U.S. patent application number 11/065700 was filed with the patent office on 2005-09-22 for assay with reduced background.
Invention is credited to Murdoch, Heather, O'Brien, Susan, Raven, Neil David Hammond, Sutton, J. Mark, Wictome, Matthew Patrick.
Application Number | 20050208608 11/065700 |
Document ID | / |
Family ID | 10847233 |
Filed Date | 2005-09-22 |
United States Patent
Application |
20050208608 |
Kind Code |
A1 |
Raven, Neil David Hammond ;
et al. |
September 22, 2005 |
Assay with reduced background
Abstract
In an assay, an analyte in a sample is contacted with a
thermostable reporter adenylate kinase coupled to a binding agent
specific for the analyte, wherein a complex is formed. ADP is
added, and then formation of ATP is monitored. Prior to the
addition of ADP, endogenous kinase and uncomplexed thermostable
reporter adenylate kinase is substantially removed by washing and
residual-endogenous kinase is inactivated by heating. Prior to
contacting the analyte with the thermostable reporter adenylate
kinase, the sample has a background activity of at least 300,000
Relative Light Units per mg protein per ml sample when measured in
the presence of luciferin/luciferase by a luminometer.
Inventors: |
Raven, Neil David Hammond;
(Salisbury, GB) ; Wictome, Matthew Patrick;
(Salisbury, GB) ; Sutton, J. Mark; (Salisbury,
GB) ; O'Brien, Susan; (Salisbury, GB) ;
Murdoch, Heather; (Salisbury, GB) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Family ID: |
10847233 |
Appl. No.: |
11/065700 |
Filed: |
February 25, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11065700 |
Feb 25, 2005 |
|
|
|
09889520 |
Dec 10, 2001 |
|
|
|
6913896 |
|
|
|
|
09889520 |
Dec 10, 2001 |
|
|
|
PCT/GB00/00315 |
Feb 3, 2000 |
|
|
|
Current U.S.
Class: |
435/8 |
Current CPC
Class: |
G01N 33/581 20130101;
C12Q 1/485 20130101; Y10T 436/25125 20150115; C12Q 1/66
20130101 |
Class at
Publication: |
435/008 |
International
Class: |
C12Q 001/66 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 5, 1999 |
GB |
9902659.3 |
Claims
1. An assay for an analyte in a sample, comprising contacting the
analyte with a thermostable reporter adenylate kinase coupled to a
binding agent specific for the analyte, wherein a complex is
formed, adding ADP and testing for the formation of ATP, wherein,
prior to the addition of ADP, endogenous kinase and uncomplexed
thermostable reporter adenylate kinase is substantially removed by
washing and residual endogenous kinase is inactivated by heating,
and wherein the amount of ATP correlates to the concentration of
the analyte, and wherein prior to contacting said analyte with said
thermostable reporter adenylate kinase, the sample has a background
activity of at least 300,000 Relative Light Units per mg protein
per ml sample when measured in the presence of luciferin/luciferase
by a luminometer.
2. The assay of claim 1, wherein prior to contacting said analyte
with said thermostable reporter adenylate kinase the sample has a
background activity of at least 400,000 Relative Light Units per mg
protein per ml sample when measured in the presence of
luciferin/luciferase by a luminometer.
3. The assay of claim 1, wherein prior to contacting said analyte
with said thermostable reporter adenylate kinase the sample has a
background activity of at least 500,000 Relative Light Units per mg
protein per ml sample when measured in the presence of
luciferin/luciferase by a luminometer.
4. The assay of claim 1, wherein the amount of thermostable
reporter adenylate kinase complexed with the analyte is
substantially proportional to the amount of analyte.
5. The assay of claim 1, wherein formation of ATP is measured by
luciferin/luciferase.
6. The assay of claim 1, further comprising adding an ATPase to the
analyte and removing the ATPase from the analyte prior to adding
ADP.
7. The assay of claim 6, wherein the ATPase is inactivated by
heating the ATPase.
8. The assay of claim 1, wherein after the washing and heating
steps, the sample has a reduced background activity when measured
in the presence of luciferin/luciferase in a luminometer, said
reduced background activity having a Relative Light Unit value that
is 20-fold to 1000-fold lower than said background activity.
9. The assay of claim 8, wherein said reduced background activity
has a Relative Light Unit value that is 50-fold to 800-fold lower
than said background activity.
10. The assay of claim 1, wherein said analyte is present at a
concentration of less than 10 ng/ml.
11. The assay of claim 1, wherein the sample is selected from the
group consisting of urine, faeces (stool), vomitus, blood
components (including serum, plasma, whole blood, white blood cell
fractions, buffy coat), airway samples (including sputum
bronchoalveolar lavage, endotracheal aspirates, nasopharyngeal
aspirates), oral samples (including crevicular fluid, parotid
saliva, whole saliva), cerebrospinal fluid (CSF), tissue
homogenates (including brain homogenate, tonsil homogenate), pus,
swab samples (including those taken from throat, nose, ears, skin,
and wounds), effluent samples, surface swabs, food, water,
beverages, soil, air sampling and sewerage.
12. The assay of claim 1, wherein the sample is selected from the
group consisting of faeces (stool), serum and whole blood.
13. The assay of claim 8, wherein the sample is selected from the
group consisting of urine, faeces (stool), vomitus, blood
components (including serum, plasma, whole blood, white blood cell
fractions, buffy coat), airway samples (including sputum
bronchoalveolar lavage, endotracheal aspirates, nasopharyngeal
aspirates), oral samples (including crevicular fluid, parotid
saliva, whole saliva), cerebrospinal fluid (CSF), tissue
homogenates (including brain homogenate, tonsil homogenate), pus,
swab samples (including those taken from throat, nose, ears, skin,
and wounds), effluent samples, surface swabs, food, water,
beverages, soil, air sampling and sewerage.
14. The assay of claim 8, wherein the sample is selected from the
group consisting of faeces (stool), serum and whole blood.
15. The assay of claim 10, wherein the sample is selected from the
group consisting of urine, faeces (stool), vomitus, blood
components (including serum, plasma, whole blood, white blood cell
fractions, buffy coat), airway samples (including sputum
bronchoalveolar lavage, endotracheal aspirates, nasopharyngeal
aspirates), oral samples (including crevicular fluid, parotid
saliva, whole saliva), cerebrospinal fluid (CSF), tissue
homogenates (including brain homogenate, tonsil homogenate), pus,
swab samples (including those taken from throat, nose, ears, skin,
and wounds), effluent samples, surface swabs, food, water,
beverages, soil, air sampling and sewerage.
16. The assay of claim 10, wherein the sample is selected from the
group consisting of faeces (stool), serum and whole blood.
17. An assay for an analyte in a sample, comprising contacting the
analyte with a thermostable reporter adenylate kinase coupled to a
binding agent specific for the analyte, wherein a complex is
formed, adding ADP and testing for the formation of ATP, wherein,
prior to the addition of ADP, endogenous kinase and uncomplexed
thermostable reporter adenylate kinase is substantially removed by
washing and, residual endogenous kinase is inactivated by heating,
wherein the amount of ATP correlates to the concentration of the
analyte, and wherein the analyte is present in the sample at a
concentration of less than 10 ng/ml.
18. The assay of claim 17, wherein said analyte is present in the
sample at a concentration of less than 1 ng/ml.
19. The assay of claim 17, wherein said analyte is present in the
sample at a concentration of less than 100 pg/ml.
20. The assay of claim 17, wherein said analyte is present in the
sample at a concentration of less than 1 pg/ml.
21. The assay of claim 17, wherein said analyte is present in the
sample at a concentration of less than 100 fg/ml.
22. The assay of claim 17, wherein said analyte is present in the
sample at a concentration of less than 10 fg/ml.
23. The assay of claim 17, wherein the sample is selected from the
group consisting of urine, faeces (stool), vomitus, blood
components (including serum, plasma, whole blood, white blood cell
fractions, buffy coat), airway samples (including sputum
bronchoalveolar lavage, endotracheal aspirates, nasopharyngeal
aspirates), oral samples (including crevicular fluid, parotid
saliva, whole saliva), cerebrospinal fluid (CSF), tissue
homogenates (including brain homogenate, tonsil homogenate), pus,
swab samples (including those taken from throat, nose, ears, skin,
and wounds), effluent samples, surface swabs, food, water,
beverages, soil, air sampling and sewerage.
24. The assay of claim 17, wherein the sample is selected from the
group consisting of faeces (stool), serum and whole blood.
25. An assay for an analyte in a sample, comprising contacting the
analyte with a thermostable reporter adenylate kinase coupled to a
binding agent specific for the analyte, wherein a complex is
formed, adding ADP and testing for the formation of ATP, wherein,
prior to the addition of ADP, endogenous kinase and uncomplexed
thermostable reporter adenylate kinase is substantially removed by
washing and, residual endogenous kinase is inactivated by heating,
wherein the amount of ATP correlates to the concentration of the
analyte, and wherein the sample is selected from the group
consisting of urine, faeces (stool), vomitus, blood components
(including serum, plasma, whole blood, white blood cell fractions,
buffy coat), airway samples (including sputum bronchoalveolar
lavage, endotracheal aspirates, nasopharyngeal aspirates), oral
samples (including crevicular fluid, parotid saliva, whole saliva),
cerebrospinal fluid (CSF), tissue homogenates (including brain
homogenate, tonsil homogenate), pus, swab samples (including those
taken from throat, nose, ears, skin, and wounds), effluent samples,
surface swabs, food, water, beverages, soil, air sampling and
sewerage.
26. The assay of claim 25, wherein the sample is selected from the
group consisting of faeces (stool), serum and whole blood.
27. An assay for determining the presence and/or amount of an
analyte in a sample, comprising exposing the sample to thermostable
reporter adenylate kinase coupled to a binding agent specific for
the analyte, so that the reporter adenylate kinase is specifically
associated with any analyte present in the sample via the binding
agent; removing the thermostable reporter adenylate kinase that is
not bound to the analyte; exposing said thermostable reporter
adenlyate kinase bound to the analyte to ADP; and testing for the
formation of ATP, wherein prior to the addition of ADP, residual
kinase other than thermostable reporter adenylate kinase is
substantially removed by heating, and wherein prior to exposing the
sample to said thermostable reporter adenylate kinase, the sample
has a background activity of at least 300,000 Relative Light Units
per mg protein per ml sample when measured in the presence of
luciferin/luciferase by a luminometer.
28. An assay for determining the presence and/or amount of an
analyte in a sample, comprising exposing the sample to thermostable
reporter adenylate kinase coupled to a binding agent specific for
the analyte, so that the reporter adenylate kinase is specifically
associated with any analyte present in the sample via the binding
agent; removing the thermostable reporter adenylate kinase that is
not bound to the analyte; exposing said thermostable reporter
adenlyate kinase bound to the analyte to ADP; and testing for the
formation of ATP, wherein prior to the addition of ADP, residual
kinase other than thermostable reporter adenylate kinase is
substantially removed by heating, and wherein the analyte is
present in the sample at a concentration of less than 10 ng/ml.
29. An assay for determining the presence and/or amount of an
analyte in a sample, comprising exposing the sample to thermostable
reporter adenylate kinase coupled to a binding agent specific for
the analyte, so that the reporter adenylate kinase is specifically
associated with any analyte present in the sample via the binding
agent; removing the thermostable reporter adenylate kinase that is
not bound to the analyte; exposing said thermostable reporter
adenlyate kinase bound to the analyte to ADP; and testing for the
formation of ATP, wherein prior to the addition of ADP, residual
kinase other than thermostable reporter adenylate kinase is
substantially removed by heating, and wherein the sample is
selected from the group consisting of urine, faeces (stool),
vomitus, blood components (including serum, plasma, whole blood,
white blood cell fractions, buffy coat), airway samples (including
sputum bronchoalveolar lavage, endotracheal aspirates,
nasopharyngeal aspirates), oral samples (including crevicular
fluid, parotid saliva, whole saliva), cerebrospinal fluid (CSF),
tissue homogenates (including brain homogenate, tonsil homogenate),
pus, swab samples (including those taken from throat, nose, ears,
skin, and wounds), effluent samples, surface swabs, food, water,
beverages, soil, air sampling and sewerage.
30. An assay for determining the presence and/or amount of an
analyte in a sample comprising, exposing the sample to a detector
compound, the detector compound comprising an antibody specific to
the analyte coupled to a thermostable enzyme; isolating (i)
detector compound that has specifically bound to analyte from (ii)
detector compound that has not specifically bound to analyte;
determining the presence of and/or amount of detector compound that
has bound to analyte by adding a substrate for the thermostable
enzyme and measuring a product formed by conversion of said
substrate to said product by said thermostable enzyme; wherein
prior to the addition of substrate non-thermostable enzymes are
destroyed by application of heat, and wherein prior to exposing the
sample to said detector compound, the sample has a background
activity of at least 300,000 Relative Light Units per mg protein
per ml sample when measured in the presence of luciferin/luciferase
by a luminometer.
31. An assay for determining the presence and/or amount of an
analyte in a sample comprising, exposing the sample to a detector
compound, the detector compound comprising an antibody specific to
the analyte coupled to a thermostable enzyme; isolating (i)
detector compound that has specifically bound to analyte from (ii)
detector compound that has not specifically bound to analyte;
determining the presence of and/or amount of detector compound that
has bound to analyte by adding a substrate for the thermostable
enzyme and measuring a product formed by conversion of said
substrate to said product by said thermostable enzyme; wherein
prior to the addition of substrate non-thermostable enzymes are
destroyed by application of heat, and wherein the analyte is
present in the sample at a concentration of less than 10 ng/ml.
32. An assay for determining the presence and/or amount of an
analyte in a sample comprising, exposing the sample to a detector
compound, the detector compound comprising an antibody specific to
the analyte coupled to a thermostable enzyme; isolating (i)
detector compound that has specifically bound to analyte from (ii)
detector compound that has not specifically bound to analyte;
determining the presence of and/or amount of detector compound that
has bound to analyte by adding a substrate for the thermostable
enzyme and measuring a product formed by conversion of said
substrate to said product by said thermostable enzyme; wherein
prior to the addition of substrate non-thermostable enzymes are
destroyed by application of heat, and wherein the sample is
selected from the group consisting of urine, faeces (stool),
vomitus, blood components (including serum, plasma, whole blood,
white blood cell fractions, buffy coat), airway samples (including
sputum bronchoalveolar lavage, endotracheal aspirates,
nasopharyngeal aspirates), oral samples (including crevicular
fluid, parotid saliva, whole saliva), cerebrospinal fluid (CSF),
tissue homogenates (including brain homogenate, tonsil homogenate),
pus, swab samples (including those taken from throat, nose, ears,
skin, and wounds), effluent samples, surface swabs, food, water,
beverages, soil, air sampling and sewerage.
33. An assay for an analyte comprising the steps of: (a)
specifically binding the analyte with a thermostable reporter
kinase which has been coupled to a binding agent specific for the
analyte forming a complex; (b) washing to remove endogenous
non-thermostable kinase and thermostable reporter kinase not bound
to analyte; (c) heating to inactivate endogenous kinase not removed
by step (b); and (d) adding ADP and testing for formation of ATP,
and wherein, prior to step (a), the sample has a background
activity of at least 300,000 Relative Light Units per mg protein
per ml sample when measured in the presence of luciferin/luciferase
by a luminometer.
