U.S. patent application number 11/091969 was filed with the patent office on 2005-09-08 for nematode atp synthase subunit e-like sequences.
This patent application is currently assigned to Divergence, Inc. a Delaware corporation. Invention is credited to Kloek, Andrew P., Salmon, Brandy, Williams, Deryck Jeremy.
Application Number | 20050198695 11/091969 |
Document ID | / |
Family ID | 34622455 |
Filed Date | 2005-09-08 |
United States Patent
Application |
20050198695 |
Kind Code |
A1 |
Williams, Deryck Jeremy ; et
al. |
September 8, 2005 |
Nematode ATP synthase subunit E-like sequences
Abstract
Nucleic acid molecules from nematodes encoding ATP synthase
subunit E polypeptides are described. ATP synthase subunit E-like
polypeptide sequences are also provided, as are vectors, host
cells, and recombinant methods for production of ATP synthase
subunit E-like nucleotides and polypeptides. Also described are
screening methods for identifying inhibitors and/or activators, as
well as methods for antibody production.
Inventors: |
Williams, Deryck Jeremy;
(St. Louis, MO) ; Salmon, Brandy; (Durham, NC)
; Kloek, Andrew P.; (St. Louis, MO) |
Correspondence
Address: |
FISH & RICHARDSON PC
225 FRANKLIN ST
BOSTON
MA
02110
US
|
Assignee: |
Divergence, Inc. a Delaware
corporation
|
Family ID: |
34622455 |
Appl. No.: |
11/091969 |
Filed: |
March 28, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11091969 |
Mar 28, 2005 |
|
|
|
10160362 |
May 30, 2002 |
|
|
|
6903190 |
|
|
|
|
60294777 |
May 31, 2001 |
|
|
|
Current U.S.
Class: |
800/8 ; 435/199;
435/320.1; 435/325; 435/69.1; 435/7.22; 530/388.26; 536/23.2 |
Current CPC
Class: |
G01N 33/573 20130101;
C07K 14/4354 20130101; G01N 2500/04 20130101 |
Class at
Publication: |
800/008 ;
435/006; 435/069.1; 435/199; 435/320.1; 435/325; 530/388.26;
536/023.2 |
International
Class: |
A01K 067/00; C12Q
001/68; C07H 021/04; C07K 016/40; C12N 009/22 |
Claims
1-42. (canceled)
43. A method comprising: (a) providing a polypeptide comprising the
amino acid sequence of a nematode ATP synthase subunit E, the
polypeptide having ATP synthase subunit E activity; (b) contacting
the polypeptide with a test compound; and (c) measuring the binding
of the test compound to the polypeptide.
44. The method of claim 43, further comprising: (d) measuring the
ATP synthase subunit E activity of the polypeptide in the presence
of the test compound.
45. The method of claim 43, further comprising: (d) providing a
second polypeptide, wherein the second polypeptide comprises the
amino acid sequence of a mammalian or plant ATP synthase subunit E
and has ATP synthase subunit E activity; (e) contacting the second
polypeptide with a test compound; and (f) measuring the binding of
the test compound to the second polypeptide.
46. A method comprising: (a) providing a polypeptide comprising the
amino acid sequence of a nematode ATP synthase subunit E, the
polypeptide having ATP synthase subunit E activity; (b) contacting
the polypeptide with a test compound; and (c) measuring a ATP
synthase subunit E activity of the polypeptide, wherein a change in
ATP synthase subunit E activity of the polypeptide in the presence
of the test compound relative to the ATP synthase subunit E
activity of the polypeptide in the absence of the test compound is
an indication that the test compound alters the ATP synthase
subunit E activity of the polypeptide.
47. The method of claim 46, further comprising: (d) providing a
second polypeptide, wherein the second polypeptide comprises the
amino acid sequence of a mammalian or ATP synthase subunit E and
has ATP synthase subunit E activity; (e) contacting the second
polypeptide with the test compound; and (f) measuring a ATP
synthase subunit E activity of the second polypeptide in the
presence of the test compound.
48. The method of claim 43 or 46 wherein the polypeptide comprising
the amino acid sequence of a nematode ATP synthase subunit E
comprises an amino acid sequence that is at least 70% identical to
the amino acid sequence of SEQ ID NO: 4.
49. The method of claim 48 wherein the polypeptide comprising the
amino acid sequence of a nematode ATP synthase subunit E comprises
an amino acid sequence that is at least 80% identical to the amino
acid sequence of SEQ ID NO: 4.
50. The method of claim 48 wherein the polypeptide comprising the
amino acid sequence of a nematode ATP synthase subunit E comprises
an amino acid sequence that is at least 90% identical to the amino
acid sequence of SEQ ID NO: 4.
51. The method of claim 48 wherein the polypeptide comprising the
amino acid sequence of a nematode ATP synthase subunit E comprises
an amino acid sequence that is at least 95% identical to the amino
acid sequence of SEQ ID NO: 4.
52. The method of claim 43 or 46 wherein the polypeptide comprising
the amino acid sequence of a nematode ATP synthase subunit E
comprises an amino acid sequence selected from the group consisting
of SEQ ID NOs: 4, 5, and 6.
Description
RELATED APPLICATION INFORMATION
[0001] This application claims priority to provisional application
Ser. No. 60/294,777, filed May 31, 2001, which is hereby
incorporated by reference.
BACKGROUND
[0002] Nematodes (derived from the Greek word for thread) are
active, flexible, elongate, organisms that live on moist surfaces
or in liquid environments, including films of water within soil and
moist tissues within other organisms. While only 20,000 species of
nematode have been identified, it is estimated that 40,000 to 10
million actually exist. Some species of nematodes have evolved as
very successful parasites of both plants and animals and are
responsible for significant economic losses in agriculture and
livestock and for morbidity and mortality in humans (Whitehead
(1998) Plant Nematode Control., CAB International, New York).
[0003] Nematode parasites of plants can inhabit all parts of
plants, including roots, developing flower buds, leaves, and stems.
Plant parasites are classified on the basis of their feeding habits
into the broad categories: migratory ectoparasites, migratory
endoparasites, and sedentary endoparasites. Sedentary
endoparasites, which include the root knot nematodes (Meloidogyne)
and cyst nematodes (Globodera and Heterodera) induce feeding sites
and establish long-term infections within roots that are often very
damaging to crops (Whitehead, supra). It is estimated that
parasitic nematodes cost the horticulture and agriculture
industries in excess of $78 billion worldwide a year, based on an
estimated average 12% annual loss spread across all major crops.
For example, it is estimated that nematodes cause soybean losses of
approximately $3.2 billion annually worldwide (Barker et al. (1994)
Plant and Soil Nematodes: Societal Impact and Focus for the Future.
The Committee on National Needs and Priorities in Nematology.
Cooperative State Research Service, US Department of Agriculture
and Society of Nematologists). Several factors make the need for
safe and effective nematode controls urgent. Continuing population
growth, famines, and environmental degradation have heightened
concern for the sustainability of agriculture, and new government
regulations may prevent or severely restrict the use of many
available agricultural anthelmintic agents.
[0004] The situation is particularly dire for high value crops such
as strawberries and tomatoes where chemicals have been used
extensively to control soil pests. The soil fumigant methyl bromide
has been used effectively to reduce nematode infestations in a
variety of these specialty crops. It is however regulated under the
U.N. Montreal Protocol as an ozone-depleting substance and is
scheduled for elimination in 2005 in the US (Carter (2001)
Califonia Agriculture, 55(3):2). It is expected that strawberry and
other commodity crop industries will be significantly impacted if a
suitable replacement for methyl bromide is not found. Presently
there are a very small array of chemicals available to control
nematodes and they are frequently inadequate, unsuitable, or too
costly for some crops or soils (Becker (1999) Agricultural Research
Magazine 47(3):22-24; U.S. Pat. Nos. 6,048,714). The few available
broad-spectrum nematicides such as Telone (a mixture of
1,3-dichloropropene and chloropicrin) have significant restrictions
on their use because of toxicological concerns (Carter (2001)
California Agriculture 55(3):12-18).
[0005] Fatty acids are a class of natural compounds that have been
investigated as alternatives to the toxic, non-specific
organophosphate, carbamate and fumigant pesticides (Stadler et al.
(1994) Planta Medica 60(2):128-132; U.S. Pat. Nos. 5,192,546;
5,346,698; 5,674,897; 5,698,592; 6,124,359). It has been suggested
that fatty acids derive their pesticidal effects by adversely
interfering with the nematode cuticle or hypodermis via a detergent
(solubilization) effect, or through direct interaction of the fatty
acids and the lipophilic regions of target plasma membranes (Davis
et al. (1997) Journal of Nematology 29(4S):677-684). In view of
this general mode of action it is not surprising that fatty acids
are used in a variety of pesticidal applications including as
herbicides (e.g., SCYTHE by Dow Agrosciences is the C9 saturated
fatty acid pelargonic acid), as bactericides and fungicides (U.S.
Pat. Nos. 4,771,571; 5,246,716) and as insecticides (e.g., SAFER
INSECTICIDAL SOAP by Safer, Inc.).
[0006] The phytotoxicity of fatty acids has been a major constraint
on their general use in agricultural applications (U.S. Pat. No.
5,093,124) and the mitigation of these undesirable effects while
preserving pesticidal activity is a major area of research. The
esterification of fatty acids can significantly decrease their
phytotoxicity (U.S. Pat. Nos. 5,674,897; 5,698,592; 6,124,359).
Such modifications can however lead to dramatic loss of nematicidal
activity as is seen for linoleic, linolenic and oleic acid (Stadler
et al. (1994) Planta Medica 60(2): 128-132) and it may be
impossible to completely decouple the phytotoxicity and nematicidal
activity of pesticidal fatty acids because of their non-specific
mode of action. Perhaps not surprisingly, the nematicidal fatty
acid pelargonic acid methyl ester (U.S. Pat. Nos. 5,674,897;
5,698,592; 6,124,359) shows a relatively small "therapeutic window"
between the onset of pesticidal activity and the observation of
significant phytotoxicity (Davis et al. (1997) J. Nematol.
29(4S):677-684). This is the expected result if both the
phytotoxicity and the nematicidial activity derive from the
non-specific disruption of plasma membrane integrity. Similarly the
rapid onset of pesticidal activity seen with many nematicidal fatty
acids at therapeutic concentrations (U.S. Pat. Nos. 5,674,897;
5,698,592; 6,124,359) suggests a non-specific mechanism of action,
possibly related to the disruption of membranes, action potentials
and neuronal activity.
[0007] Ricinoleic acid, the major component of castor oil, provides
another example of the unexpected effects esterification can have
on fatty acid activity. Ricinoleic acid has been shown to have an
inhibitory effect on water and electrolyte absorption using everted
hamster jejunal and ileal segments (Gaginella et al. (1975) J.
Pharmacol. Exp. Ther. 195(2):355-61) and to be cytotoxic to
isolated intestinal epithelial cells (Gaginella et al. (1977) J.
Pharmacol. Exp. Ther. 201(1):259-66). These features are likely the
source of the laxative properties of castor oil which is given as a
purgative in humans and livestock. In fact, castor oil is a
component of some deworming protocols because of its laxative
properties. In contrast, the methyl ester of ricinoleic acid is
ineffective at suppressing water absorption in the hamster model
(Gaginella et al. (1975) J. Pharmacol. Exp. Ther.
195(2):355-61).
[0008] The macrocyclic lactones (e.g., avermectins and milbemycins)
and delta-toxins from Bacillus thuringiensis (Bt) are chemicals
that, in principle, provide excellent specificity and efficacy and
should allow environmentally safe control of plant parasitic
nematodes. Unfortunately, in practice, these two approaches have
proven less effective for agricultural applications against root
pathogens. Although certain avermectins show exquisite activity
against plant parasitic nematodes these chemicals are hampered by
poor bioavailability due to their light sensitivity, degradation by
soil microorganisms and tight binding to soil particles (Lasota
& Dybas (1990) Acta Leiden 59(1-2):217-225; Wright & Perry
(1998) Musculature and Neurobiology. In: The Physiology and
Biochemistry of Free-Living and Plant-parasitic Nematodes (eds R.
N. Perry & D. J. Wright), CAB International 1998). Consequently
despite years of research and extensive use against animal
parasitic nematodes, mites and insects (plant and animal
applications), macrocyclic lactones (e.g., avermectins and
milbemycins) have never been commercially developed to control
plant parasitic nematodes in the soil.
[0009] Bt delta toxins must be ingested to affect their target
organ the brush border of midgut epithelial cells (Marroquin et al.
(2000) Genetics 155(4):1693-1699). Consequently they are not
anticipated to be effective against the dispersal, non-feeding,
juvenile stages of plant parasitic nematodes in the field. These
juvenile stages only commence feeding when a susceptible host has
been infected, thus to be effective nematicides may need to
penetrate the cuticle. In addition, soil mobility of a relatively
large 65-130 kDa protein--the size of typical Bt delta toxins--is
expected to be poor and delivery in planta is likely to be
constrained by the exclusion of large particles by the feeding tube
of certain plant parasitic nematodes such as Heterodera (Atkinson
et al. (1998) Engineering resistance to plant-parasitic nematodes.
In: The Physiology and Biochemistry of Free-Living and
Plant-parasitic Nematodes (eds R. N. Perry & D. J. Wright), CAB
International 1998).
[0010] Many plant species are known to be highly resistant to
nematodes. The most well documented of these include marigolds
(Tagetes spp.), rattlebox (Crotalaria spectabilis), chrysanthemums
(Chrysanthemum spp.), castor bean (Ricinus communis), margosa
(Azardiracta indica), and many members of the family Asteraceae
(family Compositae) (Hackney & Dickerson (1975) J. Nematol.
7(1):84-90). The active principle(s) for this nematicidal activity
has not been discovered in all of these examples and no
plant-derived products are sold commercially for control of
nematodes. In the case of the Asteraceae, the photodynamic compound
alpha-terthienyl has been shown to account for the strong
nematicidal activity of the roots. Castor beans are plowed under as
a green manure before a seed crop is set. However, a significant
drawback of the castor plant is that the seed contains toxic
compounds (such as ricin) that can kill humans, pets, and livestock
and is also highly allergenic.
[0011] There remains an urgent need to develop environmentally
safe, target-specific ways of controlling plant parasitic
nematodes. In the specialty crop markets, economic hardship
resulting from nematode infestation is highest in strawberries,
bananas, and other high value vegetables and fruits. In the
high-acreage crop markets, nematode damage is greatest in soybeans
and cotton. There are however, dozens of additional crops that
suffer from nematode infestation including potato, pepper, onion,
citrus, coffee, sugarcane, greenhouse ornamentals and golf course
turf grasses.
[0012] Nematode parasites of vertebrates (e.g., humans, livestock
and companion animals) include gut roundworms, hookworms, pinworms,
whipworms, and filarial worms. They can be transmitted in a variety
of ways, including by water contamination, skin penetration, biting
insects, or by ingestion of contaminated food.
[0013] In domesticated animals, nematode control or "de-worming" is
essential to the economic viability of livestock producers and is a
necessary part of veterinary care of companion animals. Parasitic
nematodes cause mortality in animals (e.g., heartworm in dogs and
cats) and morbidity as a result of the parasites' inhibiting the
ability of the infected animal to absorb nutrients. The
parasite-induced nutrient deficiency results in diseased livestock
and companion animals (i.e., pets), as well as in stunted growth.
For instance, in cattle and dairy herds, a single untreated
infection with the brown stomach worm can permanently stunt an
animal's ability to effectively convert feed into muscle mass or
milk.
