U.S. patent application number 11/130921 was filed with the patent office on 2005-10-06 for systems and methods for ordering, performing, and reporting genetic screening.
Invention is credited to Hodge, Timothy A..
Application Number | 20050221370 11/130921 |
Document ID | / |
Family ID | 25483747 |
Filed Date | 2005-10-06 |
United States Patent
Application |
20050221370 |
Kind Code |
A1 |
Hodge, Timothy A. |
October 6, 2005 |
Systems and methods for ordering, performing, and reporting genetic
screening
Abstract
The present invention provides computer-implemented systems and
methods for ordering, performing, and reporting transgenic and
targeted mutagenesis screening of genomic DNA. The methods are
performed by a remote user's computer, a web site computer and a
laboratory computer. The remote user, in communication with another
computer, requests a screening of biological samples that are
disposed in a multi-well plate. The remote user designates on his
computer a variety of parameters necessary to perform the testing
and identifies the location of samples in the multi-well plate. A
computer at the laboratory receives this information and uses it to
perform testing, and to prepare a sample test report that is
returned to the remote user. A computer intermediate to the user's
computer and the laboratory computer, such as a web site computer,
may be used. The laboratory computer is configured to extract
information from the remote user's electronic communication and
transmit that information electronically to a supplier to order
reagents necessary for the testing.
Inventors: |
Hodge, Timothy A.; (Eads,
TN) |
Correspondence
Address: |
BUTLER, SNOW, O'MARA, STEVENS & CANNADA PLLC
6075 POPLAR AVENUE
SUITE 500
MEMPHIS
TN
38119
US
|
Family ID: |
25483747 |
Appl. No.: |
11/130921 |
Filed: |
May 17, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11130921 |
May 17, 2005 |
|
|
|
09945952 |
Sep 4, 2001 |
|
|
|
60230371 |
Sep 6, 2000 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
702/20; 705/3 |
Current CPC
Class: |
B01J 2219/00533
20130101; B01J 2219/00659 20130101; B01J 2219/00722 20130101; C12Q
1/6837 20130101; Y10S 436/805 20130101; G16B 50/00 20190201; G16B
50/30 20190201; G01N 1/312 20130101; G16H 40/67 20180101; G16H
10/40 20180101; Y10T 436/143333 20150115; C12Q 1/6834 20130101;
C40B 40/06 20130101; G01N 35/025 20130101; Y10S 436/80 20130101;
C12Q 1/6888 20130101; G01N 35/00871 20130101; B01J 2219/00387
20130101; C40B 60/14 20130101; C12Q 1/6834 20130101; C12Q 2565/518
20130101; C12Q 1/6837 20130101; C12Q 2565/518 20130101 |
Class at
Publication: |
435/006 ;
702/020; 705/003 |
International
Class: |
G06F 017/60; C12Q
001/68; G06F 019/00; G01N 033/48; G01N 033/50 |
Claims
I claim:
1. A method of requesting and receiving a sample outcome report for
genomic DNA screening of a plurality of biological samples sent by
a remote user to a screening laboratory, the remote user providing
screening parameters via an electronic communications link to the
screening laboratory, the method comprising: (a) transmitting an
access request from a remote user to a screening laboratory via an
electronic communications link; (b) receiving an access enabling
response from the screening laboratory by the remote user via an
electronic communications link, the access enabling response
including the screening parameters; (c) selecting screening
parameters by the remote user to provide selected screening
parameter selections; (d) transmitting the selected screening
parameter selections from the remote user to the screening
laboratory via an electronic communications link; (e) transmitting
a plurality of biological samples from the remote user to the
screening laboratory wherein transmitting a plurality of biological
samples involves the step of placing one of each of the plurality
of biological samples in a corresponding well of a multi-well
plate; and (f) receiving a sample outcome report for a plurality of
biological samples from the screening laboratory by the remote user
via an electronic communications link, wherein the electronic
communications link is the Internet.
2. The method of claim 1 wherein the multi-well plate is a 96 well
plate.
3. The method of claim 1 further comprising the step of correlating
each of the plurality of biological samples with a well of the
multi-well plate.
4. The method of claim 1 wherein the step of receiving an access
enabling response includes a sample identification and designation
section.
5. The method of claim 4 wherein the sample identification and
designation section indicates a well plate having a plurality of
wells, each well having an associated well position.
6. The method of claim 4, wherein the sample identification and
designation section presents an x-y orientation of a plurality of
wells, the orientation defining a plurality of rows and a plurality
of columns.
7. The method of claim 6, further comprising the step of
designating individual ones of the x-y orientation of a plurality
of wells.
8. The method of claim 1 wherein the step of receiving an access
enabling response includes a survey of work section for entering at
least one screening parameter selection.
9. The method of claim 1 further comprising the step of designating
each of the plurality of biological samples in the multi-well
plate.
10. The method of claim 1, further comprising the step of
designating a control sample of the plurality of biological
samples.
11. The method of claim 1, further comprising the step of
designating a plate accession number of the multi-well plate.
12. The method of claim 1 further comprising the step of
designating which sample of the plurality of biological samples is
placed into each well of the multi-well plate.
13. The method of claim 1 wherein access request includes an
account identifier and a password.
14. The method of claim 1 wherein the screening parameter
selections include a selectable marker.
15. The method of claim 1 wherein the screening parameter
selections include data indicative of a number of lines to be
tested.
16. The method of claim 1 where the screening parameter selections
include a probe sequence.
17. The method of claim 1 wherein the screening parameter
selections include a designated control.
18. The method of claim 1 wherein the screening parameter
selections include a designated genetic sequence.
19. The method of claim 1 wherein the screening parameter
selections include a target genetic sequence.
20. The method of claim 1 wherein the sample outcome report
includes a pictorial representation of screening results.
21. The method of claim 17 wherein the sample outcome report
identifies the designated control.
22. The method of claim 21 wherein the sample outcome report
includes a quantitative analysis of each of the plurality of
biological samples in comparison to the designated control.
23. The method of claim 21 wherein the sample outcome report
includes a qualitative analysis of each of the plurality of
biological samples in comparison to the designated control.
24. The method of claim 1 wherein the sample outcome report
includes a well location of each of the plurality of biological
samples in the multi-well plate.
25. The method of claim 1 wherein the sample outcome report
includes a copy number for each of the plurality of biological
samples.
26. The method of claim 1 wherein the sample outcome report
includes an accession number of the well plate.
27. The method of claim 1 further comprising the step of
electronically showing the remote user a well plate having a
plurality of wells, each of the wells having a corresponding well
plate location on the multi-well plate.
28. A computer-implemented method of electronically ordering
transgenic or targeted mutagenic screening for a plurality of
biological samples by electronic communications between a website
and a remote user computer, the method comprising the steps of: (a)
transmitting an account identifier and password from the remote
user's computer to the website to gain access to the website; (b)
designating at the remote user's computer a plurality of biological
samples for transgenic or targeted mutagenic screening; (c)
designating at the remote user's computer the location of the
plurality of biological samples in the plurality of wells; and (d)
designating a genetic sequence to be screened for each of the
plurality of biological samples.
29. The method of claim 28 further comprising the step of showing
on the remote user's computer a well plate having a plurality of
wells.
30. The method of claim 28, further comprising the step of
providing the number of the plurality of biological samples in the
plurality of wells in the well plate.
31. The method of claim 28, further comprising the step of
designating a control sample.
32. The method of claim 31 wherein the step of designating the
control sample includes the step of identifying the zygosity of the
control sample.
33. The method of claim 31 wherein the step of designating the
control sample includes the step of identifying a copy number of
the control sample.
34. The method of claim 31 wherein the step of designating the
control sample includes the step of identifying mosaic nature of
the control sample.
35. The method of claim 28, further comprising the step of
designating a probe sequence complimentary to a portion of the
designated genetic sequence.
36. The method of claim 28, further comprising the steps of: (a)
transmitting results of the step of designating the location of the
plurality of biological samples in the plurality of wells to the
website; (b) transmitting results of the step of designating the
genetic sequence of the plurality of biological samples to the
website; and (c) transmitting the corresponding plurality of
biological samples in the well plate to the screening
laboratory.
37. The method of claim 28, wherein the step of showing includes
the step of showing a corresponding row and column identifier for
each of the plurality of wells.
38. A method of screening genomic DNA in a plurality of biological
samples, wherein the samples are to be sent by a remote user for
ultimate arrival at a screening laboratory, wherein the screening
is for a designated genetic sequence, and further wherein the
remote user provides screening parameters via the Internet to a
screening website, the method comprising: (a) transmitting an
access enabling response from the screening website to the remote
user via the Internet, the access enabling response including
screening parameters; (b) receiving selected screening parameter
selections via the Internet from the remote user; (c) receiving the
plurality of biological samples in a multi-well plate; (d)
conducting screening of the plurality of biological samples
according to the selected screening parameters with the reagents to
obtain screening results; and (e) transmitting screening results
for the designated genetic sequence to the remote user via the
Internet.
39. The method of step 38 further comprising the step of
transmitting a request via the Internet to a supplier to obtain
reagents conforming to the screening parameter selections.
40. The method of claim 38 wherein the screening parameter
selections include a selectable marker.
41. The method of claim 38 wherein the plurality of biological
samples in a multi-well plate include at least two lines, and
further wherein the screening parameter selections include
identification of the at least two lines.
42. The method of claim 38 wherein the screening parameter
selections include a probe sequence.
43. The method of claim 38 wherein the screening parameter
selections include a designated control.
44. The method of claim 43 wherein the designated control is a
biological sample having the designated genetic sequence.
45. The method of claim 38 wherein the step of conducting screening
includes the step of treating the plurality of biological samples
with a lysis buffer to obtain cellular debris including genomic
DNA.
46. The method of claim 45, wherein the step of conducting
screening further includes the step of separating the genomic DNA
from the cellular debris of the plurality of biological samples
using magnetic particles.
47. The method of claim 38 wherein the reagents are labeled probes
specific for a portion of the designated genetic sequence.
48. The method of claim 38 wherein the request to a supplier is
generated to an order manager.
49. A computer-implemented method of processing an order for
transgenic or targeted mutagenesis screening of a plurality of
biological samples in a multi-well plate by electronic
communications between a website and a remote user's computer, the
method comprising the steps of: (a) receiving from the remote
user's computer a user account identifier and password; (b)
checking validity of the account identifier and password; (c)
receiving from the remote user a designation of a genetic sequence
for screening the plurality of biological samples; (d) receiving a
designation from the remote user's computer of a plurality of
biological samples for transgenic or targeted mutagenic screening;
and (e) receiving from the remote user's computer a designation of
which of the plurality of biological samples was placed into each
well of a multi-well plate.
50. The method of claim 49 wherein the designated genetic sequence
is selected from the group including SEQ ID NO: 1, SEQ ID NO: 2,
SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.
51. The method of claim 49 wherein the designated genetic sequence
is a transgenic insert.
52. The method of claim 49 wherein the designated genetic sequence
is a selectable marker.
53. The method of claim 49 wherein the designated genetic sequence
is a knock-in.
54. The method of claim 49 wherein the designated genetic sequence
is a knock-out.
55. The method of claim 49 further comprising the step of adding
labeled probes specific for reference genetic sequence to the
plurality of biological samples.
56. The method of claim 49 wherein the reference genetic sequence
is selected from the group consisting of: SEQ. ID NO: 6, SEQ. ID
NO: 7, SEQ. ID NO: 8, SEQ. ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11,
SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ
ID NO: 16.
57. The method of claim 49 further comprising the step of receiving
selected screening parameter selections via the Internet from the
remote user.
58. The method of claim 57 wherein the screening parameter
selections include a selectable marker.
59. The method of claim 57 wherein the screening parameter
selections include a designation of a plurality of lines to be
tested.
60. The method of claim 57 where the screening parameter selections
includes a probe sequence.
61. The method of claim 57 wherein the screening parameter
selections include a designated control.
62. The method of claim 49 further comprising the step of receiving
a designation of a control sample from the remote user via the
Internet.
63. The method of claim 62 wherein the step of receiving a
designation of a control sample includes the step of receiving an
identification of a zygosity of the control sample from the remote
user via the Internet.
64. The method of claim 62 wherein the step of receiving a
designation of a control sample includes the step of receiving an
identification of a copy number of the control sample from the
remote user via the Internet.
65. The method of claim 62 wherein the step of receiving a
designation of a control sample includes the step of receiving an
identification of a mosaic nature of the control sample from the
remote user via the Internet.
66. The method of claim 49 further comprising the step of receiving
a designation of a probe sequence complimentary to a portion of the
designated genetic sequence.
67. The method of claim 49 further comprising the step of
transmitting screening results to the remote user, wherein the
screening results are the result of screening the plurality of
biological samples.
68. The method of claim 67 wherein the step of transmitting
screening results includes the step of transmitting a sample
outcome report for the plurality of biological samples to the
remote user via the Internet.
69. The method of claim 68 wherein the sample outcome report
includes a pictorial representation of screening results.
70. The method of claim 68 wherein the sample outcome report
includes a quantitative analysis of each of the plurality of
biological samples in comparison to a designated control.
71. The method of claim 68 wherein the sample outcome report
includes a qualitative analysis of each of the plurality of
biological samples in comparison to a designated control.
72. The method of claim 70, wherein the designated control includes
the designated genetic sequence.
73. The method of claim 68 wherein the sample outcome report
includes an accession number of the well plate.
74. The method of claim 68 wherein the sample outcome report
includes a well location of each of the plurality of biological
samples in the well plate.
75. The method of claim 68 wherein the sample outcome report
includes a copy number for each of the plurality of biological
samples.
76. The method of claim 50 wherein the designated genetic sequence
is selected from the group consisting of SEQ ID NO: 1; SEQ ID NO:
2; SEQ ID NO: 3; SEQ ID NO: 4; and SEQ ID NO: 5.
77. The method of claim 49 further comprising the steps of:
reviewing the designated genetic sequence; and designating a
portion of the designated genetic sequence as a target genetic
sequence.
78. The method of claim 77 further comprising the steps of:
transmitting the target genetic sequence to a supplier to create a
target-binding probe; and receiving the target-binding probe from
the supplier.
79. The method of claim 49 wherein the plurality of biological
samples comes from a genetic line.
80. The method of claim 49, wherein the plurality of biological
samples comes from a plurality of genetic lines.
81. A process for screening a plurality of biological samples in a
multi-well plate at a screening laboratory, the process comprising
the steps of: receiving an electronic communication from a remote
user, the communication including screening parameter selections;
entering the screening parameter selections into a laboratory
information management system of the screening laboratory;
receiving the multi-well plate at the screening laboratory; and
screening genomic DNA isolated from the plurality of biological
samples at the screening laboratory.
82. The process of claim 81 wherein the step of receiving an
electronic communication from a remote user includes the step of
receiving the electronic communication directly from the remote
user.
83. The process of claim 81 wherein the step of receiving an
electronic communication from a remote user includes the step of
receiving the electronic communication indirectly from the remote
user.
84. The process of claim 81 wherein the step of receiving
electronic communication from a remote user includes the step of
receiving a designation of an electronic accession number of the
multi-well plate, and further wherein the step of entering the
screening parameter selections includes the step of entering the
designated electronic accession number into the laboratory
information management system.
85. The process of claim 81 wherein the step of receiving the
multi-well plate includes the step of electronically scanning an
actual accession number on the plate.
86. The process of claim 85 wherein the step of electronically
scanning includes the step of barcode scanning the actual accession
number on the plate.
87. The process of claim 86, wherein the step of barcode scanning
the actual accession number includes the step of entering the
barcode scanned accession number into the laboratory information
management system.
88. The process of claim 85 further comprising the step of
comparing the actual accession number with the designated accession
number previously entered by the remote user when the remote user
ordered genetic scanning.
89. The process of claim 88 further comprising the step of
electronically communicating an arrival of the multi-well plate at
the laboratory to the remote user after the step of comparing.
90. The process of claim 88 further comprising the steps of posting
an arrival of the multi-well plate at the laboratory on a web site
after the step of comparing, wherein the remote user has password
protected access to the web site.
91. The process of claim 88 further comprising the step of the
e-mailing the remote user of an arrival of the plurality of
biological samples in the multi-well plate at the laboratory after
the step of comparing multi-well plate accession numbers.
92. The process of claim 81 wherein the step of receiving an
electronic communication from a remote user includes the step of
receiving the electronic communication from the remote user at the
laboratory.
