U.S. patent application number 11/103362 was filed with the patent office on 2005-09-22 for treatment for insulin dependent diabetes.
This patent application is currently assigned to Biogen, Inc., a Massachusetts corporation. Invention is credited to Burkly, Linda C..
Application Number | 20050208053 11/103362 |
Document ID | / |
Family ID | 21848497 |
Filed Date | 2005-09-22 |
United States Patent
Application |
20050208053 |
Kind Code |
A1 |
Burkly, Linda C. |
September 22, 2005 |
Treatment for insulin dependent diabetes
Abstract
A method for the prevention of insulin dependent (type I)
diabetes. The method comprises administration of an antibody,
polypeptide or other molecule recognizing VLA-4.
Inventors: |
Burkly, Linda C.; (West
Newton, MA) |
Correspondence
Address: |
FISH & RICHARDSON
225 FRANKLIN STREET
BOSTON
MA
02110
US
|
Assignee: |
Biogen, Inc., a Massachusetts
corporation
|
Family ID: |
21848497 |
Appl. No.: |
11/103362 |
Filed: |
April 11, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11103362 |
Apr 11, 2005 |
|
|
|
09234290 |
Jan 20, 1999 |
|
|
|
09234290 |
Jan 20, 1999 |
|
|
|
08447118 |
May 22, 1995 |
|
|
|
5888507 |
|
|
|
|
08447118 |
May 22, 1995 |
|
|
|
08029330 |
Feb 9, 1993 |
|
|
|
08447118 |
May 22, 1995 |
|
|
|
PCT/US94/01456 |
Feb 9, 1994 |
|
|
|
Current U.S.
Class: |
424/145.1 |
Current CPC
Class: |
C07K 14/70542 20130101;
A61P 3/08 20180101; C07K 2319/00 20130101; A61P 3/10 20180101; C07K
2319/02 20130101; C07K 16/2842 20130101; A61K 2039/505 20130101;
A61K 38/00 20130101 |
Class at
Publication: |
424/145.1 |
International
Class: |
A61K 039/395 |
Claims
1. A method for the prevention of insulin dependent (type I)
diabetes comprising administering to a prediabetic individual a
composition comprising an anti-VLA-4 antibody.
2. A method according to claim 1, wherein the anti-VLA-4 antibody
selected from the group consisting of HP1/2, HP2/1, HP2/4, L25, and
P4C2.
3. A method according to claim 1, wherein the anti-VLA-4 antibody
is HP1/2, or a fragment thereof, capable of binding to VLA-4.
4. A method according to claim 1, wherein the anti-VLA-4 antibody
is a humanized HP1/2 antibody, or a fragment thereof, capable of
binding to VLA-4.
5. A method according to claim 1, wherein the composition is
administered at a dosage so as to provide from about 0.1 to about
10 mg/kg, based on the weight of the prediabetic individual.
6. A method according to claim 1, wherein the composition is
administered in an amount effective to coat VLA-4-positive cells in
the peripheral blood for a period of 1-14 days.
7. A method according to claim 1, wherein the composition is
administered in an amount effective to provide a plasma level of
antibody in the prediabetic individual of at least 1 .mu.g/ml.
8. A method according to claim 1, wherein the composition is
administered prior to the development of overt diabetes, as
measured by a serum glucose level of less than about 250 mg/dL.
9. A method according to claim 1, wherein the prediabetic
individual is a human.
10. A method for the treatment of diabetes comprising administering
to a mammal with a susceptibility to diabetes, an antibody, a
recombinant antibody, a chimeric antibody, fragments of such
antibodies, a polypeptide or a small molecule capable of binding to
the .alpha..sub.4 subunit of VLA-4, or combinations of any of the
foregoing, in an amount effective to provide inhibition of onset of
diabetes.
11. A method according to claim 10, wherein the antibody,
polypeptide or molecule is selected from monoclonal antibody HP1/2;
Fab, Fab', F(ab').sub.2 or F(v) fragments of such antibody; soluble
VCAM-1 or fibronectin polypeptides; or small molecules that bind to
the VCAM-1 or fibronectin binding domain of VLA-4.
12. A method according to claim 11, wherein the soluble VCAM-1
polypeptides comprise a VCAM-IgG fusion.
13. A method according to claim 11, wherein the composition is
administered in an amount effective to provide a plasma level of
soluble VCAM-1 polypeptides in the mammal of at least 10-20
.mu.g/ml over a period of 1-14 days.
14. A method according to claim 11, wherein the soluble VCAM-1
polypeptides comprise VCAM 2D-IgG.
15. A method according to claim 10, wherein the composition
comprises a plurality of anti-VLA-4 monoclonal antibodies or
VLA-4-binding fragments thereof.
16. A method according to claim 10, wherein, the composition is
administered at a dosage so as to provide from about 0.1 to about
10 mg/kg of antibody, antibody fragment, polypeptide or small
molecule, based on the weight of the susceptible mammal.
17. A method according to claim 10, wherein the composition is
administered in an amount effective to coat VLA-4-positive cells in
the peripheral blood for a period of 1-14 days.
18. A method according to claim 10, wherein the composition is
administered in an amount effective to provide a plasma level of
antibody or antibody fragement in the mammal of at least 1 .mu.g/ml
over a period of 1-14 days.
19. A method according to claim 10, wherein the composition is
administered in an amount effective to provide a dosage of small
molecule of about 0.1-10 mg/kg body wieght/day over a period of
1-14 days.
20. A pharmaceutical composition effective to provide inhibition of
onset of diabetes consisting essentially of a monoclonal antibody
recognizing VLA-4 in a pharmaceutically acceptable carrier.
21. A chimeric molecule comprising: a VLA-4 targeting moiety
capable of binding to VLA-4 antigen on the surface of VLA-4 bearing
cells and a toxin moiety.
22. The molecule of claim 21, wherein the VLA-4 targeting moiety
comprises a portion of VCAM.
23. A method of treating a subject at risk for a disorder
characterized by the presence of activated VLA-4 comprising
administering to the subject the chimeric molecule of claims
21.
24. The method of claim 23, wherein said disorder is diabetes.
Description
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 08/447,118, filed May 22, 1995, which is a
continuation-in-part of U.S. patent application Ser. No.
08/029,330, filed Feb. 9, 1993, and of Burkly PCT US94/01456, filed
Feb. 9, 1994, all of which are incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to a treatment for insulin
dependent (type-I) diabetes. More particularly, this invention
relates to the use of antibodies recognizing the integrin VLA-4
(very late antigen 4) in the prevention of diabetes.
BACKGROUND OF THE INVENTION
[0003] Insulin dependent diabetes (also termed type-I diabetes and
formerly juvenile onset diabetes mellitus) has been classified
during the past two decades as a chronic autoimmune disease. In
this disorder, cells producing insulin (.beta. cells) within the
pancreatic islets are selectively targeted and destroyed by a
cellular infiltrate of the pancreas. This inflammatory infiltrate
affecting the islets has been termed insulitis. Cells producing
insulin comprise the majority of islet cells but less than 2% of
the total pancreatic mass (Castano and Eisenbarth, 1990, [1];
Fujita et al., 1982 [2]; Foulis et al., 1986 [3]). The development
of type I diabetes can conceptually be divided into six stages,
beginning with genetic susceptibility and ending with complete
.beta. cell destruction (Eisenbarth, 1986 [4]). Stage I is genetic
susceptibility, which is a necessary but insufficient condition for
development of the disease. A hypothetical triggering event (Stage
II) leads to active autoimmunity against .beta. cells (Stage III).
In Stage II, the .beta. cell mass is hypothesized to decline and
immunologic abnormalities such as autoantibodies directed against
insulin and islet cytoplasmic antigens are found. Stimulated
insulin secretion is still preserved at this stage. Over a period
of years, however, the progressive loss of P cells leads to
diminished insulin secretion with intravenous glucose tolerance
tests (IVGTT) while the individual is still normoglycemic (Stage
1V). Overt diabetes (i.e., diabetes onset or clinical manifestation
of disease characterized by hyperglycemia) is Stage V, and can
develop years later when approximately 90% of pancreatic .beta.
cells are destroyed. In Stage V when overt diabetes is first
recognized, some residual insulin production remains (as
demonstrated by the presence of exogenous insulin for life.
Finally, in Stage VI, even the remaining .beta. cells are destroyed
and C peptide can no longer be detected in the circulation.
[0004] While the initiating factor(s) and specific sequence of
events leading to diabetes, including the relative importance of
different cell types and cytokines, are still widely debated, a key
role is generally recognized for self-antigen reactive T cells
(Miller et al., 1988 [5]; Harada and Makino, 1986 [6]; Koike et
al., 1987 [7]; Makino et al., 1986 [8]). In addition to T
lymphocytes, insulitis is characterized by macrophages, dendritic
cells (Voorbij et al., 1989 [9]) and .beta. cells, which may serve
as professional antigen presenting cells (APC). Macrophages may
also destroy islet P cells themselves by release of cytokines or
free radicals (Nomikos et al., 1986 [10]). Thus, autoimmune
diabetes relies upon both cellular migration and immune stimulation
of newly resident cells.
[0005] Cell trafficking to inflammatory sites is regulated by
accessory molecules LFA-1, MAC-1 and VLA-4 (Larson and Springer,
1990 [11]; Hemler et al., 1990 [12]) on the surface of lymphocytes
(LFA-1, VLA-4) and macrophages (Mac-1, VLA-4), and by their
counter-ligands ICAM (for LFA-1 and MAC-1), and VCAM (for VLA-4)
which are unregulated by cytokines on vascular endothelium (Larson
and Springer, 1990 [11]; Lobb, 1992 [13]; Osborn, 1990,[14]). In
addition, VLA-4 binds to an extracellular matrix component, the
CS-1 domain of fibronectin (FN) (Wayner et al., 1989 [15]). The
relative importance of these pathways, for example, LFA-1 and VLA-4
on lymphocytes or MAC-1 and VLA-4 on monocytes, in controlling cell
migration is still a subject of investigation. In vitro data
suggest that the differential use of these pathways appears to
depend upon the activation status of both the leukocytes and
endothelial cells (Shimizu et al., 1991 [16]). Their ability to
control cell migration to inflammatory sites in vivo has been
directly demonstrated with monoclonal antibodies (mAbs) to ICAM,
MAC-1 or VLA-4 inhibiting various animal models of disease (Barton
et al., 1989 [17], phorbol ester-induced rabbit lung inflammation;
Issekutz and Issekutz, 1991 [18], delayed type hypersensitivity;
Issekutz, 1991 [19], adjuvant-induced arthritis; Yednock et al.,
1992 [20], transfer of experimental allergic encephalomyelitis
(EAE); Lobb, 1992 [21], asthma).
[0006] ICAM and VCAM are also found on the surface of macrophages
and dendritic cells in lymphoid tissues (Dustin et al., 1986 [22];
Rice et al., 1990 [23]; Rice et al., 1991 [24]). Their distribution
on these professional APC is consistent with functional data
indicating a role for LFA-1 and VLA-4 in T cell activation (Shimuzu
et al., 1990 [25], Burkly et al., 1991 [26]). However, numerous
other receptor-ligand pairs including CD4/MHC class 11 and CD8/MHC
class I (Rudd et al., 1989 [27]), CD2/LFA-3 (Moingeon et al., 1989
[287]), CD28/B7 (Harding et al., 1992 [29]) may also support
adhesion or costimulate T cells during T/APC or T/target cell
interactions. The specific contributions of these numerous pathways
in the development of diabetes is unresolved. Because there are
multiple molecular pathways for cell adhesion and T
cell-activation, it is not possible to predict whether intervention
in one or more of these pathways might affect onset or severity of
diabetes disease, and, in particular, which of these pathways are
crucial or relevant to the disease process.
[0007] Antibodies directed to T cells have been utilized in murine
and rat models for spontaneous diabetes and adoptive transfer of
diabetes to deplete T cells and thus prevent disease (see, e.g.,
Harada and Makino, 1986 [6], anti-Thy 1.2; Koike et al., 1987 [7],
Miller et al., 1988 [5] and Shizuru et al., 1988 [30], anti-CD4;
Barlow and Like, 1992 [31], anti-CD2; Like et al., 1986 [32],
anti-CD5 and anti-CD8). In addition, an antibody directed to the
complement receptor type 3 (CR3) molecule or MAC-1 on macrophages
has been utilized to prevent macrophage and T cell infiltration of
pancreatic tissue in a murine adoptive transfer model of disease
(Hutchings et al., 1990 [33]). It is unknown whether VLA-4 is
relevant to insulitis or to the activity of islet-specific cells
after localization in the pancreas.
[0008] Current treatment protocols suggested for type I diabetes
have included certain immunomodulatory drugs summarized by Federlin
and Becker [34] and references cited therein. A long prediabetic
period with immunologic abnormalities and progressive .beta. cell
destruction suggests it may be possible to halt .beta. cell loss
with immune intervention (Castano and Eisenbarth, 1990 [1]).
[0009] Suggested agents/protocols have included certain
immunomodulatory and immunosuppressive agents: levamisol,
theophyllin, thymic hormones, ciamexone, anti-thymocyte globulin,
interferon, nicotinamide, gamma globulin infusion, plasmapheresis
or white cell transfusion. Agents such as cyclosporin A and
azathioprine which impair T cell activation and T cell development,
respectively, have been used in clinical trials (Zielasek et al.,
1989 [35]). The most promising results have been achieved with
cyclosporin A (Castano and Eisenbarth, 1990 [1]). Federlin and
Becker, 1990 [34] suggest, however, that cyclosporin A may not be
recommended for general or long-term use because of toxic side
effects, at least when given in higher doses. Higher doses of
cyclosporin, or in combination with other immunosuppressive drugs,
or both, have been associated with the development of lymphoma and
irreversible kidney damage (Eisenbarth, 1986 [4]; Eisenbarth, 1987
[36]). Additional studies on other suggested agents are necessary
to assess safety and efficacy. Even the cyclosporin A studies show
that its efficacy in maintaining remission of diabetes is for one
year in about 30-60% of new onset diabetes. Within 3 years,
however, remissions are almost invariably lost (Castano and
Eisenbarth, 1990 [1]). Treatment protocols after onset of disease
are particularly problematic, since, for example, at the time
diabetes is diagnosed in humans, insulitis has typically progressed
already to a loss of more than 80% of the .beta. cells. Thus, it is
possible that cyclosporin A may be preventing further .beta. cell
destruction, but so few .beta. cells may be present at the onset of
the diabetes that they cannot maintain a non-diabetic state over
time (Castano and Eisenbarth, 1990 [1]). Suppression of insulitis
and/or prevention of disease may be more successful if the
treatment could start at an earlier phase, i.e., before disease
onset.
