U.S. patent application number 10/985832 was filed with the patent office on 2005-09-08 for ctla4-cy4 fusion proteins.
This patent application is currently assigned to REPLIGEN CORPORATION. Invention is credited to Carson, Jerry, Gray, Gary S., Javaherian, Kashi, Rennert, Paul D., Silver, Sandra.
Application Number | 20050196402 10/985832 |
Document ID | / |
Family ID | 24383868 |
Filed Date | 2005-09-08 |
United States Patent
Application |
20050196402 |
Kind Code |
A1 |
Gray, Gary S. ; et
al. |
September 8, 2005 |
CTLA4-Cy4 fusion proteins
Abstract
CTLA4-immunoglobulin fusion proteins having modified
immunoglobulin constant region-mediated effector functions, and
nucleic acids encoding the fusion proteins, are described. The
CTLA4-immunoglobulin fusion proteins comprise two components: a
first peptide having a CTLA4 activity and a second peptide
comprising an immunoglobulin constant region which is modified to
reduce at least one constant region-mediated biological effector
function relative to a CTLA4-IgG1 fusion protein. The nucleic acids
of the invention can be integrated into various expression vectors,
which in turn can direct the synthesis of the corresponding
proteins in a variety of hosts, particularly eukaryotic cells. The
CTLA4-immunoglobulin fusion proteins described herein can be
administered to a subject to inhibit an interaction between a CTLA4
ligand (e.g., B7-1 and/or B7-2) on an antigen presenting cell and a
receptor for the CTLA4 ligand (e.g., CD28 and/or CTLA4) on the
surface of T cells to thereby suppress an immune response in the
subject, for example to inhibit transplantation rejection, graft
versus host disease or autoimmune responses.
Inventors: |
Gray, Gary S.; (Brookline,
MA) ; Carson, Jerry; (Belmont, MA) ;
Javaherian, Kashi; (Lexington, MA) ; Rennert, Paul
D.; (Holliston, MA) ; Silver, Sandra; (Boston,
MA) |
Correspondence
Address: |
LAHIVE & COCKFIELD, LLP.
28 STATE STREET
BOSTON
MA
02109
US
|
Assignee: |
REPLIGEN CORPORATION
41 Seyon Street, Building One Suite 100
Waltham
MA
02453-8348
|
Family ID: |
24383868 |
Appl. No.: |
10/985832 |
Filed: |
November 8, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10985832 |
Nov 8, 2004 |
|
|
|
10027075 |
Dec 20, 2001 |
|
|
|
10027075 |
Dec 20, 2001 |
|
|
|
09227595 |
Jan 8, 1999 |
|
|
|
6444792 |
|
|
|
|
09227595 |
Jan 8, 1999 |
|
|
|
08595590 |
Feb 2, 1996 |
|
|
|
6750334 |
|
|
|
|
Current U.S.
Class: |
424/178.1 ;
530/391.1 |
Current CPC
Class: |
C07K 2319/00 20130101;
C07K 14/70503 20130101; A61K 2039/5154 20130101; A61K 38/00
20130101; A61P 37/06 20180101 |
Class at
Publication: |
424/178.1 ;
530/391.1 |
International
Class: |
A61K 039/395; C07K
016/46 |
Claims
1-55. (canceled)
56. A CTLA4-immunoglobulin fusion protein comprising a first
peptide having a CTLA4 activity and a second peptide comprising an
immunoglobulin constant region which is modified to reduce at least
one constant region-mediated biological effector function relative
to a CTLA4-IgG1 fusion protein.
57. A CTLA4-immunoglobulin fusion protein of claim 56, wherein the
first peptide comprises an extracellular domain of the CTLA4
protein.
58. A CTLA4-immunoglobulin fusion protein of claim 57, wherein the
first peptide comprises amino acid residues 1-125 of the human
CTLA4 protein.
59. A CTLA4-immunoglobulin fusion protein of claim 56, wherein the
immunoglobulin constant region comprises a hinge region, a CH2
domain and a CH3 domain.
60. A CTLA4-immunoglobulin fusion protein of claim 59, wherein the
hinge region, the CH2 domain and the CH3 domain are selected from
the group consisting of C.gamma.1, C.gamma.2, C.gamma.3 and
C.gamma.4.
61. A CTLA4-immunoglobulin fusion protein, comprising a first
peptide having a CTLA4 activity and a second peptide comprising an
immunoglobulin constant region wherein the immunoglobulin constant
region comprises a heavy chain CH1 domain, a hinge region, a CH2
domain and a CH3 domain.
62. The peptide of claim 61, wherein the immunoglobulin constant
region is modified to reduce at least one constant region-mediated
biological effector function.
63. The peptide of claim 61, wherein the first peptide having a
CTLA4 activity and the hinge region of the second peptide include
at least one cysteine residue available for disulfide bond
formation.
64. The peptide of claim 62, wherein the first peptide having a
CTLA4 activity and the hinge region of the second peptide include
at least one cysteine residue available for disulfide bond
formation.
65. A CTLA4-immunoglobulin fusion protein of claim 59, wherein the
CH2 domain is modified to reduce biological effector functions.
66. A CTLA4-immunoglobulin fusion protein of claim 65, wherein the
biological effector function is selected from the group consisting
of complement activation, Fc receptor interaction, and complement
activation and Fc receptor interaction.
67. A CTLA4-immunoglobulin fusion protein of claim 66, wherein the
CH2 domain is modified by substitution of an amino acid residue
located at a position of an intact immunoglobulin heavy chain
selected from the group consisting of position 234, position 235
and position 237.
68. A CTLA4-immunoglobulin fusion protein of claim 67 comprising an
amino acid sequence shown in SEQ ID NO: 24.
69. A CTLA4-immunoglobulin fusion protein of claim 68 comprising an
amino acid sequence shown in SEQ ID NO: 28.
70. A CTLA4-immunoglobulin light chain fusion protein, wherein the
first peptide comprises a CTLA4 extracellular domain and the second
peptide comprises an immunoglobulin kappa light chain constant
domain.
71. An isolated peptide consisting of a CTLA4 extracellular domain
produced by a bacterial host cell, wherein said host cell is
transfected with an expression vector comprising a nucleotide
sequence encoding a CTLA4 extracellular domain.
72. An isolated peptide consisting of a signal sequence and a CTLA4
extracellular domain produced by a bacterial host cell, wherein
said host cell is transfected with an expression vector consisting
of a nucleotide sequence encoding a signal sequence and a
nucleotide sequence encoding a CTLA4 extracellular domain.
73. A composition suitable for pharmaceutical administration
comprising a CTLA4-immunoglobulin fusion protein of claim 56, and a
pharmaceutically acceptable carrier.
