U.S. patent application number 11/058728 was filed with the patent office on 2005-09-29 for combined chemotherapy compositions and methods for the treatment of cancer, ischemia-reperfusion injury, and septic shock.
Invention is credited to Gololobov, Gennady, Paul, Sudhir, Smith, Larry J..
Application Number | 20050214295 11/058728 |
Document ID | / |
Family ID | 21943098 |
Filed Date | 2005-09-29 |
United States Patent
Application |
20050214295 |
Kind Code |
A1 |
Paul, Sudhir ; et
al. |
September 29, 2005 |
Combined chemotherapy compositions and methods for the treatment of
cancer, ischemia-reperfusion injury, and septic shock
Abstract
Covalently reactive antigen analogs are disclosed herein. The
antigens of the invention may be used to stimulate production of
catalytic antibodies specific for predetermined antigens assocated
with particular medical disorders. The antigen analogs may also be
used to permanently inactivate endogenously produced catalytic
antibodies produced in certain autoimmune diseases as well as in
certain lymphoproliferative disorders.
Inventors: |
Paul, Sudhir; (Houston,
TX) ; Gololobov, Gennady; (Houston, TX) ;
Smith, Larry J.; (Omaha, NE) |
Correspondence
Address: |
DANN, DORFMAN, HERRELL & SKILLMAN
1601 MARKET STREET
SUITE 2400
PHILADELPHIA
PA
19103-2307
US
|
Family ID: |
21943098 |
Appl. No.: |
11/058728 |
Filed: |
February 15, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11058728 |
Feb 15, 2005 |
|
|
|
09862849 |
May 22, 2001 |
|
|
|
6855528 |
|
|
|
|
09862849 |
May 22, 2001 |
|
|
|
09046373 |
Mar 23, 1998 |
|
|
|
6235714 |
|
|
|
|
Current U.S.
Class: |
424/145.1 ;
435/188.5 |
Current CPC
Class: |
C07K 16/1063 20130101;
A61P 19/04 20180101; A61P 31/00 20180101; A61P 5/14 20180101; C12N
9/0002 20130101; A61P 35/00 20180101; A61P 17/00 20180101; A61P
37/02 20180101; C07K 16/32 20130101; A61P 35/02 20180101; A61K
2039/505 20130101; C07K 2317/34 20130101; A61P 11/06 20180101; A61P
19/02 20180101; A61P 37/06 20180101; A61P 29/00 20180101 |
Class at
Publication: |
424/145.1 ;
435/188.5 |
International
Class: |
A61K 039/395; C12N
009/00; C12N 009/64 |
Claims
1-13. (canceled)
14. A method for treating a disease state in a patient comprising
administering a therapeutically effective amount of a catalytic
antibody in combination with a therapeutically effective amount of
an agent which blocks programmed cell death.
15. The method of claim 14, wherein said disease state is selected
from the group consisting of ischemia and reperfusion injury,
septic shock, systemic inflammatory response syndrome (SIRS), acute
respiratory distress syndrome (ARDS), inflammatory disorders,
rheumatoid arthritis, inflammatory bowel disease, multiple
sclerosis, and neurotrophic pain.
16. The method of claim 15, wherein said catalytic antibody is
selected from the group consisting of antibodies specific for p53,
p21, p27 and at least one inflammatory mediator or its receptor,
and said agent which blocks programmed cell death is selected from
the group consisting of p53 antisense oligonucleotides, p27
antisense oligonucleotides, p21 antisense oligonucleotides.
17. The method of claim 16, wherein said catalytic antibody is
specific for an inflammatory mediator or its receptor selected from
the group consisting of interleukin-1 (IL-1), IL-1.beta., IL-4,
tumor necrosis factor alpha (TNF.alpha.), IL-1 receptor, IL-4
receptor, and TNF.alpha. receptor and said agent which blocks
programmed cell death is a p53 antisense oligonucleotide.
18. The method of claim 17, wherein said p53 antisense
oligonucleotide is OL(1)p53.
19. A method for treating cancer in a patient comprising
administering a therapeutically effective amount of a catalytic
antibody in combination with a therapeutically effective amount of
a cell cycle check point inhibitor.
20. The method of claim 19, wherein said catalytic antibody is
specific for at least one neoplastic antigen or its receptor.
21. The method of claim 20 wherein said neoplastic antigen is
selected from the group consisting of epidermal growth factor
(EGF), transforming growth factor alpha (TGF.alpha.), p53 products,
prostate specific antigen, carcinoembryonic antigen, prolactin,
human chorionic gonadotropin, c-myc, c-fos, c-jun, p-glycoproteins,
multidrug resistance associated proteins, metalloproteinases,
angiogenesis factors, epidermal growth factor receptor (EGFR),
HER-2, prolactin receptors, and steroid receptors.
22. The method of claim 21, wherein said cell cycle checkpoint
inhibitor is selected from the group consisting of at least one of
p53 antisense oligonucleotides, UCN-01 (7-hydroxystaurosporine),
pentoxifylline, lisofylline, p21 antisense oligonucleotides, p27
antisense oligonucleotides, GADD45 antisense oligonucleotides, and
catalytic antibodies specific for p53, p21, or p27.
23. The method of claim 22, wherein said cell cycle checkpoint
inhibitor is a p53 antisense oligonucleotide.
24. The method of claim 22, wherein said p53 antisense
oligonucleotide is OL(1)p53.
25. The method of claim 19, further comprising administering a
therapeutically effective amount of an anti-cancer agent capable of
causing genomic damage.
26. The method of claim 25, wherein said anti-cancer agent is
selected from the group consisting of .gamma.-irradiation,
camptothecan, topoisomerase inhibitors, alkylating agents,
anthracyclines, spindle poisons, antimetabolites, and
chemotherapeutic agents.
27. The method of claim 26, wherein said chemotherapeutic agents
are selected from the group consisting of doxorubicin, etoposide,
and cisplatin.
28. The method of claim 22, wherein said catalytic antibody is
specific for a receptor selected from the group consisting of
epidermal growth factor receptor and Her2 receptor.
29. The method of claim 28, further comprising administration of at
least one agent selected from the group consisting of UCN-01,
pentoxifylline, lisophylline, GADD45 antisense oligonucleotides, an
anti-EGFR mononclonal antibody and an anti-HER2 monoclonal
antibody.
30. A method for the treatment of cancer comprising the
administration of a catalytic antibody specific for a neoplastic
antigen selected from the group consisting of epidermal growth
factor (EGF), transforming growth factor alpha (TGF.alpha.), p53
products, prostate specific antigen, carcinoembryonic antigen,
prolactin, human chorionic gonadotropin, c-myc, c-fos, c-jun,
p-glycoproteins, multidrug resistance associated proteins,
metalloproteinases, angiogenesis factors, epidermal growth factor
receptor (EGFR), HER-2, prolactin receptors, and steroid receptors
and an OL-1 p53 antisense oligonucleotide having the sequence of
5'CCCTGCTCCCCCCTGGCTCC 3' (SEQ ID NO: 11).
31. The method as claimed in claim 30, further comprising
administration of an agent selected from the group consisting of an
EGFR inhibitor and a HER2 receptor inhibitor.
Description
[0001] This application is a divisional application of U.S. patent
application Ser. No. 09/046,373, filed Mar. 23, 1998, now U.S. Pat.
No. 6,235,714.
FIELD OF THE INVENTION
[0002] This invention relates to the fields of immunology,
molecular biology and medicine. More specifically, the invention
provides novel methods and compositions for stimulating the
production of novel catalytic antibodies and inhibitors thereof.
The invention also provides methods for identifying and isolating
naturally occurring catalytic antibodies expressed from germline
genes. Finally, the invention provides methods for synthesizing
covalently reactive antigenic analogs which stimulate the
production of catalytic antibodies and/or irreversibly inhibit the
activity thereof.
BACKGROUND OF THE INVENTION
[0003] Several publications are referenced in this application by
numerals in brackets in order to more fully describe the state of
the art to which this invention pertains. The disclosure of each of
these publications is incorporated by reference herein.
[0004] The observation that vasoactive intestinal peptide (VIP) is
cleaved by Abs from asthma patients provided early evidence that
Abs may possess peptidase activity [1,2]. This observation has been
reproduced independently by Suzuki et al [3]. Autoantibody
catalysis is not restricted to catalysis of VIP. Autoantibodies in
Hashimoto's thyroiditis catalyze the cleavage of thyroglobulin [4].
Further evidence for autoantibody catalysis has been provided by
reports of DNase activity in Abs from lupus patients [5,6]. The
bias towards catalytic Ab synthesis in autoimmune disease is
supported by observations that mouse strains with a genetic
predisposition to autoimmune disease produce esterase Abs at higher
levels when compared to control mouse strains in response to
immunization with a transition state analog [7].
[0005] Like noncatalytic Abs, peptidase Abs are capable of binding
Ags with high specificity mediated by contacts at residues from the
VL and VH domains. The purified H and L subunits are known to be
independently capable of binding Ags, albeit with lower affinity
than the parent Ab. X-ray crystallography of Ab-Ag complexes have
shown that the VL and VH domains are both involved in binding the
Ag [8]. The precise contribution of the two V domains varies in
individual Ab-Ag complexes, but the VH domain may contribute at a
somewhat greater level, because CDRH3 tends to be longer and more
variable in sequence compared to CDRL3.
[0006] The initial complexation of a polypeptide Ag by a peptidase
Ab is followed by cleavage of one or more peptide bonds. Just prior
to cleavage, contacts with the catalytic residues of the antibody
are established with the peptide bond in the transition state. The
ability to hydrolyze peptide bonds appears to reside in the VL
domain. This conclusion is based on the cleavage of VIP by
polyclonal autoantibody L chains, monoclonal L chains isolated from
multiple myeloma patients and their recombinant VL domains, and
recombinant L chains raised by immunization with VIP. The H chains
of polyclonal and monoclonal Abs to VIP are capable of VIP binding
but are devoid of the catalytic activity [9]. The VH domain can
nevertheless influence the peptidase activity by "remote control",
because in binding to VIP remote from the cleavage site, it can
influence the conformation of the binding site as shown by the
peptidase activity of F.sub.v constructs composed of the catalytic
anti-VIP VL domain linked to its VH domain. The anti-VIP VH domain
exerted beneficial effects and an irrelevant VH domain exerted
detrimental effects on the catalytic activity, as evaluated by the
values of VIP binding affinity and catalytic efficiency. The
proposed existence of distinct catalytic and antigen binding
subsites in catalytic Abs is consistent with data that Abs
generally contain large combining sites, capable of accommodating
15-22 amino acids of polypeptide substrates [8], and that substrate
regions distant from the cleavage site are recognized by the Abs.
Thus, the VH domain offers a means to control the specificity of
the catalytic site.
[0007] Molecular modeling of the L chain suggested that its Asp1,
Ser27a and His93 are appropriately positioned to serve as the
catalytic triad [10]. The hydrolysis of VIP was reduced by >90%
by substitution of Ala residues for Ser27a, His93 or Asp1 by
site-directed mutagenesis [12]. The catalytic activity of the wild
type protein was inhibited selectively by
diisopropylfluorophosphate (DFP), a serine protease inhibitor, but
the residual activity of the Ser27a mutant was refractory to DFP.
The K.sub.m of the wild type L chain for VIP (130 nM) was
unaffected by mutations at Ser27a, His93 and Asp1. In contrast,
mutagenesis at residues forming the extended active site of the L
chain (Ser26, H27d/Asp28) produced increases in the K.sub.m values
(by 10-fold) and increases in turnover (by 10-fold). These results
can be explained as arising from diminished ground state
stabilization. The consequent decrease of
.DELTA.G.sup..dagger..sub.cat produces an increase in turnover.
Thus, two types of residues participating in catalysis by the L
chain have been identified. Ser27a and His93 are essential for
catalysis but not for initial high affinity complexation with the
ground state of VIP. Ser26 and His27d/Asp28 participate in VIP
ground state binding and limit turnover indirectly. See FIG. 1.
[0008] The VIPase L chain displayed burst kinetics in the early
phase of the reaction, suggesting the formation of a covalent
acyl-L chain intermediate, as occurs during peptide bond cleavage
by serine proteases. The fluorescence intensity was monitored as a
function of time after mixing the L chain with the substrate
Pro-Phe-Arg-MCA. There was an immediate increase in fluorescence,
corresponding to formation of the covalent intermediate, followed
by a slower increase, corresponding to establishment of the steady
rate. The number of active sites was computed from the magnitude of
the burst by comparison with the fluorescence yield of standard
aminomethylcoumarin. The concentration of catalytic sites was
estimated at 114 nM, representing about 90% of the L chain
concentration estimated by the Bradford method (125 nM).
[0009] The catalytic residues (Ser27a, His93, Asp1) in the anti-VIP
VL domain are also present in its germline VL domain counterpart
(GenBank accession number of the germline VL gene, Z72384). The
anti-VIP VL domain contains 4 amino acid replacements compared to
its germline sequence. These are His27d:Asp, Thr28e:Ser, Ile34:Asn
and Gln96:Trp. The germline configuration protein of the anti-VIP L
chain was constructed by introducing the required 4 mutations as
described previously [12]. The purified germline protein expressed
catalytic activity as detected by cleavage of the Pro-Phe-Arg-MCA
substrate at about 3.5 fold lower level than the mature L chain
(330.+-.23 FU/0.4 .mu.M L chain/20 min; substrate conc. 50 .mu.M).
The data suggest that remote effects due to the somatically mutated
residues are not essential for expression of the catalytic
activity.
[0010] The present invention provides novel compositions and
methods for stimulating production of catalytic antibodies and
fragments thereof. Catalytic antibodies with specificity for
predetermined disease-associated antigens provide a valuable
therapeutic tool for clinical use. Provided herein are methods for
identifying, isolating and refining naturally occurring catalytic
antibodies for the treatment of a variety of medical diseases and
disorders, including but not limited to infectious, autoimmune and
neoplastic disease. Such catalytic antibodies will also have
applications in the fields of veterinary medicine, industrial and
clinical research and dermatology.
SUMMARY OF THE INVENTION
[0011] According to one aspect of the invention, methods and
compositions are provided herein for stimulating catalytic antibody
production to predetermined target antigens, including but not
limited to those involved in pathogenic and neoplastic processes.
Covalently reactive antigen analogs (CRAAs) are described which
stimulate the production of catalytic antibodies with therapeutic
value in the treatment of a variety of medical conditions,
including autoimmunity disorders, microbial diseases,
lymphoproliferative disorders and cancer. The catalytic antibodies
of the invention may also be used prophylatically to prevent
certain medical disorders, including but not limited to septic
shock, systemic inflammatory disease and acute respiratory distress
syndrome.
[0012] The covalently reactive antigen analogs, (CRAAs) of the
present invention contain three essential elements and have the
following formula: X1-Y-E-X2. E is an electrophilic reaction center
designed to react covalently with nucleophilic side chains of
certain amino acids; Y is a basic residue (Arg or Lys) at the P1
position (first amino acid on the N-terminal side of the reaction
center); and X1 and X2 comprise three to ten flanking amino acids
on the N-terminal and C-terminal side of the reaction center. The
resultant CRAA represents a novel combination of individual
structural elements which act in concert to (a) bind chemically
reactive serine residues encoded by the germline genes for certain
serine protease types of catalytic antibodies (as well as residues
such as Thr and Cys that might acquire their chemical reactivity
via somatic sequence diversification of the germline genes); (b)
utilize ion pairing and noncovalent forces to bind structures such
as positively charged Asp/Glu residues that are responsible for the
basic residue cleavage specificity of the germline encoded
catalytic sites; and (c) bind antibody combining sites at multiple
amino acids via ion pairing and noncovalent forces.
[0013] In one aspect of the invention, CRAAs are administered to a
living organism under conditions whereby the CRAAs stimulate
production of specific catalytic antibodies. The catalytic
antibodies are then purified. Antibodies so purified are then
adminstered to a patient in need of such treatment in an amount
sufficient to inactivate antigens associated with a predetermined
medical disorder.
[0014] According to another aspect of the present invention,
methods and compositions are disclosed for administering
immunogenic amounts of CRAAs combined with an immunogenic amount of
a conventional transition state analog (TSA) to further stimulate
catalytic antibody production.
[0015] According to another aspect of the present invention, a
method is provided for treating a pathological condition related to
the presence of endogenously expressed catalytic antibodies.
Examples of such abnormal pathological conditions are certain
autoimmune disorders as well as lymphoproliferative disorders. The
method comprises administering to a patient having such a
pathological condition a pharmaceutical preparation comprising
covalently reactive antigen analog capable of irreversibly binding
the endogenously produced catalytic antibodies, in an amount
sufficient to inhibit the activity of the antibodies, thereby
alleviating the pathological condition. In this embodiment, the
CRAA contains a minimal B epitope only to minimize the
immunogenicity of the CRAA.
[0016] According to another aspect of this invention, a
pharmaceutical preparation is provided for treating a pathological
condition related to the presence of endogenously produced
catalytic antibodies. This pharmaceutical preparation comprises a
CRAA in a biologically compatible medium. Endogenously produced
catalytic antibodies are irreversibly bound and inactivated upon
exposure to the CRAA. The preparation is administered an amount
sufficient to inhibit the activity of the catalytic antibodies.
[0017] In another aspect of the invention, methods for passively
immunizing a patient with a catalytic antibody preparation are
provided. Catalytic antibodies are infused into the patient which
act to inactivate targeted disease associated antigens. In an
alternative embodiment, should the patient experience unwanted side
effects, the activity of the infused catalytic antibodies may be
irreversibly inactiviated by administering the immunizing CRAA to
said patient. Again, the immunogenicity of the CRAA in this
embodiment would be reduced via the inclusion of a minimally
immunogenic B cell epitope. A T cell universal epitope would be
omitted in this CRAA.
[0018] In yet an alternative embodiment, the catalytic antibodies
of the invention may be coadministered with antisense
oligonucleotides to p53. Such combined therapy should prove
efficacious in the treatment of cancer.
[0019] In yet another aspect of the invention, active immunization
of patients is achieved by administering the CRAAs of the invention
in a CRAA-adjuvant complex to a patient to be immunized. At least 2
subsequent booster injections of the CRAA-adjuvant complex at 4
week intervals will also be adminstered. Following this procedure,
the patient' sera will be assessed for the presence of prophylactic
catalytic antibodies.
[0020] The methods and CRAAs of the present invention provide
notable advantages over currently available compounds and methods
for stimulating catalytic antibodies specific for predetermined
target antigens. Accordingly, the disclosed compounds and methods
of the invention provide valuable clinical reagents for the
treatment of disease.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 is a free energy diagram for antibody catalysis
involving stabilization of the substrate ground state
(.DELTA.G.sub.s) and transition state (.DELTA.G.sub.TS).
.DELTA.G.sup.+.sub.uncat and .DELTA.G.sup.+.sub.cat correspond to
activation energies for the uncatalyzed and catalyzed reactions,
respectively. Km is a function of the extent of ground state
stabilization (.DELTA.G.sub.s). Kcat/Km is a function of the extent
of transition state stabilizatin relative to the catalyst-substrate
ground state complex.
[0022] FIG. 2 is a schematic representation of the domain structure
of the epidermal growth factor receptor (EGFR) protein. Ligand,
ligand-binding region found mainly in domain III; TM; transmembrane
domain; CYs, cysteine rich domains; and SP, signal peptide.
[0023] FIG. 3 is a schematic diagram of the cloning strategies
proposed for preparing anti-EGFR catalytic antibodies.
[0024] FIG. 4 depicts the structure of the CRAA-EGFR peptide.
[0025] FIG. 5 is a diagram depicting Fv construction by overlap
extension.
[0026] FIG. 6 shows a schematic diagram of the immobilization of a
serine protease reactive fluorophosphate transition state analog.
(a) triethylamine, CH2C12; (b) water, THF; (c) DAST; (d) glutaric
anhydride, pyridine; (e) DCC, DMAP, triethylamine, fluorescein.
[0027] FIG. 7 shows a schematic representation of the structure of
gp120. V, variable regions; PND, principal neutralizing
determinant; arrow, cleavage site targeted by catalytic antibodies
generated using the methods of the present invention.
[0028] FIG. 8 is a schematic depiction of the DFP reaction with
nucleophillic serine residues.
[0029] FIG. 9 is a bar graph showing irreversible inhibition of L
chain peptidase activity by diisopropylfluorophosphate ester
conjugated to biotin (top structure). L chain from clone U19 (1
.mu.M) was incubated for 30 minutes with the inhibitor. Unbound
inhibitors were removed by gel filtration. Peptidase activity was
measured at 20 nM L chain with radiolabeled VIP substrate. Data are
expressed as % inhibition relative to activity of the L chain
subjected to gel filtration without inhibitor pretreatment (about
15,000 cpm).
[0030] FIG. 10 depicts exemplary immunogen structures contemplated
for use in the present invention. The box shows the structure
around the targeted cleavage site (Lys432-Ala433). Flanking
residues are indentical in the three immunogens. Amino acid numbers
are those in full-lenghth gp120.
[0031] FIG. 11 is an autoradiogram of a non-reducing gel showing
the hydrolysis of .sup.125I-gp120 (100 nM) incubated with 50 nM IgG
from a lupus patient (lane 2, left panel) and 11 nM L chains from
MRL/lpr mice (lane 2, right panel). Lane 1 in the left and right
panel show equivalent amounts of the substrate incubated with
noncatalytic IgG from an HIV-1 positive subject and L chains from
BALB/c mice. Incubation, 2 hours at 37.degree. C.
[0032] FIG. 12 is a graph showing antibody catalyzed cleavage of
.sup.125I-gp120 incubated for 1 hour with lupus IgG (50 nM) without
and with DFP (10 .mu.M). (B) .sup.125I-gp120 from various strains
incubated for 2 hours with L chain Lay2 (1 .mu.M).
[0033] FIG. 13 is an immunoblot of a reducing SDS-gel showing
hydrolysis of unlabeled gp120 (11 .mu.M; SF2, Chiron) by L chain
Lay2 (20 .mu.M) (Lane 2).
[0034] FIG. 14 is a schematic drawing of the putative transition
state of acyl-enzyme formation during peptide bond cleavage by
serine proteases. The acyl enzyme complex (right structure) is
deacylated by an attacking water molecule.
[0035] FIG. 15 is an exemplary CRAA designed to elicit catalytic
antibodies to TNF.alpha..
[0036] FIG. 16 is an exemplary CRAA designed to elicit catalytic
antibodies to IL-1.beta..
[0037] FIG. 17 is an exemplary CRAA designed to elicit catalytic
antibodies to IL1-.beta.. In this CRAA the electrophillic reaction
center comprises a boronate molecule.
[0038] FIG. 18 is a schematic diagram of the cellular molecules
which participate in p53 mediated signalling events.
[0039] FIGS. 19A and 19B depict a list of antigens targeted by
conventional monoclonal antibodies showing clinical promise. Such
antigens are suitable targets for the catalytic antibodies of the
present invention.
DETAILED DESCRIPTION OF THE INVENTION
[0040] Methods are disclosed for stimulating synthesis of catalytic
antibodies of predetermined specificity by the immune system. In
one embodiment of the invention compositions and methods are
provided for the generation of catalytic antibodies to a peptide
antigen of choice. In another embodiment, compositions and methods
are provided which are useful in passive immunotherapy modalities
for the treatment of cancer and other medical conditions. Catalytic
antibodies for treatment of disorders in which TNF.alpha. and
IL.beta.1 play a key role are also contemplated for use in the
present invention. Such disorders include, but are not limited to,
ischemia and reperfusion injury, septic shock, SIRS, acute
respiratory distress syndrome, rheumatoid arthritis, inflammatory
bowel disease, multiple schlerosis and neurotrophic pain.
[0041] In another embodiment of the invention, vaccination
protocols are described which elicit catalytic Ab production to
predetermined viral or pathogenic antigens. The covalently reactive
antigen analogs disclosed preferentially stimulate the production
of catalytic antibodies. Such antibodies provide superior
protection against infection due to the presence of catalytic
action against the target antigen which results in its permanent
inactivation. Additionally, a single catalytic Ab molecule may be
reused to inactivate multiple antigen molecules as compared to
noncatalytic Abs which bind antigen reversibly and
stoichiometrically.
[0042] Immunization with TSAs [1] has been proposed as a means to
derive Abs that can bind the transition state, and thus lower the
activation energy barrier for the reaction. The commonly used
phosphonate analogs contain a tetrahedral phosphorous atom and a
negatively charged oxygen atom attached to the phosphorous.
Formation of the transition state of peptide bond cleavage is
thought to involve conversion of the trigonal carbon atom at the
cleavage site to the tetrahedral state, and acquisition of a
negative charge by the oxygen of the carbonyl group. The
conventional phosphonate TSAs may induce, therefore, the synthesis
of Abs capable of binding the oxyanion structure and the
tetrahedral configuration of the transition state. However, Abs to
these TSAs, while capable of accelerating comparatively undemanding
acyl transfer reactions, cannot effectively catalyze peptide bond
cleavage. An antibody to a phosphinate TSA has recently been
reported to slowly cleave a stable primary amide [11]. It is
possible that the anti-phosphinate Ab may permit superior transfer
of a proton to the amide nitrogen at the scissile bond, compared to
the more common anti-phosphonate Abs, which might account for its
better catalytic activity.
[0043] Most enzymologists hold that phosphonate TSAs fail to elicit
efficient catalytic Abs because they are poor transition state
mimics, and because multiple transition states are involved.
Enzymes use activated amino acid sidechains to catalyze peptide
bond cleavage. For instance, the Ser hydroxyl group acquires
enhanced nucelophilicity and the capability to mediate covalent
catalysis due to formation of an intramolecular, hydrogen bonded
network of the Ser, His and Asp residues. The phosphonate analogs
do not contain structural elements necessary to bind the
nucleophilic reaction center. Induction of the covalent catalysis
capability in Abs is therefore unattainable using conventional
phosphonate TSAs. Further, these TSAs do not exploit the existence
of the germline encoded, serine protease site in Abs.
[0044] Methods are disclosed for the preparation of electrophilic
CRAAs which are capable of reacting with the nucleophilic serine
residue of the catalytic Abs. These novel antigen analogs will be
applied to select catalysts from the antibody libraries. The
logical extension of this strategy is to force the utilization of
the serine protease sites for the synthesis of antibodies specific
for individual target antigens, such as the EGFR. This can be
achieved by immunization with the aforementioned electrophilic
CRAAs. Such CRAAs promote clonal selection of B cells expressing
the germline encoded serine protease sites on their cell surface.
Further, the specificity for EGFR, for example, will be ensured by
incorporating an appropriate antigenic epitope from EGFR which will
flank the covalently reactive antigen analog structure.
[0045] Catalytic Ab synthesis has been documented in autoimmune
disease [2, 4]. Further, the immune system is capable of producing
Abs that catalyze the cleavage of exogenous antigens, including the
cleavage of HIV protein gp120. However, patients infected with the
virus do not mount a catalytic Ab response to gp120. The HIV CRAAs
discussed herein will force the immune systme to synthesize
protective catalytic antibodies to HIV. Data are presented herein
which support this approach. gp120 has been selected as the target
antigen for the following reasons: (a) It is an essential
constituent of HIV-1 for productive infection of host cells; (b) As
a virus-surface protein, gp120 is readily accessible to Abs; and
(c) Certain anti-gp120 Abs have been shown to arrest HIV
infection.
[0046] The catalyst VL genes can be recruited for the synthesis of
HIV-specific catalytic Abs, by immunization with the CRAAs of the
present invention. The analogs are capable of binding the
nucleophilic, germline encoded catalytic site, and therefore,
preferentially stimulate the clonal expansion of B cells producing
the catalytic Abs. When necessary, phosphonate TSAs can be combined
with CRAAs to induce catalytic antibodies that contain an oxyanion
hole in addition to nucleophillic chemical reactivity.