[0014] Two factors contribute to the need for novel anthelmintics
and vaccines for control of parasitic nematodes of animals. First,
some of the more prevalent species of parasitic nematodes of
livestock are building resistance to the anthelmintic drugs
available currently, meaning that these products will eventually
lose their efficacy. These developments are not surprising because
few effective anthelmintic drugs are available and most have been
used continuously. Presently a number of parasitic species has
developed resistance to most of the anthelmintics (Geents et al.
(1997) Parasitology Today 13:149-151; Prichard (1994) Veterinary
Parasitology 54:259-268). The fact that many of the anthelmintic
drugs have similar modes of action complicates matters, as the loss
of sensitivity of the parasite to one drug is often accompanied by
side resistance--that is, resistance to other drugs in the same
class (Sangster & Gill (1999) Parasitology Today
15(4):141-146). Secondly, there are some issues with toxicity for
the major compounds currently available.
[0015] Human infections by nematodes result in significant
mortality and morbidity, especially in tropical regions of Africa,
Asia, and the Americas. The World Health Organization estimates 2.9
billion people are infected with parasitic nematodes. While
mortality is rare in proportion to total infections (180,000 deaths
annually), morbidity is tremendous and rivals tuberculosis and
malaria in disability adjusted life year measurements. Examples of
human parasitic nematodes include hookworm, filarial worms, and
pinworms. Hookworm is the major cause of anemia in millions of
children, resulting in growth retardation and impaired cognitive
development. Filarial worm species invade the lymphatics, resulting
in permanently swollen and deformed limbs (elephantiasis) and
invade the eyes causing African Riverblindness. Ascaris
lumbricoides, the large gut roundworm infects more than one billion
people worldwide and causes malnutrition and obstructive bowl
disease. In developed countries, pinworms are common and often
transmitted through children in daycare.
[0016] Even in asymptomatic parasitic infections, nematodes can
still deprive the host of valuable nutrients and increase the
ability of other organisms to establish secondary infections. In
some cases, infections can cause debilitating illnesses and can
result in anemia, diarrhea, dehydration, loss of appetite, or
death.
[0017] While public health measures have nearly eliminated one
tropical nematode (the water-borne Guinea worm), cases of other
worm infections have actually increased in recent decades. In these
cases, drug intervention provided through foreign donations or
purchased by those who can afford it remains the major means of
control. Because of the high rates of reinfection after drug
therapy, vaccines remain the best hope for worm control in humans.
There are currently no vaccines available.
[0018] Until safe and effective vaccines are discovered to prevent
parasitic nematode infections, anthelmintic drugs will continue to
be used to control and treat nematode parasitic infections in both
humans and domestic animals. Finding effective compounds against
parasitic nematodes has been complicated by the fact that the
parasites have not been amenable to culturing in the laboratory.
Parasitic nematodes are often obligate parasites (i.e., they can
only survive in their respective hosts, such as in plants, animals,
and/or humans) with slow generation times. Thus, they are difficult
to grow under artificial conditions, making genetic and molecular
experimentation difficult or impossible. To circumvent these
limitations, scientists have used Caenorhabidits elegans as a model
system for parasitic nematode discovery efforts.
[0019] C. elegans is a small free-living bacteriovorous nematode
that for many years has served as an important model system for
multicellular animals (Burglin (1998) Int. J. Parasitol. 28(3):
395-411). The genome of C. elegans has been completely sequenced
and the nematode shares many general developmental and basic
cellular processes with vertebrates (Ruvkin et al. (1998) Science
282: 2033-41). This, together with its short generation time and
ease of culturing, has made it a model system of choice for higher
eukaryotes (Aboobaker et al. (2000) Ann. Med. 32: 23-30).
[0020] Although C. elegans serves as a good model system for
vertebrates, it is an even better model for study of parasitic
nematodes, as C. elegans and other nematodes share unique
biological processes not found in vertebrates. For example, unlike
vertebrates, nematodes produce and use chitin, have gap junctions
comprised of innexin rather than connexin and contain
glutamate-gated chloride channels rather than glycine-gated
chloride channels (Bargmann (1998) Science 282: 2028-33). The
latter property is of particular relevance given that the
avermectin class of drugs is thought to act at glutamate-gated
chloride receptors and is highly selective for invertebrates
(Martin (1997) Vet. J. 154:11-34).
[0021] A subset of the genes involved in nematode specific
processes will be conserved in nematodes and absent or
significantly diverged from homologues in other phyla. In other
words, it is expected that at least some of the genes associated
with functions unique to nematodes will have restricted
phylogenetic distributions. The completion of the C. elegans genome
project and the growing database of expressed sequence tags (ESTs)
from numerous nematodes facilitate identification of these
"nematode specific" genes. In addition, conserved genes involved in
nematode-specific processes are expected to retain the same or very
similar functions in different nematodes. This functional
equivalence has been demonstrated in some cases by transforming C.
elegans with homologous genes from other nematodes (Kwa et al.
(1995) J. Mol. Biol. 246:500-10; Redmond et al. (2001) Mol.
Biochem. Parasitol. 112:125-131). This sort of data transfer has
been shown in cross phyla comparisons for conserved genes and is
expected to be more robust among species within a phylum.
Consequently, C. elegans and other free-living nematode species are
likely excellent surrogates for parasitic nematodes with respect to
conserved nematode processes.
[0022] Many expressed genes in C. elegans and certain genes in
other free-living nematodes can be "knocked out" genetically by a
process referred to as RNA interference (RNAi), a technique that
provides a powerful experimental tool for the study of gene
function in nematodes (Fire et al. (1998) Nature 391:806-811;
Montgomery et al. (1998) Proc. Natl. Acad. Sci. USA
95(26):15502-15507). Treatment of a nematode with double-stranded
RNA of a selected gene can destroy expressed sequences
corresponding to the selected gene thus reducing expression of the
corresponding protein. By preventing the translation of specific
proteins, their functional significance and essentiality to the
nematode can be assessed. Determination of essential genes and
their corresponding proteins using C. elegans as a model system
will assist in the rational design of anti-parasitic nematode
control products.
SUMMARY
[0023] The invention features nucleic acid molecules encoding
Meloidogyne javanica, Heterodera glycines, and Zeldia punctata ATP
synthase subunit E and other nematode ATP synthase subunit E-like
proteins. M. javanica is a Root Knot Nematode that causes
substantial damage to several crops, including cotton, tobacco,
pepper, and tomato. H. glycines, referred to as Soybean Cyst
Nematode, is a major pest of soybean. Z. punctata is free-living
nematode that serves as a model for parasitic nematodes. The ATP
synthase subunit E-like nucleic acids and polypeptides of the
invention allow for the identification of a nematode species, and
for the identification of compounds that bind to or alter the
activity of ATP synthase subunit E-like polypeptides. Such
compounds may provide a means for combating diseases and
infestations caused by nematodes, particularly those caused by M.
javanica (e.g., in tobacco, cotton, pepper, or tomato plants) and
by H. glycines, (e.g., in soybean).
[0024] The invention is based, in part, on the identification of a
cDNA encoding M. javanica ATP synthase subunit E (SEQ ID NO: 1).
This 466 nucleotide cDNA has a 312 nucleotide open reading frame
(SEQ ID NO: 7) encoding a 104 amino acid polypeptide (SEQ ID NO:
4).
[0025] The invention is also based, in part, on the identification
of a cDNA encoding H. glycines ATP synthase subunit E (SEQ ID NO:
2). This 516 nucleotide cDNA has a 339 nucleotide open reading
frame (SEQ ID NO: 8) encoding a 113 amino acid polypeptide (SEQ ID
NO: 5).
[0026] The invention is also based, in part, on the identification
of a cDNA encoding Z. punctata ATP synthase subunit E (SEQ ID NO:
3). This 489 nucleotide cDNA has a 318 nucleotide open reading
frame (SEQ ID NO: 9) encoding a 106 amino acid polypeptide (SEQ ID
NO: 6).
[0027] In one aspect, the invention features novel nematode ATP
synthase subunit E-like polypeptides. Such polypeptides include
purified polypeptides having the amino acid sequences set forth in
SEQ ID NO: 4, 5, and/or 6. Also included are polypeptides having an
amino acid sequence that is at least about 60%, 70%, 75%, 80%, 85%,
90%, 95%, or 98% identical to SEQ ID NO: 4, 5, and/or 6. The
invention includes polypeptides comprising, consisting of, or
consisting essentially of such polypeptides. The invention also
features such polypeptides linked, e.g., by a peptide bond to at
least one heterologous polypeptide to form a fusion protein. The
ATP synthase subunit E-like polypeptide can be flanked by
heterologous polypeptides or by one or more heterologous amino
acids. The purified polypeptides can be encoded by a nematode gene,
e.g., a nematode gene other than C. elegans. For example, the
purified polypeptide has a sequence other than SEQ ID NO: 10 (C.
elegans ATP synthase subunit E). The purified polypeptides can
further include a heterologous amino acid sequence, e.g., an
amino-terminal or carboxy-terminal amino acids (or both) that are
not part of the naturally occurring sequence. Also featured are
purified polypeptide fragments of the aforementioned ATP synthase
subunit E-like polypeptides, e.g., a fragment of at least about 20,
30, 40, 50, 75, 85, 104, 106, 113 amino acids. Non-limiting
examples of such fragments include: fragments from about amino acid
1 to 50, 1 to 75, 1 to 89, 1 to 91, 1 to 99, 1 to 100, 1 to 125, 51
to 113, 93 to 104, 99 to 113, and 93 to 106 of SEQ ID NO: 4, 5,
and/or 6. The polypeptide or fragment thereof can be modified,
e.g., processed, truncated, modified (e.g. by glycosylation,
phosphorylation, acetylation, myristylation, prenylation,
palmitoylation, amidation, addition of glycerophosphatidyl
inositol), or any combination of the above.
[0028] Certain ATP synthase subunit E-like polypeptides comprise a
sequence of 104, 106, 113, 125, 150 amino acids or fewer.
[0029] In another aspect, the invention features novel isolated
nucleic acid molecules encoding nematode ATP synthase subunit
E-like polypeptides. Such isolated nucleic acid molecules include
nucleic acids having the nucleotide sequence set forth in SEQ ID
NO: 1, 2, and/or 3 or SEQ ID NO: 7, 8, and/or 9. Also included are
isolated nucleic acid molecules having the same sequence as or
encoding the same polypeptide as a nematode ATP synthase subunit
E-like gene (other than C. elegans ATP synthase subunit E-like
genes).
[0030] Also featured are: 1) isolated nucleic acid molecules (e.g.,
nucleic acid probes) having a strand that hybridizes under low
stringency conditions to a single stranded probe of the sequences
of SEQ ID NO: 1, 2, and/or 3 or their complements and, optionally,
encodes polypeptides of between 104 and 106 or 113 amino acids; 2)
isolated nucleic acid molecules having a strand that hybridizes
under high stringency conditions to a single stranded probe of the
sequence of SEQ ID NO: 1, 2, and/or 3 or their complements and,
optionally, encodes polypeptides of between 104 and 106 or 113
amino acids; 3) isolated nucleic acid fragments of an ATP synthase
subunit E-like nucleic acid molecule, e.g., a fragment of SEQ ID
NO: 1, 2, and/or 3 that is about 280, 415, 420, 440, and 500 or
more nucleotides in length or ranges between such lengths; and 4)
oligonucleotides that are complementary to an ATP synthase subunit
E-like nucleic acid molecule or an ATP synthase subunit E-like
nucleic acid complement, e.g., an oligonucleotide of about 10, 15,
18, 20, 22, 24, 28, 30, 35, 40, 50, 60, 70, 80, or more nucleotides
in length. Exemplary oligonucleotides are oligonucleotides which
anneal to a site located between nucleotides about 1 to 24, 1 to
48, 1 to 60, 1 to 120, 24 to 48, 24 to 60, 49 to 60, 61 to 180, 381
to 420, 421 to 480, 451 to 466, 451 to 489, and 451 to 516 of SEQ
ID NO: 1, 2, and/or 3. Nucleic acid fragments include the following
non-limiting examples: nucleotides about 1 to 200, 100 to 300, 200
to 400, 300 to 500, 300 to 466, 300 to 516, and 300 to 489 of SEQ
ID NO: 1, 2, and/or 3. Also within the invention are nucleic acid
molecules that hybridize under stringent conditions to nucleic acid
molecule comprising SEQ ID NO: 1, 2 or 3 and comprise 3,000, 2,000,
1,000 or fewer nucleotides. The isolated nucleic acid can further
include a heterologous promoter operably linked to the ATP synthase
subunit E-like nucleic acid molecule.
[0031] A molecule featured herein can be from a nematode of the
class Araeolaimida, Ascaridida, Chromadorida, Desmodorida,
Diplogasterida, Monhysterida, Mononchida, Oxyurida, Rhigonematida,
Spirurida, Enoplia, Desmoscolecidae, Rhabditida, or Tylenchida.
Alternatively, the molecule can be from a species of the class
Rhabditida, particularly a species other than C. elegans.
[0032] In another aspect, the invention features a vector, e.g., a
vector containing an aforementioned nucleic acid. The vector can
further include one or more regulatory elements, e.g., a
heterologous promoter. The regulatory elements can be operably
linked to the ATP synthase subunit E-like nucleic acid molecules in
order to express an ATP synthase subunit E-like nucleic acid
molecule. In yet another aspect, the invention features a
transgenic cell or transgenic organism having in its genome a
transgene containing an aforementioned ATP synthase subunit E-like
nucleic acid molecule and a heterologous nucleic acid, e.g., a
heterologous promoter.
[0033] In still another aspect, the invention features an antibody,
e.g., an antibody, antibody fragment, or derivative thereof that
binds specifically to an aforementioned polypeptide. Such
antibodies can be polyclonal or monoclonal antibodies. The
antibodies can be modified, e.g., humanized, rearranged as a
single-chain, or CDR-grafted. The antibodies may be directed
against a fragment, a peptide, or a discontinuous epitope from an
ATP synthase subunit E-like polypeptide.
[0034] In another aspect, the invention features a method of
screening for a compound that binds to a nematode ATP synthase
subunit E-like polypeptide, e.g., an aforementioned polypeptide.
The method includes providing the nematode polypeptide; contacting
a test compound to the polypeptide; and detecting binding of the
test compound to the nematode polypeptide. In one embodiment, the
method further includes contacting the test compound to a mammalian
ATP synthase subunit E-like polypeptide; and detecting binding of
the test compound to the mammalian ATP synthase subunit E-like
polypeptide. A test compound that binds the nematode ATP synthase
subunit E-like polypeptide with at least 2-fold, 5-fold, 10-fold,
20-fold, 50-fold, or 100-fold affinity greater relative to its
affinity for the mammalian (e.g., a human) ATP synthase subunit
E-like polypeptide can be identified.
