U.S. patent application number 11/136464 was filed with the patent office on 2005-10-06 for ion channel.
This patent application is currently assigned to IONIX PHARMACEUTICALS LIMITED. Invention is credited to Akopian, Armen Norakovitch, Wood, John Nicholas.
Application Number | 20050221394 11/136464 |
Document ID | / |
Family ID | 10776812 |
Filed Date | 2005-10-06 |
United States Patent
Application |
20050221394 |
Kind Code |
A1 |
Wood, John Nicholas ; et
al. |
October 6, 2005 |
Ion channel
Abstract
The present invention relates to a novel 1,957 amino acid
tetrodotoxin-insensitive voltage-gated sodium channel specifically
located in mammalian sensory neurons. Nucleic acid sequences coding
for the novel sodium channel, vectors, host cells and methods of
identifying modulators of the novel sodium channel for use in
treatment of pain are also provided.
Inventors: |
Wood, John Nicholas;
(London, GB) ; Akopian, Armen Norakovitch;
(London, GB) |
Correspondence
Address: |
NIXON & VANDERHYE, PC
901 NORTH GLEBE ROAD, 11TH FLOOR
ARLINGTON
VA
22203
US
|
Assignee: |
IONIX PHARMACEUTICALS
LIMITED
Cambridgeshire
GB
|
Family ID: |
10776812 |
Appl. No.: |
11/136464 |
Filed: |
May 25, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11136464 |
May 25, 2005 |
|
|
|
10202824 |
Jul 26, 2002 |
|
|
|
10202824 |
Jul 26, 2002 |
|
|
|
08669656 |
Jun 24, 1996 |
|
|
|
6451554 |
|
|
|
|
Current U.S.
Class: |
435/7.2 ;
435/320.1; 435/334; 435/69.1; 530/388.22; 536/23.53 |
Current CPC
Class: |
C07K 16/28 20130101;
C07K 14/705 20130101; G01N 33/6872 20130101; G01N 33/9486 20130101;
G01N 2500/00 20130101; G01N 33/94 20130101; G01N 33/6893
20130101 |
Class at
Publication: |
435/007.2 ;
530/388.22; 435/069.1; 435/334; 435/320.1; 536/023.53 |
International
Class: |
G01N 033/53; G01N
033/567; C07H 021/04; C12N 015/09; C07K 016/28; C12N 005/06 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 28, 1995 |
GB |
9513180.1 |
Claims
1. An antibody which binds specifically to a voltage gated TTX
resistant sodium channel, wherein said channel is encoded by an
nucleic acid that specifically hybridizes to the complement of SEQ
ID NO: 1 under conditions of 50-60.degree. C., 5.times.SSC for 30
minutes.
2. The antibody of claim 1 wherein said channel is encoded by a
nucleic acid that specifically hybridises to the complement of SEQ
ID NO:1 under conditions of 0.2.times.SSC, 0.5% SDS at 68.degree.
C. for 20 minutes.
3. The antibody of claim 2 wherein the channel has the sequence of
SEQ ID NO: 2.
4. The antibody of claim 3 which binds specifically to an
extracellular loop of the sodium channel of SEQ ID NO: 2.
5. The antibody of claim 3 which binds specifically to a peptide
selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 18,
SEQ ID NO: 19 and SEQ ID NO: 20.
6. The antibody of claim 1 which is a polyclonal antibody.
7. The antibody of claim 1 which is a monoclonal antibody.
8. The antibody of claim 7, wherein said antibody selected from the
group consisting of chimeric, single chain and humanised
antibodies.
9. The antibody of claim 7, which is a human monoclonal
antibody.
10. The antibody of claim 1 which is an intact antibody
molecule.
11. The antibody of claim 1, which is a fragment of an intact
antibody molecule, wherein said fragment comprises the antibody
binding region.
12. The antibody of claim 11 which is a Fab or F(ab).sub.2
fragment.
13. A method of producing an antibody comprising; administering a
voltage gated TTX resistant sodium channel encoded by an nucleic
acid that specifically hybridizes to the complement of SEQ ID NO: 1
under conditions of 50-60.degree. C., 5.times.SSC for 30 minutes,
or a fragment thereof to a non-human animal, and obtaining an
antibody from said animal.
14. The method of claim 13 wherein said fragment comprises an
extracellular loop of said polypeptide.
15. The method of claim 13 wherein the fragment is contained in a
fusion protein with glutathione-S-transferase.
16. The method of claim 13 wherein said fragment is a peptide
selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 18,
SEQ ID NO: 19 and SEQ ID NO: 20.
17. The method of claim 13 comprising determining the binding of
the antibody to the channel
18. The method of claim 13 comprising determining the binding of
the antibody to sensory neurons.
19. A method of preparing a monoclonal antibody which binds
specifically to a voltage gated TTX resistant sodium channel
encoded by an nucleic acid that specifically hybridizes to the
complement of SEQ ID NO: 1 under conditions of 50-60.degree. C.,
5.times.SSC for 30 minutes, the method comprising; culturing a cell
line which produces said antibody.
20. The method of claim 19 wherein the cell line is selected from
the group consisting of hybridoma, trioma, human B cell hybridoma
and EBV hybridoma.
21. A method of binding an antibody comprising; contacting a
voltage gated TTX resistant sodium channel encoded by an nucleic
acid that specifically hybridizes to the complement of SEQ ID NO: 1
under conditions of 50-60.degree. C., 5.times.SSC for 30 minutes
with an antibody which binds specifically to said channel, whereby
said antibody binds to said channel.
22. The method of claim 21 wherein the channel is in a tissue which
expresses said channel.
23. The method of claim 21 further comprising detecting the binding
of the antibody to the channel.
24. A method of identifying an antibody which modulates a mammalian
sensory neuron sodium channel, comprising; contacting an antibody
with a host cell comprising a voltage gated TTX resistant sodium
channel encoded by an nucleic acid that specifically hybridizes to
the complement of SEQ ID NO: 1 under conditions of 50-60.degree.
C., 5.times.SSC for 30 minutes, and detecting the binding of said
antibody to the channel, binding of said antibody to the channel
being indicative that the antibody modulates the mammalian sensory
neuron sodium channel.
25. A method of identifying an antibody which modulates a mammalian
sensory neuron sodium channel, comprising; contacting an antibody
with a host cell comprising a voltage gated TTX resistant sodium
channel encoded by an nucleic acid that specifically hybridizes to
the complement of SEQ ID NO: 1 under conditions of 50-60.degree.
C., 5.times.SSC for 30 minutes, and detecting the activity of said
channel, a change in activity in the presence of the antibody being
indicative that the antibody modulates the mammalian sensory neuron
sodium channel.
26. The method of claim 25 wherein said antibody is identified as a
blocker of the activity of said channel.
27. The method of claim 25 wherein said host cell and said test
compound are contacted under depolarising conditions.
28. The method of claim 25 wherein changes in the activity of the
sodium channel are detected by determining the ion flux through
said channel.
29. The method of claim 28 wherein changes in the activity of the
sodium channel are detected by determining the sodium ion flux
through said channel.
30. The method of claim 29 wherein the sodium ions are
radiolabelled.
31. The method of claim 27 wherein changes in the activity of the
sodium channel are detected by determining the flux of guanidine
through said channel.
32. The method of claim 25 comprising detecting changes in the
activity of the sodium channel using electrophysiology.
33. The method of claim 32 comprising detecting changes in the
activity of the sodium channel using a patch clamp.
34. A method of treating pain comprising administering to an
individual in need thereof an antibody which binds specifically to
a sensory neuron specific sodium channel encoded by an nucleic acid
that specifically hybridizes to the complement of SEQ ID NO: 1
under conditions of 50-60.degree. C., 5.times.SSC for 30
minutes.
35. A method according to claim 34 wherein the channel has the
sequence of SEQ ID NO: 2.
Description
[0001] This is a divisional of application Ser. No. 10/202,824,
filed Jul. 26, 2002 (allowed), which is a continuation of
application Ser. No. 08/669,656, filed Jun. 24, 1996 (U.S. Pat. No.
6,451,554), which claims benefit of GB 9513180.1, filed Jun. 28,
1995, the entire contents of each of which is incorporated herein
by reference.
[0002] Voltage-gated sodium channels are transmembrane proteins
which cause sodium permeability to increase. Depolarization of the
plasma membrane causes sodium channels to open allowing sodium ions
to enter along the electrochemical gradient creating an action
potential.
[0003] Voltage-gated sodium channels are expressed by all
electrically excitable cells, where they play an essential role in
action potential propagation. They comprise a major subunit of
about 2000 amino acids which is divided into four domains (D1-D4),
each of which contains 6 membrane-spanning regions (S1-S6). The
alpha-subunit is usually associated with 2 smaller subunits (beta-1
and beta-2)) that influence the gating kinetics of the channel.
These channels show remarkable ion selectivity, with little
permeability to other monovalent or divalent cations. Patch-clamp
studies have shown that depolarisation leads to activation with a
typical conductance of about 20 pS, reflecting ion movement at the
rate of 10.sup.7 ions/second/channel. The channel inactivates
within milliseconds (Caterall. W. A., Physiol. Rev. 72, S4-S47
(1992): Omri et al, J. Membrane Biol 115, 13-29: Hille, B. Ionic
Channels in Excitable Membranes, Sinauer, Sunderland, Mass.
(1991)).
[0004] Sodium channels have been pharmacologically characterised
using toxins which bind to distinct sites on sodium channels. The
heterocyclic guanidine-based channel blockers tetrodotoxin (TTX)
and saxitoxin (STX) bind to a site in the S5-S6 loop, whilst
.mu.-conotoxin binds to an adjacent overlapping region. A number of
toxins from sea anemones or scorpions binding at other sites alter
the voltage-dependence of activation or inactivation.
[0005] Voltage-gated sodium channels that are blocked by nanomolar
concentrations of tetrodotoxin are known as tetrodotoxin sensitive
sodium channels (Hille (1991) "Ionic Channels in Excitable
Membranes", Sinauer Sunderland, Mass. (1991)) whilst sodium
channels that are blocked by concentrations greater than 1
micromolar are known as tetrodotoxin-insensitive (TTXi) sodium
channels (Pearce and Duchen Neuroscience 63, 1041-1056 (1994)).
[0006] Dorsal root ganglion (DRG) neurons express at least three
types of sodium channels which differ in kinetics and sensitivity
to TTX. Neurons with small-diameter cell bodies and unmyelinated
axons (C-fibers) include most of the nociceptor (damage-sensing)
population and express a fast TTX-sensitive current and a slower
TTX-insensitive current. Of the five cloned sodium channel
.alpha.-subunit transcripts known to be present in dorsal root
ganglia, none exhibits the properties of the TTX-insensitive
channel.
[0007] Sodium channel blockers are used clinically to provide pain
relief. Three classes of sodium channel blockers in common clinical
use are: local anesthetics such as lidocaine, some anticonvulsants
such as phenytoin and carbamazepine, and some antiarrhythmics such
as mexiletine. Each of these is known to suppress ectopic
peripheral nervous system discharge in experimental preparations
and to provide relief in a broad range of clinical neuropathic
conditions.
[0008] Applicants have now found a novel voltage-gated sodium
channel (hereinafter referred to as a sodium channel specifically
located in sensory neurons or also referred to as SNS sodium
channel) that is present in sensory neurons (or neurones) but not
present in glia, muscle, or the neurons of the sympathetic,
parasympathetic, enteric or central nervous systems. Preferably the
sodium channel of the invention is found in the neurons of the
dorsal root ganglia (DRG) or cranial ganglia. More preferably the
sodium channel of the invention is found in the neurons of the
dorsal root ganglia. Preferably the sodium channel is specifically
located in rat sensory neurons or human sensory neurons.
[0009] The sodium channel of the present invention is believed to
play a role in nociceptive transmission because some noxious input
to the central nervous system is known to be insensitive to TTX.
Persistent activation of peripheral nociceptors has been found to
result in changes in excitability in the dorsal horn associated
with the establishment of chronic pain. Increased sodium channel
activity has also been shown to underlie neuroma-induced
spontaneous action potential generation. Conversely, chronic pain
may be successfully treated by surgical or pharmacological
procedures which block peripheral nerve activation. Blockage of
nociceptor input may therefore produce useful therapeutic effects,
even though central nervous system plasticity plays a pivotal role
in the establishment of chronic pain. Sensory neuron-specific
voltage-gated sodium channels, particularly sub-types associated
with a nociceptive modality such as the sodium channel of the
invention, thus provide targets for therapeutic intervention in a
range of pain states. The electrophysiological and pharmacological
properties of the expressed SNS sodium channel are similar to those
described for the small diameter sensory neuron
tetrodotoxin-resistant sodium channels. As some noxious input into
the spinal cord is resistant to tetrodotoxin, block of expression
or function of such a C-fiber-restricted sodium channel may have a
selective analgesic effect.
[0010] In another aspect the present invention provides an isolated
protein comprising a sodium channel specifically located in rat
sensory neurons as encoded by the insert deposited in NCIMB deposit
number 40744, which was deposited at The National Collections of
Industrial and Marine Bacteria, 23 St Machar Drive, Aberdeen AB2
1RY, Scotland, United Kingdom on 27 Jun. 1995 in accordance with
the Budapest Treaty.
[0011] The invention also provides nucleotide sequences coding for
the SNS sodium channel. In a preferred embodiment, the nucleotide
sequence encodes a sodium channel specifically located in rat
sensory neurons which is as set out in FIG. 1a or a complementary
strand thereof.
[0012] The approximately 6.5 kilobase (kb) transcript expressed
selectively in rat dorsal root ganglia that codes for the novel
sodium channel of the invention shows sequence similarities with
known voltage-gated sodium channels. The cDNA codes for a 1.957
amino acid protein. In particular, the novel sodium channel of the
invention shows 65% identity at the amino acid level with the rat
cardiac tetrodotoxin-insensitive (TTXi) sodium channel. The
aromatic residue that is involved in high-affinity binding of TTX
to the channel atrium of TTX-sensitive sodium channels is altered
to a hydrophilic serine in the predicted protein of the SNS sodium
channel, whereas the residues implicated in sodium-selective
permeability are conserved. The novel sodium channel specifically
located in sensory neurons shows relative insensitivity to TTX
(IC50>1 micromolar) and thus exhibits properties different from
other cloned sodium channel transcripts known to be present in
dorsal root ganglia.
