U.S. patent application number 10/801986 was filed with the patent office on 2005-09-22 for methimazole derivatives and tautomeric cyclic thiones to inhibit cell adhesion.
Invention is credited to Dagia, Nilesh, Giuliani, Cesidio, Goetz, Douglas, Hari, Norikazu, Kohn, Leonard D., Lewis, Chris, Napolitano, Giorgio.
Application Number | 20050209295 10/801986 |
Document ID | / |
Family ID | 34987186 |
Filed Date | 2005-09-22 |
United States Patent
Application |
20050209295 |
Kind Code |
A1 |
Kohn, Leonard D. ; et
al. |
September 22, 2005 |
Methimazole derivatives and tautomeric cyclic thiones to inhibit
cell adhesion
Abstract
The present invention relates to novel compounds and methods of
use for inhibition and prevention of cell adhesion and cell
adhesion-mediated pathologies. This invention also relates to
pharmaceutical formulations comprising these compounds and methods
of using them for inhibition and prevention of cell adhesion and
cell adhesion-mediated pathologies. The compounds and
pharmaceutical compositions of this invention can be used as
therapeutic or prophylactic agents. In particular, methimazole
derivatives and tautomeric cyclic thiones have the ability to
inhibit the adhesion and the migration of leukocytes. In addition
to being active anti-inflammatories, the methimazole derivatives
and tautomeric cyclic thiones and their physiologically tolerable
salts, derivatives and prodrugs are generally suitable for the
treatment (i.e., for the therapy and prophylaxis) of diseases that
are based on the interaction between VCAM-1 and its ligands or can
be influenced by an inhibition of this interaction. In particular,
the methimazole derivatives and tautomeric cyclic thiones are
suitable for the treatment of diseases that are caused at least
partly by an undesired extent of leukocyte adhesion and/or
leukocyte migration or are connected therewith, and for whose
prevention, alleviation or cure the adhesion and/or migration of
leukocytes should be decreased.
Inventors: |
Kohn, Leonard D.; (Athens,
OH) ; Goetz, Douglas; (Athens, OH) ; Hari,
Norikazu; (Yaminashi, JP) ; Lewis, Chris;
(Athens, OH) ; Giuliani, Cesidio; (Roccamorice,
IT) ; Napolitano, Giorgio; (Pescara, IT) ;
Dagia, Nilesh; (Athens, OH) |
Correspondence
Address: |
FROST BROWN TODD, LLC
2200 PNC CENTER
201 E. FIFTH STREET
CINCINNATI
OH
45202
US
|
Family ID: |
34987186 |
Appl. No.: |
10/801986 |
Filed: |
March 16, 2004 |
Current U.S.
Class: |
514/389 |
Current CPC
Class: |
A61K 31/4166 20130101;
Y02A 50/30 20180101; Y02A 50/411 20180101 |
Class at
Publication: |
514/389 |
International
Class: |
A61K 031/4166 |
Goverment Interests
[0001] This invention was made with government support under Grant
Nos. BES 9733542 (0096303) awarded by the National Science
Foundation and GM57640 (DJG) awarded by the National Institutes of
Health. The government may have certain rights in the invention.
Claims
What is claimed is:
1. A method for inhibiting cell adhesion in a mammal which
comprises administering to the mammal a pharmaceutical composition
comprising a methimazole derivative or tautomeric cyclic thione or
mixtures thereof in an amount effective for prevention, inhibition
or suppression of cell adhesion.
2. A method for the treatment of diseases, disorders, conditions or
symptoms mediated by cell adhesion in a mammal which comprises
administering to the mammal a pharmaceutical composition comprising
a methimazole derivative or tautomeric cyclic thione or mixtures
thereof in an amount effective for prevention, inhibition or
suppression of cell adhesion.
3. The method according to claim 1, wherein the disease or
condition is one or more of acute lung injury, allergic rhinitis,
Alzheimer's disease, arthritis, asthma, atherosclerosis, autoimmune
glomerulonephritis, Behcet's disease, cancer, cerebral infarcts,
chronic hepatitis, cirrhosis, cutaneous anaphylaxis reaction,
cutaneous vasculitides, delayed type hypersensitivity reaction,
diabetes, disseminated intravascular coagulation, eosinophilic
granuloma of the lung, gastritis, giant cell arteritis, Graves'
disease, haemorrhagic shock, hypertensive vascular disease,
hypothyroidism, inflammatory bowel disease (Crohns' disease and
ulcerative colitis), inflammatory dermatoses, intestinal infarcts,
Kawasaki's disease (mucocutaneous lymph node syndrome), lymphoid
interstitial pneumonia, malaria, meningitis, multiple sclerosis,
myocardial infarcts, organ transplantation (host vs. graft and
graft vs. host), polyarteritis nodosa,
polymyositis/dermatomyositis, psoriasis, pulmonary infarcts, renal
infarcts, reperfusion injury following ischemia, Rickettsial
vasculitis, sarcoidosis, sepsis, sjogren's disease, stroke,
systemic lupus erythematosus, thermal injury (burns),
thromboangiitis obliterans (Buerger's disease), thrombosis,
thyroiditis, tuberculosis, vasculitis, and Wegner's
granulomatosis.
4. A method of preventing, inhibiting or suppressing cell adhesion
in a mammal comprising the step of administering to the mammal a
pharmaceutical composition comprising a methimazole derivative or
tautomeric cyclic thione or mixtures thereof in an amount effective
for prevention, inhibition or suppression of cell adhesion, wherein
the cell adhesion is VCAM-1 mediated and a pharmaceutically
acceptable carrier.
5. The method according to claim 4, wherein the cell adhesion is
mediated by VCAM-1 and E-selectin.
6. The method according to claim 5, wherein the cell adhesion is
IRF-1 dependent VCAM-1 mediated cell adhesion.
7. A method of preventing, inhibiting or suppressing
cytokine-induced cell adhesion in a mammal comprising the step of
administering to the mammal a pharmaceutical composition comprising
a methimazole derivative or tautomeric cyclic thione or mixtures
thereof in an amount effective for prevention, inhibition or
suppression of cell adhesion, wherein the cell adhesion is VCAM-1
mediated and a pharmaceutically acceptable carrier.
8. The method according to claim 7, wherein the cell adhesion is
mediated by VCAM-1 and E-selectin.
9. The method according to claim 8, wherein the cell adhesion is
IRF-1 dependent VCAM-1 mediated cell adhesion.
10. The method according to claim 7, wherein the cytokine is
TNF-alpha.
11. The method according to claims 1, 4 or 7, wherein the method is
used for preventing, inhibiting or suppressing cell
adhesion-associated inflammation.
12. The method according to claim 7 wherein the method is used for
preventing, inhibiting or suppressing cytokine-induced cell
adhesion-associated inflammation.
13. The method according to claims 1, 4 or 7, wherein the method is
used for preventing, inhibiting or suppressing cell adhesion
associated with immune or autoimmune responses.
14. The method according to claim 4, wherein the method is used to
treat or prevent a disease selected from the group consisting of
wherein the disease or condition is one or more of adult
respiratory distress syndrome, AIDS, allergy conditions,
arteriosclerosis, arthritis, asthma, atherosclerosis,
cardiovascular diseases, detaching retina, harmful platelet
aggregation, inflammation, inflammatory bowel diseases, multiple
sclerosis, neoplastic diseases, ophthalmic inflammatory conditions,
osteoarthritis, osteoporosis, psoriasis, regional enteritis,
rejection after transplantation, reocclusion following
thrombolysis, reperfusion injury, Sjogren's Syndrome, skin
inflammatory diseases, systemic lupus erythematosus, thrombosis,
Type I diabetes, thyroiditis and wounds.
15. The method according to claim 1, 4 or 7, wherein the
pharmaceutical composition comprises a safe and effective amount of
an active compound selected from: 23wherein Y is selected from the
group consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl, --NO.sub.2, and the phenyl moiety: 24and wherein
no more than one Y group in said active compound may be the phenyl
moiety; R.sup.1 is selected from the group consisting of H, --OH,
C.sub.1-C.sub.4 alkyl, and C.sub.1-C.sub.4 substituted alkyl;
R.sup.2 is selected from the group consisting of H, C.sub.1-C.sub.4
alkyl and C.sub.1-C.sub.4 substituted alkyl; R.sup.3 is selected
from the group consisting of H, C.sub.1-C.sub.4 alkyl,
C.sub.1-C.sub.4 substituted alkyl, and --CH.sub.2Ph; R.sup.4 is
selected from the group consisting of H, C.sub.1-C.sub.4 alkyl, and
C.sub.1-C.sub.4 substituted alkyl; X is selected from S and O; and
Z is selected from --SR.sup.3, --OR.sup.3 and C.sub.1-C.sub.4
alkyl; and wherein at least two of the R.sup.2 and R.sup.3 groups
in said compound are C.sub.1-C.sub.4 alkyl when Y is not a phenyl
moiety, and at least one Y is --NO.sub.2 when Z is alkyl; and a
pharmaceutically-acceptable carrier.
16. The method according to claim 15, wherein Z is selected from
--SR.sup.3 and OR.sup.3.
17. The method according to claim 16, wherein Z is --SR.sup.3 and X
is S.
18. The method according to claim 17, wherein Y is H.
19. The method according to claim 18, wherein R.sup.3 is
C.sub.1-C.sub.4 alkyl.
20. The method according to claim 19, wherein R.sup.3 is
methyl.
21. The method according to claim 20, wherein at least one of the
R.sup.2 groups is methyl.
22. The method according to claim 20, wherein both R.sup.2 groups
are methyl.
23. The method according to claim 15, wherein the active compound
has the formula 25
24. The method according to claim 15, wherein the active compound
has the formula 26
25. The method according to claim 15, wherein the active compound
has the formula: 27
26. The method according to claim 15, wherein the active compound
has the formula: 28
27. The method according to claim 15, wherein the active compound
has the formula: 29
28. The method according to claim 17, wherein one of the Y groups
is the phenyl moiety.
29. The method according to claim 26, wherein R.sup.1 and R.sup.4
are H.
30. The method according to claim 27, wherein R.sup.3 is methyl and
at least one of the R.sup.2 groups is methyl.
31. The method according to claim 28, wherein R.sup.3 is H.
32. The method according to claim 29, wherein both R.sup.2 groups
are methyl.
33. The method according to claim 15, wherein the active compound
is selected from the group consisting of: 30
34. The method according to claim 15, wherein the pharmaceutical
composition is in prodrug form.
35. The method according to claim 15, wherein the pharmaceutical
composition comprises from about 0.01% to about 25% of the active
compound and from about 75% to about 99.99% of the
pharmaceutically-acceptable carrier.
36. The method according to claim 1, 4 or 7, wherein the
pharmaceutical composition comprises a safe and effective amount of
an active compound having the formula: 31wherein R.sup.2 is
selected from the group consisting of H, C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl.
37. The method according to claim 34, wherein the R.sup.2 is
selected from the group consisting of C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl.
38. The method according to claim 35, wherein the R.sup.2 is
methyl.
39. The method according to claim 1, 4 or 7, wherein the
pharmaceutical composition comprises a safe and effective amount of
a compound selected from 32wherein Y is selected form the group
consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted
alkyl, --NO.sub.2, and the phenyl moiety 33and wherein no more than
one Y group is said active compound may be the phenyl moiety;
R.sup.1 is selected from the group consisting H, --OH, halogens,
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl,
C.sub.1-C.sub.4 ester and C.sub.1-C.sub.4 substituted ester;
R.sup.2 is selected from the group consisting of H, C.sub.1-C.sub.4
alkyl and C.sub.1-C.sub.4 substituted alkyl; R.sup.3 is selected
from the group consisting of H, C.sub.1-C.sub.4 alkyl,
C.sub.1-C.sub.4 substituted alkyl, and --CH.sub.2Ph; R.sup.4 is
selected from the group consisting of H, C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl; X is selected from S and O; Z is
selected from --SR.sup.3, --OR.sup.3, --S(O)R.sup.3, --SR.sup.3,
and C.sub.1-C.sub.4 alkyl; and wherein at least two of the R.sup.2
and R.sup.3 groups in said compound are C.sub.1-C.sub.4 alkyl when
Y is not a phenyl moiety, and at least one Y is --NO.sub.2, when Z
is alkyl: and a pharmaceutically-accept- able carrier.
40. The method according to claim 37, wherein the active compound
is selected from the group consisting of 34wherein R.sup.9 is
selected from the group consisting of --OH, -M and --OOCCH.sub.2M;
wherein M is selected from F, Cl, Br and I.
41. The method according to claim 38, wherein the active compound
is selected from the group consisting of 35wherein R.sup.10 is
selected from the group consisting of H, --NO.sub.2, Ph, 4-HOPh and
4-MPh, wherein M is selected from F, Cl, Br and I.
42. A method of treating a condition involving vascular adhesion of
leukocytes, comprising: (a) identifying a subject suspected of
having a condition involving aberrant leukocyte adhesion to
vascular endothelium; and (b) administering to the subject an
amount of a pharmaceutical composition comprising a methimazole
derivative or tautomeric cyclic thione or mixtures thereof
sufficient to decrease cell surface expression of at least one of
VCAM-I and E-selectin on endothelial cells, thereby reducing
adhesion of leukocyte cells to vascular endothelium.
43. The method according to claim 40, wherein one or more
additional active ingredients are combined with the composition of
the present invention, either administered separately or in the
same pharmaceutical composition, selected from the group comprising
(a) VCAM-1 antagonists; (b) steroids; (c) immunosuppressants; (d)
antihistamines; (e) non-steroidal anti-asthmatics; (f)
non-steroidal antiinflammatory agents (NSAIDs); (g)
cyclooxygenase-2 (COX-2) inhibitors; (h) inhibitors of
phosphodiesterase type IV (PDE-IV); (i) antagonists of the
chemokine receptors; (O) cholesterol lowering agents; (k)
anti-diabetic agents; (1) preparations of interferon beta; (m)
anticholinergic agents; and (n) antibiotics.
44. A method of screening for compounds capable of preventing,
inhibiting or suppressing VCAM-1 mediated cell adhesion or
preventing, inhibiting or suppressing cell adhesion-associated
inflammation in a mammal, comprising: (a) contacting the mammal
with a test compound; (b) measuring an effect of the test compound
on leukocyte adhesion or migration or both; and (c) determining
whether the test compound is an inhibitor of the adhesion or
migration activities or both of the leukocytes.
45. The method according to claim 42, wherein the measuring an
effect of the test compound comprises one or more of measuring
IRF-1 RNA expression levels; measuring IRF-1 protein expression
levels; measuring IRF-1 dependent VCAM-1 promoter activation;
measuring cytokine-increased IRF-1 RNA expression levels; measuring
cytokine-increased IRF-1 protein expression levels; measuring
cytokine-increased IRF-1 dependent VCAM-1 promoter activation;
measuring TNF-alpha-increased IRF-1 RNA expression levels;
measuring TNF-alpha-increased IRF-1 protein expression levels; and
measuring TNF-alpha-increased IRF-1 dependent VCAM-1 promoter
activation.
46. The method according to claim 42, wherein the measuring an
effect of the test compound comprises one or more of measuring
VCAM-1 RNA expression levels; measuring cytokine-increased VCAM-1
protein expression levels; measuring cytokine-increased VCAM-1
promoter activation measuring TNF-alpha-increased VCAM-1 RNA
expression levels; measuring TNF-alpha increased VCAM-1 protein
expression levels; and measuring TNF-alpha increased VCAM-1
promoter activation.
47. A method of screening for compounds capable of cell adhesion
inhibitory activity in VCAM-1 expressing cells, comprising: (a)
contacting VCAM-1-expressing cells with a test compound; (b)
contacting the VCAM-1-expressing cells to VCAM-1 ligand expressing
cells; (c) measuring an effect of the test compound on binding of
the VCAM-1-expressing cells to VCAM-1 ligand expressing cells; and
(d) determining whether the test compound is an inhibitor of the
binding activities of the VCAM-1-expressing cells to VCAM-1 ligand
expressing cells.
48. The method according to claim 45, comprising the further step
prior to, concurrently with or subsequently to addition of the test
compound, of contacting VCAM-1-expressing cells with a cytokine
capable of inducing expression of VCAM-1.
49. The method according to claim 46, wherein the cytokine is
TNF-alpha.
50. The method according to claim 47, wherein the VCAM-1-expressing
cells are selected from the group comprising nonimmune target
tissue cells, endothelial cells, and epithelial cells.
51. The method according to claim 47, wherein the VCAM-1-expressing
cells are human aorta endothelial cells (HAEC).
52. The method according to claim 47, wherein the VCAM-1 ligand
expressing cells are leukocytes.
53. The method according to claim 47, wherein the cells are allowed
to remain in contact for at least 30 minutes.