34. An assay for an analyte comprising the steps of: (e)
specifically binding the analyte with a thermostable reporter
kinase which has been coupled to a binding agent specific for the
analyte forming a complex; (f) washing to remove endogenous
non-thermostable kinase and thermostable reporter kinase not bound
to analyte; (g) heating to inactivate endogenous kinase not removed
by step (b); and (h) adding ADP and testing for formation of ATP,
and wherein the analyte is present in the sample at a concentration
of less than 10 ng/ml.
35. An assay for an analyte comprising the steps of: (i)
specifically binding the analyte with a thermostable reporter
kinase which has been coupled to a binding agent specific for the
analyte forming a complex; (j) washing to remove endogenous
non-thermostable kinase and thermostable reporter kinase not bound
to analyte; (k) heating to inactivate endogenous kinase not removed
by step (b); and (l) adding ADP and testing for formation of ATP,
and wherein the sample is selected from the group consisting of
urine, faeces (stool), vomitus, blood components (including serum,
plasma, whole blood, white blood cell fractions, buffy coat),
airway samples (including sputum bronchoalveolar lavage,
endotracheal aspirates, nasopharyngeal aspirates), oral samples
(including crevicular fluid, parotid saliva, whole saliva),
cerebrospinal fluid (CSF), tissue homogenates (including brain
homogenate, tonsil homogenate), pus, swab samples (including those
taken from throat, nose, ears, skin, and wounds), effluent samples,
surface swabs, food, water, beverages, soil, air sampling and
sewerage.
Description
[0001] The present invention relates to an assay with reduced
background, a method of assaying for an analyte, a method of
reducing background in an assay and apparatus, in particular a test
kit, for carrying out such an assay.
[0002] ATP bioluminescence has rapidly become the method of choice
for hygiene and cleanliness monitoring due to its combination of
sensitivity and ease of assay. A luciferin-luciferase
bioluminescence assay can detect as little as 10.sup.-15 moles of
ATP. Since an average microbial cell contains approximately
10.sup.-18 moles of ATP, this gives a detection limit of only
10.sup.3 cells.ml.sup.-1.
[0003] For most operations this detection level is sufficient,
however, there are applications where even greater sensitivity is
required, even down to a single microbial cell. GB-A-2304892
describes such an assay using the ATP-forming enzyme adenylate
kinase (AK). An average cell contains several hundred-fold less AK
molecules than ATP molecules, however, in a 10 minute incubation, a
typical 400,000-fold amplification is achieved by detecting AK
through the ATP it produces. This corresponds to the level of
single cell detection, although in practice 10 cells.ml.sup.-1 is
more readily achieved due to background AK and ATP contamination.
It also corresponds to a detection level of down to at least
10.sup.-20 moles of AK.
[0004] The commercial use of this extreme sensitivity is,
therefore, under investigation. There are, however, some problems
with more widespread use of this known AK-based assay. One is that
while the assay detects the presence of micro-organisms, it does
not differentiate between one organism and another. This has been
overcome to a degree by the use of bacteriophage to release AK from
specific bacteria (Blasco R, Murphy M J, Sanders M F and Squirrell
D J (1998) Specific assays for bacteria using phage mediated
release of adenylate kinase. J. Appl. Microbiol. 84: 661-666).
[0005] Each micro-organism, however, requires a specific phage and
contains an AK with different buffer requirements, plus temperature
and pH optima. The second problem is more fundamental and is a
problem for its use as a generalised reporter enzyme. Whereas in
hygiene and cleanliness monitoring the ubiquity of ATP and AK is
beneficial, in an enzyme reporter assay any unwanted background
activity is detrimental. This is especially so where the sample is
greatly concentrated to maximise potential detection.
[0006] A further problem is that the known assay is only effective
for microorganisms which contain AK; the known assay will not work
with other biological material, such as viruses or other analytes,
including other biological such material that does not contain
AK.
[0007] Transmissible Spongiform Encephalopathies (TSEs) is the term
given for a spectrum of diseases associated with an unconventional
transmissible agent. The agent displays many virus-like features,
such as strain variation and mutation, but differs from
conventional viruses in being exceptionally resistant to heat,
ultraviolet and ionising radiation and to chemical disinfectants.
The TSEs are a heterogeneous group of fatal neurodegenerative
disorders occurring in humans, mink, cats and ruminant herbivores.
The endemic occurrence of the TSE "scrapie" in many sheep
populations and more rarely human TSEs, such as Creutzfeldt-Jakob
Disease (CJD), has been known for some time. The occurrence of
novel TSEs in wild populations of mule deer and elk in the United
States and an outbreak of "Bovine Spongiform Encephalopathy" (BSE)"
in cattle in the United Kingdom and Europe has, however, emphasised
the need for sensitive and reliable diagnostic tests and detection
systems for these diseases. More recently, however, it has become
apparent that BSE has crossed the species barrier to the human
population giving rise to a new variant TSE, generally known as
"new variant CJD" (nvCJD) or "variant CJD" (vCJD).
[0008] The highest native concentrations of TSE infectivity are
found in 263K scrapie-infected hamster brain where titres as high
as 10.sup.10 infectious units per gram of tissue are frequently
reported.
[0009] Current immunoassays give positive signals for PrP.sup.Sc
from as little as 1-10 g of TSE infectious brain tissue, e.g. by
Western blotting or ELISA. ELISA, however, is considerably more
suitable than Western blotting for the development of a fast and
practical PrP (PrP.sup.C+PrP.sup.Sc) detection system. This level
of detection is approximately 10.sup.-14 moles of PrP.sup.Sc but
insufficient to detect the presence of still infectious quantities
of PrP.sup.Sc. Where PrP.sup.C is also included, however, the
differential between the current and required level of sensitivity
is significantly reduced. This brings current immunoassays
potentially into the appropriate range, but with an inadequate
margin of safety.
[0010] There is currently great uncertainty regarding the numbers
of individuals in the UK potentially or actually infected with new
variant Creutzfeld-Jakob Disease (nvCJD). As a result there have
been calls that all surgical procedures should be carried out using
disposable instruments as a safeguard. Implementation has severe
cost and procedural implications, consequently an alternative means
to validate decontamination would be extremely beneficial, and
would also be of benefit to other equipment such as meat processing
equipment. Therefore, it remains a problem to provide an
alternative assay for biological material, especially prior
protein, preferably of increased sensitivity.
[0011] The present invention is aimed at addressing and overcoming
or at least ameliorating these problems. A further object of
specific embodiments of the present invention is to develop a rapid
and sensitive method for assay of biological material, in
particular for the detection of prion protein PrP (PrP.sup.C and
PrP.sup.Sc)--as the presence of either isoform in a sample is
indicative of the presence of residual PrP-expressing tissue and
the potential for transmissible infectivity. A still further object
of specific embodiments of the present invention is to provide a
method for assay of prion proteins that may be used in the
screening of cleaning protocols to determine their suitability for
the removal of TSE agents from surfaces and delivery of recovered
material for immunoassay.
[0012] Accordingly, a first aspect of the invention provides an
assay for an analyte, comprising specifically associating the
analyte with a reporter kinase, adding ADP and testing for
formation of ATP wherein, prior to addition of ADP, kinase other
than reporter kinase is substantially removed.
[0013] Thus, in use of an assay of the present invention, a
reporter adenylate kinase is specifically associated with the
analyte so that the amount of reporter adenylate kinase is
substantially in proportion to the amount of analyte present. In
the absence of analyte there will be no reporter adenylate kinase
associated and no signal generated. By substantially removing
adenylate kinase other than reporter adenylate kinase, the present
invention has the advantage that the signal obtained is not
contaminated or otherwise adversely affected by any endogenous
adenylate kinase that might have been present in a sample being
tested. By reference to removing adenylate kinase it is intended to
refer to removing adenylate kinase activity, such as by removing
the adenylate kinase, or denaturing or otherwise inactivating it in
situ. Furthermore, by addition of reporter adenylate kinase, the
assay is of application for detection of substantially any analyte
and, unlike the prior art, is not limited to detecting analytes
that comprise their own adenylate kinase.
[0014] In an embodiment of the invention there is provided a method
of determining presence and/or amount of an analyte in a sample,
comprising:
[0015] exposing the sample to a reporter adenylate kinase coupled
to a binding agent specific for the analyte, so that the reporter
adenylate kinase is specifically associated with any analyte
present in the sample;
[0016] removing reporter adenylate kinase that is not specifically
associated with analyte;
[0017] exposing reporter adenylate kinase specifically associated
with the analyte to ADP; and
[0018] testing for formation of ATP,
[0019] wherein prior to addition of ADP adenylate kinase other than
reporter adenylate kinase is substantially removed.
[0020] Typically, the reporter adenylate kinase is coupled to an
antibody that binds specifically to the analyte under
investigation. The antibody may be obtained using conventional
techniques for identification and isolation of specific antibodies,
and the assay of the present invention is thus of application to
substantially all analytes against which an antibody can be raised.
This confers the advantage that the present invention is of
considerably wider application compared to the known AK/ATP-based
assays, as the previous assays were restricted to target analytes
that contained their own adenylate kinase.
[0021] The reporter adenylate kinase is suitably coupled to the
specific binding agent by conventional techniques. For example,
there are numerous ways of labelling immunoreactive biomolecules
with enzymes (conjugation). Antibodies, the majority of antigens,
and enzymes are all proteins and, therefore, general methods of
protein covalent cross-linking can be adapted to the production of
immunoassay reagents, The preparation of antibody-enzyme conjugates
requires mild conditions to ensure the retention of both the
immunological properties of the antibody and the catalytic
properties of the enzyme. Common methods include, glutaraldehyde
coupling, the use of periodate oxidation of glycoproteins to
generate dialdehydes capable of forming Schiff-base linkages with
free amino groups on other protein molecules, and the use of
heterobifunctional reagents, for example,
succinimidyl-4-(N-maleimidometh- yl)cyclohexane-1-carboxylate
(SMCC).
[0022] Endogenous adenylate kinase present in the analyte is
substantially removed or destroyed or otherwise inactivated before
testing for formation of ATP is carried out. This removal step can
conveniently be achieved by heating the endogenous adenylate kinase
to a temperature at which it is denatured. Alternatively, other
treatments might be appropriate to destroy the activity of the
endogenous adenylate kinase, such as the use of ultrasound or
extremes of pH or salt concentration. In an embodiment of the
invention, the reporter adenylate kinase is a thermostable enzyme
and endogenous adenylate kinase is removed by heating. In a
specific embodiment of the invention described in more detail
below, this denaturing step is carried out at about 90.degree. C.
for a period of about 10 minutes, though other temperatures and
durations will be appropriate so long as the endogenous adenylate
kinase is rendered incapable of catalysing the formation of ATP and
the reporter adenylate kinase retains its activity.
[0023] It is a further, preferred, step in the assay of the present
invention for any ATP present prior to addition of ADP to be
removed, thereby further decreasing the background noise in the
assay. The removal of endogenous ATP may be achieved by addition of
an ATPase and incubation prior to adding ADP. More preferably, a
thermolabile ATPase is used to remove ATP and then the thermolabile
ATPase is itself destroyed by use of elevated temperature, to avoid
the presence of the ATPase adversely influencing the signal
obtained using the thermostable, reporter adenylate kinase.
[0024] The precise order of carrying out the steps of the present
invention is not critical, provided that endogenous adenylate
kinase is destroyed before addition of ADP and testing for the
formation of ATP. Thus, the method of the present invention can be
carried out by treating a sample to destroy its endogenous
adenylate kinase, adding reporting adenylate kinase coupled to an
antibody specific to the analyte, isolating reporting adenylate
kinase that is specifically associated with analyte and then adding
ADP and testing for formation of ATP. Alternatively, the assay can
be carried out by adding a reporter adenylate kinase coupled to an
antibody specific for the analyte to a sample, isolating reporter
adenylate kinase that is specifically associated with analyte,
destroying any endogenous adenylate kinase that may be present and
then adding ADP and testing for formation of ATP. A further
alternative is to add reporter adenylate kinase coupled to an
antibody specific for analyte to the sample, treating the sample to
destroy endogenous adenylate kinase, isolating reporter adenylate
kinase specifically associated with analyte and then adding ADP and
testing for formation of ATP.
[0025] In a specific embodiment of the invention described in more
detail below, an assay is carried out by following the steps:
[0026] 1. An antibody specific to the analyte is immobilised on a
solid phase.
[0027] 2. A sample is combined with the solid phase so that analyte
present in the sample can bind to the antibody.
[0028] 3. The solid phase is washed, thereby washing away
components of the sample and retaining on the solid phase only any
analyte that has bound to the immobilised antibody.
[0029] 4. A reporter composition is added to the solid phase, the
reporter composition comprising an antibody which is specific to
the analyte and which is coupled to a thermostable adenylate
kinase.
[0030] 5. The solid phase is washed, thereby washing away unbound
components of the reporter composition and retaining reporter
composition that has specifically bound the analyte, the analyte
being itself bound to the immobilised antibody.
[0031] 6. The solid phase is heated to denature any endogenous
adenylate kinase that may be present but so as not to denature the
thermostable adenylate kinase.
[0032] 7. Optionally, a thermolabile ATPase is added to the solid
phase to remove any endogenous ATP.
[0033] 8. Optionally, the solid phase is heated to destroy the
thermolabile ATPase of step 7.
[0034] 9. ADP is added to the solid phase which is then tested for
presence and/or amount of ATP.
[0035] 10. If ATP is detected, this indicates that adenylate kinase
in the reporter composition was bound to the solid phase, ie that
analyte was present in the sample.
[0036] The solid phase is suitably selected from conventional solid
phases used in immunoassays, and can for example be a microtitre
well, a column, a dipstick or a bead, such as a latex or a magnetic
bead. Examples of further suitable solid supports are
nitrocellulose, polyvinylchloride, polystyrene, diazotized paper,
activated beads having a range of appropriate linking agents and S.
aureus protein A beads. More thermostable supports are provided by
plastics such as polypropylene, polycarbonate, polyphenylenine
oxide polymethylpentene and fluoropolymers (e.g. PTFE, PFA, FEP and
EFTE). The solid support can have several forms dependent upon the
type of support and the conditions required. Commonly these will be
microtitre plates, where each individual well serves as an
independent incubation chamber. Similarly, membranes or sheets can
be used providing lateral diffusion is limited. Alternatively,
beads can be used, which enable the separate reactions to be
performed in different tubes under different conditions. These
individual matrix materials can be purchased in a variety of forms,
as appropriate for the particular type of assay.
[0037] Firefly luciferin catalyses the oxidation of D(-) luciferin
in the presence of ATP--Mg and O.sub.2 to generate oxyluciferin and
light. The quantum yield for this reaction (0.88) is the highest
known for bioluminescent reactions (Gould and Subramini, 1988).
Firefly luciferase, however, is relatively unstable and has,
therefore, not proved readily adaptable as an immunoassay label
(Kricka, 1993). By contrast, in the present invention, the
luciferase enzyme can be operated under its optimal conditions and
is not exposed to harsh treatments such as antibody-coupling.
[0038] A number of extremely thermostable adenylate kinases have
now been characterised (Ki and Takahisa, 1988; Lacher and Schfer
1993; Rusnak et al., 1995) and are suitable for use in the present
invention. One has been cloned and overexpressed in E. coli
(Bonisch et al., 1996) and the full sequences of a range of others
are now available as a result of genome sequencing programmes. A
rapid and simple purification scheme is thus available to produce
homogenous adenylate kinase. Initially a thermal denaturation step
can be employed to denature the bulk of E. coli proteins
(.about.90-95%) while retaining the thermostable activity in
solution.
