U.S. patent application number 10/782548 was filed with the patent office on 2005-09-15 for immune responses using compositions containing stress proteins.
This patent application is currently assigned to Stressgen Biotechnologies Corp., a Canadian corporation. Invention is credited to Anthony, Lawrence S. D., Mizzen, Lee, Siegel, Marvin I., Wu, Huacheng Bill.
Application Number | 20050202044 10/782548 |
Document ID | / |
Family ID | 34922833 |
Filed Date | 2005-09-15 |
United States Patent
Application |
20050202044 |
Kind Code |
A1 |
Mizzen, Lee ; et
al. |
September 15, 2005 |
Immune responses using compositions containing stress proteins
Abstract
The present invention relates to a vaccine for inducing an
immune response to an antigen in a vertebrate (e.g., mammal)
comprising an antigen and all or a portion of a stress protein or
all or a portion of a protein having an amino acid sequence
sufficiently homologous to the amino acid sequence of the stress
protein to induce the immune response against the antigen. In a
particular embodiment, the present invention relates to vaccines
and compositions which induce a CTL response in a mammal comprising
an antigen and all or a portion of a stress protein. In another
embodiment, the invention relates to vaccines and compositions
which induce an immune response to an influenza virus in a mammal
comprising an antigen of the influenza virus and all or a portion
of one or more stress proteins. The invention also relates to
vaccines and compositions for inducing a CTL response to a
tumor-associated antigen comprising a tumor-associated antigen and
all or a portion of the stress protein. The invention also relates
to vaccines and composition for suppressing allergic immune
responses to allergens comprising an allergen and all or a portion
of a stress protein.
Inventors: |
Mizzen, Lee; (Victoria,
CA) ; Anthony, Lawrence S. D.; (Victoria, CA)
; Wu, Huacheng Bill; (Victoria, CA) ; Siegel,
Marvin I.; (Victoria, CA) |
Correspondence
Address: |
FISH & RICHARDSON PC
225 FRANKLIN ST
BOSTON
MA
02110
US
|
Assignee: |
Stressgen Biotechnologies Corp., a
Canadian corporation
|
Family ID: |
34922833 |
Appl. No.: |
10/782548 |
Filed: |
February 19, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10782548 |
Feb 19, 2004 |
|
|
|
08977787 |
Nov 25, 1997 |
|
|
|
08977787 |
Nov 25, 1997 |
|
|
|
08756621 |
Nov 26, 1996 |
|
|
|
Current U.S.
Class: |
424/209.1 ;
424/248.1 |
Current CPC
Class: |
C07K 14/005 20130101;
C07K 2319/00 20130101; Y10S 530/825 20130101; A61K 39/00 20130101;
C12N 2760/16122 20130101; Y10S 530/826 20130101; A61K 47/646
20170801; A61K 38/00 20130101; C07K 14/35 20130101 |
Class at
Publication: |
424/209.1 ;
424/248.1 |
International
Class: |
A61K 039/145; A61K
039/04 |
Claims
1-5. (canceled)
6. A vaccine for inducing a cell-mediated cytolytic immune response
against an antigen in a mammal comprising a polynucleotide which
encodes and directs expression of an antigen and a stress protein
sequence in the mammal.
7. The vaccine of claim 6 wherein the antigen and the stress
protein are expressed as a fusion protein.
8. The vaccine of claim 6 wherein the stress protein sequences are
from a mycobacterial stress protein or a protein having an amino
acid sequence sufficiently homologous to the amino acid sequence of
the mycobacterial stress protein to induce the immune response to
the antigen in the mammal to whom it is administered.
9. The vaccine of claim 6 wherein the stress protein is selected
from the group consisting of: hsp65 and hsp71.
10. A vaccine for inducing a cell-mediated cytolytic immune
response against an antigen of an influenza virus in a mammal
comprising a polynucleotide which directs expression of the antigen
of the influenza virus and a stress protein in the mammal.
11. The vaccine of claim 10 wherein the stress protein is a
mycobacterial stress protein or a protein having an amino acid
sequence sufficiently homologous to the amino acid sequence of the
mycobacterial stress protein to induce the immune response to the
antigen in the mammal to whom it is administered.
12. The vaccine of claim 10 wherein the stress protein sequences
are selected from the group consisting of: hsp65 and hsp71.
13-41. (canceled)
42. The vaccine of claim 10 wherein the antigen of the influenza
virus includes a cytolytic T cell epitope.
43-48. (canceled)
49. A vaccine for suppressing a Th2 response to an allergenic
antigen in a mammal comprising the antigen and all or a portion of
a stress protein or all or a portion of a protein having an amino
acid sequence sufficiently homologous to the amino acid sequence of
the stress protein to suppress the Th2 response to the antigen.
50. A composition for suppressing a Th2 response to an allergenic
antigen in a mammal comprising the antigen and all or a portion of
a stress protein or all or a portion of a protein having an amino
acid sequence sufficiently homologous to the amino acid sequence of
the stress protein to suppress the Th2 response to the antigen.
51. A conjugate for suppressing a Th2 response to an allergenic
antigen in a mammal comprising the antigen and all or a portion of
a stress protein or all or a portion of a protein having an amino
acid sequence sufficiently homologous to the amino acid sequence of
the stress protein to suppress the Th2 response to the antigen.
52. A fusion protein for suppressing a Th2 response to an
allergenic antigen in a mammal comprising the antigen and all or a
portion of a stress protein or all or a portion of a protein having
an amino acid sequence sufficiently homologous to the amino acid
sequence of the stress protein to suppress the Th2 response to the
antigen.
Description
RELATED APPLICATIONS
[0001] This application is a Continuation-in-Part of U.S.
application Ser. No. 08/756,621, filed Nov. 26, 1996, the entire
teachings of which are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] The viruses causing influenza have been arbitrarily named as
influenza type A, B, and C. These types define antigenically
distinct viruses. Each type has, several distinct subtypes. Viruses
within one type are genetically compatible in the sense that cells
infected with two different subtypes can assemble mixed viruses
containing components from both subtypes. Influenza viruses are
classified as orthomyxoviruses. The viruses form particles of
between 80 and 120 nm in diameter. Influenza viruses are enveloped
viruses, i.e., their outer surface is derived from host cell
membrane. Inserted in and protruding from the envelope are two
major viral-encoded proteins, hemagglutinin (HA) and neuraminidase
(NA). Influenza viruses are negative-stranded RNA viruses,
containing a genome made up of 8 RNA segments of non-messenger RNA
polarity. The genomic RNA segments are assembled in RNP complexes
with virus-encoded nuclear protein (NP). Following infection of a
host cell, genomic RNA segments are first transcribed into RNAs
with messenger RNA polarity which are later reverse-transcribed to
produce genomic RNA. The transcriptase activities responsible for
these steps lacks proof-reading capability. Mistakes that are made
during transcription and reverse transcription are therefore not
repaired, resulting in a high frequency of mutation of the viral
genome. While all viral genes are subject to the same mutational
process, genes for external proteins HA and NA are particularly
subject to strong selection processes that drive their evolution
towards mutant forms that escape immune detection in their hosts.
Hosts include not only humans but also animals such as chicken,
turkey, swine and horse.
[0003] Influenza has traditionally been one of the leading causes
of human death. The clinical signs of influenza are variable,
ranging from asymptomatic to fatal infection. Typically, onset of
illness is rapid and prostrating, and is almost invariably attended
by cough, malaise, headache, and myalgia. Coryza, sore throat, and,
less commonly, substernal pain also indicate that the primary site
of infection is the respiratory system. Typically, however, fever
and systemic symptoms predominate. Recovery typically is rapid. The
severity of the disease is largely host-dependent and relates to
age, physiological state and prior immunization by infection or
immunization. A severe complication is pneumonia. Compromised
individuals are prone to suffer secondary infections with bacterial
pathogens that cause pneumonia. Most patients who die following
influenza die with bacterial pneumonia. Minor antigenic variations
in influenza virus types A and B occur yearly, causing regional
epidemics. The yearly death rate from such yearly epidemics may
approach 20,000 in the U.S. alone. At variable intervals between 10
and 30 years, global pandemics occur with death tolls far exceeding
that of yearly epidemics. These pandemics are probably caused by
genetic reassortment of components from human and animal influenza
A viruses, resulting in new virus with a surface structure totally
alien to human experience. The death toll of the1918-19 pandemic
killed about 500,000 Americans. (As a general reference: Joshua
Lederberg, Encyclopedia of Microbiology, 2(D-L):505-520, Academic
Press Inc., San Diego, Calif. 92101 (1992).
[0004] Presently licensed vaccines include inactivated purified
virus. The vaccines are trivalent and include representative
strains of the two prevalent A subtypes, H3N2 and H1Ni, and a
single type B strain. Attenuated live virus vaccines have also been
used with some success, particularly in the previous Soviet Union.
Subunit vaccines have been developed containing HA and NA (split
flu vaccine; Connaught Lab.). These vaccines are not completely
effective in providing protective immunity. It is generally
accepted that influenza vaccines generate protective immunity
mainly by means of inducing antibody responses to the viral surface
proteins HA and NA. This may explain why the vaccines are only
incompletely effective; they are susceptible to continuous
antigenic variation in these surface proteins.
[0005] The search for differences between tumor cells and normal
cells has led to the isolation and characterization of a number of
so-called tumor-associated antigens (Henderson, R. A. and Finn, O.
J., Advances in Immunology, 62:217-256 (1996)). These antigens are
expressed by tumor cells but not at all or at least not in large
amounts in fully differentiated cells. The sequences encoding these
tumor antigens are either virus-derived or are normally present in
the genome of the host. An example of a virus-derived
tumor-associated antigen is the human papillomavirus transforming
protein E7 present in most human cervical tumors. A typical host
genome-derived tumor-associated antigen is gp 100, also referred to
as pMel-17, that is expressed in many human melanomas. While
tumor-associated antigens are known to induce a host immune
response, the response is typically insufficient to be
therapeutically effective. There is a need for approaches to
stimulate this response.
[0006] Using monospecific cytotoxic T lymphocyte (CTL) clones, the
expression of at least five tumor-associated antigens, termed A, B,
C, D and E, has been identified in mouse P815 mastocytoma tumor
cells. One of these antigens, termed P1A, expresses a single
epitope that is recognized by CTL clones. Using a molecular
approach, the gene for P1A was cloned and was found to be a
nonmutated gene present in normal cells but transcribed and
translated only in transformed cells (Van den Eynde et al., J. Exp.
Med., 173:1373 (1991)). Further, by examination of variants of P815
cells that had lost P1A antigen expression, it was possible to
identify the sequence of the MHC class I (L.sup.d)-restricted
minimal CTL epitope of P1A (Lethe, et al., Eur. J. Immunol.,
22:2283 (1992)).
[0007] Thus, a need exists for more effective vaccines against
antigens associated with viruses and tumors.