Description
TECHNICAL FIELD
[0002] The present invention relates to novel compounds and methods
of use for inhibition and prevention of cell adhesion and cell
adhesion-mediated pathologies. This invention also relates to
pharmaceutical formulations comprising these compounds and methods
of using them for inhibition and prevention of cell adhesion and
cell adhesion-mediated pathologies.
BACKGROUND OF THE INVENTION
[0003] Cell adhesion is a process by which cells associate with
each other, migrate towards a specific target or localize within
the extra-cellular matrix. As such, cell adhesion constitutes one
of the fundamental mechanisms underlying numerous biological
phenomena. For example, cell adhesion is responsible for the
adhesion of hematopoietic cells to endothelial cells and the
subsequent migration of those hematopoietic cells out of blood
vessels and to the site of injury. Cell adhesion plays a role in
pathological inflammation and immune reactions in mammals.
[0004] Adhesion mediated by VCAM-1 and other endothelial cell
surface receptors is associated with a number of inflammatory
responses. At the site of an injury or other inflammatory stimulus,
activated vascular endothelial cells express molecules that are
adhesive for leukocytes. The mechanics of leukocyte adhesion to
endothelial cells involves, in part, the recognition and binding of
cell surface receptors on leukocytes to the corresponding cell
surface molecules on endothelial cells. Once bound, the leukocytes
migrate across the blood vessel wall to enter the injured site and
release chemical mediators to combat infection.
[0005] Inflammatory brain disorders, such as experimental
autoimmune encephalomyelitis (EAE), multiple sclerosis (MS) and
meningitis, are examples of central nervous system disorders in
which the endothelium/leukocyte adhesion mechanism results in
destruction to otherwise healthy brain tissue. Large numbers of
leukocytes migrate across the blood brain barrier (BBB) in subjects
with these inflammatory diseases. The leukocytes release toxic
mediators that cause extensive tissue damage resulting in impaired
nerve conduction and paralysis.
[0006] In other organ systems, tissue damage also occurs via an
adhesion mechanism resulting in migration or activation of
leukocytes. For example, it has been shown that the initial insult
following myocardial ischemia to heart tissue can be further
complicated by leukocyte entry to the injured tissue causing still
further insult. Other pathologies mediated by an adhesion mechanism
include, by way of example, asthma, Alzheimer's disease,
atherosclerosis, AIDS dementia, diabetes, inflammatory bowel
disease, multiple sclerosis, rheumatoid arthritis, tissue
transplantation and tumor metastasis.
[0007] The adhesion of leukocytes to the endothelium in the fluid
dynamic environment of the circulation plays a central role in
pathological inflammation (e.g. atherosclerosis (1), and
inflammatory bowel disease (2)). Endothelial cell adhesion
molecules (ECAMs.sup.3) known to participate in leukocyte
recruitment, (e.g. VCAM-1, E-selectin and ICAM-1), have been shown
to be up-regulated in such settings and to contribute to disease
progression and/or tissue damage by virtue of their role in
leukocyte adhesion (3). For example, VCAM-1 is present in a
localized fashion on aortic endothelium that overlies early foam
cell lesions (1) and is increased on endothelium in models of
colitis (4). A promising therapeutic approach for treating
pathological inflammation is, therefore, to reduce aberrant
leukocyte adhesion to the endothelium via suppression of ECAM
expression (5).
[0008] ECAM expression is influenced by the cytokine milieu in
which the endothelial cells reside. Indeed, treating cultured
endothelial cells with the pro-inflammatory cytokine TNF-.alpha.
for 4 hrs. elicits expression of E-selectin, VCAM-1 and ICAM-1 (6).
The cytokine dependent ECAM induction is regulated at the gene
level by the activity of transcription factors such as nuclear
factor-.kappa.B (NF-.kappa.B), activator protein-1 (AP-1),
specificity protein-1 (SP-1), interferon regulatory factor-1
(IRF-1) and GATA. For example, the E-selectin promoter has binding
sites for NF-.kappa.B (7), the VCAM-1 promoter has binding sites
for NF-.kappa.B, AP-1, SP-1, IRF-1 and GATA (8-11) and the ICAM-1
promoter has functional binding sites for NF-.kappa.B and AP-1 (12,
13). Some of these transcription factors (e.g. NF-.kappa.B) are
present in unstimulated endothelial cells in an inactive form (14).
Cytokine treatment of endothelial cells stimulates the activity of
these transcription factors (14) and also induces the expression of
other transcription factors (e.g. IRF-1) (10). The active/induced
transcription factors ligate to their respective binding sites
leading to gene transcription.
[0009] Several current or potential therapeutics for pathological
inflammation work, at least in part, by modulating the activity of
transcription factors (15-19). Indeed, compounds that block
cytokine induced ECAM expression at the transcription level have
been shown to inhibit leukocyte adhesion to the endothelium (16-18,
20) and to reduce inflammation in animal models (15, 17).
Methimazole is widely used clinically for the treatment of
autoimmune Graves' disease or primary hyperthyroidism (21) and has
been shown to be effective in treating several other forms of
autoimmune disease, both psoriasis in humans (22) and systemic
lupus, autoimmune blepharitis, autoimmune uveitis, thyroiditis, and
diabetes in murine experimental models (23-26). Evidence has
accumulated that methimazole acts as a transcriptional inhibitor of
abnormally increased MHC Class I and Class II gene expression
(26-29) and mimics the effect of a Class I knockout in preventing
autoimmune disease (30). Several observations suggest that
methimazole may also affect ECAM expression and thus could be a
potential anti-inflammatory compound. Specifically, it has been
reported that (a) Graves' disease patients treated with methimazole
have reduced levels of circulating soluble E-selectin and soluble
VCAM-1 (31) and (b) methimazole decreases colonic mucosal damage in
a rat model of experimental colitis (32). An effort to identify
derivative compounds with greater efficacy as an anti-immune agent
or immunosuppressive than methimazole, led to the observation that
phenyl methimazole (compound 10, C-10), a tautomeric cyclic thione,
was 50 to 100-fold more potent at suppressing abnormally increased
MHC gene expression and was a far more effective agent in
experimental models of lupus and diabetes (26, 28). These
observations motivated us to probe the hypothesis that a derivative
of methimazole, phenyl methimazole, or other tautomeric cyclic
thiones can reduce pro-inflammatory cytokine (e.g.
TNF-.alpha.)-induced ECAM expression and consequent leukocyte
adhesion to endothelial cells.
[0010] There remains a need for inhibitors of VCAM-1-dependent cell
adhesion. Such compounds would provide useful agents for treatment,
prevention or suppression of various pathologies involving VCAM-1
mediated cell adhesion.
[0011] It has now been found that a specific class of methimazole
derivatives and tautomeric cyclic thiones are effective as
anti-inflammatories, in the case of inflammatory symptoms of very
different cause, to prevent, reduce or suppress the undesired or
harmful sequence of the inflammation. They are used, for example,
for the treatment of arthritis, rheumatoid arthritis,
polyarthritis, inflammatory bowel disease (ulcerative colitis,
Crohn's disease), systemic lupus erythematosus, inflammatory
diseases of the central nervous system (e.g., multiple sclerosis),
or asthma or allergies (e.g., allergies of the delayed type (type
IV allergy)). Furthermore, compounds of the present invention are
suitable for cardioprotection, for stroke protection and for the
secondary prophylaxis of stroke and for the treatment of
cardiovascular diseases, atherosclerosis, myocardial infarct,
myocardial reinfarct, acute coronary syndrome, stroke, restenoses,
diabetes, damage to organ transplants, immune diseases, autoimmune
diseases, tumor growth or tumor metastasis in various malignancies,
malaria and other diseases where a blocking of abnormally increased
expression of VCAM-1 and/or an influencing of the leukocyte
activity appears appropriate for prevention, alleviation or cure. A
preferred use is the prevention of inflammatory bowel disease and
macro- or microvascular complications of Types I or II diabetes,
e.g., myocardial infarct or of myocardial reinfarct or
nephropathy.
SUMMARY OF THE INVENTION
[0012] The present invention relates to novel compounds and methods
of use for inhibition and prevention of cell adhesion and cell
adhesion-mediated pathologies. This invention also relates to
pharmaceutical formulations comprising these compounds and methods
of using them for inhibition and prevention of cell adhesion and
cell adhesion-mediated pathologies. The compounds and
pharmaceutical compositions of this invention can be used as
therapeutic or prophylactic agents. In particular, methimazole
derivatives and tautomeric cyclic thiones have the ability to
inhibit the adhesion and the migration of leukocytes (e.g., the
adhesion of monocytes to endothelial cells), which is mediated by
VCAM-1 adhesion mechanism. In addition to being active
anti-inflammatories, the methimazole derivatives and tautomeric
cyclic thiones and their physiologically tolerable salts and
derivatives are generally suitable for the treatment (i.e., for the
therapy and prophylaxis) of diseases that are based on the
interaction between VCAM-1 and VCAM-1 ligands (e.g. VLA-4 or
.alpha.4.beta.7) or can be influenced by an inhibition of this
interaction. In particular, the methimazole derivatives and
tautomeric cyclic thiones are suitable for the treatment of
diseases that are caused at least partly by an undesired extent of
leukocyte adhesion and/or leukocyte migration or are connected
therewith, and for whose prevention, alleviation or cure the
adhesion and/or migration of leukocytes should be decreased.
[0013] The present invention also relates to the methimazole
derivatives and tautomeric cyclic thiones and/or their
physiologically acceptable salts and/or derivatives for the
inhibition of the adhesion and/or migration of leukocytes or for
the inhibition of abnormally increased VCAM-1 expression, e.g. that
induced by cytokines such as TNF-.alpha.. In addition, the present
invention relates to the use of the methimazole derivatives and
tautomeric cyclic thiones and/or their physiologically acceptable
salts and/or derivatives for the preparation of pharmaceuticals
thereof, i.e., of pharmaceuticals for the treatment of diseases,
wherein the leukocyte adhesion and/or leukocyte migration shows an
undesired extent, or for the treatment of diseases, wherein
VCAM-1-dependent adhesion processes play a role, and to the use of
the methimazole derivatives and tautomeric cyclic thiones and/or
their physiologically acceptable salts and/or derivatives in the
treatment of diseases of this type.
[0014] In one embodiment, the present invention provides for
methods for reducing aberrant leukocyte-endothelial adhesion during
pathological inflammation by inhibiting endothelial cell adhesion
molecule (ECAM) expression at the transcriptional level.
Specifically, the present invention provides for methods of using
methimazole derivatives to modulate TNF-.alpha.-induced ECAM (e.g.,
E-selectin, ICAM-1 and VCAM-1) expression and consequent monocytic
cell (U-937) adhesion to human aortic endothelial cells (HAEC).
[0015] According to one embodiment of this invention, these novel
compounds, compositions and methods are advantageously used to
treat inflammatory and immune diseases. The present invention also
provides methods for preparing the compounds of this invention and
intermediates useful in those methods.
[0016] In one embodiment, the present invention provides for the
use of methimazole (1-methyl-2-mercaptoimidazole) and its
derivatives. In another embodiment, the present invention provides
for the use of a prodrug form of methimazole, known as carbimazole
(neomercazole) and its derivatives.
[0017] In another embodiment, the present invention provides for
the use of a composition containing one or more of the compounds
selected from the group consisting of methimazole, metronidazole,
2-mercaptoimidazole, 2-mercaptobenzimidazole,
2-mercapto-5-nitrobenzimidazole, 2-mercapto-5-methylbenzimidazole,
s-methylmethimazole, n-methylmethimazole, 5-methylmethimazole,
5-phenylmethimazole, and 1-methyl-2-thiomethyl-5(4)nitroimidazole.
Preferably, 5-phenylmethimazole is used.
[0018] In another embodiment, the present invention provides for
the use of phenyl methimazole (compound 10; C-10) and its
derivatives.
[0019] It is one objective of the present invention to provide
methods of using phenyl methimazole to modulate or reduce
TNF-.alpha.-induced monocytic cell adhesion to HAEC by inhibiting
VCAM-1 gene expression in an IRF-1 dependent manner.
[0020] Compounds of this invention may be synthesized using any
conventional technique. Preferably, these compounds are chemically
synthesized from readily available starting materials.
[0021] The compounds of this invention may also be modified by
appending appropriate functionalities to enhance selective
biological properties. Such modifications are known in the art and
include those which increase biological penetration into a given
biological system (e.g., blood, lymphatic system, central nervous
system), increase oral availability, increase solubility to allow
administration by injection, alter metabolism and alter rate of
excretion.
[0022] As used throughout this application, the term "patient"
refers to mammals, including humans. And the term "cell" refers to
mammalian cells, including human cells.
[0023] Once synthesized, the activities and VCAM-1 specificities of
the compounds according to this invention may be determined using
in vitro and in vivo assays.
[0024] For example, the cell adhesion inhibitory activity of these
compounds may be measured by determining the concentration of
inhibitor required to block the binding of VCAM-1-expressing cells
to VCAM-1 ligand (e.g., VLA-4) expressing cells (e.g., monocytes,
lymphocytes). In this assay, microtiters wells are coated with
cells (e.g., endothelial cells), which can express VCAM-1. Once the
wells are coated, varying concentrations of the test compound are
then added together with a cytokine (e.g., TNF-.alpha.), which can
induce the expression of VCAM-1. Alternatively, the test compound
may be added first and allowed to incubate with the coated wells
containing endothelial cells prior to the addition of the cytokine.
The cells are allowed to incubate in the wells for at least 2 hrs.
Following incubation, appropriately labeled VCAM-1
ligand-expressing cells (e.g., monocytes, lymphocytes) are added to
the wells and incubated for at least 30 minutes. After the
incubation period, the wells are washed. Inhibition of binding is
measured by quantitating the fluorescence or radioactivity bound to
the VCAM-1 expressing cells in the plate for each of the various
concentrations of test compound, as well as for controls containing
no test compound.
[0025] VCAM-1-expressing cells that may be utilized in this assay
include nonimmune target tissue cells, endothelial cells, and
epithelial cells. The VCAM-1 ligand expressing cells (e.g.,
monocytes, lymphocytes) used in this assay may be fluorescently or
radioactively labeled.
[0026] A direct binding assay may also be employed to quantitate
the inhibitory activity of the compounds of this invention.
[0027] Once VCAM-1-specific inhibitors are identified, they may be
further characterized in in vivo assays. One such assay tests the
effects of inhibitors on VCAM-1 expression and leukocyte adhesion
in well-established in vivo models of pathological inflammation
(e.g., inflamed mesenteric endothelium in murine model of chronic
inflammation (i.e., colitis); isolated carotid arteries of
apolipoprotein E-deficient (apoE -/-) mice with developing
atherosclerotic lesions).
[0028] The compounds of the present invention may be used in the
form of pharmaceutically acceptable salts derived from inorganic or
organic acids and bases. Included among such acid salts are the
following: acetate, adipate, alginate, aspartate, benzoate,
benzenesulfonate, bisulfate, butyrate, citrate, camphorate,
camphorsulfonate, cyclopentanepropionate, digluconate,
dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate,
glycerophosphate, hemisulfate, heptanoate, hexanoate,
hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate,
lactate, maleate, methanesulfonate, 2-naphthalenesulfonate,
nicotinate, oxalate, pamoate, pectinate, persulfate,
3-phenyl-propionate, picrate, pivalate, propionate, succinate,
tartrate, thiocyanate, tosylate and undecanoate. Base salts include
ammonium salts, alkali metal salts, such as sodium and potassium
salts, alkaline earth metal salts, such as calcium and magnesium
salts, salts with organic bases, such as dicyclohexylamine salts,
N-methyl-D-glucamine, and salts with amino acids such as arginine,
lysine, and so forth. Also, the basic nitrogen-containing groups
can be quaternized with such agents as lower alkyl halides, such as
methyl, ethyl, propyl, and butyl chloride, bromides and iodides;
dialkyl sulfates, such as dimethyl, diethyl, dibutyl and diamyl
sulfates, long chain halides such as decyl, lauryl, myristyl and
stearyl chlorides, bromides and iodides, aralkyl halides, such as
benzyl and phenethyl bromides and others. Water or oil-soluble or
dispersible products are thereby obtained.
[0029] The compounds of the present invention may be formulated
into pharmaceutical compositions that may be administered orally,
parenterally, by inhalation spray, topically, rectally, nasally,
buccally, vaginally or via an implanted reservoir. The term
"parenteral" as used herein includes subcutaneous, intravenous,
intraperitoneal, intramuscular, intra-articular, intra-synovial,
intrasternal, intrathecal, intrahepatic, intralesional and
intracranial injection or infusion techniques.