93. The process of claim 81 wherein the screening parameter
selections include a selectable marker.
94. The process of claim 81 wherein the screening parameter
selections include identifying the number of lines to be
tested.
95. The process of claim 81 wherein the screening parameter
selections include a designated control.
96. The process of claim 81 wherein the screening parameter
selections include a designated genetic sequence.
97. The process of claim 96 further comprising the step of
electronically transmitting the designated genetic sequence to a
supplier.
98. The process of claim 81 further comprising the steps of:
receiving an electronic designation of a control sample from the
remote user; and receiving the control sample at the
laboratory.
99. The process of claim 98, wherein the step of receiving the
control sample at the laboratory includes the step of receiving the
control sample from the remote user.
100. The process of claim 98 wherein the step of receiving an
electronic designation of a control sample includes the step of
receiving an electronic identification of the zygosity of the
control sample from the remote user via the Internet.
101. The process of claim 98 wherein the step of receiving an
electronic designation of a control sample includes the step of
receiving an electronic identification of a copy number of the
control sample from the remote user via the Internet.
102. The process of claim 98 wherein the step of receiving an
electronic designation of a control sample includes the step of
receiving an electronic identification of a mosaic nature of the
control sample from the remote user via the Internet.
103. The process of claim 98 further comprising the step of
receiving an electronic designation of a probe sequence
complimentary to a portion of the designated genetic sequence.
104. The process of claim 81 wherein each of the plurality of
biological samples is a tissue sample and further wherein each is
contained in the corresponding well of a plurality of wells of the
multi-well plate, the method further comprising the steps of:
adding lysis buffer to each of the plurality of wells containing a
tissue sample to lysis the tissue; and producing cellular debris
including genomic DNA mixed with lysis buffer in each of the
plurality of wells.
105. The process of claim 104 further comprising the step of
transferring the genomic DNA from each of the plurality of wells to
a corresponding well in a second multi-well plate.
106. The process of claim 105 further comprising the step of adding
magnetic particles to each corresponding well in the second
multi-well plate.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. .sctn. 120
as a CONTINUATION APPLICATION of a co-pending application entitled
"System, Method and Apparatus for Transgenic and Targeted
Mutagenesis Screening" which was filed on Sep. 4, 2001, and was
assigned U.S. application Ser. No. 09/945,952 (the "'952
application"), the entire disclosure of to which is incorporated
herein by reference for all that it teaches. This application and
the '952 application also claim priority under 35 U.S.C.
.sctn.119(e), based on U.S. Provisional Application Ser. No.
60/230,371, filed Sep. 6, 2000, the entire disclosure of which is
incorporated herein by reference for all that it teaches.
FIELD OF THE INVENTION
[0002] This invention relates to a system for transgenic and
targeted mutagenesis screening. Additionally, this invention
relates to various methods to detect or screen for designated
genetic sequences or portion thereof derived from a tissue sample.
More specifically, this invention relates to a high volume
apparatus for transgenic and targeted mutagenesis screening.
BACKGROUND OF THE INVENTION
[0003] Genomic modification resulting from mutations in the DNA of
an organism can be transferred to the progeny if such mutations are
present in the gametes of the organism, referred to as germ-line
mutations. These mutations may arise from genetic manipulation of
the DNA using recombinant DNA technology or may be introduced by
challenging the DNA by chemical or physical means. DNA introduced
via recombinant DNA technology can be derived from many sources,
including but not limited to DNA from viruses, mycoplasm, bacteria,
fungi, yeast, and chordates including mammals such as humans.
[0004] Recombinant DNA technology allows for the introduction,
deletion or replacement of DNA of an organism. Random introduction
of DNA into a cell can be achieved by technologies such as
transfection (including electroporation, lipofection), injection
(pronuclear injection, nuclear transplantation) or transduction
(viral infection). Random mutations (point mutations, deletions,
amplifications) can be generated by treatment of cells with
chemical mutagens or submitting them to physical insult such as
X-irradiation or linear energy transfer irradiation (LET). Targeted
addition, deletion or replacement of DNA in an organism (either
inducible or non-inducible) is achieved via homologous
recombination. Inducible systems employ sequence-specific
recombinases such as Cre-LoxP (U.S. Pat. Nos. 5,654,182 and
5,677,177) and FLP/FRT (U.S. Pat. No. 5,527,695) (hereby
incorporated by reference).
[0005] Transgenic organisms are organisms that carry DNA sequences
(be it genes or gene segments) derived from another species, stably
integrated into their genome. Transgenic mammals are generally
created by microinjection of DNA into the pronucleus of fertilized
eggs, a technique in which the number of DNA copies or the
integration site of the DNA into the host genome is uncontrollable.
A transgenic line refers to an organism that transmits the foreign
DNA sequences to its offspring.
[0006] Targeted mutations, site directed mutagenesis or gene
targeting is described as methods that employ homologous
recombination of DNA to alter a specific DNA sequence within the
host genome. This can result in inactivation of a gene (knock-out
mutation), or genetic alteration of the gene (knock-in mutation).
In mammals this can be achieved by transfection of a cloned,
mutated gene segment (targeting construct) into embryonic stem
cells (ES cells), which, via homologous recombination, replaces the
endogenous gene segment in the ES cell. Animals derived from these
ES cells will carry the targeted mutation in their genome. Further
refinement of this technique involves inducible gene alteration, in
which the endogenous gene has been targeted with a DNA segment that
contains recognition sequences (LoxP or FRT sequences) for
site-specific recombinases (Cre, FLP). Expression of the
recombinase in the targeted ES cell or the ES cell-derived animal
will result in deletion of the DNA segment flanked by the
recognition sites. Depending on the configuration of targeting
construct, this can result in inactivation, activation or
alteration of the targeted gene. The advantage of an inducible
system in animals is that the gene alteration can be induced at any
point in time or in any tissue, depending on the ability to
specifically activate the recombinase. This can be achieved by
placing the recombinase under the control of inducible promoters
(chemically or hormone-inducible promoters).
[0007] Transgenic and targeted mutagenesis screening is used to
determine if a genome possesses specific genetic sequences that
exist endogenously or have been modified, mutated or genetically
engineered. Genomic DNA is screened for these modifications or
mutations. Genomic DNA is challenging to sufficiently immobilize on
the substrate because of its size. The genomic DNA includes both
coding and non-coding regions. Therefore, the genomic DNA contains
exons and introns, promoter and gene regulation regions, telomeres,
origins or replication and non-functional intergenic DNA. The
genomic DNA is a double stranded molecule which is methylated.
Immobilizing cDNA and PCR-amplicons differs in that the molecules
are much smaller. Additionally, biochemical modification events,
such as methylation, do not occur with the smaller molecules.
Shena, M (2000) DNA Microarrays: A Practical Approach. Oxford
University Press, New York, N.Y. (hereby incorporated by
reference).
[0008] Transgenic screening is currently done manually. The present
manual system is time-consuming and can provide variable results
depending on the laboratory and even depending on skill of
laboratory workers. Presently, a researcher using Southern blot
technology may require greater than a week to screen a tissue
sample for a transgene or a targeted mutation.
[0009] In an alternative technology, up to thirty PCR (polymerase
chain reaction) can be conducted in an Eppendorf microtube.RTM.
(Brinkmann Instruments, Westbury, N.Y.) and separated on a gel.
This process in most laboratories requires 3 to 7 days. A need
exists in the industry to provide a system and method for more
accurate, faster and high volume transgenic and targeted
mutagenesis screening.
SUMMARY OF THE INVENTION
[0010] The present invention provides a unique solution to the
above-described problems by providing a method and system for
automated transgenic and targeted mutagenesis testing.
[0011] The object of this invention is to provide higher volume
screening of transgenic and targeted mutagenesis samples for a
designated genetic sequence than by prior art methods. It is
another object of this invention to provide screening results to a
researcher more quickly than by prior art method to screen
transgenic and targeted mutagenic samples. These objects are
achieved by several features of this invention. These features
include depositing prokaryotic or eukaryotic genomic DNA on a
substrate and detecting the genomic DNA with a microarray imager to
facilitate high volume screening. Additionally, an order process
that provides a remote user's selection parameters to conduct
screening of a sample and provides the associated reagents, in a
coordinated way facilitates high volume screening of transgenic and
targeted mutagenesis samples for a designated genetic sequence. In
addition to this feature, screening of genomic DNA from cellular
lysate using magnetic particles and lysing the tissue sample with a
lysis buffer that is formulated to work while the to samples are in
transit to the screening laboratory from a remote user have been
found to facilitate high volume screening. It should be noted that
the techniques taught in the specification that enable higher
volume screening of genomic DNA for a designated genetic sequence
can be more broadly applied to by one skilled in the art to various
methods to detect genetic sequences in samples of genomic DNA.
[0012] According to another aspect of this invention, a method is
provided to detect a designated genetic sequence in a sample of
genomic DNA. This method involves depositing the genomic DNA on a
substrate; adding at least one labeled probe specific for a portion
of the designated genetic sequence; and detecting the signal from
at least one labeled probe specific for a portion of the designated
genetic sequence to detect the designated genetic sequence in the
sample of genomic DNA.
[0013] According to another aspect of this invention, a method is
provided to detect a designated genetic sequence in a sample of
genomic DNA, by comparing the sample with a designated control
sample of genomic DNA. This method involves the steps of:
depositing the genomic DNA from the sample at a first location on
the substrate; depositing genomic DNA from the designated control
sample at a second location on the substrate; adding at least one
labeled probe specific for a portion of the designated genetic
sequence to the first and second locations on the substrate;
detecting the signal from the at least one labeled probe specific
for a portion of the designated genetic sequence at the first and
second locations on the substrate, and comparing the signal from
the first and second locations on the substrate to detect a
designated genetic sequence in the sample of genomic DNA.
[0014] In another aspect of this invention, a method is provided to
detect a designated genetic sequence in a sample of tissue by
comparing the sample to a designated control sample of tissue. This
method comprises the steps of: treating the sample of tissue and
the designated control sample of tissue with a sufficient amount of
a lysis buffer to obtain cellular debris including genomic DNA;
separating the genomic DNA from the cellular debris for the sample
of tissue and the designated control sample of tissue; depositing
the genomic DNA from the sample at a first location on a substrate;
depositing the genomic DNA from the designated control sample at a
second location on the substrate; adding at least one labeled probe
specific for a portion of the designated genetic sequence to the
first and second locations on the substrate; detecting the signal
from the at least one labeled probe, specific for a portion of the
designated genetic sequence, at the first and second locations on
the substrate, and comparing the signal from the first and second
locations on the substrate to detect a designated genetic sequence
in the sample of tissue.
[0015] According to another aspect of the invention a method is
provided to detect a designated genetic sequence in a sample of
tissue by comparing the sample with a designated control sample of
tissue. This method comprises the steps of: treating the sample of
tissue and the designated control sample of tissue with a
sufficient amount of a lysis buffer to obtain cellular debris
including genomic DNA; separating the genomic DNA from the cellular
debris for the sample of tissue and the designated control sample
of tissue using magnetic particles; depositing genomic DNA from the
sample at a first location on a substrate; depositing genomic DNA
from the designated control sample at a second location on the
substrate; adding at least one labeled probe specific for a portion
of the designated genomic sequence to the first and second
locations on the substrate; detecting the signal from the at least
one labeled probe, specific for a portion of the designated genetic
sequence at the first and second locations on the substrate, and
comparing the signal from the first and second locations on the
substrate to detect the designated genetic sequence in the sample
of tissue.
[0016] According to another aspect of the invention a method is
provided to detect a designated genetic sequence in a sample of
tissue by comparing said sample with a designated control sample of
tissue. This method comprises the steps of: treating the sample of
tissue and the designated control sample of tissue with a
sufficient amount of a lysis buffer to obtain cellular debris
including genomic DNA; separating the genomic DNA from the cellular
debris for the sample of tissue and the designated control sample
of tissue using magnetic particles; adjusting genomic DNA
concentration to facilitate detection of the designated genetic
sequence; depositing genomic DNA from the sample at a first
location on the substrate; depositing genomic DNA from the
designated control sample at a second location on the substrate;
adding at least one labeled probe specific for a portion of the
designated genomic sequence to the first and second locations on
said substrate; detecting the signal from the at least one labeled
probe, specific for a portion of the designated genetic sequence at
the first and second locations on the substrate, and comparing the
signal from the first and second locations on the substrate to
detect the designated genetic sequence in the sample of tissue.
[0017] In another aspect of the invention, a method is provided of
screening a sample for a designated genetic sequence by comparing
said sample with a designated control sample of tissue the
screening method using at least one labeled target-binding probe
and at least one labeled refererice-binding probe. This method
involves the steps of: treating said sample of tissue and the
designated control sample of tissue with a sufficient amount of a
lysis buffer to obtain cellular debris including genomic DNA;
separating the genomic DNA from the cellular debris for the sample
of tissue and the designated control sample of tissue using
magnetic particles; depositing genomic DNA from the sample at a
first location on a substrate; depositing genomic DNA from the
designated control sample at a second location on the substrate;
adding at least one labeled probe specific for a portion of the
designated genetic sequence to the first and second locations on
the substrate; adding at least one labeled reference-binding probe
to the first and second locations on the substrate; detecting the
signal from the at least one labeled probe, specific for a portion
of the designated genetic sequence at the first and second
locations on the substrate, detecting the signal from at least one
labeled reference-binding probe at the first and second locations
on the substrate; and comparing the signal from the first and
second locations on the substrate to screen a sample for the
designated genetic sequence.
[0018] According to another aspect of the invention a method is
provided of screening genomic DNA for a designated genetic
sequence, wherein a tissue sample, including the genomic DNA, is
sent by a remote user to a screening laboratory. The method
involves the steps of: facilitating the extraction of genomic DNA
from a tissue sample by providing a lysis buffer to a remote user;
transmitting the tissue sample from the remote user to the
screening laboratory; receiving the lysed tissue sample at the
screening laboratory from the remote user; separating the genomic
DNA from the lysed tissue sample using magnetic particles;
depositing genomic DNA from the sample at a first location on a
substrate location; depositing genomic DNA from the designated
control sample at a second location on the substrate; adding at
least one labeled probe specific for a portion of the designated
genetic sequence to the first and second locations on the
substrate; adding at least one labeled reference-binding probe to
the first and second locations on the substrate; detecting the
signal from the at least one labeled probe, specific for a portion
of the designated genetic sequence at the first and second
locations on the substrate, detecting signal from at least one
labeled reference-binding probe to the first and second locations
on the substrate; and comparing the signal from the first and
second locations on the substrate to screening a sample for a
designated genetic sequence.
[0019] According to another aspect of the invention, a method is
provided of screening a sample of tissue for a designated genetic
sequence, by comparing the sample with a designated control sample
of tissue, wherein the tissue samples, including the genomic DNA,
are sent by a remote user to a screening laboratory. This method
comprises the steps of: facilitating the extraction of genomic DNA
from a tissue sample by providing a lysis buffer to a remote user;
treating the sample of tissue and the designated control sample of
tissue with a sufficient amount of the lysis buffer to obtain
cellular debris including genomic DNA; transmitting the tissue
samples in the lysis buffer from the remote user to the screening
laboratory; receiving the lysed tissue samples at the screening
laboratory from the remote user; separating the genomic DNA from
the cellular debris for the sample of tissue and the designated
control sample of tissue using magnetic particles; depositing
genomic DNA from the sample at a first location on a substrate;
depositing genomic DNA from the designated control sample at a
second location on the substrate; adding at least one labeled probe
specific for a portion of the designated genomic sequence to the
first and second locations on the substrate; detecting the signal
from the at least one labeled probe, specific for a portion of the
designated genetic sequence at the first and second locations on
the substrate, and comparing the signal from the first and second
locations on the substrate to screen the tissue sample for the
designated genetic sequence.
[0020] According to another aspect of the invention, a method is
provided of screening genomic DNA, in at least one sample, sent by
a remote user to a screening laboratory, for a designated genomic
DNA sequence, the remote user providing screening parameters via an
electronic communications link to the screening laboratory and a
supplier. This method comprises the steps of: transmitting an
access request from a remote user to a screening laboratory via an
electronic communications link; transmitting an access enabling
response from the screening laboratory to the remote user via an
electronic communications link, the access enabling response
including the screening parameters; selecting screening parameters
by the remote user; transmitting the selected screening parameter
selections from the remote user to the screening laboratory via an
electronic communications link; receiving screening parameter
selections from the remote user by the screening laboratory via
said communications link; transmitting a request from the remote
user via an electronic communications link to a supplier to obtain
probes conforming to selected screening parameters; receiving the
probes by said laboratory; transmitting the sample from the remote
user to the screening laboratory; conducting screening of the
sample, according to the selected screening parameters, to obtain
data; and transmitting the data to the remote user via an
electronic communications link.