SUMMARY OF THE INVENTION
[0008] The present invention relates to a vaccine for inducing a
cell-mediated cytolytic immune response (cytolytic T cell (CTL)
response) against an antigen in a mammal comprising the antigen and
all or a portion of a stress protein (or heat shock protein (hsp))
or all or a portion of a protein having an amino acid sequence
sufficiently homologous to the amino acid sequence of the stress
protein to induce the immune response to the antigen. In one
embodiment, the antigen is an antigen of the influenza virus. In
another embodiment, the antigen is a tumor-associated antigen. The
stress protein for use in the present invention can be, for
example, a mycobacterial stress protein (e.g., hsp65, hsp71) or a
protein having an amino acid sequence sufficiently homologous to
the amino acid sequence of the mycobacterial stress protein to
induce the immune response to the antigen in the mammal to whom it
is administered. The antigen and stress protein of the vaccine of
the present invention can be linked by chemical conjugation or as a
fusion protein. The vaccine for inducing a cell-mediated cytolytic
immune response against an antigen in a mammal can also comprise a
polynucleotide which encodes and directs expression of an antigen
and a stress protein sequence in the mammal. The polynucleotide can
express the antigen and stress protein as a fusion protein.
[0009] The present invention also relates to a vaccine for inducing
a cell mediated cytolytic immune response to an influenza virus in
a mammal comprising an antigen of the influenza virus and all or a
portion of a stress protein or all or a portion of a protein having
an amino acid sequence sufficiently homologous to the amino acid
sequence of the stress protein to induce the immune response
against the antigen. In one embodiment, the present invention
relates to a vaccine for inducing a cell-mediated cytolytic immune
response against an antigen of an influenza virus in a mammal
comprising a polynucleotide which directs expression of the antigen
of the influenza virus and a stress protein in the mammal. The
antigen of the influenza virus which can be used in the present
invention includes, for example, hemagglutinin, nucleoprotein,
neuraminidase, M1, M2, PB1, PB2, PA and a combination thereof.
[0010] In one embodiment, the vaccine for inducing an immune
response to an influenza virus in a mammal is an antigen of the
influenza virus conjugated to all or a portion of a stress protein
or all or a portion of a protein having an amino acid sequence
sufficiently homologous to the amino acid sequence of the stress
protein to induce the immune response to the antigen.
[0011] In another embodiment, the vaccine for use in inducing an
immune response to an influenza virus in a mammal is a recombinant
fusion protein which includes an antigen of the influenza virus
fused to all or a portion of a stress protein or all or a portion
of a protein having an amino acid sequence sufficiently homologous
to the amino acid sequence of the stress protein to induce the
immune response against the antigen.
[0012] The present invention also relates to compositions
comprising a stress protein and an antigen of an influenza virus.
In one embodiment, the composition is a conjugate comprising a
stress protein joined with an antigen of an influenza virus. In
another embodiment, the composition is a fusion protein
(pET65MP/NP-B and pET65M/NP--D) comprising a stress protein fused
to an antigen of the influenza virus.
[0013] The present invention also relates to use of the
compositions for preventing or treating influenza virus in a
mammal.
[0014] The present invention also relates to a vaccine for inducing
a cell-mediated cytolytic immune response to a tumor-associated
antigen in a mammal, the vaccine comprising a tumor-associated
antigen linked to all or a portion of a stress protein or all or a
portion of a protein having an amino acid sequence sufficiently
homologous to the amino acid sequence of the stress protein to
induce the immune response against the antigen. The antigen which
can be used in the present invention comprises any mammalian
tumor-associated antigen including those presently known in the
art. It also includes fragments of these antigens that contain a
CTL epitope.
[0015] In one embodiment, the vaccine for inducing a cell-mediated
cytolytic immune response to a tumor-associated antigen in a mammal
is a tumor-associated antigen chemically conjugated to all or a
portion of a stress protein or all or a portion of a protein having
an amino acid sequence sufficiently homologous to the amino acid
sequence of the stress protein to induce the immune response
against the antigen.
[0016] In another embodiment, the vaccine for inducing a
cell-mediated cytolytic immune response to a tumor-associated
antigen in a mammal is a recombinant fusion protein which includes
a tumor-associated antigen and all or a portion of a stress protein
or all or a portion of a protein having an amino acid sequence
sufficiently homologous to the amino acid sequence of the stress
protein to induce the immune response against the antigen.
[0017] In a further embodiment, the vaccine for inducing a
cell-mediated cytolytic immune response to a tumor-associated
antigen in a mammal is a polynucleotide containing in expressible
form sequences encoding a tumor-associated antigen and all or a
portion of a stress protein or all or a portion of a protein having
an amino acid sequence sufficiently homologous to the amino acid
sequence of the stress protein to induce the immune response
against the antigen.
[0018] In yet another embodiment, the vaccine for inducing a
cell-mediated cytolytic immune response to a tumor-associated
antigen in a mammal can also be a polynucleotide encoding a
recombinant fusion protein which includes a tumor-associated
antigen and all or a portion of a stress protein or all or a
portion of a protein having an amino acid sequence sufficiently
homologous to the amino acid sequence of the stress protein to
induce the immune response against the antigen.
[0019] The invention also relates to vaccines for suppressing
allergic immune responses to natural or artificial antigens
(allergens) in a mammal, the vaccines including an allergen and all
or a portion of a stress protein or all or a protion of a protein
having an amino acid sequence sufficiently homologous to the amino
acid sequence of the stress protein to suppress the allergic
responses. Any allergen, regardless of whether it is peptidic or
not, can be used.
[0020] In one embodiment, the vaccine for suppressing allergic
immune responses to natural or artificial antigens (allergens) in a
mammal is an allergen chemically conjugated to all or a portion of
a stress protein or all or a portion of a protein having an amino
acid sequence sufficiently homologous to the amino acid sequence of
the stress protein to suppress the allergic responses.
[0021] In another embodiment, the vaccine for suppressing allergic
immune responses to natural or artificial antigens (allergens) in a
mammal is a recombinant fusion protein which includes an allergen
and all or a portion of a stress protein or all or a portion of a
protein having an amino acid sequence sufficiently homologous to
the amino acid sequence of the stress protein to suppress the
allergic responses.
[0022] In a further embodiment, the vaccine for suppressing
allergic immune responses to natural or artificial antigens
(allergens) in a mammal is a polynucleotide containing in
expressible form sequences encoding a peptidic allergen and all or
a portion of a stress protein or all or a portion of a protein
having an amino acid sequence sufficiently homologous to the amino
acid sequence of the stress protein to suppress the allergic
responses.
[0023] In yet another embodiment, the vaccine for suppressing
allergic immune responses to natural or artificial antigens
(allergens) in a mammal can also be a polynucleotide encoding a
recombinant fusion protein which includes a peptidic allergen and
all or a portion of a stress protein or all or a protion of a
protein having an amino acid sequences sufficiently homologous to
the amino acid sequence of the stress protein to suppress the
allergic responses.
[0024] The present invention also pertains to a composition for
suppressing a Th2 response to an antigen in a mammal comprising the
antigen and all or a portion of a stress protein or all or a
portion of a protein having an amino acid sequence sufficiently
homologous to the amino acid sequence of the stress protein to
suppress the Th2 response to the antigen. The composition can be a
vaccine, conjugate or fusion protein.
BRIEF DESCRIPTION OF THE FIGURES
[0025] FIG. 1 is a graph of effector:target ratio versus % specific
cell lysis demonstrating a cytolytic T cell (CTL) response in mice
to a mixture comprising nucleoprotein (NP) peptide and heat shock
protein 70 (hsp70).
[0026] FIG. 2 is a graph of effector:target ratio versus % specific
cell-lysis demonstrating a CTL response in mice to a composition
comprising a chemical conjugate of an NP peptide and hsp70.
[0027] FIG. 3 is a schematic representation of the vector,
pET65MP.
[0028] FIG. 4A is a schematic representation of the vector,
pET65MP/NP-B.
[0029] FIG. 4B is a schematic representation of the vector,
pET65MP/NP-D.
[0030] FIGS. 5A-5B are graphs of effector:target ratio versus %
specific cell lysis demonstrating a CTL response in mice to the
hsp-NP fusion protein, hsp65-NP.B, wherein the effector cells were
restimulated in the absence of IL-2 (FIG. 5A) and in the presence
of IL-2 (FIG. 5B).
[0031] FIGS. 6A-6B are graphs of effector:target ratio versus %
specific cell lysis demonstrating a CTL response in mice to the
hsp-NP fusion protein, hsp65-NP.D, wherein the effector cells were
restimulated in the absence of IL-2 (FIG. 6A) and in the presence
of IL-2 (FIG. 6B).
[0032] FIGS. 7A-7B are graphs of effector:target ratio versus %
specific cell lysis demonstrating a CTL response in BALB/c mice
immunized with an hsp-P1A fusion protein.
[0033] FIGS. 8A-8B are graphs of effector:target ratio versus %
specific cell lysis demonstrating a CTL response in DBA/2
(H-2.sup.d) mice immunized with an hsp-P1A fusion protein.
[0034] FIG. 9 is a bar graph demonstrating that immunization with
the hsp-tumor-associated antigen, hsp71-P1A, results in stimulation
of CTL activity directed against cells displaying relevant MHC
class I-restricted epitopes.
DETAILED DESCRIPTION OF THE INVENTION
[0035] The present invention relates to vaccines and compositions
which induce an immune response to an antigen in a mammal (e.g.,
human) comprising an antigen (one or more) and all or a portion of
a stress protein or heat shock protein (one or more) or all or a
portion of a protein having an amino acid sequence sufficiently
homologous to the stress protein to induce the immune response
against the antigen. In a particular embodiment, the present
invention relates to vaccines and compositions which induce a cell
mediated immune response in a mammal comprising an antigen (one or
more) and all or a portion of a stress protein (one or more) or all
or a portion of a protein having an amino acid sequence
sufficiently homologous to the stress protein to induce the immune
response against the antigen.
[0036] In a particular embodiment, the invention relates to
vaccines and compositions which induce an immune response to an
influenza virus in a mammal comprising an antigen of the influenza
virus and all or a portion of a stress protein or all or a portion
of a protein having an amino acid sequence sufficiently homologous
to the amino acid sequence of the stress protein to induce the
immune response against the antigen. As described herein
compositions comprising an influenza antigen (e.g., NP sequences
including CTL epitopes) and at least one stress protein, either in
the form of mixtures of an influenza antigen and a stress proteins
as a conjugate of an influenza antigen and a stress protein or as a
fusion protein containing influenza antigen and stress protein
sequences, are effective in stimulating specific immune responses
(e.g., cytolytic T cell (CTL) response, T cell helper response, B
cell response) against the influenza antigen used in mammals. For
example, as demonstrated in the examples, immunization of a host
(vertebrate, such as a mammal) with the vaccines described herein
can result in stimulation of specific CTL activity directed against
cells displaying the influenza antigen (e.g., NP). Alternatively,
the individual influenza-antigen and a stress protein could be
administered consecutively.
[0037] In a further embodiment, the invention relates to vaccines
that induce a cell-mediated immune response to tumor-associated
antigens comprising a tumor-associated antigen suitable for
immunization against a pre-existing tumor of a particular type or
for prevention of the development of such tumor and all or a
portion of a stress protein or all or a portion of a protein having
an amino acid sequence sufficiently homologous to the amino acid
sequence of the stress protein to induce the immune response
against the antigen. Analogous to the previous embodiment, vaccines
comprising at least one tumor-associated antigen and one stress
protein, either in the form of mixtures of tumor-associated antigen
and stress protein, conjugates of tumor-associated antigen and
stress protein or fusion proteins containing tumor-associated
antigen and stress protein sequences, can stimulate cell-mediated
cytolytic immune responses against the tumor-associated antigen in
mammals. Alternatively, the antigen and the stress protein can be
administered consecutively. As demonstrated in the examples, a
vaccine of this type, a fusion protein containing a minimal P1A
mastocytoma antigen and a stress protein, induces a cell-mediated,
cytolytic response against cells displaying the P1A antigen.