74. A composition suitable for pharmaceutical administration
comprising a CTLA4-immunoglobulin fusion protein of claim 58, and a
pharmaceutically acceptable carrier.
75-91. (canceled)
Description
BACKGROUND OF THE INVENTION
[0001] To induce antigen-specific T cell activation and clonal
expansion, two signals provided by antigen-presenting cells (APCs)
must be delivered to the surface of resting T lymphocytes (Jenkins,
M. and Schwartz, R. (1987) J. Exp. Med. 165:302-319; Mueller, D.
L., et al. (1990) J. Immmunol. 144:3701-3709; Williams, I. R. and
Unanue, E. R. (1990) J. Immunol. 145:85-93). The first signal,
which confers specificity to the immune response, is mediated via
the T cell receptor (TCR) following recognition of foreign
antigenic peptide presented in the context of the major
histocompatibility complex (MHC). The second signal, termed
costimulation, induces T cells to proliferate and become functional
(Schwartz, R. H. (1990) Science 248:1349-1356). Costimulation is
neither antigen-specific, nor MHC restricted and is thought to be
provided by one or more distinct cell surface molecules expressed
by APCs (Jenkins, M. K., et al. (1988) J. Immunol. 140:3324-3330;
Linsley, P. S., et al. (1991) J. Exp. Med. 173:721-730; Gimmi, C.
D. et al., (1991) Proc. Natl. Acad. Sci. USA, 88:6575-6579; Young,
J. W., et al. (1992) J. Clin. Invest. 90:229-237; Koulova, L., et
al. (1991) J. Exp. Med. 173:759-762; Reiser, H., et al. (1992)
Proc. Natl. Acad. Sci. USA. 89:271-275; van-Seventer G. A., et al.
(1990) J. Immunol. 144:4579-4586; LaSalle, J. M., et al., (1991) J.
Immunol. 147:774-80; Dustin, M. I. et al., (1989) J. Exp. Med.
169:503; Armitage, R. J., et al. (1992) Nature 357:80-82; Liu, Y.,
et al. (1992) J. Exp. Med. 175:437-445).
[0002] Considerable evidence suggests that the B7-1 protein (CD80;
originally termed B7), expressed on APCs, is one such critical
costimulatory molecule (Linsley, P. S., et al., (1991) J. Exp. Med.
173:721-730; Gimmi, C. D., et al., (1991) Proc. Natl. Acad. Sci.
USA. 88:6575-6579; Koulova, L., et al., (1991) J. Exp. Med.
173:759-762; Reiser, H., et al. (1992) Proc. Natl. Acad. Sci. USA,
89:271-275; Linsley, P. S. et al. (1990) Proc. Natl. Acad. Sci.
USA. 87: 5031-5035; Freeman, G. J. et al. (1991) J. Exp. Med.
174:625-631.). Recent evidence suggests the presence of additional
costimulatory molecules on the surface of activated B lymphocytes
(Boussiotis V. A., et al. (1993) Proc. Natl. Acad. Sci. USA.
90:11059-11063; Freeman G. J., et al. (1993) Science 262:907-909;
Freeman G. J., et al. (1993) Science 262:909-911; and Hathcock K.
S., et al. (1993) Science 262:905-907). The human B lymphocyte
antigen B7-2 (CD86) has been cloned and is expressed by human B
cells at about 24 hours following stimulation with either
anti-immunoglobulin or anti-MHC class II monoclonal antibody
(Freeman G. J., et al. (1993) Science 262:909-911). At about 48 to
72 hours post activation, human B cells express both B7-1 and a
third CTLA4 counter-receptor which is identified by a monoclonal
antibody BB-1, which also binds B7-1 (Yokochi, T., et al. (1982) J.
Immunol. 128:823-827). The BB-1 antigen is also expressed on B7-1
negative activated B cells and can costimulate T cell proliferation
without detectable IL-2 production, indicating that the B7-1 and
BB-1 molecules are distinct (Boussiotis V. A., et al. (1993) Proc.
Natl. Acad. Sci. USA 90:11059-11063). The presence of these
costimulatory molecules on the surface of activated B lymphocytes
indicates that T cell costimulation is regulated, in part, by the
temporal expression of these molecules following B cell
activation.
[0003] B7-1 is a counter-receptor for two ligands expressed on T
lymphocytes. The first ligand, termed CD28, is constitutively
expressed on resting T cells and increases after activation. After
signaling through the T cell receptor, ligation of CD28 induces T
cells to proliferate and secrete IL-2 (Linsley, P. S., et al.
(1991) J. Exp. Med. 173: 721-730; Gimmi, C. D., et al. (1991) Proc.
Natl. Acad. Sci. USA. 88:6575-6579; Thompson, C. B., et al. (1989)
Proc. Natl. Acad. Sci. USA. 86:1333-1337; June, C. H., et al.
(1990) Immunol. Today, 11:211-6; Harding, F. A., et al. (1992)
Nature, 356:607-609.). The second ligand, termed CTLA4, is
homologous to CD28, but is not expressed on resting T cells and
appears following T cell activation (Brunet, J. F., et al. (1987)
Nature 328:267-270). Like B7-1, B7-2 is a counter-receptor for both
CD28 and CTLA4 (Freeman G. J., et al. (1993) Science 262:909-911).
CTLA4 was first identified as a mouse cDNA clone, in a library of
cDNA from a cytotoxic T cell clone subtracted with RNA from a B
cell lymphoma (Brunet, J. F., et al. (1987) supra). The mouse CTLA4
cDNA was then used as a probe to identify the human and mouse CTLA4
genes (Harper, K., et al. (1991) J. Immunol. 147:1037-1044; and
Dariavich, et al. (1988) Eur. J. Immunol. 18(12):1901-1905,
sequence modified by Linsley, P. S., et al. (1991) J. Exp. Med.
174:561-569). A probe from the V domain of the human gene was used
to detect the human cDNA which allowed the identification of the
CTLA4 leader sequence (Harper, K., et al. (1991) supra).
[0004] Soluble derivatives of cell surface glycoproteins in the
immunoglobulin gene superfamily have been made consisting of an
extracellular domain of the cell surface glycoprotein fused to an
immunoglobulin constant (Fc) region (see e.g., Capon, D. J. et al.
(1989) Nature 337:525-531 and Capon U.S. Pat. Nos. 5,116,964 and
5,428,130 [CD4-IgG1 constructs]: Linsley, P. S. et al. (1991) J.
Exp. Med. 173:721-730 [a CD28-IgG1 construct and a B7-1-IgG1
construct]: and Linsley, P. S. et al. (1991) J. Exp. Med.
174:561-569 and U.S. Pat. No. 5,434,131[a CTLA4-IgG1]). Such fusion
proteins have proven useful for studying receptor-ligand
interactions. For example, a CTLA4-IgG immunoglobulin fusion
protein was used to study interactions between CTLA4 and its
natural ligands (Linsley, P. S., et al., (1991) J. Exp. Med.
