinant aminotransferases, any
changes from the Genbank sequences were either silent or generated
conservative substitutions in the protein sequence. SEQ ID NOS: 11
and 12 are novel sequences.
[0287] Gene Expression and Assays
[0288] Plasmid DNA, verified by sequence analysis, was subcloned
into E. coli expression hosts BLR(DE3) or BL21(DE3) (Novagen,
Madison, Wis.). The cultures were grown and the plasmids were
isolated using Qiagen miniprep kit, and analyzed by restriction
digest to confirm identity.
[0289] Induction was initially performed with L. amylovorus araT,
B. subtilis araT, and S. meliloti tatA in both BLR(DE3) and
BL21(DE3) cells. A time course study was performed with cultures
grown in LB containing kanamycin (30 mg/L) to an OD.sub.600 of
0.5-0.8 and induced with 1 mM IPTG (isopropyl thiogalacatoside) and
sampled at 0, 1, 2, and 4 hours post induction. Cells from 2.0 mL
were resuspended in 0.10 mL 120 mM Tris-HCI, pH 6.8 containing 10%
sodium dodecyl sulfate, 10% 2-mercaptoethanol, and 20% glycerol,
heated at 95.degree. C. for 10 min, and cooled, and diluted with
0.10 mL H.sub.2O. Aliquots of these total cellular protein samples
were analyzed by SDS-PAGE using a 4-15% gradient gel. There were no
significant differences in the amount of protein expressed between
the 2 hour and 4 hour induction, nor between the BLR(DE3) and
BL21(DE3) cells.
[0290] Cell extracts were also prepared from the 4 hour samples by
suspending cell pellets from 2 mL of culture in 0.25 mL Novagen
BugBuster.TM. reagent containing 0.25 .mu.L benzonase nuclease,
incubating at room temperature for 20 minutes with gentle shaking,
and centrifuging at 16,000.times.g to remove cell debris. The
supernatants (cell extracts) were loaded onto 4-15% gradient gels
for analysis of the cellular soluble proteins.
[0291] The three clones, (L. amylovorus araT (SEQ ID NOS: 11 and
12), B. subtilis araT (SEQ ID NOS: 9 and 10), and S. meliloti tatA
(SEQ ID NOS: 1 and 2) showed soluble protein that corresponded to
the correct size (approximately 45 kDa). The B. subtilis araT gene
product was over-expressed at the highest level and/or was more
soluble than the other two gene products.
[0292] In subsequent expression methods, plasmid DNA from positive
clones was subcloned into BL21(DE3) due to the better growth
characteristics of this host. Induction was repeated using 1 mM
IPTG with cultures grown in LB containing kanamycin at 50 mg/L,
inducing when the OD.sub.600 reached approximately 0.8. Cells were
harvested after 4 hours of growth at 37.degree. C., centrifuged at
3000 rpm for 10 minutes (4.degree. C.), washed with TEGGP buffer
(50 mM Tris-HCl (pH 7.0), 0.5 mM EDTA, 100 mg/L glutathione, 5%
glycerol, with Roche complete protease inhibitor cocktail), and
flash frozen in -80.degree. C. ethanol.
[0293] Samples were resuspended in 5 mL/g wet cell weight of
BugBuster.TM. (Novagen) reagent containing 5 .mu.L/mL protease
inhibitor cocktail set #3 (Calbiochem-Novabiochem Corp., San Diego,
Calif.) and 1 .mu.L/mL benzonase nuclease. Samples were incubated
at room temperature for 20 minutes on an orbital shaker. Insoluble
cell debris was removed by centrifugation at 16,000.times.g for 20
minutes at 4.degree. C.
[0294] Cell extracts were analyzed by SDS-PAGE, and assayed for
tryptophan aminotransferase activity by following production of
indole-pyruvic acid using the following protocol. One mL reactions
were carried out in 50 mM sodium tetraborate (pH 8.5), 0.5 mM EDTA,
0.5 mM sodium arsenate, 50 .mu.M pyridoxal phosphate, 5 mM
.alpha.-ketoglutarate, and 5 mM L-tryptophan. The reactions were
initiated by the addition of cell free extracts or purified enzyme
and were incubated 30 minutes at 30.degree. C. 20% TCA (200 .mu.L)
was added to stop the reaction, and the precipitated protein was
removed by centrifugation. The absorbance at 327 nm was measured
and compared to a standard curve of freshly prepared
indole-3-pyruvate in the assay buffer. Control reactions without
the substrate tryptophan or using cell-free extracts from clones
transformed with pET30a alone were also performed.
[0295] Due to background from the native E. coli aminotransferases
in cell extracts, the recombinant fusion proteins each containing
an aminotransferase protein fused to the pET30 amino terminal
HIS.sub.6-Tag/S-Tag were purified using immobilized metal affinity
chromatography with His-Bind cartridges following manufacturer's
protocols (Novagen, Madison, Wis.). The HIS.sub.6-Tag sequence of
the fusion proteins binds to the divalent Ni.sup.2+ cations
immobilized on IDA-based His-Bind resin. The eluent fractions were
desalted on PD-10 (Amersham Biosciences, Piscataway, N.J.) columns
and eluted in 50 mM Tris, pH 7.0. Purified proteins were analyzed
by SDS-PAGE and assayed for aminotransferase activity.
[0296] Results from the 37.degree. C. induction with 1 mM IPTG (4
hours) demonstrate that L. major bsat, S. meliloti tatA, E. coli
aspC, and both R. sphaeroides tatA clones have significant levels
of tryptophan aminotransferase activity. The araT protein from B.
subtilis was over-expressed and soluble, but showed little
enzymatic activity. The L. amylovorus araT gene product appeared to
be soluble in the cell extract, but purification using a His-Bind
cartridge resulted in only small amounts of protein with the
correct molecular weight. The msa gene products were insoluble and
further expression experiments were done at 24.degree. C. to
minimize inclusion body formation. Several concentrations of IPTG
between 10 .mu.M and 1 mM were used to maximize the amount of
soluble protein.
[0297] Table 1 lists the specific activities measured in micrograms
of indole-3-pyruvate (I3P) formed per milligram protein per minute.
In some cases, very small amounts of recombinant protein showed
high levels of activity above the effective linear range of the
assay. In these cases a `>` precedes the specific activity
number.
12TABLE 1 Specific Activities of Clones in Cell Extracts (CE) and
Purified (P) and Commercial Enzyme Specific Activity (.mu.g I3P/mg
Enzyme protein/min) Note L. major bsat CE >49.3 L. major bsat P
>4280 S. meliloti tatA CE >28.6 S. meliloti tatA P >931 R.
sphaeroides 2.4.1 tatA CE >41.2 R. sphaeroides 2.4.1 tatA P 1086
R. sphaeroides 35053 tatA CE >62.3 R. sphaeroides 35053 tatA P
>486 L. amylovorus araT CE 1.26 L. amylovorus araT P 0 little
protein after His-Bind cartridge B. subtilis araT CE 0 undetectable
B. subtilis araT P 1.5-4.5 R. sphaeroides 2.4.1 msa CE 2.05 very
little soluble protein R. sphaeroides 2.4.1 msa P 0 no protein
after His-Bind cartridge R. sphaeroides 35053 msa CE 3.97 very
little soluble protein R. sphaeroides 35053 msa P 0 no protein
after His-Bind cartridge E. coli aspC (P) 800 E. coli tyrB (P) 1
not very soluble B. subtilis D-aminotransf.(P) 2.7 using
D-tryptophan as substrate broad range transaminase 22 Sigma cat # T
7684 Porcine type II-A 1.5 Sigma G7005 Porcine type I 1 Sigma
G2751
[0298] An alignment comparing all of the recombinant proteins
cloned illustrates that there are not many highly conserved areas
between the araT, tatA, bsat, and msa sequences. An alignment of
highest activity recombinant proteins: Rhodobacter tatA gene
product homologs, L. major broad substrate aminotransferase, and
the Sinorhizobium meliloti tyrosine aminotransferase showed several
conserved regions, however they are only approximately 30-43%
identical at the protein level. The availability of the broad
range, D-specific (D-alanine) aminotransferase can be useful in the
production of other stereoisomers of monatin (see Examples 3 and
4).
Example 2
Converting Indole-3-pyruvate to 2-hydroxy
2-(indol-3-ylmethyl)-4-keto glutaric acid with an Aldolase
[0299] This example describes methods that can be used to convert
indole-3-pyruvate to MP using an aldolase (lyase) (FIG. 2). Aldol
condensations are reactions that form carbon-carbon bonds between
the .beta.-carbon of an aldehyde or ketone and the carbonyl carbon
of another aldehyde or ketone. A carbanion is formed on the carbon
adjacent to the carbonyl group of one substrate, and serves as a
nucleophile attacking the carbonyl carbon of the second substrate
(the electrophilic carbon). Most commonly, the electrophilic
substrate is an aldehyde, so most aldolases fall into the EC
4.1.2.-category. Quite often, the nucleophilic substrate is
pyruvate. It is less common for aldolases to catalyze the
condensation between two keto-acids or two aldehydes.
[0300] However, aldolases that catalyze the condensation of two
carboxylic acids have been identified. For example, EP 1045-029
describes the production of L-4-hydroxy-2-ketoglutaric acid from
glyoxylic acid and pyruvate using a Pseudomonas culture (EC
4.1.3.16). In addition, 4-hydroxy-4-methyl-2-oxoglutarate aldolase
(4-hydroxy-4-methyl-2-oxogluta- rate pyruvate lyase, EC 4.1.3.17)
can catalyze the condensation of two keto acids. Therefore, similar
aldolase polypeptides were used to catalyze the condensation of
indole-3-pyruvate with pyruvate. The activity or enantiospecificity
of these enzymes can be modified for production of a specific
stereoisomer of monatin and screened using the method described in
Example 9 below.
[0301] Cloning
[0302] 4-Hydroxy-4-methyl-2-oxoglutarate pyruvate lyases (ProA
aldolase, EC 4.1.3.17) and 4-hydroxy-2-oxoglutarate
glyoxylate-lyase (KHG aldolase, EC 4.1.3.16) catalyze reactions
very similar to the aldolase reaction of FIG. 2. Primers were
designed with compatible overhangs for the pET30 Xa/LIC vector
(Novagen, Madison, Wis.). The design of these primers is described
above in Example 1.
[0303] The following primers were designed for pET30 Xa/LIC
cloning:
[0304] 1. Pseudomonas straminea proA gene (Genbank Accession No.:
12964663 Version: 12964663; alternatively designated AB050935.2
GI:12964663) and Comamonas testosteroni proA gene (SEQ ID NOS:
65-66, nucleic acid sequence and amino acid sequence,
respectively)
13 (SEQ ID NOS: 55 and 56) forward 5'-GGTATTGAGGGTCGCATGTAC-
GAACTGGGAGTTGT-3' and reverse
5'-AGAGGAGAGTTAGAGCCTTAGTCAATATATTTCAGGC- 3'.
[0305] 2. Sinorhizobium meliloti 1021 SMc00502 gene (homologous to
proA, Genbank Accession Nos.: 15074579 or alternatively AL591788.1
GI:15074579 and CAC46344.1, nucleic acid sequence and amino acid
sequence, respectively)
14 (SEQ ID NO: 61 and 62) forward 5'-GGTATTGAGGGTCGCATGAGCG-
TGGTTCACCGGAA-3' and reverse
5'-AGAGGAGAGTTAGAGCCTCAATCGATATATTTCAGTC- 3'.
[0306] 3. Sphingomonas sp. LB 126 fldZ gene (Genbank Accession No.:
7573247 Version: 7573247 or alternatively AJ277295.1 GI:7573247,
codes for a putative acyl transferase GenBank Accession No.:
CAB87566.1 GI:7573254)
15 (SEQ ID NOS: 57 and 58) forward 5'-GGTATTGAGGGTCGCATGTCC-
GGCATCGTTGTCCA-3' and reverse
5'-AGAGGAGAGTTAGAGCCTCAGACATATTTCAGTCCCA- 3'.
[0307] 4. Arthrobacter keyseri pcmE gene (Genbank Accession No.:
AF331043 Version: AF331043.1, codes for an oxalocitramalate
aldolase GenBank Accession No.: AAK16525.1 GI:13242045)
16 (SEQ ID NOS: 59 and 60) forward 5'-GGTATTGAGGGTCGCATGCGA-
CTGAACAACCTCGG-3' and reverse
5'-AGAGGAGAGTTAGAGCCTCAGTTCTCCACGTATTCCA- 3'.
[0308] 5. Yersinia pestis strain CO92 YPO0082 gene (Genbank
Accession No.: 15978115 Version: 15978115 or alternatively
AJ414141.1 GI:15978115, codes for a possible transferase GenBank
Accession No.: CAC88948.1 GI:15978195)
17 (SEQ ID NOS: 63 and 64) forward 5'-GGTATTGAGGGTCGCATGAGC-
CTGGTTAATATGAA-3' and reverse
5'-AGAGGAGAGTTAGAGCCTTATGACTTTAACGCGTTGA- 3'.
[0309] 6. Bacillus subtilis khg gene (Genbank Accession Nos.
Z99115.1 GI:2634478, 126711-127301 or alternatively Z99115.1
GI:2634478, 126711-127301 and CAB14127.1, nucleic acid sequence and
amino acid sequence, respectively) forward
18 (SEQ ID NOS: 35 and 36) forward 5'-GGTATTGAGGGTCGCATGGAG-
TCCAAAGTCGTTGA-3' and reverse
5'-AGAGGAGAGTTAGAGCCTTACACTTGGAAACAGCCT- 3'.
[0310] 7. E. coli khg gene (Genbank Accession Nos. .AE000279.1
1331-1972 and AAC74920. 1, nucleic acid and amino acid sequence,
respectively)
19 (SEQ ID NOS: 37 and 38) forward 5'-GGTATTGAGGGTCGCATGAAA-
AACTGGAAAACAAG-3' and reverse 5'-AGAGGAGAGTTAGAGCCTTACAGCTT-
AGCGCCTTCTA- 3'.
[0311] 8. S. meliloti khg or SMc03153 gene (Genbank Accession Nos.
AL591792.1 GI:15075850 or alternatively AL591792.1 GI:15075850,
64673 . . . 65311 and CAC47463.1, nucleic acid and amino acid
sequence, respectively)
20 (SEQ ID NOS: 39 and 40) forward 5'-GGTATTGAGGGTCGCATGCGA-
GGGGCATTATTCAA- 3' and reverse
5'-AGAGGAGAGTTAGAGCCTCAGCCCTTGAGCGCGAAG-3'
[0312] Genomic DNA from the organisms described in 1-2 and 6-8,
above, was purified using the Qiagen Genomic-tip.TM. (Valencia,
Calif.) protocol. Using similar techniques the genomic DNA from
organisms described in 3-5 can be purified.
[0313] Pseudomonas straminea (ATCC 33636) was grown at 30.degree.
C. in Nutrient Broth and hydroxybenzoate medium. Comamonas
testosteroni (ATCC 49249) was grown at 26.degree. C. in Nutrient
Broth and hydroxybenzoate medium. Sphingomonas sp. LB 126 (Flemish
Institute for Technological Research, VITO, B-2400 Mol, Belgium) is
grown according to the method described by Wattiau et al. (Research
in Microbiol. 152:861-72, 2001). Arthrobacter keyseri (Gulf Ecology
Division, National Health and Environmental Effects Research
Laboratory, U.S. Environmental Protection Agency, Gulf Breeze, Fla.
32561, USA) is grown according to the protocol described by Eaton
(J. Bacteriol. 183:3689-3703, 2001). Sinorhizobium meliloti 1021
(ATCC 51124) was grown at 26.degree. C. in ATCC TY medium and
hydroxybenzoate medium. Yersinia pestis strain CO92 (ATCC) is grown
at 26.degree. C. in ATCC medium 739 Horse blood agar. Bacillus
subtilis 6051 (ATCC) was grown at 30.degree. C. in Bereto Nutrient
Broth (Difco; Detroit, Mich.). E. coli genomic DNA was isolated
from strain DH10B (Invitrogen) as described in Example 1.
[0314] The PCR, cloning, and screening protocols described in
Example 1 were used to clone the C. testosteroni and the S.
meliloti proA sequences, as well as the E. coli, B. subtilis, and
S. meliloti khg sequences. The same methods can be used to clone
the other sequences described above. For the C. testosteroni proA
gene, the annealing and extension conditions for PCR were
40-60.degree. C. for 1 minute, 45 seconds (gradient thermocycler)
and 72.degree. C. for 2 minutes, 15 seconds.
[0315] Positive clones were sequenced using dideoxy chain
termination sequencing (Seqwright, Houston, Tex.) with S-tag and T7
terminator primers (Novagen), and internal primers from Integrated
DNA Technologies, Inc. (Coralville, Iowa).
[0316] Expression and Activity Assays
[0317] Plasmid DNA (verified by sequence analysis) was subcloned
into expression host BL21(DE3) (Novagen). The cultures were grown
in LB medium with 50 mg/L kanamycin, the plasmids isolated using a
Qiagen spin plasmid miniprep kit and subsequently analyzed by
restriction digest to confirm identity. Induction experiments were
done with the BL21(DE3) constructs grown in LB medium containing 50
mg/L kanamycin at 37.degree. C. Protein expression was induced
using 0.1 mM IPTG after the OD.sub.600 reached approximately 0.6.
The cells were grown for 4 hours at 30.degree. C. and harvested by
centrifugation. The cells were then lysed using Bugbuster.TM.
reagent (Novagen) and the His-tag recombinant proteins were
purified using His-Bind cartridges as described above (Example 1).
Purified proteins were desalted on PD-10 disposable columns and
eluted in 50 mM Tris-HCl buffer, pH 7.3 with 2 mM MgCl.sub.2.
[0318] The proteins were analyzed by SDS-PAGE on 4-15% gradient
gels to detect soluble protein levels at the predicted MW of the
recombinant fusion protein.
[0319] The proteins were assayed for activity using
indole-3-pyruvate and sodium pyruvate as substrates. The assay
mixture contained 100 mM Tris-HCl (pH 7-pH 8.9), 0-8 mM MgCl.sub.2,
3 mM potassium phosphate (pH 8), and 6 mM of each substrate in 1
mL. The reaction was started by adding varying amounts of
polypeptide (for example from 10 to 100 .mu.g), and was incubated
at 25.degree. C.-37.degree. C. for 30 minutes, filtered, and then
frozen at -80.degree. C.
[0320] Activity Results with proA Gene Products
[0321] Both the C. testosteroni proA and S. meliloti SMc00502 gene
constructs had high levels of expression when induced with IPTG.
The recombinant proteins were highly soluble, as determined by
SDS-PAGE analysis of total protein and cellular extract samples.
The C. testosteroni gene product was purified to >95% purity.
Because the yield of the S. meliloti gene product was very low
after affinity purification using a His-Bind cartridge, cellular
extract was used for the enzymatic assays.
[0322] Both recombinant aldolases catalyzed the formation of MP
from indole-3-pyruvate and pyruvate. The presence of both divalent
magnesium and potassium phosphate were required for enzymatic
activity. No product was apparent when indole-3-pyruvate, pyruvate,
or potassium phosphate was absent. A small amount of the product
was also formed in the absence of enzyme (typically one order of
magnitude less than when enzyme was present).
[0323] Using the LC/MS method described in Example 6, the product
peak eluted from the reverse phase C18 column slightly later than
the indole-3-pyruvate standard, the mass spectrum of this peak
showed a collisionally-induced parent ion ([M+H]+) of 292.1, the
parent ion expected for the product MP. The major daughter
fragments present in the mass spectrum included those with m/z=158
(1H-indole-3-carbaldehyde carbonium ion), 168
(3-buta-1,3-dienyl-1H-indole carbonium ion), 274 (292--H.sub.2O),
256 (292--2 H.sub.2O), 238 (292--3 H2O), 228 (292--CH4O3), and 204
(loss of pyruvate). The product also exhibited a UV spectrum
characteristic of other indole-containing compounds such as
tryptophan, with the .lambda..sub.max of 279-280 and a small
shoulder at approximately 290 nm.
[0324] The amount of MP produced by the C. testosteroni aldolase
increased with an increase in reaction temperature from room
temperature to 37.degree. C., amount of substrate, and amount of
magnesium. The synthetic activity of the enzyme decreased with
increasing pH, the maximum product observed was at pH 7. Based on
tryptophan standards, the amount of MP produced under a standard
assay using 20 .mu.g of purified protein was approximately 10-40
.mu.g per one mL reaction.
[0325] Due to the high degree of homology of the S. meliloti and C.
testosteroni ProA aldolase coding sequences with the other genes
described above, it is expected that all of the recombinant gene
products can catalyze this reaction. Moreover, it is expected that
aldolases that have threonine (T) at positions 59 and 87, arginine
(R) at 119, aspartate (D) at 120, and histidine (H) at 31 and 71,
(based on the numbering system of C. testosteroni) will have
similar activity.
[0326] Activity Results with khg Gene Products
[0327] Both the B. subtilis and E. coli khg gene constructs had
high levels of expression of protein when induced with IPTG, while
the S. meliloti khg had a lower level of expression. The
recombinant proteins were highly soluble, as judged by SDS-PAGE
analysis of total proteins and cellular extracts. The B. subtilis
and E. coli khg gene products were purified to >95% purity; the
yield of the S. meliloti gene product was not as high after
affinity purification using a His-Bind cartridge.
[0328] There is no evidence that magnesium and phosphate are
required for activity for this enzyme. However, the literature
reports performing the assays in sodium phosphate buffer, and the
enzyme reportedly is bifunctional and has activity on
phosphorylated substrates such as 2-keto-3-deoxy-6-phosphogluconate
(KDPG). The enzymatic assays were performed as described above, and
in some instances the phosphate was omitted. The results indicate
that the recombinant KHG aldolases produced MP, but were not as
active as the ProA aldolases. In some cases the level of MP
produced by KHG was almost identical to the amount produced by
magnesium and phosphate alone. Phosphate did not appear to increase
the KHG activities. The Bacillus enzyme had the highest activity,
approximately 20-25% higher activity than the magnesium and
phosphate alone, as determined by LC/MS/MS (see Example 6). The
Sinorhizobium enzyme had the least amount of activity, which can be
associated with folding and solubility problems noted in the
expression. All three enzymes have the active site glutamate
(position 43 in B. subtilis numbering system) as well as the lysine
required for Shiff base formation with pyruvate (position 130);
however, the B. subtilis enzyme contains a threonine in position
47, an active site residue, rather than arginine. The B. subtilis
KHG is smaller and appears to be in a cluster distinct from the S.
meliloti and E. coli enzymes, with other enzymes having the active
site threonine. The differences in the active site may be the
reason for the increased activity of the B. subtilis enzyme.
[0329] Improvement of Aldolase Activity
[0330] Catalytic antibodies can be as efficient as natural
aldolases, accept a broad range of substrates, and can be used to
catalyze the reaction shown in FIG. 2.
[0331] Aldolases can also be improved by directed evolution, for
example as previously described for a KDPG aldolase (highly
homologous to KHG described above) evolved by DNA shuffling and
error-prone PCR to remove the requirement for phosphate and to
invert the enantioselectivity. The KDPG aldolase polypeptides are
useful in biochemical reactions since they are highly specific for
the donor substrate (herein, pyruvate), but are relatively flexible
with respect to the acceptor substrate (i.e. indole-3-pyruvate)
(Koeller & Wong, Nature 409:232-9, 2001). KHG aldolase has
activity for condensation of pyruvate with a number of carboxylic
acids and aldehydes. Mammalian versions of the KHG aldolase are
thought to have broader enantiospecificity than many bacterial
versions, including higher activity on 4-hydroxy 4-methyl
2-oxoglutarate and acceptance of both stereoisomers of
4-hydroxy-2-ketoglutarate. Bacterial sources appear to have a
10-fold preference for the R isomer. There are nearly 100 KHG
homologs available in genomic databases, and activity has been
demonstrated in Pseudomonas, Paracoccus, Providencia,
Sinorhizobium, Morganella, E. coli, and mammalian tissues. These
enzymes can be used as a starting point for tailoring the
enantiospecificity that is desired for monatin production.
[0332] Aldolases that utilize pyruvate and another substrate that
is either a keto acid and/or has a bulky hydrophobic group like
indole can be "evolved" to tailor the polypeptide's specificity,
speed, and selectivity. In addition to KHG and ProA aldolases
demonstrated herein, examples of these enzymes include, but are not
limited to: KDPG aldolase and related polypeptides (KDPH);
transcarboxybenzalpyruvate hydratase-aldolase from Nocardioides st;
4-(2-carboxyphenyl)-2-oxobut-3-e- noate aldolase
(2'-carboxybenzalpyruvate aldolase) which condenses pyruvate and
2-carboxybenzaldehyde (an aromatic ring-containing substrate);
trans-O-hydroxybenzylidenepyruvate hydratase-aldolase from
Pseudomonas putida and Sphingomonas aromaticivorans, which also
utilizes pyruvate and an aromatic-containing aldehyde as
substrates; 3-hydroxyaspartate aldolase
(erythro-3-hydroxy-L-aspartate glyoxylate lyase), which uses 2-oxo
acids as the substrates and is thought to be in the organism
Micrococcus denitrificans; benzoin aldolase (benzaldehyde lyase),
which utilizes substrates containing benzyl groups;
dihydroneopterin aldolase; L-threo-3-phenylserine
benzaldehyde-lyase (phenylserine aldolase) which condenses glycine
with benzaldehyde; 4-hydroxy-2-oxovalerate aldolase;
1,2-dihydroxybenzylpyruvate aldolase; and 2-hydroxybenzalpyruvate
aldolase.
[0333] Using assays similar to those described above, and the
detection methods described in Example 6, isocitrate lyase,
N-acetyl neuraminic acid synthase, citrate lyase, tryptophanase and
certain mutants, beta-tyrosinase and certain mutants, PLP,
catalytic aldolase antibodies, tryptophan synthase(s) did not
appear to detectably convert indole-3-pyruvate to MP under the
conditions tested.
[0334] A polypeptide having the desired activity can be selected by
screening clones of interest using the following methods.
Tryptophan auxotrophs are transformed with vectors carrying the
clones of interest on an expression cassette and are grown on a
medium containing small amounts of monatin or MP. Since
aminotransferases and aldolase reactions are reversible, the cells
are able to produce tryptophan from a racemic mixture of monatin.
Similarly, organisms (both recombinant and wildtype) can be
screened by ability to utilize MP or monatin as a carbon and energy
source. One source of target aldolases is expression libraries of
various Pseudomonas and rhizobacterial strains. Pseudomonads have
many unusual catabolic pathways for degradation of aromatic
molecules and they also contain many aldolases; whereas the
rhizobacteria contain aldolases, are known to grow in the plant
rhizosphere, and have many of the genes described for construction
of a biosynthetic pathway for monatin.
Example 3
Conversion of Tryptophan or Indole-3-Pyruvate to Monatin
[0335] An in vitro process utilizing two enzymes, an
aminotransferase and an aldolase, produced monatin from tryptophan
and pyruvate. In the first step alpha-ketoglutarate was the
acceptor of the amino group from tryptophan in a transamination
reaction generating indole-3-pyruvate and glutamate. An aldolase
catalyzed the second reaction in which pyruvate was reacted with
indole-3-pyruvate, in the presence of Mg.sup.2+ and phosphate,
generating the alpha-keto derivative of monatin (MP),
2-hydroxy-2-(indol-3-ylmethyl)-4-ketoglutaric acid. Transfer of the
amino group from the glutamate formed in the first reaction
produced the desired product, monatin. Purification and
characterization of the product established that the isomer formed
was S,S-monatin. Alternative substrates, enzymes, and conditions
are described as well as improvements that were made to this
process.
[0336] Enzymes
[0337] The aldolase, 4-hydroxy-4-methyl-2-oxoglutarate pyruvate
lyase (ProA aldolase, proA gene) (EC 4.1.3.17) from Comamonas
testosteroni was cloned, expressed and purified as described in
Example 2. The 4-hydroxy-2-oxoglutarate glyoxylate lyases (KHG
aldolases) (EC 4.1.3.16) from B. subtilis, E. coli, and S. meliloti
were cloned, expressed and purified as described in Example 2.
[0338] The aminotransferases used in conjunction with the aldolases
to produce monatin were L-aspartate aminotransferase encoded by the
E. coli aspC gene, the tyrosine aminotransferase encoded by the E.
coli tyrB gene, the S. meliloti TatA enzyme, the broad substrate
aminotransferase encoded by the L. major bsat gene, or the
glutamic-oxaloacetic transaminase from pig heart (Type IIa). The
cloning, expression and purification of the non-mammalian proteins
are described in Example 1. Glutamic-oxaloacetic transaminase from
pig heart (type IIa) was obtained from Sigma (# G7005).
[0339] Method Using ProA Aldolase and L-Aspartate
Aminotransferase
[0340] The reaction mixture contained 50 mM ammonium acetate, pH
8.0, 4 mM MgCl.sub.2, 3 mM potassium phosphate, 0.05 mM pyridoxal
phosphate, 100 mM ammonium pyruvate, 50 mM tryptophan, 10 mM
alpha-ketoglutarate, 160 mg of recombinant C. testosteroni ProA
aldolase (unpurified cell extract, .about.30% aldolase), 233 mg of
recombinant E. coli L-aspartate aminotransferase (unpurified cell
extract, .about.40% aminotransferase) in one liter. All components
except the enzymes were mixed together and incubated at 30.degree.
C. until the tryptophan dissolved. The enzymes were then added and
the reaction solution was incubated at 30.degree. C. with gentle
shaking (100 rpm) for 3.5 hours. At 0.5 and 1 hour after the
addition of the enzymes aliquots of solid tryptophan (50 mmoles
each) were added to the reaction. All of the added tryptophan did
not dissolve, but the concentration was maintained at 50 mM or
higher. After 3.5 hours, the solid tryptophan was filtered off.
Analysis of the reaction mixture by LC/MS using a defined amount of
tryptophan as a standard showed that the concentration of
tryptophan in the solution was 60.5 mM and the concentration of
monatin was 5.81 mM (1.05 g).
[0341] The following methods were used to purify the final product.
Ninety percent of the clear solution was applied to a column of
BioRad AG50W-X8 resin (225 mL; binding capacity of 1.7 meq/mL). The
column was washed with water, collecting 300 mL fractions, until
the absorbance at 280 nm was <5% of the first flow through
fraction. The column was then eluted with 1 M ammonium acetate, pH
8.4, collecting 4 300-mL fractions. All 4 fractions contained
monatin and were evaporated to 105 mL using a roto-evaporator with
a tepid water bath. A precipitate formed as the volume reduced and
was filtered off over the course of the evaporation process.
[0342] Analysis of the column fractions by LC/MS showed that 99% of
the tryptophan and monatin bound to the column. The precipitate
that formed during the evaporation process contained >97%
tryptophan and <2% of monatin. The ratio of tryptophan to
product in the supernatant was approximately 2:1.
[0343] The supernatant (7 ml) was applied to a 100 mL Fast Flow
DEAE Sepharose (Amersham Biosciences) column previously converted
to the acetate form by washing with 0.5 L 1 M NaOH, 0.2 L water,
1.0 L of 1.0 M ammonium acetate, pH 8.4, and 0.5 L water. The
supernatant was loaded at <2 mL/min and the column was washed
with water at 3-4 mL/min until the absorbance at 280 nm was
.about.0. Monatin was eluted with 100 mM ammonium acetate, pH 8.4,
collecting 4 100-mL fractions.
[0344] Analysis of the fractions showed that the ratio of
tryptophan to monatin in the flow through fractions was 85:15 and
the ratio in the eluent fractions was 7:93. Assuming the extinction
coefficient at 280 nm of monatin is the same as tryptophan, the
eluent fractions contained 0.146 mmole of product. Extrapolation to
the total 1 L reaction would produce .about.2.4 mmoles (.about.710
mg) of monatin, for a recovery of 68%.
[0345] The eluent fractions from the DEAE Sepharose column were
evaporated to <20 mL. An aliquot of the product was further
purified by application to a C.sub.8 preparative reversed-phase
column using the same chromatographic conditions as those described
in Example 6 for the analytical-scale monatin characterization.
Waters Fractionlynx.TM. software was employed to trigger automated
fraction collection of monatin based on detection of the m/z=293
ion. The fraction from the C.sub.8 column with the corresponding
protonated molecular ion for monatin was collected, evaporated to
dryness, and then dissolved in a small volume of water. This
fraction was used for characterization of the product.
[0346] The resulting product was characterized using the following
methods.
[0347] UV/Visible Spectroscopy. UV/visible spectroscopic
measurements of monatin produced enzymatically were carried out
using a Cary 100 Bio UV/visible spectrophotometer. The purified
product, dissolved in water, showed an absorption maximum of 280 nm
with a shoulder at 288 nm, characteristics typical of indole
containing compounds.
[0348] LC/MS Analysis. Analyses of mixtures for monatin derived
from the in vitro biochemical reactions were carried out as
described in Example 6. A typical LC/MS analysis of monatin in an
in vitro enzymatic synthetic mixture is illustrated in FIG. 5. The
lower panel of FIG. 5 illustrates a selected ion chromatogram for
the protonated molecular ion of monatin at m/z=293. This
identification of monatin in the mixture was corroborated by the
mass spectrum illustrated in FIG. 6. Analysis of the purified
product by LC/MS showed a single peak with a molecular ion of 293
and absorbance at 280 nm. The mass spectrum was identical to that
shown in FIG. 6.
[0349] MS/MS Analysis. LC/MS/MS daughter ion experiments, as
described in Example 6, were also performed on monatin. A daughter
ion mass spectrum of monatin is illustrated in FIG. 7. Tentative
structural assignments of all fragment ions labeled in FIG. 7 were
made. These include fragment ions of m/z=275 (293--H.sub.2O), 257
(293--(2.times.H.sub.2O)), 230 (275--COOH), 212 (257--COOH), 168
(3-buta-1,3-dienyl-1H-indole carbonium ion), 158
(1H-indole-3-carbaldehyde carbonium ion), 144 (3-ethyl-1H-indole
carbonium ion), 130 (3-methylene-1H-indole carbonium ion), and 118
(indole carbonium ion). Many of these are the same as those
obtained for MP (Example 2), as expected if derived from the indole
portion of the molecule. Some are 1 mass unit higher than those
seen for MP, due to the presence of an amino group instead of a
ketone.
