U.S. patent application number 10/965357 was filed with the patent office on 2005-09-29 for plant reproduction polynucleotides and methods of use.
This patent application is currently assigned to Pioneer Hi-Bred International, Inc.. Invention is credited to Butler, Karlene H., Danilevskaya, Olga, Famodu, Omolayo O., Hantke, Sabine, Miao, Guo-Hua, Morgante, Michele, Sakai, Hajime, Simmons, Carl R., Weng, Zude.
Application Number | 20050216968 10/965357 |
Document ID | / |
Family ID | 25512962 |
Filed Date | 2005-09-29 |
United States Patent
Application |
20050216968 |
Kind Code |
A1 |
Butler, Karlene H. ; et
al. |
September 29, 2005 |
Plant reproduction polynucleotides and methods of use
Abstract
This invention relates to an isolated nucleic acid fragment
encoding a reproduction protein. The invention also relates to the
construction of a chimeric gene encoding all or a portion of the
reproduction protein, in sense or antisense orientation, wherein
expression of the chimeric gene results in production of altered
levels of the reproduction protein in a transformed host cell. The
invention also provides isolated transcriptional regulatory
elements and polynucleotides associated therewith.
Inventors: |
Butler, Karlene H.; (Newark,
DE) ; Danilevskaya, Olga; (Johnston, IA) ;
Miao, Guo-Hua; (Johnston, IA) ; Morgante,
Michele; (Udine, IT) ; Sakai, Hajime; (Newark,
DE) ; Simmons, Carl R.; (Des Moines, IA) ;
Weng, Zude; (Vernon Hills, IL) ; Famodu, Omolayo
O.; (Newark, DE) ; Hantke, Sabine; (Koein,
DE) |
Correspondence
Address: |
PIONEER HI-BRED INTERNATIONAL, INC.
7250 N.W. 62ND AVENUE
P.O. BOX 552
JOHNSTON
IA
50131-0552
US
|
Assignee: |
Pioneer Hi-Bred International,
Inc.
|
Family ID: |
25512962 |
Appl. No.: |
10/965357 |
Filed: |
October 14, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10965357 |
Oct 14, 2004 |
|
|
|
09967552 |
Sep 28, 2001 |
|
|
|
6887988 |
|
|
|
|
09967552 |
Sep 28, 2001 |
|
|
|
PCT/US00/23735 |
Aug 30, 2000 |
|
|
|
60151575 |
Aug 31, 1999 |
|
|
|
Current U.S.
Class: |
800/278 ;
435/412; 435/468; 536/23.2; 800/320.1 |
Current CPC
Class: |
C12N 15/8287 20130101;
C07K 14/415 20130101; C12N 15/8261 20130101; Y02A 40/146
20180101 |
Class at
Publication: |
800/278 ;
800/320.1; 536/023.2; 435/412; 435/468 |
International
Class: |
A01H 001/00; C12N
015/82; C07H 021/04; A01H 005/00; C12N 005/04 |
Claims
What is claimed is:
1. An isolated polynucleotide encoding a functional
fertilization-independent endosperm (FIE) polypeptide, wherein the
full-length sequence of said encoded polypeptide is at least 80%
identical to SEQ ID NO: 28, based on BESTFIT, using default
parameters.
2. The isolated polynucleotide of claim 1, wherein the full-length
sequence of said encoded polypeptide sequence is at least 90%
identical to SEQ ID NO: 28, based on BESTFIT, using default
parameters.
3. The isolated polynucleotide of claim 1, wherein the nucleotide
sequence is at least 80% identical to SEQ ID NO: 27, based on
BESTFIT, using default parameters.
4. The isolated polynucleotide of claim 1, wherein the nucleotide
sequence is at least 90% identical to SEQ ID NO: 27, based on
BESTFIT, using default parameters.
5. The isolated polynucleotide of claim 1, wherein the nucleotide
sequence comprises SEQ ID NO: 27.
6. A recombinant expression cassette, comprising the polynucleotide
of claim 1 or a fragment thereof, which fragment may or may not
encode a functional FIE polypeptide, operably linked to a promoter
which directs expression in the reproductive tissues of a
plant.
7. The recombinant expression cassette of claim 6, wherein said
polynucleotide or fragment is operably linked in antisense
orientation to said promoter.
8. A host cell transformed with the recombinant expression cassette
of claim 6.
9. A transgenic plant comprising the recombinant expression
cassette of claim 6.
10. The transgenic plant of claim 9, wherein the plant is Zea
mays.
11. A method for producing seed in the absence of fertilization,
the method comprising reduction of expression, within a plant, of
the polynucleotide of claim 1.
12. A method for altering endosperm development in seed, the method
comprising modulation of expression, within a plant, of the
polynucleotide of claim 1.
13. A method of plant reproduction comprising embryogenesis from
callus tissue derived from fie germplasm, wherein tissue-specific
downregulation of a CHD polypeptide stimulates embryogenesis and
wherein the fie germplasm comprises endosperm development without
fertilization.
14. A method of modulating seed development in a plant, comprising:
a) transforming a plant cell with the recombinant expression
cassette of claim 6; b) growing said plant cell under conditions
which favor plant regeneration; c) regenerating a plant from said
transformed plant cell; and d) growing said plant under conditions
which allow or induce expression of said polynucleotide, wherein
expression of said polynucleotide results in
fertilization-independent endosperm development.
Description
[0001] This application is a divisional of U.S. Non-provisional
application Ser. No. 09/967,552, filed Jun. 7, 2004, which is a
Continuation of Ser. No. 09/967,552, filed Sep. 28, 2001, which is
a Continuation-in-part of international application PCT/US00/23735
filed 30 Aug. 2000, which claims priority to U.S. Provisional
Application No. 60/151,575 filed 31 Aug. 1999, all of which are
incorporated by reference.
FIELD OF THE INVENTION
[0002] This invention is in the field of plant molecular biology.
More specifically, this invention pertains to nucleic acid
fragments encoding proteins involved in endosperm and embryo
development in plant seeds.
BACKGROUND OF THE INVENTION
[0003] Reproduction in flowering plants involves two fertilization
events. A sperm fuses with the egg cell to form a zygote which
becomes the embryo; a second sperm cell fuses with the
doubled-haploid central cell nucleus to form the starting point of
the triploid endosperm tissue. While fertilization is thus normally
the trigger for seed development, mutants have been identified in
which reproductive processes are initiated independent of
fertilization. Such mutations uncouple components of seed
development from the fertilization process, resulting in
developmental patterns resembling those found in apomictic
plants.
[0004] Arabidopsis fie mutants (for fertilization-independent
endosperm) isolated by Ohad et al. (Proc. Natl. Acad. Sci. USA
93:5319-5324, 1996; see also U.S. Pat. No. 6,229,064) exhibit
replication of the central cell nucleus, initiating endosperm
development, in the absence of fertilization. Inheritance of the
mutant fie allele by the female gametophyte results in embryo
abortion; thus, the trait can be transmitted to progeny only by the
male gametophyte. The Arabidopsis FIE gene was cloned (Ohad et al.,
The Plant Cell 11:407-416 (1999); GenBank entry AF129516) and found
to encode a polypeptide related to the WD Polycomb group proteins
encoded by, for example, Esc in Drosophila (Gutjahr et al., EMBO J.
14:4296-4306 (1995); Sathe and Harte, Mech. Dev. 52:77-87 (1995);
Jones and Gelbart, Mol. Cell. Biol. 13:6357-6366 (1993). WD
polycomb proteins may interact with other polynucleotides to form
complexes which interfere with gene transcription (Pirrotta, Cell
93:333-336 (1998). Fertilization may trigger alteration of the
protein complexes, allowing transcription of genes involved in
endosperm development. Thus, loss-of-function fie mutants would
lack the ability to form the protein complexes which repress
transcription, and endosperm development could proceed independent
of fertilization (Ohad et al. 1999, supra).
[0005] Chaudhury et al. (Proc. Natl. Acad. Sci. USA 94:4223 (1997))
reported fis (fertilization-independent seed) mutants in
Arabidopsis. In fis1 and fis2 seed, the endosperm develops to the
point of cellularization before atrophying. Proembryos are formed
in a low proportion of seeds but do not develop beyond the globular
stage. The FIS1 and FIS2 genes were cloned and further
characterized. The FIS2 gene comprised structures suggesting
function as a transcription factor; the FIS1 gene was found to be
allelic (Proc. Natl. Acad. Sci. USA 96:296 (1999)) to the
Arabidopsis gene MEDEA (Grossniklaus et al. Science 280:446
(1998)).
[0006] Apomixis (asexual reproduction) may occur through vegetative
reproduction or through agamospermy, the formation of seeds without
fertilization. Generally, agamospermy has not been exploited in
agriculture; however, it has numerous potential applications,
including perpetuation of high yielding crop plant hybrids and
varieties, and maintenance of pure inbred lines. Also, seed
formation without fertilization avoids factors that can reduce the
efficiency of seed set, such as pollen count and pollen viability,
and stigma or anther emergence or viability. Agamospermy would also
allow the immediate stable incorporation of transgenes without the
need for selfing to produce homozygotes. In addition, the
fertilization-independent endosperm gene and other related genes
could be used to cause the formation of a fertilization-independent
endosperm without necessarily forming a viable embryo. Such a seed
would not germinate because it lacks an embryo. However, the
endosperm, if sufficiently formed, could be used for human and
animal food and for commercial milling and extraction. Such
embryo-less seeds would have the added advantage of allowing
containment of genetically modified organisms to satisfy
environmental and regulatory concerns. Such seeds could also be
independently modified to produce novel products in the endosperm
such as pharmaceuticals, nutraceuticals, and industrial compounds
and polymers.
[0007] Identification of specific genes involved in agamospermy,
such as fertilization-independent endosperm genes, will offer new
ways of producing apomictic plants. Such approaches may involve
selective mutagenesis of fertilization-independent endosperm genes
and then tracking of the mutant alleles in a molecular breeding
program, or transgenic methods. Accordingly, identification and
isolation of nucleic acid sequences encoding all or a portion of a
protein affecting seed development independent of fertilization
would facilitate studies of developmental regulation in plants and
provide genetic tools to engineer apomixis.
SUMMARY OF THE INVENTION
[0008] The present invention concerns an isolated polynucleotide
comprising a nucleotide sequence selected from the group consisting
of: (a) a first nucleotide sequence encoding a functional
fertilization-independent-endosperm (FIE) polypeptide having at
least 80% identity, based on the GAP (GCG Version 10) method of
alignment, to a polypeptide selected from the group consisting of
SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30,
32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64,
66, 68 and 70.
[0009] In a second embodiment, it is preferred that the isolated
polynucleotide of the claimed invention comprise a nucleic acid
sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5,
7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39,
41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67 and 69 that
codes for the polypeptide selected from the group consisting of SEQ
ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32,
34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66,
68 and 70.
[0010] In a third embodiment, this invention concerns an isolated
polynucleotide comprising a nucleotide sequence of at least about
30 contiguous nucleotides derived from a nucleotide sequence
selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9,
11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43,
45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 72, and the
complement of each such nucleotide sequence.
[0011] In a fourth embodiment, this invention relates to a chimeric
gene comprising an isolated polynucleotide of the present invention
operably linked to at least one suitable regulatory sequence.
[0012] In a fifth embodiment, the present invention concerns an
isolated host cell comprising a chimeric gene of the present
invention or an isolated polynucleotide of the present invention.
The host cell may be eukaryotic, such as a plant cell, or
prokaryotic, such as a bacterial cell. The present invention also
relates to a virus, preferably a baculovirus, comprising an
isolated polynucleotide of the present invention or a chimeric gene
of the present invention.
[0013] In a sixth embodiment, the invention also relates to a
process for producing an isolated host cell comprising a chimeric
gene of the present invention or an isolated polynucleotide of the
present invention, the process comprising either transforming or
transfecting an isolated compatible host cell with a chimeric gene
or isolated polynucleotide of the present invention.
[0014] In a seventh embodiment, the invention concerns a
fertilization-independent endosperm polypeptide at least 80%
identical, based on the GAP (GCG Version 10) method of alignment,
to a polypeptide selected from the group consisting of SEQ ID NOS:
2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36,
38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68 and
70.
[0015] In an eighth embodiment, the invention relates to a method
of selecting an isolated polynucleotide that affects the level of
expression of a fertilization-independent endosperm polypeptide or
enzyme activity in a host cell, preferably a plant cell, the method
comprising the steps of: (a) constructing an isolated
polynucleotide of the present invention or an isolated chimeric
gene of the present invention; (b) introducing the isolated
polynucleotide or the isolated chimeric gene into a host cell; (c)
measuring the level of the fertilization-independent endosperm
polypeptide or enzyme activity in the host cell containing the
isolated polynucleotide; and (d) comparing the level of the
fertilization-independent endosperm polypeptide or enzyme activity
in the host cell containing the isolated polynucleotide with the
level of the fertilization-independent endosperm polypeptide or
enzyme activity in a host cell that does not contain the isolated
polynucleotide.
[0016] In a ninth embodiment, the invention concerns a method of
obtaining a nucleic acid fragment encoding a substantial portion of
a fertilization-independent endosperm polypeptide, preferably a
plant fertilization-independent endosperm polypeptide, comprising
the steps of: (a) synthesizing an oligonucleotide primer comprising
a nucleotide sequence of at least 30 contiguous nucleotides derived
from a nucleotide sequence selected from the group consisting of
SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29,
31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63,
65, 67, 69, 71, 72, and the complement of each such nucleotide
sequence; and (b) amplifying a nucleic acid fragment (preferably a
cDNA inserted in a cloning vector) using the oligonucleotide
primer. The amplified nucleic acid fragment preferably will encode
a substantial portion of a fertilization-independent
polypeptide.
[0017] In a tenth embodiment, this invention relates to a method of
obtaining a nucleic acid fragment encoding all or a substantial
portion of the amino acid sequence comprising a
fertilization-independent endosperm polypeptide, such method
comprising the steps of: (a) probing a cDNA or genomic library with
an isolated polynucleotide of the present invention; (b)
identifying a DNA clone that hybridizes with an isolated
polynucleotide of the present invention; (c) isolating the
identified DNA clone; and (d) sequencing the cDNA or genomic
fragment that comprises the isolated DNA clone.
[0018] In an eleventh embodiment, this invention concerns a
composition, such as a hybridization mixture, comprising an
isolated polynucleotide of the present invention.
[0019] In a twelfth embodiment, this invention concerns a method
for positive selection of a transformed cell comprising: (a)
transforming a host cell with the chimeric gene of the present
invention or an expression cassette of the present invention; (b)
growing the transformed host cell, preferably a plant cell, such as
a monocot or a dicot, under conditions which allow expression of
the fertilization-independent endosperm polynucleotide in an amount
sufficient to complement a null mutant to provide a positive
selection means.
[0020] In a thirteenth embodiment, this invention relates to a
method of altering the level of expression of an fie protein in a
host cell comprising: (a) transforming a host cell with a chimeric
gene of the present invention; and (b) growing the transformed host
cell under conditions that are suitable for expression of the
chimeric gene wherein expression of the chimeric gene results in
altered levels of the fie protein in the transformed host cell. The
fie protein may act in suppressing transcription of genes involved
in endosperm formation.
[0021] A fourteenth embodiment relates to an isolated chromosomal
polynucleotide of the claimed invention which comprises a first
nucleotide sequence selected from the group consisting of SEQ ID
NOS:71 and 72.
[0022] A fifteenth embodiment relates to regulatory sequences
associated with Zea mays fie polynucleotides comprising SEQ ID NOS:
73 and 74.
BRIEF DESCRIPTION OF THE FIGURES
[0023] FIG. 1 shows the pattern of direct repeats in the ZmFIE-B 5'
upstream region.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0024] The invention can be more fully understood from the
following detailed description and the accompanying Sequence
Listing which form a part of this application.
[0025] Table 1 lists the polynucleotides and polypeptides that are
described herein, the designation of the cDNA clones and
chromosomal sequences that comprise the nucleic acid fragments
encoding all or a substantial portion of these polypeptides, and
the corresponding identifier (SEQ ID NO:) as used in the attached
Sequence Listing. The sequence descriptions and Sequence Listing
attached hereto comply with the rules governing nucleotide and/or
amino acid sequence disclosures in patent applications as set forth
in 37 C.F.R. .sctn.1.821-1.825. The Sequence Listing contains the
one-letter code for nucleotide sequence characters and the
three-letter codes for amino acids as defined in conformity with
the IUPAC-IUBMB standards described in Nucleic Acids Res.