[0010] There are two major prerequisites in order to develop any
preventative treatment for diabetes disease: (1) the ability to
accurately identify the prediabetic individual and (2) the
development of safe, specific and effective preventive treatments.
Significant progress has been made in identifying prediabetic
individuals, however, much work remains in the development of safe,
specific and effective preventive treatments as discussed and
reviewed by Eisenbarth and colleagues (see, e.g., Ziegler and
Eisenbarth, 1990 [37]; Ziegler et al., 1990 [38]; Ziegler et al.,
1990 [39]). It has been possible to identify certain risk factors
and at risk groups for type I diabetes and thus to predict
individuals most likely to go on to clinical disease and to
estimate the approximate rate of disease onset in these
individuals. The ability to identify individuals with
susceptibility to diabetes or to predict type I diabetes in the
pre-clinical stage by the combination of genetic (HLA typing),
immunological (islet and insulin autoantibodies) and metabolic
(first phase insulin secretion to intravenous glucose preceding the
development of hyperglycemia) markers makes the identification and
use of prophylactic immunotherapeutic drugs and protocols possible
during the evolution of the autoimmune disease process when .beta.
cell destruction is only partial. To date, there has been little
success, however, in treating human diabetes. Generally, because
human-treatment has been used only after onset of the disease,
treatment was followed by a temporary complete or partial remission
only in a certain number of patients. Since immunosuppressive
mechanisms may prevent insulitis and/or diabetes, there is a need
for immunosuppressive components for use in the prediabetic stage.
In particular, there is a need for safer and more specifically
acting compounds, e.g., monoclonal antibodies, which inhibit entry
of effector cells into the pancreas or function of those cell which
may have already entered the islets of Langerhans.
[0011] It has now been surprisingly discovered that administering
an anti-VLA-4 antibody significantly reduced the incidence of
diabetes, in a rodent model of diabetes disease. The NOD mouse
model of diabetes is a well established model directly comparable
to human type-I diabetes. Using an adoptively transferred disease
experimental protocol, irradiated non-diabetic NOD mice were
administered splenocytes from spontaneously diabetic NOD mice for
the acute transfer of the disease. These splenocytes were treated
with anti-VLA-4 antibody before administration and the recipients
were also treated for various periods of time after the transfer
with anti-VLA-4 antibody.
SUMMARY OF THE INVENTION
[0012] Accordingly, the present invention provides novel methods
for the treatment of insulin dependent (type-I) diabetes in a
prediabetic. In particular, the present invention provides a method
for the prevention of insulin dependent diabetes comprising the
step of administering to a prediabetic individual a VLA-4 blocking
agent, e.g., a soluble VCAM-IgG fusion protein or an anti-VLA-4
antibody, such as antibody HP 1/2 or a humanized anti-VLA-4
antibody derived from HP1/2. Also contemplated is the use of
analogous antibodies, antibody fragments, soluble proteins and
small molecules, e.g., those that mimic the action of anti-VLA-4
antibodies in the treatment of diabetes. In addition, the present
invention provides a method for the treatment of diabetes by
administering to a mammal, including a human with a susceptibility
to diabetes, a VLA-4 blocking agent, e.g., a soluble VCAM-IgG
fusion protein, or an antibody capable of binding to the .alpha.4
subunit of VLA-4 in an amount effective to provide inhibition of
the onset of diabetes. Also contemplated is the use of recombinant
and chimeric antibodies, fragments of such antibodies, polypeptides
or small molecules capable of binding .alpha.4/VLA-4 or a VLA-4
ligand. Also contemplated are soluble forms of the natural binding
proteins for VLA-4, including soluble VCAM-1, VCAM-1 peptides or
VCAM-1 fusion proteins as well as fibronectin, fibronectin having
an alternatively spliced non-type III connecting segment and
fibronectin peptides containing the amino acid sequence EILDV or a
similar conservatively substituted amino acid sequence. These
agents block VLA-4, e.g., by competing with the cell-surface
binding protein for VLA-4 or by otherwise altering, inhibiting or
blocking VLA-4 function.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 is a graph depicting the effect of anti-VLA-4
antibody (R1-2) and controls on prevention of diabetes after
adoptive transfer of spleen cells; the frequency of recipients
which became diabetic and day of disease onset are shown for
transfer of 2.times.10.sup.7 splenocytes from diabetic (D) NOD
donors without treatment (closed circles), with a non-specific rat
IgG2b treatment (closed triangles), and with R1-2 anti-VLA-4
treatment (closed diamonds), as well as for transfer of splenocytes
from nondiabetic (Y) NOD donors (open squares); the splenocytes
were transferred with R1-2 or rat IgG2b or without mAb, and then
R1-2 or rat IgG2b was injected every other day through day 12 post
transfer (n=8-10 for all groups).
[0014] FIG. 2 is a graph depicting the effect of anti-VLA-4
antibody (R1-2) and controls on prevention of diabetes after
adoptive transfer of spleen cells; the frequency of recipients
which became diabetic and day of disease onset are shown for
transfer of 3.times.10.sup.7 splenocytes from diabetic (D) NOD
donors without treatment (closed circles), with a non-specific rat
IgG2b treatment (closed triangles), and with R1-2 anti-VLA-4
treatment (closed diamonds), as well as for transfer of splenocytes
from nondiabetic (Y) NOD donors (open squares); the splenocytes
were transferred with R1-2 or rat IgG2b or without mAb, and then
R1-2 or rat IgG2b was injected every 3.5 days through day 25 post
transfer (n=4-5 for all groups).
[0015] FIG. 3 is a graph depicting the effect of anti-VLA-4
antibody (R1-2) and controls on prevention of diabetes after
adoptive transfer of spleen cells; the frequency of recipients
which became diabetic and day of disease onset are shown for
transfer of 2-3.times.10.sup.7 splenocytes from diabetic (D) NOD
donors without treatment (closed circles), with a non-specific rat
IgG2b treatment (closed triangles), and with R1-2 anti-VLA-4
treatment (closed diamonds), as well as for transfer of splenocytes
from nondiabetic (Y) NOD donors (open squares) or for PBS alone
(open circles); the splenocytes were transferred with R1-2 or rat
IgG2b or without mAb, and then R1-2 or rat IgG2b was injected every
3.5 days through day 25 post transfer (n--5 for all groups).
[0016] FIG. 4 is a bar graph depicting the effect of anti-VLA-4
antibody (R1-2) and controls on the degree of insulitis after
adoptive transfer of spleen cells; the frequency of uninfiltrated
islets (Grade 0-I infiltrate, stipled bar) and infiltrated islets
(Grade II-IV insulitis, solid bar) were quantitated and shown after
transfer of cells treated with R1-2, rat IgG2b or without mAb, and
then R1-2 or rat IgG2b injected every 3.5 days through day 25 with
mice sacrificed when diabetic or on day 26 post-transfer.
Pancreatic sections from n=4-5 mice were scored for each
experimental group, i.e., Y.fwdarw.Y (non-diabetic donor cells) or
D.fwdarw.Y (diabetic donor cells) into non-diabetic (Y) recipients
with no mAb treatment, treatment with rat IgG2b or treatment with
R1-2.
[0017] FIG. 5 is a bar graph depicting the effect of anti-VLA-4
antibody (R1-2) and controls on the degree of insulitis after
adoptive transfer of spleen cells; the frequency of uninfiltrated
islets (Grade 0-I infiltrate, stipled bar) and infiltrated islets
(Grade II-IV insulitis, solid bar) were quantitated and shown after
transfer of cells treated with R1-2, rat IgG2b or without mAb, and
then R1-2 or rat IgG2b injected every other day through day 12
post-transfer, then maintained without further mAb injection until
sacrificed when diabetic or on day 29 post-transfer. Pancreatic
sections from n=4-5 mice were scored for each experimental group,
i.e., Y.fwdarw.Y (non-diabetic donor cells) or D.fwdarw.Y (diabetic
donor cells) into non-diabetic (Y) recipients with no mAb
treatment, treatment with rat IgG2b or treatment with R1-2.
[0018] FIG. 6 is a graph depicting the effect of anti-VLA-4
antibody (R1-2) and controls on prevention of diabetes in a
spontaneous disease model for diabetes; the frequency of recipients
which became diabetic and day of disease onset are shown for NOD
mice without treatment (closed squares), with a non-specific rat
IgG2b treatment (closed circles), and with R1-2 anti-VLA-4
treatment (closed triangles); R1-2 or rat IgG2b was injected for 8
weeks in NOD mice twice weekly from week four to week twelve of
age.
[0019] FIG. 7 is a graph depicting the effect of VCAM 2D-IgG fusion
protein and controls on prevention of diabetes after adoptive
transfer of spleen cells; the frequency of recipients which became
diabetic and day of disease onset are shown for transfer of
2.times.10.sup.7 splenocytes from diabetic (D) NOD donors with an
irrelevant rat LFA-3Ig fusion protein treatment (closed squares),
and with VCAM 2D-IgG treatment (open circles) or of recipients
which received PBS alone without cells transferred (closed
triangles); the splenocytes were transferred with VCAM 2D-IgG or
rat LFA-3Ig, and then VCAM 2D-IgG or rat LFA-3Ig was injected every
other day through day 17 post-transfer (n=5 for all groups).
[0020] FIG. 8 is a schematic depicting structure of VCAM 2DIgG
fusion protein described in Example 5. VCAM 2D-IgG is a soluble
form of the ligand for VLA-4 (VCAM1) and consists of the two
N-terminal domains of VCAM1 fused to the human IgG1 heavy chain
constant region sequences (Hinges, CH2 and CH3).
DETAILED DESCRIPTION OF THE INVENTION
[0021] The invention relates to a treatment including the
prevention of insulin dependent (type I) diabetes. More
particularly, methods of the invention relate to the use of VLA-4
blocking agents, e.g., soluble VCAM-IgG fusion peptides or
antibodies to VLA-4 in the treatment of diabetes in a prediabetic
individual. The term "prediabetic" is intended to mean an
individual at risk for the development of diabetes disease (e.g.,
genetically predisposed) at any stage in the disease process prior
to overt diabetes or diabetes onset. The term "diabetic" is
intended to mean an individual with overt hyperglycemia (i.e.,
fasting blood glucose levels.gtoreq.250 mg/dL). The term "overt
diabetes" or "diabetes onset" is intended to mean a disease state
in which the pancreatic islet cells are destroyed and which is
manifested clinically by overt hyperglycemia (i.e., fasting blood
glucose levels.gtoreq.250 mg/dL).
[0022] Also, from the discussion herein it will be apparent that
other VLA-4 blocking agents can be used in the methods described
herein. For the purposes of the invention a VLA-4 blocking agent
refers to an agent, e.g., a polypeptide or other molecule, which
can inhibit or block VLA-4-mediated binding or which can otherwise
modulate VLA-4 function, e.g., by inhibiting or blocking
VLA-4-ligand mediated VLA-4 signal transduction and which is
effective in the treatment of diabetes, preferably in the same
manner as are anti-VLA-4 antibodies.
[0023] A VLA-4 blocking agent is a molecule which has one or more
of the following properties: (1) it coats, or binds to, a VLA-4
antigen on the surface of a VLA-4 bearing cell with sufficient
specificity to inhibit a VLA-4-ligand/VLA-4 interaction, e.g., the
VLA-4/VCAM-1 interaction; (2) it coats, or binds to, a VLA-4
antigen on the surface of a VLA-4 bearing cell with sufficient
specificity to modify, and preferably to inhibit, transduction of a
VLA-4-mediated signal, e.g., VLA-4/VCAM-1-mediated signaling; (3)
it coats, or binds to, a VLA-4-ligand, e.g., VCAM-1 or fibronectin,
with sufficient specificity to inhibit the VLA-4/VLA-4-ligand
interaction; (4) it coats, or binds to, a VLA-4-ligand, e.g.,
VCAM-1 or fibronectin, with sufficient specificity to modify, and
preferably to inhibit, transduction of VLA-4-ligand mediated VLA-4
signaling, e.g., VCAM-1-mediated VLA-4 signaling. In preferred
embodiments the VLA-4 blocking agent has one or both of properties
1 and 2. In other preferred embodiments the VLA-4 blocking agent
has one or both of properties 3 and 4.
[0024] For purposes of the invention, any agent capable of binding
to VLA-4 antigens on the surface of VLA-4 bearing cells and which
effectively blocks or coats VLA-4 antigens, is considered to be an
equivalent of the monoclonal antibody used in the examples
herein.
[0025] As discussed herein, the blocking agents used in methods of
the invention are not limited to antibodies or antibody
derivatives, but may be other molecules, e.g., soluble forms of
other proteins which bind VLA-4, e.g., the natural binding proteins
for VLA-4. These binding agents include soluble VCAM-1 or VCAM-1
peptides, VCAM-1 fusion proteins, bifunctional VCAM-1/Ig fusion
proteins, fibronectin, fibronectin having an alternatively spliced
non-type III connecting segment, and fibronectin peptides
containing the amino acid sequence EILDV or a similar
conservatively substituted amino acid sequence. These binding
agents can act by competing with the cell-surface binding protein
for VLA-4 or by otherwise altering VLA-4 function. For example, a
soluble form of VCAM-1 (see, e.g., Osborn et al. 1989 [58]) or a
fragment thereof may be administered to bind to VLA-4, and
preferably compete for a VLA-4 binding site, thereby leading to
effects similar to the administration of anti-VLA-4 antibodies.
Soluble VCAM-1 fusion proteins can be used in the methods described
herein. For example, VCAM-1, or a fragment thereof which is capable
of binding to VLA-4 antigen on the surface of VLA-4 bearing cells,
e.g., a fragment containing the two N-terminal domains of VCAM-1,
can be fused to a second peptide, e.g., a peptide which increases
the solubility or the in vivo life time of the VCAM-1 moiety. The
second peptide can be a fragment of a soluble peptide, preferably a
human peptide, more preferably a plasma protein, or a member of the
immunoglobulin super family. In particularly preferred embodiments
the second peptide is IgG or a portion or fragment thereof, e.g.,
the human IgG1 heavy chain constant region. A particularly
preferred fusion protein is the VCAM 2D-IgG fusion.