174:561-569; International Application WO93/00431; and Freeman G.
J., et al. (1993) Science 262:909-911).
[0005] The importance of the B7:CD28/CTLA4 costimulatory pathway
has been demonstrated in vitro and in several in vivo model
systems. Blockade of this costimulatory pathway results in the
development of antigen specific tolerance in murine and human
systems (Harding, F. A., et al. (1992) Nature 356:607-609;
Lenschow, D. J., et al. (1992) Science 257:789-792; Turka, L. A.,
et al. (1992) Proc. Natl. Acad. Sci. USA 89:11102-11105; Gimmi, C.
D., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6586-6590;
Boussiotis, V., et al. (1993) J. Exp. Med. 178:1753-1763).
Conversely, transfection of a B7-1 gene into B7-1 negative murine
tumor cells to thereby express B7-1 protein on the tumor cell
surface induces T-cell mediated specific immunity accompanied by
tumor rejection and long lasting protection to tumor challenge
(Chen, L., et al. (1992) Cell 71:1093-1102; Townsend, S. E. and
Allison, J. P. (1993) Science 259:368-370; Baskar, S., et al.
(1993) Proc. Natl. Acad. Sci. USA 90:5687-5690.). Therefore,
approaches which manipulate the B7:CD28/CTLA4 interaction to
thereby stimulate or suppress immune responses would be beneficial
therapeutically.
SUMMARY OF THE INVENTION
[0006] This invention pertains to CTLA4-immunoglobulin fusion
proteins having modified immunoglobulin constant (IgC)
region-mediated effector functions and to nucleic acids encoding
the proteins. In one embodiment, the fusion proteins of the present
invention have been constructed by fusing a peptide having a CTLA4
activity and a second peptide comprising an immunoglobulin constant
region to create a CTLA4Ig fusion protein. In another embodiment,
the variable regions of immunoglobulin heavy and light chains have
been replaced by the B7-binding extracellular domain of CTLA4 to
create CTLA4-Ab fusion proteins. As used herein, the term
"CTLA4-immunoglobulin fusion protein" refers to both the CTLA4Ig
and CTLA4-Ab forms. In a preferred embodiment, the fusion proteins
of the invention have been modified to reduce their ability to
activate complement and/or bind to Fc receptors. In one embodiment,
an IgC region of an isotype other than C.gamma.1 is used in the
fusion protein and the modified effector function(s) can be
assessed relative to a C.gamma.1-containing molecule (e.g., an IgG1
fusion protein). In another embodiment, a mutated IgC region (of
any isotype) is used in the fusion protein and the modified
effector function can be assessed relative to an antibody or Ig
fusion protein containing the non-mutated form of the IgC
region.
[0007] The CTLA4-immunoglobulin fusion proteins of the invention
are useful for inhibiting the interaction of CTLA4 ligands (e.g.,
B7 family members such as B7-1 and B7-2) with receptors on T cells
(e.g., CD28 and/or CTLA4) to thereby inhibit delivery of a
costimulatory signal in the T cells and thus downmodulate an immune
response. Use of the CTLA4-immunoglobulin fusion proteins of the
invention is applicable in a variety of situations, such as to
inhibit transplant rejection or autoimmune reactions in a subject.
In these situations, immunoglobulin constant region-mediated
biological effector mechanisms, such as complement-mediated cell
lysis. Fc receptor-mediated phagocytosis or antibody-dependent
cellular cytotoxicity, may induce detrimental side effects in the
subject and are therefore undesirable. The CTLA4-immunoglobulin
fusion proteins of the invention exhibit reduced IgC
region-mediated effector functions compared to a
CTLA4-immunoglobulin fusion protein in which the IgG1 constant
region is used and, thus are likely to have improved
immunoinhibitory properties. These compositions can also be used
for immunomodulation, to produce anti-CTLA4 antibodies, to purify
CTLA4 ligands and in screening assays. The CTLA4-Ab fusion proteins
are particularly useful when bivalent preparations are preferred,
i.e. when crosslinking is desired.
[0008] One aspect of the invention pertains to isolated nucleic
acid molecules encoding modified CTLA4-immunoglobulin fusion
proteins. The nucleic acids of the invention comprise a nucleotide
sequence encoding a first peptide having a CTLA4 activity and a
nucleotide sequence encoding a second peptide comprising an
immunoglobulin constant region which is modified to reduce at least
one constant region-mediated biological effector function. A
peptide having a CTLA4 activity is defined herein as a peptide
having at least one biological activity of the CTLA4 protein, e.g.,
the ability to bind to the natural ligand(s) of the CTLA4 antigen
on immune cells, such as B7-1 and/or B7-2 on B cells, or other
known or as yet undefined ligands on immune cells, and inhibit
(e.g., block) or interfere with immune cell mediated responses. In
one embodiment, the peptide having a CTLA4 activity binds B7-1
and/or B-2 and comprises an extracellular domain of the CTLA4
protein. Preferably, the extracellular domain includes amino acid
residues 20-144 of the human CTLA4 protein (amino acid positions
20-144 of SEQ ID NO: 24, 26 and 28).
[0009] The present invention also contemplates forms of the
extracellular domain of CTLA4 which are expressed without Ig
constant regions and are expressed in E. coli. These soluble forms
of the CTLA4 extracellular domain, although not glycosylated, are
fully functional and have similar uses as the CTLA4 immunoglobulin
fusion proteins of the invention.
[0010] The nucleic acids of the invention further comprise a
nucleotide sequence encoding a second peptide comprising an
immunoglobulin constant region which is modified to reduce at least
one Ig constant region-mediated biological effector function.
Preferably, the immunoglobulin constant region comprises a hinge
region, a CH2 domain and a CH3 domain derived from C.gamma.1,
C.gamma.2, C.gamma.3 or C.gamma.4. In one embodiment, the constant
region segment is altered (e.g., mutated at specific amino acid
residues by substitution, deletion or addition of amino acid
residues) to reduce at least one IgC region-mediated effector
function. In another embodiment, a constant region other than
C.gamma.1 that exhibits reduced IgC region-mediated effector
functions relative to C.gamma.1 is used in the fusion protein. In a
preferred embodiment, the CH2 domain is modified to reduce a
biological effector function, such as complement activation, Fc
receptor interaction, or both complement activation and Fc receptor
interaction. For example, to reduce Fc receptor interaction, at
least one amino acid residue selected from a hinge link region of
the CH2 domain (e.g., amino acid residues at positions 234-237 of
an intact heavy chain protein) is modified by substitution,
addition or deletion of amino acids. In another embodiment, to
reduce complement activation ability, a constant region which lacks
the ability to activate complement, such as C.gamma.4 or C.gamma.2
is used in the fusion protein (instead of a C.gamma.1 constant
region which is capable of activating complement). In another
embodiment the variable region of the heavy and light chain is
replaced with a polypeptide having CTLA4 activity creating a
CTLA4-Ab molecule. In a preferred embodiment the heavy chain
constant region of the CTLA4-Ab molecule comprises a hinge region,
a CH2 domain and a CH3 domain derived from C.gamma.1, C.gamma.2,
C.gamma.3 or C.gamma.4. In a preferred embodiment the light chain
constant region of the CTLA4-Ab molecule comprises an Ig signal
sequence, the CTLA4 extracellular domain, and the light chain
(kappa or lambda) constant domain.