13:3021-3030 (1985) and in Biochemical J. 219 (No. 2):345-373
(1984), which are herein incorporated by reference.
1TABLE 1 Reproduction Proteins and Polynucleotides SEQ ID NO: Clone
(Nucleo- (Amino Protein Designation tide) Acid)
Fertilization-independent ccase-b.pk0026.g4 1 2 endosperm protein
(CGS) Fertilization-independent cen1.mn0001.g10 3 4 endosperm
protein (CGS) Fertilization-independent cen3n.pk0076.b8 5 6
endosperm protein (CGS) Fertilization-independent cpb1c.pk001.d10 7
8 endosperm protein (FIS) Fertilization-independent eec1c.pk003.e23
9 10 endosperm protein (CGS) Fertilization-independent
hlp1c.pk003.e8 11 12 endosperm protein (FIS)
Fertilization-independent ncs.pk0019.h3 13 14 endosperm protein
(CGS) Fertilization-independent p0003.cgpfn34f 15 16 endosperm
protein (EST) Fertilization-independent p0003.cgped29rb 17 18
endosperm protein (CGS) Fertilization-independent p0037.crwao47r 19
20 endosperm protein (FIS) Fertilization-independent p0041.crtaw93r
21 22 endosperm protein (FIS) Fertilization-independent
p0101.cgamg48r 23 24 endosperm protein (CGS)
Fertilization-independent p0104.cabbn62r 25 26 endosperm protein
(CGS) Fertilization-independent p0107.cbcai79r 27 28 endosperm
protein (CGS) Fertilization-independent p0119.cmtoh49r 29 30
endosperm protein (CGS) Fertilization-independent p0120.cdebd48r 31
32 endosperm protein (FIS) Fertilization-independent
rcal1c.pk0001.d2 33 34 endosperm protein (CGS)
Fertilization-independent ses2w.pk0015.b10 35 36 endosperm protein
(CGS) Fertilization-independent wkm1c.pk0003.f4 37 38 endosperm
protein (CGS) Fertilization-independent ccase-b.pk0026.g4 39 40
endosperm protein (EST) Fertilization-independent cen1.mn0001.g10
41 42 endosperm protein (EST) Fertilization-independent
cpb1c.pk001.d10 43 44 endosperm protein (EST)
Fertilization-independent eec1c.pk003.e23 45 46 endosperm protein
(EST) Fertilization-independent hlp1c.pk003.e8 47 48 endosperm
protein (EST) Fertilization-independent ncs.pk0019.h3 49 50
endosperm protein (EST) Fertilization-independent p0003.cgpfn34rb
51 52 endosperm protein (EST) Fertilization-independent
p0003.cgped29rb 53 54 endosperm protein (EST)
Fertilization-independent p0037.crwao47r 55 56 endosperm protein
(EST) Fertilization-independent p0041.crtaw93r 57 58 endosperm
protein (EST) Fertilization-independent p0104.cabbn62r 59 60
endosperm protein (EST) Fertilization-independent p0107.cbcai79r 61
62 endosperm protein (CGS) Fertilization-independent p0120.cdebd48r
63 64 endosperm protein (EST) Fertilization-independent
rcal1c.pk0001.d2 65 66 endosperm protein (EST)
Fertilization-independent ses2w.pk0015.b10 67 68 endosperm protein
(EST) Fertilization-independent wkm1c.pk0003.f4 69 70 endosperm
protein (EST) Fertilization-independent Genomic Sequence 71
endosperm protein for ZmFIE-B Fertilization-independent Genomic
Sequence 72 endosperm protein for ZmFIE-A 5' non-coding region
Genomic 5' up- 73 stream sequence of ZmFIE-A 5' non-coding region
Genomic 5' up- 74 stream sequence of ZmFIE-B ZmFIE-B partial
genomic From B73 75 sequence Forward primer For Mo17 and B73 76
Reverse primer For B73 77 Reverse primer For Mo17 78 Primer
Mu-specific 79 Primer Gene-specific 80 Primer Gene-specific 81
Primer Gene-specific 82
DETAILED DESCRIPTION OF THE INVENTION
[0026] In the context of this disclosure, a number of terms shall
be utilized. The terms "polynucleotide", "polynucleotide sequence",
"nucleic acid sequence", "nucleic acid fragment" and "isolated
nucleic acid fragment" are used interchangeably herein. These terms
encompass nucleotide sequences and the like. A polynucleotide may
be a polymer of RNA or DNA that is single- or double-stranded, that
optionally contains synthetic, non-natural or altered nucleotide
bases. A polynucleotide in the form of a polymer of DNA may be
comprised of one or more segments of cDNA, genomic DNA, synthetic
DNA, or mixtures thereof. An isolated polynucleotide of the present
invention may include at least 60 contiguous nucleotides,
preferably at least 40 contiguous nucleotides, most preferably at
least 30 contiguous nucleotides derived from SEQ ID NOS:1, 3, 5, 7,
9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41,
43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 72, and
the complement of each such sequence.
[0027] The term "isolated" polynucleotide refers to a
polynucleotide that is substantially free from other nucleic acid
sequences, such as and not limited to, other chromosomal and
extrachromosomal DNA and RNA. Isolated polynucleotides may be
purified from a host cell in which they naturally occur.
Conventional nucleic acid purification methods known to skilled
artisans may be used to obtain isolated polynucleotides. The term
also embraces recombinant polynucleotides and chemically
synthesized polynucleotides.
[0028] The term "recombinant" means, for example, that a nucleic
acid sequence is made by an artificial combination of two otherwise
separated segments of sequence, e.g., by chemical synthesis or by
the manipulation of isolated nucleic acids by genetic engineering
techniques.
[0029] As used herein, "contig" refers to a nucleotide sequence
that is assembled from two or more constituent nucleotide sequences
that share common or overlapping regions of sequence homology. For
example, the nucleotide sequences of two or more nucleic acid
fragments can be compared and aligned in order to identify common
or overlapping sequences. Where common or overlapping sequences
exist between two or more nucleic acid fragments, the sequences
(and thus their corresponding nucleic acid fragments) can be
assembled into a single contiguous nucleotide sequence.
[0030] As used herein, "substantially similar" refers to nucleic
acid fragments wherein changes in one or more nucleotide bases may
result in substitution of one or more amino acids, but do not
affect the functional properties of the polypeptide encoded by the
nucleotide sequence. "Substantially similar" also refers to nucleic
acid fragments wherein changes in one or more nucleotide bases do
not affect the ability of the nucleic acid fragment to mediate
alteration of gene expression through, for example, antisense or
co-suppression technology, or through acting as a promoter.
"Substantially similar" also refers to modifications of the nucleic
acid fragments of the instant invention, such as deletion or
insertion of one or more nucleotides, that do not substantially
affect the functional properties of the resulting transcript (such
as in the ability to mediate gene silencing) or do not result in
alteration of the functional properties of the resulting protein
molecule. It is therefore understood that the invention encompasses
more than the specific exemplary nucleotide or amino acid sequences
and includes functional equivalents thereof. The terms
"substantially similar" and "corresponding substantially" are used
interchangeably herein.
[0031] Substantially similar nucleic acid fragments may be selected
by screening nucleic acid fragments, representing subfragments or
modifications of the nucleic acid fragments of the instant
invention wherein one or more nucleotides are substituted, deleted
and/or inserted, for their ability to affect the level of the
polypeptide encoded by the unmodified nucleic acid fragment (the
"subject polypeptide") in a plant or plant cell. For example, a
substantially similar nucleic acid fragment derived from the
instant nucleic acid fragment can be constructed and introduced
into a plant or plant cell. The level of the subject polypeptide in
a plant or plant cell comprising the substantially similar nucleic
fragment can then be compared to the level of the polypeptide in a
plant or plant cell that does not comprise the substantially
similar nucleic acid fragment.
[0032] For example, it is well known in the art that antisense
suppression and co-suppression of gene expression may be
accomplished using nucleic acid fragments representing less than
the entire coding region of a gene, and by using nucleic acid
fragments that do not share 100% sequence identity with the gene to
be suppressed. Moreover, alterations at a given site in a nucleic
acid fragment which result in the production of a chemically
equivalent amino acid, but which do not affect the functional
properties of the encoded polypeptide, are well known in the art.
Thus, a codon for the amino acid alanine, a hydrophobic amino acid,
may be substituted by a codon encoding another less hydrophobic
residue, such as glycine, or a more hydrophobic residue, such as
valine, leucine, or isoleucine. Similarly, changes which result in
substitution of one negatively-charged residue for another, such as
aspartic acid for glutamic acid, or one positively-charged residue
for another, such as lysine for arginine, can also be expected to
produce a functionally equivalent product. Nucleotide changes which
result in alteration of the N-terminal and C-terminal portions of
the polypeptide molecule would also not be expected to alter the
activity of the polypeptide. Each of the proposed modifications is
well within the routine skill in the art, as is determination of
retention of biological activity of the encoded products.
Consequently, an isolated polynucleotide comprising a nucleotide
sequence of at least 30 contiguous nucleotides, derived from a
nucleotide sequence selected from the group consisting of SEQ ID
NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33,
35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67,
69, 71 and 72, may be used in methods of selecting an isolated
polynucleotide that affects the expression of a
fertilization-independent endosperm polypeptide in a host cell. A
method of selecting an isolated polynucleotide that affects the
level of expression of a polypeptide in a virus or in a eukaryotic
or prokaryotic host may comprise the steps of: (a) constructing an
isolated polynucleotide of the present invention or an isolated
chimeric gene of the present invention; (b) introducing the
isolated polynucleotide or the isolated chimeric gene into a host
cell; (c) measuring the level of a polypeptide or enzyme activity
in the host cell containing the isolated polynucleotide; and (d)
comparing the level of a polypeptide or enzyme activity in the host
cell comprising the isolated polynucleotide with the level of a
polypeptide or enzyme activity in a host cell that does not
comprise the isolated polynucleotide.
[0033] Moreover, substantially similar nucleic acid fragments may
also be characterized by their ability to hybridize. Estimates of
homology are provided by either DNA-DNA or DNA-RNA hybridization
under conditions of stringency as is well understood by those
skilled in the art (Hames and Higgins, Eds. (1985) Nucleic Acid
Hybridisation, IRL Press, Oxford, U.K.). By "stringent conditions"
or "stringent hybridization conditions" is intended conditions
under which a probe will hybridize to its target sequence to a
detectably greater degree than to other sequences (e.g., at least
2-fold over background). Stringency conditions can be adjusted to
screen for moderately similar fragments, such as homologous
sequences from distantly related organisms, or to screen for highly
similar fragments, such as genes that duplicate functional enzymes
from closely-related organisms. Stringent conditions are
sequence-dependent and will be different in different
circumstances. By controlling the stringency of the hybridization
and/or washing conditions, target sequences that are 100%
complementary to the probe can be identified (homologous probing).
Alternatively, stringency conditions can be adjusted to allow some
mismatching in sequences so that lower degrees of identity are
detected (heterologous probing). Generally, a probe is less than
about 1000 nucleotides in length, preferably less than 500
nucleotides in length.
[0034] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. Duration of hybridization is generally less than
about 24 hours, usually about 4 to about 12 hours.
[0035] Alternatively, one set of preferred conditions uses a series
of washes starting with 6.times.SSC, 0.5% SDS at room temperature
for 15 min, then with 2.times.SSC, 0.5% SDS at 45.degree. C. for 30
min, and then twice with 0.2.times.SSC, 0.5% SDS at 50.degree. C.
for 30 min. A more-preferred set of stringent conditions uses
washes identical to those above except that the temperature of the
final two 30-minute washes is increased to 60.degree. C. Another
preferred set of highly stringent conditions uses two final washes
in 0.1.times.SSC, 0.1% SDS at 65.degree. C.
[0036] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl
(1984) Anal. Biochem. 138:267-284: T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization, and/or wash conditions can be adjusted to
hybridize to sequences of the desired identity. For example, if
sequences with >90% identity are sought, the T.sub.m can be
decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the thermal melting point (T.sub.m). Using the equation,
hybridization and wash compositions, and desired T.sub.m, those of
ordinary skill will understand that variations in the stringency of
hybridization and/or wash solutions are inherently described. If
the desired degree of mismatching results in a T.sub.m of less than
45.degree. C. (aqueous solution) or 32.degree. C. (formamide
solution), it is preferred to increase the SSC concentration so
that a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, New York); and Ausubel et al., eds. (1995) Current
Protocols in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0037] Substantially similar nucleic acid fragments of the instant
invention may also be characterized by the percent identity of
their encoded amino acid sequences to the amino acid sequences
disclosed herein, as determined by algorithms commonly employed by
those skilled in this art. Suitable nucleic acid fragments
(isolated polynucleotides of the present invention) encode
polypeptides that are at least about 70% identical, preferably at
least about 80% identical to the amino acid sequences reported
herein. Preferred nucleic acid fragments encode amino acid
sequences that are about 85% identical to the amino acid sequences
reported herein. More preferred nucleic acid fragments encode amino
acid sequences that are at least about 90% identical to the amino
acid sequences reported herein. Most preferred are nucleic acid
fragments that encode amino acid sequences that are at least about
95% identical to the amino acid sequences reported herein. Suitable
nucleic acid fragments not only have the above identities but
typically encode a polypeptide having at least 50 amino acids,
preferably at least 100 amino acids, more preferably at least 150
amino acids, still more preferably at least 200 amino acids, and
most preferably at least 250 amino acids.
[0038] The following terms are used to describe the sequence
relationships between a polynucleotide/polypeptide of the present
invention and a reference polynucleotide/polypeptide: (a)
"reference sequence", (b) "comparison window", (c) "sequence
identity", and (d) "percentage of sequence identity".
[0039] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison with a
polynucleotide/polypeptide of the present invention. A reference
sequence may be a subset or the entirety of a specified sequence;
for example, as a segment of a full-length cDNA or gene sequence,
or the complete cDNA or gene sequence.
[0040] (b) As used herein, "comparison window" includes reference
to a contiguous and specified segment of a
polynucleotide/polypeptide sequence, wherein the
polynucleotide/polypeptide sequence may be compared to a reference
sequence and wherein the portion of the polynucleotide/polypeptide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. Generally, the comparison window is at least 20
contiguous nucleotides/amino acid residues in length, and
optionally can be 30, 40, 50, 100, or longer. Those of skill in the
art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide/polypeptide
sequence, a gap penalty is typically introduced and is subtracted
from the number of matches.
[0041] Methods of alignment of sequences for comparison are
well-known in the art. Optimal alignment of sequences for
comparison may be conducted by the local homology algorithm of
Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); by the homology
alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443
(1970); by the search for similarity method of Pearson and Lipman,
Proc. Natl. Acad. Sci. 85: 2444 (1988); by computerized
implementations of these algorithms, including, but not limited to:
CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View,
Calif.; GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Genetics
Computer Group (GCG.RTM.) package, Accelrys, Inc., San Diego,
Calif.; the CLUSTAL program is well described by Higgins and Sharp,
Gene 73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153
(1989); Corpet, et al., Nucleic Acids Research 16: 10881-90 (1988);
Huang, et al., Computer Applications in the Biosciences 8: 155-65
(1992), and Pearson, et al., Methods in Molecular Biology 24:
307-331 (1994).
[0042] The BLAST family of programs which can be used for database
similarity searches includes: BLASTN for nucleotide query sequences
against nucleotide database sequences; BLASTX for nucleotide query
sequences against protein database sequences; BLASTP for protein
query sequences against protein database sequences; TBLASTN for
protein query sequences against nucleotide database sequences; and
TBLASTX for nucleotide query sequences against nucleotide database
sequences. See, Current Protocols in Molecular Biology, Chapter 19,
Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience,
New York (1995); Altschul et al., J. Mol. Biol., 215:403-410
(1990); and, Altschul et al., Nucleic Acids Res. 25:3389-3402
(1997).
[0043] Software for performing BLAST analyses is publicly
available, e.g., through the National Center for Biotechnology
Information (http://www.ncbi.nim.nih.gov/BLAST). This algorithm
involves first identifying high scoring sequence pairs (HSPs) by
identifying short words of length W in the query sequence, which
either match or satisfy some positive-valued threshold score T when
aligned with a word of the same length in a database sequence. T is
referred to as the neighborhood word score threshold. These initial
neighborhood word hits act as seeds for initiating searches to find
longer HSPs containing them. The word hits are then extended in
both directions along each sequence for as far as the cumulative
alignment score can be increased. Cumulative scores are calculated
using, for nucleotide sequences, the parameters M (reward score for
a pair of matching residues; always >0) and N (penalty score for
mismatching residues; always <0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) of 10, a cutoff of 100, M=5, N=4, and a comparison of both
strands. For amino acid sequences, the BLASTP program uses as
defaults a wordlength (W) of 3, an expectation (E) of 10, and the
BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc.