[0021] According to another aspect of the invention, a method is
provided of screening genomic DNA, in at least one sample, sent by
a remote user to a screening laboratory for a designated genomic
DNA sequence, the remote user providing screening parameters via an
electronic communications link to the screening laboratory. This
method comprises transmitting an access request from a remote user
to a screening laboratory via an electronic communications link,
transmitting an access enabling response from the screening
laboratory to the remote user via an electronic communications
link, the access enabling response including the screening
parameters; selecting screening parameters by the remote user;
transmitting the selected screening parameter selections from the
remote user to the screening laboratory via an electronic
communications link; receiving screening parameter selections from
the remote user by the screening laboratory via the communications
link; transmitting a request from the screening laboratory via an
electronic communications link to a supplier to obtain probes
conforming to selected screening parameters; receiving the probes
by the screening laboratory, transmitting the sample from the
remote user to the screening laboratory, conducting screening of
the sample, according to the selected screening parameters, to
obtain data; and transmitting the data to the remote user via an
electronic communications link.
[0022] According to another aspect of this invention, a method is
provided of screening genetic DNA, in at least one sample, sent by
a remote user to a screening laboratory for a designated genomic
DNA sequence, the remote user providing screening parameters via an
electronic communications link to the screening laboratory. This
method comprises: transmitting an access request from a remote user
to a screening laboratory via an electronic communications link;
transmitting an access enabling response from the screening
laboratory to the remote user via an electronic communications
link, the access enabling response including the screening
parameters; selecting screening parameters by the remote user;
transmitting the selected screening parameter selections from the
remote user to the screening laboratory via an electronic
communications link; receiving selected screening parameter
selections from the remote user by the screening laboratory via the
communications link; transmitting a request from the screening
laboratory via an electronic communications link to a supplier to
obtain probes conforming to selected screening parameters;
receiving the probes by the screening laboratory; transmitting a
sample of tissue in a lysis buffer from the remote user to the
screening laboratory, the lysis buffer formulated to lysis the
tissue in the sample during transit time between the remote user
and the screening laboratory; conducting screening of the sample,
according to the selected screening parameters, to obtain data; and
transmitting the data to the remote user via an electronic
communications link.
[0023] According to another aspect of the invention, an automated
apparatus for high volume screening and targeted mutagenesis
screening of tissue samples sent by a remote user to a screening
laboratory is provided. This apparatus comprises means for
transmitting an access request from a remote user to a screening
laboratory via an electronic communications link; means for
transmitting an access enabling response from the screening
laboratory, to the remote user via an electronic communications
link with screening parameters; means for transmitting screening
parameter selections from the remote user to the screening
laboratory; means for transmitting the sample from the remote user
to the screening laboratory; means for isolating genomic DNA from
the sample; means for depositing the genomic DNA on a substrate;
means for screening genomic DNA; and means for transmitting the
data to the remote user.
[0024] According to another aspect of this invention, a high volume
apparatus for screening a tissue sample for modified or mutated
genomic DNA according to screening parameter selections made by a
remote user is provided. This apparatus includes an automated
accessioning station for removing liquid from a first well plate to
a second well plate; an isolation station for isolating genomic DNA
in the second well plates; an optical standardization station for
adjusting DNA concentration in the second well plate; an arraying
station for depositing the genomic DNA from the second testing well
plate on to a substrate; a hybridization station for hybridizing
labeled probes that bind to the portions of the genomic DNA; a
detection station for detecting the bound labeled probes; means for
making screening parameter selections by a remote user, the remote
user communicating with the apparatus through an electronic
communications link; and means for communicating screening results
to the remote user through an electronic communications link.
[0025] According to another aspect of the invention, a system of
screening genomic DNA in a sample for a designated genomic DNA
sequence is provided. The system includes a computer having a
processor, memory and web browser wherein the computer is adapted
to receive the screening parameter selections from a remote user;
and a workstation that analyzes samples of genomic DNA for the
screening parameter selections wherein the workstation includes a
microarray imager.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] A more complete understanding of the invention and its
advantages will be apparent from the following Description of the
Preferred Embodiment(s) taken in conjunction with the accompanying
drawings, wherein:
[0027] FIG. 1 is an illustrative overview of the remote automated
testing procedures of the present invention.
[0028] FIG. 2 is a block diagram of one embodiment of the
system.
[0029] FIG. 3 is a block diagram of the ordering procedure.
[0030] FIG. 4 is a block diagram of account registration.
[0031] FIG. 5 is a block diagram of survey of work.
[0032] FIG. 6 is an illustration of orientation for sample
identification and designation.
[0033] FIG. 7A is a block diagram of the laboratory process
system.
[0034] FIG. 7B is a block diagram of the laboratory process
system.
[0035] FIG. 7C is a block diagram of the laboratory process
system.
[0036] FIG. 7D is a block diagram of the laboratory process
system.
[0037] FIG. 8 is a block diagram of standard laboratory
stations.
[0038] FIG. 9 is an illustration of a heating cassette.
[0039] FIG. 10 is a screen display illustrating a document on the
transgenic screening laboratory's web site relating to an outcome
file.
[0040] FIG. 11 is a graphical representation of the results.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0041] The present invention provides a method and system for high
volume transgenic and targeted mutagenesis screening. This
invention provides a method for rapid identification of an
organism, whose genome possesses specific genetic sequences that
exist endogenously or has been modified, mutated or genetically
engineered. All patents, patent applications and articles discussed
or referred to in this specification are hereby incorporated by
reference.
[0042] 1. Definitions:
[0043] The following terms and acronyms are used throughout the
detailed description.
[0044] complementary--chemical affinity between nitrogenous bases
as a result of hydrogen bonding. Responsible for the base pairing
between nucleic acid strands. Klug, W. S. and Cummings, M. R.
(1997) Concepts of Genetics, fifth ed., Prentice-Hall, Upper Saddle
River, N.J. (hereby incorporated by reference)
[0045] copy number--the number of transgenes that have randomly
integrated into the genome.
[0046] deletion mutation--a mutation caused by the removal of one
or more nucleotides from a gene or chromosome.
[0047] designated genetic sequence--includes a transgenic insert, a
selectable marker, recombinant site or any gene or gene
segment.
[0048] DNA (deoxyribonucleic acid)--The molecule that encodes
genetic information. DNA is a double-stranded molecule held
together by weak bonds between base pairs of nucleotides. The four
nucleotides in DNA contain the bases: adenine (A), guanine (G)
cytosine (C), and thymine (T). In nature, base pairs form only
between A and T and between G and C; thus the base sequence of each
single strand can be deduced from that of its partner.
[0049] electroporation--the exposure of cells to rapid pulses of
high-voltage current which renders the plasma membrane of the cells
permeable and thus allowing transfection.
[0050] embryonic stem cells (ES cells)--a cell of the early embryo
that can replicate indefinitely and which can differentiate into
other cells; stem cells serve as a continuous source of new
cells.
[0051] genome--all the genetic material in the chromosomes of a
particular organism;
[0052] its size is generally given as its total number of base
pairs.
[0053] genomic DNA--all of the genetic information encoded in a
cell. Lehninger, A. L., Nelson, D. L. Cox, M. M. (1993) Principles
of Biochemistry, second ed., Worth Publishers, New York, N.Y.
(hereby incorporated by reference)
[0054] genotype--genetic constitution of an individual cell or
organism.
[0055] germ-line--unmodified genetic material transmitted to
progeny via gametes.
[0056] gene targeting--the creation of a null or mutant allele by
homologous recombination or gene replacement.
[0057] heating cassette--housing mechanism for glass substrates
while heating
[0058] imaging cassette--housing mechanism for glass substrate
while imaging
[0059] inducible gene targeting--a method of gene targeting that
allows the inducible inactivation (or activation) of a targeted
gene by experimental manipulation, such as administration of a
drug. Example: Cre recombinase is a site-specific recombinase that
catalyzes the excision of DNA flanked by lox recognition sequences.
Since the promoter for Cre expression is sensitive to the drug
interferon, targeted deletion is inducible.
[0060] Internet--a collection of interconnected (public and/or
private) networks that are linked together by a set of standard
protocols to form a global, distributed network. The World Wide Web
(hereinafter web) refers to both a distributed collection of
interlinked, user viewable hypertext documents (commonly referred
to as web pages) that are accessible via the Internet and the user
and server software components which provide user access to such
documents using standard Internet protocols.
[0061] line--A line is a colony bred for a genetic condition.
[0062] lipofection--the introduction of transgenes across cell
membranes by using liposome vesicles formed by phagocytosis. This
method is advantageous in that it is tissue-specific.
[0063] microarray imager--is a reader used to detect luminescence
from samples bound or affixed to an optically flat substrate.
[0064] microarray technology--is a hybridization-based process that
allows simultaneous quantitation of many nucleic acid species, has
been described (M. Schena, D. Shalon, R. W. Davis, and P. O. Brown,
"Quantitative Monitoring of Gene Expression Patterns with a
Complementary DNA Microarray," Science, 270(5235), 467-70, 1995; J.
DeRisi, L. Penland, P. O. Brown, M. L. Bittner, P. S. Meltzer, M.
Ray, Y, Chen, Y. A. Su, and J. M. Trent, "Use of a cDNA Microarray
to Analyze Gene Expression Patterns in Human Cancer," Nature
Genetics, 14(4), 457-60 ("DeRisi"), 1996; M. Schena, D. Shalon, R.
Heller, A Chai, P. O. Brown, and R. W. Davis, "Parallel Human
Genome Analysis: Microarray-Based Expression Monitoring of 1000
Genes," Proc. Natl. Acad. Sci. USA., 93(20), 10614-9, 1996; hereby
incorporated by reference. This technique combines robotic spotting
of small amounts of individual, pure nucleic acids species on a
glass surface, hybridization to this array with multiple
fluorescently labeled nucleic acids, and detection and quantization
of the resulting fluor tagged hybrids with a scanning confocal
microscope. This technology was developed for studying gene
expression.
[0065] microinjection--a technique for introducing a solution of
DNA into a blastocyst or pronucleus of a fertilized egg using a
fine microcapillary pipette.
[0066] mutation--a heritable change in DNA sequence resulting from
mutagens. Various types of mutations including frame-shift
mutations, missense mutations, and nonsense mutations.
[0067] null mutation--completely eliminates the function of a gene,
usually because it has been physically deleted.
[0068] recombination--The process by which offspring derive a
combination of genes different from that of either parent. In
higher organisms, this can occur by crossing over.
[0069] recombinant DNA--A combination of DNA molecules of different
origin that are joined using recombinant DNA technologies.
[0070] retroviral infection--retroviral vectors with recombinant
DNA incorporate their genome into the chromosomes of cells it
infects.
[0071] selectable marker--an approach to facilitate the detection
of targeted cells by decreasing the detection of random integrants
rather than increasing targeting efficiency. There are two types of
selectable genes: designated and negative. A designated selector
gene, such as neomycin, confers resistance to drugs normally lethal
to the cell. Cells that have incorporated neomycin into their
genome by homologous recombination will be resistant to the drug
neomycin. Conversely, non-homologous recombination events will
retain the negative selector gene. The negative selector gene, such
as HSV-tk, confers sensitivity to certain drugs (cells expressing
HSV-tk are sensitive to gancyclovir) resulting in cell death. A
selectable marker is a genetic sequence.
[0072] site specific recombinase--an enzyme that promotes
recombination between specific DNA sequences.
[0073] secondary well plate--plate DNA is printed from.
[0074] source well plate--The plate that remote user fills with
sample and lypholized reagent.
[0075] targeted deletion--technique for inactivating a gene by
deleting it from the genome. May be accomplished by homologous
recombination or inducible gene targeting.
[0076] targeted mutagenesis--alteration of the germline by the
introduction of a site-directed mutation.
[0077] transfection--the uptake, incorporation, and expression of
recombinant DNA by eukaryotic cells.
[0078] transgene--the foreign gene or DNA.
[0079] transgenic--this term describes an organism that has had
genes from another organism put into its genome through recombinant
DNA techniques. These organisms are usually made by microinjection
of DNA in the pronucleus of fertilized eggs, with the DNA
integrating at random.
[0080] transgenic line--a transgenic mouse or organism strain in
which the transgene is stably integrated into the germline and
therefore inherited in Mendelian fashion by succeeding
generation.
[0081] web site--a computer system that serves informational
content over a network using the standard protocol of the World
Wide Web. A web site corresponds to a particular Internet domain
name such as TransnetYX.com.
[0082] 2. Overview of the Systems Components and Operations:
[0083] The present invention provides a method and system for
transgenic and targeted mutagenesis screening. A system and method
operating according to the features described herein can be used to
screen about 2000 samples per day, (using only an automated
arrayer) or if fully automated about 100,000 samples per day.
Additionally, a system and method operating according to the
features described herein can provide screening results to a remote
user 1 from the screening laboratory 20 within 48 hours of
receiving the screening parameter selections for a plurality of
samples.
[0084] FIGS. 1-3 present an overview of certain features of the
present invention. The present invention allows a remote user 1
with access to a computer 5 to order transgenic and targeted
mutagenesis screening of samples they submit to the transgenic or
targeted mutagenesis screening website 19, hereinafter screening
laboratory. Using the Internet or other communication link 7, the
remote user 1 sends an access request 7 from the remote user's
computer 5 to a screening laboratory computer 9 via an electronic
communication link 7, such as the Internet. The screening
laboratory website 16 will transmit an access enabling response to
the remote user 1 via an electronic communication link, such as the
Internet. This response includes three distinct sections. The three
sections are Account Registration 21, Survey of Work 23 and Sample
Identification and Designation 25.
[0085] Now referring to FIG. 2, a remote user 1 can access
screening laboratory's website 19 via a communication link 7. The
website 19 can be housed by an order manager 22 such as
Dotlogix.RTM. (Memphis, Tenn.). An order manager is a software
ordering management system. In the preferred embodiment the
software is the order management system developed by SpaceWorks,
Inc. of Rockville, Md., and now provided by Manugistics Group,
Inc., of Rockville, Md. The order manager 22 functions to manage
the placement of the order and houses the web site 19. The order
received from the remote user 1 as recorded in the website 19, is
reported to order manager 22, which is in electronic communication
7 with the screening laboratory computer 9. The screening
laboratory computer 9 includes LIMS 24, which is communicatively
coupled to a process controller 26.
[0086] LIMS 24 is the generic name for laboratory information
management system software. The function of LIMS 24 is to be a
repository for data, control automation of a laboratory, track
samples, chart work flow, and provide electronic data capture. LIMS
24 can also, in another embodiment, be in direct communication with
the remote user 1 via an electronic communications link 7. Any
standard laboratory information system software can be used to
provide these functions. In the preferred embodiment, the
Nautilus.RTM. program (Thermo LabSystems, a business of Thermo
Electron Corporation, Beverly, Mass.) is used.
[0087] The process controller 26 is communicatively coupled to the
workstation 14. The process controller provides commands to any
portions of the workstation 14 that are amenable to automation.
See, e.g. Layne et al., U.S. Pat. No. 5,968,731 (hereby
incorporated by reference). For example, the process controller 26
directs the delivery of the probes to the substrate 229 in the
hybridization station 96. The workstation 14 is communicatively
linked 28 to LIMS 24. In this way, the workstation 14 can provide
data to LIMS 24 for the formulation of the outcome report 249, via
an electronic communication link 7, such as the Internet, to the
order manager 22 or remote user 1. In an alternative embodiment,
the remote user 1 can be linked 7 to the screening laboratory 20 by
a direct phone line, cable or satellite connection.
[0088] Now referring to FIG. 4, the user's Account Registration
section 21 requires upon receiving access to the screening
laboratory's web site, a remote user 1 accesses an existing account
by entering an account number 31. The user will then enter a
password. The user is asked whether the user is the primary user 33
or another authorized user 35. If a valid password is entered, the
user can place a new order 39. Alternatively, the user can check an
order status 41 by providing an order number 43 and can proceed to
tracking 45. Alternatively, a new account 47 can by opened by
providing institution name, principal investigator, address, phone
number, fax number, electronic mail address, billing information,
other authorized user names 49. A password is selected 51,
confirmed 53 and billing information 55 is provided by the
user.