[0011] The nucleic acids obtained in accordance with this invention
can be inserted into various expression vectors, which in turn
direct the synthesis of the corresponding protein in a variety of
hosts, particularly eucaryotic cells, such as mammalian or insect
cell culture and procaryotic cells, such as E. coli. Expression
vectors within the scope of the invention comprise a nucleic acid
as described herein and a promotor operably linked to the nucleic
acid. Such expression vectors can be used to transfect host cells
to thereby produce fusion proteins encoded by nucleic acids as
described herein.
[0012] Another aspect of the invention pertains to isolated
CTLA4-immunoglobulin fusion proteins comprising a first peptide
having a CTLA4 activity and a second peptide comprising an
immunoglobulin constant region which is modified to reduce at least
one constant region-mediated biological effector function relative
to a CTLA4-IgG1 fusion protein. A preferred CTLA4-immunoglobulin
fusion protein comprises an extracellular domain of the CTLA4
protein (e.g., amino acid positions 20-144 of the human
CTLA4-immunoglobulin fusion protein shown in SEQ ID NO: 24, 26 and
28) linked to an immunoglobulin constant region comprising a hinge
region, a CH2 domain and a CH3 domain derived from C.gamma.1,
C.gamma.2, C.gamma.3 or C.gamma.4. A preferred constant domain used
to reduce the complement activating ability of the fusion protein
is C.gamma.4. In one embodiment, the CH2 domain of the
immunoglobulin constant region is modified to reduce at least one
biological effector function, such as complement activation or Fc
receptor interaction. In a particularly preferred embodiment, the
CTLA4-immunoglobulin fusion protein includes a CH2 domain which is
modified by substitution of an amino acid residue at position 234,
235 and/or 237 of an intact heavy chain protein. One example of
such a protein is a CTLA4-immunoglobulin fusion protein fused to
IgG4 comprising an amino acid sequence shown in SEQ ID NO: 28 or a
CTLA4-immunoglobulin fused to IgG1 fusion protein comprising an
amino acid sequence shown in SEQ ID NO: 24.
[0013] The CTLA4-immunoglobulin fusion proteins of the invention
can be incorporated into pharmaceutical compositions and
administered to a subject to inhibit an interaction between a CTLA4
ligand (e.g., B7-1 and/or B7-2) and a receptor therefor (e.g., CD28
and/or CTLA4) on the surface of a T cell, to thereby suppress
cell-mediated immune responses in vivo. Inhibition of the CTLA4
ligand/receptor interaction may be useful for both general
immunosuppression and to induce antigen-specific T cell tolerance
in a subject for use in preventing transplantation rejection (solid
organ, skin and bone marrow) or graft versus host disease,
particularly in allogeneic bone marrow transplantation. The
CTLA4-immunoglobulin fusion proteins can also be used
therapeutically in the treatment of autoimmune diseases, allergy
and allergic reactions, transplantation rejection and established
graft versus host disease in a subject. Moreover, the
CTLA4-immunoglobulin fusion proteins of the invention can be used
as immunogens to produce anti-CTLA4 antibodies in a subject, to
purify CTLA4 ligands and in screening assays to identify molecules
which inhibit the interaction of CTLA4 with a CTLA4 ligand.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 is a schematic diagram of the "zip up" polymerase
chain reaction (PCR) procedure used to contrust gene fusions.
[0015] FIG. 2A-B show the amino acid mutations introduced into the
hinge and CH2 domains of hCTLA4-IgG1m (panel A) and hCTLA4-IgG4m
(panel B). Mutated amino acid residues are underlined.
[0016] FIG. 3 is a schematic diagram of the expression vector
pNRDSH.
[0017] FIG. 4A-B are graphic representations of competition ELISAs
depicting the ability of unlabeled hCTLA4-IgG1 or unlabeled
hCTLA4-IgG4m to compete for the binding of biotinylated hCTLA4-IgG1
to hB7-1-Ig (panel A) or hB7-2-Ig (panel B).
[0018] FIG. 5A-B are graphic representations of Fc receptor binding
assays depicting the ability of CTLA4-IgG1 or CTLA4-IgG4 to bind to
Fc receptors. In panel A, the ability of unlabeled CTLA4-IgG1 or
unlabeled CTLA4-IgG4 to compete for the binding of
.sup.125I-labeled CTLA4-IgG1 to FcRI-positive U937 cells is
depicted. In panel B, the percent specific activity of unlabeled
CTLA4-IgG1, CTLA4-IgG4 or hIgG1 used to compete itself for binding
to U937 cells is depicted.
[0019] FIG. 6A-C are graphic representations of complement
activation assays depicting the ability of CTLA4-IgG1, CTLA4-IgG4m
or anti-B7-1 mAb (4B2) to activate complement-mediated lysis of
CHO-B7-1 cells. In panel A, guinea pig complement is used as the
complement source. In panel B, human serum is used as the
complement source. In panel C, control untransfected CHO cells are
used as the target for complement-mediated lysis.
[0020] FIG. 7 is a graphic representation of the binding of
CTLA4-IgG1, CTLA4-IgG4m or anti-B7-1 mAb (4B2) to CHO-B7-1 cells,
demonstrating that despite the inability of CTLA4-IgG4m to activate
complement it can still bind to CHO-B7-1 cells.
[0021] FIG. 8 is a graphic representation of a competition curve
demonstrating that soluble CTLA4 expressed in E. coli is functional
and competes with unlabeled CTLA4Ig for binding to plate-bound
B7-1.