Natl. Acad. Sci. USA 89:10915).
[0044] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences (see, e.g., Karlin & Altschul,
Proc. Nat'l. Acad. Sci. USA 90:5873-5877 (1993)). One measure of
similarity provided by the BLAST algorithm is the smallest sum
probability (P(N)), which provides an indication of the probability
by which a match between two nucleotide or amino acid sequences
would occur by chance.
[0045] BLAST searches assume that proteins can be modeled as random
sequences. However, many real proteins comprise regions of
nonrandom sequences which may be homopolymeric tracts, short-period
repeats, or regions enriched in one or more amino acids. Such
low-complexity regions may be aligned between unrelated proteins
even though other regions of the protein are entirely dissimilar. A
number of low-complexity filter programs can be employed to reduce
such low-complexity alignments. For example, the SEG (Wooten and
Federhen, Comput. Chem., 17:149-163 (1993)) and XNU (Clayerie and
States, Comput. Chem., 17:191-201 (1993)) low-complexity filters
can be employed alone or in combination.
[0046] Unless otherwise stated, nucleotide and protein
identity/similarity values provided herein are calculated using GAP
(GCG Version 10) under default values.
[0047] GAP (Global Alignment Program) can also be used to compare a
polynucleotide or polypeptide of the present invention with a
reference sequence. GAP uses the algorithm of Needleman and Wunsch
(J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two
complete sequences that maximizes the number of matches and
minimizes the number of gaps. GAP considers all possible alignments
and gap positions and creates the alignment with the largest number
of matched bases and the fewest gaps. It allows for the provision
of a gap creation penalty and a gap extension penalty in units of
matched bases. GAP must make a profit of gap creation penalty
number of matches for each gap it inserts. If a gap extension
penalty greater than zero is chosen, GAP must, in addition, make a
profit for each gap inserted of the length of the gap times the gap
extension penalty. Default gap creation penalty values and gap
extension penalty values in Version 10 of the Wisconsin Genetics
Software Package for protein sequences are 8 and 2, respectively.
For nucleotide sequences the default gap creation penalty is 50
while the default gap extension penalty is 3. The gap creation and
gap extension penalties can be expressed as an integer selected
from the group of integers consisting of from 0 to 100. Thus, for
example, the gap creation and gap extension penalties can each
independently be: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40,
50, 60 or greater.
[0048] GAP presents one member of the family of best alignments.
There may be many members of this family, but no other member has a
better quality. GAP displays four figures of merit for alignments:
Quality, Ratio, Identity, and Similarity. The Quality is the metric
maximized in order to align the sequences. Ratio is the quality
divided by the number of bases in the shorter segment. Percent
Identity is the percent of the symbols that actually match. Percent
Similarity is the percent of the symbols that are similar. Symbols
that are across from gaps are ignored. A similarity is scored when
the scoring matrix value for a pair of symbols is greater than or
equal to 0.50, the similarity threshold. The scoring matrix used in
Version 10 of the Wisconsin Genetics Software Package is BLOSUM62
(see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA
89:10915).
[0049] Multiple alignment of the sequences can be performed using
the CLUSTAL method of alignment (Higgins and Sharp (1989) CABIOS.
5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH
PENALTY=10). Default parameters for pairwise alignments using the
CLUSTAL method are KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5.
[0050] (c) As used herein, "sequence identity" or "identity" in the
context of two nucleic acid or polypeptide sequences includes
reference to the residues in the two sequences which are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g. charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. Where sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences which differ by such conservative substitutions are said
to have "sequence similarity" or "similarity". Means for making
this adjustment are well-known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., according to the algorithm of
Meyers and Miller, Computer Applic. Biol. Sci., 4: 11-17 (1988)
e.g., as implemented in the program PC/GENE (Intelligenetics,
Mountain View, Calif., USA).
[0051] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0052] A "substantial portion" of an amino acid or nucleotide
sequence comprises an amino acid or a nucleotide sequence that is
sufficient to afford putative identification of the protein or gene
that the amino acid or nucleotide sequence comprises. Amino acid
and nucleotide sequences can be evaluated either manually by one
skilled in the art, or by using computer-based sequence comparison
and identification tools that employ algorithms such are described
above. In general, a sequence of ten or more contiguous amino
acids, or thirty or more contiguous nucleotides, is necessary in
order to putatively identify a polypeptide or nucleic acid sequence
as homologous to a known protein or gene. Moreover, with respect to
nucleotide sequences, gene-specific oligonucleotide probes
comprising 30 or more contiguous nucleotides may be used in
sequence-dependent methods of gene identification (e.g., Southern
hybridization) and isolation (e.g., in situ hybridization of
bacterial colonies or bacteriophage plaques). In addition, short
oligonucleotides of 12 or more nucleotides may be used as
amplification primers in PCR in order to obtain a particular
nucleic acid fragment comprising the primers. Accordingly, a
"substantial portion" of a nucleotide sequence comprises a
nucleotide sequence that will afford specific identification and/or
isolation of a nucleic acid fragment comprising the sequence. The
instant specification teaches amino acid and nucleotide sequences
encoding polypeptides that comprise one or more particular plant
proteins. The skilled artisan, having the benefit of the sequences
as reported herein, may now use all or a substantial portion of the
disclosed sequences for purposes known to those skilled in this
art. Accordingly, the instant invention comprises the complete
sequences as reported in the accompanying Sequence Listing, as well
as substantial portions of those sequences as defined above.
[0053] "Codon degeneracy" refers to divergence in the genetic code
permitting variation of the nucleotide sequence without affecting
the amino acid sequence of an encoded polypeptide. Accordingly, the
instant invention relates to any nucleic acid fragment comprising a
nucleotide sequence that encodes all or a substantial portion of
the amino acid sequences set forth herein.
[0054] "Synthetic nucleic acid fragments" can be assembled from
oligonucleotide building blocks that are chemically synthesized
using procedures known to those skilled in the art. These building
blocks are ligated and annealed to form larger nucleic acid
fragments which may then be enzymatically assembled to construct
the entire desired nucleic acid fragment. "Chemically synthesized",
as related to a nucleic acid fragment, means that the component
nucleotides were assembled in vitro. Manual chemical synthesis of
nucleic acid fragments may be accomplished using well established
procedures, or automated chemical synthesis can be performed using
one of a number of commercially available machines. Accordingly,
the nucleic acid fragments can be tailored for optimal gene
expression based on optimization of the nucleotide sequence to
reflect the codon bias of the host cell. The skilled artisan
appreciates the likelihood of successful gene expression if codon
usage is biased towards those codons favored by the host.
Determination of preferred codons can be based on a survey of genes
derived from the host cell where sequence information is
available.
[0055] "Gene" refers to a nucleic acid fragment which directs
expression of a specific protein, including regulatory sequences
preceding (5' non-coding sequences) and following (3' non-coding
sequences) the coding sequence. "Native gene" refers to a gene as
found in nature with its own regulatory sequences. "Chimeric gene"
refers to any gene that is not a native gene, comprising regulatory
and coding sequences that are not found together in nature.
Accordingly, a chimeric gene may comprise regulatory sequences and
coding sequences that are derived from different sources, or
regulatory sequences and coding sequences derived from the same
source, but arranged in a manner different than that found in
nature. "Endogenous gene" refers to a native gene in its natural
location in the genome of an organism. A "foreign gene" refers to a
gene not normally found in the host organism, but that is
introduced into the host organism by gene transfer. Foreign genes
can comprise native genes inserted into a non-native organism, or
chimeric genes. A "transgene" is a gene that has been introduced
into the genome by a transformation procedure.
[0056] "Coding sequence" refers to a nucleotide sequence that codes
for a specific amino acid sequence. "Regulatory sequences" refer to
nucleotide sequences located upstream (5' non-coding sequences),
within, or downstream (3' non-coding sequences) of a coding
sequence, and which influence the transcription, RNA processing or
stability, or translation of the associated coding sequence.
Regulatory sequences may include promoters, translation leader
sequences, introns, binding sites for regulatory proteins, and
polyadenylation recognition sequences.
[0057] "Promoter" refers to a nucleotide sequence capable of
controlling the expression of a coding sequence or functional RNA.
In general, a coding sequence is located 3' to a promoter sequence.
The promoter sequence consists of proximal and more distal upstream
elements, the latter elements often referred to as enhancers.
Accordingly, an "enhancer" is a nucleotide sequence which can
stimulate promoter activity and may be an innate element of the
promoter or a heterologous element inserted to enhance the level or
tissue-specificity of a promoter. Enhancer elements for plants are
known in the art and include, for example, the SV40 enhancer
region, the .sup.35S enhancer element, and the like.
[0058] Promoters may be derived in their entirety from a native
gene, or may be composed of different elements derived from
different promoters found in nature, or may even comprise synthetic
nucleotide segments. It is understood by those skilled in the art
that different promoters may direct the expression of a gene in
different tissues or cell types, or at different stages of
development, or in response to different environmental conditions.
Promoters which cause a nucleic acid fragment to be expressed in
most cell types at most times are commonly referred to as
"constitutive promoters". New promoters of various types useful in
plant cells are constantly being discovered; numerous examples may
be found in the compilation by Okamuro and Goldberg (1989)
Biochemistry of Plants 15:1-82. Constitutive promoters include, for
example, the core promoter of the Rsyn7 (U.S. Pat. No. 6,072,050);
the core CaMV 35S promoter (Odell et al. (1985) Nature
313:810-812); rice actin (McElroy et al. (1990) Plant Cell
2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol.
12:619-632 and Christensen et al. (1992) Plant Mol. Biol.
18:675-689); PEMU (Last et al. (1991) Theor. Appl. Genet
81:581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS
promoter (U.S. Pat. No. 5,659,026), and the like. Other
constitutive promoters include, for example, U.S. Pat. Nos.
5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680;
5,268,463; and 5,608,142.
[0059] It is further recognized that since in most cases the exact
boundaries of regulatory sequences have not been completely
defined, nucleic acid fragments of different lengths may have
identical promoter activity.
[0060] By "tissue-preferred" is intended that the expression driven
by a plant promoter is selectively enhanced or suppressed in
particular plant cells or tissues, in comparison to other cells or
tissues.
[0061] By "promoter" or "transcriptional initiation region" is
intended a regulatory region of DNA usually comprising a TATA box
capable of directing RNA polymerase II to initiate RNA synthesis at
the appropriate transcription initiation site for a particular
coding sequence. A promoter may additionally comprise other
recognition sequences generally positioned upstream or 5' to the
TATA box, and referred to as "promoter elements" which influence
the expression driven by the core promoter. Promoter elements
located upstream or 5' to the TATA box are also referred to as
upstream promoter elements. In particular embodiments of the
invention, the promoter elements of the invention are positioned
upstream or 5' to the TATA box. However, the invention also
encompasses plant promoter configurations in which the promoter
elements are positioned downstream or 3' to the TATA box.
[0062] By "transcription regulatory unit" is intended a promoter
comprising one or more promoter elements.
[0063] By "core promoter" is intended a promoter not comprising
promoter elements other than the TATA box and the transcriptional
start site.
[0064] In reference to a promoter, by "native" is intended a
promoter capable of driving expression in a cell of interest,
wherein the nucleotide sequence of the promoter is found in that
cell in nature.
[0065] In reference to a promoter or transcription initiation
region, by "synthetic" is intended a promoter capable of driving
expression in a cell of interest, wherein the nucleotide sequence
of the promoter is not found in nature. A synthetic promoter cannot
be isolated from any cell unless it is first introduced to the cell
or to an ancestor thereof.
[0066] By "suppressors" are intended nucleotide sequences that
mediate suppression or decrease in the expression directed by a
promoter region. That is, suppressors are the DNA sites through
which transcription repressor proteins exert their effects.
Suppressors can mediate suppression of expression by overlapping
transcription start sites or transcription activator sites, or they
can mediate suppression from distinct locations with respect to
these sites.
[0067] Modifications of the promoter sequences of the present
invention can provide for a range of expression. Generally, by
"weak promoter" is intended a promoter that drives expression of a
coding sequence at a low level. By "low level" is intended at
levels of about 1/10,000 transcripts to about 1/100,000 transcripts
to about 1/500,000 transcripts. Conversely, a strong promoter
drives expression of a coding sequence at a high level, or at about
1/10 transcripts to about 1/100 transcripts to about 1/1,000
transcripts.
[0068] The nucleotide sequences for the plant promoters of the
present invention comprise the sequences set forth in SEQ ID NOS:
73 and 74 or any sequence having substantial identity to the
sequences. By "substantial identity" is intended a sequence
exhibiting substantial functional and structural equivalence with
the sequence set forth. Any functional or structural differences
between substantially identical sequences do not affect the ability
of the sequence to function as a promoter as disclosed in the
present invention.
[0069] Promoters comprising biologically active fragments of SEQ ID
NOS: 73 and 74 of the invention are also encompassed by the present
invention. By "fragment" is intended a portion of the promoter
nucleotide sequence that is shorter than the full-length promoter
sequence and which may retain biological activity. Alternatively,
fragments of a nucleotide sequence that are useful as hybridization
probes or PCR primers generally do not retain biological activity.
Thus, fragments of a nucleotide sequence may range from at least
about 15, 20, or 25 nucleotides, and up to but not including the
full length of a nucleotide sequence of the invention.
[0070] The invention encompasses variants of the plant promoters.
By "variants" is intended substantially identical sequences.
Naturally-occurring variants of the promoter sequences can be
identified and/or isolated with the use of well-known molecular
biology techniques, as, for example, with PCR and hybridization
techniques as outlined below.
[0071] Variant promoter nucleotide sequences include synthetically
derived nucleotide sequences, such as those generated, for example,
by using site-directed mutagenesis or automated oligonucleotide
synthesis, but which still exhibit promoter activity. Methods for
mutagenesis and nucleotide sequence alterations are well known in
the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA
82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382;
U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques
in Molecular Biology (MacMillan Publishing Company, New York) and
the references cited therein. Generally, a nucleotide sequence of
the invention will have at least 80%, preferably 85%, 90%, 95%, up
to 98% or more sequence identity to its respective reference
promoter nucleotide sequence, and enhance or promote expression of
heterologous coding sequences in plants or plant cells.
[0072] Biologically active variants of the promoter element
sequences should retain promoter regulatory activity, and thus
enhance or suppress expression of a nucleotide sequence operably
linked to a transcription regulatory unit comprising the promoter
element. Promoter activity may be measured by Northern blot
analysis. See, for example, Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.); herein incorporated by reference. Protein
expression indicative of promoter activity can be measured by
determining the activity of a protein encoded by the coding
sequence operably linked to the particular promoter; including but
not limited to such examples as GUS (b-glucoronidase; Jefferson
(1987) Plant Mol. Biol. Rep. 5:387), GFP (green florescence
protein; Chalfie et al. (1994) Science 263:802), luciferase (Riggs
et al. (1987) Nucleic Acids Res. 15(19):8115 and Luehrsen et al.
(1992) Methods Enzymol. 216:397-414), and the maize genes encoding
for anthocyanin production (Ludwig et al. (1990) Science
247:449).
[0073] The invention also encompasses nucleotide sequences which
hybridize to the promoter element sequences of the invention under
stringent conditions, and enhance or suppress expression of a
nucleotide sequence operably linked to a transcription regulatory
unit comprising the promoter sequences. Hybridization methods are
known in the art. See, for example Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.). See also Innis et al., eds. (1990) PCT
Protocols: A Guide to Methods and Applications (Academic Press, New
York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic
Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods
Manual (Academic Press, New York).
[0074] An "isolated" or "purified" nucleic acid molecule, or
biologically active portion thereof, is substantially free of other
cellular material, or culture medium when produced by recombinant
techniques, or substantially free of chemical precursors or other
chemicals when chemically synthesized.
[0075] "Translation leader sequence" refers to a nucleotide
sequence located between the promoter sequence of a gene and the
coding sequence. The translation leader sequence is present in the
fully processed mRNA upstream of the translation start sequence.