[0039] This procedure has been successfully employed in embodiments
of the present invention with several recombinant thermostable
enzymes. Subsequently a generally applicable affinity purification
procedure can be utilised to yield the purified enzyme. This
involves binding of the enzyme to a mimetic dye matrix and
selective desorption with the adenylate kinase inhibitor
P.sup.1,P.sup.5-di(adenosine-5')pentaphosphate (Rusnak et al.,
1995). The use of stable enzymes overcomes problems associated with
inactivation upon antibody-coupling, and also provide other
benefits. Since the activity is extremely thermostable, once
substrate binding and removal of unbound components has occurred,
the temperature can be increased to e.g. 70-90.degree. C.,
denaturing and inactivating any residual contaminating mesophilic
adenylate kinase. Additionally, on cooling, a mesophilic ATPase (or
apyrase) can be added to remove any residual ATP. This ensures that
no ATP or AK background is now present. A further heat incubation
inactivates the mesophilic ATPase and ADP is added in order to
generate ATP derived exclusively from the thermostable adenylate
kinase. This ATP is then available for conventional
luciferin-luciferase bioluminescence detection. A potentially
contaminating ATP signal is now only possible from three sources:
non-specifically bound thermostable AK, ATP-contaminated ADP and AK
contaminated luciferase. The latter two can be eliminated by the
use of high purity reagents and careful handling. In each case,
however, contamination would result in a positive signal, i.e. a
PrP-free sample might be determined to be PrP-containing but the
opposite could not occur.
[0040] A known thermostable adenylate kinases, Methanococcus
jannaschii has a very high specific activity, namely 89 .mu.mol of
ATP mg.sup.-1 min.sup.-1. This corresponds to a turnover number in
excess of 2000 min.sup.-1 and the potential to produce more than
1.2.times.10.sup.5 molecules of ATP per molecule of AK in an hour's
incubation. Since 6.times.10.sup.8 molecules of ATP are detectable
by ATP-bioluminescence then as few as 5.times.10.sup.3 molecules of
PrP would be detectable. This is 40-fold lower than the minimum
number of PrP.sup.Sc molecules identified as constituting a single
infectious unit. An additional safety margin is provided by the
presence of much higher quantities of PrP.sup.C in relation to
PrP.sup.Sc indicating that the present invention exceeds the
required sensitivity by several orders of magnitude.
[0041] As an alternative to use of an analyte-specific antibody to
immobilize analyte on the solid phase, the solid phase may be
provided with analyte immobilised directly thereon without the
presence of the first antibody. For example, the solid phase can
itself be a substrate potentially contaminated by an amount,
typically a trace amount, of analyte. This is the case in respect
of medical equipment potentially contaminated by very small amounts
of prion protein which are effectively immobilised on the surface
of the equipment. The assay is of use in testing for the presence
of the analyte for example following cleaning of the equipment.
Analyte can also be immobilised non-specifically.
[0042] The method of the present invention may be carried out
utilising relatively inexpensive equipment in a standard
laboratory. Use of a method of the present invention to determine
when the level of prion protein has been reduced to below
detectable and, by extrapolation, infectious levels may be used to
confirm the decontamination of instruments, equipment and other
items potentially exposed to TSE infectious agents, permitting
their safe use.
[0043] In use of a specific embodiment of the invention, the first
washing step can be repeated a number of times, in accordance with
conventional practice in this field, the object being to remove
from the solid phase all components of the sample that have not
bound specifically to the immobilised antibody. Thus, if there is
no analyte present in the sample then the washing step will remove
the whole of the sample and ultimately the assay will give no
signal, indicating that no analyte was present. The antibody in the
reporter composition binds to the same analyte as the antibody
immobilised on the solid phase. The antibody and the reporter
composition can in fact have the same binding properties as the
immobilised antibody, though it is an alternative for the reporter
antibody to bind to a different site on the same analyte. The
reporter antibody is preferably selected so that the amount of
reporter composition that binds to the analyte is substantially
proportional to the amount of analyte present. The second washing
step can, in line with the first, be repeated a number of times in
accordance with conventional practice, the object of the second
washing step being to remove all components of the reporter
composition that have not specifically bound to analyte which
itself has specifically bound to immobilised antibody. Thus, if no
analyte is present on the solid phase the second washing step is to
remove all reporter composition, leading ultimately to no signal
being generated in the assay, indicating no analyte was present in
the sample under investigation.
[0044] This latter embodiment represents use of the principles of
the invention in a two antibody capture assay, sometimes referred
to as a sandwich assay. The invention is similarly of application
in antigen capture assays and antibody capture assays.
[0045] Thus in a further embodiment of the invention, an assay for
analyte comprises specifically associating an analyte with a
reporter adenylate kinase, wherein the analyte is bound to a solid
phase. This embodiment may be referred to as being of the antibody
capture type. Binding of the analyte to the solid phase can be
achieved by non-specifically binding the analyte to the solid phase
and then treating the solid phase to prevent further non-specific
binding thereto--in this way, a number of components from a sample
are bound to the solid phase, which components include the analyte
of interest if present in the sample, and subsequent treatment
ensures that when an antibody is added to detect the analyte that
antibody will only bind to the solid phase if analyte is
present.
[0046] The use of heat to denature any endogenous kinase that may
be present has been carried out in an embodiment above as step 6,
though as mentioned this step can be carried out at an alternative
juncture in the assay provided that it is carried out before
addition of ADP. Further, ADP may be added before the ATPase
provided the ATPase has no ADPase activity. The temperature and
duration adopted are chosen so as to be sufficient to denature the
endogenous adenylate kinase whilst leaving intact the reporter
adenylate kinase, this reporter adenylate kinase preferably being a
thermostable enzyme. In a specific embodiment described below,
heating to a temperature of about 90.degree. C. for about 10
minutes has been found effective. Sufficiently thermostable
adenylate kinases may be found amongst a range of bacterial and
archaeal genera and families. In the Bacteria, they may be
produced, for example, by members of the genera Alicyclobacillus,
Ammonifex, Aquifex, Bacillus, Caldariella, Calderobacterium,
Caldicellulosiruptor, Caldocellum, Caloramator, Carboxydothermus,
Chloroflexus, Clostridium, Coprothermobacter, Dictyloglomus,
Fervidobacterium, Geotoga, Hydrogenobacter, Hydrogenothermophilus,
Meiothermus, Petrotoga, Rhodothermus, Rubrobacter,
Thermoactinomyces, Thermoanaerobacter, Thermoanaerobacterium,
Thermoanaerobium, Thermobacterium, Thermobacteroides, Thermobifida,
Thermobispora, Thermobrachium, Thermochromatium, Thermocrispum,
Thermodesulfobacterium, Thermodesulforhabdus, Thermodesulfovibrio,
Thermohydrogenium, Thermomicrobium, Thermomonospora, Thermonema,
Thermonospora, Thermopolyspora, Thermosipho, Thermosphaera,
Thermosyntropha, Thermoterrabacterium, Thermotoga and Thermus.
Amongst the archaea, they may be produced, for example, by members
of the genera Acidianus, Aeropyrum, Archaeoglobus, Desulfurococcus,
Desulfurolobus, Ferroglobus, Hyperthermus, Metallosphaera,
Methanobacterium, Methanococcus, Methanopyrus, Methanothermus,
Picrophilus, Pyrobaculum, Pyrococcus, Pyrodictium, Pyrolobus,
Staphylothermus, Stetteria, Stygiolobus, Sulfolobus,
Sulfophobococcus, Thermococcus, Thermofilum, Thermoplasma and
Thermoproteus.
[0047] It is preferred, though optional, also to carry out a step
of removing endogenous ATP from the sample using a thermolabile
ATPase and subsequently destroying this latter enzyme, again
conveniently using heat. In a specific embodiment of the invention
described below, an incubation of about 10 minutes has been
effective using a thermolabile ATPase and this enzyme has been then
denatured by temperatures of about 90.degree. C. for 5 minutes. ATP
can be released from cells or other cellular components after
heating. Therefore, it is preferred that the step of removing ATP
is carried out after an initial heating of the sample, for example
after the step of using heat to destroy endogenous adenylate
kinase.
[0048] It is further preferred to use ultrapure ADP, free of ATP,
to avoid risk of background from contaminating ATP. As an
alternative to the use of a pre-purified ultrapure form of ADP,
ATP-free ADP can be generated in situ by the addition of an
essentially irreversible and strictly ATP-dependent mesophilic
kinase plus its substrate, for example, yeast hexokinase and
glucose. ATP present is converted to ADP and the kinase is
inactivated by heat prior to the incubation with thermostable
adenylate kinase. Similarly, it is also preferred to use other
reagents form of contamination by kinase or ATP. Luciferin and
luciferase can contain adenylate kinase contamination and so it is
preferred to use purified forms of these, or recombinant forms of
luciferase. Luciferin is preferably the d-isomer as the I-isomer
can inhibition the luminescence reaction.
[0049] The invention is of particular application to detection of
diseases such as vCJD, which by December 1999 had resulted in
approximately 50 deaths in the UK, with further cases reported in
France and Ireland. Due to the long and variable incubation period
for this new disease however, there is currently great uncertainty
regarding the total numbers of individuals in the UK potentially or
actually infected with vCJD. Affected individuals will frequently
present with symptoms requiring neurological examination or may
merely undergo common surgical procedures such as tonsillectomy or
appendectomy along with the general population. A wide range of
tissues, including tonsil and appendix, has been shown to harbour
vCJD infectivity in addition to brain and spinal cord. This gives
rise to a significant potential for transmission of infection by
exposure to contaminated surgical instruments, since complete
elimination of infectivity is not achievable using conventional
sterilisation procedures.
[0050] Although the nature of the responsible agent is not fully
understood, infectivity appears to be associated very closely with
the abnormal conformation (PrP.sup.Sc) of a normal central nervous
system protein (PrP.sup.C), designated the "prion" protein.
Although the prion is not universally accepted as being solely
responsible for infectivity, there is general agreement that it has
an intimate association with it. Detection of prion protein is,
therefore, considered to be an excellent measure of the potential
presence of TSE infectivity. Prions have a tendency to form
insoluble aggregates and are highly hydrophobic. There is,
therefore, considerable doubt as to whether they can be reliably
detached from surfaces and solubilised for detection by
conventional enzyme-linked immunosorbent assay. This is
particularly important for items like surgical instruments, where
the presence of a very small amount of residual material after
attempted decontamination, could give rise to iatrogenic
transmission of vCJD infection. In a specific embodiment, the
invention describes an assay which permits in situ detection of the
prion protein (Prion ELISA 1-3).
[0051] Since the presence of any residue containing either
PrP.sup.C or PrP.sup.Sc indicates that the test item is not
completely clean, the antibody selected need not discriminate
between the different conformers. This greatly increases the range
of antibodies available. The PrP.sup.Sc conformation is, however,
considerably more persistent and in general it is the form
associated with infectivity which will be detected.
[0052] Thyroid stimulating hormone (TSH) is secreted by the
anterior pituitary of the brain. This hormone acts upon the
thyroid, stimulating the production of the hormones T3 and T4. The
level of TSH is controlled by a negative feed-back system that
maintains a constant level of free TSH. Hyperthyroidism is a
condition caused by reduced levels of circulating TSH.
[0053] Diagnostic assays for the diagnosis of hyperthyroidism must
be able to distinguish between hyperthyroidism and normal levels of
circulating hormone. The assays should be able to monitor a very
low signal without interference. In addition, assays for the
measurement of circulating TSH should have a broad dynamic range. A
specific embodiment of the invention, described below in more
detail, provides an assay for a blood hormone.
[0054] Assays for drugs of abuse are routinely used by clinical
laboratories, drug rehabilitation clinics, health officials and
clinical justice facilities. The data obtained is often used to
support medical-legal applications involving custody of children. A
decision to renew custody of a child often rests on the results of
urine drug analyses demonstrating prolonged abstinence of drug
abuse, by the parent. In many countries random urine testing is
mandatory in sensitive government posts, the armed forces and the
transport industries. There is a requirement for more sensitive and
rapid assays for drugs of abuse.
[0055] The principal agent produced by Cannabis sativa is
.delta.-9-tetrahdrocannabinol (THC). Only a small amount of THC is
excreted in the urine and the majority of assays are designed to
detect the main inactive oxidation product,
11-nor-.delta.-tetrahydrocannabinol-- 9-carboxylic acid
(11-COOH--THC). A specific embodiment of the invention, described
in more detail below, provides an assay for cannabis
metabolite.
[0056] Urine is a complex medium, which exacerbates the problem of
distinguishing a signal from that of background instrument noise.
This is overcome in commercial assays by assigning a threshold
concentration, above which a sample is considered positive, that
exceeds the detection limit by several orders of magnitude. In
practice this results in a number of positive samples being
assigned as negative as their signals are below the assigned
threshold. More sensitive assays make it easier to discriminate
between positive and negative samples.
[0057] Many of the current commercial assays involve enzyme
multiplied immunoassay (Emit). This ELISA involves competition
between drug in the test sample and drug labelled with
glucose-6-phosphate dehydrogenase (G6PDH). The G6PH drug conjugate
is inactive when immobilised to a solid-phase comprising of an
antibody specific for the drug of interest. On displacement the
free drug-G6PH conjugate is detected by a change in the optical
density at 340 nm, as NAD+ is reduced to NADH and the substrate is
glucose-6-phosphate is oxidised. A further specific embodiment of
the invention provides an assay for cocaine metabolites in
urine.
[0058] It is known that human papilloma virus (HPV) infection is a
prerequisite of the oncogenesis of many forms of cervical cancer.
Currently cervical smears are screened for the presence of viral
infection as a predictive precursor of oncogenesis. Another
specific embodiment of the invention is a rapid screen for the
presence of viral infection of cervical cells.
[0059] Combinational libraries are powerful tools for drug
discovery. The sensitivity of the screening methodology is a major
limit on the number of combinations that can be screened for in a
combinational library. A library comprised of every combination of
an hexa-peptide is composed of 20.sup.6 possible combinations. More
sensitive assays for the detection of target sequences would allow
more extensive libraries to be screened. In a yet further specific
embodiment of the invention a thermostable AK is used to screen a
combinational peptide library for a sequence that binds a specific
ligand of interest. This ligand may be a receptor or an enzyme.
[0060] Botulinum toxins are produced by the bacterial species
Clostridium botulinum and are the causative agents of food-borne
botulism. The most sensitive accepted method for the detection of
botulinum toxins is the mouse lethality test. Few ELISA based
assays using conventional amplification methodology have the
sensitivity required. A yet further embodiment of the invention
describes an ELISA based assay for the detection of botulinum
neurotoxin in foods.
[0061] The present invention also provides, in a second aspect,
apparatus for determining the presence and/or amount of analyte in
a sample, comprising:
[0062] a solid phase on which is immobilised the analyte or an
antibody specific for the analyte;
[0063] a reporter composition comprising a thermostable kinase
coupled to an antibody specific for the analyte; and
[0064] ADP plus, optionally, associated reagents for conversion of
ADP into ATP by thermostable kinase.
[0065] An optional additional component of the apparatus is a
thermolabile ATPase.
[0066] The components of the apparatus may be combined into a test
kit for determining presence and/or amount of an analyte in a
sample.
[0067] Testing for formation of ATP may be carried out using a
number of conventional means, including formation of colour.
Particularly preferred is the use of luciferin/luciferase reagents
in combination with calibration curves to determine both presence
and amount of analyte. The presence of magnesium ions is usually
required for formation of ATP, and further details are provided in
the prior art publication GB-A-2304892, the contents of which are
incorporated herein by reference.