DETAILED DESCRIPTION OF THE INVENTION
[0022] This invention features isolated CTLA4-immunoglobulin fusion
proteins which have been modified to reduce immunoglobulin constant
(IgC) region-mediated effector functions. The invention also
features isolated nucleic acids encoding the proteins, methods for
producing the CTLA4-immunoglobulin fusion proteins of the invention
and methods for using the CTLA4-immunoglobulin fusion proteins of
the invention for immunomodulation. E. coli-expressed forms of
CTLA4 are also disclosed. These and other aspects of the invention
are described in further detail in the following subsections:
[0023] I. Chimeric CTLA4-Immunoglobulin Gene Fusions
[0024] The invention provides isolated nucleic acids encoding
CTLA4-immunoglobulin fusion proteins. The CTLA4-immunoglobulin
fusion proteins are comprised of two components: a first peptide
having a CTLA4 activity and a second peptide comprising an
immunoglobulin constant region which, in certain embodiments is
modified to reduce at least one constant region-mediated biological
effector function. Accordingly, the isolated nucleic acids of the
invention comprise a first nucleotide sequence encoding the first
peptide having a CTLA4 activity and a second nucleotide sequence
encoding the second peptide comprising an immunoglobulin constant
region which, in a preferred embodiment, is modified to reduce at
least one constant region-mediated biological effector function. In
the case of CTLA4Ig forms, the first and second nucleotide
sequences are linked (i.e., in a 5' to 3' orientation by
phosphodiester bonds) such that the translational frame of the
CTLA4 and IgC coding segments are maintained (i.e., the nucleotide
sequences are joined together in-frame). Thus, expression (i.e.,
transcription and translation) of the nucleotide sequences produces
a functional CTLA4Ig fusion protein. In the case of the CTLA4-Ab
fusion proteins, the heavy chain gene is constructed such that the
CTLA4 extracellular binding domain is linked to a 5' signal
sequence and a 3' immunoglobulin CH1, hinge, CH2, and CH3 domain.
CTLA4-light chain constructs are prepared in which an Ig signal
sequence, an intron, the CTLA4 extracellular domain, an intron, and
the light chain constant domain are linked. The DNA encoding the
heavy and light chains is then expressed using an appropriate
expression vector as described in the Examples.
[0025] The term "nucleic acid" as used herein is intended to
include fragments or equivalents thereof. The term "equivalent" is
intended to include nucleotide sequences encoding functionally
equivalent CTLA4-immunoglobulin fusion proteins, i.e., proteins
which have the ability to bind to the natural ligand(s) of the
CTLA4 antigen on immune cells, such as B7-1 and/or B7-2 on B cells,
and inhibit (e.g., block) or interfere with immune cell mediated
responses.
[0026] The term "isolated" as used throughout this application
refers to a nucleic acid or fusion protein substantially free of
cellular material or culture medium when produced by recombinant
DNA techniques, or chemical precursors or other chemicals when
chemically synthesized. An isolated nucleic acid is also free of
sequences which naturally flank the nucleic acid (i.e., sequences
located at the 5' and 3' ends of the nucleic acid) in the organism
from which the nucleic acid is derived.
[0027] The nucleic acids of the invention can be prepared by
standard recombinant DNA techniques. For example, a chimeric
CTLA4-immunoglobulin gene fusion can be constructed using separate
template DNAs encoding CTLA4 and an immunoglobulin constant region
and a "zip up" polymerase chain reaction (PCR) procedure as
described in Example 1 and illustrated schematically in FIG. 1.
Alternatively, a nucleic acid segment encoding CTLA4 can be ligated
in-frame to a nucleic acid segment encoding an immunoglobulin
constant region using standard techniques. A nucleic acid of the
invention can also be chemically synthesized using standard
techniques. Various methods of chemically synthesizing
polydeoxynucleotides are known, including solid-phase synthesis
which has been automated in commercially available DNA synthesizers
(See e.g., Itakura et al. U.S. Pat. No. 4,598,049; Caruthers et al.
U.S. Pat. No. 4,458,066; and Itakura U.S. Pat. Nos. 4,401,796 and
4,373,071, incorporated by reference herein).
[0028] The nucleic acid segments of the CTLA4-immunoglobulin gene
fusions of the invention are described in further detail below:
[0029] A. CTLA4 Gene Segment
[0030] An isolated nucleic acid of the invention encodes a first
peptide having a CTLA4 activity. The phrase "peptide having a CTLA4
activity" or "peptide having an activity of CTLA4" is used herein
to refer to a peptide having at least one biological activity of
the CTLA4 protein, i.e., the ability to bind to the natural
ligand(s) of the CTLA4 antigen on immune cells, such as B7-1 and/or
B7-2 on B cells, or other known or as yet undefined ligands on
immune cells, and which, in soluble form, can inhibit (e.g., block)
or interfere with immune cell mediated responses. In one
embodiment, the CTLA4 protein is a human CTLA4 protein, the
nucleotide and amino acid sequences of which are disclosed in
Harper, K., et al. (1991) J. Immunol. 147:1037-1044 and Dariavich,
et al. (1988) Eur. J. Immunol. 18(12):1901-1905. In another
embodiment, the peptide having a CTLA4 activity binds B7-1 and/or
B7-2 and comprises at least a portion of an extracellular domain of
the CTLA4 protein. Preferably, the extracellular domain includes
amino acid residues 1-125 of the human CTLA4 protein (amino acid
positions 20-144 of SEQ ID NO: 24, 26 and 28). CTLA4 proteins from
other species (e.g., mouse) are also encompassed by the invention.
The nucleotide and amino acid sequences of mouse CTLA4 are
disclosed in Brunet, J. F., et al., (1987) Nature 328:267-270.
[0031] The nucleic acids of the invention can be DNA or RNA.
Nucleic acid encoding a peptide having a CTLA4 activity may be
obtained from mRNA present in activated T lymphocytes. It is also
possible to obtain nucleic acid encoding CTLA4 from T cell genomic
DNA. For example, the gene encoding CTLA4 can be cloned from either
a cDNA or a genomic library in accordance with standard protocols.
A cDNA encoding CTLA4 can be obtained by isolating total mRNA from
an appropriate cell line. Double stranded cDNAs can then prepared
from the total mRNA. Subsequently, the cDNAs can be inserted into a
suitable plasmid or bacteriophage vector using any one of a number
of known techniques. Genes encoding CTLA4 can also be cloned using
established polymerase chain reaction techniques in accordance with
the nucleotide sequence information provided by the invention (see
Example 1). For example, a DNA vector containing a CTLA4 cDNA can
be used as a template in PCR reactions using oligonucleotide
primers designed to amplify a desired region of the CTLA4 cDNA,
e.g., the extracellular domain, to obtain an isolated DNA fragment
encompassing this region using standard techniques.
[0032] It will be appreciated by those skilled in the art that
various modifications and equivalents of the nucleic acids encoding
the CTLA4-immunoglobulin fusion proteins of the invention exist.