[0350] Accurate Mass Measurement of Monatin. FIG. 8 illustrates the
mass spectrum obtained for purified monatin employing an Applied
Biosystems-Perkin Elmer Q-Star hybrid quadrupole/time-of-flight
mass spectrometer. The measured mass for protonated monatin using
tryptophan as an internal mass calibration standard was 293.1144.
The calculated mass of protonated monatin, based on the elemental
composition C.sub.14H.sub.17N.sub.2O.sub.5 is 293.1137. This is a
mass measurement error of less than 2 parts per million (ppm),
providing conclusive evidence of the elemental composition of
monatin produced enzymatically.
[0351] NMR Spectroscopy. The NMR experiments were performed on a
Varian Inova 500 MHz instrument. The sample of monatin (.about.3
mg) was dissolved in 0.5 ml of D.sub.2O. Initially, the solvent
(D.sub.2O) was used as the internal reference at 4.78 ppm. Since
the peak for water was large, the .sup.1H-NMR was run with
suppression of the peak for water. Subsequently, due to the
broadness of the water peak, the C-2 proton of monatin was used as
the reference peak, and set at the published value of 7.192
ppm.
[0352] For .sup.13C-NMR, an initial run of several hundred scans
indicated that the sample was too dilute to obtain an adequate
.sup.13C spectrum in the allotted time. Therefore, a heteronuclear
multiple quantum coherence (HMQC) experiment was performed, which
enabled the correlation of the hydrogens and the carbons to which
they were attached, and also providing information on the chemical
shifts of the carbons.
[0353] A summary of the .sup.1H and HMQC data is shown in Tables 2
and 3. By comparison to published values, the NMR data indicated
that the enzymatically produced monatin was either (S,S), (R,R), or
a mixture of both.
[0354] Chiral LC/MS Analysis. To establish that the monatin
produced in vitro was one isomer, and not a mixture of the (R,R)
and (S,S) enantiomers, chiral LC/MS analyses were carried out using
the instrumentation described in Example 6.
[0355] Chiral LC separations were made using an Chirobiotic T
(Advanced Separations Technology) chiral chromatography column at
room temperature. Separation and detection, based on published
protocols from the vendor, were optimized for the R-(D) and S-(L)
isomers of tryptophan. The LC mobile phase consisted of A) water
containing 0.05% (v/v) trifluoroacetic acid; B) Methanol containing
0.05% (v/v) trifluoroacetic acid. The elution was isocratic at 70%
A and 30% B. The flow rate was 1.0 mL/min, and PDA absorbance was
monitored from 200 nm to 400 nm. The instrumental parameters used
for chiral LC/MS analysis of tryptophan and monatin are identical
to those described in Example 6 for LC/MS analysis. Collection of
mass spectra for the region m/z 150-400 was utilized. Selected ion
chromatograms for protonated molecular ions ([M+H].sup.+=205 for
both R- and S-tryptophan and [M+H].sup.+=293 for monatin) allowed
direct identification of these analytes in the mixtures.
[0356] The chromatograms of R-- and S-tryptophan and monatin,
separated by chiral chromatography and monitored by MS, are shown
in FIG. 9. The single peak in the chromatogram of monatin indicates
that the compound is one isomer, with a retention time almost
identical to S-tryptophan.
21TABLE 2 .sup.1H NMR data 3 Cargill Vleggaar et al..sup.1 Takeshi
et al..sup.2 Atom .delta..sub.H J(HH) Hz .delta..sub.H J(HH) Hz
.delta..sub.H J(HH) Hz 2 7.192 (1H, s) 7.192 (s) 7.18 (s) 4 7.671
(d) 7.99 7.686 (d) 7.9 7.67 (d) 8.0 5 7.104 (dd) 7.99 7.102 (dd)
8.0, 8.0 7.11 (dd) 7.5, 7.5 6 7.178 (dd) * 7.176 (dd) 8.0, 8.0 7.17
(dd) 7.5, 7.5 7 7.439 (d) 7.99 7.439 (d) 8.1 7.43 (d) 8.0 10a 3.242
(d) 14.5 3.243 (d) 14.3 3.24 (d) 14.5 10b 3.033 (d) 14.5 3.051 (d)
14.3 3.05 (d) 14.5 12 2.626 (dd) 15.5, 1.5 2.651 (dd) 15.3, 1.7
2.62 (dd) 15.5, 1.8 2.015 (dd) 15.0, 12.0 2.006 (dd) 15.3, 11.7
2.01 (dd) 15.5, 12.0 13 3.571 (dd) 10.75*, 1.5 3.168 (dd) 11.6, 1.8
3.57 (dd) 12.0, 1.8 .sup.1Vleggaar et al. (J.C.S. Perkin Trans.
1:3095-8, 1992). .sup.2Takeshi and Shusuke (JP 2002060382,
2002-02-26).
[0357]
22TABLE 3 .sup.13C NMR data (from HMQC spectrum) Cargill Vleggaar
et al..sup.1 Atom .delta..sub.C .delta..sub.C 2 126.1 126.03 3 *
110.31 4 120.4 120.46 5 120.2 120.25 6 122.8 122.74 7 112.8 112.79
8 * 137.06 9 * 129.23 10a 36.4 36.53 12 39.5 39.31 13 54.9 54.89 14
* 175.30 15 * 181.18 .sup.1Vleggaar et al. (J.C.S. Perkin Trans. 1:
3095-8, 1992).
[0358] Polarimetry. The optical rotation was measured on a Rudolph
Autopol III polarimeter. The monatin was prepared as a 14.6 mg/mL
solution in water. The expected specific rotation
([.alpha.].sub.D.sup.20) for S,S monatin (salt form) is -49.6 for a
1 g/mL solution in water (Vleggaar et al). The observed
[.alpha.].sub.D.sup.20 was -28.1 for the purified, enzymatically
produced monatin indicating that it was the S, S isomer.
[0359] Improvements
[0360] The reaction conditions, including reagent and enzyme
concentrations, were optimized and yields 5-10 mg/mL were produced
using the following reagent mix: 50 mM ammonium acetate pH 8.3, 2
mM MgCl.sub.2, 200 mM pyruvate (sodium or ammonium salt), 5 mM
alpha-ketoglutarate (sodium salt), 0.05 mM pyridoxal phosphate,
deaerated water to achieve a final volume of 1 mL after the
addition of the enzymes, 3 mM potassium phosphate, 50 .mu.g/mL of
recombinant ProA aldolase (cell extract; total protein
concentration of 167 .mu.g/mL), 1000 .mu.g/mL of L-aspartate
aminotransferase encoded by the E. coli aspC gene (cell extract;
total protein concentration of 2500 .mu.g/mL), and solid tryptophan
to afford a concentration of >60 mM (saturated; some undissolved
throughout the reaction). The mixture was incubated at 30.degree.
C. for 4 hours with gentle stirring or mixing.
[0361] Substitutions
[0362] The concentration of alpha-ketoglutarate can be reduced to 1
mM and supplemented with 9 mM aspartate with an equivalent yield of
monatin. Alternative amino acid acceptors can be utilized in the
first step, such as oxaloacetate.
[0363] When recombinant L. major broad substrate aminotransferase
was used in place of the E. coli L-aspartate aminotransferase,
similar yields of monatin were achieved. However, a second
unidentified product (3-10% of the major product) with a molecular
mass of 292 was also detected by LC-MS analysis. Monatin
concentrations of 0.1-0.5 mg/mL were produced when the E. coli tyrB
encoded enzyme, the S. meliloti tat A encoded enzyme or the
glutamic-oxaloacetic transaminase from pig heart (type IIa) was
added as the aminotransferase. When starting the reaction from
indole-3-pyruvate, a reductive amination can be done for the last
step with glutamate dehydrogenase and NADH (as in Example 4).
[0364] The KHG aldolases from B. subtilis, E. coli , and S.
meliloti were also used with the E. coli L-aspartate
aminotransferase to produce monatin enzymatically. The following
reaction conditions were used: 50 mM NH.sub.4--OAc pH 8.3, 2 mM
MgCl.sub.2, 200 mM pyruvate, 5 mM glutamate, 0.05 mM pyridoxal
phosphate, deaerated water to achieve a final volume of 0.5 mL
after the addition of the enzymes, 3 mM potassium phosphate, 20
.mu.g/mL of recombinant B. subtilis KHG aldolase (purified), ca.
400 .mu.g/mL of E. coli L-aspartate aminotransferase (AspC)
unpurified from cell extract, and 12 mM indole-3-pyruvate. The
reactions were incubated at 30.degree. C. for 30 minutes with
shaking. The amount of monatin produced using the B. subtilis
enzyme was 80 ng/mL, and increased with increasing amounts of
aldolase. If indole-3-pyruvate and glutamate were replaced by
saturating amounts of tryptophan and 5 mM alpha-ketoglutarate, the
production of monatin was increased to 360 ng/mL. Reactions were
repeated with 30 .mu.g/mL of each of the three KHG enzymes in 50 mM
Tris pH 8.3, with saturating amounts of tryptophan, and were
allowed to proceed for an hour in order to increase detection. The
Bacillus enzyme had the highest activity as in Example 2, producing
approximately 4000 ng/mL monatin. The E. coli KHG produced 3000
ng/mL monatin, and the S. meliloti enzyme produced 2300 ng/mL.
Example 4
[0365] Interconversion Between MP and Monatin
[0366] The amination of MP to form monatin can be catalyzed by
aminotransferases such as those identified in Examples 1 and 3, or
by dehydrogenases that require a reducing cofactor such as NADH or
NADPH. These reactions are reversible and can be measured in either
direction. The directionality, when using a dehydrogenase enzyme,
can be largely controlled by the concentration of ammonium
salts.
[0367] Dehydrogenase activity. The oxidative deamination of monatin
was monitored by following the increase in absorbance at 340 nm as
NAD(P)+ was converted to the more chromophoric NAD(P)H. Monatin was
enzymatically produced and purified as described in Example 3.
[0368] A typical assay mixture contained 50 mM Tris-HCl, pH 8.0 to
8.9, 0.33 mM NAD.sup.+ or NADP.sup.+, 2 to 22 units of glutamate
dehydrogenase (Sigma), and 10-15 mM substrate in 0.2 mL. The assay
was performed in duplicate in a UV-transparent microtiter plate, on
a Molecular Devices SpectraMax Plus platereader. A mix of the
enzyme, buffer, and NAD(P).sup.+ were pipetted into wells
containing the substrate and the increase in absorbance at 340 nm
was monitored at 10 second intervals after brief mixing. The
reaction was incubated at 25.degree. C. for 10 minutes. Negative
controls were carried out without the addition of substrate, and
glutamate was utilized as a positive control. The type III
glutamate dehydrogenase from bovine liver (Sigma # G-7882)
catalyzed the conversion of the monatin to the monatin precursor at
a rate of conversion approximately one-hundredth the rate of the
conversion of glutamate to alpha-ketoglutarate.
[0369] Transamination activity. Monatin aminotransferase assays
were conducted with the aspartate aminotransferase (AspC) from E.
coli, the tyrosine aminotransferase (TyrB) from E. coli, the broad
substrate aminotransferase (BSAT) from L. major, and the two
commercially available porcine glutamate-oxaloacetate
aminotransferases described in Example 1. Both oxaloacetate and
alpha-ketoglutarate were tested as the amino acceptor. The assay
mixture contained (in 0.5 mL) 50 mM Tris-HCl, pH 8.0, 0.05 mM PLP,
5 mM amino acceptor, 5 mM monatin, and 25 .mu.g of
aminotransferase. The assays were incubated at 30.degree. C. for 30
minutes, and the reactions were stopped by addition of 0.5 mL
isopropyl alcohol. The loss of monatin was monitored by LC/MS
(Example 6). The highest amount of activity was noted with L. major
BSAT with oxaloacetate as the amino acceptor, followed by the same
enzyme with alpha-ketoglutarate as the amino acceptor. The relative
activity with oxaloacetate was: BSAT>AspC>porcine type
IIa>porcine type I=TyrB. The relative activity with
alpha-ketoglutarate was: BSAT>AspC>porcine type I>porcine
type IIa>TyrB.
[0370] Using assays similar to those described above, and the
detection methods described in Example 6, two enzymes, S. meliloti
tatA and R. sphaeroides tatA, did not appear to detectably convert
monatin to MP under the conditions tested. This lack of detectable
activity, however, may be due to the fact that MP is sometimes
difficult to detect because it is unstable in an aqueous
solution.
Example 5
Production of Monatin from Tryptophan and C3 Sources Other than
Pyruvate
[0371] As described above in Example 3, indole-3-pyruvate or
tryptophan can be converted to monatin using pyruvate as the C3
molecule. However, in some circumstances, pyruvate may not be a
desirable raw material. For example, pyruvate may be more expensive
than other C3 carbon sources, or may have adverse effects on
fermentations if added to the medium. Alanine can be transaminated
by many PLP-enzymes to produce pyruvate.
[0372] Tryptophanase-like enzymes perform beta-elimination
reactions at faster rates than other PLP enzymes such as
aminotransferases. Enzymes from this class (4.1.99.-) can produce
ammonia and pyruvate from amino acids such as L-serine, L-cysteine,
and derivatives of serine and cysteine with good leaving groups
such as O-methyl-L-serine, O-benzyl-L-serine, S-methylcysteine,
S-benzylcysteine, S-alkyl-L-cysteine, O-acyl-L-serine,
3-chloro-L-alanine.
[0373] Processes to produce monatin using EC 4.1.99.-polypeptides
can be improved by mutating the .beta.-tyrosinase (TPL) or
tryptophanase according to the method of Mouratou et al. (J. Biol.
Chem 274:1320-5, 1999). Mouratou et al. describe the ability to
covert the .beta.-tyrosinase into a dicarboxylic amino acid
.beta.-lyase, which has not been reported to occur in nature. The
change in specificity was accomplished by converting valine (V) 283
to arginine (R) and arginine (R) 100 to threonine (T). These amino
acid changes allow for the lyase to accept a dicarboxylic amino
acid for the hydrolytic deamination reaction (such as aspartate).
Aspartate, therefore, can also be used as a source of pyruvate for
subsequent aldol condensation reactions.
[0374] Additionally, cells or enzymatic reactors can be supplied
with lactate and an enzyme that converts lactate to pyruvate.
Examples of enzymes capable of catalyzing this reaction include
lactate dehydrogenase and lactate oxidase.
[0375] Isolation of Genomic DNA
[0376] Tryptophanase polypeptides have previously been reported in,
for example, Mouratou et al. (JBC 274:1320-5, 1999). To isolate
genes that encode tryptophanase polypeptides, genomic DNA from E.
coli DH10B was used as a template for PCR as described in Example
1.
[0377] The gene for tyrosine-phenol lyase was isolated from C.
freundii (ATCC catalog number 8090, Designation ATCC 13316; NCTC
9750) and grown on Nutrient agar (Difco 0001) and nutrient broth
(Difco 0003) at 37.degree. C. to an OD of 2.0. The genomic DNA was
purified using a Qiagen Genomic-tip.TM. 100/G kit.
[0378] PCR Amplification of Coding Sequences
[0379] Primers were designed with compatible overhangs for the pET
30 Xa/LIC vector (Novagen, Madison, Wis.) as described above in
Example 1.
[0380] E. coli tna (SEQ ID NO: 41). N-terminal primer for pET30
Xa/LIC cloning: 5'-GGT ATT GAG GGT CGC ATG GAA AAC TTT AAA CAT
CT-3' (SEQ ID NO: 43). C-terminal primer for pET30 Xa/LIC cloning:
5'-AGA GGA GAG TTA GAG CCT TAA ACT TCT TTA AGT TTT G-3' (SEQ ID NO:
44).
[0381] C. freundii tpl (SEQ ID NO: 42). N-terminal primer for pET30
Xa/LIC cloning:
23 (SEQ ID NO: 45) 5'-GGT ATT GAG GGT CGC
ATGAATTATCCGGCAGAACC-3'.
[0382] C-terminal primer for pET 30 Xa/LIC cloning:
24 (SEQ ID NO: 46) 5'-AGA GGA GAG TTA GAG
CCTTAGATGTAATCAAAGCGTG-3'.
[0383] The Eppendorf Mastercycler.TM. Gradient 5331 Thermal Cycler
was used for all PCR reactions. In 50 .mu.L was added 0.5 .mu.g
template (genomic DNA), 1.0 .mu.M of each primer, 0.4 mM each dNTP,
3.5 U Expand High Fidelity Polymerase (Roche), 1.times. Expand
buffer with Mg, and 5% DMSO (final concentration). The thermocycler
PCR program used was as follows: 96.degree. C. hot start (5
minutes), 94.degree. C.--30 seconds, 40-60.degree. C.--1 minute 45
seconds, 72.degree. C.--2 minutes 15 seconds; 30 repetitions. The
final polymerization step was for 7 minutes, and the samples were
then stored at 4.degree. C.
[0384] Cloning
[0385] Cloning and positive clone identification procedures
detailed above in Example 1 were used to identify the appropriate
clones.
[0386] Gene Expression and Activity Assays
[0387] Plasmid DNA (verified by sequence analysis) was subcloned
into the expression host BL21(DE3)(Novagen). The cultures were
grown in LB medium with 30 mg/L kanamycin, the plasmids were
isolated using a Qiagen miniprep kit, and analyzed by restriction
digest to confirm identity.
[0388] Induction experiments were done with the BL21(DE3)
expression host, the constructs were grown in LB medium containing
50 mg/L kanamycin at 37.degree. C. Protein expression was induced
using 0.1 mM IPTG after the OD.sub.600 of the culture reached
approximately 0.6. The cells were grown for 4 hours at 30.degree.
C. and harvested by centrifugation. The cells were then lysed in 5
mL/g wet cell weight BugBuster.TM. (Novagen) reagent containing 5
.mu.L/mL protease inhibitor cocktail set #III (Calbiochem) and 1
.mu.L/mL benzonase nuclease (Novagen), and the His-tagged
recombinant proteins were purified using the His-Bind cartridges as
described above in Example 1. Purified proteins were desalted on a
PD-10 (G25 Sephadex, Amersham Biosciences) column and eluted in 100
mM Tris-Cl buffer, pH 8.0. The proteins were analyzed by SDS-PAGE
on 4-15% gradient gels to check for soluble protein levels at the
predicted MW of the recombinant fusion protein.
[0389] Mutagenesis
[0390] Some members of polypeptide class 4.1.99.--(tryptophanase
and .beta.-tyrosinase) will perform the beta-lyase reaction with
aspartate or similar amino acids without any modification. However,
some members of the class may need to be mutagenized to allow for
the use of the substrates and/or the creation of the product.
Moreover, in some cases polypeptides that can perform the
conversion can be further optimized by mutagenesis.
[0391] Site directed mutagenesis was performed based on 3D
structure analysis of PLP-binding polypeptides. Two examples for
changing the substrate specificity of the polypeptides are shown
below.
Mutagenesis of Tryptophanase Example A
[0392] The mutagenesis protocol provided below introduced two point
mutations in the amino acid sequence. The first point mutation
changed arginine (R) at position 103 to threonine (T) and the
second point mutation changed valine (V) at position 299 to
arginine (R) (numbering system for E. coli mature protein).
Mutagenesis experiments were performed by ATG Laboratories (Eden
Prairie, Minn.). Mutations were introduced sequentially by PCR of
gene fragments and reassembly of the fragments was accomplished by
PCR as well.
[0393] Primers for converting arginine (R)103 to threonine (T):
25 (SEQ ID NO: 47) 5'-CCAGGGCACCGGCGCAGAGCAAATCTATATT-3' and (SEQ
ID NO: 48) 5'-TGCGCCGGTGCCCTGGTGAGTCGGAA- TGGT-3'.
[0394] Primers for converting valine (V)299 to arginine (R):
26 (SEQ ID NO: 49) 5'-TCCTGCACGCGGCAAAGGGTTCTGCACTCGGT-3' and (SEQ
ID NO: 50) 5'-CTTTGCCGCGTGCAGGAAGGCTTCCC- GACA-3'.
[0395] Mutants were screened by restriction digest with Xba
I/HindIII and SphI, and verified by sequencing.
Mutagenesis of Tyrosine Phenol Lyase (.beta.-tyrosinase) Example
B
[0396] Two point mutations were made to the tyrosine phenol lyase
amino acid sequence. These mutations converted arginine (R) at
position 100 to threonine (T) and valine (V) at position 283 to
arginine (R) (in C. freundii mature protein sequence).
[0397] Primers for the R100T conversion were:
27 (SEQ ID NO: 51) 5'-AGGGGACCGGCGCAGAAAACCTGTTATCG-3' and (SEQ ID
NO: 52) 5'-TCTGCGCCGGTCCCCTGGTGAGTCGGAACAAT-3'.
[0398] Primers for the V283R conversion were:
28 (SEQ ID NO: 53) 5'-GTTAGTCCGCGTCTACGAAGGGATGCCAT-3' and (SEQ ID
NO: 54) 5'-GTAGACGCGGACTAACTCTTTGGCAGAAG-3'.
[0399] The methods described above were used, and the clones were
screened by KpnI/SacI digestion, and BstXI digestion. The sequences
were verified by dideoxy chain termination sequencing. Recombinant
protein was produced as described above for the wildtype
enzymes.
[0400] The reaction mixture consisted of 50 mM Tris-Cl pH 8.3, 2 mM
MgCl.sub.2, 200 mM C3 carbon source, 5 mM alpha-ketoglutarate,
sodium salt, 0.05 mM pyridoxal phosphate, deaerated water to
achieve a final volume of 0.5 mL after the addition of the enzymes,
3 mM potassium phosphate pH 7.5, 25 .mu.g of crude recombinant C.
testosteroni ProA aldolase as prepared in Example 2, 500 .mu.g of
crude L-aspartate aminotransferase (AspC) as prepared in Example 1,
and solid tryptophan to afford a concentration of >60 mM
(saturated; some undissolved throughout the reaction). The reaction
mix was incubated at 30.degree. C. for 30 minutes with mixing.
Serine, alanine, and aspartate were supplied as 3-carbon sources.
Assays were performed with and without secondary PLP enzymes
(purified) capable of performing beta-elimination and beta-lyase
reactions (tryptophanase (TNA), double mutant tryptophanase,
.beta.-tyrosinase (TPL)). The results of the LC/MS analyses of the
reaction mixtures are shown in Table 4:
29TABLE 4 Production of monatin utilizing alternative C3-carbon
sources Additional PLP C3-carbon source Enzyme Relative Activity
none None 0% pyruvate None 100% serine None 3% serine 11 .mu.g
wildtype TNA (1 U) 5.1% serine 80 .mu.g double mutant TNA 4.6%
alanine None 32% alanine 11 .mu.g wildtype TNA 41.7% alanine 80
.mu.g mutant TNA 43.9% aspartate 110 .mu.g wildtype TNA (10 U) 7.7%
aspartate 5 U wildtype TPL (crude) 5.1% aspartate 80 .mu.g mutant
TNA 3.3%
[0401] The monatin produced from alanine and serine as 3-carbon
sources was verified by LC/MS/MS daughter scan analysis, and was
identical to the characterized monatin produced in Example 3.
Alanine was the best alternative tested, and was transaminated by
the AspC enzyme. The amount of monatin produced was increased by
addition of the tryptophanase, which has a transamination secondary
activity. The amount of monatin produced with serine as a carbon
source nearly doubled with the addition of the tryptophanase
enzymes, even though only one-fifth of the amount of tryptophanase
was added in comparison to the aminotransferase. AspC is capable of
some amount of beta-elimination activity alone. The results with
aspartate indicate that the tryptophanase activity on aspartate
does not increase with the same site-directed mutations as
previously suggested for .beta.-tyrosinase. It is expected that the
mutant .beta.-tyrosinase will have higher activity for production
of monatin.
Example 6
[0402] Detection of Monatin, MP, Tryptophan, and Glutamic Acid
[0403] This example describes methods used to detect the presence
of monatin, or its precursor 2-hydroxy 2-(indol-3-ylmethyl)-4-keto
glutaric acid, as well tryptophan and glutamic acid. It also
describes a method for the separation and detection of the four
stereoisomers of monatin.
[0404] LC/MS Analysis of Monatin, MP, and Tryptophan
[0405] Analyses of mixtures for monatin, MP, and/or tryptophan
derived from in vitro or in vivo biochemical reactions were
performed using a Waters/Micromass liquid chromatography-tandem
mass spectrometry (LC/MS/MS) instrument including a Waters 2795
liquid chromatograph with a Waters 996 Photo-Diode Array (PDA)
absorbance monitor placed in series between the chromatograph and a
Micromass Quattro Ultima triple quadrupole mass spectrometer. LC
separations were made using an Xterra MS C.sub.8 reversed-phase
chromatography column, 2.1 mm.times.250 mm, or a Supelco Discovery
C.sub.18 reversed phase chromatography column, 2.1 mm.times.150 mm
at room temperture or at 40.degree. C. The LC mobile phase
consisted of A) water containing 0.05% (v/v) trifluoroacetic acid
and B) methanol containing 0.05% (v/v) trifluoroacetic acid.
[0406] The gradient elution was linear from 5% B to 35% B, 0-4 min,
linear from 35% B to 60% B, 4-6.5 min, linear from 60% B to 90% B,
6.5-7 min, isocratic at 90% B 7-11 min, linear from 90% B to 95% B,
11-12 min, linear from 95% B to 5% B, 12-13 min, with a 5 min
re-equilibration period between runs. The flow rate was 0.25
mL/min, and PDA absorbance was monitored from 200 nm to 400 nm. All
parameters of the ESI-MS were optimized and selected based on
generation of protonated molecular ions ([M+H].sup.+) of the
analytes of interest, and production of characteristic fragment
ions.
[0407] The following instrumental parameters were used for LC/MS
analysis of monatin: Capillary: 3.5 kV; Cone: 40 V; Hex 1: 20 V;
Aperture: 0 V; Hex 2: 0 V; Source temperature: 100.degree. C.;
Desolvation temperature: 350.degree. C.; Desolvation gas: 500 L/h;
Cone gas: 50 L/h; Low mass resolution (Q1): 15.0; High mass
resolution (Q1): 15.0; Ion energy: 0.2; Entrance: 50V; Collision
Energy: 2; Exit: 50V; Low mass resolution (Q2): 15; High mass
resolution (Q2): 15; Ion energy (Q2): 3.5; Multiplier: 650.
Uncertainties for reported mass/charge ratios (m/z) and molecular
masses are .+-.0.01%. Initial detection of the alpha-keto acid form
of monatin (MP) and monatin in the mixtures was accomplished by
LC/MS monitoring with collection of mass spectra for the region m/z
150-400. Selected ion chromatograms for protonated molecular ions
([M+H].sup.+=292 for MP, [M+H].sup.+=293 for monatin,
[M+H].sup.+=205 for tryptophan) allowed direct identification of
these analytes in the mixtures. Subsequent methods for monatin and
MP detection used multiple reaction monitoring (MRM) LC/MS/MS
methodology (see below).
[0408] LC/MS/MS Analysis for Monatin
[0409] LC/MS/MS daughter ion experiments were performed on monatin
as follows. A daughter ion analysis involves transmission of the
parent ion (e.g., m/z=293 for monatin) of interest from the first
mass analyzer (Q1) into the collision cell of the mass
spectrometer, where argon is introduced and chemically dissociates
the parent into fragment (daughter) ions. These fragment ions are
then detected with the second mass analyzer (Q2), and can be used
to corroborate the structural assignment of the parent. Tryptophan
was characterized and quantified in the same way via transmission
and fragmentation of m/z=205.
[0410] The following instrumental parameters were used for LC/MS/MS
analysis of monatin: Capillary: 3.5 kV; Cone: 40 V; Hex 1: 20 V;
Aperture: 0 V; Hex 2: 0 V; Source temperature: 100 .degree. C.;
Desolvation temperature: 350.degree. C.; Desolvation gas: 500 L/h;
Cone gas: 50 L/h; Low mass resolution (Q1): 13.0; High mass
resolution (Q1): 13.0; Ion energy: 0.2; Entrance: -5 V; Collision
Energy: 14; Exit: 1V; Low mass resolution (Q2): 15; High mass
resolution (Q2): 15; Ion energy (Q2): 3.5; Multiplier: 650.
[0411] LC/MS/MS Multiple Reaction Monitoring
[0412] To increase the, sensitivity and selectivity of monatin
detection, an LC/MS/MS method employing MRM measurements has been
developed. LC separations were performed as described in previous
sections. Instrumental parameters for EST-MS/MS were set up as
described in the previous section, except that low and high mass
resolution settings for Q1 and Q2 are set to 12.0 to maximize
sensitivity. Five monatin-specific parent-to daughter transitions
are used to specifically detect monatin in in vitro and in vivo
reactions. The transitions are 293.1 to 158.3, 293.1 to 168.2,
293.1 to 211.2, 293.1 to 230.2, and 293.1 to 257.2.
[0413] High-Throughput Determination of Monatin, Tryptophan, and
Glutamic Acid (Glutamate)
[0414] High-throughput analyses (<5 min/sample) of mixtures for
monatin, tryptophan, and/or glutamic acid derived from in vitro or
in vivo reactions were carried out using instrumentation described
above, and the same MS parameters as described for LC/MS/MS
Multiple Reaction Monitoring. LC separations were made using a 4.6
mm.times.50 mm Advanced Separation Technologies Chirobiotic T
column at room temperature. The LC mobile phase consisted of A)
water containing 0.25% acetic acid; B) Methanol containing 0.25%
acetic acid. The isocratic elution was at 50% B, 0-5 min. The flow
rate was 0.6 mL/min. All parameters of the ESI-MS/MS system were
optimized and selected based on optimal in-source generation of the
protonated molecular ions of tryptophan and monatin and the
internal standard .sup.2H.sub.5-tryptophan or
.sup.2H.sub.3-glutamic acid, as well as collision-induced
production of analyte-specific fragment ions for multiple reaction
monitoring (MRM) experiments (204.7 to 146.4 for tryptophan, 209.7
to 151.4 for .sup.2H.sub.5-tryptophan, 147.6 to 102.4 for glutamic
acid, 150.6 to 105.4 for .sup.2H.sub.3-glutamic acid,
monatin-specific transitions listed in the previous section).
[0415] Accurate Mass Measurement of Monatin.
[0416] High resolution MS analysis was carried out using an Applied
Biosystems-Perkin Elmer Q-Star hybrid quadrupole/time-of-flight
mass spectrometer. The measured mass for protonated monatin used
tryptophan as an internal mass calibration standard. The calculated
mass of protonated monatin, based on the elemental composition
C.sub.14H.sub.17N.sub.2O.sub.- 5 is 293.1137. Monatin produced
using the biocatalytic process described in Example 3 showed a
measured mass of 293.1144. This is a mass measurement error of less
than 2 parts per million (ppm), providing conclusive evidence of
the elemental composition of monatin produced enzymatically.
[0417] Chiral LC/MS/MS (MRM) Measurement of Monatin
[0418] Determination of the stereoisomer distribution of monatin in
in vitro and in vivo reactions was accomplished by derivitization
with 1-fluoro-2-4-dinitrophenyl-5-L-alanine amide (FDAA), followed
by reversed-phase LC/MS/MS MRM measurement.
[0419] Derivitization of Monatin with FDAA
[0420] To 50 .mu.L of sample or standard was added 200 .mu.L of a
1% solution of FDAA in acetone. Forty .mu.L of 1.0 M Sodium
bicarbonate was added, and the mixture incubated for 1 h at
40.degree. C. with occasional mixing. The sample was removed and
cooled, and neutralized with 20 .mu.L of 2.0 M HCl (more HCl may be
required to effect neutralization of a buffered biological
mixture). After degassing is complete, samples were ready for
analysis by LC/MS/MS.
[0421] LC/MS/MS Multiple Reaction Monitoring for the Determination
of the Stereoisomer Distribution of Monatin in in vitro and in vivo
Reactions.
[0422] Analyses were performed using the LC/MS/MS instrumentation
described in previous sections. LC separations capable of
separating all four stereoisomers of monatin (specifically
FDAA-monatin) were performed on a Phenomenex Luna (5 .mu.m) C18
reversed phase chromatography column at 40.degree. C. The LC mobile
phase consisted of A) water containing 0.05% (mass/volume) ammonium
acetate and B) acetonitrile. The gradient elution was linear from
2% B to 34% B, 0-33 min, linear from 34% B to 90% B, 33-34 min,
isocratic at 90% B 34-44 min, and linear from 90% B to 2% B, 44-46
min, with a 16 min re-equilibration period between runs. The flow
rate was 0.25 mL/min, and PDA absorbance was monitored from 200 nm
to 400 nm. All parameters of the ESI-MS were optimized and selected
based on generation of protonated molecular ions ([M+H].sup.+) of
FDAA-monatin, and production of characteristic fragment ions.
[0423] The following instrumental parameters were used for LC/MS
analysis of monatin in the negative ion ESI/MS mode: Capillary: 2.0
kV; Cone: 25 V; Hex 1: 10 V; Aperture: 0 V; Hex 2: 0 V; Source
temperature: 100.degree. C.; Desolvation temperature: 350.degree.
C.; Desolvation gas: 500 L/h; Cone gas: 50 L/h; Low mass resolution
(Q1): 12.0; High mass resolution (Q1): 12.0; Ion energy: 0.2;
Entrance: -5V; Collision Energy: 20; Exit: 1V; Low mass resolution
(Q2): 12; High mass resolution (Q2): 12; Ion energy (Q2): 3.0;
Multiplier: 650. Three FDAA-monatin-specific parent-to daughter
transitions are used to specifically detect FDAA-monatin in in
vitro and in vivo reactions. The transitions are 543.6 to 268.2,
543.6 to 499.2, and 543.6 to 525.2. Identification of FDAA-monatin
stereoisomers is based on chromatographic retention time as
compared to purified monatin stereoisomers, and mass spectral
data.