[0068] The present invention has been described in relation to the
use of kinases, in particular thermostable adenylate kinase. More
generally, the invention also provides, in a third aspect, an assay
for determining presence and/or amount of an analyte in a sample,
comprising:
[0069] exposing the sample to a detector composition, the detector
composition comprising an antibody specific to the analyte coupled
to a thermostable enzyme;
[0070] isolating (i) detector composition that has specifically
bound to analyte from (ii) detector composition that has not
specifically bound to analyte;
[0071] determining the presence and/or amount of detector
composition that has bound to analyte by adding a substrate for the
thermostable enzyme;
[0072] wherein prior to adding the substrate non-thermostable
enzymes are destroyed by application of heat.
[0073] The thermostable enzyme is suitably a kinase, and may be
selected from pyruvate kinase, adenylate kinase and acetyl kinase.
All of these catalyse formation of ATP from ADP and may be used
with reagent such as luciferin/luciferase.
[0074] It is preferred that prior to addition of the substrate
background product is removed, which assists in reducing or
limiting background in the assay. Background product is suitably
removed by the action of enzyme or by thermal inactivation.
[0075] The third aspect of the invention also provides apparatus
for determining presence and/or amount of analyte in a sample,
comprising:
[0076] a solid phase on which is immobilised the analyte or an
antibody specific for the analyte;
[0077] a reporter composition comprising a thermostable enzyme
coupled to an antibody specific for the analyte; and substrate for
the thermostable enzyme.
[0078] This aspect of the invention confers the advantage that the
signal obtained from the thermostable enzyme is substantially not
contaminated by any background signals or background noise that may
otherwise be obtained from the action of non-thermostable enzymes
on the substrate.
[0079] Background signals and/or background noise are thus reduced
and possibly even removed entirely. In use of a method of the third
aspect of the present invention, an analyte is immobilised on a
solid phase, a sample is combined with the solid phase and then the
solid phase is washed, the solid phase is exposed to a detector
composition including an antibody specific to the analyte coupled
to a thermostable enzyme, the solid phase is then again washed, the
solid phase is then heated to denature non-thermostable enzymes but
so as not to denature the thermostable enzyme of the detector
composition, and the amount of thermostable enzyme specifically
bound to analyte which itself is specifically bound to the solid
phase is determined by adding a substrate for the thermostable
enzyme and determining how much product is then obtained.
Immobilisation of the analyte can be through use of an
analyte-specific antibody immobilised on the solid phase, or by
directly binding the analyte to the solid phase.
[0080] A further aspect of the invention provides a conjugate
comprising an antibody conjugated to a thermostable enzyme for use
in the assay of any preceding aspect of the invention. In an
embodiment of the invention, the enzyme an adenylate kinase. The
antibody may suitably bind to an analyte selected from a protein, a
microorganism, a peptide, a toxin, a hormone and a metabolite. In a
specific embodiment, the antibody binds to a prion protein.
[0081] A stil further aspect of the invention lies in use of the
apparatus of the invention or the conjugate of the invention in an
assay for an analyte.
[0082] The present invention is thus suitably employed to
investigate the effectiveness of a range of agents with potential
for surface cleaning of contaminated surfaces to remove cellular
material and PrP. Steel, glass and plastic surfaces can all be
investigated to determine whether any one is particularly
recalcitrant to cleaning, and PTFE can be used as a control surface
for comparative purposes.
[0083] Thermostable adenylate kinases may be purified from a number
of thermophilic and hyperthermophilic microorganisms using a
combination of ion exchange, gel filtration and affinity
chromatography. The adenylate kinases may be cloned and expressed
in E. coli in plasmid or phage libraries. Direct expression can be
screened for (after replica plating) by examining pooled colonies
for thermostable adenylate kinase activity by incubation with ADP,
followed by ATP bioluminescence assay.
[0084] A range of commercially available coupling reagents is
available for antibody-adenylate kinase conjugation. Both the
antibody and the adenylate kinase can be re-purified by affinity
chromatography.
[0085] In certain uses of the invention, such as in the case that
there is no endogenous adenylate kinase or no microbial
contamination of the sample or if the risk of such contamination is
removed, it is optional to dispense with the step of removing
endogenous adenylate kinase. The method of the invention then
comprises specifically associating the analyte with a reporter
adenylate kinase, adding ADP and testing for formation of ATP.
Preferably, prior to addition of ADP, ATP is substantially removed,
for example by the use of an ATPase.
[0086] In one embodiment, the invention provides an assay for an
analyte in a sample, comprising contacting the analyte with a
thermostable reporter adenylate kinase coupled to a binding agent
specific for the analyte, wherein a complex is formed, adding ADP
and testing for the formation of ATP, wherein, prior to the
addition of ADP, endogenous kinase and uncomplexed thermostable
reporter adenylate kinase is substantially removed by washing, and
residual endogenous kinase is inactivated by heating, wherein the
amount of ATP correlates to the concentration of the analyte,
[0087] In another embodiment, the invention provides an assay for
determining the presence and/or amount of an analyte in a sample,
comprising exposing the sample to thermostable reporter adenylate
kinase coupled to a binding agent specific for the analyte, so that
the reporter adenylate kinase is specifically associated with any
analyte present in the sample via the binding agent; removing the
thermostable reporter adenylate kinase that is not bound to the
analyte; exposing said thermostable reporter adenlyate kinase bound
to the analyte to ADP; and testing for the formation of ATP,
wherein prior to the addition of ADP, residual kinase other than
thermostable reporter adenylate kinase is substantially removed by
heating.
[0088] In a further embodiment, the invention provides an assay for
determining the presence and/or amount of an analyte in a sample
comprising, exposing the sample to a detector compound, the
detector compound comprising an antibody specific to the analyte
coupled to a thermostable enzyme; isolating (i) detector compound
that has specifically bound to analyte from (ii) detector compound
that has not specifically bound to analyte; determining the
presence of and/or amount of detector compound that has bound to
analyte by adding a substrate for the thermostable enzyme and
measuring a product formed by conversion of said substrate to said
product by said thermostable enzyme; wherein, prior to the addition
of substrate, non-thermostable enzymes are destroyed by application
of heat.
[0089] In a further embodiment, the invention provides an assay for
an analyte comprising the steps of:
[0090] (a) specifically binding the analyte with a thermostable
reporter kinase which has been coupled to a binding agent specific
for the analyte forming a complex;
[0091] (b) washing to remove endogenous non-thermostable kinase and
thermostable reporter kinase not bound to analyte;
[0092] (c) heating to inactivate endogenous kinase not removed by
step (b); and
[0093] (d) adding ADP and testing for formation of ATP.
[0094] The assay of the invention is particularly suited to the
analysis of samples having a high level of background activity.
These samples may also be known as "complex" samples.
[0095] A high level of background activity can be caused by various
factors, which are discussed in more detail below.
[0096] High background activity may be due to the presence of large
amounts of material in suspension. This might represent fat
(lipid), protein, carbohydrate or cellular debris derived from
either host or bacterial contaminant. This material may directly
interfere with the binding of, for example, an analyte with the
solid phase used for the assay. The same would be true for samples
where there are high levels of protein or other molecules, that,
due to their solubility, do not make the sample turbid. Any
reduction in the levels of analyte bound to the solid phase would
effectively reduce the potential signal of the assays by limiting
the amount of detectable substance.
[0097] Background activity may also result from the presence of
contaminating enzyme activity. For example, endogenous peroxidase
activity can interfere with horseradish peroxidase assays,
endogenous phosphatases can interfere with alkaline
phosphatase-based assays, and many cell/tissue extract have an
endogenous fluorescence that may interfere with fluorimetric
assays. In the assay of the present invention, enzymes such as
endogenous adenylate kinase may increase the background activity of
the samples. Any samples that contain intact cells or where cell
debris is present are likely to have relatively high background
activity.
[0098] The presence of endogenous ATP may also increase the
background activity of the sample.
[0099] The background activity may be further complicated by the
disease state of the individual. For example, the analysis of urine
for the presence of cocaine metabolites might be complicated by a
high level of protein or other metabolites present as a result of
urinary tract infection, infection of the kidney or liver or with
advanced kidney damage (perhaps with associated proteinuria).
Similar considerations would be relevant for oral diagnosis of
patients with disease(s) of the oral cavity, airway samples for
patients with chronic obstructive pulmonary disorder (COPD), cystic
fibrosis or other lung/airway disease.
[0100] One way of measuring the background activity of a sample
(such as the background activity caused by endogenous kinase
activity and the presence of endogenous ATP) is by measuring the
Relative Light Unit value of the sample in the presence of
luciferin/luciferase in a luminometer. Typical values for the
background activity in complex biological samples (caused by e.g.
endogenous adenylate kinase activity and the presence of ATP) may
be in the range of about 300,000-500,000 RLUs for a 1 mg/ml sample
of tissue homogenate, serum, oral sample or urine, up to a maximum
of about 6,000,000 to 10,000,000 RLUs for a 1 mg/ml sample of whole
blood.
[0101] Those familiar with the art will recognise that Relative
Light Units (RLU) are a relative, not absolute, measurement. The
figures given in the specification relate to measurements taken
using a Berthold Orion 96-well microplate luminometer with injector
system using a "flash" method of light measurement for 2 seconds
immediately after the addition of the luciferase/luciferin reagents
(technical specification photomultiplier measuring light emitted at
a wavelength of 300-650nm).
[0102] To address this issue, manufacturers have generated data for
RLU "factors", which allow the data generated by a given
luminometer to be normalised to a calibrated standard. Thus,
comparisons can be made between different instruments. The RLU
factor for the Berthold Orion 96-well microplate luminometer used
in the experiments described in the present specification is 1.
Accordingly, the RLU values given in the specification can be
regarded as standardised/normalised RLU values.
[0103] In terms of absolute values, an RLU value can be related to
the concentration of ATP required to give said value with the
reagents as described in the method. As an approximate conversion,
and given the linear relationship between RLU values and ATP
concentration, the following values can be used:
1 Approximate concen- RLU tration of ATP/.mu.M 12,000,000 1000
1,200,000 100 120,000 10 12,000 1 1,200 0.1 120 0.01
[0104] In preferred embodiments of the invention, the sample used
in the assay has an initial background activity (ie. before the
sample is brought into contact with the reporter enzyme/detector
compound) of at least 300,000 Relative Light Units per mg protein
per ml sample when measured in the presence of luciferin/luciferase
by a luminometer. Preferably, the sample has an initial background
activity of at least 400,000, or at least 500,000, or at least
600,000, or at least 700,000, or at least 800,000, or at least
900,000, or at least 1,000,000, or at least 3,000,000, or at least
6,000,000, or at least 10,000,000 Relative Light Units per mg
protein per ml sample when measured in the presence of
luciferin/luciferase by a luminometer. More preferably, the sample
has an initial background activity of between 300,000-500,000 or
800,000-1,000,000 or 6,000,000-10,000,000 Relative Light Units per
mg protein per ml sample when measured in the presence of
luciferin/luciferase by a luminometer.
[0105] The initial background activity of a sample may be
significantly reduced by steps carried out during the assay. For
example, the washing and/or heating and/or enzymatic steps of the
assay described throughout this specification may result in a
reduced background activity. In preferred embodiments of the
invention, the sample, prior to the addition of the reporter enzyme
substrate/detector compound substrate, has a reduced background
activity when measured in the presence of luciferin/luciferase in a
luminometer, said reduced background activity having a Relative
Light Unit value that is 20-fold to 1000-fold lower than the
initial background activity described above. Preferably, said
reduced background activity has a Relative Light Unit value that is
50-fold to 800-fold lower than the initial background activity,
more preferably 500-1000-fold lower than the initial background
activity. Alternatively, the reduced background activity has a
Relative Light Unit value that is 100, or 200, or 300, or 400, or
500, or 600, or 700, or 800, or 900 or 1000-fold lower than the
initial background activity.
[0106] Thus, samples used in the assay of the invention may have
(i) an initial background activity as described above, and/or (ii)
a reduced background activity after the background reduction steps
of the assay have been completed.
[0107] Against the reduced background activity, the assay of the
invention is capable of achieving a detection limit, based on a
definition of 3 Standard Deviations above the control, that may be
as little as 10-20% above the reduced background value. This
compares to standard assay methods, which would require around a
100% greater value than the control background, based on the same
3SD definition of the detection limit.
[0108] As well as being particularly suited to "high background"
samples, the assay of the invention may also be used to analyse
samples that contain particularly low levels of analyte. The assay
may also be used to analyse samples that have low levels of analyte
and high levels of background activity, i.e. a low signal:noise
ratio.
[0109] In a preferred embodiment of the invention, the analyte is
present in the sample at a concentration of less than 10 ng/ml.
Preferably, the analyte is present at a concentration of less than
1 ng/ml, or less than 500 pg/ml, or less than 100 pg/mi, or less
than 10 pg/ml, or less than 1 pg/ml, or less than 100 fg/ml, or
less than 10 fg/ml, or less than 1 fg/ml. Samples containing such
levels of analyte may also have an initial and/or reduced
background activity as described above.
[0110] A wide variety of sample types can be analysed using the
assay of the invention. These samples may include a sample, or any
combination of samples, independently selected from the group
consisting of urine, faeces (stool), vomitus, blood components
(including serum, plasma, whole blood, white blood cell fractions,
buffy coat), airway samples (including sputum bronchoalveolar
lavage, endotracheal aspirates, nasopharyngeal aspirates), oral
samples (including crevicular fluid, parotid saliva, whole saliva),
cerebrospinal fluid (CSF), tissue homogenates (including brain
homogenate, tonsil homogenate), pus, swab samples (including those
taken from throat, nose, ears, skin, and wounds), effluent samples,
surface swabs, food, water, beverages, soil, air sampling and
sewerage. Preferably, the sample is selected from the group
consisting of faeces (stool), serum and whole blood.
[0111] Within such samples the detection of a wide range of
agents/analytes/antigens provide the basis for a rapid and
ultra-sensitive detection method to support diagnosis of an
infection or disease. Similarly the methods can be applied to
detect the presence of foreign material that may be present in the
sample due to accidental or deliberate contamination. The method
also allows for the development of methods to validate that an
agent/analyte/antigen has been effectively removed by a
decontamination or disinfection procedure, such that the
environment or sample is now safe.
[0112] Specific examples of agents/antigens/analytes that can be
detected via the assay of the invention include the following:
[0113] Bacteria:
[0114] Any bacterial agent, either Gram-positive or Gram-negative
that is associated or may be associated with disease,
Staphylococcus aureus (in particular antibiotic resistant strains
such as methicillin resistant Staphylococcus aureus; MRSA).
[0115] Toxins:
[0116] Botulinum toxin (including all botulinum neurotoxin
serotypes A-G; BoNT A-G and tetanus neurotoxin; TeNT), Anthrax
toxins (including lethal toxin, oedema toxin and their component
parts; lethal factor (LF), oedema factor (EF) and protective
antigen (PA), ricin, mycotoxins, afalatoxins, superantigens.
[0117] Viruses:
[0118] Rotavirus, Norwalk/Norwalk-like virus (alternatively termed
norovirus), Measles, mumps, rubella, HIV, hepatitis (all
forms).
[0119] Prion agents:
[0120] Agents responsible for causing diseases such as Creutzfeldt
Jakob Disease (CJD; including variant, familial, sporadic and
iatrogenic forms of the disease), scrapie, bovine spongiform
encephalopathy (BSE), chronic wasting disease (CWD) and any other
member of this family of disorders. The surrogate marker PrP.sup.Sc
(prion protein-scrapie associated form) associated with prion
diseases may also be a valid means of identifying and/or diagnosing
the presence of disease or infectious material.