The translation leader sequence may affect processing of the
primary transcript to mRNA, mRNA stability or translation
efficiency. Examples of translation leader sequences have been
described (Turner and Foster (1995) Mol. Biotechnol.
3:225-236).
[0076] The term "3' non-coding sequences" refers to nucleotide
sequences located downstream of a coding sequence and includes
polyadenylation recognition sequences and other sequences encoding
regulatory signals capable of affecting mRNA processing or gene
expression. The polyadenylation signal is usually characterized by
the addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. The use of different 3' non-coding sequences is
exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
[0077] "RNA transcript" refers to the product resulting from RNA
polymerase-catalyzed transcription of a DNA sequence. When the RNA
transcript is a perfect complementary copy of the DNA sequence, it
is referred to as the primary transcript. An RNA sequence derived
from post-transcriptional processing of the primary transcript is
referred to as the mature RNA. "Messenger RNA (mRNA)" refers to the
RNA that is without introns and that can be translated into
polypeptides by the cell. "cDNA" refers to DNA that is
complementary to and derived from an mRNA template. The cDNA can be
single-stranded or converted to double-stranded form using, for
example, the Klenow fragment of DNA polymerase 1. "Sense-RNA"
refers to an RNA transcript that includes the mRNA and so can be
translated into a polypeptide by the cell. "Antisense RNA" refers
to an RNA transcript that is complementary to all or part of a
target primary transcript or mRNA and that blocks the expression of
a target gene (see U.S. Pat. No. 5,107,065, incorporated herein by
reference). The complementarity of an antisense RNA may be with any
part of the specific nucleotide sequence, i.e., at the 5'
non-coding sequence, 3' non-coding sequence, introns, or the coding
sequence. "Functional RNA" refers to sense RNA, antisense RNA,
ribozyme RNA, or other RNA that may not be translated but yet has
an effect on cellular processes.
[0078] The term "operably linked" refers to the association of two
or more nucleic acid fragments on a single polynucleotide so that
the function of one is affected by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of affecting the expression of that coding sequence (i.e.,
that the coding sequence is under the transcriptional control of
the promoter). Coding sequences can be operably linked to
regulatory sequences in sense or antisense orientation.
[0079] The term "expression", as used herein, refers to the
transcription and stable accumulation of sense (mRNA) or antisense
RNA derived from the nucleic acid fragment of the invention.
Expression may also refer to translation of mRNA into a
polypeptide. "Antisense inhibition" refers to the production of
antisense RNA transcripts capable of suppressing the expression of
the target protein. "Overexpression" refers to the production of a
gene product in transgenic organisms that exceeds levels of
production in normal or non-transformed organisms. "Co-suppression"
refers to the production of sense RNA transcripts capable of
suppressing the expression of identical or substantially similar
foreign or endogenous genes (U.S. Pat. No. 5,231,020, incorporated
herein by reference).
[0080] A "protein" or "polypeptide" is a chain of amino acids
arranged in a specific order determined by the coding sequence in a
polynucleotide encoding the polypeptide. Each protein or
polypeptide has a unique function.
[0081] "Altered levels" or "altered expression" refers to the
production of gene product(s) in transgenic organisms in amounts or
proportions that differ from that of normal or non-transformed
organisms.
[0082] "Null mutant" refers here to a host cell which either lacks
the expression of a certain polypeptide or expresses a polypeptide
which is inactive or does not have any detectable expected
enzymatic function.
[0083] "Mature protein" or the term "mature" when used in
describing a protein refers to a post-translationally processed
polypeptide; i.e., one from which any pre- or propeptides present
in the primary translation product have been removed. "Precursor
protein" or the term "precursor" when used in describing a protein
refers to the primary product of translation of mRNA; i.e., with
pre- and propeptides still present. Pre- and propeptides may be,
but are not limited to, intracellular localization signals.
[0084] A "chloroplast transit peptide" is an amino acid sequence
which is translated in conjunction with a protein and directs the
protein to the chloroplast or other plastid types present in the
cell in which the protein is made. "Chloroplast transit sequence"
refers to a nucleotide sequence that encodes a chloroplast transit
peptide. A "signal peptide" is an amino acid sequence which is
translated in conjunction with a protein and directs the protein to
the secretory system (Chrispeels (1991) Ann. Rev. Plant Phys. Plant
Mol. Biol. 42:21-53). If the protein is to be directed to a
vacuole, a vacuolar targeting signal (supra) can further be added,
or if to the endoplasmic reticulum, an endoplasmic reticulum
retention signal (supra) may be added. If the protein is to be
directed to the nucleus, any signal peptide present should be
removed and instead a nuclear localization signal included (Raikhel
(1992) Plant Phys. 100:1627-1632).
[0085] "Transformation" refers to the transfer of a nucleic acid
fragment into the genome of a host organism, resulting in
genetically stable inheritance. Host organisms containing the
transformed nucleic acid fragments are referred to as "transgenic"
organisms. Examples of methods of plant transformation include
Agrobacterium-mediated transformation (De Blaere et al. (1987)
Meth. Enzymol. 143:277) and particle-accelerated or "gene gun"
transformation technology (Klein et al. (1987) Nature (London)
327:70-73; U.S. Pat. No. 4,945,050, incorporated herein by
reference). Thus, isolated polynucleotides of the present invention
can be incorporated into recombinant constructs, typically DNA
constructs, capable of introduction into and replication in a host
cell. Such a construct can be a vector that includes a replication
system and sequences that are capable of transcription and
translation of a polypeptide-encoding sequence in a given host
cell. A number of vectors suitable for stable transfection of plant
cells or for the establishment of transgenic plants have been
described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory
Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for
Plant Molecular Biology, Academic Press, 1989; and Flevin et al.,
Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990.
Typically, plant expression vectors include, for example, one or
more cloned plant genes under the transcriptional control of 5' and
3' regulatory sequences and a dominant selectable marker. Such
plant expression vectors also can contain a promoter regulatory
region (e.g., a regulatory region controlling inducible or
constitutive, environmentally- or developmentally-regulated, or
cell- or tissue-specific expression), a transcription initiation
start site, a ribosome binding site, an RNA processing signal, a
transcription termination site, and/or a polyadenylation
signal.
[0086] Standard recombinant DNA and molecular cloning techniques
used herein are well known in the art and are described more fully
in Sambrook et al. Molecular Cloning: A Laboratory Manual; Cold
Spring Harbor Laboratory Press: Cold Spring Harbor, 1989
(hereinafter "Maniatis").
[0087] "PCR" or "polymerase chain reaction" is well known by those
skilled in the art as a technique used for the amplification of
specific DNA segments (U.S. Pat. Nos. 4,683,195 and 4,800,159).
[0088] As used herein, the term "plant" includes reference to whole
plants and their progeny; plant cells; plant parts or organs, such
as embryos, pollen, ovules, seeds, flowers, kernels, ears, cobs,
leaves, husks, stalks, stems, roots, root tips, anthers, silk and
the like. Plant cell, as used herein, further includes, without
limitation, cells obtained from or found in: seeds, suspension
cultures, embryos, meristematic regions, callus tissue, leaves,
roots, shoots, gametophytes, sporophytes, pollen, and microspores.
Plant cells can also be understood to include modified cells, such
as protoplasts, obtained from the aforementioned tissues. The class
of plants which can be used in the methods of the invention is
generally as broad as the class of higher plants amenable to
transformation techniques, including both monocotyledonous and
dicotyledonous plants. A particularly preferred plant is Zea
mays.
[0089] The nucleotide sequences for the promoters of the invention
are provided in expression cassettes along with nucleotide
sequences of interest for expression in the plant of interest. Such
nucleotide constructs or expression cassettes will comprise a
transcriptional initiation region in combination with a promoter
element operably linked to the nucleotide sequence whose expression
is to be controlled by the promoters disclosed herein. Such
construct is provided with a plurality of restriction sites for
insertion of the nucleotide sequence to be under the
transcriptional regulation of the regulatory regions. The
expression cassette may additionally contain selectable marker
genes.
[0090] The transcriptional cassette will include in the 5'-to-3'
direction of transcription, a transcriptional and translational
initiation region, one or more promoter elements, a nucleotide
sequence of interest, and a transcriptional and translational
termination region functional in plant cells. The termination
region may be native with the transcriptional initiation region
comprising one or more of the promoter nucleotide sequences of the
present invention, may be native with the DNA sequence of interest,
or may be derived from another source. Convenient termination
regions are available from the Ti-plasmid of A. tumefaciens, such
as the octopine synthase and nopaline synthase termination regions.
See also, Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144;
Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev.
5:141-149; Mogen et al., (1990) Plant Cell 2:1261-1272; Munroe et
al. (1990) Gene 91:151-158; Ballas et al. 1989) Nucleic Acids Res.
17:7891-7903; Joshi et al. (1987) Nucleic Acid Res.
15:9627-9639.
[0091] The expression cassette comprising the transcription
regulatory unit of the invention operably linked to a nucleotide
sequence may also contain at least one additional nucleotide
sequence for a gene to be cotransformed into the organism.
Alternatively, the additional sequence(s) can be provided on
another expression cassette.
[0092] Where appropriate, the nucleotide sequence whose expression
is to be under the control of the promoter sequence of the present
invention, and any additional nucleotide sequence(s), may be
optimized for increased expression in the transformed plant. That
is, these nucleotide sequences can be synthesized using
plant-preferred codons for improved expression. Methods are
available in the art for synthesizing plant-preferred nucleotide
sequences. See, for example, U.S. Pat. Nos. 5,380,831 and
5,436,391, and Murray et al., (1989) Nucleic Acids Res. 17:477-498,
herein incorporated by reference.
[0093] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other such
well-characterized sequences that may be deleterious to gene
expression. The G-C content of the nucleotide sequence of interest
may be adjusted to levels average for a given cellular host, as
calculated by reference to known genes expressed in the host cell.
When possible, the sequence is modified to avoid predicted hairpin
secondary mRNA structures.
[0094] The expression cassettes may additionally contain 5' leader
sequences in the expression cassette construct. Such leader
sequences can act to enhance translation. Translation leaders are
known in the art and include: picornavirus leaders, for example,
EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein
et al. (1989) Proc. Nat. Acad. Sci. USA 86:6126-6130); potyvirus
leaders, for example, TEV leader (Tobacco Etch Virus) (Allison et
al. (1986)); MDMV leader (Maize Dwarf Mosaic Virus) (Virology
154:9-20); human immunoglobulin heavy-chain binding protein (BiP)
(Macejak and Sarnow (1991) Nature 353:90-94); untranslated leader
from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4)
(Jobling and Gehrke (1987) Nature 325:622-625); tobacco mosaic
virus leader (TMV) (Gallie et al. (1989) Molecular Biology of RNA,
pages 237-256); and maize chlorotic mottle virus leader (MCMV)
(Lommel et al. (1991) Virology 81:382-385). See also Della-Cioppa
et al. (1987) Plant Physiology 84:965-968. Other methods known to
enhance translation and/or mRNA stability can also be utilized, for
example, introns, and the like.
[0095] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Toward this end, adapters or linkers may be
employed to join the DNA fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous DNA, removal of restriction sites, or the like. For
this purpose, in vitro mutagenesis, primer repair, restriction,
annealing, substitutions, for example, transitions and
transversions, may be involved.
[0096] The promoters may be used to drive reporter genes or
selectable marker genes. Examples of suitable reporter genes known
in the art can be found in, for example, Jefferson et al. (1991) in
Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer Academic
Publishers), pp. 1-33; DeWet et al. (1987) Mol. Cell. Biol.
7:725-737; Goff et al. (1990) EMBO J. 9:2517-2522; and Kain et al.
(1995) BioTechniques 19:650-655; and Chiu et al. (1996) Current
Biology 6:325-330.
[0097] Selectable marker genes for selection of transformed cells
or tissues can include genes that confer antibiotic resistance or
resistance to herbicides. Examples of suitable selectable marker
genes include, but are not limited to, genes encoding resistance to
chloramphenicol (Herrera Estrella et al. (1983) EMBO J. 2:987-992);
methotrexate (Herrera Estrella et al. (1983) Nature 303:209-213;
Meijer et al. (1991) Plant Mol. Biol. 16:807-820); hygromycin
(Waldron et al. (1985) Plant Mol. Biol. 5:103-108; Zhijian et al.
(1995) Plant Science 108:219-227); streptomycin (Jones et al.
(1987) Mol. Gen. Genet. 210:86-91); spectinomycin (Bretagne-Sagnard
et al. (1996) Transgenic Res. 5:131-137); bleomycin (Hille et al.
(1990) Plant Mol. Biol. 7:171-176); sulfonamide (Guerineau et al.
(1990) Plant Mol. Biol. 15:127-136); bromoxynil (Stalker et al.
(1988) Science 242:419423); glyphosate (Shaw et al. (1986) Science
233:478481); phosphinothricin (DeBlock et al. (1987) EMBO J.
6:2513-2518).
[0098] Other genes that could serve utility in the recovery of
transgenic events but might not be required in the final product
would include, but are not limited to, such examples as GUS
(b-glucoronidase; Jefferson (1987) Plant Mol. Biol. Rep. 5:387),
GFP (green fluorescence protein; Chalfie et al. (1994) Science
263:802), luciferase (Riggs et al. (1987) Nucleic Acids Res.
15(19):8115 and Luehrsen et al. (1992) Methods Enzymol.
216:397-414), and the maize genes encoding for anthocyanin
production (Ludwig et al. (1990) Science 247:449).
[0099] The expression cassette comprising the transcription
regulatory unit of the present invention operably linked to a
nucleotide sequence of interest can be used to transform any plant.
In this manner, genetically modified plants, plant cells, plant
tissue, seed, and the like can be obtained. Transformation
protocols as well as protocols for introducing nucleotide sequences
into plants may vary depending on the type of plant or plant cell,
i.e., monocot or dicot, targeted for transformation. Suitable
methods of introducing nucleotide sequences into plant cells and
subsequent insertion into the plant genome include microinjection
(Crossway et al. (1986) Biotechniques 4:320-334), electroporation
(Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606,
Agrobacterium-mediated transformation (Townsend et al., U.S. Pat.
No. 5,563,055), direct gene transfer (Paszkowski et al. (1984) EMBO
J. 3:2717-2722), and ballistic particle acceleration (see, for
example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al.,
(1995) "Direct DNA Transfer into Intact Plant Cells via
Microprojectile Bombardment," in Plant Cell, Tissue, and Organ
Culture: Fundamental Methods, ed. Gamborg and Phillips
(Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology
6:923-926). Also see Weissinger et al. (1988) Ann. Rev. Genet.
22:421-477; Sanford et al. (1987) Particulate Science and
Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol.
87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926
(soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol.
27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet.
96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740
(rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:43054309
(maize); Klein et al. (1988) Biotechnology 6:559-563 (maize);
Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos.
5,322,783 and 5,324,646; Tomes et al. (1995) "Direct DNA Transfer
into Intact Plant Cells via Microprojectile Bombardment," in Plant
Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg
(Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant
Physiol. 91:440444 (maize); Fromm et al. (1990) Biotechnology
8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature
(London) 311:763-764; Bytebier et al. (1987) Proc. Natl. Acad. Sci.
USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The
Experimental Manipulation of Ovule Tissues, ed. Chapman et al.
(Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990)
Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor.
Appl. Genet. 84:560-566 (whisker-mediated transformation);
D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation);
Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and
Ford (1995) Annals of Botany 75:407413 (rice); Osjoda et al. (1996)
Nature Biotechnology 14:745-750 (maize via Agrobacterium
tumefaciens); all of which are herein incorporated by
reference.
[0100] In certain preferred embodiments in this regard, the vectors
provide for preferred expression. Such preferred expression may be
inducible expression, or temporally limited, or restricted to
predominantly certain types of cells, or any combination of the
above. Particularly preferred among inducible vectors are vectors
that can be induced for expression by environmental factors that
are easy to manipulate, such as temperature and nutrient additives.
A variety of vectors suitable to this aspect of the invention,
including constitutive and inducible expression vectors for use in
prokaryotic and eukaryotic hosts, are well known and employed
routinely by those of skill in the art. Such vectors include, among
others, chromosomal, episomal and virus-derived vectors, e.g.,
vectors derived from bacterial plasmids, from bacteriophage, from
transposons, from yeast episomes, from insertion elements, from
yeast chromosomal elements, from viruses such as baculoviruses,
papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl
pox viruses, pseudorabies viruses and retroviruses, and vectors
derived from combinations thereof, such as those derived from
plasmid and bacteriophage genetic elements, such as cosmids and
phagemids and binaries used for Agrobacterium-mediated
transformations. All may be used for expression in accordance with
this aspect of the present invention.