[0026] VLA-4 blocking agents include but are not limited to
peptides, peptide mimetics, carbohydrates and small molecules
capable of blocking VLA-4, e.g., by binding VLA-4 antigens on the
surface of VLA-4-bearing cells. Small molecules such as
oligosaccharides that mimic the binding domain of a VLA-4 ligand
and fit the receptor domain of VLA-4 may also be employed. (See, J.
J. Devlin et al., 1990 [59], J. K. Scott and G. P. Smith, 1990
[60), and U.S. Pat. No. 4,833,092 (Geysen) [61], all incorporated
herein by reference.) Examples of small molecules useful in the
invention can be found in Adams et al. U.S. Ser. No. 08/376,372,
filed Jan. 23, 1995, hereby incorporated by reference.
[0027] In preferred embodiments more than one VLA-4 blocking agent
is administered to a patient, e.g., a VLA-4 blocking agent which
binds to VLA-4 can be combined with a VLA-4 blocking agent which
binds to VCAM-1.
[0028] Peptide, as used herein, includes proteins, polypeptides,
and shorter peptides.
[0029] In the first aspect, the invention provides a method of
treatment of diabetes comprising the step of administering a
composition capable of blocking VLA-4 e.g., agents capable of
binding to, including blocking or coating, the VLA-4 antigens on
the surface of VLA-4-positive cells, including lymphocytes and
macrophages. For purposes of the invention, the term "binding to
VLA-4 antigens" is intended to mean reacting with VLA-4 antigens on
cells and thereby interfering with interactions between VLA-4
antigens and either VCAM-1 or fibronectin on the surface of other
cells or thereby inducing a change in the function of the
VLA-4-positive cells, e.g., by altering, e.g., inhibiting VLA-4
mediated signal transduction. As demonstrated herein, such binding,
including blocking or coating, of VLA-4 antigens results in a
prevention in or protection against the incidence of diabetes. This
demonstration utilized soluble VCAM-IgG fusion protein and a
monoclonal antibody against VLA-4 as a binding agent. Both
effectively blocked or coated the VLA-4 antigens. Those skilled in
the art will recognize that, given this demonstration, any agent
that can bind to, including those that can block or coat, VLA-4
antigens can be successfully used in the methods of the invention.
Thus, for purposes of the invention, any agent capable of binding
to VLA-4 antigens on the surface of VLA-4-bearing cells and which
may effectively block or coat VLA-4 antigens, is considered to be
an equivalent of the monoclonal antibody used in the examples
herein. For example, the invention contemplates as binding
equivalents at least peptides, peptide mimetics, carbohydrates and
small molecules capable of binding VLA-4 antigens on the surface of
VLA-4-bearing cells.
[0030] In another aspect the invention features a chimeric molecule
which includes: (1) a VLA-4 targeting moiety, e.g., a VCAM-1 moiety
capable of binding to VLA-4 antigen on the surface of VLA-4 bearing
cells; (2) optionally, a second peptide, e.g., one which increases
solubility or in vivo life time of the VLA-4 targeting moiety,
e.g., a member of the immunoglobulin super family or fragment or
portion thereof, e.g., a portion or a fragment of IgG, e.g., the
human IgG1 heavy chain constant region, e.g., C.sub.H2 and C.sub.H3
hinge regions; and (3) a toxin moiety. The VLA-4 targeting moiety
can be any naturally occurring VLA-4 ligand or fragment thereof,
e.g., a VCAM-1 peptide, fibronectin, fibronectin having an
alternatively spliced non-type III connecting segment, and
fibronectin peptides containing the amino acid sequence EILDV or a
similar conservatively substituted amino acid sequence. A preferred
targeting moiety is a soluble VCAM-1 fragment, e.g., the N-terminal
domains 1 and 2 of the VCAM-1 molecule. The toxin moiety can be any
agent which kills or inactivates a cell when the toxin is targeted
to the cell by the VLA-4 targeting moiety. Toxin moieties include:
cytotoxic peptide moieties, e.g., Diphtheria toxin A, Pseudomonas
Exotoxin, Ricin A, Abrin A, Schigella toxin, or Gelonin;
radionucleotides; and chemotherapeutic agents.
[0031] The chimeric molecule can be used to treat a subject, e.g.,
a human, at risk for a disorder, e.g., insulin dependent (type I)
diabetes, characterized by the presence of cells bearing VLA-4, and
preferably activated VLA-4.
[0032] In a preferred embodiment, the agent that is used in the
method of the invention to bind to, including block or coat,
cell-surface VLA-4 antigens is a monoclonal antibody or antibody
derivative. Preferred antibody derivatives for treatment, in
particular for human treatment, include humanized recombinant
antibodies, chimeric recombinant antibodies, Fab, Fab', F(ab')2 and
F(v) antibody fragments, and monomers or dimers of antibody heavy
or light chains or intermixtures thereof. Thus, monoclonal
antibodies against VLA-4 are a preferred binding agent in the
method according to the invention.
[0033] The technology for producing monoclonal antibodies is well
known. Briefly, an immortal cell line (typically myeloma cells) is
fused to lymphocytes (typically splenocytes) from a mammal
immunized with whole cells expressing a given antigen, e.g., VLA-4,
and the culture supernatants of the resulting hybridoma cells are
screened for antibodies against the antigen. (See, generally,
Kohler et al., 1975 [40]).
[0034] Immunization may be accomplished using standard procedures.
The unit dose and immunization regimen depend on the species of
mammal immunized, its immune status, the body weight of the mammal,
etc. Typically, the immunized mammals are bled and the serum from
each blood sample is assayed for particular antibodies using
appropriate screening assays. For example, anti-VLA-4 antibodies
may be identified by immunoprecipitation of .sup.125]-labeled cell
lysates from VLA-4-expressing cells. (See, Sanchez-Madrid et al.
1986 [41] and Hemler et al. 1987 [42]). Anti-VLA-4 antibodies may
also be identified by flow cytometry, e.g., by measuring
fluorescent staining of Ramos cells incubated with an antibody
believed to recognize VLA-4 (see, Elices et al., (1990) [43]). The
lymphocytes used in the production of hybridoma cells typically are
isolated from immunized mammals whose sera have already tested
positive for the presence of anti-VLA-4 antibodies using such
screening assays.
[0035] Typically, the immortal cell line (e.g., a myeloma cell
line) is derived from the same mammalian species as the
lymphocytes. Preferred immortal cell lines are mouse myeloma cell
lines that are sensitive to culture medium containing hypoxanthine,
aminopterin and thymidine ("HAT medium").
[0036] Typically, HAT-sensitive mouse myeloma cells are fused to
mouse splenocytes using 1500 molecular weight polyethylene glycol
("PEG 1500"). Hybridoma cells resulting from the fusion are then
selected using HAT medium, which kills unfused and unproductively
fused myeloma cells (unfused splenocytes die after several days
because they are not transformed). Hybridomas producing a desired
antibody are detected by screening the hybridoma culture
supernatants. For example, hybridomas prepared to produce
anti-VLA-4 antibodies may be screened by testing the hybridoma
culture supernatant for secreted antibodies having the ability to
bind to a recombinant .alpha.4-subunit-expressing cell line, such
as transfected K-562 cells (see, Elices et al. [43]).
[0037] To produce anti-VLA-4 antibodies, hybridoma cells that
tested positive in such screening assays were cultured in a
nutrient medium under conditions and for a time sufficient to allow
the hybridoma cells to secrete the monoclonal antibodies into the
culture medium. Tissue culture techniques and culture media
suitable for hybridoma cells are well known. The conditioned
hybridoma culture supernatant may be collected and the anti-VLA-4
antibodies optionally further purified by well-known methods.
[0038] Alternatively, the desired antibody may be produced by
injecting the hybridoma cells into the peritoneal cavity of an
unimmunized mouse. The hybridoma cells proliferate in the
peritoneal cavity, secreting the antibody which accumulates as
ascites fluid. The antibody may be harvested by withdrawing the
ascites fluid from the peritoneal cavity with a syringe.
[0039] Several mouse anti-VLA-4 monoclonal antibodies have been
previously described (see, e.g., Sanchez-Madrid et al., 1986 [41];
Hemler et al., 1987 [42]; Pulido et al., 1991 [44]). These
anti-VLA-4 monoclonal antibodies such as HP1/2 and other anti-VLA-4
antibodies (e.g., mAb HP2/1, HP2/4, L25, P4C2, P4G9) capable of
recognizing the .beta. chain of VLA-4 will be useful in the methods
of treatment according to the present invention. Anti-VLA-4
antibodies that will recognize the VLA-.alpha.4 chain epitopes
involved in binding to VCAM-1 and fibronectin ligands (i.e.,
antibodies which can bind to VLA-4 at a site involved in ligand
recognition and block VCAM-1 and fibronectin binding) are
preferred. Such antibodies have been defined as B epitope-specific
antibodies (B1 or B2) (see, Pulido et al. (1991) [36]) and are
preferred anti-VLA-4 antibodies according to the present invention.
The R1-2 antibody used as described herein is the B epitope type
antibody.
[0040] Human monoclonal antibodies against VLA-4 are another
preferred binding agent which may block or coat VLA-4 antigens in
the method of the invention. These may be prepared using in
vitro-primed human splenocytes, as described by Boemer et al., 1991
[45]. Alternatively, they may be prepared by repertoire cloning as
described by Persson et al., 1991 [46] or by Huang and Stollar,
1991 [47]. Another preferred binding agent which may block or coat
VLA-4 antigens in the method of the invention is a chimeric
recombinant antibody having anti-VLA-4 specificity and a human
antibody constant region. Yet another preferred binding agent which
may block or coat VLA-4 antigens in the method of the invention is
a humanized recombinant antibody having anti-VLA-4 specificity.
Humanized antibodies may be prepared, as exemplified in Jones et
al., 1986 [48]; Riechmann, 1988, [49]; Queen et al., 1989 [50]; and
Orlandi et al., 1989 [51]. Preferred binding agents including
chimeric recombinant and humanized recombinant antibodies with B
epitope specificity have been prepared and are described in
co-pending an co-assigned U.S. patent application Ser. No.
08/004,798, filed Jan. 12, 1993 [52]. The starting material for the
preparation of chimeric (mouse V--human C) and humanized anti-VLA-4
antibodies may be a murine monoclonal anti-VLA-4 antibody as
previously described, a monoclonal anti-VLA-4 antibody commercially
available (e.g., HP2/1, Amac International, Inc., Westbrook, Me.),
or a monoclonal anti-VLA-4 antibody prepared in accordance with the
teaching herein. For example, the variable regions of the heavy and
light chains of the anti-VLA-4 antibody HP1/2 have been cloned,
sequenced and expressed in combination with constant regions of
human immunoglobulin heavy and light chains. Such a chimeric HP1/2
antibody is similar in specificity and potency to the murine HP1/2
antibody, and may be useful in methods of treatment according to
the present invention. The HP1/2 V.sub.H DNA sequence and its
translated amino acid sequences are set forth in SEQ ID NO: 1 and
SEQ ID NO: 2, respectively. The HP1/2 V.sub.K DNA sequence and its
translated amino acid sequence are set forth in SEQ IS NO: 3 and
SEQ ID NO: 4, respectively. Similarly, humanized recombinant
anti-VLA-4 antibodies may be useful in these methods. A preferred
humanized recombinant anti-VLA-4 antibody is an AS/SVMDY antibody,
for example, the AS/SVMDY antibody produced by the cell line
deposited with the ATCC on Nov. 3, 1992 and given accession no. CRL
11175. The AS/SVMDY humanized antibody is at least equipotent with
or perhaps more potent than the murine HP1/2 antibody. The AS
V.sub.H DNA sequence and its translated amino acid sequences are
set forth in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. The SVMDY
V.sub.K DNA sequence and its translated amino acid sequence are set
forth in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.
[0041] Those skilled in the art will recognize that any of the
above-identified antibody or antibody derivative binding agents can
also act in the method of the invention by binding to the receptor
for VLA-4, and may block or coat the cell-surface VLA-4 antigen.
Thus, antibody and antibody derivative binding agents according to
the invention may include embodiments having binding specificity
for VCAM-1 or fibronectin, since these molecules appear to either
be important in the adhesion cells or the extracellular matrix or
interfere with traffic of cells through tissues and blood.
[0042] Alternatively, as discussed above the binding agents used in
the method according to the invention may not be antibodies or
antibody derivatives, but rather may be soluble forms of the
natural binding proteins for VLA-4. These binding agents include
soluble VCAM-1, VCAM-1 peptides, or VCAM-1 fusion proteins as well
as fibronectin, fibronectin having an alternatively spliced
non-type III connecting segment and fibronectin peptides containing
the amino acid sequence EILDV or a similar conservatively
substituted amino acid sequence. These binding agents can act by
competing with the cell-surface binding protein for VLA-4.
[0043] In this method according to the first aspect of the
invention, VLA-4 binding agents are preferably administered
parenterally. The VLA-4 binding agents are preferably administered
as a sterile pharmaceutical composition containing a
pharmaceutically acceptable carrier, which may be any of the
numerous well known carriers, such as water, saline, phosphate
buffered saline, dextrose, glycerol, ethanol, and the like, or
combinations thereof. Preferably, the VLA-4 binding agent, if an
antibody or antibody derivative, will be administered at a dose
ranging between about 0.1 mg/kg body weight/day and about 20 mg/kg
body weight/day, preferably ranging between about 0.1 mg/kg body
weight/day and about 10 mg/kg body weight/day and at intervals of
every 1-14 days. For non-antibody or antibody derivative binding
agents, the dose range should preferably be between molar
equivalent amounts to these amounts of antibody. Preferably, an
antibody composition is administered in an amount effective to
provide a plasma level of antibody of at least 1 .mu.g/ml.