Moreover, mammalian animals immunized with the vaccine are immune
against a subsequent challenge with tumor cells expressing the P1A
antigen.
[0038] In the present invention, the composition is comprised of
two moieties: a stress protein and an antigen against which an
immune response is desired. The two moieties are mixed, conjugated
or joined and can form a single unit. Conjugation can be achieved
by chemical means known to those skilled in the art (e.g. through a
covalent bond between the stress protein and the second moiety;
reductive amination) or by recombinant techniques. If recombinant
techniques are used to link or connect the two moieties, the result
is a recombinant fusion protein which includes the stress protein
and the antigen in a single molecule. This makes it possible to
produce and purify a single recombinant molecule in the vaccine
production process. The stress protein can be conjugated to any
antigen against which the cell mediated, cytolytic immune response
is desired or to a portion of the antigen sufficient to induce an
immune response in an individual to whom it is administered.
[0039] As defined herein the term "vaccine" includes compositions
which can be used as a prophylactic or a therapeutic vaccine. In
one embodiment, the vaccine composition is one or more nucleic
acids which encode the antigen and the stress protein. The present
invention also relates to use of the compositions which are nucleic
acids encoding a stress protein and/or the antigen for preventing
or treating a disease or condition associated with or caused by the
presence of the antigen (e.g., tumor antigen), or a pathogen (e.g.,
bacteria, virus, parasite) which includes the antigen, in a mammal.
For example, the compositions described herein can be used to
induce an immune response against an influenza virus in a mammal
not infected with the virus. In addition, the vaccines or
compositions described herein can be used to induce an immune
response against an influenza virus in a mammal infected with an
influenza virus, and can result in amelioration or elimination of
the disease state caused by the infecting influenza virus in the
mammal. As used herein "induction of an immune response" means an
increased immune response (more than undetectable or more than
before); or a response that is superior to that achievable by
immunization, under comparable conditions, with antigen alone.
[0040] As described herein, an antigen (one or more per stress
protein) preferably is of a peptidic nature, i.e., it is a protein,
polypeptide or peptide. In applications in which antigen and stress
protein are admixed or chemically linked, the antigen can also be a
carbohydrate, lipid, glycolipid or organic or inorganic molecule.
As used herein an "antigen" includes peptides or polypeptides which
comprises at least one CTL epitope. A CTL epitope is defined as
either a class I-restricted T cell epitope or a class II-restricted
T cell epitope. The antigen for use in the present invention can be
isolated, purified (essentially pure), chemically synthesized or
recombinantly produced. Other suitable antigens useful in the
compositions of the present invention can be determined by those of
skill in the art.
[0041] In the embodiment in which the vaccine or composition
induces a cell-mediated, cytolytic immune response to an influenza
virus, antigens of the influenza virus include but are not limited
to hemagglutinin, whole virus, (e.g., inactivated or live,
attenuated whole virus), an antigenic portion of an influenza virus
and recombinantly produced virus or portions thereof. An antigen of
the influenza virus includes peptides or polypeptides which
comprises at least one B cell and/or T cell (e.g., T helper cell,
cytolytic T cell) epitope. For example, an antigen of the influenza
virus includes, but is not limited to hemagglutinin (HA, e.g., HA1,
HA7), nucleoprotein (e.g., NP, such as NP-b and NP-D described in
the examples), neuramidase (NA), M1, M2 PB1, PB2 and PA. Other
antigens of an influenza virus which can be used in the
compositions of the present invention can be determined by those of
ordinary skill in the art.
[0042] In the embodiment in which the vaccine or composition
induces a cell-mediated, cytolytic immune response against a
tumor-associated antigen, antigens include, but are not limited to,
MAGE1, MAGE3, BAGE and GAGE. These proteins are normally expressed
in testis. Ectopic expression gives rise to a variety of tumors
including melanomas. Also included in this list are melanocyte
differentiation antigens Tyrosinase, MART-1/MELAN-1 and gp
100/pMel17 as well as tyrosinase-related protein pg75 and MUM-1,
all of which are associated with melanomas. Other useful
tumor-associated antigens are HER2/neu found in breast and ovarian
tumors, MUC-1 found in epithelial cell tumors, and human
papillomavirus proteins E6 and E7 which are associated strongly
with cervical tumors. Additional antigens include GnT-V,
beta-catenin, CDK4 and p15. All these tumor-associated antigens are
recognized by T cells. (Wang, R.-F. and Rosenberg, S. A., Journal
of Leukocyte Biology, 60:296-309 (1996); Houghton, A. N., J. Exp.
Med., 180:1-4 (1994); Henderson, R. A. and Finn, O. J., Advances of
Immunology, 62:217-256).
[0043] The important players in allergic (atopic) and asthmatic
disease are IgE and local inflammatory reactions dominated by the
infiltration of eosinophils. Pulmonary hyperreactivity to
nonspecific stimuli due to chronic inflammation is the modern
definition of asthma. This inflammation may be cause by abnormal
allergic responses to natural or artificial antigens mediated by
IgE and leads to a chronic cellular infiltration of granular cells
called eosinophils. The release of mediators from resident mast
cells and recruited basophils and eosinophils is thought to be the
cause of the inflammation and subsequent hyperreactivity. In man,
as in other species, any inflammatory reaction produces local
hyperreactivity. However, in asthma the inflammation is chronic,
leading to life-threatening hyperreactivity unless treated
appropriately. Current treatment includes the use of
corticosteroids to reduce the inflammation and bronchodilators such
as albuterol (beta agonists) for prompt symptomatic relief.
[0044] In humans as in mice, two distinct patterns of cytokine
secretion have been defined among CD4.sup.+ helper T cell clones
(del Prete, G., Allergy, 47:450-455 (1992)). Human type 1 helper
(Th1) but not type 2 helper (Th2) cells produce interleukin-2
(IL-2), gamma interferon and tumor necrosis factor beta. Th2 cells
but not Th1 cells secrete IL-4 and IL-5 but not IL-2 or gamma
interferon. Other cytokines such as IL-3, IL-6, GM-CSF or tumor
necrosis factor alpha are produced by both Th1 and Th2 cells. The
different cytokine patterns are associated with different
functions. In general, Th2 cells provide an excellent helper
function for B cell antibody production, particularly of the IgE
class. Th1 cells are responsible for delayed hypersensitivity
reactions and are cytolytic for autologous antigen presenting cells
including B cells. Most allergen- or helminth-antigen specific
human CD4.sup.+ T cell clones exhibit a Th2 phenotype while most
clones specific for bacterial antigens show a Th1 profile. Allergen
specific Th2 cells seem to play a crucial role in atopy. These
cells induce IgE production via IL-4I and favor the proliferation,
differentiation and activation of eosinophils via IL-5. In
addition, Th2 derived IL-3, IL-4 and IL-13 are mast cell growth
factors that act in synergy, at least in vitro. There is evidence
that allergen-specific Th2 cells are selectively enriched in
tissues affected by allergic inflammation such as the bronchial
mucosa of humans with allergic asthma.
[0045] With the increasing use of antibiotics in early childhood in
the developed world, the incidence of and deaths due to (allergic)
asthma are rising. The following discussion is using this
information that links increased incidence and severity of allergic
reactions to a lack of exposure and T cell memory for bacterial
proteins including stress proteins to support the notion that
deliberate exposure to bacterial antigens including stress proteins
will dampen allergic responses.
[0046] Many scientists believe that the development of resistance
or sensitivity to environmental antigens depends on the nature of
immunological memory generated during early antigen encounters in
infancy and early childhood (Holt P. G., Toxicol Lett.,
86:205-210). This process appears to be antigen driven. Selection
is for specific Th1 versus Th2 like memory cells within individual
immune responses to inhaled antigens, a process which occurs in the
regional lymph nodes draining the conducting airways. This
selection appears to be regulated by a variety of cytokines
produced by antigen specific CD4.sup.+ and CD8.sup.+ T cells. This
T cell selection process can theoretically be influenced by
infectious agents: infections in the airway mucosa may mobilize and
activate local tissue (alveolar) macrophages which migrate to the
regional lymph nodes and secrete Th2 inhibitory cytokines such as
IL-12 and alpha-interferon. In addition, they may add to the
gamma-interferon levels in the milieu through activation of natural
killer cells. The net result is the production of CTLs (which are
predominantly CD8.sup.+ cells). Gamma-interferon inhibits the
generation of Th2 cells and therefore production of IL-4 and IL-5,
cytokines crucial for the generation of humoral (IgE) and cellular
(eosinophils, basophils and mast cells) allergic responses
(Anderson, G. P. and Coyle, A. J., Trends Pharmacol. Sci.,
15:324-332 (1995); Stam, W. B., van Oosterhout, A. J. and Nijkamp,
F. P., Life Sci., 53:1921-1934 (19939)).
[0047] In mammals, stress proteins have been shown to induce
humoral as well as cellular immune responses. As shown in the
examples herein, when soluble antigen mixed with, chemically
conjugated to or fused to a stress protein is administered to a
mammal, cell-mediated cytolytic immune responses are substantially
enhanced. These responses are largely due to CD8.sup.+ T cells.
Therefore, a comparison of the CD4.sup.+ responses to antigens by
themselves to those mixed with or coupled to stress proteins give
the predicted profile: soluble antigens mixed with or linked to
stress proteins yield a high proportion of CTLs (mainly CD8.sup.+ T
cells) which are a measure of stimulation of the Th1 pathway
described before because these CTLs arose as a result of the
induction of antigen specific T cells of the Th1 type. These Th1
cells produce gamma-interferon, which cytokine inhibits Th2 cells.
Therefore, the Th2 cytokines IL-4 and IL-5 are no longer available
to support the production of IgE and eosinophils. With decreasing
titer of IgE, direct antigenic stimulation of mast and basophil
cells will decline. In addition, decreased IL-5 production will
lead to decreased production, differentiation and activation of
eosinophils. This pattern will cause decreased inflammation of the
involved tissue and result in less hyperreactive (asthmatic)
events.
[0048] Therefore, administration of mixtures of known allergenic
antigens (allergens) and stress proteins or compositions containing
allergens chemically linked to or fused to stress proteins should
influence the Th1 to Th2 ratio in atopic patients, restoring a more
normal balance and leading to decreased allergy or asthma. Stress
proteins used in such compositions are preferably of bacterial or
mycoplasmic origin. Allergens used in allergen-stress protein
fusion proteins are necessarily of a peptidic nature; nonpeptidic
allergens can be used in conjugates containing an allergen and a
stress protein or a mixtures of allergen and stress protein.