[0424] Liquid Chromatography-Post Column Fluorescence Detection of
Amino Acids Including Glutamate
[0425] Liquid chromatography with post-column fluorescence
detection for the determination of glutamic acid in in vitro and in
vivo reactions was performed on a Waters 2690 LC system or
equivalent combined with a Waters 474 scanning fluorescence
detector, and a Waters post-column reaction module. LC separations
were performed on an Interaction-Sodium loaded ion exchange column
at 60.degree. C. Mobile phase A was Pickering Na 328 buffer
(Pickering Laboratories, Inc.; Mountain View, Calif.). Mobile phase
B was Pickering Na 740 buffer. The gradient elution was from 0% B
to 100% B, 0-20 min, isocratic at 100% B, 20-30 min, and linear
from 100% B to 0% B, 30-31 min, with a 20 min re-equilibration
period between runs. The flow rate for the mobile phase was 0.5
mL/min. The flow rate for the OPA post-column derivitization
solution was 0.5 mL/min. The fluorescence detector settings were EX
338 nm and Em 425 nm. Norleucine was employed as an internal
standard for the analysis. Identification of amino acids was based
on chromatographic retention time data for purified standards.
Example 7
[0426] Production of Monatin in Bacteria
[0427] This example describes methods used to produce monatin in E.
coli cells. One skilled in the art will understand that similar
methods can be used to produce monatin in other bacterial cells. In
addition, vectors containing other genes in the monatin synthesis
pathway (FIG. 2) can be used.
[0428] Production of Monatin in E. coli BL21(DE3)::proA/pET30
Xa/LIC Cells
[0429] Fresh plates of E. coli BL21(DE3)::C. testosteroni
proA/pET30 Xa/LIC cells (as described in Example 2) were prepared
on LB medium containing 50 .mu.g/mL kanamycin. Overnight cultures
(5 mL) were inoculated from a single colony and grown at 30.degree.
C. in LB medium with kanamycin. Typically, a 1 to 50 inoculum was
used for induction in trp-1+glucose medium containing 50 .rho.g/mL
kanamycin.
[0430] Trp-1+glucose medium, a minimal medium that has been used
for increased production of tryptophan in E. coli cells (Zeman et
al. Folia Microbiol. 35:200-4, 1990), was prepared as follows. To
700 mL nanopure water the following reagents were added: 2 g
(NH.sub.4).sub.2SO.sub.4, 13.6 g KH.sub.2PO.sub.4, 0.2 g
MgSO.sub.4*7H.sub.2O, 0.01 g CaCl.sub.2*2H.sub.2O and 0.5 mg
FeSO.sub.4*7H.sub.2O. The pH was adjusted to 7.0, the volume was
increased to 850 mL, and the medium was autoclaved. A 50% glucose
solution was prepared separately, and sterile-filtered. Forty mL
was added to the base medium (850 mL) for a 1 L final volume.
[0431] A 10 g/L L-tryptophan solution was prepared in 0.1 M sodium
phosphate pH 7, and sterile-filtered. One-tenth volume was
typically added to cultures as specified below. A 10% sodium
pyruvate solution was also prepared and sterile-filtered. A 10 mL
aliquot was typically used per liter of culture. Stocks of
ampicillin (100 mg/mL), kanamycin (25 mg/mL) and IPTG (840 mM) were
prepared, sterile-filtered, and stored at -20.degree. C. before
use. Tween 20 (polyoxyethylene 20-Sorbitan monolaurate) was
utilized at a 0.2% (vol/vol) final concentration. Ampicillin was
used at non-lethal concentrations, typically 1-10 .mu.g/mL final
concentration.
[0432] Cells were grown at 37.degree. C. and sampled every hour
until an OD.sub.600 of 0.35-0.8 was obtained. Cells were then
induced with 0.1 mM IPTG, and the incubation temperature was
reduced to 34.degree. C. Samples (1 ml) were collected prior to
induction (zero time point) and centrifuged at 5000.times.g. The
supernatant was frozen at -20.degree. C. for LC-MS analysis. Four
hours post-induction, another 1 mL sample was collected and
centrifuged to separate the broth from the cell pellet. Tryptophan,
sodium pyruvate, ampicillin, and Tween were added as described
above.
[0433] The cells were grown for 48 hours post-induction, and
another 1 mL sample was taken and prepared as above. At 48 hours,
another aliquot of tryptophan and pyruvate were added. The entire
culture volume was centrifuged after approximately 70 hours of
growth (post-induction), for 20 minutes at 4.degree. C. and 3500
rpm. The supernatant was decanted and both the broth and the cells
were frozen at -80.degree. C. The broth fractions were filtered and
analyzed by LC/MS. The heights and areas of the [M+H].sup.+=293
peaks were monitored as described in Example 6. The background
level of the medium was subtracted. The data was also normalized
for cell growth by plotting the height of the [M+H].sup.+=293 peak
divided by the optical density of the culture at 600 nm.
[0434] Higher levels of monatin were produced when pyruvate,
ampicillin, and Tween were added 4 hours post induction rather than
at induction. Other additives such as PLP, additional phosphate, or
additional MgCl.sub.2 did not increase the production of monatin.
Higher titers of monatin were obtained when tryptophan was utilized
instead of indole-3-pyruvate, and when the tryptophan was added
post-induction rather than at inoculation, or at induction. Prior
to induction, and 4 hours post-induction (at time of substrate
addition), there was typically no detectable level of monatin in
the fermentation broth or cellular extracts. Negative controls were
done utilizing cells with pET30a vector only, as well as cultures
where tryptophan and pyruvate were not added. A parent MS scan
demonstrated that the compound with (m+1)/z=293 was not derived
from larger molecules, and daughter scans (performed as in Example
6) were similar to monatin made in vitro.
[0435] The effect of a non-ionic detergent (such as Tween, Trixon
X-100 and dodecylammonium acetate) on monatin cell secretion was
studied. In particular, the effect of Tween on the secretion of
monatin was studied by utilizing 0, 0.2% (vol/vol), and 0.6% final
concentrations of Tween-20. The highest amount of monatin produced
by shake flasks was at 0.2% Tween. Other Tween types (for example,
Tween-40, Tween-60, and Tween-80) were also tested in E. coli at
this concentration, because in this host it is expected that many
detergents will non-specifically increase the leakiness of the
cell, although the growth of the cells is typically inhibited by
Tween or other detergents. Tween 40 caused the least inhibition to
growth, followed by Tween 60, Tween 80, and Tween 20. The final
OD.sub.600 of cells grown in Tween 20 was slightly over half of the
cultures grown in the presence of Tween 40.
[0436] The ampicillin concentration was varied between 0 and 10
.mu.g/mL. The amount of monatin in the cellular broth increased
rapidly (2.5.times.) between 0 and 1 .mu.g/mL, and increased
1.3.times. when the ampicillin concentration was increased from 1
to 10 .mu.g/mL.
[0437] A time course experiment showing typical results is shown in
FIG. 10. The amount of monatin secreted into the cell broth
increased, even when the values are normalized for cell growth. By
using the molar extinction coefficient of tryptophan, the amount of
monatin in the broth was estimated to be less than 10 .mu.g/mL. The
same experiment was repeated with the cells containing vector
without proA insert. Many of the numbers were negative, indicating
the peak height at (m+1)/z=293 was less in these cultures than in
the medium alone (FIG. 10). The numbers were consistently lower
when tryptophan and pyruvate were absent, demonstrating that
monatin production is a result of an enzymatic reaction catalyzed
by the aldolase enzyme.
[0438] The in vivo production of monatin in bacterial cells was
repeated in 800 mL shake flask experiments and in fermentors. A 250
mL sample of monatin (in cell-free broth) was purified by anion
exchange chromatography and preparative reverse-phase liquid
chromatography. This sample was evaporated, and submitted for high
resolution mass analysis (described in Example 3). The high
resolution MS indicated that the metabolite being produced is
monatin.
[0439] Because the optimization experiments for the in vitro
process suggested that higher concentrations of monatin could be
produced when the aminotransferase concentration was several times
higher than that of the aldolase (see Example 3), an operon was
constructed for in vivo studies in which the aspC gene was
expressed at a higher level than the proA gene.
[0440] Primers were designed to introduce C. testosteroni proA into
an operon with aspC/pET30 Xa/LIC, as follows:
30 (SEQ ID NO: 67) 5' primer: ACTCGGATCCGAAGGAGATATACATATGT-
ACGAACTGGG ACT and (SEQ ID NO: 68) 3'primer:
CGGCTGTCGACCGTTAGTCAATATATTTCAGGC.
[0441] The 5' primer contains a BamHI site, the 3' primer contains
a SalI site for cloning. PCR was performed as described in Example
2 and the product was gel purified using a QIAquick.RTM. Gel
Extraction Kit. The aspC/pET30 Xa/LIC construct and the PCR product
were digested with BamHI and SalI. The digests were purified using
a QIAquick.RTM. PCR Purification Kit, eluting from the spin columns
with EB buffer. The proA PCR product was ligated with the vector
using the Roche Rapid DNA Ligation kit (Indianapolis, Ind.)
according to manufacturer's instructions. Chemical transformations
were done using NovaBlue Singles (Novagen) as described in Example
1. Single colonies were used to inoculate LB medium containing 50
mg/L kanamycin (5 mL) and plasmid DNA was purified using the Qiagen
QIAquick.RTM. Spin Miniprep Kit. The plasmid DNA was screened by
restriction digest analysis and the sequence was confirmed by
Seqwright (Houston, Tex.).
[0442] The intervening sequence between the two genes was shortened
by 23 base pairs using a Stratagene QuikChange.TM. Site-Directed
Mutagenesis Kit (LaJolla, Calif.). The following primers were
designed and synthesized for the procedure:
31 SEQ ID NO. 75) forward 5'-GAAGCGATTGTGGCAGTGCTGTAAGGCTCT-
AACGGATCC GAAGGAGATATACATATGTAC;
[0443]
32 (SEQ ID NO. 76) reverse 5'-GTACATATGTATATCTCCGGATCCGTTAG-
A-GCCTTACA GCACTGCCACAATCGCTTC.
[0444] The manufacturer's protocol was followed for the temperature
cycling, digestion, and transformation into XL10-Gold competent
cells. Clones able to grow on LB plates containing 50 mg/L
kanamycin were screened by restriction digest analysis and the
sequences were confirmed by dideoxy chain termination DNA
sequencing (SeqWright, Houston, Tex.). One mutation occurred in all
sequenced clones in the proA gene (G642A) that changed the aldolase
amino acid sequence from methionine to isoleucine at position 214.
This construct was used without further modification. Constructs
were subcloned into BLR(DE3), BLR(DE3)pLysS, BL21(DE3) and
BL21(DE3)pLysS (Novagen). The proA/pET30 Xa/LIC construct was also
transformed into BL21 (DE3)pLysS.
[0445] Initial comparisons of BLR(DE3) shake flask samples under
the standard conditions described above analyzed by LC/MS as
described in Example 6 demonstrated that the addition of the second
gene (aspC) improved the amount of monatin produced by seven-fold.
Because the growth rate is higher, BL21(DE3)-derived host strains
were used for the following experiments. The proA clones and the
two gene operon clones were induced in Trp-1 medium as above.
Chloramphenicol (34 .mu.g/mL) was added to the medium of cultures
containing cells with the pLysS vector. Shake flask experiments
were performed with and without the addition of 0.2% Tween-20 and 1
mg/L ampicillin. The amount of monatin in the broth was calculated
using in vitro produced purified monatin as a standard. Lc/MS/MS
analyses were performed as described in Example 6. Cells were
sampled at zero, 4 hours, 24 hours, 48 hours, 72 hours, and 96
hours of growth.
[0446] The results are shown in Table 5 for the maximum amounts
produced in the culture broths. In most instances, the two gene
construct gave higher values than the corresponding proA construct.
The host strains with the pLysS vector, which should have leakier
cell envelopes, showed higher levels of monatin secretion, although
these strains typically grow at a slower rate. The additions of
Tween and ampicillin were beneficial for monatin secretion. It is
expected that subsitution of penicillin or other penicillin
derivatives (such as carbenicillin) for ampicillin will give
similar benefits.
33TABLE 5 Amount of Monatin Produced by E. coli Bacteria Construct
Host Tween + Amp .mu.g/mL monatin time proA BL21(DE3) - 0.41 72 hr
proA BL21(DE3) + 1.58 48 hr proA BL21(DE3)pLysS - 1.04 48 hr proA
BL21(DE3)pLysS + 1.60 48 hr aspC:proA BL21(DE3) - 0.09 48 hr
aspC:proA BL21(DE3) + 0.58 48 hr aspC:proA BL21(DE3)pLysS - 1.39 48
hr aspC:proA BL21(DE3)pLysS + 6.68 48 hr
[0447] The affect of several detergent Tweens on the growth rate of
E. coli BL21(DE3)was studied in shake flask experiments. Either
Tween-20, -40, 60, or -80 was added at 0.2% in the presence of 10
.mu.g/mL ampicillin and the growth was followed over 48 h. Tween-40
affected the growth rate the least. The rate of growth in the
presence of Tween-20 was about half that was observed when the
organism was grown in the presence of Tween-40. Tween-60 and -80
were intermediate in affect.
[0448] It is expected that, in addition to differentially affecting
the growth rate of the E. coli host organism, the different Tween
formulations will have different affects on the secretion of
monatin.
[0449] Construction of aspCproApET32b
[0450] The aspCproA/pET30 Xa/LIC plasmid with the shortened
intervening sequence (.about.7 .mu.g) and pET32b (.about.6.6 .mu.g)
were digested with XbaI and SalI. The digestion of the pET32b
vector with XbaI and SalI removes the amino-terminal thioredoxin-,
His-, and S-tags while this digestion maintains the His-Tag that is
upstream of the aspC sequence in the pET30 Xa/LIC plasmid. The 2.1
kB aspCproA band and the 5.4 kB pET32b band were purified from a
1%-TAE agarose gel using a QIAquick.RTM. Gel Extraction Kit. The
digested DNA was ligated with the digested vector using the Roche
Rapid DNA Ligation kit and the ligation mix was transformed into
NovaBlue.TM. Singles (Novagen) as described above. Clones able to
grow on LB plates containing 100 .mu.g/mL of ampicillin or
carbenicillin were screened by restriction digest analysis and the
sequences were confirmed by dideoxy chain termination DNA
sequencing (SeqWright, Houston, Tex.). E. coli BL21(DE3) and
BL21(DE3)pLysS cells were transformed with aspCproA/pET32 according
to the Novagen protocol. Two clones from the BL21(DE3)
transformation set able to grow on LB plates with 100 .mu.g/mL
ampicillin and two clones from the BL21(DE3)pLysS transformation
set able to grow on LB plates with 100 .mu.g/mL ampicillin plus 34
.mu.g/mL chloramphenicol were tested for their ability to express
the aldolase and aminotransferase genes. Fifty mL cultures of the
constructs in LB with the appropriate antibiotics were grown at
37.degree. C. with shaking to an OD.sub.600 of between 0.5 and
0.75. The gene expression was induced by the addition of 0.1 mM
IPTG and the cultures were incubated a further 3 h at 30.degree. C.
with shaking. The cells were harvested by centrifugation at
4000.times.g for 10 min, washed with 50 mM MOPS, pH 7 and
centrifuged again. Cell extracts were prepared using Novagen
BugBuster.TM. reagent with benzonase nuclease and Calbiochem
protease inhibitor cocktail III according to the Novagen protocol.
The level of protein expression in the cell extracts was analyzed
by SDS-PAGE using 4-15% gradient gel (Bio-Rad, Hercules, Calif.).
Both polypeptides expressed well; the aldolase polypeptide appeared
to be 15-20% of the soluble protein fraction while the
aminotransferase polypeptide appeared to be 20-30% of the soluble
protein fraction in the BL21(DE3) host cultures. The level of
expression in the BL21(DE3)pLysS cultures was lower.
[0451] Fresh plates of E. coli BL21(DE3)::aspCproA/pET32b were
prepared on LB medium containing 100 .mu.g/mL ampicillin. Overnight
cultures (5 mL) were inoculated from a single colony and grown at
30.degree. C. in LB medium with ampicillin. Typically, a 1 to 100
inoculum was used for induction in trp-1+glucose medium containing
100 mg/L ampicillin or carbenicillin. The inoculated cultures (100
mL) were incubated at 37.degree. C. with shaking until the
OD.sub.600 reached 0.5. The gene expression was induced by the
addition of 0.1 mM IPTG (final concentration) and the culture was
incubated a further 4 h at 30.degree. C. with shaking. Pyridoxine
was also added to a final concentration of 0.5 mM when gene
expression was induced. Four hours after induction, a 25-mL aliquot
of trp-1 medium and 0.05 mL of 100 mg/mL carbenicillin (5 mg) were
added to the culture and the incubation was continued at 30.degree.
C. with shaking. Eighteen hours after induction, 0.04 mM pyridoxal
phosphate (final concentration) in potassium phosphate (50 mM, pH
7.2) was added. The culture was divided into two equal aliquots in
sterile culture flasks. Solid tryptophan to a final concentration
of 50 mM, Tween-20 to a final concentration of 0.2% (stock solution
of 20%), and sodium pyruvate to a final concentration of 0.1%
(stock solution of 10%) were added to the first aliquot. Solid
tryptophan to a final concentration of 50 mM and Tween-20 to a
final concentration of 0.2% were added to the second aliquot. The
pH of both cultures was adjusted to 8.2-8.4 and the incubation at
30.degree. C. was continued. Samples for analysis of monatin (0.5
mL) and protein production (5-10 mL) were withdrawn at 4, 18
(before additions), 19, 24, and 48 h after induction with IPTG.
These samples were centrifuged to pellet the cells. Supernatants
were filtered using Acrodisc.RTM. 13 mm syringe filters (0.45 um;
Gelman Laboratory) before LC-MS analysis for monatin. The cell
pellets were washed with 50 mM MOPS, pH 7, and frozen at
-80.degree. C. until cell extracts were prepared for analysis of
protein production.
[0452] The concentration of monatin in the fermentation broth
samples was measured by LC/MS or LC/MS/MS (described in Example 6).
Monatin was detected in the 24 h fermentation broth sample at a
concentration of 34 mg/L when tryptophan and Tween were added to
the culture. The concentration fell to 4.4 mg/L 48 h after
induction. Monatin was detected in the fermentation broth samples
at a concentration of 130-150 mg/L from 19-48 h after induction
when tryptophan, pyruvate and Tween were added to the culture.
[0453] Cell extracts were prepared using Novagen BugBuster.TM.
reagent with benzonase nuclease and Calbiochem protease inhibitor
cocktail III according to the Novagen protocol. The level of
protein expression in the cell extracts was analyzed by SDS-PAGE
using 4-15% gradient gel (Bio-Rad, Hercules, Calif.). The
concentrations of the expressed proteins were at their highest in
the cell extract samples from 18-24 h after induction. The aldolase
polypeptide accounted for >10% of the soluble protein while the
aminotranferase protein appeared to be >25% of the soluble
protein.
Example 8
Production of Monatin in Yeast
[0454] This example describes methods used to produce monatin in
eukaryotic cells. One skilled in the art will understand that
similar methods can be used to produce monatin in any cell of
interest. In addition, other genes can be used (e.g., those listed
in FIG. 2) in addition to, or alternatively to, those described in
this example.
[0455] The pESC Yeast Epitope Tagging Vector System (Stratagene, La
Jolla, Calif.) was used to clone and express the E. coli aspC and
C. testosteroni proA genes into Saccharomyces cerevisiae. The pESC
vectors contain both the GAL1 and the GAL10 promoters on opposite
strands, with two distinct multiple cloning sites, allowing for
expression of two genes at the same time. The pESC-His vector also
contains the His3 gene for complementation of histidine auxotrophy
in the host (YPH500). The GAL1 and GAL10 promoters are repressed by
glucose and induced by galactose; a Kozak sequence is needed for
optimal expression in yeast. The pESC plasmids are shuttle vectors,
allowing the initial constructs to be made in E. coli (with the bla
gene for selection); however, no bacterial ribosome binding sites
are present in the multiple cloning sites.
[0456] The following primers were designed for cloning into
pESC-His (restriction sites are underlined, Kozak sequence is in
bold): aspC (BamHI/SalI), GAL 1:
34 (SEQ ID NO: 69) 5'-CGCGGATCCATAATGGTTGAGAACATTACCG-3' and (SEQ
ID NO: 70) 5'-ACGCGTCGACTTACAGCACTGCCACA- ATCG-3'
[0457] proA (EcoRI/NotI), GAL 10:
35 (SEQ ID NO: 71) 5'-CCGGAATTCATAATGGTCGAACTGGGAGTTGT-3' and (SEQ
ID NO: 72) 5'-GAATGCGGCCGCTTAGTCAATATATTTCAGGCC-3'.
[0458] The second codon for both mature proteins was changed from
an aromatic amino acid to valine due to the introduction of the
Kozak sequence. The genes of interest were amplified using pET30
Xa/LIC DNA) purified using a Qiagen QIAprep.RTM. Spin Miniprep Kit
(Valencia, Calif.)) of the clones described in Examples 1 and 2 as
template. PCR was performed using an Eppendorf Master cycler
gradient thermocycler and the following protocol for a 50 .mu.L
reaction: 1.0 .mu.L template, 1.0 .mu.M of each primer, 0.4 mM each
dNTP, 3.5 U Expand High Fidelity Polymerase (Roche, Indianapolis,
Ind.), and 1.times. Expand.TM. buffer with Mg. The thermocycler
program used consisted of a hot start at 94.degree. C. for 5
minutes, followed by 29 repetitions of the following steps:
94.degree. C. for 30 seconds, 50.degree. C. for 1 minute 45
seconds, and 72.degree. C. for 2 minutes 15 seconds. After the 29
repetitions the sample was maintained at 72.degree. C. for 10
minutes and then stored at 4.degree. C. The PCR products were
purified by separation on a 1% TAE-agarose gel followed by recovery
using a QIAquick.RTM. Gel Extraction Kit (Qiagen).
[0459] The pESC-His vector DNA (2.7 .mu.g) was digested with
BamHI/SalI and gel-purified as described above. The aspC PCR
product was digested with BamHI/SalI and purified with a QIAquick
PCR Purification Kit (Qiagen). Ligations were performed with the
Roche Rapid DNA Ligation Kit following the manufacturer's
protocols. Desalted ligation mixtures were electroporated into 40
.mu.l Electromax DH10B competent cells (Invitrogen; Carlsbad,
Calif.) using a 0.2 cm Bio-Rad disposable cuvette with a BioRad
Gene Pulser II system, according to the manufacturer's
instructions. After 1 h of recovery in 1 mL of SOC medium, the
transformants were plated on LB medium containing 100 .mu.g/mL
ampicillin. Single colonies were used to inoculate 5 mL cultures of
LB containing 100 .mu.g/mL ampicillin and these were incubated
overnight at 37.degree. C. Plasmid DNA was purified from the
overnight cultures using QIAprep Spin Miniprep Kits. This DNA was
screened by restriction digest and sequenced (Seqwright) for
verification using primers designed for the vector.
[0460] The aspC/pESC-His clone and the proA PCR product were
digested with EcoRI and NotI. The DNA was purified and the
ligations were carried out as described above. The two gene
construct was transformed into Electromax DH10B competent cells
(Invitrogen) and screened by restriction digest and sequenced
(Seqwright) for verification.
[0461] The two gene construct was transformed into S. cerevisiae
strain YPH500 using the S.c. EasyComp.TM. Transformation Kit
(Invitrogen). Transformation reactions were plated on SC-His
minimal medium (Invitrogen pYES2 manual) containing 2% glucose.
Individual yeast colonies were screened for the presence of the
proA and aspC genes by colony PCR using the PCR primers listed
above. Pelleted cells (2 .mu.l) were suspended in 20 .mu.L of
Y-Lysis Buffer (Zymo Research; Orange, Calif.) containing 1 .mu.l
of zymolase and heated at 37.degree. C. for 10 minutes. Four .mu.L
of this suspension was then used in a 50 .mu.L PCR reaction using
the PCR protocol described above.
[0462] Five mL cultures were grown overnight on SC-His+2% glucose
at 30.degree. C. and 225 rpm. The cells were gradually adjusted to
growth on raffinose in order to minimize the lag period prior to
induction with galactose. After approximately 12 hours of growth,
absorbance measurements at 600 nm were taken and an appropriate
volume of cells was spun down and resuspended to give an OD600 of
0.4 in the fresh SC-His medium. The following carbon sources were
used sequentially: 1% raffinose+1% glucose, 0.5% glucose+1.5%
raffinose, 2% raffinose, and finally 1% raffinose+2% galactose for
induction.
[0463] After approximately 16 hours of growth in induction medium,
the 50 mL cultures were divided into duplicate 25 mL cultures and
the following were added to one of the cultures: (final
concentrations) 1 g/L L-tryptophan, 5 mM sodium phosphate, pH 7.1,
1 g/L sodium pyruvate, 1 mM MgCl.sub.2. Samples of broths and cell
pellets from the non-induction medium and from the 16 h cultures
(prior to addition of substrates for the monatin pathway) were
saved as negative controls. In addition, constructs containing only
a functional aspC gene (and a truncated nonfunctional proA gene)
were utilized as another negative control. The cells were allowed
to grow for a total of 69 hours post-induction. In some experiments
the yeast cells were induced at a lower OD600 and only grown for 4
hours prior to addition of tryptophan and pyruvate. However, the
monatin pathway substrates appear to inhibit growth and the
addition at higher OD600 was more effective.
[0464] The cell pellets from the cultures were lysed with 5 mL of
YeastBuster.TM. +50 .mu.l THP (Novagen) per gram of cells (wet
weight) following manufacturer's protocols. In addition, Calbiochem
protease inhibitor set III and benzonase nuclease (Novagen) was
added to the reagent as described in previous examples for the
preparation of bacterial cell extracts. The culture broth and cell
extracts were filtered and analyzed by LC/MS/MS as described in
Example 6. Using this method, no monatin was detected in the broth
samples, indicating that the cells could not secrete monatin under
these conditions (the proton motive force may be insufficient under
these conditions or the general amino acid transporters may be
saturated with tryptophan). Expression of the recombinant proteins
was not at a level that allowed for detection of changes using
SDS-PAGE.
[0465] Monatin was detectable (about 60 ng/mL) transiently in cell
extracts generated from the cells expressing two functional genes
when tryptophan and pyruvate were added to the medium. Monatin was
not detected in any of the negative control cell extracts. In vitro
assays for monatin were performed in duplicate with cell extracts
containing 4.4 mg/mL of total protein (about double what is
typically used for E. coli cell extracts) using the optimized assay
described in Example 3. Other assays were performed with the
addition of either 32 .mu.g/mL C. testosteroni ProA aldolase or 400
.mu.g/mL AspC aminotransferase to determine which enzyme was
limiting in the yeast cell extracts. Negative controls were
performed with no addition of enzyme or the addition of only AspC
aminotransferase (the aldol condensation can occur at a low level
non-enzymatically). Positive controls were performed with partially
purified enzymes (30-40%), using 16 .mu.g/mL aldolase and 400
.mu.g/mL aminotransferase.
[0466] The in vitro assays were analyzed by SRM. The analysis of
cell extracts showed that tryptophan was effectively transported
into the cells when it was added to the medium post-induction,
resulting in tryptophan levels two orders of magnitude higher than
those in which no additional tryptophan was added. The results for
in vitro monatin analysis are shown in Table 6 (numbers indicate
ng/mL).
36TABLE 6 Monatin production with yeast cell extracts. AspC
two-gene yeast +ProA +AspC yeast +ProA +AspC construct aldolase
aminotransferase construct aldolase aminotransferase repressed 0
888.3 173.5 0 465.2 829 (glucose medium) 24 hr post-induction 0
2832.8 642.4 0 1375.6 9146.6 69 hr post-induction 0 4937.3 340.3
71.9 1652.8 23693.5 69 hr post-induction + substrates 0 556.9 659.1
21.9 755.6 16688.2 positive control 21853 21853 (purified enzymes)
negative control 0 254.3 0 254.3 (no enzymes)
[0467] Positive results were obtained with the full two-gene
construct cell extracts from cultures with and without added
substrate during growth. These results, when compared to the
positive controls, indicate that the enzymes were expressed at
levels of close to 1% of the total protein in yeast. The amount of
monatin produced when the cell extracts from the aspC construct
(with truncated proA) were assayed with aldolase was significantly
greater than when cell extracts were assayed alone. This indicates
that the recombinant AspC aminotransferase comprises approximately
1-2% of the yeast total protein. The cell extracts of uninduced
cultures had a small amount of activity when assayed with added
ProA aldolase due to the presence of native aminotransferases in
the cells. When assayed with added AspC aminotransferase, the
activity of the extracts from uninduced cells increased to the
amount of monatin produced by the negative control with AspC (ca.
200 ng/ml). In contrast, the activity observed when assaying the
two gene construct cell extract increases more when
aminotransferase is supplemented than when aldolase is added. Since
both genes should be expressed at the same level, this indicates
that the amount of monatin produced is maximized when the level of
aminotransferase is higher than that of aldolase.
[0468] The addition of pyruvate and tryptophan not only inhibits
cellular growth, but apparently inhibits protein expression as
well. The addition of the pESC-Trp plasmid can be used to correct
for tryptophan auxotrophy of the YPH500 host cells, to provide a
means of supplying tryptophan with fewer effects on growth,
expression, and secretion. S. cerevisiae strain YPH500 was
co-transformed with the aspCproA/pESC-His construct and pESC-trp
using the S.c. EasyComp.TM. Transformation Kit (Invitrogen).
Cultures were grown in a medium with both histidine and tryptophan
omitted and induced as described above. Monatin was detected at low
levels in cell extract samples (less than 8.7 ng/mL) from the
YPH500::aspCproA/pESC-His cultures to which no substrates (neither
tryptophan nor pyruvate) were added to the growth medium after
induction. In contrast no monatin was detected in cell extracts
from cultures containing YPH500 cells transformed solely with the
aspCproA/pESC-His construct.
Example 9
[0469] In vivo Production of Monatin in Wildtype Organisms
[0470] For some markets, it may be desirable to have a
non-genetically modified organism as a production host for monatin.
Genomics databases were searched for organisms known to have the
4-hydroxy 4-methyl 2-oxoglutarate aldolase, an enzyme that can be
used for monatin production. Sinorhizobium meliloti, Comamonas
testosteroni, and Pseudomonas straminea are known to contain this
aldolase as well as aromatic aminotransferases. These organisms
were grown under various conditions to induce production of
monatin. Classical mutagenesis techniques could be utilized to
improve the titer of monatin produced by these organisms.
[0471] Materials
[0472] Unless otherwise specified all reagents were of media-grade
purity or higher. TY medium contained (per L) 6 g tryptone, 3 g
yeast extract, 9 mM CaCl.sub.2. The tryptone and yeast extract were
dissolved in nanopure water, and the pH was adjusted to 7.2. The
volume was adjusted to 991 ml, and the mixture was sterilized by
autoclaving. One molar calcium chloride was prepared separately,
filter-sterilized, and added to the freshly autoclaved medium.
[0473] Para-hydroxybenzoate (PHB) Medium was prepared as directed
by ATCC (ATCC 1702). Solution A (990 ml) contained 3g
(NH.sub.4).sub.2SO.sub.4, 1.6 g K.sub.2HPO.sub.4, 2.5 g NaCl, 0.5 g
yeast extract, and 3 g 4-hydroxybenzoate. Solution B (10 ml)
contained 0.27 g MgSO.sub.4-7H.sub.2O. Solutions A and B were
autoclaved separately and combined after cooling to prepare
Solution C. To this freshly prepared Solution C, 1 ml of a solution
was added that contained 0.05 g
Fe(NH.sub.4).sub.2(SO.sub.4).sub.2-6H.sub.2O(filter-sterilized
prior to use). The pH of the final medium was adjusted to 7.0 with
6N NaOH.
[0474] A 10 g/L L-tryptophan solution was prepared in 0.1 M sodium
phosphate pH 7, and sterile-filtered. One-tenth volume was
typically added to cultures as specified below. A 10% sodium
pyruvate solution was also prepared and sterile-filtered. A 10 ml
aliquot was typically used per liter of culture.
[0475] M9 minimal medium plates were prepared as described in
Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd
ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989 and Rhizobium minimal medium plates were
prepared as follows. Each liter of media contained 15 g agar, 0.1 g
yeast extract, 1 g (NH.sub.4).sub.2SO.sub.4, 7 g K.sub.2HPO.sub.4,
2 g KH.sub.2PO.sub.4, 0.1 g MgSO4-7H20 0.02 g ZnSO.sub.4-7H.sub.20,
0.0025 g NiCl.sub.2-6H.sub.20, and 4 mL 1 M CaCl.sub.2 (filter
sterilized, added after autoclaving). Carbon sources and casamino
acids were added at various concentrations described in the text
below.
[0476] Methods
[0477] Sinorhizobium meliloti 1021 (ATCC 51124) was inoculated in
TY medium, while Comamonas testosteroni (ATCC 49249) and
Pseudomonas straminea (ATCC 33636) were grown in Nutrient Broth
(Difco). All strains were cultured at 26.degree. C. After two days
growth, 2 mL of culture were used to inoculate 100 mL of freshly
prepared PHB media. After 1 hour of growth with PHB as the sole
carbon and energy source, which can induce the aldolase-containing
pathway in C. testosteroni, 10 mL of tryptophan and 1 mL pyruvate
were added. Cells were grown for 60 h, and all cultures had a final
pH of 8-9.
[0478] The absorbance at 600 nm was recorded after 60 h as follows:
S. meliloti, 3.35; P. straminea, 1.28; and C. testosteroni,
1.93.
[0479] Cells were centrifuged for 20 minutes at 3500 rpm at
4.degree. C. Pellets were frozen at -80.degree. C. until processed.
Supernatants (fermentation broth) were filtered for LC/MS analysis.
Results were normalized to account for differences in amount of
biomass. The cell pellets were treated with BugBuster reagent
(Novagen) as described in Example 1, and the resulting cell
extracts were analyzed by SDS-PAGE and filtered for LC/MS. Due to
differences in efficiencies of lysis, the results were normalized
by absorbance at 280 nm, an indication of the relative amounts of
cellular protein. Similar cell extracts were prepared for cells
grown on PHB without addition of tryptophan and pyruvate, and in
one case (S. meliloti), the cells were grown on TY medium rather
than PHB.