[0035] The invention also features methods for identifying
compounds that alter the activity of a nematode ATP synthase
subunit E-like polypeptide. The method includes contacting the test
compound to the nematode ATP synthase subunit E-like polypeptide;
and detecting an ATP synthase subunit E-like activity. A decrease
in the level of ATP synthase subunit E-like activity of the
polypeptide relative to the level of ATP synthase subunit E-like
activity of the polypeptide in the absence of the test compound is
an indication that the test compound is an inhibitor of the ATP
synthase subunit E-like activity. In still another embodiment, the
method further includes contacting a test compound such as an
allosteric inhibitor or other types of inhibitors that prevent
binding of the ATP synthase subunit E-like polypeptide to other
molecules or proteins. A change in activity of proteins normally
bound by the subunit E is an indication that the test compound is
an inhibitor of the ATP synthase subunit E-like activity. Such
inhibitory compounds are potential selective agents for reducing
the viability of a nematode expressing an ATP synthase subunit
E-like polypeptide, e.g., the viability of M. javanica, H.
glycines, and/or Z. punctata. These methods can also include
contacting the compound with a mammalian (e.g., a human) ATP
synthase subunit E-like polypeptide; and detecting an ATP synthase
subunit E-like activity. A compound that decreases nematode ATP
synthase subunit E activity to a greater extent than it decreases
mammalian ATP synthase subunit E-like polypeptide activity could be
useful as a selective inhibitor of the nematode polypeptide. A
desirable compound can exhibit 2-fold, 5-fold, 10-fold, 20-fold,
50-fold, 100-fold or greater selective activity against the
nematode polypeptide.
[0036] Another featured method is a method of screening for a
compound that alters an activity of an ATP synthase subunit E-like
polypeptide or alters binding or regulation of other polypeptides
by ATP synthase subunit E. The method includes providing the
polypeptide; contacting a test compound to the polypeptide; and
detecting an ATP synthase subunit E-like activity or the activity
of polypeptides bound or regulated by the subunit E (e.g., ATP
synthase complex), wherein a change in activity of ATP synthase
subunit E-like polypeptides or other downstream polypeptides
relative to the ATP synthase subunit E-like activity of the
polypeptide or downstream polypeptides (e.g., ATP synthase complex)
in the absence of the test compound is an indication that the test
compound alters the activity of the polypeptide(s). The method can
further include contacting the test compound to a mammalian (e.g.,
a human) ATP synthase subunit E-like polypeptide and measuring the
ATP synthase subunit E-like activity of the mammalian ATP synthase
subunit E-like polypeptide or other polypeptides affected or
regulated by the subunit E. A test compound that alters the
activity of the nematode ATP synthase subunit E-like polypeptide at
a given concentration and that does not substantially alter the
activity of the mammalian ATP synthase subunit E-like polypeptide
or downstream polypeptides at the given concentration can be
identified. An additional method includes screening for both
binding to an ATP synthase subunit E-like polypeptide and for an
alteration in the activity of an ATP synthase subunit E-like
polypeptide.
[0037] Yet another featured method is a method of screening for a
compound that alters the viability or fitness of a transgenic cell
or organism or nematode. The transgenic cell or organism has a
transgene that expresses an ATP synthase subunit E-like
polypeptide. The method includes contacting a test compound (e.g.,
an unscreened compound or one known to decrease ATP synthase
subunit E activity in vitro) to the transgenic cell or organism and
detecting changes in the viability or fitness of the transgenic
cell or organism. This alteration in viability or fitness can be
measured relative to an otherwise identical cell or organism that
does not harbor the transgene.
[0038] Also featured is a method of screening for a compound that
alters the expression of a nematode nucleic acid encoding an ATP
synthase subunit E-like polypeptide, e.g., a nucleic acid encoding
a M. javanica, H. glycines, and/or Z. punctata ATP synthase subunit
E-like polypeptide. The method includes contacting a cell, e.g., a
nematode cell, with a test compound and detecting expression of a
nematode nucleic acid encoding an ATP synthase subunit E-like
polypeptide, e.g., by hybridization to a probe complementary to the
nematode nucleic acid encoding an ATP synthase subunit E-like
polypeptide or by contacting polypeptides isolated from the cell
with a compound, e.g., antibody that binds an ATP synthase subunit
E-like polypeptide. Compounds identified by the method are also
within the scope of the invention.
[0039] The screening methods described herein can further include
exposing a nematode to the compound and assessing the effect of the
compound on the viability or reproductive ability of the nematode.
Such methods can entail exposing nematodes to those compounds which
bind to, inhibit, reduce the espression of or otherwise interfere
with ATP synthase subunit E-like activity. Compounds which reduce
nematode viability or reproductive ability in such assays are
candidate pesticides.
[0040] In yet another aspect, the invention features a method of
treating a disorder (e.g., an infection) caused by a nematode,
e.g., M. javanica or H. glycines, in a subject, e.g., a host plant
or host animal. The method includes administering to the subject an
effective amount of an inhibitor of an ATP synthase subunit E-like
polypeptide activity or an inhibitor of expression of an ATP
synthase subunit E-like polypeptide. Non-limiting examples of such
inhibitors include: an antisense nucleic acid (or PNA) to an ATP
synthase subunit E-like nucleic acid, an antibody to an ATP
synthase subunit E-like polypeptide, or a small molecule identified
as an ATP synthase subunit E-like polypeptide inhibitor by a method
described herein.
[0041] A "purified polypeptide", as used herein, refers to a
polypeptide that has been separated from other proteins, lipids,
and nucleic acids with which it is naturally associated. The
polypeptide can constitute at least 10, 20, 50 70, 80 or 95% by dry
weight of the purified preparation.
[0042] An "isolated nucleic acid" is a nucleic acid, the structure
of which is not identical to that of any naturally occurring
nucleic acid, or to that of any fragment of a naturally occurring
genomic nucleic acid spanning more than three, preferably one,
separate genes. The term therefore covers, for example: (a) a DNA
which is part of a naturally occurring genomic DNA molecule but is
not flanked by both of the nucleic acid sequences that flank that
part of the molecule in the genome of the organism in which it
naturally occurs; (b) a nucleic acid incorporated into a vector or
into the genomic DNA of a prokaryote or eukaryote in a manner such
that the resulting molecule is not identical to any naturally
occurring vector or genomic DNA; (c) a separate molecule such as a
cDNA, a genomic fragment, a fragment produced by polymerase chain
reaction (PCR), or a restriction fragment; and (d) a recombinant
nucleotide sequence that is part of a hybrid gene, i.e., a gene
encoding a fusion protein. Specifically excluded from this
definition are nucleic acids present in mixtures of different (i)
DNA molecules, (ii) transfected cells, or (iii) cell clones in a
DNA library such as a cDNA or genomic DNA library. Isolated nucleic
acid molecules according to the present invention further include
molecules produced synthetically, as well as any nucleic acids that
have been altered chemically and/or that have modified
backbones.
[0043] Although the phrase "nucleic acid molecule" primarily refers
to the physical nucleic acid molecule and the phrase "nucleic acid
sequence" refers to the sequence of the nucleotides in the nucleic
acid molecule, the two phrases can be used interchangeably.
[0044] The term "substantially pure" as used herein in reference to
a given polypeptide means that the polypeptide is substantially
free from other biological macromolecules. The substantially pure
polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%)
pure by dry weight. Purity can be measured by any appropriate
standard method, for example, by column chromatography,
polyacrylamide gel electrophoresis, or HPLC analysis.
[0045] The "percent identity" of two amino acid sequences or of two
nucleic acids is determined using the algorithm of Karlin and
Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified
as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA
90:5873-5877. Such an algorithm is incorporated into the BLASTN and
BLASTX programs (version 2.0) of Altschul et al. (1990) J. Mol.
Biol. 215:403-10. BLAST nucleotide searches can be performed with
the BLASTN program, score=100, wordlength=12 to obtain nucleotide
sequences homologous to the nucleic acid molecules of the
invention. BLAST protein searches can be performed with the BLASTX
program, score=50, wordlength=3 to obtain amino acid sequences
homologous to the protein molecules of the invention. Where gaps
exist between two sequences, Gapped BLAST can be utilized as
described in Altschul et al. (1997) Nucleic Acids Res.
25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the
default parameters of the respective programs (e.g., BLASTX and
BLASTN) can be used. Available on the internet at
ncbi.nlm.nih.gov.
[0046] As used herein, the term "transgene" means a nucleic acid
sequence (encoding, e.g., one or more subject polypeptides), which
is partly or entirely heterologous, i.e., foreign, to the
transgenic plant, animal, or cell into which it is introduced, or,
is homologous to an endogenous gene of the transgenic plant,
animal, or cell into which it is introduced, but which is designed
to be inserted, or is inserted, into the plant's genome in such a
way as to alter the genome of the cell into which it is inserted
(e.g., it is inserted at a location which differs from that of the
natural gene or its insertion results in a knockout). A transgene
can include one or more transcriptional regulatory sequences and
other nucleic acid sequences, such as introns, that may be
necessary for optimal expression of the selected nucleic acid, all
operably linked to the selected nucleic acid, and may include an
enhancer sequence.
[0047] As used herein, the term "transgenic cell" refers to a cell
containing a transgene.
[0048] As used herein, a "transgenic plant" is any plant in which
one or more, or all, of the cells of the plant includes a
transgene. The transgene can be introduced into the cell, directly
or indirectly by introduction into a precursor of the cell, by way
of deliberate genetic manipulation, such as by T-DNA mediated
transfer, electroporation, or protoplast transformation. The
transgene may be integrated within a chromosome, or it may be
extrachromosomally replicating DNA.
[0049] As used herein, the term "tissue-specific promoter" means a
DNA sequence that serves as a promoter, i.e., regulates expression
of a selected DNA sequence operably linked to the promoter, and
which affects expression of the selected DNA sequence in specific
cells of a tissue, such as a leaf, root, or stem.
[0050] As used herein, the terms "hybridizes under stringent
conditions" and "hybridizes under high stringency conditions" refer
to conditions for hybridization in 6.times.sodium chloride/sodium
citrate (SSC) buffer at about 45.degree. C., followed by two washes
in 0.2.times.SSC buffer, 0.1% SDS at 60.degree. C. or 65.degree. C.
As used herein, the term "hybridizes under low stringency
conditions" refers to conditions for hybridization in 6.times.SSC
buffer at about 45.degree. C., followed by two washes in
6.times.SSC buffer, 0.1% (w/v) SDS at 50.degree. C.
[0051] A "heterologous promoter", when operably linked to a nucleic
acid sequence, refers to a promoter which is not naturally
associated with the nucleic acid sequence.
[0052] As used herein, an agent with "anthelminthic activity" is an
agent, which when tested, has measurable nematode-killing activity
or results in infertility or sterility in the nematodes such that
unviable or no offspring result. In the assay, the agent is
combined with nematodes, e.g., in a well of microtiter dish having
agar media or in the soil containing the agent. Staged adult
nematodes are placed on the media. The time of survival, viability
of offspring, and/or the movement of the nematodes are measured. An
agent with "anthelminthic activity" reduces the survival time of
adult nematodes relative to unexposed similarly staged adults,
e.g., by about 20%, 40%, 60%, 80%, or more. In the alternative, an
agent with "anthelminthic activity" may also cause the nematodes to
cease replicating, regenerating, and/or producing viable progeny,
e.g., by about 20%, 40%, 60%, 80%, or more.
[0053] As used herein, the term "binding" refers to the ability of
a first compound and a second compound that are not covalently
linked to physically interact. The apparent dissociation constant
for a binding event can be 1 mM or less, for example, 10 nM, 1 nM,
0.1 nM or less.
[0054] As used herein, the term "binds specifically" refers to the
ability of an antibody to discriminate between a target ligand and
a non-target ligand such that the antibody binds to the target
ligand and not to the non-target ligand when simultaneously exposed
to both the given ligand and non-target ligand, and when the target
ligand and the non-target ligand are both present in molar excess
over the antibody.
[0055] As used herein, the term "altering an activity" refers to a
change in level, either an increase or a decrease in the activity,
(e.g., an increase or decrease in the ability of the polypeptide to
bind or regulate other polypeptides or molecules) particularly an
ATP synthase subunit E-like or ATP synthase subunit E activity. The
change can be detected in a qualitative or quantitative
observation. If a quantitative observation is made, and if a
comprehensive analysis is performed over a plurality of
observations, one skilled in the art can apply routine statistical
analysis to identify modulations where a level is changed and where
the statistical parameter, the p value, is less than 0.05.
[0056] In part, the nematode ATP synthase subunit E proteins and
nucleic acids described herein are novel targets for anti-nematode
vaccines, pesticides, and drugs. Inhibition of these molecules can
provide means of inhibiting nematode metabolism and/or the nematode
life-cycle.
[0057] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
[0058] FIG. 1 depicts the cDNA sequence of M. javanica ATP synthase
subunit E (SEQ ID NO: 1), its corresponding encoded amino acid
sequence (SEQ ID NO: 4), and its open reading frame (SEQ ID NO:
7).
[0059] FIG. 2 depicts the cDNA sequence of H. glycines ATP synthase
subunit E (SEQ ID NO: 2), its corresponding encoded amino acid
sequence (SEQ ID NO: 5), and its open reading frame (SEQ ID NO:
8).
[0060] FIG. 3 depicts the cDNA sequence of Z. punctata ATP synthase
subunit E (SEQ ID NO: 3), its corresponding encoded amino acid
sequence (SEQ ID NO: 6), and its open reading frame (SEQ ID NO:
9).
[0061] FIG. 4 is an alignment of the sequences of M. javanica, H.
glycines, and Z. punctata ATP synthase subunit E-like polypeptides
(SEQ ID NO: 4, 5, and 6) and C. elegans ATP synthase subunit E-like
polypeptide (SEQ ID NO: 10).
DETAILED DESCRIPTION
[0062] ATP synthases of eubacteria, chloroplasts, and mitochondria
synthesize ATP from ADP and inorganic phosphate using a
transmembrane proton gradient to drive the reaction. In bacterial
enzymes and in reconstituted mitochondrial enzymes the process is
reversible and the enzymes can also hydrolyze ATP and use the
energy released in the process to pump protons. The enzymes from
various sources differ in complexity of their subunits. To date,
the simplest ATP synthase to be described (F.sub.1F.sub.0 synthase)
is from E. coli. The F.sub.1F.sub.0 synthase has eight different
subunits. Five of the subunits form a globular catalytic subcomplex
(F.sub.1), and three others comprise the membrane bound domain of
the enzyme (F.sub.0) to which the catalytic F.sub.1 subcomplex is
bound. Proton flux through the F.sub.0 subcomplex has been
postulated to cause conformational changes, which may pass to the
catalytic F.sub.1 subcomplex through the stalk of the F.sub.0
complex. While the overall architecture of the ATP synthases in
higher invertebrates and vertebrates appears to be similar to that
of bacterial ATP synthases, they are generally more complex and
have a number of additional subunits. Mammalian mitochondrial ATP
synthases, for example, include between 12 and 18 protein
components (Walter et al. (1991) Biochemistry 30: 5369-5378).
[0063] One subunit suspected of having a regulatory role in a
mammalian ATP synthases, perhaps in response to Ca.sup.2+, is
subunit E. Subunit E is a highly charged, basic protein that has
been shown to be peripherally associated with the F.sub.0
subcomplex of the mammalian F.sub.1F.sub.0-ATP synthase. Subunit E
is thought to bind to the F.sub.0 subcomplex and transmit
conformational changes to the F.sub.1 catalytic subcomplex. The
regulatory role of subunit E is predicted based upon its
differential regulation at the transcriptional level in response to
such diverse conditions as hypoxia, UV irradiation, and high/low
fat diets. Ultimately, regulation of the F.sub.0F.sub.1-ATP
synthase, through subunit E and other subunits, leads to control of
energy production, as would be expected of an enzyme involved in
ATP synthesis (Elliot et al. (1993) Biochem Biophys. Res. Com.
190:167-174; Levy (1997) Amer. Phys. Soc. 457-465).