[0030] The pharmaceutical compositions of this invention comprise
any of the compounds of the present invention, or pharmaceutically
acceptable salts thereof, together with any pharmaceutically
acceptable carrier. The term "carrier" as used herein includes
acceptable adjuvants and vehicles. Pharmaceutically acceptable
carriers that may be used in the pharmaceutical compositions of
this invention include, but are not limited to, ion exchangers,
alumina, aluminum stearate, lecithin, serum proteins, such as human
serum albumin, buffer substances such as phosphates, glycine,
sorbic acid, potassium sorbate, partial glyceride mixtures of
saturated vegetable fatty acids, water, salts or electrolytes, such
as protamine sulfate, disodium hydrogen phosphate, potassium
hydrogen phosphate, sodium chloride, zinc salts, colloidal silica,
magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based
substances, polyethylene glycol, sodium carboxymethylcellulose,
polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers,
polyethylene glycol and wool fat. They may comprise liposomes or
drug carriers made lipids or polymeric particles, including
biodegradable polymers, or targeted delivery applications, e.g.,
coupling to antibodies. They include solubilization with
dimethylsulfoxide before dilution to final useful
concentrations.
[0031] According to this invention, the pharmaceutical compositions
may be in the form of a sterile injectable preparation, for example
a sterile injectable aqueous or oleaginous suspension. This
suspension may be formulated according to techniques known in the
art using suitable dispersing or wetting agents and suspending
agents. The sterile injectable preparation may also be a sterile
injectable solution or suspension in a non-toxic
parenterally-acceptable diluent or solvent, for example as a
solution in 1,3-butanediol or dimethyl sulfoxide. Among the
acceptable vehicles and solvents that may be employed are water,
Ringer's solution and isotonic sodium chloride solution. In
addition, sterile, fixed oils are conventionally employed as a
solvent or suspending medium. For this purpose, any bland fixed oil
may be employed including synthetic mono- or di-glycerides. Fatty
acids, such as oleic acid and its glyceride derivatives are useful
in the preparation of injectables, as do natural
pharmaceutically-acceptable oils, such as olive oil or castor oil,
especially in their polyoxyethylated versions. These oil solutions
or suspensions may also contain a long-chain alcohol diluent or
dispersant, such as Ph. Helv or similar alcohol.
[0032] The pharmaceutical compositions of this invention may be
orally administered in any orally acceptable dosage form including,
but not limited to, capsules, tablets, aqueous suspensions or
solutions. In the case of tablets for oral use, carriers, which are
commonly used include lactose and corn starch. Lubricating agents,
such as magnesium stearate, are also typically added. For oral
administration in a capsule form, useful diluents include lactose
and dried cornstarch. When aqueous suspensions are required for
oral use, the active ingredient is combined with emulsifying and
suspending agents. If desired, certain sweetening, flavoring or
coloring agents may also be added.
[0033] Alternatively, the pharmaceutical compositions of this
invention may be administered in the form of suppositories for
rectal administration. These can be prepared by mixing the agent
with a suitable non-irritating excipient which is solid at room
temperature but liquid at the rectal temperature and therefore will
melt in the rectum to release the drug. Such materials include
cocoa butter, beeswax and polyethylene glycols.
[0034] The pharmaceutical compositions of this invention may also
be administered topically, especially when the target of treatment
includes areas or organs readily accessible by topical application,
including diseases of the eye, the skin, or the lower intestinal
tract. Suitable topical formulations are readily prepared for each
of these areas or organs.
[0035] Topical application for the lower intestinal tract can be
effected in a rectal suppository formulation (see above) or in a
suitable enema formulation. Topically-transdermal patches may also
be used.
[0036] For topical applications, the pharmaceutical compositions
may be formulated in a suitable ointment containing the active
component suspended or dissolved in one or more carriers. Carriers
for topical administration of the compounds of this invention
include, but are not limited to, mineral oil, liquid petrolatum,
white petrolatum, propylene glycol, polyoxyethylene,
polyoxypropylene compound, emulsifying wax and water.
Alternatively, the pharmaceutical compositions can be formulated in
a suitable lotion or cream containing the active components
suspended or dissolved in one or more pharmaceutically acceptable
carriers. Suitable carriers include, but are not limited to,
mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters
wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and
water.
[0037] For ophthalmic use, the pharmaceutical compositions may be
formulated as micronized suspensions in isotonic, pH adjusted
sterile saline, or, preferably, as solutions in isotonic, pH
adjusted sterile saline, either with our without a preservative
such as benzylalkonium chloride. Alternatively, for ophthalmic
uses, the pharmaceutical compositions may be formulated in an
ointment such as petrolatum.
[0038] The pharmaceutical compositions of this invention may also
be administered by nasal aerosol or inhalation through the use of a
nebulizer, a dry powder inhaler or a metered dose inhaler. Such
compositions are prepared according to techniques well-known in the
art of pharmaceutical formulation and may be prepared as solutions
in saline, employing benzyl alcohol or other suitable
preservatives, absorption promoters to enhance bioavailability,
fluorocarbons, and/or other conventional solubilizing or dispersing
agents.
[0039] The amount of active ingredient that may be combined with
the carrier materials to produce a single dosage form will vary
depending upon the host treated, and the particular mode of
administration. It should be understood, however, that a specific
dosage and treatment regimen for any particular patient will depend
upon a variety of factors, including the activity of the specific
compound employed, the age, body weight, general health, sex, diet,
time of administration, rate of excretion, drug combination, and
the judgment of the treating physician and the severity of the
particular disease being treated. The amount of active ingredient
may also depend upon the therapeutic or prophylactic agent, if any,
with which the ingredient is co-administered.
[0040] The dosage and dose rate of the compounds of this invention
effective to prevent, suppress or inhibit cell adhesion will depend
on a variety of factors, such as the nature of the inhibitor, the
size of the patient, the goal of the treatment, the nature of the
pathology to be treated, the specific pharmaceutical composition
used, and the judgment of the treating physician. Dosage levels of
between about 0.001 and about 100 mg/kg body weight per day,
preferably between about 0.1 and about 10 mg/kg body weight per day
of the active ingredient compound are useful.
[0041] According to another embodiment compositions containing a
compound of this invention may also comprise an additional agent
selected from the group consisting of corticosteroids,
bronchodilators, antiasthmatics (mast cell stabilizers),
anti-inflammatories, antirheumatics, immunosuppressants,
antimetabolites, immunonodulators, antipsoriatics, antibiotics, and
antidiabetics. Also included within this group are compounds such
as theophylline, sulfasalazine and aminosalicylates
(antiinflammatories); cyclosporin, FK-506, and rapamycin
(immunosuppressants); cyclophosphamide and methotrexate
(antimetabolites); and interferons (immunomodulators).
[0042] According to other embodiments, the invention provides
methods for preventing, inhibiting or suppressing cell
adhesion-associated inflammation and cell adhesion-associated
immune or autoimmune responses. VCAM-1-associated cell adhesion
plays a central role in a variety of inflammatory, immune and
autoimmune diseases. Thus, inhibition of cell adhesion by the
compounds of this invention may be utilized in methods of treating
or preventing inflammatory, immune and autoimmune diseases.
Preferably the diseases to be treated with the methods of this
invention are selected from asthma, arthritis, psoriasis,
transplantation rejection, multiple sclerosis, diabetes,
inflammatory bowel disease, and inflammatory/immune diseases
related to activation of the innate immune system such as endotoxic
shock.
[0043] These methods may employ the compounds of this invention in
a monotherapy or in combination with an anti-inflammatory or
immunosuppressive agent. Such combination therapies include
administration of the agents in a single dosage form or in multiple
dosage forms administered at the same time or at different
times.
[0044] The above summary of the present invention is not intended
to describe each embodiment or every implementation of the present
invention. Advantages and attainments, together with a more
complete understanding of the invention, will become apparent and
appreciated by referring to the following detailed description and
claims taken in conjunction with the accompanying drawings.
[0045] Throughout this document, all temperatures are given in
degrees Celsius, and all percentages are weight percentages unless
otherwise stated. All publications mentioned herein are
incorporated herein by reference for the purpose of describing and
disclosing the compositions and methodologies, which are described
in the publications which might be used in connection with the
presently described invention. The publications discussed herein
are provided solely for their disclosure prior to the filing date
of the present application. Nothing herein is to be construed as an
admission that the invention is not entitled to antedate such a
disclosure by virtue of prior invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0046] This invention, as defined in the claims, can be better
understood with reference to the following drawings:
[0047] FIG. 1. A methimazole derivative (C-10) significantly
inhibits short term (2-4 hr.) TNF-.alpha. induced expression of
VCAM-1 but has little to no effect on TNF-.alpha. induced
E-selectin and ICAM-1 expression. The protein (A) and mRNA (B)
levels of E-selectin, ICAM-1, VCAM-1 on unactivated and 4 (ELISA)
or 2 (mRNA) hr. TNF-.alpha. activated HAEC, in the absence or
presence of C-10, are determined by ELISA and Northern blot
analysis respectively. (A) The level of absorbance indicated by
optical density (O.D. at 450 nm) correlates with the level of a
given ECAM protein (e.g. E-selectin) on the HAEC. All values are
mean+/-std. deviation of triplicate wells. Results presented are
representative of a typical experiment done at least 3 times. A mAb
to LFA-1 (TS1/22) served as a negative control. (B) RNA isolated
from HAEC was subjected to Northern blot analyses using appropriate
probes for E-selectin, ICAM-1 and VCAM-1. G3PDH probe was used as
the loading control. Results presented are typical of 3 separate
experiments. (Legend: TNF-.alpha. activation indicates activation
of HAEC with TNF-.alpha. (+) or no activation (-) prior to the
assay. Treatment indicates treatment of HAEC with C-10, DMSO or no
treatment (-) during activation with TNF-.alpha.. * indicates
p<0.001).
[0048] FIG. 2. C-10 significantly inhibits 24 hr. TNF-.alpha.
induced expression of VCAM-1 and E-selectin but has no effect on
ICAM-1 expression. The protein (A) and mRNA (B) levels of
E-selectin, ICAM-1, VCAM-1 on unactivated and 24 hr. TNF-.alpha.
activated HAEC, in the absence or presence of C-10, are determined
by ELISA and Northern blot analysis respectively. (A) The level of
absorbance indicated by optical density (O.D. at 450 nm) correlates
with the level of a given ECAM protein (e.g. E-selectin) on the
HAEC. All values are mean+/-std. deviation of triplicate wells.
Results presented are representative of a typical experiment done
at least 3 times. A mAb to LFA-1 (TS1/22) served as a negative
control and gave results (data not shown) similar to that shown in
FIG. 1A. (B) RNA isolated from HAEC was subjected to Northern blot
analyses using appropriate probes for E-selectin, ICAM-1 and
VCAM-1. G3PDH probe was used as a loading control. Results
presented are typical of 3 separate experiments. (Legend:
TNF-.alpha. activation indicates activation of HAEC with
TNF-.alpha. (+) or no activation (-) prior to the assay. Treatment
indicates treatment of HAEC with C-10, DMSO or no treatment (-)
during activation with TNF-.alpha.. * indicates p<0.001)
[0049] FIG. 3. C-10 has a modest effect on U937 adhesion to 4 hr.
TNF-.alpha. activated HAEC and a dramatic effect on U937 adhesion
to 24 hr. TNF-.alpha. activated HAEC. HAEC are treated for 4 hrs.
(A) or 24 hrs. (B) with TNF-.alpha. in the absence or presence of
C-10. In certain instances, HAEC are pre-treated with mAb prior to
use in adhesion assays. Subsequently, U937 cells are perfused over
the HAEC and the number of U937 cells adherent to the HAEC at the
end of 2.5 minutes of flow determined. (Legend: TNF-.alpha.
activation indicates activation of HAEC with TNF-.alpha. (+) or no
activation (-) for 4 hrs. (A) or 24 hrs. (B) prior to the adhesion
assay. Treatment indicates treatment of HAEC with 0.5 mM (A) or 0.1
mM (B) C-10, DMSO or no treatment (-) during activation with
TNF-.alpha. mAb indicates pre-treatment of HAEC with a mAb to
E-selectin, HEL3/2 (E), a mAb to VCAM-1,51-10C9 (V), a combination
of mAbs to VCAM-1, 51-10C9, and E-selectin, HEL3/2 (V+E) or no
pre-treatment (-) after the other treatments but prior to the
adhesion assay. Shear Stress=1.8 dynes/cm.sup.2; n>3; error bars
represent SEM; # indicates p<0.05)
[0050] FIG. 4. C-10 inhibits TNF-.alpha. induced increase in VCAM-1
promoter activity in HAEC. (Left) The locations of the binding
sites for various transcription factors known to play a role in
TNF-.alpha. induced human VCAM-1 expression are used as a template
to create -1641/+12, -288/+12, -228/+12 and -85/+12 bp constructs.
(Right) HAEC are transfected for 24 hrs. with 400 ng of the
constructs indicated on the left or pGL3 basic luciferase reporter
vector. All HAEC are also transfected with phRL-TK (Int-) vector
that contains Renilla luciferase (Rluc) as an "internal"
transfection control. HAEC are treated for 6 hrs. with 10 ng/ml
TNF-.alpha. in the absence or presence of 0.3 mM C-10. All
treatment conditions contained 0.3% DMSO. Assays are conducted with
the Dual-Luciferase Reporter Assay System. The luciferase activity
indicated by relative light units (R.L.U) correlates with the level
of promoter activity. All values are mean+/-std. deviation of
triplicate wells. Results presented are typical of 3 separate
experiments. (Legend: Bar 1 indicates untreated HAEC, bar 2
indicates 0.3 mM C-10 treated HAEC, bar 3 indicates 10 ng/ml
TNF-.alpha. treated HAEC and bar 4 indicates HAEC treated with 10
ng/ml TNF-.alpha. in the presence of 0.3 mM C-10.)
[0051] FIG. 5. C-10 inhibits 2 hr. TNF-.alpha. induced IRF-1
binding activity to VCAM-1 promoter. (A) Probe sequences used in
EMSA. Overhead line indicates the IRF-1 binding site. Lower case
letters indicate the mutated bases. The sense strand sequence of
the consensus NF-.kappa.B probe (not shown) is: 5'
AGTTGAGGGGACTTTCCCAGGC 3'. (B) EMSA or (C) supershift EMSA are
performed with .sup.32P-labeled IRF-1 probe and 3 .mu.g of nuclear
extracts prepared from HAEC treated with or without 10 ng/mL
TNF-.alpha. in the absence or presence of C-10. Results presented
are typical of 2 separate experiments. (Legend: TNF-.alpha.
activation indicates activation of HAEC with TNF-.alpha. (+) or no
activation (-) prior to the assay. Treatment indicates treatment of
HAEC with 0.5 mM C-10, 1 mM C-10, or DMSO (DMSO) or no treatment
(-) during activation with TNF-.alpha.. Competitor indicates
absence (-) or presence of 100 fold molar excess of unlabeled
VCAM-1 IRF-1 probe (VCAM-1 IRF wild) or VCAM-1 IRF-1 mutant probe
(VCAM IRF Mutant) or consensus IRF-1 probe (Cons. IRF) or consensus
NF-.kappa.B probe (cons. NF-.kappa.B) or 2 .mu.g antibody to IRF-1
(IRF-1 Ab)).
[0052] FIG. 6. C-10 reduces TNF-.alpha. induced IRF-1 expression.
The mRNA (A) and protein (B) levels of IRF-1 on unactivated and 2
hr. TNF-.alpha. activated HAEC, in the absence or presence of C-10,
are determined by Northern blot analysis and Western blot analysis
respectively. (A) RNA isolated from HAEC was subjected to Northern
blot analyses using IRF-1 probe. Ethidium bromide stained rRNA was
the loading control. (B) Whole cell lysates of HAEC are subjected
to Western blot analysis using IRF-1 antibody. Ponceau S staining
of blots after transfer revealed equivalent loading of total
protein (data not shown). (Legend: TNF-.alpha. indicates activation
of HAEC with 10 ng/ml TNF-.alpha. (+) or no activation (-) prior to
the assay. C-10 indicates treatment of HAEC with 0.5 mM or 1 mM
C-10 or DMSO (-) during activation with TNF-.alpha..)
[0053] In the following description of the illustrated embodiments,
references are made to the accompanying drawings, which form a part
hereof, and in which is shown by way of illustration various
embodiments in which the invention may be practiced. It is to be
understood that other embodiments may be utilized, and structural
and functional changes may be made without departing from the scope
of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
[0054] Before the present device and methods for tissue
augmentation is described, it is to be understood that this
invention is not limited to the specific methodology, devices,
formulations, and compositions described as such may, of course,
vary. It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to limit the scope of the present invention, which
will be limited only by the appended claims.