[0480] After several days of growth, no bands at expected sizes for
aldolase dominated on SDS-PAGE. These cell extracts were desalted
on a PD10 column and assayed for in vitro production of monatin or
monatin precursor from indole-3-pyruvate, pyruvate, and glutamate.
The assay mixture contained, in 1 mL, 100 mM Tris-HCl (pH 7), 2 mM
MgCl.sub.2, 1 mM potassium phosphate (pH 8), 0.05 mM PLP, enzyme
(cell extract), and 6 mM each of indole-3-pyruvate (prepared in
ethanol), glutamate, and sodium pyruvate. The reactions were
started by adding 0.5 mL of desalted cellular extracts and were
incubated at 37.degree. C. for 30 minutes, filtered, and frozen at
-80.degree. C. prior to LC/MS analysis.
[0481] Detection on LC/MS was done as described in Example 6. For
the in vitro assays, negative controls were done with no cell
extracts supplied to determine the baseline amount of monatin or MP
that was produced from the reaction of the substrates with
magnesium and phosphate. The results are shown in Tables 7-9. The
numbers reflect Electrospray peak heights from LC-MS analysis, due
to difficulties integrating the area in some cases. These numbers
are roughly proportional to monatin concentration and were used to
look for qualitative trends.
37TABLE 7 In vivo results: Fermentation broth analysis monatin
normalized Sample MP monatin by OD.sub.600 S. meliloti at 60 hr 0
1.7 .times. 10.sup.6 0.5 .times. 10.sup.6 P. straminea at 60 hr 0
1.1 .times. 10.sup.6 0.85 .times. 10.sup.6 C. testosteroni at 60 hr
0 1 .times. 10.sup.6 0.5 .times. 10.sup.6
[0482] Analysis of the LC/MS chromatograms indicated that the C.
testosteroni strain may have metabolized a larger percentage of the
tryptophan feed than the other two organisms, although it did not
appear to increase the level of monatin detected. These results may
suggest that the cells were not efficient at secreting monatin.
Therefore, the cellular extracts also were analyzed by LC/MS (Table
8).
38TABLE 8 Cell Extract analysis normalized Sample monatin
OD.sub.280 of CE monatin S. meliloti PHB + tryptophan + pyruvate
low but 0.137 detectable PHB alone 3 .times. 10.sup.5 0.029 1.03
.times. 10.sup.7 TY media alone 1.3 .times. 10.sup.5 0.047 2.77
.times. 10.sup.6 P. straminea PHB + tryptophan + pyruvate Low but
0.195 detectable PHB alone 2 .times. 10.sup.5 0.061 3.2 .times.
10.sup.6 C. testosteroni PHB + tryptophan + pyruvate 2 .times.
10.sup.5 0.144 1.38 .times. 10.sup.6 PHB alone 2.4 .times. 10.sup.5
0.282 8.5 .times. 10.sup.5
[0483] The absence of detectable levels of MP in both the broth and
the cell extracts indicated that the MP was not stable in this
particular matrix. Any effect of additional tryptophan and pyruvate
was not detectable, except in the case of Comamonas, where a
benefit was noted. Later experiments have suggested that the timing
of the addition of tryptophan and pyruvate is very important,
addition at the incorrect time can adversely affect the growth of
the cultures. It is not known whether tryptophan and pyruvate are
efficiently taken up in these wildtype organisms, or what changes
in gene expression occur as a result of adding large concentrations
of these substrates to the medium. While the parahydroxybenzoate
substrate is only known to induce the aldolase in Comamonas, it
appears to have improved the level of monatin produced in S.
meliloti as well.
[0484] To confirm the presence enzymes capable of producing monatin
from indole-3-pyruvate in the cellular extracts of S. meliloti and
C. testosteroni, in vitro assays were performed as described above.
The cell extracts were desalted to remove any residual monatin left
from the culture. The culture condition for the cells is shown on
the left of Table 9, while the MS peak height for monatin is shown
in the right column.
39TABLE 9 In vitro results with cell extracts Growth medium monatin
MS peak height S. meliloti PHB + tryptophan + pyruvate 2.8 .times.
10.sup.6 PHB alone 8.3 .times. 10.sup.5 TY media alone 4.8 .times.
10.sup.6 C. testosteroni PHB + tryptophan + pyruvate 2.58 .times.
10.sup.6 PHB alone 3.5 .times. 10.sup.6 MgCl.sub.2 - no enzyme 6.5
.times. 10.sup.5
[0485] The results shown in Table 9 qualitatively demonstrate that
monatin is formed by these filtered cell extracts, in comparison to
the negative control. The negative control on the last line of the
table is indicative of chemically induced aldol condensation. The
cells grown on PHB without excess tryptophan had very low signal to
noise ratios for monatin, suggesting that addition of tryptophan
may induce the expression of native aromatic aminotransferases. The
S. meliloti cell extracts from cells grown on TY appear to have at
least one other contaminant that is interfering with the
quantitation as the mass spectra and UV spectra show distinct
differences from the positive controls and other samples. The
daughter fragments and UV spectra of the S. meliloti 293 monatin
peak are consistent with monatin produced from purified
aldolase/transaminase mixtures, although there was an indication of
larger molecular mass-species. Parent scans, however, did not
indicate that the larger molecules were related to the 293
peaks.
[0486] Further growth experiments were done with S. meliloti and C.
testosteroni. S. meliloti was grown in TY and PHB media with and
without tryptophan and pyruvate. Additionally, Tween and ampicillin
were added to one of the PHB+tryptophan+pyruvate flasks to
permeabilize the cells. C. testosteroni was grown in NB or PHB
media, with and without added tryptophan. TY media was used as a
negative control in LC/MS analyses. In both organisms tested, the
peak heights corresponding to monatin molecular mass were higher
for cells grown in PHB medium versus the rich TY medium, and
increased for both cell types upon addition of tryptophan and
pyruvate. The addition of Tween and ampicillin greatly reduced the
growth rate of the Sinorhizobium cells, but did appear to improve
the level of monatin in the broth when normalized by OD.sub.600. In
PHB medium, the LC/MS signal level corresponding to monatin was
2-3.times. higher in the broth samples than the negative
control.
[0487] Samples from the S. meliloti PHB experiments were evaporated
and partially purified by cation exchange chromatography. The
elution profile looked similar to other enzymatically produced
samples of monatin.
[0488] Plate Assays Using Monatin as the Main Carbon and Energy
Source
[0489] Organisms that can synthesize monatin can be detected by
screening for growth on plates in which monatin (or the monatin
precursor (MP)) is the main carbon and energy source. Screening by
this method requires (1) that the synthetic pathway be reversible,
allowing the product, monatin, to be metabolized by this route and
(2) that the organism has a transport system that is able to import
monatin or MP. S. meliloti, P. straminea, and C. testosteroni were
tested for their ability to grow on minimal medium plates which
contained monatin as the primary carbon and energy source.
[0490] Experimental Methods and Results
[0491] Plates containing M9 minimal medium or Rhizobium minimal
medium were prepared with 0.01% casamino acids and 0.1-0.2% carbon
source (glucose or purified monatin). Negative control plates
contained casamino acids but no additional carbon source. S.
meliloti, P. straminea, and C. testosteroni were grown in rich
media to OD 2.1-2.7 and diluted 1000-fold with sterile 1.times.
phosphate-buffered saline (PBS). A volume of 1-10 .mu.L was used
for plating. The plates were incubated at 26.degree. C. for several
days. S. meliloti grown on M9 medium+monatin exhibited better
growth than the other strains tested, while there was no growth on
the M9 medium alone. The experiments were repeated and C.
testosteroni was grown in both NB as well as PHB media prior to
induction. Again using M9 media for plating, the S. meliloti
appeared to grow better with monatin as the carbon source than the
other organisms. The C. testosteroni also exhibited some growth.
Using the Rhizobium minimal medium, the C. testosteroni grew better
with monatin as the carbon and energy source than it did with
glucose. In addition, at the higher dilution (10.sup.-6), the use
of PHB-grown inoculum increased the number and size of colonies
obtained compared to the NB-grown inoculum.
[0492] To ensure that contamination had not occurred, four colonies
from various C. testosteroni plates were analyzed by colony-PCR
using the primers for the HMG aldolase gene. All four colonies gave
PCR products at about 750 bp (the correct size), while the negative
control contained no product. The colonies were also restreaked on
PHB plates and were again found to be capable of growth. The
plating experiment for C. testosteroni using PHB-grown liquid
cultures and M9 plates was repeated, and the cells were spun down,
washed with 1.times. PBS, and resuspended in 1.times. PBS prior to
plating. The number of colonies obtained was comparable to the
glucose plate, while the negative control contained no
colonies.
[0493] These results, along with the fact that Sinorhizobium and
several Pseudomonads contain the aldolase genes for the in vitro
production of monatin, suggest that these organisms are capable of
producing monatin without introduction of heterologous genes. It is
clear that the growth medium, addition of substrates such as
tryptophan and pyruvate, and the addition of components that affect
the cell wall are important factors for increasing the level of
monatin produced by these wildtype organisms. Understanding the
expression of the aldolase and aromatic aminotransferase genes in
the organisms and influencing that expression will lead to improved
monatin production. It is expected that classical mutagenesis
techniques could be used to improve productivity.
[0494] Other Experiments Using Different Feeding Strategies
[0495] The shake flask experiments of P. straminea, C. testosteroni
and S. meliloti cultures were repeated with experimental
improvements using a different feeding strategy for substrates and
cofactors and analyzed using LC/MS/MS MRM.
[0496] Methods
[0497] Pseudomonas straminea and Comamonas testosteroni were grown
in PHB medium. Sinorhizobium meliloti was grown in PHB medium as
described above and supplemented with 3.75 ml of 20% yeast extract
and 2 ml of 50% glucose. Starter cultures were grown up and
inoculated into 250 ml medium in 1 L shake flasks. All cultures
were incubated at 29.degree. C. overnight, shaking at 250 rpm to an
OD.sub.600 of .about.0.5-1.1.
[0498] A feeding strategy for addition of substrates, cofactors and
agents (Component list in Tables 10 and 11) to assist with monatin
efflux, was implemented as follows per 250 ml of culture:
40TABLE 10 Day 2: Additions Component Control Experimental 1
Experimental 2 50 mM pyridoxine HCl 2.5 ml 2.5 ml 2.5 ml 0.1 M
NaPO.sub.4 buffer 25 ml -- -- 1% L-tryptophan in 0.1 M -- 25 ml 25
ml NaP0.sub.4 buffer Distilled water 5 ml 2.5 ml -- 10% sodium
pyruvate -- 2.5 ml 2.5 ml 100 mg/ml ampicillin -- -- 2.5 .mu.l 20%
Tween 20 -- -- 2.5 ml
[0499] Following day 2 additions cultures were incubated at
25.degree. C. with shaking at 90-100 rpm.
41TABLE 11 Day 3: Additions Component Control Experimental 1
Experimental 2 10% sodium pyruvate -- 2.5 ml 2.5 ml L-tryptophan
(solid) -- 1 g 1 g 20 mM PLP -- 500 .mu.l 500 .mu.l Distilled water
2.5 ml -- --
[0500] Following day 3 additions, cultures were grown for .about.8
hours after which culture was centrifuged to separate the cells.
Supernatants were filtered and analyzed by LC/MS/MS analysis for
monatin (see Example 6). Cell extracts were prepared from cell
pellets as follows: pellets were resuspended in 1.times. phosphate
buffered saline and suspensions were passed twice through the
French press (.about.20,000 psi) and then centrifuged to remove
cell debris.
42TABLE 12 Results: Monatin Formation (ppb) Bacterial strain
Control Experimental 1 Experimental 2 Pseudomonas stramininea Not
Detected trace 84 ppb (secreted) detected amount, unable to
integrate Comamonas testosteroni Not 200 ppb 355 ppb (secreted)
detected Sinorhizobium meliloti Not Not detected Not detected
(secreted) detected Sinorhizobium meliloti Not Not analyzed 168 ppb
(cell extracts) detected
[0501] Analyses of the filtered fermentation broth samples using
the LC/MS/MS MRM method definitively demonstrated that monatin was
produced by C. testosteroni and P. straminea (see Table 12). Using
the FDAA derivitization method described in Example 6, S,S monatin
formation was confirmed in C. testosteroni samples.
[0502] Analysis of the filtered cell extracts from Experimental 2
condition demonstrated that monatin was produced intracellularly by
S. meliloti as well. No monatin was detected in the fermentation
broth of S. meliloti, indicating that this organism was not
secreting monatin. However, when cell extracts of this culture from
Experimental 2 condition were examined, multiple monatin isomers
were identified using reverse phase LC/MS/MS. The isomers were
identified as S,S or R,R and S,R or R,S monatin. These analyses
suggest that at least two isomers of monatin are produced by S.
meliloti. Organisms that produce multiple isomers of monatin can be
used as a source of enzymes for production of specific
stereoisomers of monatin in vitro.
[0503] Taken together, the results above clearly demonstrated the
potential of Pseudomonas straminea, Comamonas testosteroni and
Sinorhizobium meliloti to produe monatin or serve as asource of
genes in the monatin operon that can be xpressed in heterologous
hosts.
[0504] Selection Method for Screening of Pyruvate Aldolases in
Recombinant E. coli
[0505] Strains of Escherichia coli that require pyruvate
supplementation when grown on M9 minimal medium with ribose as the
carbon source have been described previously (J. Bacteriol. 1995.
177:5719-5722). The genotype of the strain is: .DELTA.pykA
.DELTA.pykF. The double knockout can be generated by the method of
Datsenko and Wanner (PNAS. 2000. 97:6640-6645). These strains can
form a basis for a pyruvate-generating aldolase screen and to
screen for aldolases that are more active on a specific
stereoisomer of monatin, a particular stereoisomer of monatin
precursor, or an analog of monatin or monatin precursor. An analog
of monatin precursor includes compounds that have been identified
as substrates for ProA aldolases or KHG aldolases such as
4-hydroxy-4-methyl-2-oxoglutarate,
4-carboxy-4-hydroxy-2-oxoadipate, 4-hydroxy-4-methyl-2-oxoadipate,
or other carboxyl rich compounds that are converted to pyruvate in
an aldol reaction. An example of an analog of monatin that can be
used is 4-hydroxy-4-methyl glutamic acid, which can be easily
transaminated to 4-hydroxy-4-methyl-2-oxoglutarate (a substrate of
ProA) by native aminotransferases in a test cell.
[0506] Cloning
[0507] The following primers were used to generate the pykA
knockout:
43 (SEQ ID NO: 85) 5'-ATGTCCAGAAGGCTTCGCAGAACAAAAATCGTTACCA-
CGTTAGGTGT AGGCTGGAGCTGCTTC-3' and (SEQ ID NO: 86)
5'-CTCTACCGTTAAAATACGCGTGGTCTTAGTAGAACCCACGGTACCAT
ATGAATATCCTCCTTAG-3'.
[0508] The following primers were used to generate the pykF
knockout:
44 (SEQ ID NO: 87) 5'-AGGACGTGAACAGATGCGGTGTTAGTAGTGCCGCTCG-
GTACCAGCAT ATGAATATCCTCCTTAG-3' and (SEQ ID NO: 88)
5'-ATGAAAAAGACCAAAATTGTTTGCACCATCGGACCGAAAACCGGTGT
AGGCTGGAGCTGCTTC-3'.
[0509] A PCR reaction was performed with either pKD3 or pKD4 as
template using standard protocols. The PCR product was
electroporated into a strain of E. coli that expresses the lambda
red homologous recombination system. The PCR product had homology
to pyk4 or pykF and recombined into the chromosome at those sites.
When the double crossover occurred the resulting progeny carried a
deleted pykA or pykF gene and an antibiotic resistance marker. The
deleted genes with the antibiotic resistance markers were
transduced into an E. coli strain (MG1655) using standard P1
transduction techniques.
[0510] Strain Analyses
[0511] The double knockout was tested for growth on minimal medium
(M9 salts (Difco) supplemented with Balch's vitamin solution,
Balch's modified trace element solution (Balch, W. E., G. E. Fox,
L. J. Magrum, C. R. Woese, and R. S. Wolfe. 1979. Methanogens:
reevaluation of a unique biological group. Microbiol. Rev.
43:260-296), 0.4% D-ribose). No growth was seen for the double
mutant unless 5 mM pyruvate was also included in the media.
Wild-type MG1655 grew on the above media both in the presence and
absence of pyruvate. The double knockout was tested for growth on
the minimal medium described above supplemented with 0.4% glucose
rather than ribose. Growth on this medium was similar to that seen
with the wild-type strain. With this medium pyruvate can be
generated from glucose via the ptsi gene product (the enzyme of the
phosphotransferase system that makes pyruvate from
phosphoenolpyruvate and transfers the phosphate to glucose). The
double knockout strain was also tested for growth using the medium
as described above supplemented with 0.4% L-arabinose or 0.4%
D-xylose rather than ribose. Pyruvate is not generated from growth
on these 5-carbon containing (non-PTS) substrates. The double
knockout did not grow under these conditions unless it was
supplemented with 5 mM pyruvate, while the wild-type strain grew
normally both in the presence and absence of pyruvate.
[0512] The proA aldolase gene from Comomonas testosteroni
(described in Example 2 cloned in pET30 Xa/LIC) and the aspC/proA
genes described in Example 3 (cloned in pET30 Xa/LIC and pET32)
were sub-cloned into pBAD-TOPO using the pBAD TOPO TA expression
kit (Invitrogen). Expression of the gene(s), in these constructs,
is regulated by the inducible araBAD promoter. In the presence of
arabinose (for example 0.4%) and IPTG the gene(s) are expressed.
Unless supplemented with pyruvate or a source of pyruvate, the
strain will not grow on minimal medium. The medium can be
supplemented with monatin, monatin precursor, or an analog of
monatin or monatin precursor. Typical ranges of substrate used in
literature are 0.5-5 mM. The ProA aldolase can, for example,
convert the monatin precursor into pyruvate and indole-3-pyruvate
providing the strain a source of pyruvate and allowing growth on
minimal medium with 0.4% arabinose. The construct expressing both
the proA and the aspC genes can convert monatin into the monatin
presursor and the montain precursor into pyruvate and
indole-3-pyruvate. This system can be used to screen for aldolases
and to screen for aldolases that are more active on a specific
stereoisomer of monatin, a specific stereoisomer of monatin
precursor, or an analog of monatin or monatin precursor. For
example, if directed evolution is performed on any of the aldolases
mentioned in Example 2, a plate assay can utilize media containing
either R or S monatin precursor to measure the enantiospecificity
of the resulting mutant enzyme. If growth occurs on the plates
containing R-monatin precursor and little or no growth occurs on
the plate containing S-monatin precursor, the aldolase has a
specificity for substrates containing the R-chirality at the
reaction site.
[0513] M9 minimal medium plates were made containing 1.times.
Balch's vitamin solution and Balch's modified trace element
solution (Balch, W. E., G. E. Fox, L. J. Magrum, C. R. Woese, and
R. S. Wolfe. 1979. Methanogens: reevaluation of a unique biological
group. Microbiol. Rev. 43:260-296). Glucose or arabinose was
included as the carbon source (0.4% w/v) and plates were
supplemented with either 5 mM monatin (R,R; S,S racemic mixture)
that had been dissolved in 20 mM potassium phosphate buffer (pH
8.0) or an equal volume of potassium phosphate buffer without
monatin. Growth is summarized in Table 13 below:
45 TABLE 13 Glucose Arabinose Glucose monatin Arabinose monatin
MG1655 ++++ ++++ ++++ ++++ MG1655 .DELTA.pykA ++++ ++++ + +
.DELTA.pykF MG1655 .DELTA.pykA ++++ ++++ + ++ .DELTA.pykF +
aspCproA/ pBAD- TOPO
[0514] It is expected that the screen could be optimized by
controlling the levels of ProA and AspC, increasing uptake of
monatin, using monatin precursor in the place of monatin (in this
case the aminotransferase would not need to be present), or using a
less hydrophobic analog of monatin such as those described above.
Methods for increasing the uptake of monatin include addition of
amino acid mixtures, addition of specific amino acids, and the use
of detergents, antibiotics, antibiotic analogs, or enzymes that
help to permeabilize the cell wall. Polymyxin B nonapeptide (Dixon
and Chopra. 1986. Antimicrobial Agents and Chemotherapy.
29:781-788) and microcystin RR (Dixon, Al-Nazawi, and Alderson.
FEMS Microbiology Letters. 2004. 230:167-170) have been described
as agents that permeabilize the outer membrane of E. coli.
[0515] It is expected that other promoter systems/plasmids can be
used in this screening system with equivalent results. Examples
include T7 promoter systems, and IPTG inducible promoters such as
taq and lac.
[0516] Synthesis of Monatin and Monatin Precursor (MP) Analogs
[0517] The monatin precursor (MP) analog
4-hydroxy-4-methyl-2-oxoglutarate is synthesized using the method
of Shannon and Marcus (1962) or Prey et al (1955) or Waldmann et al
(1954). The monatin precursor (MP) analog
4-carboxy-4-hydroxy-2-oxoadipate is synthesized by the method of
Tack et al (1972) or the method of Martius (1943).
[0518] The monatin analog 4-hydroxy-4-methyl glutamic acid is
biosynthesized from 4-hydroxy-4-methyl-2-oxoglutarate by reaction
with aspC aminotransferase in the presence of the amino donor
glutamate as described in the Transamination Activity section of
Example 4.
Example 10
[0519] Increased Production of Pyruvate in Escherichia coli by
Knockout of Lipoate Biosynthetic Gene
[0520] Interruption of the lipoate biosynthesis pathway can
increase pyruvate productivity in E. coli, which can be
advantageous for in vivo monatin production. If little or no
lipoate is available to serve as a cofactor for pyruvate
dehydrogenase, the formation of acetyl-CoA from pyruvate is
limited. A DE3 strain can be used for expression of the monatin
operon from the T7 promoter in pET30 Xa/LIC. A
BW25113.DELTA.lipA::cam strain was used as a donor strain for P1
transduction of the lipA knockout (with chloramphenicol insertion)
into E. coli 7692, a tryptophan overproducing strain. Both the E.
coli 7692.DELTA.lipA and BW25113.DELTA.lipA mutants were
lysogenized for T7 expression.
[0521] Strains
[0522] E. coli strain BW25113 and E. coli CGSC 7692 were obtained
from the Genetic Stock Center (Yale University). E. coli CGSC 7692
has the following genotype: W3110tnaA2trpEFBR19 (Doolittle and
Yanofsky, J. Bacteriol., (1968) 95:1283-1294; and Yanofsky et al.,
J.Bacteriol., (1984) 158:1018-1024). This strain has a feedback
resistant anthranilate synthase gene (trpE), which is a key
branchpoint and regulatory point for the biosynthesis of
tryptophan.
[0523] The BW25113 .DELTA.lipA::cam construct was provided by Dr.
Hans Liao (WO02085293 A).
[0524] Materials and Methods
[0525] P1 phage was purchased from ATCC (Manassas, Va.) catalog #
25404-B 1. The lambda (DE3) lysogenization kit was purchased from
Novagen (Madison, Wis.). Unless otherwise stated, all reagents were
of media grade or higher.
[0526] Pyruvate overproduction medium was used that contained the
following: 50 g/L glucose (added after autoclaving); 10 g/L
(NH.sub.4).sub.2SO.sub.4; 4 g/L peptone (Fisher); 1 g/L
K.sub.2HPO.sub.4; 2 g/l NaCl; 0.5 g/L MgSO.sub.4-7H.sub.2O; 14.7
mg/L CaCl.sub.2-2H.sub.2O (added after autoclaving); and 1 .mu.g
per liter lipoate (added after autoclaving). The pyruvate
overproduction medium was adjusted to a pH of 8 with NaOH.
[0527] Genetic Manipulation of E. coli Strains
[0528] P1 transduction was performed using the method of Miller
(Miller, J. H., "A short course in bacterial genetics": Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y., 1992). P1 lysates were
created using E. coli BW25113 .DELTA.lipA::cam cells. The P1 phage
isolated was then used to transduce E. coli CGSC 7692. The clones
of interest were selected by growth on LB plates containing 34
.mu.g/ml chloramphenicol and 10 nM lipoate. The lipoate synthase
deletion was confirmed by growth comparison on plates with and
without lipoate and by PCR screening and analysis of the PCR
product for correct size and restriction pattern.
[0529] The .lambda.DE3 lysogenization of E. coli strains CGSC 7692,
7692.DELTA.lipA, and BW25113.DELTA.lipA was performed using the
Novagen .lambda.DE3 Lysogenization Kit following the manufacturer's
protocol. The presence of DE3 phage was verified by utilization of
the T7 Tester phage (4107) which cannot form plaques in the absence
of the T7 RNA polymerase. Lysogenization was further verified by
expression studies using the aspC/pET30 Xa/LIC construct.
[0530] Detection of Pyruvic Acid
[0531] Samples from in vitro or in vivo biochemical reaction
experiments to be analyzed for pyruvic acid were treated with
formic acid to reduce the pH to less than 3 and then filtered
through 0.45 .mu.m Nylon syringe filters prior subjecting to LC/MS
analysis. Identification of pyruvic acid was based on retention
time and mass selective detection. LC separations were made using
Waters 2690 liquid chromatography system and a 2.1 mm.times.250 mm
Phenomenex Aqua C.sub.18 reversed-phase chromatography column with
isocratic elution at 40.degree. C. The LC mobile phase was 1%
methanol in water containing 0.1% (v/v) formic acid with a flow
rate of 0.18 mL/min.
[0532] The detection system for analysis of pyruvic acid includes a
Waters 996 Photo-Diode Array (PDA) detector and a Waters Micromass
ZQ quadrupole mass spectrometer. The PDA, operating at 195 to 225
nm for monitoring chromatographic profile, was placed in series
between the chromatography system and the mass spectrometer. To
enhance the stability of pyruvic acid's [M-H].sup.- ion, an in-line
post column additive of 1% (v/v) NH4OH in iso-propanol and water
was added at the rate of 0.025 mL/min prior to the mass
spectrometer.
[0533] Parameters for the Micromass ZQ quadrupole mass spectrometer
operating in negative electrospray ionization mode (-ESI) were set
as the following; Capillary: 2.0 kV; Cone: 30 V; Extractor: 4 V; RF
lens: 1 V; Source temperature: 120.degree. C.; Desolvation
temperature: 380.degree. C.; Desolvation gas: 600 L/h; Cone gas:
Off; Low mass resolution: 15.0; High mass resolution: 15.0; Ion
energy: 0.2; Multiplier: 650. Single ion monitoring MS experiment
was set up to allow selectively detect m/z 87, which was the
deprotonated molecular [M-H].sup.- ion of pyruvic acid.
[0534] Growth Experiments
[0535] Twenty mL cultures of BW25113, BW25113.DELTA.lipA,
BW25113.DELTA.lipA(DE3), CGSC 7692, 7692.DELTA.lipA, 7692(DE3), and
7692.DELTA.lipA(DE3) were grown in 125 mL shake flasks containing
2YT medium (Sambrook et al.) with 10 nM lipoate. After 24 hours, a
sample of fermentation brothwas removed for analysis and 20 g/L of
glucose was added. The culture was allowed to grow for another 24
hours, at which time the cells were harvested and the fermentation
broths were filtered and analyzed by LC/MS as described above. The
benefit of the genetic knockout of lipoate biosynthesis is shown in
FIG. 14 as both the 7692.DELTA.lipA and BW25113.DELTA.lipA cells
are clearly capable of producing more pyruvate than the CGSC 7692
and BW25113 cells that contain the lipA gene. The experiment was
repeated in pyruvate overproduction media (Yokota et al., (1997).
J. Ferment. Bioeng., 83:132-138) containing 50 g/L glucose. Samples
of broth were removed after 24, 48, and 72 hours of growth and
analyzed by LC/MS for pyruvate. The results are shown in FIG. 15,
confirming the results of FIG. 14 using a different medium. The
7692 constructs appear to have higher productivity in 2YT media. It
is expected that similar genetic mutations in other microorganisms
will have similar effects.
Example 11
[0536] Production of Monatin in Escherichia coli Constructs Lacking
the Lipoate synthase Gene
[0537] In Example 10, pyruvate production was increased in E. coli
constructs in which the lipA gene was deleted. The DE3 strains of
the lipA knockouts were transformed with the monatin operon (aspC
proA/pET32b construct described in Example 7) and were evaluated
for their ability to express the induced proteins and to produce
monatin. The E. coli BW25113.DELTA.lipA(DE3) construct, transformed
with the monatin operon, produced 8-9 ng/mL biomonatin when
tryptophan was added to the culture several hours after induction.
The tryptophan overproducing strain E. coli 7692.DELTA.lipA(DE3),
transformed with the monatin operon, produced about 2 ng/mL monatin
without a tryptophan feed. The E. coli 7692(DE3) construct,
transformed with the monatin operon but containing the lipA gene,
did not produce any detectable monatin.
[0538] Preparation of Electrocompetent Cells of E. coli 7692(DE3),
7692.DELTA.lipA(DE3), and BW25113.DELTA.lipA(DE3)
[0539] Two hundred milliliter cultures of E. coli 7692(DE3),
7692.DELTA.lipA(DE3), and BW25113.DELTA.lipA(DE3) in LB medium
(containing 12.5 .mu.g/mL chloramphenicol and 10 nM alpha-lipoic
acid if AlipA) were grown at 37.degree. C. with shaking to an
OD.sub.650 of 0.45-0.5. After cooling in an ice bath, the cultures
were centrifuged at 4,000.times.g for 10 min at 4.degree. C. The
supernatants were decanted, and the cell pellets were each
suspended in 200 mL of sterile ice cold water. The centrifugation
was repeated, and the cell pellets were each suspended in 20 mL of
sterile ice cold water. After a third centrifugation, the cell
pellets were each suspended in 2 mL ice cold 10% glycerol. The cell
pellets resulting from a fourth centrifugation were suspended in
0.15 mL ice cold 10% glycerol, and the suspensions were dispensed
into 40 .mu.L aliquots and frozen at -80.degree. C.
[0540] E. coli 7692(DE3), 7692.DELTA.lipA(DE3), and
BW25113.DELTA.lipA(DE3) electrocompetent cells were transform.ed
with the monatin operon construct (aspC proA/pET32) by
electroporation under standard conditions described in the Bio-Rad
electroporation manual using a Bio-Rad Gene Pulsar II apparatus.
Clones able to grow on LB plates containing 100 .mu.g/mL of
ampicillin (and 20 nM alpha lipoic acid if .DELTA.lipA) were
analyzed for their ability to express the aldolase and
aminotransferase genes.
[0541] Fifty mL cultures of two 7692(DE3) clones in LB with 100
.mu.g/mL ampicillin were grown at 37.degree. C. with shaking to an
OD.sub.650 of between 0.5 and 0.9. In addition, fifty mL cultures
of one 7692DlipA(DE3) clone and one BW25113.DELTA.lipA(DE3) clone
in LB with 100 .mu.g/mL ampicillin and 10 nM alpha lipoic acid were
grown at 37.degree. C. with shaking to an OD.sub.650 of between 0.5
and 0.9. The gene expression was induced by the addition of 0.1 mM
IPTG, and the cultures were incubated a further 4 h at 30.degree.
C. with shaking. The cells were harvested by centrifugation at
4,000 rpm for 10 min and washed with 50 mM MOPS, pH 7 buffer and
centrifuged again. Cell extracts were prepared using Novagen
BugBuster.TM. reagent with benzonase nuclease and Calbiochem
protease inhibitor cocktail III according to the manufacturer's
protocol. The level of protein expression in the cell extracts was
analyzed by SDS-PAGE using a 4-15% gradient gel (Bio-Rad, Hercules,
Calif.). Both the aldolase and aminotransferase expressed well in
all the hosts, and the levels were similar to those seen in the E.
coli BL21(DE3) host when grown on LB medium.
[0542] Production of Monatin in E. coli 7692(DE3),
7692.DELTA.lipA(DE3), and BW25113.DELTA.lipA (DE3) Cells
Transformed with aspCproApET32
[0543] In these experiments the E. coli strains transformed with
aspCproA/pET32 were grown and induced as described above. To these
cultures were added both tryptophan and pyruvate and intracellular
and extracellular samples were analyzed for production of
monatin.
[0544] Fresh plates of E. coli 7692(DE3), 7692.DELTA.lipA(DE3), and
BW25113.DELTA.lipA(DE3) cells transformed with aspC proA/pET32 were
prepared on LB medium containing 100 .mu.g/mL ampicillin. The
plates used for the AlipA strains also contained 10 nM alpha lipoic
acid. Overnight cultures (5 mL) were inoculated from a single
colony and grown at 37.degree. C. in LB medium with 100 .mu.g/mL
ampicillin and 10 nM alpha lipoic acid. One mL of the overnight
culture was used as an inoculum in 100 mL of trp-1 medium
containing 100 .mu.g/mL carbenicillin and 10 nM alpha lipoic acid.
The cultures were incubated at 37.degree. C. with shaking until the
OD.sub.650 reached about 0.5. The gene expression was induced by
the addition of 0.1 mM IPTG, and the cultures were incubated a
further 4 h at 30.degree. C. with shaking. When gene expression was
induced, pyridoxine was added to a final concentration of 0.5 mM,
as well as 1 nmole of alpha lipoic acid. Four hours after
induction, a 25 mL aliquot of trp-1 medium and 0.05 mL of 100 mg/mL
carbenicillin (5 mg) were added to the cultures, and the incubation
was continued at 30.degree. C. with shaking. Eighteen hours after
induction, 0.04 mM pyridoxal phosphate in potassium phosphate (50
mM, pH 7.2) was added to all cultures. The E. coli 7692(DE3) and
7692 .DELTA.lipA(DE3) cultures which had been transformed with aspC
proA/pET32 received glucose (0.2 g) and Tween-20 to a final
concentration of 0.2%. The E. coli BW25113.DELTA.lipA(DE3)
construct culture received solid tryptophan to final concentration
of 50 mM and Tween-20 to final concentration of 0.2%. The pH of all
3 cultures was adjusted to 8.2-8.4, and the incubation at
30.degree. C. was continued. Samples for analysis of monatin (0.5
mL) and protein production (5-10 mL) were withdrawn at 0, 4, 18
(before additions), 19, 24, 48, and 72 h after induction with
IPTG.