[0101] The cells that have been transformed may be grown into
plants in accordance with conventional ways. See, for example,
McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting hybrid having
expression of the desired phenotypic characteristic identified. Two
or more generations may be grown to ensure that expression of the
desired phenotypic characteristic is stably maintained and
inherited and then seeds harvested to ensure expression of the
desired phenotypic characteristic has been achieved.
[0102] The present invention may be used for transformation of any
plant species, including, but not limited to, maize (Zea mays),
Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly
those Brassica species useful as sources of seed oil, alfalfa
(Medicago sativa), rice (Oryza sativa), rye (Secale cereale),
sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl
millet (Pennisetum glaucum), proso millet (Panicum miliaceum),
foxtail millet (Setaria italica), finger millet (Eleusine
coracana)), sunflower (Helianthus annuus), safflower (Carthamus
tinctorius), wheat (Triticum aestivum), soybean (Glycine max),
tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts
(Arachis hypogaea), cotton (Gossypium barbadense, Gossypium
hirsutum), sweet potato (Ipomoea batatus), cassaya (Manihot
esculenta), coffee (Coffea spp.), coconut (Cocos nucifera),
pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa
(Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.),
avocado (Persea americana), fig (Ficus casica), guava (Psidium
guajava), mango (Mangifera indica), olive (Olea europaea), papaya
(Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia integrifolia), almond (Prunus amygdalus), sugar beets
(Beta vulgaris), sugarcane (Saccharum spp.), oats, barley,
vegetables, ornamentals, and conifers.
[0103] Vegetables include tomatoes (Lycopersicon esculentum),
lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris),
lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members
of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C.
cantalupensis), and musk melon (C. melo). Ornamentals include
azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea),
hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa
spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida),
carnation (Dianthus caryophyllus), poinsettia (Euphorbia
pulcherrima), and chrysanthemum. Conifers that may be employed in
practicing the present invention include, for example, pines such
as loblolly pine (Pinus taeda), slash pine (Pinus elliotii),
ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta),
and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga
menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea
glauca); redwood (Sequoia sempervirens); true firs such as silver
fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars
such as Western red cedar (Thuja plicata) and Alaska yellow-cedar
(Chamaecyparis nootkatensis). Preferably, plants of the present
invention are crop plants (for example, maize, alfalfa, sunflower,
Brassica, soybean, cotton, safflower, peanut, sorghum, wheat,
millet, tobacco, etc.), more preferably maize and soybean plants,
yet more preferably maize plants.
[0104] Plants of particular interest include grain plants that
provide seeds of interest, oil-seed plants, and leguminous plants.
Seeds of interest include grain seeds, such as maize, wheat,
barley, rice, sorghum, rye, etc. Oil-seed plants include cotton,
soybean, safflower, sunflower, Brassica, maize, alfalfa, palm,
coconut, etc. Leguminous plants include beans and peas. Beans
include guar, locust bean, fenugreek, soybean, garden beans,
cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
[0105] The promoter sequences and methods disclosed herein,
comprising SEQ ID NO: 73 and 74, are useful in regulating
expression of a nucleotide sequence of interest in a host plant in
a spatial-, temporal-, and/or tissue-preferred manner. Thus, the
nucleotide sequence operably linked to the promoters disclosed
herein may be a structural gene encoding a protein of interest.
Examples of such genes include, but are not limited to, genes
encoding proteins conferring resistance to abiotic stress, such as
drought, temperature, salinity, and toxins such as pesticides and
herbicides, or to biotic stress, such as attacks by fungi, viruses,
bacteria, insects, and nematodes, and development of diseases
associated with these organisms. Other examples include genes
encoding proteins which modify plant reproduction, such as those
affecting male or female sterility or fertility, or which
preferentially express in maternal or paternal tissue.
[0106] Alternatively, the nucleotide sequence operably linked to
one of the promoters disclosed herein may be an antisense sequence
for a targeted gene. Thus, sequences can be constructed which are
complementary to, and will hybridize with, the messenger RNA (mRNA)
of the targeted gene. Modifications of the antisense sequences may
be made, as long as the sequences hybridize to and interfere with
expression of the corresponding mRNA. In this manner, antisense
constructions having 70%, preferably 80%, more preferably 85%
sequence similarity to the corresponding antisensed sequences may
be used. Furthermore, portions of the antisense nucleotides may be
used to disrupt the expression of the target gene. Generally,
sequences of at least 50 nucleotides, 100 nucleotides, 200
nucleotides, or greater may be used. When delivered into a plant
cell, expression of the antisense DNA sequence prevents normal
expression of the DNA nucleotide sequence for the targeted gene. In
this manner, production of the native protein encoded by the
targeted gene is inhibited to achieve a desired phenotypic
response. Thus the promoter is linked to antisense DNA sequences to
reduce or inhibit expression of a native protein in the plant.
[0107] The present invention concerns an isolated polynucleotide
comprising a nucleotide sequence encoding a functional FIE
polypeptide having at least 80% identity, based on the GAP (GCG
Version 10) method of alignment, to a polypeptide selected from the
group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56, 58, 60, 62, 64, 66, 68 and 70.
[0108] The present invention also concerns an isolated
polynucleotide comprising a chromosomal nucleotide sequence having
at least 80% identity, based on the GAP (GCG Version 10) method of
alignment, to a nucleotide of SEQ ID NO: 71 or 72.
[0109] Preferably, the isolated nucleotide sequence comprises a
nucleic acid sequence selected from the group consisting of SEQ ID
NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33,
35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67,
69, 71, and 72 that codes for the polypeptide selected from the
group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56, 58, 60, 62, 64, 66, 68 and 70.
[0110] Nucleic acid fragments encoding at least a portion of
several proteins involved in seed development have been isolated
and identified by comparison of random plant cDNA sequences to
public databases containing nucleotide and protein sequences, using
the BLAST algorithms well known to those skilled in the art. The
nucleic acid fragments of the instant invention may be used to
isolate cDNAs and genes encoding homologous proteins from the same
or other plant species. Isolation of homologous genes using
sequence-dependent protocols is well known in the art. Examples of
sequence-dependent protocols include, but are not limited to,
methods of nucleic acid hybridization, and methods of DNA and RNA
amplification as exemplified by various uses of nucleic acid
amplification technologies (e.g., polymerase chain reaction, ligase
chain reaction).
[0111] For example, genes encoding other fertilization-independent
endosperm proteins, either as cDNAs or genomic DNAs, could be
isolated directly by using all or a portion of the instant nucleic
acid fragments as DNA hybridization probes to screen libraries from
any desired plant, employing methodology well known to those
skilled in the art. Specific oligonucleotide probes based upon the
instant nucleic acid sequences can be designed and synthesized by
methods known in the art (e.g., Molecular Cloning: A Laboratory
Manual, 2.sup.nd Edition, Sambrook, Fritsch, and Maniatis).
Moreover, an entire sequence can be used directly to synthesize DNA
probes by methods known to the skilled artisan, such as random
primer DNA labeling, nick translation, end-labeling techniques, or
RNA probes using available in vitro transcription systems. In
addition, specific primers can be designed and used to amplify a
part or all of the instant sequences. The resulting amplification
products can be labeled directly during amplification reactions or
labeled after amplification reactions, and used as probes to
isolate full length cDNA or genomic fragments under conditions of
appropriate stringency.
[0112] In addition, two short segments of the instant nucleic acid
fragments may be used in polymerase chain reaction protocols to
amplify longer nucleic acid fragments encoding homologous genes
from DNA or RNA. The polymerase chain reaction may also be
performed on a library of cloned nucleic acid fragments wherein the
sequence of one primer is derived from the instant nucleic acid
fragments, and the sequence of the other primer takes advantage of
the presence of the polyadenylic acid tracts to the 3' end of the
mRNA precursor encoding plant genes. Alternatively, the second
primer sequence may be based upon sequences derived from the
cloning vector. For example, the skilled artisan can follow the
RACE protocol (Frohman et al., (1988) Proc. Natl. Acad. Sci. USA
85:8998-9002) to generate cDNAs by using PCR to amplify copies of
the region between a single point in the transcript and the 3' or
5' end. Primers oriented in the 3' and 5' directions can be
designed from the instant sequences. Using commercially available
3' RACE or 5' RACE systems (BRL), specific 3' or 5' cDNA fragments
can be isolated (Ohara et al. (1989) Proc. Natl. Acad. Sci. USA
86:5673-5677; Loh et al. (1989) Science 243:217-220). Products
generated by the 3' and 5' RACE procedures can be combined to
generate full-length cDNAs (Frohman and Martin (1989) Techniques
1:165). Consequently, a polynucleotide comprising a nucleotide
sequence of at least 60 (preferably at least 40, most preferably at
least 30) contiguous nucleotides derived from a nucleotide sequence
selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9,
11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43,
45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, and 72 and
the complement of such nucleotide sequences may be used in such
methods to obtain a nucleic acid fragment encoding a substantial
portion of an amino acid sequence of a polypeptide.
[0113] The present invention relates to a method of obtaining a
nucleic acid fragment encoding a substantial portion of a
fertilization-independe- nt endosperm polypeptide, comprising the
steps of: synthesizing an oligonucleotide primer comprising a
nucleotide sequence of at least 60 (preferably at least 40, most
preferably at least 30) 10 contiguous nucleotides derived from a
nucleotide sequence selected from the group consisting of SEQ ID
NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33,
35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67,
69, 71 and 72, and the complement of such nucleotide sequences; and
amplifying a nucleic acid fragment (preferably a cDNA inserted in a
cloning vector) using the oligonucleotide primer. The amplified
nucleic acid fragment preferably will encode a portion of a
fertilization-independent endosperm polypeptide.
[0114] Availability of the instant nucleotide and deduced amino
acid sequences facilitates immunological screening of cDNA
expression libraries. Synthetic peptides representing portions of
the instant amino acid sequences may be synthesized. These peptides
can be used to immunize animals to produce polyclonal or monoclonal
antibodies with specificity for peptides or proteins comprising the
amino acid sequences. These antibodies can be then be used to
screen cDNA expression libraries to isolate full-length cDNA clones
of interest (Lerner (1984) Adv. Immunol. 36:1-34; Maniatis).
[0115] In another embodiment, this invention concerns viruses and
host cells comprising either the chimeric genes of the invention as
described herein or an isolated polynucleotide of the invention as
described herein. Examples of host cells which can be used to
practice the invention include, but are not limited to, yeast,
bacteria, and plants.
[0116] As was noted above, the nucleic acid fragments of the
instant invention may be used to create transgenic plants in which
the disclosed polypeptides are present at higher or lower levels
than normal or in cell types or developmental stages in which they
are not normally found. This would have the effect of altering
endosperm and/or embryo formation in those plants.
[0117] Overexpression of the proteins of the instant invention may
be accomplished by first constructing a chimeric gene in which the
coding region is operably linked to a promoter capable of directing
expression of a gene in the desired tissues at the desired stage of
development. The chimeric gene may comprise promoter sequences and
translation leader sequences derived from the same genes. 3'
non-coding sequences encoding transcription termination signals may
also be provided. The instant chimeric gene may also comprise one
or more introns in order to facilitate gene expression.
[0118] Plasmid vectors comprising the instant isolated
polynucleotide (or chimeric gene) may be constructed. The choice of
plasmid vector is dependent upon the method that will be used to
transform host plants. The skilled artisan is well aware of the
genetic elements that must be present on the plasmid vector in
order to successfully transform, select and propagate host cells
containing the chimeric gene. The skilled artisan will also
recognize that different independent transformation events will
result in different levels and patterns of expression (Jones et al.
(1985) EMBO J. 4:2411-2418; De Almeida et al. (1989) Mol. Gen.
Genetics 218:78-86), and thus that multiple events must be screened
in order to obtain lines displaying the desired expression level
and pattern. Such screening may be accomplished by Southern
analysis of DNA, Northern analysis of mRNA expression, Western
analysis of protein expression, or phenotypic analysis.
[0119] For some applications it may be useful to direct the instant
polypeptides to different cellular compartments, or to facilitate
their secretion from the cell. It is thus envisioned that the
chimeric gene described above may be further supplemented by
directing the coding sequence to encode the instant polypeptides
with appropriate intracellular targeting sequences such as transit
sequences (Keegstra (1989) Cell 56:247-253), signal sequences or
sequences encoding endoplasmic reticulum localization (Chrispeels
(1991) Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21-53) or nuclear
localization signals (Raikhel (1992) Plant Phys. 100:1627-1632)
with or without removing targeting sequences that are already
present. While the references cited give examples of each of these,
the list is not exhaustive and more targeting signals of use may be
discovered in the future.
[0120] It may also be desirable to reduce or eliminate expression
of genes encoding the instant polypeptides in plants for some
applications. In order to accomplish this, a chimeric gene designed
for co-suppression of the instant polypeptide can be constructed by
linking a gene or gene fragment encoding that polypeptide to plant
promoter sequences. Alternatively, a chimeric gene designed to
express antisense RNA for all or part of the instant nucleic acid
fragment can be constructed by linking the gene or gene fragment in
reverse orientation to plant promoter sequences. Either the
co-suppression or antisense chimeric genes could be introduced into
plants via transformation wherein expression of the corresponding
endogenous genes is reduced or eliminated.
[0121] Molecular genetic solutions to the generation of plants with
altered gene expression have a decided advantage over more
traditional plant breeding approaches. Changes in plant phenotypes
can be produced by specifically inhibiting expression of one or
more genes by antisense inhibition or co-suppression (U.S. Pat.
Nos. 5,190,931, 5,107,065, and 5,283,323), by formation of
double-stranded RNA (International Publication Number WO 99/53050;
Smith et al., Nature 407:319-320 (2000)), and through other methods
known to those of skill in the art.
[0122] An antisense, co-suppression, or dsRNA construct would act
as a dominant negative regulator of gene activity. While
conventional mutations can yield negative regulation of gene
activity, these effects are most likely recessive. The dominant
negative regulation available with a transgenic approach may be
advantageous from a breeding perspective. In addition, the ability
to restrict the expression of a specific phenotype to the
reproductive tissues of the plant by the use of tissue-specific
promoters may confer agronomic advantages relative to conventional
mutations which may have an effect in all tissues in which a mutant
gene is ordinarily expressed.
[0123] The person skilled in the art will know that special
considerations are associated with the use of antisense or
cosuppression technologies in order to reduce expression of
particular genes. For example, the proper level of expression of
sense or antisense genes may require the use of different chimeric
genes utilizing different regulatory elements known to the skilled
artisan. Once transgenic plants are obtained by one of the methods
described above, it will be necessary to screen individual
transgenics for those that most effectively display the desired
phenotype. Accordingly, the skilled artisan will develop methods
for screening large numbers of transformants. The nature of these
screens will generally be chosen on practical grounds. For example,
one can screen by looking for changes in gene expression by using
antibodies specific for the protein encoded by the gene being
suppressed, or one could establish assays that specifically measure
enzyme activity. A preferred method will be one which allows large
numbers of samples to be processed rapidly, since it will be
expected that a large number of transformants will be negative for
the desired phenotype.
[0124] In another embodiment, the present invention concerns a
polypeptide that has at least 80% identity, based on the GAP (GCG
Version 10) method of alignment, to a polypeptide selected from the
group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56, 58, 60, 62, 64, 66, 68 and 70.
[0125] The instant polypeptides (or portions thereof) may be
produced in heterologous host cells, particularly in the cells of
microbial hosts, and can be used to prepare antibodies to these
proteins by methods well known to those skilled in the art. The
antibodies are useful for detecting the polypeptides of the instant
invention in situ in cells or in vitro in cell extracts. Preferred
heterologous host cells for production of the instant polypeptides
are microbial hosts. Microbial expression systems and expression
vectors containing regulatory sequences that direct high level
expression of foreign proteins are well known to those skilled in
the art. Any of these could be used to construct a chimeric gene
for production of the instant polypeptides. This chimeric gene
could then be introduced into appropriate microorganisms via
transformation to provide high level expression of the encoded
reproduction proteins. An example of a vector for high level
expression of the instant polypeptides in a bacterial host is
provided (Example 16).