Optimization of dosages can be determined by administration of the
binding agents, followed by assessment of the coating of
VLA-4-positive cells by the agent over time after administered at a
given dose in vivo. Peripheral blood mononuclear cells contained in
a sample of the individual's peripheral blood should be probed for
the presence of the agent in vitro (or ex vivo) using a second
reagent to detect the administered agent. For example, this may be
a fluorochrome labelled antibody specific for the administered
agent which is then measured by standard FACS (fluorescence
activated cell sorter) analysis. Alternatively, presence of the
administered agent may be detected in vitro (or ex vivo) by the
inability or decreased ability of the individual's cells to bind
the same agent which has been itself labelled (e.g., by a
fluorochrome). The preferred dosage should produce detectable
coating of the vast majority of VLA-4-positive cells. Preferably,
coating is sustained in the case of a monoclonal antibody or
monoclonal antibody derivative for a 114 day period.
[0044] In practicing this invention, treatment with VLA-4 binding
agents is preferably continued for as long as the prediabetic
subject maintains a stable normoglycemic plasma level and a stable
prediabetic state as reflected by a number of known markers as
described above. In the Examples which follow, it has been found
that anti-VLA-4 mAb, e.g., R1-2 mAb, administration prevented
diabetes onset during treatment and that the residual beneficial
results of treatment were extended as long as two months following
cessation of R1-2 treatment. To sustain the full protective effect
of the VLA-4 binding agent against diabetes onset, however,
continuous treatment with the binding agents is preferred.
[0045] The method of the present invention comprises administering
to a prediabetic individual a composition comprising an anti-VLA-4
antibody. The examples below set forth the results observed in a
rodent model of disease. These results demonstrate a protective
effect of anti-VLA-4 antibody in disease onset in the acute
transfer model of the disease. The non-obese diabetic (NOD) mouse
has become an important model of type I or insulin dependent
diabetes mellitus since its introduction by Makino et al., 1980 [7]
and has been documented as a particularly relevant model for human
diabetes (see, e.g., Castano and Eisenbarth [1], Miller et al.,
1988 [5], Hutchings et al., 1990 [33] and references cited
therein). That the diabetic syndromes displayed in the NOD mouse
and human are similar has been shown by several lines of evidence.
For example, in both the NOD mouse and human [1], there is a strong
genetic association of diabetes with loci of the major
histocompatibility complex. In addition, for example, in both
species, an autoimmune pathogenesis is evidenced by (i) the
presence of lymphocytic inflammation in the pancreatic islets
(i.e., insulitis) that appears to mediate the selective destruction
of P cells, (ii) the presence of anti-islet cell antibodies, and
(iii) the modulating effects of cyclosporin A. Further evidence in
the NOD mouse for an autoimmune etiology of diabetes disease is (i)
the ability to transfer diabetes with spleen cells (including
purified splenic T cells) from diabetic donors, (ii) prevention of
diabetes by in vivo treatment with antibodies specific for T cells,
and (iii) failure of a thymic nude mice with NOD genetic background
to develop moulitis or diabetes (see, e.g., Miller et al., 1988
[5], Hutchings et al., 1990 [33] and references cited therein).
[0046] Although the precise events resulting in diabetes remain
unclear, in the NOD mouse a progressive inflammatory response in
the pancreas appears to be the initial histological lesion which
begins as a periductal/perivascular mononuclear cell infiltrate at
3-4 weeks of age. At about 4-6 weeks of age, insulitis may be
observed and beginning at about 12 weeks of age, overt diabetes
(i.e., consistent values of 1+ or higher using a Testape (Eli
Lilly, Indianapolis, Ind.) assay for glycosuria or greater than 250
mg/dL if plasma glucose is monitored) occurs. To avoid variations
in the immune status of the animals, the NOD mice are obtained from
a specific pathogen-free colony and exhibit stable, high incidence
of diabetes of about 80% of females and 20% of males which
typically become diabetic by about 20 weeks of age. The preferred
source for the NOD mice used in the experiments described herein is
Taconic Farms (Germantown, N.Y.). A large body of data,
particularly from studies of the BB rat and NOD mouse has indicated
that type I diabetes may be a T-cell mediated disease. Evidence to
date suggests an important role for both major T cell
subpopulations (CD4/L3T4 and CD8/Ly2) in the development of
diabetes in man and in the NOD mouse. The data supporting the
essential role of T cells in diabetes do not exclude the
possibility that T lymphocytes may recruit other cells (e.g.,
macrophages) as the final effectors for .beta. cell destruction.
Macrophages have been implicated in the disease process based on
their presence in the infiltrated islet and the ability of chronic
silica treatment to prevent disease (see, e.g., Hutchings et al.,
1990 [33] and references cited therein).
[0047] Using the NOD strain of mice, investigators have developed
an acute transfer model of disease which parallels the spontaneous
disease model in that transferred cells derived from diabetogenic
NOD mice mediate the disease process, which is characterized by
immune reactive cells that mediate insulitis and islet P
cell-specific destruction. Moreover, in this model, certain
monoclonal antibodies against T cells (see, e.g., Miller et al.,
1988 [5]) and macrophages (see, e.g., Hutchings et al., 1990 [33]
have been shown to abrogate disease onset. Such monoclonal
antibodies have been used in the treatment of spontaneous disease
and adoptively transferred disease, for example, antiCD4 antibody
has been shown to abrogate disease in both models (Miller et al.,
1988 [5] and Shizuru et al., 1988 [30]). Results of treatment with
an agent in the adoptive transfer model or spontaneous disease
model are indicative of the ability of the agent to modulate the
human disease process.
EXAMPLE 1
Effect of Anti-VLA-4 Antibody Treatment on Adoptive Transfer of
Diabetes
[0048] For the adoptive transfer of diabetes experiments, NOD mice
were obtained from Taconic Farms (Germantown, N.Y.) or from the
Joslin Diabetes Center (Boston, Mass.). Spontaneously diabetic (D)
females of recent onset (13-20 weeks of age) were used as spleen
cell donors and 8 week old nondiabetic (Y) females served as
recipients. Spleen cells from 4 week old nondiabetic (Y) female
donors which fail to transfer disease were used as a negative
control.
[0049] Recipient mice were placed on acidified water (1:8400
dilution of concentrated HCl in water) one week prior to sublethal
irradiation (775 rad) performed in split doses (300 rad, 300 rad,
and 175 rad) on each of three days (day-2, -1, and the day of
transfer), in order to minimize any incidence of intestinal
infection subsequent to high dose irradiation (Gamma Cell 1000
Cesium .sup.137 source, Nordion International, Inc., Ontario,
Canada). Spleens were harvested from diabetic donors or from
nondiabetic controls, cell suspensions made and red cells lysed
with Hemolytic Geys solution. Spleen cells were injected
intravenously (2-3.times.10.sup.7 in 0.2 ml PBS) pretreated with
either 75 .mu.g R1-2 monoclonal antibody (mAb), 75 .mu.g rat IgG2b,
or untreated. For the antibody treatment, cells were simply
suspended at 1-1.5.times.10.sup.8 cells/ml with mAb at 375 .mu.g/ml
and kept on ice until injection. The timing of injection was within
3 hours after last irradiation. Some recipients received PBS alone.
The anti-VLA-4 mAb R1-2 and isotype-matched rat IgG2b were
purchased from Pharmingen (La Jolla, Calif.). The R1-2 (rat
anti-mouse) anti-VLA-4 mAb was originally described by Holzmann et
al., 1989 [53]. The R1-2 anti-VLA-4 mAb blocks VLA-4 binding to its
ligands (Hession et al., 1992 [54]) and therefore belongs by
definition to the B group (Pulido et al., 1991 [44], i.e., is
equivalent to anti-human VLA-4 mAbs of the B group (e.g., HP1/2 or
HP2/1).
[0050] The R1-2 mAb or rat IgG2b was administered at a dose of 75
.mu.g/0.2 ml intraperitoneally every 2-3 days, a dosing regimen
which was determined to maintain maximal coating of VLA-4-positive
cells in the peripheral blood, lymphoid organs and bone marrow as
detected by staining of peripheral blood cells and single cell
suspensions prepared from these organs with a fluorochrome labelled
mAb specific for the R1-2 mAb and FACS analysis to measure
fluorochrome positive cells (as described above). Injections were
maintained through day 12 or day 24 post transfer. Mice were
monitored for diabetes by testing for glycosuria with Testape (Eli
Lilly, Indianapolis, Ind.) and by plasma glucose levels
(Glucometer, 3 Blood Glucose Meter, Miles, Inc., Elkhart, Ind.) and
were considered diabetic after two consecutive urine positive tests
[Testape values of [+1] or higher] or plasma glucose levels>250
mg/dL.
[0051] An inhibitory effect of the anti-VLA-4 mAb on the onset of
diabetes was demonstrated when spleen cells isolated from NOD
diabetic donors were treated with a saturating quantity of
anti-VLA-4 mAb R1-2 followed by transfer into nondiabetic
irradiated hosts, as described above, and the R1-2 mAb was then
administered every other day for 12 days in order to maintain
maximal coating of all VLA-4-positive cells in the peripheral blood
and lymphoid organs for two weeks. FIG. 1 shows the frequency of
recipients that became diabetic and the day of disease onset for
transfer of 2.times.10.sup.7 splenocytes from diabetic NOD donor
(D.fwdarw.Y) (i) without treatment (closed circles); (ii) with rat
IgG2b treatment (closed triangles), and (iii) with R1-2 anti-VLA-4
treatment (closed diamonds) as well as for transfer of splenocytes
from non-diabetic NOD donors (Y.fwdarw.Y) (open squares). Injection
of PBS alone gave 0% incidence. Under these conditions, only 1 of 8
individual R1-2 mAb treated recipients became diabetic, with onset
on day 29 post transfer. By contrast, 6/10 and 5/9 individuals
became diabetic after receiving splenocytes from diabetic donors
treated with no mAb or with non-specific rat IgG2b, respectively.
As shown in FIG. 1, diabetes onset occurred as early as day 14 post
transfer, though administration of the irrelevant rat IgG2b
somewhat delayed onset.
[0052] These data demonstrate a protective effect of the R1-2 mAb
which was dependent upon its specificity for VLA-4. Recipients of
splenocytes from nondiabetic mice or of PBS alone failed to become
diabetic. Thus, treatment with anti-VLA-4 antibody reduced the
frequency of diabetes during 30 days post transfer.
[0053] Although the results shown in FIG. 1 demonstrate that
clinical diabetes occurred in only 1 of 8 anti-VLA-4 treated
animals, it was possible that the anti-VLA-4 antibody caused only a
minor delay in the onset of disease. Plasma glucose levels were
monitored in parallel with urine glucose in order to quantify any
increase in blood sugar levels and thereby detect progression to
clinical disease. In the anti-VLA-4 antibody treated group shown in
FIG. 1, all mice were still nommoglycemic on day 29 with an average
plasma glucose value of 100.+-.7 mg/dL, n=7, except for the single
individual who scored as clinically diabetic by urine test and
plasma glucose>500 mg/dL. Thus, disease progression was not
apparent in any of the other anti-VLA-4 antibody treated recipients
shown in FIG. 1 on day 29 post transfer, a full 2 weeks beyond the
last anti-VLA-4 antibody injection. Analysis of sera from these
mice confirmed that the anti-VLA-4 mAb dropped to low or
undetectable levels by day 18-21 post-transfer.
[0054] Additional cell transfers were performed in order to confirm
that the anti-VLA-4 mAb protected against transfer of diabetes. In
these experiments, the anti-VLA-4 antibody treatment was extended
to day 25 post transfer but administered every 3.5 days thereby
maintaining saturating levels of R1-2 mAb or rat IgG2b through day
26 when mice were sacrificed for pancreatic tissue. Under these
conditions, an inhibitory effect of the anti-VLA-4 mAb on the onset
of diabetes was also demonstrated upon spleen cell transfer and
R1-2 treatment. FIG. 2 shows the frequency of recipients (n=4-5 for
each group) that became diabetic and the day of disease onset for
transfer of 3.times.10.sup.7 splenocytes from diabetic NOD donors
(D.fwdarw.Y) (i) without treatment (closed circles), (ii) with
IgG2b treatment (closed triangles) and with R1-2 anti-VLA-4
treatment (closed diamonds), as well as for transfer of splenocytes
from nondiabetic NOD donors (Y.fwdarw.Y; open squares). Injection
of PBS alone gave 0% incidence. FIG. 2 shows that only 1 out of 5
R1-2 mAb treated mice became diabetic by day 22 post transfer
whereas diabetes was transferred in 4/4 recipients without R1-2 mAb
and 5/5 treated with rat IgG2b. Disease onset occurred as early as
day 13 post transfer. These experiments, individually and
collectively demonstrate that anti-VLA-4 mAb reproducibly protects
against development of diabetes in an acute transfer model of
disease.
[0055] Further experiments were performed to determine whether the
anti-VLA-4 mAb simply delayed disease onset during the treatment
period or if it could achieve a longer-term protective effect. FIG.
3 shows the onset of diabetes in mice over time after R1-2
injection (once every 3.5 days through day 25) with only 2/5 mice
becoming diabetic on days 35 and 38 post transfer, 10-13 days after
the last R1-2 injection. By contrast, diabetes occurred in the
untreated and IgG2b treated groups as early as day 11 post
transfer, with 100% incidence by days 18-21. Surprisingly, disease
incidence in the R1-2 treated group did not further increase even
as long as 2 months following the last R1-2 injection. Plasma
glucose values monitored in parallel during this time reveal that
these three individuals were consistently normoglycemic. After this
point (i.e., approximately 3 months post-transfer), even the
negative control groups which received PBS alone or non-diabetic
cells begin developing spontaneous disease. In summary, the
VLA-4-specific mAb reduces the incidence of diabetes transfer.
Moreover, its protective effect against disease is sustained in the
absence of further mAb treatment.
EXAMPLE 2
Effect of Anti-VLA-4 mAb on Pancreatic Insulitis
[0056] For histological analysis, mice were sacrificed between 2-4
weeks post-transfer as described in this Example and pancreata
harvested in 10% formalin buffered saline for paraffin-embedded
sections which were stained with hematoxylin and eosin (H&E)
for histology. Degree of insulitis was scored as follows: Grade 0:
no insulitis [islet devoid of inflammation]; Grade I:
peri-insulitis [inflammatory mononuclear cells located peripheral
to the islet]; Grade II: <25% infiltrated [<25% of the islet
interior contains lymphocytic inflammatory cells]; Grade III:
25-50% infiltrated [lymphocytic infiltration]; Grade IV: >50%
infiltrated. The percent of islets in each Grade was then
calculated relative to the total number of islets examined.