[0545] The concentration of monatin in the fermentation broth
samples was measured by LC/MS or LC/MS/MS as described in Example
6.
[0546] Monatin was detected in the fermentation broth at a
concentration of .about.2 ng/mL in the 18 h sample from the aspC
proA/pET32 transformed E. coli 7692.DELTA.lipA(DE3) culture. No
monatin was detected in the samples withdrawn between 24 and 72 h.
No monatin was detected in any of the samples from the aspC
proA/pET32 transformed E. coli 7692(DE3) culture. Monatin was
detected, however, in the 48 and 72 h fermentation broth samples of
the aspC proA/pET32 transformed E. coli BW25113.DELTA.lipA(DE3)
culture at a concentration of 8-9 ng/mL.
[0547] Cell extracts were prepared using Novagen BugBuster.TM.
reagent with benzonase nuclease and Calbiochem protease inhibitor
cocktail III according to Novagen's protocol. The level of protein
expression in the cell extracts was analyzed by SDS-PAGE using a
4-15% gradient gel (Bio-Rad, Hercules, Calif.). The concentrations
of the expressed proteins were at the highest level in the 24 h
cell extract sample for the aspC proA/pET32 transformed E. coli
7692(DE3) samples. The concentrations of the expressed proteins
were at their highest in the 4 and 18 h samples for the aspC
proA/pET32 transformed E. coli 7692 .DELTA.lipA(DE3) cell extract
samples. The aldolase polypeptide accounted for about 15% of the
soluble protein, while the aminotransferase polypeptide appeared to
be >30% of the soluble protein in these samples. The two
polypeptides did not express as well in the aspC proA/pET32
transformed E. coli BW25113 .DELTA.lipA(DE3) culture grown in the
trp-1 medium. The highest levels appeared in the 18 and 24 h cell
extract samples, however, neither polypeptide was greater than
10-15% of the total soluble protein.
[0548] These results show that the proteins were produced in all
the strains transformed with aspC proA/pET32 after induction with
IPTG. The two strains in which the lipA gene was deleted (E. coli
BW25113.DELTA.lipA (DE3) and 7692.DELTA.lipA(DE3)) and were
transformed with aspC proA/pET32 produced monatin without a
pyruvate feed. This shows tht the lipA gene knockout is beneficial
for in vivo production of monatin. The tryptophan overproducing
strain E. coli 7692.DELTA.lipA(DE3) produced monatin without the
addition of tryptophan or pyruvate. The level of monatin production
was much less, however, than the amounts produced and secreted in
E. coli constructs that were fed both tryptophan and pyruvate (For
example, see Table 5 of Example 7).
Example 12
[0549] Production of Monatin in Escherichia coli Constructs That
Overproduce Tryptophan and Pyruvate
[0550] Escherichia coli tryptophan overproducing strains, NRRL
12264 lacking a lipA gene were evaluated for the ability to produce
monatin when transformed with a plasmid containing the aspC and
proA genes as well as a second operon containing a tryptophan
operon. Both monatin and tryptophan were measured after induction
of gene expression.
[0551] Strains
[0552] In Example 15, three strains cited in U.S. Pat. No.
4,371,614 as tryptophan overproducers were examined for their
ability to produce tryptophan in two media formulations. One
strain, NRRL B-12262, (also called AGX15 with the cited genotype
serB.sup.-, trp.DELTA.ED, tnaA2.sup.-, tetS, tyrA.sup.-,
pheA.sup.-) carries a plasmid called pGX44 that is derived from
pBR322 (Roeder and Somerville, Molec. Gen. Genet., 1979, 176:
361-368) and contains the serB gene and the tryptophan operon.
Another strain, NRRL B-12264 (also called AGX6 with the cited
genotype serB.sup.-, trp.DELTA.ED, tnaA2.sup.-, aroP.sup.-)
contains a plasmid called pGX50 derived from pBR322 and contains
the serB gene, a tryptophan operon, which was derived from cells
that are resistant to 5-methyltryptophan, and an ampicillin
resistance gene. These two strains were subjected to the following
genetic manipulations and the strain derived from NRRL B-12264 was
analyzed for monatin production.
[0553] Genetic Manipulations
[0554] The P1 transductions to delete the lipA gene and the
.lambda.DE3 lysogenization of E. coli NRRL strains 12262 and 12264
were carried out as described in Example 10. The lipoate synthase
deletion was confirmed by growth comparison on plates with and
without lipoate and by PCR screening and analysis of the PCR
product for correct size and restriction pattern. The presence of
DE3 phage was verified by utilization of the T7 Tester phage and
the ability to express the aspC gene when transformed with
aspCpET30 (Xa/LIC). The plasmid pGX44 was cured from strain 12262
and the plasmid pGX50 was cured from strain 12264 by repeated
passages on rich media containing serine and tryptophan and without
ampcillin. The curing was verified in strain 12264 by the loss of
the abililty to grow in the presence of ampicillin.
[0555] Preparation of Electrocompetent Cells of E. coli
12262.DELTA.lipA(DE3) and 12264.DELTA.lipA (DE3)
[0556] Electrocompetent cells of E. coli 12264.DELTA.lipA(DE3) and
12262.DELTA.lipA(DE3) were prepared as described in Example 10.
After the final wash and re-suspension in ice cold 10% glycerol the
cells were dispensed into 40 .mu.L aliquots and frozen at
-80.degree. C.
[0557] Construction of Plasmids Containing Tryptophan Operons
[0558] The plasmid pGX44 was purified from strain 12262 and the
plasmid pGX50 was purified from strain 12264 using a Qiagen
QIAprep.RTM. Spin Miniprep Kit. Escherichia coli genomic DNA was
isolated from strain E. coli DH10B (Invitrogen; Carlsbad, Calif.)
as described in Example 1.
[0559] Primers were designed to clone the tryptophan operon of
plasmid pGX44, pGX50 and genomic DNA from E. coli strain DH10B into
the pPRONco plasmid using the KpnI and BamHI restriction sites.
This plasmid is a derivative of the pPROLar.A122 vector (BD
Biosciences Clontech, Palo Alto, Calif.) in which one of the NcoI
sites was removed by mutation T1538C. The tryptophan operon
(Genbank Accession No.: NC.sub.--000913.2 GI:49175990
1320970-1314440) contains the open reading frames of the following
genes: trpE, trpD, trpC, trpB and trpA. The GenBank Accession
numbers for the gene products are as follows: trpE, GenBank
Accession No.:NP.sub.--415780.1 GI:16129225; trpD, GenBank
Accession No.: NP.sub.--415779.1 GI:16129224; trpC, GenBank
Accession No.: NP.sub.--415778.1 GI:16129223; trpB, GenBank
Accession No.: NP.sub.--415777.1 GI:16129222; trpA GenBank
Accession No.: NP.sub.--415776.1 GI:16129221.
46 (SEQ ID NO: 79) N term: 5'-CGGGGTACCCATGCAAACACAAAAACCGA-
CTCTCGAACTG-3'
[0560]
47 5'-CGCGGATCCTTAACTGCGCGTCGCCGCTTTC (SEQ ID NO: 80) AT-3'
[0561] The following PCR protocol was used for gene amplification:
In a 50 .mu.L reaction, 100-300 ng DNA template, 1.0 .mu.M of each
primer, 0.2 mM each dNTP, 0.75 U pfuUltra HF Polymerase
(Stratagene; LaJolla, Calif.), 2.5 U Expand High Fidelity.TM.
Polymerase (Roche Molecular Biochemicals, Indianapolis, Ind.), and
1.times. Expand.TM. buffer with Mg were added. The thermocycler
program utilized a hot start of 94.degree. C. for 5 minutes;
followed by 30 cycles of a denaturing step at 94.degree. C. (30
sec), an annealing step at 61.5.degree. C. (1 min), and an
extension step at 72.degree. C. (8 min); and finally a finishing
step at 72.degree. C. (7 min). The amplified DNA was purified from
a 1% agarose gel using a Qiagen QIAquick.RTM. Gel Extraction Kit
(Valencia, Calif).
[0562] The PCR products and the pPRONco vector were sequentially
digested with BamHI and then KpnI purchased from NEB (Beverly,
Mass.) and following the manufacturer's protocols. After both
digests the DNA purified from the protein and buffer salts using a
Qiagen QIAquick PCR Clean-up Kit. The vector was also treated with
shrimp alkaline phosphatase (Roche Molecular Biochemicals,
Indianapolis, Ind.) according to the manufacturer's recommendations
before the second clean-up step. The purified DNA was quantified by
measuring the absorbance at 260 nm and ligated using T4 ligase
(NEB) at a ratio of insert to vector of >8 to 1. Transformation
of the ligation mixtures into electrocompetent E. coli DH10B cells
was performed under standard conditions using a 0.1 cm cuvette and
a Bio-Rad Gene Pulser II system as described in the Bio-Rad
electroporation manual. Clones containing a tryptophan operon were
identified by restriction analysis and confirmed by DNA sequencing.
The nucleic acid sequence of the tryptophan operon genes from E.
coli DH10B and pGX44 (E. coli strain 12262) were identical and in
agreement with the NCBI database (see accession numbers listed
above) while the tryptophan operon from pGX50 (E. coli strain
12264) showed 15 mutations in the trpE gene but was identical to
the DH10B and pGX44 sequences in the trpD, trpC, trpB and trpA
genes. The mutations in the trpE gene of pGX44 are as follows:
G30A(silent), T61C(silent), C63G(silent), G160A(silent),
T189A(silent), C210T(silent), C211A(Gln72Lys), A217G(silent),
C218T(silent), T220A(silent), C229T(silent); C232T(silent),
C241G(silent), G281A(Ser94Asn), C349T(silent). SEQ ID NOS.: 81 and
82 set forth the nucleic acid and amino acid sequences,
respectively, of the trpE gene from pGX50.
[0563] Tranformation of E. coli Strains 12262.DELTA.lipA (DE3) and
12264.DELTA.lipA(DE3) E. coli 12264.DELTA.lipA(DE3), and
12262.DELTA.lipA(DE3) electrocompetent cells were transformed with
aspC proApET32 (described in Example 10) or co-tranformed with
aspCproApET32 and one of the tryptophan operon constructs described
above by electroporation under standard conditions described in the
Bio-Rad electroporation manual using a Bio-Rad Gene Pulsar II
apparatus. Clones able to grow on LB plates containing either
ampicillin at 100 mg/L and 20 nM alpha lipoic acid (aspCpro ApET32
transformed strains) or ampicillin at 100 mg/L, kanamycin at 50
mg/L, and 20 mM alpha lipoic acid (aspC proApET32 and tryptophan
operon transformed strains) were chosen for further analysis.
[0564] Production of Monatin in E. coli Strain
12264.DELTA.lipA(DE3) Transformed With Plasmids Containing the aspC
and proA Genes and a Tryptophan Operon
[0565] Fresh plates of E. coli 12264.DELTA.lipA(DE3) transformed
with aspC proA/pET32, or aspC proA/pET32 and DH10trpoperon/pPRONco,
or with aspC proA/pET32 and pGX44trpoperon/pPRONco, or with aspC
proA/pET32 and pGX50trpoperon/pPRONco were prepared on LB medium
containing the appropriate antibiotics and 20 nM alpha lipoic acid.
Overnight cultures (5 mL) were inoculated from a single colony and
grown at 37.degree. C. in LB medium or trp-1 medium (described in
Examples 1 and 7) containing the appropriate antibiotics and 20 nM
alpha lipoic acid. The strain carrying aspC proA/pET32 and
pGX50trpoperon/pPRONco did not grow in liquid culture in either
trp-1 or LB and was not did not grow and was not used further. One
to two mL of each of the overnight cultures were used as inocula
for 100 mL of trp-1 medium containing the appropriate antibiotics,
0.4% casamino acids, 0.1% Balch's vitamin solution, and 20 nM alpha
lipoic acid. Balch's vitamin solution contains the following:
p-aminobenzoic acid (5.0 mg), folic acid (2.0 mg), biotin (2.0 mg),
nicotinic acid (5.0 mg), calcium pantothenate (5.0 mg), riboflavin
(5.0 mg), thiamin-HCl (5.0 mg), pyridoxine-HCl (10.0 mg),
cyanocobalamin (0.1 mg), and alpha lipoic acid (0.1 mg) in 1 L. The
pH is adjusted to 7.0 with NaOH and the solution is filtered
sterilized before use.
[0566] The strains were incubated at 37.degree. C. with shaking.
The strain carrying only the aspC proA/pET32 vector showed no
increase in OD at 600 nm through 8 h and was not incubated further.
The other cultures were incubated until the OD600 reached about 0.5
(approximately 8 h). The gene expression was induced by the
addition of 0.2 mM IPTG and 0.5% arabinose. Pyridoxine at 0.5 mM
and biotin at 1 mg/mL were also added to each culture flask. Five
hours after induction, 0.04 mM pyridoxal phosphate, 0.5% sodium
pyruvate, 0.2% Tween-20 and 10 .mu.g/mL ampicillin were added to
each culture flask and the incubation was continued at 30.degree.
C. Samples for analysis of monatin (0.5 mL) and protein production
(5-10 mL) were withdrawn at 0, 4, 16, 24, 40, 49 and 67 h after
induction with IPTG. The concentrations of monatin and tryptophan
in the fermentation broth samples were measured by LC-MS/MS MRN.
The results are shown in the following tables. The concentration of
both tryptophan and monatin was highest in the fermentation broth
samples withdrawn 16 to 24 h after induction, as shown in Tables 14
and 15.
48TABLE 14 Monatin and tryptophan production in E. coli
12264.DELTA.lipA(DE3) transformed with aspCproA/pET32 and
DH10trpoperon/pPRONco Fermentation broth samples Time after
[monatin]; [tryptophan]; induction ng/mL ng/mL 4 12.4 2992.5 16
140.1 6986.1 24 179.1 7599.3 40 169.6 5993.2 49 150.7 5033.8 67
152.2 3854.4
[0567]
49TABLE 15 Monatin and tryptophan production in E. coli
12264.DELTA.lipA(DE3) transformed with aspCproA/pET32 and
pGX44trpoperon/pPRONco Fermentation broth samples Time after
[monatin]; [tryptophan]; induction ng/mL ng/mL 4 9.4 1959.1 16 91.6
5231.2 24 119.3 5611.8 40 116.1 4470.2 49 112.4 3973.9 67 114.0
2947.3
[0568] Cell extracts were prepared using Novagen BugBuster.TM.
reagent with benzonase nuclease, r-Lysozyme and Calbiochem protease
inhibitor cocktail III according to Novagen's protocol. The level
of protein expression in the cell extracts was analyzed by SDS-PAGE
using a 4-15% gradient gel (Bio-Rad, Hercules, Calif.). The
proteins expressed efficiently in the cell extracts prepared from
samples harvested 4-24 h after induction. Proteins with a molecular
mass of 55 to 59 kD (trpD and trpE gene products) and 48 to 50 kD
(trpC and HIS.sub.6aspC gene products) showed high levels of
expression. The cell extract samples were diluted 5-fold, filtered
and analyzed by LC/MS/MS MRM. Tryptophan but not monatin was
detected in the cell extract samples. The highest concentrations of
tryptophan were measured in the samples withdrawn 16 to 24 h after
induction and decreased in later time points. It is expected that
more concentrated cell extract samples will show monatin
concentrations at detectable levels.
Example 13
[0569] Production of Monatin in Recombinant Gram Positive
Bacteria
[0570] This example describes methods that can be used to produce
monatin in Gram positive bacteria such as Corynebacterium cells.
One skilled in the art will understand that similar methods can be
used to produce monatin in other bacterial cells. In addition,
vectors can contain other genes for increased production of
monatin.
[0571] Methods and Materials
[0572] Corynebacterium glutamicum ATCC 21847 was obtained from the
American Type Culture Collection. This strain is known to be
resistant to a variety of aromatic amino acid analogs and requires
phenylalanine and tyrosine for growth.
[0573] All restriction enzymes were purchased from New England
BioLabs (Beverly, Mass.). Primers were synthesized by Integrated
DNA Technologies, Inc (Coralville, Iowa) unless noted otherwise.
The Corynebacterium/E. coli shuttle vector, pEKEX-2, was obtained
from Dr. Lothar Eggeling, Institute of Biotechnology 1,
Forschungszentrum Julich GmbH, 52425 Julich Germany (Eikmanns et
al., (1991) Gene 102(1):93-8)).
[0574] Construction of aspCproApEKEX-2
[0575] Recombinant DNA techniques for PCR, purification of DNA,
ligations and transformations were carried out according to
established procedures (Sambrook, Fritsch, Maniatis et al., 1989).
The monatin operon containing the aspC and proA genes was cloned
into the pEKEX-2 vector using the aspCproApET32b construct as the
template. Primers for the synthesis of the operon with a KpnI
restriction 5' of the aspC ATG start codon and 3' of the proA stop
codon were designed for PCR amplification. The forward primer was
designed to include a ribosomal binding site 5' of the aspC
sequence and to exclude the His-tag sequence present in the pET32
construct. Forward primer:
50 5'-CGCGGTACCAGAAGGAGAGATGCACGATGTTTGAGAACATTACCGCC GCT-3',
[0576] Reverse primer 5'-
51 (SEQ ID NOS: 83 and 84) CGGGGTACCGCTTAGTCAAT-ATA-
TTTCAGGC-3'.
[0577] The following PCR protocol was used to amplify the monatin
operon. In a 50 .mu.L reaction, 50 ng template, 1.0 .mu.M of each
primer, 0.2 mM each dNTP, 0.5 U Pfuturbo DNA polymerase
(Stratagene, LaJolla, Calif.), 2.8 U Expand High Fidelity.TM.
Polymerase, and 1.times. Expand.TM. buffer with Mg were added
(Roche, Indianapolis, Ind.). The thermocycler program used included
a hot start at 96.degree. C. for 5 min; 10 repetitions of the
following steps: 94.degree. C. for 30 sec, 59-59.degree. C. for 1
min, 45 sec (gradient thermocycler), and 72.degree. C. for 1 min,
30 sec; 15 repetitions of the following steps: 94.degree. C. for 30
sec, 59-59.degree. C. for 1 min, 45 sec, and 72.degree. C. for 1
min, 30 sec increasing 5 sec each cycle; 10 repetitions of the
following steps: 94.degree. C. for 30 sec, 59-59.degree. C. for 1
min, 45 sec, and 72.degree. C. for 2 min, 45 sec. After the 35
cycles, the sample was incubated at 72.degree. C. for 7 min and
then stored at 4.degree. C. The PCR product was purified using the
QIAQuick PCR Clean-up kit (Valencia, Calif.) and was quantified by
measuring the absorbance at 260 nm.
[0578] The pEKEX-2 plasmid was digested with KpnI for 2 h at
37.degree. C. and then treated with shrimp alkaline phosphatase for
15 min (Roche Molecular Biochemicals; Indianapolis, Ind.). The PCR
product was digested with KpnI in an overnight reaction at
37.degree. C., and both digests were purified using a QIAQuick PCR
Clean-up kit. The ligation reaction was carried out using the Roche
Rapid DNA Ligation kit (Indianapolis, Ind.) with 84 ng of plasmid
and 130 ng of PCR product, and the resulting ligation mixture was
transformed into E. coli DH10B ElectroMAX cells (Invitrogen,
Carlsbad, Calif.) using the manufacturer's recommended procedure
for transformation of E. coli cells with 0.2 cm
micro-electroporation cuvettes and a Bio-Rad Gene Pulser II system
(Hercules, Calif.). After recovery in SOC medium, the
transformation mixture was plated on LB plates containing kanamycin
at 50 .mu.g/mL. Plasmid DNA was isolated from liquid cultures (5 mL
2.times. YT medium+kanamycin (50 .mu.g/mL) grown overnight at
37.degree. C.) of colonies picked from the LB+kanamycin plates and
purified using a QIAprep.RTM. Spin Miniprep kit (Qiagen). The
plasmids were then screened by restriction digestion for inserts
with the correct orientation and size, and the sequences were
verified by dideoxynucleotide chain-termination DNA sequencing
(SeqWright, Houston, Tex.).
[0579] Two clones with the correct sequence and orientation were
tested for their ability to express the aldolase and
aminotransferase genes. Fifty mL cultures of the constructs in LB
with 50 .mu.g/mL kanamycin were grown at 37.degree. C. with shaking
to an OD.sub.600 of about 0.3. The gene expression was induced by
the addition of 0.1 mM IPTG, and the cultures were incubated a
further 15 h at 30.degree. C. with shaking. Samples (10 mL) were
withdrawn at 0, 2, and 15 h after induction. The cells were
harvested by centrifugation at 4000.times.g for 10 min, washed with
50 mM MOPS, pH 7, and centrifuged again. Cell extracts were
prepared using Novagen BugBuster.TM. reagent with benzonase
nuclease and Calbiochem protease inhibitor cocktail III according
to the Novagen's protocol. The level of protein expression in the
cell extracts was analyzed by SDS-PAGE using 4-15% gradient gel
(Bio-Rad, Hercules, Calif.). Both polypeptides were expressed. The
proA aldolase polypeptide was 5-10% of the soluble protein fraction
15 h after induction, while the aspC aminotransferase polypeptide
appeared to be 20-30% of the soluble protein fraction in the 15 h
sample.
[0580] Preparation of Corynebacterium glutamicum Competent Cells
For Electroporation
[0581] Electrocompetent C. glutamicum cells were prepared using a
method that combined the protocols of Tauch et al. (Current
Microbiology, (2002) 45:362-367) and Koffas et al. (Metabolic
Engineering, (2003) 5:32-41). C. glutamicum cells were grown
overnight and inoculated the next day into 200 mL of MB medium
(with an initial absorbance at 600 nm of 0.1). MB medium contains 5
g/L yeast extract, 15 g/L tryptone, 5 g/L soytone, and 5 g/L sodium
chloride. The cells were then grown to a final absorbance at 600 nm
of 0.7 with shaking at 200 rpm. The cells were collected by
centrifugation (4000.times.g for 20 min at 4.degree. C.), and the
cell pellet was washed 3 times with 40 mL of ice-cold buffer (20 mM
HEPES, pH 7.2, containing 5% glycerol). The thrice washed pellet
was washed two more times with 20 mL ice-cold 10% v/v glycerol.
After centrifugation at 4000.times.g for 10 min at 4.degree. C.,
the cell pellet was suspended in 1.0 mL 10% v/v glycerol, divided
into 0.15 mL aliquots, and stored at -80.degree. C.
[0582] Transformation of Corynebacterium glutamicum with
aspCproApEKEX-2
[0583] Transformations in C. glutamicum cells (strain 21847) were
carried out using a method that combined the procedures of Tauch et
al. (Current Microbiology, (2002) 45:362-367) and Koffas et al.
(Metabolic Engineering, (2003) 5:32-41). The electrocompetent C.
glutamicum cells were thawed on ice. The aspCproApEKEX-2 DNA was
added (1 .mu.g), and the mixture incubated on ice for 5 minutes
before transfer to a chilled 0.2 cm electroporation cuvette. Prior
to the electric pulse, 0.8 mL of ice-cold 10% v/v glycerol was put
on the cell suspension very gently to avoid mixing the two liquid
layers. The electroporation conditions were 200 ohms, 25 .mu.Fd,
and 12.5 kV/cm. Following exposure to the single electric pulse,
the cell suspension was immediately transferred into 4 mL of
pre-warmed (46.degree. C.) MB medium and incubated at 46.degree. C.
for 6 min without shaking. Subsequently, the cells were incubated
with shaking at 200 rpm for 50 min at 30.degree. C. Portions of the
cells were spread on selective MB plates containing 25 .mu.g/mL
kanamycin to recover transformants. Clones able to grow on the
selective MB plates containing 25 .mu.g/mL kanamycin were screened
by PCR to confirm transformation.
[0584] Production of Monatin in Corynebacterium Cells Transformed
With aspCproApEKEX-2
[0585] Fresh plates of C. glutamicum::aspC proA/pEKEX-2 (strain
21847) were prepared on MB medium containing 25 .mu.g/mL kanamycin.
Overnight cultures (5 mL) were inoculated from a single colony and
grown at 30.degree. C. in MB containing 25 .mu.g/mL kanamycin. The
culture was centrifuged, and the cells suspended in 1 mL of the
production medium. An aliquot of the suspension (0.5 mL) was used
to inoculate 100 mL of production medium. The production medium was
similar to that used by Koffas et al. (Metabolic Engineering,
(2003) 5:32-41) for the production of lysine with the following
modifications. The amino acid additions were tyrosine and
phenylalanine at final concentrations of 200 .mu.g/mL; kanamycin
was added at 25 .mu.g/mL; threonine, methionine, and leucine were
not added. The inoculated cultures (100 mL) were incubated at
30.degree. C. with shaking until the OD.sub.600 reaches 0.2-0.4.
The gene expression was induced by the addition of 1.0 mM IPTG
(final concentration), and the culture was incubated at 30.degree.
C. with shaking. Pyridoxine was added to a final concentration of
0.5 mM when gene expression was induced. The incubation was
continued at 30.degree. C. with shaking overnight.
[0586] Sixteen hours after induction, 0.04 mM pyridoxal phosphate
(final concentration) in potassium phosphate (50 mM, pH 7.2),
sodium pyruvate (0.1%), and Tween-20 (0.2%) was added. The
incubation at 30.degree. C. was continued. Samples for analysis of
monatin and protein production (5 mL) were withdrawn at several
time points from 0 to 112 hours after the induction with IPTG. The
samples were centrifuged, and the separated supernatant and pellet
fractions were frozen at -80.degree. C. until analysis.
[0587] The concentration of monatin in the fermentation broth
samples was measured by LC-MS/MS (described in Example 6). Monatin
(from 3 to 12 ng/mL) was detected in broth samples withdrawn 66 to
112 hours after induction. Cultures producing more tryptophan also
produced more monatin. For example, when the concentration of
tryptophan in a broth sample withdrawn at 40 hours after induction
was 70 .mu.g/mL, the monatin concentration was 11-12 ng/mL in
samples withdrawn 66 to 112 hours after induction. In contrast, a
culture that produced less tryptophan (51 .mu.g/mL at 40 hours)
only secreted 3 ng/mL of monatin.
[0588] Production of Monatin in C. glutamicum (ATCC 13058), a
Glutamate Overproducer
[0589] Methods and Materials
[0590] Corynebacterium glutamicum ATCC 13058 was obtained from the
American Type Culture Collection. This strain is known to produce
and secrete glutamate.
[0591] Preparation of Corynebacterium glutamicum (ATCC 13058)
Competent Cells for Electroporation and Transformation With
aspCproApEKEX-2
[0592] Electrocompetent C. glutamicum (ATCC 13058) cells were
prepared as described for ATCC strain 21847. After the final wash
and re-suspension in 10% glycerol, 0.15 mL aliquots were stored at
-80.degree. C. The cells also were transformed with aspCproApEKEX-2
and pEKEX-2 as described for ATCC strain 21847.
[0593] Production of Monatin in Corynebacterium (ATCC 13058) Cells
Transformed With aspCproApEKEX-2
[0594] Fresh plates of 2 isolates of C.
glutamicum::aspCproA/pEKEX-2 (ATCC 13058) and 1 isolate of C.
glutamicum::pEKEX-2 (ATCC 13058) were prepared on MB medium
containing 25 .mu.g/mL kanamycin. Overnight cultures (5 mL) were
inoculated from a single colony and grown at 30.degree. C. in MB
containing 25 .mu.g/mL kanamycin. The cultures were centrifuged,
and the cells suspended in 1 mL of the C. glutamicum fermentation
medium. This medium contains the following in 1 L: glucose (100 g),
(NH.sub.4).sub.2SO.sub.4 (2 g), K.sub.2HPO.sub.4 (1 g),
KH.sub.2PO.sub.4 (1 g), MgSO.sub.4-7H.sub.2O (0.25 g),
FeSO.sub.4-7H.sub.2O (0.01 g), MnSO.sub.4-4H.sub.2O (0.01 g),
biotin (2.5 .mu.g). (Small aliquots 10% urea are added to the
cultures at intervals of 4-6 h to maintain the pH for long
fermentations.) An aliquot of each suspension (0.5 mL) was used to
inoculate 2.times.100-mL of the medium. The inoculated cultures
(100 mL) were incubated at 30.degree. C. with shaking until the
OD.sub.600 reached .about.0.4. The gene expression was induced by
the addition of 1.0 mM IPTG (final concentration), and the culture
was incubated at 30.degree. C. with shaking. Pyridoxine was added
to a final concentration of 0.5 mM when gene expression was
induced. The incubation was continued at 30.degree. C. with shaking
overnight.
[0595] Nine hours after induction, 0.04 mM pyridoxal phosphate
(final concentration) in potassium phosphate (50 mM, pH 7.2),
sodium pyruvate (0.1%), and Tween-20 (0.2%) were added to one
culture flask for each construct. The Tween-20 was omitted from the
second flask of each culture. The incubation at 30.degree. C. was
continued. Samples for analysis of monatin and protein production
(5 mL) were withdrawn at several time points from 0 to 68 hours
after the induction with IPTG. The samples were centrifuged, and
the separated supernatant and pellet fractions were frozen at
-80.degree. C. until analysis.
[0596] Results
[0597] The concentration of monatin in the fermentation broth
samples was measured by LC-MS/MS. Monatin was detected in broth
samples withdrawn 30 to 68 hours after induction. At 45 h after
induction the monatin concentration was highest in the cultures
transformed with aspCproApEKEX-2 to which Tween-20 had been
added--between 240 and 330 ng/mL. The level of monatin in the
cultures without Tween-20 ranged from 50 to 66 ng/mL. Surprisingly,
monatin was also observed in detectable but not quantifiable levels
in the control cultures.
[0598] Production of Monatin in Corynebacterium (ATCC 13058) Cells
Transformed With aspCproApEKEX-2 (con't)
[0599] The shake flask experiments were repeated with C. glutamicum
13058::aspC proA/pEKEX-2 and C. glutamicum 13058::pEKEX-2 using a
different feed regimen and were analyzed by LC/MS/MS MRM as
described in Example 6.
[0600] The following starter cultures were grown in LB with
kanamycin at 50 mg/L at 30.degree. C. with shaking at 250 rpm
overnight:
[0601] C. glutamicum 13058::aspCproA/pEKEX-2-1 (monatin operon)
[0602] C. glutamicum 13058::pEKEX-2-1 (vector control)
[0603] The 5 ml starter cultures were transferred to 100 ml of C.
glutamicum fermentation medium containing kanamycin at 50 mg/L.
Cultures were incubated at 30.degree. C. with shaking at 250 rpm to
OD.sub.600 of .about.0.5. At this time the following additions were
made to each flask to induce gene expression: 1 .mu.l IPTG (840 mM
stock), 10 ml pyridoxine HCl (50 mM stock), and 200 .mu.l PLP (20
mM stock). Cultures were incubated at 30.degree. C. with shaking at
250 rpm for 3 hours (OD600.about.0.5) following induction with
IPTG. The cultures were divided into two flasks by removal of 55 ml
(half) volume to new flasks. Each flask was subjected to one of the
two treatments described below. Additions were made as described in
Table 16:
52TABLE 16 Treatment: substrates + Sterile stock solutions
Treatment: substrates Tween, Ampicillin L-tryptophan (1% in 5 mL 5
mL 0.1 M NaPO.sub.4 buffer) 10% sodium pyruvate 5 mL 5 mL Distilled
water 3 mL -- 20% Tween 40 -- 1 mL 10% Tween 60 -- 2 mL 100 mg/mL
ampicillin -- 50 .mu.l
[0604] After the additions, cultures were incubated at 30.degree.
C. with shaking at 250 rpm for 48 hours. Ten ml culture broth from
each flask was removed for dry cell weight determination. The
remaining culture volume was centrifuged and supernatants were
filtered and used for glutamate and monatin analysis.
[0605] The results for culture broths are tabulated below in Table
17.
53TABLE 17 Dry cell weight Monatin Glutamate (DCW) Monatin (ng/mg
Glutamate (mg/mg Description (mg/ml) (ng/ml) DCW) (mg/mL) DCW) C.
glutamicum 1.64 293 179 7.4 4.5 13058 (PEKEX2-1) + substrates C.
glutamicum 0.52 67 129 616.0 1185 13058 (PEKEX2-1) + substrates +
Tween, Amp C. glutamicum 0.86 248 288 5.4 6.3 13058 (monatin
operon) + substrates C. glutamicum 0.28 164 586 166.4 594.3 13058
(monatin operon) + substrates + Tween, Amp
[0606] As observed above there was a definite increase in monatin
production in C.glutamicum 13058 cells expressing the aspC and proA
genes when compared to cells transformed with the vector pEKEX-2.
However, monatin is clearly being formed in cells that were not
transformed with the vector containing the aspC and proA genes
indicating that wildtype Corynebacterium glutamicum strains are
capable of making monatin. A further increase in monatin efflux was
also observed upon addition of Tween-40, Tween-60 and ampicillin to
the cultures. In addition chiral analysis using the FDAA
derivatization method of Example 6 of a C.glutamicum 13058
supernatant sample transformed with vector alone demonstrated the
presence of both S,S monatin and trace amounts of R,R monatin (seen
transiently). In a separate experiment, LC/MS/MS MRM analysis
showed the presence of multiple monatin peaks, indicating the
presence of either S,R or R,S and RR, or SS monatin.
[0607] C. glutamicum 13032::aspCproA/PEKEX-2 was also grown in
shake flask experiments using the same protocol as used with C.
glutamicum 13058::aspCproA/PEKEX-2. At 21 hours following
induction, C. glutamicum 13032::aspCproA/PEKEX-2 produced 1059 ppb
of monatin when the cultures were treated with Tween and ampicillin
in addition to substrates as shown in Table 16. C.glutamicum
13032::aspCproA/PEKEX-2 produced 428 ppb of monatin in the absence
of Tween and ampicillin treatment at the corresponding time point
of 21 hours following induction with IPTG. A control experiment
with C. glutamicum 13032::PEKEX-2 produced 45-58 ppb of monatin
with or without Tween and ampicillin at 21 hours following
induction with IPTG. C. glutamicum 13032 represents an additional
production host for monatin production.
[0608] Taken together, the results above clearly demonstrated the
potential of Corynebacterium glutamicum and other members of the
genus Corynebacterium, to produce monatin or serve as a source of
genes in the monatin operon that can be expressed in heterologous
hosts.