[0126] All or a substantial portion of the polynucleotides of the
instant invention may also be used as probes for genetically and
physically mapping the genes that they are a part of, and used as
markers for traits linked to those genes. Such information may be
useful in plant breeding in order to develop lines with desired
phenotypes. For example, the instant nucleic acid fragments may be
used as restriction fragment length polymorphism (RFLP) markers.
Southern blots (Maniatis) of restriction-digested plant genomic DNA
may be probed with the nucleic acid fragments of the instant
invention. The resulting banding patterns may then be subjected to
genetic analyses using computer programs such as MapMaker (Lander
et al. (1987) Genomics 1:174-181) in order to construct a genetic
map. In addition, the nucleic acid fragments of the instant
invention may be used to probe Southern blots containing
restriction endonuclease-treated genomic DNAs of a set of
individuals representing parent and progeny of a defined genetic
cross. Segregation of the DNA polymorphisms is noted and used to
calculate the position of the instant nucleic acid sequence in the
genetic map previously obtained using this population (Botstein et
al. (1980) Am. J. Hum. Genet. 32:314-331).
[0127] The production and use of plant gene-derived probes for use
in genetic mapping is described in Bematzky and Tanksley (1986)
Plant Mol. Biol. Reporter 4:37-41. Numerous publications describe
genetic mapping of specific cDNA clones using the methodology
outlined above or variations thereof. For example, F2 intercross
populations, backcross populations, randomly mated populations,
near isogenic lines, and other sets of individuals may be used for
mapping. Such methodologies are well known to those skilled in the
art.
[0128] Nucleic acid probes derived from the instant nucleic acid
sequences may also be used for physical mapping (i.e., placement of
sequences on physical maps; see Hoheisel et al. In: Nonmammalian
Genomic Analysis: A Practical Guide, Academic press 1996, pp.
319-346, and references cited therein).
[0129] In another embodiment, nucleic acid probes derived from the
instant nucleic acid sequences may be used in direct fluorescence
in situ hybridization (FISH) mapping (Trask (1991) Trends Genet.
7:149-154). Although current methods of FISH mapping favor use of
large clones (several to several hundred kilobases; see Laan et al.
(1995) Genome Res. 5:13-20), improvements in sensitivity may allow
performance of FISH mapping using shorter probes.
[0130] A variety of nucleic acid amplification-based methods of
genetic and physical mapping may be carried out using the instant
nucleic acid sequences. Examples include allele-specific
amplification (Kazazian (1989) J. Lab. Clin. Med. 11:95-96),
polymorphism of PCR-amplified fragments (CAPS; Sheffield et al.
(1993) Genomics 16:325-332), allele-specific ligation (Landegren et
al. (1988) Science 241:1077-1080), nucleotide extension reactions
(Sokolov (1990) Nucleic Acid Res. 18:3671), Radiation Hybrid
Mapping (Walter et al. (1997) Nat. Genet. 7:22-28) and Happy
Mapping (Dear and Cook (1989) Nucleic Acid Res. 17:6795-6807). For
these methods, the sequence of a nucleic acid fragment is used to
design and produce primer pairs for use in the amplification
reaction or in primer extension reactions. The design of such
primers is well known to those skilled in the art. In methods
employing PCR-based genetic mapping, it may be necessary to
identify DNA sequence differences between the parents of the
mapping cross in the region corresponding to the instant nucleic
acid sequence. This, however, is generally not necessary for
mapping methods.
[0131] Loss-of-function mutant phenotypes may be identified for the
instant cDNA clones either by targeted gene disruption protocols or
by identifying specific mutants for these genes contained in a
maize population carrying mutations in all possible genes
(Ballinger and Benzer (1989) Proc. Natl. Acad. Sci USA
86:9402-9406; Koes et al. (1995) Proc. Natl. Acad. Sci USA
92:8149-8153; Bensen et al. (1995) Plant Cell 7:75-84). The latter
approach may be accomplished in two ways. First, short segments of
the instant nucleic acid fragments may be used in polymerase chain
reaction protocols in conjunction with a mutation tag sequence
primer on DNAs prepared from a population of plants in which
Mutator transposons or some other mutation-causing DNA element has
been introduced (see Bensen, supra). The amplification of a
specific DNA fragment with these primers indicates the insertion of
the mutation tag element in or near the plant gene encoding the
instant polypeptides. Alternatively, the instant nucleic acid
fragment may be used as a hybridization probe against PCR
amplification products generated from the mutation population using
the mutation tag sequence primer in conjunction with an arbitrary
genomic site primer, such as that for a restriction enzyme
site-anchored synthetic adaptor. With either method, a plant
containing a mutation in the endogenous gene encoding the instant
polypeptides can be identified and obtained. This mutant plant can
then be used to determine or confirm the natural function of the
instant polypeptides disclosed herein.
[0132] The Trait Utility System for Corn (TUSC) is a method that
employs genetic and molecular techniques to facilitate the study of
gene function in maize. Studying gene function implies that the
gene's sequence is already known, thus the method works in reverse:
from sequence to phenotype. This kind of application is referred to
as "reverse genetics", which contrasts with "forward" methods that
are designed to identify and isolate the gene(s) responsible for a
particular trait (phenotype). One of skill in the art could readily
conceive of use of this procedure with the sequences disclosed in
the current application.
[0133] Pioneer Hi-Bred International, Inc., has a proprietary
collection of maize genomic DNA from approximately 42,000
individual F.sub.1 plants (Reverse genetics for maize, Meeley, R.
and Briggs, S., 1995, Maize Genet. Coop. Newslett. 69:67, 82). The
genome of each of these individuals contains multiple copies of the
transposable element family, Mutator (Mu). The Mu family is highly
mutagenic; in the presence of the active element Mu-DR, these
elements transpose throughout the genome, inserting into genic
regions, and often disrupting gene function. By collecting genomic
DNA from a large number (42,000) of individuals, Pioneer has
assembled a library of the mutagenized maize genome.
[0134] Mu insertion events are predominantly heterozygous; given
the recessive nature of most insertional mutations, the F.sub.1
plants appear wild-type. Each of the F.sub.1 plants is selfed to
produce F.sub.2 seed, which is collected. In generating the F.sub.2
progeny, insertional mutations segregate in a Mendelian fashion so
are useful for investigating a mutant allele's effect on the
phenotype. The TUSC system has been successfully used by a number
of laboratories to identify the function of a variety of genes
(Cloning and characterization of the maize An1 gene, Bensen, R. J.,
et al., 1995, Plant Cell 7:75-84; Diversification of C-function
activity in maize flower development, Mena, M., et al., 1996,
Science 274:1537-1540; Analysis of a chemical plant defense
mechanism in grasses, Frey, M., et al., 1997, Science 277:696-699;
The control of maize spikelet meristem fate by the APETALA2-like
gene Indeterminate spikelet 1, Chuck, G., Meeley, R. B., and Hake,
S., 1998, Genes & Development 12:1145-1154; A SecY homologue is
required for the elaboration of the chloroplast thylakoid membrane
and for normal chloroplast gene expression, Roy, L. M. and Barkan,
A., 1998, J. Cell Biol. 141:1-11).
[0135] The disclosure of each reference set forth herein is
incorporated herein by reference in its entirety.
EXAMPLES
[0136] The present invention is further defined in the following
Examples, in which parts and percentages are by weight and degrees
are Celsius, unless otherwise stated. It should be understood that
these Examples, while indicating preferred embodiments of the
invention, are given by way of illustration only and not by way of
limitation.
[0137] From the above discussion and these Examples, one skilled in
the art can ascertain the essential characteristics of this
invention, and without departing from the spirit and scope thereof,
can make various changes and modifications of the invention to
adapt it to various usages and conditions. Thus, various
modifications of the invention in addition to those shown and
described herein will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims.
Example 1
Composition of cDNA Libraries: Isolation and Sequencing of cDNA
Clones
[0138] cDNA libraries representing mRNAs from various catalpa,
maize, eucalyptus, rice, soybean, sunflower and wheat tissues were
prepared. The characteristics of the source tissues are described
below in Table 2.
2TABLE 2 cDNA Libraries from Catalpa, Maize, Eucalyptus, Rice,
Soybean, Sunflower and Wheat Library Tissue Clone ccase-b Maize
callus, somatic embryo ccase- formed b.pk0026.g4 cen1 Maize
endosperm 10 to 11 cen1.mn0001.g10 days after pollination cen3n
Maize endosperm 20 days cen3n.pk0076.b8 after pollination* cpb1c
Maize pooled BMS treated with cpb1c.pk001.d10 chemicals related to
Ca.sup.++ channel** eec1c Eucalyptus tereticornis eec1c.pk003.e23
capsules (older flowers, lost stamens, possibly fertilized) from
adult tree hlp1c Helianthus sp. leaf infected hlp1c.pk003.e8 with
phomopsis ncs Catalpa speciosa developing ncs.pk0019.h3 seed p0003
Maize premeiotic ear shoot, p0003.cgped29rb 0.2-4 cm p0003.cgpfn34f
p0003.cgpfn34rb p0037 Maize V5 stage*** roots p0037.crwao47r
infested with corn root worm p0041 Maize root tips smaller than
p0041.crtaw93r 5 mm in length four days after imbibition p0101
Maize embryo sacs 4 days p0101.cgamg48r after pollination* p0104
Maize roots V5, corn root p0104.cabbn62r worm infested* p0107 Maize
whole kernels 7 days p0107.cbcai79r after pollination* p0119 Maize
V12 stage*** ear shoot p0119.cmtoh49r with husk, night harvested*
p0120 Pooled endosperm: 18, 21, 24, p0120.cdebd48r 27 and 29 days
after pollination* rcal1c Rice nipponbare callus rcal1c.pk0001.d2
ses2w Soybean embryogenic ses2w.pk0015.b10 suspension 2 weeks after
subculture wkm1c Wheat kernel malted 55 wkm1c.pk0003.f4 hours at 22
degrees Celsius *These libraries were normalized essentially as
described in U.S. Pat. No. 5,482,845, incorporated herein by
reference. **Chemicals used included caffeine, BHQ, cyclopiazonic
acid, nifedipine, verapamil, fluphenizine-N-2-chloroethane,
calmidazoilum chloride. ***Maize developmental stages are explained
in the publication "How a corn plant develops" from the Iowa State
University Coop. Ext. Service Special Report No. 48 reprinted June
1993.
[0139] cDNA libraries may be prepared by any one of many methods
available. For example, the cDNAs may be introduced into plasmid
vectors by first preparing the cDNA libraries in Uni-ZAP.TM. XR
vectors according to the manufacturer's protocol (Stratagene
Cloning Systems, La Jolla, Calif.). The Uni-ZAP.TM. XR libraries
are converted into plasmid libraries according to the protocol
provided by Stratagene. Upon conversion, cDNA inserts will be
contained in the plasmid vector pBluescript. In addition, the cDNAs
may be introduced directly into precut Bluescript II SK(+) vectors
(Stratagene) using T4 DNA ligase (New England Biolabs), followed by
transfection into DH10B cells according to the manufacturer's
protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid
vectors, plasmid DNAs are prepared from randomly picked bacterial
colonies containing recombinant pBluescript plasmids, or the insert
cDNA sequences are amplified via polymerase chain reaction using
primers specific for vector sequences flanking the inserted cDNA
sequences. Amplified insert DNAs or plasmid DNAs are sequenced in
dye-primer sequencing reactions to generate partial cDNA sequences
(expressed sequence tags or "ESTs"; see Adams et al., (1991)
Science 252:1651-1656). The resulting ESTs are analyzed using a
Perkin Elmer Model 377 fluorescent sequencer.
Example 2
Identification of cDNA Clones
[0140] The cDNA sequences obtained in Example 1 were analyzed for
similarity to all publicly available DNA sequences contained in the
"nr" database using the BLASTN algorithm (Basic Local Alignment
Search Tool; Altschul et al. (1993) J. Mol. Biol. 215:403-410)
provided by the National Center for Biotechnology Information
(NCBI; see www.ncbi.nlm.nih.gov/BLAST/).
[0141] The DNA sequences were also translated in all reading frames
and compared for similarity to all publicly available protein
sequences contained in the "nr" database (comprising all
non-redundant GenBank CDS translations, sequences derived from the
3-dimensional structure Brookhaven Protein Data Bank, the last
major release of the SWISS-PROT protein sequence database, EMBL,
and DDBJ databases) using the BLASTX algorithm (Gish and States
(1993) Nat. Genet. 3:266-272) provided by the NCBI.
[0142] For convenience, the P-value (probability) of observing a
match of a cDNA sequence to a sequence contained in the searched
databases merely by chance as calculated by BLAST is reported
herein as a "pLog" value, which represents the negative of the
logarithm of the reported P-value. Accordingly, the greater the
pLog value, the greater the likelihood that the cDNA sequence and
the BLAST "hit" represent homologous proteins.
[0143] Abbreviations which may be used in describing the sequences
listed in the following tables include:
[0144] EST--individual Expressed Sequence Tag
[0145] FIS--Full Insert Sequence; the entire cDNA insert comprising
the indicated EST
[0146] Contig--an assembly of two or more contiguous ESTs
[0147] Contig+--a contig comprising an FIS and one or more ESTs
[0148] CGS--Complete Gene Sequence; a sequence encoding an entire
protein, derived from one or more of the above DNA segments; may be
determined in combination with PCR
Example 3
Characterization of cDNA EST Clones Encoding
Fertilization-Independent Endosperm Protein
[0149] The BLASTX search using the EST sequences of clones listed
in Table 1 revealed similarity of the polypeptides encoded by the
cDNAs to fertilization-independent endosperm protein from
Arabidopsis thaliana (NCBI Identifier No. gi 4567095). Scores, on a
pLog basis, ranged from 18.0 to 89.7, with an average score of
50.3.
Example 4
Characterization of cDNA FIS and CGS Clones Encoding
Fertilization-Independent Endosperm Protein
[0150] The sequence of the entire cDNA insert (FIS) in each of the
clones listed in Table 3 was determined. Further sequencing and
searching of the DuPont proprietary database allowed the
identification of other maize, rice, soybean, wheat, eucalyptus,
sunflower, and catalpa clones encoding fertilization-independent
endosperm proteins. A BLASTX search using the full insert sequences
and complete gene sequences listed in Table 1 revealed similarity
of the polypeptides encoded by these cDNAs to
fertilization-independent endosperm protein from Arabidopsis
thaliana (NCBI Identifier No. gi 4567095). Scores, on a pLog basis,
averaged 57.4 for Full Insert Sequences and 150.5 for Complete Gene
Sequences.
Example 5
[0151] The amino acid sequences set forth in SEQ ID NOS: 2, 4, 6,
8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40,
42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68 and 70 were
compared to the Arabidopsis thaliana sequence gi4567095 using the
Megalign program of the LASERGENE bioinformatics computing suite
(DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences
was performed using the Clustal method of alignment (Higgins and
Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP
PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise
alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3,
WINDOW=5 and DIAGONALS SAVED=5. Sequence alignments and BLAST
scores and probabilities indicated that the nucleic acid fragments
comprising the instant cDNA clones encoded a substantial portion of
a fertilization-independent endosperm protein. These sequences
represent the first catalpa, eucalyptus, maize, rice, soybean,
sunflower and wheat sequences encoding fertilization-independent
endosperm proteins known to Applicant.
Example 6
Mapping and Isolation of Genomic Sequences of FIE-A and FIE-B
[0152] ZmFIE-A (also referred to as ZmFIE1) maps to Chromosome 4
(bin 4.04) and ZmFIE-B (also referred to as ZmFIE2) maps to
Chromosome 10 (bin 10.03). Map positions were identified by a
standard procedure using RFLP analysis of a mapping population
(Davis et al., Genetics (1999) 152:1137-1172).
[0153] To obtain genomic copies of Zm FIE genes, BAC (Bacterial
Artificial Chromosome) libraries were used. BAC libraries were
constructed according to the Texas A&M BAC Center protocol
(http://hbz.tamu.edu/bacindex.html). High-molecular-weight DNA
isolated from line Mo17, embedded in LMP agarose microbeads, was
partially digested by HindIII. The DNA was then size-selected by
pulsed-field gel electrophoresis to remove the smaller DNA
fragments that can compete more effectively than the larger DNA
fragments for vector ends. The size-selected DNA fragments were
ligated into pBeloBAC11 at the HindIII site. BAC libraries were
screened by hybridization with .sup.32P-labeled probes (Maniatis).
SEQ ID NO: 1 and SEQ ID NO: 29 correspond to ZmFIE-B and ZmFIE-A
ESTs. BAC DNAs were isolated, subcloned into BluescriptII (SK+)
vector (Stratagene), and sequenced.