[0013] The invention also provides expression and cloning vectors
comprising a nucleotide sequence as hereinabove defined. In order
to effect transformation. DNA sequences containing the desired
coding sequence and control sequences in operable linkage (so that
hosts transformed with these sequences are capable of producing the
encoded proteins) may be included in a vector, however, the
relevant DNA may then also be integrated into the host
chromosome.
[0014] The invention also provides a screening assay for modulators
of the sodium channel which is specifically located in sensory
neurons wherein the assay comprises adding a potential modulator to
a cell expressing the SNS sodium channel and detecting any change
in activity of the sodium channel.
[0015] The present invention also provides a modulator which has
activity in the screening assay hereinabove defined. Modulators of
the sodium channel as hereinabove defined are useful in modulating
the sensation of pain. Blockers of the sodium channel will block or
prevent the transmission of impulses along sensory neurons and
thereby be useful in the treatment of acute, chronic or neuropathic
pain.
[0016] The present invention thus relates to novel voltage-gated
sodium channel proteins specific to sensory neurons, to nucleotide
sequences capable of encoding these sodium channel proteins, to
vectors comprising a nucleotide sequence coding for a sodium
channel of the invention, to host cells containing these vectors,
to cells transformed with a nucleic acid sequence coding for the
sodium channel, to screening assays using the sodium channel
proteins and/or host cells, to complementary stands of the DNA
sequence which is capable of encoding the sodium channel proteins
and to antibodies specific for the sodium channel proteins. These
and other aspects of the present invention are set forth in the
following detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1a shows the nucleic acid and amino acid sequences of
the sodium channel specific to the rat DRG (SNS-B) (SEQ ID NO: 1
and SEQ ID NO: 2).
[0018] FIG. 1b shows the structure of the SNS-B voltage-gated
sodium channel in pGEM-3Z.
[0019] FIG. 1c shows a schematised drawing of a known voltage-gated
sodium channel.
[0020] FIG. 2 shows sequences of examples of PCR primers for
isolation of human clone probes. RLLRVFKLAKSWPTL--SEQ ID NO: 21; 5'
gcttgctgcgggtcttcaagc 3' SEQ ID NO: 22; LRALPLRALSRFEG--SEQ ID NO:
23; 5' atcgagacagagcccgcagcg3' SEQ ID NO: 24; 5'
acgggtgccgcaaggacggcgtctccgtgtg- gaacggcgagaag 3' SEQ ID NO: 25;
and 5' ggctatccttcctcttccagctctcacccaggtat- ggagccaggt 3'-SEQ ID
NO: 26.
[0021] FIG. 3 shows a film of .sup.35S radio-labelled SNS-B
voltage-gated sodium channel protein in a coupled
transcription/translation system.
[0022] FIG. 4a and FIG. 4b show SNS-GST fusion protein constructs
for antibody generation. TCCCGTACGCTGCAGCTCTTT--SEQ ID NO: 27;
CCCGGGGAAGGCTAC--SEQ ID NO: 28; GTCGACACCAGAAAT--SEQ ID NO: 29;
GGATCCTCTAGAGTCGACCTGCAGAAGGAA--SEQ ID NO: 30
[0023] In accordance with one aspect of the invention there is
provided an isolated and/or purified nucleic acid sequence (or
polynucleotide or nucleotide sequence) which comprises a nucleic
acid sequence which encodes the mammalian sodium channel
specifically located in sensory neurons or a complementary strand
thereof. Preferably, the nucleic acid sequence encodes the sodium
channel specifically located in mammalian dorsal root ganglia. More
preferably, the nucleic acid sequence encodes the rat or human
sodium channel specifically located in dorsal root ganglia. The rat
nucleic acid sequence preferably comprises the sequence of the
coding portion of the nucleic acid sequence shown in FIG. 1a (SEQ
ID NO: 1) or the coding portion of the cDNA deposited in NCIMB
deposit number 40744 which was deposited at the National
Collections of Industrial and Marine Bacteria, 23 St. Machar Drive,
Aberdeen AB21RY, Scotland, United Kingdom on Jun. 27, 1995 in
accordance with the Budapest Treaty.
[0024] A nucleic acid sequence encoding a sodium channel of the
present invention may be obtained from a cDNA library derived from
mammalian sensory neurons, preferably dorsal root ganglia,
trigeminal ganglia or other cranial ganglia, more preferably rat or
human dorsal root ganglia. The nucleotide sequence described herein
was isolated from a cDNA library derived from rat dorsal root
ganglia cells. The nucleic acid sequence coding for the SNS sodium
channel has an open reading frame of 5,871 nucleotides encoding a
1,957 amino acid protein. A nucleic acid sequence encoding a sodium
channel of the present invention may also be obtained from a
mammalian genomic library, preferably a human or rat genomic
library. The nucleic acid sequence may be isolated by the
subtraction hybridization method described in the examples, by
screening with a probe derived from the rat sodium channel
sequence, or by other methodologies known in the art such as
polymerase chain reaction (PCR) with appropriate primers derived
from the rat sodium channel sequence and/or relatively conserved
regions of known voltage-gated sodium channels.
[0025] The nucleic acid sequences of the present invention may be
in the form of RNA or in the form of DNA, which DNA includes cDNA,
genomic DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the rat SNS sodium channel or variant thereof may be identical to
the coding sequences set forth herein or that of the deposited
clone, or may be a different coding sequence which coding sequence,
as a result of the redundancy or degeneracy of the genetic code,
encodes the same protein as the sequences set forth herein or the
deposited cDNA.
[0026] The nucleic acid sequence which encodes the SNS sodium
channel may include: only the coding sequence for the full length
protein or any variant thereof; the coding sequence for the full
length protein or any variant thereof and additional coding
sequence such as a leader or secretory sequence or a proprotein
sequence; the coding sequence for the full length protein or any
variant thereof (and optionally additional coding sequence) and
non-coding sequences, such as introns or non-coding sequences 5'
and/or 3' of the coding sequence for the full length protein.
[0027] The present invention further relates to variants of the
hereinabove described nucleic acid sequences which encode
fragments, analogs, derivatives or splice variants of the SNS
sodium channel. The variant of the SNS sodium channel may be a
naturally occurring allelic variant of the SNS sodium channel. As
known in the art, an allelic variant is an alternate form of a
protein sequence which may have a substitution, deletion or
addition of one or more nucleotides, which does not substantially
alter the function of the encoded protein. The present invention
relates to splice variants of the SNS sodium channel that occur
physiologically and which may play a role in changing the
activation threshold of the sodium channel.
[0028] Variants of the sequence coding for the rat SNS sodium
channel have been identified and are listed below:
[0029] 1) a 2573 base pair nucleic acid sequence shown in SEQ ID
NO:3. This sequence codes for a 521 amino acid protein that
corresponds to amino acids 1437-1957 of FIG. 1a (SEQ ID NO:1) and
has the same sequence as bases 4512 through 6524 of FIG. 1a in the
coding portion and 3' untranslated region.
[0030] 2) a 7052 base pair nucleic acid sequence shown in SEQ ID
NO: 5. SEQ ID NO:6 codes for a 2,132 amino acid protein that
contains a 176 amino acid repeat (amino acids 586-760 of SEQ ID
NO:6) inserted after amino acid 585 in FIG. 1a or SEQ ID NO:2.
[0031] A preferred sequence for the rat SNS sodium channel is shown
in FIG. 1a (SEQ ID NO: 1). However, sequencing variations have been
noted. Sequencing has provided
[0032] a 6,321 base pair nucleic acid sequence coding for a 1957
amino acid protein that has the same base sequence as bases 1-6321
of FIG. 1a or SEQ ID NO: 1 with the following changes: bases 1092 G
to A, base 1096 C to T, base 2986 G to T, base 3525 C to G and base
3556 G to C.
[0033] a 6,527 base pair nucleic acid sequence coding for a 1,957
amino acid protein as shown in SEQ ID NO:7 that has the same base
sequence as bases 1-6524 of FIG. 1a (SEQ ID NO:1) with an
additional 3 bases AAA, at the 3' end, and the following chances:
base 299 C to G, base 1092 G to A, base 1096 C to T, base 1964 G to
C, base 1965 C to G, base 2472 A to T, base 2986 G to T, base 3019
A to G, base 3158 C to T, base 3525 C to G, base 3556 G to C and
base 5893 T to G. The sequence of SEQ ID NO: 7 is also a preferred
sequence coding for the rat SNS sodium channel.
[0034] a 6524 base pair nucleic acid sequence that has the same
sequence as FIG. 1a (SEQ ID NO: 1) except for the following base
changes: base 1092 G to A (resulting in a change at amino acid 297
of SEQ ID NO: 2 from Val to Ile), base 1096 C to T (resulting in a
change at amino acid 298 from Ser to Phe), base 1498 C to A
(resulting in a change at amino acid 432 from Ala to Glu), and base
2986 G to T (resulting in a change at amino acid 928 form Ser to
Ile).
[0035] Sequence variability has been identified in different
isolates. One such seqeuence has been identified that has the
sequence of the third sequencing variation shown immediately above
except for eight base differences, five of which resulted in an
altered amino acid sequence F16-S16, L393-P393, T470-I470,
R278-H278, and I1,876-M1,876.
[0036] The present invention also relates to nucleic acid probes
constructed from the nucleic acid sequences of the invention or
portion thereof. Such probes could be utilized to screen a dorsal
root ganglia cDNA library to isolate a nucleic acid sequence
encoding the sodium channel of the present invention. The nucleic
acid probes can include portions of the nucleic acid sequence of
the SNS sodium channel or variant thereof useful for hybridizing
with mRNA or DNA for use in assays to detect expression of the SNS
sodium channel or localize its presence on a chromosome, such as
the in situ hybridization assay described herein.
[0037] A conservative analogue is a protein sequence which retains
substantially the same biological properties of the sodium channel
but differs in sequences by one or more conservative amino acid
substitutions. For the purposes of this document a conservative
amino acid substitution is a substitution whose probability of
occuring in nature is greater than ten times the probability of
that substitution occuring by chance (as defined by the
computational methods described by Dayhoff et al, Atlas of Proteins
Sequence and Structure, 1971, page 95-96 and FIG. 9-10).
[0038] A splice variant is a protein product of the same gene,
generated by alternative splicing of mRNA, that contains additions
or deletions within the coding region (Lewin B. (1995) Genes V
Oxford University Press, Oxford, England)
[0039] The nucleic acid sequences of the present invention may also
have the coding sequence fused in frame to a marker sequence which
allows for purification of the protein of the present invention
such as a hexa-histidine tag or a hemagglutinin (HA) tag.
[0040] The present invention further relates to nucleic acid
sequences which hybridize to the hereinabove-described sequences if
there is at least 50% and preferably 70% identity between the
sequences. The present invention particularly relates to nucleic
acid sequences which hybridize under stringent conditions to the
hereinabove-described nucleic acid sequences. As herein used, the
term "stringent conditions" means hybridization will occur only if
there is at least 95% and preferably at least 97% identity between
the sequences preferably the nucleic acid sequences which hybridize
to the hereinabove described nucleic acid sequences encode proteins
which retain substantially the same biological function or activity
as the SNS sodium channel, however, nucleic acid sequences that
have different properties are also within the scope of the present
invention. Such sequences, while hybridizing with the above
described nucleic acid sequences may encode a protein having
different properties, such as sensitivity to tetrodotoxin which
property is found in the altered SNS sodium channel protein
described herein.
[0041] In accordance with another aspect of the invention there is
provided purified mammalian sensory neuron sodium channel protein,
wherein the sodium channel is insensitive to tetrodotoxin.
Preferably the sodium channel of the invention is found in the
neurons of the dorsal root ganglia or cranial ganglia, more
preferably the neurons of the dorsal root ganglia. The sodium
channel protein may be derived from any mammalian species,
preferably the rat or human sodium channel protein. The rat SNS
sodium channel protein preferably has the deduced amino acid
sequence shown in FIG. 1a (SEQ ID NO:2) or SEQ ID NO: 8, or the
amino acid sequence encoded by the deposited cDNA. Fragments,
analogues, derivatives, and splice variants of the sodium channel
specifically located in sensory neurons are also within the scope
of the present invention.
[0042] The terms "fragment," "derivative" and "analogue" when
referring to the DRG sodium channel of the invention refers to a
protein which retains substantially the same biological function or
activity as such protein. Thus, an analogue includes a proprotein
which can be activated by cleavage of the proprotein portion to
produce an active mature protein. In addition, the present
invention also includes derivatives wherein the biological function
or activity of the protein is significantly altered, including
derivatives that are sensitive to tetrodotoxin.
[0043] The protein of the present invention may be a recombinant
protein, a natural protein or a synthetic protein, preferably a
recombinant protein.
[0044] The fragment, derivative or analog of the SNS sodium channel
protein includes, but is not limited to, (i) one in which one or
more of the amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituted group, or (iii)
one in which the mature polypeptide is fused with another compound,
such as a compound to increase the half-life of the protein (for
example, polyethylene glycol), or (iv) one in which the additional
amino acids are fused to the mature protein, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature protein or a proprotein sequence, or (v) one in which
one or more amino acids has/have been deleted so that the protein
is shorter than the full length protein. Variants of the rat SNS
sodium channel are discussed hereinabove and shown in SEQ ID NO:4
and SEQ ID NO:6.
[0045] The proteins and nucleic acid sequences of the present
invention are preferably provided in an isolated form, and
preferably are purified to at least 50% purity, more preferably
about 75% purity, most preferably about 90% purity.
[0046] The terms "isolated" and/or "purified" mean that the
material is removed from is original environment (e.g., the natural
environment if it is naturally occurring). For example, a
naturally-occurring nucleic acid sequence or protein present in a
living animal is not isolated or purified, but the same nucleic
acid sequence or DNA or protein, separated from some or all of the
coexisting materials in the natural system, is isolated or
purified. Such nucleic acid sequence could be part of a vector
and/or such nucleic acid sequence or protein could be part of a
composition, and still be isolated or purified in that such vector
or composition is not part of its natural environment.
[0047] The present invention also provides vectors comprising a
nucleic acid sequence of the present invention, and host cells
transformed or transfected with a nucleic of the invention.
[0048] The nucleic acid sequences of the present invention may be
employed for producing the SNS sodium channel protein or variant
thereof by recombinant techniques. Thus, for example, the nucleic
acid sequence may be included in any one of a variety of expression
vehicles or cloning vehicles, in particular vectors or plasmids for
expressing a protein. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences. Examples of suitable
vectors include derivatives of SV40; bacterial plasmids; phage DNA;
yeast plasmids; vectors derived from combinations of plasmids and
phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus,
pseudorabies and baculovirus. However, any other plasmid or vector
may be used as long as it is replicable and viable in the host.