Nonlimiting examples for allergens include Fel d 1 (cat); Amb a 1
(antigen E), Amb a 2 (antigen K) (ragweed); Der f 2, Der p 1, Der p
9, Der f 1 (mites); Bla g 1, Bla g 2 (cockroach); Bet v 1 (birch);
Rat n 1 (rat); Cha o 1 (Japanese cypress); Hev b 5 (latex); gp40
(mountain cedar). For a reasonably comprehensive list of allergens
up to the time of publication, see King, T. P. et al., Int. Arch.
Allergy Immunol., 105:224-233 (1994).
[0049] When compositions containing covalently linked or admixed
allergen and stress protein are administered by a suitable route
such as subcutaneous or intramuscular injection or even given by
inhalation to a patient in need of treatment for hypersensitivity
reactions, they should produce a decrease in allergic symptoms as
measured by the classic hyperreactivity test in asthma, for
example. After treatment, the patient will exhibit less nonspecific
reactivity. In asthmatics, or in animal models of asthma,
hyperreactivity is measured by determining the doses of inhaled
methacholine that induce a bronchoconstrictive response. Mammals
with chronic inflammatory conditions which lead to hyperreactivity
will exhibit greater sensitivity to methacholine challenge. They
will bronchoconstrict at lower doses than "normal" mammals. After
treatment with the appropriate stress protein-containing
composition, the dose response to methacholine would shift to less
sensitive.
[0050] Any suitable stress protein (heat shock protein (hsp)) can
be used in the compositions of the present invention. For example,
as described in the examples, hsp65 and/or hsp71 can be used.
Turning to stress proteins generally, cells respond to a stressor
(typically heat shock treatment) by increasing the expression of a
group of genes commonly referred to as stress, or heat shock,
genes. Heat shock treatment involves exposure of cells or organisms
to temperatures that are one to several degrees Celsius above the
temperature to which the cells are adapted. In coordination with
the induction of such genes, the levels of corresponding stress
proteins increase in stressed cells. As used herein, a "stress
protein," also known as a "heat shock protein" or "Hsp," is a
protein that is encoded by a stress gene, and is therefore
typically produced in significantly greater amounts upon the
contact or exposure of the stressor to the organism. A "stress
gene", also known as "heat shock gene" is used herein as a gene
that is activated or otherwise detectably unregulated due to the
contact or exposure of an organism (containing the gene) to a
stressor, such as heat shock or glucose deprivation or addition.
"Stress gene" also includes homologous genes within known stress
gene families, such as certain genes within the Hsp70 and Hsp90
stress gene families, even though such homologous genes are not
themselves induced by a stressor. Each of the terms stress gene and
stress protein as used in the present specification may be
inclusive of the other, unless the context indicates otherwise. In
addition to the increased expression of the Hsps, the cell
downregulates certain other genes, activates several kinases
involved in signal transduction, changes the intracellular locale
of certain proteins, and, in some situations, can experience
changes at the cytoskeletal level as well as transient growth
arrest.
[0051] In particular embodiments, the stress proteins for use in
the present invention are isolated stress proteins, which means
that the stress proteins have been selected and separated from the
host cell in which they were produced. Such isolation can be
carried out as described herein and using routine methods of
protein isolation known in the art. (Maniatis et al., Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y., 1982; Sambrook et al., Molecular Cloning:. A
Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press,
1989)). The isolated stress protein may also, further, be purified
(essentially pure) in accordance with the methods, particularly the
detergent purification methods.
[0052] In bacteria, the predominant stress proteins are proteins
with molecular sizes of about 70 and 60 kDa, respectively, that are
referred to as Hsp70 and Hsp60, respectively. These and other
specific stress proteins and the genes encoding them are discussed
further below. In bacteria, Hsp70 and Hsp60 typically represent
about 1-3% of cell protein based on the staining pattern using
sodium dodecyl sulfate polyacrylamide gel electrophoresis and the
stain coomassie blue, but accumulate to levels as high as 25% under
stressful conditions. Stress proteins appear to participate in
important cellular processes such as protein synthesis,
intracellular trafficking, and assembly and disassembly of protein
complexes. It appears that the increased amounts of stress proteins
synthesized during stress serve primarily to minimize the
consequences of induced protein unfolding. Indeed, the preexposure
of cells to mildly stressful conditions that induce the synthesis
of stress proteins affords protection to the cells from the
deleterious effects of a subsequent more extreme stress.
[0053] The major stress proteins appear to be expressed in every
organism and tissue type examined so far. Also, it appears that
stress proteins represent the most highly conserved group of
proteins identified to date. For example, when stress proteins in
widely diverse organisms are compared, Hsp90 and Hsp70 exhibit 50%
or higher identity at the amino acid level and share many
similarities at nonidentical positions.
[0054] The genes encoding stress proteins may be present in a
single copy or in multiple, non-identical copies in the genome of a
cell or organism. For example, the human genome has been shown to
contain at least one copy of an Hsp1OO gene, at least two different
Hsp90 genes, up to ten Hsp70 genes of which at least several are
non-identical copies, several T complex genes (Tcp genes) and at
least one gene encoding the related mitochondrial protein Hsp60, as
well as at least three copies of small Hsp genes encoding proteins
in the 20-30 kDa range of molecular size. In most groups of stress
genes there is at least one gene whose expression level is
relatively high and is either entirely constitutive or only mildly
heat shock-inducible. Furthermore, several groups of stress genes
include members that are not up-regulated by heat but by other cues
such as increased calcium levels, etc.
[0055] The stress proteins, particularly Hsp70, Hsp60, Hsp20-30 and
Hsp1O, are among the major determinants recognized by the host
immune system in the immune response to infection by Mycobacterium
tuberculosis and Mycobacterium leprae. Young, R. A., and Elliott,
T. J., Stress Proteins, Infection, And Immune Surveillance, Cell
50:5-8, (1989). Further, some rat arthritogenic T-cells recognize
Hsp60 epitopes. Van Eden, W., Thole, J., van der Zee, R., Noordzij,
A., van Embden, J., Hensen, E., and Cohen, I., Nature 331:171-173,
(1988). However, individuals, including healthy individuals, with
no history of mycobacterial infection or autoimmune disease also
carry T-cells that recognize both bacterial and human Hsp60
epitopes; a considerable fraction of T-cells in healthy individuals
that are characterized by expression of the gamma-delta T-cell
receptor recognize both self and foreign stress proteins. O'Brien,
R., Happ, M., Dallas, A., Palmer, E. Kubo, R., and Born, W., Cell
57:664-674 (1989). Thus, individuals, even healthy individuals
possess T-cell populations that recognize both foreign and self
stress protein epitopes.
[0056] This system of recognizing stress protein epitopes
constitutes an "early defense system" against invading organisms.
The system may be maintained by frequent stimulation by bacteria
and viruses that cause the host cells to upregulate their own
stress genes. However, the presence of autoreactive T-cells is
compatible with normal health and does not cause autoimmune
disease; this also demonstrates the safety of stress proteins
within an individual. The safety of stress proteins is additionally
demonstrated by the success and relative safety of BCG (Bacille
Calmette Guerin, a strain of Mycobacterium bovis) vaccinations,
which induce an immune response against stress proteins that is
also protective against Mycobacterium tuberculosis.
[0057] Stress genes and proteins for use in the present invention
are those well known in the art and include, for example,
HsplOO-200, Hsp1OO, Hsp90, Lon, Hsp70, Hsp60, TF55, Hsp40, FKBPs,
cyclophilins, Hsp20-30, C1pP, GrpE, HsplO, ubiquitin, calnexin, and
protein disulfide isomerases. Macario, A. J. L., Cold Spring Harbor
Laboratory Res. 25:59-70, 1995; Parsell, D. A., & Lindquist,
S., Ann. Rev. Genet. 27:437-496 (1993); U.S. Pat. No. 5,232,833
(Sanders et al.). A particular group of stress proteins includes
Hsp90, Hsp70, Hsp60, Hsp20-30, and ubiquitin, further preferably
Hsp70 and Hsp60.
[0058] A stress protein in the methods and compositions of the
present invention is preferably selected from extracellularly
antigen-presenting stress proteins or from stress proteins that are
processed and the resulting peptide fragments are presented on the
surface of the cell, such that it is an extracellularly
antigen-presenting protein. Additionally, a selected stress gene or
protein for use in the present invention is preferably selected
such that the stress gene or protein is unregulated pursuant to one
or more forms of stress in at least one expression, preferably a
bacterium or a human. Further preferably, the selected stress genes
or proteins are unregulated in humans, including by stressors such
as those described above or transformation.
[0059] Hsp1OO-200 examples include Grp170 (for glucose-regulated
protein), Grp170 resides in the lumen of the ER, in the pre-golgi
compartment, and may play a role in immunoglobulin folding and
assembly.
[0060] Hsp1OO examples include mammalian Hsp11O, yeast Hsp 104,
c1pA, c1pB, c1pC, c1pX and c1pY. Yeast Hsp104 and E. coli c1pA,
form hexameric and E. coil c1pB, tetrameric particles whose
assembly appears to require adenine nucleotide binding. C1p
protease provides a 750 kDa heterooligomer composed of C1pP (a
proteolytic subunit) and of C1pA. C1pB-Y are structurally related
to C1pA, although unlike C1pA they do not appear to complex with
C1pP.
[0061] Hsp90 examples include HtpG in E. coli, Hsp83 and Hsc83
yeast, and Hsp90', Hsp90.beta. and Grp94 in humans. Hsp90 binds
groups of proteins, which proteins are typically cellular
regulatory molecules such as steroid hormone receptors (e.g.,
glucocorticoids, estrogen, progesterone, and testosterone),
transcription factors and protein kinases that play a role in
signal transduction mechanisms. Hsp90 proteins also participate in
the formation of large, abundant protein complexes that include
other stress proteins.
[0062] Lon is a tetrameric protein functioning as an ATP-dependent
protease degrading non-native proteins in E. coli.
[0063] Hsp70 examples include Hsp72 and Hsp73 from mammalian cells,
DnaK from bacteria, particularly mycobacteria such as Mycobacterium
leprae, Mycobacterium tuberculosis, and Mycobacterium bovis (such
as Bacille-Calmette Guerin), DnaK from Escherichia coli, yeast, and
other prokaryotes, and BiP and Grp78.
[0064] Hsp70 is capable of specifically binding ATP as well as
unfolded polypeptides and peptides, thereby participating in
protein folding and unfolding as well as in the assembly and
disassembly of protein complexes.
[0065] Hsp60 examples include Hsp65 from mycobacteria. Bacterial
Hsp60 also commonly known as GroEL, such as the GroEL from E. coli.
Hsp60 forms large homooligomeric complexes, and appears to play a
key role in protein folding. Hsp60 homologues are present in
eukaryotic mitochondria and chloroplasts.
[0066] TF55 examples include Tcp1, TRiC and thermosome. The
proteins are typically occur in the cytoplasm of eukaryotes and
some archaebacteria, and form multi-membered rings, promoting
protein folding. They are also weakly homologous to Hsp60.
[0067] Hsp40 examples include DnaJ from prokaryotes such as E.
coli, and mycobacteria and HSJ1, HDJ1 and Hsp40. Hsp40 plays a role
as a molecular chaperone in protein synthesis, thermotolerance and
DNA replication, among other cellular activities.