[0047] CRAAs reactive with the key structural elements of serine
protease-like catalysts will be synthesized which contain a model B
cell epitope of gp120 involved in CD4 binding (residues 421-436).
Autoimmune and non-autoimmune mice wil be immunized with the B
epitope and its CRAA using procedures well known to those of skill
in the art. A T helper epitope will also be incorporated in the
CRAA. Individual structural features known to contribute in serine
protease catalysis, i.e., a nucleophilic serine residue, an
oxyanion hole forming residues, shape complementarity with the
tetrahedral geometry of the scissile bond, and recognition of
flanking residues in the substrate will be recruited in the
elicited antibodies by incorporating the following features in the
TSAs: an electrophilic, tetrahedral phosphonate ester or a
negatively charged phosphonate flanked by the B epitope
residues.
[0048] The CRAAs of the invention and the resulting catalytic
antibodies have at least three major applications. The first
application is directed to the generation of catalytic antibodies
in either humans or animals following immunization with a CRAA
designed for a particular medical disorder. The catalytic
antibodies so generated would then be administered to patients to
inactivate targeted antigen moieties. In this scenario, should the
patient experience adverse side effects, the immunizing CRAA may be
administered to irreversibly inactivate the catalytic antibody. The
CRAAs in this embodiment would be synthesized with a B cell epitope
only in order to minimize immunogenicity.
[0049] In the second application, CRAAs may be administered to
patients for the purposes of actively immunizing the patient
against particular pathological to generate a state of protective
immunity. These CRAAs would be administered as a CRAA-adjuvant
complex.
[0050] Finally, the CRAAs of the invention may be administered to
patients who are currently expressing catalytic antibodies in
association with a medical disorder such as autoimmune disease or
multiple myeloma. CRAAS may be designed with specifically react
with the antibodies present. Inhibition of catalytic function
should result in an amelioration of the disease state. Again, these
CRAAs are designed to contain a minimally immunogenic B cell
epitope only.
[0051] The detailed description set forth below describes preferred
methods for practicing the present invention. Methods for selecting
and preparing CRAAs, stimulating the production of catalytic
antibodies to predetermined disease antigens are described, as well
as methods for administering the CRAAs or catalytic antibodies in
vivo.
[0052] I. Selection and Preparation of CRAAs
[0053] The covalently reactive antigen analogs of the invention are
prepared using conventional organic synthetic schemes. The novel
CRAAs of the invention contain an electrophilic center flanked by
peptide residues derived from proteins associated with a particular
peptide antigen to be targeted for cleavage and the intended use of
the CRAA.
[0054] Selection of suitable flanking amino acid sequences depends
on the particular peptide antigen targeted for cleavage. For
example, viral coat proteins, certain cytokines, and
tumor-associated antigens contain many different epitopes. Many of
these have been mapped using conventional monoclonal Ab-based
methods. This knowledge facilitates the design of efficacious
covalently reactive antigen analogs useful as catalytic antibody
inhibitors as well as inducers of catalytic antibodies with
catalytic activities against predetermined target antigens.
[0055] The amino acids flanking the reaction center represent the
sequence of the targeted epitope in defined polypeptides that play
a role in disease, or to which autoantibodies are made in
disease.
[0056] The structural features of the CRAAs are intended to permit
specific and covalent binding to immature, germline encoded
antibodies as well as mature antibodies specialized to recognize
the targeted epitope. Based on the tenets of the clonal selection
theory, the CRAAs are also intended to recruit the germline genes
encoding the catalytic antibodies for the synthesis of mature
antibodies directed towards the targeted epitope.
[0057] Polypeptides to be targeted include soluble ligands and the
membrane bound receptors for these ligands.
[0058] Microbial proteins are also intended to targeted for
catalysis by the antibodies of the present invention. These include
but are not limited to gp120, gp160, Lex1 repressor, gag, pol,
hepatitis B surface antigen, bacterial exotoxins (diptheria toxin,
C. tetani toxin, C. botulinum toxin, pertussis toxin).
[0059] Neoplastic antigens will also be incorporated into
therapeutically beneficial CRAAs. These include but are not limited
to EGF, TGF.alpha., p53 products, prostate specific antigen,
carcinoembryonic antigen, prolactin, human chorionic gonadotropin,
c-myc, c-fos, c-jun, p-glycoproteins, multidrug resistance
associated proteins, metalloproteinases and angiogenesis
factors.
[0060] Receptors for neoplastic antigens will also be targeted for
antibody-mediated catalysis. These include EGFR, EGFR mutants,
HER-2, prolactin receptors, and steroid receptors.
[0061] Inflammatory mediators are also suitable targets for
catalysis. Exemplary molecules in this group include TNF, IL-1beta,
IL-4 as well as their cognate receptors.
[0062] Preexisting catalytic antibodies are found in autoimmune
disease and lymphoproliferative disorders. The harmful actions of
these catalytic antibodies will be inhibited by administering CRAAs
to patients. CRAAs designed to be weakly immunogenic will be
administered which covalently interact with antibody subunits with
specificity for VIP, Arg-vasopressin, thyroglobulin, thyroid
peroxidase, IL-1, IL-2, interferons, proteinase-3, glutamate
decarboxylase.
[0063] For maximum selectivity, the flanking peptide sequences
comprise an epitope which is targeted for cleavage. For example, an
epitope present in the epidermal growth factor receptor is
incorporated in a CRAA of the present invention. In another
embodiment of the invention, an epitope present in HIV gp120 is
incorporated into a CRAA. An explary CRAA for the treatment of HIV
infectin comprises both a B cell epitope and a T cell epitope to
maximize the immunogenicity of the CRAA. Other CRAAs exemplified
herein include those suitable for generating catalytic antibodies
to TNF and IL-1.beta..
[0064] II. Administration of CRAAs
[0065] CRAAs as described herein are generally administered to a
patient as a pharmaceutical preparation. The term "patient" as used
herein refers to human or animal subjects.
[0066] The pharmaceutical preparation comprising the CRAAs of the
invention are conveniently formulated for administration with a
acceptable medium such as water, buffered saline, ethanol, polyol
(for example, glycerol, propylene glycol, liquid polyethylene
glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents,
suspending agents or suitable mixtures thereof. The concentration
of CRAAs in the chosen medium will depend on the hydrophobic or
hydrophilic nature of the medium, as well as the other properties
of the CRAA. Solubility limits may be easily determined by one
skilled in the art.
[0067] As used herein, "biologically acceptable medium" includes
any and all solvents, dispersion media and the like which may be
appropriate for the desired route of administration of the
pharmaceutical preparation, as exemplified in the preceding
paragraph. The use of such media for pharmaceutically active
substances is known in the art. Except insofar as any conventional
media or agent is incompatible with the CRAA to be administered,
its use in the pharmaceutical preparation is contemplated.
[0068] Conventional immunization methods will applied to induce
catalytic Ab synthesis. Three intraperitoneal and one intravenous
injections of the immunogens (about 100 .mu.g peptide each) will be
administered. The final immunization will be carried out
intravenously. RIBI will be used in the animal studies. For human
use, alum will be employed as the adjuvant. Alum is approved for
human use and has previously been shown to provoke Ab synthesis to
a B-T epitope similar to those proposed in the present invention.
RIBI is a low toxicity replacement for Freund's Complete Adjuvant,
and reproducibly facilitates good Ab responses to a variety of Ags.
Analysis of two adjuvants is advantageous because the quality and
magnitude of Ab responses to vaccines can be influenced by
adjuvants, via effects of the cytokines and TH subpopulations
recruited by the adjuvants on B CRAAs may be administered
parenterally by intravenous injection into the blood stream, or by
subcutaneous, intramuscular or intraperitoneal injection.
Pharmaceutical preparations for parenteral injection are commonly
known in the art. If parenteral injection is selected as a method
for administering the molecules of the invention, steps must be
taken to ensure that sufficient amounts of the molecules reach
their target cells to exert a biological effect.
[0069] The pharmaceutical preparation is formulated in dosage unit
form for ease of administration and uniformity of dosage. Dosage
unit form, as used herein, refers to a physically discrete unit of
the pharmaceutical preparation appropriate for the patient
undergoing treatment. Each dosage should contain a quantity of
active ingredient calculated to produce the desired effect in
association with the selected pharmaceutical carrier. Procedures
for determining the appropriate dosage unit are well known to those
skilled in the art.
[0070] The pharmaceutical preparation comprising the CRAA may be
administered at appropriate intervals, for example, twice a day
until the pathological symptoms are reduced or alleviated, after
which the dosage may be reduced to a maintenance level. The
appropriate interval in a particular case would normally depend on
the condition and the pathogenic state sought to be treated in the
patient.
[0071] III. Administration of Catalytic Antibodies
[0072] The catalytic antibodies described herein are generally
administered to a patient as a pharmaceutical preparation.
[0073] The pharmaceutical preparation comprising the catalytic
antibodies of the invention are conveniently formulated for
administration with a acceptable medium such as water, buffered
saline, ethanol, polyol (for example, glycerol, propylene glycol,
liquid polyethylene glycol and the like), dimethyl sulfoxide
(DMSO), oils, detergents, suspending agents or suitable mixtures
thereof. The concentration of catalytic antibodies in the chosen
medium will depend on the hydrophobic or hydrophilic nature of the
medium, as well as the other properties of the catalytic
antibodies. Solubility limits may be easily determined by one
skilled in the art.
[0074] As used herein, "biologically acceptable medium" includes
any and all solvents, dispersion media and the like which may be
appropriate for the desired route of administration of the
pharmaceutical preparation, as exemplified in the preceding
paragraph. The use of such media for pharmaceutically active
substances is known in the art. Except insofar as any conventional
media or agent is incompatible with the catalytic antibody to be
administered, its use in the pharmaceutical preparation is
contemplated.
[0075] Conventional passive immunization methods will be employed
when administering the catalytic antibodies of the invention. In a
preferred embodiment, Abs will be infused intravenously into the
patient. For treatment of certain medical disorders, steps must be
taken to ensure that sufficient amounts of the molecules reach
their target cells to exert a biological effect. The lipophilicity
of the molecules, or the pharmaceutical preparation in which they
are delivered may have to be increased so that the molecules can
arrive at their target locations. Furthermore, the catalytic
antibodies of the invention may have to be delivered in a
cell-targeted carrier so that sufficient numbers of molecules will
reach the target cells. Methods for increasing the lipophilicity
and targeting of therapeutic molecules, which include capsulation
of the catalytic antibodies of the invention into antibody studded
liposomes, are known in the art.
[0076] The catalytic antibodies that are the subject of the present
invention can be used as antibody fragments or whole antibodies or
they can be incorporated into a recombinant molecule or conjugated
to a carrier such as polyethylene glycol. In addition any such
fragments or whole antibodies can be bound to carriers capable of
causing the transfer of said antibodies or fragments across cell
membranes as mentioned above. Carriers of this type include but are
not limited to those described (Cruikshank et al. in the Journal of
Acquired Immune Deficiency Syndromes and Human Retrovirology, March
1997).
[0077] The pharmaceutical preparation is formulated in dosage unit
form for ease of administration and uniformity of dosage. Dosage
unit form, as used herein, refers to a physically discrete unit of
the pharmaceutical preparation appropriate for the patient
undergoing treatment. Each dosage should contain a quantity of
active ingredient calculated to produce the desired effect in
association with the selected pharmaceutical carrier. Procedures
for determining the appropriate dosage unit are well known to those
skilled in the art. For example, the half-life of syngeneic IgG in
the human is about 20 days. Over this period, 60,480 Ag molecules
will be cleaved by one molecule of an antibody with a turnover of
2.1/min (which is the turnover of a human anti-VIP L chain isolated
from a phage display library [14]. It can be seen, therefore, that
the peptidase antibodies can express considerably more potent
antigen neutralizing activity than stoichiometric,
reversibly-binding molecules. Note that the antibody light chains
discussed here were selected based on their antigen-binding
affinity, a procedure that favors tight binding to the antigen, but
will not select catalysts with the best turnover. Antibodies
produced by immunization with CRAAs and isolated by appropriate
selection methods, as disclosed here, will express considerably
greater turnover. Such catalytic antibodies can be used to treat
disease at substantially lower doses of corresponding noncatalytic
antibodies.
[0078] The pharmaceutical preparation comprising the catalytic
antibodies may be administered at appropriate intervals, for
example, twice a week until the pathological symptoms are reduced
or alleviated, after which the dosage may be reduced to a
maintenance level. The appropriate interval in a particular case
would normally depend on the condition and the pathogenic state
sought to be treated in the patient.
[0079] CRAAs will be selected that will generate catalytic
antibodies for passive or active immunotherapy that will fulfill
the standard criteria for acceptable prophylatic or therapeutic
agents: (1) Cleavage of the target peptide antigen by the catalytic
antibody will lead to a beneficial change in a pathological process
by either functionally activating or functionally inactivating the
target peptide antigen; and (2) Administation of said catalytic
antibodies or the induction of their production in the body by
means of immunization with a CRAA will result in a favorable
therapeutic index such that the clinical benefit gained outweighs
the morbidity associated with andy side-effects. Discussions of how
such criteria are established for the acceptability of prophylatic
or therapeutic agents are common in the art can can be found in
such texts as Guide to Clinical Trials by Bert Spilker, Raven
Press, New York, 1991.
[0080] Suitable categories of prophylatic or therapeutic target
peptide antigens for the practice of the present invention include
but are not limited to cytokines, growth factors, cytokine and
growth factor receptors, proteins involved in the transduction of
stimuli intiated by growth factor receptors, clotting factors,
integrins, antigen receptors, enzymes, transcriptional regulators
particularly those involved in cellular program (differentiation,
proliferation and programmed cell death) control, other inducers of
these cellular programs, cellular pumps capable of expelling
anticancer agents, microbial and viral peptide antigens.
[0081] Conventional monoclonal antibodies that act to inhibit the
function of particular target molecules are among the most common
type of therapeutic agent under development for clinical use by
biotechnology and pharmaceutical companies. Some of these have
shown substantial clincal promise and any exposed peptide target
antigens that are part of the same molecular functional unit are
therefore shown to be particularly well suited as potential targets
for the catalytic antibodies that are the subject of the present
invention. The catalytic antibodies comtmplated in the present
invention will constitute a major inprovement over such
conventional monoclonals becaule of their ability to affect many
target molecules vs. just one and because of the resulting dramatic
decrease in the cost of treatment. The availability of peptide
bonds within these targeted antigens can be determined by methods
well established in the art including but not limited to a
demonstration of cleavage following exposure to proteolytic enzymes
and catalytic light chains capable of cleaving a range of peptide
bonds.
[0082] A listing of some of the antigens targeted by conventional
monoclonal antibodies showing clinical promise and the
corresponding medical indications are shown in FIGS. 19A and
19B.
[0083] Thus, it is an object of the present invention to provide a
covalently reactive antigen analog, and a method of producing it,
which is capable of 1) provoking the generation of catalytic
antibodies specific to a predetermined antigen of the invention
and/or 2) irreversibly inhibiting the catalytic action of catalytic
antibodies associated with autoimmune disease and certain
lymphoproliferative disorders. Further objects reside in providing
processes for preparing antigens and their corresponding
antibodies, and in providing assays and methods of using these
antibodies as beneficial therapeutic agents.
EXAMPLE IA
Catalytic Antibodies for Tumor Immunotherapy
[0084] Methods for producing catalytic antibodies (Abs) suitable
for treatment of cancer are described in the present example. Such
antibodies offer superior immunotherapy alternatives for cancer
treatment by virtue of the catalytic function, as cleavage of the
target antigen should result in its permanent inactivation.
Further, a single Ab molecule may be reused to inactivate multiple
antigen molecules. In comparison, noncatalytic Abs bind antigen
stoichiometrically, and the binding is reversible. Upon
dissociation from the complex, the antigen may recover its
biological functions.
[0085] The tumor-associated antigen, epidermal growth factor
receptor (EGFR), will be utilized for the synthesis of an exemplary
antigen suitable for stimulating the production of antibodies with
enzymatic activities. Previous work on peptidase antibodies has
revealed the following: 1) certain Abs are capable of combining the
ability to bind individual peptide antigens with a peptide bond
cleaving activity; 2) the peptidase site is structurally similar to
the active site of non-AB serine proteases. This site is located in
the VL domain and is encoded by a germline V domain gene(s); and 3)
the synthesis of peptidase Abs occurs at increased levels in
autoimmune disease.
[0086] EGFR serves vital roles in the transduction of signals
necessary for cellular differentiation and mitosis. See FIG. 2.
Further, signals transduced via EGFR have been implicated in tumor
invasiveness and transformation. Binding of EGF or TGF.alpha. to
the EGF receptor stimulates the receptor tyrosine kinase and
autophosphorylation activities. Receptor activation leads to a
cascade of intracellular events which culminate in increased cell
proliferation.
[0087] Overexpression of the EGFR gene has been associated with a
number of neoplasms, including adenocarcinoma and squamous cell
carcinoma of the lung, breast carcinoma, colon gynecological and
bladder carcinoma, glioma, hepatocellular and pancreatic carcinoma
and prostate carcinomas. The overexpression in some tumors has been
attributed to EGFR gene amplification [15].
[0088] EGFR is a suitable tumor antigen, as it is expressed at much
higher levels in tumors compared normal tissues. Consequently, Abs
to EGFR are suitable candidates for anti-tumor reagents. Many
monoclonal antibodies (Mabs) to EGFR have been raised to specific
epitopes of the receptor which do not compete with each other for
binding EGFR [e.g., 16]. Mendelsohn and coworkers have described
mouse MAbs raised using the EGF receptor protein from human A431
epidermoid carcinoma cells as the immunogen. MAbs which inhibit the
binding of EGF to EGFR also inhibited the EGF-stimulated tyrosine
protein kinase activity which was assayed using intact cells or
solubilized membranes and an exogenous peptide substrate. Further,
these MAbs inhibited the proliferation of A431 cells in tissue
culture, whereas those incapable of blocking the binding of EGF to
EGFR were without effect on cell proliferation. Further research
showed that administration of anti-EGF receptor MAbs can inhibit
tumor formation by A431 cells in athymic mice. MAbs of different
isotypes have been shown to inhibit tumor growth in mice,
indicating that constant domain effector functions are probably not
critical in the observed antiproliferative activity. Complete
inhibition of tumor growth in vivo has been observed, provided that
sufficient Ab amounts were administered. The few tumors that
persist continue to express EGFR, suggesting that their survival is
due to inadequate exposure of the cells to the Abs [17].
[0089] Using a breast carcinoma cell line as the immunogen,
Modjtahedi et al [16] generated several MAbs against EGFR, some of
which blocked the binding of growth factors by EGFR and inhibited
the growth of human squamous carcinoma cell lines. Several
additional EGFR-specific Mabs have been prepared using purified EGF
receptors or cells expressing high levels of EGFR as the immunogens
[18]. Phase 1 clinical trial of anti-EGFR Abs for the treatment of
malignant gliomas [19,20], head and neck cancer, and lung cancer
are under way.
[0090] The data reveal that Abs capable of disrupting EGF binding
to EGFR may be utilized in development of agents effective for
immunotherapy of EGFR expressing tumors. An inverse correlation has
been noted between EGFR expression and the levels of BCL-2, a
protein that plays an important role in overriding programed cell
death (apoptosis). Ligand binding by EGFR under certain conditions
has been shown to protect tumor cells from c-myc induced apoptosis.
Glioblastoma cells transfected with a mutant EGFR display decreased
apoptosis [21]. In principle, therefore, Abs to EGFR may be capable
of inducing apoptosis in tumor cells. If this possibility is valid,
the likelihood of complete tumor regression via an apoptotic
pathway following treatment with EGFR Abs will be strengthened.
[0091] Abs capable of cleaving EGFR comprise superior
immunotherapeutic agents compared to their noncatalytic
counterparts for the following reasons: (a) Cleavage of EGFR at the
appropriate peptide bonds should cause permanent loss of the
biological activity, whereas EGFR binding by a noncatalytic Ab can
be reversible, and dissociation of the Ab will regenerate the
biological functions of the EGFR; and (b) A single catalyst
molecule can cleave multiple substrate molecules, whereas
noncatalytic Abs can only act stoichiometrically.
[0092] Three strategies for the prepararation of catalytic Abs are
disclosed herein. The first strategy capitalizes on the
availability of cloned Ab light chains with peptidase activity.
Previous studies have suggested that the nonspecific peptidase
activity residing in the VL domain can be directed by the antigen
binding specificity of the VH domain. Hybrid Fv constructs will be
generated composed of an available VL domain linked to EGFR binding
VH domains. Following synthesis and expression in suitable
expression systems, the Fv constructs will be assessed for specific
EGFR cleaving activity.
[0093] The second cloning strategy is based on the observation that
certain Abs expressed in autoimmune disease utilize serine protease
catalytic sites encoded by germline VL genes. Mice with an
autoimmune disease background will be immunized with EGFR
expressing cells. Following immunization, catalytic Fv domains will
be isolated from a phage display library. Catalysts that combine
the germline encoded catalytic activity with somatically acquired
specificity for EGFR will selected by binding to covalently
reactive antigen analogs (CRAAs) reactive with nucleophilic serine
residues, followed by binding to the extracellular domain of
EGFR.
[0094] The third strategy is based on the hypothesis that the
immune system can be forced to utilize the germline encoded
catalytic site for synthesis of Abs to EGFR. Mice will be immunized
with an electrophilic CRAA of an EGFR peptide capable of
preferentially stimulating catalytic Ab synthesis. The Ab catalysts
so produced will be assessed for their inhibitory effects on the
tumorigenicity of an EGFR-expressing human cell line in vivo using
a variety of methods known to those of skill in the art, i.e.,
inhibition of EGF-stimulated EGFR autophosphorylation and
inhibition of tumor cell growth.
[0095] The compositions and methods disclosed herein facilitate the
preparation of specific and catalytically efficient EGFR cleaving
antibodies suitable for cancer immunotherapy. FIG. 3 summarizes the
approach to be taken. Previous studies have established the
feasibility of isolating Abs capable of catalyzing the cleavage of
certain Ags, i.e., VIP, thyroglobulin and gp120. Information from
these studies has been applied in the present invention resulting
in the disclosed strategies for preparing catalytic Abs to
EGFR.
[0096] The following materials and methods are provided to
facilitate the practice of the present invention.
[0097] Materials and Methods
[0098] Immunization: Six MRL/lpr mice will be hyperimmunized with
EGFR expressing cells as previously described. Briefly, about
10.sup.7 A431 cells will be recovered by trypsinization of tissue
culture flasks, resuspended in PBS and administered in RIBI
adjuvant to the mice intraperitoneally. Three booster immunizations
using about 5.times.10.sup.6 cells will be carried out at ten day
intervals. If high level Ab titers are not reached, booster
injections with the soluble extracellular domain of the epidermal
growth factor receptor (exEGFR) (25 .mu.g) will be administered. To
drive the immune system to generate catalytic antibodies, six
MRL/lpr mice will be hyperimmunized i.p. with the TSA-EGFR
conjugated to keyhole limpet hemocyanin (KLH) (50 .mu.g protein) in
RIBI according to the above scheme. Blood will be obtained from the
retro-orbital plexus at ten day intervals.
[0099] Expression and purification of exEGFR: The extracellular
domain of EGFR (exEGFR, composed of residues 1-621 of EGFR) will be
purified from a baculovirus expression system as previously
described [22]. Expression of the exEGFR is done in Sf9 insect
cells, which secrete about 2 mg/ml of the exEGFR into the culture
supernatant [22]. Purification by a two step ion exchange
chromatography procedure, permits recovery of the protein at about
95% homogeneity, as determined by SDS-PAGE [22].
[0100] Preparation and purification of EGFR-CRAA peptide: The CRAA
is composed of three basic elements: an electrophilic phosphonate
ester flanked on the N terminal side by EGFR residues 294-303 and
on the C terminal side by EGFR residues 304-310. See FIG. 4. The
electrophilicity resides on the phosphorous atom, and is intended
to trap nucelophilic serine residues present in Abs. The basic
synthesis scheme for synthesis of such CRAAs has been described
[23]. Briefly, a phosphinate containing isostere of lysine (EGFR
residue 303) is attached to the appropriate flanking peptide
sequence. The isostere will be prepared from the
diphenylmethylamine salt of hypophosphorous acid and
6-aminohexanal, followed by removal of the diphenylmethyl group in
acid [24]. The required flanking peptides are prepared by
conventional solid phase peptide synthesis, except that the peptide
corresponding to EGFR residue 304-310 contains
2-hydroxy-6-aminohexanoic acid instead of the N terminal lysine.
Side chain protected peptides will be attached to the phosphinate
structure by classical solution phase peptide synthesis methods.
The phosphinate structure will be converted to the phosphonate
phenyl ester by oxidative coupling with phenol. The N terminus of
the side chain protected CRAA-EGFR peptide will be coupled to KLH
by the glutaraldehyde method. The reaction mixture will be
separated by gel filtration, and residual unconjugated peptide in
the lower molecular fractions will be analyzed for inorganic
phosphorous after complete digestion with perchloric acid. This
will permit estimation of the conjugation efficiency.
[0101] exEGFR and EGFR-CRAA ELISA: exEGFR or CRAA-EGFR (100 ng/ml)
will be coated on PVC 96 well plates, excess protein binding sites
blocked with 5% albumin, and binding of appropriately diluted serum
Abs to the immobilized antigens will be measured. The extent of the
reaction is measured by treatment with goat anti-mouse IgG tagged
to peroxidase. Controls include the incubation with preimmune sera
and with excess soluble competitor exEGFR. The procedure for
measuring exEGFR and CRAA-EGFR binding by cloned Fv constructs is
essentially as above, except that the reaction is visualized by
treatment with mouse anti-c-myc Ab (the recombinant proteins
contain a 10 residue c-myc tag) and anti-mouse IgG tagged to
peroxidase.
[0102] Fv preparation: The methods described in previous
publications [10,14,25] with certain adaptations will be applied,
as summarized below. See also FIG. 5. Construction of an Fv cDNA
library will be done as follows: Total RNA is prepared by standard
methods from the splenocytes of immunized mice while minimizing
RNase contamination. Libraries of VL cDNA (residues 1-113) and VH
cDNA (residues 1-123) will be produced from the RNA template using
reverse transcriptase and appropriate VL or VH forward primers,
which contain, respectively, an SfiI restriction site for cloning
into the vector and an antisense sequence encoding a peptide
linker. The cDNA is amplified by PCR using Taq, dNTPs and
appropriate primers as shown in FIG. 5. The back primers are based
on sequences coding for conserved N-terminal amino acids in the FR1
regions. Limited degeneracy has been introduced in the primers to
allow amplification of closely related V-gene families (e.g., K
families 2,3,6). 6 back VL primers, 8 VH back primers, 1 VL forward
primers and 2 VH forward primers are needed. The forward primers
are designed to anneal to constant region sequences close to the 3'
end of the V domain [26]. The VH and VL back primers contain a NotI
site for cloning and a sense sequence encoding the linker. The
linker is a 14-residue, flexible peptide. SfiI and NotI sites are
rare cutters, minimizing loss of library diversity at the
restriction digestion step. Following completion of the PCR, the
amplified cDNA bands of the correct size are cut from agarose gels,
extracted using Geneclean II (BIO 101) and quantitated by EtBr
fluorescence (.lambda.em 590 nm, .lambda.ex 302 nm). The VL and VH
cDNA species are linked by overlap extension, i.e., annealing of
linker sense and antisense sequences, and filling in of the two
strands with Taq. Individual cDNA species are purified by agarose
gel electrophoresis and Wizard kits (Promega) prior to performing
the linkage reaction.