[0049] More particularly, the present invention also provides
recombinant constructs comprising one or more of the nucleic acid
sequences as broadly described above. The constructs comprise an
expression vector, such as a plasmid or viral vector, into which a
sequence of the invention has been inserted, in a forward or
reverse orientation. In a preferred aspect of this embodiment, the
construct further comprises one or more regulatory sequences,
including, for example, a promoter, operably linked to the
sequence. Large numbers of suitable vectors and promoters are known
to those of skill in the art, and are commercially available. The
following vectors are provided by way of example. Bacterial: pQE70,
pQE60, pQE-9 (Qiagen) pBs, phagescript, psiX174, pBluescript SK,
pBsKS, pNH8a, pNH16a, pNH18a, pNH461 (Stratagene); pTrc99A,
pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLneo,
pSV2cat, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL
(Pharmacia) pcDNA 3.1 (Invitrogen, San Diego, Calif.), pEE14 (WO
87/04462) and pREP8 (Invitrogen). Preferred vectors include pcDNA
3.1, pEE14 and pREP8. However, any other plasmid or vector may be
used as long as it is replicable and viable in the host.
[0050] As hereinabove indicated, the appropriate DNA sequence may
be inserted into the vector by a variety of procedures. In general,
the DNA sequence is inserted into appropriate restriction
endonuclease sites by procedures known in the art. Such procedures
and others are deemed to be within the scope of those skilled in
the art.
[0051] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector may
contain a ribosome binding site for translation initiation and
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0052] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include LacI, LacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0053] Depending on the expression system employed in addition, the
expression vectors preferably contain a gene to provide a
phenotypic trait for selection of transformed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic cell
culture, or such as tetracycline or ampicillin resistance in E.
coli.
[0054] Transcription of DNA encoding the protein of the present
invention by higher eukaryotes can be increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp, that act on a
promoter to increase its transcription. Examples include the SV40
enhancer on the late side of the replication origin (bp 100 to
270), a cytomegalovirus early promoter enhancer, a polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers.
[0055] Useful expression vectors for bacterial use may be
constructed by inserting a structural DNA sequence encoding a
desired protein together with suitable translation initiation and
termination signals in operable reading phase with a functional
promoter. The vector will comprise one or more phenotypic
selectable markers and an origin of replication to ensure
maintenance of the vector and to, if desirable, provide
amplification within the host. Suitable prokaryotic hosts for
transformation include E. coli, Bacillus subtilis, Salmonella
typhimurium and various species within the genera Pseydomonas,
Streptomyces, and Staphylococcus, although others may also be
employed as a matter of choice.
[0056] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, PKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., U.S.A.).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0057] The sodium channel can be expressed in insect cells with the
baculovirus expression system which uses baculovirus such as
Autographa Californica nuclear polyhydrosis virus (AcNPV) to
produce large amounts of protein in insect cells such as the Sf9 or
21 clonal lines derived from Spodoptera frugiperda cells. See for
example O'Reilly et al., (1992) Baculovirus Expression Vectors: A
Laboratory Manual, Oxford University Press.
[0058] Mammalian expression vectors will comprise an origin of
replication, a suitable promoter and enhancer, and also any
necessary ribosome binding sites, polyadenylation site, splice
donor and acceptor sites, transcriptional termination sequences,
and 5' flanking nontranscribed sequences. DNA sequences derived
from the SV40 viral genome, for example, SV40 origin, early
promoter, enhancer, splice, and polyadenylation sites may be used
to provide the required nontranscribed genetic elements.
[0059] Mammalian expression vectors will comprise an origin of
replication, a suitable promoter and enhancer, and also any
necessary ribosome binding sites, polyadenylation site, splice
donor and acceptor sites, transcriptional termination sequences,
and 5' flanking nontranscribed sequences. DNA sequences derived
from the SV40 viral genome, for example, SV40 origin, early
promoter, enhancer, splice, and polyadenylation sites may be used
to provide the required nontranscribed genetic elements.
[0060] In a further embodiment, the present invention provides host
cells capable of expressing a nucleic acid sequence of the
invention. The host cell can be, for example, a higher eukaryotic
cell, such as a mammalian cell, a lower eukaryotic cell, such as a
yeast cell, a prokaryotic cell, such as a bacterial cell.
Introduction of the construct into the host cell may be effected by
calcium phosphate transfection, DEAE-Dextran mediated transfection,
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, 1986) or any other method known in the
art.
[0061] Host cells are genetically engineered (transduced,
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the SNS
sodium channel genes. The culture conditions, such as temperature,
pH and the like, are those previously used with the host cell
selected for expression, and will be apparent to the ordinarily
skilled artisan.
[0062] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein. As representative
examples of appropriate hosts, there may be mentioned: bacterial
cells, such as E. coli, and Salmonella typhimurium; Streptomyces;
fungal cells, such as yeast; insect cells such as Drosophila and
Spodoptera fugiperda Sf9; animal cells such as CHO, COS or Bowes
melanoma Ltk.sup.---and Y1 adrenal carcinoma; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art based on the teachings herein.
Preferred host cells include mammalian cell lines such as CHO-K 1,
COS-7; Y1 adrenal; carcinoma cells. More preferably, the host cells
are CHO-K1 cells. Preferred host cells for transient expresion of
the SNS sodium channel include Xenopus laevis oocytes.
[0063] The sodium channel may be transiently expressed in Xeropus
laevis oocytes. Cell-free translation systems can also be employed
to produce such proteins using RNAs derived from the DNA constructs
of the present invention. Appropriate cloning and expression
vectors for use with prokaryotic and eukaryotic hosts are described
in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989).
[0064] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, CHO-K1, HeLa, HEK 293, NIH 3 T3and BHK cell lines.
[0065] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the proteins of the invention can be
synthetically produced by conventional peptide synthesizers.
[0066] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0067] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well-known to those skilled in the art.
[0068] The SNS sodium channel protein is recovered and purified
from recombinant cell cultures by methods known in the art,
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, hydroxyapatite chromatography and lectin
chromatography. Protein refolding steps may be used, as necessary,
in completing configuration of the mature protein. Finally, high
performance liquid chromatography (HPLC) can be employed for final
purification steps.
[0069] The SNS sodium channel protein of the present invention may
be naturally purified products expressed from a high expressing
cell line, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture).
[0070] The present invention also provides antibodies specific for
the SNS sodium channel hereinabove defined. The term antibody as
used herein includes all immunoglobulins and fragments thereof
which contain recognition sites for antigenic determinants of
proteins of the present invention. The antibodies of the present
invention may be polyclonal or preferably monoclonal, may be intact
antibody molecules or fragments containing the active binding
region of the antibody, e.g. Fab or F(ab).sub.2 and can be produced
using techniques well established in the art [see e.g. R. A DeWeger
et al; Immunological Rev., 62 p29-45 (1982)].
[0071] The proteins, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present also
includes chimeric, single chain and humanized antibodies, as well
as Fab fragments, or the product of an Fab expression library.
Various procedures known in the art may be used for the production
of such antibodies and fragments.
[0072] Antibodies generated against the SNS sodium channel can be
obtained by direct injection of the polypeptide into an animal or
by administering the protein to an animal, preferably a nonhuman.
The antibody so obtained, will then bind the protein itself. In
this manner, even a sequence encoding only a fragment of the
protein can be used to generate antibodies binding the whole native
protein. Such antibodies can then be used to locate the protein in
tissue expressing that polypeptide. For preparation of monoclonal
antibodies, any technique which provides antibodies produced by
continuous cell line cultures can be used. Examples include the
hybridoma technique (Kohler and Milstein, 1975, Nature
256:495-497), the trioma technique, the human B-cell hybridoma
technique (Kozbor et al., 1983, Immunology Today 4:72), and the
EBV-hybridoma technique to produce human monoclonal antibodies
(Cole, 35 al., 1985, in Monoclonal Antibodies and Cancer Therapy,
Alan R. Liss., pp. 77-96).
[0073] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention.
[0074] The antibodies of the present invention may also be of
interest in purifying a protein of the present invention and
accordingly there is provided a method of purifying a protein of
the present invention as hereinabove defined or any portion thereof
or a metabolite or degration product thereof which method comprises
the use of an antibody of the present invention.
[0075] The purification method of the present invention may be
effected by any convenient technique known in the art for example
by providing the antibody on a support and contacting the antibody
with a solution containing the protein whereby the antibody binds
to the protein of the present invention. The protein may be
released from binding with the antibody by known methods for
example by changing the ionic strength of the solution in contact
with the complex of the protein/antibody.
[0076] The present invention also provides methods of identifying
modulators of the sodium channel which is specifically located in
sensory neurons comprising contacting a test compound with the
sodium channel and detecting the activity of the sodium channel.
Preferably, the methods of identifying modulators or screening
assays employ transformed host cells that express the sodium
channel. Typically, such assays will detect changes in the activity
of the sodium channel due to the test compound, thus identifying
modulators of the sodium channel. Modulators of the sodium channel
are useful in modulating the sensation of pain. Blockers of the
sodium channel will prevent the transmission of impulses along
sensory neurons and thereby be useful in the treatment of acute,
chronic or neuropathic pain.
[0077] The sodium channel can be used in a patch clamp or other
type of assay, such as the assays disclosed herein in the examples,
to identify small molecules, antibodies, peptides, proteins, or
other types of compounds that inhibit, block, or otherwise interact
with the sodium channel. Such modulators identified by the
screening assays can then be used for treatment of pain in
mammals.
[0078] For example, host cells expressing the SNS sodium channel
can be employed in ion flux assays such as .sup.22Na+ ion flux and
.sup.14C guanidinium ion assays, as described in the examples and
in the art, as well as the SFBI fluorescent sodium indicator assays
as described in Levi et al., (1994) J. Cardiovascular
Electrophysiology 5:241-257. Host cells expressing the SNS sodium
channel can also be employed in binding assays such as the
3H-batrachotoxin binding assay described in Sheldon et al., (1986)
Molecular Pharmacology 30:617-623; the 3H-saxitoxin assay as
described in Rogart et al (1983) Proc. Natl. Acad. Sci. USA
80:1106-1110; and the scorpion toxin assay described in West et
al., (1992) Neuron 8:59-70. Additionally, the host cells expressing
the SNS sodium channel can be used in electrophysiological assays
using patch clamp or two electrode techniques. In general, a test
compound is added to the assay and its effect on sodium flux is
determined or the test compound's ability to competitively bind to
the sodium channel is assessed. Test compounds having the desired
effect on the SNS sodium channel are then selected. Modulators so
selected can then be used for treating pain as described above.
[0079] Complementary strands of the nucleotide sequences as
hereinabove defined can be used in gene therapy, such as disclosed
in U.S. Pat. No. 5,399,346. For example, the cDNA sequence or
fragments thereof could be used in gene therapy strategies to down
regulate the sodium channel. Antisense technology can be used to
control gene expression through triple-helix formation or antisense
DNA or RNA, both of which methods are based on binding of a nucleic
acid sequence to DNA or RNA. For example, the 5' coding portion of
the nucleic acid sequence that encodes the sodium channel is used
to design an antisense RNA oligonucleotide of from about 10 to
about 40 base pairs in length. A DNA oligonucleotide is designed to
be complimentary to a region of the gene involved in transcription
(triple helix--see Lee et al., Nucl. Acids Res. 6:3073 (1979):
Cooney et al, Science 241:456 (1988); and Deruau et al., Science
251:1360 (1991)), thereby preventing transcription and the product
of the sodium channel. The antisense RNA oligonucleotide hybridizes
to the mRNA in vivo and blocks translation of the mRNA into the
sodium channel. Antisense oligonucleotides or an antisense
construct driven by a strong constituitive promoter expressed in
the target sensory neurons would be delivered either peripherally
or to the spinal cord.
[0080] The regulatory regions controlling expression of the sodium
channel gene could be used in gene therapy to control expression of
a therapeutic construct in cells expressing the sodium channel.
[0081] Such regions would be isolated by using the cDNA as a probe
to identify genomic clones carrying the gene and also flanking
sequence e.g. cosmids. Fragments of the cosmids containing intron
or flanking sequence would be used in a reporter gene assay in e.g.
DRG cultures or transgenic animals and genomic fragments carrying
e.g. promoter, enhancer or LCR activity identified.
[0082] The invention will now be further described with reference
to the following examples:
EXAMPLE 1
Derivation of the Sequence of a Rat Dorsal Root Ganglia (DRG)
Sodium Channel cDNA by Subtraction Hybridisation Methodology
[0083] 1.1 cDNA Synthesis from DRG-Derived Poly-A+ RNA
[0084] Dorsal root ganglia (DRG) from all spinal levels of neonatal
Sprague-Dawley male and female rats were frozen in liquid nitrogen.
RNA is extracted using guanidine isothiocyanate and
phenol/chloroform extraction (Chomczynski and Sacchi 1987 Anal
Biochem 162,156-159).
[0085] Total RNA isolation--the nerve tissue is homogenised using a
Polytron homogeniser in 1 ml extraction buffer (23.6 g guanidinium
isothiocyanate, 5 ml of 250 mM sodium citrate (pH 7.0) made up to
50 ml with distilled water. To this is added 2.5 ml 10% sarcosyl
and 0.36 ml .beta.-mercaptoethanol). 0.1 ml of 2M sodium acetate
(pH 4.0) is added followed by 1 ml phenol. After mixing, 0.2 ml
chloroform is added and this is shaken vigorously and placed on ice
for 5 minutes. This is then centrifuged at 12,000 revolutions per
minute (rpm) for 30 minutes at 4.degree. C. The aqueous phase is
transferred to a fresh tube, 1 ml of isopropanol is added and this
is left at -20.degree. C. for an hour followed by centrifuging at
12000 rpm for 30 minutes at 4.degree. C. The pellet is dissolved in
0.1 ml extraction buffer and is again extracted with isopropanol.