For example, different cell lines can be expected to yield DNA
molecules having different sequences of bases. Additionally,
variations may exist due to genetic polymorphisms or cell-mediated
modifications of the genetic material. Furthermore, the nucleotide
sequence of a CTLA4-immunoglobulin fusion protein of the invention
can be modified by genetic techniques to produce proteins with
altered amino acid sequences that retain the functional properties
of CTLA4 (e.g., the ability to bind to B7-1 and/or B7-2). Such
sequences are considered within the scope of the invention, wherein
the expressed protein is capable of binding a natural ligand of
CTLA4 and, when in the appropriate form (e.g., soluble) can inhibit
B7:CD28/CTLA4 interactions and modulate immune responses and immune
function. In addition, it will be appreciated by those of skill in
the art that there are other B7-binding ligands and the fusion of
these alternative molecules (such as CD28) to form immuonglobulin
fusion proteins or expressed in soluble form in E. coli is also
contemplated by the present invention.
[0033] To express a CTLA4-immunoglobulin fusion protein of the
invention, the chimeric gene fusion encoding the
CTLA4-immunoglobulin fusion protein typically includes a nucleotide
sequence encoding a signal sequence which, upon transcription and
translation of the chimeric gene, directs secretion of the fusion
protein. A native CTLA4 signal sequence (e.g., the human CTLA4
signal sequence disclosed in Harper, K., et al. (1991) J. Immunol.
147.1037-1044) can be used or alternatively, a heterologous signal
sequence can be used. For example, the oncostatin-M signal sequence
(Malik N., et al. (1989) Mol. Cell. Biol. 9(7), 2847-2853) or an
immunoglobulin signal sequence (e.g., amino acid positions 1 to 19
of SEQ ID NO: 24, 26 and 28) can be used to direct secretion of a
CTLA4-immunoglobulin fusion protein of the invention. A nucleotide
sequence encoding a signal sequence can be incorporated into the
chimeric gene fusion by standard recombinant DNA techniques, such
as by "zip up" PCR (described further in Example 1) or by ligating
a nucleic acid fragment encoding the signal sequence in-frame at
the 5' end of a nucleic acid fragment encoding CTLA4.
[0034] B. Immunoglobulin Gene Segment
[0035] The CTLA4-immunoglobulin fusion protein of the invention
further comprises a second peptide linked to the peptide having a
CTLA4 activity. In one embodiment the second peptide comprises a
light chain constant region. In a preferred embodiment the light
chain is a kappa light chain.
[0036] In another embodiment the second peptide comprises a heavy
chain constant region. In a preferred embodiment the constant
region comprises an immunoglobulin hinge region, a CH2 domain and a
CH3 domain. In another embodiment the constant region also
comprises a CH1 domain. The constant region is preferably derived
from C.gamma.1, C.gamma.2, C.gamma.3 or C.gamma.4. In a preferred
embodiment the heavy chain constant region is modified to reduce at
least one constant region-mediated biological effector function. In
one embodiment, the constant region segment (either C.gamma.1 or
another isotype) is altered (e.g., mutated from the wild-type
sequence at specific amino acid residues by substitution, deletion
or addition of amino acid residues) to reduce at least one IgC
region-mediated effector function. The effector functions of this
altered fusion protein can be assessed relative to an unaltered IgC
region-containing molecule (e.g., a whole antibody or Ig fusion
protein). In another embodiment, a constant region other than
C.gamma.1 that exhibits reduced IgC region-mediated effector
functions is used in the fusion protein. The effector functions of
this fusion protein can be assessed relative to a
C.gamma.1-containing molecule (e.g., an IgG1 antibody or IgG1
fusion protein). In a particularly preferred embodiment, the fusion
protein comprises a constant region other than C.gamma.1 that is
also mutated to further reduce effector function. For example, a
preferred IgC region is a mutated C.gamma.4 region.
[0037] The term "immunoglobulin constant (IgC) region-mediated
biological effector function" is intended to include biological
responses which require or involve, at least in part, the constant
region of an immunoglobulin molecule. Examples of such effector
functions include complement activation. Fc receptor interactions,
opsonization and phagocytosis, antibody-dependent cellular
cytotoxicity (ADCC), release of reactive oxygen intermediates and
placental transfer. While such effector functions are desirable in
many immune responses, they are undesirable in situations where an
immune response is to be downmodulated. The CTLA4-immunoglobulin
fusion proteins of the invention exhibit reduced IgC
region-mediated biological effector functions and thus are
efficient agents for downregulating immune responses. Additionally,
the CTLA4-immunoglobulin fusion proteins of the invention display a
long plasma half life in vivo. The long plasma half-life makes the
proteins particularly useful as therapeutic agents.
[0038] All immunoglobulins have a common core structure of two
identical light and heavy chains held together by disulfide bonds.
Both the light chains and the heavy chains contain a series of
repeating, homologous units, each about 110 amino acid residues in
length, which fold independently in a common globular motif, called
an immunoglobulin domain. In each chain, one domain (V) has a
variable amino acid sequence depending on the antibody specificity
of the molecule. The other domains (C) have a constant sequence
common among molecules of the same isotype. Heavy chains are
designated by the letter of the Greek alphabet corresponding to the
overall isotype of the antibody: IgA1 contains .alpha.1 heavy
chains: IgA2, .alpha.2; IgD, .delta.; IgE, .epsilon.; IgG1,
.gamma.1; IgG2, .gamma.2; IgG3, .gamma.3; IgG4, .gamma.4; and IgM,
.mu.. Each heavy chain includes four domains; an amino terminal
variable, or VH domain which displays the greatest sequence
variation among heavy chains and three domains which form the
constant region (CH1, CH2 and CH3) in order from the amino to the
carboxy terminus of the heavy chain. In .gamma., .alpha. and
.delta. heavy chains, there is a nonglobular region of amino acid
sequence, known as the hinge, located between the first and second
constant region domains (CH1 and CH2) permitting motion between
these two domains.
[0039] To modify a CTLA4-immunoglobulin fusion protein such that it
exhibits reduced binding to the FcRI receptor, the immunoglobulin
constant region segment of the CTLA4-immunoglobulin fusion protein
can be mutated at particular regions necessary for Fc receptor
(FcR) interactions (see Canfield, S. M. and S. L. Morrison (1991)
J. Exp. Med. 173:1483-1491; and Lund, J. et al. (1991) J. of
Immunol. 147:2657-2662). Reduction in FcR binding ability of a
CTLA4-immunoglobulin fusion protein will also reduce other effector
functions which rely on FcR interactions, such as opsonization and
phagocytosis and antigen-dependent cellular cytotoxicity. To reduce
FcR binding, in one embodiment, the constant region is mutated
within a region of the CH2 domain referred to as the "hinge link"
or "lower hinge" region. This region encompasses amino acid
residues 234-239 in a full-length native immunoglobulin heavy
chain. It should be appreciated that all IgC region amino acid
residue positions described herein refer to the position within the
full-length intact native immunoglobulin heavy chain; it will be
apparent to those skilled in the art that depending upon the length
of the CTLA4 segment used in the CTLA4-immunoglobulin fusion
protein, the positions of the corresponding IgC amino acid residues
within the fusion protein will vary (Kabat, E. A. T. T. Wu, M.