[0068] FKBPs examples include FKBP12, FKBP13, FKBP25, and FKBP59,
Fpr1 and Nep1. The proteins typically have peptidyl-prolyl
isomerase activity and interact with immunosuppressants such as
FK506 and rapamycin. The proteins are typically found in the
cytoplasm and the endoplasmic reticulum.
[0069] Cyclophilin examples include cyclophilins A, B and C. The
proteins have peptidyl-prolyl isomerase activity and interact with
the immunosuppressant cyclosporin A. The protein cyclosporin A
binds calcineurin (a protein phosphatase). Hsp20-30 examples
include .alpha.-crystallin, and Hsp20-30 is also referred to as
small Hsp. Hsp20-30 is typically found in large homooligomeric
complexes or, possibly, also heterooligomeric complexes where an
organism or cell type expresses several different types of small
Hsps. Hsp20-30 interacts with cytoskeletal structures, and may play
a regulatory role in the polymerization/depolymerization of actin.
Hsp20-30 is rapidly phosphorylated upon stress or exposure of
resting cells to growth factors.
[0070] C1pP is an E. coli protease involved in degradation of
abnormal proteins. Homologues of C1pP are found in chloroplasts.
C1pP forms-a heterooligomeric complex with C1pA.
[0071] GrpE is an E. coli protein of about 20 kDa that is involved
in both the rescue of stress-damaged proteins as well as the
degradation of damaged proteins. GrpE plays a role in the
regulation of stress gene expression in E. coli. HsplO examples
include GroES and CpnlO. HsplO is typically found in E. coli and in
mitochondria and chloroplasts of eukaryotic cells. HsplO forms a
seven-membered ring that associates with Hsp60 oligomers. HsplO is
also involved in protein folding.
[0072] Ubiquitin has been found to bind proteins in coordination
with:the proteolytic removal of the proteins by ATP-dependent
cytosolic proteases.
[0073] In particular embodiments, the stress proteins of the
present invention are obtained from enterobacteria, mycobacteria
(particularly M. leprae. M. tuberculosis and M. bovis, E. coli,
yeast, Drosophila, vertebrates, avians, chickens, mammals, rats,
mice, primates, or humans.
[0074] The stress proteins may be in the form of acidic or basic
salts, or in neutral form. In addition, individual amino acid
residues may be modified by oxidation or reduction. Furthermore,
various substitutions, deletions, or additions may be made to the
amino acid or nucleic acid sequences, the net effect of which is to
retain or further enhance the increased biological activity of the
mutant. Due to code degeneracy, for example, there may be
considerable variation in nucleotide sequences encoding the same
amino acid sequence. The present invention is also suitable for use
with stress protein fragments or peptides obtained from stress
proteins, provided such fragments or peptides include the
conformational epitopes involved with enhancing the immune response
to the chosen antigen. Stress protein fragments may be obtained by
fragmentation using proteinases, or by recombinant methods, such as
the expression of a portion of a stress protein-encoding nucleotide
sequence (either alone or as fusions with another protein).
Peptides may also be produced by such methods, or by chemical
synthesis. The present invention is also suitable for use with a
stress protein fused or conjugated to a second protein, which may
or may not be a stress protein. The stress proteins may include
mutations introduced at particular loci by a variety of known,
techniques. See, e.g., Sambrook et al., Molecular Cloning: 4
Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press,
1989; Drinkwater and Klinedinst, PNAS 83:3402-3406, 1986; Liao and
Wise Gene 88:107-111, 1990'); Horwitz et al., Genome 3:112-117,
1989.
[0075] The term "sufficiently homologous to the amino acid sequence
of the stress protein" means that the amino acid sequence of the
protein or polypeptide will generally show at least 40% identity
with the stress protein amino acid sequence; in some cases, the
amino acid sequence of a functional equivalent exhibits
approximately 50% identity with the amino acid sequence of the
stress protein.
[0076] Methods of identifying a gene or a protein under
consideration as a stress gene or protein are well known in the
art. For example, the conservation of the genes and proteins of a
particular stress protein group permits comparison of the
nucleotide or amino acid sequence of the gene/protein under
consideration with well known stress genes such as DnaK, GroEL or
DnaJ, e.g., by nucleic acid hybridization or nucleic acid or amino
acid sequencing followed by computer comparison analysis. Voellmy,
R., et al., PNAS 82:4949-4953 (1985). Alternatively, an assay may
be used to identify and/or discriminate between essential
structural features and/or functional properties of a selected
stress protein. For example, an expression library may be screened
using anti-Hsp antibodies and other assays well known in the art.
Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold
Spring Harbor Laboratory Press, (1988). In addition, the biological
activity of a given stress protein group may be exploited. Guidon,
P. T., and Hightower, L. E., Biochem., 25:3231-3239 (1986). For
example, Hsp70 is capable of specifically binding ATP as well as
unfolded polypeptides and peptides in the assembly of protein
complexes. Thus, mixing a protein under consideration with a sample
comprising appropriate polypeptides, peptides, or ATP, followed by
determination of the presence or absence of production of
protein-protein or protein-nucleic acid complexes indicates the
apparent presence or absence of an Hsp70 gene or protein, which
presence or absence can be confirmed utilizing other assays such as
antibody-based assays.
[0077] An effective dosage of the stress proteins of the present
invention as vaccines, to elicit specific cellular and humoral
immunity to stress proteins, or to substances conjugated to the
stress proteins, such as proteins or oligosaccharides, is in the
range of 0.1 to 1000 ug hsp per injection, depending on the
individual to whom the stress protein is being administered
(Lussow, A. R., et al., Eur. J. Immun., 21:2297-2302 (1991);
Barrios, C. et al., Eur. J. Immun., 22:1365-1372 (1992)). The
appropriate dosage of the stress protein for each individual will
be determined by taking into consideration, for example, the
particular stress protein being administered, the type of
individual to whom the stress protein is being administered, the
age and size of the individual, the condition being treated or
prevented and the severity of the condition. Those skilled in the
art will be able to determine using no more than routine
experimentation, the appropriate dosage to administer to an
individual.
[0078] The stress protein, stress protein portion, stress protein
functional equivalent and the antigen to which the stress protein
is admixed, fused or conjugated, present in the vaccine can be
produced or obtained using known techniques. For example, the
stress protein and/or the antigen of influenza virus can be
obtained (isolated) from a source in which it occurs in nature, can
be produced by cloning and expressing a gene encoding the desired
stress protein or the antigen or can be synthesized chemically or
mechanically.
[0079] The compositions described herein can be used to induce an
immune response against a variety of pathogens (e.g., bacteria,
virus, parasite). The composition comprising an antigen of the
influenza virus and all or a portion of one or more stress proteins
or all or a portion of a protein having an amino acid sequence
sufficiently homologous to the amino acid sequence of the stress
protein to induce the immune response against the antigen can be
used to induce an immune response to an influenza virus in any
vertebrate (e.g., mammals, fowl) susceptible to an influenza virus.
For example, the compositions can be used to induce an immune
response against an influenza virus in primates (e.g., humans),
horses, swine, turkeys and chickens.
[0080] The compositions described herein can be administered to a
host in a variety of ways. The routes of administration include
intradermal, transdermal (e.g., slow release polymers),
intramuscular, intraperitoneal, intravenous, subcutaneous, oral,
epidural and intranasal routes. Any other convenient route of
administration can be used, for example, infusion or bolus
injection or absorption through epithelial or mucocutaneous
linings. In addition, the compositions described herein can be
administered together with other components or biologically active
agents (e.g., alum), pharmaceutically acceptable surfactants (e.g.,
glycerides), excipients (e.g., lactose), carriers, diluents and
vehicles.
[0081] Further, the stress protein and/or peptidic antigen can be
administered by in vivo expression of polynucleotides encoding such
into a mammalian subject. That is, a vector can be used to deliver
nucleic acid(s) encoding an antigen and a stress protein or a
nucleic acid encoding a fusion protein containing antigen and
stress protein sequences. For example, the stress protein and/or
the antigen can be administered to host (mammal) using live vectors
wherein the live vectors containing stress protein and antigen
nucleic acid sequences are administered under conditions in which
the antigen and/or the stress protein are expressed in vivo. For
example, a mammal can be injected with a vector which encodes and
expresses an antigen in vivo in combination with a stress protein
in protein or peptide form, or in combination with a vector which
codes for and expresses a stress protein in vivo. Alternatively, a
host can be injected with a vector which encodes and expresses
stress protein in vivo in combination with an antigen in peptide or
protein form, or in combination with a vector which encodes and
expresses an antigen in vivo. A single vector containing the
sequences encoding a protein (peptide) antigen can also be used for
the compositions of the present invention.
[0082] Several expression vector systems are available commercially
or can be reproduced according to recombinant DNA and cell culture
techniques. For example, vector systems such as the yeast or
vaccinia virus expression systems, or virus vectors can be used in
the methods and compositions of the present invention (Kaufman, R.
J., A J. of Meth. in Cell and Molec. Biol., 2:221-236 (1990)).
Other techniques using naked plasmids or DNA, and cloned genes
encapsidated in targeted liposomes or in erythrocytes ghosts, can
be used to introduce the stress protein and/or antigen
polynucleotides into the host (Freidman, T., Science, 244:1275-1281
(199); Rabinovich, N. R., et al., Science, 265:1401-1404 (1994)).
The construction of expression vectors and the transfer of vectors
and nucleic acids into various host cells can be accomplished using
genetic engineering techniques, as described in manuals like
Molecular Cloning and Current Protocols in Molecular Biology, which
are hereby incorporated by reference, or by using commercially
available kits (Sambrook, J., et al., Molecular Cloning, Cold
Spring Harbor Press, 1989; Ausubel, F. M., et al., Current
Protocols in Molecular Biology, Greene Publishing Associates and
Wiley-Interscience, 1989)).
[0083] The amount of stress protein and/or antigen in the
compositions of the present invention is an amount which produces
an effective immunostimulatory response in the host (vertebrate
such as mammal). An effective amount is an amount such that when
administered, it results in an enhanced immune response relative to
the immune response when not administered. That is, an effective
amount is an amount that provides a more pronounced immune response
than similar amounts of the antigen or the stress proteins alone.
In addition, the amount of stress protein and/or antigen
administered to the host will vary depending on a variety of
factors, including the antigen employed, the size, age body weight,
general health, sex, and diet of the host, and the time of
administration, duration or particular qualities of the influenza
virus. Adjustment and manipulation of established dose ranges are
well within the ability of those skilled in the art. For example,
the amount of stress protein and antigen can be from about 100 ug
to about 1 g, preferably about 1 mg to about 1 g, and from about 1
mg to about 100 mg.
[0084] The present invention teaches that the presence of a stress
protein greatly stimulates the cell-mediated cytolytic response to
an antigen. Although tumor-associated antigens have been
identified, the immune responses against these antigens alone are
not therapeutically effective. Enhancement of the cellular response
against these antigens by means of co-administration of a stress
protein, either in a mixture or linked to antigen, is beneficial in
cancer therapy. This expectation is supported by the observation
detailed in the examples that a composition of the present
invention immunizes a mammalian animal against a subsequent tumor
challenge. Enhancement of the cell-mediated, cytolytic response
against an antigen is predicted to result in the downregulation of
a preexisting (Th2-mediated) humoral response against the same
antigen. The present invention is therefore also useful for
suppressing allergic responses. Finally, T cell-mediated immunity
is also considered to be an important element in the mammalian
host's defense against infections caused by viruses, protozoa and
certain intracellular bacteria such as mycobacteria. As is shown in
the examples, compositions (mixtures, conjugates and fusion
proteins) of the present invention including a stress protein and
an influenza virus antigen are effective in eliciting a substantial
cell-mediated cytolytic response against mammalian cells expressing
the viral antigen.