[0103] Cloning and phase display: The library will then be cloned
into the phagemid vector pCANTABhis.sub.6 [27]. The vector contains
the following sequence elements: restriction sites, a signal
peptide, a gene3 structural peptide, a stop codon (amber) between
the insert and gene3, a c-myc peptide tag, poly(his).sub.6, an
IPTG-inducible lac promoter and an ampicillin resistance gene. The
amber codon permits secretion of soluble V domains or their
expression as p3-fusion proteins on the phage surface, depending on
the host strain (HB2151 cells recognize amber as a stop and TG1
cells recognize amber as Glu). The cDNA and the vector are digested
sequentially with SfiI and NotI followed by ligation using T4 DNA
ligase. Host cells are transformed by electroporation, clones are
selected in kanamycin and the presence of inserts in individual
colonies is confirmed by PCR using primers located in the vector
upstream and downstream of the insert, yielding EtBr-stained bands
at 0.7 kb. Addition of helper phage (VCSM13) permits packaging of
phage particles from TG1 cell cultures. The particles in the
supernatant of the culture are precipitated twice with 4% PEG,
yielding phage ready for the selection procedures described
below.
[0104] Selection of EGFR binding Fv: exEGFR will be coated on
polystyrene plates at a concentration of about 5 .mu.g/ml in PBS.
Following removal of unbound protein and saturation of nonspecific
protein binding sites, the plates are incubated with the phage
preparations. Unbound phage will be removed by extensive washing
and bound phage particles will be eluted using a pH 3.0 buffer.
[0105] Catalytic VL domain and hybrid Fv library: The hybrid Fv
libraries will be prepared by linking a VL domain already
established to possess catalytic activity (clone U24 [15]) isolated
from an unimmunized mouse to VH domains from the EGFR-binding Fv
library. The VL domain cDNA will be reamplified by PCR as above,
except that the forward primer will contain a NotI site for direct
cloning into the vector. The VH domains will be reamplified from
the EGFR binding Fv cDNA library using VH primers described above,
except that the forward primer contains a linker antisense
sequence. VL/VH linkage will be as above.
[0106] Soluble Fv expression and purification:
[0107] Phagemid DNA from selected clones is grown in HB2151 cells.
Periplasmic extracts contain 2-10 mg/l of the recombinant protein.
Chromatography is on Ni-Sepharose (Qiagen). Unbound proteins are
removed with a 0.5 M NaCl buffer. Recombinant antibodies are eluted
at pH 5 or with imidazole. A second round of metal affinity
chromatography provides pure recombinant proteins, assessed by
SDS-electrophoresis, isoelectric focusing, Mono-Q chromatography
and N-terminal amino acid sequencing. Each batch of purified
protein is analyzed by gel filtration (Superose 12 column) and by
immunoadsorption with immobilized anti-c-myc Ab [14] to confirm
that the catalytic activity belongs to the Ab fragments.
Chromatographic procedures are conducted using a gradient FPLC
system. Amino acid sequencing is done using blots of
electrophoresis gels by the Protein Structure Core Facility at the
University of Nebraska Medical Center.
[0108] Catalyst selection reagents: Two compounds capable of
covalent reactions with nucleophillic serine residues will be
prepared. The first compound, a fluorophosphate (FP) bifunctional
reagent, is similar to the serine protease inhibitor DFP shown in
previous studies to inhibit the catalytic activities of Abs.
Because of the poor stability of DFP in water, its direct
attachment to a solid support for phage adsorption is impractical.
A bifunctional reagent containing an FP group conjugated to an
affinity tag like biotin will be employed which will permit
immobilization of the conjugate on avidin coated solid phase. The
FP ester will be reacted with biotin activated with
N-hydroxysuccinimide (NHS-LC biotin II, Pierce Chemical Co., 1 in
FIG. 6, which also introduces a long spacer to minimize steric
hindrance effects. The synthesis will proceed by esterification of
phosphate diester 2 with NHS-LC biotin II (1). Compound 2 will be
obtained by phosphorylation of 4-triisopropylsilyloxy-2-butanol
with dichloroisopropyl phosphate followed by hydrolysis and
deprotection of the monochlorophosphate intermediate. Conversion to
the fluorophosphate 3 will be accomplished at the final step by
treatment with diethylaminosulfuryl trifluoride (DAST). Reagent 3
shall by kept in dioxane or other organic solvent to mitigate
possible autoreactivity. An aliquot of the organic solution will
then be transferred into an aqueous solution containing phage to
give an effective concentration of 0.1 to 0.5 mM of 3. In the event
that the chemical autoreactivity of reagent 3 is too severe for
practical application we will consider a fluorescein tag as an
alternative to biotin. Fluorescein contains a phenolic OH and a
carboxylic ester which should be compatible with the
fluorophosphate. Fluorescein will be acylated with the phosphate
derivative 4 (obtainable by treatment of 2 with glutaric anhydride)
to form an amide linkage to its aniline group. Fluorination at
phosphorus to obtain 5 will be achieved by treatment with DAST. See
FIG. 6.
[0109] A peptide aldehyde matrix will also be prepared as a means
to trap serine protease sites. The commercially available
arginal-containing ligand antipain
(N-[-N-carbonyl-Arg-Val-Arg-al]-Phe) will be activated with
carbodiimide and linked covalently via the carboxyl group of the
Phe residue to the amino residues of AH-Sepharose 4B (Pharmacia).
The synthesis methods are routine, and have been detailed by
Pharmacia.
[0110] Catalytic Fv selection: The Fv phage library will be passed
through the immobilized serine protease trapping reagent described
above. Unbound phage will be removed by extensive washing. Elution
of bound phage will be done with 0.1 M glycine-HCl, pH 2.2, which
is sufficient to disrupt biotin-avidin and
fluorescein-antifluorescein interactions. Elution could also be
done using 0.1-1M hydroxylamine to dissociate the phosphate-serine
linkage. Elution of the peptide aldehyde matrix will be done with
weakly acidic buffer (pH 4.5), which favors breakdown of the
hemiacetal adduct. Phage particles recovered from the serine
protease binding matrix will be amplified by growth in TG1 cells
and then subjected to selection for binding to immobilized exEGFR
as described above for selection of EGFR binding Fv.
[0111] Screening for catalytic activity: Fv fragments will be
screened for cleavage of exEGFR, the CRAA-EGFR peptide and a
nonspecific peptidase substrate, Pro-Phe-Arg-methylcoumarinamide
(MCA). A protocol has been developed to rapidly purify large
numbers of Ab clones based on their metal binding capability.
Bacterial supernatants are incubated with Ni-Sepharose in 96-well
plates fitted with a nitrocellulose filter, unbound material
removed by washing with neutral pH buffer, and bound V domains
eluted into a catch plate using a pH 5 buffer. A Millipore
Multiscreen apparatus permits rapid processing. The eluate is
neutralized, and Pro-Phe-Arg-MCA (500 .mu.M), [.sup.125I]exEGFR or
[.sup.125I]EGFR(tyr,294-310) (about 30,000 cpm) is added.
Hydrolysis of the peptide-MCA substrate is determined using a plate
reader (.lambda.ex 360 nm, .lambda.em 470 nm; cleavage of the amide
bond linking Arg to aminomethylcoumarin produces increased
fluorescence). The peptide-MCA substrate is available commercially.
The EGFR(tyr,294-310) is a 19 residue synthetic peptide
corresponding to residues 294-310 of EGFR with a tyrosine residue
placed at the N terminus to permit the radiolabeling with
.sup.125I. Preparation of the .sup.125 IexEGFR and
[.sup.125I]EGFR(tyr,294-310) is by the standard chloramine-T
method. Removal of free .sup.125I is on a disposable gel filtration
column or on a reversed-phase HPLC column, respectively. exEGFR
cleavage is determined by nonreducing SDS-electrophoresis (4-15%
gels) using a PHAST system (Pharmacia) followed by autoradiography
using Kodak XAR film and quantitative scanning of band areas using
the program Image. The reaction will be evident as the depletion of
the 105 kD band and appearance of smaller radioactive fragments.
Care is taken to only quantitate the bands lying within the linear
response range of the X ray film. Cleavage of
[.sup.125I]EGFR(tyr,294-310) will be determined by measuring the
radioactivity rendered soluble in 10% trichloroacetic acid. The TCA
precipitation procedure is similar to that described previously to
determine VIP cleavage [3]. The method will be validated by
comparison with RP-HPLC on a C-18 column. If difficulties are
encountered, electrophoresis on 25% PAGE gels can be carried out to
discriminate between the intact peptide and its fragments, as
described previously for VIP [28]. Controls will be eluates from
bacteria transformed with vector without a cDNA insert or cDNA
encoding a noncatalytic Fv. Dot-blotting with an anti-c-myc Ab as
described in [25] permits quantitation of the recombinant
protein.
[0112] Screening for inhibition of EGF binding: The selected clones
will be screened for their effect on binding of .sup.125I-labeled
EGF to A431 cells in 96 well plates using our previously published
methods [15, 18]: The cells (1.times.10.sup.5 cells/well) will be
plated in the wells and allowed to adhere to the solid phase,
.sup.125I-labeled EGF (Amersham) and the Fv solutions will be added
(about 1 nM), the reaction mixture incubated for 60 min, the wells
washed three times in iced binding buffer, and the wells counted
for bound .sup.125I-labeled EGFR. Controls will include binding
assays conducted in the absence of Fv, and in the presence of
excess competitor exEGFR.
[0113] Assessment of Catalytic Properties
[0114] An immunoblotting cleavage assay will be performed to
confirm that the cleavage reaction is not due to artefacts
associated with radiolabeling of exEGFR. About 1 .mu.g purified
exEGFR is treated with the catalyst for an appropriate length of
time followed by SDS-PAGE. The gel is blotted onto nitrocellulose
and stained with polyclonal rabbit anti-exEGFR followed by
anti-rabbit IgG-peroxidase. Depletion of immunostainable intact
exEGFR and appearance of immunostainable exEGFR fragments will
indicate exEGFR cleavage.
[0115] Kinetics: Initial rates for the Ab-catalyzed hydrolysis of
radiolabeled exEGFR mixed with increasing amounts of unlabeled
exEGFR are computed based on band intensities seen by
SDS-electrophoresis and autoradiography. The velocity of exEGFR
cleavage is determined from the intensity of the intact substrate
band, and the velocities of individual reactions, from the
intensity of each product band. Kinetic constants (K.sub.m,
k.sub.cat) will be calculated from the rate data fitted to the
Michaelis-Menten equation
{v=(V.sub.max.multidot.[S])/(K.sub.m+[S])}. Kinetic studies will
also be conducted using synthetic exEGFR peptides as the substrate,
a peptide in which only a single peptide bond is cleaved. The use
of such a substrate will eliminate complexities associated with
multiple simultaneous reactions. The kinetics of hydrolysis of such
a substrate will be determined as described above, except that
reversed-phase HPLC will be employed to separate the products.
Quantitation will be by determining the area under the product
peaks observed at 214 nm.
[0116] Cleavage sites: To identify the peptide bonds cleaved by
Abs, electrophoretically pure exEGFR will be incubated with the
catalyst for a period sufficient to produce about 100 pmoles of
product fragments, the fragments will be separated by
polyacrylamide gel electrophoresis, blotted onto a PVDF membrane
and the immobilized proteins sequenced by N-terminal Edman's
degradation at the UNMC Protein Structure Core Facility. Controls
will include exEGFR incubated with an inactive Fv and exEGFR
incubated without Fv. At least 5 N-terminal residues of each
fragment will be identified to permit unambiguous assignment of the
cleavage sites. Tryptic mapping and FAB-Mass spectrometry to
identify resultant fragments will be considered if necessary, i.e.,
if the N-terminus is blocked.
[0117] Substrate specificity: Along with exEGFR, cleavage of the
following substrate will be tested: (a) .sup.125I-lysozyme; (b)
.sup.125I-thyroglobulin; (c) .sup.125I-IgG; (d) .sup.125I-VIP; and
(e) various peptide-MCA conjugates. Protocols for assaying the
hydrolysis of these substrates are in place. Purified human
thyroglobulin, hen lysozyme (Sigma) and human IgG from serum are
labeled with .sup.125I by the chloramine-T method and purified by
gel filtration [2, 4]. Following incubation of the radiolabeled
proteins with the Abs, the reaction mixtures will be
electrophoresed. Autoradiography will permit products to be
visualized as smaller-sized bands (mass of intact thyroglobulin
(monomer), lysozyme and IgG: 330 kD, 15 kD and 150 kD,
respectively). VIP cleavage is measured as the amount of
radioactivity rendered soluble in TCA or by RP-HPLC separations
[2]. Cleavage of substrates containing MCA linked to charged (Arg,
Lys, Asp), uncharged (Leu, Ala) and bulky (Phe) amino acids is
measured by fluorimetry.
[0118] Isolation of Specific EGFR Cleaving Catalysts from Mice
Immunized with a Covalently Reactive Antigen Analog of an EGFR
Peptide
[0119] As mentioned previously, catalytic Ab synthesis is increased
in autoimmune disease. To derive high efficiency catalysts, the
immune system will be further challenged via the immunization with
a covalently reactive antigen analog, CRAA, of an EGFR peptide
(CRAA-EGFR). This antigen analog is designed to increase the
recruitment of the germline V gene encoded site for the synthesis
of the EGFR-specific catalytic Abs. Further, the CRAA-EGFR will
also select for any serine protease-like catalytic sites formed by
somatic means, i.e., V/D/J rearrangement and somatic
hypermutation.
[0120] The key structural features of the CRAA-EGFR are: (a) the
tetrahedral, electrophilic phosphorous atom capable of binding
nucleophilic serine residues in catalytic Abs; and (b) the lysine
residue on the N-terminal side of the phosphorous atom capable of
binding catalytic sites specialized for cleavage on the C terminal
side of basic residues; and (c) ten and seven amino acids,
respectively, on the N and C terminal sides of the CRAA structure,
corresponding to the sequence of residues 294-310 of EGFR.
[0121] The phosphorous atom serves as the analog of the scissile
peptide bond carbon atom linking residues 303 and 304 in EGFR. In
the phenylester configuration shown in FIG. 4, the phosphorous atom
acquires a partial positive charge, just as the scissile bond
carbon atom carries the partial positive charge required for its
reaction with nucleophilic serine residues. Peptidic
O-phenylphosphonates have previously been described to be capable
of irreversibly inactivating various serine proteases by forming a
covalent bond with the oxygen atom of the active site serine
residue [29]. Sampson and Bartlett [23] have established the
chemical synthesis protocol to prepare the phenyl ester at the
phosphorous atom, and to attach peptide sequences flanking the
phosphonate ester.
[0122] It should be noted that the CRAA-EGFR described above is
distinct from previous phosphonate TSAs applied to raise esterase
Abs [13]. The conventional phosphonate TSAs contain an anionic
oxygen attached to the phosphorous, which can bind the oxyanion
hole found in the catalysts. The phosphonate TSAs, however, do not
react with nucleophilic serine residues in the catalytic site.
[0123] A basic residue is incorporated at the P1 position of the
CRAA-EGFR to exploit the existence of the germline encoded, basic
residue-specific catalytic site in Abs. The presence of the basic
residue, along with the phosphonate phenylester structure, promotes
tight binding to catalytic site, and thus promotes the ability of
the CRAA-EGFR to selectively stimulate the clonal proliferation of
B cells synthesizing the catalytic sites.
[0124] EGFR residues 294-310 are incorporated in the CRAA-EGFR to
promote synthesis of Abs with EGFR-specific catalytic activity, as
opposed to nonspecific catalytic activity. This epitope has been
selected because it is a component of domain III of EGFR, which is
the main contributor of the residues constituting the EGF binding
site [30]. See FIG. 4. Further, insertional mutagenesis at the N
terminal region of this sequence is described to result in reduced
EGF binding. As discussed previously, the EGF binding site is
composed of non-contiguous residues. Thus, conformational
disruptions caused by the intended cleavage at position 303-304
could also indirectly result in impaired EGFR function.
[0125] Fv phage display libraries will be prepared from MRL/lpr
mice hyperimmunized with the CRAA-EGFR. The presence of high
affinity serum Abs capable of binding the CRAA-EGFR will be
measured by ELISA to confirm that the mice mount a vigorous Ab
response. Fv library preparation and selection will be essentially
as described [25] except that selection of phages will be carried
out using the immobilized CRAA-EGFR. Screening for catalytic
activity will be done as described hereinabove. The substrate will
be an 18 residue peptide containing a tyrosine residue at the N
terminus followed by 17 residues corresponding to positions 294-310
of EGFR. The tyrosine residue is located distant from the intended
cleavage site to minimize interference with Fv recognition. In
addition, screening for exEGFR cleavage will be performed using the
conformational epitope of residues 294-310 as presented in the
functional EGFR protein.
[0126] The binding affinity of the catalysts for CRAA-EGFR will be
determined by ELISA. Inhibition of EGFR(294-310) cleavage by
increasing concentrations of the CRAA-EGFR will be determined. The
CRAA-EGFR will serve as a competitive alternate substrate, with Ki
values close to the Kd values estimated from the binding assay.
[0127] The product fragments generated by cleavage of EGFR(294-310)
and of exEGFR will be identified, permitting deduction of the
cleavage site(s). If the recruitment of the catalytic activity
occurs mainly because of the phenylphosphonate ester structure in
the CRAA-EGFR, both substrates ought to be cleaved mainly at the
peptide bond linking residues 303 and 304 (Lys-Lys bond). As
discussed above, antigen specific catalysts can be synthesized by
immunization with ground state antigens. Thus, catalysts capable of
cleaving EGFR(294-310) at peptide bonds other the 303-304 bond
should also be identified. One possible target for cleavage is
found at the Arg300-Lys301 bond, as the germline encoded activity
present in the preimmune repertoire recognizes basic residues.
[0128] The methods described above provide a series of high
affinity, high turnover catalytic Abs that recognize and cleave
EGFR at residues 303-304, and induce the loss of the EGF binding
activity. Inclusion of EGFR residues 294-310 in the immunogen is
ensures recruitment of high affinity Abs for EGFR. Inclusion of the
phenylphosphonate ester structure induces clonal selection of Abs
with a structurally optimized serine protease catalytic site.
Therefore, catalysts superior to those generated in MRL/lpr mice
will be synthesized by implementing the EGFR-CRAA strategy outlined
here.
[0129] Biodistribution and Anti-Tumor Effects In Vivo
[0130] To assess biodistribution and growth effects in vivo,
athymic mice bearing human tumors have been used as a model to
study the tumor localization and anti-tumor effects of various
drugs, toxins and Abs. The biodistribution of the six most
promising catalytic Fv constructs, along with a noncatalytic Fv
construct in tumor bearing mice will be compared. The ability of
the .sup.125I-radiolabeled Fv constructs to bind and cleave the
target antigen will be established in preliminary studies. The
tissue-to-blood and tumor-to-blood ratios of the Fv constructs will
be calculated. Imaging studies will be carried to out further
evaluate the tumor specificity of the Fv preparations. The presence
of the catalytic function in the Fv constructs might lead to their
increased dissociation from the surface of tumor cells, because the
product fragments of the target antigen will likely bind the
catalyst weakly compared to the intact antigen. This might result
in lower tumor:blood ratios for the catalysts compared to the
noncatalytic Fv. On the other hand, if the rate of internalization
of the Fv into tumor cells is very rapid, the catalytic function
may not influence the biodistribution pattern of the Fv.
Autoradiography of tumor sections will be performed to determine
the extent to which the Fv constructs are internalized by the tumor
cells.
[0131] Target antigen cleaving catalysts with favorable
biodistribution profiles, along with a non-catalytic Fv and an
irrelevant FV, will be evaluated for their ability to inhibit the
growth of tumor cells in athymic mice. The time to tumor formation
(latent period), the number of mice developing tumors, and the size
of tumors will be noted. Tumor growth is determined by the relative
rates of cell proliferation and cell death. Apoptosis and necrosis
are the distinct processes in cell death. EGFR is thought to be an
important regulator of apoptotic cell death. It is possible that
treatment with the catalytic Fv constructs may result in complete
regression of the tumor, because the cells might be freed from
negative regulation of apoptosis by EGFR. Cryostat sections of the
tumors recovered from the animals will be examined by
immunohistochemical methods for markers of proliferation and
apoptosis, i.e., ki-67, bcl2 and bax. ki-67 is a proliferation
associated antigen present throughout the cell cycle and is a
reliable marker for evaluating the growing fraction of a tumor cell
population. The bcl-2 and bax markers will help assess whether the
cells are destined to undergo death via apoptosis.
[0132] In summary, the catalytic antibodes of the present invention
represent a beneficial therapeutic reagent for the treatment of
neoplastic disorders.
EXAMPLE IB
[0133] Administration of Catalytic Antibodies and Antisense p53 in
Combined Chemotherapy Protocol.
[0134] When a cell suffers damage to its genome there are
mechanisms in place in the cell that will determine if the cell
will attempt repair itself or if it will undergo programmed cell
death. In order for proliferating cells to effectively undertake
genomic repair, they must be taken out of cycle. This is achieved
by means of the so-called "cell cycle checkpoints" which allow
proliferating cells time to repair genomic damage rather than
passing it on to daughter cells.
[0135] FIG. 18 illustrates the central role of normal (wild-type)
p53 in inducing one or the other of these two possible responses of
cells to genomic damage. Damage to the genome leads to an increased
expression of p53 which, in turn, sets in motion a variety of other
events that produce the specific cellular response to this
damage.
[0136] Based on these relationships, certain agents that inhibit
p53 function, such as p53 oligos or p53 catalytic antibodies
prepared according to the present invention and used incombination
with a methods that provide for getting antibodies or antibody
fragments accross the cell membrane, can reasonably be expected to
both block programmed cell death and prevent the activation of cell
cycle checkpoints depending on which event would naturally occur.
Attempts to block either of these cellular responses by using
inhibitors that act upstream or downstream of p53 are problematic
because of the multiplicity of factors involved, FIG. 18.
[0137] These important realizations form the scientific basis for
proposed therapeutic uses of p53 oligos and catalytic antibodies to
treat cancer, ischemia-reperfusion injury, and septic
shock/SIRS.
[0138] Description of the Cellular Mechanisms
[0139] During cell division three fundamental processes must be
coordinated and any associated errors repaired: (1) the centrosomes
must be duplicated and then segregated; (2) the mitotic spindle
must be formed, attached to the chromosomes, and primed for
elongation and sister chromatid separation at anaphase; and (3) the
DNA must be replicated and the chromosomes condensed and then
segregated by the mitotic spindle to opposing sides of the cell
which shortly will become daughter cells.
[0140] A surveillance system is in place that interrupts cell
division by means of checkpoints when it detects damage or
potential damage to the genome, including any damage incurred
during the natural processes just described. Hartwell and Weinhert
operationally defined a cell cycle checkpoint as follows: When the
occurrence of cell cycle event B is dependent upon the completion
of a prior cell cycle event A, that dependence is due to a
checkpoint if a loss-of-function mutation can be found that
relieves the dependence.
[0141] This operational definition has been rigorously demonstrated
in studies of yeast cells where three checkpoints have been
described: the DNA damage, spindle and spindle pole body
(centrosome equivalent) checkpoints. The DNA damage checkpoint acts
at three different positions in the cell cycle to arrest
proliferation when damage is detected: the G1/S and G2/M
transitions, and another that monitors progression through S.
Genetic studies have identified many of the checkpoint components
in yeasts but the proteins involved have proven to be functionally
pleiotropic, making it difficult to establish simple
cause-and-effect relationships. As pointed out by Paulovich et al.
(1997), for example, genes required for the DNA damage checkpoint
are also involved in DNA repair, programmed cell death and
transcriptional regulation. Results of yeast studies were
subsequently extrapolated to mammalian cells where homologous
components were found (Hartwell et al. 1994).
[0142] Many of the genes necessary for cell cycle arrest at one
checkpoint are also necessary in one or both of the other two. p53,
for example, has been shown to play a key role in all three (Cross
et al. 1995; Fukasawa et al. 1996; Levine 1997). The critical role
of p53 in instigating cell cycle arrest at the G1/S transition in
response to DNA damage was first demonstrated by Kastan and his
colleagues (1991) and has since been extensively researched.
Kastan's group examined the human ML-1 myeloblastic leukemia cell
line that appears to express wild-type p53 (exons 5 through 9 were
sequenced and shown to be normal). As is true for normal cells,
treatment of these leukemic cells with nonlethal doses of
.gamma.-irradiation or actinomycin D caused both G1/S and G2/M
arrest. In ML-1 cells, G1/S arrest was associated with a transient
3- to 5-fold increase in p53 levels that proceeded cell cycle
arrest. Caffeine treatment was found to block both induction of p53
expression and G1/S cell cycle arrest, suggesting that p53 might
play role in G1/S arrest in response to DNA damage. In keeping with
this hypothesis, cells lacking wild-type p53 did not show a G1/S
arrest following .gamma.-irradiation. In a subsequent study,
Kastan's group used solid tumor cell lines to strengthen their
hypothesis (Kuerbitz et al. 1992). Introducing wild-type p53
expression under the control of an inducible promotor in a cancer
cell line lacking p53 expression allowed cells to undergo a G1/S
cell cycle arrest following .gamma.-irradiation. It has
additionally been shown that agents causing DNA strand breaks
induce p53 and cycle arrest but that agents such as
anti-metabolites, which are simply incorporated into DNA, do not
(Nelson & Kastan 1994).
[0143] The work of Kastan's group and others have made it clear
that a medically important group of agents can cause the production
of reactive oxygen species (ROS) leading to the activation of
p53-dependent processes by causing DNA strand breaks. These agents
include a variety of anticancer treatments such as ionizing
radiation and doxorubicin, as well as natural mediators including
nitric oxide.
[0144] The effects of mitotic spindle inhibitors have been studied,
including certain cancer chemotherapeutic agents, on cells taken
from mice having a p53 genetic knockout. Following treatment, cells
became tetraploid or octaploid as a result of undergoing multiple
rounds of DNA synthesis without completing chromosome segregation.
In contrast, normal mouse cells underwent a G2/M cell cycle arrest
following treatment. In the absence of spindle inhibitors, 50% of
the cells from p53 knockout mice, but not normal mice, became
tetraploid by passage 7. Examination of the tissues of the p53
knockout mice also revealed the presence of tetraploid cells,
demonstrating that the results obtained in in vitro studies with
cells from these mice were not a culture artifact. These
observations confirm earlier reports that show a correlation
between loss or inactivation of p53 and tetraploidy or
aneuploidy.
[0145] Similarly, Fuksaswa et al. (1996) demonstrated that cells
from p53 knockout mice produce abnormal numbers of centrosomes.
This appears to explain why cultured cells from p53 knockout mice
become increasingly aneuploid in culture when, during the same time
period, cells from mice with intact p53 remain diploid. Brown et
al. (1994) found that p53 copurifies with centrosomes isolated from
cultured cells, suggesting a possible direct role for p53 in
regulating these organelles.
[0146] As shown in FIG. 18, p21 is a key mediator of p53-dependent
cell cycle arrest in response to genomic damage. p21 binds to a
number of cyclin and cyclin-dependent kinase (cdk) complexes as
well as to the proliferating cell nuclear antigen (PCNA). Normal
levels of p21 appear to be necessary for the formation of
cyclin-cdk complexes which, in turn, are necessary for cell cycle
progression (El-Deiry et al. 1993). Increased levels of p21
resulting from p53 activation, however, block cell cycle
progression by interfering with the functions of these complexes
and with PCNA. In at least some situations, another gene that is
up-regulated by p53 in response to genomic damage, GADD45, also can
institute cell cycle arrest at the G1/S transition point (Marhin et
al. 1997).
[0147] Alternatively, genomic damage can lead to a p53-dependent
induction of programmed cell death instead of cell cycle arrest and
repair. Clarke et al. (1993), for example, have shown that
thymocytes taken from mice constitutively homozygous for a deletion
in the p53 gene are resistant to the induction of programmed cell
death by .gamma.-irradiation or etoposide, but not by
glucocorticoid or calcium. Mice heterozygous for p53 deletion were
also relatively resistant to agents that cause DNA strand breaks,
but less so than the homozygots. In contrast, thymocytes from mice
with intact p53 underwent programmed cell death in response to all
of these treatments.