Example 14
[0609] Increased Production of Tryptophan in vivo Using Mutations
Which Relieve Regulation in Escherichia coli
[0610] The tryptophan biosynthetic pathway is highly regulated in
Escherichia coli. Relief of the regulatory points can increase the
flux towards tryptophan biosynthesis. Regulation can occur either
by feedback inhibition of the enzymes, as well as repression of the
synthesis of enzymes in the pathway. As tryptophan is an
intermediate in monatin production, improvement of the levels of
tryptophan can improve the levels of monatin produced. The
regulatory genes described below are only a few of the regulatory
points in the trytophan pathway and those skilled in the art know
that other tryptophan overproduction strategies can also increase
monatin yields in E. coli.
[0611] One skilled in the art can use analogs to select for
resistant mutants that can overproduce tryptophan. Relief of
regulatory points in the trytophan pathway can result in an
increase in the levels of monatin produced by bacteria such as E.
coli. One approach towards altering control points of feedback
inhibition is to select mutants that are resistant to analog
compounds. Examples of such compounds include, but are not limited
to, 5-fluorotryptophan, 3-fluorophenylalanine,
beta-2-thienylalanine, 6-fluorotryptophan, tryptophanhydroxamate,
p-fluorophenylalanine, p-aminophenylalanine, tyrosinehydroxamate,
and phenylalaninehydroxate (Azuma et al., Appl. Microbiol.
Biotechnol., 1993, 39: 471-476; and Duda and Sasvari-Szekely, Acta
Biochim. Biophys. Acad. Sci. Hung., 1973, 8: 81-90).
[0612] E. coli strains such as 7692 and E. coli 7692.DELTA.lipA DE3
(described in Example 10) can be grown on fresh LB plates.
Individual colonies can be used to inoculate shake flasks with M9
medium plus glucose and other required vitamins or cofactors. After
24 hours of incubation at 37.degree. C. with 250 rpm shaking, small
aliquots of E. coli culture can be removed and plated on M9 medium
plates that contain various concentrations of analogs (e.g., 1
mg/mL p-fluoropheynlalanine). Resistant colonies can be picked and
grown in 5 mL cultures of LB at 37.degree. C. with shaking to
screen for increased tryptophan production. Increased tolerance to
the analogs on the plates can be affected by gradually increasing
the analog concentration. This could also be carried out in
continuous culture.
[0613] These analogs can, for example, affect a key branchpoint at
the start of aromatic amino acid synthesis,
3-deoxy-D-arabino-heptulosonate 7-phosphate synthase. In E. coli,
this is coded for by three isozymes aroF, aroG, and aroH, each of
which are feedback inhibited by an amino acid of the pathway,
namely tyrosine, phenylalanine, and tryptophan, respectively.
Mutants resistant to the analogs described above will show relief
of this feedback inhibition.
[0614] Another key branchpoint is anthranilate synthase and
feedback resistant mutations in this gene can also improve
tryptophan production. Also, the effects of the one regulatory
mutation (e.g., the feedback resistant anthranilate synthase) can
be masked by a backup of an intermediate in the pathway. Thus,
those skilled in the art will combine tryptophan pathway mutations
to improve monatin production. Other examples of mutations in the
tryptophan pathway and aromatic biosynthetic pathway that can be
used to improve monatin production include, but are not limited to,
any of the enzymes specific to tryptophan biosynthesis which are
made resistant to feedback inhibition by tryptophan, and relief of
repression altering trpR or its binding site, as well as relief of
the attenuation control of operon expression (Kim et al., J.
Microbiol. Biotechnol., 2000, 10: 789-796; Jossek et al., FEMS
Microbiol. Lett., 2001, 202: 145-148; Bongaerts et al., Metabol.
Eng., 2001, 3: 289-300; Azuma et al., Appl. Microbiol. Biotechnol.,
1993, 39: 471-476; Flores et al., Nature Biotechnol., 1996, 14:
620-623; Tribe and Pittard, Appl. Environ. Microbiol., 1979, 38:
181-190; Yanofsky et al., J. Bacteriol., 1984, 158: 1018-1024;
Gosset et al., J. Indus. Microbiol., 1996, 17: 47-52).
[0615] Besides genetic alteration of strains to enhance tryptophan
and monatin production, growth conditions such as medium
ingredients as well as altered process conditions such as pH,
temperature and mixing can improve synthesis of tryptophan and
monatin by a host microorganism. Thus, suitable medium such as
those containing growth factors can be used to increase tryptophan
production from E. coli. For example, the concentration of growth
factors such as pyrimidines, trace elements, and biotin can impact
production and excretion of intermediates (Jensen, (1993) J.
Bacteriol., 175:3401-3407).
Example 15
[0616] Increased Production of Tryptophan in E. coli Using an
Overexpression Strategy
[0617] Another strategy to increase the levels of tryptophan in E.
coli is to increase the number of copies of the trytophan
biosynthetic genes in the cell. This can be accomplished by cloning
the genes into a vector and transforming the vector into cells. One
skilled in the art will recognize that increasing the copy number
of the genes can also be accomplished by cloning the genes into the
chromosomal DNA, or altering the native promoter region.
[0618] Three strains cited in U.S. Pat. No. 4,371,614 were obtained
from the U.S.D.A. Peoria culture collection. The first host strain,
NRRL B-4574, is also called KB3100 and is .DELTA.aroP. The second
strain, NRRL B-12262, is also called AGX15 and has the genotype
serB.sup.-, trp.DELTA.ED, tnaA2.sup.-, tetS, tyrA.sup.-,
pheA.sup.-. It contains a plasmid called pGX44. pGX44 is derived
from pBR322 (Roeder and Somerville, Molec. Gen. Genet., 1979, 176:
361-368) and contains the serB gene and the tryptophan operon. The
third strain, NRRL B-12264, is also called AGX6 and has the
genotype serB.sup.-, trp.DELTA.ED, tnaA2.sup.-, aroP.sup.-. It
contains a plasmid called pGX50. pGX50 is derived from pBR322 and
contains the serB gene and a tryptophan operon which was derived
from cells that are resistant to 5-methyltryptophan.
[0619] Strains NRRL B-12262 and B-12264 have the serB gene deleted,
which results in serine being needed for host strain growth. The
plasmids pGX44 (in B12262) and pGX50 (in B-12264) each contain the
serB gene, thus the serine auxotrophy is a selection pressure for
retaining the plasmid. A medium that lacks serine can be used to
maintain the plasmid even in the presence of high concentrations of
tryptophan produced by these organisms. The plasmid carrying
strains, 12262 and 12264, when cultured in medium without serine
must maintain multiple copies of the plasmid to survive and grow
and, therefore, carry multiple copies of a tryptophan operon. The
NRRL B-4574 strain does not carry either of these plasmids, and
thus, only has one copy of a tryptophan operon (on the genome). All
growth media and fermentation media used for NRRL B-12264 contained
50 .mu.g/mL ampicillin as the pGX50 vector contains an ampicillin
resistance gene.
[0620] The strains were grown in LB broth and Trp Production
medium. Trp production medium contains, per liter: 30 g of Glucose,
10 g of (NH.sub.4).sub.2 SO.sub.4, 1.0 g of KH.sub.2PO.sub.4, 1.0 g
of MgSO.sub.4-7H.sub.2O, 0.01 g of FeSO.sub.4-7H.sub.2O, 0.01 g of
MnCl.sub.2-4H.sub.2), 4 g of Casamino acids, and 40 g of
CaCO.sub.3. The inoculum for the shake flasks was grown in LB
broth. Three milliliters of inoculum culture was used to inoculate
50 mL of media in a 250 mL baffled shake flask. The shake flasks
were incubated at 30.degree. C. with moderate shaking (200 rpm).
Tryptophan was measured as described in Example 6. The shake flasks
were sampled periodically for glucose and OD.sub.550. The results
are presented in Table 18.
54TABLE 18 Tryptophan production by E. coli strains containing
multiple copies of the tryptophan operon E. coli strain .mu.g/mL
Tryptophan NRRL B-4574 Trp Production Medium 6 NRRL B-4574 LB Broth
44 NRRL B-12262 Trp Production Medium 417 NRRL B-12262 LB Broth 568
NRRL B-12264 Trp Production Medium 104 NRRL B-12264 LB Broth 2 Trp
Production Medium Blank 0.01 LB Broth Medium Blank 60
[0621] Multiple copies of the tryptophan operon appear to increase
the production of tryptophan by E. coli. Strains that contain some
of the same genetic modifications but no extra copies of the
tryptophan operon produced less tryptophan under similar
experimental conditions. For example, E. coli SR 250 (Rothman and
Kirsch, 2003) is a tyrA- and pheA-strain, but it produced only
approximately 0.1 .mu.g/mL when tested under similar conditions.
These data suggest that a host strain with multiple copies of
tryptophan biosynthetic genes, particularly ones with pheA
disrupted, can be used to obtain increased monatin production.
Example 16
[0622] Production of Tryptophan in Fermentors
[0623] Fermentors can be used to achieve economically efficient
monatin production. With the use of fermentation equipment,
parameters such as pH, oxygen, and mixing are easily controlled so
that a fermentation reaction can be optimized.
[0624] Three E. coli strains, NRRL B-4575, NRRL B-1 2262 and NRRL
B-1 2264 were obtained from the U.S.D.A. laboratory in Peoria, Ill.
The latter two strains both contain the tryptophan operon on
plasmids. These strains are descibed in more detail in Example 15.
Infors fermentors with 300 ml of medium was used for the
fermentation study. The tryptophan production medium was described
in Example 15.
[0625] The bacterial inoculum was taken from freshly streaked LB
plates. One loopful was inoculated into 50 mL of Trp Production
medium in 250 mL shake flask, and the culture grown overnight at
37.degree. C. 15 mL from the seed flask was inoculated into each
duplicate Infor 300 mL fermentor vessel containing 250 mL of Trp
Production medium. Agitation was started at 500 rpm and allowed to
increase to 1000 rpm. Air was sparged in at 1 vvm and increased to
5 vvm by 4 hours. The pH was maintained at 7.0 with 1N sodium
hydroxide.
[0626] Samples were taken periodically and analyzed for glucose and
OD.sub.550. After 3 days, the fermentation broth was spun down at
15,000 rpm for 2 minutes, filtered, and frozen until tryptophan
analysis.
[0627] As shown in Example 15, NRRL B-12262 produces about 4-fold
more tryptophan than NRRL B-12264 in shake flasks using the Trp
production medium. As seen in Table 19, NRRL B-12262 produces
considerably less tryptophan in fermentors than in shake flasks,
which could be due to unoptimized scale-up stress on the
microorganism. A similar stress of strain NRRL B-12264 could
explain its lack of production of detectable tryptophan in
fermentors. It is expected that those skilled in the art will be
able to improve tryptophan production in fermentors by both NRRL
B-12262 and NRRL B-12264 strains.
55 TABLE 19 E. coli strain .mu.g/mL Tryptophan NRRL B-4574 0.03
NRRL B-12262 221 NRRL B-12264 0.03 Tryptophan Production Medium
Blank 0.04
Example 17
[0628] Increased Production of Tryptophan by Mutants of
Corynebacterium
[0629] Corynebacterium glutamicum ATCC 21847 was obtained from the
American Type Culture Collection. This strain is resistant to a
variety of analogs and has genetic mutations that create
phenylalanine and tyrosine auxotrophy. C. glutamicum 21850 and
21851 are different strains that were created similarly using
analogs such as 6 fluoro-tryptophan, 4 aminophenylalanine,
tryptophan hydroxamate and 4 methyl tryptophan.
[0630] A fresh colony of ATCC 21847 from a nutrient agar plate was
inoculated into a 5 mL tube of seed which contains glucose, 2%,
peptone, 1%, yeast extract, 1%, and NaCl, 0.3%. After overnight
culture at 30.degree. C. with shaking, 2 mL of the tube was
inoculated into 50 mL of media in a shake flask. Two media were
used. The first medium (Medium 1) is composed of: glucose, 10%,
KH.sub.2PO.sub.4, 0.05%, K.sub.2HPO.sub.4, 0.05%,
MgSO.sub.4-7H.sub.2O, 0.025%, (NH.sub.4).sub.2SO.sub.4, 2%,
NZ-amine, 0.5%, biotin, 30 .mu.g/mL, and CaCO.sub.3, 2%. The pH was
adjusted to 7.2. The second medium (Medium 2) is composed of per
liter: Molasses, 100 g based on glucose, KH.sub.2PO.sub.4, 0.5 g,
K.sub.2HPO.sub.4, 0.5 g, MgSO.sub.4,0.25 g, NH4SO.sub.4, 0.25 g,
Corn Steep Liquor, 10 g, CaCO.sub.3, 20 g, tyrosine, 38 mL of 4
mg/mL stock solution, and phenylalanine, 12 mL of a 25 mg/mL stock
solution (U.S. Pat. No. 3,849,251). The pH was adjusted to 7.2.
[0631] The flasks were incubated at 30.degree. C. in Innova shakers
at 250 rpm for four days, and tryptophan levels were measured as
described in Example 6.
[0632] The results are shown in Table 20. The analog resistant
mutant of Corynebacterium produced tryptophan (Table 20) at higher
levels than other C. glutamicum strains. The higher levels observed
with Medium 2 are likely a reflection of the rich medium
components, such as the Corn Steep Liquor and molasses. Similarly,
ATCC 21851 produced 300-370 .mu.g/mL tryptophan in Medium 2, and
only 1-2 .mu.g/mL tryptophan in Medium 1. ATCC 21850 was not tested
in the optimal medium (Medium 2), but is expected to behave
similarly to 21851. These results demonstrate that Corynebacterium
host strains can be economical producers of monatin. In addition,
strategies similar to those described herein for increasing
tryptophan production in E. coli (See, e.g., Examples 14-17) can be
used in Corynebacterium to improve its properties as a host
production microbial strain for monatin (Shiio et al., Agr. Biol.
Chem., 1975, 39: 627-635; Hagino and Nakayama, Agr. Biol. Chem.,
1975, 39: 343-349; Shiio et al., Agr. Biol. Chem., 1984, 48:
2073-2080; Heery etal., Biochem. Biophys. Res. Commun., 1994, 201:
1255-1262; Heery and Dunican, Appl. Environ. Microbiol., 1993,
59:791-799; and Katsumata and Ikeda, Bio/Technol., 1993,
11:921-925).
56TABLE 20 Production of tryptophan by Corynebacterium ATCC 21847
Medium Tryptophan (.mu.g/mL) Medium 1 80.8 Medium 1 119 Medium 2
2517 Medium 2 2535 Medium 1 Blank 37.2 Medium 2 Blank 1.0
Example 18
[0633] Glutamate Production in Corynebacterium glutamicum
[0634] Part A: Physical Methods for Improving Yields of Glutamate
in the Broth
[0635] One important limitation for economical amino acid
production is the excretion of the amino acid out of the cell.
Microbial cells typically have mechanisms for transporting amino
acids into the cell, but the mechanisms of export of high levels of
amino acids is not known in many cases. Physical means, such as use
of detergents and modifications of the medium, can be used to
effect glutamate efflux. Since both glutamate and monatin are
dicarboxylic acids, one skilled in the art could use the techniques
described below for glutamate to improve monatin release into the
medium.
[0636] Corynebacterium glutamicum ATCC 13058, 13655, and 13689 were
obtained from the American Type Culture Collection. These strains
are cited as producers of glutamate (U.S. Pat. Nos. 3,002,889 and
3,128,237).
[0637] The strains were grown in shake flasks in medium containing
per liter: KH.sub.2PO.sub.4, 1.0g, soy peptone, 2.0 g,
MgSO.sub.47H.sub.2O, 0.4 g, FeSO.sub.4, 0.01 g, MnSO.sub.4, 0.01 g,
glucose, 100 g, urea, 5 g, biotin, 4 .mu.g, thiamine, 200 .mu.g.
The pH of the medium was adjusted to 6.0 and urea, glucose, biotin,
and thiamine were all sterilized separately. The cultures were
incubated at 30.degree. C. for 72 hours with shaking. At 18 hr,
1.8% urea was added to the flasks.
[0638] All three strains produced glutamate and secreted some of it
in the medium, as shown in Table 21. Cells were recovered from the
flasks by centrifugation and were split and treated by either of
two methods: a detergent-enzyme method using BugBuster.RTM. with
Lysonase.TM. (Novagen) and osmotic shock. Osmotic shock was
performed by diluting cells 1:20 with cold deionized water. These
treatments are expected to partially, but not completely, disrupt
the cell envelope of a gram positive organism (such as
Corynebacterium glutamicum) and, thus, should facilitate release of
intracellular metabolites. Glutamate was analyzed by the high
throughput method described in Example 6.
[0639] The data show that an equivalent amount of glutamate to that
secreted was retained in the cell and that various physical
treatments were able to release it. In addition to these
treatments, other physical treatments would also be expected to
release glutamate from the cell and these techniques could also be
employed to facilitate the liberation of monatin.
57TABLE 21 Glutamate concentration in medium (secreted) and
glutamate released from C. glutamicum by physical treatment
TREATMENT Excreted .mu.g/mL* Bug Buster .mu.g/mL Osmotic .mu.g/mL
ATCC 13869 300 198.5 318.5 ATCC 13655 275.5 221.5 137 ATCC 13058
253 207 200.5 *values are presented as .mu.g of glutamate produced
per mL of fermentation broth.
[0640] Part B: Additional factors for Improvement of Glutamate
Production
[0641] Glutamate excretion can be affected by a variety of factors
including antibiotics, surfactants, temperature, osmotic stress, pH
and biotin concentration. This example elucidates factors involved
in glutamate production and/or secretion.
[0642] Corynebacterium glutamicum ATCC 13058 and ATCC 13655 were
obtained from the American Type Culture Collection. These strains
are known producers of glutamate.
[0643] A series of statistical, factorial designs were done to
investigate various factors in glutamate production in C.
glutamicum ATCC strainsl3058 and 13655. A colony of each strain was
used to inoculate 5 mL of modified MCGC medium for an overnight
culture at 30.degree. C. Shake flasks with modified MCGC medium
were inoculated with 0.5-1.0 mL of the seed cultures. The modified
MCGC medium contains (per L): 3 g Na.sub.2HPO.sub.4, 6 g
KH.sub.2PO.sub.4, 2 g NaCl, 8 g (NH.sub.4).sub.2SO.sub.4, 0.5 g
Soytone, 60 g glucose, 3.9 mg FeCl.sub.3, 0.9 mg
ZnSO.sub.4-7H.sub.2O, 0.56 mg CuSO.sub.4-5H.sub.2O, 3.9 mg
MnSO.sub.4-7H.sub.2O, 0.1 mg
(NH.sub.4).sub.6Mo.sub.7O.sub.4-4H.sub.2O, 0.3 mg
Na.sub.2B.sub.4O.sub.7-10H.sub.2O, 84 mg CaCl.sub.2-2H.sub.2O, 2 g
betaine. Treatments included (per liter) 100 mmol MOPS or MES, 50
or 400 mg MgSO.sub.4-7H.sub.2O, 4 or 20 mg thiamin, and 4 or 20 ug
biotin. At 16 hours, Tween 40 or 60 were added to 3 mls per liter,
ampicillin to 0 or 10 ug/mL, and temperature increased to
40.degree. C. for flasks requiring higher temperature treatment.
The flasks were incubated at 250 rpm and 30.degree. C., unless
otherwise noted, for 2-3 days.
[0644] Samples were taken periodically and analyzed for glucose
concentration (g/L), cell density (OD.sub.600) and pH. After 2-3
days, samples were centrifuged and supernatant was filtered and
frozen until glutamate analysis by HPLC as in Example 6 for the
fluorescence detection method.
[0645] Factors studied for glutamate production/excretion included
ampicillin, Tween, temperature, initial pH, biotin, magnesium, and
thiamine. For C. glutamicum ATCC 13058, statistically significant
factors in glutamate production included biotin, initial pH and an
interaction between biotin and pH. Analysis of variance (ANOVA), a
statistical method to test hypotheses about differences between two
or more means, was used to analyze the results. The predictive
model was significant at the .alpha. level of <0.0001 with an
adjusted R.sup.2 of 0.96. An initial pH of 8.0 was better for
glutamate production than pH 7.6 or 6.5. The lowest biotin
concentration, 4 ug/L, resulted in greater production of glutamate.
This result is consistent with other research showing that a
limiting concentration of biotin from 2 to 5 ug/L (micrograms/L)
affects the fluidity of the cell membrane and enhances glutamate
efflux (Eggeling L and Sahm H (1999) "Amino-acid production:
principles of metabolic engineering" in Metabolic Engineering (Ed:
Lee S Y, Papoutsakis E T); Marcel Dekker, Inc, NY, N.Y. Thus, in
one embodiment, culture medium for a microorganism comprises 5 ug/L
or less biotin.
[0646] Both the low and high levels of biotin (4 ug/L and 20 ug/L)
resulted in higher glutamate at pH 8.0 than at pH 7.6. Tween 40 and
Tween 60 worked equally well, although, there was a possible
interaction between magnesium concentration and Tween type that
affected glutamate production. In the presence of Tween, ampicillin
addition decreased glutamate production. The supernatant glutamate
concentration ranges for ATCC 13058 and ATCC 13655 were 0-13.3 mM
and 0-11.3 mM, respectively.
[0647] These results show that glutamate production/excretion can
be manipulated with the significant factors above. It is predicted
that the same factors will be useful in monatin
production/excretion based on the dicarboxylic acid structure that
it shares with glutamate. (Delaunay S., et al, 1999, Enzyme and
Microbial Technology, 25, 762-768).
[0648] Part C: Improvement of Glutamate Production with Kramer's
Medium and Increased Temperature
[0649] This example demonstrates an improved glutamate production
with a different strain, temperature, and medium.
[0650] Corynebacterium glutamicum strains ATCC 13032 and ATCC 13058
were obtained from the American Type Culture Collection.
[0651] A study with both strains was carried out at 30.degree. and
37.degree. C. in Kramer's A medium. A colony of each strain was
used to inoculate 5 mL of Kramer's A medium for an overnight
culture at 30.degree. C. Shake flasks with Kramer's A medium were
inoculated with 0.5-1.0 mL of the seed cultures. Kramer's A medium
contains (per L): 5 g (NH.sub.4).sub.2SO.sub.4, 5.0 g urea, 2.0 g
KH.sub.2PO.sub.4, 1.53 g K.sub.2HPO.sub.4, 1 mole
MgSO.sub.4-7H.sub.2O, 50 g glucose, 0.01 g FeSO.sub.4-7H.sub.2O,
0.01 g MnSO.sub.4-7H.sub.2O, 0.01 g CaCl.sub.2-2H.sub.2O, 0.03 mg
ZnSO.sub.4-7H.sub.2O, 0.1 mg as Mo from
(NH.sub.4).sub.6Mo.sub.7O.sub.4-4H.sub.2O, 0.10 mg H.sub.3BO.sub.3,
0.07 mg CoCl.sub.2-6H.sub.2O, 0.01 mg NiCl.sub.2-2H.sub.2O, 0.03 mg
CuCl.sub.2-2H.sub.2O and 1 ug biotin. The pH is adjusted to 7.0
with 5M NaOH. Tween and ampicillin were not added in this
experiment. The flasks were incubated at 250 rpm and 30.degree. C.
or 37.degree. C. for 24 hours. Glutamate was analyzed by the high
throughput method described in Example 6.
[0652] Results for the experiment with ATCC 13032 and ATCC 13058 at
30.degree. and 37.degree. C. are listed in Table 22.
58TABLE 22 Glutamate concentration in Kramer's A medium at two
temperatures ATCC Strain Temperature (.degree. C.) Glutamate (mM)
13032 30 40.7 13032 37 39.4 13058 30 40.5 13058 37 54.2
[0653] Corynebacterium glutamicum ATCC 13058 produced more
glutamate (54 mM) at 37.degree. C. while C. glutamicum 13032
produced similar amounts (.about.40mM) at both temperatures. These
results again show that glutamate production/excretion can be
manipulated by varying the temperature and medium components. It is
predicted that the same factors will be useful in monatin
production/excretion based on the dicarboxylic acid backbone that
it shares with glutamate. (Hoischen C. and Kramer R., 1989, Arch
Microbiol, 151:342-347).
Example 19
[0654] Cloning of Tryptophanase Gene (tna) from Escherichia
coli
[0655] Tryptophanase Polypeptides (EC 4.1.99.1) Catalyze the
Following Reversible Reaction:
[0656] L-Tryptophan+H.sub.2OIndole+Pyruvate+NH.sub.3
[0657] In some instances, the gene encoding tryptophanase is
deleted from host strains to prevent hydrolytic breakdown of
tryptophan. However, if an excess of indole, pyruvate, and ammonium
are supplied to cells, this enzyme can be overexpressed to aid in
the synthesis of tryptophan. This approach is particularly useful
when no deregulation of the host biosynthetic pathway of tryptophan
has been performed. The tryptophanase gene from Escherichia coli
DH10B was cloned into a pPROLAR derived vector that is compatible
with pET vectors containing monatin biosynthetic pathway genes and
supplementary genes.
[0658] Isolation of Genomic DNA for Cloning
[0659] Escherichia coli genomic DNA was isolated from strain DH10B
(Invitrogen) and prepared using the Qiagen Genomic-tip.TM. (500/G)
kit. From 30 mL of this strain grown in LB to an OD.sub.650 of
1.87, 0.3 mg of purified DNA was obtained. The purified DNA was
dissolved in Qiagen elution buffer (EB) at a concentration of 0.37
.mu.g/.mu.L.
[0660] Polymerase Chain Reaction Protocol
[0661] Primers were designed for molecular cloning in pPROLar.A122
(Clontech Laboratories, Inc.) in which the NcoI recognition site in
the kanamycin gene was mutated (herein referred to as pPRONco). The
sequence of the pPRONco primers was as follows:
59 (SEQ ID NOS: 77 and 78) forward:
5'-TGCCATGGAAAACTTTA-AACATCT-3'; reverse:
5'-CCAAGCTTTTAAACTTCTTTAAGTTTTG-3'.
[0662] PCR was performed using the following PCR protocol. In a 50
.mu.L reaction, 0.1-0.5 .mu.g template, 1.5 .mu.M of each primer,
0.4 mM each dNTP, 3.5 U Expand High Fidelity Polymerase (Roche,
Indianapolis, Ind.), and 1.times. Expand.TM. buffer with Mg were
used. The thermocycler program used included a hot start at
96.degree. C. for 5 minutes, followed by 29 repetitions of the
following steps: 94.degree. C. for 30 seconds, 50.degree. C. for
1.75 minutes, and 72.degree. C. for 2.25 minutes. After the 29
repetitions, the sample was maintained at 72.degree. C. for 10
minutes and then stored at 4.degree. C. This PCR protocol produced
a product of about 1500 bp.
[0663] Cloning
[0664] The PCR products were gel purified from 0.8 or 1%
TAE-agarose gels using the Qiagen gel extraction kit (Valencia,
Calif.). The tna gene was inserted in the pPRONco vector by
insertion between the NcoI and HindIII restriction sites in the
multiple cloning site. Cloning in pPRONde was accomplished by
insertion between the NdeI and HindIII sites.
[0665] The ligation mixture was tranformed into DH10B cells using
electroporation. Cells were plated on LB plates containing 50 mg/L
kanamycin for selection. Plasmid DNA was purified using the Qiagen
spin miniprep kit and screened for the correct inserts by
restriction digest. The sequences of plasmids that appeared to have
the correct insert were verified by dideoxy chain termination DNA
sequencing. Chemically competent E. coli BL21(DE3) cells were
co-transformed with aspC proA/pET32 and tna/pPRONco or transformed
with tna/pPRONco alone according to the manufacturer's protocol
(Novagen, Madison, Wis.).
[0666] Production of Monatin and Tryptophan in E. coli BL21(DE3)
Cells Transformed With aspC proApET32 and tna/pPRONco
[0667] Cultures of E. coli BL21(DE3) transformed with tna/pPRONco
or transformed with both aspC proA/pET32 and tna/pPRONco were grown
in trp-1 medium with 0.4% glucose and Balch's vitamin solution at
37.degree. C. with shaking (duplicate cultures for each construct).
The tna/pPRONco cultures also contained 50 .mu.g/mL kanamycin while
the cultures containing BL21(DE3) transformed with both plasmids
also contained 50 .mu.g/mL kanamycin and 100 .mu.g/mL ampicillin.
(see Examples 1, 7 and 11 for recipes). When the OD.sub.600 reached
between 0.5 to 0.7 the cultures were induced with 1.0 mM IPTG and
0.5% L-arabinose and the incubation was continue at 30.degree. C.
In addition, 0.5 mM pyridoxine was added at the time of induction.
Five hours after induction, 0.04 mM pyridoxal phosphate, 0.5%
sodium pyruvate, and 0.6% ammonium chloride were added to each
culture flask, the pH of each was adjusted to 7.5-7.6, and then 5
mM indole (from a stock of 50 mM indole in aqueous 2% TritonX-100)
was added to each flask. The incubation was continued at 30.degree.
C. Samples for analysis of tryptophan and monatin (0.5 mL) and
protein induction (1 mL) were withdrawn at 0, 5, 7.5, 20, 30, 48,
and 74 h after induction with IPTG. Samples for dry cell weight
(DCW) analysis were withdrawn 7.5, 20, 30, and 48 h after
induction. The concentrations of monatin and tryptophan in the
fermentation broth samples was measured by LC-MS/MS MRM as
described in Example 6.
[0668] The results are shown in Tables 23 and 24 below. The
concentration of tryptophan in the fermentation broth reached about
1.1 g/L 20 h after induction in the cultures expressing the tna
gene alone and increased to approximately 1.3 g/L by 74 h. Monatin
could not be detected in any of the samples withdrawn from the
cultures expressing only the tna gene. The concentration of
tryptophan in the cultures expressing both tna and aspCproA genes
was about 10% that of the cultures expressing the tna gene alone.
In these cultures, however, monatin was produced. The highest
concentration was measured at 48 h after induction (263 ng/mL).
60TABLE 23 Tryptophan production in E. coli BL21(DE3) transformed
with tna/pPRONco Fermentation broth samples Time after
[tryptophan]; [tryptophan]; induction .mu.g/mL .mu.g/mg DCW 0 0 0 5
0 0 7.5 223.8 19.7 20 1188.5 134.6 28 872.2 95.2 48 1137 170.5 74
1300.8
[0669]
61TABLE 24 Monatin and tryptophan production in E. coli BL21(DE3)
transformed with tna/pPRONco and aspCproA/pET32a Fermentation broth
samples Time after [tryptophan]; [tryptophan]; [monatin];
[monatin]; induction .mu.g/mL .mu.g/mgDCW ng/mL ng/mgDCW 0 0 0 0 0
5 0 0 0 0 7.5 29.2 3.7 0 0 20 109.3 20.0 80.5 12.8 28 79.2 12.9
145.5 23.3 48 104.1 19.2 262.6 49.2 74 110.1 187.3
Example 20
[0670] Increasing Flux to Aromatic Pathways by Overexpression of
Phosphoenolpyruvate Synthase (EC 2.7.9.2) and Related Genes
[0671] Engineering central metabolism to increase the flux of
carbon from glucose or pyruvate to the aromatic pathways can
increase the amount of tryptophan, and therefore the amount of
monatin produced during fermentation. Different approaches have
been taken, one of which is to recycle the pyruvate formed by
either the PTS or pyruvate kinases back to PEP by enhancing
expression of PEP synthase (Pps) (Patnaik and Liao, (1994), Appl.
Env. Microbiol., 60:3903-3908; Patnaik et al., (1995), Biotechnol.
Bioeng., 46, 361-370; Yi etal., (2002), Biotechnol. Prog., 18,
1141-1148; U.S. Pat. No. 6,489,100; U.S. Pat. No 5,985,617; and
U.S. Pat. No. 5,906,925). PEP synthase converts ATP and pyruvate to
AMP, phosphoenolpyruvate, and phosphate in the presence of water.
Increased PEP levels cause an increase in DAHP production, which is
an important precursor to shikimate, chorismate, and to aromatic
amino acid production. The ppsA gene is highly ubiquitous and can
be readily isolated and overexpressed in a production host such as
E. coli. Recombinant PpsA can be introduced into the chromosome of
a host organism or on a plasmid. A plasmid containing the ppsA gene
could be co-expressed with the monatin operon described in Example
7 or could be added to the monatin operon. The transketolase (tkt)
gene can be co-expressed to further increase aromatic amino acid
precursor molecules. It is expected that such genetic constructs
would improve monatin production.
Example 21
[0672] Production of Biosynthetic Genes in Fermentors
[0673] Example 3 describes a process utilizing two enzymes, an
aminotransferase and an aldolase to produce monatin from tryptophan
and pyruvate. The aldolase (ProA aldolase, proA gene) from
Comamonas testosteroni and the L-aspartate aminotransferase encoded
by the E. coli aspC gene have been cloned, expressed, and purified
as described in previous examples. Fermentation processes were
developed to increase production of the enzymes so they can be used
in an in vitro process for the production of monatin.
[0674] Batch Fermentation for the Production of L-aspartate
Aminotransferase
[0675] An E. coli aspC/pET30/BL21(DE3) (L-aspartate
aminotransferase producer) strain was grown in batch in a 3 L
fermentor using a medium containing per liter: 2 g
(NH.sub.4).sub.2SO.sub.4, 1.6 g KH.sub.2PO.sub.4, 9.9 g
Na.sub.2HPO.sub.4*7H.sub.2O, 0.65 g sodium citrate MgSO.sub.4, 20 g
NZ Amine A, 20 g glucose, and 25 mg kanamycin. The pH was
controlled at 7.0 with NaOH, the temperature was maintained at
37.degree. C. before induction and lowered to 34.degree. C. at the
time of induction. The culture was maintained aerobic throughout
the fermentation by increasing the agitation rate. Enzyme
expression was induced with 0.1 to 0.4 mM IPTG. The cells were
induced at an OD.sub.600 of 3 (between 3 and 4 h after inoculation)
or 10 (between 5 and 6 h after inoculation). The best results were
obtained when the cells were induced at OD.sub.600 of 3 with 0.1 mM
IPTG. Under these conditions, cell biomass concentration reached
7.2 g/L, with about 20-40% of the total soluble protein being the
aminotransferase. The overall amount of enzyme (0.8 grams of
aminotransferase polypeptide per liter of culture) was 6 times
greater than was obtained in shake flask cultures experiments
carried out as described in Example 3.