[0085] The present invention is illustrated by the following
examples, which are not intended to be limiting in any way.
EXAMPLES
Example 1
Isolation of Recombinant Stress Proteins
[0086] A. Recombinant Mycobacterial Hsp70. Plasmid Y3111 contains
an M. tuberculosis Hsp70 gene functionally inserted between
expression control sequences. (Mehlert, A. and Young, D. B., Mol.
Microbiol., 3:125-130 (1989). E. coli strain CG2027 (obtained from
C. Georgopoulos, University of Geneva, Switzerland) containing a
truncated Hsp70 gene was transformed with plasmid Y3111 by standard
procedures. (Maniatis, et al., Molecular Cloning, A Laboratory
Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
(1982)).
[0087] Bacteria containing plasmid Y3111 were grown overnight in
2.times.YT medium (20 g Tryptone, 10 g yeast extract, 10 g NaCl per
liter) containing 100 microgram/ml ampicillin at 37.degree. C.,
with agitation (250 rpm). A 10% glycerol stock was prepared from
this culture and was stored at -70.degree. C. Several scrapings
from the frozen glycerol stock were used to inoculate a large
culture that was incubated as before for about 48 h. When the
optical density at 590 nm reached 2.5 to 3.5, cells were collected
by centrifugation.
[0088] The following steps were performed at 4.degree. C. Cell
pellets were resuspended in 3 ml per gram of lysis buffer. The
composition of lysis buffer was 10 mM Tris-HCl, 2 mM
ethylenediamine tetraacetate (EDTA), 5 mM beta-mercaptoethanol, 10
microgram/ml aprotinin, 10 microgram/ml leupeptin, and 1
microgram/ml pepstatin. Lysozyme was added to the cell suspension
to a final concentration of 0.14 mg/ml. The suspension was then
frozen at -70.degree. C.,
[0089] The cell suspension was thawed, and cells were broken by
sonication. Sonicates were subjected to centrifugation at 17,000
rpm for 30 min. (JA-17 rotor, Beckmann). Solid (NH.sub.4).sub.204
was added to the supernatant solution until that solution was 65%
saturated with (NH.sub.4).sub.2SO4. After a 30 min. incubation, the
mixture was centrifuged as before. The pellet was dissolved in Q
SEPHAROSE buffer A. To this solution were added 10 microgram/ml
aprotinin, 10 microgram/ml leupeptin, and 1 microgram/mil
pepstatin, and the solution was dialyzed overnight against 65
volumes of Q SEPHAROSE buffer A. Q SEPHAROSE buffer A contained 30
mM Tris-HCl (pH 7.5), 1 mM EDTA, 5 mM beta-mercaptoethanol. The
dialyzed solution was clarified by centrifugation as described
before.
[0090] Dialyzed solution was applied to a Q SEPHAROSE column
(Pharmacia) equilibrated in Q SEPHAROSE buffer A. The column was
washed with 2 volumes of the same buffer. Elution was with a 0 to
600 mM NaCl gradient. Fractions were tested by SDS-PAGE and
staining with Coomassie Blue for the presence of a major 71 kDa
polypeptide (i.e., the recombinant M. tuberculosis Hsp70 protein).
Fractions containing the polypeptide were pooled, and the pool was
brought to 65% saturation by the addition of solid
(NH.sub.4).sub.2SO4. The mixture was centrifuged as described
before, the pellet was dissolved in ATP Start buffer (50 mM
Tris-HCl (pH 8.0), 20 mM NaCl, 5 mM MgCl.sub.2, 15 mM
beta-mercaptoethanol and 0.1 mM EDTA), and the resulting protein
solution dialyzed overnight against 65 volumes of the same buffer
and clarified by centrifugation.
[0091] The dialyzed protein solution was then applied to an
ATP-agarose column (Fluka) equilibrated in ATP Start buffer. The
column was washed with 1 column volume of ATP Start buffer with 1 M
NaCl. Elution was achieved with ATP Start buffer supplemented with
10 mM ATP. The eluate was brought to 65% saturation with
(NH.sub.4).sub.2SO4, and precipitated protein was collected as
described before. The centrifugation pellet was dissolved in and
dialyzed against 200 volumes of Blue SEPHAROSE buffer (30 mM
Tris-HCl (pH 7.5), 5 mM MgCl.sub.2, 5 mM beta-mercaptoethanol).
[0092] The dialyzed protein solution from the last step was applied
to a Blue SEPHAROSE column (Pharmacia) equilibrated Blue
SEPHAROSE-buffer. The column was washed with 1.5 column volumes of
the same buffer. The flow-through and was fractions were collected
as a single pool.
[0093] The purity of the final preparation was assessed by SDS-PAGE
and Coomassie Blue staining, by western blot analysis (Maniatis, et
al., Molecular Cloning, A Laboratory manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. (1982); (see Sambrook et al.,
Molecular Cloning: A Laboratory manual, 2.sup.nd ed., Cold Spring
Harbor Laboratory press, NY (1989)) using mouse monoclonal
antibodies specific for mycobacterial Hsp70 and E. coli. Hsp70,
respectively, and by assays of ATPase activity. Preparations are
typically more than 90% pure based on the staining pattern of the
preparation in coomassie blue stained gels, and preferably more
than 95% pure, and contained less than 1% of E. coli Hsp60 and no
detectable E. coli Hsp70.
[0094] B. Mycobacterial Hsp60
[0095] Plasmid RIB1300 contains an M. bovis BCG Hsp60 gene
functionally inserted between expression control sequences. (Thole,
J. E. R., et al., J. Exp. Med., 178:343-348 (1993). E. coli strain
M1546 was transformed with plasmid RIB1300 (Thole, J. E. R.,
supra.) using standard procedures. Maniatis, et al., Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor laboratory, Cold
Spring Harbor, N.Y. (1982).
[0096] An inoculum of bacteria containing plasmid RIB1300 was grown
to saturation in NCZYM medium (10 g N-Z Amine A, 5 g Bacto yeast
extract, 1 g Casamino acids, 5 g NaCl, 2 g
(NH.sub.4).sub.2SO.sub.4-7H.sub.2O) per liter) containing 200
microgram/ml of ampicillin at 28.degree. C. and under agitation.
This culture was used to inoculate a larger culture which was grown
under the same conditions as the inoculum culture until the optical
density of the culture was between 0.3 to 0.6 at an optical density
of 590 nm. Production of the recombinant protein was initiated by
rapidly raising the temperature of the culture to 42.degree. C. by
incubation in a hot water bath. The culture was maintained at this
temperature for 3 h. The bacteria were then collected by
centrifugation and resuspended in 6 volumes per weight of bacterial
pellet of lysis buffer. Lysis buffer contained 10 mM Tris-JCL (pH
8.0), 10 mM ethylenediamine tetraacetate (EDTA), 0.1 mM PMSF and
0.1% RIVM BA (0.104 g 4-amino-benzamidine-2HCl, 0.066 g
epsilon-amino caproic acid per 50 ml). Lysozyme was added to a
concentration of 0.1 mg/ml, and the suspension was frozen at
-70.degree. C.
[0097] The bacterial suspension was thawed and placed at 4.degree.
C. The following operations were at this temperature. Complete
lysis of bacteria was achieved by sonication. The sonicate was
centrifuged at 17,000 rpm for 30 min in a JA-17 rotor (Beckman).
Saturated (NH.sub.4).sub.2SO.sub.4 was added to the supernatant
solution until 20% saturation wa achieved. Precipitates were
removed by centrifugation (see above) and were discarded. The
supernatant solution was brought to 55% saturation by the addition
of saturated (NH.sub.4).sub.2SO.sub.4. The pellet resulting from
the subsequent centrifugation was dissolved in TE buffer (10 mM
Tris-HCl (pH 8.0), 15 mM beta-mercaptoethanol, 1 mM EDTA). The
protein solution in TE was then dialyzed against 50 volumes of TE
buffer.
[0098] After centrifugation (as above) to remove precipitated
material, the dialyzed protein solution was applied to a DEAE
SEPHAROSE (Pharmacia) column. After washing with TE buffer,
proteins were eluted with a 0-300 mM NaCl gradient in TE buffer.
Fractions containing an M. bovis BCG Hsp60 (actual apparent
molecular weight equal to 65 kDa), were identified by SDS-PAGE and
Coomassie Blue staining and were pooled. 10 microgram/ml aprotinin,
10 microgram/ml leupeptin, and 1 microgram/ml pepstatin were added
to the pool which was then concentrated in an Amicon cell using a
YM30 membrane.
[0099] The concentrated pool was applied to a S-200 SEPHACRYL
(Pharmacia) column equilibrated with S200 buffer (10 mM
Na.sub.2HP0.sub.4 (pH 6.8), 150 mM NaCl and 15 mM
beta-mercaptoethanol). Elution was with the same buffer. Fractions
were tested for the presence of mycobacterial Hsp60 as before, and
positive fractions containing highly purified protein were pooled
and dialyzed overnight against HAP buffer (10 mM Na.sub.2HP0.sub.4
(pH 6.8), 15 mM beta-mercaptoethanol).
[0100] The dialyzed pool was applied to a hydroxyapatite (Bio-Rad;
Bio-Gel HTP Gel) column equilibrated in HAP buffer. The column was
washed with 3 column volumes of 1 mN MgCl.sub.2 and 15 mM
beta-mercaptoethanol and then with 1 mM Na.sub.2HP0.sub.4 (pH 6.8)
and 15 mM beta-mercaptoethanol. Protein was eluted with a 10-60 mM
phosphate gradient. Fractions were tested as before, and positive
fractions were pooled, concentrated and exchanged into 0.85% NaCl
by means of gel filtration through PD10. The purity of
mycobacterial Hsp60 was assessed by SDS-PAGE and Coomassie Blue
staining as well as by western blot analysis using antibodies
specific for E. coli Hsp70 and Hsp60. Preparations were typically
more than 90% pure, and contained no more than 0.5% of E. coli
Hsp60 and 0.1-0.2.% E. coli Hsp70, respectively.
[0101] Hsp preparations can be depyrogenated either by affinity
chromatography on DetoxiGel resin, addition of polymyxin B or
(least preferably) by extraction with detergents such as Triton
X-114.
Example 2
CTL response to a Composition Comprising a Mixture of an NP Peptide
and hsp70
[0102] a. Preparation of hsp70 and NP peptide Hsp 70, here M.
tuberculosis hsp71, was prepared as described in example 1. NP
peptide (referred to herein as NP.B; Motal, U. M. A., et al., Eur.