[0089] The Survey of Work section 23 has a drop down section that
allows a user to make screening parameter selections. Now referring
to FIG. 5, these selections include designating if the samples are
transgenic 60 or targeted mutations 70.
[0090] A transgenic organism has genes from another organism put
into its genome through recombinant DNA techniques. These animals
are usually made by microinjection of DNA into the pronucleus of
fertilized eggs, with the DNA integrating at random. The number of
copies of the transgene that integrates into the genome is
uncontrollable. A transgenic line refers an organism strain in
which the transgene is stably integrated into the germ-line and
therefore inherited in Mendelian fashion by succeeding generations.
A transgene is any foreign DNA sequence or gene.
[0091] In the preferred embodiment, mice, i.e. the Genus Mus, are
screened for transgenic and targeted mutations. Some of the probes
designated in the Survey of Work section 23 are derived from Mus.
Additionally, a genetic sequence present in all members of a
species is used by the screening laboratory 20 as screening
reference. For example, in the Genus Mus, the major urinary protein
MUP can be a reference genetic sequence. Hogan, B., Beddington, R.,
Constantini, F. and Lacy, E. (1994) Manipulating the Mouse Embryo,
second ed. Cold Springs Harbor Laboratory Press, Cold Springs
Harbor, N.Y. (hereby incorporated by reference.)
[0092] All species of Mus can be screened with this method.
Additionally, it is anticipated that other species can be screened
according to the present methods. It is well within the ability of
one skilled in the relevant art to make screening parameter
selections for a different species and for the screening laboratory
to select a reference genetic sequence for a different genus
species.
[0093] If the samples are transgenic 60, the remote user 1 is asked
to designate the genetic sequence 61, i.e. the transgenic insert,
the number of lines to be tested, the number of samples per line
62, and the target genetic sequence to be targeted per line 63. The
target genetic sequence is a portion of the designated genetic
sequence and it corresponds to the sequence of the probe. The
remote user 1 is asked to identify the probe sequence that is
needed to be used for screening (usually 17 to 30 base pairs) per
line 64, which is complementary to a portion of the designated
genetic sequence. It should be noted that wherever the term
"screening" is used, these processes also refer to "detecting". The
probe sequence is complementary to the target genetic sequence. The
remote user 1 identifies a probe sequence 64 that will hybridize,
i.e. bind the target genetic sequence 63, if it is present in the
sample. This probe sequence is then communicated to a supplier and
the target-binding probe made by the probe provider will include
this sequence.
[0094] The remote user 1 is then asked to identify
characterizations 65 about the designated control(s) provided by
the remote user 1. The designated control is a genomic DNA sample
known to have the designated genetic sequence. The designated
control is submitted by the remote user 1 to the screening
laboratory 20. Additionally, the remote user 1 provides certain
characterizations known about the designated control, including
identifying the zygosity, copy number and the mosaic nature of the
designated control. The unknown samples copy number can be
extrapolated and may accompany the quantitative results relative to
the designated control sample.
[0095] With respect to targeted mutagenesis screening 70, the
remote user 1 is asked to identify the number of lines and samples
71. The remote user 1 is asked if the genetic modification is a
knock-out or knock-in 72. If the remote user 1 designated that a
selectable marker is present 73, then a choice of marker will be
presented to the user 74. The selectable marker sequence is the
designated genetic sequence. Common selectable markers include, but
are not limited to, the genetic sequence for neomycin resistance,
hygromycin resistance and puromycin resistance. Once the remote
user 1 identifies which selectable marker is present, the genetic
sequence is then presented to the user 1.
1 Neomycin Sequence SEQ ID NO:1)
ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGG
TGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCT
GCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGT
TCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAG
GACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT
GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT
GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACGTT
GCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGC
TGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAA
ACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTC
GATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCC
GAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGAT
CTCGTCGTGACCCATGGCGATGCCTGCTTGCGGAATATCATGGTGG
AAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGT
GGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCT
GAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACG
GTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTT GACGAGTTCTTCTGA
Hygromycin Sequence (SEQ ID NO:2)
ATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTG
ATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAG
GGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGA
TATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGAT
CGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGG
AAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCA
TCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAA
CCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATG
CGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCAT
TCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCA
TATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGA
TGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGC
TGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGC
ACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCA
TAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCC
AATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTT
GTATGGAGCAGCAGACGGCGCTACTTCGAGCGGAGGCATCCGGAG
CTTGCAGGATCGCCGCGGCTCCGGGCGTATATGGTCCGCATTGGT
CTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGAT
GCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGG
AGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGG
CCGTCTGGACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAA
ACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAG Puromycin Sequence (SEQ ID
NO:3) ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGA- CGTCCC
CCGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGC
GCCACACCGTCGACCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAA
GAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGC
GGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAG
CGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGT
TCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCG
GCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACC
ACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCG
GCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAA
CCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGT
GCCCGAAGGACCGCGCGACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA
[0096] The remote user 1 is asked to review the sequence
base-by-base and confirm that the sequence presented is indeed
present in their sample 74. A portion of the selectable marker is
designated as the target genetic sequence 63. The probe sequence is
designated 64. The probe sequence 64 binds to the target genetic
sequence 63.
[0097] If the remote user 1 indicates that the selectable marker
has been removed or that the sample has undergone site-directed
recombinant mutations 75. The remote user 1 is directed to indicate
which recombinant technology was employed to mutate their samples.
The remote user 1 is presented with common recombinant
technologies, which may include, but are not limited to Cre-lox 78
and yeast FLP/FRT 79. After selecting one of the techniques a
sequence such as
2 (SEQ ID NO:4) ATAACTTCGTATA ATGTATGC TATACGAAGTTAT and (SEQ ID
NO:5) GAAGTTCCTATAC TTTCTAGA GAATAGGAACTTC C GAATAGGAACTTC
CTTCAAGGATATG AAAGATCT CTTATCCTTGAAG G CTTATCCTTGAAG
[0098] is presented to the remote user 1, which correlates to Lox-p
site 78 and FRT site 79, respectively. The remote user 1 is asked
to review the sequence base-by-base and confirm that the sequence
presented is indeed present in their sample. The recombinant sites
are the designated genetic sequences for selectable marker removal.
The remote user 1 designates a target genetic sequence that
corresponds to a portion of the recombinant sequence 78 or 79. The
remote user 1 identifies a probe sequence 77 that will hybridize,
i.e. bind the target genetic sequence 63 if it is present in the
sample. This probe sequence 77 is then communicated to a supplier
and made according to the designation.
[0099] The remote user 1 is then asked to identify
characterizations about the designated control(s) provided by the
remote user 1. The designated control is a genomic DNA sample known
to have the designated genetic sequence. The designated control is
submitted by the remote user 1 to the screening laboratory 20.
Additionally, the remote user 1 provides certain characterizations
known about the designated control, including identifying the
zygosity, copy number and the mosaic nature of the designated
control. The unknown samples copy number can be extrapolated and
may accompany the quantitative results relative to the designated
control sample.
[0100] In the preferred embodiment, remote user 1 is asked to
identify their name, unique pre-registered account number, password
and submit their order to the company. The insert for a transgenic
sample or genetic sequence of the selectable marker for targeted
mutagenesis screening can be collectively referred to as the
designated genetic sequence. The target is any subset of the
designated genetic sequence.
[0101] Now referring to FIG. 6, once the remote user 1 submits the
Survey of Work section the remote user 1 will be presented with the
Sample Identification and Designation section 25. The Sample
Identification and Designation section 25 includes 96 well plate
locations. The remote user 1 designates which sample was placed
into each well. If the remote user 1 has more than 96 samples,
subsequent 96 source well plates and designations are available.
With respect to FIG. 6, a 96 well plate having a barcode accession
number 3 will be shown oriented in the longitudinal direction
having X axis labeled H to A and Y axis labeled 1 to 12 80. The X
and Y axes designate a well position such as A1 81.
[0102] Now referring to FIG. 6, the remote user 1 is asked to
provide: plate accession number 82, number of lines 83, genetic
line identification 84, number of samples 85, target sequence 86,
probe sequence 87 and well location 88. The remote user 1 is then
asked if the material deposited in well A1 is a control. If the
material is a control 89, than the remote user designates the
zygosity, mosaic nature and copy number of the material 90. If all
of these parameters are not known, then the remote user enters as
much information as is known. The remote user 1 is then asked for
any internal sample identification number 91.
[0103] Now referring to FIGS. 1 and 2, the remote user 1 transmits
his or her order including the completed screening parameter
selection to the screening laboratory 20 via a form of electronic
communication 7 such as the Internet or a direct line. The remote
user 1 can transmit the selected screening parameter selections to
the screening laboratory via an electronic communications 7 link.
This link 7 can be direct or indirect. In the indirect route, the
screening parameters are transmitted to web site 19, wherein order
manager 22 provides LIMS 24 with the screening parameter
selections. In the preferred embodiment, the order generates two
electronic messages, which will be sent to different locations. The
first message is cross-referenced in LIMS 24 with a list of stocked
probes. If the probe designated by the user is not stocked, an
order message is sent to a supplier 16, such as a contracted probe
provider. This request can be transmitted from remote user 1 to
screening laboratory 20 via any form of electronic communication,
and then via a form of electronic communication 10 to suppliers'
computer 8, or in the alternative, the order message can go from
user 1 via any form of electronic communication 12 to suppliers'
computer 8.
[0104] This supplier 11 creates the probe that the remote user 1
has designated in their order for the screening the genomic DNA for
the designated genomic sequence. The made to order probe can be
referred to as the target-binding probe. This supplier 11 will then
barcode and overnight ship 13 the target-binding probe to the
screening laboratory 20. Once the target-binding probes for each
order for that days screening, is received by screening laboratory
20, the barcodes on the target-binding probes are scanned into LIMS
24. The LIMS 24 records the date and time the target-binding probes
were received along with the quality control data provided from the
probe provider.
[0105] In the preferred embodiment, the target-binding probes are
placed on in workstation 14 and LIMS 24 will record the barcode of
the probe and record its specific location on the deck of the
workstation 14, as will be discussed in more detail with respect to
the Hybridization Station 96. Additionally, the screening
laboratory 20 and the LIMS 24 system correlates which
target-binding probes will be used on which samples, as will be
discussed in more detail with regard to the Hybridization Station
96.
[0106] The second message, in the preferred embodiment, that is
generated from the order placement of the remote user 1 will be to
ensure the users have the proper supplies to package and ship their
samples. This message will define the number of well plate(s),
shipping labels and amount of reagents needed for the user. This
request will be cross-referenced with an inventory list located in
LIMS 24 at the remote user's location. This request can be sent
from the remote user 1 to laboratory 20 via any form of electronic
communication 7, and then via a form of electronic communication 10
to suppliers 11 or suppliers' computer 8, or in the alternative,
the request can go from the remote user 1 via any form of
electronic communication 12 to suppliers 11. If the appropriate
amount of supplies are located within the user's facility a message
will be sent to the user defining the location where they can
procure the shipping material needed. However, upon
cross-referencing known inventories if a sufficient number of
supplies cannot be confirmed at the user's location these items
will then be packaged 18 and shipped to the user 14. The remote
user 1 will receive a message to inform them that materials are
being shipped to them with an expected time of arrival.
[0107] Once the remote user 1 procures or receives these supplies,
they place the appropriate samples into the source well plates 2.
The samples can be obtained from prokaryotic or eukaryotic
organisms. The samples may be a tissue sample from a mouse 8, but
can also come from other animals and plants. In the preferred
embodiment, mouse tails or ears are snipped to provide a tissue
sample. A source well plate 2 is a 96 well plate or the like that
receives the tissue sample and a sufficient amount of lysis buffer
to cover the tissue sample during transit to the screening
laboratory 20. A source well plate 2 has an accession number 3
affixed to the side of the plate. The accession number is used by
LIMS 24 to track the source of well plate 2. The remote user 1
places the appropriate samples into the well locations in the
source well plate 2 that they had previously designated while
placing their order FIG. 6. Once the samples are in the proper
wells in the source well plate 2 then the remote user 1 dispenses a
predetermined amount of reconstituted lyophilized buffer 4 to cover
the sample into each well using a pipette. The buffer is formulated
to lysis the tissue to obtain cellular debris including genomic
DNA. More specifically, the buffer is formulated to lysis the
sample while in transit between remote user 1 and the screening
laboratory 14. The transit time is approximately 24 hours as all
samples are shipped via an express delivery service, such as
FedEx.RTM. (Memphis, Tenn.). More specifically, for example, the
buffer can be made of (4M Urea, 0.1 M Tris-HCl (pH.about.7.5), 1-mM
NaCl, 10 mM EDTA, 1% SDS, 5 mM DDT and 415 mg of proteinase K and
RNase). The remote user 1 will add lysis buffer 4 to each well of
the source well plate 2. The buffer 4 should completely cover the
samples. Once the samples and lysis buffer are in the source well
plate 2 then a seal will be placed on the top of the source well
plate 2 preventing samples from leaking. A plastic lid will then be
placed on the seal for transportation. The remote user 1 will then
place the source well plate 2 into an overnight delivery service
package 15. The remote user 1 will then seal the package and ship
16 to screening laboratory 20, and apply a barcode shipping
label.
[0108] Now referring to FIG. 7A-D, the preferred embodiment of the
present invention is shown. In FIG. 7A, the source well plates 2
arrive 101 at the screening laboratory 20. The tracking number of
the shipping label is read with a barcode reader 103. If the
shipping label is unreadable 105, the tracking numbers are manually
entered 107. The scanning of the tracking number is received 104 in
LIMS 24 and a received message is posted to the user's account as
shown in tracking field. The source well plates 2 are removed from
the package and taken to a clean room 109. The source well plates 2
contain the raw biological matter and lysis buffer. The source well
plates 2 individual barcodes are scanned by the barcode reader 111
and recorded 106 in LIMS 24 as accession numbers. LIMS 24 can send
106 a probe order to supplier 11 through the order manager 22. If
the source well plates 2 individual barcodes are unable to be
scanned 113, the accession numbers are entered manually 115. If the
tracking number, accession number user order and worklist properly
correlate, LIMS 24 will activate (not shown) an active record
number for the plates.
[0109] The source well plates 2 are loaded 116 into a
transportation apparatus in a clean room. A transportation
apparatus is any device that holds well plates and that can dock
with the workstation. The transportation apparatus, in the
preferred embodiment, includes several rigid trays stacked
vertically in a housing unit that is mobile. This transportation
apparatus can be moved between different automated stations, docked
and the rigid trays can be removed in an automated fashion and
processed on the deck of a workstation. Each rigid tray consists of
nine locations for well plates. Each of these nine locations per
tray has a unique barcode designating its specific location inside
the transportation module.
[0110] The source well plate 2 accession number 3 is scanned with a
barcode reader and the bar-coded well plate location in the
transportation apparatus is scanned. The barcodes of the source
plates 2 are married 106 in LIMS 24 with the unique barcode
locations in the transportation apparatus for tracking purposes.
The source well plate 2 is physically placed 117 into the
transportation apparatus. LIMS 24 records and associates 106 the
well plate to this location. Once the transportation apparatus is
loaded with the source well plates 2, the transportation apparatus
is docked 119 into the workstation 14.
[0111] LIMS 24 will generate a worksheet for laboratory personnel
(not shown). The worksheets outline the number of assay plates
required and the various probes that will be needed. The LIMS 24
worklist will generate a single file. The file format may include,
but is not limited to, ASCII, XML or HTML. The file will be written
into a specified directory on the network drive. The name of the
file will be unique and will correlate to a run number. The
extension will be unique for worklist files.
[0112] We now refer to FIG. 8, a block diagram depicting one
embodiment of the workstation. Standard laboratory stations are
logical groupings of laboratory operations. These groupings,
however, do not necessarily refer to different physical stations.
These groupings include: Automated Accessioning Station 92,
Isolation/Purification Station 93, Optical Standardization Station
94, Arraying Station 95, Hybridization Station 96 and Detection
Station 97.
[0113] The following description provides the preferred embodiment,
although one skilled in the art could elect to conduct these
methods with varying degrees of automation as required.