[0055] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
referents unless the context clearly dictates otherwise. Unless
defined otherwise, all technical and scientific terms used herein
have the same meaning as commonly understood to one of ordinary
skill in the art to which this invention belongs. Although any
methods, devices and materials similar or equivalent to those
described herein can be used in the practice or testing of the
invention, the preferred methods, devices and materials are now
described.
[0056] The present invention also provides for the use of
methimazole derivatives and tautomeric cyclic thione compounds that
specifically inhibit the binding of VCAM-1. These compounds are
useful for inhibition, prevention and suppression of VCAM1-mediated
cell adhesion and pathologies associated with that adhesion, such
as inflammation and immune reactions. The compounds of this
invention may be used alone or in combination with other
therapeutic or prophylactic agents to inhibit, prevent or suppress
cell adhesion. This invention also provides pharmaceutical
formulations containing these VCAM-1-mediated cell adhesion
inhibitors and methods of using the compounds and compositions of
the invention for inhibition of cell adhesion. As used herein, the
following terms shall have the definitions given below.
[0057] The phrase "safe and effective amount" means a sufficient
amount of pharmaceutically active compound to effect the inhibition
and prevention of cell adhesion and cell adhesion-mediated
pathologies. Within the scope of sound medical judgement, the
required dosage of a pharmaceutically active agent or of the
pharmaceutical composition containing that active agent will vary
with the severity of the condition being treated, the duration of
the treatment, the nature of adjunct treatment, the age and
physical condition of the patient, the specific active compound
employed, and like considerations discussed more fully hereinafter.
In arriving at the "safe and effective amount" for a particular
compound, these risks must be taken into consideration, as well as
the fact that the compounds described herein provide pharmaceutical
activity at lower dosage levels than conventional methimazole
compounds.
[0058] "Pharmaceutically-acceptable" shall mean that the
pharmaceutically active compound and other ingredients used in the
pharmaceutical compositions and methods defined herein are suitable
for use in contact with the tissues of humans and lower animals
without undue toxicity, irritation, allergic response, and the
like, commensurate with a reasonable benefit/risk ratio.
[0059] The term "administration" of the pharmaceutically active
compounds and the pharmaceutical compositions defined herein
includes systemic use, as by injection (especially parenterally),
intravenous infusion, suppositories and oral administration
thereof, as well as topical application of the compounds and
compositions. Oral administration is particularly preferred in the
present invention.
[0060] "Ameliorate" or "amelioration" means a lessening of the
detrimental effect or severity of the cell adhesion disorder in the
subject receiving therapy, the severity of the response being
determined by means that are well known in the art.
[0061] The term adhesion disorder of cell adhesion means atypical
cell adhesion leading to pathologies, including, without
limitation, reperfusion injury following ischemia, atherosclerosis,
inflammatory bowel disease (Crohns' disease and ulcerative
colitis), thermal injury (burns), arthritis, asthma, organ
transplantation (host vs. graft and graft vs. host), stroke,
malaria, multiple sclerosis, diabetes, hemorrhagic shock,
myocardial infarcts, pulmonary infarcts, cerebral infarcts,
intestinal infarcts, renal infarcts, sepsis, thrombosis, delayed
type hypersensitivity reaction, cancer, acute lung injury,
autoimmune or nonautoimmune glomerulonephritis, tuberculosis,
sarcoidosis, systemic lupus erythematosus, Sjogren's disease,
polymyositis/dermatomyositis, hypertensive vascular disease,
vasculitis, polyarteritis nodosa, giant cell arteritis, Wegner's
granulomatosis, Kawasaki's disease (mucocutaneous lymph node
syndrome), thromboangiitis obliterans (Buerger's disease), Behcet's
disease, cutaneous vasculitides, Rickettsial vasculitis,
disseminated intravascular coagulation, lymphoid interstitial
pneumonia, eosinophilic granuloma of the lung, gastritis, chronic
hepatitis, cirrhosis, Graves' disease, thyroiditis, hypothyroidism,
psoriasis, Alzheimer's disease, allergic rhinitis, inflammatory
dermatoses, cutaneous anaphylaxis reaction, and meningitis.
[0062] The term "comprising", as used herein, means that various
other compatible drugs and medicaments, as well as inert
ingredients, can be conjointly employed in the pharmaceutical
compositions and methods of this invention, as long as the defined
pharmaceutically active compounds and carriers are used in the
manner disclosed. The term "comprising" thus encompasses and
includes the more restrictive terms "consisting of" and "consisting
essentially of".
[0063] The term "patient", as used herein, is intended to encompass
any mammal, animal or human, which may benefit from treatment with
the compounds, compositions and methods of the present invention.
"Treat," "treating," "treatment," and "therapy" as used herein
refer to any curative therapy, prophylactic therapy, ameliorative
therapy and preventative therapy.
[0064] By "compatible" herein is meant that the components of the
compositions which comprise the present invention are capable of
being commingled without interacting in a manner which would
substantially decrease the efficacy of the pharmaceutically active
compound under ordinary use conditions.
[0065] The pharmaceutical compositions of the present invention
comprise specifically-defined methimazole derivatives and
tautomeric cyclic thiones, used in a safe and effective amount,
together with a pharmaceutically-acceptable carrier.
[0066] The methimazole derivatives used in the compositions of the
present invention are those having the following structural
formulae: 1
[0067] In these formulae, Y is selected from H, C1-C4 alkyl C1-C4
substituted alkyl, --NO.sub.2, and the phenyl moiety: 2
[0068] wherein no more than one Y group in said active compound may
be the phenyl moiety; R.sup.1 is selected from H, --OH, halogens
(F, Cl, Br or I), C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl, C.sub.1-C.sub.4 ester or C.sub.1-C.sub.4
substituted ester; R.sup.2 is selected from H, C.sub.1-C.sub.4
alkyl or C.sub.1-C.sub.4 substituted alkyl; R.sup.3 is selected
from H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl or
--CH.sub.2Ph (wherein Ph is phenyl); R.sup.4 is selected from H,
C.sub.1-C.sub.4 alkyl or C.sub.1-C.sub.4 substituted alkyl; X is
selected from S or O; Z is selected from --SR.sup.3, --OR.sup.3,
S(O)R.sup.3 or C.sub.1-C.sub.4 alkyl; and wherein at least two of
the R.sup.2 and R.sup.3 groups on said compound are C.sub.1-C.sub.4
alkyl when Y is not a phenyl moiety, and at least one Y is
--NO.sub.2 when Z is alkyl; together with a
pharmaceutically-acceptabl- e carrier.
[0069] Y is preferably H, the phenyl moiety or --NO.sub.2, and is
most preferably H or the phenyl moiety 3
[0070] In the defined compounds, no more than one Y group may be
the phenyl moiety. R.sup.1 is selected from H, --OH, halogens (F,
Cl, Br and I), C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted
alkyl, C.sub.1-C.sub.4ester and C.sub.1-C.sub.4 substituted ester;
preferably R.sup.1 is H, --OH, halogen, --OOC CH.sub.2M (where M is
H or a halogen); and is most preferably H. R.sup.2 is selected from
H, C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 substituted alkyl;
preferably one or both of the R.sup.2 groups is methyl. As used
herein, "substituted alkyl" or "substituted ester" is intended to
include alkyl, aryl or ester groups which are substituted in one or
more places with hydroxyl or alkoxyl groups, carboxyl groups,
halogens, nitro groups, amino or acylamino groups, and mixtures of
those moieties. Preferred "substituted alkyl" groups are
C.sub.1-C.sub.4 hydroxyl or alkoxyl groups, as well as groups
substituted with halogens. The R.sup.3 groups in the above formulae
are selected from H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl and --CH.sub.2Ph (wherein Ph is phenyl); in
preferred compounds, R.sup.3 is H or C.sub.1-C.sub.4 alkyl; most
preferably R.sup.3 is C.sub.1-C.sub.4 alkyl, particularly methyl.
R.sup.4 is selected from H, C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl, and preferably is H. X may be S
or O, and is preferably S. Finally, Z is selected from
C.sub.1-C.sub.4 alkyl, --SR.sup.3, --S(O)R.sup.3 and --OR.sup.3, is
preferably --SR.sup.3, --OR.sup.3, and --S(O)R.sup.3; most
preferably --SR.sup.3 and --OR.sup.3; and particularly --SR.sup.3.
In the above formulae, at least two of the R.sup.2 and R.sup.3
groups on the compound must be C.sub.1-C.sub.4 alkyl when Y is not
a phenyl moiety. Further, at least one of the Y groups should be
--NO.sub.2, when Z is C.sub.1-C.sub.4 alkyl.
[0071] Compounds useful in the present invention include the
tautomeric cyclic thiones, disclosed in Kjellin and Sandstrom, Acta
Chemica Scandanavica 23: 2879-2887 (1969), incorporated herein by
reference, having the formulae 4
[0072] wherein R.sup.5, R.sup.6=CH.sub.3, CH.sub.3; Ph, H; H,
Ph
[0073] R.sup.7=H, CH.sub.3
[0074] R.sup.8=O, S, NH, NCH.sub.3
[0075] Preferred compounds for use in the compositions of the
present invention include those having the formulae: 5
[0076] Another group of preferred compositions include those having
the formulae: 6
[0077] wherein R.sup.10 is selected from H. NO.sub.2, Ph, 4-HOPh
and 4-m-Ph (wherein m is F, Cl, Br, or I).
[0078] A particularly preferred subset of the pharmaceutical
compounds defined herein are those wherein one of the Y groups is
the phenyl moiety defined above. These compounds have the following
formulae: 7
[0079] In these compounds, Y is selected from H, C.sub.1-C.sub.4
alkyl and C.sub.1-C.sub.4 substituted alkyl, and is preferably H.
R.sup.1 is selected from H, --OH, halogens (F, Cl, Br and I),
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl,
C.sub.1-C.sub.4 ester, and C.sub.1-C.sub.4 substituted ester, and
is preferably H, --OH, halogen, --OOCCH.sub.2M (where) M is H or a
halogen), and is not preferably H. R.sup.2 is selected from H,
C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 substituted alkyl, and it
is preferred that at least one of the R.sup.2 groups be methyl.
R.sup.3 is selected from H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl, and --CH.sub.2Ph; preferred R.sup.3 moieties are
H and methyl. R.sup.4 is selected from H, C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl, and is preferably H. X is
selected from S and O, and is preferably S. Finally, the Z moiety
is selected from --SR.sup.3 and --OR.sup.3, and is preferably
--SR.sup.3. Particularly preferred compounds are those having the
structural formulae: 8
[0080] Other preferred compounds include: 9
[0081] wherein R.sup.9 is selected from --OH, -M and --OOCCH.sub.2
M; and M is selected from F, Cl, Br and I.
[0082] Most preferred is the compound having the structure given
below. 10
[0083] Mixtures of the pharmaceutically active compounds defined
herein may also be used. The methimazole derivatives and tautomeric
cyclic thiones described above can be synthesized using techniques
well known to those skilled in the art. For example, the synthesis
of several tautomeric cyclic thiones is described in Kjellin and
Sandstrom, Acta Chemica Scandanavica 23: 2879.congruent.2887
(1969), incorporated herein by reference.
[0084] A representative methimazole derivative may be synthesized
using the following procedure. Appropriately substituted analogs of
acetaldehyde are brominated in the 2-position by treatment with
bromine and UV light, followed by formation of the corresponding
diethylacetal using absolute ethanol. The bromine is then displaced
from this compound by treatment with anhydrous methylamine, or
other suitable amine, in a sealed tube at about 120.degree. for up
to about 16 hours. Reaction of the resulting aminoacetal with
potassium thiocyanate in the presence of hydrochloric acid, at
steam bath temperatures overnight, provides the methimazole
analogs.
1TABLE 1 Structure of Compounds. Compounds Imidazole 11 #1
1-Methylimidazole-2- thiol (Methimzaole) C.sub.4H.sub.6N.sub.2S;
1-Methyl-2- mercaptoimidazole (MMI) 12 #2 2-Methyl-5-nitro-1-
imidazole ethanol (Metronidazole) C.sub.6H.sub.9N.sub.3O.sub.3; MW:
171.16 13 #3 2-Mercaptoimidazole MW: 100.14 14 #4
2-Mercaptobenzimida- zole MW: 150.20 15 #5 2-Mercapto-5-
nitrobenzimidazole MW: 195.20 16 #6 2-Mercapto-5-
methylbenzimidazole MW: 164.23 17 #7 S-Methylmethimazole
C.sub.5H.sub.8N.sub.2S; MW: 128.20 B.P. 48.degree. @100u (liq.) 18
#8 N-Methylmethimazole C.sub.5H.sub.8N.sub.2S; MW: 128.20 B.P.
188.degree.-194.degree. 19 #9 5-Methylmethimazole
C.sub.5H.sub.8N.sub.2S; MW: 128.20 B.P. 254.degree.-255.degree. 20
#10 5-Phenylmethimazole C.sub.10H.sub.10N.sub.2S; MW: 190.27 B.P.
168.degree.-173.degree. 21 #11 1-Methyl-2- Thiomethyl-
5(4)nitroimidazole 22
[0085] The pharmaceutical compositions of the present invention
comprise a safe and effective amount of one or more of the
methimazole derivatives or tautomeric cyclic thione compounds
(i.e., the active compounds). Preferred compositions contain from
about 0.01% to about 25% of the active compounds, with most
preferred compositions containing from about 0.1% to about 10% of
the active compounds. The pharmaceutical compositions of the
present invention may be administered in any way conventionally
known, for example, intraperitoneally, intravenously,
intramuscularly, or topically, although oral administration is
preferred. Preferred compositions are in unit dosage form, i.e.,
pharmaceutical compositions, which are available in a pre-measured
form suitable for single dosage administration without requiring
that the individual dosage be measured out by the user, for
example, pills, tablets or ampules.
[0086] The pharmaceutical compositions of the present invention
additionally include a pharmaceutically-acceptable carrier
compatible with the methimazole derivatives or tautomeric cyclic
thiones described above. In addition to the
pharmaceutically-acceptable carrier, the pharmaceutical
compositions may contain, at their art accepted levels, additional
compatible ingredients, such as additional pharmaceutical actives,
excipients, formulational aids (e.g., tabletting aids), colorants,
flavorants, preservatives, solubilizing or dispersing agents, and
other materials well known to those skilled in the art.
[0087] As used herein, the term "pharmaceutical carrier" denotes a
solid or liquid filler, diluent or encapsulating substance. These
materials are well known to those skilled in the pharmaceutical
arts. Some examples of the substances which can serve as
pharmaceutical carriers are sugars, such as lactose, glucose, and
sucrose; starches, such as corn starch and potato starch; cellulose
and its derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose, and cellulose acetate; powdered tragacanth; malt;
gelatin; talc; stearic acid; magnesium stearate; calcium sulfate;
vegetable oils, such as peanut oil, cottonseed oil, sesame oil,
olive oil, corn oil and oil of theobroma; polyols, such as
propylene glycol, glycerine, sorbitol, mannitol, and polyethylene
glycol; agar; alginic acid; pyrogen-free water; isotonic saline;
and phosphate buffer solutions, as well as other non-toxic
compatible substances used in pharmaceutical formulations. They may
comprise liposomes or drug carriers made lipids or polymeric
particles, including biodegradable polymers, or targeted delivery
applications, e.g., coupling to antibodies. Wetting agents and
lubricants, such as sodium lauryl sulfate, as well as coloring
agents, flavoring agents, tableting agents, and preservatives, can
also be present. Formulation of the components into pharmaceutical
compositions is done using conventional techniques.
[0088] The pharmaceutical carrier employed in conjunction with the
pharmaceutical compositions of the present invention is used at a
concentration sufficient to provide a practical size-to-dosage
relationship. Preferably, the pharmaceutical carrier comprises from
about 75% to about 99.99%, preferably from about 90% to about
99.9%, by weight of the total pharmaceutical composition. The
methimazole derivatives or tautomeric cyclic thiones defined in the
present application may surprisingly be more soluble than
methimazole in conventional carrier materials. This provides
significant benefits in allowing greater flexibility in the
formulation of pharmaceutical compositions containing those
methimazole derivatives, and may allow the use of significantly
lower doses of the active compound.
[0089] In its broadest aspects, methimazole derivatives of the
present invention are administered in a dosage range of from about
0.001 to about 100 milligrams, preferably from about 0.05 to about
50 milligrams, per day. The pharmaceutical compositions of the
present invention are administered such that appropriate levels of
pharmaceutical active are achieved in the bloodstream. The precise
dosage level required in a given case will depend upon, for
example, the particular methimazole derivative used, the nature of
the disease being treated, and the size, weight, age and physical
condition of the patient.