[0064] This invention describes a novel class of nematode genes
related C. elegans protein T23910 (GenBank.RTM. Accession No:
7506279). The nematode genes can be shown by a PSI-BLAST
bioinformatics analysis to be highly divergent members of the ATP
synthase subunit E gene family. This divergent gene family appears
to be restricted to higher metazoans (e.g., nematodes, arthropods,
vertebrates) and is not detected in available sequences of fungi,
bacteria or plants. We have identified additional homologs in the
nematodes M. javanica, H. glycines and Z. punctata. Importantly, we
have shown that these proteins are essential for the viability of
C. elegans using RNAi interference, suggesting that these proteins
are promising targets for anti-parasitic compounds.
[0065] As in the case of the mammalian proteins, the nematode
homologs are small, hydrophilic proteins. Despite the low pairwise
sequence identity over the entire length of molecule (below 30%)
for several nematode-vertebrate comparisons, a multiple alignment
of all ATP synthase subunit E-like proteins shows regions of
similarity, as well as absolute conservation in some regions
(particularly in the amino terminus). Another quality shared among
the members of this family is the lack of a mitochondrial
pro-sequence. Instead, the proteins are all predicted to contain
putative transmembrane regions in their N-terminal regions (by
TMHMM, available on the Internet at cbs.dtu.dk/services/TMHMM ),
which can be recognized as a weak preference for mitochondrial
localization in some cases (by Target P, available on the Internet
at cbs.dtu.dk/services/TargetP/).
[0066] The present invention provides nucleic acids from nematodes
encoding ATP synthase subunit E-like polypeptides. The M. javanica
nucleic acid molecule (SEQ ID NO: 1) and the encoded ATP synthase
subunit E-like polypeptide (SEQ ID NO: 4) are depicted in FIG. 1.
The H. glycines nucleic acid molecule (SEQ ID NO: 2) and the ATP
synthase subunit E-like polypeptide (SEQ ID NO: 5) are depicted in
FIG. 2. The Z. punctata nucleic acid molecule (SEQ ID NO: 3) and
the ATP synthase subunit E-like polypeptide (SEQ ID NO: 6) are
depicted in FIG. 3. Certain sequence information for the ATP
synthase subunit E genes described herein is summarized in Table 1,
below.
1TABLE 1 ATP Synthase Subunit E Sequences Species cDNA ORF
Polypeptide FIG. M. javanica SEQ ID NO: 1 SEQ ID NO: 7 SEQ ID NO: 4
H. glycines SEQ ID NO: 2 SEQ ID NO: 8 SEQ ID NO: 5 Z. punctata SEQ
ID NO: 3 SEQ ID NO: 9 SEQ ID NO: 6
[0067] The invention is based, in part, on the discovery of ATP
synthase subunit E-like sequences from M. javanica, H. glycines,
and Z. punctata. The following examples are, therefore, to be
construed as merely illustrative, and not limitative of the
remainder of the disclosure in any way whatsoever. All of the
publications cited herein are hereby incorporated by reference in
their entirety.
EXAMPLES
[0068] A TBLASTN query with the C. elegans gene T23910
(GenBank.RTM. GI: 7506279) identified multiple expressed sequence
tags (ESTs are short nucleic acid fragment sequences from single
sequencing reads) in dbest that are predicted to encode a portion
of ATP synthase subunit E-like enzymes in at least three nematode
species: M. javanica (GenBank.RTM. GI:9829776) similar to C.
elegans codons 12-104; H. glycines (GenBank.RTM. GI:10713753)
similar to C. elegans codons 6-104; and Z. punctata (GenBank.RTM.
GI:7710479) similar to C. elegans codons 15-107, all from McCarter,
et al. (1999) Washington University Nematode EST Project. Also
identified were sequences from Pristionchus pacificus (GenBank.RTM.
Identification No:5914683) similar to C. elegans codons 6-107;
Strongyloides stercoralis (GenBank.RTM. GI:10715244) similar to C.
elegans codons 1-107; Ancylostoma caninum (GenBank.RTM.
GI:11180617) similar to C. elegans codons 49-107 (all from McCarter
et al. (1999) Washington University Nematode EST Project),
Litomosoides sigmodontis (GenBank.RTM. GI:6200636) similar to C.
elegans codons 1-58 (from Allen et al. (2000) Infect. Immun.
68:5454-8); and Brugia malayi (GenBank.RTM. GI:1592572) similar to
C. elegans codons 8-58 were also identified in dbest.
[0069] Full Length ATP Synthase Subunit E-Like cDNA Sequences
[0070] Plasmid clone Div348, corresponding to the M. javanica EST
sequence (GI: 9829776) was obtained from the Genome Sequencing
Center (St. Louis, Mo.). Similarly, plasmid clone Div361,
corresponding to the H. glycines EST sequence (GI: 10713753), and
plasmid clone Div222, corresponding to the Z. punctata EST sequence
(GI: 7710479), were also obtained from the Genome Sequencing Center
(St. Louis, Mo.). The cDNA inserts in the plasmids were sequenced
in their entirety to obtain full-length sequences for ATP synthase
subunit E-like genes from M. javanica (SEQ ID NO: 1), H. glycines
(SEQ ID NO:2), and Z. punctata (SEQ ID NO:3).
[0071] Unless otherwise indicated, all nucleotide sequences
determined herein were sequenced with an automated DNA sequencer
(such as model 373 from Applied Biosystems, Inc.) using processes
well-known to those skilled in the art. Primers used for sequencing
are listed in Table 2, below.
2TABLE 2 Sequencing Primers Name Sequence SEQ ID NO: Homology to T7
gtaatacgactcactatagggc 11 vector polylinker primer T3
aattaaccctcactaaaggg 12 vector polylinker primer SL1
gggtttaattacccaagtttga 13 nematode transpliced leader Oligo dT
gagagagagagagagagagaactagtctc- gagtttttttttttttttttt 14 universal
primer to poly A tail
[0072] Characterization of M. javanica, H. glycines, and Z.
punctata ATP Synthase Subunit E
[0073] The sequences of three ATP synthase subunit E-like nucleic
acid molecules are depicted in FIG. 1, FIG. 2, and FIG. 3 as SEQ ID
NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively. SEQ ID NO: 7
contains an open reading frame encoding a 104 amino acid
polypeptide, SEQ ID NO: 8 contains open reading frame encoding a
113 amino acid polypeptide, and SEQ ID NO: 9 contains an open
reading frame encoding a 106 amino acid polypeptide.
[0074] The sequence of the M. javanica ATP synthase subunit E-like
cDNA (SEQ ID NO: 1) is depicted in FIG. 1. This nucleotide sequence
also contains an open reading frame (SEQ ID NO:7) encoding a 104
amino acid polypeptide (SEQ ID NO:4). The M. javanica ATP synthase
subunit E -like protein sequence (SEQ ID NO: 4) is also
approximately 38% identical to the C. elegans ATP synthase subunit
E-like gene (SEQ ID NO: 10).
[0075] The sequence of the H. glycines ATP synthase subunit E-like
cDNA (SEQ ID NO:2) is depicted in FIG. 2. This nucleotide sequence
contains an open reading frame (SEQ ID NO:8) encoding a 113 amino
acid polypeptide (SEQ ID NO:5). The H. glycines ATP synthase
subunit E-like protein sequence (SEQ ID NO: 5) is approximately 41%
identical to the C. elegans ATP synthase subunit E-like gene (SEQ
ID NO: 10).
[0076] The sequence of the Z. punctata ATP synthase subunit E-like
cDNA (SEQ ID NO:3) is depicted in FIG. 3. This nucleotide sequence
contains an open reading frame (SEQ ID NO:9) encoding a 106 amino
acid polypeptide (SEQ ID NO:6). The Z. punctata ATP synthase
subunit E-like protein sequence (SEQ ID NO: 6) is approximately 36%
identical to the C. elegans ATP synthase subunit E-like gene (SEQ
ID NO: 10).
[0077] The similarity among the M. javanica, H. glycines, Z.
punctata, and C. elegans polypeptides is presented as a multiple
alignment generated by Clustal X multiple alignment program as
described below (FIG. 4).
[0078] The similarity between M. javanica, H. glycines, and Z.
punctata ATP synthase subunit E-like sequences and other sequences
was also investigated by comparison to sequence databases using
BLASTP analysis against nr (a non-redundant protein sequence
database available on the Internet at ncbi.nlm.nih.gov/) and
TBLASTN analysis against dbest (an EST sequence database availavle
on the Internet at ncbi.nlm.nih.gov/; top 500 hits; E=1e-4). The
"Expect (E) value" is the number of sequences that are predicted to
align by chance to the query sequence with a score S or greater
given the size of the database queried. This analysis was used to
determine the potential number of plant and vertebrate homologs for
each of the nematode ATP synthase subunit E-like polypeptides
described above. M. javanica (SEQ ID NO: 1), H. glycines (SEQ ID
NO: 2), Z. punctata (SEQ ID NO: 3), and C. elegans (SEQ ID NO: 10)
ATP synthase subunit E-like sequences had no vertebrate and/or
plant hits in nr or dbest having sufficient sequence similarity to
meet the threshold E value of le-4 (this E value approximately
corresponds to a threshold for removing sequences having a sequence
identity of less than about 25% over approximately 100 amino
acids). Accordingly, the M. javanica, H. glycines, and/or Z.
punctata ATP synthase subunit E-like enzymes of this invention do
not appear to share significant sequence similarity with the more
common vertebrate forms of the enzyme such as the Homo sapiens
(GenBank.RTM. GI:6005717;GenBank.RTM. Accession No:
NP.sub.--009031.1) or the Rattus norvegicus (GenBank.RTM. Accession
No: P29419) ATP synthase subunit E.
[0079] On the basis of the lack of similarity to plants and
vertebrates, the M. javanica, H. glycines, and/or Z. punctata ATP
synthase subunit E-like enzymes are useful targets of inhibitory
compounds selective for some nematodes over their hosts (e.g.,
humans, animals, and plants).
[0080] Functional predictions were made using four iterations of
PSI-BLAST with the default parameters on the nr database. PSI-BLAST
searches and multiple alignment construction with CLUSTALX
demonstrated that the C elegans gene (GenBank.RTM. Accession No:
T23910) was a member of the ATP synthase subunit E family.
Reciprocal blast searches and phylogenetic trees confirm that the
nucleotide sequences in M. javanica, H. glycines, and/or Z.
punctata do encode orthologs of the C. elegans gene and therefore
also likely ATP synthase subunit E proteins. Protein localizations
were predicted using the TargetP server available on the Internet
at cbs.dtu.dk/services/TargetP/). The M. javanica, H. glycines,
and/or Z. punctata ATP synthase subunit E (SEQ ID NO: 4, 5, and 6,
respectively) polypeptides are potentially mitochondrial based on
the presence of putative transmembrane domain in the amino-terminus
and the fact that all other proteins in the family have weak
mitochondrial signals and putative transmembrane domains in the
N-terminus.
[0081] RNA Mediated Interference (RNAi) A double stranded RNA
(dsRNA) molecule can be used to inactivate a subunit E-like gene in
a cell by a process known as RNA mediated-interference (Fire et al.
(1998) Nature 391:806-811, and Gonczy et al. (2000) Nature
408:331-336). The dsRNA molecule can have the nucleotide sequence
of a subunit E-like nucleic acid described herein or a fragment
thereof. For example, the molecule can comprise at least 50, at
least 100, at least 200, at least 300, or at least 500 or more
contiguous nucleotides of a subunit E-like gene. The dsRNA molecule
can be delivered to nematodes via direct injection, by soaking
nematodes in aqueous solution containing concentrated dsRNA, or by
raising bacteriovorous nematodes on E. coli genetically engineered
to produce the dsRNA molecule (Kamath et al. (2000) Genome Biol. 2;
Tabara et al. (1998) Science 282:430-431).
[0082] C. elegans were grown on lawns of E. coli genetically
engineered to produce double stranded RNA designed to inhibit ATP
synthase subunit expression. E. coli were transformed with a 437
nucleotide genomic fragment of the subunit E-like gene. The genomic
fragment included 255 nucleotides of exon sequence and 182
nucleotides of intron sequence (58% exon overall). The exonic
sequences correspond to the first 115 nucleotides of SEQ ID NO:4,
followed by 182 nucleotides of intronic sequence (interrupting the
glycine codon at position 39) and then by 140 nucleotides of
additional exonic sequence (ending at the glutamine codon at
position 85). The 437 nucleotide genomic fragment was cloned into
an E. coli expression vector between opposing T7 polymerase
promoters, and the vector was transformed into a strain of E. coli
that carries an IPTG-inducible T7 polymerase. As a control, E. coli
was transformed with a gene encoding the Green Fluorescent Protein
(GFP). GFP is a commonly used reporter gene originally isolated
from jellyfish and is widely used in both prokaryotic and
eukaryotic systems. The GFP gene is not present in the wild-type C.
elegans genome and thus it does not trigger an RNAi phenotype when
ingested by C. elegans. In both samples, C. elegans was grown at
15.degree. C. on NGM plates containing IPTG and E. coli expressing
the subunit E-like specific dsRNA or GFP. Total eggs layed and
hatch-rates of F1 and F2 individuals were followed over the course
of 7-10 days (as shown below) and compared to nematode cultures
grown on non-toxic dsRNAs.
[0083] In another example, dsRNA was injected into the nematode,
basically as described in Mello et al. (1991) EMBO J. 10:3959-3970.
In short, a plasmid was constructed that contains a portion of the
C. elegans gene sequence, specifically a fragment 437 nucleotides
long, containing 115 nucleotides of the first exon followed by the
first intron of 182 nucleotides and 140 nucleotides of the second
exon (58% exon sequence) corresponding to amino acid positions
1-85. The TOPO vector and PCR primers corresponding to the T7 and
SP6 regions were to specifically amplify this sequence as a linear
dsDNA. Single-strand RNAs can be transcribed from this fragment
using either T7 RNA polymerase or SP6 RNA polymerase (the RNAs
correspond to the sense and antisense RNA strands). RNA so produced
was precipitated and resuspended in RNAse free water. SsRNAs were
combined, heated to 95.degree. C. for two minutes then allowed to
cool from 70.degree. C. to room temperature over 1.5-2.5 hours.
[0084] DsRNA was injected into the body cavity of 15-20 young adult
C. elegans hermaphrodites. Worms were typically immobilized on an
agarose pad and injected with 2-5 nanoliters of dsRNA at a
concentration of 1 mg/ml. Injections were performed with visual
observation using a Zeiss Axiovert compound microscope equipped
with 10.times. and 40.times. DIC objectives. Needles for
microinjection were prepared using a Narishige needle puller, stage
micromanipulator (Leitz) and an N2-powered injector (Narishige) set
at 10-20 p.s.i. After injection, 200 .mu.l of recovery buffer (0.1%
salmon sperm DNA, 4% glucose, 2.4 mM KCl, 66 mM NaCl, 3 mM
CaCl.sub.2, 3 mM HEPES, pH 7.2) was added to the agarose pad and
the worms were allowed to recover on the agarose pad for 0.5-4
hours. After recovery, the worms were transferred to NGM agar
plates seeded with a lawn of E. coli strain OP50 as a food source.
The following day and for 3 successive days thereafter, 7
individual healthy injected worms were transferred to new NGM
plates seeded with OP50. The number of eggs laid per worm per day
and the number of those eggs that hatch and reach fertile adulthood
can be determined. As a control, GFP dsRNA was produced and
injected using similar methods.
[0085] The results of the studies described above were as
follows.