[0148] Cancer cells that do not express wild-type p53 are often
found to undergo programmed cell death if expression of the protein
is experimentally introduced. This has provided a model system for
attempts to arrive at a mechanistic explanation of how p53 can
induce programmed cell death. It must be kept in mind, however,
that the use of cell lines that have eliminated wild-type p53
function and have subsequently had wild-type p53 constitutively
expressed experimentally to create a model for analyzing endogenous
wild-type p53 functions may result in misleading conclusions.
[0149] Johnson et al. (1996) first demonstrated that ROS can
function as downstream mediators of p53-dependent programmed cell
death. They produced high level human wild-type p53 expression in
cultured human or rat smooth muscle cells (SMC) using adenoviral
vectors carrying human p53 cDNA under the control of a strong
promoter. p53 was expressed in both cell types at equivalent
levels, but only in the human cells was programmed cell death
induced. Within eight days of infection, essentially all of the
human SMC over-expressing p53 were found to be dead. Kinetic
studies documented increased levels of p53 and ROS in the SMC four
hours following infection with the p53-carrying virus. Three
unrelated antioxidants were shown to block ROS production but not
p53 over-expression and to block the induction of programmed cell
death. It was concluded that increased expression of p53 is
sufficient to induce programmed cell death in at least some normal
cell types, and that ROS are a downstream mediator of this
induction.
[0150] Vogelstein's group (Polyak et al. 1997) used an adenoviral
vector to cause the expression of wild-type p53 in human DLD-1
colon cancer cells that had inactive endogenous p53 genes. RNA was
purified from these cells 16 hours after viral infection and 8
hours before evidence of programmed cell death. Analysis was
conducted using the SAGE technique which allowed the quantitative
evaluation of cellular mRNA populations. Approximately 8,000
transcripts were identified. Of these, 14 were markedly (greater
than 10-fold) and 26 were significantly more abundant in the cells
expressing p53. Thirteen of the 14 most highly induced genes were
identified and several were found to encode proteins that affect
the redox status of cells.
[0151] The group hypothesized that p53 might induce programmed cell
death by stimulating the production of ROS. Using a fluorescent
probe to measure intracellular ROS levels, the investigators found
that ROS production was induced following infection with the
p53-carrying virus, and that the levels of ROS continued to
increase as programmed cell death progressed. Treatment of DLD-1
cells with the powerful oxidant menadione or hydrogen peroxide only
induced the expression of one of the 14 genes, p21, demonstrating
that this group of genes was not induced simply as a result of ROS
expression. Neither were these genes induced as the result of
treating the cells with indomethacin or ceramide, two agents that
can induce programmed cell death in the absence of p53
expression.
[0152] Time course experiments suggested a sequence of events
during which p53 transcriptionally activates redox-controlling
genes, causing ROS production that results in oxidative damage to
mitochondria and, in turn, cell death. Inhibition of each of these
steps with specific pharmacologic agents demonstrated a
cause-and-effect relationship between sequential events.
[0153] These findings suggest the following three-step model for
p53-induced programmed cell death in DLD-1 cells: (1) p53
transcriptionally activates a specific subset of genes that include
oxidoreductases; (2) the induced proteins collectively cause an
increase in ROS levels; and (3) ROS damages mitochondria, causing
leakage of calcium and other components. These components stimulate
members of the ICE-like enzyme family that are consistently
involved in the terminal events of programmed cell death.
[0154] There also appears to be some variability among different
cell types in terms of the genes that are transcriptionally
up-regulated by wild-type p53 in response to genomic damage. Two of
these are Bax, a member of the BCL-2 family that has been shown to
sometimes be involved in the p53-dependent induction of programmed
cell death, and GADD45, the product of which binds to PCNA and
thereby can cause a cell cycle checkpoint arrest. McCurrach et al.
(1997), for example, found that in primary fibroblasts, Bax is one
of the effectors of wild-type p53-dependent programmed cell death
induced by chemotherapy. In this study, wild-type p53 was found to
transcriptionally activate Bax. Neither Bax nor GADD45, however,
were among the genes found to be induced by wild-type p53 in the
previously discussed study by Polyak et al. (1997). The potential
importance of Bax in the induction of programmed cell death in
response to cellular damage caused by chemotherapy has been
demonstrated in work by Strobel et al. (1996). This group
transfected an expression vector carrying the Bax cDNA into the
SW626 ovarian cancer cell line that lacks functional p53.
Transfectants showed a mean 10-fold increase in Bax expression
compared to control cells. The threshold for the induction of
programmed cell death following chemotherapy treatment was
substantially reduced in the Bax transfectants when the
chemotherapeutic agent was paclitaxel, vincristine or doxorubicin,
but not when the agent was carboplatin, etoposide or
hydroxyurea.
[0155] Additional studies involving cancer cell lines that express
wild-type p53 and undergo either proliferation arrest or programmed
cell death following treatment with doxorubicin, show that most of
the same 14 genes that were highly induced in DLD-1 cells following
the introduction of p53, were up-regulated both at lower doses of
the drug, which caused cell cycle arrest, and at higher doses,
which caused programmed cell death (Polyak et al. 1997). The
authors speculated that the critical factor in determining whether
a cell undergoes cycle arrest or programmed cell death is the
ability of that cell to cope with oxidative stress. In other words,
cells with a low capacity to handle oxidative stress undergo
programmed cell death while more resistant cells undergo cycle
arrest.
[0156] The level of oxidative stress that cells are experiencing
has been positively correlated with their tendency to undergo
p53-dependent programmed cell death rather than cell cycle arrest
and repair following genomic damage. Lotem et al. (1996) studied
the effects of oxidative stress and cytokines on these phenomena in
myeloid leukemia cells. Antioxidants and certain cytokines
exhibited a cooperative protection of these cells against
programmed cell death induced by cytotoxic compounds. Increasing
oxidative stress with hydrogen peroxide treatment, however,
augmented the occurrence of the cell death program and increased
the level of protective cytokine treatment needed to prevent
programmed cell death.
[0157] Salicylates are known to inhibit the activation of protein
kinases and transcription factors involved in stress responses.
Chernov and Stark (1997) found that salicylate reversibly inhibits
wild-type p53 from binding to DNA and consequently inhibits the
ability of p53 to induce p21 transcription and programmed cell
death following treatment with toxorubicin or radiation. If the
salicylate is washed out within 60 hours of the DNA damage, the
inhibited p53-dependent events are able to go on to completion.
[0158] One factor that in some circumstances influences whether
wild-type p53 induces cell cycle arrest or programmed cell death
following genomic damage is c-myc. Saito and Ogawa (1995) studied
the rat hepatocellular carcinoma cell line, FAA-HTC1, that
constitutively expresses c-myc and does not express p53. c-myc
expression in these cells was effectively suppressed by an
antisense L CHK2HRoligonucleotide. Wild-type p53 expression was
achieved by transfecting a dexamethasone-inducible expression
vector carrying wild-type p53 cDNA into these cells. The results
showed that wild-type p53 can act in the same cells as either an
inducer of cell cycle arrest or as an inducer of programmed cell
death depending on the status of c-myc. Wild-type p53 expression
resulted in the induction of programmed cell death in a portion of
the cells, but did not inhibit the proliferation of surviving
cells. If c-myc expression was inhibited, wild-type p53 expression
caused an inhibition of cell proliferation but did not induce
programmed cell death. Unregulated expression of c-myc has also
been shown by others to be capable of inducing programmed cell
death (Evan et al. 1992; Hoang et al. 1994; Lotem & Sachs
1993).
[0159] Additional studies have shown that wild-type p53 may in some
circumstances induce programmed cell death without first causing
the expression of other genes. In these situations, wild-type
p53-dependent programmed cell death occurs in the presence of
actinomycin D or cycloheximide, which block RNA and protein
synthesis respectively (Caelles et al. 1994). The introduction into
Hela cells of a p53 expression vector that lacks the terminal p53
amino acid residues required for p53 binding to DNA, for example,
has been shown to produce p53-dependent programmed cell death
(Haupt et al. 1995). That this observation supports the
non-involvement of p53 in transcription assumes without adequate
justification, however, that the only way p53 can affect
transcription is by directly binding to the regulatory elements of
genes themselves. These and similar findings (Sabbatini et al.
1995) have been used to support the argument that p53 can induce
programmed cell death without affecting transcription.
[0160] It is probable, therefore, that wild-type p53 may induce
programmed cell death by means of transcriptionally activating
specific sets of genes, by direct protein-protein interactions or
by a combination of these methods. The induction of programmed cell
death, however, does not necessarily require the expression of
wild-type p53. This is clear from the observation that p53-knockout
mice develop normally as well as the fact that cells lacking
wild-type p53 can be induced to undergo programmed cell death
(Clarke et al. 1993).
[0161] As shown in FIG. 18, the multiple pathways that can initiate
programmed cell death converge to utilize a common terminal phase
involving the interleukin 1-beta-converting enzyme (ICE-like)
family. This enzyme family is currently known to contain 11 members
and can be divided into three subfamilies: the ICE, CPP32, and
Ich-1 subfamily called caspases (Boldin et al. 1996; Chinnaiyan et
al. 1996; Duan et al. 1996a & 1996b; Fernandes-Alnemri et al.
1996; Lin & Benchimol 1995; Lippke et al. 1996; Muzio et al.
1996; Wang et al. 1996). Sabbatini et al. (1997), for example,
specifically studied the role of ICE family enzymes in the
occurrence of p53-dependent programmed cell death. They
demonstrated that a peptide inhibitor of the ICE-like protease
CPP32 inhibited the cell death program in baby rat kidney cell
lines induced by experimentally expressing wild-type p53 in these
cells.
[0162] It also appears that wild-type p53 can potentiate the
ability of ICE family enzymes to cause programmed cell death (Jung
& Yuan 1997). For example, inactivating wild-type p53 function
in COS-1 cells keeps them from undergoing programmed cell death
when they are transfected with an expression vector carrying the
cDNA for an ICE-like enzyme, while transfecting normal COS-1 cells
causes them to undergo the death program. Expression vectors
carrying either an ICE-like enzyme or a temperature-sensitive p53
mutant were both transfected into COS-1 cells with inactive
endogenous wild-type p53. At the temperature permissive for
wild-type p53 function, the ability of the ICE-like enzyme to cause
programmed cell death was significantly augmented. Additional
experimentation showed that the ability of wild-type p53 to
potentiate the induction of programmed cell death by the enzyme was
mediated by Bax.
[0163] OL(1)p53 for the Treatment of Cancer
[0164] All cancer treatments in clinical use kill cancer cells by
inducing programmed cell death in a dose-dependent manner. In some
instances induction of this program has been shown to be wild-type
p53-dependent. At lower doses, many agents that cause genomic
damage effect the induction of a checkpoint in cells with wild-type
p53. The checkpoint temporarily arrests cell proliferation,
providing time for the damaged cells to repair.
[0165] Recent studies by investigators who have not been involved
in the development of OL(1)p53 provide a rationale for why
inhibiting wild-type p53 expression can enhance the killing effect
of many anticancer treatments on comparable cancer cells with an
intact wild-type p53-dependent cell cycle checkpoint. Evidence
shows that when the cell cycle checkpoint fails to engage following
therapeutic damage to the genome, cancer cells continue to
replicate their DNA in the absence of mitosis leading to the
induction of programmed cell death. The therapeutically important
result is that, in the context of a blocked checkpoint, anticancer
treatments become much more effective in killing cancer cells.
[0166] In some studies, engagement of the checkpoint was prevented
by genetically knocking out the expression of wild-type p53 or one
of its downstream effectors, particularly p21. Given the
irreversible nature of these interruptions, it is clear that
wild-type p53 is not required for the induction of programmed cell
death under these circumstances. In other experiments,
methylxanthine derivatives such as pentoxifylline or the protein
kinase C inhibitor UCN-01 (7-hydroxystaurosporine), both of which
inhibit G2 checkpoint function, were shown to synergize with agents
that interrupt the wild-type p53 pathway in further boosting the
sensitivity of cancer cells to anticancer agents.
[0167] Consistent with this role of wild-type p53, p53 oligos and
OL(1)p53 in particular can synergistically boost the ability of
genome-damaging agents to kill cancer cells. Further, at doses
optimum for causing a maximal lethal effect on cancer cells, the
combination of OL(1)p53 and an anticancer agent did not kill tested
normal cell types.
[0168] When phosphorothioate oligos such as OL(1)p53 or natural
phosphodiester oligos bind to cells, they induce the cells to
increase their production of free oxygen radicals by a
cyclo-oxygenase-dependent mechanism. The effect is much more
pronounced in ordinary cell cultures carried out in 20%
(atmospheric) oxygen than at reduced oxygen tensions. These free
radicals can cause genomic damage, and this phenomenon may explain
why OL(1)p53 kills cancer cells in ordinary tissue culture without
the necessity of adding a compound capable of causing genomic
damage, such as a cancer chemotherapeutic agent, and why OL(1)p53
does not kill cancer cells cultured under oxygen levels similar to
those found in the body unless a genomic damaging agent is added.
Cancer cells pretreated with oligos such as OL(1)p53 can be killed
with doses of genome-damaging agents which are not cytotoxic to the
cells in the absence of the p53 oligo. Presumably this synergy can
be even further enhanced by G2 inhibitors, such as pentoxifylline
or UCN-01, that are more effective when used to treat cancer cells
with compromised wild-type p53 function than those with intact p53
function.
[0169] Since phosphorothioates are DNA analogs, it is possible that
cancer chemotherapeutic agents with an affinity for DNA would bind
to them. This notion was tested using OL(1)p53, which was shown to
tightly bind mitoxantrone but not idarubicin or daunorubicin. The
interaction between mitoxantrone and the oligo substantially
reduced the toxic effects of the chemotherapeutic agent on cancer
cells that did not express wild-type p53.
[0170] In another study of oligo-drug interactions, bioactive
metabolites of acetaminophen known to react with sulfur groups were
shown to bind to phosphorothioate oligos including OL(1)p53. This
interaction may inactivate OL(1)p53 and should be determined prior
to further clinical testing.
[0171] Pharmacology and toxicology studies carried out in several
species, including Rhesus monkeys, demonstrate that OL(1)p53 has
pharmacokinetic properties favorable for its use as a systemic
therapeutic agent and that the oligo is non-toxic even at dose
levels well above the expected therapeutic level. Sequencing and
cell culture studies suggest that OL(1)p53 suppresses p53
expression in monkey cells as it does in human cells. The oligo,
however, does not have any specific effects on cells or tissues
from lower animals.
[0172] A Phase I clinical trial of OL(1)p53 as a single agent was
carried out in patients with acute myelogenous leukemia or the
myelodysplastic syndrome. The oligo was given by continuous
infusion over 10 days, and results showed the oligo to be nontoxic
over a dose range predicted to yield therapeutic levels. No
complete responses were seen.
[0173] Malignant cells taken from the patients just prior to the
start of OL(1)p53 administration and at various times during the
infusion were put in culture under 20% oxygen. Compared to
peripheral leukemic blast cells from the untreated patients, those
taken after the start of OL(1)p53 infusion died more rapidly as a
function of the amount of OL(1)p53 infused into the patient.
Similarly, long-term bone marrow cultures set up from leukemia or
myelodysplasia patients demonstrated a substantially reduced
capacity to generate malignant cells as a function of the amount of
OL(1)p53 infused into the donor. This suppression lasted for many
months following treatment without any evidence that the effect was
reversible.
[0174] The OL(1)p53 clinical trial results are consistent with
laboratory data that strongly suggest that the oligo must be used
in conjunction with genomic damaging anticancer agents in order to
be active in patients. Interpretation of cell culture data using
cells from patients in the trial is also consistent with this
hypothesis. When cancer cells were placed in culture under 20%
oxygen, the oligo induced these cells to produce ROS which served
as the genomic damaging agent.
[0175] It follows from the above discussion that blocking p53
expression, with a p53 oligo for example, can result in the
prevention of (1) cell cycle arrest, allowing time for an attempt
at repair, and
[0176] (2) p53-dependent programmed cell death. Since many cancer
therapies cause genomic damage, they can also be expected to cause
the induction of wild-type p53 in those cancer cells that express
it. Indeed, x-irradiation, topoisomerase inhibitors, alkylating
agents, anthracyclines, spindle poisons and certain antimetabolites
are all known to produce p53-dependent cell cycle arrest (Cross et
al. 1995; Kastan et al. 1991; Linke et al. 1996; Tishler et al.
1995). Inhibition of such induction of wild-type p53 should
increase the toxicity of these anticancer therapies to
proliferating cancer cells by allowing the damaged genome to be
replicated, resulting in the production of dysfunctional cells and
inducing programmed cell death as well.
[0177] A series of publications that address this issue have come
from the laboratories of collaborating investigators at Johns
Hopkins and the University of Pennsylvania (McDonald et al. 1996;
Waldman et al. 1996 & 1997). Isogenic human colon cancer cell
lines were used in these studies, differing only in their p21
status. The p21-/- cells were produced from the p21+/+ cells using
homologous recombination. Normally, the induction of p53 by genomic
damage leads to induction of p21 by the p53 acting as a
transcription factor in directly binding to the p21 gene. Newly
synthesized p21 then binds to and blocks the function of proteins
required for cell cycle progression, FIG. 18.
[0178] The first of these studies (McDonald et al. 1996) sought to
determine if p21-/- HCT116 human colon cancer cells had DNA repair
defects when compared to p21+/+ HCT116 cells (both HCT116 clones
have wild-type p53). The p21-deficient clone was found to be two to
three times more sensitive to UV damage than the p21-expressing
cells when judged by clonogenic survival assays. Further, p21-/-
cancer cells had a two- to three-fold increased frequency of
spontaneously arising 6-TG-resistant colonies indicative of hprt
gene inactivation by mutation compared to cells with intact p21
function. These data suggest that the loss of p21 function is
associated with reduction in the ability of cells to repair DNA
damage.
[0179] To further test this concept, investigators transfected an
expression vector into p21+/+ or -/- HCT116 human colon cancer
cells. The vector consisted of a beta-galactosidase cDNA driven by
a cytomegalovirus reporter, and was purposely damaged prior to
transfection using either UV irradiation or a cis-platinum
anticancer agent. HCT116 cells lacking p21 were found to be three-
to five-fold less efficient at repairing the damaged expression
vector compared to p21+/+ HCT116 cells. Transfection of an
expression vector carrying p21 cDNA into the p21-/- HCT116 cells
increased their repair capacity two- to three-fold. It was
concluded that agents which inhibit p21 interaction with PCNA, and
thus prevent cell cycle arrest in response to DNA damage, may have
synergistic cytotoxic interactions with classical anticancer agents
that cause DNA damage.
[0180] In a subsequent study, investigators examined the effects of
certain genomic damaging agents on p21+/+ and -/- HCT116 cells
(Waldman et al. 1996). Agents included the cancer therapeutics
doxorubicin, etoposide and .gamma.-irradiation as well as the
topoisomerase-1 inhibitor camptothecan. Each was shown to be
capable of completely killing cultures of the p21-/- cells within
90 hours of treatment by inducing programmed cell death at
concentrations causing p21+/+ cells to undergo a prolonged cell
cycle arrest but not cell death. Analysis of the p21-/- cells
showed that, following treatment, the cells were briefly blocked in
G2 but not G1 and then began multiple rounds of DNA synthesis in
the absence of mitosis, and that the resulting hyperdiploid cells
with abnormal nuclear morphology subsequently underwent programmed
cell death.
[0181] A similar set of experiments was conducted using the DLD-1
human colon cancer cell line which, unlike the HCT116 line, has
mutated p53 but resembles the HCT116 line in being diploid. The
authors reasoned that p53 mutant cells would not express p21
following DNA damage and would be functionally equivalent to p21-/-
cells. As predicted, DLD-1 cells expressed little p21 after
treatment with doxorubicin or .gamma.-irradiation, and demonstrated
a checkpoint defect that resulted in the occurrence of essentially
the same set of morphologic/physiologic changes as in the HCT116
line that terminate in programmed cell death.
[0182] When these experiments were conducted using aneuploid human
colon cancer cell lines with mutant p53, the effects of treating
two of these lines with DNA-damaging agents were found to follow
the same pattern of events that lead to programmed cell death. In
the third line, pre-existing aneuploidy was sufficiently pronounced
to inhibit any firm conclusions about a significant increase in DNA
content prior to cell death. Waldman et al. concluded that
"detailed analyses demonstrated that the programmed cell death was
apparently induced by an uncoupling between mitosis and S phase
after DNA damage. Instead of undergoing coherent arrest, cells
without the p21-dependent checkpoint continued to undergo rounds of
DNA synthesis in the absence of mitosis, culminating in polyploidy
and programmed cell death" (p. 1034).
[0183] However, the authors failed to comment on an important point
demonstrated by their experiments. Several publications have
indicated that in cells with wild-type p53, programmed cell death
induced by many anticancer therapeutics is p53-dependent
(Dronehower et al. 1992; Lowe et al. 1993; Symonds et al. 1994).
Further, some cancer cells with wild-type p53 can be more sensitive
to chemotherapy than similar cells with mutated p53 (Aas et al.
1996; Lowe et al. 1993a & 1993b). Yet the finding that three
different colon cancer cell lines with mutated p53 underwent a
similar series of events leading to the induction of programmed
cell death, as in the HCT116 p21-/- cells, suggests that programmed
cell death as a result of replicating damaged DNA in the absence of
mitosis is wild-type p53-independent.
[0184] The HCT116 studies demonstrate that interruption of
p53/p21-dependent cell cycle arrest can lead to a lowering of the
threshold for programmed cell death induction by anticancer
treatments because programmed cell death is induced in p21-/- cells
at lower doses than is required for HCR116 cells that are p21+/+.
Since both the p21+/+ and p21-/- HCT116 cells express wild-type
p53, this induction could be p53-dependent. If based on a
p53-dependent programmed cell death mechanism, the threshold level
at which DNA or genomic damage induces programmed cell death might
be lower in cancer cells that express wild-type p53. In the absence
of wild-type p53, however, there could be a higher damage level
threshold for the induction of p53-independent programmed cell
death.
[0185] Because OL(1)p53 transiently inhibits the expression of p53,
treating cancer cells with this oligo plus conventional therapy can
cause both an interruption of cell cycle checkpoints during the
time p53 is suppressed, and p53-dependent programmed cell death
following the recovery of p53 expression. OL(1)p53, therefore,
should be more effective at sensitizing cancer cells expressing
wild-type p53 to anticancer therapies than the approaches just
described involving p53 or p21 genetic knockouts.
[0186] Experiments presented in the third monograph of this series
were designed to determine if inhibition of cell cycle checkpoints
would increase .gamma.-irradiation sensitivity of HCT116 human
colon cancer cells grown in immunocompromised animals (Waldman et
al. 1997). Xenograft tumors were established from p21+/+ and p21-/-
subclones of the cell line. In the absence of treatment, p21+/+ and
p21-/- tumors grew at almost identical rates. Twelve to 17 animals
per group with tumors of approximately 50 mm.sup.2 were then
treated with either 7.5 or 15 Gy of local .gamma.-irradiation and
subsequently measured biweekly. Radiation of animals with the
p21+/+ tumors resulted in no cures, and all of the p21+/+ tumors
continued to grow for several days following treatment. In
contrast, 18% and 38% of the p21-/- tumors (P<0.01 by chi-square
test) were cured by the .gamma.-irradiation as a function of dose
where a cure was defined as the absence of detectable tumor. p21-/-
tumors that were not cured showed substantial dose-dependent
decreases in size following treatment.
[0187] A second objective of this study was to determine the value
of clonogenic survival assays in evaluating cancer therapies
influenced by the p53 and/or p21 status of target cells. It was
found that the number of clones surviving .gamma.-irradiation were
few in number, but nearly equivalent when the p21+/+ and p21-/-
subclones of HCT116 were compared. The low colony number was
attributed to cell cycle arrest and programmed cell death
respectively. In the case of p21+/+ cells, but not p21-/-, the area
between surviving colonies consisted of a lawn of viable cells.
Investigators pointed out that this lawn of viable p21+/+ cells
functioned like a feeder cell layer such as is known to be
important in supporting the growth of clonogenic cells. They
further argued that the existence of this feeder layer in the
treated p21+/+ tumors and the lack of such a feeder cell population
in vivo could explain their animal data.
[0188] Another group also examined the effects of wild-type p53
and/or p21 disruption on the sensitivity of cancer cells to certain
cancer chemotherapeutic agents and ionizing radiation (Fan et al.
1995 & 1997). MCF-7 human breast cancer cells or HCT116 colon
cancer cells, both of which had wild-type p53, were either
transfected with a human papilloma virus type-16 E6 gene (MCF-7/E6
or HCT116/E6) or a dominant p53 mutant (MCF-7/mu-p53) to interrupt
the wild-type p53 function. Using a clonogenic survival assay, all
three subclones with inhibited wild-type p53 function, as well as
the HCT116 p21-/- cells, were shown to be significantly more
sensitive to cisplatin and nitrogen mustard than the corresponding
cells with intact wild-type p53 or p21 function.
[0189] All four of the subclones with disrupted wild-type p53 or
p21 function were found to be deficient in their ability to repair
transfected cisplatin-damaged CAT-reporter genes when compared to
the corresponding cells with intact wild-type p53 or p21 function.
Consequently, the investigators attributed the increased cisplatin
sensitivity of these cells to defects in G1 checkpoint control,
nucleotide excision repair, or both.
[0190] Like the Johns Hopkins group, Fan's group did not see a
significant difference in the clonogenic survival assay between
cells with intact wild-type p53 or p21 function and those without
it when ionizing radiation was used as the genomic damaging agent.
They apparently were not aware, however, of the shortcomings of
this assay as illuminated by the Johns Hopkins research team.
[0191] A survey of the p53 status and radiosensitivity of twenty
human squamous-cell carcinoma cell lines taken from patients with
head and neck cancers was conducted by Servomaa et al. (1996). p53
mutations and/or deletions were found in 15 of the lines. The "mean
inactivation dose" (AUC) was determined using a clonogenic survival
assay scored four weeks after radiation treatment. The results were
1.82.+-.0.24 Gy for the lines with mutated or absent p53 and
2.23.+-.0.15 Gy for the lines with wild-type p53 (P<0.01). The
authors concluded that the lines with no p53 expression were the
most radiosensitive.
[0192] The methylxanthine derivative pentoxifylline has been found
to be a G2 checkpoint inhibitor (Russell et al. 1996). It is a
relatively nontoxic compound given to patients with a variety of
disorders because of some of its other properties, which include
the ability to increase red blood cell flexibility (Ciocon et al.
1997). Pentoxifylline exhibited synergism with cisplatin in killing
cancer cell lines with interrupted wild-type p53 function or p21
deficiency without altering the sensitivity of control cells with
intact wild-type p53 and p21 (Pan et al. 1995). The drug was also
found to be much more effective at inhibiting the G2 checkpoint in
cells that had compromised wild-type p53 function.
[0193] Russell et al. (1996) inactivated p53 function in the human
A549 lung adenocarcinoma cell line by transducing the E6 gene from
HPV type 16. Using a clonogenic survival assay, they found that
both pentoxifylline and a novel methylxanthine, lisofylline, caused
a 15-fold sensitization of the E6 transduced cancer cells to
.gamma.-irradiation when compared to controls. Both agents were
shown to block the ability of radiation to induce G2 cell cycle
arrest, and lisofylline was found to block G1 arrest as well.
[0194] UCN-01 (7-hydroxystaurosporine) is a protein kinase C
inhibitor that can also block the G2 checkpoint. It has shown
anti-neoplastic activity against human tumors grown in rodents and
is currently in clinical trail for cancer treatment (Pollack et al.