[0121] Analytes:
[0122] B-lactamases, (including extended spectrum B-lactamases;
ESBL), hormones, tumour markers, neurotransmitters, growth
factors.
[0123] The ability of the invention to support the detection of
antigen/antibodies/analytes at a lower level and in cruder samples
than traditional formats has a number of advantages.
[0124] For example, the ability to detect a low level of a
bacterial or viral antigen in eg. oral, faecal or urine samples may
allow the earlier diagnosis of infection than would be supported by
waiting for a general bacteraemia or viremia to be detected in
blood. Further, the ability of the assay method to detect antigens
directly in blood (rather than via an antigen-capture type assay)
may facilitate detection and/or the diagnosis of disease. For
example the early detection of circulating endotoxin in blood
following infection by any one of a range of bacteria associated
with human diseases would accelerate treatment and improve the
prognosis.
[0125] The sensitivity of the assay also allows detection of a
disease that might otherwise be undetectable due to the phase of
the infection. For example diseases such as TB and HIV are
characterised by extended dormant/latent phases where diagnosis may
be difficult. The ability of the invention to assess very low
levels of antigen in crude samples might support the diagnosis of
such diseases despite the fact that they may be immunologically
silent. In the case of TB for example the ability to work with very
crude sputum, or bronchoalveolar aspirates would be very relevant
to supporting diagnosis, even of very low levels of antigen. This
same feature is true of a wide range of intracellular pathogens
that evade recognition by the host by manipulating the immune
response. The ability of these organisms to remain "immunologically
silent" means that there may be little or no detectable immune
response, and during early stages and/or specific phases of the
infection the levels of antigen may be below detectable limits.
Again the nature of the samples that can be analysed according to
the method of the invention, makes it more adaptable to measure
such infections within, for example, the oral cavity, urinary
tract, lower bowel or airways where samples are likely to be more
complex and may have greater levels of contaminating activity
and/or material.
[0126] The direct detection of analyte in a complex sample, whilst
maintaining high sensitivity, is also an advantageous feature of
the invention. For example, this would allow detection to be
achieved where only a single antibody or equivalent reagent is
available. Standardly, a pair of antibodies is used to provide a
"capture" phase and a detection phase. In the absence of a suitable
pair of antibodies (e.g. due to lack of epitopes on a particular
antigen, where the binding of a single antibody prevents the
binding of further reagents or where there is significant cross
reactivity for one of the reagent pair) detection is currently
difficult due to low sensitivity and high levels of interference.
The assay method helps to reduce this as it is intrinsically more
sensitive than most available assay methods and can eliminate
background activity.
[0127] The invention also allows for reduced sample processing. The
detection of low levels of an analyte/agent/antigen in complex
biological samples may often require the enrichment and/or partial
purification of the target molecule(s). This may be time consuming,
require the collection and use of large amounts of sample and may
pose a possible risk to the operators (e.g. during centrifugation
of infectious samples). By being able to directly capture the
antigen at sufficient levels for detection even in complex samples
the method significantly reduces the time required for the assay,
with a reduction in associated costs, can be used for assays where
the amount of sample may be limiting (e.g. neonatal samples), and
minimises any risks associated with processing of the sample.
[0128] The fact that the assay of the invention allows detection of
low level of analytes in a sample means that it allows the
detection of a disease at an earlier point than is currently
possible. As an example the detection of immunoglobulins in oral
samples is at the limit of current detection technologies with the
level of immunoglobulin in oral samples typically {fraction
(1/1000)}th that in blood. This is illustrated in the following
table:
2 Concentrations of immunoglobulins relevant for supporting
diagnosis in plasma and fractions of saliva. Specimen IgG mg/ml IgM
mg/ml Plasma 14730 1280 Parotid Saliva 0.36 0.43 Crevicular Fluid
3500 250 Whole Saliva 14.4 2.1
[0129] (Adapted from McKie A, Vyse A, Maple C. Novel methods for
the detection of microbial antibodies in oral fluid. Lancet Infect
Dis. (2002) 2: 18-24. Original data from Brandtzaeg P, Fjellanger
I, Gjeruldsen S T. Human secretory immunoglobulins. I. Salivary
secretions from individuals with normal or low levels of serum
immunoglobulins. Scand J Haematol Suppl 1970; 12: 3-83, and Roitt
I, Lehner T. Oral immunity of oral diseases, 2nd ed. Oxford:
Blackwell).
[0130] The review article (McKie et al Lancet Infectious Disease
2002) describes many problems with the oral diagnosis of disease,
but in particular suggest that lack of sensitivity is the most
significant issue. The analysis of such samples is complicated by
the high background of cellular debris, protein and possible
contaminating microrganisms. Whilst the levels of IgG are
sufficient to support the diagnosis of certain diseases/immune
states, this often requires the use of radioimmunoassays. These
have a number of advantages over traditional reporter enzyme
detection formats, in terms of the dynamic range and sensitivity,
but have serious disadvantages in that they require dedicated
laboratories for the handling of radio-isotopes, are technically
demanding, generate radioactive waste with disposal issues and have
proved very difficult to transfer between laboratories.
[0131] The levels of IgM have, in the vast majority of cases,
proved to be insufficient to support diagnosis via oral samples.
For a number of infectious diseases the detection of IgM type
antibodies as part of the initial infection prior to seroconversion
to an IgG type response is a useful diagnostic indicator. For
example in the diagnosis of West Nile disease, an emerging
infectious disease in North America and elsewhere, levels of
anti-virus serum IgM are used to support an initial presumptive
diagnosis (as approved by the FDA as part of the PanBio West Nile
Test kit). Aside from infection they are also an extremely valuable
method for assessing the initial response to a vaccination, which
after the first inoculation leads to an IgM response in most cases.
By monitoring this initial priming response, by way of a simple
non-invasive oral sample, it would be possible to predict likely
efficacy of the vaccination schedule and curtail the vaccination if
the person was not responding. This would be particularly useful
for cases where there is significant risk of adverse effects from
the vaccination. Such assays are described in Examples 18 and
19.
[0132] In other infections, IgM production is currently used as the
diagnostic indicator by way of serum sampling. The ability of the
invention to detect the relatively low levels of IgG or IgM in oral
samples and to cope with the intrinsic high background of the
sample, means that it supports both the early diagnosis of
infections and the assessment of initial immune response following
vaccination.
[0133] In one embodiment, the assay allows for the detection of a
bacteraemia at an earlier stage than is currently possible, e.g.
the detection of bacteria such as Streptococcus pneumoniae in urine
as described in Example 17. It also offers the potential to
discriminate against carriers of S. pneumoniae who are not actually
infected.
[0134] In a further embodiment, the assay is used to detect
Methicillin-resistant Staphylococcus aureus (MRSA) (see Example
16). MRSA is a significant public health issue with respect to
hospital acquired infection. The number of cases of infection have
increased in many countries over recent years and the spread of
multiple antibiotic resistant strains is also of considerable
concern. A method for the rapid and sensitive detection and
diagnosis of MRSA from tissues swabs, without the time-consuming
requirement to culture the bacteria, would significantly assist
diagnosis. Those familiar with the art will recognise that a number
of assays have been developed in which the bacteria are captured
and lysed and the AK released from the cells is quantified. Some of
these methods have been adapted to the detection of MRSA. The
method of the invention has the advantage that by using serotype
specific antibodies the method can provide information on both the
presence and type of MRSA present in the sample. This is not
possible with the alternative methods. The ability of the method of
the invention to detect low levels of MRSA in tissue swabs and/or
other samples makes it a valuable method for detecting and
controlling the transmission of MRSA in healthcare facilities. The
emergence of community acquired cases of MRSA and other antibiotic
resistant bacteria means that such an assay is likely to find
widespread applications.
[0135] Toxins, such as eg. ricin and botulinum, can also represent
a significant threat to public health. The assay of the invention
is suitable for testing for the presence of these potent toxins in
food, water or other environmental samples, even when the toxin is
present at extremely low levels. Examples of toxin assays are
provided in Examples 11 and 12.
[0136] The invention can also be used to assay for viruses.
Noroviruses, sometimes termed Norwalk-like viruses (NLV), and
associated with Winter Vomiting Disease are a major cause of viral
gastroenteritis with high attack rates. Major outbreaks occur in a
variety of settings associated with high densities of people,
including hospitals, cruise ships, schools, and residential homes.
Outbreaks of Norovirus can have a significant public health impact.
Outbreaks in hospitals may be particularly severe due to general
poor health of patients and hospital outbreaks often result in
closure of wards and out-patient facilities, to control the spread
of the disease, with consequences for the wider patient population.
The relative ease with which the disease is transmitted between
infected people and the enormous difficulties encountered with
decontamination and disinfection means that secondary outbreaks are
not uncommon. New methods to support the early diagnosis of NLV and
the presence of NLV that remains after ineffective decontamination
procedures would have a significant benefit for the public health
management of these disorders.
[0137] The assessment of immune response to NLV infection offers
the potential to identify patients at very early stages of
infection, monitor people carrying the disease without symptoms and
help to control and prevent onward transmission of the disease as
part of outbreak control. Of particular use would be an assay with
sufficient sensitivity to be able to detect the presence of IgM
antibodies in oral samples at an early stage of infection. The
value of IgM as a diagnostic marker of early phase NLV infection
has been described by Brinker et al 1998, Detection of Norwalk
virus and other genogroup I human calciviruses by a monoclonal
antibody, recombinant antigen-based immunoglobulin M capture enzyme
immunoassay, J. Clin. Microbiol. 171 : p 1064-1069). An assay for
the detection of NLV/Norovirus is described in Example 14.
[0138] The ability to effectively decontaminate surfaces, floors,
walls etc in hospital wards and other sites of NLV outbreaks is
critical in controlling the onward spread of the disease. To
support this process a method to validate effective cleaning would
be extremely valuable. The assay of the invention is ideally suited
to be able to fulfil this role, being able to detect very low
levels of antigen in environmental samples and surface swabs that
may contain high levels of organic and inorganic matter. This type
of assay is described in Example 15.
[0139] A further example of the use of the invention to assay for
viruses is presented in Example 13, which describes the detection
of rotavirus in a faecal sample.
[0140] One specific application of the assay of the invention is
the detection of prion material in tissue homogenates, as described
in Example 9. The diagnosis and detection of prion diseases is an
important priority for public health management of this class of
disorders. The assay method of the invention may be suitable for
the detection of prion agents in blood fractions (Example 9),
and/or on surgical instruments (Example 10) and/or urine, due to
its high sensitivity and ability to eliminate background
interference. One tissue that has been found to support the
diagnosis of the variant form of Creuzfeldt Jakob Disease (vCJD),
probably the form of CJD of most concern to public health
scientists and the public, is the tonsil. Whilst a number of
studies have examined the tonsil and used this as a basis for
diagnosis, this has been done routinely by immunohistochemistry.
This method is difficult and time consuming and does not lend
itself to the high throughput required for routine diagnosis. The
method of the invention is suitable for the rapid analysis of
tonsil samples due to its ability to detect low levels of signal in
complex samples. Hence the tonsil would be homogenised to generate
a very crude sample containing a mixture of intact and lysed cells
with high background activity, in terms of both total protein
content and enzymatic activity, within which the prion is present
at only low levels. Whilst the removal of tonsils requires surgery
and as such could not be considered to be non-invasive, this is
currently due to the nature of the immunohistochemistry assay used
to detect the prion in tonsil tissue. With the method of the
invention it might be possible, and preferable, to remove a small
number of cells from the tonsil, either by swabbing the surface or
using a fine needle to take the equivalent of a biopsy sample. Even
if the tonsil does need to be removed to support diagnosis, given
the difficulty in detecting the disease without analysis of brain
tissue, this may still be a viable option. The assay would also be
valuable for the diagnosis of the disease in prospective anonomysed
tonsil tissue archives, being collected in the UK and elsewhere,
for the assessment of the levels of the disease in the population.
Cerebrospinal fluid samples might also be useful for the diagnosis
of CJD and might be considered to be acceptably invasive if their
use allows diagnosis leading to treatment of the disease. Again
these would be complex samples with high levels of protein and
cellular debris likely during the progression of neurodegenerative
diseases such as CJD.
[0141] The invention is further described with reference to the
following Figures in which:
[0142] FIG. 1 is a schematic representation of steps 1-4 of the
assay described in Example 1;
[0143] FIG. 2 is a schematic representation of steps 5-8 of the
assay described in Example 1;
[0144] FIG. 3 is a schematic representation of steps 9-10 of the
assay described in Example 1;
[0145] FIG. 4 is a key, which explains the symbols used in FIGS.
1-3;
[0146] FIG. 5 is a comparison of an AK-based assay and a
traditional HRP based assay method for the detection of recombinant
PrP. In Panel A, data is shown for the detection of recombinant PrP
diluted in either phosphate buffered saline or in mouse brain
homogenate (MBH) in PBS (data shown is for dilution in 0.5 mg/ml
MBH but similar results have been shown for 0.05 mg/ml). Panel B
shows the expanded range of the assay for ultrasensitive detection
of recPrP;
[0147] FIG. 6 shows the detection limits for the detection of
recPrP in complex samples. Panel A shows the sensitivity of the
assay when recPrP is spiked into whole blood prior to plating.
Panel B shows the similar data for recPrP spiked into serum;
[0148] FIG. 7 shows the detection of recombinant PrP on type 316
steel disks as a model for surgical instruments;
[0149] FIG. 8 is a comparison of an AK and a HRP-based assay for
the detection of BoNT/B light chain domain. Similar results were
obtained with full length BoNT/B (not shown);
[0150] FIG. 9 is a comparison of assay methods for the detection of
rotavirus. The detection limit of an anti-rotavirus AK conjugate is
compared with a commercially available Rotavirus assay kit
(Dakocytomation, UK).
[0151] Specific embodiments of the invention are now described.
[0152] The assay of the present invention can involve the use of
conventional equipment and reagents required for known ATP/AK
bioluminescence assays, supplemented by a thermal cycler (widely
and inexpensively available for PCR), plus two specific enzymes, a
thermolabile ATPase and a thermostable adenylate kinase.
EXAMPLE 1
Assay for Prior Protein
[0153] Prion ELISA--1
[0154] (Reference is made to the attached drawings)
[0155] 1. Blocking
[0156] A standard item of potentially infectious equipment presents
with a diverse range of biological material bound to the surface.
This includes both free and cellular ATP and mesophilic adenylate
kinases (mAK). A small area of the surface is sectioned off to form
a chamber (not shown, .about.1 ml volume) into which reagents can
be added and removed. To prevent non-specific binding of the
antibody-thermostable adenylate kinase conjugate, the exposed
surfaces, including the enclosed area of the surgical instrument,
are "blocked" by incubation in the presence of buffer containing,
for example, the non-ionic detergent Tween 20 (1% v/v) in 10 mM PBS
pH 7 for 1 hour. The chamber is then washed twice with 0.05% Tween
20 in 10 mM PBS pH 7 prior to binding of the antibody-thermostable
adenylate kinase conjugate.
[0157] 2. Antibody Binding
[0158] The thermostable adenylate kinase from Bacillus
stearothermophilus is coupled to an affinity-purified polyclonal
antibody via a heterobifunctional thiol-cleavable cross-linking
agent, N-Succinimidyl-3-(2-Pyridyldithio)Propionate (SPDP). The
antibody is raised by standard procedures against a synthetic
peptide corresponding to a conserved region of the prion protein,
coupled to maleimide-activated keyhole limpet haemocyanin. Active
conjugate (50 .mu.l) is added to the buffer in the chamber and
incubated for 30 minutes at room temperature.