The resulting pellet is washed with 70% ethanol and is resuspended
in diethyl pyrocarbonate (DEPC)-treated water, 0.3M sodium acetate
(pH 5.2) and 2 volumes of ethanol are added and the mixture is
placed at -20.degree. C. for 1 hour. The RNA is precipitated,
washed again with 70% ethanol and resuspended in DEPC-treated
water. The optical density is measured at 260 nanometres (nm) to
calculate the yield of total RNA. Poly A+ RNA is isolated from the
total RNA by oligo-dT cellulose chromatography (Aviv and Leder 1972
Proc Natl Acad Sci 69, 1408-1411). The following procedures are
carried out at 4.degree. C. as far as is possible. Oligo-dT
cellulose (Sigma) is prepared by treatment with 0.1M sodium
hydroxide for 5 minutes. The oligo-dT resin is poured into a column
and is neutralised by washing with neutralising buffer (0.5 M
potassium chloride, 0.01M Tris (Trizma
base-Sigma-Tris(hydroxymethyl)am- inomethane) (pH 7.5). The RNA
solution is adjusted to 0.5M potassium chloride, 0.01M Tris (pH
7.5) and is applied to the top of the column. The first column
eluate is re-applied to the column to ensure sticking of the mRNA
to the oligo-dT in the column. The column is then washed with 70 ml
of neutralising buffer and the polyA+ RNA is eluted with 6 ml 0.01M
Tris (pH 7.5) and 1 ml fractions are collected. The poly A+ RNA is
usually in fractions 2 to 5 and this is checked by measuring the
optical density at 260 nm. These fractions are pooled and ethanol
precipitated overnight at -70.degree. C., washed in 70% ethanol and
then redissolved in deionised water at a concentration of 1
mg/ml.
[0086] First strand cDNA was generated using 0.5 mg DRG poly A+
mRNA, oligo-dT/Not-I primer adapters and SuperScript reverse
transcriptase (Gibco-BRL) using methodology as described in example
2. One half of the cDNA was labelled by including 2 MBq .sup.32P
dCTP (Amersham) in the reverse transcriptase reaction. Labelled
cDNA is separated from unincorporated nucleotides on Nick columns
(Sephadex G50-Pharmacia).
[0087] 1.2 Enrichment of DRG-Specific cDNA Using Subtraction
Hybridisation.
[0088] Poly A+ RNA from various tissues (10 .mu.g) is incubated
with 10 .mu.g photoactivatable biotin (Clontech) in a total volume
of 15 .mu.l and irradiated at 4.degree. C. for 30 minutes with a
250 watt sunlamp. The photobiotin is removed by extraction with
butanol, and the cDNA co-precipitated with the biotinylated RNA
without carrier RNA (Sive and St. John 1988 Nuc Ac Res 16,
10937).
[0089] Hybridisation is carried out at 58.degree. C. for 40 hours
in 20% formamide, 50 mM 3-(N-morpholino)propanesulphonic acid
(MOPS) (pH 7.6), 0.2% sodium dodecyl sulphate (SDS), 0.5M sodium
chloride, 5 mM ethylenediaminetetraacetate (EDTA-Sigma). The total
reaction volume is 5 .mu.l and the reaction is carried out under
mineral oil, after an initial denaturation step of 2 minutes at
95.degree. C. 100 .mu.l 50 mM MOPS (pH 7.4), 0.5M sodium chloride,
5 mM EDTA containing 20 units of streptavidin (BRL) is then added
to the reaction mixture at room temperature, and the aqueous phase
retained after two phenol/chloroform extraction steps. After
sequential hybridisation of the cDNA from Example 1.1 with
biotinylated mRNA from liver and kidney, followed by cortex and
cerebellum, a 80-fold concentration of DRG-specific transcripts is
achieved.
[0090] One third of the 1-2 ng of residual cDNA is then G-tailed
with terminal deoxynucleotide transferase at 37.degree. C. for 30
minutes. The polymerase chain reaction is used to amplify the cDNA
using an oligo-dT-Not-I primer adapter and oligo-dC primers
starting with the sequence AATTCCGA(C).sub.10. Amplification is
carried out using 2 cycles of 95.degree. C. for 1 min, 45.degree.
C. for 1 min, 72.degree. C. for 5 min, followed by 2 cycles of
95.degree. C. for 1 minute, 58.degree. C. for 1 minute and
72.degree. C. for 5 minutes. The resulting products are then
separated on a 2% Nu-sieve agarose gel, and material running at a
size of greater than 0.5 kilobase pairs (kb) is eluted and further
amplified with 6 cycles of 95.degree. C. for 1 minute, 58.degree.
C. for 1 minute and 72.degree. C. for 5 minutes. This material is
further separated on a 2% Nu-sieve agarose gel, and the material
running from 6 kb on the gel is eluted and further amplified using
the same PCR conditions for 27 cycles. The amplified DNA derived
from this high molecular weight region is then further fractionated
on a 2% Nu-Sieve gel, and cDNA from 0.5 to 1.5 kb, and from 1.5 to
5 kb pooled.
[0091] 1.3. Library Construction
[0092] 10 .mu.g of the bacteriophage vector lambda-zap II
(Stratagene) is restriction digested with NotI and EcoRI in high
salt buffer overnight at 37.degree. C. followed by
dephosphorylation using 1 unit of calf intestinal phosphatase
(Promeca) for 30 minutes at 37.degree. C. in 10 mM TRIS.HCl (pH
9.5), 1 mM spermidine, 0.1 mM EDTA. DRG cDNA is digested with
Klenow enzyme in the presence of dGTP and dCTP to construct an
EcoRI site from the oligo-dC primer (see above) at the 5' end of
the cDNA, and cut with NotI for directional cloning. The cDNA is
ligated into the cloning vector bacteriophage lambda-zap II for 16
hours at 12.degree. C. Recombinant phage DNA is then packaged into
infective phage using Gigapack gold (Stratagene) and protocols
specified by the suppliers. 0.1% of the packaged DNA is used to
infect E. coli BB4 cells which are plated out to calculate the
number of independent clones generated.
[0093] 1.4 Differential Screening
[0094] The library is plated at a low density (10.sup.3
clones/12.times.12 cm.sup.2 dish) and screened using three sets of
.sup.32P-labelled cDNA probes and multiple filter lifts. Replica
filters are made by laying them onto the plated library plates,
briefly drying them and then laying onto fresh agar plates to
increase the quantity of phage and the subsequent hybridisation
signals of lifts taken from them. The probes are derived from: a)
cortex and cerebellum poly (A)+ RNA, b) DRG poly (A)+ RNA, and c)
subtracted cDNA from DRG. The two mRNA probes are labelled with
.sup.32P dCTP using a reaction mixture containing 2-5 .mu.g RNA, 50
.mu.l 5.times.RT buffer, 25 .mu.l 0.1M dithiothreitol (DTT), 12.5
.mu.l 10 mM dATP, dGTP, dCTP, 30 pM oligo-dT, 75 .mu.l
.sup.32P-dCTP (30MBq; Amersham), 25 .mu.l 100 .mu.M dCTP, 2 .mu.l
RNasin (2 units/.mu.l) and 2 .mu.l SuperScript reverse
transcriptase (GibcoBRL) in a final volume of 250 .mu.l. The
reaction is incubated at 39.degree. C. for 60 minutes, and the RNA
subsequently destroyed by adding 250 .mu.l water, 55 .mu.l 1M NaOH,
and incubating at 70.degree. C. for 20 minutes. The reaction
mixture is neutralised with acidified Tris base (pH 2.0) and
precipitated with carrier tRNA (Boehringer) with isopropanol. The
subtracted and amplified double-stranded DRG cDNA is random-prime
labelled with .sup.32P dATP (Gibco multiprime kit). Replica filters
are then prehybridised for 4 hours at 68.degree. C. in
hybridisation buffer. Hybridisation was carried out for 20 hours at
68.degree. C. in 4.times.SSC (20.times.SSC consists of 175.3 g of
sodium chloride and 88.2 g of sodium citrate in 800 ml of distilled
water. The pH is adjusted to 7.0 with 10 N sodium hydroxide and
this is made to 1 literwith distilled water), 5.times. Denhardts
solution containing 150 .mu.g/ml salmon sperm DNA, 20 .mu.g/ml
poly-U, 20 .mu.g/ml poly-C, 0.5% SDS (Sigma), 5 mM EDTA. The
filters are briefly washed in 2.times.SSC at room temperature, then
twice with 2.times.SSC with 0.5% SDS at 68.degree. C. for 15
minutes, followed by a 20 minute wash in 0.5% SDS, 0.2.times.SSC at
68.degree. C. The filters are autoradiographed for up to 1 week on
Kodak X-omat film. Plaques that hybridise with DRG probes but not
cortex and cerebellum probes are picked, phage DNA prepared and the
cloned inserts released for subcloning into pBluescript
(Stratagene).
[0095] The positive plaques are picked by lining up the
autoradiogram with the plate using orientation marks and taking a
plug from the plate corresponding to the positive hybridisation
signal. The phage is eluted from the plug in 0.5 ml phage dilution
buffer (10 mM Tris chloride (pH 7.5) 10 mM magnesium sulphate) and
the phage re-infected into E. coli BB4 and replated at a density of
200 to 1000 plaques/150 mm plate as a secondary purification step
to ensure purity of the clones. The positive secondaries are then
picked as described previously. In order to sub-clone the insert
DNA from the positive recombinant phage, they need to be amplified.
This is accomplished by plate lysis where the phage totally lyse
the E. coli BB4. 0.2 ml of phage suspension is mixed with 0.1 ml of
an overnight culture of E. coli. This is added to 2.5 ml of top
agar (16 g bacto-tryptone 10 g bacto-yeast extract, 5 g sodium
chloride, 7 g bacto-agar in 900 mls distilled water) and plated
onto 9 cm.sup.2 agar plates. These are incubated overnight at
37.degree. C. 5 ml of phage dilution buffer is then added to the
plates and is incubated overnight at 4.degree. C. or for 4 hours
with gentle scraping at room temperature. The phage-containing
buffer is then recovered, 0.1 ml chloroform is added and this phage
stock is titrated as above and stored at 4.degree. C. Phage DNA is
prepared by first infecting 10.sup.10 E. Coli B44 with 10.sup.9
plaque forming units (pfus) of phage in 3 ml of phage dilution
buffer and shaking at 37.degree. C. for 20 minutes. The infected
bacteria are added to 400 ml of L broth (1.6% bactotryptone, 0.5%
(w/v) Bacto yeast extract, 0.5% (w/v) magnesium sulphate) with
vigorous shaking at 37.degree. C. for 9 hours. When lysis has
occurred, 10 ml of chloroform is added and shaking is continued for
a further 30 minutes. The culture is then cooled to room
temperature and pancreatic RNAase and DNAase are added to 1 ug/ml
for 40 minutes. Sodium chloride is then added to 1M and is
dissolved by swirling on ice. After centrifuging at 8000 rpm for 10
minutes the supernatant is recovered. Polyethylene glycol (PEG
6000) is added to 10% w/v and is dissolved by stirring whilst on
ice for 2 hours. After centrifuging for 8000 rpm for 10 minutes at
4.degree. C. the pellet is resuspended in 8 ml of phage dilution
buffer. This is extracted with an equal volume of phenol/chloroform
followed by purification on a caesium chloride gradient (0.6752
g/ml caesium chloride--24 hours at 38000 rpm at 4.degree. C.). The
opaque phage band is removed from the centrifugation tube and
dialysed against 10 mM sodium chloride, 50 mM Tris (pH 8.0). 10 mM
magnesium chloride for 2 hours. EDTA is then added to 20 mM,
proteinase K to 50 .mu.g/ml and SDS to 0.5% and is incubated at
65.degree. C. for 1 hour. After dialysis overnight against TE pure
phage DNA results. The cloned insert is digested from the purified
phage DNA using restriction enzymes as previously described. Each
phage insert is then ligated into a plasmid vector e.g.
pBluescript--Clontech using a ligation reaction as previously
described.
[0096] Clone Characterisation.
[0097] The plasmids are cross hybridised with each other. Unique
clones are further analysed by Northern blotting and sequencing.
The clone/s showing transcript sizes and sequence comparable with
sodium channels are then used as hybridisation probes to screen a
neonatal rat DRG oligo dT-primed full length cDNA library to derive
full length cDNA clones using methodology as described above and in
example 2. Biological activity of the rat DRG sodium channel is
confirmed as in examples 4 and 7 below.
EXAMPLE 2
Homology Cloning of the Human cDNA Homologous to the Rat DRG Sodium
Channel cDNA (SNS-B).
[0098] 2.1. Isolation of Human Ganglia Total RNA
[0099] The starting material for the derivation of the human cDNA
homologue of the rat DRG sodium channel cDNA is isolated human
dorsal root ganglia or trigeminal ganglia or other cranial ganglia
from post-mortem human material or foetuses. Total ribonucleic acid
(RNA) is isolated from the human neural tissue by extraction in
guanidinium isothiocyanate (Chomczynski and Sacchi 1987 Anal
Biochem 162,156-159) as described in example 1.
[0100] 2.2 Determination of the Transcript Size of the Human
Homologue of the Rat DRG Sodium Channel cDNA (SNS-B).
[0101] Human dorsal root ganglia total RNA is electrophoretically
separated in a 1% (w/v) agarose gel containing a suitable
denaturing agent e.g. formaldehyde (Lehrach et al 1977 Biochemistry
16, 4743: Goldberg 1980 Proc Natl Acad Sci 77, 5794; Seed 1982 in
Genetic engineering: principles and methods (ed J K Setlow and A
Hollaender) vol 4 p91 Plenum Publishing New York) or glyoxal/DMSO
(McMaster G K and Carmichael G G 1977 Proc Natl Acad Sci 74, 4835),
followed by transfer of the RNA to a suitable membrane (e.g.
nitrocellulose). The immobilised RNA is then hybridised to
radioactive (or other suitable detection label) probes consisting
of portions of the rat sodium channel cDNA sequence (see below).
After washing of the membrane to remove non-hybridised probe, the
hybridised probe is visualised using a suitable detection system
(e.g. autoradiography for .sup.32P labelled probes) thus revealing
the size of the human homologous mRNA molecule. Specifically, 20-30
.mu.g total RNA from neonatal rat tissues are separated on 1.2%
agarose-formaldehyde gels, and capillary blotted onto Hybond-N
(Amersham) (Ninkina et al. 1993 Nuc Ac Res 21, 3175-3182). The
amounts of RNA on the blot are roughly equivalent, as judged by
ethidium bromide staining of ribosomal RNA or by hybridisation with
the ubiquitously expressed L-27 ribosomal protein transcripts (Le
Beau et al. 1991 Nuc Ac Res 19, 1337). Each Northern blot contains
human DRG, cortex, cerebellum, liver kidney, spleen and heart RNA.
Probes (50 ng) are labelled with .sup.32P-dATP (Amersham) by random
priming. Filters are prehybridised in 50% formaldehyde 5.times.SSC
containing 0.5% SDS, 5.times. Denhardts solution (50.times.