[0114] 3. Automated Accessioning Station 92
[0115] An Automated Accessioning Station 92 provides a device to
remove liquid from the source well plate 2 to the primary master
well plate. The primary master well plate is the plate in which the
DNA is isolated. Any commercially available automated accessioning
device can perform this function such as Genesis.RTM. Tecan
(Raleigh-Durham, N.C.) or Multimeck.RTM. Beckman (Indianapolis,
Ind.). These devices are referred to as liquid handlers. The liquid
handler delids the rigid plastic cover of the source plate 121. In
the preferred embodiment, liquid detection is performed by the
liquid handler by piercing the barrier sealing mechanism 123. The
liquid handler performs liquid detection to verify the existence of
the original sample 125. The source well plates 2 barcodes are
re-scanned 127. This measurement will be recorded and posted 108
into the LIMS 24 database and reflected in the outcome report 249.
Additionally, LIMS 24 ensures 108 that well plates are consistent
from transportation apparatus to the Automated Accessioning Station
92. Error codes will be generated if insufficient amount of raw
testing material is available. The liquid handler utilizes
stainless steel, or the like, pipette tips that are washed between
each sample transfer.
[0116] The DNA is transferred 129 to clean well plates, referred to
a primary master well plate. The barcodes of the primary master
well plates are scanned 131 and LIMS 24 marries 102 to the new
barcodes for the primary well plates. The automated process
accessioning continues until all of the days pending samples are
accessioned into the primary master well plates.
[0117] 4. Isolation/Purification Station 93
[0118] The tray of primary matter well plates is moved by the
transportation apparatus to the Isolation/Purification Station 93.
In this station, the genomic DNA will be isolated and purified
using a separation method such as magnetic or paramagnetic
particles. The term "magnetic" in the present specification means
both magnetic and paramagnetic. The magnetic particles can range
from 0.1 micron in mean diameter to 100 microns in mean diameter.
The magnetic particles can be functionalized as shown by Hawkins,
U.S. Pat. No. 5,705,628 at col. 3 (hereinafter '628 patent hereby
incorporated by reference). In the preferred embodiment, the
magnetic particles are 1 micron carboxylated iron core particles,
but other magnetic particles with different functional groups of
different size can be used.
[0119] For example, in the Isolation/Purification Station 93, each
well of the primary master well plate is filled with magnetic
particles 133. The particles are dispensed into the well via a
syringe pump. A second syringe pump dispenses a binding buffer into
the wells containing the raw biological material and active
particles 133. The dispensing itself may be sufficient to
facilitate mixing of the samples. A secondary mixing mechanism,
such as a tip can aspirate and redispense the liquid. A binding
buffer, such as, 20% polethylene glycol (PEG) 8000, 0.02% sodium
azide and 2.5M sodium chloride is used to non-specifically bind the
genomic DNA to the surface chemistry of the magnetic particles. The
PEG allows for hydrogen binding of water, which causes
concentration of the DNA. Additional binding parameters are
disclosed in Hawkins' 628 patent. The particles, binding buffer and
raw biological material are allowed to incubate at room temperature
for ten minutes. After incubation, a magnet contacts the bottom of
the primary master well plates for several minutes, i.e. two to six
minutes 137. The magnetic particles with attached genomic DNA are
magnetically attracted to the bottom of the master well plates
forming a pellet of particles. The supernatant is removed 139. A
wash buffer, for example 70% ethanol and 30% de-ionized water, is
used to resuspend the particles 141. The magnetic particles with
the attached genomic DNA are separated from the supernatant using a
magnet 143. The supernatant is aspirated 145. The particle washing
step is repeated two to four times.
[0120] The primary master well plates with pelletized particles are
air dried 147. In an alternative method, the pelletized particles
can be dried with compressed nitrogen. Once the particles are
completely dry, the magnet is removed 149. The particles with
attached genomic DNA are resuspended in a suspension buffer 151. A
suspension buffer formulated to elute the bound DNA from the
particles. An example of one such suspension buffer is 0.01 M Tris
(pH 7.4), 0.02% Sodium Azide or Sodium Saline citrate (SSC),
dimethyl sulfoxide (DMSO), sucrose (20%) or foramide (100%). In the
preferred embodiment, the primary master plates are heated 153 to
80.degree. C. for two minutes to disassociate the DNA from the
particles.
[0121] After heating and resuspending the DNA in solution, the
magnetic particles are separated from the purified DNA using a
magnet 155. The supernatant is removed 157 from the particles and
is pipetted into a secondary well plate 2. The barcode of the
secondary well plate is read. LIMS 24 will correlate the barcodes
of the primary and secondary well plates 114. A small amount (1-10
.mu.l) of DNA supernatant is pipetted 159 into a clean bar-coded
optical 1536 well plate.
[0122] If a fully automated system is desired, the magnetic
separator can be automated and rise from the bottom of the
workstation and make contact with bottoms of all primary well
plates simultaneously.
[0123] In one embodiment, the genomic DNA can be sonicated before
or after separation with the magnetic particles 161. In the
preferred embodiment, the genomic DNA is sonicated after separation
from the cellular debris. Sonication can be done by any
conventional means such as a fixed horn instrument. In the
preferred embodiment, the genomic DNA is sonicated for 5 minutes to
produce DNA fragments. Although there is a wide range of fragments
from about 100 base pairs to up to 1 kilobase, the average size of
the fragment is around about 500 base pairs (about meaning 50 base
pairs).
[0124] 5. Optical Standardization and Well Plate Station 94
[0125] Optical Standardization involves DNA quantification. An
optical plate, such as a 1536 well plate with a clear bottom from
which an absorbent reading can be measured, is provided. In the
preferred embodiment, a 1536 ULTRAMARK (Bio-Rad, Hercules, Calif.)
is used. The barcode of the optical plate is scanned 161. Small
aliquots of DNA supernatant from the secondary master well plates
are tracked 110 via LIMS 24 to specific well locations within the
DNA concentration optical well plate. The optical well plate is
subjected to a DNA concentration analysis 163. This analyses
involves an optical density scan (260/280 ratio) or a fluorometry
as known by one skilled in the art. The DNA concentration values
are quantified and recorded 112 in LIMS 24.
[0126] The concentration of genomic DNA in the secondary well is
preferably adjusted to be within the range of about 12.5 to 500
ng/.mu.l of fluid in the secondary master well plate and more
preferable to be within the range from 17 ng to 250 ng/.mu.l of
fluid in the secondary master well plate.
[0127] The optical standardization station 94 performs adjustments
based on known sample volumes in secondary master well plates with
the known DNA concentration to calculate the volume to hydrate or
the time to desiccate each sample. The secondary well plate samples
may be hydrated with de-ionized water by the automated liquid
handler system to decrease the DNA concentration 165. Conversely,
samples may be desiccated for a calculated time frame with
compressed gas to concentrate the DNA samples 167. If the DNA
concentration is zero or the quantification value falls below the
parameters for optimization the LIMS 24 will generate an
insufficient quantity report to be noted on the outcome report (not
shown). The optimized sample 169, in the secondary master well
plates are re-scanned for concentration verification 171.
[0128] 6. Arraving Station 95
[0129] In the Arraying Station 95, a sample of genomic DNA from the
secondary well plate is deposited on a substrate 229. A substrate
is shown in FIG. 9. A substrate 229 is optically flat so that it
can be scanned with a laser and it includes a sufficient number of
functional groups to bind the genomic DNA to be screened. The
substrates 229 may be glass, plastic, membranes, or a combination
of the elements. Typically, the substrates 229 have some surface
chemistry attached. These surface chemistries include by not
limited to amine groups, aldehydes groups or polylysine. The
reactive groups covalently or non-covalently attach the nucleic
acid (DNA, cDNA, EST, Amplicon, etc.) to the surface of the
substrate 229. In the preferred embodiment, aldehyde function
groups (5.0.times.10.sup.12), reactive groups per cm are affixed to
optically flat glass slide. The slide (SMA-1000) is purchased from
TeleChem International, Inc., of Sunnyvale, Calif.
("Tele-Chem").
[0130] In the Arraying Station 95, the genomic DNA is deposited 175
on the surface of the substrate 229 with a solid pin tool using the
automatic arrayer. An arrayer is a machine that dips titanium tips,
or the like, into wells and prints on substrates. An automatic
arrayer includes software that tracks the location of a specific
sample with its location on the substrate. The arrayer is
communicatively coupled to LIMS 24 and information on each sample
is transmitted 114 to LIMS. Typically, automatic arrayers include,
but are not limited, to solid pin, split pin/quill, tweezer,
TeleChem's, pin and ring, piezoelectric technology and
syringe-solenoid technologies. An automatic arrayer can be used in
this method according to the manufactures operating instructions
without modification.
[0131] With the aldehyde-coated slides, the genomic DNA spots do
not need to be processed further for attachment to the substrate.
However, using other functional groups, the genomic sample is
attached on the substrates 229 by ultra-violet cross-linking to the
surface and/or thermally heating to attach the samples. For
example, the genomic DNA is ultra-violetly attached to the
substrate at 1200 .mu./j for thirty seconds. Similarly, heating at
80.degree. C. for 2-4 hours will also accomplish the attachment.
The spots on the substrate 229 are from between 1-100 microns in
size. Between approximately 1-130,000 genomic DNA spots,
corresponding to discrete trackable samples are located on an
individual substrate 229.
[0132] Now referring to FIG. 7C, for example, the substrates
barcode 231 is scanned 173. LIMS 24 associates 118 well plate and
substrate barcodes 231. Additionally, LIMS 24 associates 114 the
substrate barcodes 231 with a specific sample with a location on
the substrate. Genomic DNA from the samples to be tested and
genomic DNA from the designated control provided by the remote user
1 are deposited on the substrate in assigned locations, for example
if referring only to the testing of one tissue sample, the first
and second locations on the substrate. Prior to depositing the
genomic DNA on the substrate, the genomic DNA samples are mixed
with a sufficient amount of spotting buffer to facilitate
deposition on the substrate 229.
[0133] In the preferred embodiment, the spotting buffer is
3.times.SSC, but other equivalent buffers may be used including
DSMO, 1.times.SSC or commercial spotting buffers. The genomic DNA
is deposited 175 on to the substrate 229. The sample of genomic DNA
is deposited three times on the substrate 229 for quality control
purposes. LIMS 24 records 114 the precise location of the deposited
genomic DNA samples on the substrate 229 from information received
from the automated microarray device. In an alternative embodiment,
at least one probe specific for a reference genetic sequence is
also added to each spot. The probe is specific for the reference
genetic sequence.
[0134] In another alternative embodiment, a small amount of
morphology sequence nucleic acid is added 177 to each well of the
secondary well plate. The morphology sequence may be any nucleic
acid sequence derived from any source, such as prokaryotes or
eukaryotes that does not naturally occur in the genome of
biological material being tested. Lambda DNA spiked into the sample
could be used as a morphology control. Examples of morphology
sequences may include but are not limited to exogenous genes,
partial genes, tandem repeats, arbitrary sequences or synthetic
oligonucleotides. The morphology sequence is pipetted into the
genomic DNA of the secondary well plate and mixed by gently
pipetting up and down. The morphology control is used to determine
if sample was successfully transferred to the substrate 229.
[0135] Now referring to FIG. 7D, in the preferred embodiment, after
the depositing onto the substrate 229 is completed, the secondary
well plates are off loaded 197 from the Arraying Station 95. The
secondary well plate is sealed 199, the primary master plate is
re-lidded 201 and the barcodes of these plates are re-scanned and
storage unit location is assigned 203. LIMS 24 marries the master
plate to transportation apparatus location 204. The secondary well
plates are then moved to freezer 205. The secondary well plates
that contain DNA samples, and optionally the morphology control
sequences, are sealed with a barrier seal. The barrier seal will
prevent sample degradation and provide a safe storage mechanism.
The transportation storage unit that houses the secondary well
plates after processing has a specific number as well as specific
locations within the unit. Each location inside the unit has an
associated unique barcode number. Each secondary well plate that is
removed from the workstation 14 will have it barcode scanned, as
well as a scanning of the barcode of a specific location within the
transportation storage unit. LIMS 24 records the secondary well
plate number as well as its specific location. The marrying of the
secondary well plate with its location is useful if a sample needs
to be re-accessed 204. The transportation storage unit will be
moved to a cold storage room for long-term storage.
[0136] 7. Hybridization Station 96
[0137] The substrate 229 is placed in a heating cassette 177 for
hybridization. Now referring to FIG. 9, a heating cassette 220 is
shown, by way of example. This heating cassette 220 is made of a
beveled top 225, a plurality of spacers 226, a metal frame 227 and
tension clamps 230. The substrate 229 is lowered into the metal
frame 227 and plastic spacers 226 are placed on top of the
substrate 229 running lengthwise along the edge. The beveled top
plate 225 is then lowered on around of the substrate 229 only
separated by the plurality of spacers 226. The metal tension clamps
230 are then applied to the heating cassette 220, which hold the
cassette 220 together securely. The barcode of the substrate 231
will extend beyond the heating cassette 220 to facilitate
scanning.
[0138] Now referring to FIG. 7C, in the preferred embodiment, the
heating cassette 220 is assembled 178. The substrates 229 in the
heating cassettes 220 are transferred 179 to the heating block
(Gene Paint.RTM.--Tecan) (Raleigh-Durham, N.C.). The function of
the heating block is to increase and decrease temperature. In the
preferred embodiment, the heating block is heated to 95-99.degree.
C. for two minutes in order to separate the double stranded DNA
making it more amenable to hybridization 181. The substrate 229 is
then washed with 10 to 20 volumes of ethanol 115. In the preferred
embodiment, the substrate 229 is then dried by forcing compressed
N.sub.2 into the top bevel of the heating cassette forcing out any
residual ethanol. A sufficient amount of Casine, bovine serum
albumine (BSA) or any commercial available blocking agent is
dispensed 183 to the bevel of the heating cassette 220 to block
unbound surface chemistry, i.e. aldehydes. The heating cassette 230
is incubated 184 on the heating block. Following the blocking of
the surface chemistry with the blocking agent, the substrate 229 is
washed 185. In the preferred embodiment, the substrate 229 is
washed with de-ionized water for one minute three different
times.
[0139] The genomic DNA, which is immobilized on the substrate 229,
is hybridized 187 with the probes. The LIMS 24 directs the
Hybridization Station 96 to dispense reagents, such as probes, as
selected by the remote user 1 in the Survey of Work 23. In the
preferred embodiment, various probes are added to each DNA spot on
the substrate 229. The spot can be the sample to be tested or the
spot can be the corresponding control sample of DNA. The first
probe is specific for a portion of the designated genetic sequence,
which for both transgenic and targeted mutagenesis screening, is
referred to as the target genetic sequence 63. The target probe
specific for the target genetic sequence is referred to as a
target-binding probe.
[0140] In the preferred embodiment, additionally, at least one
second probe specific for a portion of the reference genetic
sequence is added to the hybridization buffer. This probe can be
referred to as a reference-binding probe. The function of the
reference-binding probe is to provide a designated quality control
checkpoint. The reference-binding probe has a genetic sequence that
is complementary to the gene or gene segment in the species being
screened, i.e. the reference genetic sequence.
[0141] The endogenous gene used as a reference genetic sequence
will have a reiteration frequency similar to that of the transgene,
so that the similar amount of hybridizations and linear curves will
be obtained with each probe. Individuals carrying 1-10 copies of a
transgene, any single copy mouse gene can be used as the reference
genetic sequence. Examples, of a single copy mouse gene present in
the species Mus are shown in the Table 1.
3TABLE 1 (SEQ ID NO:6) 32.MMHAP9FLC5.seq.53F ATCACAAGTACTGGGAGAGG
(SEQ ID NO:7) MHAa67gl.seq.120F GTCTCAGAGGTTAACTCACC (SEQ ID NO:8)
D9Mit211.1.38 TTCTTATCTTCAGCCCCACC (SEQ ID NO:9) X61434.129F
ATAACACGGTGTGCACCACG (SEQ ID NO:10) U11075.95F TCCCTTCCTGTTGACTACAG
(SEQ ID NO:11) Z49987.38F TACCCACACGGGCTTAAAAC (SEQ ID NO:12)
32.MMHAP9FLC5.seq.53R CACTGCCAGTGTGTTTTCAC
[0142] Additionally, for example, the mouse Major Urinary Protein
gene family include 20-30 copies per haploid genome. The gene
sequences included in the major protein family include:
4 Mup_ctgtgacgtatgatggattcaataca. (SEQ ID NO: 13) mup
tcggccatagagctccatcagctgga. (SEQ ID NO: 14) mup
ctgtatggataggaagggatgatgc. (SEQ ID NO: 15) mup
ggctcaggccattcttcattctcgggcct. (SEQ ID NO: 16)
[0143] To evaluate individuals that contain numerous numbers of
transgene integration events, a probe for a ribosomal RNA gene
works well. Ribosomal RNA gene can adequately elucidate 50 to
several hundred copies. Hogan, B., Beddington, R., Constantini, F.
and Lacy, E. (1994) Manipulating the Mouse Embryo, 2.sup.nd ed.