Histologic sections were examined and scored for the degree of
insulitis following the adoptive transfer of NOD splenocytes with
and without anti-VLA-4 mAb treatment and the results tabulated.
Specifically, the frequency of uninfiltrated islets (Grade 0-I
infiltrate) and islets with Grade II-IV insulitis (as described
above) were quantitated. For each experimental group, pancreatic
sections from n=4-5 mice were scored.
[0057] Pancreatic tissue was recovered from recipients treated with
the anti-VLA-4 mAb for various time periods in order to address its
effect on the establishment of islet-specific cellular infiltrates.
Mice were treated with nonspecific rat IgG2b or R1-2 mAb every 3.5
days through day 14 when sacrificed. Similarly, mice were treated
through day 25 and sacrificed after diabetes was diagnosed or on
day 26 post transfer. Mice continuously treated with the R1-2 mAb
for 14 days post transfer maintain a high frequency (76%) of
uninfiltrated islets, with only 24% progressing to grade II-IV
insulitis. By contrast those treated with nonspecific rat IgG2b
show the reciprocal pattern, with 74% severe insulitis. Likewise,
in the mice treated with R1-2 though day 25 (20% diabetic,
pancreata isolated from mice reported in FIG. 2), a high frequency
(58%) of uninfiltrated islets were preserved, similar to that (55%
uninfiltrated) in nondiabetic recipients of young NOD splenocytes,
as shown in FIG. 4. By contrast, both the untreated or
IgG2b-treated mice had only 28% uninfiltrated islets, and
conversely had increased (72%) insulitis. Thus, the anti-VLA-4 mAb
treatment appears to specifically inhibit or alternatively to delay
the development of insulitis upon adoptive transfer of diabetogenic
spleen cells.
[0058] In order to distinguish between these alternatives, the
pattern of insulitis after 4 weeks post transfer was determined
when mice were treated with rat IgG2b or R1-2 mAb through day 12
and then maintained without further treatment. Mice were sacrificed
upon diabetes diagnosis or on day 29 post transfer. Analysis of
sera from these mice confirmed that circulating anti-VLA-4 mAb
dropped to undetectable levels by days 18-21 post transfer. With
this protocol, the degree of insulitis in the R1-2-treated group
(69% insulitis, 25% diabetic) was similar to that in untreated
recipients (73% insulitis, 60% diabetic) though still lower than
that in the rat IgG2b-treated mice (96% insulitis, 75% diabetic),
as shown in FIG. 5. Significantly, the severity of insulitis was
similar between the R1-2 treated, untreated and rat IgG2b treated
groups with an average of 57%, 47%, 64% Grade III/IV infiltrates,
respectively. Even considering only the nondiabetic R1-2 treated
individuals, they still exhibited 59% insulitis with 52% Grade
III/IV infiltrates. Recipients of nondiabetogenic NOD splenocytes
had only 7% Grade III/IV infiltrates. Conversely, FIG. 5 shows that
the frequency of uninfiltrated islets was decreased in the R1-2
treated mice as compared to recipients of saline or nondiabetogenic
spleen cells. Thus, the degree of insulitis progressed in these
R1-2 treated mice (FIG. 5) as compared to mice wherein R1-2
treatment was maintained (FIG. 4) and approached that in the
untreated and rat IgG2b treated control groups. Taken together,
these data indicate that anti-VLA-4 mAb administration can delay
the progression of insulitis in an acute transfer model of
disease.
EXAMPLE3
Comparison of Different Anti-VLA-4 Antibody Treatment on Adoptive
Transfer of Diabetes
[0059] This Example provides comparative efficacy results of PS/2,
an anti-VLA-4 antibody, with R1-2 using the adoptive transfer model
and procedure described in Example 1. NOD mice were treated with
(a) an irrelevant control antibody (D/rat IgG2b, n=19 mice); (b)
R1-2 antibody (D/R1-2 mAb, n=24 mice); (c) PS/2 mAb (D/PS/2 mAb,
n=5 mice); or (d) no treatment (NONE, n=26 mice). Spleen cells were
injected intravenously (2-3.times.10.sup.7 in 0.2 ml PBS) and
pretreated with either 75 .mu.g R1-2 mAb, 75 .mu.g PS/2 mAb, 75
.mu.g rat IgG2b, or untreated. Isolation and purification of PS/2
anti-VLA-4 mAb was originally described by Miyake et al., 1991
[55].
[0060] The R1-2 mAb, PS/2 mAb or rat IgG2b was administered at a
dose of 75 .mu.g/0.2 ml intraperitoneally every 2-3 days, a dosing
regimen which was determined to maintain maximal coating of
VLA-4-positive cells in the peripheral blood, lymphoid organs and
bone marrow as detected by staining of peripheral blood cells and
single cell suspensions prepared from these organs with a
fluorochrome labelled mAb specific for the R1-2 and PS/2 mAb and
FACS analysis to measure fluorochrome positive cells (as described
above). Injections were maintained through days 22 to 25 post
transfer. Mice were monitored for diabetes by testing for
glycosuria with Testape (Eli Lilly, Indianapolis, Ind.) and by
plasma glucose levels (Glucometer, 3 Blood Glucose Meter, Miles,
Inc., Elkhart, Ind.) and Were considered diabetic after two
consecutive urine positive tests [Testape values of [+1] or higher]
or plasma glucose levels>250 mg/dL.
[0061] An inhibitory effect of the anti-VLA-4 mAb on the onset of
diabetes was demonstrated when spleen cells isolated from NOD
diabetic donors were treated with a saturating quantity of
anti-VLA-4 mAb R1-2 or PS/2 followed by transfer into nondiabetic
irradiated hosts, as described above, and the R1-2 mAb or PS/2 mAb
was then administered every other day for 22-25 days in order to
maintain maximal coating of all VLA-4-positive cells in the
peripheral blood and lymphoid organs for about two weeks. Table I
shows the frequency of recipients that became diabetic and the day
of disease onset for transfer of splenocytes from diabetic NOD
donor (i) without treatment (D); (ii) with rat IgG2b treatment
(D/nonspecific rat IgG2b); (iii) with R1-2 anti-VLA-4 treatment
(D/R1-2 mAb); (iv) with PS/2 treatment (D/PS/2 mAb) as well as for
transfer of splenocytes from non-diabetic NOD donors (non-D).
Nondiabetic mice receiving PBS and no splenocytes (NONE) were
included as a control. Injection of PBS alone gave 4% incidence.
Under these conditions, only 1 of 24 individual R1-2 mAb treated
recipients became diabetic, with onset on day 22 post transfer
while none of the five individual PS/2 mAb treated recipients
became diabetic. By contrast, 16/19 individuals became diabetic
after receiving splenocytes from diabetic donors treated with no
mAb or with non-specific rat IgG2b. As shown in Table 1, diabetes
onset occurred as early as day 14 post transfer, though
administration of the irrelevant rat IgG2b somewhat delayed onset
by one day.
[0062] These data demonstrate a protective effect of the R1-2 mAb
and PS/2 which were dependent upon its specificity for VLA-4.
Recipients of splenocytes from nondiabetic mice or of PBS alone
failed to become diabetic. Thus, treatment with anti-VLA-4 antibody
reduced the frequency of diabetes during 30 days post transfer.
Analysis of sera from these mice confirmed that levels of R1-2 and
PS/2 anti-VLA-4 mAb become undetectable between days 26 and 34
post-transfer.
1TABLE 1 Anti-VLA-4 mAbs Inhibit Adoptive Transfer of Diabetes in
NOD Mice Cells Transferred/ Day of Onset Treatment* No.
Diabetic/Total Recipients+ X .+-. SEM NONE 1/26 (4%) 34 Non-D 1/15
(7%) 15 D 16/19 (84%) 14 .+-. 0.2 D/Nonspecific 16/19 (84%) 15 .+-.
0.9 rat IgG2b D/R1-2 mAb 1/24 (4%) 22 D/PS/2 mAb 0/5 (0%) *Spleen
cells from 4 week old nondiabetic (NON-D) or from new onset
diabetic (D) NOD females were transferred, with D cells suspended
in mAb or rat IgG or without mAb before transfer and recipients
treated twice weekly for 22-25 days. Mice were monitored for one
month post transfer. Data are compiled from 5 experiments. +D/R1-2
and D/PS/2 mAb treated groups are significantly different from D
and D/rat IgG2b treated groups by Chi square test with Yates'
correction as follows: R1-2 vs. IgG2b treated and D group, p <
0.0001 PS/2 vs. IgG2b treated and D group, p < 0.003.
EXAMPLE4
Effect of Anti-VLA-4 Antibody Treatment on Spontaneous Diabetes
Model
[0063] This Example described efficacy results using R1-2 mAb in
the spontaneous diabetes model which employs NOD mice. NOD mice
were treated for 8 weeks with (a) an irrelevant control antibody
(NOD/rat IgG2b, n=10 mice); (b) R1-2 antibody (NOD/R1-2, n=20
mice); or (c) no treatment (NOD, n=10 mice) starting at week four
to week twelve of age. mAb was administered at a dose of 75 .mu.g
in 0.2 ml PBS iv, twice weekly. Mice were monitored for diabetic
events by Testape for glycosuria as previously described.
[0064] FIG. 6 demonstrates a marked delay in diabetes onset (12-16
weeks delay) following R1-2 administration, as compared to the two
control groups. NOD mice which received irrelevant IgG2b mAb or no
treatment developed diabetes as early as 13 weeks. These
spontaneous disease model results parallel the adoptive transfer
results with R1-2 mAb illustrated in FIG. 1 and directly
demonstrate that an anti-VLA-4 antibody protects against diabetes
onset.
EXAMPLE5
Effect of a VCAM-Ig Fusion Protein on Adoptive Transfer of
Diabetes
[0065] The adoptive transfer experiment described in Example 1 was
repeated with a VCAM-Ig fusion protein (VCAM 2D-IgG) instead of an
anti-VLA-4 mAb. VCAM 2D-IgG is a soluble form of the ligand for
VLA-4 (VCAM1) which consists of the two N-terminal domains of VCAM1
fused to the human IgG1 heavy chain constant region sequences
(Hinges, C.sub.H2 and C.sub.H3). The VCAM 2D-IgG DNA sequence and
its translated amino acid sequence are shown in SEQ ID NO: 9. FIG.
8 illustrates the fusion protein structure. The fusion protein was
constructed by recombinant techniques as described below.
[0066] Isolation of cDNA of Human IgG1 Heavy Chain
[0067] Region and Construction of Plasmid pSAB 144
[0068] In order to isolate a cDNA copy of the human IgG1 heavy
chain region, RNA was prepared from COS7 cells which has been
transiently transfected by the plasmid VCAM1-IgG1 (also known as
pSAB133). Construction of plasmid VCAM1-IgG1 is described in PCT
patent application WO 90/13300. The RNA was reverse transcribed to
generate cDNA using reverse transcriptase and random hexamers as
the primers. After 30 min. at 42.degree. C., the reverse
transcriptase reaction was terminated by incubation of the reaction
at 95.degree. C. for 5 min. The cDNA was then amplified by PCR
(Polymerase Chain Reaction, see, e.g., Sambrook et al., Molecular
Cloning, Vol. 3, pp. 14.1-14.35 (Cold Spring Harbor; 1989)) using
the following kinased primers: 370-31 (SEQ ID NO: 10):
2 5'TCGTC GAC AAA ACT CAC ACA TGC C Asp Lys Thr His Thr Cys
[0069] which contains a SalI site, and 370-32 (SEQ ID NO: 11):
3 5' GTAAATGAGT GCGGCGGCCG CCAA,
[0070] which encodes the carboxy terminal lysine of the IgG1 heavy
chain constant region, followed by a NotI site.
[0071] The PCR amplified cDNA was purified by agarose gel
electrophoresis and glass bead elution for cloning in plasmid
pNNO3. Plasmid pNNO3 was constructed by removing the synthetic
polylinker sequence from the commercially available plasmid pUC8
(Pharmacia, Piscataway, N.J.) by restriction endonuclease digestion
and replacing the synthetic polylinker sequence with the following
novel synthetic sequence (SEQ ID NO: 12): GCGGCCGCGG TCCAACCACC
AATCTCAAAG CTTGGTACCC GGGAATTCAG ATCTGCAGCA TGCTCGAGCT CTAGATATCG
ATTCCATGGA TCCTCACATC CCAATCCGCG GCCGC.
[0072] The purified PCR amplified cDNA fragment was ligated to
pNNO3 which had been cleaved with EcoRV, dephosphorylated, and
purified by low melt agarose gel electrophoresis. The ligation
reaction was used to transform E. coli JA221 and the resulting
colonies were screened for a plasmid containing an insert of
approximately 700 bp. The identity of the correct insert was
confirmed by DNA sequence analysis, and the plasmid was designated
pSAB 144.
[0073] Construction of Plasmid pSAB 142
[0074] The plasmid pSAB142 was constructed as follows. cDNA
prepared from COS cells transfected with pSAB133 (as described in
the previous section) was subjected to PCR amplification using
oligonucleotides 370-01 and 370-29. Oligonucleotide 370-01 includes
a NotI site and the nucleotides corresponding to amino acids 1
through 7 of the VCAM-1 signal sequence (SEQ ID NO: 13):
4 5' GAGCTCGAGGCGGCCGCACC ATG CCT GGG AAG ATG GTC GTG Met Pro Gly
Lys Met Val Val
[0075] Oligonucleotide 370-29 corresponds to the VCAM-1 amino acids
214-219 and includes a SalI site (SEQ ID NO: 14):
5 5'AA GTC GAC TTG CAA TTC TTT TAC
[0076] The amplified DNA fragment was ligated to the vector
fragment of pNNO3, cleaved by EcoRV.
[0077] Construction of pSAB132.