Denhardts contains 5 g of Ficoll (Type 400, Pharmacia), 5 g of
polyvinylpyrrolidone, 5 g of bovine serum albumin (Fraction V,
Sigma) and water to 500 ml), 100 .mu.g/ml boiled salmon sperm DNA,
10 .mu.g/ml poly-U and 10 .mu.g/ml poly-C at 45.degree. C. for 6
hours. After 36 hours hybridisation in the same conditions, the
filters are briefly washed in 2.times.SSC at room temperature, then
twice with 2.times.SSC with 0.5% SDS at 68.degree. C. for 15
minutes, followed by a 20 minute wash in 0.5% SDS, 0.2.times.SSC at
68.degree. C. The filters are autoradiographed for up to 1 week on
Kodak X-omat film. The transcript size is calculated from the
signal from the gel in comparison with gel molecular weight
standard markers.
[0102] 2.3 Production of a Human DRG cDNA Library
[0103] In order to produce a representative cDNA library from the
human dorsal root ganglia messenger RNA (poly A+ mRNA) is first
isolated from the total RNA pool using oligo-dT cellulose
chromatography (Aviv and Leder 1972 Proc Natl Acad Sci 69,
1408-1411) using methodology described in example 1. Synthesis of
the first strand of cDNA from the polyA+ RNA uses the enzyme
RNA-dependent DNA polymerase (reverse transcriptase) to catalyse
the reaction. The most commonly used method of second strand cDNA
synthesis uses the product of first strand synthesis, a cDNA:mRNA
hybrid, as a template for priming the second strand synthesis.
(Gubler and Hoffman 1983 Gene 25, 263)).
[0104] 2.3.1. First Strand cDNA Synthesis
[0105] 20 .mu.g of human DRG polyA+ RNA is pre-treated to destroy
secondary structure which may inhibit first strand cDNA synthesis.
20 .mu.g of polyA+ RNA, 1 .mu.l 1M Tris (pH 7.5) are made up to a
volume of 100 .mu.l with distilled water. This is incubated at
90.degree. C. for 2 minutes followed by cooling on ice. 4.8 .mu.l
of 100 mM methyl mercury is then added for 10 minutes at room
temperature. 10 .mu.l of 0.7M .beta.-mercaptoethanol and 100 units
of human placental RNAase inhibitor are then added for 5 minutes at
room temperature. The first strand synthesis reaction consists of 8
.mu.l 20 mM dATP, 5.mu.l 20 mM dCTP, 8 .mu.l 20 mM dGTP 8 .mu.l 20
mM dTTP, 10 .mu.l 1 mg/ml oligo-dT (12-18), 20 .mu.l 1M Tris (pH
8.3) (at 45.degree. C.), 8 .mu.l 3M potassium chloride, 3.3 .mu.l
0.5M magnesium chloride, 3.mu.l a.sup.32P dCTP, 100 units
Superscript II reverse transcriptase (GibcoBRL) made up to 200
.mu.l with distilled water. This reaction mixture is incubated at
45.degree. C. for 45 minutes after which another 50 units of
Superscript reverse transcriptase is added and incubated for a
further 30 minutes at 45.degree. C. EDTA is then added to 10 mM to
terminate the reaction and a phenol/chloroform extraction is
carried out. The DNA is then precipitated using ammonium acetate
(freezing in dry ice/ethanol before centrifuging), washed with 70%
ethanol and resuspended in 50 ml distilled water. The size of the
single stranded DNA is assessed by electrophoretically separating
it out on an agarose gel (1% w/v) and autoradiographing the result
against markers.
[0106] 2.3.2 Second Strand Synthesis
[0107] The second strand synthesis reaction mixture consists of 0.5
.mu.g human DRG single stranded DNA, 2 .mu.l 1M Tris (pH 7.5), 1
.mu.l 0.5M magnesium chloride, 3.33 .mu.l 3M potassium chloride, 2
.mu.l 0.5M ammonium sulphate, 1.5 .mu.l 10 mM .beta.nicotinamide
adenine dinucleotide (NAD), 4 .mu.l of each of the 1 mM dNTPs, 5
.mu.l 1 m/ml bovine serum albumin (BSA), 1 unit RNAase-H, 25 units
Klenow polymerase all made up to 100 .mu.l with distilled water.
This is incubated at 12.degree. C. for 1 hour and then at
20.degree. C. for 1 hour. The reaction is stopped by addition of
EDTA to 20 mM followed by a phenol/chloroform extraction. The DNA
is ethanol precipitated (-70.degree. C. overnight) and is then
washed with 70% ethanol followed by resuspension in 20 .mu.l
distilled water. Size is checked by gel electrophoresis and
autoradiography.
[0108] 2.3.3 Double Stranded cDNA End Repair
[0109] In order to add linkers to the end of the cDNA molecules for
subsequent cloning, the ends must first be repaired. The human DRG
cDNA is treated with 500 units/ml of S1 nuclease in 0.25M sodium
chloride, 1 mM zinc sulphate, 50 mM sodium acetate (pH 4.5).
Incubation is at 30.degree. C. for 40 minutes followed by
neutralisation with Tris (pH 8.0) to 0.2M. The DNA is again ethanol
precipitated, washed in 70% ethanol and resuspended in 20 .mu.l
distilled water. The size is again checked to ensure that S1
nuclease digestion has not radically reduced the average DNA
fragment size. The repair reaction consists of 19 .mu.l cDNA, 3
.mu.l 10.times. T4 polymerase buffer (0.33M Tris acetate (pH 7.9),
0.66M potassium acetate, 0.1M magnesium acetate, 1 mg/ml BSA and 5
mM DTT), 2 .mu.l of each dNTP at 2 mM, 2 .mu.l T4 polymerase and 4
.mu.l distilled water. This is incubated at 37.degree. C. for 30
minutes followed by addition of 1 .mu.l Klenow polymerase for 1
hour at room temperature. The DNA is then ethanol precipitated,
washed in 70% ethanol and resuspended in 5 .mu.l distilled water.
In order to protect naturally occurring restriction sites within
the cDNA from being cleaved, the cDNA is treated with a methylase
before the addition of linkers. The reaction mixture consists of 5
.mu.l human DRG double stranded DNA, 1 .mu.S-adenosylmethionine, 2
.mu.l 1 mg/ml BSA, 2 .mu.l 5.times. methylase buffer (0.5M Tris (pH
8.0), 5 mM EDTA), 0.2 .mu.l EcoRI methylase (NEB). This is
incubated at 37.degree. C. for 20 minutes followed by phenol
extraction, ethanol precipitation washing with 70% ethanol and
resuspension in 20 .mu.l distilled water.
[0110] 2.3.4. Addition of Linkers to cDNA
[0111] EcoRI linkers are ligated to the cDNA molecules to
facilitate cloning into lambda vectors. The ligation reaction
mixture consists of 1 .mu.l 10.times. ligation buffer (0.5M Tris
chloride (pH 7.5), 0.1M magnesium chloride and 0.05M DTT), 1 .mu.l
10 mM ATP, 100 ng cDNA, 5 .mu.g EcoRI linkers, 1 unit T4 DNA
ligase, distilled water to 10 .mu.l. The reaction is incubated at
37.degree. C. for 1 hour, followed by addition of 6 more units of
T4 ligase and a further incubation overnight at 15.degree. C. The
ligated samples are ethanol precipitated, washed in 70% ethanol and
resuspended in 10 .mu.l distilled water. The cDNA is then digested
with EcoRI to cleave any linker concatamers formed in the ligation
process. This restriction digestion reaction contains 10 .mu.l
cDNA, 2 .mu.l high salt buffer (10 mM magnesium chloride, 50 mM
Tris chloride (pH 7.5), 1 mM DTT, 100 mM sodium chloride), 2 .mu.l
EcoRI (10 units/.mu.l-NEB) and distilled water to 20 .mu.l. The
digestion is carried out for 3 hours. The ligation and digestion
steps are monitored using gel elecrophoresis to monitor the size of
the products.
[0112] 2.3.5 Size Fractionation of cDNA
[0113] In order to assure that the library is not swamped with
short cDNA molecules and to remove linker molecules a column
purification is carried out. A 1 ml Sepharose 4B column is made in
a 1 ml plastic pipette plugged with a small piece of glass wool.
This is equilibrated with 0.1M sodium chloride in TE. The cDNA is
loaded onto the column and 1 drop fractions are collected. 2 .mu.l
aliquots of each fraction are analysed by gel electrophoresis and
autoradiography to determine the sizes of the cDNA in each
fraction. Fractions containing cDNA of about 800 base pairs and
above are pooled and purified by ethanol precipitation and
resuspending in 10 .mu.l distilled water.
[0114] 2.3.6 Cloning of cDNA into Bacteriophage Vector
[0115] Bacteriophage vectors designed for the cloning and
propagation of cDNA are provided ready-digested with EcoRI and with
phosphatased ends from commercial sources (e.g. lambda gt10 from
Stratagene). The prepared subtracted cDNA is ligated into lambda
gt10 using a ligation rection consisting of ligase buffer and T4
DNA ligase (New England Biolabs) as described elsewhere in this
document.
[0116] 2.4 Labelling of cDNA Fragments (Probes) for Library
Screening
[0117] The 3' untranslated region of the rat DRG sodium channel
cDNA clone (SNS-B) is subcloned using appropriate restriction
enzymes into a plasmid vector e.g. pBluescript--Stratagene. The
cDNA insert which is to form the labelled probe is released from
the vector via digestion with appropriate restriction enzymes and
the insert is separated from the vector via electrophoresis in a 1%
(w/v) agarose gel. After removal of the separated insert from the
agarose gel and purification it is labelled by standard techniques
such as random priming and polymerisation (Feinberg and Vogelstein
1983 Anal Biochem 132, 6) or nick translation (Rigby et al 1977 J
Mol Biol 113, 237) with .sup.32P or DIG-labelled nucleotides.
Alternatively, if the probe cDNA insert is cloned into a vector
containing strong bacteriophage promoters to which DNA-dependant
RNA polymerases bind (SP6, T3 or T7 polymerases), synthetic cRNA is
produced by in vitro transcription which incorporates .sup.32P or
digoxygenin nucleotides. Other regions of the rat DRG sodium
channel cDNA can also be used as probes in a similar fashion for
cDNA library screening or Northern blot analysis. Specifically, a
probe is made using a kit such as the Pharmacia oligo labelling
kit. This will radioactively label the rat DRG sodium channel cDNA
fragment. 50 ng of denatured DNA (place in boiling waterbath for 5
minutes), 3 .mu.l of .sup.32PdCTP (Amersham) and 10 .mu.l reagent
mix is made up to 49 .mu.l with distilled water. 1 .mu.l of Klenow
fragment is added and the mixture is incubated at 37.degree. C. for
one hour. To remove unincorporated nucleotides, the reaction
mixture is applied to a Nick column (Sephadex G50--Pharmacia)
followed by 400 .mu.l of TE (10 mM Tris chloride (pH 7.4) 1 mM EDTA
(pH 8.0)). Another 400 .mu.l of TE is added and the eluate is
collected. This contains the labelled DNA to be used as a
hybridisation probe.
[0118] 2.5 cDNA Library Screening
[0119] In order to detect recombinants containing human homologues
of the rat DRG sodium channel the human DRG cDNA library is
screened using moderate stringency hybridisation washes
(50-60.degree. C., 5.times.SSC, 30 minutes), using radiolabelled or
other labelled DNA or cRNA probes derived from the 3' untranslated
region as described above. Libraries are screened using standard
methodologies involving the production of nitrocellulose or nylon
membrane replicas of DNA from recombinant plaques formed on agar
plates (Benton et al 1977 Science 196; 180). These are then
hybridised to single stranded nucleic acid probes (see above).
Moderate stringency washes are carried out (see wash conditions for
Northern analysis in section 2.2). Plaques which are positive on
duplicate filters (i.e. not artefacts or background) are then
purified by one or more rounds of replating after dilution to
separate the colonies and further hybridisation screening.
Resulting positive plaques are purified, DNA is extracted and the
insert sizes of these clones is examined. The clones are
cross-hybridised to each other using standard techniques (Sambrook
et al 1989 Molecular Cloning Second Edition Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.) and distinct positive
clones identified. Detailed protocols for cDNA library screening
are given in example 1.
[0120] 2.6 Derivation of a Full-Length Clone of the Human Homologue
of the Rat DRG Sodium Channel cDNA
[0121] Overlapping positive clones from above are identified by
cross-hybridisation. They are then restriction mapped to identify
their common portions and restriction fragments representing the
separate portions from the overlapping clones are ligated together
using standard cloning techniques (Sambrook et al 1989 Molecular
Cloning Second Edition Cold Spring Harbor Laboratory Press). For
example, the most 5' fragment will contain any 5' untranslated
sequence, the start codon ATG and 5' coding sequence. The most 3'
clone will contain the most 3' coding sequence, a stop codon and
any 3' untranslated sequence, a poly A consensus sequence and
possibly a poly A run. Thus a recombinant molecule is generated
which contains the full cDNA sequence of the human homologue of the
rat DRG sodium channel cDNA. If overlapping clones do not produce
sufficient fragments to assemble a full length cDNA clone, the full
length oligo dT-primed human DRG library is re-screened to isolate
a full length clone. Alternatively, a full length clone is derived
directly from the library screening.
[0122] 2.7 Characterisation of the Human Homologue Full-Length
Clone
[0123] The cDNA sequence from the full-length clone is used as a
probe in Northern blot analysis to detect the messenger RNA size in
human tissue for comparison with the rat messenger RNA size (see
sections 1.1 and 2.2 for methodology).
[0124] Confirmation of biological activity of the cloned cDNA is
carried out via in vitro translation of the human sodium channel
mRNA and its expression in Xenopus oocytes in an analogous manner
to that for the rat DRG-specific TTXi resistant sodium channel as
described in examples 4 and 7.
[0125] cDNA sequences which are shown to have activity as defined
above are completely sequenced using dideoxy-mediated chain
termination sequencing protocols (Sanger et al 1977 Proc Natl Acad
Sci 74, 5463).
EXAMPLE 3
Polymerase Chain Reaction (PCR) Approaches to Clone the Human DRG
Sodium Channels Using DNA Sequence Derived from the Rat DRG Sodium
Channel cDNA Clone
[0126] Total RNA and poly A+ RNA is isolated from human dorsal root
ganglia or trigeminal ganglia or other cranial ganglia from
post-mortem human material or foetuses as described in example 2
above.
[0127] Random primers are hybridised to the RNA followed by
polymerisation with MMLV reverse transcriptase to generate single
stranded cDNA from the extracted human RNA.
[0128] Using degenerate PCR primers derived from relatively
conserved regions of the known voltage-gated sodium channels (FIG.