[0159] 3. Washing
[0160] The chamber is washed manually or by use of an automated
washing device with six changes of buffer containing 0.2 M NaCl,
0.05% Tween 20 in 10 mM PBS, pH 7. These serve to remove unbound
conjugate and any biological material only loosely attached to the
surface.
[0161] 4. Linker Cleavage
[0162] Dithiothreitol is added to the last wash to a final
concentration of 25 mM and incubation at room temperature continued
for 30 minutes. This cleaves the thermostable adenylate kinase
moiety from the bound antibody providing a signal molecule in free
solution proportional to the original amount of prion protein
present.
[0163] Prion ELISA 2
[0164] 5. Recovery/Transfer
[0165] At this stage the thermostable adenylate kinase-containing
solution is aspirated by pipette and transferred to the wells of a
thermostable luminometer microtitre plate. Transfer of non-specific
background ATP and mesophilic adenylate kinase also occurs, giving
the potential for over-estimation of prion protein present on the
original instrument surface.
[0166] 6. Thermal Inactivation
[0167] The adenylate kinase used is thermostable. The temperature
is, therefore, increased to 80.degree. C. and maintained at this
temperature for 10 minutes in a microtitre plate thermal cycler.
This thermally denatures and inactivates any residual contaminating
mesophilic adenylate kinase leaving a preparation containing only
the specific thermostable adenylate kinase proportional to the
prion protein content of the sample.
[0168] 7. ATP Hydrolysis
[0169] The plate is then cooled and 0.05 units.ml.sup.-1 of
adenosine deaminase and Solanum tuberosum apyrase added prior to
incubation at 30.degree. C. for 30 minutes. This enzyme removes any
residual ATP carried over from the original sample.
[0170] 8. Thermal Inactivation
[0171] The combination of steps 6 & 7 ensures that no ATP or AK
background is now present. A further heat incubation as in step 6
is then used to inactivate the mesophilic apyrase.
[0172] Prion ELISA--3
[0173] 9. ATP Generation
[0174] Ultrapure ADP (0.1 mM) and free of ATP, is added along with
magnesium ions (10 mM) in order to generate ATP derived exclusively
from the thermostable adenylate kinase. Incubation is carried out
at 80.degree. C. for 30 minutes. The ATP is then available for
D-luciferin-luciferase bioluminescence detection.
[0175] 10. ATP Bioluminescence
[0176] The ATP-containing wells are cooled to 25.degree. C. and
synthetic ultrapure D-luciferin and adenylate kinase-free
luciferase added to a concentration of 40 .mu.M and 1 mg.l.sup.-1
respectively. Individual wells are read for ATP-dependent
bioluminescence in a microtitre plate luminometer and the results
recorded. The amount of light generated correlates directly with
the original amount of prion protein in the sample.
EXAMPLE 2
An Assay for a Microorganism
[0177] A micro-organism is immobilized onto solid surface by
non-specifically binding sample components including the
microorganism to the solid phase, treating the solid phase to
prevent further non-specific binding thereto and washing (we use a
microtitre well in this case but other known solid phases are
suitable, such as a latex bead or a magnetic bead). An antibody
specific to the micro-organism and coupled to a thermostable
adenylate kinase is introduced and allowed to bind, prior to
further washing/recovery.
[0178] (In the known AK assay, sensitivity would have been limited
by the level of sample concentration possible before levels of
background ATP and non-specific AK obscured any signal).
[0179] The sample is now heated to about 90.degree. C. for about 10
minutes in a cell extraction buffer (in a thermal cycler) to
denature any endogenous AK present and release any ATP that may be
trapped within the micro-organism. The sample is then cooled to
37.degree. C. and a thermolabile ATPase added. The sample is
incubated for about 10 minutes to remove the background ATP, then
the temperatures is raised to about 90.degree. C. to denature the
thermolabile ATPase.
[0180] Next, ADP is added and the temperature maintained at
90.degree. C. so the thermostable adenylate kinase can convert ADP
into ATP. This incubation generates ATP exclusively from the
thermostable adenylate kinase. The ATP thus generated is then
assayed by conventional ATP bioluminescence and is directly
proportional to the concentration of the target present.
EXAMPLE 3
An Assay for a Microorganism
[0181] A micro-organism is captured by a conventional capture
technique, using a specific antibody immobilised onto a solid
surface (we use a microtitre well in this case but other known
solid phases are suitable, such as a latex bead or a magnetic
bead). After washing/recovery, a second antibody specific to the
micro-organism and coupled to a thermostable adenylate kinase is
introduced and allowed to bind, prior to further
washing/recovery.
[0182] Thus, the method of Example 1 is repeated but using a
microorganism immobilized using antibody.
EXAMPLE 4
A Blood-Hormone Assay
[0183] An antibody specific for the alpha subunit of TSH is
immobilised onto a solid-phase. The solid-phase is treated to
prevent further non-specific binding thereto. The solid-phase is
washed with wash buffer, optionally containing detergent. A test
sample of blood serum is added.
[0184] The sample is then incubated, e.g.: 37.degree. C. for 60
mins, allowing the free TSH in the sample to bind to the capture
antibody. The solid-phase is then washed to remove non-specifically
bound material and an antibody specific for the beta subunit of TSH
is added, to which a thermostable adenylate kinase reporter enzyme
has been conjugated. The conjugate is then incubated at 37.degree.
C. for 60 minutes, or equivalent.
[0185] Non-bound material is then removed by washing and any
endogenous ATP present on the solid-phase is removed by the
addition of adenosine-5'-triphosphatase (an alternative is
apyrase). The sample is then heated to 90.degree. C., or
equivalent, to denature and inactivate any mesophilic adenylate
kinase that may be present.
[0186] Adenosine diphosphate (ADP) is added and the temperature is
maintained at 90.degree. C. so that the thermostable adenylate
kinase can convert the ADP to ATP. This incubation generates ATP
exclusively from thermostable adenylate kinase. The ATP generated
is then assayed by conventional ATP bioluminescence technology
using a luciferin/luciferase reaction. Signal from contaminating
adenylate kinase in the luciferin/luciferase reagents may be
quenched by the addition of a specific enzyme inhibitor. The ATP
bioluminescence measured is directly proportional to the
concentration of the TSH in the original test sample.
[0187] Whilst the solid-phase used in the above is a
microtitre-plate, other solid-phases are suitable, such as latex or
magnetic bead. The test sample may be whole blood or other body
fluid, rather than blood, and the antibody may be a polyclonal or a
monoclonal antibody.
EXAMPLE 5
An Assay for Cocaine Metabolites in Urine
[0188] A thermostable G6PDH is used as reporter enzyme. Test
antibody specific for the class of drug of interest is immobilised
onto a micro-titre plate as solid-phase. The solid-phase is treated
to prevent further non-specific binding thereto. The solid-phase is
washed with wash buffer, which may or may not contain detergent. A
test sample of urine is added along with the drug-G6PDH conjugate.
The drug-G6PDH is thermostable and is not active when bound to the
antibody immobilised to the solid-phase.
[0189] The sample is then incubated, at 37.degree. C. for 60 mins.
The contents of the micro-titre well is then removed and heated to
90.degree. C. to inactivate any mesophilic G6PDH present. The
temperature is then maintained at 90.degree. C. and the substrate
glucose-6-phosphate and cofactor NAD+ is added in the appropriate
buffer. The rate of change in the absorbance at 340 nm is measured
and is directly proportional to the level of drug metabolite in the
test sample.
[0190] Another reporter for this assay is a thermostable adenylate
kinase. Test antibody specific for the class of drug of interest is
immobilised onto a solid-phase. The solid-phase is treated to
prevent further non-specific binding thereto. The solid-phase is
washed with wash buffer, which may or may not contain detergent. A
urine test sample is added along with the drug-adenylate kinase
(AK) conjugate. The drug-AK conjugate is thermostable and is not
active when bound to the antibody immobilised to the
solid-phase.
[0191] The sample is then incubated, e.g.: 37.degree. C. for 60
mins. The contents of the micro-titre well is then removed and
endogenous ATP removed by addition of adenosine-5'-triphosphatase
or apyrase and incubation at 37.degree. C. The sample is then
heated to 90.degree. C. to inactivate any mesophilic adenylate
kinase present.
[0192] Adenosine diphosphate (ADP) is added and the temperature is
maintained at 90.degree. C. such that the thermostable adenylate
kinase can convert the ADP to ATP. This incubation generates ATP
exclusively from thermostable adenylate kinase. The ATP generated
is then assayed by conventional ATP bioluminescence using a
luciferin/luciferase system. Signal from contaminating adenylate
kinase in the luciferin/luciferase may be quenched by the addition
of a specific enzyme inhibitor. The ATP bioluminescence measured is
directly proportional to the concentration of the drug metabolite
in the original test sample.
[0193] Other solid-phases are suitable, such as latex or magnetic
bead, and the test sample may be sera or other body fluid.
EXAMPLE 6
Assays for the Detection of Human Papilloma Virus DNA
[0194] Assay A: Cervical cells are collected and resuspended in
phosphate buffered saline. PCR amplification of the HPV1 6, or
equivalent sequence, is carried out as described in Lambropoulous
et al. (1994) Journal of Medical Virology: 43, 228-230 using the
consensus primers MY11 and MY09 and 30 rounds of amplification.
[0195] The PCR products are then transferred and immobilised on to
a non-charged nylon coated microtitre plate, or equivalent. An
oligonucleotide probe specific for HPV16 (MY14) conjugated to a
thermostable adenylate kinase is then added and incubated. The
oligonucleotide-AK conjugate is prepared following an identical
method described the synthesis of DNA-antibody conjugates. This
complex comprises of a biotinylated AK and an avidin-biotinylated
DNA complex generated using available methodology: Ruzicka et al.
Science 1993, 260, 698-699.
[0196] Non-bound material is then removed by washing and any
endogenous ATP present on the solid-phase is removed by the
addition of adenosine-5'-triphosphatase or apyrase. The solid-phase
is then washed and the sample heated to 90.degree. C., or
equivalent, to denature and inactivate any mesophilic adenylate
kinase that may be present.
[0197] Adenosine diphosphate (ADP) is added and the temperature is
maintained at 90.degree. C. such that the thermostable adenylate
kinase can convert the ADP to ATP. This incubation generates ATP
exclusively from thermostable adenylate kinase. The ATP generated
is then assayed by conventional ATP bioluminescence using a
luciferin/luciferase reaction. A positive signal is indicative of
HPV infection.
[0198] Assay B: Cervical cells are collected and fixed onto a
solid-surface, a non-charged nylon membrane contained within a
microtitre plate. The cells are lysed and the endogenous ATP
present on the solid-phase is removed by the addition of
adenosine-5'-triphosphatase or apyrase. An oligonucleotide probe
specific for HPV16 (MY14: 5'CATACACCTCCAGCACCTAA3') conjugated to a
thermostable adenylate kinase is then added. The oligonucleotide-AK
conjugate is prepared following an identical method described the
synthesis of DNA-antibody conjugates. This complex comprises a
biotinylated AK and an avidin-biotinylated DNA complex generated
using available methodology: Ruzicka et. al. Science 1993, 260,
698-699.
[0199] After incubation, 37.degree. C. for 60 min, the sample is
heated to 90.degree. C., or equivalent, to denature and inactivate
any mesophilic adenylate kinase that may be present. ADP added and
the temperature is maintained at 90.degree. C. such that the
thermostable adenylate kinase can convert the ADP to ATP. This
incubation generates ATP exclusively from thermostable adenylate
kinase. The ATP generated is then assayed by conventional ATP
bioluminescence using a luciferin/luciferase reaction. A positive
signal is indicative of HPV infection.
EXAMPLE 7
An Assay to Screen Peptide Combinational Libraries
[0200] Peptides are synthesised on small beads (100 .mu.m-200
.mu.m) using standard solid-phase peptide synthesis methodology.
The sequence corresponds to a combinational peptide library
generated as described Lam. et al. (1991) Nature (UK). 354,
82-84.
[0201] The beads are split into 20 portions and a separate amino
acid coupled to each portion. The beads are then recombined,
randomised, and split into 20 for addition of the next amino acid.
This process is repeated to build a peptide library of all possible
combinations of amino acids. In theory each bead should have a
different peptide sequence attached. After synthesis the beads are
washed and any endogenous ATP is removed by addition of
adenosine-5'-triphosphatase or apyrase. A ligand-thermostable AK
conjugate is added and the sample heated to 90.degree., or
equivalent, to denature and inactivate any mesophilic adenylate
kinase that may be present.
[0202] Adenosine diphosphate (ADP) is added and the temperature is
maintained at 90.degree. C. such that the thermostable adenylate
kinase can convert the ADP to ATP. The beads are split into
portions and screened for the generation of light generated by a
luciferin/luciferase reaction using a standard luminescence reader.
Portions generating a positive signal are split into further
portions and re-screened. This process is continued using a
microscope equipped with a charge couple device camera, until the
signal from a single bead is identified. The bead is removed and
the sequence of peptide is then determined using standard
micro-sequencing methodology.
EXAMPLE 8
An Assay for botulinum Toxin
[0203] Antibody specific for the botulinum toxin is immobilised
onto a solid-phase. The solid-phase may be a microtitre-plate but
other solid-phases are suitable, such as latex or magnetic bead.
The solid-phase is treated to prevent further non-specific binding
thereto. The solid-phase is washed with wash buffer, which may or
may not contain detergent. Test sample is added. The test sample is
a food sample, but may be whole blood or body fluid. The sample is
then incubated, e.g.: 37.degree. C. for 60 mins, allowing the free
toxin in the sample to bind capture antibody. The solid-phase is
then washed to remove non-specifically bound material and an
antibody specific for the botulinum toxin is added to which a
thermostable adenylate kinase reporter enzyme has been conjugated.
This antibody may be a polyclonal or a monoclonal antibody. The
conjugate is then incubated at 37.degree. C. for 60 minutes, or
equivalent.
[0204] Non-bound material is then removed by washing and any
endogenous ATP present on the solid-phase is removed by the
addition of adenosine-5'-triphosphatase or apyrase. The solid-phase
is washed and the sample heated to 90.degree. C., or equivalent, to
denature and inactivate any mesophilic adenylate kinase that may be
present.
[0205] Adenosine diphosphate (ADP) is added and the temperature is
maintained at 90.degree. C. such that the thermostable adenylate
kinase can convert the ADP to ATP. This incubation generates ATP
exclusively from thermostable adenylate kinase. The ATP generated
is then assayed by conventional ATP bioluminescence using a
luciferin/luciferase reaction. Signal form contaminating adenylate
kinase in the luciferin/luciferase may be quenched by the addition
of a specific enzyme inhibitor. The ATP bioluminescence measured is
directly proportional to the concentration of the toxin in the
original test sample.
EXAMPLE 9
Detection of TSE Agents in Serum, Whole Blood, or Tissue (Brain,
Tonsil) Homogenate
[0206] Recombinant human prion protein was used as a model for the
detection of TSE agents in complex biological samples. In the model
system the assay was performed essentially as described below.