J. Immunol., 25:1121-1124 (1995) and references therein) with the
amino acid sequence VQLASNENMETM (SEQ ID NO: 1) corresponding to
residues 363-374 in the complete NP and containing a known CTL
epitope (H-2b-restricted) was produced synthetically (0.25 mM
scale) on an Applied Biosystems model 431A peptide synthesizer
using Fmoc (9-fluorenylmethyloxycarbonyl) as the alpha-amino
protective group and HMP (Wang) resin as the solid support. All
amino acid and synthesis chemicals were purchased from Applied
biosystems.
[0103] NP.B was cleaved off the support and side-chain-protecting
groups were removed by incubating under continuous agitation
NP.B-resin for 3 h in 2 ml of a mixture prepared by combining 10 ml
trifluoroacetic acid, 0.5 ml water, 0.75 g crystalline phenol, 0.25
ml ethanedithiol and 0.5 ml thioanisole. The cleavage mixture was
filtered into 40 ml of ice cold diethyl ether. Insoluble material
was collected by centrifugation at 5000.times.g for 8 min. Ether
was decanted and the pellet washed three times by resuspension in
cold diethyl ether followed by centrifugation. After the last wash
the pellet was air-dried, taken up in distilled water and
lyophilized.
[0104] b. Immunization of Mice and Preparation of Effector
Cells
[0105] NP.B peptide was dissolved in a small volume of Dulbecco's
PBS (DPBS; 2.7 mM KH.sub.2PO.sub.4, 4.3 mM Na.sub.2HP0.sub.4, 2.7
mM KCl, 0.137 M NaCl). 1.89, 18.9 or 189 microgram aliquots,
respectively, of peptide NP.B were mixed with 10.0 microgram
aliquots of hsp71 in DPBS to obtain compositions with molar ratios
of peptide:hsp of 1, 10, or 100, respectively. Groups of four
female mice of strain C57BL/6 were either left unimmunized
(control) or were injected subcutaneously in the nape of the neck
with the three different NP.B-hsp71 mixtures. After seven days, the
mice were euthanized by cervical dislocation, and their spleens
were removed. Single cell suspensions of pooled spleens were
prepared and washed once in `complete medium`, which was RPMI-1640
medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine,
1 mM sodium pyruvate, 50 uM 2-mercaptoethanol and 50 ug/ml
gentamycin sulfate. Lymphoid cells were restimulated by culturing
25.times.10.sup.6 viable cells with NP.B peptide at a 0.1 umolar
concentration for five days. Cultures were incubated in upright 25
cm2 flasks with 10 ml complete medium at 37.degree. C. and 5% CO2.
The cultures (effector cells) were then used in the CTL activity
assay described below.
[0106] c. CTL Activity Assay
[0107] EL4 cells (H-2b) were used as target cells. Cells were
incubated for 90 min with 150 uCi Na.sub.2Cr0.sub.4 and 10 ug NP.B
peptide per 10.sup.6 cells. Following extensive washing to remove
excess radiolabel, 10.sup.4 labeled target cells were co-cultured
with restimulated effector cells at various effector:target cell
ratios. After 4-5 hours of incubation, culture plates were
centrifuged for 5 min at 200.times.g, and 100 ul aliquots of
supernatant solutions containing radiolabel released from cells
were collected into Beckman Ready Caps. Radioactivity was measured
by liquid scintillation counting. To determine spontaneously
released and total releasable radioactivity, supernatant solutions
from cultures containing target cells only or from target cells
lysed by the addition of Triton X-100 were collected, and
radioactivity determined as before. Results were expressed as %
specific lysis, calculated based on the following formula:
Percent Specific
lysis=100.times.(cpmtest-cpmspont)/(cpmtotal-cpmspont),
[0108] wherein cpmtest is the radioactivity released from a
particular co-culture, cpmspont is the spontaneously released
radioactivity of a target cell culture and cpmtotal is the
radioactivity released by Triton X-100 lysis of target cells. CTL
assays were performed in triplicate, and averaged value were
provided.
[0109] Results of the experiment are shown in FIG. 1. The control
reaction, i.e., assay of chromium release of a co-culture of target
cells and effector cells prepared from unimmunized mice, provides a
background value for lysis of about 10% at an effector:target cell
ratio of 100. No enhancement of CTL activity over background was
observed with effector cells from mice immunized with 1:1 or 10:1
NP.B-hsp71 mixtures. Greatly enhanced lysis was found with effector
cells from mice immunized with a 100:1 mixture of NP.B peptide and
hsp71, demonstrating that co-immunization with a peptide such as
NP.B and an hsp such as hsp71 can drastically stimulate CTL
activity against cells displaying the peptide. Note that, as is
well known in the field, immunization with NP.B peptide in DPBS
alone does not stimulate CTL activity.
Example 3
CTL Response to a Composition Comprising a Chemical Conjugate of an
NP Peptide and hsp70
[0110] a. Preparation of hsp70 and NP Peptide
[0111] M. tuberculosis hsp71 was prepared as described in Example
1. NP.B peptide was synthesized as discussed in Example 2, except
that the peptide contained an extra amino-terminal cysteine residue
and, thus, had the amino acid sequence CVQIASNENMETM (SEQ ID NO:
2).
[0112] b. Chemical Conjugation of Np.B Peptide to hsp70 and
Diphtheria Toxoid
[0113] Conjugations were carried out with both hsp70 and, to
provide a standard for comparisons of efficacies of specific
stimulation of CTL activity, commonly used carrier protein
diphtheria toxoid (abbreviated DT; DT was obtained from a
commercial source).
[0114] b.1. Activation of M. tuberculosis hsp71 and DT Carrier
Proteins
[0115] Nine mg of hsp71 were dissolved in 4.5 ml of 0.1 M sodium
borate buffer, pH 8.0. Sulfo-MBS
(m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester) (2.3 mg in 100
ul dimethyl sulfoxamine) was added to the protein, and the reaction
mixture was incubated for 1 hour at room temperature. The pH was
then adjusted to 6.0, and the reaction mixture dialyzed overnight
at 4.degree. C. against 1 liter of 20 mM sodium phosphate and 150
mM NaCl, pH 5.6. DT was similarly treated.
[0116] b.2. Preparation of NP.B Peptide for Conjugation
[0117] For each conjugation reaction, 3 mg of peptide was dissolved
in 100 ul of 0.1 M beta-mercaptoethanol. After 1 hour of incubation
to allow reduction of the peptide, reducing agent was removed by
drying the reaction mixture in a SpeedVac centrifuge. Peptide was
redissolved in 0.5 ml distilled water to which 5 ul aliquots of 1 N
NaOH were added until the peptide was fully dissolved. For
conjugation experiments with DT, 6 mg of peptide were reduced and
then redissolved in 1 ml of water.
[0118] b.3. Conjugate Formation
[0119] The pH of the activated carrier protein solutions was
adjusted to 6.8 using 0.1 N NaOH. Solution containing 3 mg of
activated carrier protein was reacted with 0.5 ml of reduced
peptide solution (or 1 ml of reduced peptide solution for the
preparation of conjugates with DT) for 3 hours at room temperature
with continuous mixing. To remove unreacted peptide, the resulting
conjugate-containing solution was dialyzed overnight at 4.degree.
C. against 1 liter of 20 mM sodium phosphate and 150 mM NaCl, pH7.
Protein concentration was determined by BCA assay. The efficiency
of conjugation achieved by this procedure had been determined in
prior pilot experiments using radiolabeled NP.B peptide. The
peptide:protein ratio was found to be 17.5 for NP.B-hsp71 conjugate
(71.NP) and 10.1 for NP.B-DT (DT.NP).
[0120] C. Immunization of Mice and Preparation of Effector
Cells
[0121] Immunizations with 1-100 ug of 71.NP and DT.NP conjugates
and preparation of effector cells were performed as described in
Example 2.
[0122] d. CTL Activity Assay
[0123] Assays were performed as described in Example 2.
RESULTS
[0124] Results obtained are displayed in FIG. 2. CTL activity
assays with effector cells from mice injected with DPBS or with 1
or 10 ug of DT.NP conjugate gave negative results (lowest line FIG.
2). Only effector cells injected with 100 ug of DT.NP produced
measurable (between 5 and 10% lysis at an effector:target cell
ratio of 100) CTL activity that was comparable to that of effector
cells from mice immunized with 1 ug of 71.NP. Assays with effector
cells from mice immunized with 10 or 100 ug of 71.NP conjugate
showed substantially greater CTL activity i.e., between 15 and 25%
target cell lysis at an effector:target cell ratio of 100. This
experiment demonstrates on the example of the NP.B peptide and
hsp71 that immunization with a peptide-hsp conjugate stimulates
specific CTL activity directed against cells displaying the
peptide.
Example 4
CTL Response to a Composition Comprising an hsp-NP Fusion
Protein
[0125] a. Preparation of hsp-NP Fusion Proteins
[0126] a.1. Preparation of Expression Plasmids Encoding Fusion
proteins Containing NP CTL Epitopes at the carboxy terminus of
Mycobacterial hsp65
[0127] Plasmids expressing as part of hsp65 fusion proteins
influenza virus NP sequences including the H-2b CTL epitope NP.B
(see above) or the H-2.sup.d CTL epitope NP.D (residues 147-155 of
NP; Levi, R. and Arnon, R., Vaccines, 14:85-92 (1996) and
references therein) were constructed.
[0128] An expression vector, pET65 mp, derived from a pET system
plasmid (Novagen) and containing a complete M. bovis BCG hsp65 gene
and useful restriction sites for insertion of additional coding
sequences at the carboxy terminus of the hsp65.gene was previously
constructed. A schematic representation of this vector is provided
in FIG. 3.
[0129] Construct pNP/cA containing the open reading frame of NP of
influenza virus strain A/PR/8/34 under the control of the
cytomegalovirus promoter provided by plasmid pcDNA1(Invitrogen) was
obtained from Dr. Peter Palese (Dept. Of Microbiology, Mount Sinai
School of Medicine, New York, N.Y.).
[0130] Two primer pairs for amplification of fragments containing
the NP.B and NP.D epitopes were synthesized on an automated
oligonucleotide synthesizer and were purified using routine
procedures. Forward primers contained, in addition to appropriate
sequences complementary to NP sequences, an EcoRI restriction site,
and reverse primers a SpeI restriction site. The forward primer for
the NP.D fragment had the sequence 5' AAAGAAGAATTCAGGCGAATC (SEQ ID
NO: 3), and the reverse primer the sequence 5'
GTTCCGATCACTAGTCCCACG (SEQ ID NO: 4). This pair was designed to
amplify a fragment containing NP residues 117-200. The forward
primer for the NP.B fragment had the sequence 5'
CTGCTTGAATTCAGCCAAGTG (SEQ ID NO: 5), and the reverse primer the
sequence 5' CTGTTGACTAGTGTTTCCTCC (SEQ ID NO: 6). The latter pair
was designed to produce a fragment containing NP residues
310-395.
[0131] Polymerase chain reactions (PCR) were carried out using the
above primer pairs and pNP/cA as the DNA template. PCR fragments
were double-digested with restriction endonucleases EcoRI and SpeI
and ligated to EcoRI/SpeI-cut pET65 mp using routine subcloning
procedures (Maniatis et al., Molecular Cloning, A Laboratory
Manual, Cold Spring-Harbor Lab., Cold Spring Harbor, N.Y. (1989)).