2), amplify the cDNA using the polymerase chain reaction (Saiki et
al 1985 Science 230, 1350). It is appreciated by those skilled in
the art that there are many variables which can be manipulated in a
PCR reaction to derive the homologous sequences required. These
include but are not limited to varying cycle and step temperatures,
cycle and step times, number of cycles, thermostable polymerase,
Mg2+ concentration. It is also appreciated that greater specificity
can be gained by a second round of amplification utilising one or
more nested primers derived from further conserved sequence from
the sodium channels.
[0129] Specifically, the above can be accomplished in the following
manner. The first strand cDNA reaction consists of 1 .mu.g of total
RNA made up to 13 .mu.l with DEPC-treated water and 1 .mu.l of 0.5
.mu.g/.mu.l oligo(dT). This is heated to 70.degree. C. for 10
minutes and then incubated on ice for 1 minute. The following is
then added: 2 .mu.l of 10.times. synthesis buffer (200 mM Tris
chloride, 500 mM potassium chloride, 25 mM magnesium chloride, 1
.mu.g/ml BSA), 2 .mu.l of 0.1M DTT, 1 .mu.l of 200U/.mu.l
Superscript Reverse Transcriptase (Gibco BRL). This is incubated at
room temperature for 10 minutes then at 42.degree. C. for 50
minutes. The reaction is then terminated by incubating for 15
minutes at 70.degree. C. 1 .mu.l of E. coli RNase H (2 U/.mu.l) is
added to the tube which is then incubated for 20 minutes at
37.degree. C.
[0130] The PCR reaction is set up in a 0.5 ml thin-walled Eppendorf
tube. The following reagents are added: 10 .mu.l 10.times. PCR
buffer, 1 .mu.l cDNA, 16 .mu.l dNTP's (25 .mu.l of 100 .mu.M dATP,
dCTP, dCTP and dGTP into 900 .mu.l sterile distilled water), 7
.mu.l of 25 mM magnesium chloride, 1 .mu.l of Taq DNA polymerase
(Amplitaq Perkin-Elmer)plus sterile distilled water to 94
.mu.l.
[0131] To each reaction tube a wax PCR bead is added (Perkin-Elmer)
and the tube placed in a 70.degree. C. hot block for 1 minute. The
tubes are allowed to cool until the wax sets and 3 .mu.l of each
primer (33 pM/.mu.l ) are added above the wax. The tubes are placed
in a thermal cycler (Perkin-Elmer) and the following 3-step program
used after an initial 94.degree. C. for 5 minutes; 92.degree. C.
for 2 minutes, 55.degree. C. for 2 minutes, 72.degree. C. for 2
minutes for 35 cycles. A final polymerisation step is added at
72.degree. C. for 10 minutes. The reaction products are then run on
a 1% agarose gel to assess the size of the products. In addition,
control reactions are performed alongside the samples. These should
be: 1) all components without cDNA (negative control) and 2) all
reaction components with primers for constitutively expressed
product e.g. .alpha.-actin or HPRT.
[0132] The products of the PCR reactions are examined on 0.8%-1.2%
(w/v) agarose gels. Bands on the gel (visualised by staining with
ethidium bromide and viewing under UV light) representing
amplification products of the approximate predicted size were then
cut from the gel and the DNA purified. Further bands of interest
are also identified by Southern blot analysis of the amplification
products and probing of the resulting filters with labelled primers
from further conserved regions e.g. those used for secondary
amplification.
[0133] The resulting DNA is ligated into suitable vectors such as,
but not limited to, pCR II (Invitrogen) or pGemT. Clones are then
sequenced to identify those containing sequence with similarity to
the rat DRG sodium channel sequence (SNS-B).
[0134] Clone Analysis
[0135] Candidate clones from above are used to screen a human cDNA
DRG library constructed using methods described in example 2. If a
full length clone is not identified, positive overlapping clones
which code for the full length human cDNA homologue are identified
and a full length clone is then assembled as described in example
1. Biological activity is then confirmed as described in examples 4
and 7.
EXAMPLE 4
In Vitro Translation of Rat and Human DRG Sodium Channel in Xenopus
laevis Oocytes
[0136] In order to demonstrate the biological activity of the
protein coded for by the rat DRG sodium channel cDNA sequence
(SNS-B) and its human homologue the complete double-stranded cDNA
coding sequences are ligated into in vitro transcription vectors
(including but not limited to the pGEM series, Promega) using one
or more of the available restriction enzyme sites such that the
cDNAs are inserted in the correct orientation. The constructs are
then used to transform bacteria and constructs with the correct
sequence in the correct orientation are identified via diagnostic
restriction enzyme analysis and dideoxy-mediated chain termination
DNA sequencing (Sanger et al 1977 Proc Natl Acad Sci 74, 5463).
[0137] These constructs are then linearised at a restriction site
downstream of the coding sequence and the linearised and purified
plasmids are then utilised as a template for in vitro
transcription. Sufficient quantities of synthetic mRNA are produced
via in vitro transcription of the cloned DNA using a DNA-dependent
RNA polymerase from a bacteriophage that recognises a bacteriophage
promoter found in the cloning vector. Examples of such polymerases
include (but are not limited to) T3, T7 and SP6 RNA polymerase.
[0138] A variation on the above method is the synthesis of mRNA
containing a 5' terminal cap structure (7-methylguanosine) to
increase its stability and enhance its translation efficiency
(Nielson and Shapiro 1986 Nuc Ac Res 14, 5936). This is
accomplished by the addition of 7-methylguanosine to the reaction
mixture used for synthetic mRNA synthesis. The cap structure is
incorporated into the 5' end of the transcripts as polymerisation
occurs. Kits are available to facilitate this process e.g. mCAP RNA
Capping Kit-Stratagene).
[0139] The synthetic RNA produced from the in vitro transcription
is isolated and purified. It is then translated via microinjection
into Xenopus laevis oocytes. 50 nls of 1 mg/ml synthetic RNA is
micro-injected into stage 5 or stage 6 oocytes according to methods
established in the literature (Gurdon et al (1983) Methods in
Enzymol 101, 370). After incubation to allow translation of the
mRNAs the oocytes are analysed for expression of the DRG sodium
channels via electrophysiological or other methods as described in
example 7.
[0140] A further method for expression of functional sodium
channels involves the nuclear injection of a Xenopus oocyte protein
expression vector such as pOEV (Pfaff et al., Anal. Biochem. 188,
192-195 (1990)) which allows cloned DNA to be transcribed and
translated directly in the oocyte. Since proteins translated in
oocytes are post-translationally modified according to conserved
eukaryotic signals, these cells offer a convenient system for
performing structural and functional analyses of cloned genes. pOEV
can be used for direct analysis of proteins encoded by cloned cDNAs
without preparing mRNA in vitro, simplifying existing protocols for
translating proteins in oocytes with a very high translational
yield. Transcription of the vector in oocytes is driven by the
promoter for the TFIIIA gene, which can generate 1-2 ng (per oocyte
within 2 days) of stable mRNA template for translation. The vector
also contains SP6 and T7 promoters for in vitro transcription to
make mRNA and hybridization probes. DNA clones encoding SNS channel
transcripts are injected into oocyte nuclei and protein accumulated
in the cell over a 2- to 10-day period. The presence of functional
protein is then assessed using twin electrode voltage clamp as
described in example 7.
EXAMPLE 5
Expression of Rat and Human DRG Sodium Channel in Mammalian
Cells
[0141] In order to be able to establish a mammalian cell expression
system capable of producing the sodium channel in a stable
bioactive manner, constructs have to be first generated consisting
of the cDNA of the channel in the correct vectors suitable for the
cell system in which it is desired to express the protein. There
are available a range of vectors containing strong promoters which
drive expression in mammalian cells.
[0142] i/Transient Expression
[0143] In order to determine rapidly the bioactivity of a given
cDNA it can be introduced directly into cells and resulting protein
activity assayed 48-72 hours later. Although this does not result
in a cell line which is stably expressing the protein of interest
it does give a quick answer as to the biological activity of the
molecule. Specifically, the cDNA representing the human or rat DRG
sodium channel is ligated into appropriate vectors (including but
not limited to pRc/RSV, pRc/CMV, pcDNA1 (Invitrogen)) using
appropriate restriction enzymes such that the resulting construct
contains the cDNA in the correct orientation and such that the
heterologous promoter can drive expression of the transcription
unit. The resulting expression constructs are introduced into
appropriate cell lines including but not limited to COS-7 cells (an
African Green Monkey Kidney cell line), HEK 293 cells (a human
embryonic kidney cell line) and NIH3T3 cells (a murine fibroblastic
cell line). The DNA is introduced via standard methods (Sambrook et
al 1989 Molecular Cloning Second Edition, Cold Spring Harbour
Laboratory Press) including but not limited to calcium phosphate
transfection, electroporation or lipofectamine (Gibco)
transfection. After the required incubation time at 37.degree. C.
in a humidified incubator the cells are tested for the presence of
an active rat DRG sodium channel using methods described in example
7.
[0144] ii/Stable Expression
[0145] The production of a stable expression system has several
advantages over transient expression. A clonal cell line can be
generated that a has a stable phenotype and in which the expression
levels of the foreign protein can be characterised and, with some
expression systems, controlled. Also, a range of vectors are
available which incorporate genes coding for antibiotic resistance,
thus allowing the selection of cells transfected with the
constructs introduced. Cell lines of this type can be grown in
tissue culture and can be frozen down for long-term storage. There
are several systems available for accomplishing this e.g. CHO,
CV-1, NIH-3T3.
[0146] Specifically COS-7 cells can be transfected by lipofection
using Lipofectamine (GibcoBRL) in the following manner. For each
sample 2.times.10.sup.6 cells are seeded in a 90 mm tissue culture
plate the day prior to transfection. These are incubated overnight
at 37.degree. C. in a CO.sub.2 incubator to give 50-80% confluency
the following day. The day of the transfection the following
solutions are prepared in sterile 12.times.75 mm tubes: Solution A:
For each transfection, dilute 10-50 .mu.g of DNA into 990 .mu.l of
serum-free media (Opti-MEM I Reduced Serum Medium GibcoBRL).
Solution B: For each transfection, dilute 50 .mu.l of Lipofectamine
Reagent into 950 .mu.l serum-free medium. The two solutions are
combined, mixed gently and incubated at room temp for 45 minutes.
During this time the cells are rinsed once with serum-free medium.
For each transfection 9 ml of serum-free medium is added to the
DNA-lipofectamine tubes. This solution is mixed gently and
overlayed on the rinsed cells. The plates are incubated for 5 hours
at 37.degree. C. in a CO.sub.2 incubator. After the incubation the
medium is replaced with fresh complete media and the cells returned
to the incubator. Cells are assayed for activity 72 hours post
transfection as detailed in examples 4 and 7. To ascertain the
efficiency of transfection, .beta.-galactosidase in pcDNA3 is
transfected alongside the DRG sodium channel cDNA. This control
plate is stained for .beta.-galactosidase activity using a
chromogenic substrate and the proportion of cells staining
calculated. For transient transfection of DRG the cDNA must first
be cloned into a eucaryotic expression vector such as pcDNA3
(Invitrogen).
EXAMPLE 6
Expression of Rat DRG Sodium Channel in Insect Cells
[0147] The baculovirus expression system uses baculovirus such as
Autographa californica nuclear polyhedrosis virus (AcNPV) to
produce large amounts of target protein in insect cells such as the
Sf9 or 21 clonal cell lines derived from Spodoptera frugiperda
cells. Expression of the highly abundant polyhedrin gene is
non-essential in tissue culture and its strong promoter (polh) can
be used for the synthesis of foreign gene products (Smith et al
1983 Mol Cell Biol 3, 2156-2165). The polyhedrin promoter is
maximally expressed very late in infection (20 hours post
infection).
[0148] A transfer vector, where the rat DRG sodium channel cDNA is
cloned downstream of the polh promoter, or another late promoter
such as p10, is transfected into insect cells in conjunction with
modified AcNPV viral DNA such as but not limited to BaculoGold DNA
(PharMingen). The modified DNA contains a lethal mutation and is
incapable of producing infectious viral particles after
transfection. Co-transfection with a complementing transfer vector
such as (but not limited to) pAcYM1 (Matsuura et al 1987 J Gen
Virol 68, 1233-1250) or pVL1392/3 (InVitrogen) allows the
production of viable recombinant virus. Although more than 99% of
the resultant virus particles should be derived from
plasmid-rescued virus it is desirable to further purify the virus
particles by plaque assay. To ensure that the recombinant stock is
clonal, a single plaque is picked from the plaque assay and
amplified to produce a recombinant viral stock. Once the
recombinant phenotype is verified the viral stock can be used to
infect insect cells and express functional rat DRG sodium channel.
There are a number of variations in the methodology of baculovirus
expression which may give increased expression (O'Reilly et al 1999
Baculovirus Expression Vectors: A Laboratory Manual, Oxford
University Press). The expression of the rat or human DRG sodium
channel is achieved by cloning of the cDNA into pVL1392 and
introducing this into Sf21 insect cells.
EXAMPLE 7
[0149] Electrophysiological Characterisation of Cloned Human and
Rat DRG Sodium Channel Expression
[0150] Xenopus laevis oocytes are used to express the channel after
injection of the mRNA or cDNA in an expression vector. Expression
would be transient and thus functional studies would be made at
appropriate times after the injections. Comparison with
mock-injected oocytes would demonstrate lack of the novel channel
as an endogenously expressed characteristic. Standard two electrode
voltage clamp (TEVC) techniques as described, for example, in
Fraser, Moon & Djamgoz (1993) Electrophysiology of Xenopus
oocytes: an expression system in molecular neurobioloy: In:
Electrophysiology: A practical approach, Wallis, D. I., ed. Oxford
University Press, Chapter 4 pp. 65-86, would be used to examine the
characteristics of responses of ionic currents to changes in the
applied membrane potential. Appropriately modified saline media
would be used to manipulate the type of ionic currents detectable.
The kinetics of activation and inactivation of the sodium current,
its ionic selectivity, the effects of changes in ionic
concentration of the extracellular medium on its reversal
potential, and the sensitivity (or resistance) to TTX would be
defining characteristics.
[0151] Similar electrophysiolocical studies would be undertaken to
assess the success of functional expression in a permanently or
transiently expressing mammalian cell line, but patch clamp methods
would be more suitable than TEVC. Whole cell, cell-attached patch,
inside-out patch or outside-out patch configurations as described
for example by Hamill et al. (1981) Pflugers Arch. 391:85-100 and
Fenwick et al. (1982) J. Physiol. 331 599-635 might be used to
assess the channel characteristics.