[0086] Feeding RNAi:
[0087] Experiment F8-D403 (ATP Sythetase Subunit E-Like RNA)
[0088] Total # worms monitored: 6
[0089] Total # eggs layed: 171
[0090] Total # eggs hatched: 2
[0091] Hatch %: 1.2%
[0092] Experiment F8-D334 (GFP Control RNA)
[0093] Total # worms monitored: 6
[0094] Total # eggs layed: 527
[0095] Total # eggs hatched: 526
[0096] Hatch %: 99.8%
[0097] Injection RNAi:
[0098] Experiment J332 (ATP Synthetase Subunit-Like RNA)
[0099] Total # worms monitored: 7
[0100] Total # eggs layed: 141
[0101] Total # eggs hatched: 0
[0102] Hatch %: 0.0%
[0103] Experiment J335 (GFP Control RNA)
[0104] Total # worms monitored: 8
[0105] Total # eggs layed: 798
[0106] Total # eggs hatched: 789
[0107] Hatch %: 98.9%
[0108] As the results demonstrate, C. elegans cultures grown in the
presence of E. coli expressing dsRNA and those injected with dsRNA
from the subunit E-like gene were strongly impaired indicating that
the subunit E-like gene provides an essential function in nematodes
and that dsRNA from the subunit E-like gene is lethal when ingested
by or injected into C. elegans.
[0109] These results demonstrate that ATP synthase subunit E is
important for the viability of C. elegans and suggest that it is a
useful target for the development of compounds that reduce the
viability of nematodes.
[0110] Identification of Additional ATP Synthase Subunit E-Like
Sequences
[0111] A skilled artisan can utilize the methods provided in the
example above to identify additional nematode ATP synthase subunit
E-like sequences, e.g., ATP synthase subunit E-like sequence from
nematodes other than M. javanica, H. glycines, Z. punctata and/or
C. elegans. In addition, nematode ATP synthase subunit E-like
sequences can be identified by a variety of methods including
computer-based database searches, hybridization-based methods, and
functional complementation.
[0112] Database Identification. A nematode ATP synthase subunit
E-like sequence can be identified from a sequence database, e.g., a
protein or nucleic acid database using a sequence disclosed herein
as a query. Sequence comparison programs can be used to compare and
analyze the nucleotide or amino acid sequences. One such software
package is the BLAST suite of programs from the National Center for
Biotechnology Institute (NCBI; Altschul et al. (1997) Nucl. Acids
Research 25:3389-3402). An ATP synthase subunit E-like sequence of
the invention can be used to query a sequence database, such as nr,
dbest (expressed sequence tag (EST) sequences), and htgs
(high-throughput genome sequences), using a computer-based search,
e.g., FASTA, BLAST, or PSI-BLAST search. Homologous sequences in
other species (e.g., humans and animals) can be detected in a
PSI-BLAST search of a database such as nr (E value=10, H
value=le-2, using, for example, four iterations; available on the
Internet at ncbi.nlm.nih.gov/). Sequences so obtained can be used
to construct a multiple alignment, e.g., a ClustalX alignment,
and/or to build a phylogenetic tree, e.g., in ClustalX using the
Neighbor-Joining method (Saitou et al. (1987) Mol. Biol. Evol.
4:406-425) and bootstrapping (1000 replicates; Felsenstein (1985)
Evolution 39:783-791). Distances may be corrected for the
occurrence of multiple substitutions [D.sub.corr=-ln(1-D-D.sup.2/5)
where D is the fraction of amino acid differences between two
sequences] (Kimura (1983) The Neutral Theory of Molecular
Evolution, Cambridge University Press).
[0113] The aforementioned search strategy can be used to identify
ATP synthase subunit E-like sequences in nematodes of the following
non-limiting, exemplary genera: Plant nematode genera: Afrina,
Anguina, Aphelenchoides, Belonolaimus, Bursaphelenchus, Cacopaurus,
Cactodera, Criconema, Criconemoides, Cryphodera, Ditylenchus,
Dolichodorus, Dorylaimus, Globodera, Helicotylenchus,
Hemicriconemoides, Hemicycliophora, Heterodera, Hirschmanniella,
Hoplolaimus, Hypsoperine, Longidorus, Meloidogyne, Mesoanguina,
Nacobbus, Nacobbodera, Panagrellus, Paratrichodorus, Paratylenchus,
Pratylenchus, Pterotylenchus, Punctodera, Radopholus,
Rhadinaphelenchus, Rotylenchulus, Rotylenchus, Scutellonema,
Subanguina, Thecavermiculatus, Trichodorus, Turbatrix,
Tylenchorhynchus, Tylenchulus, Xiphinema.
[0114] Animal and human nematode genera: Acanthocheilonema,
Aelurostrongylus, Ancylostoma, Angiostrongylus, Anisakis, Ascaris,
Ascarops, Bunostomum, Brugia, Capillaria, Chabertia, Cooperia,
Crenosoma, Cyathostome species (Small Strongyles), Dictyocaulus,
Dioctophyma, Dipetalonema, Dirofiliaria, Dracunculus, Draschia,
Elaneophora, Enterobius, Filaroides, Gnathostoma, Gonylonema,
Habronema, Haemonchus, Hyostrongylus, Lagochilascaris,
Litomosoides, Loa, Mammomonogamus, Mansonella, Muellerius,
Metastrongylid, Necator, Nematodirus, Nippostrongylus,
Oesophagostomum, Ollulanus, Onchocerca, Ostertagia, Oxyspirura,
Oxyuris, Parafilaria, Parascaris, Parastrongyloides,
Parelaphostrongylus, Physaloptera, Physocephalus, Protostrongylus,
Pseudoterranova, Setaria, Spirocerca, Stephanurus, Stephanofilaria,
Strongyloides, Strongylus, Spirocerca, Syngamus, Teladorsagia,
Thelazia, Toxascaris, Toxocara, Trichinella, Trichostrongylus,
Trichuris, Uncinaria, and Wuchereria.
[0115] Particularly preferred nematode genera include: Plant:
Anguina, Aphelenchoides, Belonolaimus, Bursaphelenchus,
Ditylenchus, Dolichodorus, Globodera, Heterodera, Hoplolaimus,
Longidorus, Meloidogyne, Nacobbus, Pratylenchus, Radopholus,
Rotylenchus, Tylenchulus, Xiphinema.
[0116] Animal and human: Ancylostoma, Ascaris, Brugia, Capillaria,
Cooperia, Cyathostome species, Dictyocaulus, Dirofiliaria,
Dracunculus, Enterobius, Haemonchus, Necator, Nematodirus,
Oesophagostomum, Onchocerca, Ostertagia, Oxyspirura, Oxyuris,
Parascaris, Strongyloides, Strongylus, Syngamus, Teladorsagia,
Thelazia, Toxocara, Trichinella, Trichostrongylus, Trichuris, and
Wuchereria.
[0117] Particularly preferred nematode species include: Plant:
Anguina tritici, Aphelenchoides fragariae, Belonolaimus
longicaudatus, Bursaphelenchus xylophilus, Ditylenchus destructor,
Ditylenchus dipsaci Dolichodorus heterocephalous, Globodera
pallida, Globodera rostochiensis, Globodera tabacum, Heterodera
avenae, Heterodera cardiolata, Heterodera carotae, Heterodera
cruciferae, Heterodera glycines, Heterodera major, Heterodera
schachtii, Heterodera zeae, Hoplolaimus tylenchiformis, Longidorus
sylphus, Meloidogyne acronea, Meloidogyne arenaria, Meloidogyne
chitwoodi, Meloidogyne exigua, Meloidogyne graminicola, Meloidogyne
hapla, Meloidogyne incognita, Meloidogyne javanica, Meloidogyne
nassi, Nacobbus batatiformis, Pratylenchus brachyurus, Pratylenchus
coffeae, Pratylenchus penetrans, Pratylenchus scribneri,
Pratylenchus zeae, Radopholus similis, Rotylenchus reniformis,
Tylenchulus semipenetrans, Xiphinema americanum.
[0118] Animal and human: Ancylostoma braziliense, Ancylostoma
caninum, Ancylostoma ceylanicum, Ancylostoma duodenale, Ancylostoma
tubaeforme, Ascaris suum, Ascaris lumbrichoides, Brugia malayi,
Capillaria bovis, Capillaria plica, Capillaria feliscati, Cooperia
oncophora, Cooperia punctata, Cyathostome species, Dictyocaulus
filaria, Dictyocaulus viviparus, Dictyocaulus arnfieldi,
Dirofiliaria immitis, Dracunculus insignis, Enterobius
vermicularis, Haemonchus contortus, Haemonchus placei, Necator
americanus, Nematodirus helvetianus, Oesophagostomum radiatum,
Onchocerca volvulus, Onchocerca cervicalis, Ostertagia ostertagi,
Ostertagia circumcincta, Oxyuris equi, Parascaris equorum,
Strongyloides stercoralis, Strongylus vulgaris, Strongylus
edentatus, Syngamus trachea, Teladorsagia circumcincta, Toxocara
cati, Trichinella spiralis, Trichostrongylus axei, Trichostrongylus
colubriformis, Trichuris vulpis, Trichuris suis, Trichurs
trichiura, and Wuchereria bancrofti.
[0119] Further, an ATP synthase subunit E-like sequence can be used
to identify additional ATP synthase subunit E-like sequence
homologs within a genome. Multiple homologous copies of an ATP
synthase subunit E-like sequence can be present. For example, a
nematode ATP synthase subunit E-like sequence can be used as a seed
sequence in an iterative PSI-BLAST search (default parameters,
substitution matrix=Blosum62, gap open=11, gap extend=1) of a non
redundant database such as wormpep (E value=le-2, H value=le-4,
using, for example 4 iterations) to determine the number of
homologs in a database, e.g., in a database containing the complete
genome of an organism. A nematode ATP synthase subunit E-like
sequence can be present in a genome along with 1, 2, 3, 4, 5, 6, 8,
10, or more homologs.
[0120] Hybridization Methods. A nematode ATP synthase subunit
E-like sequence can be identified by a hybridization-based method
using a sequence provided herein as a probe. For example, a library
of nematode genomic or cDNA clones can be hybridized under low
stringency conditions with the probe nucleic acid. Stringency
conditions can be modulated to reduce background signal and
increase signal from potential positives. Clones so identified can
be sequenced to verify that they encode ATP synthase subunit E-like
sequences.
[0121] Another hybridization-based method utilizes an amplification
reaction (e.g., the polymerase chain reaction (PCR)).
Oligonucleotides, e.g., degenerate oligonucleotides, are designed
to hybridize to a conserved region of an ATP synthase subunit
E-like sequence (e.g., a region conserved in the three nematode
sequences depicted in FIG. 4). The oligonucleotides are used as
primers to amplify an ATP synthase subunit E-like sequence from
template nucleic acid from a nematode, e.g., a nematode other than
M. javanica, H. glycines, Z. punctata, and/or C. elegans. The
amplified fragment can be cloned and/or sequenced.
[0122] Complementation Methods. A nematode ATP synthase subunit
E-like sequence can be identified from a complementation screen for
a nucleic acid molecule that restores ATP synthase subunit E-like
activity to a cell lacking an ATP synthase subunit E-like activity.
Routine methods can be used to construct strains (i.e., nematode
strains) that lack specific enzymatic activities, e.g., ATP
synthase subunit E activity. For example, a nematode strain mutated
at the ATP synthase subunit E gene locus can be identified by
selecting for resistance to inhibitory compounds and/or compounds
that prevent the subunit E from binding to and thus, regulating,
activity of an ATP synthase. Such a strain can be transformed with
a plasmid library expressing nematode cDNAs. Strains can be
identified in which ATP synthase subunit E activity is restored.
For example, the ATP synthase subunit E mutant strains transformed
with the plasmid library can be exposed to allosteric inhibitors or
other inhibitory compounds to select for strains that have acquired
sensitivity to the inhibitors and are expressing a nematode ATP
synthase subunit E-like gene. The plasmid harbored by the strain
can be recovered to identify and/or characterize the inserted
nematode cDNA that provides ATP synthase subunit E-like activity
when expressed.
[0123] Full-length cDNA and Sequencing Methods. The following
methods can be used, e.g.,. alone or in combination with another
method described herein, to obtain full-length nematode ATP
synthase subunit E-like genes and determine their sequences.
[0124] Plant parasitic nematodes are maintained on greenhouse pot
cultures depending on nematode preference. Root Knot Nematodes
(Meloidogyne sp) are propagated on Rutgers tomato (Burpee), while
Soybean Cyst Nematodes (Heterodera sp) are propagated on soybean.
Total nematode RNA is isolated using the TRIZOL reagent (Gibco
BRL). Briefly, 2 ml of packed worms are combined with 8 ml TRIZOL
reagent and solubilized by vortexing. Following 5 minutes of
incubation at room temperature, the samples are divided into
smaller volumes and spun at 14,000.times.g for 10 minutes at
4.degree. C. to remove insoluble material. The liquid phase is
extracted with 200 .mu.l of chloroform, and the upper aqueous phase
is removed to a fresh tube. The RNA is precipitated by the addition
of 500 .mu.l of isopropanol and centrifuged to pellet. The aqueous
phase is carefully removed, and the pellet is washed in 75% ethanol
and spun to re-collect the RNA pellet. The supematant is carefully
removed, and the pellet is air dried for 10 minutes. The RNA pellet
is resuspended in 50 .mu.l of DEPC-H.sub.2O and analyzed by
spectrophotometry at .lambda. 260 and 280 nm to determine yield and
purity. Yields can be 1-4 mg of total RNA from 2 ml of packed
worms.
[0125] Full-length cDNAs can be generated using 5' and 3' RACE
techniques in combination with EST sequence information. The
molecular technique 5' RACE (Life Technologies, Inc., Rockville,
Md.) can be employed to obtain complete or near-complete 5' ends of
cDNA sequences for nematode ATP synthase subunit E-like cDNA
sequences. Briefly, following the instructions provided by Life
Technologies, first strand cDNA is synthesized from total nematode
RNA using Murine Leukemia Virus Reverse Transcriptase (M-MLV RT)
and a gene specific "antisense" primer, e.g., designed from
available EST sequence. RNase H is used to degrade the original
mRNA template. The first strand cDNA is separated from
unincorporated dNTPs, primers, and proteins using a GlassMAX Spin
Cartridge. Terminal deoxynucleotidyl transferase (TdT) is used to
generate a homopolymeric dC tailed extension by the sequential
addition of dCTP nucleotides to the 3' end of the first strand
cDNA. Following addition of the dC homopolymeric extension, the
first strand cDNA is directly amplified without further
purification using Taq DNA polymerase, a gene specific "antisense"
primer designed from available EST sequences to anneal to a site
located within the first strand cDNA molecule, and a
deoxyinosine-containing primer that anneals to the homopolymeric dC
tailed region of the cDNA in a polymerase chain reaction (PCR). 5'
RACE PCR amplification products are cloned into a suitable vector
for further analysis and sequencing.
[0126] The molecular technique, 3' RACE (Life Technologies, Inc.,
Rockville, Md.), can be employed to obtain complete or
near-complete 3' ends of cDNA sequences for nematode ATP synthase
subunit E-like cDNA sequences. Briefly, following the instructions
provided by Life Technologies (Rockville, Md.), first strand cDNA
synthesis is performed on total nematode RNA using SuperScript.TM.
Reverse Transcriptase and an oligo-dT primer that anneals to the
polyA tail. Following degradation of the original mRNA template
with RNase H, the first strand cDNA is directly PCR amplified
without further purification using Taq DNA polymerase, a gene
specific primer designed from available EST sequences to anneal to
a site located within the first strand cDNA molecule, and a
"universal" primer which contains sequence identity to 5' end of
the oligo-dT primer. 3' RACE PCR amplification products are cloned
into a suitable vector for further analysis and sequencing.