1996). Wang et al. (1996) tested the ability of this agent to
influence the sensitivity to cisplatin of MCF-7 breast cancer cells
with wild-type p53 or p53 inactivated by transfection of an
expression vector carrying the HPV E6 gene. Drug sensitivity was
measured using both clonogenic survival and MTT assays and was
shown to be markedly enhanced by UCN-01 treatment in cells lacking
intact wild-type p53 function when compared to cells with
functional wild-type p53. As for the studies involving
pentoxifylline, UCN-01 was found to be much more effective in
blocking G2 arrest induced by genomic damage in cells where
wild-type p53 function had been eliminated than in those with
intact function.
[0195] Similarly, Shao et al. (1997) demonstrated that UCN-01 is
much more effective in boosting the cytotoxic effects of genomic
damaging agents on HCT116 colon and MCF-7 breast cancer cell lines
lacking wild-type p53 function as a result of experimental
manipulation compared to the same cells where this function is
intact.
[0196] Caffeine also blocks G2 cell cycle arrest in vitro, and
appears to operate by activating p34cdc2 kinase. Yao (1996a)
demonstrated that caffeine treatment selectively sensitizes tumor
cells deficient in wild-type p53 function to radiation-induced
programmed cell death. Thus it appears that for some cancers, the
use of OL(1)p53 plus a G2 checkpoint inhibitor might boost the
beneficial effects of conventional anticancer therapy to a greater
degree than OL(1)p53 alone.
[0197] Microtubule active agents induce a cell cycle checkpoint
that typically causes a G2 arrest. Several studies have implicated
wild-type p53 as playing a role in influencing the response of
cells to G2 active agents (Fan et al. 1995; Powell et al. 1995;
Russell et al. 1995). These findings led Tishler et al. (1995) to
examine the ability of the cancer chemotherapeutic agents taxol,
vinblastine and nocodazole to induce wild-type p53-dependent
processes in the pre-malignant embryonic mouse NIH-3T3 cell line.
All three microtubule active agents caused G2 cell cycle arrest and
increased p53-DNA binding. Only vinblastine and nocodazole were
shown to cause an increase in p21 transcription.
[0198] Wahl et al. (1996) extended these studies by looking at the
effects of interrupting wild-type p53 function on the sensitivity
of fibroblasts to taxol. Wild-type p53 function was disrupted in
normal human fibroblasts by transfecting them with expression
vectors carrying either the HPV E6 gene or the SV40 T antigen gene.
Fibroblasts also were taken from normal and p53 knockout mice.
Compromised p53 function in cells from either type correlated with
a seven- to nine-fold increase in taxol cytotoxicity compared to
controls. Taxol was shown to kill cells by inducing programmed cell
death independently of their p53 status. Cells with intact p53 that
survived taxol treatment showed increased levels of p21 and
underwent cell cycle arrest.
[0199] In response to genomic damage, wild-type p53 induces, in
addition to p21, a second gene GADD45 that also functions to induce
a cell cycle checkpoint by means of its inhibiting effect on PCNA.
Smith et al. (1996) blocked GADD45 expression in the RKO human
colon cancer cell line that expresses wild-type p53 by transfecting
it with an antisense vector. Reducing GADD45 levels sensitized the
cancer cells to the killing effects of UV irradiation and to
cisplatin treatment. In addition, cells in which GADD45 was
suppressed showed a reduced capacity to repair DNA damage as judged
by the use of UV-damaged reporter plasmids and unscheduled DNA
synthesis experiments. Expression vectors carrying a variety of
genes that disrupt wild-type p53 function were also transfected
into the RKO cells. Suppressing p53 function had the same effect on
DNA repair as suppressing GADD45 expression.
[0200] The existence of at least one additional p53-regulated gene,
GADD45, that can produce generally the same inductive effects as
p21 cell cycle checkpoints makes p53 a better target than p21 for
blocking checkpoint induction by genomic damaging agents.
[0201] According to the present invention, inhibitors of EGFR or
HER2 such as conventional monoclonal antibodies or preferably
catalytic antibodies generated according to the present invention
used in combination with p53 oligos such as OL(1)p53 and/or other
cell cycle checkpoint inhibitors such as UCN-01, p21 oligos or p27
oligos will be particularly well suited for use incombination with
conventional chemotherapy for the treatment of carcinomas that
express EGFR and/or HER2.
[0202] Mendelsohn and his coworkers have shown that blocking EGFR
function, for example with a monoclonal antibody, causes an
increased expression of p53 and p21 or p27/KIP1 resulting in the
induction of a cell cycle checkpoint (Wu et al. 1996; Peng et al.,
1996). The combined use of a EGFR inhibitor with a p53, p21, or p27
inhibitor such as an oligonucleotide or catalytic antibody will
prevent the cell cycle arrest and boost the anticancer effect of
the EGFR inhibitor particularly when used in combination with
conventional cancer therapy capable of causing genomic damage.
[0203] In addition the use of a p53 oligo, such as OL(1)p53, will
assist the inhibitory effect of other EGFR inhibitors because p53
transcriptionally acitvates the EGFR gene (Ludes-Meyers et al.,
1996; Sheikh et al., 1997).
[0204] (C) Combined Treatment of Patients with EGFR Catalytic
Antibodies and OL(1)p53
[0205] Treatment schedule would include the following aspects: (1)
A sample of the cancer will be taken to determine the mutational
status of the p53 gene. (2) Patients will be infused with 0.1
mg/kg/hr of the oligo for approximately five days and will receive
a bolus injection of the EGFR catalytic antibody iv at a dose in
the 1-50 mg range dependig to the turnover rate of the antibody.
(3) Conventional chemotherapy will be started 24 hours after
beginning the oligo infusion. The chemotherapeutic agent(s)
selected will be ones that do not bind to OL(1)p53 and which are
capable of causing genomic damage. Suitable oligos for this use are
described in U.S. Pat. No. 5,654,415, the disclosure of which is
incorporated by reference herein.
EXAMPLE II
Catalytic Antibodies in Vaccination Against HIV
[0206] A vaccine construct useful in the treatment of AIDS composed
of a model B cell epitope and a T helper epitope derived from gp120
is described herein. CRAAs of the B cell epitope will be designed
to elicit catalytic Abs. An exemplary B cell epitope is derived
from the CD4 binding site, which is generally conserved in
different HIV-1 strains. The CD4 binding site of gp120 is a
suitable target, further, because unlike many other epitopes, it is
accessible to Abs on the native viral surface [31]. It is known
that the CD4 binding site is a conformational determinant.
[0207] In the present invention, preparation of a catalytic Ab that
recognizes a specific portion of the CD4 binding site (as opposed
to the entire CD4 binding site) is described. Additional peptide
epitopes in gp120 (or other HIV proteins) that might be suitable
targets for catalytic Abs will also be identified. Because cleavage
of gp120 may lead to global changes in the protein conformation,
accompanied by loss of biological activity, certain gp120 peptide
epitopes may be appropriate targets of catalytic Abs even if they
do not participate directly in HIV-1 binding to host cells or HIV-1
interactions with intracellular components. These and other targets
are also contemplated to be within the scope of the present
invention.
[0208] T cell help for Ab synthesis is potentially subject to
restriction in different individuals due to MHC polymorphism. In
the present invention, mouse strains with well-defined genetic
backgrounds will be used as models for the elicitation of catalytic
immunity in response to B-T epitope conjugates. A "universal"
T-helper epitope recognized promiscuously by various MHC class II
alleles will be utilized. Another benefit of this approach is that
it is readily adaptable to human clinical trials.
[0209] The envelope glycoproteins of HIV-1 are synthesized as a
single 160 kD precursor, gp160. This protein is cleaved at the
Arg511-Ala512 bond by a cellular protease, producing gp120 and the
integral membrane protein gp41. The biological activity of gp120 is
a key ingredient in initial binding of host cells by HIV-1,
propagation of the virus, and its toxic effects on uninfected
neurons and other cells. Binding of a conformational epitope of
gp120 to CD4 receptors on host cells is the first step in HIV-1
infection. Individual amino acids constituting this epitope appear
to be located in the second (C2), third (C3), and fourth (C4)
conserved gp120 segments [12]. These are gp120 residues 256, 257,
368-370, 421-427 and 457. See FIG. 7. Monoclonal antibodies that
bind the CD4 binding site have been described [32]. Since the CD4
binding site is a conformational epitope, distant residues that are
not themselves constituents of the epitope may be important in
maintaining the ability to bind CD4.
[0210] gp120 interactions with other host cell proteins are also
essential for virus propagation. For example, binding of gp120 by
calmodulin may be involved in HIV-1 infectivity, as revealed by the
inhibitory effect of calmodulin antagonists. Asp180 located between
the V1 and V2 regions of gp120 is critical for viral replication
[33]. Similarly, the V3 loop may be essential for infectivity [34].
It is clear, therefore, that structural determinants in gp120 other
than those constituting the CD4 binding site are necessary for
virus genome replication, coat protein synthesis, and virus
particle packaging.
[0211] Trypsinization of gp120 blocks its neurotoxic effects.
Treatment of HIV-1 particles with trypsin, mast cell tryptase or
Factor Xa attenuates their infectivity. Cleavage of gp120 at
residues 269-270 or 432-433 destroys CD4 binding capability,
whereas cleavage at residues 64-65, 144-145, 166-167, 172-173 or
315-316 does not affect CD4 binding [35]. On the other hand,
cleavage at the Arg315-Ala316 peptide bond located in the V3 loop
of gp120 by a cellular protease is believed to be essential for
productive viral infection. A dipeptidylpeptidase expressed on the
host cell-surface (CD26) has been proposed as being responsible for
cleavage at Arg315-Ala316. This cleavage site is located in the
principal neutralizing determinant (PND), which is a component of
the V3 gp120 loop to which protective Abs are readily synthesized.
It has been hypothesized that Ab binding to the PND blocks the
cleavage of gp120 by a host cell protease, resulting in HIV
neutralization. There is no evidence that the PND plays a direct
role in HIV binding by CD4, but its participation in binding by the
HIV coreceptors has been suggested.
[0212] Efficient Ab synthesis by B cells is dependent in part on
recruitment of T helper cells, which, once sensitized, secrete the
necessary stimulatory cytokines and activate B cells by direct
contact mediated through accessory molecules, such as CD4 on T
helper cells and B7 on B cells. Recruitment of Ag-specific T cells
occurs through recognition by the T cell receptor (TCR) of the
complex of a processed Ag epitope bound to MHC class II
molecules.
[0213] The peptide-based vaccines are formulated by covalently
linking a T cell epitope to a B cell epitope, against which the
host synthesizes Abs. The T epitope binds MHC class II molecules on
the surface of antigen-presenting cells, and the MHC class II
complex of the B-T epitopes is then bound by the TCR. Different
individuals in an outbred species express different MHC class II
alleles involved in Ag presentation to T cells (I-E and I-K loci).
Ideally, a peptide vaccine should be free of MHC restrictions,
i.e., a robust Ab response should be provoked regardless of the MHC
class II variations involved in Ag presentation.
[0214] The interactions between MHC class II molecules, the TCR and
the Ag epitope are quite promiscuous. Thus, certain peptides can
serve as universal T epitopes, i.e., these peptides can bind the
different MHC class II alleles efficiently. Further, there is no
apparent restriction of recognition of the peptides at the level of
the different types of TCRs. Such peptides are suitable T epitope
components in vaccines designed to neutralize HIV through
elicitation of a protective Ab response, as described in the
present invention.
[0215] As mentioned previously, certain Abs both bind and cleave
peptide bonds in protein antigens. Recent studies suggest that
certain germline genes encoding the V domain of L chains are
capable of expressing this catalytic activity. Abs and L chains
with comparatively nonspecific peptidase activity (designated
polyreactive activity) have been described in unimmunized humans
and animals [36]. Further, the catalytic residues of a VIPase L
chain identified by mutagenesis are encoded by a germline VL gene.
The peptidase activity may also be improved over the course of
somatic diversification of Abs which occurs following immunization
with peptide antigens. Certain VIPase L chains with high levels of
catalytic efficiency have been observed to be highly mutated in
comparison to their germline gene counterparts [14]. Pairing of the
appropriate VH domain with a catalytic VL domain is described to
result in improved catalytic efficiency [28]. Further, polyclonal
catalytic Abs isolated from patients with autoimmune disease
display high affinities for their autoantigens [1,4,5], which is a
classical sign that the Abs have beeen subjected to somatic
mutations and clonal selection.
[0216] The presence of catalytic Abs in autoimmune disease may be
due to a genetic predisposition towards catalyst synthesis, brought
about by selective expression of particular germline V genes or by
increased formation of catalytic sites during somatic sequence
diversification of Ab V domains. The observation that autoimmune
disease is associated with biased usage of different V-genes is
well-established in the literature. Other genes relevant to Ab
expression may also contribute to catalytic activity levels in
autoimmune disease. The MRL/lpr mouse is known to be a good
catalytic Ab producer [7]. In this mouse strain, a mutation of the
Fas apoptosis gene is believed to permit proliferation of T and B
cells and expression of lupus-like disease.
[0217] By incorporating appropriate structure in the immunogens
capable of inducing the synthesis of Abs that combine specificity
for gp120 with rapid peptide bond cleaving activity, an
immunotherapeutic agent for the treatment of AIDS will be
generated.
[0218] The catalytic activity of autoantibodies to thyroglobulin
and of various L chains capable of cleaving synthetic protease
substrates is inhibited by diisopropylfluorophosphate (DFP), which
reacts covalently with activated serine residues. See FIGS. 8 and
9.
[0219] The catalytic Abs to VIP contain a high affinity antigen
binding subsite that is structurally and functionally distinct from
the catalytic subsite. In the anti-VIP L chain, mutagenesis at the
residues responsible for chemical catalysis (Ser27a, His93)
produces reductions of turnover (k.sub.cat) but minimal change in
K.sub.m, suggesting that residues responsible for transition state
stabilization do not contribute in substrate ground state
recognition. Mutagenesis at residues spatially distant from the
catalytic subsite produced loss of binding to the substrate ground
state (increased K.sub.m) and also a gain in turnover, as
predicted. It may be concluded, therefore, that the residues
responsible for initial high affinity binding and the chemical
cleavage step are not the same.
[0220] Antibodies to Transition State Analogs (TSAs) and Covalently
Reactive Antigen Analogs (CRAAs):
[0221] Immunization with TSAs [37, 13, 38] has been proposed as a
means to derive Abs that bind the transition state, and thus lower
the activation energy barrier for the reaction. As described
hereinabove, the commonly used phosphonate analogs contain a
tetrahedral phosphorous atom and a negatively charged oxygen atom
attached to the phosphorous. Formation of the transition state of
peptide bond cleavage is thought to involve conversion of the
trigonal carbon atom at the cleavage site to the tetrahedral state,
and acquisition of a negative charge by the oxygen of the carbonyl
group. The phosphonate TSAs may induce, therefore, the synthesis of
Abs capable of binding the oxyanion structure and the tetrahedral
configuration of the transition state. However, Abs to these TSAs,
while capable of accelerating comparatively undemanding acyl
transfer reactions, have not been reported to catalyze peptide bond
cleavage. An antibody to a phosphinate TSA has recently been
reported to slowly cleave a stable primary amide [11]. The
anti-phosphinate Ab may permit superior transfer of a proton to the
amide nitrogen at the scissile bond, compared to the more common
anti-phosphonate Abs, which probably accounts for its better
catalytic activity.
[0222] In the present example, our CRAA design is predicated on the
following hypotheses: (a) as in enzymes, catalysis by Abs requires
the participation of chemically activated amino acids to catalyze
peptide bond cleavage. (For instance, the Ser hydroxyl group in
serine proteases acquires nucleophilic character and the capability
to mediate covalent catalysis due to formation of an
intramolecular, hydrogen bonded network between the Ser, His and
Asp residues); and (b) multiple structural elements are recognized
by catalysts to achieve efficient transition state stabilization.
It appears that the phosphonate TSA structure alone is an
incomplete immunogen for induction of catalytic Abs, because this
structure does not contain the elements needed to bind nucleophilic
catalytic sites, or the sites in the catalysts responsible for S1
flanking residue recognition site. The antigen analogs of the
present invention induce the synthesis of Abs with covalent
catalytic capability, along with the ability to recognize basic
flanking residue and the tetrahedral reaction center. Synthesis of
the afore-mentioned type of catalytic Abs induced by CRAAs designed
to bind the germline encoded, serine protease site in Abs is
described herein. Electrophilic CRAAs capable of reacting with the
nucleophilic serine residue in catalytic Abs will be prepared.
These novel CRAAs will be used as immunogens, to force the
utilization of the serine protease sites for the synthesis of the
gp120-specific Abs. Immunization with the aforementioned CRAAs
promotes clonal selection of B cells expressing the germline
encoded catalytic sites. Further, the specificity for gp120 will be
ensured by incorporating an appropriate antigenic epitope of gp120
on the flanks of the CRAA structure. See FIG. 10.
[0223] It should be noted that the conventional phosphonate TSA
structure may also be useful, even if it is an insufficienct
immunogen by itself. The incorporation of a basic residue at the P1
site in a phosphonate TSA might help induce catalytic Ab synthesis,
because stabilization of the reaction center in the transition
state can occur in conjunction with flanking residue recognition.
Further, heterologous immunization, in which immunization with the
phosphonate ester CRAA is followed by immunization with the
phosphonate TSA, might permit development of the covalent catalytic
site as well as the oxyanion stabilizing site. Ab sites that
combine these functions will be catalytically more powerful than
those utilizing only one of the above-mentioned mechanisms.
Accordingly, methods for co-administering both TSAs and CRAAs to a
patient are contemplated to be within the scope of the present
invention.
[0224] Autoimmune disease is associated with the production of
potent antigen-specific catalytic Abs. Abs capable of binding [39]
and cleaving gp120 have been identified in lupus patients. Further,
the L chains isolated from lupus-prone mice (MRL/lpr strain) cleave
gp120.
[0225] IgG samples purified by affinity chromatography on protein
G-Sepharose [41] from 17 HIV-1 positive patients and 10 lupus
patients were analyzed for the ability to cleave .sup.125I-gp120.
Radiolabeling of electrophoretically pure gp120 (IIIB, AIDS
Research and Reference Reagent Program, NIH) was by the
chloramine-T method, followed by purification of .sup.125I-gp120 by
gel filtration. A single band of radiolabeled gp120 at 120 kD was
observed by SDS-PAGE and autoradiography. Sixteen of 17 HIV-1
positive IgG samples were devoid of the gp120 cleaving activity,
and one showed barely detectable activity. In comparison, 3 of 10
lupus IgG samples showed readily detectable gp120 cleavage. See
FIG. 11. No hydrolysis of .sup.125I-albumin by the IgG samples was
evident, suggesting that the observed gp120 hydrolysis is not a
nonspecific phenomenon. In separate experiments, L chains were
purified from one of the gp120 cleaving lupus IgG samples and from
the serum IgG of MRL/lpr mice. This was done by reduction and
alkylation of the IgG and FPLC gel filtration, using protocols
described previously for isolation of VIP cleaving L chains from
human monoclonal and polyclonal IgG [9, 28]. .sup.125I-gp120
cleaving activity was evident in the fractions corresponding to the
L chain peak from both the the lupus patient and the MRL/lpr mice
(25 kD). The identity of the L chains recovered from the FPLC
column was confirmed by SDS-PAGE and immunoblotting as described
previously [28]. Similar L chain fractions from HIV-1 positive IgG
and BALB/c IgG did not display the gp120 cleaving activity. The
specific activities of .sup.125I-gp120 cleavage by the lupus L
chains, MRL/lpr L chains and trypsin were (expressed as the
reduction in the intact gp120 band area in arbitrary units/nM
catalyst/h incubation time), 31, 307 and 204 respectively. Note
that the catalyst subpopulation probably constitutes a small
fraction of the L chains, implying that the true specific activity
of the catalytic L chain must be greater than the value cited
above.
[0226] In the presence of a serine protease inhibitor (0.3 mM
diisopropylfluorophosphate), gp120 cleavage by IgG from a lupus
patient was essentially completely inhibited (FIG. 12A). In
comparison, inhibitors of metalloproteases, cysteine proteases and
acid proteases (EDTA, iodoacetamide, Pepstatin A) were without
effect on the reaction.
[0227] Further proof for L chain catalyzed gp120 cleavage has come
from identification of a monoclonal L chain with this activity.
Twenty nine monoclonal L chains purified from patients with
multiple myeloma, three recombinant VL domains of these L chains, a
recombinant L-chain with VIP hydrolyzing activity [10] and
polyclonal anti-VIP Abs[2] were screened for the ability to
hydrolyze .sup.125I-gp120. One monoclonal L-chain from a multiple
myeloma patient with gp120 hydrolyzing activity was identified
(Lay2). The remaining Ab samples were devoid of activity. The gp120
hydrolyzing activity coeluted from a gel filtration column with the
L-chain protein peak. Nearly equivalent cleavage of gp120 by Lay2
was observed in physiological buffers and nutrient media (PBS, HBSS
and RPMI1640). Four radiolabeled gp120 cleavage products of mass
approximately 80 kD, a smear around 50 kD, 20 kD, and <6 kD were
evident by nonreducing electrophoresis. The 80 kD band underwent
further diminution in size under reducing conditions, suggesting
that it contained disulfide bonded fragments. Identical product
profiles were observed using .sup.125I-gp120 preparations derived
from HIV-1 strains IIIB, SF2 and MN (FIG. 12B). Like the lupus IgG,
the activity of the L chain was inhibited by the serine protease
inhibitor DFP, but not by inhibitors of other types of
proteases.
[0228] To confirm that the cleavage reaction was not an artefact
associated with the radioiodination of gp120, cleavage of the
unlabeled protein was studied (FIG. 13). The cleavage products were
identified by immunoblotting of reducing SDS-electrophoresis gels
with an anti-gp120 antibody previously described to recognizes
proteolytic breakdown products of the protein [35]. Increasing
hydrolysis of gp120 was evident at increasing L chain
concentrations, estimated as the reduction in intensity of the 120
kD substrate band. This was accompanied by increasing accumulation
of the 80 kD and other cleavage products. The cleavage profiles of
unlabeled gp120 and radiolabeled gp120 analyzed under reducing
conditions were identical, except that the intensities of the
individual bands were different, which is probably a reflection of
the methods used for detection of the two types of substrates
(immunoblotting versus .sup.125I-labeling at Tyr residues followed
by autoradiography).
[0229] The initial rates of the cleavage reaction measured at 20 nM
L chain and increasing gp120 concentrations (10-300 nM) were
saturable (apparent K.sub.m value 30 nM; Vmax0.06 nmol gp120/nmol
Lay2/h). The nM Km value suggests comparatively high affinity
binding. Trypsin-catalyzed gp120 cleavage analyzed in parallel was
nonsaturable at concentrations up to 1 .mu.M, suggesting low
affinity recognition. VIP inhibited the cleavage of .sup.125I-gp120
by the L chain (K.sub.i of VIP, 620 nM). The Lay2 L chain also
hydrolyzed radiolabeled VIP with a K.sub.m of 144 nM [40]. Thus,
VIP appears to bind the L chain about 5-21 fold less strongly than
gp120. Two short regions of homology have been identified between
gp120 and VIP, which might underlie reactivity of both polypeptides
with the catalyst.
[0230] Methods are provided for the synthesis of peptide analog
formulations that elicit the synthesis of specific and efficient
catalytic Abs capable of protecting against HIV infection. Earlier
studies have suggested that polyreactive catalytic activity of
germline encoded Abs can be recruited and improved by immunization
of mice with the serine-reactive CRAA of a gp120 peptide. The
elicitation of a catalytic Ab response should provide superior
protection against HIV-1 infection compared to a noncatalytic Ab
response.
[0231] The following synthetic immunogens will be prepared and
assessed:
[0232] A) synthetic immunogens
[0233] a) the phosphonate transition state analog (TSA) of a B cell
epitope of gp120 (residues 421-436) conjugated to a T-helper
epitope from tetanus toxoid (residues 830-844) [designated B-T
epitope];
[0234] (b) the phosphonate ester CRAA of the B-T epitope; and
[0235] (c) the unmodified peptide form of the B-T epitope.
[0236] (B) Immunize non-autoimmune mice (strain B10.BR) and
autoimmune mice (MRL/lpr) with the three immunogens from (A) and
study the following activities of IgG purified from the sera:
[0237] (a) binding and cleavage of the phosphonate B-T epitope, the
phosponate ester B-T epitope and the unmodified B-T epitope;
[0238] (b) binding and cleavage of monomer full-length gp120;
and
[0239] (c) binding and cleavage of native cell-surface-bound
gp120.
[0240] Immunogens
[0241] The prototype vaccine capable of eliciting catalytic
antibodies to HIV contains: 1) an epitope to which B cells can make
high affinity antibodies (B epitope); 2) an epitope that is bound
by MHC class II antigens and presented to T cells (T epitope); and
3) a structural mimic of the transition state formed during peptide
bond cleavage, which is intended to provoke the synthesis of
antibodies capable of stabilizing the transition state, and thus
catalyzing the cleavage reaction.
[0242] B epitope component: Loss of infectivity following cleavage
of gp120 can be achieved by directing the catalyst to cleave a
peptide bond located in an epitope of gp120 that plays an important
role in the infection process. Note that cleavage of gp120 at a
bond distant from the biologically important determinants may also
lead to loss of gp120 function, because the conformation of the
gp120 fragments may be altered "globally" relative to the parent
protein. The probability of neutralizing viral infectivity can be
increased by directing the Ab to recognize an epitope that is a
known target of neutralizing Abs. Cleavage of the CD4 binding site
is an attractive mechanism to achieve HIV neutralization for the
following reasons: CD4-gp120 binding is an essential step in HIV
entry into host cells; cleavage of the CD4 binding at the 432-433
bond by trypsin is known to block the ability of gp120 to bind CD4;
Abs to the CD4 binding site are known to inhibit HIV infection; the
CD4 binding site on native gp120 expressed on the HIV surface is
exposed to the environment (as opposed to several other epitopes of
monomeric gp120 that are buried in native gp120 oligomers) [32];
and, the CD4 binding site is quite conserved in different subtypes
of HIV-1. The linear peptide sequence composed of gp120 residues
421-436 has been selected as the B epitope component of the
immunogen in the present project (KQIINMWQEVGKAMYA; FIG. 10).
Mutagenesis studies have shown that this region of gp120 make
important contributions in CD4 binding.
[0243] Transition state analog component and covalently reactive
antigen analog component: Catalysis occurs when the transition
state is stabilized more than the ground state. In the present
invention the antigen analogs act to recruit catalytic function
while retaining the ability of Abs to bind the ground state of the
antigen. The latter property is necessary to obtain gp120-specific
catalysts, as opposed to Abs that cleave various polypeptides
non-specifically. Inclusion of the gp120 peptide sequences flanking
the targeted peptide bond will confer specificity for gp120. The
key structural features responsible for stabilization of the
transition state of peptide bond cleavage by serine protease-like
catalytic Abs are shown in FIG. 14 and may include: (a) The
tetrahedral, electrophilic carbon atom formed in the transition
state at the scissile peptide bond, capable of binding nucleophilic
serine residues in the catalyt; (b) The oxyanionic structure formed
at this carbon, which can be stabilized by ion pairing with
residues like Asn, Gln or Arg in the catalyst (the so-called
oxyanion hole); and (c) The basic residue on the N-terminal side of
the scissile peptide bond, recognition of which may occur by ion
pairing with acidic residues such as Asp or Glu located within or
close to the catalytic site in the Abs. Note that the positively
charged side chain of the flanking residue, although not directly
involved in bond making and breaking processes during catalysis,
can occupy a different spatial position in the transition state
than in the ground state. This is possible because the partial
double bond character of the scissile peptide bond will be lost
upon formation of the transition state, permitting rotation around
this bond, and consequent changes in the positions of remote
groups. The feasibility of such remote spatial changes in the
transition state has been deduced by computational modeling of a
peptide substrate in the sp2 (ground state) and sp3 (transition
state) configurations at the scissile bonds.