[0152] For example, isolated transfected cells (see above) will be
voltage-clamped using the whole-cell variant of the patch clamp
technique for recording the expressed sodium channel current.
[0153] Recordings will be obtained at room temperature
(22-24.degree. C.). Both external and internal recording solutions
will be used to isolate Na+ currents as previously described (Lalik
et al., Am. J. Physiol. 264:C803-C809, 1992; West et al., Neuron
8:59-70, 1992). External solution (mM): sodium chloride, 65;
choline chloride, 50; TEA-Cl, 20, KCl, 1.5; calcium chloride, 1;
magnesium chloride, 5; glucose 5; HEPES, 5; at a pH 7.4 and and
osmolality of 320. Internal solution (mM): CsF, 90; CsCl, 60;
sodium chloride, 10; MgCl, 2;EGTA, 10; HEPES, 10 at pH 7.2 and an
osmolarity of 315.
[0154] The kinetics and voltage parameters of the expressed sodium
channel current will be examined and compared with data existing in
the literature. These include current-voltage relationships and
peak current amplitude. Cells will be voltage-clamped at -70 mV and
depolarizing pulses to 50 mV (at 10 mV increments) will be used to
generate currents.
[0155] The pharmacology of the expressed sodium channel current
will be examined with the Na channel blocker, tetrodotoxin (TTX).
To date sodium channels have been classified as TTX-sensitive and
TTX-resistant: block by low (1-30 nM) and high (>1 .mu.M)
concentrations of TTX, respectively (Elliot & Elliot, J.
Physiol. (Lond.) 463:39-56, 1993: Yang et al., J. Neurosci.
12:268-277, 1992; W1992).
[0156] The channel is unaffected by concentrations lower than 1
micromolar tetrodotoxin, and is only partially blocked by
concentrations as high as 10 micromolar tetrodotoxin.
EXAMPLE 8
Production of Purified Channel
[0157] Using a commercial coupled transcription-translation system,
35-S methionine labelled protein products of the SNS clone can be
generated (see FIG. 3). The size of the resulting protein when
assessed by SDS-polyacrylamide gel electrophoresis confirms the
predicted size of the protein deduced by DNA sequencing. The system
used is the Promega TNT system (Promega Technical Bulletin 126 1993
). The experiment is carried out precisely according to the
protocol provided (see FIG. 3).
EXAMPLE 9
Use of Rat or Human Sodium Channel in Screening Assays
[0158] Cell lines expressing the cloned sodium channels could be
used to determine the effects of drugs on the ability of the
channels to pass sodium ions across the cell membranes, e.g to
block the channels or to enhance their opening. Since the channel
activation is voltage dependent, depolarising conditions will be
required for observation of baseline activity that would be
modified by drug actions. Depolarisation could be achieved by for
example raising extracellular potassium ion concentration to 20 or
40 mM, or by repeated electrical pulses. Detection of the
activation of sodium conducting channels could be achieved by flux
of radiolabelled sodium ions, guanidine or by reporter gene
activation leading to for example a colour change or to
fluorescence of a light emitting protein. Subsequent confirmation
of the effectiveness of the drug action on sodium channel activity
would require electrophysiological studies similar to those
described above.
EXAMPLE 10
In Vitro Influx Assays
[0159] 1. 22Na+ influx assay: A modified assay has been adapted
from methods reported by Tamkum and Catterall, Mol Pharm. 19:78,
(1981). Oocytes or cells expressing the sodium channel gene are
suspended in a buffer containing 0.13 M sodium chloride, 5 mM KCl,
0.8 mM MgSO.sub.4, 50 mM HEPES-Tris (pH 7.4), and 5.5 mM glucose.
Aliquots of the cell suspension are added a buffer containing
22NaCl (1.3 .mu.Ci/mi, New England Nuclear, Boston, Mass.), 0.128 M
choline chloride, 2.66 mM sodium chloride, 5.4 mM KGl, 0.8 mM
MgSO.sub.4, 50 mM HEPES-Tris (pH 7.4), 5 mM ouabain, 1 mg/ml bovine
serum albumin, and 5.5 mM glucose and then incubated at 37.degree.
C. for 20 sec in either the presence or absence of 100 .mu.M
veratridine (Sigma Chemical Co., St Louis, Mo.). The influx assay
is stopped by the addition of 3 ml of ice-cold wash buffer
containing 0.163 M sodium chloride, 0.8 mM MgSO.sub.4, 1.8 mM
CaCl.sub.2, 50 mM HEPES-Tris (pH 7.4) and 1 mg/ml bovine serum
albumin, collected on a glass fiber filter (Whatman GF/C), and
washed twices with 3 ml of wash buffer. Radioactive incorporation
is determined by with a gammacounter. The specific
tetrodotoxin-resistant influx is measured by the difference in
22Na+ uptake in the absence or the presence of 10 .mu.M
transmethrin or 1 .mu.M (+) trans allethrin. The
tetrodotoxin-sensitive influx is measured by the difference in
22Na+ uptake in the absence or the presence of 1 .mu.M tetrodotoxin
(Sigma Chemical Co., St Louis, Mo.).
[0160] Guanidine influx: Another assay is modified from the method
described by Reith, Eur. J. Pharmacol. 188:33 (1990). In this assay
sodium ions are substituted with guanidinium ions. Oocytes or cells
are washed twice with a buffer containing 4.74 mM KCl, 1.25 mM
CaCl.sub.2, 1.2 mM KH2PO4, 1.18 mM MgSO.sub.4, 22 mM HEPES (pH
7.2), 22 mM choline chloride and 11 mM glucose. The oocytes or
cells are suspended in the same buffer containing 250 .mu.M
guanidine for 5 min at 19-25.degree. C. An aliquot of 14C-labelled
guanidine hydrochloride (30-50 mCi/mmol supplied by New England
Nuclear, Boston, Mass.) is added in the absence or presence of 10
.mu.M veratridine, and the mixture is incubated for 3 min. The
uptake reaction is stopped by filtration through Whatman GF/F
filters and followed by 2.5 ml washes with ice-cold 0.9% saline.
Radioactive incorporation is determined by scintillation
counting.
EXAMPLE 11
[0161] In order to measure the expression of sodium channels in in
vitro systems, as well as to analyse distribution and relative
level of expression in vivo, and to attempt to block function,
polyclonal and monoclonal antibodies will be generated to peptide
and protein fragments derived from SNS protein sequence shown in
FIG. 1.
[0162] a) Immunogens
[0163] Glutathione-sulphotransferase (GST)-fusion proteins will be
constructed (Smith and Johnson Gene 67:31-40 (1988)) using PGEX
vectors obtained from Pharmacia. Fusion proteins including both
intracellular and extracellular loops with little homology with
known sodium channels other than SNS-B will be produced. One such
method involves subcloning of fragments into pGex-5X3 or pGEX 4t-2
to produce in-frame fusion proteins encoding extracellular,
intracellular or C-terminal domains as shown in detailed maps in
FIG. 4. The pGEX fusion vectors are transformed into E. coli XL-1
blue cells or other appropriate cells grown in the presence of
ampicillin. After the cultures have reached an optical density of
OD600>0.5, fusion protein synthesis is induced by the addition
of 100 micromolar IPTG, and the cultures further incubated for 1-4
hours. The cells are harvested by centrifugation and washed in ice
cold phosphate buffered saline. The resulting pellet (dissolved in
300 microlitres PBS from each 50 ml culture) is then sonicated on
ice using a 2 mm diameter probe, and the lysed cells microfuged to
remove debris. 50 microliters of glutathione-agarose beads are then
added to each pellet, and after gentle mixing for 2 minutes at room
temperature, the beads are washed by successive spins in PBS. The
washed beads are then boiled in Laemmli gel sample buffer, and
applied to 10% polyacrylamide SDS gels. Material migrating at the
predicted molecular weight is identified on the gel by brief
staining with coommassie blue, and comparison with molecular weight
markers. This material is then electroeluted from the gel and used
as an immunogen as described below.
[0164] b) Antibody Production
[0165] Female Balb/c mice are immunised intraperiteonally with
1-100 micrograms of GST fusion protein emulisfied in Freunds
complete adjuvant. After 4 weeks, the animals will be further
immunised with fusion proteins (1-100 micrograms) emulsified in
Freunds incomplete adjuvant. Four weeks later, the animals will be
immunised intraperitoneally with a further 1-100 micrograms of GST
fusion protein emulsified with Freunds incomplete adjuvant. Seven
days later, the animals will be tail bled, and their serum assessed
for the production of antibodies to the immunogen by the following
screen; (protocols for the production of rabbit polyclonal serum
are the same, except that all injections are subcutaneous, and 10
times as much immunogen is used. Polyclonal rabbit serum are
isolated from ear-vein bleeds.)
[0166] Serial ten-fold dilutions of the sera (1;100 to 1;1000,000)
in phosphate buffered saline (PBS) containing 0.5% NP-40 and 1%
normal goat serum will be applied to 4% paraformaldehyde-fixed 10
micron sections of neonatal rat spinal cord previously treated with
10% goat serum in PBS, After overnight incubation, the sections are
washed in PBS, and further incubated in the dark with 1;200
FITC-conjugated F(ab)2 fragment of goat anti-mouse antibodies for 2
hours in PBS containing 1% normal goat serum. The sections are
further washed in PBS, mounted in Citifluor, and examined by
fluorescence microscopy. Those sera that show specific staining of
laminar II in the spinal cord will be retained, and the mice
generating such antibodies subsequently used for the production of
monoclonal antibodies. Three weeks later, mice producing useful
antibodies are immunised with GST-fusion proteins without adjuvant.
After 3 days, the animals are killed, their spleens removed, and
the lymphocytes fused with the thymidine kinase-negative myeloma
line NS0 or equivalent, using polyethylene glycol. The fused cells
from each experiment are grown up in 3.times.24 well plates in the
presence of DMEM medium containing 10% fotal calf serum and
hypoxanthine, aminopterin and thymidine (HAT) medium to kill the
myeloma cells (Kohler and Milstein. Eur. J. Immunol 6, 511-519
(1976)). The tissue culture supernatants from wells containing
hybridomas are further screened by immunofluorescence as described
above, and cells from positive wells cloned by limiting dilution.
Antibody from the positive testing cloned hybridomas is then used
to Western blot extracts of rat dorsal root ganglia, to determine
if the antibody recognises a band of size approximately 200,000,
confirming the specificity of the monoclonal antibody for the SNS
sodium channel. Those antibodies directed against extracellular
domains that test positive by both of these criteria will then be
assessed for function blocking activity in electrophysiological
tests of sodium channel function (see example 7), and in screens
relying on ion flux or dye-based assays in cells lines expressing
sodium channel (see examples 9 and 10).
EXAMPLE 12
Cell-Type Distribution of Expression
[0167] In situ hybridization demonstrates the presence of SNS in a
subset of sensory neurons. An SNS fragment between positions 1740
and 1960 was sub-cloned into pGem4z, and DIG-UTP labeled sense or
antisense cRNA generated. Sample preparation, hybridization, and
visualization of in situ hybridization with alkaline phosphatase
conjugated anti-DIG antibodies was carried out exactly as described
in Schaeren-Wimers N. and Gerfin-Moser A. Histochemistry 100,
431-440 (1993).
EXAMPLE 13
Electrophysiological Properties of the Rat DRG Sodium Channel
Expressed in Xenopus Oocytes
[0168] pBluescript SK plasmid containing DNA encoding the SNS
sodium channel was digested to position -21 upstream of the
initiator methionine using a commercially available kit (Erase a
base system, Promega, Madison, Wis., USA). The linearized and
digested plasmid was cut with Kpn1 and subcloned into an oocyte
expression vector pSp64GL (Sma-Kpn1) sites. pSP64GL is derived from
pSP64.T pSP64. T was cut with Sma1-EcoR1, blunt-ended with Klenow
enzyme, and recircularized. Part of the pGem 72 (+) polylinker
(Sma1-Kpn1-EcoR1-Xho1) was ligated into the blunt-ended Bg1 II site
of pSP64.T. This vector with an altered polylinker for DNA inserts
(Sma1-Kpn1-EcoR1-Xho1) and linearization (Sal 1-Xba 1-BamH 1) was
named pSP64GL. The resulting plasmid was linearized with Xba1. and
cRNA transcribed with SP6 polymerase using 1 mM 7-methylGppG.
[0169] cRNA (70 ng) was injected into Xenopus oocytes 7-14 days
before recording; immature, stage IV oocytes were chosen cause of
their smaller diameter and therefore capacitance. Oocytes were
impaled with 3M KCl electrodes (.ltoreq.1M.OMEGA.) and perfused at
3-4 ml per minute with modified Ringer solution containing 115 mM
NaCl, 2.5 mM KCl, 10 mM HEPES, 1.8 mM MgCl.sub.2, and 1 mM
CaCl.sub.2, pH 7.2, at temperature of 19.5 -20.5.degree. C. Digital
leak substraction of two electrode voltage-clamp current records
was carried out using as leak currents produced by hyperpolarizing
pulses of the same amplitude as the test depolarizing commands.
Oocytes in which leak commands elicited time-dependent currents
were discarded. Averages of 10 records were used for both test and
leak.
[0170] Inward currents were evoked by depolarizing, in 10 mV steps,
from -60 mV to a command potential of -20 to +40 mV in 10 mV steps
and from -80 mV to a command potential of -30 to +2- mV in oocytes
injected with sodium channel cRNA. Current traces are blanked for
the first 1.5 ms from the onset of the voltage step to delete the
capacity transients for clarity. The peak current is reached at the
same command voltage for the two holding potentials, but is
slightly smaller from -60 mV because of steady-state
inactivation.
[0171] The effects of 50% or 100% replacement of external Na+ by
N-methyl-D-glucosamine on the sodium channel current were elicited
by stepping the depolarizing currents given to the oocyte from -60
to +1 mV. Data were fitted with the equation
h.sub.x=1/(1+exp((V-V.sub.50)/k)), where V is the prepulse
potential, V.sub.50 the potential of 50% inactivation and the k the
slope factor (best squares fit). The effect of TTX (10 .mu.M and
100 .mu.M) on the peak Na+ current (test pulse from -60 to +20 mV)
was also determined. The effect was quickly reversible upon
washout.