[0090] The term "pharmaceutically acceptable salts" refers to salts
prepared from pharmaceutically acceptable non-toxic bases or acids
including inorganic or organic bases and inorganic or organic
acids. Salts derived from inorganic bases include aluminum,
ammonium, calcium, copper, ferric, ferrous, lithium, magnesium,
manganic salts, manganous, potassium, sodium, zinc, and the like.
Particularly preferred are the ammonium, calcium, magnesium,
potassium, and sodium salts. Salts derived from pharmaceutically
acceptable organic non-toxic bases include salts of primary,
secondary, and tertiary amines, substituted amines including
naturally occurring substituted amines, cyclic amines, and basic
ion exchange resins, such as arginine, betaine, caffeine, choline,
N,N'-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol,
2-dimethylaminoethanol, ethanolamine, ethylenediamine,
N-ethyl-morpholine, N-ethylpiperidine, glucamine, glucosamine,
histidine, hydrabamine, isopropylamine, lysine, methylglucamine,
morpholine, piperazine, piperidine, polyamine resins, procaine,
purines, theobromine, triethylamine, trimethylamine,
tripropylamine, tromethamine, and the like. When the compound of
the present invention is basic, salts may be prepared from
pharmaceutically acceptable non-toxic acids, including inorganic
and organic acids. Such acids include acetic, benzenesulfonic,
benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric,
gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic,
maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic,
pantothenic, phosphoric, succinic, sulfuric, tartaric,
p-toluenesulfonic acid, and the like. Particularly preferred are
citric, hydrobromic, hydrochloric, maleic, phosphoric, sulfuric,
and tartaric acids. It will be understood that, as used herein, the
compounds referred to herein are meant to also include the
pharmaceutically acceptable salts.
[0091] The ability of the therapeutic compounds of the present
invention to inhibit the actions of VCAM-1 makes them useful for
preventing or reversing the symptoms, disorders or diseases induced
by the binding of VCAM-1 to its various-ligands (e.g., VLA-4).
Thus, these compounds will inhibit rolling and cell adhesion
processes including cell signaling, activation, migration,
proliferation and differentiation. Accordingly, another aspect of
the present invention provides a method for the treatment
(including prevention, alleviation, amelioration or suppression) of
diseases or disorders or symptoms mediated by VCAM-1 binding, and
cell adhesion and activation, which comprises administering to a
mammal an effective amount of a compound of the present invention.
Such diseases, disorders, conditions or symptoms are for example
(1) multiple sclerosis, (2) asthma, (3) allergic rhinitis, (4)
allergic conjunctivitis, (5) inflammatory lung diseases, (6)
rheumatoid arthritis, (7) septic arthritis, (8) type I or Type II
diabetes and their macro- or microvascular complications, e.g.
nephropathy, stroke, or myocardial infarct, (9) organ
transplantation rejection, (10) restenosis, (11) autologous bone
marrow transplantation, (12) inflammatory sequelae of viral
infections, (13) myocarditis, (14) inflammatory bowel disease
including ulcerative colitis and Crohn's disease, (15) certain
types of toxic and immune-based nephritis, (16) contact dermal
hypersensitivity, (17) psoriasis, (18) tumor metastasis, (19)
thyroiditis, and (20) atherosclerosis.
[0092] The magnitude of prophylactic or therapeutic dose of the
therapeutic compound of the present invention will, of course, vary
with the nature of the severity of the condition to be treated and
with the particular therapeutic compound of the present invention
and its route of administration. It will also vary according to the
age, weight and response of the individual patient. In general, the
daily dose range lie within the range of from about 0.001 mg to
about 100 mg per kg body weight of a mammal, preferably 0.01 mg to
about 50 mg per kg, and most preferably 0.1 to 10 mg per kg, in
single or divided doses. On the other hand, it may be necessary to
use dosages outside these limits in some cases.
[0093] For use where a composition for intravenous or
intraperitoneal administration is employed, a suitable dosage range
is from about 0.001 mg to about 25 mg (preferably from 0.01 mg to
about 1 mg) of a therapeutic compound of the present invention per
kg of body weight per day and for cytoprotective use from about 0.1
mg to about 100 mg (preferably from about 1 mg to about 100 mg and
more preferably from about 1 mg to about 10 mg) of the therapeutic
compound of the present invention per kg of body weight per
day.
[0094] In the case where an oral composition is employed, a
suitable dosage range is, e.g. from about 0.01 mg to about 100 mg
of the therapeutic compound of the present invention per kg of body
weight per day, preferably from about 0.1 mg to about 10 mg per kg
and for cytoprotective use from 0.1 mg to about 100 mg (preferably
from about 1 mg to about 100 mg and more preferably from about 10
mg to about 100 mg) of a therapeutic compound of the present
invention per kg of body weight per day.
[0095] For the treatment of diseases of the eye, ophthalmic
preparations for ocular administration comprising 0.001-1% by
weight solutions or suspensions of the therapeutic compound of the
present invention in an acceptable ophthalmic formulation may be
used.
[0096] Another aspect of the present invention provides
pharmaceutical compositions which comprises a compound of the
present invention and a pharmaceutically acceptable carrier. The
term "composition", as in pharmaceutical composition, is intended
to encompass a product comprising the active ingredient(s), and the
inert ingredient(s) (pharmaceutically acceptable excipients) that
make up the carrier, as well as any product which results, directly
or indirectly, from combination, complexation or aggregation of any
two or more of the ingredients, or from dissociation of one or more
of the ingredients, or from other types of reactions or
interactions of one or more of the ingredients. Accordingly, the
pharmaceutical compositions of the present invention encompass any
composition made by admixing a compound of the present invention,
additional active ingredient(s), and pharmaceutically acceptable
excipients.
[0097] Any suitable route of administration may be employed for
providing a mammal, especially a human with an effective dosage of
a compound of the present invention. For example, oral, rectal,
topical, parenteral, ocular, pulmonary, nasal, and the like may be
employed. Dosage forms include tablets, troches, dispersions,
suspensions, solutions, capsules, creams, ointments, aerosols, and
the like.
[0098] The pharmaceutical compositions of the present invention
comprise a compound of the present invention as an active
ingredient or a pharmaceutically acceptable salt thereof, and may
also contain a pharmaceutically acceptable carrier and optionally
other therapeutic ingredients. The term "pharmaceutically
acceptable salts" refers to salts prepared from pharmaceutically
acceptable non-toxic bases or acids including inorganic bases or
acids and organic bases or acids.
[0099] The compositions include compositions suitable for oral,
rectal, topical, parenteral (including subcutaneous, intramuscular,
and intravenous), ocular (ophthalmic), pulmonary (aerosol
inhalation), or nasal administration, although the most suitable
route in any given case will depend on the nature and severity of
the conditions being treated and on the nature of the active
ingredient. They may be conveniently presented in unit dosage form
and prepared by any of the methods well-known in the art of
pharmacy.
[0100] For administration by inhalation, the compounds of the
present invention are conveniently delivered in the form of an
aerosol spray presentation from pressurized packs or nebulisers.
The compounds may also be delivered as powders, which may be
formulated and the powder composition may be inhaled with the aid
of an insufflation powder inhaler device. The preferred delivery
systems for inhalation are metered dose inhalation (MDI) aerosol,
which may be formulated as a suspension or solution of a compound
of the present invention in suitable propellants, such as
fluorocarbons or hydrocarbons and dry powder inhalation (DPI)
aerosol, which may be formulated as a dry powder of a compound of
the present invention with or without additional excipients.
[0101] Suitable topical formulations include transdermal devices,
aerosols, creams, ointments, lotions, dusting powders, and the
like.
[0102] In practical use, the compounds of the present invention can
be combined as the active ingredient in intimate admixture with a
pharmaceutical carrier according to conventional pharmaceutical
compounding techniques. The carrier may take a wide variety of
forms depending on the form of preparation desired for
administration, e.g., oral or parenteral (including intravenous).
In preparing the compositions for oral dosage form, any of the
usual pharmaceutical media may be employed, such as, for example,
water, glycols, oils, alcohols, flavoring agents, preservatives,
coloring agents and the like in the case of oral liquid
preparations, such as, for example, suspensions, elixirs and
solutions; or carriers such as starches, sugars, microcrystalline
cellulose, diluents, granulating agents, lubricants, binders,
disintegrating agents and the like in the case of oral solid
preparations such as, for example, powders, capsules and tablets,
with the solid oral preparations being preferred over the liquid
preparations. Because of their ease of administration, tablets and
capsules represent the most advantageous oral dosage unit form in
which case solid pharmaceutical carriers are obviously employed. If
desired, tablets may be coated by standard aqueous or nonaqueous
techniques. In addition to the common dosage forms set out above,
the therapeutic compound of the present invention may also be
administered by controlled release means and/or delivery devices
such as those described in U.S. Pat. Nos. 3,845,770; 3,916,899;
3,536,809; 3,598,123; 3,630,200 and 4,008,719.
[0103] Pharmaceutical compositions of the present invention
suitable for oral administration may be presented as discrete units
such as capsules, cachets or tablets each containing a
predetermined amount of the active ingredient, as a powder or
granules or as a solution or a suspension in an aqueous liquid, a
non-aqueous liquid, an oil-in-water emulsion or a water-in-oil
liquid emulsion. Such compositions may be prepared by any of the
methods of pharmacy but all methods include the step of bringing
into association the active ingredient with the carrier, which
constitutes one or more necessary ingredients. In general, the
compositions are prepared by uniformly and intimately admixing the
active ingredient with liquid carriers or finely divided solid
carriers or both, and then, if necessary, shaping the product into
the desired presentation. For example, a tablet may be prepared by
compression or molding, optionally with one or more accessory
ingredients. Compressed tablets may be prepared by compressing in a
suitable machine, the active ingredient in a free-flowing form such
as powder or granules, optionally mixed with a binder, lubricant,
inert diluent, surface active or dispersing agent. Molded tablets
may be made by molding in a suitable machine, a mixture of the
powdered compound moistened with an inert liquid diluent.
Desirably, each tablet contains from about 1 mg to about 500 mg of
the active ingredient and each cachet or capsule contains from
about 1 to about 500 mg of the active ingredient.
[0104] Compounds of the present invention may be used in
combination with other drugs that are used in the
treatment/prevention/suppression or amelioration of the diseases or
conditions for which compounds of the present invention are useful.
Such other drugs may be administered, by a route and in an amount
commonly used therefor, contemporaneously or sequentially with a
compound of the present invention, such as methimazole derivatives
and tautomeric cyclic thiones. When a compound of the present
invention is used contemporaneously with one or more drugs, a
pharmaceutical composition containing such other drugs in addition
to the compound of the present invention is preferred. Accordingly,
the pharmaceutical compositions of the present invention include
those that also contain one or more other active ingredients, in
addition to a compound of the present invention. Examples of other
active ingredients that may be combined with a compound of the
present invention I, either administered separately or in the same
pharmaceutical compositions, include, but are not limited to: (a)
VCAM-1 antagonists; (b) steroids such as beclomethasone,
methylprednisolone, betamethasone, prednisone, dexamethasone, and
hydrocortisone; (c) immunosuppressants such as cyclosporin,
tacrolimus, rapamycin and other FK-506 type immunosuppressants; (d)
antihistamines (H1-histamine antagonists) such as bromopheniramine,
chlorpheniramine, dexchlorpheniramine, triprolidine, clemastine,
diphenhydramine, diphenylpyraline, tripelennamine, hydroxyzine,
methdilazine, promethazine, trimeprazine, azatadine,
cyproheptadine, antazoline, pheniramine pyrilamine, astemizole,
terfenadine, loratadine, cetirizine, fexofenadine,
descarboethoxyloratadine, and the like; (e) non-steroidal
anti-asthmatics such as .beta.2-agonists (terbutaline,
metaproterenol, fenoterol, isoetharine, albuterol, bitolterol,
salmeterol and pirbuterol), theophylline, cromolyn sodium,
atropine, ipratropium bromide, leukotriene antagonists
(zafirlukast, montelukast, pranlukast, iralukast, pobilukast,
SKB-106,203), leukotriene biosynthesis inhibitors (zileuton,
BAY-1005); (f) non-steroidal antiinflammatory agents (NSAIDs) such
as propionic acid derivatives (alminoprofen, benoxaprofen, bucloxic
acid, carprofen, fenbufen, fenoprofen, fluprofen, flurbiprofen,
ibuprofen, indoprofen, ketoprofen, miroprofen, naproxen, oxaprozin,
pirprofen, pranoprofen, suprofen, tiaprofenic acid, and
tioxaprofen), acetic acid derivatives (indomethacin, acemetacin,
alclofenac, clidanac, diclofenac, fenclofenac, fenclozic acid,
fentiazac, furofenac, ibufenac, isoxepac, oxpinac, sulindac,
tiopinac, tolmetin, zidometacin, and zomepirac), fenamic acid
derivatives (flufenamic acid, meclofenamic acid, mefenamic acid,
niflumic acid and tolfenamic acid), biphenylcarboxylic acid
derivatives (diflunisal and flufenisal), oxicams (isoxicam,
piroxicam, sudoxicam and tenoxican), salicylates (acetyl salicylic
acid, sulfasalazine) and the pyrazolones (apazone, bezpiperylon,
feprazone, mofebutazone, oxyphenbutazone, phenylbutazone); (g)
cyclooxygenase-2 (COX-2) inhibitors such as celecoxib; (h)
inhibitors of phosphodiesterase type IV (PDE-IV); (i) antagonists
of the chemokine receptors, especially CCR-1, CCR-2, and CCR-3; (j)
cholesterol lowering agents such as HMG-CoA reductase inhibitors
(lovastatin, simvastatin and pravastatin, fluvastatin,
atorvastatin, and other statins), sequestrants (cholestyramine and
colestipol), nicotinic acid, fenofibric acid derivatives
(gemfibrozil, clofibrat, fenofibrate and benzafibrate), and
probucol; (k) anti-diabetic agents such as insulin, sulfonylureas,
biguanides (metformin), a-glucosidase inhibitors (acarbose) and
glitazones (troglitazone, pioglitazone, englitazone, MCC-555,
BRL49653 and the like); (1) preparations of type 1 interferon
(e.g., beta-interferon and alpha-interferon); (m) anticholinergic
agents such as muscarinic antagonists (ipratropium bromide); (n)
other compounds such as 5-aminosalicylic acid and prodrugs thereof,
antimetabolites such as azathioprine and 6-mercaptopurine, and
cytotoxic cancer chemotherapeutic agents, (o) antibiotics.
[0105] The weight ratio of the therapeutic compound of the present
invention to the second active ingredient may be varied and will
depend upon the effective dose of each ingredient. Generally, an
effective dose of each will be used. Thus, for example, when a
therapeutic is combined with an NSAID the weight ratio of the
compound of the therapeutic compound of the present invention to
the NSAID will generally range from about 1000:1 to about 1:1000,
preferably about 200:1 to about 1:200. Combinations of a
therapeutic and other active ingredients will generally also be
within the aforementioned range, but in each case, an effective
dose of each active ingredient should be used.
[0106] The following examples are intended to illustrate the
pharmaceutically active compounds, pharmaceutical compositions and
methods of treatment of the present invention, but are not intended
to be limiting thereof.
EXAMPLES
[0107] The following examples are intended to illustrate the
pharmaceutically active compounds, pharmaceutical compositions and
methods of treatment of the present invention, but are not intended
to be limiting thereof.
[0108] Pro-inflammatory cytokine (e.g. TNF-.alpha.)-induced
expression of endothelial cell adhesion molecules (ECAMs) on the
lumenal surface of the vascular endothelium, and a consequent
increase in leukocyte adhesion, is a key aspect of pathological
inflammation. The present invention provides for the use of
methimazole derivatives and tautomeric cyclic thiones that (i)
dramatically inhibit TNF-.alpha.-induced VCAM-1 mRNA and protein
expression in human aortic endothelial cells (HAEC), has a
relatively modest inhibitory effect on TNF-.alpha. induced
E-selectin expression and have no effect on ICAM-1 expression; (ii)
significantly reduce TNF-.alpha. induced monocytic (U937) cell
adhesion to HAEC under in vitro flow conditions similar to that
present in vivo; (iii) inhibit TNF-.alpha. induced interferon
regulatory factor-1 (IRF-1) binding to VCAM-1 promoter and (iv)
reduce TNF-.alpha. induced IRF-1 expression in HAEC cells.
Combined, the results indicate that methimazole derivatives and
tautomeric cyclic thiones can reduce TNF-.alpha. induced monocytic
cell adhesion to HAEC predominantly by inhibiting VCAM-1 expression
in an IRF-1 dependent manner.