[0207] A. Production and Purification of Recombinant Thermostable
Adenylate Kinases
[0208] A clone expressing thermostable AK from the
thermoacidophilic archaeon Sulfolobus acidocaldarius was generated
in the expression vector pET3a and the protein expressed in JM109
host cells carrying additional tRNA genes for rarely expressed E.
coli codons (specifically those encoding lie codon ATA and Arg
codon AGA) on a pACYC derived vector. Recombinant expression was
carried out as follows. A primary inoculum of 100 ml was set up in
Terrific broth supplemented with 100 .mu.g/ml ampicillin and 35
.mu.g/ml chloramphenicol and grown overnight at 30.degree. C. 160
rpm. The primary inoculum was subcultured by diluting 40 ml into 1
litre of fresh media with the same additions. The culture was grown
at 30.degree. C. 200 rpm for approximately 4-5 hours until the
OD600 measurement reached at least 0.6 and typically around 0.8.
The culture was induced by the addition of IPTG to a final
concentration of 500 .mu.M and the culture grown overnight at
30.degree. C. Cells were harvested by centrifugation and stored at
-80.degree. C. until required.
[0209] A purification method was established using an initial heat
treatment of incubation for 20 min at 80.degree. C., to destroy
proteins derived from E. coli, followed by centrifugation at 15000
rpm SS34 rotor in a Sorvall CL4B centrifuge to remove the degraded
proteins. The thermostable nature of the AK enzyme, even in the
presence of sequences derived from the pET3a vector, mean that it
is unaffected by the treatment and will stay in solution under
these conditions. An affinity chromatography step was then carried
out by adsorption of the enzyme to Blue Sepharose in a buffer
containing 50 mM Tris-HCl, pH 7.5, followed by specific elution
with a low concentration of AK co-factors (AMP+ATP and magnesium
ions). The ATP and AMP in the elution buffer were degraded by
incubation with apyrase, which is readily inactivated by subsequent
heat treatment. Gel filtration chromatography on a preparation
grade Superdex column could be added to the protocol if required to
add additional clean up of the enzyme.
[0210] Those familiar with the art will recognize that a number of
further options are available for the production of adenylate
kinase or other appropriate enzymes, e.g. purification of adenylate
kinase from thermophilic bacteria or archaea using standard
methods. The ability to overexpress the enzyme in E. coli does
offer some advantages in terms of yield and according to our
current studies is surprisingly effective at allowing the
production and correct folding of the thermostable enzymes. A wide
range of expression systems are available for the production of
such enzymes. The use of plasmids expressing rare tRNA genes is a
well described method for allowing the expression of AT-rich genes
(or GC-rich as appropriate) in E. coli where the codon usage may be
sub-optimal. Alternatively the use of E. coli-codon optimized
synthetic genes, familiar to those with knowledge of the art may
allow efficient production of the protein.
[0211] B. Development of Ultra-Sensitive ELISA with 6H4
[0212] The anti-prion monoclonal antibody, 6H4 (Prionics) was
conjugated to purified recombinant thermostable Sulfolobus
acidocaldarius adenylate kinase using the heterobifunctional
thiol-cleavable linker N-succinimidyl 3-(2-pyridyldithio)propionate
(SPDP) (Pierce Chemicals) (Carlsson et al, 1978). In brief both the
antibody and AK was derivatised with SPDP at a molar ratio of
approximately 3 SPDP: 1 protein. The free SPDP was removed by
either dialysis or gel filtration and the derivatised AK reduced to
generate a reactive thiol group. This was reacted with the
derivatised antibody either for 1-4 hours at room temperature or
overnight at 4.degree. C. The conjugate preparations were assessed
by ELISA. A microtitre plate was coated with recPrP at a
concentration of 0.2 .mu.g/ml. The wells were washed 4 times with
PBS+0.05% Tween 20 (all washing steps). Non-specific binding to the
wells was blocked by incubation with a 3% solution of casein
dissolved in PBS. After incubation with the sample, ADP was added
to the wells at a concentration of 0.15 mM (0.01 volumes) diluted
in 15 mM magnesium acetate buffer+1 mM EDTA, pH 6.7. 30 .mu.l of
D-luciferin-luciferase (Biothema) substrate was added to each well
and the Relative Light Units (RLU) measured in a microtitre plate
luminometer (Berthold Orion).
[0213] C. Detection of Recombinant PrP
[0214] A titration of RecPrP was coated onto a microtitre plate
(Maxisorp, Nunc) by doubling dilutions from a starting
concentration of 10 ng/ml. Dilutions were made in Coating Buffer
(sodium carbonate buffer, pH 9.6) and 100 .mu.l/well of each
dilution was incubated overnight at RT. The unbound antigen was
removed by washing with 4 changes of PBS containing 0.05% Tween-20
(All washing steps). 100 .mu.l of a 1:2000 dilution of 6H4-AK
conjugate was added to each well diluted in PBS containing 5%
casein and 0.05% Tween-20 and incubated for 1 hour at RT.
Thermostable AK was cleaved from the bound antibody by the addition
of 100 ml of a 25 mM solution of (2-Mercaptoethanesulfonic acid)
MESNA diluted in 50 mM Tris-HCl (pH 7.2) incubated for 30 minutes
at 45.degree. C. The contents of the microtitre well were
transferred to a white thermocycler compatible microtitre plate.
All further incubation steps take place in the thermocycler. 100
.mu.l of 0.13 mM ADP substrate (Celsis) diluted in 15 mM MgAc, 1 mM
EDTA buffer (pH 6.8) was added to each well and incubated at
70.degree. C. for 20 minutes, cooled to RT and 30 ml of
luciferin-luciferase reagent (Biothema) was added and the RLU read
immediately on a plate luminometer.
[0215] The results of the assay are shown in Panel A of FIG. 5,
together with the results obtained when the assay was carried out
using an HRP conjugated anti-mouse antibody to detect 6H4. The
detection limit for the AK-based assay (defined as 3SD above the
control background value) was calculated as 156 pg/ml, which
equates to 6.75 pM of recPrP. This indicates a 100-1000 fold
increase in sensitivity of the AK-based assay compared to the
HRP-based assay.
[0216] D. Detection of recPrP in Complex Backgrounds
[0217] A further requirement of the assay is that it can detect PrP
in the presence of complex biological material. A titration of
recPrP from a starting concentration of 10 .mu.g/ml was diluted in
either 0.5 or 0.05 mg/ml MBH in coating buffer, in sheep's blood,
or in serum (Sigma) by placing 100 .mu.l/well and incubated
overnight at RT. The assay was continued exactly as described in
sections 1A-C.
[0218] Results are shown in FIG. 5 (for MBH in coating buffer) and
in FIG. 6 (for sheep's blood and serum).
[0219] FIG. 5 shows the detection of recPrP spiked into
non-infectious mouse brain homogenate (MBH). The data shown are for
dilution in 0.5 mg/ml MBH but similar results were shown for 0.05
mg/ml. These values equate to a 5000-50000 fold excess of MBH. The
detection limit for the assay (defined as 3SD above the control
background value) was calculated as 156 pg/ml (which equates to
6.75 pM of recPrP). This detection limit appeared to be unaffected
by the amount of MBH present (ie. within the 5000-50000 fold
range).
[0220] In FIG. 6, the assay of the invention was used to detect
recPrP spiked into ovine sera (Panel B) and blood (Panel A). The
assay was found to be capable of detecting PrP at levels of 100
pg/ml in sera and 10 fg/ml in whole blood.
[0221] A further example of the use of the assay is for detection
of prion agents in tissue homogenates, principally in tonsil
samples taken for diagnostic purposes or as part of surveillance
studies. Tissue homogenate is prepared by disruption of the tonsil
tissue, using any one of a variety of apparatus sold for such
purposes, in a suitable buffer. If required, proteinase K is used
to discriminate between the normal cellular PrPc and the
disease-associated protease-resistant form PrPSc. Whilst this forms
the basis of most current tests for BSE, many experts in the field
suggest that this may hide the presence of a protease-sensitive
disease-associated form that may be important for assessing the
presence of the disease. The detection of this form of the protein
may increase the sensitivity of the assay if it can be detected
alongside the protease-resistant form. Following homogenisation and
protease digestion, if appropriate, the homogenate is applied
directly to a solid support. Optionally, a specific capture reagent
is used to increase the amount of the disease-associated PrP bound
to the solid support. Many of these capture reagents will be
familiar to those with knowledge of the art, but include
derivatives of Congo Red (and related amyloid-binding reagents),
heparin-derivatives, antibodies, peptides, nucleic acid derivatives
(shown to bind PrPSc) or RNA aptamers. The plate is then washed and
the bound prion material detected by the addition of AK-conjugated
prion antibodies essentially as described above. Background
reduction steps using heat treatment and/or apyrase are performed
according to the protocol outlined above. The method allows the
detection of the abnormal prion isoforms in the tissue as a
presumptive confirmation of diagnosis.
EXAMPLE 10
Detection of Prion Protein on the Surface of a Surgical Steel
Instrument
[0222] Surgical stainless steel disks of 5 mm diameter were
purchased from Goodfellow; Cambridge Ltd. The diameter of the disks
enabled them to be placed in the bottom of a microtitre well. These
were coated by carefully placing a solution of recPrP or
non-infectious mouse brain homogenate (MBH) diluted in coating
buffer on the surface of the disc and incubating overnight at room
temperature. The unbound antigen was removed by washing with 4
changes of PBS containing 0.05% Tween-20 (all washing steps). 100
.mu.l of a 1:2000 dilution of 6H4-AK conjugate was added to each
well diluted in PBS containing 5% casein and 0.05% Tween-20 and
incubated for 1 hour at RT. Thermostable AK was cleaved from the
bound antibody by the addition of 100 .mu.l of a 25 mM solution of
MESNA diluted in 50 mM Tris-HCl (pH 7.2) incubated for 30 minutes
at 45.degree. C. The contents of the microtitre well were
transferred to a white thermocycler-compatible microtitre plate.
All further incubation steps take place in the thermocycler.
Thermal inactivation of contaminating AK was achieved by heating to
80.degree. C. for 10 minutes. 5 .mu.l of apyrase (Celsis) was added
to each well and incubated at 37.degree. C. for 30 minutes followed
by inactivation of the apyrase by inclusion of a heat step to
60.degree. C. for 10 minutes. 100 .mu.l of 0.13 mM ADP substrate
(Celsis) diluted in 15 mM MgAc, 1 mM EDTA buffer (pH 6.8) was added
to each well and incubated at 70.degree. C. for 20 minutes, cooled
to RT and 30 .mu.l of luciferin-luciferase reagent (Thermo
Labsystems) was added and the RLU read immediately on a plate
luminometer.
[0223] The results of this assay are shown in FIG. 7.
[0224] A detection limit of below 10 ng/ml was achieved using the
assay. At 10 ng/ml the assay values were significantly above the
background value obtained suggesting that further serial dilutions
below this value would be detectable via the assay method.
EXAMPLE 11
Detection of botulinum Neurotoxin
[0225] An anti-guinea pig IgG antibody AK conjugate was generated
as described in Example 9(A). The assay was then conducted as
described below, using the "toxic" light chain (LC) domain as a
model of the toxin activity.
[0226] A. BoNT/B Cleavage Assay with 1 mg/ml VAMP Substrate
Standard Curve for Demonstration
[0227] 1. A Nunc-MaxiSorp 96 well plate was coated with 100
.mu.l/well of 5 .mu.g/ml streptavidin in 50 mM Sodium Bicarbonate
pH 9.5, incubated for 1 hr at 37.degree. C., and then washed with 4
changes of PBS-Tween 0.1%.
[0228] 2. The wells were then blocked with 200 .mu.l/well of
SuperBlock and shaken for 1 hr at 37.degree. C. In addition, an
additional plate was blocked in the same way but with 300
.mu.l/well of SuperBlock for the cleavage reaction. The plates were
then washed with 4 changes of PBS-Tween 0.1%.
[0229] 3. Dilutions of toxin or isolated LC were then set up in
cleavage buffer [5 ml HEPES 50 mM pH 7.4 containing 2 mg/ml BSA; 50
.mu.l DTT (1 M); 5 .mu.l ZnCl2 (20 mM)] at twice the required
concentration by adding 1 .mu.l of LC/B (2.5 mg/ml) to 125 .mu.l of
cleavage buffer producing a 20,000 ng/ml solution. 10-fold serial
dilutions of toxin in cleavage buffer were then prepared.
[0230] 4. 108 .mu.l of 1 mg/ml VAMP (in 50 mM HEPES pH 7.4) was
then mixed with 108 .mu.l of the required toxin concentration on
the additional preblocked plate, and shaken for 2 hrs at 37.degree.
C. The cleaved VAMP samples were then transferred to the
streptavidin-coated plate, incubated for 5 mins at 37.degree. C.,
and the plate was then washed with PBS-Tween 0.1%.
[0231] 5. 100 .mu.l of 1 .mu.g/ml Guinea Pig (GP) anti FESS
antibody made up in 10% SuperBlock, PBS-Tween 0.1% was then applied
to each well. The plate was then shaken for 1 hr at 25.degree. C.
or 4.degree. C., and then washed with 4 changes of PBS-Tween
0.1%.
[0232] 6. 100 .mu.l of 1 .mu.g/ml Goat anti GP-AK conjugated
antibody made up in 10% SuperBlock, PBS-Tween 0.1% was then applied
to each well. The plate was then shaken for 1 hr at 25.degree. C.
and then washed with 4 changes of PBS-Tween 0.1%.
[0233] 7. 100 .mu.l of MESNA buffer (25 mM MESNA, 50 mM Tris-HCl pH
7.2) was then applied to each well, and the plate shaken for 30
mins at 45.degree. C. The content of the wells was then transferred
to a white thermocycler plate (Costar) and 5 .mu.l per well of
apyrase was added (Celsis Luminase). The plate was then shaken for
30 mins at 37.degree. C., followed by heating for 10 mins at
70.degree. C. to inactivate the apyrase.
[0234] 8. 100 .mu.l of 135 .mu.M ADP (add 33 .mu.l of 20.5 mM ADP
to 5 ml of 15 mM MgAc, 1 mM EDTA buffer) was then added to each
well, and the plate was incubated for 20 mins at 70.degree. C. in
the thermocycler.
[0235] 9. Lastly, 30 .mu.l of Luciferin/Luciferase (ATP) reagent
(Biothema) was added to each well and the results were read on a
luminometer immediately.
[0236] The results of this assay in comparison to a standard
HRP-based assay are shown in FIG. 8. The AK based assay shows a
significant increase in sensitivity of between 1000 and 10,000 fold
compared to the traditional HRP format. The detection limits of
around 1 fg are significantly lower than the level of toxin that
could be detected by mouse bioassay, currently the most sensitive
method available for the detection of BoNT. Similar results were
obtained with full length BoNT/B (not shown).
[0237] For use of the assay in detection of toxin in potentially
contaminated food stuffs or in other samples the assay is performed
essentially as described above. The suspected sample is homogenised
in a suitable buffer to ensure dispersal of any toxin in the
sample. A buffer such as the cleavage buffer outlined in the method
described above, optionally supplemented with inhibitors for serine
or cysteine proteases (the inhibitor is chosen so as not to
interfere with substrate cleavage by BoNT and will be selected from
a variety of options known to those familiar with the art) is used.
Following homogenisation, the sample is optionally cleared by
centrifugation and diluted if appropriate to the levels of toxin in
the sample.