[0172] After a minimum incubation of 7 days from cRNA injection,
step depolarizations to potentials positive to -30 mV elicited
inward currents which peaked between +10 and +20 mV with an average
maximum amplitude of 164.+-.72 nA (from -60 mV holding potential,
n=13) and a reversal potential of +35.5.+-.2.2 mV (n=10). The
inward current was reversed by total replacement of Na+ in the
external medium with an impermeant cation (N-methyl-D-glucosamine).
The current's reversal potential was shifted in 50% Na+ by
13.7.+-.3.2 mV in the hyperpolarizing direction (n=3; predicted
value for a Na+-selective channel, 17.5 mV). The inactivation
produced by a 1 s prepulse was half-maximal at -30.0.+-.1.3 mV
(slope factor 14.0.+-.1.7 mV, n=5.
[0173] TTX had no effect at nanomolar concentrations, and produced
only a 19.1.+-.8.3% reduction at 10 .mu.M, n=3). The estimated
half-maximal inhibitory concentration (IC.sub.50) was 59.6.+-.10.1
.mu.M TTX.
[0174] The local anesthetic lignocaine was also weakly inhibitory,
producing a maximum block of 41.7.+-.5.4% at 1 mM on the peak
current elicited by depolarizing pulses from -60 mV to +10 mV (1
every min; n=3), whereas under the same conditions 100 .mu.M
phenytoin had no effect.
[0175] A similarity with the TTX-insensitive Na+ current of DRG
neurons was the effectiveness and rank order of Pb.sup.2+ versus
Cd.sup.2+ in reducing peak Na.sup.+ currents (-63.9.+-.18.1% for
Pb.sup.2 + versus -24.4.+-.7.9% for Cd.sup.2+ at 50 .mu.M and 100
.mu.M, respectively; n=3, P=0.0189). The electrophysiological and
pharmacological characteristics of the oocyte expressed DRG sodium
channel are thus similar to the properties of the sensory neuron
TTX-insensitive channel, given the constraints of expression in an
oocyte system. In oocytes expressing the DRG sodium channel, the
peak of the I/V plot occurred at a more depolarized potential than
that of the DRG TTX-insensitive current, despite a similar reversal
potential. This difference may reflect the absence of the accessory
.beta.1 subunit found in DRG, which is known to shift activation to
more negative potentials when expressed with the subunit of other
Na.sup.30 channels. In addition, splice variants that exhibit an
activation threshold more negative to SNS sodium channel may shift
activation to the more negative potentials observed in sensory
neurons.
EXAMPLE 14
Distribution of DRG Sodium Channel in Neonatal and Adult Rat
Tissues and Cell Lines
[0176] Northern blot and reverse transcriptase-polymerase chain
reaction (RT-PCR) were used to examine neonatal and adult rat
tissues for expression of the DRG sodium channel messenger RNA.
[0177] Random primed .sup.32P-labeled DNA Pst-Acc1 fragment probes
(50 ng, specific activity 2.times.10.sup.9 c.p.m. per .mu.g DNA)
from interdomain region 1 (nucleotide position 1.478-1.892) of the
SNS sodium channel nucleic acid sequence were used to probe total
RNA extracted from tissues. The following tissues and cell lines
were tested: central nervous system and non-neuronal tissues from
neonatal rats: peripheral nervous tissue including neonatal Schwann
cells and sympathetic neurons, as well as C6 glioma, human
embryonal carcinoma line N-tera-2 and N-tera-2 neuro, rat sensory
neuron-derived lines ND7 and ND8, and human neuroblastomas SMS-KCN
and PC12 cells grown in the presence of NGF: adult rat tissue
including pituitary, superior cervical ganglia, coeliac ganglia,
trigeminal mesencephalic nucleus, vas deferens, bladder, ileum and
DRG of adult animals treated with capsaicin (50 mg/kg) at birth and
neonatal DRG control. Total RNA (10 .mu.g) or 25 .mu.g of RNA from
tissues apart from superior cervical ganglion sample (10 .mu.g) and
capsaicin-treated adult rat DRG (5 .mu.g) were northern
blotted.
[0178] Total RNA was separated on 1.2% agarose-formaldehyde gels,
and capillary blotted onto Hibond-N filters (Amersham). The amounts
of RNA on the blot were roughly equivalent, as judged by ethidium
bromide staining of ribosomal RNA and by hybridization with the
ubiquitously expressed L-27 ribosomal protein transcripts. Filters
were prehybridized in 50% formamide, 5.times.SSC containing 0.5%
sodium dodecyl sulfate, 5.times. Denhardts solution, 100 .mu.g/ml
boiled sonicated salmon sperm DNA (average size 300 bp), 10
.mu.g/ml poly-U and 10 .mu.g/ml poly-C at 45.degree. C. for 6 h.
After 36 hours hybridization in the same conditions using 10.sup.7
c.p.m. per ml hybridization probe, the filters were briefly washed
in 2.times.SSC at room temperature, then twice with 2.times.SSC
with 0.5% SDS at 68.degree. C. for 15 min, followed by a 20 min
wash in 0.5% SDS, 0.2.times.SSC at 68.degree. C. The filters were
autoradiographed overnight or for 4 days on autoradiography film
(Kodak X-omat).
[0179] For RT-PCR experiments, 10 .mu.g total RNA from neonatal rat
tissues (spleen, liver, kidney, lung, intestine, muscle, heart,
superior cervical ganglia, spinal cord, brain stem, hippocampus,
cerebellum, cortex and dorsal root ganglia), or 2 .mu.g total RNA
from control or capsaicin-treated rat DRG or DRG neurons in culture
were treated with DNase I and extracted with acidic phenol to
remove genomic DNA.
[0180] cDNA was synthesized with Superscript reverse transcriptase
using oligo dT(12-18) primers and purified on Qiagen 5 tips.
Polymerase chain reaction (PCR) was used to amplify cDNA (35
cycles, 94.degree. C., 1 min; 55.degree. C., 1 min; and 72.degree.
C., 1 min), and products separated on agarose gels before staining
with ethidium bromide. L-27 primers (Ninkina et al. (1983) Nucleic
Acids Res. 21, 3175-3182) were added to the PCR reaction 5 cycles
after the start of the reaction with the DRG sodium channel
specific primers which comprised
1 5'-CAGCTTCGCTCAGAAGTATCT-3' (SEQ ID NO: 9) and
5'-TTCTCGCCGTTCCACACGGAGA-3'. (SEQ ID NO: 10)
[0181] Transcription of mRNA coding for the DRG sodium channel
could not be detected in any non-neuronal tissues or in the central
nervous system using northern blots or reverse transcription of
mRNA and the polymerase chain reaction. Sympathetic neurons from
the superior cervical ganglion and Schwann cell-containing sciatic
nerve preparations, as well as several neuronal cell lines were
also negative. However, total RNA extracts from neonatal and adult
rat DRG gave a strong signal of size about 7kb on northern blots.
These data suggest that the DRG sodium channel is not expressed
only in early development.
[0182] RT-PCR of oligo dT-primed cDNA from various tissues using
DRG sodium channel primers and L-27 ribosomal protein primer showed
the presence of DRG sodium channel transcripts in DRG tissue
only.
[0183] RT-PCR was also performed on DRG-sodium channel and L-27
transcripts from DRG neurons cultured and treated with capsaicin
(overnight 10 .mu.M) or dissected from neonatal animals treated
with capsaicin (50 mg/kg on 2 consecutive days, followed by DRG
isolation 5 days later. The signal from the L-27 probe was the same
in capsaicin-treated cell cultures or animals as compared with
controls that were not treated with capsaicin. There was a
significant diminution in the DRG sodium channel signal from
capsaicin-treated cultures or animals as compared with controls.
Control PCR reactions without reverse transcriptase treatment were
also done to control for contaminating genomic DNA.
[0184] When neonatal rats were treated with capsaicin and total
adult DRG RNA subsequently examined by northern blotting, the
signal was substantially reduced, suggesting that the DRG sodium
channel transcript is expressed selectively by capsaicin-sensitive
(predominantly nociceptive) neurons. These data were confirmed by
RT-PCF experiments on both cultures of DRG neurons, and in whole
animal studies.
EXAMPLE 15
Distribution of DRG Sodium Channel in Rat Tissue by In Situ
Hybridization
[0185] In situ hybridization was used to examine the expression of
the DRG sodium channel transcripts at the single-cell level in both
adult trigeninal ganalia and neonatal and adult rat DRG.
[0186] A SNS sodium channel PCR fragment of interdomain region I
between positions 1,736 and 1,797 of the SNS sodium channel nucleic
acid sequence was subcloned into pGem3Z (Promega. Madison, Wis.,
USA) and digoxygenin (DIG)-UTP (Boehringer-Mannheim, Germany)
labeled sense or antisense cRNA generated using SP6 or T7
polymerase, respectively. Sample preparation, hybridization and
visualization of in situ hybridization with alkaline phosphatase
conjugated anti-DIG antibodies was carried out as described in
Schaeren-Wimers, et al., A. (1993) Histochemistry 100: 431-440,
with the following modifications. Frozen tissue sections (10
.mu.M-thick) of neonatal rat lumbar DRG, and adult trigeminal
ganglion neurons were fixed for 10 min in phosphate buffered saline
(PBS) containing 4% paraformaldehyde. Sections were acetylated in
0.1M triethanolamine, 0.25% acetic anhydride for 10 min.
Prehybridization was carried out in 50% formamide, 4.times.SSC, 100
.mu.g/ml boiled and sonicated ssDNA, 50 .mu.g/ml yeast tRNA,
2.times. Denhardts solution at room temperature for 1 h.
Hybridization was carried out overnight in the same buffer at
65.degree. C. Probe concentration was 50 ng/ml. Sections were
washed in 2.times.SSC for 30 min at 72.degree. C. for 1 hr and
twice in 0.1 SSC for 30 min at 72.degree. C. before visualization
at room temperature with anti-digoxygenin alkaline phosphatase
conjugated antibodies. The same sections were then stained with
mouse monoclonal antibody RT97 which is specific for neurofilaments
found in large diameter neurons.
[0187] Subsets of sensory neurons from both tissues showed intense
signals with a DRG sodium channel-specific probe. Combined
immunohistochemistry with the large-diameter neuron-specific
monoclonal antibody RT97 and the DRG sodium channel specific probe
showed that most of the large diameter neurons did not express the
DRG sodium channel transcript. Small diameter neurons were stained
with the DRG sodium channel specific probe but not the large
diameter neurons.
EXAMPLE 16
Site Directed MutaGenesis of SNS Sodium Channel--TTX
Sensitivity
[0188] The SNS sodium channel is 65% homologous to the
tetrodotoxin-insensitive cardiac sodium channel. A number of
residues that line the channel atrium have been implicated in
tetrodotoxin binding. The amino acid sequence of the SNS sodium
channel exhibits sequence identity to other tetrodotoxin-sensitive
sodium channels in 7 out of 9 such residues. One difference is a
conservative substitution at D(905)E. A single residue (C-357) has
been shown to play a critical role in tetrodotoxin binding to the
sodium channel. In the SNS sodium channel, a hydrophilic serine is
found at this position, whereas a other sodium channels that are
sensitive to TTX have phenylalanine in this position.
[0189] Site-directed mutagenesis using standard techniques and
primers having the sequence TGACGCAGGACTCCTGGGAGCGCC (SEQ ID NO:
31) was used to substitute phenylalanine for serine at position 357
in the SNS sodium channel. The mutated SNS sodium channel, when
expressed in Xenopus oocytes produces voltage-gated currents
similar in amplitude and time course to the native channel.
However, sensitivity to TTX is restored to give an IC.sub.50 of 2.5
nM (+-0.4, n=5), similar to other voltage-gated sodium channels
that have aromatic residues at the equivalant position. The table
below shows IC.sub.50 for SNS sodium channel, and the rat brain
iia, muscle type 1, and cardiac tetrodotoxin-insensitive sodium
channels.
2 Sodium Channel ss1 domain ss2 domain IC.sub.50 Rat brain iia FRLM
TQDFWENLY 18 nM muscle type 1 FRLM TQDYWENLY 40 nM cardiac TTXi
FRLM TQDCWERLY 950 nM SNS FRLM TQDSWERLY 60 micromolar SNS mutant
FRLM TQDFWERLY 2.5 nM
[0190]
3 FRLM; SEQ ID NO: 11 TQDFWENLY; SEQ ID NO: 12 TQDYWENLY; SEQ ID
NO: 13 TQDCWERLY; SEQ ID NO: 14 TQDSWERLY; SEQ ID NO: 15 TQDFWERLY
SEQ ID NO: 16
EXAMPLE 18
[0191] Polyclonal antibodies were raised in rabbits against the
following peptides derived from the SNS sodium channel protein
amino acid sequence:
4 Peptide 1 TQDSWER (SEQ ID NO: 17) Peptide 2 GSTDDNRSPQSDPYN (SEQ
ID NO: 18) Peptide 3 SPKENHGDFI (SEQ ID NO: 19) Peptide 4 PNHNGSRGN
(SEQ ID NO: 20)
[0192] The peptides were conjugated to Keyhole limpet heocyanin
(KLH) and injected repeatedly into rabbits. Sera from the rabbits
was treated by Western blotting. Several sera showed positive
results indicating the presence of antibodies specific for the
peptide in the sera.
[0193] References
[0194] Catterall W. A. (1992) Physiol. Rev. 72, S4-S47.
[0195] Cohen S. A. and Barchi R. L. (1993) Int. Rev. Cytology 137c,
55-103.
[0196] Hodgkin A. L. and Huxley A. F. (1952) J. Physiol. 116,
473-496.
[0197] Hille B. (1991) Ionic channels in excitable membranes
(Sinauer Sunderland Mass.)
[0198] Jeftjina S. (1994) Brain Res. 639, 125-134.
[0199] Kohler G. and Milstein C. (1976) Eur J. Immunol 6,
511-519
[0200] Lewin B. (1995) Genes V Oxford University Press, Oxford.
[0201] Melton D. et al. (1984) Nucleic Acids Res. 12, 7035
[0202] Nowycky M. (1993) in Sensory Neurons (Ed Scott S.) OUP,
Oxford.
[0203] Omri G. and Meir H. (1990) J. Membrane Biol. 115, 13-29
[0204] Pearce R. J. and Duchen M. R. (1994) Neuroscience 63,
1041-1056
[0205] Pfaff S L; Tamkun-M M; Taylor-W L (1990 Anal-Biochem. 1990
188 192-195
[0206] Schaeren-Wimers N. and Gerfin-Moser A. (1993) Histochemistry
100, 431-440.
[0207] Smith D. B. and Johnson K. S. (1988) Gene 67, 31-40.
Sequence CWU 1
1
* * * * *