[0244] A TSA and a CRAA which comprise phosphonate analog and a
phosphonate ester analog, respectively, will be assessed. In both
cases, the tetrahedral phosphorous atom serves as the analog of the
scissile peptide bond carbon atom linking residues 432 and 433 in
gp120. In the phenylester configuration shown in FIG. 10, the
phosphorous atom acquires a partial positive charge, just as the
scissile bond carbon atom carries the partial positive charge
required for its reaction with nucleophilic serine residues.
Peptidic O-phenylphosphonates have previously been described to be
capable of irreversibly inactivating various serine proteases by
forming a covalent bond with the oxygen atom of the active site
serine residue [29]. Sampson and Bartlett and others [23, 24] have
established the chemical synthesis needed to prepare the phenyl
ester at the phosphorous atom, and to attach peptide sequences
flanking the phosphonate ester.
[0245] Twelve and four amino acids are present, respectively, on
the N and C terminal sides of the TSA/CRAA structure, corresponding
to the sequence of residues 421-436 of gp120. A basic residue has
been incorporated at the P1 position of the CRAA-gp120 to exploit
the existence of the germline encoded, basic residue-specific
catalytic site in Abs. The presence of the basic residue, along
with the phosphonate phenylester structure, promotes tight binding
to catalytic site, and thus promotes the ability of the CRAA-gp120
to selectively stimulate the clonal proliferation of B cells
synthesizing the catalytic sites.
[0246] It should be noted that the above phosphonate ester CRAA of
the B epitope is structurally distinct from previous phosphonate
TSAs applied to raise esterase Abs [13, 38]. The conventional
phosphonate TSAs contain an anionic oxygen attached to the
phosphorous, which can bind the oxyanion hole found in the
catalysts. The phosphonate TSAs, however, can not react with
nucleophilic serine residues in the catalytic site. A phosphonate
TSAs of the Phe-Ile peptide bond reportedly did not induce the
formation of amidase catalytic Ab formation [41].
[0247] The phosphonate ester analog described above will be
compared to a phosphonate TSA of the B epitope for the following
reasons: (a) the immunogen described in the afore-mentioned study
did not contain a basic residue at the P1 position, which would
work against recruitment of the germline catalysts for synthesis of
peptidase Abs; and (b) while immunization with a phosphonate analog
alone may be insufficient to provoke peptidase Ab synthesis,
heterologous immunization with the phosphonate and phosphonate
ester analogs may lead to a good peptidase Ab response, because the
heterologous immunization can be anticipated to select for the
oxyanion hole (phosphonate immunization) as well as the
nucleophilic serine residues (phosphonate ester immunization). Such
a coimmunization using the gp120 phosphonate and phosphonate ester
immunogens is contemplated to be within the scope of the present
invention.
[0248] T epitope component: To recruit T cell help for synthesis of
anti-gp120 Abs, a fifteen amino acid peptide (QYIKANSKFIGITEL)
corresponding to residues 830-844 of tetanus toxin will be placed
on the N terminal side of the B epitope. The presence of the T
epitope in the vaccine construct eliminates the need to conjugate
the B epitope to a large carrier protein. Several previous studies
have shown that comparatively short linear peptides that include a
T and a B epitope are capable of provoking efficient Ab synthesis
to the B epitope [42]. The tetanus toxin T epitope to be employed
in the present invention is known to serve as a T epitope in hosts
expressing diverse class II alleles, and has been characterized,
therefore, as a "universal" T epitope [43]. Further, a gp120 B
epitope linked to this T epitope is described to induce anti-gp120
Ab synthesis. The "universality" of the T epitope, although deduced
from human studies, probably extends to the mouse, because class II
restrictions tend to be conserved phylogenetically. Regardless of
the possible differences on this point between man and mouse, the
mouse strains to be utilized in the present invention have been
matched for class II alleles involved in recruitment of T cell help
for Ab synthesis (A.sup.kE.sup.k haplotype), eliminating concern
that differential T helper recruitment might contribute to
variations in catalytic Ab responses.
[0249] Assembly of immunogens: Synthesis of the 31 residue ground
state B-T construct (designated unmodified B-T epitope) composed of
tetanus toxin residues 830-844 at the N terminus and gp120 residues
421-436 at the C terminus will be done by conventional solid phase
synthesis on an Applied Biosystems synthesizer. Mass spectrometry
and .sup.1H and .sup.13CNMR will be done to confirm the
structures.
[0250] The TSA and CRAA of the B-T epitope will contain the
phosphonate and the phosphonate ester structures at the targeted
cleavage site. These are novel reagents, but their synthesis should
not present problems. Standard organic chemistry techniques
utilized previously for synthesis of TSAs and other types of enzyme
inhibitors [23,24].
[0251] A brief overview of the synthetic scheme is as follows. The
phosphinate isostere of lysine will be prepared from the
diphenylmethlyamine salt of hypophosporus acid and
6-benzylcarbamatohexanal, followed by removal of the diphenylmethyl
group in acid. The required flanking peptides (tetanus toxoid
residues 830-844 extended with gp120 residues 421-431; gp120
residues 432-436) are prepared by conventional solid phase
synthesis, except that the peptide corresponding to the C terminal
fragment contains 2-hydroxy-6-carbobenzyl- oxyaminohexanoic acid
instead of the N terminal lysine. Other basic side chains are
protected with the carbobenzyloxy group and acidic side chains are
protected with a benzyl ester group. Protected peptides will be
attached to the phosphinate lysine isostere by classical solution
phase peptide synthesis methods. The final peptide phosphonate
phenyl ester structure will be prepared by oxidative coupling of
the phosphinate with phenol. This same synthesis scheme will be
used used for preparation of the phosphonic acid by converting the
phosphinate to the phosphonic acid monoester by treatment with
bis(trimethylsilyl)acetamide in acetonitrile followed by aqueous
triethylamine, carbon tetrachloride, and lithium exchange on
AG-X-50 ion exchange resin [23; scheme h and I]. Mass spectrometry
and NMR will be done to confirm the structures.
[0252] Immunization of Mice
[0253] Two strains of mice will be studied for Ab responses to 4
immunogen constructs, BR10.BR and MRL/lpr. Immunizations will be
done with:
[0254] a. B-T epitope (residues 421-436 of gp120 linked to residues
830-844 of tetanus toxin).
[0255] b. Phosphonate analog of the B-T epitope at residue Lys432.
(TSA)
[0256] c. Phosphonate ester analog of the B-T epitope at residue
Lys432. (CRAA)
[0257] d. Phosphonate ester analog followed by phosphonate analog
the B-T epitope (TSA+CRAA; heterologous immunization).
[0258] Conventional immunization methods will applied to induce Ab
synthesis. Three intraperitoneal and one intravenous injection of
the immunogens (about 100 .mu.g peptide each) will be administered.
The final immunization will be carried out intravenously. Two
adjuvants will be tested: RIBI and alum. Alum is approved for human
use and has previously been shown to provoke Ab synthesis to a B-T
epitope similar to those proposed in the present invention. RIBI is
a low toxicity replacement for Freund's Complete Adjuvant, and
reproducibly facilitates good Ab responses to a variety of Ags.
Sera will be prepared from retroorbital plexus bleeds obtained from
the mice at five time points over the course of the immunization
schedule. Splenocytes will be harvested and processed for
preparation of Fv phage display libraries for structure-function
studies. Analysis of two adjuvants is advantageous because the
quality and magnitude of Ab responses to vaccines can be influenced
by adjuvants, via effects of the cytokines and TH subpopulations
recruited by the adjuvants on B cell development and clonal
selection [44]. Thus, a total of 16 groups of mice will be studied
(4 immunogens.times.2 mouse strains.times.2 adjuvants), each
composed of 5 animals.
[0259] Low affinity, antigen-nonspecific peptidase antibodies are
already present in preimmune repertoire. Provided that the germline
gene encoding the nonspecific peptidase activity is recruited for
the Ab synthesis, immunization with the CRAAs will result in
synthesis of gp120-specific catalytic Abs. Humans and mice with
autoimmune disease are prolific producers of Ag-specific catalytic
Abs, suggesting that the diseased immune system efficiently
recruits the germline gene encoding the catalytic site, and permits
maturation of the catalytic sites to become specific for individual
Ags over the course of the immune response. The MRL/lpr mouse
strain is genetically prone to autoimmune disease, and has
previously been observed to be capable of high level catalytic
antibody production. Further, the L chains from the serum of
preimmune MRL mice express gp120 cleaving activity. Thus, a subset
of antibodies formed by immunization of MRL/lpr mice with the
disclosed immunogens can be anticipated to express gp120-specific
catalytic activity. It is relevant that gp120-binding Abs found in
lupus patients are directed, in part, to the gp120 B epitope
included in the disclosed immunogens [39]. The BR10.BR mouse strain
is not prone to autoimmune disease. The results from this strain
will reflect the ability of the disclosed immunogens to stimulate
catalytic immunity to gp120 in the healthy immune system. B10.BR
mice and MRL/lpr mice have identical haplotypes at the class II
loci responsible for T cell restriction of Ab synthesis
(A.sup.kE.sup.k), ensuring that any differences in catalytic Ab
synthesis between the two strains will not be due to the class II
restriction.
[0260] Ab Binding Activity
[0261] Abs synthesized in response to the CRAAs should bind the
transition state of the peptide bond cleavage reaction better than
the ground state, permitting catalysis to occur. The strength of
the binding of the Abs to the CRAAs/TSAs will serve as an predictor
of the Ab catalytic activity. Further, if the B epitope in the
immunogen exists in approximately the same conformation in the
immunogen and the full-length gp120, the Abs will also bind the
full-length protein. Finally, if the epitope is exposed as in the
native gp120 known to exist in the form of oligomers on the viral
surface, the Abs should also bind the oligomeric gp120
structure.
[0262] Unmodified B-T epitope and TSA B-T epitope and CRAA B-T
epitope: The binding of the three forms of the B-T epitope, i.e.,
the unmodified, phosphonate, and the phosphonate ester form, will
be compared by ELISA. Apparent values of binding strength will be
assessed by competition assays (as IC50 values), using ELISA plates
coated with the unmodified B-T epitope (about 50 .mu.g/ml) as the
solid phase and the unmodified, phosphonate and phosphonate ester
B-T epitope as the soluble competitor. The binding will be measured
using peroxidase coupled anti-mouse IgG followed by addition of the
substrates (o-phenylene diamine and hydrogen peroxide). Since
polyclonal preparations are to be studied, the binding curves may
deviate from simple sigmoidal binding isotherms. The IC50 values
for the individual ligands will serve, nevertheless, as valid
indicators of the average binding affinity of the Abs.
[0263] The following relationship could be applied to predict the
catalytic rate acceleration: Ki/Kd=k.sub.cat/k.sub.uncat, where Ki
and Kd are the equilibrium dissociation constants of the TSA and
the unmodified B-T epitope, respectively, and k.sub.cat and
k.sub.uncat are the first order rate constants for the catalyzed
and uncatalyzed reactions, respectively. IC50 values could be
substituted in this equation to predict the rate acceleration, but
the predicted value will be an average of the activity of several
Abs, because the IgG samples to be studied are mixtures of
different Abs. The binding assays will be conducted at 4.degree. C.
in the presence of diisopropylfluorophosphate (DFP) to minimize
interference with measurement of the binding parameters due to
peptide cleavage. DFP, a known serine protease inhibitor, has been
observed in previous studies to uniformly inhibit the catalytic
activity of Abs. Reduction of the reaction temperature will reduce
the rate of the catalytic reaction. Note that Km values estimated
from catalysis assays will help confirm the validity of the IC50 as
an indicator of binding strength.
[0264] Solution phase assays will be conducted to confirm that
avidity effects due to the antigen "carpeting" on the solid phase
do not lead to misleading binding estimates. The solution phase
assays will be carried out using the .sup.125I-radiolabeled B-T
epitope. Radiolabeling of the peptide will be done using the
chloramine-T method as described previously [2]. [The B-T epitope
contains one Tyr, corresponding to gp120 residue 435]. Ab-Ag
complexes will be trapped using protein G-Sepharose and the binding
determined by counting the radioactivity in a .gamma.-spectrometer.
As before, the binding will be studied at various concentrations of
the TSA/CRAA competitors, permitting estimation of the binding
strength of the unmodified epitope and its TSA/CRAA.
[0265] Purified gp120 and cell-surface expressed gp120: Ab binding
by purified gp120 and cell-surface gp120 will be measured to
determine whether the targeted B epitope is accessible to the Abs
in the full-length oligomeric form of the protein. Recombinant
gp120 expressed in a mammalian cell line will be employed to assure
that the glycosylation pattern of the protein is similar to that in
HIV-infected cells. Competitive ELISA using gp120 coated on a solid
phase will be performed to determine the apparent binding strengths
of the Abs. Competitor ligands to be studied are the full-length
gp120 and the three B-T epitopes to which the Abs are elicited
(phosphonate TSA, phosphonate ester CRAA and the unmodified B-T
epitope). The relative reactivity of the synthetic immunogens and
the full-length gp120 will be estimated from the IC50 values
(apparent Ki) of the competitor ligands. Near equivalent IC50
values for the full-length gp120 and the unmodified B-T epitope
will indicate that the targeted B epitope exists in a
near-equivalent conformation ln the two molecules. Observations
indicating stronger binding of the Abs to the phosphonate or the
phosphonate ester of the B-T epitope compared to full-length gp120
will indicate that the Abs may display catalytic activity. As
described above, solution phase assays using radiolabeled gp120
will be carried out to confirm the absence of ELISA artefacts, such
as increased binding avidity due to the ligand immobilization.
[0266] HIV-1 infected cells of the H9 T cell line express gp120 on
their surface. The majority of cell-surface gp120 mimics the form
of adherent virus particles. The cell-surface gp120 is thought to
exist in an oligomeric state similar to the aggregation status of
the gp120 on the surface of the virions. Ab reactions with the
cell-surface expressed gp120, thus, have been held to indicate the
ability of the Abs to recognize virion-bound gp120.
[0267] In the present invention, H9 cells obtained from the NIH
AIDS Repository will be grown in RPMI/10% FCS in 5% CO.sub.2. The
cells (10.sup.6/ml) are infected with the culture supernatant
containing HIV-1 strain MN (AIDS Repository) for 2 hours at
37.degree. C. Following washing, the cells are cultured for about 1
week. Binding of various concentrations of IgG (1 nM-1 .mu.M) will
be determined by incubation with an appropriate number of the
intact cells for 4-6 h at 4.degree. C. in round-bottomed 96 well
plates in the presence of 1 mM DFP, followed by washing of the
cells to remove unbound Ab, incubation with rabbit anti-mouse IgG
conjugated to peroxidase, development of the reaction with hydrogen
peroxide and o-phenylenediamine, and quantitation of the optical
density at 490 nm using an ELISA reader. Controls will include the
preimmune IgG and an Ab known to be reactive with cell-surface
gp120 (available from the NIH AIDS repository). Ab binding to the
cells can also be studied by flow cytometry, using a fluorescent
second Ab for detection of the bound anti-gp120 Ab as described
[45]. This procedure permits determination of apparent Ab affinity
by estimation of Ab association and dissociation rates.
[0268] Competition experiments will be carried out in which the B-T
epitope constructs or soluble full-length gp120 will be permitted
to act as competing ligands for Ab binding to the cells. As in the
competition studies described in the preceding paragraph, the IC50
values of the B-T epitopes will estimate the relative strengths of
the Ab binding to the B epitope. To minimize gp120 cleavage by the
Abs, the incubations will be conducted at 4.degree. C.
Diisopropylfluorophosphate, which is an effective inhibitor of Ab
catalysis, can also be included in the incubations. Cell viability
will be estimated at the end of the binding reaction by trypan blue
exclusion tests, to confirm that the inhibitor (and other
experimental conditions) does not disrupt cellular integrity, which
could potentially perturb the oligomeric structure of the
gp120.
[0269] Screening for Catalytic Activity:
[0270] IgG purified from sera by affinity chromatography on protein
G-Sepharose will be screened for catalytic activity using the
unmodified B-T epitope as the substrate. Initial screening assays
will be carried out at 10 .mu.M substrate and 0.25 .mu.M IgG
concentrations with incubations times of 1-2 hours. Even with an
apparent turnover as low as 0.1/min, the products should accumulate
to concentrations of about 3 .mu.M (30% of initial substrate
concentration). The reaction mixtures will be analyzed by
reversed-phase HPLC with detection at 214 nm (trifluoracetic
acid/acetronitrile gradient). Product concentrations will be
computed from areas under the product peaks. Controls will include
preimmunization IgG.
[0271] All IgG samples will also be screened for cleavage of
full-length gp120. .sup.125I-gp120 will be the substrate.
Radiolableing of gp120 (recombinant MN expressed in CHO cells) is
by the chloramine-T method followed by resolutive FPLC to obtain
electrophoretically homogeneous .sup.125I-gp120.
SDS-electrophoresis and autoradiography will be applied to
visualize product bands. Procedures permitting rapid sample
handling have been described. About 50 IgG samples can be screened
for the activity per day. Unlabeled gp120 will be used as substrate
to confirm that the cleavage reaction is not an artefact associated
with the radiolabeling procedure. Immunoblotting of SDS-PAGE gels
of the reaction mixtures with an anti-gp120 Ab capable of
recognizing various proteolytic fragments of gp120 will be applied
for this purpose.
[0272] Purity of the IgG used as catalyst will be established by
SDS-PAGE. Retention of the catalytic activity in the Fab fractions
and IgG prepared by gel filtration under denaturing conditions (6 M
guanidinium chloride) will confirm that the catalytic activity is
due to Abs as previously described [36].
[0273] The assays will be done in the absence and presence of human
serum to assess whether protease inhibitors found in serum
influence catalytic Ab activity. In preliminary studies, serum has
been found to be without effect on gp120 or thyroglobulin cleavage
by Abs isolated from lupus serum. Based on these results, serum
inhibitor-resistant Abs should also be present in mice.
[0274] Cleavage site specificity: The product fragments generated
by cleavage of the unmodified B-T epitope and of full-length gp120
will be identified, permitting deduction of the cleavage site(s).
The B-T epitope fragments separated by HPLC will be subjected to
N-terminal amino acid sequencing and FAB-mass spectrometry to
identify the cleavage site(s), as previously described (1,2). In
the case of the full-length gp120 substrate, the reaction products
will be separated by SDS-electrophoresis, blotted onto PVDF and the
blotted polypeptides subjected to N-terminal sequencing, permitting
identification of the cleavage sites by comparison with the
sequence of gp120. Controls will include IgG from preimmune
mice.
[0275] Trypsin will be included as a positive control. Trypsin can
be expected to cleave the B-T epitope at multiple peptide bonds
that are flanked by a Lys or Arg residue, i.e., at residues 421-422
and 432-433 in the B epitope and at residues 833-834 and 837-838 in
the T epitope. In comparison, recruitment of the catalytic activity
in Abs due to the presence of the phosphonate or phenylphosphonate
ester structure, should cleave the the B-T epitope mainly at the
Lys432-Ala433 peptide bond by IgG. It is possible that an
alternative result may be observed. Ag-specific catalysts can be
synthesized by immunization with ground state antigens. Thus,
catalysts capable of cleaving the substrates at peptide bonds other
the 432-433 bond may be found, because the germline encoded
activity present in the preimmune repertoire may recognize basic
residues without regard to the overall structure of the antigen
epitope [36, 40]. The extent to which the cleavage reaction occurs
preferentially at residues 432-433 will indicate the importance of
the phosphonate/phenylphosphonate ester structure in recruiting the
catalytic site. Similarly, the extent to which the cleavage of
full-length gp120 is confined to peptide bonds located within
residues 421-436 will indicate the importance of this peptide
epitope in recruiting catalytic activity that is specific for
gp120.
[0276] Substrate specificity These studies will be performed to
assess the therapeutic use of the antibody catalysts. Cleavage of
various peptide and protein substrates will be studied. Several
radiolabeled polypeptides are available to study the
substrate-specificity profile: (a) .sup.125I-albumin; (b)
.sup.125I-thyroglobulin; (c) .sup.125I-VIP; and, (d) .sup.125I-IgG.
Hydrolysis of the proteins is indicated by appearance of lower mass
product bands visualized by electrophoresis and autoradiography.
VIP hydrolysis is measured by precipitation of the intact peptide
with trichloroacetic acid or by reversed-phase HPLC [2]. A larger
panel of randomly selected polypeptides (n>10; commercially
available polypeptides, e.g., casein, collagen, etc.) will also be
examined by inhibition assays, i.e., their ability to inhibit
.sup.125I-gp120 hydrolysis by the catalyst. Inhibition of the
reaction is indicated by reduced depletion of the 120 kD gp120
band.
[0277] Kinetics: Kinetic studies will be done to determine the
apparent rate constant and catalytic efficiency
(k.sub.cat/K.sub.m). The unmodified B-T epitope and full-length
gp120 will be used as substrates. The kinetic constants will be
determined from assays conducted at varying concentrations of the
substrates. If the the sera contain catalytic Abs mixed with
noncatalytic Abs capable of binding the epitope, the binders may
protect the epitope from cleavage by the catalyzers. To
differentiate between these two pools, the serum IgG will be
adsorbed onto an immobilized inhibitor that can binds the catalytic
Abs but not the noncatalytic Abs. Such inhibitors are available.
Because such inhibitors do not contain a gp120 epitope, they will
not bind noncatalytic Abs induced by immunization with the gp120
B-T epitope. Biotin will be attached to the inhibitor to permit
immobilization using avidin coated plates. Following incubation of
the serum IgG from immune mice with excess immobilized inhibitor,
the supernatant will be analyzed by ELISA for binding to the
unmodified B-T epitope. An absence of binding will suggest that the
noncatalytic Abs to the epitope are not present in significant
amounts. Further, the bound Abs may be elutable with hydroxylamine,
pH 9 or greater, which may cleave the covalent bond between the Abs
and the inhibitor. The eluted Abs, which will be deficient in
noncatalytic Abs to the B-T epitope, can then be analyzed for
kinetic parameters.
[0278] Nanomolar or lower Km values will indicate high affinity
antigen binding activity. Observations of equivalent Km and kcat
values for the two substrates will suggest that residues 421-436
located in the synthetic immunogen adopt a conformation similar to
that in gp120. Concerning values of the apparent rate constant, the
IgG preparations should display more rapid turnover than that
observed previously using polyclonal Ab preparations, because the
immunogens of the invention are expressly designed to promote the
recruitment and improvement of catalytic sites over the course of
the immunization procedure.
[0279] The inhibition of IgG catalyzed cleavage of the unmodified
B-T epitope by the phosphonate and phosphonate ester of the epitope
will also be assessed. Reduced hydrolysis will indicate that the
phosphonate and phosphonate ester peptides are competitive
inhibitors of the binding of the B-T epitope and/or serve as
alternate substrates. When inhibition is seen, the K.sub.i value
will be measured to assess the relative reactivity of the IgG with
the B-T epitope and its TSA/CRAAs. To determine whether the
TSA/CRAAs are used as substrates, their cleavage by the IgG will be
studied by RP-HPLC separation of product peptides and
identification of the product peptides by amino acid sequencing. If
the catalysts are capable of cleaving multiple peptide bonds
promiscuously, the TSA/CRAA peptides may be cleaved by the
catalysts. On the other hand, if the Abs cleave exclusively at the
Lys432-Ala433 bond, the TSA/CRAAs will not serve as substrates
because they contain noncleavable analogs of the peptide bond at
this position.
[0280] Cleavage of cell-surface expressed gp120: To confirm that
the catalytic antibody activity is directed to the biologically
relevant form of the gp120, i.e., virion bound oligomeric gp120.
Biosynthetically radiolabeled gp120 expressed on the cell surface
will serve as the substrate. gp120 radiolabeling will be done by
growing HIV-infected H9 cells in .sup.35S-labeled methionine (in
Met-deficient medium). The cells will be treated with varying
concentrations of the IgG fractions from preimmune and immune mice.
Cell extracts will be prepared using a mild detergent (0.1%
Triton-X-100), which should be sufficient to release the
radiolabeled gp120 into the supernatant. The gp120 (and its
fragments) will be immunoprecipitated from the cell extracts using
an available rabbit anti-gp120 Ab, which is known to bind various
tryptic fragments of the protein [35]. SDS-electrophoresis will be
employed to separate the reaction products. Disappearance of the
intact gp120 band and appearance of lower mass fragments will
indicate the cleavage of cell-surface bound gp120. Controls will
include immunoprecipitation of the cell extracts with nonimmune
rabbit IgG, in which case no radioactivity should be precipitated.
Immunoblotting of the gels with anti-gp120 Abs will be carried out
to confirm that the immunoprecipitated material represents gp120
fragments.
[0281] Confirmatory experiments that the Abs recognize the
conformation of gp120 expressed on the surface of HIV-1 will also
be performed. Sucrose density gradient purified MN-virus
preparations as the substrate (available from Advanced
Biotechnologies) will be used. Following incubation of the virus
with the Abs, gp120 cleavage will be determined as described for
cell-surface expressed gp120, i.e., detergent extraction,
electrophoresis and immunoblotting with the anti-gp120 Ab known to
bind gp120 cleavage fragments.
[0282] Immunization with the B-T epitope immunogens will elicit Abs
that bind full-length soluble and cell-surface expressed gp120,
because the targeted epitope in gp120 is a part of the CD4 binding
site, which can be assumed to be exposed on the protein surface (as
opposed to being buried in the interior of the protein). Moreover,
the targeted epitope is conserved in different HIV strains. Thus,
synthesis of broadly reactive Abs is expected.
[0283] Preimmune IgG from non-autoimmune mice will be devoid of the
ability to catalyze the cleavage of the targeted epitope in gp120.
Similarly, IgG from non-autoimmune mice immunized with the
unmodified B-T epitope will express little or no gp120 cleaving
activity.
[0284] Preimmune IgG from autoimmune mice may display low-level
cleavage of gp120, but the activity will not be highly specific for
gp120. Immunization of the autoimmune mice with the unmodified B-T
epitope will render the catalytic activity specific for gp120, but
improvements in catalytic turnover are not predicted from the
structure of the immunogen. In comparison, the B-T epitope TSA and
CRAA are designed to provoke the synthesis of Abs that combine the
ability to bind the ground state of gp120 as well as the transition
state of the peptide bond cleavage reaction. Thus, the TSA and CRAA
immunizations are predicted to elicit the synthesis of Abs that
display bind gp120 with high affinity (low values of apparent Km
and Kd) and display rapid turnover (apparent kcat). Further,
immunization of the autoimmune mice with the analogs of the B-T
epitope will direct the promiscuous catalytic activity found in the
preimmune state to one specialized to recognize the targeted gp120
epitope (residues 421-436).
[0285] Immunization of B10.BR mice (non-autoimmune mice) with the
TSAs and CRAAs will overwhelm the suppressor mechanisms that limit
catalytic Ab synthesis in the non-autoimmune state. This test is
relevant to development of an HIV vaccine, because the goal is to
develop vaccines that protect against the infection, regardless of
the autoimmune or non-autoimmune status of the host.
[0286] The phosphonate ester of the B-T epitope will elicit more
potent catalysts than the phosphonate B-T epitope, because the
former immunogen will promote clonal expansion of B cells
synthesizing Abs containing nucleophilic Ser/Thr residues, which is
a feature of the pre-existing catalytic sites encoded by germline
VL gene(s). The phosphonate B-T epitope, on the other hand, is
designed to recruit Abs that contain an oxyanion hole (such as
Asn255 in subtilisin) to stabilize the developing negative charge
on the carbonyl oxygen in the transition state. No evidence is
available that proves that oxyanion stabilization is responsible
for catalysis by the germline encoded catalysts. Note, however,
that V region somatic diversification mechanisms (hypermutation,
V-J/V-D-J recombination and VL/VH pairing diversity) are powerful
mechanisms capable of evolving catalytic sites de novo. Development
of Abs that combine the germline nucleophilic site and a
somatically developed oxyanion hole is quite feasible. Such
nucleophilic, oxyanion stabilizing sites are responsible for
efficient catalysis by non-Ab serine proteases. The proposed
heterologous immunizations, in which Ab synthesis will be induced
by sequential immunization with the phosphonate ester B-T epitope
and phosphonate B-T epitope will provoke the synthesis of high
turnover, gp120-specific catalysts. The heterologous immunization
will also recruit the Ab germline gene(s) encoding nucleophilic
sites due to the covalent, electrophilic reactivity of the
phosphonate ester, followed by somatic development of an oxyanion
stabilizing structure over the course of the immune response.