[0676] Fed-Batch Fermentation for the Production of ProA
Aldolase
[0677] An E. coli proA/pET30/BL21(DE3) (aldolase producer) was
grown in a 3 liter fermentor in fed-batch mode. A defined medium
was used containing, per liter: 2 g (NH.sub.4).sub.2SO.sub.4, 8 g
KH.sub.2PO.sub.4, 2 g NaCl, 1 g Na Citrate, 0.01 g
FeSO.sub.4*7H.sub.2O, 2 g MgSO.sub.4*7H.sub.2O, 0.05 g
CaSO.sub.4*2H.sub.2O, 7.5 mg EDTA, 2.5 mg MnSO.sub.4*H.sub.2O, 0.5
mg
[0678] CoCl.sub.2*6H.sub.2O, 0.5 mg ZnSO.sub.4*7H.sub.2O, 0.05 mg
CuSO.sub.4*5H.sub.2O, 0.05 mg H.sub.3BO.sub.3, 50 mg p-aminobenzoic
acid, 20 mg folic acid, 20 mg biotin, 20 mg nicotinic acid, 50 mg
calcium pantothenate, 50 mg riboflavin, 50 mg thiamine
hydrochloride, and 100 mg of pyridoxine hydrochloride. The initial
glucose concentration was 2 g/L, and glucose was fed exponentially
to maintain a growth rate between 0.15 and 0.25 hour.sup.-1.
Nitrogen was provided on demand through pH control with NH.sub.4OH.
The cultures were induced with 1 mM IPTG when an OD.sub.600 of 25
(17 h after inoculation) or 35 (21 h after inoculation) was
reached. The better protein expression was obtained when the cells
were induced at the lower cell density. Enzyme expression was very
high at 20-30% of the total soluble protein, and even though
specific enzyme activity was reduced compared with cells grown in
flasks, the overall enzyme activity per L of medium was 9 times
greater than that measured in shake flask experiments carried out
as described in Example 3. A total of 1.8 grams of aldolase
polypeptide was measured per liter of culture. Different cell
concentrations were obtained depending on the growth rate, with a
maximum of 26.3 g/L of dry cell weight.
[0679] Both fermentation processes can be applied to produce any of
these enzymes. The fed-batch protocol in which glucose is fed
exponentially to maintain a growth rate between 0.15 and 0.25
hour.sup.-1 is a better method to obtain high cell density with
high enzyme concentration and can be further optimized to increase
the specific enzyme activity in each case. Alternative feeding
protocols for the fed-batch fermentation could also be utilized,
such as constant feeding-rate or intermittent feeding.
Other Embodiments
[0680] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
90 1 1170 DNA Sinorhizobium meliloti 1 atgttcgacg ccctcgcccg
ccaagccgac gatcccttgc ttttcctgat cggcctgttc 60 aggaaggatg
agcgccccgg aaaggtcgat ctcggcgtag gagtctatcg cgacgagacc 120
ggacgcacgc cgatcttccg ggccgtcaag gcggcggaaa agcggcttct cgaaacacag
180 gacagcaagg cctatatcgg ccccgaaggg gacctcgtct ttctcgatcg
gctctgggaa 240 ctcgtcggcg gcgacacgat cgagcggagc catgttgcgg
gcgtccagac gcccggcggc 300 tccggcgcgc tccgtttggc ggcggacctc
atcgcccgca tgggcggccg aggcatctgg 360 ctcgggctgc cgagctggcc
gaaccacgcg ccgatcttca aggcggccgg gctcgatatc 420 gccacctacg
acttcttcga cattccgtcg cagtcggtca tcttcgataa tctggtgagc 480
gcgctggaag gcgccgcatc cggcgatgcg gtgctgctgc atgcaagctg ccacaacccg
540 accggcggcg tcctgagcga agcacaatgg atggagatcg ccgcgctggt
ggccgagcgc 600 ggcctgctgc cgctcgtcga tctcgcctat caggggttcg
gccgcggcct cgaccaggat 660 gtcgcgggcc tccggcatct tctcggcgtg
gtcccggaag cgctcgtcgc ggtttcctgc 720 tcgaagtcct tcgggcttta
tcgcgagcgc gcgggcgcga tcttcgcgcg gaccagctcg 780 actgcctcgg
cggacagggt gcgctcaaac ctcgcgggcc tcgcacgcac cagctattcc 840
atgccgccgg atcacggcgc agccgtcgtg cggacgatcc ttgacgaccc ggaactcagg
900 cgcgactgga cggaggagct cgagacgatg cggctcagga tgacgggcct
ccggcggtcg 960 cttgccgagg gactccgcac ccgctggcag agcctcggcg
cagtcgccga tcaggagggc 1020 atgttctcca tgctgccgct ttccgaagcg
gaggttatgc ggctcaggac cgagcacggc 1080 atctatatgc cggcatccgg
ccgcatcaac atcgccgggc tgaagacggc ggaagccgcc 1140 gagattgccg
gcaagttcac cagtctctga 1170 2 389 PRT Sinorhizobium meliloti 2 Met
Phe Asp Ala Leu Ala Arg Gln Ala Asp Asp Pro Leu Leu Phe Leu 1 5 10
15 Ile Gly Leu Phe Arg Lys Asp Glu Arg Pro Gly Lys Val Asp Leu Gly
20 25 30 Val Gly Val Tyr Arg Asp Glu Thr Gly Arg Thr Pro Ile Phe
Arg Ala 35 40 45 Val Lys Ala Ala Glu Lys Arg Leu Leu Glu Thr Gln
Asp Ser Lys Ala 50 55 60 Tyr Ile Gly Pro Glu Gly Asp Leu Val Phe
Leu Asp Arg Leu Trp Glu 65 70 75 80 Leu Val Gly Gly Asp Thr Ile Glu
Arg Ser His Val Ala Gly Val Gln 85 90 95 Thr Pro Gly Gly Ser Gly
Ala Leu Arg Leu Ala Ala Asp Leu Ile Ala 100 105 110 Arg Met Gly Gly
Arg Gly Ile Trp Leu Gly Leu Pro Ser Trp Pro Asn 115 120 125 His Ala
Pro Ile Phe Lys Ala Ala Gly Leu Asp Ile Ala Thr Tyr Asp 130 135 140
Phe Phe Asp Ile Pro Ser Gln Ser Val Ile Phe Asp Asn Leu Val Ser 145
150 155 160 Ala Leu Glu Gly Ala Ala Ser Gly Asp Ala Val Leu Leu His
Ala Ser 165 170 175 Cys His Asn Pro Thr Gly Gly Val Leu Ser Glu Ala
Gln Trp Met Glu 180 185 190 Ile Ala Ala Leu Val Ala Glu Arg Gly Leu
Leu Pro Leu Val Asp Leu 195 200 205 Ala Tyr Gln Gly Phe Gly Arg Gly
Leu Asp Gln Asp Val Ala Gly Leu 210 215 220 Arg His Leu Leu Gly Val
Val Pro Glu Ala Leu Val Ala Val Ser Cys 225 230 235 240 Ser Lys Ser
Phe Gly Leu Tyr Arg Glu Arg Ala Gly Ala Ile Phe Ala 245 250 255 Arg
Thr Ser Ser Thr Ala Ser Ala Asp Arg Val Arg Ser Asn Leu Ala 260 265
270 Gly Leu Ala Arg Thr Ser Tyr Ser Met Pro Pro Asp His Gly Ala Ala
275 280 285 Val Val Arg Thr Ile Leu Asp Asp Pro Glu Leu Arg Arg Asp
Trp Thr 290 295 300 Glu Glu Leu Glu Thr Met Arg Leu Arg Met Thr Gly
Leu Arg Arg Ser 305 310 315 320 Leu Ala Glu Gly Leu Arg Thr Arg Trp
Gln Ser Leu Gly Ala Val Ala 325 330 335 Asp Gln Glu Gly Met Phe Ser
Met Leu Pro Leu Ser Glu Ala Glu Val 340 345 350 Met Arg Leu Arg Thr
Glu His Gly Ile Tyr Met Pro Ala Ser Gly Arg 355 360 365 Ile Asn Ile
Ala Gly Leu Lys Thr Ala Glu Ala Ala Glu Ile Ala Gly 370 375 380 Lys
Phe Thr Ser Leu 385 3 1260 DNA Rhodobacter sphaeroides 3 atgcgctcta
cgacggctcc tggtccgagt ggggcatgta tgacgatctc aaggtcgcga 60
aaggatgacg aaggaatgct gaccgccctg aagccgcagc ccgcggacaa gatcctgcaa
120 ctgatccaga tgttccgcga ggatgcgcgc gcggacaaga tcgatctggg
cgtgggcgtc 180 tacaaggacc cgaccgggct caccccggtc atgcgggccg
tgaaggcggc cgagaagcgg 240 ctctgggagg tcgagaccac caagacctac
accggccttg ccgacgagcc ggcctacaat 300 gccgcgatgg cgaagctgat
cctcgcgggc gcggtcccgg ccgaccgggt ggcctcggtc 360 gccacccccg
gcggcacggg cgcggtgcgt caggcgctcg agctgatccg catggcctcg 420
cccgaggcca ccgtctggat ctcgaacccg acctggccga accatctgtc gatcgtgaaa
480 tatctcggca tcccgatgcg ggaataccgc tatttcgacg ccgagaccgg
cgccgtcgat 540 gccgagggca tgatggagga tctggcccag gtgaaggcgg
gcgacgtggt gctgctgcac 600 ggctgctgcc acaacccgac cggcgccaac
ccgaacccgg tgcagtggct ggccatctgc 660 gagagcctgg cccggacagg
cgcggtgccg ctgatcgacc tcgcctatca gggcttcggc 720 gacgggctcg
agatggatgc ggcggcgacg cggcttctgg ccaccagact gcccgaggtg 780
ctgatcgcgg cctcctgctc gaagaacttc ggcatctacc gcgagcgcac gggcatcctg
840 atcgccatcg gcgaggcggc gggccggggc acggtgcagg ccaacctcaa
cttcctgaac 900 cggcagaact actccttccc gccggaccat ggcgcgcggc
tcgtgaccat gatcctcgag 960 gacgagacgc tgagcgccga ctggaaggcg
gaactcgagg aggtgcggct caacatgctg 1020 acactgcgcc gccagcttgc
cgatgcgctg caggccgaga ccggctcgaa ccgcttcggc 1080 ttcgtggccg
agcatcgcgg catgttctcg cgcctcggga tcacgcccgc cgaggtggag 1140
cggctgcgga ccgagcacgg ggtctacatg gtgggcgatt cgcggctgaa catcgcgggg
1200 ctgaaccgga cgaccgtgcc ggtgctggcg cgcgcggtgg ccaaggtgct
gcgcggctga 1260 4 419 PRT Rhodobacter sphaeroides 4 Met Arg Ser Thr
Thr Ala Pro Gly Pro Ser Gly Ala Cys Met Thr Ile 1 5 10 15 Ser Arg
Ser Arg Lys Asp Asp Glu Gly Met Leu Thr Ala Leu Lys Pro 20 25 30
Gln Pro Ala Asp Lys Ile Leu Gln Leu Ile Gln Met Phe Arg Glu Asp 35
40 45 Ala Arg Ala Asp Lys Ile Asp Leu Gly Val Gly Val Tyr Lys Asp
Pro 50 55 60 Thr Gly Leu Thr Pro Val Met Arg Ala Val Lys Ala Ala
Glu Lys Arg 65 70 75 80 Leu Trp Glu Val Glu Thr Thr Lys Thr Tyr Thr
Gly Leu Ala Asp Glu 85 90 95 Pro Ala Tyr Asn Ala Ala Met Ala Lys
Leu Ile Leu Ala Gly Ala Val 100 105 110 Pro Ala Asp Arg Val Ala Ser
Val Ala Thr Pro Gly Gly Thr Gly Ala 115 120 125 Val Arg Gln Ala Leu
Glu Leu Ile Arg Met Ala Ser Pro Glu Ala Thr 130 135 140 Val Trp Ile
Ser Asn Pro Thr Trp Pro Asn His Leu Ser Ile Val Lys 145 150 155 160
Tyr Leu Gly Ile Pro Met Arg Glu Tyr Arg Tyr Phe Asp Ala Glu Thr 165
170 175 Gly Ala Val Asp Ala Glu Gly Met Met Glu Asp Leu Ala Gln Val
Lys 180 185 190 Ala Gly Asp Val Val Leu Leu His Gly Cys Cys His Asn
Pro Thr Gly 195 200 205 Ala Asn Pro Asn Pro Val Gln Trp Leu Ala Ile
Cys Glu Ser Leu Ala 210 215 220 Arg Thr Gly Ala Val Pro Leu Ile Asp
Leu Ala Tyr Gln Gly Phe Gly 225 230 235 240 Asp Gly Leu Glu Met Asp
Ala Ala Ala Thr Arg Leu Leu Ala Thr Arg 245 250 255 Leu Pro Glu Val
Leu Ile Ala Ala Ser Cys Ser Lys Asn Phe Gly Ile 260 265 270 Tyr Arg
Glu Arg Thr Gly Ile Leu Ile Ala Ile Gly Glu Ala Ala Gly 275 280 285
Arg Gly Thr Val Gln Ala Asn Leu Asn Phe Leu Asn Arg Gln Asn Tyr 290
295 300 Ser Phe Pro Pro Asp His Gly Ala Arg Leu Val Thr Met Ile Leu
Glu 305 310 315 320 Asp Glu Thr Leu Ser Ala Asp Trp Lys Ala Glu Leu
Glu Glu Val Arg 325 330 335 Leu Asn Met Leu Thr Leu Arg Arg Gln Leu
Ala Asp Ala Leu Gln Ala 340 345 350 Glu Thr Gly Ser Asn Arg Phe Gly
Phe Val Ala Glu His Arg Gly Met 355 360 365 Phe Ser Arg Leu Gly Ile
Thr Pro Ala Glu Val Glu Arg Leu Arg Thr 370 375 380 Glu His Gly Val
Tyr Met Val Gly Asp Ser Arg Leu Asn Ile Ala Gly 385 390 395 400 Leu
Asn Arg Thr Thr Val Pro Val Leu Ala Arg Ala Val Ala Lys Val 405 410
415 Leu Arg Gly 5 1260 DNA Rhodobacter sphaeroides 5 atgcgctcta
cgacggctcc tggtccgagt ggggcatgta tgacgatctc aaggtcgcga 60
aaggatgacg aaggaatgct gaccgccctg aagccgcagc ccgcggacaa gatcctgcaa
120 ctgatccaga tgttccgcga ggatgcgcgc gcggacaaga tcgatctggg
cgtgggcgtc 180 tacaaggacc cgaccgggct caccccggtc atgcgggccg
tgaaggccgc cgagaagcgg 240 ctctgggagg tcgagaccac caagacctac
accggccttg ccggcgagcc cgcctacaat 300 gccgcgatgg cgaagctgat
cctcgcaggc gcggtcccgg ccgaccgggt ggcctcggtc 360 gccacccccg
gcggcacggg cgcggtgcgt caggcgctcg agctgatccg catggcctcg 420
cccgaggcca ctgtctggat ctcgaacccg acctggccga accatctgtc gatcgtgaaa
480 tatctcggca tcccgatgcg ggaataccgc tatttcgacg ccgagaccgg
cgccgtcgat 540 gccgagggct tgatggagga tctggcccag gtgaaggcgg
gcgacgtggt gctgctgcac 600 ggctgctgcc acaacccgac cggcgccaac
ccgaacccgg tgcagtggct ggccgtctgc 660 gagagcctgg cccggacagg
cgcggtgccg ctgatcgacc tcgcctatca gggcttcggc 720 gacgggctcg
agatggatgc ggcggcgacg cggcttctgg ccaccagact gcccgaggtg 780
ctgatcgcgg cctcctgctc gaagaacttc ggcatctacc gcgagcgaac gggcatcctg
840 atcgccatcg gcgaggcggc gggccggggc acggtgcagg ccaacctcaa
cttcctgaac 900 cggcagaact actccttccc gccggaccat ggcgcgcggc
tcgtgaccat gatcctcgag 960 gacgagacgc tgagcgccga ctggaaggcg
gaactcgagg aggtgcggct caacatgctg 1020 acgctgcgcc gccagcttgc
cgatgcgctg caggccgaga ccggctcgaa ccgcttcggc 1080 ttcgtggccg
agcatcgcgg catgttctcg cgcctcggga tcacgcccgc cgaggtggag 1140
cggctgcgga ccgagcacgg ggtctacatg gtgggcgatt cgcggctgaa catcgcgggg
1200 ctgaaccgga cgaccgtgcc ggtgctggcg cgcgcggtgg ccaaggtgct
gcgcggctga 1260 6 419 PRT Rhodobacter sphaeroides 6 Met Arg Ser Thr
Thr Ala Pro Gly Pro Ser Gly Ala Cys Met Thr Ile 1 5 10 15 Ser Arg
Ser Arg Lys Asp Asp Glu Gly Met Leu Thr Ala Leu Lys Pro 20 25 30
Gln Pro Ala Asp Lys Ile Leu Gln Leu Ile Gln Met Phe Arg Glu Asp 35
40 45 Ala Arg Ala Asp Lys Ile Asp Leu Gly Val Gly Val Tyr Lys Asp
Pro 50 55 60 Thr Gly Leu Thr Pro Val Met Arg Ala Val Lys Ala Ala
Glu Lys Arg 65 70 75 80 Leu Trp Glu Val Glu Thr Thr Lys Thr Tyr Thr
Gly Leu Ala Gly Glu 85 90 95 Pro Ala Tyr Asn Ala Ala Met Ala Lys
Leu Ile Leu Ala Gly Ala Val 100 105 110 Pro Ala Asp Arg Val Ala Ser
Val Ala Thr Pro Gly Gly Thr Gly Ala 115 120 125 Val Arg Gln Ala Leu
Glu Leu Ile Arg Met Ala Ser Pro Glu Ala Thr 130 135 140 Val Trp Ile
Ser Asn Pro Thr Trp Pro Asn His Leu Ser Ile Val Lys 145 150 155 160
Tyr Leu Gly Ile Pro Met Arg Glu Tyr Arg Tyr Phe Asp Ala Glu Thr 165
170 175 Gly Ala Val Asp Ala Glu Gly Leu Met Glu Asp Leu Ala Gln Val
Lys 180 185 190 Ala Gly Asp Val Val Leu Leu His Gly Cys Cys His Asn
Pro Thr Gly 195 200 205 Ala Asn Pro Asn Pro Val Gln Trp Leu Ala Val
Cys Glu Ser Leu Ala 210 215 220 Arg Thr Gly Ala Val Pro Leu Ile Asp
Leu Ala Tyr Gln Gly Phe Gly 225 230 235 240 Asp Gly Leu Glu Met Asp
Ala Ala Ala Thr Arg Leu Leu Ala Thr Arg 245 250 255 Leu Pro Glu Val
Leu Ile Ala Ala Ser Cys Ser Lys Asn Phe Gly Ile 260 265 270 Tyr Arg
Glu Arg Thr Gly Ile Leu Ile Ala Ile Gly Glu Ala Ala Gly 275 280 285
Arg Gly Thr Val Gln Ala Asn Leu Asn Phe Leu Asn Arg Gln Asn Tyr 290
295 300 Ser Phe Pro Pro Asp His Gly Ala Arg Leu Val Thr Met Ile Leu
Glu 305 310 315 320 Asp Glu Thr Leu Ser Ala Asp Trp Lys Ala Glu Leu
Glu Glu Val Arg 325 330 335 Leu Asn Met Leu Thr Leu Arg Arg Gln Leu
Ala Asp Ala Leu Gln Ala 340 345 350 Glu Thr Gly Ser Asn Arg Phe Gly
Phe Val Ala Glu His Arg Gly Met 355 360 365 Phe Ser Arg Leu Gly Ile
Thr Pro Ala Glu Val Glu Arg Leu Arg Thr 370 375 380 Glu His Gly Val
Tyr Met Val Gly Asp Ser Arg Leu Asn Ile Ala Gly 385 390 395 400 Leu
Asn Arg Thr Thr Val Pro Val Leu Ala Arg Ala Val Ala Lys Val 405 410
415 Leu Arg Gly 7 1239 DNA Leishmania major 7 atgtccatgc aggcggccat
gaccacggcg gagcgctggc agaagattca ggcacaagct 60 cccgatgtca
tcttcgatct cgcaaaacgc gccgccgctg ccaagggccc caaggccaac 120
ctcgtcattg gtgcctaccg cgacgagcag ggccgtccct atccgctacg cgtggtccgc
180 aaggctgagc agcttctctt ggacatgaat ctcgactacg agtacctacc
catctcgggc 240 taccagccct tcatcgatga ggcggtaaag attatctacg
gcaataccgt cgagctggag 300 aacctggttg cggtgcagac gctgagcggg
accggtgctg tctctctcgg ggcgaagctg 360 ctgactcgcg tcttcgacgc
tgagacgacg cccatctacc tttccgaccc cacgtggccc 420 aaccactacg
gcgtcgtgaa ggctgctggc tggaagaaca tctgcacgta cgcctactac 480
gaccccaaga cggtcagcct gaatttcgag ggcatgaaga aagacattct ggcggcgccg
540 gacggctccg tgttcattct gcaccagtgc gcgcacaacc ccaccggcgt
ggacccgtcg 600 caggagcagt ggaacgagat cgcgtcactg atgctggcca
agcaccatca ggtgttcttc 660 gactccgcct accaaggcta tgcgagcggc
agcctcgaca cggacgcgta tgctgcccgc 720 ctgtttgccc gccgcggcat
cgaggtactg ctggcgcagt cgttctccaa gaacatgggc 780 ttgtacagcg
agcgtgcagg cacgctgtcg ctgctcctca aggacaagac gaagcgcgcg 840
gatgtaaaga gcgtgatgga ttcgctgatc cgtgaggagt acacgtgccc cccagcccac
900 ggtgcccgct tagcccacct aatcctgagc aacaacgaac tgcgaaagga
gtgggaggca 960 gagctatcag ccatggcaga gcgcatccgt acgatgcgcc
gcaccgtgta cgacgagctg 1020 ctgcgcctgc agacgcccgg gagctgggaa
catgtcatta accagattgg catgttttcc 1080 ttcctcgggc tgtcaaaggc
gcagtgcgaa tactgccaaa accacaacat cttcatcaca 1140 gtgtcgggcc
gcgctaacat ggcaggtctg acgcatgaga cggcgctgat gctagcacag 1200
acgatcaacg atgctgtgcg caatgtgaat cgtgagtga 1239 8 412 PRT
Leishmania major 8 Met Ser Met Gln Ala Ala Met Thr Thr Ala Glu Arg
Trp Gln Lys Ile 1 5 10 15 Gln Ala Gln Ala Pro Asp Val Ile Phe Asp
Leu Ala Lys Arg Ala Ala 20 25 30 Ala Ala Lys Gly Pro Lys Ala Asn
Leu Val Ile Gly Ala Tyr Arg Asp 35 40 45 Glu Gln Gly Arg Pro Tyr
Pro Leu Arg Val Val Arg Lys Ala Glu Gln 50 55 60 Leu Leu Leu Asp
Met Asn Leu Asp Tyr Glu Tyr Leu Pro Ile Ser Gly 65 70 75 80 Tyr Gln
Pro Phe Ile Asp Glu Ala Val Lys Ile Ile Tyr Gly Asn Thr 85 90 95
Val Glu Leu Glu Asn Leu Val Ala Val Gln Thr Leu Ser Gly Thr Gly 100
105 110 Ala Val Ser Leu Gly Ala Lys Leu Leu Thr Arg Val Phe Asp Ala
Glu 115 120 125 Thr Thr Pro Ile Tyr Leu Ser Asp Pro Thr Trp Pro Asn
His Tyr Gly 130 135 140 Val Val Lys Ala Ala Gly Trp Lys Asn Ile Cys
Thr Tyr Ala Tyr Tyr 145 150 155 160 Asp Pro Lys Thr Val Ser Leu Asn
Phe Glu Gly Met Lys Lys Asp Ile 165 170 175 Leu Ala Ala Pro Asp Gly
Ser Val Phe Ile Leu His Gln Cys Ala His 180 185 190 Asn Pro Thr Gly
Val Asp Pro Ser Gln Glu Gln Trp Asn Glu Ile Ala 195 200 205 Ser Leu
Met Leu Ala Lys His His Gln Val Phe Phe Asp Ser Ala Tyr 210 215 220
Gln Gly Tyr Ala Ser Gly Ser Leu Asp Thr Asp Ala Tyr Ala Ala Arg 225
230 235 240 Leu Phe Ala Arg Arg Gly Ile Glu Val Leu Leu Ala Gln Ser
Phe Ser 245 250 255 Lys Asn Met Gly Leu Tyr Ser Glu Arg Ala Gly Thr
Leu Ser Leu Leu 260 265 270 Leu Lys Asp Lys Thr Lys Arg Ala Asp Val
Lys Ser Val Met Asp Ser 275 280 285 Leu Ile Arg Glu Glu Tyr Thr Cys
Pro Pro Ala His Gly Ala Arg Leu 290 295 300 Ala His Leu Ile Leu Ser
Asn Asn Glu Leu Arg Lys Glu Trp Glu Ala 305 310 315 320 Glu Leu Ser
Ala Met Ala Glu Arg Ile Arg Thr Met Arg Arg Thr Val 325 330 335 Tyr
Asp Glu Leu Leu Arg Leu Gln Thr Pro Gly Ser Trp Glu His Val 340 345
350 Ile Asn Gln Ile Gly Met Phe Ser Phe Leu Gly Leu Ser Lys Ala Gln
355 360 365 Cys Glu Tyr Cys Gln Asn His Asn Ile Phe Ile Thr Val Ser
Gly Arg 370 375 380 Ala
Asn Met Ala Gly Leu Thr His Glu Thr Ala Leu Met Leu Ala Gln 385 390
395 400 Thr Ile Asn Asp Ala Val Arg Asn Val Asn Arg Glu 405 410 9
1182 DNA Bacillus subtilis 9 atggaacatt tgctgaatcc gaaagcaaga
gagatcgaaa tttcaggaat acgcaaattc 60 tcgaatcttg tagcccaaca
cgaagacgtc atttcactta caatcggcca gcctgatttt 120 ttcacaccgc
atcatgtgaa agctgccgca aaaaaagcca ttgatgaaaa cgtgacgtca 180
tatactccga atgccggcta cctggagctg agacaagctg tgcagcttta tatgaagaaa
240 aaagcggatt tcaactatga tgctgaatct gaaattatca tcacaacagg
cgcaagccaa 300 gccattgatg ctgcattccg gacgatttta tctcccggtg
atgaagtcat tatgccaggg 360 cctatttatc cgggctatga acctattatc
aatttgtgcg gggccaagcc tgtcattgtt 420 gatactacgt cacacggctt
taagcttacc gcccggctga ttgaagatgc tctgacaccc 480 aacaccaagt
gtgtcgtgct tccttatccg tcaaacccta ccggcgtgac tttatctgaa 540
gaagaactga aaagcatcgc agctctctta aaaggcagaa atgtcttcgt attgtctgat
600 gaaatataca gtgaattaac atatgacaga ccgcattact ccatcgcaac
ctatttgcgg 660 gatcaaacga ttgtcattaa cgggttgtca aaatcacaca
gcatgaccgg ttggagaatt 720 ggatttttat ttgcaccgaa agacattgca
aagcacattt taaaggttca tcaatacaat 780 gtgtcgtgcg cctcatccat
ttctcaaaaa gccgcgcttg aagctgtcac aaacggcttt 840 gacgatgcat
tgattatgag agaacaatac aaaaaacgtc tggactatgt ttatgaccgt 900
cttgtttcca tgggacttga cgtagttaaa ccgtccggtg cgttttatat cttcccttct
960 attaaatcat ttggaatgac ttcatttgat tttagtatgg ctcttttgga
agacgctggc 1020 gtggcactcg tgccgggcag ctcgttctca acatatggtg
aaggatatgt aaggctgtct 1080 tttgcatgct caatggacac gctgagagaa
ggcctagacc gtttagaatt atttgtatta 1140 aaaaaacgtg aagcaatgca
gacgataaac aacggcgttt aa 1182 10 393 PRT Bacillus subtilis 10 Met
Glu His Leu Leu Asn Pro Lys Ala Arg Glu Ile Glu Ile Ser Gly 1 5 10
15 Ile Arg Lys Phe Ser Asn Leu Val Ala Gln His Glu Asp Val Ile Ser
20 25 30 Leu Thr Ile Gly Gln Pro Asp Phe Phe Thr Pro His His Val
Lys Ala 35 40 45 Ala Ala Lys Lys Ala Ile Asp Glu Asn Val Thr Ser
Tyr Thr Pro Asn 50 55 60 Ala Gly Tyr Leu Glu Leu Arg Gln Ala Val
Gln Leu Tyr Met Lys Lys 65 70 75 80 Lys Ala Asp Phe Asn Tyr Asp Ala
Glu Ser Glu Ile Ile Ile Thr Thr 85 90 95 Gly Ala Ser Gln Ala Ile
Asp Ala Ala Phe Arg Thr Ile Leu Ser Pro 100 105 110 Gly Asp Glu Val
Ile Met Pro Gly Pro Ile Tyr Pro Gly Tyr Glu Pro 115 120 125 Ile Ile
Asn Leu Cys Gly Ala Lys Pro Val Ile Val Asp Thr Thr Ser 130 135 140
His Gly Phe Lys Leu Thr Ala Arg Leu Ile Glu Asp Ala Leu Thr Pro 145
150 155 160 Asn Thr Lys Cys Val Val Leu Pro Tyr Pro Ser Asn Pro Thr
Gly Val 165 170 175 Thr Leu Ser Glu Glu Glu Leu Lys Ser Ile Ala Ala
Leu Leu Lys Gly 180 185 190 Arg Asn Val Phe Val Leu Ser Asp Glu Ile
Tyr Ser Glu Leu Thr Tyr 195 200 205 Asp Arg Pro His Tyr Ser Ile Ala
Thr Tyr Leu Arg Asp Gln Thr Ile 210 215 220 Val Ile Asn Gly Leu Ser
Lys Ser His Ser Met Thr Gly Trp Arg Ile 225 230 235 240 Gly Phe Leu
Phe Ala Pro Lys Asp Ile Ala Lys His Ile Leu Lys Val 245 250 255 His
Gln Tyr Asn Val Ser Cys Ala Ser Ser Ile Ser Gln Lys Ala Ala 260 265
270 Leu Glu Ala Val Thr Asn Gly Phe Asp Asp Ala Leu Ile Met Arg Glu
275 280 285 Gln Tyr Lys Lys Arg Leu Asp Tyr Val Tyr Asp Arg Leu Val
Ser Met 290 295 300 Gly Leu Asp Val Val Lys Pro Ser Gly Ala Phe Tyr
Ile Phe Pro Ser 305 310 315 320 Ile Lys Ser Phe Gly Met Thr Ser Phe
Asp Phe Ser Met Ala Leu Leu 325 330 335 Glu Asp Ala Gly Val Ala Leu
Val Pro Gly Ser Ser Phe Ser Thr Tyr 340 345 350 Gly Glu Gly Tyr Val
Arg Leu Ser Phe Ala Cys Ser Met Asp Thr Leu 355 360 365 Arg Glu Gly
Leu Asp Arg Leu Glu Leu Phe Val Leu Lys Lys Arg Glu 370 375 380 Ala
Met Gln Thr Ile Asn Asn Gly Val 385 390 11 1176 DNA Lactobacillus
amylovorus 11 atgccagaat tagctaatga tttaggatta agcaaaaaga
tcactgatgt aaaagcttca 60 ggaattagaa tctttgataa caaagtttca
gctattcctg gcattatcaa attgactttg 120 ggtgaaccag atatgaatac
tcctgagcat gttaagcaag cggctattaa gaatattgca 180 gataatgatt
cacactatgc tccacaaaag ggaaagcttg aattaagaaa agctatcagt 240
aaatatttga aaaagattac tggaattgaa tatgatccag aaacagaaat cgtagtaaca
300 gttggtgcaa ctgaagcaat taacgctacc ttgtttgcta ttactaatcc
gggtgacaag 360 gttgcaattc ctacgccagt cttttctcta tattggcccg
tggctacact tgctgatgcc 420 gattatgttt tgatgaatac tgcagaagat
ggttttaagt taacacctaa gaagttagaa 480 gaaactatca aagaaaatcc
aacaattaaa gcagtaattt tgaattatcc aactaaccca 540 actggtgttg
aatatagcga agatgaaatt aaagctttgg ctaaggtaat taaagataat 600
catctgtacg taattaccga tgaaatttac agtactttga cttacggtgt aaaacacttt
660 tcaattgcca gcttaattcc agaaagagca atttatatct ctggtttatc
taaatcacat 720 gcgatgactg gttatcgttt aggctatgtt gccggacctg
caaaaattat ggcagaaatt 780 ggtaaagttc atggccttat ggtgacgact
acgacggatt catcacaagc tgccgcaatt 840 gaagcacttg aacacggact
tgatgaccct gagaaatata gggaagttta tgaaaagcgt 900 cgtgactatg
ttttaaagga attagccgag atagagatgc aagcagttaa gccagaaggt 960
gcattttata tctttgctaa aattccagct aagtatggca aagacgatat gaaatttgcc
1020 ttggatttag cttttaaaga aaaagtgggt atcactccag gtagtgcatt
tggtcctggt 1080 ggtgaaggtc atattagatt atcttatgca tcaagtgatg
aaaacttgca tgaggcaatg 1140 aagcgaatga agaaagtttt acaagaggac gaataa
1176 12 391 PRT Lactobacillus amylovorus 12 Met Pro Glu Leu Ala Asn
Asp Leu Gly Leu Ser Lys Lys Ile Thr Asp 1 5 10 15 Val Lys Ala Ser
Gly Ile Arg Ile Phe Asp Asn Lys Val Ser Ala Ile 20 25 30 Pro Gly
Ile Ile Lys Leu Thr Leu Gly Glu Pro Asp Met Asn Thr Pro 35 40 45
Glu His Val Lys Gln Ala Ala Ile Lys Asn Ile Ala Asp Asn Asp Ser 50
55 60 His Tyr Ala Pro Gln Lys Gly Lys Leu Glu Leu Arg Lys Ala Ile
Ser 65 70 75 80 Lys Tyr Leu Lys Lys Ile Thr Gly Ile Glu Tyr Asp Pro
Glu Thr Glu 85 90 95 Ile Val Val Thr Val Gly Ala Thr Glu Ala Ile
Asn Ala Thr Leu Phe 100 105 110 Ala Ile Thr Asn Pro Gly Asp Lys Val
Ala Ile Pro Thr Pro Val Phe 115 120 125 Ser Leu Tyr Trp Pro Val Ala
Thr Leu Ala Asp Ala Asp Tyr Val Leu 130 135 140 Met Asn Thr Ala Glu
Asp Gly Phe Lys Leu Thr Pro Lys Lys Leu Glu 145 150 155 160 Glu Thr
Ile Lys Glu Asn Pro Thr Ile Lys Ala Val Ile Leu Asn Tyr 165 170 175
Pro Thr Asn Pro Thr Gly Val Glu Tyr Ser Glu Asp Glu Ile Lys Ala 180
185 190 Leu Ala Lys Val Ile Lys Asp Asn His Leu Tyr Val Ile Thr Asp
Glu 195 200 205 Ile Tyr Ser Thr Leu Thr Tyr Gly Val Lys His Phe Ser
Ile Ala Ser 210 215 220 Leu Ile Pro Glu Arg Ala Ile Tyr Ile Ser Gly
Leu Ser Lys Ser His 225 230 235 240 Ala Met Thr Gly Tyr Arg Leu Gly
Tyr Val Ala Gly Pro Ala Lys Ile 245 250 255 Met Ala Glu Ile Gly Lys
Val His Gly Leu Met Val Thr Thr Thr Thr 260 265 270 Asp Ser Ser Gln
Ala Ala Ala Ile Glu Ala Leu Glu His Gly Leu Asp 275 280 285 Asp Pro
Glu Lys Tyr Arg Glu Val Tyr Glu Lys Arg Arg Asp Tyr Val 290 295 300
Leu Lys Glu Leu Ala Glu Ile Glu Met Gln Ala Val Lys Pro Glu Gly 305
310 315 320 Ala Phe Tyr Ile Phe Ala Lys Ile Pro Ala Lys Tyr Gly Lys