[0078] pJOD-S (Barsoum, J., DNA and Cell Biol., 9, pp. 293-300
(1990)) was modified to insert a unique NotI site downstream from
the adenovirus major late promoter so that NotI fragments could be
inserted into the expression vector. pJOD-S was linearized by NotI
cleavage of the plasmid DNA. The protruding 5' termini were
blunt-ended using Mung Bean nuclease, and the linearized DNA
fragment was purified by low melting temperature agarose gel
electrophoresis. The DNA fragment was religated using T4 DNA
ligase. The ligated molecules were then transformed into E. coli
JA221. Colonies were screened for the absence of a NotI site. The
resulting vector was designated pJOD-S delta NotI. pJOD-8 delta
NotI was linearized using SalI and the 5' termini were
dephosphorylated using calf alkaline phosphatase. The linearized
DNA fragment was purified by low melting temperature agarose gel
eletrophoresis and ligated in the presence of phosphorylated
oligonucleotide ACE175, which has the following sequence (SEQ ID
NO: 15):
6 TCGACGCGGC CGCG
[0079] The ligation mixture was transformed into E. coli JA221, and
colonies were screened for the presence of a plasmid having a NotI
site. The desired plasmid was named pMDR901.
[0080] In order to delete the two SV40 enhancer repeats in the Sv40
promoter which controls transcription of the DHFR cDNA, pMDR901 and
pJOD.DELTA.e-tPA (Barsoum, DNA and Cell Biol., 9, pp. 293-300
(1990)), both were cleaved with AatII and DraIII. The 2578 bp
AatII-DraIII fragment from pMDR901 and the 5424 bp AatII-DraIII
fragment from pJOD.DELTA.e-tPA were isolated by low melting
temperature agarose gel electrophoresis and ligated together.
Following transformation into E. coli JA221, the resulting plasmid,
pMDR902, was isolated. pSAB132 was then formed by eliminating the
EcoRI-NotI fragment of pMDR902 containing the adenovirus major late
promoter and replacing it with an 839 bp EcoRI-NotI fragment from
plasmid pCMV-B (Clontech, Palo Alto, Calif.) containing the human
cytomegalovirus immediate early promoter and enhancer.
[0081] Construction of pSAB 146 pSAB144 was cleaved with SalI and
NotI, and the 693 bp fragment isolated. pSAB142 was cleaved with
NotI and SalI and the 664 bp fragment was isolated. The two
fragments were ligated to pSAB 132 which had been cleaved with
NotI, and the 5' termini dephosphorylated by calf alkaline
phosphatase. The resulting plasmid, pSAB 146, contained the DNA
sequence encoding the VCAM-1 signal sequence, the amino terminal
219 amino acids of mature VCAM-1, ten amino acids of the hinge
region of IgG1 and the CH2 and CH3 constant domains of IgG1.
[0082] Production of VCAM 2D-IgG from a stably transformed CHO cell
line
[0083] A recombinant VCAM 2D-IgG expression vector was constructed
as described below and transfected into CHO cells to produce a cell
line continuously secreting VCAM 2D-IgG.
[0084] The 1.357 kb NotI fragment containing the VCAM 2D-IgG coding
sequence of pSAB146 was purified by agarose gel electrophoresis.
This fragment was ligated into the NotI cloning site of the
expression vector pMDR901, which uses the adenovirus 2 major late
promoter for heterologous gene expression and the selectable,
amplifiable dihydrofolate reductase (dhfr) marker. The ligated DNA
was used to transform E. coli DH5. Colonies containing the plasmid
with the desired, correctly oriented insert were identified by the
presence of 5853 and 3734 bp fragments upon digestion with Hind
III; and 4301, 2555, 2293, and 438 bp fragments upon digestion with
BglI. The resultant recombinant VCAM 2D-IgG expression vector was
designated pEAG100. The identity of the correct insert was
confirmed by DNA sequence analysis.
[0085] The recombinant expression plasmid pEAG100 was
electroporated into dhfr-deficient CHO cells according to the
published protocol of J. Barsoum (DNA Cell Biol 9: 293-300, 1990),
with the following changes: 200 .mu.g of PvuI-linearized pEAG100
plasmid and 200 .mu.g of sonicated salmon sperm DNA were used in
the electroporation protocol. In addition, cells were selected in
alpha-complete medium supplemented with 200 nM methotrexate.
[0086] To determine expression levels of secreted VCAM 2D-IgG,
clones were transferred to a flat bottom 96 well microtiter plate,
grown to confluency and assayed by ELISA as described below.
[0087] Wells of Immulon 2 plates (Dynatech, Chantilly, Va.) were
each coated with anti-VCAM MAb 4B9 (isolated and purified on
Protein A Sepharose as described by Carlos et al, 1990 [56]) with
10011 of anti-VCAM 4B9 MAb diluted to 10 .mu.g/ml in 0.05 M sodium
carbonate/bicarbonate buffer, pH 9.6, covered with Parafilm, and
incubated overnight at 4.degree. C. The next day, the plate
contents were dumped out and blocked with 200 .mu.l/well of a block
buffer (5% fetal calf serum in 1.times.PBS), which had been
filtered through a 2 filter. The buffer was removed after a 1 hour
incubation at room temperature and the plates were washed twice
with a solution of 0.05% Tween-20 in 1.times.PBS. Conditioned
medium was added at various dilutions. As a positive control, an
anti-mouse Ig was also included. Block buffer and LFA-3TIP
constituted as negative controls. The samples and controls were
incubated at room temperature for 2 hours.
[0088] The plates were then washed twice with a solution of 0.05%
Tween-20 in 1.times.PBS. Each well, except for the positive control
well, was then filled with 50 .mu.l of a 1:2000 dilution of
HRP-Donkey anti-human IgG (H+L) (Jackson Immune Research
Laboratories, Inc.; West Grove, Pa.) in block buffer. The positive
control well was filled with 50 .mu.l of a 1:2000 dilution of
HRP-Goat anti-mouse IgG (H+L)(Jackson Immune Research Laboratories,
Inc.; West Grove, Pa.) in block buffer. The plates were then
incubated for 1 hour at room temperature.
[0089] The HRP conjugated Ab solutions were removed, and the wells
were washed twice with 0.05% Tween-20 in 1.times.PBS. Then, 100
.mu.l of HRP-substrate buffer was added to each well at room
temperature. HRP-substrate buffer was prepared as follows: 0.5 ml
of 42 mM 3,3', 5,5'-tetramethylbenzidine (TMB), (ICN
Immunobiologicals, Lisle, S.C., Catalogue No. 980501) in DMSO
(Aldrich) was slowly added to 50 ml of substrate buffer (0.1 M
sodium acetate/citric acid, pH 4.9); followed by addition of 7.5
.mu.l of 30% hydrogen peroxide (Sigma, Catalogue No. H-1009).
[0090] The development of a blue color in each well was monitored
at 650 nm on a microtiter plate reader. After 7-10 minutes, the
development was stopped by the addition of 100 .mu.l of 2N Sulfuric
acid. The resulting yellow color was read at 450 nm on a microtiter
plate reader. A negative control well was used to blank the
machine.
[0091] Purification of VCAM 2D-IgG
[0092] CHO cells expressing VCAM 2D-IgG were grown in roller
bottles on collagen beads. Conditioned medium (5 Liters) was
concentrated to 500 ml using an Amicon S1Y10 spiral ultrafiltration
cartridge (Amicon, Danvers, Mass.). The concentrate was diluted
with 1 liter of Pierce Protein A binding buffer (Pierce, Rockford,
Ill.) and gravity loaded onto a 10 ml Protein A column (Sepharose 4
Fast Flow, Pharmacia, Piscataway, N.J.). The column was washed 9
times with 10 ml of Protein A binding buffer and then 7 times with
10 ml of PBS. VCAM 2D-IgG was eluted with twelve-5 ml steps
containing 25 mM H.sub.3P0.sub.4 pH 2.8, 100 mM NaCl. The eluted
samples were neutralized by adding 0.5 M Na.sub.2HP0.sub.4 pH 8.6
to 25 mM. Fractions were analyzed for absorbance at 280 nm and by
SDS-PAGE. The three peaks fractions of highest purity were pooled,
filtered; aliquoted and stored at -70.degree. C. By SDS-PAGE, the
product was greater than 95% pure. The material contained less than
1 endotoxin unit per mg of protein. In some instances, it was
necessary to further purify the Protein A eluate product on
Q-Sepharose FF (Pharmacia). The protein A eluate was diluted with 3
volumes of 25 mM Tris HCl pH 8.0 and loaded onto a Q-Sepharose FF
column at 10 mg VCAM 2D-IgG per ml of resin. The VCAM 2D-IgG was
then eluted from the Q-Sepharose with PBS.
[0093] Evaluation of VCAM 2D-IgG
[0094] Spleen cell suspensions were prepared from diabetic donors
or from nondiabetic controls as described above. Spleen cells were
injected intravenously (2-3.times.10.sup.7 in 0.2 ml PBS) and were
pretreated with either 100%g VCAM 2D-IgG or 100 .mu.g of irrelevant
LFA-3Ig fusion protein control. Another group received PBS alone
without cells transferred. The fusion protein LFA-3Ig (LFA-3TIP)
was isolated and purified as described in PCT US92/02050 and Miller
et al., 1993 [57]. The VCAM 2D-IgG fusion protein or irrelevant
LFA-3Ig protein was administered at a dose of 100 .mu.g/0.2 ml
intraperitoneally twice weekly through day 17. This concentration
was sufficient to provide a serum level of fusion protein
sufficient to saturate VLA-4-positive cells, the serum levels
determined by ELISA as described above. Diabetes onset was
monitored as described above.
[0095] The results of the evaluation are shown in FIG. 7. As shown
in this Figure, VCAM 2D-IgG fusion protein significantly inhibits
the onset of diabetes in recipients of cells from diabetic donor
mice (D/VCAM-Ig, open circles) with 60% incidence by day 30
post-transfer, as compared to the mice which received cells from
diabetic donor (data not shown) and LFA-3Ig irrelevant control Ig
fusion protein (D/LFA-3 Ig) which had already achieved 60%
incidence by day 15 post-transfer. Mice which received no cells
(PBS only) did not develop disease. There were n=5 mice per
experimental group.
[0096] In summary, VLA-4 binding agents such as anti-VLA-4
antibodies were protective against diabetes disease onset (Examples
1, 3 and 4) and were effective in delaying the progression of
insulitis (Example 2) using a murine model for human diabetes.
Other VLA-4 binding agents such as soluble VCAM derivatives (VCAM
2D-IgG) were also useful in protecting against diabetes disease
onset (Example 5). The foregoing examples are intended as an
illustration of the method of the present invention and are not
presented as a limitation of the invention as claimed hereinafter.
From the foregoing disclosure, numerous modifications and
additional embodiments of the invention will be apparent to those
experienced in this art. For example, actual dosage used, the type
of antibody or antibody fragment used, mode of administration,
exact composition, time and manner of administration of the
treatment, and many other features all may be varied without
departing from the description above. All such modifications and
additional embodiments are within the contemplation of this
application and within the scope of the appended claims.
LIST OF REFERENCES CITED
[0097] [1] Castano and Eisenbarth, 1990, Annu. Rev. Immunology 8:
647-79, "Type I Diabetes: A Chronic Autoimmune Disease of Human,
Mouse, and Rat"
[0098] [2] Fujita et al., 1982, Biomed. Res. 3:429-436,
"Lymphocytic Insulitis in a Non-obese Diabetic (NOD) Strain of
Mice: An Immunohistochemical and Electron Microscope
Investigation"
[0099] [3] Foulis et al., 1986, Diabetologia 29:267, "The
histopathology of the pancreas in Type I (insulin-dependent)
diabetes mellitus: a 25-year review of deaths in patients under 20
years of age in the United Kingdom"
[0100] [4] Eisenbarth, 1986, New Engl. J. Med. 314:1360-1368, "Type
I Diabetes Mellitus--A Chronic Autoimmune Disease"
[0101] [5] Miller et al., 1988, J. Immunol. 140:52-58, "Both the
Lyt-2+ and L3T4+T Cell subsets are required for the transfer of
diabetes in Nonobese diabetic mice"
[0102] [6] Harada and Makino, 1986, Exp. Anim. 35:501, "Suppression
of overt diabetes in NOD mice by Anti-thymocyte serum or anti-Thy
1.2 antibody"
[0103] [7] Koike et al., 1987, Diabetes 36: 539, "Preventive effect
of monoclonal anti-L3T4 antibody on development of diabetes in NOD
mice"
[0104] [8] Makino et al., 1986, Exp. Anim. 35: 495, "Absence of
insulitis and overt diabetes in athymic nude mice with NOD genetic
background"
[0105] [9] Voorbij et al., 1989, Diabetes 35:1623-1629, "Dendritic
cells and scavenger macrophages in pancreatic islets of prediabetic
BB rats"
[0106] [10] Nomikos et al., 1986, Diabetes 35:11302-1304, "Combined
treatment with nicotinamide and desferrioxamine prevents islet
allograft destruction in NOD mice"
[0107] [11] Larson and Springer, 1990, Immunol. Rev. 114: 181-217,
"Structure and Function of Leukocyte Integrins"
[0108] [12] Hemler et al., 1990, Immunol. Rev. 114:45-66,
"Structure of the Integrin VLA-4 and its Cell-Cell and Cell-matrix
adhesion functions"
[0109] [13] Lobb, R. R., 1992, Adhesion: Its Role in Inflammatory
Diseases. ed. J. M. Harlan and D. Y. Liu, New York: W.H. Freeman.
1-18.