Reid-Miller, H. M. Perry, and K. S. Gottesman eds. (1987)
"Sequences of Proteins of Immunological Interest" National
Institutes of Health, Bethesda, Md.). The hinge link region can be
mutated by substitution, addition or deletion of amino acid
residues. A preferred CTLA4-immunoglobulin fusion protein of the
invention is one in which the IgG1 constant region has substitution
mutations at positions 234, 235 and/or 237 of the C.gamma.1
segment. Preferably, Leu at 234 is substituted with Ala, Leu at 235
is substituted with Glu and Gly at 237 is substituted with Ala (see
Example 1). A preferred CTLA4-immunoglobulin fusion protein of the
invention is one in which IgG4 has substitution mutations at
positions 235 and/or 237 of the C.gamma.4 segment. Preferably, Leu
at 235 is substituted with Glu and Gly at 237 is substituted with
Ala (see Example 1).
[0040] In another embodiment, the Fc receptor binding capability of
the CTLA4-immunoglobulin fusion protein is reduced by mutating a
region of the CH2 domain referred to as the "hinge-proximal bend"
region (amino acid residues at positions 328-333 within a
full-length intact heavy chain). This region can be mutated by
substitution, addition or deletion of amino acid residues. In a
preferred embodiment, position 331 of C.gamma.1 or C.gamma.3 is
mutated. A preferred mutation in C.gamma.1 or C.gamma.3 is
substitution of Pro with Ser.
[0041] To modify a CTLA4-immunoglobulin fusion protein such that it
exhibits reduced complement activation ability, the immunoglobulin
constant region segment of the fusion protein can be mutated at
particular regions important for complement activation, such as
regions involved in IgC region binding to the C1q component of
complement. In one embodiment, one or more residues present within
the CH2 domain of IgG subclasses that are involved in C1q binding
are altered. In a preferred embodiment, positions 318, 320 and/or
322 are mutated (see Duncan and Winter (1988) Nature 332, 738-740).
Preferably, Glu at 318 is substituted with Ala or Val, Lys at 320
is substituted with Ala or Gln and/or Lys at 322 is substituted
with Ala or Gln.
[0042] Alternatively, to reduce complement activation by the
CTLA4-immunoglobulin fusion protein, a constant region which lacks
the ability to activate complement can be used in the fusion
protein. For example, it is known that both IgG1 and IgG3, but not
IgG2 and IgG4 activate the classical complement cascade in the
presence of human complement. Accordingly, a CTLA4-immunoglobulin
fusion protein utilizing a C.gamma.4 constant region exhibits
reduced complement activation ability relative to a
CTLA4-immunoglobulin fusion protein comprising IgG1 (as
demonstrated in Example 2).
[0043] In yet another embodiment, the hinge region of the IgC
segment is altered to inhibit complement activation ability. The
hinge regions of the human IgG molecules vary in amino acid
sequence and composition as well as length. For example, IgG1, IgG2
and IgG4 have hinge regions consisting of 12 to 15 amino acids,
whereas IgG3 has an extended hinge region, consisting of 62 amino
acids. The hinge region is believed to be essential for binding
with the first component of complement, C1q (see Tan et al. (1990)
Proc. Natl. Acad. Sci. USA 87:162-166). A number of chimeric human
IgG3 and IgG4 molecules with different hinge lengths and amino acid
composition have been produced, confirming the role of the hinge
region in C1q binding and complement activation. To reduce or
interfere with the ability of a CTLA4-immunoglobulin (IgG1) or
CTLA4-immunoglobulin (IgG3) construct to activate complement, it
may be necessary to modify, by substitution, addition or deletion,
at least one amino acid residue in the hinge region. In one
embodiment, the hinge region of C.gamma.1 or C.gamma.3 is
substituted with a hinge region derived from C.gamma.2 or
C.gamma.4, each of which lack the ability to activate
complement.
[0044] In addition to modifying the CTLA4-immunoglobulin fusion
proteins of the invention to reduce IgC region-mediated biological
effector functions, the fusion proteins can be further modified for
other purposes, e.g., to increase solubility, enhance therapeutic
or prophylactic efficacy, or stability (e.g., shelf life ex vivo
and resistance to proteolytic degradation in vivo). Such modified
proteins are considered functional equivalents of the
CTLA4-immunoglobulin fusion proteins as defined herein. For
example, amino acid residues of the CTLA4 portion of the fusion
protein which are not essential for CTLA4 ligand interaction can be
modified by being replaced by another amino acid whose
incorporation may enhance, diminish, or not affect reactivity of
the fusion protein. Alternatively, a CTLA4-immunoglobulin fusion
protein which binds only B7-1 or B7-2 but not both could be created
by mutating residues involved in binding to one ligand or the
other. Another example of a modification of a CTLA4-immunoglobulin
fusion protein is substitution of cysteine residues, preferably
with alanine, serine, threonine, leucine or glutamic acid residues,
to minimize dimerization via disulfide linkages. A particularly
preferred modification is substitution of cysteine residues in the
hinge region of the immunoglobulin constant region with serine. In
addition, amino acid side chains of a CTLA4-immunoglobulin fusion
protein can be chemically modified.
[0045] A particularly preferred embodiment of the invention
features a nucleic acid encoding a CTLA4-immunoglobulin fusion
protein comprising a nucleotide sequence encoding a first peptide
having a CTLA4 activity and a nucleotide sequence encoding a second
peptide comprising an IgG4 immunoglobulin constant region,
C.gamma.4. Preferably, the nucleic acid is a DNA and the first
peptide comprises an extracellular region of CTLA4 which binds
B7-1. Such a CTLA4-IgG4 construct can comprise a nucleotide
sequence show in SEQ ID NO: 25 and an amino acid sequence shown in
SEQ ID NO: 26. In an even more preferred embodiment, the CH2 domain
of the C.gamma.4 portion of this CTLA4IgG4 fusion protein is
modified to reduce Fc receptor interaction. For example, the CH2
domain can be modified by substitution of Leu at position 235
(e.g., with Glu) and/or substitution of Gly at position 237 (e.g.,
with Ala). A particularly preferred CTLA4-IgG4 fusion protein
comprises the extracellular domain of human CTLA4 (i.e., amino acid
residues 1-125), has reduced Fc receptor interaction due to two
substitutions in the CH2 domain (i.e., substitution of Leu at
position 235 with Glu and substitution of Gly at position 237 with
Ala). Such a CTLA4-IgG4 fusion protein comprises an amino acid
sequence shown in SEQ ID NO: 28 and a nucleotide sequence shown in
SEQ ID NO: 27. This construct, referred to as CTLA4-IgG4m, exhibits
markedly reduced complement activation ability and FcR binding
activity relative to a wild-type CTLA4-IgG1 construct (see Example
2).