[0109] Materials and Methods
[0110] Materials: Medium 199 (M199), RPMI 1640 (RPMI), and Hanks
Balanced Salt Solution (HBSS) with Ca++ and Mg++ (HBSS+) all are
from Biowhittaker (Walkersville, Md.). Delbecco's Phosphate
Buffered Saline without Ca.sup.++ or Mg.sup.++ (PBS) is from KD
Medical (Columbia, Md.). Heat inactivated defined fetal bovine
serum (FBS) is from Hyclone Laboratories Inc. (Logan, Utah).
L-glutamine, trypsin-versene, penicillin/streptomycin- , and
non-essential amino acid all are from Biosource International
(Camarillo, Calif.). Endothelial growth factor is from Calbiochem
(San Diego, Calif.). Bovine hypothalamus extract is from Pel-Freeze
Biological Inc. (Rogers, Ark.). Gelatin, heparin, DMSO, BSA,
O-phenylenediamine dihydrochloride (OPD) and phosphate citrate
buffer tablets with sodium perborate are from Sigma Chemical Co.
(St. Louis, Mo.). BSA is added to HBSS+ to generate a HBSS+, 0.5%
BSA assay buffer. Recombinant human TNF-.alpha. is from Calbiochem.
C-10 is synthesized as described by Ricerca (Cleveland, Ohio) (26).
C-10 is prepared as 200 mM stock solution in DMSO.
[0111] Antibodies: Function blocking murine mAb HEL3/2 (anti-human
E-selectin; IgG.sub.1) is a generous gift from Dr. Raymond T.
Camphausen (Wyeth Laboratories; Cambridge, Mass.). Function
blocking murine mAb 51-10C9 (anti-human VCAM-1; IgG.sub.1) is from
BD Pharmingen (San Diego, Calif.). Murine mAb R6.5 (anti-human
ICAM-1; IgG.sub.2a) is kindly provided by Dr. Robert Rothlein
(Boehringer Ingelheim; Ridgefield, Conn.). Murine mAb TS 1/22
(anti-human LFA-1; IgG.sub.1) is from Endogen (Woburn, Mass.). HRP
conjugated goat F(ab').sub.2 anti-mouse IgG polyclonal secondary
antibody (Calbiochem) is used to detect the primary mAbs in the
ELISA. The polyclonal antibodies to p50 (sc-1191), p65 (sc-109),
p52 (sc-298), c-rel (sc-70), RelB (sc-226), IRF-1 (sc-1041.times.)
are from Santa Cruz Biotechnology (Santa Cruz, Calif.).
[0112] Cell culture and treatment of HAEC: Human aortic endothelial
cells (HAEC; Cambrex Bio Science Walkersville, Inc., Walkersville,
Md.) are cultured in M199 supplemented with 8% FBS, 100 .mu.g/ml
heparin, 10 ng/ml endothelial growth factor, 100 .mu.g/ml
hypothalamus extract, 2 mM L-glutamine, 1% non-essential amino
acids, 100 units/ml penicillin and 100 .mu.g/ml streptomycin. HAEC
are subcultured on gelatin pre-coated: 96-well tissue culture
plates (Corning Incorporated; Corning, N.Y.) for viability assays
and ELISA; 100-mm tissue culture dishes (BD Falcon; Franklin Lakes,
N.J.) for Northern blot analyses, Western blot analyses and EMSA;
35-mm tissue culture dishes (Corning) for adhesion assays and on
24-well tissue culture plates for luciferase promoter assays (BD
Falcon). All experiments are performed with confluent HAEC
monolayers. Unless noted otherwise, HAEC are treated with 25 ng/ml
TNF-.alpha., in the absence or presence of C-10 or 0.25% DMSO
(carrier control for C-10), for 2-24 hrs. The concentration of DMSO
is held constant at 0.25% (unless indicated otherwise) for all of
the C-10 conditions. We observed that treatment of HAEC with C-10,
at the concentrations used in this study, has little to no effect
on HAEC viability as determined by MTS assay (20) and visual
inspection of the HAEC monolayers (data not shown).
[0113] U937 cells (American Type Culture Collection; Manassas, Va.)
are cultured in RPMI supplemented with 8% FBS, 2 mM L-glutamine,
100 units/ml penicillin and 100 .mu.g/ml streptomycin. For the
adhesion assays, U937 cells are washed, resuspended to
1.times.10.sup.8 cells/ml in RPMI and held on ice (<4 hrs.)
until the time they are used in the flow adhesion assay.
[0114] ELISA: ELISA is used to characterize the protein levels of
ECAMs on HAEC in a manner similar to that described previously
(20). HAEC are washed with cold HBSS+, fixed in 1% formaldehyde at
4.degree. C. for 20 min., washed with cold HBSS+, and incubated in
cold M199 containing 8% FBS. Unless otherwise noted, from this
point on all antibody dilutions and washes are carried out with
M199 containing 8% FBS. Murine mAbs (primary mAbs) to ECAMs are
added (10 .mu.g/ml) and the HAEC incubated at 4.degree. C. for 20
min. Following the incubation, the wells are washed and a
peroxidase conjugated polyclonal (secondary) antibody to mouse IgG
is added (diluted 1:50). After a 20 min. incubation at 4.degree.
C., the wells are washed and treated with OPD dissolved in
phosphate citrate buffer containing sodium perborate. Following a
10 min. incubation at room temperature, the absorbance of the fluid
in each well is determined at 450 nm using a micro-well plate
spectrophotometer (Molecular Devices; Sunnyvale, Calif.). In every
experiment, each condition is run in triplicate wells.
[0115] RNA isolation and Northern blot analysis: Northern blot
analysis is used to characterize the mRNA levels in a manner
similar to that described previously (27, 29, 33). HAEC are washed
with PBS and total RNA extracted using a commercial kit (RNeasy
Mini Kit; Qiagen Inc.; Valencia, Calif.). 12 .mu.g of total RNA per
lane is resolved on 1% denaturing agarose gels containing 0.66M
formaldehyde. Gels are capillary blotted on Nytran membranes
(Schleicher and Schuell Inc.; Keene, N.H.), UV cross-linked, and
used for hybridization. The probe for IRF-1 has been previously
described (33). The G3PDH cDNA is from Clontech (Palo Alto,
Calif.). Other probe sequences are synthesized by RT-PCR (33) using
the following cDNA specific primers: VCAM-1,
5'GACTCCGTCTCATTGACTTGCAGCACCACA- G 3' and
5'ATACTCCCGCATCCTTCAACTGGGCCTTTCG 3' (1876 bp); E-Selectin,
5'GTGCAGCCATTCCCCTGCTGGAGAGTTC 3' and
2 5'GGGCCAGAGACCCGAGGAGAGTTATCTG 3' (977 bp); and ICAM-1,
5'CTCAGGTATCCATCCATCCCAGAGAAGCCTTCC 3' and
5'CCCTTGAGTTTTATGGCCTCCTCCTGAGCCTTC 3' (1514 bp).
[0116] cDNAs are labeled with .alpha.-.sup.32P-dCTP using the
Ladderman Labeling Kit (Takara Biochemical Inc.; Berkeley, Calif.)
(33). Northern blots are developed using a BAS 1500 Bioimaging
Analyzer (Fuji Photo Film Co., Ltd. Medical Systems USA Inc.;
Stanford, Calif.). Each experiment is replicated at least
twice.
[0117] Nuclear Extracts and EMSA: Nuclear extracts are prepared
from harvested HAEC using NE-PER.RTM. extraction reagents (Pierce
Chemical Co.; Rockford, Ill.) in the presence of a protease
inhibitor cocktail (PMSF, Leupeptin, Pepstatin-A). Oligonucleotides
(Biosynthesis Inc.; Lewisville, Tex.) are annealed and precipitated
double stranded oligonucleotides end labeled with
.gamma.-.sup.32P-ATP using T4 polynucleotide kinase enzyme. Binding
reactions (20 min., room temperature) included .sup.32P-labeled
probe (activity 100,000 cpm), 3-6 .mu.g HAEC nuclear extract, 1
.mu.g poly(dI-dC), 1 mM DTT, 10% glycerol and 1.times. binding
buffer. Binding buffer (10.times.) for NF-.kappa.B EMSA is 200 mM
HEPES-KOH (pH7.9), 340 mM KCl, 50 mM MgCl.sub.2, 5 mM EDTA (pH
8.0), 1% Triton X-100. Binding buffer (10.times.) for IRF-1 EMSA is
100 mM Tris-HCL (pH 7.5), 500 mM NaCl, 50 mM MgCl.sub.2, 10 mM EDTA
(pH 8.0). In competition studies, nuclear extracts are incubated
with 100 fold molar excess of unlabeled double stranded
oligonucleotide. In supershift studies, nuclear extracts are
incubated with 2 .mu.g of appropriate antibodies. After the
incubations, reaction mixtures are electrophoresed (160V, room
temperature) on 5% non-denaturing polyacrylamide gels containing 5%
glycerol in 1.times.TBE (50 mM Tris, 50 mM boric acid, and 1 mM
EDTA). Gels are dried and autoradiographed. Each experiment is
replicated at least twice.
[0118] Flow adhesion assays: A parallel plate flow chamber
(Glycotech; Rockville, Md.), similar to that described by McIntire,
Smith and colleagues (34) is used in this study. Our particular set
up has been described previously (20). A 35-mm tissue culture dish
containing a confluent HAEC monolayer is loaded into the flow
chamber. After a brief rinse, U937 cells (5*10.sup.5 cells/ml in
assay buffer) are drawn over the HAEC monolayer at a shear stress
of 1.8 dynes/cm.sup.2. To determine U937 cell accumulation, the
number of U937 cells adherent (either rolling or firmly adherent)
to the HAEC monolayer in 8 different fields of view after 2.5
minutes of flow is determined, averaged and normalized to the area
of the field of view to give the result for that particular run.
Such an assay is done at least 3 times. In certain experiments,
TNF-.alpha. activated HAEC, in the absence or presence of C-10, are
treated with mAbs HEL3/2 or 51-10C9 (10 .mu.g/ml) or a combination
of HEL3/2 and 51-10C9. The mAb treated HAEC are then incubated at
37.degree. C. for 15 min. prior to use in adhesion assays.
[0119] Dual Luciferase Assay: Four human VCAM-1 promoter deletion
constructs of different length, -1641/+12, -288/+12, -228/+12,
-85/+12 bp are amplified by PCR from human genomic DNA. Each
upstream primer contained a restriction endonuclease Mlu I site
located at the 5'-end of the primer. The downstream primer
corresponding to the +12 end contained a restriction endonuclease
Xho I site at the 5'-end. The PCR products are digested by Mlu I
and Xho I (New England Biolabs Inc., Beverly, Mass.) and ligated
into a similarly digested pGL3 basic luciferase reporter vector
(Promega, Madison, Wis.). Cells are transfected for 24 hrs. with
400 ng of indicated constructs, or pGL3 basic luciferase reporter
vector as control, using GeneJuice transfection reagent (Novagen
Inc., Madison, Wis.). All cells are also transfected with phRL-TK
(Int-) vector (Promega), which contains wildtype Renilla luciferase
(Rluc) as an "internal" transfection control. Luciferase assays are
conducted with the Dual-Luciferase Reporter Assay System (Promega)
on a Lumat LB 9507 tube luminometer. In every experiment, each
condition is run in triplicate wells. Each experiment is replicated
at least twice.
[0120] Western blot analysis: Whole cell lysates are prepared in
lysis buffer (150 mM NaCl, 1% IGEPAL CA-630, 50 mM Tris-HCL pH
8.0). 20 .mu.g of lysates are then resolved on 4-12% Bis-Tris PAGE
gels under denaturing conditions using the NuPAGE Bis-Tris System
(Invitrogen; Carlsbad, Calif.). Proteins are transferred to
nitrocellulose membranes, which are probed with IRF-1 antibody.
Subsequent binding of HRP conjugated goat anti-rabbit Ab (sc-2054,
Santa Cruz Biotechnology, Inc.) is detected using Lumigen PS-3
detection reagents (Amersham Pharmacia Biotech.; Piscataway,
N.J.).
[0121] Statistics: A single factor ANOVA is used to assess the
presence of statistical differences. If ANOVA indicated significant
differences between conditions, a Bonferroni test is used for
multiple pair-wise comparisons. Student's T-test is used to assess
the statistical difference in luciferase promoter assays. P values
<0.001 (for ELISA) and <0.05 (for adhesion and luciferase
promoter assays) are considered statistically significant. Unless
stated otherwise, all error bars represent standard deviation.
[0122] Results
[0123] Methimazole Derivatives and Tautomeric Cyclic Thiones
Dramatically Inhibit TNF-.alpha. Induced VCAM-1 Expression have a
Modest Effect on E-Selectin Expression, and has No Effect on ICAM-1
Expression
[0124] We sought to determine the effect of methimazole derivatives
and tautomeric cyclic thiones on TNF-.alpha. induced ECAM
expression using arterial endothelial cells, e.g., HAEC. Since the
ECAM profile on 4 hr. and 24 hr. TNF-.alpha. treated endothelial
cells is significantly different (6), we investigate the effect of
C-10 on 4 hr. and 24 hr. TNF-.alpha. treatment of HAEC. We first
determine the effect of C-10 on 4 hr. and 24 hr. TNF-.alpha.
induced ECAM protein expression on HAEC. Unactivated HAEC does not
appear to express E-selectin or VCAM-1 but did express ICAM-1 (FIG.
1A). 4 hr. treatment of HAEC with TNF-.alpha. induced E-selectin
and VCAM-1 protein expression and significantly increased ICAM-1
protein expression (FIG. 1A). Treatment of HAEC with DMSO (carrier
control) has little to no effect on 4 hr. TNF-.alpha. induced
protein expression of E-selectin, ICAM-1 and VCAM-1 (FIG. 1A). In
contrast, treatment of HAEC with C-10 significantly reduces 4 hr.
TNF-.alpha. induced protein expression of VCAM-1 (FIG. 1A). This
effect is observed with C-10 concentrations .gtoreq.0.25 mM (FIG.
1A). Treatment of HAEC with methimazole derivatives and tautomeric
cyclic thiones has little, if any, effect on 4 hr. TNF-.alpha.
induced protein expression of E-selectin and ICAM-1 (FIG. 1A). The
expression at the protein level is paralleled at the mRNA level.
Specifically, Northern blot analyses reveales that C-10 reduced, in
a dose-dependent manner, TNF-.alpha. induced VCAM-1 mRNA
expression, has a marginal effect on E-selectin mRNA expression and
no effect on ICAM-1 mRNA expression (FIG. 1B).
[0125] Similar results are observed at the 24 hr. time point with
the exception that an inhibitory effect on E-selectin expression is
also observed. HAEC treated with TNF-.alpha. for 24 hrs. expresses
a level of E-selectin that is higher than the basal level (FIG. 2A)
although distinctly less than the level seen at 4 hrs.
post-TNF-.alpha. treatment (FIG. 1A). 24 hr. TNF-.alpha. activated
HAEC also expresses elevated levels of ICAM-1 and VCAM-1 (relative
to unactivated HAEC) (FIG. 2A). Treatment of HAEC with DMSO has
little to no effect on the 24 hr. TNF-.alpha. induces expression of
E-selectin, ICAM-1 and VCAM-1 (FIG. 2A). In contrast, treatment of
HAEC with C-10 significantly reduces the 24 hr. TNF-.alpha. induces
expression of E-selectin and VCAM-1 but has no effect on ICAM-1
expression (FIG. 2A). The effect is observed with C-10
concentrations .gtoreq.0.05 mM (FIG. 2A). Again, the expression at
the protein level is paralleled at the mRNA level. Specifically,
Northern blot analyses reveales that C-10 reduced, in a dose
dependent manner, 24 hr. TNF-.alpha. induces E-selectin and VCAM-1
mRNA, while it has little to no effect on ICAM-1 mRNA expression
(FIG. 2B).
[0126] The effect is not restricted to C10 but is exemplified by
other methimazole derivatives or tautomeric cyclic thiones.
3TABLE 1 Effect of different concentrations of MMI derivatives and
Tautomeric Cyclic Thiones on TNF-alpha-induced VCAM-1 RNA levels in
aortic endothelial cells % INHIBITION Compound 10 :M 100 :M 5.0 mM
Methimazole 0 0 20 .+-. 10 2-mercaptoimidazole None None None
2-mercaptobenzimidazole 0 0 26 .+-. 10 2-mercapto-5- ND ND 11 .+-.
7 methylbenzimididazole N-methylmethimazole 0 31 .+-. 10 47 .+-. 12
5-Phenylmethimazole 75 .+-. 7 99 .+-. 4 99 .+-. 3
1-methyl-2-thiomethyl- 34 .+-. 6 83 .+-. 10 92 .+-. 5
5(4)nitroimidazole Values from three experiments in duplicate, mean
.+-. SD. ND is not done. Bold values represent significant
inhibition (P < 0.05 or better).