Cold Springs Harbor Laboratory Press, Cold Springs Harbor, N.Y.
(hereby incorporated by reference.)
[0144] In addition to the target-binding probe, and the
reference-binding probe, the morphology-binding probe can be added
to the hybridization buffer. The function of the morphology-binding
probe is to provide a quality control checkpoint to ensure that the
printing process is successful. This quality control allows for the
determination of whether a target sample was applied to the
substrate. Also, it allows for the shape of the deposited sample to
be evaluated in order to evaluate reproducibility across samples
and substrates.
[0145] Once the target-binding probe, reference-binding probes, and
optionally morphology-binding probe are suspended in hybridization
buffer the probe amplification molecules or secondary signal
generation reagent is also added to the mixture. The amplification
molecules such as a dendrite probe, has a nucleic acid capture
sequence that is complementary to the target-binding probe,
morphology-binding probe or reference-binding probes.
Alternatively, the epitome of the target-binding probe,
morphology-binding probe and reference-binding probes may be
incubated at 45.degree. C. to 50.degree. C. to pre-hybridize the
probes with the secondary signal generating reagent.
[0146] Different techniques may be employed in order to label the
probes. Both direct labeling techniques and indirect labeling
provide acceptable results. The indirect methodology as is
described in U.S. Pat. Nos. 5,731,158; 5,583,001; 5,196,306 and
5,182,203 (hereby incorporated by reference). In the direct
labeling technique, the labeled probe hybridizes to the target
genetic sequence. The probe will be directly modified to contain at
least one fluorescent, radioactive or staining molecule per probe,
such as cyanine, horseradish peroxidase (HRP) or any other
fluorescent signal generation reagent. The fluorescent signal
generation reagent includes, for example, FITC, DTAF and FAM. FAM
is a fluorescein bioconjugate made of carboxyfluorescein
succinimidyl ester (e.g. 5-FAM (Molecular Probes, Eugene, Oreg.).
DTAF is a fluorescein dichlorotriazine bioconjugate.
[0147] The indirect labeling techniques uses a probe that binds the
selected genetic target sequence and that has been modified to
contain a specified epitome or if it has a nucleic acid binding
sequence it forms a bipartite probe. The probes are made based on
the remote user's 1 screening parameter selections. The remote user
1 submits the probe sequence 64 that correlates to the target
genetic sequence 63. In addition to the target sequence 63, an
additional binding sequence beyond the specified target sequence 63
is added. The combination of these two elements gives rise to a
bipartite probe.
[0148] For example, the binding sequence of the probe may have the
same sequence as the 5' end of reverse transcriptase. So the
bipartite probe would contain the binding sequence of:
[0149] 5'CCG GCT GAG TGA CGC GCA GAA GAC AGG GAC G--Probe Sequence
3'. (SEQ ID NO:17). This binding sequence would then be
complimentary to the capture sequence for the Cy3 dendrite 5' GGC
CGA CTC ACT GCG CGT CTT CTG TCC CGC C-3' (SEQ ID NO:18).
[0150] The target genetic sequence 63 is specific for the probe
genetic sequence 64 respectively. The binding sequence of the
bipartite is free and does not bind to the target genetic sequence
63. In the same manner, with respect to the reference genetic
sequence, the reference-binding probe sequence is specific for the
reference genetic sequence. The binding sequence of the bipartite
probe is free and does not bind to the associated genetic
sequence.
[0151] Examples of bipartite probes, complementary to single copy
mouse genes, are shown the table below:
5TABLE 2 (SEQ ID NO:10) AAA32.MMHAP9FLC5. 5'-GGC CGA CTC ACT GCG
CGT CTT CTG TCC CGC seq 53F CATCACAAGTACTGGGAGAGG (SEQ ID NO:20)
AAAMHAa67gl.seq.120F 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC
CGTCTCAGAGGTTAACTCACC (SEQ ID NO:21) AAAD9Mit211.1.38 5'-GGC CGA
CTC ACT GCG CGT CTT CTG TCC CGC CTTCTTATCTTCAGCCCCACC (SEQ ID
NO:22) AAAX61434.129F 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC
CATAACACGGTGTGCACCACG (SEQ ID NO:23) AAAU11075.95F 5'-GGC CGA CTC
ACT GCG CGT CTT CTG TCC CGC CTCCCTTCCTGTTGACTACAG (SEQ ID NO:24)
AAAZ49987.38F 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC
CTACCCACACGGGCTTAAAAC (SEQ ID NO:25) AAA32.MMHAP9FLC5. 5'-GGC CGA
CTC ACT GCG CGT CTT CTG TCC CGC seq.53R CCACTGCCAGTGTGTTTTCAC
[0152] Examples of bipartite probes, complementary to Mouse Major
Urinary Protein are shown in the table below. These bipartite
probes are comprised one of the MUP genetic sequences and a second
genetic sequence that is complementary to an amplification
molecule.
6TABLE 3 MUP_probe 1 (SEQ ID NO:26) 5'-
GGCCGACTCACTGCGCGTCTTCTGTCCCGCCCTGTGACGTATGATGGATT CAATACA MUP
probe 2 (SEQ ID NO:27)
5'GGCCGACTCACTGCGCGTCTTCTGTCCCGCCTCGGCCATAGAGCTCCA TCAGCTGGA MUP
probe 3 (SEQ ID NO:28) 5'-
GGCCGACTCACTGCGCGTCTTCTGTCCCGCCCTGTATGGATAGGAAGGGA TGATGC MUP probe
4 (SEQ ID NO:29) 5'-
GGCCGACTCACTGCGCGTCTTCTGTCCCGCCGGCTCAGGCCATTCTTCAT TCTCGGGCCT.
[0153] An amplification molecule, such as a dendrimer or tyramide,
is introduced. The amplification molecule is bound directly or
indirectly to the nucleic acid binding sequence or epitome. Free
bipartite probes and excess amplification molecules are removed via
several successive wash steps. The bound amplification molecule
emits a signal that has a linear relationship to the number of
bound molecule.
[0154] Typical modifications of binding probes include, but are not
limited to biotinylation and fluorescein attachments. A secondary
signal generation reagents, such as an enzyme, is then bound to the
epitome. The secondary signal generation element may have a signal
molecule directly attached to it or it may activate or facilitate
the attachment of another signal unit. Multiple signals units may
be used to amplify the signal of the target.
[0155] Dendrimers, tyramide or the like are examples of
amplification molecules that have traditionally been used to
amplify cDNA for gene expression analysis and can be used in the
present method.
[0156] In the preferred embodiment, LIMS 24 directs the
hybridization station 96 to direct a liquid dispenser to pipette
the selected binding probes and the hybridization buffer. A number
of hybridization buffers are acceptable, such as water and saline
sodium citrate (SSC). Alternatively, buffer solutions such as 0.25
NaPO.sub.4, 4.5% SDS, 1 mMEDTA, 1.times.SSC or 40% Formamide,
4.times.SSC, 1% SDS may also be used.
[0157] The hybridization solution will then be applied 187 to the
bevel top 225 of the heating cassette 220. The substrates 229 in
the heating cassette 220 will be incubated 189. In the preferred
embodiment, the hybridization mixture is incubated 189 for between
4 to 12 hours at a temperature ranging from 40.degree. C. to
65.degree. C. on the heating block after the target-binding probe,
reference-binding probe and optional morphology-binding probe have
hybridized to their respective targets. It should be noted that the
hybridization solution can contain the amplification molecules or
secondary signal reagents or they may be added secondarily.
[0158] Once the substrates 229 have been incubated 189 with the
hybridization solution the surface of the substrate is washed 191
several times to remove any excess reagent such as probe
amplification molecules or secondary signal reagents. In the
preferred embodiment, the substrates 229 will first be washed 191
and incubates at 55.degree. C. with several volumes of 2.times.SSC,
0.2% SDS for ten minutes 189. The substrate will again be washed at
room temperature for 10 minutes with several volumes of
2.times.SSC. The final wash will be conducted at room temperature
for ten minutes with 0.2.times.SSC.
[0159] The substrate is dried 197 to facilitate imaging. In the
preferred embodiment, the substrate is dried by forcing compressed
Nitrogen into the top bevel of the heating cassette. The compressed
Nitrogen drying will continue for several minutes until all of the
residual buffer is forced out of the heating cassette and the
substrate is dry.
[0160] 8. Detection Station 97
[0161] This detection station 97 involves detecting the signal from
the at least one labeled probe, specific for a portion of said
designated genetic sequence at a first and second locations on said
substrate, and comparing the signal from the first and second
locations on the substrate to detect a designated genetic sequence
in the sample of genomic DNA.
[0162] In the preferred embodiment, the substrates 229 are then
transferred to the detection station 97. The substrates 229 are
loaded into a commercially available imaging cassette, such as GSI
Lumonics (Watertown, Mass.) and the imaging cassettes are loaded
into the microarray imager GSI Lumonics 5000 (Watertown, Mass.)
used according to the manufacturer's instructions. The substrate
229 is exposed to an excitatory energy source to produce a
quantifiable signal 195 from the signal molecule. More
particularly, the substrate's barcode will be scanned and reported
120 to LIMS 24. The substrate surface will be scanned with and at
least three different channels and the results will be recorded 120
in LIMS 24. The individual substrates 229 will have their barcodes
scanned and married to a storage location barcode. The
reference-binding probes, the target-binding probe and optionally
the morphology probe signal will be recorded and analyzed.
[0163] Now referring to FIG. 10, LIMS 24 now prepares the outcome
report 249. Several calculations are performed in LIMS 24 before
they are posted to the outcome report 249. In the preferred
embodiment, such calculations include the evaluation of all three
replicate per sample. The slope of the curve (quantified
hybridization intensity/ng DNA) obtained with the target-binding
probe is divided by the slope of the curve of the designated
control probe for each individual sample. This is referred is the
induction ratio. The induction ratios are then compared to
determine the closeness of the replicates to the control and other
replicates' induction ratios. Once the induction ratios are
calculated, the qualitative and quantified results are posted to
outcome reports 249. Calculating the linear relationship between
the experimental quantified signal and the quantified signals of
designated control elucidates the copy number, zygosity or mosaic
nature of the sample. The ratio for homozygous individuals should
be twice the ratio of heterozygous individuals. Additionally, the
cell number is determined from the amount of genomic DNA that is
recovered from the isolation process.
[0164] Now referring to FIG. 10, the sample outcome report 240 may
include account registration 250, well plate accession number(s)
252, control sample locations 250 and genetic characterization of
the designated control 252. Additionally, the outcome report 249
may include well location 254, sample identification 256, liquid
level sensing 258, DNA concentration 260, target sequence 262,
probe sequence 264, signal quantification 266, qualitative results
268, zygosity/copy number 270, optical density reading per well
before correction 274, optical density reading after correction
276, estimated number of cells analyzed 278, quantitative analysis
via comparison to designated control signal strengths allowing for
copy number estimation, zygosity or mosaic nature 270. The outcome
report 249 may also include a picture file (email) or pictorial
representations of results 272. Additionally, information gathered
at the request of the remote user 1 from optimization and sequence
confirmation quality control data and error messages will be
included in the outcome report 249. The remote user 1 may choose to
have this file electronically sent or choose to be electronically
notified. Additionally, remote user 1 has the option to have a hard
copy sent via the postal service.
[0165] Once the LIMS 24 has compiled all the data for the outcome
report 249, the outcome report will be sent 7 to the remote user 1.
In the preferred embodiment, LIMS 24 will send the report via a
remote link 7 to either the remote user 1 or the order manager 22,
which can post the results on the web site 16 or via an electronic
link 7 send the outcome report 249. The LIMS 24 will keep results
available for six months and then the results will be recorded onto
a long-term storage disk and archived.
[0166] In an alternative embodiment, high through put polymerase
chain reaction (PCR) or variation of the PCR reaction such as
Taqman.RTM. (PerkinElmer, Inc., Wellesley, Mass.) or molecular
beacons sold by Integrated DNA Technologies, Inc. (Coralville,
Iowa) can be used for conducting automated transgenic and targeted
mutagenesis screening. The user's account registration, survey of
work and sample identification and designation could be created
with the same or equivalent factors taken into consideration.
Additionally, the supplies, shipping tracking, sample tracking,
quality control and results software architecture could be
reproduced in a similar manner. The modification for the use of a
PCR reaction would require the additional information being
delineated in the order process, specifically the survey of work.
Using this equivalent chemistry would require the user to designate
criteria such as the reaction buffer, magnesium concentration,
primer sequences, primer concentration, dNTP concentration, cycle
conditions and reaction volume. The automated liquid handling could
adjust these variables and dispense the reaction buffer to the
appropriate location. While tracking the samples through the
automated system the genomic DNA may be isolated in an automated
fashion via a vacuum manifold isolation, microparticle isolation or
chemical extraction. Isolated mammalian DNA can be loaded into a
high throughput thermocycler, such as the IAS's Genomatron (Boston,
Mass.). Alternatively, substrates such as chemically treated glass,
plastic, membrane or any combination could be used as a reaction
substrate. These substrates can be housed onto a heating block that
heats and cools according the thermal parameters of PCR. The liquid
handling platform would add the appropriate reaction buffer to each
sample of a well or across the surface of a substrate. The
detection of the amplification can be staining via gel
electrophoresis or capillary electrophoresis. Detection could also
be qualified/quantified by the incorporation of fluorescent or
radiolabeled dNTP's during the PCR reaction or via indirect
staining methods.
[0167] An alternative PCR detection method would include the use of
a Taqman.RTM. probe. The Taqman.RTM. probe is composed of a signal
generating element (reporter dye) and a quenching element
(quenching dye) that under normal conditions does not allow for the
detection of the signal-generating element. The oligonucleotide
Taqman.RTM. probe sequence is homologous to an internal target
sequence present in the PCR amplicon. The specific hybridization
reaction of the Taqman.RTM. probe to the amplicon allows the
quenching element to be separated from the signal-generating
element. The signal molecule that is released is quantifiable. The
signal strength is proportional to the number of bound Taqman.RTM.
primers.
[0168] Akin to the Taqman.RTM. technology is the molecular beacon
technology. Molecular beacons can discriminate between single base
variances. The probe is equipped with a signal generation element,
such as a fluorescent molecule, and a quencher element. Once the
probe properly binds to it complimentary sequence the quencher
element is removed and the fluorescent molecule is then
detectable.
[0169] The following examples are provided by way of examples and
are not intended to limit the scope of the invention.
9. EXAMPLES
a. Example 1
Transgenic Screening
[0170] A remote user 1 accesses the web site 19 for the screening
laboratory 20 to order testing services. The remote user 1 enters
the account number 31 that had previously been specifically
assigned by the screening laboratory 20. After the remote user 1
completes the Account Registration section 21 the remote user 1 is
presented with the Survey of Work section 23. The first designation
that is required by the Survey of Work section 23 by the remote
user 1 is to identify if the samples are of a transgenic or
targeted mutagenesis in nature.
[0171] The remote user 1, in this example, designates that the
samples to be tested are of a transgenic 60 nature. The remote user
1 specifies 62 only one transgenic line is to be tested. The
designated genetic sequence 61 to be tested is "HUPPCA." The remote
user 1 then specifies 47 transgenic samples needs to be screened
from this line 62. The remote user 1 identifies the target genetic
sequence to be detected 63. The remote user 1 provides base
sequence 64 of the probe is GCA AGG ACG CAA GGA AGC AGA G (SEQ ID
NO: 30). That is complementary to the target genetic sequence 63.
The probe sequence the user indicates is linked to the binding
sequence of:
7 (SEQ ID NO:31) 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC
[0172] Which results in the bipartite probe of:
8 (SEQ ID NO:32) 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC GCA AGG
ACG CAA GGA AGC AGA G
[0173] This binding sequence specifically couples to the capture
arm of the reverse transcriptase sequence for the Cyanine 3 (Cy3)
dendrimer.