[0110] [14] Osborn, L., 1990, Cell 62: 3-6, "Leukocyte Adhesion to
Endothelium in Inflammation"
[0111] [15] Wayner et al., 1989, J. Cell. Biol. 109:1321-1330,
"Identification and Characterization of the T Lymphocyte Adhesion
Receptor for an Alternative Cell Attachment Domain (CS-1) in Plasma
Fibronectin"
[0112] [16] Shimizu et al., 1991, J. Cell Biol. 113:1203, "Four
molecular pathways to T cell adhesion to endothelial cells: roles
of LFA-1 VCAM-1 and ELAM-1 and changes in pathway hierarchy under
different activation conditions"
[0113] [17] Barton et al., 1989, J. Immunol. 143:1278, "The effect
of anti-intercellular adhesion molecule-1 on phorbolester-induced
rabbit lung inflammation"
[0114] [18] Issekutz, T. B. and Issekutz, A. C., 1991, Clinical
Immunol. and Immunopathol. 138:300-312, "T lymphocyte migration to
arthritis joints and dermal inflammation in the rat: differing
migration patterns and the involvement of VLA-4"
[0115] [19] Issekutz, T. G., 1991, J. Immunol 147:4178-4184,
"Inhibition of In Vivo Lymphocyte Migration to Inflammation and
Homing to Lymphoid Tissues by the TA-2 Monoclonal Antibody--A
Likely Role for VLA-4 In Vivo"
[0116] [20] Yednock, et al., 1992, Nature .sctn.: 63-66,
"Prevention of experimental autoimmune encephalomyelitis by
antibodies against .alpha.4.beta.1 integrin"
[0117] [21] Lobb, U.S. patent application Ser. No. 07/821,768 filed
Jan. 13, 1992, "Treatment for Asthma"
[0118] [22] Dustin et al., 1986, J. Immunol. 137:245-254 "Induction
by IL-1 and Interferon-.gamma. Tissue Distribution, Biochemistry,
and Function of a Natural Adherence Molecule (ICAM-1)"
[0119] [23] Rice et al., 1990, J. Exp. Med. 171:1369, "Inducible
Cell Adhesion Molecule 110 (INCAM-110) Is An Endothelial Receptor
for Lymphocytes--A CD11/CD18-Independent Adhesion Mechanism"
[0120] [24] Rice et al., 1991, Am. J. Path. 138:385-393, "Vascular
and Nonvascular Expression of INCAM-110"
[0121] [25] Shimuzu et al., 1990, Immunol. Rev. 114:109-144, "Roles
of Adhesion Molecules in T-cell recognition: Fundamental
Similarities between four integrins on resting human T cells
(LFA-1, VLA-4, VLA-5, VLA-6) in expression, binding and
costimulation"
[0122] [26] Burkly et al., 1991, Eur. J. Immunol. 21: 2871-2875,
"Signaling by vascular cell adhesion molecule-1 (VCAM-1) through
VLA-4 promotes CD3-dependent T cell proliferation"
[0123] [27] Rudd et al., 1989, Immunol. Rev. 111:225-266,
"Molecular Interactions, T-Cell Subsets, and a Role of the
CD4/CD8:p56.sup.1Ck Complex in Human T-Cell Activation"
[0124] [28] Moingeon et al., 1989, Immunol. Rev. 111: 111-144, "The
Structural Biology of CD2"
[0125] [29] Harding et al., 1992, Nature 356:607-609,
"CD28-mediated signalling co-stimulates murine T cells and prevents
induction of energy in T cell clones"
[0126] [30] Shizuru et al., 1988, Science 240:659-662,
"Immunotherapy of the Nonobese Diabetic Mouse: Treatment with an
Antibody to T-Helper Lymphocytes"
[0127] [31] Barlow and Like, 1992, Amer. J. Pathol. 141:1043-1051,
"Anti-CD2 Monoclonal Antibodies Prevent Spontaneous and Adoptive
Transfer of Diabetes in the BB/Wor Rat"
[0128] [32] Like et al., 1986, J. Exp. Med. 164:1145-1159,
"Prevention of Diabetes in Biobreeding/Worchester Rats with
Monoclonal Antibodies that Recognize T Lymphocytes of Natural
Killer Cells"
[0129] [33]. Hutchings et al., 1990, Nature 348:639-642, "Transfer
of diabetes in mice prevented by blockade of adhesion-promoting
receptor on macrophages"
[0130] [34] Federlin and Becker, 1990, Klin. Wochenschr. 68: Supp.
XXI 38-43, "Specific Therapeutic Attempts in Experimental and
Clinical Type-I Diabetes"
[0131] [35] Zielasek et al., 1989, Clin. Immunol. Immunopathol.
52:347-365, "The Potentially Simple Mathematics of Type I
Diabetes"
[0132] [36] Eisenbarth, 1987, Hosp. Prac. 22:167-183, "Type I
Diabetes: Clinical Implication of Autoimmunity"
[0133] [37] Ziegler and Eisenbarth, 1990, Horm. Res. 33:144-150,
"Multiple Target Antigens in Pre-Type I Diabetes: Implications for
Prediction"
[0134] [38] Ziegler et al., 1990, Diabetes Care 13:762-765,
"Predicting Type I Diabetes"
[0135] [39] Ziegler et al., 1990, J. Autoimmun. 3 Suppl. 1:69-74,
"Type I Diabetes: polygenic inheritance, multiple autoantigens and
`dual` parameter prediction"
[0136] [40] Kohler, G. and Milstein, 1975, C. Nature 265: 295-497,
"Continuous Cultures of Fused Cells Secreting Antibody of
Predefined Specificity"
[0137] [41] Sanchez-Madrid et al., 1986, Eur. J. Immunol., 16:
1343-1349, "VLA-3: A novel polypeptide association within the VLA
molecular complex: cell distribution and biochemical
characterization"
[0138] [42] Hemler et al., 1987, J. Biol. Chem. 262:11478-11485,
"Characterization of the cell surface heterodimer VLA-4 and related
peptides"
[0139] [43] Elices et al., 1990, Cell 0: 577-584, "VCAM-1 on
Activated Endothelium Interacts with the Leukocyte Integrin VLA-4
at a Site Distinct from the VLA-4/Fibronectin Binding Site"
[0140] [44] Pulido et al., 1991, J. Biol. Chem., 266(16):
10241-10245, "Functional Evidence for Three Distinct and
Independently Inhibitable Adhesion Activities. Mediated by the
Human Integrin VLA-4"
[0141] [45] Boerner et al., 1991, J. Immunol. 147:86-95,
"Production of Antigen-specific Human Monoclonal Antibodies from In
Vitro-Primed Human Splenocytes"
[0142] [46] Persson et al., 1991, Proc. Natl. Acad. Sci. USA 88:
2432-2436, "Generation of diverse high-affinity human monoclonal
antibodies by repertoire cloning"
[0143] [47] Huang and Stollar, 1991, J. Immunol. Methods 141:
227-236, "Construction of representative immunoglobulin variable
region cDNA libraries from human peripheral blood lymphocytes
without in vitro stimulation"
[0144] [48] Jones et al., 1986, Nature 321: 522-525, "Replacing the
complementarity-determining regions in a human antibody with those
from a mouse"
[0145] [49] Riechmann, 1988, Nature 332:323-327, "Reshaping human
antibodies for therapy"
[0146] [50] Queen et al., 1989, Proc. Natl. Acad. Sci. USA
86:10029, "A humanized antibody that binds to the interleukin 2
receptor"
[0147] [51] Orlandi et al., 1989, Proc. Natl. Acad. Sci. USA
86:3833 "Cloning Immunoglobulin variable domains for expression by
the polymerase chain reaction"
[0148] [52] U.S. patent application Ser. No. 08/004,798, filed Jan.
12, 1993, "Recombinant Anti-VLA-4 Antibody Molecules"
[0149] [53] Holzmann et al., 1989, Cell 56:37-46, "Identification
of a Murine Peyer's Patch-Specific Lymphocyte Homing Receptor as an
Integrin Molecule with .alpha. Chain Homologous to Human
VLA-4.alpha."
[0150] [54] Hession et al., 1992, Biochem. Biophys. Res. Commun.
183:163-169, "Cloning of Murine and Rat Vascular Cell Adhesion
Molecule-1"
[0151] [55] Miyake et al., 1991, J. Exp. Med. 173:599-607.
[0152] [56] Carlos et al., 1990, Blood 17:965, "Vascular Cell
Adhesion molecule-1 (VCAM-1) mediates Lymphocyte Adherence to
Cytokine-activated Cultured Human Endothelial Cells."
[0153] [57] Miller et al., 1993, J. Exp. Med. 178:211.
[0154] [58] L. Osborn et al., "Direct Expression Cloning of
Vascular Cell Adhesion Molecule 1, a Cytokine-induced Endothelial
Protein That Binds to Lymphocytes," Cell, 59, pp. 1203-11
(1989).
[0155] [59] J. Devlin et al., "Random Peptide Libraries: A Source
of Specific Protein Binding Molecules," Science, 249, pp. 400406
(1990).
[0156] [60] J. Scott and G. Smith, "Searching for Peptide Ligands
with an Epitope Library," Science, 249, pp. 386-90 (1990).
[0157] [61] U.S. Pat. No. 4,833,092, Geysen, "Method For
Determining Mimotopes", issued May 23, 1989.
[0158] The foregoing documents are incorporated herein by reference
in their entirety.
Sequence CWU 1
1
19 1 360 DNA Homo sapiens misc_feature (0)...(0) pBAG159 insert
HP1/2 heavy chain variableregion; amino acid 1 is Glu (E) but Gln
(Q) may be substituted 1 gtc aaa ctg cag cag tct ggg gca gag ctt
gtg aag cca ggg gcc tca 48 Val Lys Leu Gln Gln Ser Gly Ala Glu Leu
Val Lys Pro Gly Ala Ser 1 5 10 15 gtc aag ttg tcc tgc aca gct tct
ggc ttc aac att aaa gac acc tat 96 Val Lys Leu Ser Cys Thr Ala Ser
Gly Phe Asn Ile Lys Asp Thr Tyr 20 25 30 atg cac tgg gtg aag cag
agg cct gaa cag ggc ctg gag tgg att gga 144 Met His Trp Val Lys Gln
Arg Pro Glu Gln Gly Leu Glu Trp Ile Gly 35 40 45 agg att gat cct
gcg agt ggc gat act aaa tat gac ccg aag ttc cag 192 Arg Ile Asp Pro
Ala Ser Gly Asp Thr Lys Tyr Asp Pro Lys Phe Gln 50 55 60 gtc aag
gcc act att aca gcg gac acg tcc tcc aac aca gcc tgg ctg 240 Val Lys
Ala Thr Ile Thr Ala Asp Thr Ser Ser Asn Thr Ala Trp Leu 65 70 75 80
cag ctc agc agc ctg aca tct gag gac act gcc gtc tac tac tgt gca 288
Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 gac gga atg tgg gta tca acg gga tat gct ctg gac ttc tgg ggc
caa 336 Asp Gly Met Trp Val Ser Thr Gly Tyr Ala Leu Asp Phe Trp Gly
Gln 100 105 110 ggg acc acg gtc acc gtc tcc tca 360 Gly Thr Thr Val
Thr Val Ser Ser 115 120 2 120 PRT Homo sapiens 2 Val Lys Leu Gln
Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala Ser 1 5 10 15 Val Lys
Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Lys Asp Thr Tyr 20 25 30
Met His Trp Val Lys Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile Gly 35
40 45 Arg Ile Asp Pro Ala Ser Gly Asp Thr Lys Tyr Asp Pro Lys Phe
Gln 50 55 60 Val Lys Ala Thr Ile Thr Ala Asp Thr Ser Ser Asn Thr
Ala Trp Leu 65 70 75 80 Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala
Val Tyr Tyr Cys Ala 85 90 95 Asp Gly Met Trp Val Ser Thr Gly Tyr
Ala Leu Asp Phe Trp Gly Gln 100 105 110 Gly Thr Thr Val Thr Val Ser
Ser 115 120 3 318 DNA Homo sapiens misc_feature (0)...(0) pBAG172
insert HP1/2 light chain variable region 3 agt att gtg atg acc cag
act ccc aaa ttc ctg ctt gtt tca gca gga 48 Ser Ile Val Met Thr Gln
Thr Pro Lys Phe Leu Leu Val Ser Ala Gly 1 5 10 15 gac agg gtt acc
ata acc tgc aag gcc agt cag agt gtg act aat gat 96 Asp Arg Val Thr
Ile Thr Cys Lys Ala Ser Gln Ser Val Thr Asn Asp 20 25 30 gta gct
tgg tac caa cag aag cca ggg cag tct cct aaa ctg ctg ata 144 Val Ala
Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile 35 40 45
tat tat gca tcc aat cgc tac act gga gtc cct gat cgc ttc act ggc 192
Tyr Tyr Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly 50
55 60 agt gga tat ggg acg gat ttc act ttc acc atc agc act gtg cag
gct 240 Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr Ile Ser Thr Val Gln
Ala 65 70 75 80 gaa gac ctg gca gtt tat ttc tgt cag cag gat tat agc
tct ccg tac 288 Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln Asp Tyr Ser
Ser Pro Tyr 85 90 95 acg ttc gga ggg ggg acc aag ctg gag atc 318
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 100 105 4 106 PRT Homo
sapiens 4 Ser Ile Val Met Thr Gln Thr Pro Lys Phe Leu Leu Val Ser
Ala Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Ser
Val Thr Asn Asp 20 25 30 Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln
Ser Pro Lys Leu Leu Ile 35 40 45 Tyr Tyr Ala Ser Asn Arg Tyr Thr
Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Tyr Gly Thr Asp
Phe Thr Phe Thr Ile Ser Thr Val Gln Ala 65 70 75 80 Glu Asp Leu Ala
Val Tyr Phe Cys Gln Gln Asp Tyr Ser Ser Pro Tyr 85 90 95 Thr Phe
Gly Gly Gly Thr Lys Leu Glu Ile 100 105 5 429 DNA Homo sapiens CDS
(1)...(429) sig_peptide (1)...(57) mat_peptide (58)...(429)
misc_feature (0)...(0) pBAG195 insert AS heavy chain variable
region 5 atg gac tgg acc tgg agg gtc ttc tgc ttg ctg gct gta gca