[0287] Comparison of HIV-1 Neutralizing Activity of Anti-gp120
Antibodies Elicited by the Unmodified B-T Epitope with the
Neutralizing Activities of Abs Elicited by the Phosphonate B-T
Epitope TSA and the Phosphonate Ester B-T Epitope CRAA.
[0288] Binding of gp120 to CD4 initiates infection of cells by
HIV-1. Cleavage of gp120 in at the 432-433 bond will efficiently
block HIV-1 binding by cells, because the cleavage site is located
in the CD4 binding region of gp120, and cleavage of this bond by
trypsin has previously been shown to inhibit solution phase gp120
binding by CD4 [35].
[0289] Abs: Purified IgG samples from mice at various time over the
course of the immunization with the control B-T epitope construct
(unmodified peptide), the phosphonate B-T epitope (TSA), the
phosphonate ester B-T epitope (CRAA), and the combination of the
phosphonate and phosphonate ester B-T epitope (TSA+CRAA) will be
compared. Hyperimmune IgG from all of these immunizations should be
capable of high affinity gp120 binding. The catalytic activity is
anticipated to be present in the IgG from the TSA/CRAA
immunizations from both mouse strains.
[0290] HIV-1 neutralization: Initially, blinded IgG samples from
all of the mice at various stages of immunization will be screened
in a well-characterized, quantitative, T-cell line assay using a
standard laboratory strain (HIV-1 MN). Further studies will be done
using hyperimmune IgG obtained towards the end of the immunization
schedule. Controls will include cells incubated with IgG without
HIV-1 to rule out the possibility of a nonspecific toxic effect of
the IgG. These IgG samples will be analyzed using blood-derived
PHA-activated lymphocytes as one cell type and blood-derived
macrophages as the second cell type. A single dual-tropic primary
isolate HIV-1 ADA will be the virus isolate used in the primary
cell assay. The reason for using both cell types is to avoid
missing any neutralizing/inactivating activity which may reside in
a unique epitope specific to the different cell and virus types. It
is apparent from earlier work that a number of factors are
responsible for the profound differences in the neutralization of
laboratory strains from field isolates. Those Ab samples exhibiting
neutralizing activity will be directly compared for their potency
to both V3 and CD4-inhibiting human monoclonals and well
characterized HIV-1 positive human polyclonal sera. In addition,
these antibodies will be further evaluated for their stage of,
mechanism(s) of action, reversibility as well as their breadth of
neutralizing activity over a wide range of antigenic
subtypes/clades in multiple primary cell types.
[0291] The IgG to be tested will include the noncatalytic
anti-gp120 (from non-autoimmune mice immunized with the unmodified
B-T epitope) and catalytic anti-gp120 IgG preparations (e.g., from
mice immunized with the TSA/CRAAs of the B-T epitope). Because the
targeted B epitope in gp120 is essential for CD4 binding, even
noncatalytic Abs in IgG preparations of the invention can be
anticipated to inhibit HIV-1 neutralization. Assuming that
sufficient titers of the Abs are elicited, hyperimmune IgG from
each of the experimental groups of mice may inhibit the HIV-1
infectivity.
[0292] Homogeneous preparations of catalytic and one noncatalytic
Fv constructs will be compared for HIV-1 neutralization activity.
This will confirm the results obtained from the polyclonal IgG
studies. Further, because the Fv constructs lack the Fc domain,
phenomena like complement binding and Fc receptor binding will be
eliminated. The absence of enhanced HIV-1 infectivity due to such
phenomena will be thus be confirmed using the Fv constructs.
[0293] The major attraction of catalytic Abs is their greater and
irreversible antigen neutralizing capability compared to
noncatalytic Abs. In the present invention, the catalytic IgG
samples should display potent HIV-1 neutralization, at
concentrations several orders of magnitude lower than the
noncatalytic IgG samples. The epitope targeted by the catalyst is a
constituent of the CD4 binding site of gp120. Further, cleavage of
the targeted bond (Lys432-Ala433) by trypsin has been found to
block gp120 binding to CD4. The CD4 binding site tends to be
conserved across different strain and subtypes of HIV-1. Thus, the
anti-gp120 catalysts of the present invention represent a
beneficial therapeutic tool for the treatment of infectious
disorders, such as HIV infection.
EXAMPLE III
Use of CRAAs and Catalytic Antibodies in Ischemia-Reperfusion
Injury and Septic Shock/SIRS Larry I Need the References for this
Section
[0294] Ischemia-reperfusion injury occurs when blood supply to a
tissue is interrupted for a prolonged period (ischemia) and then
restored (reperfusion). This type of injury affects both heart
attack and stroke patients following treatment to restore blood
flow to the damaged tissue. Both ischemia and particularly
reperfusion are associated with release into this tissue of certain
factors that cause an inflammatory response and injury by inducing
programmed cell death.
[0295] Septic shock and systemic inflammatory response syndrome
(SIRS) are terms for a frequently fatal syndrome that includes
hemodynamic changes, inflammation and ultimately the failure of
major organs in a predictable order beginning with the lungs. The
septic shock syndrome was originally associated only with
gram-negative bacterial infections and the effects of endotoxin,
but subsequently a variety of other medical problems, such as
extensive tissue damage resulting from an accident, were found to
initiate the same syndrome, which in the absence of infection is
termed SIRS [46]. The multiple organ failure seen in both syndromes
is closely associated with and may largely be caused by the
occurrence of programmed cell death.
[0296] Ischmia-Reperfusion Injury
[0297] The four major soluble factors that induce programmed cell
death in this disorder are reactive oxygen species (ROS) and nitric
oxide (.fwdarw.peroxynitrite.fwdarw.hydroxyl ROS) which induce and
are induced by interleukin-1 beta (IL-1) and tumor necrosis factor
alpha (TNF).
[0298] Considering the involvement of programmed cell death in
ischemia-reperfusion injury and septic shock/SIRS, the fact that
the soluble factors just mentioned play a prominent role in both
underscores the similarities in pathophysiology between the medical
emergencies.
[0299] The novel CRAAs of the invention may be used to advantage to
develop catalytic antibodies which cleave IL-1 and TNF for the
treatment of ischemia-reperfusion injury, septic shock/SIRS and
acute respiratory distress syndrome (ARDS) as well as for other
inflammatory disorders such as rheumatoid arthritis and for the
treatment of neuropathic pain.
[0300] Ischemia-Reperfusion Injury
[0301] Early return of blood flow to ischemic tissues is critical
in halting the progression of cellular injury that results from an
interrupted oxygen and nutrient supply. Paradoxically, the
reinstitution of blood flow to ischemic tissues is associated with
further tissue damage. It has been shown experimentally, for
example, that four hours of intestinal ischemia is substantially
less damaging than three hours of ischemia plus one hour of
reperfusion [47, 48]. The importance of the reperfusion phase to
overall tissue damage has been illustrated in numerous studies
showing that therapeutic interventions initiated during the
ischemic phase are only as effective as those initiated at the
onset of reperfusion [49, 50, 51, 52]. Ischemia-reperfusion injured
tissues rapidly show zones of necrotic cell death surrounded by
areas of cells undergoing programmed cell death [53, 54, 55].
[0302] It is well established that ischemic tissues must be exposed
to molecular oxygen upon reperfusion to exhibit injury [56-61].
[0303] Several mechanisms have been postulated to explain the
pathogenesis of ischemia-reperfusion injury but most attention has
focused on ROS. ROS refers to any compound derived from molecular
oxygen that has a negative charge including superoxide, hydrogen
peroxide and the hydroxyl radical which are reduced by one, two and
three electrons respectively.
[0304] Numerous lines of evidence have implicated ROS in
ischemia-reperfusion injury including the following: 1) The
production of ROS in ischemic tissues has been detected by
electronic spin resonance and spin trapping [62, 63] as well as by
nitroblue tetrazolium reduction, chemiluminescence, and salicylate
trapping.
[0305] 2) Exposure of tissues to ROS in the absence of
ischemia-reperfusion injury produces pathologic changes similar to
ischimia-reperfusion injury itself [64,65,66,67]. 3) Treatment with
agents that scavange ROS or limit ROS production significantly
reduce ischemia-reperfusion injury damage [68,69].
[0306] One of the initial effects of ischemia is ATP depletion in
the affected tissue, which in turn makes cell membranes permeable
to ions, and calcium sequestration inefficent. The resultant
increase in cytosolic calcium promotes activation of
calcium-dependent phospholipase and proteolytic enzymes, and an
important result is the conversion of xanthine dehydrogenase into
xanthine oxidase [70]. Xanthine oxidase is found in parenchymal and
endothelial cells, and produces ROS superoxide and, directly or
indirectly, hydrogen peroxide. That the inhibition of xanthine
oxidase reduces the damage caused by ischemia-reperfusion injury
supports the notion that ROS production by this enzyme contributes
to pathogenesis.
[0307] Reduction in phosphatidylethanolamine, breakdown of
phospholipids, and liberation of free fatty acids occurs in
ischemic tissues. With the onset of reperfusion there is rapid
utilization of free fatty acids, particularly arachidonic acid,
which stimulates the lipoxygenase and cyclo-oxygenase pathways
resulting in the production of ROS. Cyclo-oxygenase inhibitors have
been shown to be beneficial in reducing tissue damage due to
ischemia-reperfusion injury.
[0308] Nitric oxide is a highly reactive species continually
released by the endothelium [71]. It maintains the microcirculation
in a state of active vasodilation and vascular impermeability and
prevents platelet and leukocyte adherence to the endothelium. It is
enzymatically synthesized by a consitutively active endothelial
synthase from L-arginine and its production can be inhibited by
L-arginine analogues such as NG-nitro-L-argine methyl ester
(L-NAME). Inhibition of nitric oxide production in the coronary
vasculature with inhibitors such as L-NAME can cause myocardial
ischemia by vasoconstriction [72]. There is a substantial body of
evidence, however, that nitric oxide synthesis-inhibitors can
substantially reduce the level of tissue damage associated with
ischemia-reperfusion injury [73, 74].
[0309] Inducible forms of nitric oxide synthase are responsible for
increased levels of this molecule during ischemia-reperfusion
injury. Inducers include inflammatory cytokines, neuroexcitatory
amino acids, and flow-related vasodilation during postischemic
hyperthermia. Noiri et al. [75] demonstrated that an antisense
oligo targeting transcripts of inducible nitric oxide synthase
genes can reduce the expression of these genes. Given systemically,
this oligo was taken up by the kidney and significantly reduced
renal failure caused by the experimental production of renal
ischemia in rats.
[0310] Nitric oxide can combine with the superoxide anion to
produce the toxic free-radical peroxynitrite, leading to the
production of the hydroxyl radical, a ROS thought to be a major
causal factor in ischemia-reperfusion injury [74]. Reduction of
molecular oxygen to produce superoxide occurs in all aerobically
respiring cells in the mitochondria transport system.
[0311] Nitric oxide has also been shown to induce programmed cell
death in a number of physiologic and experimental situations.
Activation of high-level nitric oxide production helps form the
first line of defence against invading pathogens and tumor
cells.
[0312] Release of ROS in areas of ischemia-reperfusion injury
attracts inflammatory leukocytes, which in turn can cause tissue
injury by means of a cytotoxic arsenal that includes the release of
additional ROS. Numerous studies have shown: 1) that leukocytes
accumulate in areas of ischemia-reperfusion injury, and 2) that
depletion of circulating neutrophils or use of agents that prevent
neutrophil activation can sometimes reduce tissue damage associated
with ischemia-reperfusion injury.
[0313] The terminal phases of programmed cell death involve a set
of enzymes belonging to the ICE family. Peptides capable of
inhibiting some of these enzymes have been shown to reduce ischemic
brain damage resulting from transient middle cerebral artery
occlusion in rodents and significantly improve resulting behavioral
deficits [76]. The latter observation demonstrates that functional
recovery of ischemic neural tissue can follow treatments that
prevent the cell death program from going on to completion.
Presumably, the degree of functional recovery would be even greater
in instances where ischemia is followed by reperfusion injury.
[0314] Numerous studies have demonstrated that programmed cell
death is a ubiquitous feature of tissue damaged by
ischemia-reperfusion injury [53, 54, 55].
[0315] Induction of inducible nitric oxide synthase levels has been
positively correlated with programmed cell death in rat hearts by
Szabolcs et al. [77]. Cardiac tissue was transplanted from Lewis to
Wistar-Furth rats as a model of cardiac allograft rejection, while
Lewis to Lewis transplants served as a control. The number of
cardiac myocytes undergoing programmed cell death increased sharply
from day 3 to day 5 following transplantation. At day 5, allografts
showed a significantly greater increase in the myocytes,
endothelium and macrophages undergoing programmed cell death when
compared to syngenic grafts. Expression of inducible nitric oxide
synthase mRNA, protein and enzymatic activity was shown to increase
in parallel in time and extent with programmed cell death in the
cardiac myocytes. Immunohistochemical staining demonstrated that
areas of increased inducible nitric oxide also expressed
nitrotyrosine, indicative of peroxynitrite formation.
[0316] Numerous lines of evidence support the conclusion that
interleukin-1 beta (IL-1) and tumor necrosis factor alpha (TNF)
play important roles in the evolution of ischemia-reperfusion
injury.
[0317] The production of both proinflammatory cytokines has been
shown to be associated with cell activation of the
monocyte/macrophage series, which can occur as the result of
xanthine-oxidase-derived oxygen radical activity.
[0318] IL-1 was discovered in the 1940s and was initially shown to
produce fever when injected into animals. In the early 1970s, IL-1
was found to have a variety of other biological effects when
injected into animals including neutrophilia, heightened
antimicrobial responses, increased synthesis of hepatic acute phase
reactants, and induction of colony stimulating factors. It was also
found to boost T-cell response to mitogens in culture and to
function as an adjuvant.
[0319] Cloning studies have demonstrated that IL-1 is a
three-member family consisting of IL-1 alpha, IL-1 beta and IL-1ra.
The first two are agonists and the last a receptor antagonist. IL-1
alpha is localized on cell membranes while IL-1 beta is released as
a cytokine and is the form simply referred to in this text. It is
synthesized as a precursor that must be cleaved before it can
become active. The most specific of these enzymes is
interleukin-1beta-converting enzyme (ICE) which is closely related
to the family of enzymes active in the final phases of programmed
cell death.
[0320] IL-1 expression has been demonstrated in areas subjected to
ischemia-reperfusion injury in the retina, liver, skeletal muscle
and intestine. Both IL-1 and TNF expression were similarly
demonstrated in the brain and heart. In the rodent model used by
Hara et al. [76], IL-1 expression reached its peak 30-60 minutes
after reversal of experimental occlusion of the middle cerebral
artery and decreased thereafter.
[0321] Treatment of rat cardiac myocytes with IL-1 induces nitric
oxide synthase transcription and increased expression of the enzyme
by a protein kinase A-dependent pathway. IL-1 was also shown to
induce this enzyme in brain endothelial cells. Similarly IL-1 and
TNF were shown to induce heart and hepatic nitric oxide synthase.
As discussed above, ROS cause genomic damage that induces p53
expression which can result in programmed cell death.
[0322] IL-1 also induces the expression of other proinflammatory
cytokines such as IL-6. In some instances induction is mediated by
the transcription factor NF-.kappa.B which can also mediate the
effects of TNF. The frequently observed synergy between IL-1 and
TNF as well as IL-1 and IL-6 may be explained in part on the basis
of significantly overlapping signal transduction pathways in cell
populations responsive to all three cytokines.
[0323] IL-1ra treatment of rats undergoing hepatic
ischemia-reperfusion injury has been found to reduce TNF
production, tissue injury and mortality [78]. Ischemia was induced
in rat livers by clamping the vessels of the left and middle lobes
for 90 minutes. In one set of experiments, IL-1ra was given
systemically five minutes before ischemia was induced, and TNF
levels were determined in the blood and liver at various time
points after reperfusion had begun. In control animals, TNF levels
in both tissues were found to increase over time as the reperfusion
continued, with the experiment being terminated 41/2 hours from the
initiation of ischemia. In contrast, IL-1ra treatment caused a
decrease in TNF levels in the two tissues. Histologic examination
demonstrated that IL-1ra treatment was associated with
substantially less liver damage compared to controls.
[0324] In a second set of experiments, the unaffected right lateral
and caudate lobes of the liver were removed after the period of
ischemia was completed. Eighty percent of control animals died
compared to 30% of those treated with IL-1ra.
[0325] In similar studies, it was demonstrated that IL-1ra
treatment and naturally occuring IL-1ra protect rat brain tissue
from ischemia-reperfusion injury-induced damage.
[0326] The role of TNF in ischemia-reperfusion injury of the brain
was examined. In one set of experiments, variable doses of TNF were
administered intracerebroventricularly to rats 24 hours before
occluding the middle cerebral artery for 80 or 160 minutes
(transient) or until termination of the experiment 24 hours later
(permanent). In some groups TNF neutralizing antibody was given 30
minutes before the TNF injection. Administration of exogenous TNF
produced a significant dose-dependent increase (32%) in the infact
size caused by permanent occlusion. The high dose of TNF (25 pmol)
caused an increase in the infact size in both transient occlusion
groups of 100% and 34% respectively. All of these effects of
exogenous TNF were abrogated in the animal that received
pretreatment with the TNF antibody.
[0327] In yet another set of experiments, the effects of blocking
endogenous TNF was evaluated by blocking TNF function with either a
neutralizing antibody or a soluble TNF receptor (sTNF-RI) given 30
minutes before or 3 or 6 hours after permanent occlusion. Blocking
TNF function before or after occlusion resulted in an up to 26%
reduction in infact size depending on the inhibitor dose.
[0328] TNF has been shown to partially mediate liver damage
associated with the reperfusion phase of ischemia-reperfusion
injury. Hepatic TNF production was responsible for neutrophil
sequestration and activation in the affected area, leading to the
release of ROS. Passive immunization with neutralizing TNF
antibodies could significantly inhibit these pathogenic effects. It
has also been shown that TNF administered to cultured hepatocytes
enhances the cytotoxicity of ROS given at the same time. Similarly,
neutralizing TNF antibodies were shown to reduce cardiovascular
effects and improve survival rate after acute ischemia-reperfusion
injury was induced by a 45-minute occlusion of the superior
mesenteric artery in a rat model.
[0329] Septic Shock/SIRS
[0330] Leaving etiology aside, the basic pathophysiologic events
that occur in ischemia-reperfusion injury and septic shock/SIRS are
very similar, but in the former the pathology is localized while in
the latter it is systemic and can terminate in multiple organ
failure beginning with the lungs. Key elements in both groups of
disorders are ROS, nitric oxide, IL-1, TNF, and programmed cell
death.
[0331] Most of the experimental studies in this field involve
septic shock because of the ease with which the syndrome can be
induced using bacteria or bacterial products. The pathophysiologic
changes uncovered in these studies associated with septic
shock/SIRS in patients demonstrate that the syndrome is driven by a
cascade of proinflammatory mediators. It is generally agreed that
this cascade is initiated by IL-1 and TNF which are initially
released from macrophages and other inflammatory cells. IL-1 is
also produced by a wide variety of other cell types and most of the
cells in the body have receptors for IL-1. IL-1 production has been
shown to be stimulated by ROS and TNF and both of these cytokines
promote ROS production. In septic shock, IL-1 and TNF production
results from the action of endotoxin and other bacteria products.
The high expression of these two factors along with ROS leads to
the excessive production of a wide variety of secondary mediators
including IL-6, IL-8, gamma-interferon, prostaglandin I.sub.2,
thromboxane A.sub.2, prostaglandin E.sub.2, transforming growth
factor beta, platelet activating factor, bradykinin, angiotensin,
and vasoactive intestinal peptide. These factors contribute to the
pathological cardiovascular, hemodynamic and coagulation and other
changes associated with this syndrome.
[0332] TNF was the first cytokine to be linked to the septic
shock/SIR syndrome, when it was demonstrated that its
overproduction is an antecedent to shock and death. Soon after IL-1
was shown to be similarly toxic and was synergistic when given with
TNF. As a result otherwise nonlethal amounts of TNF and IL-1 when
combined, produced lethal shock in animals.
[0333] Following an inflammatory insult, TNF is the first cytokine
to appear in the circulation followed by IL-1. In volunteers
injected with endotoxin, for example, TNF levels peak 60-90 minutes
after the insult and return to baseline within three hours. IL-1
levels plateau 3-4 hours after treatment. These general
observations and the finding that TNF can induce IL-1 production
have contributed to the notion that TNF is the initial cytokine
that begins the septic shock/SIR syndrome whereas IL-1 is more
involved with its continuation.
[0334] Measurement of serum IL-6 levels, which is induced by both
TNF and IL-1, has been suggested as a better measure of TNF and
IL-1 production than a direct measurement of these cytokines. IL-6
levels in the circulation often directly correlate with the
severity of disease in patients with trauma, sepsis and septic
shock/SIRS. Unlike IL-1 and TNF, however, IL-6 administration does
not induce inflammation or septic shock/SIRS and inhibitors of IL-6
do not prevent the lethal effects of this syndrome.
[0335] A large body of additional evidence supports the notion
these mediators play a critical role in the pathogenesis of this
syndrome. Casey et al. [77], for example, examined the correlation
between the various factors involved in septic shock and the
outcome for 97 patients, 57 of which either had full blown septic
shock or were hypotensive which is an early indicator of impending
septic shock/SIRS. The survival rate for this group of patients was
54%. The strongest positive correlation was between plasma IL-6
levels and mortality and the second strongest was with the IL-1
levels. IL-1 is usually undetectable in normal subjects (<40
pg/ml). There was no correlation between TNF, and endotoxin levels
and death. The lack of correlation with TNF was ascribed to the
fact this cytokine is only produced in the earliest stages of the
factor cascade and it has a short half-life. Elevated TNF levels,
however, did correlate with the presence of gram positive
sepsis.
[0336] The proinflammatory cytokines involved in septic shock/SIRS,
particulary TNF, activate the coagulation and complement cascades
which causes neutrophil activation with the release of ROS. Nitric
oxide synthase is induced by IL-1 and TNF in both endothelial cells
and inflammatory cells. Activated neutrophils consume oxygen in the
so called respiratory burst forming the super oxide ion that reacts
with nitric oxide to from peroxynitrite that decomposes to from the
hightly toxic hydroxyl ROS. ROS, especially superoxide, generate
chemotactic factors when they react with a plasma precursor in a
self-amplifying process.
[0337] Patients with septic shock/SIRS have responded favorably to
treatment with anti-oxidants confirming the importance of ROS in
the pathogenesis of this syndrome. A marked reduction in mortality
rate, for example, has been seen in patents with the sepsis-related
acute respiratory distress syndrome (ARDS) following treatment with
a four anti-oxidant combination treatment. ARDS refers to the
lung-failure related pathophysiology that is the first of the
multiple organ failures that characterisze the terminal phase of
septic shock/SIRS. Similarly, in another study patients with ARDS
given the antioxidant n-acetyl cysteine showed improved lung and
cardiac function including changes in pulmonary vascular
resistance, cardiac output and oxygen delivery.
[0338] The mechanistic understanding of septic shock/SIRS that has
developed based on these and a large body of additional data
strongly suggests that this syndrome could be prevented by agents
that block TNF and IL-1 production. IL-1 neutralizing antibodies
have been shown to ameliorate the septic shock syndrome in animal
models. Recombinant IL-1ra administration, however, has been the
most frequently used approach for blocking IL-1 function in animal
models of septic shock/SIRS [78].
[0339] Simultaneous treatment of rabbits, for example, with
adequate amounts of IL-1ra followed by normally lethal quantities
of endotoxin result in only mild and transient hypotension and
decreased neutrophil infiltration into tissues. IL-1ra has also
been demonstrated to prevent the death of rats infected with K.
pneumoniae and from E. coli peritonitis.
[0340] The ability of IL-1ra infusion to attenuate subsequent
lethal E. coli septic shock in baboons has been studied. When given
in excess in the range of 10.sup.3 to 10.sup.4 fold with respect to
IL-1 levels, IL-1ra prevented a sustained IL-1 response, although
no effect on the initial production of the cytokine was seen,
resulting in a 100% survival rate at 24 hours vs. 43% in placebo
treated controls.
[0341] Many reports have provided evidence that TNF neutralizing
antibodies and soluble TNF receptors can protect animals from
otherwise lethal injections of bacterial toxins, such as endotoxin,
that can induce septic shock. To be beneficial, however, these
treatments have to be given before or during the infusion of
endotoxin or bacteria.
[0342] The role of TNF in the initiation of septic shock has also
been investigated using TNF-1 receptor knockout mice. These mice
were shown to not respond to doses of TNF that produces a lethal
septic shock syndrome in normal mice. The knockouts also did not
respond to normally lethal doses of endoxin if they were pretreated
with D-galactosamine and agent that sensitizes animals to the toxin
by blocking its metabolism by the liver. There were no differences
between the normal mice and the knockouts in terms of the plasma
levels of TNF induced by endotoxin. Following a sublethal challenge
with endotoxin, the levels of IL-6 released in to the circulation
were found to be dramatically less in the knockout mice compared to
controls. Finally, macrophages from knockout mice have been shown
to be severely limited in their capacity to produce nitric oxide by
the inducible nitric oxide synthase pathway. In contrast, mice with
an IL-6 deletion showed no such deficit.
[0343] As many as six TNF antagonists under development by five
different companies for the treatment of septic shock have been in
Phase II-III clinical trials at one time. Four of these inhibitors
were neutralizing antibodies and two were soluble recombinant TNF
receptors. None of these products has has distinguished itself as a
viable treatment for this syndrome. TNF antagonists including
neutralizing antibodies, however, are not intrinsically without
efficacy in patients because they have subsequently shown
substantial promise in clinical trials for the treatment of
rheumtoid arthritis.
[0344] Clearly, attempts over the last ten years to develop new
treatments for septic shock/SIRS have resulted in many
disappointments. Pruitt et al. [78] have summarized a number of the
reasons put forth by numerous investigators for why the cytokine
inhibitor trials have failed. Perhaps the single greatest obstacle
to success relates to the cost of the existing cytokine inhibitors.
Their high price precludes them from being used prophylactically.
For example, as pointed out by Pruitt et al. [78], to sustain a
therapeutic plasma concentration of 10-15 micrograms/ml, IL-1ra has
to be given at concentrations of 1.5-2.0 mg/kg/hr of about 2.5
grams per day for as long as the patient is septic.
[0345] Consequently, patients who receive IL-1 or TNF inhibitors
are already symptomatic. Yet our understanding of the pathogenesis
of this syndrome strongly suggests that IL-1 and particularly TNF
function must be blocked at the very initiation of the cascade of
excessive proinflammatory cytokine release that has a major role in
driving the syndrome forward. Again, animal studies have
convincingly shown that to be effective IL-1 and TNF must be given
prior to or simultaneously with the inflammatory insult that
engenders the septic shock/SIR syndrome.
[0346] In the Synergen Inc. Phase II trial, for example, IL-1ra was
given 9 hours on average after a patient was judged a suitable
candidate for study [79]. As a result, numerous patients entered
into the trial had developed a septic response 24 or more hours
before the initiation of the IL-1ra infusion. Thus for many
patients the proinflammatory cascade is well advanced by the time
the attempt to block IL-1 function was begun.