[0154] The genomic sequences of the maize and arabidopsis FIE genes
show a high degree of conservation of intron/exon structure. There
are 13 exons with almost identical lengths (with the accuracy of
BestFit program, GCG) in the maize and Arabidopsis genes, with
exceptions of 5' and 3' UTRs. This high degree of conservation
between FIE genes in monocots and dicots suggests that gene
function is under strong evolutionary pressure. The genomic
structure of the ZmFIE-A gene is different from the ZmFIE-B and
arabidopsis genes by 1 intron of 385 nt length, which is positioned
within the 5'UTR, 6 nt upstream of the ATG codon. Introns located
in the 5' UTR are important for tissue-specific expression of the
genes (McElroy et al.(1991) Molecular & General Genetics
231:150-160). As is shown in Example 7, ZmFIE-A expression occurs
mostly in developing endosperm; this regulation may be achieved
through splicing of the 5'UTR intron.
3TABLE 3 The exon lengths (in bp) of the maize and arabidopsis FIE
genes 1 13 5' UTR 2 3 4 5 6 7 8 9 10 11 12 3' UTR ZmFIE-A 340 66
125 83 96 75 84 71 62 98 65 59 347 ZmFIE-B 509 66 125 83 96 75 84
71 62 98 65 59 230 AtFIE 375 66 122 83 96 75 84 71 62 106 57 59
317
Example 7
Analysis of Expression of FIE-A and FIE-B by RT-PCR
[0155] To determine ZmFIE expression patterns, RNA was extracted
from different tissues and RT-PCR was performed using ZmFIE-A- and
ZmFIE-B-specific primers.
[0156] With the exception of pollen, ZmFIE-B is expressed in all
tissues examined, including leaf, immature leaf, tassel, stem,
silk, 3-day root tissue, ovules before pollination, and in
whole-kernel, endosperm, and embryo tissues at 11 days after
pollination (DAP). Pollen is the only tissue where ZmFIE-B gene
expression is very low. It is very likely that ZmFIE-B expression
is repressed in the sperm nuclei, but that the gene is still active
in the vegetative nucleus of the pollen.
[0157] Conversely, ZmFIE-A is expressed only in kernels after
pollination. None of the vegetative tissues has a detectable level
of the ZmFIE-A transcripts. ZmFIE-A also is not expressed in mature
pollen.
[0158] In a time-course comparison of ZmFIE-A and ZmFIE-B
expression, whole kernels were collected at intervals after
pollination and RT-PCR was performed. ZmFIE-A mRNA was first
detected at about 9 days after pollination (DAP), peaked at about
11 DAP, and was markedly reduced after about 20 DAP. ZmFIE-B was
expressed at a consistent level during the time tested, from 3 DAP
to 25 DAP. These results were confirmed by Northern hybridization
of the poly-A RNA extracted from the same set of tissues.
Example 8
Analysis of Expression of FIE-A and FIE-B by Lynx MPSS.TM.
[0159] To further refine analysis of expression of FIE-A and FIE-B,
Lynx MPSS.TM. (massively parallel signature sequencing) experiments
were used for BLAST searching of the 17-mer tags expressed in
various tissues. (For a description of Lynx technology, see
www.lynxgen.com or Nature Biotechnology (2000) 18:630-634.) In
complete agreement with RT-PCR and Northern results (Example 7),
17-mer tags of ZmFIE-A transcripts were not detected in ovules
before pollination, but were detected in the endosperm of
developing kernels after pollination, rapidly reaching a peak at
about 8 to 9 days after pollination (DAP), then diminishing to
reach the basal level at about 30 DAP. A very low level of ZmFIE-A
tags was found in the embryo. These results provide strong evidence
that the ZmFIE-A gene is expressed specifically in endosperm after
fertilization. Expression of the ZmFIE-B gene cannot be detected by
Lynx technology because the ZmFIE-B gene is lacking the GATC
restriction site used in creating 17-mer tags.
Example 9
In Situ Localization of FIE mRNA in Ovules and Developing
Kernels
[0160] To further determine expression patterns of ZmFIE genes in
maize, in situ hybridization was performed using the protocol of
Jackson, D. P. (1991) (In situ Hybridization in Plants, Molecular
Plant Pathology: A Practical Approach, D. J. Bowles, S. J. Gurr,
and M. McPherson, eds.; Oxford University Press, England, pp.
63-74). Sense and antisense mRNA probes of about 0.9 kb
corresponding to FIE genes were labeled non-isotopically with
digoxigenin and incubated with fixed sections of maize tissues from
ovules at silking and from kernels at 5, 8 and 12 days after
pollination (DAP). FIE-A hybridization was performed only with
ovules and kernels at 5 DAP. Following extensive washing to remove
unbound probe, sections were incubated with anti-digoxigenin
alkaline phosphatase to detect areas of probe hybridization. FIE
mRNA was detected specifically with the antisense probe; the sense
probe did not hybridize, therefore serving as a negative
control.
[0161] FIE antisense probes gave a signal in the embryo sac of the
mature ovules at silking. The signal within the embryo sac before
fertilization is likely due to ZmFIE-B mRNA, because RT-PCR and
Lynx data do not show a detectable level of ZmFIE-A gene expression
in ovules before fertilization. In kernels at 2 to 5 DAP, the most
intense signal appeared in the embryo-surrounding region and on the
periphery of the developing endosperm. At the later stages (8, 10,
or 15 DAP), the signal persists at the embryo, but is not
detectable in the endosperm using FIE-B probe. An in situ
experiment with ZmFIE-A was not performed at these stages.
[0162] FIE proteins belong to the Polycomb group (PcG) proteins,
which are involved in multiple aspects of embryogenesis in
Drosophila and mammals. PcG proteins appear to have a conserved
role in the zygotic control of the development of the
anterior-posterior axis. The arabidopsis FIE protein plays a
pleiotropic role as a repressor of endosperm development before
pollination, a regulator of the establishment of the
anterior-posterior axis in the endosperm, and a factor of the
embryo development.
[0163] The differential pattern of expression of the ZmFIE genes
argues that functions of the maize FIE genes are separated in
evolution. The ZmFIE-B gene may play a role as a repressor of seed
development before pollination in the embryo sac, and as a
regulator of the anterior-posterior axis in the developing embryo.
The ZmFIE-A gene, induced after pollination and expressed only in
the endosperm, may play a role as a regulator of the establishment
of the anterior-posterior axis in the endosperm.
[0164] One could expect that inactivation of ZmFIE-B function would
result in seed development without fertilization (apomixis), but
that inactivation of the ZmFIE-A gene would interfere with
endosperm development.
Example 10
Isolation and Identification of the Promoter Regions of FIE-A and
FIE-B
[0165] 5.5 kb of the FIE-A upstream region and 6.0 kb of the
ZmFIE-B upstream region were sequenced from the BAC genomic clones
(Example 6).
[0166] ZmFIE-A 5' Upstream Region (SEQ ID NO: 73)
[0167] The 5' upstream region of the ZmFIE-A gene shares sequence
homology with the 5' LTR (long terminal repeat) of the
retrotransposon RIRE-1 (GenBank accession # D85597), at positions
2984-3378. Retrotransposable elements are landmarks of the
intragenic regions in the maize genome (SanMiguel et al. (1996)
Science 274:765-768). Sequence homology to retrotransposons
indicates the border of the gene-specific region. According to this
definition, the sequence downstream of 3378 nt (nucleotide/s) may
be considered as a part of the ZmFIE-A gene. The RNA startpoint is
at 4159, as shown by an alignment with the longest EST, cgamg48.
Taking these reference points, the basal promoter is located
between 3378-4159 nt and is 781 nt long. No repeats or secondary
structures are found in the ZmFIE-A basal promoter. There is an
intron 386 nt long at position 4319-4705. The intron sequence is
present in genomic DNA, but is absent in the cDNA (cgamg48). The
intron is positioned just 6 nt upstream from the translation start
codon ATG at 4712 nt. This intron may play a regulatory role in
ZmFIE-A gene expression, for example, providing the properly
spliced RNA only in kernels after fertilization.
[0168] ZmFIE-B 5' Upstream Region (SEQ ID NO: 74)
[0169] The size of the ZmFIE-B promoter is estimated to be about 6
kb from the translation start codon ATG to the point of homology
with the retrotransposon Milt1 that might be considered as a
landmark of the intragenic region. This 6 kb region is a unique
sequence with no known homology in the published databases and
shows a pattern of repetitive sequences.
[0170] The sequence from 2919 to 5237 nt (nucleotides) consists of
two types of repeats, named A and B, and a spacer (see FIG. 1).
Repeats are organized in the following order: A.sub.1-B.sub.1
spacer B.sub.2-A.sub.2. Repeats A.sub.1 and A.sub.2 are 583 nt long
and share 95% homology. Repeats B.sub.1 and B.sub.2 are 348 nt long
and share 93% homology. The spacer size is 410 nt. Repeats and a
spacer form the 2.3 kb region. The B.sub.1 spacer sequence, C, is
repeated again from 321 to 1070 nt of the 5' upstream region of
ZmFIE-B.
[0171] A pattern of perfect direct repeats argues for their
functional significance. Expression of ZmFIE-B is constitutive and
not tissue-specific. The only specific feature of this gene is the
repression of the paternal allele during early kernel development
(Example 11; also see Lai J. and Messing J., 2001, 43.sup.rd Maize
Genetics Conference, Abstract P39, page 57). This phenomenon is
termed parental imprinting and has been shown for the Arabidopsis
FIE gene (Ohad et al., PNAS 93:5319-5324 (1996); Luo et al., PNAS
97:10637-10642 (2000)). In mammals, the imprinting control region
(ICR) has been identified as a 2 kb region located from -2 to -4 kb
relative to the transcription start of the imprinted genes
(Thorvaldsen et al. (1998) Genes and Development 12:3693-3702). The
ICR (or the DMD, the differentially methylated domain) regulates
imprinting by DNA methylation.
[0172] The repetitive structure found upstream of the ZmFIE-B gene
may be responsible for imprinting of the ZmFIE-B gene and is being
termed the ICE (Imprinting Control Element, to distinguish from the
animal ICR). To determine whether the ICE is required for imprinted
expression of ZmFIE-B gene, expression cassettes can be constructed
directing expression of the reporter genes with and without fusion
with the ICE. If the ICE is required for imprinting, the
parent-of-origin expression of the reporter constructs will be
observed.
[0173] One of skill in the art would recognize that the ICE may
provide a tool for the modification of gene expression in
developing kernels and could be used as a tool in modifying or
controlling imprinting. The ICE may be a target for DNA methylation
like the DMD (ICR) in mammals, or the ICE may be a binding site for
specific proteins. Protein-mediated mechanism of the imprinting
seems more likely, because frequency of the DNA methylation sites
CpG and CpNpG is reduced to about 0.5-1% in the ICE and overall 5'
upstream region of the ZmFIE-B gene; equal distribution of di- and
tri-nucleotides along DNA sequences predicts a frequency of 6%. The
ICE may be used as a binding target for proteins regulating gene
expression by imprinting.
Example 11
Monitoring of Parent-of-Origin Expression by Allele-Specific
Primers
[0174] As described in Example 10, ZmFIE-B expression varies with
the parent of origin. Only the maternal allele is expressed
immediately following pollination; expression of the paternal
allele resumes after 10 DAP. This phenomenon, termed imprinting, is
mediated by direct repeats (the ICE, Imprinting Control Element)
positioned upstream of the ZmFIE-B coding region (Example 10).
[0175] Inbreds B73 and Mo17 comprise polymorphisms which aid in
monitoring parent-of-origin expression. The differences lie in the
genomic fragments in the vicinity of the stop codon of the ZmFIE-B
gene.
[0176] The B73 genomic sequence (SEQ ID NO: 75) contains a 185-nt
insertion with 13-nt terminal inverted repeats. The insertion is
flanked by 5-nt direct repeats, which result from a target
duplication, providing strong evidence for the transposition origin
of the insertion. The insertion is a typical example of so-called
MITE elements, which are very abundant components of the maize
genome (Wessler, S. R. Plant Physiol. (2001) 125(1):149-151). In
the B73 background, ZmFIE-B polyA transcripts are terminated in the
middle of the MITE element.
[0177] In the Mo17 background, ZmFIE-B polyA transcripts are
terminated within genomic sequence with no homology to the MITE
element.
[0178] Thus, the MITE element was used to design primers specific
for B73 or Mo17 ZmFIE-B transcripts. The forward primer,
CGTGAAGGCAAAATCTACGTGTGG (SEQ ID NO: 76), is common to both
genotypes. The reverse primers are genotype specific. A reverse
primer CATTACGTTACAAATATGTGAACCAAACG (SEQ ID NO: 77) amplifies
transcripts only from the B73 gene in an RT-PCR reaction. A reverse
primer CAGMCAAACAGATGACMCGGTTCCCAAAG (SEQ ID NO: 78) amplifies
transcripts only from the Mo17 gene in an RT-PCR reaction. This
primer combination allows monitoring of the paternal and maternal
ZmFIE-B allele expression. RT-PCR reactions were conducted at
various DAP time intervals in B73/Mo17 reciprocal crosses. The
maternal ZmFIE-B allele (either B73 or Mo17) is expressed
immediately following pollination and continuing through the full
16 days tested. Whereas the paternal ZmFIE-B allele (either Mo17 or
B73) is expressed beginning at approximately 10 days after
pollination and continuing through the full 16 days tested.
Example 12
Construction of FIE-Null Genetic Backgrounds and Inactivation of
ZmFIE Genes by the Mutator Transposon Insertions (TUSC)
[0179] Gene inactivation can be used to determine the function of
ZmFIE genes in the regulation of endosperm development. When
fertilization is prevented in Arabidopsis plants heterozygous for
fie mutant alleles, siliques nevertheless elongate and contain
seed-like structures due to partial endosperm development. No
embryo development is observed (Ohad, Yadegari et al. (1999) Plant
Cell 11:407415). Maize fie mutants would be expected to develop
endosperm (or kernels) in the absence of fertilization (i.e. when
immature ears are protected from pollination by bags).
[0180] The Pioneer proprietary system TUSC (Trait Utility System
for Corn) was used to screen for FIE genes disrupted by Mutator
transposable element insertion. F.sub.2 families segregating for
the Mutator insertions were screened by PCR with the Mu-specific
primer (SEQ ID NO: 79) and FIE-A or FIE-B gene-specific primers
(SEQ ID NOS: 80-82). No positive signals were found for the Mutator
insertions in the ZmFIE-A gene. However, six Mu insertions were
identified in the ZmFIE-B gene. The Mu insertion sites were
sequenced. Data are shown in the following table:
4TABLE 4 Mu insertion sites Allele Individual plants in # Allele
name TUSC pools Site of Mu insertion 1 fieb::Mu61E09 PV03 61 E-09
234 nt upstream of ATG 2 fieb::Mu25C04 BT94 25 C-04 188 bp upstream
of ATG 3 fieb::Mu57B12 PV03 57 B12 183 bp upstream of ATG 4
fieb::Mu217 I6A89718 B217 138 bp upstream of ATG 5 fieb::Mu203
I6A80321 B203 138 bp upstream of ATG 6 fieb::Mu29A08 BT94 29 A08 4
bp of 1.sup.st exon/intron junction
[0181] All Mu insertions occurred in non-coding regions of ZmFIE-B.
Alleles #1-5 represent the Mu insertions in the 5' UTR at distances
of 138 to 234 bp upstream of the translation start codon ATG.
Allele #6 carries the Mu insertion in the first intron, 4
nucleotides past the exon/intron junction.
[0182] Homozygous plants were obtained for alleles #1-5.
Transcription of ZmFIE-B is not affected in the Mu homozygous
plants as has been shown by RT-PCR. Those plants do not demonstrate
the expected phenotype of developing endosperm (or kernels) in the
absence of fertilization. One of the possible explanations for the
normal function of ZmFIE-B with the Mu upstream insertions is the
outward reading promoter in the end of Mu (Barkan and Martienssen
(1991) Proc. Natl. Acad. Sci. USA 88:3502-3506). This promoter may
support transcription of the fieb::Mu alleles. No changes in
phenotype were seen as a result of these Mu insertions.