[0127] Nucleic Acid Variants
[0128] Isolated nucleic acid molecules of the present invention
include nucleic acid molecules that have an open reading frame
encoding an ATP synthase subunit E-like polypeptide. Such nucleic
acid molecules include molecules having: the sequences recited in
SEQ ID NO: 1, 2, and/or 3; and sequences coding for the ATP
synthase subunit E-like proteins recited in SEQ ID NO: 4, 5, and/or
6. These nucleic acid molecules can be used, for example, in a
hybridization assay to detect the presence of a M. javanica, H.
glycines, and/or Z. punctata nucleic acid in a sample.
[0129] The present invention includes nucleic acid molecules such
as those shown in SEQ ID NO: 1, 2, and/or 3 that may be subjected
to mutagenesis to produce single or multiple nucleotide
substitutions, deletions, or insertions. Nucleotide insertional
derivatives of the nematode gene of the present invention include
5' and 3' terminal fusions as well as intra-sequence insertions of
single or multiple nucleotides. Insertional nucleotide sequence
variants are those in which one or more nucleotides are introduced
into a predetermined site in the nucleotide sequence, although
random insertion is also possible with suitable screening of the
resulting product. Deletion variants are characterized by the
removal of one or more nucleotides from the sequence. Nucleotide
substitution variants are those in which at least one nucleotide in
the sequence has been removed and a different nucleotide inserted
in its place. Such a substitution may be silent (e.g., synonymous),
meaning that the substitution does not alter the amino acid defined
by the codon. Alternatively, substitutions are designed to alter
one amino acid for another amino acid (e.g., non-synonymous). A
non-synonymous substitution can be conservative or
non-conservative. A substitution can be such that activity, e.g., a
ATP synthase subunit E-like activity, is not impaired. A
conservative amino acid substitution results in the alteration of
an amino acid for a similar acting amino acid, or amino acid of
like charge, polarity, or hydrophobicity, e.g., an amino acid
substitution listed in Table 3 below. At some positions, even
conservative amino acid substitutions can disrupt the activity of
the polypeptide.
3TABLE 3 Conservative Amino Acid Replacements For Amino Code
Replace with any of Alanine Ala Gly, Cys, Ser Arginine Arg Lys, His
Asparagine Asn Asp, Glu, Gln, Aspartic Acid Asp Asn, Glu, Gln
Cysteine Cys Met, Thr, Ser Glutamine Gln Asn, Glu, Asp Glutamic
Acid Glu Asp, Asn, Gln Glycine Gly Ala Histidine His Lys, Arg
Isoleucine Ile Val, Leu, Met Leucine Leu Val, Ile, Met Lysine Lys
Arg, His Methionine Met Ile, Leu, Val Phenylalanine Phe Tyr, His,
Trp Proline Pro Serine Ser Thr, Cys, Ala Threonine Thr Ser, Met,
Val Tryptophan Trp Phe, Tyr Tyrosine Tyr Phe, His Valine Val Leu,
Ile, Met
[0130] The current invention also embodies splice variants of
nematode ATP synthase subunit E-like sequences.
[0131] Another aspect of the present invention embodies a
polypeptide-encoding nucleic acid molecule that is capable of
hybridizing under conditions of low stringency (or high stringency)
to the nucleic acid molecule put forth in SEQ ID NO: 1, 2, and/or
3, or their complements.
[0132] The nucleic acid molecules that encode for ATP synthase
subunit E-like polypeptides may correspond to the naturally
occurring nucleic acid molecules or may differ by one or more
nucleotide substitutions, deletions, and/or additions. Thus, the
present invention extends to genes and any functional mutants,
derivatives, parts, fragments, naturally occurring polymorphisms,
homologs or analogs thereof or non-functional molecules. Such
nucleic acid molecules can be used to detect polymorphisms of ATP
synthase subunit E genes or ATP synthase subunit E-like genes,
e.g., in other nematodes. As mentioned below, such molecules are
useful as genetic probes; primer sequences in the enzymatic or
chemical synthesis of the gene; or in the generation of
immunologically interactive recombinant molecules. Using the
information provided herein, such as the nucleotide sequence SEQ ID
NO: 1, 2, and/or 3, a nucleic acid molecule encoding an ATP
synthase subunit E-like molecule may be obtained using standard
cloning and a screening techniques, such as a method described
herein.
[0133] Nucleic acid molecules of the present invention can be in
the form of RNA, such as mRNA, or in the form of DNA, including,
for example, cDNA and genomic DNA obtained by cloning or produced
synthetically. The DNA may be double-stranded or single-stranded.
The nucleic acids may be in the form of RNA/DNA hybrids.
Single-stranded DNA or RNA can be the coding strand, also referred
to as the sense strand, or the non-coding strand, also known as the
anti-sense strand.
[0134] One embodiment of the present invention includes a
recombinant nucleic acid molecule, which includes at least one
isolated nucleic acid molecule depicted in SEQ ID NO: 1, 2, and/or
3, inserted in a vector capable of delivering and maintaining the
nucleic acid molecule into a cell. The DNA molecule may be inserted
into an autonomously replicating vector (suitable vectors include,
for example, pGEM3Z and pcDNA3, and derivatives thereof). The
vector nucleic acid may be a bacteriophage DNA such as
bacteriophage lambda or M13 and derivatives thereof. The vector may
be either RNA or DNA, single- or double-stranded, prokaryotic,
eukaryotic, or viral. Vectors can include transposons, viral
vectors, episomes, (e.g., plasmids), chromosomes inserts, and
artificial chromosomes (e.g. BACs or YACs). Construction of a
vector containing a nucleic acid described herein can be followed
by transformation of a host cell such as a bacterium. Suitable
bacterial hosts include, but are not limited to, E. coli. Suitable
eukaryotic hosts include yeast such as S. cerevisiae, other fungi,
vertebrate cells, invertebrate cells (e.g., insect cells), plant
cells, human cells, human tissue cells, and whole eukaryotic
organisms. (e.g., a transgenic plant or a transgenic animal).
Further, the vector nucleic acid can be used to generate a virus
such as vaccinia or baculovirus.
[0135] The present invention also extends to genetic constructs
designed for polypeptide expression. Generally, the genetic
construct also includes, in addition to the encoding nucleic acid
molecule, elements that allow expression, such as a promoter and
regulatory sequences. The expression vectors may contain
transcriptional control sequences that control transcriptional
initiation, such as promoter, enhancer, operator, and repressor
sequences. A variety of transcriptional control sequences are well
known to those in the art and may be functional in, but are not
limited to, a bacterium, yeast, plant, or animal cell. The
expression vector can also include a translation regulatory
sequence (e.g., an untranslated 5' sequence, an untranslated 3'
sequence, a poly A addition site, or an internal ribosome entry
site), a splicing sequence or splicing regulatory sequence, and a
transcription termination sequence. The vector can be capable of
autonomous replication or it can integrate into host DNA.
[0136] In an alternative embodiment, the DNA molecule is fused to a
reporter gene such as .beta.-glucuronidase gene,
.beta.-galactosidase (lacZ), chloramphenicol-acetyltransferase
gene, a gene encoding green fluorescent protein (and variants
thereof), or red fluorescent protein firefly luciferase gene, among
others. The DNA molecule can also be fused to a nucleic acid
encoding a polypeptide affinity tag, e.g. glutathione S-transferase
(GST), maltose E binding protein, protein A, FLAG tag,
hexa-histidine, or the influenza HA tag. The affinity tag or
reporter fusion joins the reading frames of SEQ ID NO: 1, 2, and/or
3 to the reading frame of the reporter gene encoding the affinity
tag such that a translational fusion is generated. Expression of
the fusion gene results in translation of a single polypeptide that
includes both a nematode ATP synthase subunit E-like region and
reporter protein or affinity tag. The fusion can also join a
fragment of the reading frame of SEQ ID NO: 1, 2, and/or 3. The
fragment can encode a functional region of the ATP synthase subunit
E-like polypeptides, a structurally intact domain, or an epitope
(e.g., a peptide of about 8, 10, 20, or 30 or more amino acids). A
nematode ATP synthase subunit E-like nucleic acid that includes at
least one of a regulatory region (e.g., a 5' regulatory region, a
promoter, an enhancer, a 5' untranslated region, a translational
start site, a 3' untranslated region, a polyadenylation site, or a
3' regulatory region) can also be fused to a heterologous nucleic
acid. For example, the promoter of an ATP synthase subunit E-like
nucleic acid can be fused to a heterologous nucleic acid, e.g., a
nucleic acid encoding a reporter protein.
[0137] Suitable cells to transform include any cell that can be
transformed with a nucleic acid molecule of the present invention.
A transformed cell of the present invention is also herein referred
to as a recombinant or transgenic cell. Suitable cells can either
be untransformed cells or cells that have already been transformed
with at least one nucleic acid molecule. Suitable cells for
transformation according to the present invention can either be:
(i) endogenously capable of expressing the ATP synthase subunit
E-like protein or; (ii) capable of producing such protein after
transformation with at least one nucleic acid molecule of the
present invention.
[0138] In an exemplary embodiment, a nucleic acid of the invention
is used to generate a transgenic nematode strain, e.g., a
transgenic C. elegans strain. To generate such a strain, nucleic
acid is injected into the gonad of a nematode, thus generating a
heritable extrachromosomal array containing the nucleic acid (see,
e.g., Mello et al. (1991) EMBO J. 10:3959-3970). The transgenic
nematode can be propagated to generate a strain harboring the
transgene. Nematodes of the strain can be used in screens to
identify inhibitors specific for a M. javanica, H. glycines, and/or
Z. punctata ATP synthase subunit E-like gene.
[0139] Oligonucleotides
[0140] Also provided are oligonucleotides that can form stable
hybrids with a nucleic acid molecule of the present invention. The
oligonucleotides can be about 10 to 200 nucleotides, about 15 to
120 nucleotides, or about 17 to 80 nucleotides in length, e.g.,
about 10, 20, 30, 40, 50, 60, 80, 100, 120 nucleotides in length.
The oligonucleotides can be used as probes to identify nucleic acid
molecules, primers to produce nucleic acid molecules, or
therapeutic reagents to inhibit nematode ATP synthase subunit
E-like protein activity or production (e.g., antisense, triplex
formation, ribozyme, and/or RNA drug-based reagents). The present
invention includes oligonucleotides of RNA (ssRNA and dsRNA), DNA,
or derivatives of either. The invention extends to the use of such
oligonucleotides to protect non-nematode organisms (for example
e.g., plants and animals) from disease by reading the viability of
infecting namatodes, e.g., using a technology described herein.
Appropriate oligonucleotide-containing therapeutic compositions can
be administered to a non-nematode organism using techniques known
to those skilled in the art, including, but not limited to,
transgenic expression in plants or animals.
[0141] Primer sequences can be used to amplify an ATP synthase
subunit E-like nucleic acid or fragment thereof. For example, at
least 10 cycles of PCR amplification can be used to obtain such an
amplified nucleic acid. Primers can be at least about 8-40, 10-30
or 14-25 nucleotides in length, and can anneal to a nucleic acid
"template molecule", e.g., a template molecule encoding an ATP
synthase subunit E-like genetic sequence, or a functional part
thereof, or its complementary sequence. The nucleic acid primer
molecule can be any nucleotide sequence of at least 10 nucleotides
in length derived from, or contained within sequences depicted in
SEQ ID NO: 1, 2, and/or 3 and their complements. The nucleic acid
template molecule may be in a recombinant form, in a virus
particle, bacteriophage particle, yeast cell, animal cell, plant
cell, fungal cell, or bacterial cell. A primer can be chemically
synthesized by routine methods.
[0142] This invention embodies any ATP synthase subunit E-like
sequences that are used to identify and isolate similar genes from
other organisms, including nematodes, prokaryotic organisms, and
other eukaryotic organisms, such as other animals and/or
plants.
[0143] In another embodiment, the invention provides
oligonucleotides that are specific for a M. javanica, H. glycines,
and/or Z. punctata ATP synthase subunit E-like nucleic acid
molecule. Such oligonucleotides can be used in a PCR test to
determine if a M. javanica, H. glycines, and/or Z. punctata nucleic
acid is present in a sample, e.g., to monitor a disease caused M.
javanica and/or H. glycines.
[0144] Protein Production
[0145] Isolated ATP synthase subunit E-like proteins from nematodes
can be produced in a number of ways, including production and
recovery of the recombinant proteins and/or chemical synthesis of
the protein. In one embodiment, an isolated nematode ATP synthase
subunit E-like protein is produced by culturing a cell, e.g., a
bacterial, fungal, plant, or animal cell, capable of expressing the
protein, under conditions for effective production and recovery of
the protein. The nucleic acid can be operably linked to a
heterologous promoter, e.g., an inducible promoter or a
constitutive promoter. Effective growth conditions are typically,
but not necessarily, in liquid media comprising salts, water,
carbon, nitrogen, phosphate sources, minerals, and other nutrients,
but may be any solution in which ATP synthase subunit E-like
proteins may be produced.
[0146] In one embodiment, recovery of the protein may refer to
collecting the growth solution and need not involve additional
steps of purification. Proteins of the present invention, however,
can be purified using standard purification techniques, such as,
but not limited to, affinity chromatography, thermaprecipitation,
immunoaffinity chromatography, ammonium sulfate precipitation, ion
exchange chromatography, filtration, electrophoresis, hydrophobic
interaction chromatography, and others.
[0147] The ATP synthase subunit E-like polypeptide can be fused to
an affinity tag, e.g., a purification handle (e.g.,
glutathione-S-reductase, hexa-histidine, maltose binding protein,
dihydrofolate reductases, or chitin binding protein) or an epitope
tag (e.g., c-myc epitope tag, FLAG.TM. tag, or influenza HA tag).
Affinity tagged and epitope tagged proteins can be purified using
routine art-known methods.
[0148] Antibodies Against ATP Synthase Subunit E-Like
Polypeptides
[0149] Recombinant ATP synthase subunit E-like gene products or
derivatives thereof can be used to produce immunologically
interactive molecules, such as antibodies, or functional
derivatives thereof. Useful antibodies include those that bind to a
polypeptide that has substantially the same sequence as the amino
acid sequences recited in SEQ ID NO: 4, 5, and/or 6, or that has at
least 60% similarity over 50 or more amino acids to these
sequences. In a preferred embodiment, the antibody specifically
binds to a polypeptide having the amino acid sequence recited in
SEQ ID NO: 4, 5, and/or 6. The antibodies can be antibody fragments
and genetically engineered antibodies, including single chain
antibodies or chimeric antibodies that can bind to more than one
epitope. Such antibodies may be polyclonal or monoclonal and may be
selected from naturally occurring antibodies or may be specifically
raised to a recombinant ATP synthase subunit E-like protein.
[0150] Antibodies can be derived by immunization with a recombinant
or purified ATP synthase subunit E-like gene or gene product. As
used herein, the term "antibody" refers to an immunoglobulin, or
fragment thereof. Examples of antibody fragments include F(ab) and
F(ab').sub.2 fragments, particularly functional ones able to bind
epitopes. Such fragments can be generated by proteolytic cleavage,
e.g., with pepsin, or by genetic engineering. Antibodies can be
polyclonal, monoclonal, or recombinant. In addition, antibodies can
be modified to be chimeric, or humanized. Further, an antibody can
be coupled to a label or a toxin.