[0174] The remote user 1 is presented with the Sample
Identification and Designation screen as shown in FIG. 6. The
screen presents an image of the source 96 well plate in the proper
orientation. This pictorial representation aids the user in the
process of specifically designating each sample into its correct
Source 96 well location. Each of the remote user's samples are
correlated, recorded and tracked to a specific well of the source
plate as shown in FIG. 6.
[0175] The remote user 1 loads the source well plate 2 with the
proper samples into the correct locations as depicted in FIG. 6.
Information about the nature of the designated control is
ascertained. This information includes the zygosity and copy
number, if known 90. The user reconstitutes the provided
lyophilized lysis reagent with de-ionized water. The user pipettes
a sufficient amount of lysis buffer 4 into each well of the source
well plate 2 to cover the samples. The source well plate 2 is then
sealed with a barrier mechanism. To add additional structural
integrity, the source well plate 2 is sealed with a rigid lid. The
source well plate(s) 2 is loaded into the packing and shipping
materials 17 provided. The package is transmitted 16 to the
screening laboratory.
[0176] The package is received by the screening laboratory 20 and
the source well plate(s) 2 are removed and loaded into the
workstation 14. While all samples are being individual tracked the
samples have their genomic DNA extracted and optimized. The
quantity of DNA is recorded. The genomic DNA sample and designated
control sample are deposited on an optically flat glass slide and
hybridized with: Reference-binding probes:
9 (SEQ ID NO:33) 5'-CCG GCT GAG TGA CGC GCA GAA TCA AGG GCG
CTTCTTATCTTCAGCCCCACC
[0177] The 5'-CCG GCT GAG TGA CGC GCA GAA TCA AGG GCG element of
the bipartite probe specifically binds to the unique capture arm of
a Cyanine 5 (Cy5) dendrimer;
[0178] Target-binding probes:
[0179] 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC GCA AGG ACG CAA
GGA AGC AGA G (SEQ ID NO: 32); and amplification molecules (Cy3 and
Cy5 dendrimers).
[0180] An optically flat glass slide is subjected to an excitement
energy laser and the quantifiable data is recorded. An outcome
report 249 is generated and transmitted over the Internet 7 to the
remote user 1. The outcome report 249 contains the account
registration information 250, the well plate numbers 252, genetic
characterizations 254, well locations, sample identification 256,
DNA concentration 260, target sequences 262, probe sequence 264,
signal quantification 266, results 268, zygosity/copy number 270,
estimated cell number 278, pictorial representation 272, graphical
representation 280, error messages 274 and quality control data
274.
b. Example 2
Targeted Mutagenesis
[0181] A remote user 1 accesses the web site 19 for the screening
laboratory 20 to order testing services. The remote user 1 enters
the account number 31 that had previously been specifically
assigned by the screening laboratory 20. After the remote user 1
completes the Account Registration 21 the remote user 1 is
presented with the Survey of Work 23. The first designation that is
required by the Survey of Work section, by the remote user 1 is to
identify if the samples are of a transgenic or targeted mutagenesis
in nature.
[0182] The remote user 1 in this example designates that the
samples to be tested are of a targeted mutagenesis nature 70. The
remote user 1 specifies that only one 71 knock-out line 72,
NSE-PPCA (neuron specific enolase), is to be tested. The designated
genetic sequence, which is a knock-out line to be tested, is for
the selectable marker hygromycin (SEQ ID NO:2). The remote user 1
then specifies 47 NSE-PPCA samples that need to be screened from
this line. The remote user 1 identifies the selectable marker
target sequence 73 of hygromycin to be detected 74. The remote user
1 specifically indicates that this selectable marker has not been
removed 75 with recombinant technologies, such as Cre-10.times. or
FLP/FRT. The selectable marker target genetic sequence is provided
63. A probe sequence for hygromycin is designated 64 (CAG GAT TTG
GGC AAC ATC TT (SEQ ID NO:34)). The probe sequence 64 the remote
user 1 indicates is linked to the binding sequence of: 5'-GGC CGA
CTC ACT GCG CGT CTT CTG TCC CGC (SEQ ID NO:31).
[0183] This binding sequence specifically couples to the capture
arm of the reverse ranscriptase sequence for the Cyanine 3 (Cy3)
dendrimer.
[0184] The remote user 1 is presented with the Sample
Identification and Designation screen. The screen presents is an
image of the source well plate 2 in the proper orientation as shown
in FIG. 6. This pictorial representation aids the remote user 1 in
the process of specifically designating each sample into its
correct source well plate 2 location. Each of the remote user's 1
samples are correlated, recorded and tracked to a specific well of
the source plate. The user identifies the accession number 3 from
the barcode of the source plate.
[0185] The remote user 1 loads the source well plate 2 with the
proper samples into the correct locations as designated in FIG. 6
in the Sample Identification section 25. Information about the
nature of the designated control is ascertained 90. The remote user
1 reconstitutes the provided lyophilized lysis reagent with
de-ionized water. The user pipettes a sufficient amount of lysis
buffer 4 into each well of the source plate 2 to cover the samples.
The source well plate 2 is then sealed with a barrier mechanism. To
add additional structural integrity, the source well plate 2 is
sealed with a rigid lid. The source well plate(s) is loaded into
the packing and shipping materials provided. The remote user 1
places the shipping package 15 and ships 16 to the screening
laboratory 20.
[0186] The package 15 is received by the screening laboratory 20
and the source well plate(s) 2 are removed and loaded into the
workstation 14. While all samples are being individual tracked the
samples have their genomic DNA extracted and optimized in an
automated fashion. The quantity of DNA is recorded. The DNA is
printed onto a substrate and hybridized with reference probes:
10 (SEQ ID NO:35) 5'-CCG GCT GAG TGA CGC GCA GAA TCA AGG GCG
CTTCTTATCTTCAGCCCCACC
[0187] The 5'-CCG GCT GAG TGA CGC GCA GAA TCA AGG GCG element of
the bipartite probe specifically binds to the unique capture arm of
a Cyanine 5 (Cy5) dendrimer, and target-binding probes:
11 5'-GGC CGA CTC ACT GCG CGT CTT CTG (SEQ ID NO: 36) TCC CGC CAG
GAT TTG GGC AAC ATC TT
[0188] and amplification molecules (Cy3 and Cy5 dendrimers).
[0189] An optically flat glass slide is subjected to an excitement
energy laser and the quantifiable data is recorded. An outcome
report 249 is generated and transmitted over the Internet 7 to the
remote user 1. The outcome report 249 contains the account
registration information 250, the well plate numbers 252, genetic
characterizations 254, well locations, sample identification 256,
DNA concentration 260, target sequences 262, probe sequence 264,
signal quantification 266, results 268, zygosity/copy number 270,
estimated cell number 278, pictorial representation 272, graphical
representation 280, error messages 274 and quality control data
274.
c. Example 3
Eukaryotic Genomic DNA Magnetic Particle Isolation
[0190] Several mouse tails acquired from St. Jude Children's
Hospital were tested. Samples were lysed, expelling the contents of
the cell including the chromosomal DNA. The lysis buffer was made
of 4M urea, 0.1 M Tris-HCl (pH.about.7.5), 180 mM NaCl, 10 mM EDTA,
1% SDS, 5 mM DDT, 415 mg of Proteinase K and Rnase. The samples
were incubated in transport at room temperature for 24 hours. The
lysate created a solution containing genomic DNA without the cloned
DNA elements from prokaryotic work. The genomic DNA was separated.
The lysate was combined with carboxyl-terminated iron oxide
particles. Polyethylene Glycol (PEG) 8000, 0.02% Sodium Azide, 2.5M
NaCl was added and gently mixed. The samples were incubated for ten
minutes at room temperature. The samples were exposed to a magnetic
field for several minutes until the supernatant cleared. The
supernatant was aspirated and discarded. The microparticles were
washed and re-suspended with 70% ethanol and 30% de-ionized water
to remove any salt. The samples were exposed to the magnetic field
until the supernatant was clear. The supernatant was then aspirated
and discarded. The ethanol washing was repeated. The microparticles
were air dried for several minutes. The microparticles were
re-suspended in 0.01M Tris (pH 7.4), 0.02% Sodium Azide. The
Tris-microparticle solution was incubated at 80.degree. C. for
several minutes. The samples were re-exposed to the magnetic field
until the supernatant was clear. The supernatant was aspirated and
placed into clean tubes. To determine the recovery yield of genomic
DNA, a PicoGreen quantification assay was performed. PicoGreen.RTM.
(Molecular Probes, Inc., Eugene, Oreg.) is a commercially available
stain that binds only to double stranded DNA. Samples were loaded
into cuvettes and were exited at 480 nm. The fluorescence emission
intensity was measured at 520 nm using a spectrofluorometer and
plotted as a function of DNA concentration.
12TABLE 4 Mouse Tail Tissue Genomic DNA 1A 450 ng 1B 430 ng 2 584
ng 3 2070 ng 4 1944 ng
[0191] The results show that mammal genomic DNA in tissue or cells
is successfully lysed at room temperature and genomic DNA is
recovered with magnetic particles.
d. Example 4
Immobilization Hybridization, Detection of Mammalian Genomic
DNA
[0192] To evaluate the difference and to determine the optimal
conditions for which mouse genomic DNA can be bound to a substrate,
hybridized to a probe and have quantifiable signal detected several
iterations were conducted. There were two distinct types of mouse
genomic DNA that was under study, sonicated and unsonicated. Both
of these types of mouse genomic DNA were used to make serial
dilutions in four different buffers. There were six serial
dilutions of both types of mouse genomic DNA's made ranging from
538 ng/.mu.L to 17 ng/.mu.L. There were seven endogenous gene
sequences that are ubiquitous to all species of mice that were
amplified with PCR to serve as designated controls.
[0193] Seven mouse markers that naturally occur in the mouse genome
were amplified using PCR. These markers function as controls for
the unknown stock genomic DNA. The markers were:
13TABLE 5 (SEQ ID NO: 6) 32.MMHAP9FLC5.seq.53F ATCACAAGTACTGGGAGAGG
(SEQ ID NO: 7) MHAa67g1.seq.120F GTCTCAGAGGTTAACTCACC (SEQ ID NO:
8) D9Mit211.1.38 TTCTTATCTTCAGCCCCACC (SEQ ID NO: 9) X61434.129F
ATAACACGGTGTGCACCACG (SEQ ID NO: 10) U11075.95F
TCCCTTCCTGTTGACTACAG (SEQ ID NO: 11) Z49987.38F
TACCCACACGGGCTTAAAAC (SEQ ID NO: 12) 32.MMHAP9FLC5.seq.53R
CACTGCCAGTGTGTTTTCAC
[0194] The PCR fragments were separated on an agarose gel and the
amplicons were isolated with using magnetic particles using the
procedure set out in Hawkins '628 patent. A quantification analysis
(using PicoGreen) was employed to determine the specific
concentration of PCR amplicon DNA. Serial dilutions of the known
concentrations of PCR Amplicon controls and serial dilutions of
both sonicated and un-sonicated stock endogenous mouse genomic DNA
was printed onto the substrates. The amplicon (generic name for
portion of genetic sequence that is amplified DNA and the genomic
DNA were fixed to the substrates via covalent and/or non-covalent
linkage.
14TABLE 6 Results from the quantification of controls: gel well#
lane PG5_raw PG5, ng/.mu.l ng yield ug yield Amplicon A1 1 0
0.020434 A2 3 51.6 6.2 2976 2.98 U11075.95 A3 5 26.0 3.1 1502 1.50
q.120F A4 7 33.6 4.0 1940 1.94 D9Mi211.1.38 47.mmhap5flh A5 9 20.3
2.5 1177 1.18 5.seq.85 A6 11 28.5 3.4 1648 1.65 LC5.seq.53F A7 13
22.5 2.7 1305 1.31 Z49987.38F A8 15 11.2 1.4 655 0.65 X61434.129F
A9 17 15.4 1.9 894 0.89 Actb-pA
[0195] i. Results of the Control Genomic DNA Signal Serial
Dilution:
[0196] PCR amplicons, printed onto substrates, probed, and detected
are well documented in the literature. PCR amplicons are generally
used for gene expression work. These PCR amplicon controls were
made into six serial dilutions in the four different buffers at a
concentration gradient that was equivalent to the concentration
gradient of the mouse genomic DNA's (538 ng/.mu.L to 17 ng/.mu.L).
The sonicated and unsonicated mouse genomic DNA serial dilutions as
well as the PCR amplicon control serial dilutions were printed
together onto six different types of substrates. These substrates
were probed with two different types of probes: the FAM probes
(direct labeling) and the bipartite probe that was amplified with a
dendrimer.
[0197] A well plate holding the serial dilutions was created as
follows. Both the sonicated and unsonicated eukaryotic and
prokaryotic DNA was suspended at different concentrations in 4
different buffers. The four buffers include 3.times.SSC, 50% DMSO,
5.5M NaSCN, and the fourth buffer is the commercially available
TeleChem printing buffer. The mouse genomic DNA was diluted in half
6 times (538 ng/.mu.L, 269 ng/.mu.L, 135 ng/.mu.L, 68 ng/.mu.L, 34
ng/.mu.L and 17 ng/.mu.L). The PCR control serial dilutions were
also created. The control dilutions were made from the
PCR-amplicons of endogenous mouse genes that were previously
amplified. The PCR controls were generated as follows: the first
four control serial dilutions were made with 3.times.SSC buffer,
5.5M NaSCN, 50% DMSO and the TeleChem commercially available
buffer. The beginning concentration of the PCR amplicon DNA was 538
ng/.mu.L. There were 6 dilutions of the PCR amplicons (538
ng/.mu.L, 269 ng/.mu.L, 135 ng/.mu.L, 68 ng/.mu.L, 34 ng/.mu.L and
17 ng/.mu.L). The fifth and sixth controls were also diluted in a
separate well plate with a starting amount of 538 ng/.mu.L. Again
they were suspended in 3.times.SSC, 5.5M NaSCN, 50% DMSO as well as
the TeleChem commercially-available buffer.
15TABLE 7 384 Well Plate Design Mouse 3xSSC Mouse 3xSSC Control #1
3xSSC Control #1 5.5M NaSCN genomic 50% DMSO genomic 50% DMSO
Control #2 Control #2 sonicated 5.5M NaSCN sonicated 5.5M NaSCN
Control #3 Control #3 TeleChem TeleChem Control #4 Control #4 Mouse
3xSSC Mouse 3xSSC Control #1 50% Control #1 TeleChem genomic 50%
DMSO genomic 50% DMSO Control #2 DMSO Control #2 sonicated 5.5M
NaSCN sonicated 5.5M NaSCN Control #3 Control #3 TeleChem TeleChem
Control #4 Control #4 Mouse 3xSSC Mouse 3xSSC Control #5 3xSSC
Control #5 TeleChem genomic 50% DMSO genomic 50% DMSO Control #6
Control #6 unsonicated 5.5M NaSCN unsonicated 5.5M NaSCN Control #7
Control #7 TeleChem TeleChem Control #8 Control #8
[0198] The following bipartite probes were used:
16TABLE 8 (SEQ ID NO: 19) AAA32.MMHAP9FLC5. 5'-GGC CGA CTC ACT GCG
CGT CTT seq.53F CTG TCC CGC CATCACAAGTACTGGGAGAGG (SEQ ID NO: 20)
AAAMHAa67g1.seq.120 5'-GGC CGA CTC ACT GCG CGT CTT F CTG TCC CGC
CGTCTCAGAGGTTAACTCACC (SEQ ID NO: 21) AAAD9Mit211.1.38 5'-GGC CGA
CTC ACT GCG CGT CTT CTG TCC CGC CTTCTTATCTTCAGCCCCACC (SEQ ID NO:
22) AAAX61434.129F 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC
CATAACACGGTGTGCACCACG (SEQ ID NO: 23) AAAU11075.95F 5'-GGC CGA CTC
ACT GCG CGT CTT CTG TCC CGC CTCCCTTCCTGTTGACTACAG (SEQ ID NO: 24)
AAAZ49987.38F 5'-GGC CGA CTC ACT GCG CGT CTT CTG TCC CGC
CTACCCACACGGGCTTAAAAC (SEQ ID NO: 25) AAA32.MMHAP9FLC5. 5'-GGC CGA
CTC ACT GCG CGT CTT seq.53R CTG TCC CGC CCACTGCCAGTGTGTTTTCAC
[0199] The FAM modified probes (direct labeling) were used:
17TABLE 9 (SEQ ID NO: 37) CCC32.MMHAP9FLC5.seq.53F
ATCACAAGTACTGGGAGAGG (SEQ ID NO: 38) CCCMHAa67g1.seq.120F
GTCTCAGAGGTTAACTCACC (SEQ ID NO: 39) CCD9Mit211.1.38
TTCTTATCTTCAGCCCCACC (SEQ ID NO: 40) CCX61434.129F
ATAACACGGTGTGCACCACG
[0200] ii. Sonication of Mouse Genomic DNA:
[0201] The mouse genomic DNA was sonicated for five minutes with a
fixed setting using a horn sonicator.