Asp Asp 325 330 335 Met Lys Phe Ala Leu Asp Leu Ala Phe Lys Glu Lys
Val Gly Ile Thr 340 345 350 Pro Gly Ser Ala Phe Gly Pro Gly Gly Glu
Gly His Ile Arg Leu Ser 355 360 365 Tyr Ala Ser Ser Asp Glu Asn Leu
His Glu Ala Met Lys Arg Met Lys 370 375 380 Lys Val Leu Gln Glu Asp
Glu 385 390 13 1413 DNA Rhodobacter sphaeroides 13 atgcgcgagc
ctcttgccct cgagatcgac ccgggccacg gcggcccgct gttcctcgcc 60
atcgccgagg cgatcaccct cgacatcacc cgcgggcggc tgaggcccgg agcgagactg
120 cccggcacac gcgcgctggc gcgggcgctc ggcgtgcatc gcaacacggt
ggatgccgcc 180 tatcaggagt tgctgaccca gggctggctg caggccgagc
ccgcgcgggg caccttcgtg 240 gcgcaggatc tgccgcaggg gatgctggtg
cacaggcccg cgcccgcgcc ggtcgagccg 300 gtcgcgatgc gcgcggggct
cgccttctcc gatggcgcgc cggaccccga gctggtgccc 360 gacaaggcgc
tggcgcgggc ctttcgccgg gcgctcctgt cgcccgcctt ccgcgccgga 420
gcggattacg gcgatgcccg cggcacctcc tcgctgcggg aggcgctggc agcctatctc
480 gcctcggacc ggggcgtggt cgcggatcct gcgcggctgc tgatcgcgcg
gggcagccag 540 atggcgctgt tcctggtagc ccgggcggcg ctggcgccgg
gagaggcgat cgcggtcgag 600 gagccgggct atccgctggc ctgggaggcg
ttccgcgcag cgggagcgga ggtgcgcggc 660 gtgccggtgg atggcggcgg
cctcaggatc gacgcgctcg aggccgcgct ggcccgggat 720 ccgcgaatcc
gggcggtcta tgtcacgccc catcaccagt atccgacgac cgtcaccatg 780
ggcgcggcgc ggcggttgca gcttctggaa ctggcagagc gccaccggct cgcgctgatc
840 gaggacgact acgaccacga ataccgcttc gagggccgtc cggtgctgcc
gctggctgcc 900 cgcgcgccgg aaggtctgcc gctgatctat gtgggctcgc
tgtcgaaact gctctcgccc 960 ggtatccggc tgggatacgc gctggcgccc
gagcggctgc tgacccgcat ggccgcggcg 1020 cgcgccgcca tcgaccggca
gggcgacgcg ccgctcgagg cggcgctggc cgagctgatc 1080 cgcgacggcg
atctgggccg tcatgcccgc aaggcgcgca gggtctaccg ggcgcggcgg 1140
gatctgctgg cggagcgtct cacggcgcag ctggccgggc gcgccgcctt cgatctgccg
1200 gccgggggcc tcgcgctgtg gctgcgctgc gcgggcgtct cggccgagac
ctgggccgaa 1260 gccgcagggc aggcggggct cgccctgctg ccgggcacgc
gcttcgcgct ggagagcccg 1320 gcgccgcagg ccttccggct gggctatgcg
gcgctggacg aggggcagat cgcccgggcg 1380 gtggagatcc tcgcccggag
cttccccggc tga 1413 14 470 PRT Rhodobacter sphaeroides 14 Met Arg
Glu Pro Leu Ala Leu Glu Ile Asp Pro Gly His Gly Gly Pro 1 5 10 15
Leu Phe Leu Ala Ile Ala Glu Ala Ile Thr Leu Asp Ile Thr Arg Gly 20
25 30 Arg Leu Arg Pro Gly Ala Arg Leu Pro Gly Thr Arg Ala Leu Ala
Arg 35 40 45 Ala Leu Gly Val His Arg Asn Thr Val Asp Ala Ala Tyr
Gln Glu Leu 50 55 60 Leu Thr Gln Gly Trp Leu Gln Ala Glu Pro Ala
Arg Gly Thr Phe Val 65 70 75 80 Ala Gln Asp Leu Pro Gln Gly Met Leu
Val His Arg Pro Ala Pro Ala 85 90 95 Pro Val Glu Pro Val Ala Met
Arg Ala Gly Leu Ala Phe Ser Asp Gly 100 105 110 Ala Pro Asp Pro Glu
Leu Val Pro Asp Lys Ala Leu Ala Arg Ala Phe 115 120 125 Arg Arg Ala
Leu Leu Ser Pro Ala Phe Arg Ala Gly Ala Asp Tyr Gly 130 135 140 Asp
Ala Arg Gly Thr Ser Ser Leu Arg Glu Ala Leu Ala Ala Tyr Leu 145 150
155 160 Ala Ser Asp Arg Gly Val Val Ala Asp Pro Ala Arg Leu Leu Ile
Ala 165 170 175 Arg Gly Ser Gln Met Ala Leu Phe Leu Val Ala Arg Ala
Ala Leu Ala 180 185 190 Pro Gly Glu Ala Ile Ala Val Glu Glu Pro Gly
Tyr Pro Leu Ala Trp 195 200 205 Glu Ala Phe Arg Ala Ala Gly Ala Glu
Val Arg Gly Val Pro Val Asp 210 215 220 Gly Gly Gly Leu Arg Ile Asp
Ala Leu Glu Ala Ala Leu Ala Arg Asp 225 230 235 240 Pro Arg Ile Arg
Ala Val Tyr Val Thr Pro His His Gln Tyr Pro Thr 245 250 255 Thr Val
Thr Met Gly Ala Ala Arg Arg Leu Gln Leu Leu Glu Leu Ala 260 265 270
Glu Arg His Arg Leu Ala Leu Ile Glu Asp Asp Tyr Asp His Glu Tyr 275
280 285 Arg Phe Glu Gly Arg Pro Val Leu Pro Leu Ala Ala Arg Ala Pro
Glu 290 295 300 Gly Leu Pro Leu Ile Tyr Val Gly Ser Leu Ser Lys Leu
Leu Ser Pro 305 310 315 320 Gly Ile Arg Leu Gly Tyr Ala Leu Ala Pro
Glu Arg Leu Leu Thr Arg 325 330 335 Met Ala Ala Ala Arg Ala Ala Ile
Asp Arg Gln Gly Asp Ala Pro Leu 340 345 350 Glu Ala Ala Leu Ala Glu
Leu Ile Arg Asp Gly Asp Leu Gly Arg His 355 360 365 Ala Arg Lys Ala
Arg Arg Val Tyr Arg Ala Arg Arg Asp Leu Leu Ala 370 375 380 Glu Arg
Leu Thr Ala Gln Leu Ala Gly Arg Ala Ala Phe Asp Leu Pro 385 390 395
400 Ala Gly Gly Leu Ala Leu Trp Leu Arg Cys Ala Gly Val Ser Ala Glu
405 410 415 Thr Trp Ala Glu Ala Ala Gly Gln Ala Gly Leu Ala Leu Leu
Pro Gly 420 425 430 Thr Arg Phe Ala Leu Glu Ser Pro Ala Pro Gln Ala
Phe Arg Leu Gly 435 440 445 Tyr Ala Ala Leu Asp Glu Gly Gln Ile Ala
Arg Ala Val Glu Ile Leu 450 455 460 Ala Arg Ser Phe Pro Gly 465 470
15 35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 15 ggtattgagg gtcgcatgaa ggttttagtc aatgg 35 16 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 16 agaggagagt tagagcctta tgaaatgcta gcagcct 37 17
35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 17 ggtattgagg gtcgcatgtt cgacgccctc gcccg 35 18 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 18 agaggagagt tagagcctca gagactggtg aacttgc 37 19
35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 19 ggtattgagg gtcgcatgga acatttgctg aatcc 35 20 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 20 agaggagagt tagagcctta aacgccgttg tttatcg 37 21
35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 21 ggtattgagg gtcgcatgcg cgagcctctt gccct 35 22 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 22 agaggagagt tagagcctca gccggggaag ctccggg 37 23
35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 23 ggtattgagg gtcgcatgtc cacgcaggcg gccat 35 24 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 24 agaggagagt tagagcctca ctcacgattc acattgc 37 25
35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 25 ggtattgagg gtcgcatgcc agaattagct aatga 35 26 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 26 agaggagagt tagagcctta ttcgtcctct tgtaaaa 37 27
35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 27 ggtattgagg gtcgcatgcg ctctacgacg gctcc 35 28 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 28 agaggagagt tagagcctca gccgcgcagc accttgg 37 29
35 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 29 ggtattgagg gtcgcatgtt tgagaacatt accgc 35 30 37
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 30 agaggagagt tagagcctta cagcactgcc acaatcg 37 31
1194 DNA Escherichia coli 31 32 397 PRT Escherichia coli 32 Val Phe
Gln Lys Val Asp Ala Tyr Ala Gly Asp Pro Ile Leu Thr Leu 1 5 10 15
Met Glu Arg Phe Lys Glu Asp Pro Arg Ser Asp Lys Val Asn Leu Ser 20
25 30 Ile Gly Leu Tyr Tyr Asn Glu Asp Gly Ile Ile Pro Gln Leu Gln
Ala 35 40 45 Val Ala Glu Ala Glu Ala Arg Leu Asn Ala Gln Pro His
Gly Ala Ser 50 55 60 Leu Tyr Leu Pro Met Glu Gly Leu Asn Cys Tyr
Arg His Ala Ile Ala 65 70 75 80 Pro Leu Leu Phe Gly Ala Asp His Pro
Val Leu Lys Gln Gln Arg Val 85 90 95 Ala Thr Ile Gln Thr Leu Gly
Gly Ser Gly Ala Leu Lys Val Gly Ala 100 105 110 Asp Phe Leu Lys Arg
Tyr Phe Pro Glu Ser Gly Val Trp Val Ser Asp 115 120 125 Pro Thr Trp
Glu Asn Arg Val Ala Ile Phe Ala Gly Ala Gly Phe Glu 130 135 140 Val
Ser Thr Tyr Pro Trp Tyr
Asp Glu Ala Thr Asn Gly Val Arg Phe 145 150 155 160 Asn Asp Leu Leu
Ala Thr Leu Lys Thr Leu Pro Ala Arg Ser Ile Val 165 170 175 Leu Leu
His Pro Cys Cys His Asn Pro Thr Gly Ala Asp Leu Thr Asn 180 185 190
Asp Gln Trp Asp Ala Val Ile Glu Ile Leu Lys Ala Arg Glu Leu Ile 195
200 205 Pro Phe Leu Asp Ile Ala Tyr Gln Gly Phe Gly Ala Gly Met Glu
Glu 210 215 220 Asp Ala Tyr Ala Ile Arg Ala Ile Ala Ser Ala Gly Leu
Pro Ala Leu 225 230 235 240 Val Ser Asn Ser Phe Ser Lys Ile Phe Ser
Leu Tyr Gly Glu Arg Val 245 250 255 Gly Gly Leu Ser Val Met Cys Glu
Asp Ala Glu Ala Ala Gly Arg Val 260 265 270 Leu Gly Gln Leu Lys Ala
Thr Val Arg Arg Asn Tyr Ser Ser Pro Pro 275 280 285 Asn Phe Gly Ala
Gln Val Val Ala Ala Val Leu Asn Asp Glu Ala Leu 290 295 300 Lys Ala
Ser Trp Leu Ala Glu Val Glu Glu Met Arg Thr Arg Ile Leu 305 310 315
320 Ala Met Arg Gln Glu Leu Val Lys Val Leu Ser Thr Glu Met Pro Glu
325 330 335 Arg Asn Phe Asp Tyr Leu Leu Asn Gln Arg Gly Met Phe Ser
Tyr Thr 340 345 350 Gly Leu Ser Ala Ala Gln Val Asp Arg Leu Arg Glu
Glu Phe Gly Val 355 360 365 Tyr Leu Ile Ala Ser Gly Arg Met Cys Val
Ala Gly Leu Asn Thr Ala 370 375 380 Asn Val Gln Arg Val Ala Lys Ala
Phe Ala Ala Val Met 385 390 395 33 35 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 33 ggtattgagg
gtcgcgtgtt tcaaaaagtt gacgc 35 34 37 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 34 agaggagagt
tagagcctta catcaccgca gcaaacg 37 35 35 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 35 ggtattgagg
gtcgcatgga gtccaaagtc gttga 35 36 37 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 36 agaggagagt
tagagcctta cacttggaaa acagcct 37 37 35 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 37 ggtattgagg
gtcgcatgaa aaactggaaa acaag 35 38 37 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 38 agaggagagt
tagagcctta cagcttagcg ccttcta 37 39 35 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 39 ggtattgagg
gtcgcatgcg aggggcatta ttcaa 35 40 36 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 40 agaggagagt
tagagcctca gcccttgagc gcgaag 36 41 1416 DNA Escherichia coli 41
atggaaaact ttaaacatct ccctgaaccg ttccgcattc gtgttattga gccagtaaaa
60 cgtaccaccc gcgcttatcg tgaagaggca attattaaat ccggtatgaa
cccgttcctg 120 ctggatagcg aagatgtttt tatcgattta ctgaccgaca
gcggcaccgg ggcggtgacg 180 cagagcatgc aggctgcgat gatgcgcggc
gacgaagcct acagcggcag tcgtagctac 240 tatgcgttag ccgagtcagt
gaaaaatatc tttggttatc aatacaccat tccgactcac 300 cagggccgtg
gcgcagagca aatctatatt ccggtactga ttaaaaaacg cgagcaggaa 360
aaaggcctgg atcgcagcaa aatggtggcg ttctctaact atttctttga taccacgcag
420 ggccatagcc agatcaacgg ctgtaccgtg cgtaacgtct atatcaaaga
agccttcgat 480 acgggcgtgc gttacgactt taaaggcaac tttgaccttg
agggattaga acgcggtatt 540 gaagaagttg gtccgaataa cgtgccgtat
atcgttgcaa ccatcaccag taactctgca 600 ggtggtcagc cggtttcact
ggcaaactta aaagcgatgt acagcatcgc gaagaaatac 660 gatattccgg
tggtaatgga ctccgcgcgc tttgctgaaa acgcctattt catcaagcag 720
cgtgaagcag aatacaaaga ctggaccatc gagcagatca cccgcgaaac ctacaaatat
780 gccgatatgc tggcgatgtc cgccaagaaa gatgcgatgg tgccgatggg
cggcctgctg 840 tgcatgaaag acgacagctt ctttgatgtg tacaccgagt
gcagaaccct ttgcgtggtg 900 caggaaggct tcccgacata tggcggcctg
gaaggcggcg cgatggagcg tctggcggta 960 ggtctgtatg acggcatgaa
tctcgactgg ctggcttatc gtatcgcgca ggtacagtat 1020 ctggtcgatg
gtctggaaga gattggcgtt gtctgccagc aggcgggcgg tcacgcggca 1080
ttcgttgatg ccggtaaact gttgccgcat atcccggcag accagttccc ggcacaggcg
1140 ctggcctgcg agctgtataa agtcgccggt atccgtgcgg tagaaattgg
ctctttcctg 1200 ttaggccgcg atccgaaaac cggtaaacaa ctgccatgcc
cggctgaact gctgcgttta 1260 accattccgc gcgcaacata tactcaaaca
catatggact tcattattga agcctttaaa 1320 catgtgaaag agaacgcggc
gaatattaaa ggattaacct ttacgtacga accgaaagta 1380 ttgcgtcact
tcaccgcaaa acttaaagaa gtttaa 1416 42 1371 DNA Citrobacter freundii
42 atgaattatc cggcagaacc cttccgtatt aaaagcgttg aaactgtatc
tatgatcccg 60 cgtgatgaac gcctcaagaa aatgcaggaa gcgggttaca
atactttcct gttaaattcg 120 aaagatattt atattgacct gctgacagac
agtggcacta acgcaatgag cgacaagcag 180 tgggccggaa tgatgatggg
tgatgaagcg tacgcgggca gcgaaaactt ctatcatctg 240 gaaagaaccg
tgcaggaact gtttggcttt aaacatattg ttccgactca ccaggggcgt 300
ggcgcagaaa acctgttatc gcagctggct attaaacctg ggcaatatgt tgccgggaat
360 atgtatttca ctaccacccg ttatcaccag gaaaaaaatg gtgcggtgtt
tgtcgatatc 420 gttcgtgacg aagcgcacga tgccggtctg aatattgcgt
ttaaaggtga tatcgatctt 480 aaaaaattac aaaagctgat tgatgaaaaa
ggcgcagaga atattgcgta tatctgcctg 540 gcggtgacgg ttaacctcgc
gggcggccaa ccggtctcga tggctaacat gcgtgcggtg 600 cgtgaactga
cagaagcgca tggcattaaa gtgttctacg acgctacccg ctgcgtagaa 660
aacgcctact ttatcaaaga gcaagagcag ggctttgaga acaagagcat cgccgagatc
720 gtgcatgaga tgttcagcta cgccgacggt tgtaccatga gtggtaaaaa
agactgtctg 780 gtgaacatcg gcggcttcct gtgcatgaac gatgacgaaa
tgttctcttc tgccaaagag 840 ttagtcgtgg tctacgaagg gatgccatct
tacggcggcc tggccggacg tgatatggaa 900 gcgatggcga ttggcctgcg
tgaagccatg cagtacgaat atattgagca ccgcgtgaag 960 caggttcgct
acctgggcga taagctgaaa gccgctggcg taccgattgt tgaaccggta 1020
ggcggtcacg cggtattcct cgatgcgcgt cgcttctgcg agcatctgac gcaagatgag
1080 ttcccggcac aaagtctggc tgccagcatc tatgtggaaa ccggcgtgcg
cagtatggag 1140 cgcggaatta tctctgcggg ccgtaataac gtgaccggtg
aacaccacag accgaaactg 1200 gaaaccgtgc gtctgactat tccacgtcgt
gtttatacct acgcacatat ggatgttgtg 1260 gctgacggta ttattaaact
ttaccagcac aaagaagata ttcgcgggct gaagtttatt 1320 tacgagccga
agcagttgcg tttctttact gcacgctttg attacatcta a 1371 43 35 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 43 ggtattgagg gtcgcatgga aaactttaaa catct 35 44 37 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 44 agaggagagt tagagcctta aacttcttta agttttg 37 45 35 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 45 ggtattgagg gtcgcatgaa ttatccggca gaacc 35 46 37 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 46 agaggagagt tagagcctta gatgtaatca aagcgtg 37 47 31 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 47 ccagggcacc ggcgcagagc aaatctatat t 31 48 30 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 48 tgcgccggtg ccctggtgag tcggaatggt 30 49 32 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 49
tcctgcacgc ggcaaagggt tctgcactcg gt 32 50 30 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 50
ctttgccgcg tgcaggaagg cttcccgaca 30 51 29 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 51 aggggaccgg
cgcagaaaac ctgttatcg 29 52 32 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 52 tctgcgccgg tcccctggtg
agtcggaaca at 32 53 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 53 gttagtccgc gtctacgaag
ggatgccat 29 54 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 54 gtagacgcgg actaactctt
tggcagaag 29 55 35 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 55 ggtattgagg gtcgcatgta
cgaactggga gttgt 35 56 37 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 56 agaggagagt tagagcctta
gtcaatatat ttcaggc 37 57 35 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 57 ggtattgagg gtcgcatgtc
cggcatcgtt gtcca 35 58 37 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 58 agaggagagt tagagcctca
gacatatttc agtccca 37 59 35 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 59 ggtattgagg gtcgcatgcg
actgaacaac ctcgg 35 60 37 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 60 agaggagagt tagagcctca
gttctccacg tattcca 37 61 35 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 61 ggtattgagg gtcgcatgag
cgtggttcac cggaa 35 62 37 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 62 agaggagagt tagagcctca
atcgatatat ttcagtc 37 63 35 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 63 ggtattgagg gtcgcatgag
cctggttaat atgaa 35 64 37 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 64 agaggagagt tagagcctta
tgactttaac gcgttga 37 65 684 DNA Comamonas testosteroni 65 66 227
PRT Comamonas testosteroni 66 Met Tyr Glu Leu Gly Val Val Tyr Arg
Asn Ile Gln Arg Ala Asp Arg 1 5 10 15 Ala Ala Ala Asp Gly Leu Ala
Ala Leu Gly Ser Ala Thr Val His Glu 20 25 30 Ala Met Gly Arg Val
Gly Leu Leu Lys Pro Tyr Met Arg Pro Ile Tyr 35 40 45 Ala Gly Lys
Gln Val Ser Gly Thr Ala Val Thr Val Leu Leu Gln Pro 50 55 60 Gly
Asp Asn Trp Met Met His Val Ala Ala Glu Gln Ile Gln Pro Gly 65 70
75 80 Asp Ile Val Val Ala Ala Val Thr Ala Glu Cys Thr Asp Gly Tyr
Phe 85 90 95 Gly Asp Leu Leu Ala Thr Ser Phe Gln Ala Arg Gly Ala
Arg Ala Leu 100 105 110 Ile Ile Asp Ala Gly Val Arg Asp Val Lys Thr
Leu Gln Glu Met Asp 115 120 125 Phe Pro Val Trp Ser Lys Ala Ile Ser
Ser Lys Gly Thr Ile Lys Ala 130 135 140 Thr Leu Gly Ser Val Asn Ile
Pro Ile Val Cys Ala Gly Met Leu Val 145 150 155 160 Thr Pro Gly Asp
Val Ile Val Ala Asp Asp Asp Gly Val Val Cys Val 165 170 175 Pro Ala
Ala Arg Ala Val Glu Val Leu Ala Ala Ala Gln Lys Arg Glu 180 185 190
Ser Phe Glu Gly Glu Lys Arg Ala Lys Leu Ala Ser Gly Ile Leu Gly 195
200 205 Leu Asp Met Tyr Lys Met Arg Glu Pro Leu Glu Lys Ala Gly Leu
Lys 210 215 220 Tyr Ile Asp 225 67 42 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 67 actcggatcc
gaaggagata tacatatgta cgaactggga ct 42 68 33 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 68
cggctgtcga ccgttagtca atatatttca ggc 33 69 31 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 69
cgcggatcca taatggttga gaacattacc g 31 70 30 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 70 acgcgtcgac
ttacagcact gccacaatcg 30 71 32 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 71 ccggaattca taatggtcga
actgggagtt gt 32 72 33 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 72 gaatgcggcc gcttagtcaa
tatatttcag gcc 33 73 15 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 73 ggtattgagg gtcgc 15 74 17
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 74 agaggagagt tagagcc 17 75 60 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 75
gaagcgattg tggcagtgct gtaaggctct aacggatccg aaggagatat acatatgtac
60 76 57 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 76 gtacatatgt atatctccgg atccgttaga gccttacagc
actgccacaa tcgcttc 57 77 24 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 77 tgccatggaa aactttaaac atct
24 78 28 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 78 ccaagctttt aaacttcttt aagttttg 28 79 40 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 79 cggggtaccc atgcaaacac aaaaaccgac tctcgaactg 40 80 33 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 80 cgcggatcct taactgcgcg tcgccgcttt cat 33 81 1563 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
construct 81 atgcaaacac aaaaaccgac tctcgaacta ctaacctgcg aaggcgctta
tcgcgacaac 60 ccgaccgcgc tttttcacca gttgtgtggg gatcgtccgg
caacgctgct gctggaatcc 120 gcagatatcg acagcaaaga tgatttaaaa
agcctgctac tggtagacag tgcgctgcgc 180 attacagcat taggtgacac
tgtcacaatt aaggcgttat ccggcaatgg tgaagccctg 240 ctggcactac
tggataacgc cctgcctgcg ggtgtggaaa atgaacaatc accaaactgc 300
cgtgtgctgc gcttcccccc tgtcagtcca ctgctggatg aagacgctcg cttatgctcc
360 ctttcggttt ttgacgcttt ccgtttattg cagaatctgt tgaatgtacc
gaaggaagaa 420 cgagaagcca tgttcttcgg cggcctgttc tcttatgacc
ttgtggcggg atttgaagat 480 ttaccgcaac tgtcagcgga aaataactgc
cctgatttct gtttttatct cgctgaaacg 540 ctgatggtga ttgaccatca
gaaaaaaagc acccgtattc aggccagcct gtttgctccg 600 aatgaagaag
aaaaacaacg tctcactgct cgcctgaacg aactacgtca gcaactgacc 660
gaagccgcgc cgccgctgcc agtggtttcc gtgccgcata tgcgttgtga atgtaatcag
720 agcgatgaag agttcggtgg cgtagtgcgt ttgttgcaaa aagcgattcg
cgctggagaa 780 attttccagg tggtgccatc tcgccgtttc tctctgccct
gcccgtcacc gctggcggcc 840 tattacgtgc tgaaaaagag taatcccagc
ccgtacatgt tttttatgca ggataatgat 900 ttcaccctat ttggcgcgtc
gccggaaagc tcgctcaagt atgatgccac cagccgccag 960 attgagatct
acccgattgc cggaacacgc ccacgcggtc gtcgcgccga tggttcactg 1020
gacagagatc tcgacagccg tattgaactg gaaatgcgta ccgatcataa agagctgtct
1080 gaacatctga tgctggttga tctcgcccgt aatgatctgg cacgcatttg
cacccccggc 1140 agccgctacg tcgccgatct caccaaagtt gaccgttatt
cctatgtgat gcacctcgtc 1200 tctcgcgtag tcggcgaact gcgtcacgat
cttgacgccc tgcacgctta tcgcgcctgt 1260 atgaatatgg ggacgttaag
cggtgcgccg aaagtacgcg ctatgcagtt aattgccgag 1320 gcggaaggtc
gtcgccgcgg cagctacggc ggcgcggtag gttatttcac cgcgcatggc 1380
gatctcgaca cctgcattgt gatccgctcg gcgctggtgg aaaacggtat cgccaccgtg
1440 caagcgggtg ctggtgtagt ccttgattct gttccgcagt cggaagccga
cgaaacccgt 1500 aacaaagccc gcgctgtact gcgcgctatt gccaccgcgc
atcatgcaca ggagactttc 1560 tga 1563 82 520 PRT Artificial Sequence
Description of Artificial Sequence Synthetic construct 82 Met Gln
Thr Gln Lys Pro Thr Leu Glu Leu Leu Thr Cys Glu Gly Ala 1 5 10 15
Tyr Arg Asp Asn Pro Thr Ala Leu Phe His Gln Leu Cys Gly Asp Arg 20
25 30 Pro Ala Thr Leu Leu Leu Glu Ser Ala Asp Ile Asp Ser Lys Asp
Asp 35 40 45 Leu Lys Ser Leu Leu Leu Val Asp Ser Ala Leu Arg Ile
Thr Ala Leu 50 55 60 Gly Asp Thr Val Thr Ile Lys Ala Leu Ser Gly
Asn Gly Glu Ala Leu 65 70 75 80 Leu Ala Leu Leu Asp Asn Ala Leu Pro
Ala Gly Val Glu Asn Glu Gln 85 90 95 Ser Pro Asn Cys Arg Val Leu
Arg Phe Pro Pro Val Ser Pro Leu Leu 100 105 110 Asp Glu Asp Ala Arg
Leu Cys Ser Leu Ser Val Phe Asp Ala Phe Arg 115 120 125 Leu Leu Gln
Asn Leu Leu Asn Val Pro Lys Glu Glu Arg Glu Ala Met 130 135 140 Phe
Phe Gly Gly Leu Phe Ser Tyr Asp Leu Val Ala Gly Phe Glu Asp 145 150
155 160 Leu Pro Gln Leu Ser Ala Glu Asn Asn Cys Pro Asp Phe Cys Phe
Tyr 165 170 175 Leu Ala Glu Thr Leu Met Val Ile Asp His Gln Lys Lys
Ser Thr Arg 180 185 190 Ile Gln Ala Ser Leu Phe Ala Pro Asn Glu Glu
Glu Lys Gln Arg Leu 195 200
205 Thr Ala Arg Leu Asn Glu Leu Arg Gln Gln Leu Thr Glu Ala Ala Pro
210 215 220 Pro Leu Pro Val Val Ser Val Pro His Met Arg Cys Glu Cys
Asn Gln 225 230 235 240 Ser Asp Glu Glu Phe Gly Gly Val Val Arg Leu
Leu Gln Lys Ala Ile 245 250 255 Arg Ala Gly Glu Ile Phe Gln Val Val
Pro Ser Arg Arg Phe Ser Leu 260 265 270 Pro Cys Pro Ser Pro Leu Ala
Ala Tyr Tyr Val Leu Lys Lys Ser Asn 275 280 285 Pro Ser Pro Tyr Met
Phe Phe Met Gln Asp Asn Asp Phe Thr Leu Phe 290 295 300 Gly Ala Ser
Pro Glu Ser Ser Leu Lys Tyr Asp Ala Thr Ser Arg Gln 305 310 315 320
Ile Glu Ile Tyr Pro Ile Ala Gly Thr Arg Pro Arg Gly Arg Arg Ala 325
330 335 Asp Gly Ser Leu Asp Arg Asp Leu Asp Ser Arg Ile Glu Leu Glu
Met 340 345 350 Arg Thr Asp His Lys Glu Leu Ser Glu His Leu Met Leu
Val Asp Leu 355 360 365 Ala Arg Asn Asp Leu Ala Arg Ile Cys Thr Pro
Gly Ser Arg Tyr Val 370 375 380 Ala Asp Leu Thr Lys Val Asp Arg Tyr
Ser Tyr Val Met His Leu Val 385 390 395 400 Ser Arg Val Val Gly Glu
Leu Arg His Asp Leu Asp Ala Leu His Ala 405 410 415 Tyr Arg Ala Cys
Met Asn Met Gly Thr Leu Ser Gly Ala Pro Lys Val 420 425 430 Arg Ala
Met Gln Leu Ile Ala Glu Ala Glu Gly Arg Arg Arg Gly Ser 435 440 445
Tyr Gly Gly Ala Val Gly Tyr Phe Thr Ala His Gly Asp Leu Asp Thr 450
455 460 Cys Ile Val Ile Arg Ser Ala Leu Val Glu Asn Gly Ile Ala Thr
Val 465 470 475 480 Gln Ala Gly Ala Gly Val Val Leu Asp Ser Val Pro
Gln Ser Glu Ala 485 490 495 Asp Glu Thr Arg Asn Lys Ala Arg Ala Val
Leu Arg Ala Ile Ala Thr 500 505 510 Ala His His Ala Gln Glu Thr Phe
515 520 83 50 DNA Artificial Sequence Description of Artificial
Sequence Synthetic primer 83 cggggtacca gaaggagaga tgcacgatgt
ttgagaacat taccgccgct 50 84 31 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 84 cggggtaccg cttagtcaat
atatttcagg c 31 85 63 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 85 atgtccagaa ggcttcgcag
aacaaaaatc gttaccacgt taggtgtagg ctggagctgc 60 ttc 63 86 64 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 86 ctctaccgtt aaaatacgcg tggtattagt agaacccacg gtaccatatg
aatatcctcc 60 ttag 64 87 64 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 87 aggacgtgaa cagatgcggt
gttagtagtg ccgctcggta ccagcatatg aatatcctcc 60 ttag 64 88 63 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 88 atgaaaaaga ccaaaattgt ttgcaccatc ggaccgaaaa ccggtgtagg
ctggagctgc 60 ttc 63 89 10 PRT Lactobacillus amylovorus 89 Met Pro
Glu Leu Ala Asn Asp Leu Gly Leu 1 5 10 90 6 PRT Artificial Sequence
Description of Artificial Sequence Synthetic 6xHis tag 90 His His
His His His His 1 5
* * * * *