[0127] Methimazole Derivatives or Tautomeric Cyclic Thiones, e.g.,
C10, Inhibit Monocytic Cell Adhesion to TNF-.alpha. Activated
HAEC
[0128] VCAM-1 has been shown to play a role in mononuclear
leukocyte adhesion to vascular endothelium (35). This fact combined
with our finding that C-10 significantly inhibits VCAM-1 protein
expression (FIGS. 1A and 2A), led us to probe the effect of
methimazole derivatives and tautomeric cyclic thiones on monocytic
(U937) cell adhesion to 4 hr. and 24 hr. TNF-.alpha. activated
HAEC. For this study we use an in vitro flow chamber that mimics
flow conditions present in vivo and use C-10 concentrations (0.5 mM
for 4 hr. and 0.1 mM for 24 hr.) that has maximal effects in our
ELISA assays (FIGS. 1A and 2A).
[0129] First, we use a mAb blocking approach to determine which
ECAMs are involved in the adhesion of U937 cells to 4 hr.
TNF-.alpha. activated HAEC. A significant number of U937 cells
adhered to 4 hr. TNF-.alpha. activated HAEC (column 2; FIG. 3A)
while very few, if any, U937 cells adhered to unactivated HAEC
(column 1; FIG. 3A). U937 cell adhesion is unaffected by treatment
of 4 hr. TNF-.alpha. activated HAEC with 51-10C9, a function
blocking mAb to VCAM-1 (column 3 vs. column 2; FIG. 3A) and is
partially reduced by treatment of 4 hr. TNF-.alpha. activated HAEC
with HEL 3/2, a function blocking mAb to E-selectin (column 4 vs.
column 2; FIG. 3A). Further reduction in U937 cell adhesion is seen
upon treatment of 4 hr. TNF-.alpha. activated HAEC with a
combination of 51-10C9 and HEL3/2 (column 5 vs. column 4; FIG. 3A).
Combined these results suggest that U937 cell adhesion to 4 hr.
TNF-.alpha. activated HAEC is mediated by both E-selectin and
VCAM-1. This is consistent with other reports (18).
[0130] The combination of C-10 and the mAb to E-selectin (HEL3/2)
significantly reduced 4 hr. TNF-.alpha. induced U937 cell adhesion
(column 6 vs. column 2; FIG. 3A). In addition, the combination of
C-10 and the mAb to E-selectin significantly reduced the 4 hr.
TNF-.alpha. induced U937 cell adhesion relative to treatment with
the mAb to E-selectin alone (column 6 vs. column 4; FIG. 3A).
Treatment of HAEC with C-10 alone has little effect on the 4 hr.
TNF-.alpha. induced U937 cell adhesion compared to treatment with
DMSO (column 7 vs. column 8; FIG. 3A). Combined, this data
demonstrates that C-10 has a modest effect on 4 hr. TNF-.alpha.
induced U937 cell adhesion to HAEC, consistent with the mAb data
above showing inhibition required mAbs to E-selectin and VCAM-1 and
with evidence in FIG. 1 showing that at 4 hrs. C-10 has a selective
effect on VCAM-1 mRNA and protein expression.
[0131] A more dramatic effect is observed at the 24 hr. TNF-.alpha.
activation time point (FIG. 3B). A significant number of U937 cells
adhered to 24 hr. TNF-.alpha. activated HAEC (column 2; FIG. 3B)
while very few, if any, U937 cells adhered to unactivated HAEC
(column 1; FIG. 3B). The U937 cell adhesion to 24 hr. TNF-.alpha.
activated HAEC is dependent on both E-selectin and VCAM-1 (column 5
vs. columns 2,3,4; FIG. 3B). The combination of C-10 and the mAb to
E-selectin (HEL3/2) significantly reduced 24 hr. TNF-.alpha.
induced U937 cell adhesion (column 6 vs. column 2; FIG. 3B). In
addition, the combination of C-10 and the mAb to E-selectin
significantly reduced the 24 hr. TNF-.alpha. induced U937 cell
adhesion relative to treatment with the mAb to E-selectin alone
(column 6 vs. column 4; FIG. 3B). Treatment of HAEC with C-10 alone
also significantly reduced the 24 hr. TNF-.alpha. induced U937 cell
adhesion relative to treatment with DMSO (column 7 vs. column 8;
FIG. 3B). Combined, the above results clearly demonstrate that C-10
significantly reduces long term (24 hr.) TNF-.alpha. induced U937
cell adhesion to HAEC.
[0132] Methimazole Derivatives or Tautomeric Cyclic Thiones, e.g.,
C10 Effect VCAM-1 Gene Transcription
[0133] It is evident from above that methimazole derivatives, under
both conditions tested, inhibit TNF-.alpha. induced VCAM-1
expression (FIGS. 1 and 2). To probe whether methimazole
derivatives act transcriptionally to inhibit TNF-.alpha. induced
VCAM-1 gene expression and also to get an idea of the molecular
mechanism of C-10's inhibitory action, we conducted VCAM-1 promoter
reporter assays. The locations of the binding sites for various
transcription factors known to play a role in TNF-.alpha.-induced
human VCAM-1 expression, NF-.kappa.B, AP-1, SP-1, IRF-1 and GATA,
lie between -1641 and +12 as noted in FIG. 4. (8-11). Four
truncations of the VCAM-1 transcriptional regulatory element are
created (-1641/+12, -288/+12, -228/+12 and -85/+12 bp constructs)
in an attempt to grossly separate their activities (FIG. 4). These
are then inserted into a luciferase reporter plasmid and
transfected into HAEC.
[0134] TNF-.alpha. treatment induces an increase in promoter
activities of each of the four constructs (FIG. 4). C-10 treatment
inhibits the TNF-.alpha. induced activities of all four constructs
(FIG. 4) in the absence of a consistent significant effect on basal
promoter activity (FIG. 4). Note that although the
TNF-.alpha.-induced increase in promoter activity decreases between
the -228/+12 and -85/+12 bp constructs (FIG. 4), an inhibitory
effect of C-10 is observed with the 85/+12 bp construct (FIG. 4).
Combined, these data clearly demonstrate that C-10 affects VCAM-1
gene transcription and show that methimazole derivatives and
tautomeric cyclic thiones acts on a transcriptional regulatory
event that occurs within -85/+12 bp of the VCAM-1 promoter.
[0135] The effect is not restricted to C10 but is exemplified by
other methimazole derivatives or tautomeric cyclic thiones.
4TABLE 2 Effect of different concentrations of MMI derivatives and
Tautomeric Cyclic Thiones on TNF-alpha-induced VCAM-1 promoter
activity using hVCAM-1( -228 to +12)-luciferase construct activity
% INHIBITION Compound 10 :M 100 :M 5.0 mM Methimazole 0 0 0
2-mercaptoimidazole 0 0 0 2-mercaptobenzimidazole 0 0 30 .+-. 4
N-methylmethimazole 6 .+-. 2 44 .+-. 11 31 .+-. 3
5-methylmethimazole 0 0 14 .+-. 8 5-Phenylmethimazole 31 .+-. 5 61
.+-. 3 72 .+-. 3 1-methyl-2-thiomethyl- 29 .+-. 6 54 .+-. 10 58
.+-. 6 5(4)nitroimidazole Values from three experiments in
duplicate, mean .+-. SD. ND is not done. Bold values represent
significant inhibition (P < 0.05 or better).
[0136] Methimazole Derivatives or Tautomeric Cyclic Thiones, e.g.,
C10, do Not Affect TNF-.alpha. Induced NF-.kappa.B Binding Activity
to VCAM-1 Promoter
[0137] The binding sites for NF-.kappa.B, in the VCAM-1 promoter,
are located within -85/+12 bp (FIG. 4) (8, 9, 11). To determine if
the inhibitory effect of C-10 on TNF-.alpha. induced VCAM-1
expression is a consequence of C-10 inhibition of TNF-.alpha.
induced NF-.kappa.B activity we conduct EMSA. EMSA are performed
with .sup.32P-labeled NF-.kappa.B probe and 6 .mu.g of nuclear
extract prepared from HAEC treated with or without TNF-.alpha., in
the absence or presence of C-10 (results not shown). Upon 2 hr.
TNF-.alpha. treatment a complex is induced, which is prominent by
comparison to the control, no TNF-.alpha. treatment. Competition
with 100-fold molar excess of unlabeled NF-.kappa.B probe
eliminated the TNF-.alpha. induced complex formation. Addition of
0.5 mM C-10 or DMSO has no effect on TNF-.alpha. dependent complex
formation (data not shown). To identify the components of the
complex, we performed supershift studies using antibodies to
various NF-.kappa.B subunits. Antibodies directed against p50 and
p65 subunits of NF-.kappa.B supershifted the TNF-.alpha. induced
complex, whereas antibodies directed against p52, c-rel and rel-B
did not (data not shown). Addition of 0.5 mM C-10 also has no
effect in supershift studies (data not shown). Note that DMSO or
C-10 treatment alone also has no effect on unactivated HAEC.
Without wishing to be bound by theory in any way, the data strongly
suggest that the mechanism of methimazole derivatives and
tautomeric cyclic thiones inhibition of ECAM expression is not via
inhibition of NF-.kappa.B activation and binding to VCAM-1
promoter.
[0138] Methimazole Derivatives or Tautomeric Cyclic Thiones, e.g.,
C10, Inhibit TNF-.alpha. Induced IRF-1 Binding Activity to VCAM-1
Promoter
[0139] Because luciferase reporter assays suggestes that
methimazole derivatives and tautomeric cyclic thiones affect a
transcriptional regulatory event that occurs within -85/+12 bp in
the VCAM-1 promoter (FIG. 4) and because EMSA demonstrated that
C-10 does not affect TNF-.alpha. induced NF-.kappa.B activation, we
considered the possibility that methimazole derivatives and
tautomeric cyclic thiones might act at a different downstream site.
The binding site for IRF-1 is located downstream of NF-.kappa.B
binding sites within the -85/+12 bp, -11 to -1 bp, of the VCAM-1
promoter (8, 10, 11). To determine if the inhibitory effect of
methimazole derivatives and tautomeric cyclic thiones on
TNF-.alpha. induced VCAM-1 expression is a consequence of
methimazole derivatives and tautomeric cyclic thiones inhibition of
TNF-.alpha. induced IRF-1 activity we conduct EMSA. EMSA are
performed with .sup.32P-labeled IRF-1 probe (FIG. 5A) and 3 .mu.g
of nuclear extract prepared from HAEC treated with or without
TNF-.alpha., in the absence or presence of C-10 (FIG. 5B). Upon 2
hr. TNF-.alpha. treatment, a complex is induced (lane 3; FIG. 5B)
which is extremely prominent by comparison with control, no
TNF-.alpha. treatment (lane 3 vs. lane 2; FIG. 5B). Addition of 0.5
mM and 1 mM C-10 inhibits the formation of TNF-.alpha. induced
complex (lanes 4 and 5 vs. lane 3; FIG. 5B). Note, DMSO has no
effect on TNF-.alpha. dependent complex formation (lane 6 vs. lane
3; FIG. 5B). Competition with 100-fold molar excess of unlabeled
VCAM-1 IRF-1 probe (lane 7; FIG. 5B) or consensus IRF-1 probe (lane
9; FIG. 5B) eliminates the TNF-.alpha. induced complex formation.
However, competition with 100-fold molar excess of unlabeled VCAM-1
IRF-1 mutant probe (lane 8; FIG. 5B) or consensus NF-.kappa.B probe
(lane 10; FIG. 5B) did not affect the TNF-.alpha. induced complex
formation. In supershift assays (FIG. 5C), we found that an
antibody directed against IRF-1 supershifts the TNF-.alpha. induced
complex (lane 4 vs. lane 3; FIG. 5C). Combined, these data
demonstrate that methimazole derivatives and tautomeric cyclic
thiones affect IRF-1 binding activity to VCAM-1 promoter and
strongly suggest that methimazole derivatives and tautomeric cyclic
thiones inhibit VCAM-1 expression in an IRF-1 dependent manner.
[0140] To further probe and determine the mechanism by which
methimazole derivatives and tautomeric cyclic thiones inhibit
TNF-.alpha. induced IRF-1 binding to VCAM-1 promoter (FIG. 5B), we
investigate the effects of methimazole derivatives and tautomeric
cyclic thiones on TNF-.alpha. induced IRF-1 protein and mRNA
expression. Unactivated HAEC did not appear to express IRF-1 mRNA
(FIG. 6A). 2 hr. treatment of HAEC with TNF-.alpha. induced IRF-1
mRNA (FIG. 6A). Addition of 0.5 mM or 1 mM C-10 reduces the
TNF-.alpha. induced IRF-1 mRNA expression in HAEC (FIG. 6A). The
expression at the mRNA level is paralled at the protein level.
Specifically, C-10 treatment of HAEC reduced TNF-.alpha. induced
IRF-1 protein expression (FIG. 6B). Combined, the data presented in
this section demonstrates that methimazole derivatives and
tautomeric cyclic thiones reduce TNF-.alpha. induced IRF-1 protein
and mRNA expression.
[0141] These effects are not restricted to C10 but is exemplified
by other methimazole derivatives or tautomeric cyclic thiones.
5TABLE 3 Effect of different concentrations of MMI derivatives and
Tautomeric Cyclic Thiones on TNF-alpha-induced IRF-1 RNA levels %
INIHIBITION Compound 10 :M 100 :M 5 mM Methimazole 0 0 27 .+-. 12
2-mercaptoimidazole 0 0 0 N-methylmethimazole 0 34 .+-. 15 75 .+-.
14 5-Phenylmethimazole 65 .+-. 16 90 .+-. 17 95 .+-. 15
1-methyl-2-thiomethyl- 26 .+-. 12 64 .+-. 16 95 .+-. 12
5(4)nitroimidazole Values from two experiments in duplicate, mean
.+-. SD. Bold values represent significant inhibition (P < 0.05
or better).
[0142]
6TABLE 4 Effect of different concentrations of MMI derivatives and
Tautomeric Cyclic Thiones on TNF-alpha-induced IRF-1 Protein levels
% INHIBITION Compound 10 :M 100 :M 5 mM Methimazole 0 0 17 .+-. 6
5-Phenylmethimazole 76 .+-. 12 95 .+-. 12 95 .+-. 5
1-methyl-2-thiomethyl- 46 .+-. 15 69 .+-. 10 95 .+-. 12
5(4)nitroimidazole Values from two experiments in duplicate, mean
.+-. SD. Bold values represent significant inhibition (P < 0.05
or better).
[0143] Discussion. In this study, we have found that C-10, a phenyl
derivative of methimazole (a compound commonly used to treat
autoimmune diseases, e.g. Graves' disease), has novel
anti-inflammatory properties. Specifically, methimazole derivatives
and tautomeric cyclic thiones dramatically inhibit TNF-.alpha.
induced VCAM-1 mRNA and protein expression, have a relatively
modest inhibitory effect on E-selectin expression and have no
effect on ICAM-1 expression. We show that the effect on VCAM-1
inhibition is transcriptional and that methimazole derivatives and
tautomeric cyclic thiones significantly reduce TNF-.alpha. induced
monocytic cell adhesion to HAEC under in vitro flow conditions
similar to that present in vivo.
[0144] Several current and potential anti-inflammatory agents
diminish leukocyte adhesion by inhibiting cytokine induced ECAM
expression at the transcription level (5). Not all of these
compounds exert the same effect on cytokine induced ECAM
expression. For example, lactacystin, can reduce the cytokine
induced expression of E-selectin, ICAM-1 and VCAM-1 (20) while
other compounds appear to be selective for one particular ECAM
(e.g. VCAM-1; (19, 36)). Since the leukocyte adhesion cascade is
documented to have receptor--ligand functional overlap (e.g. both
E-selectin and VCAM-1 have been shown to support tethering and
rolling of lymphocytes (37, 38)) compounds that suppress the
expression of several of the ECAMs may be more effective at
blocking leukocyte adhesion in a variety of inflammation settings.
Specifically, methimazole derivatives and tautomeric cyclic thiones
exert a greater inhibitory effect on TNF-.alpha. induced VCAM-1
expression as compared to the effect on E-selectin and ICAM-1 and
can diminish monocytic cell adhesion to the endothelium under
flow.
[0145] The present invention provides that methimazole derivatives
and tautomeric cyclic thiones inhibit TNF-.alpha. induced VCAM-1
expression in a NF-.kappa.B independent and an IRF-1 dependent
manner. Further, methimazole derivatives and tautomeric cyclic
thiones can also be used tools to probe the role of IRF-1 in gene
regulation.