[0347] Positive responses in the IL-1ra clinical trials may have
also been obscured by the use of the 28 day all-cause mortality
criterion. A re-evaluation of the Phase II and first Phase III
trial data reveals that the major benefits obtained from the IL-1ra
infusion occurred 3-7 days after treatment [78]. Survival curves
were subsequently essentially parallel. This finding could reflect
the very short half-life of IL-1ra. The beta-phase half-life of
IL-1ra in septic primates, for example, is approximately 21
minutes. Similarly, the half-lives of IL-1 and TNF are measured in
minutes to hours. It is not surprising, therefore, that mortality
after the first week following IL-1ra infusion is irrelevant to
assessing the value of the therapy.
[0348] Yet another problem with the IL-1ra clinical trials, which
is generally applicable to systemically administered inhibitors of
IL-1 or TNF, comes from the practice of determining the dose of the
cytokine inhibitor based on the plasma concentration of the
cytokine. The reason is that local tissue concentration of these
cytokines can be much higher than what is present in plasma. In
patients with ARDS, for example, IL-1 concentrations in the lungs
have been shown to be as high as 15 ng/ml while the plasma
concentrations are under 100 pg/ml.
[0349] Thus the septic shock/SIRS data and current understanding of
the syndrome supports the development of novel therapies which can
(1) block IL-1 and TNF and be sufficiently inexpensive to be given
prophylactically to at risk patients; and (2) prevent the
programmed cell death that is a major contributing factor to the
organ failure that causes the many deaths associated with this
syndrome.
[0350] Accordingly, CRAAs are described herein which will stimulate
the immune production of catalytic antibodies specfic for TNF and
IL-1. These antibodies may be administered using protocols already
developed for immunotherapies based on the administration of other
known monoclonal antibodies. As the antibodies of the present
invention act catalytically, the dosage will be much lower than
antibodies with bind reversibly and stoichiometrically.
Accordingly, the cost of prophylactic treatment for patients at
risk for the syndrome will be greatly reduced. An exemplary CRAA
for eliciting catalytic antibodies to TNF.alpha. is shown in FIG.
15. Exemplary CRAAs for eliciting catalytic antibodies to IL1.beta.
are shown in FIGS. 16 and 17. A boronate electrophillic center is
shown in FIG. 17.
EXAMPLE IV
Passive Immunization with the Catalytic Antibodies of the Present
Invention
[0351] There are many areas in medicine where monoclonal antibody
administration is providing clinical benefit. In the field of organ
transplantation, a MoAb (OKT3) which binds to the T cell receptor
has been employed to deplete T cells in vivo. Additionally, MoAbs
are being used to treate graft v. host disease with some success. A
clinical trial has been established which is assessing the ability
of anti-CD4 moAB to deplete a subset of T cells in the treatment of
multiple schlerosis.
[0352] Accordingly, methods of administration of monoclonal
antibodies are well known to clinicians of ordinary skill in the
art. An exemplary method and dosage schedule are provided in a
phase III, randomized, controlled study of chemotherapy alone or in
combination with a recombinant moAB to the oncogene HER2.
[0353] All patients randomized to the recombinant humanized MoAb
Her2 arm of the study will receive treatment as a 4 mg/kg I.V.
loading dose on Day 0 (the first day of the MoAb HER2 infusion, or
the day of randomization for patients in the control group), then
weekly as a dose of 2 mg/kg I.V. through out the course of the
study. All patients will be monitored during each study visit by a
clinical assessment, a symptom directed physical examination (if
appropriate) and laboratory tests. Routine tumor evaluations will
be conducted for all patients at prescribed intervals during the
study. All adverse events will be recorded.
[0354] The administration of the catalytic antibodies of the
present invention will be done as described above for the HER2
monoclonal antibody. As in the HER2 study, following infusion,
patients will be assessed to determine the efficacy of the
administered catalytic antibody.
[0355] Should the catalytic antibodies administered as above give
rise to undesirable side effects in the patient, the immunizing
CRAAs will be administered to covalently inhibit the action of the
catalytic antibodies.
EXAMPLE V
Active Immunization Using the CRAAS of the Present Invention
[0356] Active immunization will be done using previously developed
methods with vaccines designed to elicit protective antibody
responses against the desired antigens [82, 83]. For example, the
CRAAs mixed with a suitable adjuvant formulation such as alum can
be admimistered intramuscularly at a dose optimized for maximum
antibody synthesis (100-1000 .mu.g/kg body weight), and two or
three booster injectijns can be administed at 4 week intervals,
until the catalytic antibody concentration in the serum reaches
plateau levels. The protective immunity so generated is anticipated
to last for several years, because vaccination will result in
formation of specific, long lived memory cells that can be
stimulated to produce antibodies upon exposure to the offending
organism or cancer cell. Descriptions and methods to determine the
catalytic antibody concentrations are set forth in Examples I and
II. Because antibody synthetic response to most antigens are T cell
dependent, an appropriate T cell epitope can be incorporated into
the immunogen by peptide synthesis, as described in the case of the
gp120, Example II. Alternatively, a carrier such as keyhole limpet
hemocyanin can be conjugated to the CRAA via coupling through lys
side chain amino groups or Cys side chain sulfahydryl groups to
maximize the antibody response if necessary.
REFERENCES
[0357] 1. Paul, S., Volle, D. J., Beach, C. M., Johnson, D. R.,
Powell, M. J. and Massey, R. J. Catalytic hydrolysis of vasoactive
intestinal peptide by human autoantibody. Science 244:1158-1162,
1989.
[0358] 2. Paul, S., Sun, M., Mody, R., Eklund, S. H., Beach, C. M.,
Massey, R. J. and Hamel, F. Cleavage of vasoactive intestinal
peptide at multiple sites by autoantibodies. J. Biol. Chem.
256:16128-16134, 1991.
[0359] 3. Suzuki, H., Imanishi, H., Nakai, T. and Konishi, Y. K.
Human autoantibodies that catalyze the hydrolysis of vasoactive
intestinal polypeptide. Biochem. (Life Sci. Adv.) 11:173-177,
1992.
[0360] 4. Li, L., Kaveri, S., Tyutyulkova, S., Kazatchkine, M. and
Paul, S. Catalytic activity of anti-thyroglobulin antibodies. J.
Immunol. 154:3328-3332, 1995.
[0361] 5. Shuster, A. M., Gololobov, G. V., Kvashuk, O. A.,
Bogomolova, A. E., Smirnov, I. V. and Gabibov, A. G. DNA
hydrolyzing autoantibodies. Science 256:665-667, 1992.
[0362] 6. Gololobov, G. V., Chernova, E. A., Schourov, D. V.,
Smirnov, I. V., Kudelina, I. A. and Gabibov, A. G. Cleavage of
supercoiled plasmid DNA by autoantibody Fab fragment: Application
of the flow linear dichroism technique. Proc. Natl. Acad. Sci. USA
92:254-257, 1995.
[0363] 7. Tawfik, D., Chap, R., Green, B., Sela, M. and Eshhar, Z.
Unexpectedly high occurrence of catalytic antibodies in MRL/lpr and
SJL mice immunized with a transition state analog. Is there a
linkage to autoimmunity? Proc. Natl. Acad. Sci. USA 92:2145-2149,
1995.
[0364] 8. Davies, D. R. and Chacko, S. Antibody Structure. Acc.
Chem. Res. 26:421-427, 1993.
[0365] 9. Sun, M., Gao, Q-S., Li, L. and Paul, S. Proteolytic
activity of an antibody light chain. J. Immunol. 153:5121-5126,
1994.
[0366] 10. Gao, Q-S., Sun, M., Tyutyulkova, S., Webster, D., Rees,
A., Tramontano, A., Massey, R. and Paul, S. Molecular cloning of a
proteolytic antibody light chain. J. Biol. Chem. 269:32389-32393,
1994.
[0367] 11. Titmas, R. C., Angeles, T. S., Sugasawara, R., Aman, N.,
Darsley, M. J., Blackburn, G. and Martin, M. T. Aspects of
antibody-catalyzed primary amide hydrolysis. Appl. Biochem.
Biotechnol. 47:277-290, 1994.
[0368] 12. Gao, Q.-S., Sun, M., Rees, A. and Paul, S. Site-directed
mutagenesis of proteolytic antibody light chain. J. Mol. Biol.
253:658-664, 1995.
[0369] 13. Lerner, R. A., Benkovic, S. J. and Schultz, P. G. At the
crossroads of chemistry and immunology: Catalytic antibodies.
Science 252:659-667, 1991.
[0370] 14. Tyulkova, S., Gao, Q-S., Thompson, A., Rennard, A. and
Paul, S. light chains selected from an asthma patient by phage
display. Biochem. Biophys. Acta. 1316:217-223, 1996.
[0371] 15. Batra, S. K., Rasheed, A., Bigner, S. H. and Bigner, D.
D. Oncogenes and anti-oncogenes in human central nervous system
tumors. Lab. Invest. 71:621-637, 1994.
[0372] 16. Modjtahei, H., Ecc les, S. A., Box, G., Styles, J. and
Dean, J. Antitumor activity of combinations of antibodies directed
against different epitopes on the extracellular domain of the human
EGF receptor. Cell Biophys. 22:129-146, 1993.
[0373] 17. Modjtahedi, H., Eccles, S., Sandle, J., Box, G., Titley,
J. and Dean, C. Differentiation or immune destruction: two pathways
for therapy of squamous cell carcinomas with antibodies to the
epidermal growth factor receptor. Cancer Res. 54:1695-1701,
1994.
[0374] 18. Wikstrand, C. J., Hale, L. P., Batra, S. K., Hill, M.
L., Humphrey, P. A., Kurpad, S. N., McLendon, R. E., Moscatello,
D., Pegram, C. N., Reist, C. J., Traweek, S. T., Wong, A. J.,
Zalutsky, M. R. and Bigner, D. D. Monoclonal antibodies against
EGFRvIII are tumor specific and react with breast and lung
carcinomas and malignant gliomas. Cancer Res. 55:3140-3148,
1995.
[0375] 19. Faillot, T., Magdelenat, H., Mady, E., Stasiecki, P.,
Fohanno, D., Gropp, P., Poisson, M. and Delattre, J. Y. A phase I
study of an anti-epidermal growth factor receptor monoclonal
antibody for the treatment of malignant gliomas. Neurosurgery
39:478-83, 1996.
[0376] 20. Stragliotto, G., Vega, F., Stasiecki, P., Gropp, P.,
Poisson, M. and Delattre, J. Y. Multiple infusions of
anti-epidermal growth factor receptor (EGFR) monoclonal antibody
(EMD 55,900) in patients with recurrent malignant gliomas. Eur. J.
Cancer 32A:636-40, 1996.
[0377] 21. Nagane, M., Coufal, F., Lin, H., Bogler, O., Cavenee, W.
K. and Huang, H. H. A common mutant epidermal growth factor
receptor confers enhanced tumorigenicity on human glioblastoma
cells by increasing proliferation and reducing apoptosis. Cancer
Res. 56:5079-5086, 1996.
[0378] 22. Brown, P. M., Debanne, M. T., Grothe, S., Bergsma, D.,
Caron, M., Kay, C. and O'Connor-McCourt, M. D. The extracellular
domain of the epidermal growth factor receptor. Studies on the
affinity and stoichiometry of binding, receptor dimerization and a
binding-domain mutant. Eur. J. Biochem. 225:223-233, 1994.
[0379] 23. Sampson, N. S. and Barton, P. A. Peptidic Phophonylating
agents as irreversible inhibitors of serine proteases and models of
the tetrahedral intermediates. Biochemistry 30:22255-2263,
1991.
[0380] 24. Baylis, E. K., Campbell, C. D., and Dingwall, J. G.
1-aminoalkylphoshonous acids. Part 1. Isosteres of the protein
amino acids J. Chem. Soc. Perkin Trans. Part I: 2845-2853, 1984
[0381] 25. Tyutyulkova, S., Gao, Q-S. and Paul, S. Selection of
human immunoglobulin light chains from a phage display library.
Antibody Engineering Protocols. Ed., Paul S. (Methods in Molecular
Biology Series, Humana Press, Totowa, N.J.) 51:377-394,1995.
[0382] 26. Clackson, T., Hoogenboom, H. R., Griffiths, A. D. and
Winter, G. Making antibody fragments using phage display libraries.
Nature 352:624-628, 1991.
[0383] 27. McAfferty, J., Fitzgerald, K. J., Earnshaw, J.,
Chiswell, J., Chiswell, D. J., Link, J., Smith, R. Kenten, J.
Selection and rapid purification of murine antibody fragments that
bind a transition state analog yb phage display. Appl. Biochem.
Biotechnol. 47:157-174, 1994.
[0384] 28. Sun, M., Mody, B., Eklund, S. H. and Paul, S. VIP
hydrolysis by antibody light chains. J. Biol. Chem.
266:15571-15574, 1991.
[0385] 29. Bone, R., Sampson, N. S., Bartlett, P. A. and Agard, D.
A. Crystal structures of a-lytic proteaase complexes with
irreversibly bound phophonate esters. Biochemistry 30:2263-2272,
1991.
[0386] 30. Lax, I., Fischer, R., Ng, C., Segre, J., Ullrich, A.,
Givol, D. and Schlessinger, J. Noncontiguous regions in the
extracellular domain of EGF receptor define ligand-binding
specificity. Cell Regul. 2:337-345, 1991.
[0387] 31. Moore, J. and Trkola, A. HIV type 1 coreceptors,
neutralization serotypes, and vaccine development. AIDS Res. Hum.
Retroviruses 13:733-736, 1997
[0388] 32. Thali, M., Furman, C., Ho, D., Robinson, J., Tilley, S.,
Pinter, A. and Sodroski, J. Discontinuous, conserved neutralization
epitopes overlapping the CD4-binding region of human
immunodeficiency virus type 1 gp120 envelope glycoprotein. J.
Virol. 66:5635-5641, 1992.
[0389] 33. Wang, W-K., Essex, M. and Lee, T-H. The highly conserved
aspartic acid residue between hypervariable regions 1 and 2 of
human immunodeficiency virus type 1 gp120 is important for early
stages of virus replication. J. Virol. 69:538-542, 1995.
[0390] 34. Ivanoff, L. A., Dubay, J. W., Morris, J. F., Roberts, S.
J., Gutshall, L., Sternberg, E. J., Hunter, E., Matthews, T. J. and
Petteway, S. R. J. V3 loop region of the HIV-1 gp120 envelope
protein is essential for virus infectivity. Virology 187:423-432,
1992.
[0391] 35. Pollard, S., Meier, W., Chow, P., Rosa, J. and Wiley, D.
CD4-binding regions of human immunodeficiency virus envelope
glycoprotein gp120 defined by proteolytic digestion. Proc. Natl.
Acad. Sci. USA 88:11320-11324, 1991.
[0392] 36. Kalaga, R., Li, L., O'Dell, J. and Paul, S. Unexpected
presence of polyreactive catalytic antibodies in IgG from
unimmunized donors and decreased levels in rheumatoid arthritis. J.
Immunol. 155:2695-2702, 1995.
[0393] 37. Watanabe-Fukunaga, R., Brannan, C. I., Copeland, N. G.,
Jenkins, N. A. and Nagata, S., Lymphoproliferation disorder in mice
explained by defects in Fas antigen that mediates apoptosis. Nature
356:314-317, 1992.
[0394] 38. Tramontano, A., Janda, K. D. and Lerner, R. A. Chemical
reactivity at an antibody binding site elicited by mechanistic
design of a synthetic antigen. Proc. Natl. Acad. Sci. USA
83:6736-6740, 1986.
[0395] 39. Bermas, B. L., Petri, M., Berzofsky, J. A., Waisman, A.,
Shearer, G. M. and Mozes, E. Binding of glycoprotein 120 and
peptides from the HIV-1 envelope by autoantibodies in mice with
experimentally induced systemic lupus erythematosus and in patients
with the disease. AIDS Res. Hum. Retrovir. 10:1071-1077, 1994.
[0396] 40. Paul, S., Li, L., Kalaga, R., Wilkins-Stevens, P.,
Stevens, F. J. and Solomon, A. Natural catalytic antibodies:
Peptide hydrolyzing activities of Bence Jones proteins and V.sub.L
fragment. J. Biol. Chem. 270:15257-15261, 1995.
[0397] 41. Pollack, S. J., Hsiun, P. and Schultz, P. G.
Sterospecific hydrolysis of alkyl esters by antibodies. J. Am.
Chem. Soc. 111:5962-5964, 1989.
[0398] 42. Ahlers, J. D., Pendleton, C. D., Dunlop, N., Minassian,
A., Nara, P. L. and Berzofsky, J. A. Construction of an HIV-1
peptide vaccine containing a multideterminant helper peptide linked
to a V3 loop peptide 18 inducing strong neutralizing antibody
responses in mice of multiple MHC haplotypes after two
immunizations. J. Immunol. 150:5647-5665, 1993.
[0399] 43. Panina-Bordignon, P., Tan, A., Termijtelen, A., Demotz,
S., Corradin, G. and Lanzavecchia, A. Universally immunogenic T
cell epitopes: promiscuous binding to human MHC class II and
promiscuous recognition by T cells. Eur. J. Immunol. 19:2237-2242,
1989.
[0400] 44. Ahlers, J. D., Dunlop, N. Alling, D. W., Nara, P. L. and
Berzofsky, J. A. Cytokine-in-adjuvant steering of the immune
response phenotype to HIV-1 vaccine constructs. J. Immunol.
158:3947-3958, 1997.
[0401] 45. Sattentau, Q. J. and Moore, J. P. Human Immunodeficiency
Virus Type 1 Neutralization Is Determined by Epitope Exposure on
the gp120 Oligomer. J. Exp. Med. 182:185-196, 1995.
[0402] 46. Bone R., Balk R., Cerr F (1992). Definitions for sepsis
and organ failure and guidelines for the use of innovative
therapies in sepsis. The ACCP/SCCM consensus conference committee.
American college of chest physicians/society of critical care
medicine. Crit Care Med 20, 864-874.
[0403] 47. Parks D & Granger D. (1986a). Contributions of
ischemia and reperfusion to mucosal lesion formation. Am J Physiol
250, G749-G753.
[0404] 48. Parks D. & Granger D. (1986b). Xanthine oxidase:
biochemistry, distribution, and physiology. Acta Physiol Scand 548,
87-100.
[0405] 49. Carden D., Smith J. & Korthuis R. (1990).
Neutrophil-mediated microvascular dysfunction in postischemic
canine skeletal muscle: role of granulocyte adherence. Circ Res 66,
1436-1444.
[0406] 50. Grisham M. Hernandex L. & Granger D., (1989).
Adenosine inhibits ischemia-reperfusion induced leukocyte adherence
and extravasation. Am J Physiol 257, H1334-H1339.
[0407] 51. Jerome S., Smith C. & Korthuis R. (1993).
CD18-dependent adherence reactions play an important role in the
development of the no-reflow phenomenon. Am J Physiol 263,
H1637-H1642.
[0408] 52. Morris J., Haglund U. & Bulkley G. (1987). The
protection from postischemic injury by xanthine oxidase inhibition:
blockade of free radical generation or purine salvage. Gastroen, 92
1542-1547.
[0409] 53. Charriaut-Marlangue E., Margaill I., Represa A.,
Popovici T., Plotkine M. & Ben-Ari (1996). Apoptosis and
necrosis after reversible focal ischemia: an in situ DNA
fragmentation analysis. J Cereb Blood Flow Metab 16:186, 33-41.
[0410] 54. Johnson E., Greenlund L., Akins P. & Hsu C. (1995).
Neuronal apoptosis: current understanding of moleular mechanisms
and potential role in ischemia brain injury. J Neurotrauma 12,
843-852.
[0411] 55. Li Y., Chopp M., Jiang N., Yao F. & Zaloga E. (1995)
Temporal profile of in situ DNA fragmentation after transient
middle cerebral artery occlusion in the rat. Cereb Blood Flow Metab
15, 389-397.
[0412] 56. Hearse D. (1977). Reperfusion of ischemic myocardium. J
Mol Cell Cardio 9, 605-615.
[0413] 57. Hearse D., Humphrey R. & Chain E. (1973). Abrupt
reoxygenation of the anoxic potassium arrested rat heart: a study
of myocardial enzyme release. J Mol Cell Cardio 5, 395-407.
[0414] 58. Korthuis R., Smith J. & Carden D. (1989). Hypoxic
reperfusion attneuates postischemic microvascular injury. Am J
Physio 256, H315-H319.
[0415] 59. Perry M. & Wadhaw S. (1988). Gradual reintroduction
of oxygen reduces reperfusion injury in cat stomach. Am J Physiol
254, 366-372.
[0416] 60. Walker P., Lindsay T., Labbe R., Mickle D. &
Romaschine A. (1987). Salvage of skeletal muscle with free radical
scavengers. J Vasc Surg 6, 68-75.
[0417] 61. Wright J., Fox D., Kerr J., Valeri C. & Hobson R.
(1988). Rate of reperfusion blood flow modulates reperfusion injury
in skeletal muscle. J Surg Res 44, 754-759.
[0418] 62. Bolli F., Jeroudi M., Patel B., DuBose C., Lai E.
(1989). Direct evidence that oxygen-derived free radicals
contribute to post ischemic myocardial dysfunction in the intact
dog. Proc Natl Acad Sci USA 86, 4695-4699.
[0419] 63. Bolli R., Patel B., Jeroudi M., Lai E., & McKay P.
(1988). Demonstration of free radical generation in stunned
myocardium of intact dogs with the use of the spin trap
a-phenyl-N-tert-butyl nitrone. J Clin Invest 82, 476-485.
[0420] 64. Burton K. (1988). Evidence of direct toxic effects of
free radicals on the myocardium. Free Rad Bio Med 4, 15-24.
[0421] 65. Gupta M. & Singhal P. (1989). Time course of
structure, function, and metabolic changes due to an exogenous
source of oxygen metabolites in the rat heart. Can J Physiol
Pharmcol 67, 1549-1559.
[0422] 66. Parks D., Shah A. & Granger D. (1984). Oxygen
radicals: effects on intestinal vascular permeability. Am J Physiol
247, G167-G170.
[0423] 67. Przyklenk K., Whittaker P. & Kloner R. (1990). In
vivo infusion of oxygen free radical substrates causes myocardial
systolic, but not diastolic, dysfunction. Am Heart J 119,
807-815.
[0424] 68. Downey J. (1990). Free radicals and their involvement
during long term myocardial ischemia and reperfusion. Annu Rev
Physiol 52, 487-504.
[0425] 69. Granger D. (1988). Role of xanthine oxidase and
granulocytes in ischemia-reperfusion injury. Am J Physiol 255,
H1269-H1275.
[0426] 70. Chien K & Han A. (1984). Accumulation of
unesterified arachidonic acid in ischemic canine myocardium:
relationship to a phophatidylcholine deacylation reacylation cycle
and the depletion of membrane phospholipids. Circ Res 54,
312-322.
[0427] 71. Moncada S. & Higgs A. (1993). The L-argine-nitric
oxide pathway. N Engl J Med 329, 2002-2012.
[0428] 72. Patel V., Yellow D., Singh K., Neild G. & Woolfson
R. (1993). Inhibition of nitric oxide limits infarct size in the in
situ rabbit heart. Biochem Biophys Res Commun 194, 234-238.
[0429] 73. Depre C., Vanoverschelde J., Goudemant J., Mottet I.
& Hue L. (1995). Protection against ischemic injury by
nonvasoactive concentrations of nitric oxide synthase inhibitors in
the perfused rabbit heart. Circulation 92:7, 1911-1918.
[0430] 74. Naseem S., Kontos M., Rao P., Jesse R., Hess M. &
Kukreja R. (1995). Sustained inhibition of nitric oxide by
NG-nitro-L-arginine improves myocardial function following
ischemia/reperfusion in isolated perfused rat heart. J Moll Cell
Cardio 27, 419-426.
[0431] 75. Noiri E., Peresleni T., Miller F. & Goligorsky M.
(1996). In vivo targeting of inducible NO synthase with
oligodeoxynucleotides protects rat kidney against ischemia. J Clin
Invest 97:10, 2377-2383.
[0432] 76. Hara H., Friedlander R., Gagliardini V., Ayata C., Fink
K., Huang Z., Shimizu-Sasmata M., Yuan J. & Moskowitz. (1997).
Inhibition of interleukin 1B converting enzyme family proteases
reduces ischemic and excitotoxic neuronal damage. Proc Natl Acad
Sci USA 94, 2007-2012.
[0433] 77. Szabolcs M., Michler R., Yang X., Aji W., Roy D., Athan
E., Sciacca R., Minanov O. & Cannon P. (1996). Apoptosis of
cardiac myocytes during cardiac allograft rejection: relation to
induction of nitric oxide synthase. Circulation 94:7,
1665-1673.
[0434] 78. Shito M., Wakabayashi G., Ueda M., Shimazu M., Shirasugi
N., Endo M., Mukai M. & Kitajima M. (1997). Interleukin 1
receptor blockade reduces tumor necrosis factor production, tissue
injury, and mortality after hepatic ischemia-reperfusion in the
rat. Transplant 63:1, 143-148.
[0435] 79. Casey L, Balk R., & Bone R. (1993). Plasma cytokine
and endotoxin levels correlate with survival in patients with the
sepsis syndrome. Ann Intern Med 119, 771-778.
[0436] 80. Pruitt J., Copeland E. & Moldawer L. (1995).
Interleukin-1 and interleukin-1 antagonism in sepsis, systemic
inflammatory response syndrone, and septic shock. Shock 3:4,
235-251.
[0437] 81. Fisher C., Slotman G., Opal S., Pribble J., Bone R.,
Emmanuel G., Ng D., Bloedow D. & Catalano M. (1994b). Initial
evaluation of human recombinant interleukin-1 receptor antagonist
in the treatment of sepsis syndrome: a randomized, open-label,
placebo-controlled multicenter trial. The IL-1RA sepsis syndrome
study group. Crit Care Med 22, 12-21.
[0438] 82. Robinson, A., Farrar, G. H, Wiblin, C. N., Methods in
Molecular Medicine Humana Press, Totowa, N.J., 1996.
[0439] 83. Dudgeon, J. A, Cutting, W. A. M., Chapman, Hall,
Immunization: Principles and Practice, London 1991. While certain
of the preferred embodiments of the present invention have been
described and specifically exemplified above, it is not intended
that the invention be limited to such embodiments. Various
modifications may be made thereto without departing from the scope
and spirit of the present invention, as set forth in the following
claims.
Sequence CWU 1
1
11 1 16 PRT Human Immunodeficiency Virus-1 1 Lys Gln Ile Ile Asn
Met Trp Gln Glu Val Gly Lys Ala Met Tyr Ala 1 5 10 15 2 15 PRT
Clostridium tetani 2 Gln Tyr Ile Lys Ala Asn Ser Lys Phe Ile Gly
Ile Thr Glu Leu 1 5 10 15 3 9 PRT Homo sapiens 3 Met Glu Glu Asp
Gly Val Arg Lys Cys 1 5 4 6 PRT Homo sapiens 4 Cys Glu Gly Pro Cys
Arg 1 5 5 11 PRT Homo sapiens 5 Lys Gln Ile Ile Asn Met Trp Gln Glu
Val Gly 1 5 10 6 4 PRT Homo sapiens 6 Ala Met Tyr Ala 1 7 7 PRT
Homo sapiens 7 Leu Ala Asn Gly Val Glu Leu 1 5 8 7 PRT Homo sapiens
8 Asp Asn Gln Leu Val Val Pro 1 5 9 7 PRT Homo sapiens 9 Pro Lys
Lys Lys Met Glu Lys 1 5 10 7 PRT Homo sapiens 10 Phe Val Phe Asn
Lys Ile Glu 1 5 11 20 DNA Artificial Sequence Synthetic Sequence 11
ccctgctccc ccctggctcc 20
* * * * *