[0183] To isolate derivative alleles at the ZmFIE-B locus that no
longer require Mutator activity and are stable null alleles, the
site-selected transposon mutagenesis (SSTM) method was used (Plant
Cell 7:287-294, 1995). The Mu element generates the flanking
deletions resulting in null alleles at frequencies approaching 1%
(Taylor and Walbot (1985) EMBO J. 4:869-876). To generate flanking
deletions at the ZmFIE-B locus, plants homozygous for fieb::Mu
alleles were crossed with the Mu active line les22 (wherein white
necrotic lesions are a marker for the presence of the active
Mutator; Hu, Yalpani, et al. (1998) Plant Cell 10:1095-1105). The
progeny of this cross, Mu-active fieb::Mu/+, were crossed to Mo17
inbred to produce seed with the potential Mu-flanking deletions.
Screening of the flanking deletions was performed by PCR with the
Mu- and fleb-specific primers (see above). DNA was isolated from
seedling leaf punches using Puregene kit (Gentra System,
Minneapolis, Minn.) according to the manufacturer's protocol.
Initially, four deletions, 100-200 nt long, were identified from
the fieb::Mu allele #2.
[0184] SSTM represents an efficient way to generate stable null
alleles from the original TUSC material in those cases when Mu
insertions occur in "non-coding" neutral regions of the genes.
These derivative deletions provide the genetic material for
phenotypic and cytological analysis to determine the role of the
FIE gene in controlling endosperm development in maize.
Example 13
Use of ZmFIE Mutants with Maize CHD to Induce Apomixis
[0185] A "CHD polypeptide" refers to a polypeptide containing 3
domains: a chromatin organization modifier, a helicase SNF-2
related/ATP domain, and a DNA binding domain. Down-regulation of
CHD in transformed maize is expected to result in a more
embryogenic callus phenotype. (See pending U.S. patent application
Ser. No. 60/251,555, filed Dec. 6, 2000.)
[0186] Maize expression cassettes down-regulating CHD expression
(CHD-DR) in the inner integument or nucellus can easily be
constructed. An expression cassette directing expression of the
CHD-DR polynucleotide to the nucellus is made using the barley Nuc1
promoter (See pending U.S. patent application Ser. No. 09/703,754,
filed Nov. 1, 2000). Embryos are co-bombarded with the selectable
marker PAT fused to the GFP gene (UBI::moPAT.about.moGFP) along
with the nucellus specific CHD-DR expression cassette described
above. Both inbred (P38) and GS3 transformants are obtained and
regenerated as described in Example 14.
[0187] When such nuc1:CHD-DR transformation is accomplished in a
mutant fie background, both de novo embryo development and
endosperm development without fertilization could occur. (see Ohad
et al. 1999 The Plant Cell 11:407-415). Upon microscopic
examination of the developing embryos it will be apparent that
apomixis has occurred by the presence of embryos budding off the
nucellus.
Example 14
Expression of Chimeric Genes in Monocot Cells
[0188] A chimeric gene is constructed which comprises a cDNA
encoding the instant polypeptides in sense orientation with respect
to the maize 27 kD zein promoter located 5' to the cDNA fragment,
and the 10 kD zein 3' end located 3' to the cDNA fragment. The cDNA
fragment of this gene may be generated by polymerase chain reaction
(PCR) of the cDNA clone using appropriate oligonucleotide primers.
Cloning sites (NcoI or SmaI) can be incorporated into the
oligonucleotides to provide proper orientation of the DNA fragment
when inserted into the digested vector pML103 as described below.
Amplification is then performed in a standard PCR. The amplified
DNA is then digested with restriction enzymes NcoI and SmaI and
fractionated on an agarose gel. The appropriate band can be
isolated from the gel and combined with a 4.9 kb NcoI-SmaI fragment
of the plasmid pML103. Plasmid pML103 has been deposited under the
terms of the Budapest Treaty at ATCC (American Type Culture
Collection, 10801 University Blvd., Manassas, Va. 20110-2209), and
bears accession number ATCC 97366. The DNA segment from pML103
contains a 1.05 kb SalI-NcoI promoter fragment of the maize 27 kD
zein gene and a 0.96 kb SmaI-SalI fragment from the 3' end of the
maize 10 kD zein gene in the vector pGem9Zf(+) (Promega). Vector
and insert DNA can be ligated at 15.degree. C. overnight,
essentially as described (Maniatis). The ligated DNA may then be
used to transform E. coli XL1-Blue (Epicurian Coli XL-1 Blue.RTM.;
Stratagene). Bacterial transformants can be screened by restriction
enzyme digestion of plasmid DNA and limited nucleotide sequence
analysis using the dideoxy chain termination method (Sequenase.RTM.
DNA Sequencing Kit; U.S. Biochemical). The resulting plasmid
construct comprises a chimeric gene encoding, in the 5' to 3'
direction, the maize 27 kD zein promoter, a cDNA fragment encoding
the instant polypeptides, and the 10 kD zein 3' region.
[0189] The chimeric gene described above can then be introduced
into maize cells by the following procedure. Immature maize embryos
can be dissected from developing caryopses derived from crosses of
the inbred maize lines H99 and LH132. The embryos are isolated 10
to 11 days after pollination when they are 1.0 to 1.5 mm long. The
embryos are then placed in contact with agarose-solidified N6
medium (Chu et al. (1975) Sci. Sin. Peking 18:659-668), axis-side
down. The embryos are kept in the dark at 27.degree. C. Friable
embryogenic callus, consisting of undifferentiated masses of cells
with somatic proembryoids and embryoids borne on suspensor
structures, proliferates from the scutellum of these immature
embryos. The embryogenic callus isolated from the primary explant
can be cultured on N6 medium and sub-cultured on this medium every
2 to 3 weeks.
[0190] The plasmid p35S/Ac (obtained from Dr. Peter Eckes, Hoechst
Ag, Frankfurt, Germany) may be used in transformation experiments
in order to provide for a selectable marker. This plasmid contains
the Pat gene (see European Patent Publication 0 242 236) which
encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT
confers resistance to herbicidal glutamine synthetase inhibitors
such as phosphinothricin. The pat gene in p35S/Ac is under the
control of the 35S promoter from Cauliflower Mosaic Virus (Odell et
al. (1985) Nature 313:810-812) and the 3' region of the nopaline
synthase gene from the T-DNA of the Ti plasmid of Agrobacterium
tumefaciens.
[0191] The particle bombardment method (Klein et al. (1987) Nature
327:70-73) may be used to transfer genes to the callus culture
cells. According to this method, gold particles (1 .mu.m in
diameter) are coated with DNA using the following technique: Ten
.mu.g of plasmid DNAs are added to 50 .mu.L of a suspension of gold
particles (60 mg per mL). Calcium chloride (50 .mu.L of a 2.5 M
solution) and spermidine free base (20 .mu.L of a 1.0 M solution)
are added to the particles. The suspension is vortexed during the
addition of these solutions. After 10 minutes, the tubes are
briefly centrifuged (5 sec at 15,000 rpm) and the supernatant
removed. The particles are resuspended in 200 .mu.L of absolute
ethanol, centrifuged again and the supernatant removed. The ethanol
rinse is performed again and the particles resuspended in a final
volume of 30 .mu.L of ethanol. An aliquot (5 .mu.L) of the
DNA-coated gold particles can be placed in the center of a
Kapton.RTM. flying disc (Bio-Rad Labs). The particles are then
accelerated into the maize tissue with a Biolistic.RTM. PDS-1000/He
(Bio-Rad Instruments, Hercules Calif.), using a helium pressure of
1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0
cm.
[0192] For bombardment, the embryogenic tissue is placed on filter
paper over agarose-solidified N6 medium. The tissue is arranged as
a thin lawn covering a circular area of about 5 cm in diameter. The
petri dish containing the tissue can be placed in the chamber of
the PDS-1000/He approximately 8 cm from the stopping screen. The
air in the chamber is then evacuated to a vacuum of 28 inches of
Hg. The macrocarrier is accelerated with a helium shock wave using
a rupture membrane that bursts when the He pressure in the shock
tube reaches 1000 psi.
[0193] Seven days after bombardment, the tissue can be transferred
to N6 medium that contains gluphosinate (2 mg per liter) and lacks
casein or proline. The tissue continues to grow slowly on this
medium. After an additional 2 weeks the tissue can be transferred
to fresh N6 medium containing gluphosinate. After 6 weeks, areas of
about 1 cm in diameter of actively growing callus can be identified
on some of the plates containing the glufosinate-supplemented
medium. These calli may continue to grow when sub-cultured on the
selective medium.
[0194] Plants can be regenerated from the transgenic callus by
first transferring clusters of tissue to N6 medium supplemented
with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be
transferred to regeneration medium (Fromm et al. (1990)
Bio/Technology 8:833-839).
Example 15
Expression of Chimeric Genes in Dicot Cells
[0195] A seed-specific expression cassette composed of the promoter
and transcription terminator from the gene encoding the .beta.
subunit of the seed storage protein phaseolin from the bean
Phaseolus vulgaris (Doyle et al. (1986) J. Biol. Chem.
261:9228-9238) can be used for expression of the instant
polypeptides in transformed soybean. The phaseolin cassette
includes about 500 nucleotides upstream (5') from the translation
initiation codon and about 1650 nucleotides downstream (3') from
the translation stop codon of phaseolin. Between the 5' and 3'
regions are the unique restriction endonuclease sites Nco I (which
includes the ATG translation initiation codon), Sma I, Kpn I and
Xba I. The entire cassette is flanked by Hind III sites.
[0196] The cDNA fragment of this gene may be generated by
polymerase chain reaction (PCR) of the cDNA clone using appropriate
oligonucleotide primers. Cloning sites can be incorporated into the
oligonucleotides to provide proper orientation of the DNA fragment
when inserted into the expression vector. Amplification is then
performed as described above, and the isolated fragment is inserted
into a pUC18 vector carrying the seed expression cassette.
[0197] Soybean embryos may then be transformed with the expression
vector comprising sequences encoding the instant polypeptides. To
induce somatic embryos, cotyledons, 3-5 mm in length dissected from
surface sterilized, immature seeds of the soybean cultivar A2872,
can be cultured in the light or dark at 26.degree. C. on an
appropriate agar medium for 6-10 weeks. Somatic embryos which
produce secondary embryos are then excised and placed into a
suitable liquid medium. After repeated selection for clusters of
somatic embryos which multiplied as early, globular staged embryos,
the suspensions are maintained as described below.
[0198] Soybean embryogenic suspension cultures can be maintained in
35 mL liquid media on a rotary shaker, 150 rpm, at 26.degree. C.
with florescent lights on a 16:8 hour day/night schedule. Cultures
are subcultured every two weeks by inoculating approximately 35 mg
of tissue into 35 mL of liquid medium.
[0199] Soybean embryogenic suspension cultures may then be
transformed by the method of particle gun bombardment (Klein et al.
(1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A
DuPont Biolistic.RTM. PDS1000/HE instrument (helium retrofit) can
be used for these transformations.
[0200] A selectable marker gene which can be used to facilitate
soybean transformation is a chimeric gene composed of the 35S
promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature
313:810-812), the hygromycin phosphotransferase gene from plasmid
pJR225 (from E. coli; Gritz et al. (1983) Gene 25:179-188) and the
3' region of the nopaline synthase gene from the T-DNA of the Ti
plasmid of Agrobacterium tumefaciens. The seed expression cassette
comprising the phaseolin 5' region, the fragment encoding the
instant polypeptides and the phaseolin 3' region can be isolated as
a restriction fragment. This fragment can then be inserted into a
unique restriction site of the vector carrying the marker gene.
[0201] To 50 .mu.L of a 60 mg/mL 1 .mu.m gold particle suspension
are added (in order): 5 .mu.L DNA (1 .mu.g/.mu.L), 20 .mu.l
spermidine (0.1 M), and 50 .mu.L CaCl.sub.2 (2.5 M). The particle
preparation is then agitated for three minutes, spun in a microfuge
for 10 seconds and the supernatant removed. The DNA-coated
particles are then washed once in 400 .mu.L 70% ethanol and
resuspended in 40 .mu.L of anhydrous ethanol. The DNA/particle
suspension can be sonicated three times for one second each. Five
.mu.L of the DNA-coated gold particles are then loaded on each
macro carrier disk.
[0202] Approximately 300-400 mg of a two-week-old suspension
culture is placed in an empty 60.times.15 mm petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue are
normally bombarded. Membrane rupture pressure is set at 1100 psi
and the chamber is evacuated to a vacuum of 28 inches mercury. The
tissue is placed approximately 3.5 inches away from the retaining
screen and bombarded three times. Following bombardment, the tissue
can be divided in half and placed back into liquid and cultured as
described above.
[0203] Five to seven days post bombardment, the liquid media may be
exchanged with fresh media, and eleven to twelve days post
bombardment with fresh media containing 50 mg/mL hygromycin. This
selective media can be refreshed weekly. Seven to eight weeks post
bombardment, green, transformed tissue may be observed growing from
untransformed, necrotic embryogenic clusters. Isolated green tissue
is removed and inoculated into individual flasks to generate new,
clonally propagated, transformed embryogenic suspension cultures.
Each new line may be treated as an independent transformation
event. These suspensions can then be subcultured and maintained as
clusters of immature embryos or regenerated into whole plants by
maturation and germination of individual somatic embryos.
Example 16
Expression of Chimeric Genes in Microbial Cells
[0204] The cDNAs encoding the instant polypeptides can be inserted
into the T7 E. coli expression vector pBT430. This vector is a
derivative of pET-3a (Rosenberg et al. (1987) Gene 56:125-135; see
also www.novagen.com) which employs the bacteriophage T7 RNA
polymerase/T7 promoter system. Plasmid pBT430 was constructed by
first destroying the EcoR I and Hind III sites in pET-3a at their
original positions. An oligonucleotide adaptor containing EcoR I
and Hind III sites was inserted at the BamH I site of pET-3a. This
created pET-3aM with additional unique cloning sites for insertion
of genes into the expression vector. Then, the Nde I site at the
position of translation initiation was converted to an Nco I site
using oligonucleotide-directed mutagenesis. The DNA sequence of
pET-3aM in this region, 5'-CATATGG, was converted to 5'-CCCATGG in
pBT430.
[0205] Plasmid DNA containing a cDNA may be appropriately digested
to release a nucleic acid fragment encoding the protein. This
fragment may then be purified on a 1% low melting agarose gel.
Buffer and agarose contain 10 .mu.g/ml ethidium bromide for
visualization of the DNA fragment. The fragment can then be
purified from the agarose gel by digestion with GELase.RTM.
(Epicentre Technologies, Madison, Wis.) according to the
manufacturer's instructions, ethanol precipitated, dried and
resuspended in 20 .mu.L of water. Appropriate oligonucleotide
adapters may be ligated to the fragment using T4 DNA ligase (New
England Biolabs (NEB), Beverly, Mass.). The fragment containing the
ligated adapters can be purified from the excess adapters using low
melting agarose as described above. The vector pBT430 is digested,
dephosphorylated with alkaline phosphatase (NEB) and deproteinized
with phenol/chloroform as described above. The prepared vector
pBT430 and fragment can then be ligated at 16.degree. C. for 15
hours followed by transformation into DH5 electrocompetent cells
(GIBCO BRL). Transformants can be selected on agar plates
containing LB media and 100 .mu.g/mL ampicillin. Transformants
containing the gene encoding the instant polypeptides are then
screened for the correct orientation with respect to the T7
promoter by restriction enzyme analysis.
[0206] For high level expression, a plasmid clone with the cDNA
insert in the correct orientation relative to the T7 promoter can
be transformed into E. coli strain BL21(DE3) (Studier et al. (1986)
J. Mol. Biol. 189:113-130). Cultures are grown in LB medium
containing ampicillin (100 mg/L) at 25.degree. C. At an optical
density at 600 nm of approximately 1, IPTG
(isopropylthio-.beta.-galactoside, the inducer) can be added to a
final concentration of 0.4 mM and incubation can be continued for 3
h at 250. Cells are then harvested by centrifugation and
re-suspended in 50 .mu.L of 50 mM Tris-HCl at pH 8.0 containing 0.1
mM DTT and 0.2 mM phenyl methylsulfonyl fluoride. A small amount of
1 mm glass beads can be added and the mixture sonicated 3 times for
about 5 seconds each time with a microprobe sonicator. The mixture
is centrifuged and the protein concentration of the supernatant
determined. One .mu.g of protein from the soluble fraction of the
culture can be separated by SDS-polyacrylamide gel electrophoresis.
Gels can be observed for protein bands migrating at the expected
molecular weight.
Sequence CWU 0
0
* * * * *
References