cca ggt 48 Met Asp Trp Thr Trp Arg Val Phe Cys Leu Leu Ala Val Ala
Pro Gly -15 -10 -5 gcc cac tcc cag gtc caa ctg cag gag agc ggt cca
ggt ctt gtg aga 96 Ala His Ser Gln Val Gln Leu Gln Glu Ser Gly Pro
Gly Leu Val Arg 1 5 10 cct agc cag acc ctg agc ctg acc tgc acc gcg
tct ggc ttc aac att 144 Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Ala
Ser Gly Phe Asn Ile 15 20 25 aaa gac acc tat atg cac tgg gtg aga
cag cca cct gga cga ggt ctt 192 Lys Asp Thr Tyr Met His Trp Val Arg
Gln Pro Pro Gly Arg Gly Leu 30 35 40 45 gag tgg att gga agg att gat
cct gcg agt ggc gat act aaa tat gac 240 Glu Trp Ile Gly Arg Ile Asp
Pro Ala Ser Gly Asp Thr Lys Tyr Asp 50 55 60 ccg aag ttc cag gtc
aga gtg aca atg ctg gta gac acc agc agc aac 288 Pro Lys Phe Gln Val
Arg Val Thr Met Leu Val Asp Thr Ser Ser Asn 65 70 75 cag ttc agc
ctg aga ctc agc agc gtg aca gcc gcc gac acc gcg gtc 336 Gln Phe Ser
Leu Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val 80 85 90 tat
tat tgt gca gac gga atg tgg gta tca acg gga tat gct ctg gac 384 Tyr
Tyr Cys Ala Asp Gly Met Trp Val Ser Thr Gly Tyr Ala Leu Asp 95 100
105 ttc tgg ggc caa ggg acc acg gtc acc gtc tcc tca ggt gag tcc 429
Phe Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Glu Ser 110 115
120 6 143 PRT Homo sapiens SIGNAL (1)...(19) 6 Met Asp Trp Thr Trp
Arg Val Phe Cys Leu Leu Ala Val Ala Pro Gly -15 -10 -5 Ala His Ser
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Arg 1 5 10 Pro Ser
Gln Thr Leu Ser Leu Thr Cys Thr Ala Ser Gly Phe Asn Ile 15 20 25
Lys Asp Thr Tyr Met His Trp Val Arg Gln Pro Pro Gly Arg Gly Leu 30
35 40 45 Glu Trp Ile Gly Arg Ile Asp Pro Ala Ser Gly Asp Thr Lys
Tyr Asp 50 55 60 Pro Lys Phe Gln Val Arg Val Thr Met Leu Val Asp
Thr Ser Ser Asn 65 70 75 Gln Phe Ser Leu Arg Leu Ser Ser Val Thr
Ala Ala Asp Thr Ala Val 80 85 90 Tyr Tyr Cys Ala Asp Gly Met Trp
Val Ser Thr Gly Tyr Ala Leu Asp 95 100 105 Phe Trp Gly Gln Gly Thr
Thr Val Thr Val Ser Ser Gly Glu Ser 110 115 120 7 384 DNA Homo
sapiens CDS (1)...(384) sig_peptide (1)...(57) mat_peptide
(58)...(384) misc_feature (0)...(0) pBAG198 insert VK (SVMDY) light
chain variable region 7 atg ggt tgg tcc tgc atc atc ctg ttc ctg gtt
gct acc gct acc ggt 48 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val
Ala Thr Ala Thr Gly -15 -10 -5 gtc cac tcc agc atc gtg atg acc cag
agc cca agc agc ctg agc gcc 96 Val His Ser Ser Ile Val Met Thr Gln
Ser Pro Ser Ser Leu Ser Ala 1 5 10 agc gtg ggt gac aga gtg acc atc
acc tgt aag gcc agt cag agt gtg 144 Ser Val Gly Asp Arg Val Thr Ile
Thr Cys Lys Ala Ser Gln Ser Val 15 20 25 act aat gat gta gct tgg
tac cag cag aag cca ggt aag gct cca aag 192 Thr Asn Asp Val Ala Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 30 35 40 45 ctg ctg atc tac
tat gca tcc aat cgc tac act ggt gtg cca gat aga 240 Leu Leu Ile Tyr
Tyr Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp Arg 50 55 60 ttc agc
ggt agc ggt tat ggt acc gac ttc acc ttc acc atc agc agc 288 Phe Ser
Gly Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser 65 70 75
ctc cag cca gag gac atc gcc acc tac tac tgc cag cag gat tat agc 336
Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Asp Tyr Ser 80
85 90 tct ccg tac acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgt
aag 384 Ser Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
Lys 95 100 105 8 128 PRT Homo sapiens SIGNAL (1)...(19) 8 Met Gly
Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly -15 -10 -5
Val His Ser Ser Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala 1 5
10 Ser Val Gly Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Ser Val
15 20 25 Thr Asn Asp Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala
Pro Lys 30 35 40 45 Leu Leu Ile Tyr Tyr Ala Ser Asn Arg Tyr Thr Gly
Val Pro Asp Arg 50 55 60 Phe Ser Gly Ser Gly Tyr Gly Thr Asp Phe
Thr Phe Thr Ile Ser Ser 65 70 75 Leu Gln Pro Glu Asp Ile Ala Thr
Tyr Tyr Cys Gln Gln Asp Tyr Ser 80 85 90 Ser Pro Tyr Thr Phe Gly
Gln Gly Thr Lys Val Glu Ile Lys Arg Lys 95 100 105 9 1347 DNA Homo
sapiens CDS (1)...(1338) misc_feature (1)...(219) VCAM-1 gene
segment This portion of the sequence corresponds, in part, to Exons
I, II and III nucleotide sequence of Cybulsky et al. Proc. Nat'l.
Acad. Sci. USA 88 7861 (1991). 9 atg cct ggg aag atg gtc gtg atc
ctt gga gcc tca aat ata ctt tgg 48 Met Pro Gly Lys Met Val Val Ile
Leu Gly Ala Ser Asn Ile Leu Trp 1 5 10 15 ata atg ttt gca gct tct
caa gct ttt aaa atc gag acc acc cca gaa 96 Ile Met Phe Ala Ala Ser
Gln Ala Phe Lys Ile Glu Thr Thr Pro Glu 20 25 30 tct aga tat ctt
gct cag att ggt gac tcc gtc tca ttg act tgc agc 144 Ser Arg Tyr Leu
Ala Gln Ile Gly Asp Ser Val Ser Leu Thr Cys Ser 35 40 45 acc aca
ggc tgt gag tcc cca ttt ttc tct tgg aga acc cag ata gat 192 Thr Thr
Gly Cys Glu Ser Pro Phe Phe Ser Trp Arg Thr Gln Ile Asp 50 55 60
agt cca ctg aat ggg aag gtg acg aat gag ggg acc aca tct acg ctg 240
Ser Pro Leu Asn Gly Lys Val Thr Asn Glu Gly Thr Thr Ser Thr Leu 65
70 75 80 aca atg aat cct gtt agt ttt ggg aac gaa cac tct tac ctg
tgc aca 288 Thr Met Asn Pro Val Ser Phe Gly Asn Glu His Ser Tyr Leu
Cys Thr 85 90 95 gca act tgt gaa tct agg aaa ttg gaa aaa gga atc
cag gtg gag atc 336 Ala Thr Cys Glu Ser Arg Lys Leu Glu Lys Gly Ile
Gln Val Glu Ile 100 105 110 tac tct ttt cct aag gat cca gag att cat
ttg agt ggc cct ctg gag 384 Tyr Ser Phe Pro Lys Asp Pro Glu Ile His
Leu Ser Gly Pro Leu Glu 115 120 125 gct ggg aag ccg atc aca gtc aag
tgt tca gtt gct gat gta tac cca 432 Ala Gly Lys Pro Ile Thr Val Lys
Cys Ser Val Ala Asp Val Tyr Pro 130 135 140 ttt gac agg ctg gag ata
gac tta ctg aaa gga gat cat ctc atg aag 480 Phe Asp Arg Leu Glu Ile
Asp Leu Leu Lys Gly Asp His Leu Met Lys 145 150 155 160 agt cag gaa
ttt ctg gag gat gca gac agg aag tcc ctg gaa acc aag 528 Ser Gln Glu
Phe Leu Glu Asp Ala Asp Arg Lys Ser Leu Glu Thr Lys 165 170 175 agt
ttg gaa gta acc ttt act cct gtc att gag gat att gga aaa gtt 576 Ser
Leu Glu Val Thr Phe Thr Pro Val Ile Glu Asp Ile Gly Lys Val 180 185
190 ctt gtt tgc cga gct aaa tta cac att gat gaa atg gat tct gtg ccc
624 Leu Val Cys Arg Ala Lys Leu His Ile Asp Glu Met Asp Ser Val Pro
195 200 205 aca gta agg cag gct gta aaa gaa ttg caa gtc gac aaa act
cac aca 672 Thr Val Arg Gln Ala Val Lys Glu Leu Gln Val Asp Lys Thr
His Thr 210 215 220 tgc cca ccg tgc cca gca cct gaa ctc ctg ggg gga
ccg tca gtc ttc 720 Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly
Pro Ser Val Phe 225 230 235 240 ctc ttc ccc cca aaa ccc aag gac acc
ctc atg atc tcc cgg acc cct 768 Leu Phe Pro Pro Lys Pro Lys Asp Thr
Leu Met Ile Ser Arg Thr Pro 245 250 255 gag gtc aca tgc gtg gtg gtg
gac gtg agc cac gaa gac cct gag gtc 816 Glu Val Thr Cys Val Val Val
Asp Val Ser His Glu Asp Pro Glu Val 260 265 270 aag ttc aac tgg tac
gtg gac ggc gtg gag gtg cat aat gcc aag aca 864 Lys Phe Asn Trp Tyr
Val Asp Gly Val Glu Val His Asn Ala Lys Thr 275 280 285 aag ccg cgg
gag gag cag tac aac agc acg tac cgg gtg gtc agc gtc 912 Lys Pro Arg
Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val 290 295 300 ctc
acc gtc ctg cac cag gac tgg ctg aat ggc aag gag tac aag tgc 960 Leu
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 305 310
315 320 aag gtc tcc aac aaa gcc ctc cca gcc ccc atc gag aaa acc atc
tcc 1008 Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr
Ile Ser 325 330 335 aaa gcc aaa ggg cag ccc cga gaa cca cag gtg tac
acc ctg ccc cca 1056 Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu Pro Pro 340 345 350 tcc cgg gat gag ctg acc aag aac cag
gtc agc ctg acc tgc ctg gtc 1104 Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu Thr Cys Leu Val 355 360 365 aaa ggc ttc tat ccc agc
gac atc gcc gtg gag tgg gag agc aat ggg 1152 Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 370 375 380 cag ccg gag
aac aac tac aag acc acg cct ccc gtg ctg gac tcc gac 1200 Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 385 390 395
400 ggc tcc ttc ttc ctc tac agc aag ctc acc gtg gac aag agc agg tgg
1248 Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg
Trp 405 410 415 cag cag ggg aac gtc ttc tca tgc tcc gtg atg cat gag
gct ctg cac 1296 Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His
Glu Ala Leu His 420 425 430 aac cac tac acg cag aag agc ctc tcc ctg
tct ccg ggt aaa 1338 Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Pro Gly Lys 435 440 445 tgagtgcgg 1347 10 24 DNA Artificial
Sequence oligonucleotide for PCR 10 tcgtcgacaa aactcacaca tgcc 24
11 24 DNA Artificial Sequence oligonucleotide for PCR 11 gtaaatgagt
gcggcggccg ccaa 24 12 115 DNA Artificial Sequence oligonucleotide
for PCR 12 gcggccgcgg tccaaccacc aatctcaaag cttggtaccc gggaattcag
atctgcagca 60 tgctcgagct ctagatatcg attccatgga tcctcacatc
ccaatccgcg gccgc 115 13 41 DNA Artificial Sequence oligonucleotide
for PCR 13 gagctcgagg cggccgcacc atgcctggga agatggtcgt g 41 14 23
DNA Artificial Sequence oligonucleotide for PCR 14 aagtcgactt
gcaattcttt tac 23 15 14 DNA Artificial Sequence oligonucleotide for
PCR 15 tcgacgcggc cgcg 14 16 446 PRT Homo sapiens 16 Met Pro Gly
Lys Met Val Val Ile Leu Gly Ala Ser Asn Ile Leu Trp 1 5 10 15 Ile
Met Phe Ala Ala Ser Gln Ala Phe Lys Ile Glu Thr Thr Pro Glu 20 25
30 Ser Arg Tyr Leu Ala Gln Ile Gly Asp Ser Val Ser Leu Thr Cys Ser
35 40 45 Thr Thr Gly Cys Glu Ser Pro Phe Phe Ser Trp Arg Thr Gln
Ile Asp 50 55 60 Ser Pro Leu Asn Gly Lys Val Thr Asn Glu Gly Thr
Thr Ser Thr Leu 65 70 75 80 Thr Met Asn Pro Val Ser Phe Gly Asn Glu
His Ser Tyr Leu Cys Thr 85 90 95 Ala Thr Cys Glu Ser Arg Lys Leu
Glu Lys Gly Ile Gln Val Glu Ile 100 105 110 Tyr Ser Phe Pro Lys Asp
Pro Glu Ile His Leu Ser Gly Pro Leu Glu 115 120 125 Ala Gly Lys Pro
Ile Thr Val Lys Cys Ser Val Ala Asp Val Tyr Pro 130 135 140 Phe Asp
Arg Leu Glu Ile Asp Leu Leu Lys Gly Asp His Leu Met Lys 145 150
155 160 Ser Gln Glu Phe Leu Glu Asp Ala Asp Arg Lys Ser Leu Glu Thr
Lys 165 170 175 Ser Leu Glu Val Thr Phe Thr Pro Val Ile Glu Asp Ile
Gly Lys Val 180 185 190 Leu Val Cys Arg Ala Lys Leu His Ile Asp Glu
Met Asp Ser Val Pro 195 200 205 Thr Val Arg Gln Ala Val Lys Glu Leu
Gln Val Asp Lys Thr His Thr 210 215 220 Cys Pro Pro Cys Pro Ala Pro
Glu Leu Leu Gly Gly Pro Ser Val Phe 225 230 235 240 Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro 245 250 255 Glu Val
Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val 260 265 270
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr 275
280 285 Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser
Val 290 295 300 Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu
Tyr Lys Cys 305 310 315 320 Lys Val Ser Asn Lys Ala Leu Pro Ala Pro
Ile Glu Lys Thr Ile Ser 325 330 335 Lys Ala Lys Gly Gln Pro Arg Glu
Pro Gln Val Tyr Thr Leu Pro Pro 340 345 350 Ser Arg Asp Glu Leu Thr
Lys Asn Gln Val Ser Leu Thr Cys Leu Val 355 360 365 Lys Gly Phe Tyr
Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 370 375 380 Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 385 390 395
400 Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp
405 410 415 Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala
Leu His 420 425 430 Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro
Gly Lys 435 440 445 17 6 PRT Artificial Sequence synthetically
generated peptide 17 Asp Lys Thr His Thr Cys 1 5 18 7 PRT
Artificial Sequence synthetically generated peptide 18 Met Pro Gly
Lys Met Val Val 1 5 19 5 PRT Homo sapiens 19 Glu Ile Leu Asp Val 1
5
* * * * *