[0151] Antibodies can be generated against a full-length ATP
synthase subunit E-like protein, or a fragment thereof, e.g., an
antigenic peptide. Such polypeptides can be coupled to an adjuvant
to improve immunogenicity. Polyclonal serum is produced by
injection of the antigen into a laboratory animal such as a rabbit
and subsequent collection of sera. Alternatively, the antigen is
used to immunize mice. Lymphocytic cells are obtained from the mice
and fused with myelomas to form hybridomas producing
antibodies.
[0152] Peptides for generating ATP synthase subunit E-like
antibodies can be about 8, 10, 15, 20, 30 or more amino acid
residues in length, e.g., a peptide of such length obtained from
SEQ ID NO: 4, 5, and/or 6. Peptides or epitopes can also be
selected from regions exposed on the surface of the protein, e.g.,
hydrophilic or amphipathic regions. An epitope in the vicinity of
the active or binding site can be selected such that an antibody
binding such an epitope would block access to the active site or
prevent binding. Antibodies reactive with, or specific for, any of
these regions, or other regions or domains described herein are
provided. An antibody to an ATP synthase subunit E-like protein can
modulate an ATP synthase subunit E-like activity.
[0153] Monoclonal antibodies, which can be produced by routine
methods, are obtained in abundance and in homogenous form from
hybridomas formed from the fusion of immortal cell lines (e.g.,
myelomas) with lymphocytes immunized with ATP synthase subunit
E-like polypeptides such as those set forth in SEQ ID NO: 4, 5,
and/or 6.
[0154] In addition, antibodies can be engineered, e.g., to produce
a single chain antibody (see, for example, Colcher et al. (1999)
Ann N Y Acad Sci 880: 263-280; and Reiter (1996) Clin Cancer Res 2:
245-252). In still another implementation, antibodies are selected
or modified based on screening procedures, e.g., by screening
antibodies or fragments thereof from a phage display library.
[0155] Antibodies of the present invention have a variety of
important uses within the scope of this invention. For example,
such antibodies can be used: (i) as therapeutic compounds to
passively immunize an animal in order to protect the animal from
nematodes susceptible to antibody treatment; (ii) as reagents in
experimental assays to detect presence of nematodes; (iii) as tools
to screen for expression of the gene product in nematodes, animals,
fungi, bacteria, and plants; and/or (iv) as a purification tool of
ATP synthase subunit E-like protein; (v) as ATP synthase subunit E
inhibitors/activators that can be expressed or introduced into
plants or animals for therapeutic purposes.
[0156] An antibody against an ATP synthase subunit E-like protein
can be produced in a plant cell, e.g., in a transgenic plant or in
culture (see, e.g., U.S. Pat. No. 6,080,560).
[0157] Antibodies that specifically recognize a M. javanica, H.
glycines, and/or Z. punctata ATP synthase subunit E-like proteins
can be used to identify M. javanica, H. glycines, and/or Z.
punctata nematodes, and, thus, can be used to monitor a disease
caused by M. javanica and/or H. glycines.
[0158] Nucleic Acids Agents
[0159] Also featured are isolated nucleic acids that are antisense
to nucleic acids encoding nematode ATP synthase subunit E-like
proteins. An "antisense" nucleic acid includes a sequence that is
complementary to the coding strand of a nucleic acid encoding an
ATP synthase subunit E-like protein. The complementarity can be in
a coding region of the coding strand or in a noncoding region,
e.g., a 5' or 3' untranslated region, e.g., the translation start
site. The antisense nucleic acid can be produced from a cellular
promoter (e.g., a RNA polymerase II or III promoter), or can be
introduced into a cell, e.g., using a liposome. For example, the
antisense nucleic acid can be a synthetic oligonucleotide having a
length of about 10, 15, 20, 30, 40, 50, 75, 90, 120 or more
nucleotides in length.
[0160] An antisense nucleic acid can be synthesized chemically or
produced using enzymatic reagents, e.g., a ligase. An antisense
nucleic acid can also incorporate modified nucleotides, and
artificial backbone structures, e.g., phosphorothioate derivative,
and acridine substituted nucleotides.
[0161] Ribozymes. The antisense nucleic acid can be a ribozyme. The
ribozyme can be designed to specifically cleave RNA, e.g., an ATP
synthase subunit E-like mRNA. Methods for designing such ribozymes
are described in U.S. Pat. No. 5,093,246 or Haselhoff and Gerlach
(1988) Nature 334:585-591. For example, the ribozyme can be a
derivative of Tetrahymena L-19 IVS RNA in which the nucleotide
sequence of the active site is modified to be complementary to an
ATP synthase subunit E-like nucleic acid (see, e.g., Cech et al.
U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No.
5,116,742).
[0162] Peptide Nucleic Acid (PNA). An antisense agent directed
against an ATP synthase subunit E-like nucleic acid can be a
peptide nucleic acid (PNA). See Hyrup et al. (1996) Bioorganic
& Medicinal Chemistry 4: 5-23) for methods and a description of
the replacement of the deoxyribose phosphate backbone for a
pseudopeptide backbone. A PNA can specifically hybridize to DNA and
RNA under conditions of low ionic strength as a result of its
electrostatic properties. The synthesis of PNA oligomers can be
performed using standard solid phase peptide synthesis protocols as
described in Hyrup et al. (1996) supra and Perry-O'Keefe et al.
Proc. Natl. Acad. Sci. 93: 14670-14675.
[0163] RNA Mediated Interference (RNAi). A double stranded RNA
(dsRNA) molecule can be used to inactivate an ATP synthase subunit
E-like gene in a cell by a process known as RNA
mediated-interference (RNAi; e.g., Fire et al. (1998) Nature
391:806-811, and Gonczy et al. (2000) Nature 408:331-336). The
dsRNA molecule can have the nucleotide sequence of an ATP synthase
subunit E-like nucleic acid described herein or a fragment thereof.
The molecule can be injected into a cell, or a syncytium, e.g., a
nematode gonad as described in Fire et al., supra.
[0164] Screening Assays
[0165] Another embodiment of the present invention is a method of
identifying a compound capable of altering (e.g., inhibiting or
enhancing) the activity of ATP synthase subunit E-like molecules.
This method, also referred to as a "screening assay," herein,
includes, but is not limited to, the following procedure: (i)
contacting an isolated ATP synthase subunit E-like protein with a
test inhibitory compound under conditions in which, in the absence
of the test compound, the protein has ATP synthase subunit E-like
activity; and (ii) determining if the test compound alters the ATP
synthase subunit E-like activity or alters the ability of the
subunit E to regulate other polypeptides or molecules e.g., the
catalytic subcomplex of ATP synthase or a portion (subunit)
thereof. Suitable inhibitors or activators that alter a nematode
ATP synthase subunit E-like activity include compounds that
interact directly with a nematode ATP synthase subunit E-like
protein, perhaps but not necessarily, in the active or binding
site. They can also interact with other regions of the nematode ATP
synthase subunit E protein by binding to regions outside of the
active site or site responsible for regulation, for example, by
allosteric interaction. They can also bind to the complex normally
bound by the subunit E, interfering with binding to and regulation
by the subunit E.
[0166] Compounds. A test compound can be a large or small molecule,
for example, an organic compound with a molecular weight of about
100 to 10,000; 200 to 5,000; 200 to 2000; or 200 to 1,000 daltons.
A test compound can be any chemical compound, for example, a small
organic molecule, a carbohydrate, a lipid, an amino acid, a
polypeptide, a nucleoside, a nucleic acid, or a peptide nucleic
acid. Small molecules include, but are not limited to, metabolites,
metabolic analogues, peptides, peptidomimetics (e.g., peptoids),
amino acids, amino acid analogs, polynucleotides, polynucleotide
analogs, nucleotides, nucleotide analogs, organic or inorganic
compounds (i.e., including heteroorganic and organometallic
compounds). Compounds and components for synthesis of compounds can
be obtained from a commercial chemical supplier, e.g.,
Sigma-Aldrich Corp. (St. Louis, Mo.). The test compound or
compounds can be naturally occurring, synthetic, or both. A test
compound can be the only substance assayed by the method described
herein. Alternatively, a collection of test compounds can be
assayed either consecutively or concurrently by the methods
described herein.
[0167] Compounds can also act by allosteric inhibition or by
preventing the subunit E from binding to, and thus, regulating its
target, i.e., an ATP synthase.
[0168] A high-throughput method can be used to screen large
libraries of chemicals. Such libraries of candidate compounds can
be generated or purchased, e.g., from Chembridge Corp. (San Diego,
Calif.). Libraries can be designed to cover a diverse range of
compounds. For example, a library can include 10,000, 50,000, or
100,000 or more unique compounds. Merely by way of illustration, a
library can be constructed from heterocycles including pyridines,
indoles, quinolines, furans, pyrimidines, triazines, pyrroles,
imidazoles, naphthalenes, benzimidazoles, piperidines, pyrazoles,
benzoxazoles, pyrrolidines, thiphenes, thiazoles, benzothiazoles,
and morpholines. A library can be designed and synthesized to cover
such classes of chemicals, e.g., as described in DeWitt et al.
(1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909-6913; Erb et al.
(1994) Proc. Natl. Acad. Sci. USA 91:11422-11426; Zuckermann et al.
(1994) J. Med. Chem. 37:2678-2685; Cho et al. (1993) Science
261:1303-1305; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl.
33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061;
and Gallop et al. (1994) J. Med. Chem. 37:1233-1251.
[0169] Organism-Based Assays. Organisms can be grown in microtiter
plates, e.g., 6-well, 32-well, 64-well, 96-well, 384-well
plates.
[0170] In one embodiment, the organism is a nematode. The nematodes
can be genetically modified. Non-limiting examples of such modified
nematodes include: 1) nematodes or nematode cells (M. javanica, H.
glycines, Z. punctata, and/or C. elegans) having one or more ATP
synthase subunit E-like genes inactivated (e.g., using RNA mediated
interference); 2) nematodes or nematode cells expressing a
heterologous ATP synthase subunit E-like gene, e.g., an ATP
synthase subunit E-like gene from another species; and 3) nematodes
or nematode cells having one or more endogenous ATP synthase
subunit E-like genes inactivated and expressing a heterologous ATP
synthase subunit E-like gene, e.g., a M. javanica, H. glycines,
and/or Z. punctata ATP synthase subunit E-like gene as described
herein.
[0171] A plurality of candidate compounds, e.g., a combinatorial
library, can be screened. The library can be provided in a format
that is amenable for robotic manipulation, e.g., in microtitre
plates. Compounds can be added to the wells of the microtiter
plates. Following compound addition and incubation, viability
and/or reproductive properties of the nematodes or nematode cells
are monitored.
[0172] The compounds can also be pooled, and the pools tested.
Positive pools are split for subsequent analysis. Regardless of the
method, compounds that decrease the viability or reproductive
ability of nematodes, nematode cells, or progeny of the nematodes
are considered lead compounds.
[0173] In another embodiment, the compounds can be tested on a
microorganism or a eukaryotic or mammalian cell line, e.g., rabbit
skin cells, Chinese hamster ovary cells (CHO), and/or Hela cells.
For example, CHO cells absent for ATP synthase subunit E-like
genes, but expressing a nematode ATP synthase subunit E-like gene
can be used. The generation of such strains is routine in the art.
As described above for nematodes and nematode cells, the cell lines
can be grown in microtitre plates, each well having a different
candidate compound or pool of candidate compounds. Growth is
monitored during or after the assay to determine if the compound or
pool of compounds is a modulator of a nematode ATP synthase subunit
E-like polypeptide.
[0174] In Vitro Activity Assays. The screening assay can be an in
vitro activity assay. For example, a nematode ATP synthase subunit
E-like polypeptide can be purified as described above. The
polypeptide can be disposed in an assay container, e.g., a well of
a microtitre plate. A candidate compound can be added to the assay
container, and the ATP synthase subunit E-like activity is
measured. Optionally, the activity is compared to the activity
measured in a control container in which no candidate compound is
disposed or in which an inert or non-functional compound is
disposed
[0175] In Vitro Binding Assays. The screening assay can also be a
cell-free binding assay, e.g., an assay to identify compounds that
bind a nematode ATP synthase subunit E-like polypeptide. For
example, a nematode ATP synthase subunit E-like polypeptide can be
purified and labeled. The labeled polypeptide is contacted to
beads; each bead has a tag detectable by mass spectroscopy, and
test compound, e.g., a compound synthesized by combinatorial
chemical methods. Beads to which the labeled polypeptide is bound
are identified and analyzed by mass spectroscopy. The beads can be
generated using "split-and-pool" synthesis. The method can further
include a second assay to determine if the compound alters the
activity of the ATP synthase subunit E-like polypeptide.
[0176] Optimization of a Compound. Once a lead compound has been
identified, standard principles of medicinal chemistry can be used
to produce derivatives of the compound. Derivatives can be screened
for improved pharmacological properties, for example, efficacy,
pharmacokinetics, stability, solubility, and clearance. The
moieties responsible for a compound's activity in the
above-described assays can be delineated by examination of
structure-activity relationships (SAR) as is commonly practiced in
the art. One can modify moieties on a lead compound and measure the
effects of the modification on the efficacy of the compound to
thereby produce derivatives with increased potency. For an example,
see Nagarajan et al. (1988) J. Antibiot. 41:1430-1438. A
modification can include N-acylation, amination, amidation,
oxidation, reduction, alkylation, esterification, and
hydroxylation. Furthermore, if the biochemical target of the lead
compound is known or determined, the structure of the target and
the lead compound can inform the design and optimization of
derivatives. Molecular modeling software to do this is commercially
available (e.g., Molecular Simulations, Inc.). "SAR by NMR," as
described in Shuker et al. (1996) Science 274:1531-1534, can be
used to design ligands with increased affinity, by joining
lower-affinity ligands.
[0177] A preferred compound is one that interferes with the
function of an ATP synthase subunit E-like polypeptide and that is
not substantially toxic to plants, animals, or humans. By "not
substantially toxic" it is meant that the compound does not
substantially affect the respective animal, or human ATP synthase
subunit E proteins or ATP synthase activity. Thus, particularly
desirable inhibitors of M. javanica, H. glycines, and/or Z.
punctata ATP synthase subunit E do not substantially inhibit ATP
synthase subunit E-like polypeptides or ATP synthase activity of
vertebrates, e.g., humans for example. Other desirable compounds do
not substantially inhibit to ATP synthase activity of plants.
[0178] Standard pharmaceutical procedures can be used to assess the
toxicity and therapeutic efficacy of a modulator of an ATP synthase
subunit E-like activity. The LD50 (the dose lethal to 50% of the
population) and the ED50 (the dose therapeutically effective in 50%
of the population can be measured in cell cultures, experimental
plants (e.g., in laboratory or field studies), or experimental
animals. Optionally, a therapeutic index can be determined which is
expressed as the ratio: LD50/ED50. High therapeutic indices are
indicative of a compound being an effective ATP synthase subunit
E-like inhibitor, while not causing undue toxicity or side effects
to a subject (e.g., a host plant or host animal).
[0179] Alternatively, the ability of a candidate compound to
modulate a non-nematode ATP synthase subunit E-like polypeptide is
assayed, e.g., by a method described herein. For example, the
inhibition constant of a candidate compound for a mammalian ATP
synthase subunit E-like polypeptide can be measured and compared to
the inhibition constant for a nematode ATP synthase subunit E-like
polypeptide.
[0180] The aforementioned analyses can be used to identify and/or
design a modulator with specificity for nematode ATP synthase
subunit E-like polypeptide over vertebrate or other animal (e.g.,
mammalian) ATP synthase subunit E-like polypeptides. Suitable
nematodes to target are any nematodes with the ATP synthase subunit
E-like proteins or proteins that can be targeted by a compound that
otherwise inhibits, reduces, activates, or generally effects the
activity of nematode ATP synthase subunit E proteins.