Transformation-competent cells of E. coli strain DH5alpha were
transformed with the ligation mixtures and plated out on agar
containing 100 ug/ml ampicillin. Colonies of transformed cells were
isolated, and plasmid DNA prepared and analyzed for the presence of
the correct hsp65-NP.B or D fusion gene sequence by restriction
mapping and nucleotide sequencing. Correct constructs encoding
hsp65-NP.B (pET65 mp/B) and hsp65-NP.D (pET65 mp/D) fusion proteins
were identified and were used in subsequent manipulations aimed at
expression of fusion proteins in bacteria and their purification.
See FIGS. 4A-4B for schematic representations of the fusion protein
gene constructs, pET65MP/NP-B and pET65MP/NP-D, respectively.
[0132] a.2. Expression and Purification of hsp65-NP Fusion
Proteins
[0133] Fusion protein constructs were transformed into E. coli
strain BL21 (DE3; Novagen), and fusion proteins were expressed in 6
liter cultures of the latter strain, using a protocol closely
similar to the supplier's suggested protocol. Cells were harvested
by centrifugation, suspended in 10 mM Tris-HCl, 2 mM EDTA, and 5 mM
beta-mercaptoethanol, pH 7.5 and lysed by sonication. After
removing insoluble material by centrifugation, ammonium sulfate was
added to 20% saturation, and precipitating proteins were collected
by centrifugation. The presence of fusion protein in the ammonium
sulfate pellet was verified by SDS-PAGE followed by Coomassie blue
staining. The same assay was used to monitor all subsequent
purification steps. Protein was redissolved in 30 mM Tris-HCl, 2 mM
EDTA and 5 mM beta-mercaptoethanol, pH 7.5, and the solution was
exhaustively dialyzed against the same buffer before being applied
to a DEAE Sepharose (fast flow, Pharmacia Biotech) column
equilibrated in the same buffer. The flow-through fraction (unbound
protein) was collected which typically contained about 90 mg of
protein. To further purify hsp65-NP.B fusion protein, 60 mg of the
latter fraction was dialyzed against 10 mM sodium phosphate, pH 6.8
and then applied to a hydroxyapatite (BIORAD) column equilibrated
in the same buffer. Elution was performed using a 0-600 mM
potassium phosphate gradient. This procedure resulted in the
recovery of only about 5 mg protein. The column was then further
eluted with 4 M guanidinium hydrochloride which removed another 15
mg of protein. The fractions were dialyzed against DPBS and
concentrated using an Amicon ultrafiltration device, before being
applied to a Detoxiel column for flow-through depyrogenation. To
further purify hsp65-NP.D fusion protein, DEAE Sepharose
flow-through fraction was dialyzed against 30 mM sodium acetate, 2
mM EDTA, and 5 mM beta-mercaptoethanol, pH 5.8-7.5 and then applied
to an SP Sepharose (fast flow, Pharmacia Biotech) column
equilibrated in the same buffer. Elution was with a 0-600 mM NaCl
gradient. Eluted hsp65-NP.D fusion protein was processed as
described for hsp65-NP.B fusion protein. Fusion proteins purified
by these procedures were more than 90% pure as estimated from
stained SDS-PAGE gels and were substantially pyrogen-free.
[0134] b. Immunization of Mice and Preparation of Effector
Cells
[0135] Immunizations with DPBS (referred to in FIGS. 5 & 6 as 0
ug 65-NP) or 1-100 ug of hsp65.-NP.B or hsp65-NP.D fusion proteins
and preparation of effector cells were performed essentially as
described in Example 2, except that C57BL/6 mice were used in
experiments with hsp65-NP.B, and BALB/c mice in experiments with
hsp65-NP.D. In vitro restimulation was carried out over a period of
seven days, either in the absence or in the presence of 3 U/ml of
recombinant human IL2 (to generally stimulate T cell
proliferation).
[0136] c. CTL Assays
[0137] Assays were performed essentially as described in Example 2,
except that EL4 (H-2b) target cells were used in experiments with
hsp65-NP.B fusion protein and P815 (H-2.sup.d) target cells in
experiments with hsp65-NP.D fusion protein. To provide an
additional control for the specificity of the CTL response, target
cells were either pulsed with the appropriate NP peptide (closed
symbols in FIGS. 5A-5B & 6A-6B), were pulsed with the
irrelevant residue 49-to-57-peptide derived from the sequence of
the HPV16E7 protein (open symbols in FIGS. 5A-5B) or were not
pulsed (open symbols in FIGS. 6A-6B).
[0138] The results of experiments with hsp65-NP.B fusion protein
(labeled 65-P.b) are shown in FIGS. 5A-5B. FIG. 5A refers to an
experiment in which effector cells were restimulated in the
absence, and FIG. 5B refers to an experiment in which effector
cells were restimulated in the presence of IL2. As is evident from
FIG. 5A, immunization with hsp65-NP.B fusion protein results in a
dramatic stimulation of specific CTL activity directed against
target cells displaying the NP.B peptide, ranging from about 20 to
40% lysis of target cells at an effector:target cell ratio of 100.
Essentially no specific lysis was observed with effector cells from
DPBS-"immmunized" animals. Also, no significant lysis of
E7-peptide-pulsed cells was evident. In the experiment with
effector cells restimulated in the presence of IL2, even higher
levels of target cell lysis were observed with effector cells from
hsp65-NP.B fusion protein-immunized mice. Levels ranged from about
25 to 60% at an effector:target cell ratio of 100, depending on the
fusion protein dose. These values greatly exceed the 10-15% lysis
observed with effector cells from DPBS-injected mice. Again, no
significant (greater than that observed with effector cells from
DPBS-"immunized" mice), specific lysis of E7 peptide-pulsed target
cells was observed.
[0139] Results of experiments with hsp65-NP.D fusion protein
(labeled 65-NP.D) are shown in FIGS. 6A-6B. Generally, these
results are similar to those obtained in experiments with the
hsp65-NP.B fusion protein. Note that, unlike in the previous
experiment with hsp65-NP.B, a clear dependence on the dose of
hsp65-NP.D peptide used in immunization was observed in this
experiment. Together, these experiments, using hsp65-NP fusion
proteins as examples, demonstrate that immunization with an
hsp-foreign peptide/polypeptide fusion protein results in a drastic
stimulation of CTL activity directed against appropriate target
cells displaying epitopes contained in the foreign
peptide/polypeptide fusion partner.
Example 5
CTL Responses to an hsp-P1A Fusion Protein
[0140] Using procedures similar to those used in the preceding
example, a plasmid was constructed that permitted expression in E.
coli of a fusion gene containing the complete coding sequence of M.
tuberculosis stress protein hsp71 and, added to the carboxy end of
the hsp71 sequence, four tandemly arranged copies of a synthetic
sequence encoding the minimal CTL epitope of tumor-associated
antigen P1A (LPYLGWLVP (SEQ ID NO: 7); this seuqence is referred to
as P1A in this example). Hsp71-P1A fusion protein (referred to as
71-P1A(4) in FIGS. 7A, 7B, 8A, 8B and 9) was expressed and purified
using standard biochemical methods similar to those used in the
preceding example.
[0141] BALB/c or DBA/2 (H-2.sup.d) mice were anesthetized by
intraperitoneal injection of ketamine hydrochloride. The mice were
then immunized subcutaneously in the nape of the neck with 0, 5, 50
or 500 .mu.g of hsp71-P1A fusion protein. The immunogen was
administered in DPBS without adjuvant. One week later, single cell
suspensions form four pooled spleens per group were prepared and
restimulated in vitro for 7 days with synthetic peptide
CKKKLPYLGWLVP (SEQ ID NO: 8) (1 .mu.M). Note that the CKKK residues
were added to enhance the aqueous solubility of the P1A nonamer.
Restimulated effector cells were then cultured for 4-5 hours with
.sup.51Cr-labelled target cells. Targets were cells of the P1A
antigen-expressing clone P1 (H-2.sup.d) of the P815 mastocytoma,
or, alternatively, L1210 cells (H-2.sup.d) pulsed with (CKKK) P1A
or, as control targets, unpulsed L1210 cells at effector:target
ratios of 100, 33 or 11:1. Specific lysis of target cells was
determined as described in Example 2. The results of these
experiments are represented in FIGS. 7A-7B (BALB/c mice) and 8A-8B
(DBA/2 mice). Background lysis in these experiments was less that
5%, as indicated by the lytic activity observed against irrelevant
target cells (unpulsed L1210 cells). Restimulated cells from
unimmunized mice (0 .mu.g) exhibited no lytic activity against
either P1 target cells (FIGS. 7A, 8A) or CKKK (P1A)-pulsed L1210
cells (FIGS. 7B, 8B). Cells from mice immunized with as little as 5
.mu.g of hsp71-P1A fusion protein exhibited measurable lytic
activity, with the maximal response seen in cells from mice
immunized with 50-500 .mu.g.
Example 6
Tumor Challenge of Mice Immunized with hsp71-P1A Fusion Protein
[0142] Mice were immunized as in the preceding example, except that
three injections were given at intervals of two weeks. Two weeks
after the final injection, the mice were challenged by
intraperitoneal injection of 1000 viable P1 tumour cells. After 26
days, the mice were euthanized, weighed, and the entire mass of
abdominal contents was dissected and weighed. The results of this
experiment are shown in FIG. 9. It was observed that in mice given
three 50 .mu.g immunizations with hsp71-P1A fusion protein, the
mass of the abdominal contents, as expressed as a percentage of the
total body weight, was significantly less than that found in
unimmunized mice (0 .mu.g, P<0.03), and similar to that observed
in mice which were not injected with tumor cells (control).
[0143] Together, the experiments in Examples 5 and 6 demonstrate
that immunization with hsp-tumor-associated antigen, using
hsp71-P1A as the example, results in substantial stimulation of CTL
activity directed against cells displaying irrelevant MHC class
I-restricted epitopes. Further, such immunization leads to the
expression of a relevant effector function, namely immunity against
challenge with a tumor expressing the antigen immunized
against.
EQUIVALENTS
[0144] Those skilled in the art will know, or be able to ascertain,
using no more than routine experimentation, many equivalents to the
specific embodiments of the invention described herein. These and
all other equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
8 1 12 PRT Artificial Sequence Synthetically generated peptide 1
Val Gln Leu Ala Ser Asn Glu Asn Met Glu Thr Met 1 5 10 2 13 PRT
Artificial Sequence Synthetically generated peptide 2 Cys Val Gln
Ile Ala Ser Asn Glu Asn Met Glu Thr Met 1 5 10 3 21 DNA Artificial
Sequence Primer 3 aaagaagaat tcaggcgaat c 21 4 21 DNA Artificial
Sequence Primer 4 gttccgatca ctagtcccac g 21 5 21 DNA Artificial
Sequence Primer 5 ctgcttgaat tcagccaagt g 21 6 21 DNA Artificial
Sequence Primer 6 ctgttgacta gtgtttcctc c 21 7 9 PRT Artificial
Sequence Synthetically generated peptide 7 Leu Pro Tyr Leu Gly Trp
Leu Val Pro 1 5 8 13 PRT Artificial Sequence Synthetically
generated peptide 8 Cys Lys Lys Lys Leu Pro Tyr Leu Gly Trp Leu Val
Pro 1 5 10
* * * * *