[0202] iii. Array Design:
[0203] The array design was as follows: there were six pallets,
each holding 14 slides for the array machine. Each pallet held one
format of slides with the exception of the right upper quadrant.
Each pallet held one format of slides. The left upper quadrant
pallet held 14 superaldehyde slides. The middle upper quadrant
pallet held 14 Schliecher Schuell (Dassel, Germany) slides. The
right upper quadrant held 5 sigma slides as well as 9 superamine
slides. The lower left quadrant held 14 superamine slides. The
middle lower quadrant held polylysine slides and the right lower
quadrant held the amino-sylinated slides (SCA slides).
[0204] The 384 well plate was loaded on to the array machine. The
array machine was calibrated to accurately deposit the correct
amount of sample onto each substrate using a split-pin tip. The
array machine plated the contents of the 384 well plate across the
84 slides. This process took approximately 40 minutes to complete
the entire printing. After printing, the Fast Slides.RTM. from
Schliecher Schuell (Dassel, Germany) were removed because the
nitrocellulose membrane was damaged.
[0205] iv. Crosslinking the DNA:
[0206] These slides were UV cross-linked at 1200 .mu.J, with the
exception of the aldehyde slides. All slides were boiled for 5
minutes to separate the double-stranded DNA on the surface of the
substrate. The boiling of the substrates occurred in a slide holder
and water. After the substrates were boiled in water for 5 minutes,
they were dunked into a 100% ethanol for 1 minute, which
facilitated the drying of the slides.
[0207] The FAM probes were re-suspended, making stock solutions of
each probe type. 279 mM/279 L equals 1 .mu.M. Each stock was 1
.mu.M.
[0208] The direct-labeled FAM probes were all combined
(multiplexed) into one hybridization buffer. This hybridization
buffer was applied across different substrates (1 .mu.M of the
probe or 0.3 .mu.M in 30 .mu.L). The hybridization buffer was
created as follows: Approx. 30 .mu.L of solution were needed per
substrate. The total volume of hybridization buffer was 180 .mu.L.
This hybridization buffer includes 18 .mu.L of 20.times.SSC, 0.2
.mu.L of probe-one, 0.2 .mu.L of probe-two, 0.2 .mu.L of
probe-three, 0.2 .mu.L of probe-four, 1.2 .mu.L of 10% SDS, 6 .mu.L
of BSA, and 154 .mu.L of water, equaling a total of 180 .mu.L of
buffer. It should be noted FAM traditionally has a high background
and low signal. The FAM hybridization buffer was spun for seconds
in a microfuge tube after being vortexed for a few brief seconds to
ensure proper mixing. The FAM cocktail was applied to the
superamine slide 012320, the polylysine slide 012370, the sigma
slide 012800, the superaldehyde substrate 012850 and the CSA
substrate of 012440. 30 .mu.L of hybridization buffer was applied
to the slides. The substrates with the hybridization buffer was
then covered with a cover slip from Schliecher Schuell (Dassel,
Germany) and were manipulated to remove any air bubbles from under
the slide cover that could result in poor hybridization. The
substrates were placed in the hybridization chamber with moistened
towelettes to ensure that the slides do not dry out. The chambers
were placed in a 45.1.degree. C. incubator for 30 minutes. Bovine
serum albumin (BSA) was used to adequately bind the chemical groups
on the substrate surface. After the hybridization process was
completed the slides were washed in 2.times.SSC with 1% SDS for
approximately 5 minutes. The slides were washed for another 5
minutes in 2.times.SSC. The slides were then washed in 0.6 SSC for
5 minutes, followed by a wash in 100% ethanol. The FAM slides were
imaged seven day after probing and a detectable signal was
quantifiable.
[0209] In the preferred embodiment, the bipartite probes as shown
in Table 7 were all combined (multiplexed) into one hybridization
buffer. This hybridization buffer was applied across the different
substrates and incubated. The Cyanine 3 (Cy3) dendrimer was then
used to bind to the probe. Now referring to FIG. 11, the Y-axis 282
shows the intensity of fluorescence of the labeled prove and the
X-axis 284 is the sample identification slide. The data from one
slide was used to create a graphical representation of the results
shown as FIG. 11. The slides were scanned and the quantifiable data
was recorded. FIG. 11 shows that genomic DNA can be detected using
a microarray imager.
[0210] More specifically, the results are shown in Table 10.
18TABLE 10 Sonicated and Unsonicated Mouse Genomic DNA Quantified
Results Relative to PCR Controls Mouse PCR Genome Mouse Genome
Control Un-Sonicated Sonicated #1 3xSSC 3xSSC PCR Control 3xSSC Cy3
Cy3 #5 3xSSC Cy3 Well Dens - Well Dens - Well Cy3 Well Dens -
Levels Inserted Levels Inserted Levels Inserted Dens - Levels
Inserted 1608.88 A01 913.87 A13 12717 I01 1029.33 I13 1829.92 A01
1418.65 A13 15406.2 I01 532.73 I13 10838.3 A02 1442.54 A14 27048.1
I02 1165.44 I14 17623.8 A02 1683.92 A14 24489.3 I02 1499.83 I14
1499.88 A03 971.92 A15 14616.8 I03 513.25 I15 1346.29 A03 781.81
A15 19646.3 I03 868.75 I15 694.9 A04 637.83 A16 1207.77 I04 595.54
I16 1481.81 A04 496.44 A16 999.29 I04 468.33 I16 5819.92 A05 741.6
A17 9708.62 I05 738.31 I17 6805.9 A05 1056.92 A17 9224.71 I05
607.25 I17 1481.29 A06 719.58 A18 745.94 I06 1118.46 I18 1629.08
A06 1244.08 A18 1431.6 I06 891.85 I18 11949.7 A07 32821.2 A19
6173.75 I07 14934.1 I19 9454.98 A07 34354.4 A19 6054.54 I07 15255.2
I19 16005.6 A08 12853.5 A20 23767.1 I08 33108.4 I20 21630 A08
4668.19 A20 17812.3 I08 31512.9 I20 11463.3 A09 1513.67 A21 3185.6
I09 18818.8 I21 10900.2 A09 1343.58 A21 3039.54 I09 22902.9 I21
4657.04 A10 4713.79 A22 3636.42 I10 15394.6 I22 5670.4 A10 2990.83
A22 4685.83 I10 24232.1 I22 10906.7 A11 633.38 A23 8357.56 I11
1493.71 I23 9271.25 A11 805.77 A23 5246.52 I11 13973.6 I23 713.48
A12 1075.42 A24 1381.31 I12 14037 I24 738.46 A12 904.88 A24 2326.31
I12 16366.9 I24
[0211] The results show that either sonicated or unsonicated
genomic DNA can produce a reportable signal when affixed to an
optically flat substrate and read with a microarray imager.
[0212] Although the present invention has been described and
illustrated with respect to preferred embodiments and a preferred
use thereof, it is not to be so limited since modifications and
changes can be made therein which are within the full scope of the
invention.
Sequence CWU 1
1
40 1 795 DNA Streptomyces fradiae 1 atgattgaac aagatggatt
gcacgcaggt tctccggccg cttgggtgga gaggctattc 60 ggctatgact
gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca 120
gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg
180 caggacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg
cgcagctgtg 240 ctcgacgttg tcactgaagc gggaagggac tggctgctat
tgggcgaagt gccggggcag 300 gatctcctgt catctcacct tgctcctgcc
gagaaagtat ccatcatggc tgatgcaatg 360 cggcggctgc atacgcttga
tccggctacc tgcccattcg accaccaagc gaaacatcgc 420 atcgagcgag
cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa 480
gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac
540 ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat
ggtggaaaat 600 ggccgctttt ctggattcat cgactgtggc cggctgggtg
tggcggaccg ctatcaggac 660 atagcgttgg ctacccgtga tattgctgaa
gagcttggcg gcgaatgggc tgaccgcttc 720 ctcgtgcttt acggtatcgc
cgctcccgat tcgcagcgca tcgccttcta tcgccttctt 780 gacgagttct tctga
795 2 1026 DNA Streptomyces hygroscopicus 2 atgaaaaagc ctgaactcac
cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac 60 agcgtctccg
acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120
gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt ctacaaagat
180 cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt
gcttgacatt 240 ggggaattca gcgagagcct gacctattgc atctcccgcc
gtgcacaggg tgtcacgttg 300 caagacctgc ctgaaaccga actgcccgct
gttctgcagc cggtcgcgga ggccatggat 360 gcgatcgctg cggccgatct
tagccagacg agcgggttcg gcccattcgg accgcaagga 420 atcggtcaat
acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480
cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag
540 ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc
ggatttcggc 600 tccaacaatg tcctgacgga caatggccgc ataacagcgg
tcattgactg gagcgaggcg 660 atgttcgggg attcccaata cgaggtcgcc
aacatcttct tctggaggcc gtggttggct 720 tgtatggagc agcagacgcg
ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780 cggctccggg
cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840
ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga
900 gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg
gaccgatggc 960 tgtgtagaag tactcgccga tagtggaaac cgacgcccca
gcactcgtcc gagggcaaag 1020 gaatag 1026 3 600 DNA streptomyces
alboniger 3 atgaccgagt acaagcccac ggtgcgcctc gccacccgcg acgacgtccc
ccgggccgta 60 cgcaccctcg ccgccgcgtt cgccgactac cccgccacgc
gccacaccgt cgacccggac 120 cgccacatcg agcgggtcac cgagctgcaa
gaactcttcc tcacgcgcgt cgggctcgac 180 atcggcaagg tgtgggtcgc
ggacgacggc gccgcggtgg cggtctggac cacgccggag 240 agcgtcgaag
cgggggcggt gttcgccgag atcggcccgc gcatggccga gttgagcggt 300
tcccggctgg ccgcgcagca acagatggaa ggcctcctgg cgccgcaccg gcccaaggag
360 cccgcgtggt tcctggccac cgtcggcgtc tcgcccgacc accagggcaa
gggtctgggc 420 agcgccgtcg tgctccccgg agtggaggcg gccgagcgcg
ccggggtgcc cgccttcctg 480 gagacctccg cgccccgcaa cctccccttc
tacgagcggc tcggcttcac cgtcaccgcc 540 gacgtcgagt gcccgaagga
ccgcgcgacc tggtgcatga cccgcaagcc cggtgcctga 600 4 34 DNA artificial
sequence Artificial recombinant mutation as described in U.S Patent
Nos. 5,654,182 and 5,677,177 4 ataacttcgt ataatgtatg ctatacgaag
ttat 34 5 96 DNA artificial sequence Artificial recombinant
mutation as described in U.S. Patent No. 5,527,695 5 gaagttccta
tactttctag agaataggaa cttccgaata ggaacttcct tcaaggatat 60
gaaagatctc ttatccttga aggcttatcc ttgaag 96 6 20 DNA Mus sp. 6
atcacaagta ctgggagagg 20 7 20 DNA Mus sp. 7 gtctcagagg ttaactcacc
20 8 20 DNA Mus sp. 8 ttcttatctt cagccccacc 20 9 20 DNA Mus sp. 9
ataacacggt gtgcaccacg 20 10 20 DNA Mus sp. 10 tcccttcctg ttgactacag
20 11 20 DNA Mus sp. 11 tacccacacg ggcttaaaac 20 12 20 DNA Mus sp.
12 cactgccagt gtgttttcac 20 13 26 DNA Mus sp. 13 ctgtgacgta
tgatggattc aataca 26 14 26 DNA Mus sp. 14 tcggccatag agctccatca
gctgga 26 15 25 DNA Mus sp. 15 ctgtatggat aggaagggat gatgc 25 16 29
DNA Mus sp. 16 ggctcaggcc attcttcatt ctcgggcct 29 17 31 DNA
artificial sequence containing Mus plus sequence complimentary to
an amplification molecule 17 ccggctgagt gacgcgcaga agacagggac g 31
18 31 DNA artificial sequence Mus plus sequence complimentary to a
dendrite molecule 18 ggccgactca ctgcgcgtct tctgtcccgc c 31 19 51
DNA artificial sequence Mus DNA plus DNA complimentary to a
dendrite 19 ggccgactca ctgcgcgtct tctgtcccgc catcacaagt actgggagag
g 51 20 51 DNA artificial sequence Mus DNA plus DNA complimentary
to a dendrite 20 ggccgactca ctgcgcgtct tctgtcccgc cgtctcagag
gttaactcac c 51 21 51 DNA artificial sequence Mus DNA plus DNA
complimentary to a dendrite 21 ggccgactca ctgcgcgtct tctgtcccgc
cttcttatct tcagccccac c 51 22 51 DNA artificial sequence Mus DNA
plus DNA complimentary to a dendrite 22 ggccgactca ctgcgcgtct
tctgtcccgc cataacacgg tgtgcaccac g 51 23 51 DNA artificial sequence
Mus DNA plus DNA complimentary to a dendrite 23 ggccgactca
ctgcgcgtct tctgtcccgc ctcccttcct gttgactaca g 51 24 51 DNA
artificial sequence Mus DNA plus DNA complimentary to a dendrite 24
ggccgactca ctgcgcgtct tctgtcccgc ctacccacac gggcttaaaa c 51 25 51
DNA artificial sequence Mus DNA plus DNA complimentary to a
dendrite 25 ggccgactca ctgcgcgtct tctgtcccgc ccactgccag tgtgttttca
c 51 26 57 DNA artificial sequence Mus DNA sequence plus DNA
sequence complimentary to a dendrite 26 ggccgactca ctgcgcgtct
tctgtcccgc cctgtgacgt atgatggatt caataca 57 27 57 DNA artificial
sequence Mus DNA sequence plus DNA sequence complimentary to a
dendrite 27 ggccgactca ctgcgcgtct tctgtcccgc ctcggccata gagctccatc
agctgga 57 28 56 DNA artificial sequence Mus DNA sequence plus DNA
sequence complimentary to a dendrite 28 ggccgactca ctgcgcgtct
tctgtcccgc cctgtatgga taggaaggga tgatgc 56 29 60 DNA artificial
sequence Mus DNA sequence plus DNA sequence complimentary to a
dendrite 29 ggccgactca ctgcgcgtct tctgtcccgc cggctcaggc cattcttcat
tctcgggcct 60 30 22 DNA artificial sequence Artificial DNA
complimentary to Sequence "HUPPCA" 30 gcaaggacgc aaggaagcag ag 22
31 30 DNA artificial sequence Artificial DNA complimentary to a
dendrite 31 ggccgactca ctgcgcgtct tctgtcccgc 30 32 52 DNA
artificial sequence Artificial DNA plus DNA complimentary to
"HUPPCA" 32 ggccgactca ctgcgcgtct tctgtcccgc gcaaggacgc aaggaagcag
ag 52 33 51 DNA artificial sequence Mus plus DNA complimentary to a
dendrite 33 ccggctgagt gacgcgcaga atcaagggcg cttcttatct tcagccccac
c 51 34 20 DNA Streptomyces hygroscopicus 34 caggatttgg gcaacatctt
20 35 51 DNA artificial sequence Mus DNA plus DNA complimentary to
a dendrite 35 ccggctgagt gacgcgcaga atcaagggcg cttcttatct
tcagccccac c 51 36 50 DNA artificial sequence Mus DNA plus DNA
complimentary to a dendrite 36 ggccgactca ctgcgcgtct tctgtcccgc
caggatttgg gcaacatctt 50 37 20 DNA Mus sp. 37 atcacaagta ctgggagagg
20 38 20 DNA Mus sp. 38 gtctcagagg ttaactcacc 20 39 20 DNA Mus sp.
39 ttcttatctt cagccccacc 20 40 20 DNA Mus sp. 40 ataacacggt
gtgcaccacg 20
* * * * *