[0238] Further information on the detection of botulinum neurotoxin
(BoNT) using the present assay can be found in the following
papers: Wictome M, Newton K A, Jameson K, Dunnigan P, Clarke S,
Gaze J, Tauk A, Foster K A, Shone C C. Novel assays for the
detection of botulinum toxins in foods. 1999. Dev Biol Stand. 10 p
141-5; Wictome M, Newton K, Jameson K, Hallis B, Dunnigan P, Mackay
E, Clarke S, Taylor R, Gaze J, Foster K, Shone C. 1999. Development
of an in vitro bioassay for Clostridium botulinum type B neurotoxin
in foods that is more sensitive than the mouse bioassay. Appl
Environ Microbiol. 65 p 3787-92; Hallis B, James B A, Shone C C
(1996) Development of novel assays for botulinum type A and B
neurotoxins based on their endopeptidase activities. J Clin
Microbiol. 34 p 1934-8.), the content of which is incorporated
herein by reference.
EXAMPLE 12
Method for the Detection of Ricin in Water or Other Environmental
Samples
[0239] An assay for the presence of ricin in a sample is carried
out using the method essentially as described in Example 9
above.
[0240] The sample is bound directly onto the solid support and
probed with a monoclonal or polyclonal antibody directed against
the ricin molecule and labelled with adenylate kinase. The
background reduction steps of the invention are sufficient to
eliminate any background activity associated with the sample and
allow detection of the low levels of ricin that are expected in
these samples.
[0241] Alternatively, the assay is performed as a more routine
sandwich assay with ricin captured by an antibody bound to the
solid support and detected with a second antibody-AK conjugate. If
greater signal is required, an anti-species antibody-AK conjugate
recognising the detection antibody is used.
EXAMPLE 13
Diagnosis of Rotavirus Infection by Analysis of Stool Samples
[0242] Using the protocol described below, the assay of the
invention was used to detect the presence of rotavirus in stool
samples.
[0243] 1. A Nunc-MaxiSorp 96 well plate was coated with 100
.mu.l/well of a 1:1000 dilution of rabbit anti rotavirus IgG in
carbonate coating buffer; incubated overnight at room temperature;
and washed with 4 changes of PBS-Tween 0.1%.
[0244] 2. The plate was then blocked with 5% Skim Milk Powder in
PBS-Tween 0.1%; shaken for 1 hr at 37.degree. C.; and washed with 4
changes of PBS-Tween 0.1%.
[0245] 3. 100 .mu.l/well of the stool samples, including positive
and negative controls, were added to the plate and incubated for 1
hr at room temperature.
[0246] 4. 50 .mu.l of 1:500 AK-conjugated or HRP conjugated, rabbit
anti rotavirus Ab, made up in 5% Skim Milk Powder in PBS-Tween 0.1%
was added to each well, shaken for 1 hr at room temperature and
then washed with 4 changes of PBS-Tween 0.1%.
[0247] 5. The HRP conjugated samples were developed and read on a
plate reader at 450 nm.
[0248] 6. 100 .mu.l of MESNA buffer (25 mM MESNA, 50 mM Tris-HCl pH
7.2) was applied to each well, and the plate shaken for 30 mins at
45.degree. C. 90 .mu.l/well was transferred to a white thermocycler
plate (Costar).
[0249] 7. 5 .mu.l apyrase (Sigma 100 units in 2 ml of Tris-HCl) was
added to each well, and the plate was then shaken for 30 mins at
30.degree. C. before being heated to 70.degree. C. for 10 mins.
[0250] 8. 90 .mu.l of 135 .mu.M ADP (add 33 .mu.l of 20.5 mM ADP to
5 ml of 15 mM MgAc, 1 mM EDTA buffer) was added to each well, and
the plate was then incubated for 20 mins at 70.degree. C. in the
thermocycler.
[0251] 9. 30 .mu.l of Luciferin/Luciferase (ATP) reagent (Biothema)
was added to each well and the results read on a luminometer
immediately.
[0252] The results from the assay are shown in FIG. 9 in comparison
to a standard HRP-based assay as carried out in the Dakocytomation
IDEIA Rotavirus assay. The AK-based assay shows at least a 100-fold
greater sensitivity than the existing assay and allows the
detection of low levels of rotaviral antigen in faecal samples to
support diagnosis of infection.
EXAMPLE 14
Diagnosis of Norwalk/Norovirus Infection by Analysis of Oral,
Faecal or Vomit Samples
[0253] Samples are collected and assayed using the method
essentially as described in Example 9. The assay can be run in a
variety of different formats depending on the precise strain(s) of
virus to be detected, the reagents available and the phase of the
disease.
[0254] The assay is carried out in the following ways:
[0255] A. Detection of Antigen in Faecal or Vomit Samples.
[0256] A hyperimmune serum from an immunised animal is coated onto
a solid support such as a polyvinyl plate (typically for 16-18
hours at 4.degree. C. in carbonate/bicarbonate buffer pH 9.6). The
remaining sites on the plate are blocked to prevent non-specific
binding using any one of a variety of agents known to those
familiar with the art (e.g. skimmed milk, casein, bovine serum
albumen, commercial blocking formulations). The faecal or vomit
sample is diluted 1:10 with PNS and applied to the plate for a
fixed period of time, typically 1 hour at 22.degree. C. The plate
is washed and a second hyperimmune serum, preferably from a
different species of immunised animal is applied to the plate.
Again the plate is washed to remove unbound signal. Preferably the
second hyperimmune serum is labelled with the AK enzyme by
conjugation as described above, but alternatively an anti-species
AK conjugate is used to detect the presence of the second anti-NLV
hyperimmune serum.
[0257] As an alternative, monoclonal antibodies directed against
either a broad range of NLV genogroups (to give an overall
diagnosis) or directed very specifically against a single virus
type (e.g. for outbreak tracing or surveillance) are used to
replace either or both of the hyper-immune serum in the described
assay format. Again if a monoclonal is used for the detection
antibody, then this is labelled with AK directly or an anti-mouse
(for mouse monoclonal antibodies) AK conjugate used for the assay
read out.
[0258] The use of this type of format for the detection of viruses
is occasionally complicated by the presence of molecules that
interfere with the interpretation of the assay giving rise to false
positive signals. To reduce the chances of this happening the assay
is optionally run using any one of the formats described above but
with duplicate samples run on plates coated with a capture antibody
(either polyclonal or monoclonal) derived from either a pre-immune
serum, naive animal serum or a species-matched non-relevant
monoclonal antibody. The assay read-out is then determined by
measuring a significant positive ratio (2:1 or better) between the
test sample and the duplicate control.
[0259] B. Detection of Immune Response to NLV Infection in an Oral
Sample
[0260] An NLV capsid antigen, recombinantly expressed form a
suitable expression system (such as a baculovirus system as
reviewed in Jiang et al 2000, Diagnosis of human calciviruses by
use of enzyme immunoassay, Journal of Infectious Disease
181:pS349-359) is used in this assay. The purified capsid, possibly
in the form of a non-infectious virus like particle (VLP) is coated
onto a solid support, such as a polyvinyl or polycarbonate plate,
for 16-22 hours at 4.degree. C. in carbonate/polycarbonate buffer
pH 9.6. Plates are blocked to remove additional binding sites and
incubated with an oral sample collected, for example, by one of the
methods described by McKie et al (2002) and incubated for 1-2 hours
at 22-37.degree.. The plate is washed and an anti-human IgM-AK
conjugate added. After incubation and subsequent washing the assay
is developed with bioluminescent substrates as described in Example
9.
[0261] In an alternative format, designed to reduce the potential
of anti-NLV IgG antibodies to interfere with the assay, the IgM is
captured from the oral sample by incubation with a solid support
coated with anti-human IgM antibodies. Detection of the bound
anti-NLV IgM from the serum is then effected by incubation with
recombinant capsid antigen conjugated directly to AK. As an
alternative, recombinant capsid is added, followed by an
anti-capsid monoclonal antibody-AK conjugate (or monoclonal
antibody and anti-species antibody AK conjugate) to allow detection
with bioluminescent substrates.
EXAMPLE 15
Detection of Norwalk-Like Virus/Norovirus in Environmental Samples
and Use of the Method to Validate Decontamination Procedures
[0262] A. Detection of Norwalk-Like Virus/Norovirus in
Environmental Samples
[0263] Samples are assessed using swab-type devices as currently
used for a wide variety of environmental sampling and hygiene
monitoring. Essentially these are cloth, sponge or foam type
devices moistened with a suitable buffer for the acquisition of
surface contamination. These are "swabbed" over the solid surface
for a defined period of time and transferred to a receptacle
containing additional buffer/reagent designed to release the
antigen from the swab and any associated tissue.
[0264] The swab is agitated in the buffer and this sample is then
assayed using the methods as outlined in Examples 9 and 14.
[0265] B. Method to Validate Decontamination Procedures
[0266] Recombinant NLV VLPs are used as a test antigen to ensure
that surfaces are cleaned properly. A preparation of VLPs is
sprayed onto a test surface to mimic the contamination of surfaces
by oral-faecal transmission during the course of the disease.
[0267] The surface is then cleaned according to the facility
protocol. The surface swab is then used to confirm whether the
decontamination procedure has been effective at removing the VLPs
from the surface, using the protocol as described in A. above.
[0268] Preferably, the VLPs are formulated in a material to mimic
actual contamination, e.g. a mixture of egg yolk, purified mucin,
dried blood and other components designed to mimic the
physicochemical properties of human fluids. This "soil" would
interfere with the vast majority of detection methodologies but
would be an entirely acceptable matrix for carrying out the method
of the invention.
EXAMPLE 16
Method for the Detection of MRSA or Other Antibiotic-Resistant
Bacterial Strains in Throat or Tissue Swab Samples
[0269] Tissue/throat swab samples are obtained from a patient, and
bacteria are then extracted from the swab samples.
[0270] The bacteria are bound directly to a suitable solid support,
and the assay is then performed essentially according to the method
described in Example 9. AK-conjugated antibodies specific for the
bacteria, or specific for particular strain types, are used in the
assay.
EXAMPLE 17
Method for the Detection of pneumococcal Antigens in Urine
[0271] An indirect sandwich ELISA for the detection of pneumococcal
C-polysaccharide in urine and other body fluids is described
below.
[0272] In brief, plates are coated with rabbit polyclonal antibody
to C-polysaccharide (CPS), urine (or alternative antigen source) is
added, CPS-specific monoclonal antibody is bound to retained
antigen and is detected by AK-conjugated rabbit anti-mouse
antibody.
[0273] Assay Protocol:
[0274] 1. A Nunc-MaxiSorp 96 well plate is coated with 60
.mu.l/well of polyclonal antibody diluted {fraction (1/2000)} in
carbonate-bicarbonate. The plate is placed in the 'fridge overnight
and discarded if not used within 7 days.
[0275] 2. The plate is washed with 4 changes of PBS-Tween, and then
blocked with 200 .mu.l 1% skimmed milk in PBS, and incubated at
room temperature for 1 hour. The plate is then washed again with 4
changes of PBS-Tween.
[0276] 3. Urine is spun at 15,000 rpm for 1 min and then diluted
50:50 with PBS+1% milk. 60 .mu.l is then added to each well of the
coated and blocked plates, before incubation for 1 hour at room
temperature and washing with 4 changes of PBS-Tween.
[0277] 4. Anti-CPS monoclonal antibody, diluted in PBS Tween plus
1% skimmed milk, is added to each well at 70 .mu.l/well and the
plate is then incubated at room temperature for 1 hour, followed by
washing with 4 changes of PBS-Tween.
[0278] 5. Anti-mouse antibody-AK conjugate, diluted {fraction
(1/10,000)} in PBS Tween plus 1% skimmed milk, is added to each
well at 80 .mu.l/well and the plate then incubated at room
temperature for 1 hour, followed by washing with 4 changes of
PBS-Tween.
[0279] 6. The remainder of the detection procedure is carried out
as described in Example 9B/C.
[0280] Suitable antibodies for use in this assay include, CPS
specific rabbit polyclonal antibody--(e.g. as supplied by Statens
Seruminstitut), CPS specific monoclonal antibodies--(e.g. as
supplied by Statens Seruminstitut) and Rabbit anti-mouse IgG (as
supplied by Sigma) conjugated to AK as described above.
EXAMPLE 18
Ultrasensitive Method for the Detection of Immune Response to
Vaccination
[0281] The assessment of immunisation against anthrax using an oral
sample is described below.
[0282] Oral samples are collected using any one of the devices
described in McKie et al 2002 (as cited previously above). The
vaccinee is then assessed (i) for the presence of circulating IgM
antibodies in an oral sample 7-14 days after the first vaccination,
and/or (ii) for the presence of class-switched IgGs in oral samples
approximately 7-10 days following the second immunisation. The
assay is performed essentially as described in Example 9.
[0283] The sample is transferred directly to a suitable solid
support. The support is then washed and the bound antibody probed
with either an AK labelled antigen or with an unlabelled antigen,
and a second AK labelled antibody. In the case of existing licensed
anthrax vaccines or the new generation of recombinant protective
antigen (rPA) based vaccines, the most appropriate antigen is
anthrax PA. This is labelled directly with AK to act as a probe for
the presence of PA-specific IgMs (or IgGs). An anti-PA monoclonal
antibody labelled with AK is used to provide additional
sensitivity.
[0284] In an alternative format, the solid support is coated with
anti-human IgM (or IgG) and subsequently blocked prior to the
application of the sample. The use of directly-labelled PA, or PA
plus anti-PA antibody, are essentially as described above.
Alternatively, the solid support is coated with PA, the sample
applied, and the bound antibody detected with an IgM specific
anti-human antibody.
[0285] In each case the presence of PA specific IgMs (or IgGs)
following the initial vaccination is an extremely useful indicator
that the vaccination method was capable of eliciting anti-PA
antibodies that have proved to be protective in many anthrax
challenge studies. By ascertaining the likelihood of successful
vaccination at this early stage, compared to current methods that
monitor immune response typically after the 3rd immunisation, it is
possible to curtail or adjust the immunisation schedule.
EXAMPLE 19
Diagnosis of West Nile Virus Infection by Monitoring Levels of IgM
in Oral Samples
[0286] An oral sample is collected from a patient using one of the
methods as outlined in McKie et al 2002. The assay is then
performed essentially as described in Example 9.
[0287] The sample is applied directly to the surface of a suitable
solid support or to a solid support coated with anti-human IgM
antibody. The presence of the captured anti-West Nile IgM is then
detected with either AK-labelled West Nile antigen or unlabelled
antigen together with a suitable antibody conjugate.
REFERENCES
[0288] Gould S J and Subramini S (1988) Firefly luciferase as a
tool in molecular and cell biology. Anal. Biochem. 175: 5-13.
[0289] Kricka L J (1993) Ultrasensitive immunoassay techniques.
Clin. Biochem. 26: 325-331.
[0290] Ki W-K and Takahisa O (1988) Purification and
characterisation of adenylate kinase from extreme thermophile
Thermus caldophilius GK24. Korean J. Appl. Microbiol. Bioeng. 16:
393-397.
[0291] Lacher K and Schfer G (1993) Archaebacterial adenylate
kinase from the thermoacidophile Sulfolobus acidocaldarius:
purification, characterization and partial sequence. Arch. Biochem.
Biophys. 302: 391-397.
[0292] Rusnak P, Haney P and Konisky J (1995) The adenylate kinases
from a mesophilic and three thermophilic methanogenic members of
the archaea. J. Bacteriol. 177: 2977-2981.
[0293] Bonisch H, Backmann J, Kath T, Naumann D and Schfer G (1996)
Adenylate linase from Sulfolobus acidocaldarius: expression in
Escherichia coli and characterization by Fourier transfrom infrared
spectroscopy. Arch. Biochem. Biophys. 333: 75-84.
Sequence CWU 1
1
1 1 20 DNA Artificial synthetic oligonucleotide 1 catacacctc
cagcacctaa 20
* * * * *