[0146] The increase in TNF-.alpha.-induced VCAM-1 promoter activity
is not significantly altered by deleting the AP-1 site between
-1641 and -288 bp (FIG. 4). This is consistent with previous
promoter assays (8) and a report indicating that the AP-1 effect is
mediated through the NF-.kappa.B element (41). The deletion of -288
to -228 bp with no clear loss of TNF-.alpha. induced promoter
activity (FIG. 4) is noteworthy given previous studies with other
endothelial cell types (8, 42). Interestingly, the
TNF-.alpha.-induced increase in promoter activity decreased between
the -228/+12 and -85/+12 bp constructs, despite the fact the
NF-.kappa.B elements are intact in the -85/+12 bp constructs (FIG.
4).
[0147] In conclusion, the present invention shows that methimazole
derivatives and tautomeric cyclic thiones exhibit anti-inflammation
properties. Specifically, phenyl methimazole (i) dramatically
inhibits TNF-.alpha. induced VCAM-1 expression, has a modest
inhibitory effect on E-selectin expression and has no effect on
ICAM-1 expression on HAEC; (ii) significantly reduces TNF-.alpha.
induced monocytic (U937) cell adhesion to HAEC under in vitro flow
conditions similar to that present in vivo; (iii) inhibits
TNF-.alpha. induced IRF-1 binding activity to VCAM-1 promoter and
(iv) reduces TNF-.alpha. induced IRF-1 expression in HAEC. Thus,
methimazole derivatives and tautomeric cyclic thiones can be used
as a therapeutic for the treatment of pathological inflammation, in
particular diseases involving VCAM-1 (e.g., atherosclerosis and
inflammatory bowel disease).
[0148] Pharmaceutical Compositions of the Present Invention
[0149] For the treatment of cell adhesion and inflammation
disorders, pharmaceutical compositions in dosage unit form comprise
an amount of composition which provides from about 0.05 to about 60
milligrams, preferably from about 0.05 to about 20 milligrams, of
active compound per day. Useful pharmaceutical formulations for
administration of the active compounds of this invention may be
illustrated below. They are made using conventional techniques.
7 CAPSULES Active ingredient 0.05 to 20 mg Lactose 20-100 mg Corn
Starch U.S.P. 20-100 mg Aerosolized silica gel 2-4 mg Magnesium
stearate 1-2 mg TABLETS Active ingredient 0.05 to 20 mg
Microcrystalline cellulose 50 mg Corn Starch U.S.P. 80 mg Lactose
U.S.P. 50 mg Magnesium stearate U.S.P. 1-2 mg
[0150] This tablet can be sugar coated according to conventional
art practices. Colors may be added to the coating.
8 CHEWABLE TABLETS Active ingredient 0.05 to 20 mg Mannitol, N.F.
100 mg Flavor 1 mg Magnesium stearate U.S.P. 2 mg SUPPOSITORIES
Active ingredient 0.05 to 20 mg Suppository base 1900 mg Dimethyl
sulfoxide 0.1 to 3% LIQUID Active ingredient 2.0 percent
Polyethylene glycol 300, N.F. 10.0 percent Glycerin 5.0 percent
Sodium bisulfite 0.02 percent Sorbitol solution 70%, U.S.P. 50
percent Methylparaben, U.S.P. 0.1 percent Propylparaben, U.S.P. 0.2
percent Distilled water, U.S.P. (q.s.) 100.0 cc Dimethyl sulfoxide
0.1 to 3% INJECTABLE Active ingredient 0.05 to 60 mg Polyethylene
glycol 600 1.0 cc Sodium bisulfite, U.S.P. 0.4 mg Water for
injection, U.S.P. (q.s.) 2.0 cc Dimethyl sulfoxide 0.1 to 3%
[0151] In addition, information regarding procedural or other
details supplementary to those set forth herein is described in
cited references specifically incorporated herein by reference.
[0152] It would be obvious to those skilled in the art that
modifications or variations may be made to the preferred embodiment
described herein without departing from the novel teachings of the
present invention. All such modifications and variations are
intended to be incorporated herein and within the scope of the
claims.
REFERENCES
[0153] 1. Cybulsky, M. I., and M. A. Gimbrone, Jr. 1991.
Endothelial expression of a mononuclear leukocyte adhesion molecule
during atherogenesis. Science 251:788-791.
[0154] 2. Schurmann, G. M., A. E. Bishop, P. Facer, M. Vecchio, J.
C. Lee, D. S. Rampton, and J. M. Polak. 1995. Increased expression
of cell adhesion molecule P-selectin in active inflammatory bowel
disease. Gut 36:411-418.
[0155] 3. Luscinskas, F. W., and M. A. Gimbrone. 1996.
Endothelial-dependent mechanisms in chronic inflammatory leukocyte
recruitment. Annu. Rev. Med. 47:413-421.
[0156] 4. Soriano, A., A. Salas, M. Sans, M. Gironella, M. Elena,
D.C. Anderson, J. M. Pique, and J. Panes. 2000. VCAM-1, but not
ICAM-1 or MAdCAM-1, immunoblockade ameliorates DSS-induced colitis
in mice. Lab. Invest. 80:1541-1551.
[0157] 5. Panes, J., M. Perry, and D. N. Granger. 1999.
Leukocyte-endothelial cell adhesion: avenues for therapeutic
intervention. Br J Pharmacol 126:537-550.
[0158] 6. Bevilacqua, M. P. 1993. Endothelial-leukocyte adhesion
molecules. Annu. Rev. Immunol. 11:767-804.
[0159] 7. Schindler, U., and V. R. Baichwal. 1994. Three NF-kappa B
binding sites in the human E-selectin gene required for maximal
tumor necrosis factor alpha-induced expression. Mol Cell Biol
14:5820-5831.
[0160] 8. Neish, A. S., A. J. Williams, H. J. Palmer, M. Z.
Whitley, and T. Collins. 1992. Functional analysis of the human
vascular cell adhesion molecule 1 promoter. J Exp Med
176:1583-1593.
[0161] 9. Neish, A. S., L. M. Khachigian, A. Park, V. R. Baichwal,
and T. Collins. 1995. Sp1 is a component of the cytokine-inducible
enhancer in the promoter of vascular cell adhesion molecule-1. J
Biol Chem 270:28903-28909.
[0162] 10. Neish, A. S., M. A. Read, D. Thanos, R. Pine, T.
Maniatis, and T. Collins. 1995. Endothelial interferon regulatory
factor 1 cooperates with NF-kappa B as a transcriptional activator
of vascular cell adhesion molecule 1. Mol Cell Biol
15:2558-2569.
[0163] 11. Iademarco, M. F., J. J. McQuillan, G. D. Rosen, and D.C.
Dean. 1992. Characterization of the promoter for vascular cell
adhesion molecule-1 (VCAM-1). J Biol Chem 267:16323-16329.
[0164] 12. Ledebur, H. C., and T. P. Parks. 1995. Transcriptional
regulation of the intercellular adhesion molecule-1 gene by
inflammatory cytokines in human endothelial cells. Essential roles
of a variant NF-kappa B site and p65 homodimers. J Biol Chem
270:933-943.
[0165] 13. Munoz, C., M. C. Castellanos, A. Alfranca, A. Vara, M.
A. Esteban, J. M. Redondo, and M. O. de Landazuri. 1996.
Transcriptional up-regulation of intracellular adhesion molecule-1
in human endothelial cells by the antioxidant pyrrolidine
dithiocarbamate involves the activation of activating protein-1. J
Immunol 157:3587-3597.
[0166] 14. May, M. J., and S. Ghosh. 1998. Signal transduction
through NF-kappa B. Immunol Today 19:80-88.
[0167] 15. Conner, E. M., S. Brand, J. M. Davis, F. S. Laroux, V.
J. Palombella, J. W. Fuseler, D. Y. Kang, R. E. Wolf, and M. B.
Grisham. 1997. Proteasome inhibition attenuates nitric oxide
synthase expression, VCAM-1 transcription and the development of
chronic colitis. J Pharmacol Exp Ther 282:1615-1622.
[0168] 16. Pierce, J. W., M. A. Read, H. Ding, F. W. Luscinskas,
and T. Collins. 1996. Salicylates inhibit I kappa B-alpha
phosphorylation, endothelial-leukocyte adhesion molecule
expression, and neutrophil transmigration. J Immunol
156:3961-3969.
[0169] 17. Pierce, J. W., R. Schoenleber, G. Jesmok, J. Best, S. A.
Moore, T. Collins, and M. E. Gerritsen. 1997. Novel inhibitors of
cytokine-induced IkBa phosphorylation and endothelial cell adhesion
molecule expression show anti-inflammatory effects in vivo. J.
Biol. Chem. 272:21096-21103.
[0170] 18. Weber, C., W. Erl, A. Pietsch, and P. C. Weber. 1995.
Aspirin inhibits nuclear factor-kappa B mobilization and monocyte
adhesion in stimulated human endothelial cells. Circulation
91:1914-1917.
[0171] 19. Umetani, M., H. Nakao, T. Doi, A. Iwasaki, M. Ohtaka, T.
Nagoya, C. Mataki, T. Hamakubo, and T. Kodama. 2000. A novel cell
adhesion inhibitor, K-7174, reduces the endothelial VCAM-1
induction by inflammatory cytokines, acting through the regulation
of GATA. Biochem Biophys Res Commun 272:370-374.
[0172] 20. Dagia, N. M., and D. J. Goetz. 2003. A proteasome
inhibitor reduces concurrent, sequential and long term IL-1.beta.
and TNF-.alpha. induced endothelial cell adhesion molecule
expression and adhesion. Am. J. Phys. 285:C813-C822.
[0173] 21. Cooper, D. S. 1984. Antithyroid drugs. N Engl J Med
311:1353-1362.
[0174] 22. Elias, A. N., R. J. Barr, M. K. Rohan, and K. Dangaran.
1995. Effect of orally administered antithyroid thioureylenes on
PCNA and P53 expression in psoriatic lesions. Int J Dermatol
34:280-283.
[0175] 23. Chan, C. C., I. Gery, L. D. Kohn, R. B. Nussenblatt, E.
Mozes, and D. S. Singer. 1995. Periocular inflammation in mice with
experimental systemic lupus erythematosus. A new experimental
blepharitis and its modulation. J Immunol 154:4830-4835.
[0176] 24. Davies, T. F., I. Weiss, and M. A. Gerber. 1984.
Influence of methimazole on murine thyroiditis. Evidence for
immunosuppression in vivo. J Clin Invest 73:397-404.
[0177] 25. Wang, P., S. H. Sun, P. B. Silver, C. C. Chan, R. K.
Agarwal, B. Wiggert, L. D. Kohn, G. A. Jamieson, Jr., and R. R.
Caspi. 2003. Methimazole protects from experimental autoimmune
uveitis by inhibiting antigen presenting cell function and reducing
antigen priming. J Leukoc Biol 73:57-64.
[0178] 26. Kohn, L. D., R. W. J. Curley, and J. M. Rice. 2002.
Methimazole derivatives and tautomeric cyclic thiones to treat
autoimmune diseases. U.S. Pat. No. 6,365,616.
[0179] 27. Saji, M., J. Moriarty, T. Ban, D. S. Singer, and L. D.
Kohn. 1992. Major histocompatibility complex class I gene
expression in rat thyroid cells is regulated by hormones,
methimazole, and iodide as well as interferon. J Clin Endocrinol
Metab 75:871-878.
[0180] 28. Singer, D. S., L. D. Kohn, E. Mozes, M. Saji, J.
Weissman, G. Napolitano, and F. D. Ledley. 1996. Methods for
assessing the ability of a candidate drug to suppress MHC class I
expression. U.S. Pat. No. 5,556,754.
[0181] 29. Montani, V., M. Shong, S. I. Taniguchi, K. Suzuki, C.
Giuliani, G. Napolitano, J. Saito, M. Saji, B. Fiorentino, A. M.
Reimold, D. S. Singer, and L. D. Kohn. 1998. Regulation of major
histocompatibility class II gene expression in FRTL-5 thyrocytes:
opposite effects of interferon and methimazole. Endocrinology
139:290-302.
[0182] 30. Mozes, E., L. D. Kohn, F. Hakim, and D. S. Singer. 1993.
Resistance of MHC class I-deficient mice to experimental systemic
lupus erythematosus. Science 261:91-93.
[0183] 31. Wenisch, C., D. Myskiw, A. Gessl, and W. Graninger.
1995. Circulating selecting, intercellular adhesion molecule-1, and
vascular cell adhesion molecule-1 in hyperthyroidism. J Clin
Endocrinol Metab 80:2122-2126.
[0184] 32. Oren, R., Y. Maaravi, F. Karmeli, G. Kenet, L. Zeidel,
A. Hubert, and R. Eliakim. 1997. Anti-thyroid drugs decrease
mucosal damage in a rat model of experimental colitis. Aliment
Pharmacol Ther 11:341-345.
[0185] 33. Suzuki, K., A. Mori, K. J. Ishii, J. Saito, D. S.
Singer, D. M. Klinman, P. R. Krause, and L. D. Kohn. 1999.
Activation of target-tissue immune-recognition molecules by
double-stranded polynucleotides. Proc Natl Acad Sci USA
96:2285-2290.
[0186] 34. Gopalan, P. K., D. A. Jones, L. V. McIntire, and C. W.
Smith. 1996. Cell adhesion under hydrodynamic flow conditions. In
Current Protocols in Immunology. J. E. Coligan, A. M. Kruisbeek, D.
H. Margulies, E. M. Shevach, and W. Strober, eds. J. Wiley, New
York, p. 7.29.1-7.29.23.
[0187] 35. Carlos, T., N. Kovach, B. Schwartz, M. Rosa, B. Newman,
E. Wayner, C. Benjamin, L. Osborn, R. Lobb, and J. Harlan. 1991.
Human monocytes bind to two cytokine-induced adhesive ligands on
cultured human endothelial cells: endothelial-leukocyte adhesion
molecule-1 and vascular cell adhesion molecule-1. Blood
77:2266-2271.
[0188] 36. Zapolska-Downar, D., A. Zapolski-Downar, M. Markiewski,
A. Ciechanowicz, M. Kaczmarczyk, and M. Naruszewicz. 2001.
Selective inhibition by probucol of vascular cell adhesion
molecule-1 (VCAM-1) expression in human vascular endothelial cells.
Atherosclerosis 155:123-130.
[0189] 37. Alon, R., H. Rossitier, X. Wang, T. A. Springer, and T.
S. Kupper. 1994. Distinct cell surface ligands mediate T lymphocyte
attachment and rolling on P- and E-selectin under physiological
flow. J. Cell Biol. 127:1485-1495.
[0190] 38. Alon, R., P. D. Kassner, M. W. Carr, E. B. Finger, M. E.
Hemler, and T. A. Springer. 1995. The integrin VLA-4 supports
tethering and rolling in flow on VCAM-1. J Cell Biol
128:1243-1253.
[0191] 39. Ochi, H., J. Masuda, and M. A. Gimbrone. 2002.
Hyperosmotic stimuli inhibit VCAM-1 expression in cultured
endothelial cells via effects on interferon regulatory factor-1
expression and activity. Eur J Immunol 32:1821-1831.
[0192] 40. Koo, S. W., K. A. Casper, K. B. Otto, A. K. Gira, and R.
A. Swerlick. 2003. Iron chelators inhibit VCAM-1 expression in
human dermal microvascular endothelial cells. J Invest Dermatol
120:871-879.
[0193] 41. Ahmad, M., P. Theofanidis, and R. M. Medford. 1998. Role
of activating protein-1 in the regulation of the vascular cell
adhesion molecule-1 gene expression by tumor necrosis factor-alpha.
J Biol Chem 273:4616-4621.
[0194] 42. Umetani, M., C. Mataki, N. Minegishi, M. Yamamoto, T.
Hamakubo, and T. Kodama. 2001. Function of GATA transcription
factors in induction of endothelial vascular cell adhesion
molecule-1 by tumor necrosis factor-alpha. Arterioscler Thromb Vasc
Biol 21:917-922.
Sequence CWU 1
1
7 1 31 DNA Artificial Sequence Primer for VCAM-1 1 gactccgtct
cattgacttg cagcaccaca g 31 2 31 DNA Artificial Sequence Primer for
VCAM-1 2 atactcccgc atccttcaac tgggcctttc g 31 3 28 DNA Artificial
Sequence Primer for E-Selectin 3 gtgcagccat tcccctgctg gagagttc 28
4 28 DNA Artificial Sequence Primer for E-Selectin 4 gggccagaga
cccgaggaga gttatctg 28 5 33 DNA Artificial Sequence Primer for
ICAM-1 5 ctcaggtatc catccatccc agagaagcct tcc 33 6 33 DNA
Artificial Sequence Primer for ICAM-1 6 cccttgagtt ttatggcctc
ctcctgagcc ttc 33 7 22 DNA Artificial Sequence NF- kappaB probe 7
agttgagggg actttcccag gc 22
* * * * *