[0181] Inhibitors of nematode ATP synthase subunit E-like proteins
can also be used to identify ATP synthase subunit E-like proteins
in the nematode or other organisms using procedures known in the
art, such as affinity chromatography. For example, a specific
antibody may be linked to a resin and a nematode extract passed
over the resin, allowing any ATP synthase subunit E-like proteins
that bind the antibody to bind the resin. Subsequent biochemical
techniques familiar to those skilled in the art can be performed to
purify and identify bound ATP synthase subunit E-like proteins.
[0182] Agricultural Compositions
[0183] A compound that is identified as an ATP synthase subunit
E-like polypeptide inhibitor can be formulated as a composition
that is applied to plants, soil, or seeds in order to confer
nematode resistance. The composition can be prepared in a solution,
e.g., an aqueous solution, at a concentration from about 0.005% to
10%, or about 0.01% to 1%, or about 0.1% to 0.5% by weight. The
solution can include an organic solvent, e.g., glycerol or ethanol.
The composition can be formulated with one or more agriculturally
acceptable carriers. Agricultural carriers can include: clay, talc,
bentonite, diatomaceous earth, kaolin, silica, benzene, xylene,
toluene, kerosene, N-methylpyrrolidone, alcohols (methanol,
ethanol, isopropanol, n-butanol, ethylene glycol, propylene glycol,
and the like), and ketones (acetone, methylethyl ketone,
cyclohexanone, and the like). The formulation can optionally
further include stabilizers, spreading agents, wetting extenders,
dispersing agents, sticking agents, disintegrators, and other
additives, and can be prepared as a liquid, a water-soluble solid
(e.g., tablet, powder or granule), or a paste.
[0184] Prior to application, the solution can be combined with
another desired composition such as another antihelmintic agent,
germicide, fertilizer, plant growth regulator and the like. The
solution may be applied to the plant tissue, for example, by
spraying, e.g., with an atomizer, by drenching, by pasting, or by
manual application, e.g., with a sponge. The solution can also be
distributed from an airborne source, e.g., an aircraft or other
aerial object, e.g., a fixture mounted with an apparatus for
spraying the solution, the fixture being of sufficient height to
distribute the solution to the desired plant tissues.
Alternatively, the composition can be applied to plant tissue from
a volatile or airborne source. The source is placed in the vicinity
of the plant tissue and the composition is dispersed by diffusion
through the atmosphere. The source and the plant tissue to be
contacted can be enclosed in an incubator, growth chamber, or
greenhouse, or can be in sufficient proximity that they can be
outdoors.
[0185] If the composition is distributed systemically thorough the
plant, the composition can be applied to tissues other than the
leaves, e.g., to the stems or roots. Thus, the composition can be
distributed by irrigation. The composition can also be injected
directly into roots or stems.
[0186] A skilled artisan would be able to determine an appropriate
dosage for formulation of the active ingredient of the composition.
For example, the ED50 can be determined as described above from
experimental data. The data can be obtained by experimentally
varying the dose of the active ingredient to identify a dosage
effective for killing a nematode, while not causing toxicity in the
host plant or host animal (i.e. non-nematode animal).
[0187] A number of embodiments of the invention have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the invention. Accordingly, other embodiments are within
the scope of the following claims.
Sequence CWU 1
1
14 1 466 DNA Meloidogyne javanica CDS (40)...(351) 1 gtttaattac
ccaagtttga gataaaattt atttaaaaa atg tca aag ccg cat 54 Met Ser Lys
Pro His 1 5 ccg acc gat ata att ctt cct gaa cca atc cag gtt tca ccg
tta att 102 Pro Thr Asp Ile Ile Leu Pro Glu Pro Ile Gln Val Ser Pro
Leu Ile 10 15 20 cgt ttt gct cgt tgg act gct ctt ggt gcg gga ata
att tat ggc tat 150 Arg Phe Ala Arg Trp Thr Ala Leu Gly Ala Gly Ile
Ile Tyr Gly Tyr 25 30 35 gtt cgt ttc cat caa att gct cgt ggt cat
gca ctt att cgt gaa tgg 198 Val Arg Phe His Gln Ile Ala Arg Gly His
Ala Leu Ile Arg Glu Trp 40 45 50 gag gct gat aaa ttt atc cat aaa
gtt gaa cag gag cat gag aga gct 246 Glu Ala Asp Lys Phe Ile His Lys
Val Glu Gln Glu His Glu Arg Ala 55 60 65 aaa gta aat caa agg aag
gag tct gaa ttt gtc atg cag gtg act ggt 294 Lys Val Asn Gln Arg Lys
Glu Ser Glu Phe Val Met Gln Val Thr Gly 70 75 80 85 tct aat atc gat
gag ggc aag gca agt atg gat gtt gag cat ctt tat 342 Ser Asn Ile Asp
Glu Gly Lys Ala Ser Met Asp Val Glu His Leu Tyr 90 95 100 ctg aag
ctg tagaggaata ttcgagtata gaaaaaagta aatttcaagt 391 Leu Lys Leu
taaaatttgt tgttttttgt atgaattaga caaaaaatta aataaaaata ggatttagaa
451 aaaaaaaaaa aaaaa 466 2 516 DNA Heterodera glycines CDS
(43)...(381) 2 ttgggtttta attacccaag tttgagggta ttcaaagtca tt atg
gcg gat gtt 54 Met Ala Asp Val 1 cgg cct aag acg gtt cca aaa gag
cag cac cct ttt tac atc ctc cac 102 Arg Pro Lys Thr Val Pro Lys Glu
Gln His Pro Phe Tyr Ile Leu His 5 10 15 20 ccc gag cct att cga atc
tct ccg ctg ctc cga ttt gct cgt tgg tcg 150 Pro Glu Pro Ile Arg Ile
Ser Pro Leu Leu Arg Phe Ala Arg Trp Ser 25 30 35 gcc ctc ggc cta
ggc att gtg tat ggt ttc gtc cgt ctt cgt atg gtc 198 Ala Leu Gly Leu
Gly Ile Val Tyr Gly Phe Val Arg Leu Arg Met Val 40 45 50 agc aaa
tac cac gcg gac atc cgc gaa tgg gaa gtg caa aag acc atc 246 Ser Lys
Tyr His Ala Asp Ile Arg Glu Trp Glu Val Gln Lys Thr Ile 55 60 65
cac aag aag gat gcg gat aag aag gag tca ctg aga gtg ctg cgt gag 294
His Lys Lys Asp Ala Asp Lys Lys Glu Ser Leu Arg Val Leu Arg Glu 70
75 80 caa aac gaa tgg att atg aag atc acc gac atg aat ttg gag gag
gga 342 Gln Asn Glu Trp Ile Met Lys Ile Thr Asp Met Asn Leu Glu Glu
Gly 85 90 95 100 aag tcg caa ttg ggc gtg gag cat ttg tac gat ttg
aaa tagaaagcga 391 Lys Ser Gln Leu Gly Val Glu His Leu Tyr Asp Leu
Lys 105 110 agaatcgtct cacaacgaca aattgcgatt agggatttct ttgtgttatc
agtcacagtt 451 gacgaacctt tcaattgttt tgtttggaaa aacaatgtta
ttgtagattt cgtaaaaata 511 aagaa 516 3 489 DNA Zeldia punctata CDS
(64)...(381) 3 gccgccgcca gtgtgatgga tatctgcaga attcgccctt
tttaattacc caagtttgag 60 gtc atg ccc att gga aaa aac ccc gct ttt
caa tat cac gtc cca gaa 108 Met Pro Ile Gly Lys Asn Pro Ala Phe Gln
Tyr His Val Pro Glu 1 5 10 15 cca atc ccg gtt tct cca ttg atc aga
gca acc cgt tgg gga ctt ctt 156 Pro Ile Pro Val Ser Pro Leu Ile Arg
Ala Thr Arg Trp Gly Leu Leu 20 25 30 ggt ttg ggt atc gta tgg ggt
gct atc cgt tat cgt caa att tgt gag 204 Gly Leu Gly Ile Val Trp Gly
Ala Ile Arg Tyr Arg Gln Ile Cys Glu 35 40 45 aag cat gct gat atc
cgc gca tgg gag cat gac caa gat acg gaa cta 252 Lys His Ala Asp Ile
Arg Ala Trp Glu His Asp Gln Asp Thr Glu Leu 50 55 60 acg ctt gaa
aac aat cgc aaa gct cgt ttg gca ctc cgt gaa caa ctt 300 Thr Leu Glu
Asn Asn Arg Lys Ala Arg Leu Ala Leu Arg Glu Gln Leu 65 70 75 atc
gtc tta tgg aaa caa atc ggt ctg cca ttc aac gaa ggt gtc gcc 348 Ile
Val Leu Trp Lys Gln Ile Gly Leu Pro Phe Asn Glu Gly Val Ala 80 85
90 95 tcc ttc aag gcc aac gat ctt ttc cgt gac gaa taggactttt
ttaaaaccaa 401 Ser Phe Lys Ala Asn Asp Leu Phe Arg Asp Glu 100 105
aaatagcata tttagtttat atttgtttat ttttaaaaaa cttgagctgt ctataaaaat
461 gtcttagatc aaaaaaaaaa aaaaaaaa 489 4 104 PRT Meloidogyne
javanica 4 Met Ser Lys Pro His Pro Thr Asp Ile Ile Leu Pro Glu Pro
Ile Gln 1 5 10 15 Val Ser Pro Leu Ile Arg Phe Ala Arg Trp Thr Ala
Leu Gly Ala Gly 20 25 30 Ile Ile Tyr Gly Tyr Val Arg Phe His Gln
Ile Ala Arg Gly His Ala 35 40 45 Leu Ile Arg Glu Trp Glu Ala Asp
Lys Phe Ile His Lys Val Glu Gln 50 55 60 Glu His Glu Arg Ala Lys
Val Asn Gln Arg Lys Glu Ser Glu Phe Val 65 70 75 80 Met Gln Val Thr
Gly Ser Asn Ile Asp Glu Gly Lys Ala Ser Met Asp 85 90 95 Val Glu
His Leu Tyr Leu Lys Leu 100 5 113 PRT Heterodera glycines 5 Met Ala
Asp Val Arg Pro Lys Thr Val Pro Lys Glu Gln His Pro Phe 1 5 10 15
Tyr Ile Leu His Pro Glu Pro Ile Arg Ile Ser Pro Leu Leu Arg Phe 20
25 30 Ala Arg Trp Ser Ala Leu Gly Leu Gly Ile Val Tyr Gly Phe Val
Arg 35 40 45 Leu Arg Met Val Ser Lys Tyr His Ala Asp Ile Arg Glu
Trp Glu Val 50 55 60 Gln Lys Thr Ile His Lys Lys Asp Ala Asp Lys
Lys Glu Ser Leu Arg 65 70 75 80 Val Leu Arg Glu Gln Asn Glu Trp Ile
Met Lys Ile Thr Asp Met Asn 85 90 95 Leu Glu Glu Gly Lys Ser Gln
Leu Gly Val Glu His Leu Tyr Asp Leu 100 105 110 Lys 6 106 PRT
Zeldia punctata 6 Met Pro Ile Gly Lys Asn Pro Ala Phe Gln Tyr His
Val Pro Glu Pro 1 5 10 15 Ile Pro Val Ser Pro Leu Ile Arg Ala Thr
Arg Trp Gly Leu Leu Gly 20 25 30 Leu Gly Ile Val Trp Gly Ala Ile
Arg Tyr Arg Gln Ile Cys Glu Lys 35 40 45 His Ala Asp Ile Arg Ala
Trp Glu His Asp Gln Asp Thr Glu Leu Thr 50 55 60 Leu Glu Asn Asn
Arg Lys Ala Arg Leu Ala Leu Arg Glu Gln Leu Ile 65 70 75 80 Val Leu
Trp Lys Gln Ile Gly Leu Pro Phe Asn Glu Gly Val Ala Ser 85 90 95
Phe Lys Ala Asn Asp Leu Phe Arg Asp Glu 100 105 7 312 DNA
Meloidogyne javanica 7 atgtcaaagc cgcatccgac cgatataatt cttcctgaac
caatccaggt ttcaccgtta 60 attcgttttg ctcgttggac tgctcttggt
gcgggaataa tttatggcta tgttcgtttc 120 catcaaattg ctcgtggtca
tgcacttatt cgtgaatggg aggctgataa atttatccat 180 aaagttgaac
aggagcatga gagagctaaa gtaaatcaaa ggaaggagtc tgaatttgtc 240
atgcaggtga ctggttctaa tatcgatgag ggcaaggcaa gtatggatgt tgagcatctt
300 tatctgaagc tg 312 8 339 DNA Heterodera glycines 8 atggcggatg
ttcggcctaa gacggttcca aaagagcagc acccttttta catcctccac 60
cccgagccta ttcgaatctc tccgctgctc cgatttgctc gttggtcggc cctcggccta
120 ggcattgtgt atggtttcgt ccgtcttcgt atggtcagca aataccacgc
ggacatccgc 180 gaatgggaag tgcaaaagac catccacaag aaggatgcgg
ataagaagga gtcactgaga 240 gtgctgcgtg agcaaaacga atggattatg
aagatcaccg acatgaattt ggaggaggga 300 aagtcgcaat tgggcgtgga
gcatttgtac gatttgaaa 339 9 318 DNA Zeldia punctata 9 atgcccattg
gaaaaaaccc cgcttttcaa tatcacgtcc cagaaccaat cccggtttct 60
ccattgatca gagcaacccg ttggggactt cttggtttgg gtatcgtatg gggtgctatc
120 cgttatcgtc aaatttgtga gaagcatgct gatatccgcg catgggagca
tgaccaagat 180 acggaactaa cgcttgaaaa caatcgcaaa gctcgtttgg
cactccgtga acaacttatc 240 gtcttatgga aacaaatcgg tctgccattc
aacgaaggtg tcgcctcctt caaggccaac 300 gatcttttcc gtgacgaa 318 10 107
PRT Caenorhabidits elegans 10 Met Ser Ala Pro Leu Lys His Pro Asn
Ala Val Val Leu Gln Pro Pro 1 5 10 15 Thr Val Thr Ile Ser Pro Leu
Ile Arg Phe Gly Arg Tyr Ala Ala Leu 20 25 30 Ser Leu Gly Val Val
Tyr Gly Phe Phe Arg Leu Arg Gln Ile Arg Glu 35 40 45 Tyr His Ala
Asp Ile Arg Glu Trp Asp His Glu Lys Ala Val Ala Ala 50 55 60 Ala
Glu Glu Ala Ala Lys Lys Lys Lys Trp Leu Ala Lys Asp Glu Met 65 70
75 80 Arg Tyr Leu Met Gln Val Val Asn Ile Pro Phe Glu Glu Gly Val
Lys 85 90 95 Gln Phe Gly Val Ala Asp Leu Tyr Lys Glu Asp 100 105 11
23 DNA Artificial Sequence primer 11 gtaatacgac tcactatagg ggc 23
12 20 DNA Artificial Sequence primer 12 aattaaccct cactaaaggg 20 13
22 DNA Artificial Sequence primer 13 gggtttaatt acccaagttt ga 22 14
50 DNA Artificial Sequence primer 14 gagagagaga gagagagaga
actagtctcg agtttttttt tttttttttt 50
* * * * *