[0046] Another preferred embodiment of the invention features a
nucleic acid encoding a CTLA4-IgG1 fusion protein comprising a
nucleotide sequence encoding a first peptide having a CTLA4
activity and a nucleotide sequence encoding a second peptide
comprising an immunoglobulin constant region, C.gamma.1, which is
modified to reduce at least one constant region-mediated biological
effector functions. Preferably, the nucleic acid is a DNA and the
first peptide comprises an extracellular region of CTLA4 which
binds B7-1. To reduce Fc receptor interaction the CH2 domain of
C.gamma.1 is modified by substitution of one or more of the
following amino acid residues: Leu at position 235; Leu at position
234; and Gly at position 237. A particularly preferred CTLA4-IgG1
fusion protein comprises the extracellular domain of human CTLA4
(i.e., amino acid residues 1-125), has reduced Fc receptor
interaction due to three substitutions in the CH2 domain (i.e.,
substitution of Leu at position 234 with Ala, substitution of Leu
at position 235 with Glu and substitution of Gly at position 237
with Ala). Such a CTLA4-IgG1 fusion protein, referred to herein as
CTLA4-IgG1m, comprises an amino acid sequence shown in SEQ ID NO:
24 and a nucleotide sequence shown in SEQ ID NO: 23.
[0047] Nucleic acid encoding a peptide comprising an immunoglobulin
constant region can be obtained from human immunoglobulin mRNA
present in B lymphocytes. It is also possible to obtain nucleic
acid encoding an immunoglobulin constant region from B cell genomic
DNA. For example, DNA encoding C.gamma.1 or C.gamma.4 can be cloned
from either a cDNA or a genomic library or by polymerase chain
reaction (PCR) amplification in accordance with protocols herein
described. The nucleic acids of the invention can be DNA or RNA. A
preferred nucleic acid encoding an immunoglobulin constant region
comprises all or a portion of the following: the DNA encoding human
C.gamma.1 (Takahashi, N. S. et al. (1982) Cell 29:671-679), the DNA
encoding human C.gamma.2 (Kabat, E. A. T. T. Wu, M. Reid-Miller, H.
M. Perry, and K. S. Gottesman eds. (1987) "Sequences of Proteins of
Immunological Interest" National Institutes of Health, Bethesda,
Md.); the DNA encoding human C.gamma.3 (Huck, S., et al. (1986)
Nucl. Acid Res. 14:1779); and the DNA encoding human C.gamma.4
(Kabat et al., supra).
[0048] A number of processes are known in the art for modifying a
nucleotide or amino acid sequence to thereby mutate the IgC regions
as described herein. For example, mutations can be introduced into
a DNA by any one of a number of methods, including those for
producing simple deletions or insertions, systematic deletions,
insertions or substitutions of clusters of bases or substitutions
of single bases, to generate CTLA4-immunoglobulin fusion proteins
of the invention and equivalents thereof. Preferably, amino acid
substitutions, deletions or additions, such as in the CH2 domain of
the immunoglobulin constant region, are created by PCR mutagenesis
as described in Example 1 or by standard site-directed mutagenesis.
Site directed mutagenesis systems are well known in the art. For
example, protocols and reagents can be obtained commercially from
Amersham International PLC, Amersham, U.K.
[0049] II. Expression Vectors and Host Cells
[0050] The CTLA4-immunoglobulin fusion proteins of the invention
can be expressed by incorporating a chimeric CTLA4-immunoglobulin
fusion gene described herein into an expression vector and
introducing the expression vector into an appropriate host cell.
Accordingly, the invention further pertains to expression vectors
containing a nucleic acid encoding a CTLA4-immunoglobulin fusion
protein and to host cells into which such expression vectors have
been introduced. An expression vector of the invention, as
described herein, typically includes nucleotide sequences encoding
the CTLA4-immunoglobulin fusion protein operably linked to at least
one regulatory sequence. "Operably linked" is intended to mean that
the nucleotide sequence is linked to a regulatory sequence in a
manner which allows expression of the nucleotide sequence in a host
cell (or by a cell extract). Regulatory sequences are
art-recognized and can be selected to direct expression of the
desired protein in an appropriate host cell. The term regulatory
sequence is intended to include promoters, enhancers,
polyadenylation signals and other expression control elements. Such
regulatory sequences are known to those skilled in the art and are
described in Goeddel, Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990). It should
be understood that the design of the expression vector may depend
on such factors as the choice of the host cell to be transfected
and/or the type and/or amount of protein desired to be
expressed.
[0051] An expression vector of the invention can be used to
transfect cells, either procaryotic or eucaryotic (e.g., mammalian,
insect or yeast cells) to thereby produce fusion proteins encoded
by nucleotide sequences of the vector. Expression in procaryotes is
most often carried out in E. coli with vectors containing
constitutive or inducible promoters. Certain E. coli expression
vectors (so called fusion-vectors) are designed to add a number of
amino acid residues to the expressed recombinant protein, usually
to the amino terminus of the expressed protein. Such fusion vectors
typically serve three purposes: 1) to increase expression of
recombinant protein; 2) to increase the solubility of the target
recombinant protein; and 3) to aid in the purification of the
target recombinant protein by acting as a ligand in affinity
purification. Examples of fusion expression vectors include pGEX
(Amrad Corp., Melbourne, Australia) and pMAL (New England Biolabs,
Beverly, Mass.) which fuse glutathione S-tranferase and maltose E
binding protein, respectively, to the target recombinant protein.
Accordingly, a chimeric CTLA4-immunoglobulin fusion gene may be
linked to additional coding sequences in a procaryotic fusion
vector to aid in the expression, solubility or purification of the
fusion protein. Often, in fusion expression vectors, a proteolytic
cleavage site is introduced at the junction of the fusion moiety
and the target recombinant protein to enable separation of the
target recombinant protein from the fusion moiety subsequent to
purification of the fusion protein. Such enzymes, and their cognate
recognition sequences, include Factor Xa, thrombin and
enterokinase.
[0052] Inducible non-fusion expression vectors include pTrc (Amann
et al., (1988) Gene 69:301-315) and pET 11d (Studier et al., Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990) 60-89). Target gene expression from the
pTrc vector relies on host RNA polymerase transcription from the
hybrid trp-lac fusion promoter. Target gene expression from the pET
11d vector relies on transcription from the T-7 gn10-lac 0 fusion
promoter mediated by a coexpressed viral RNA polymerase (T7 gn1).
This viral polymerase is supplied by host strains BL21(DE3) or
HMS174(DE3) from a resident .lambda. prophage harboring a T7 gn1
under the transcriptional control of the lacUV 5 promoter.
[0053] One strategy to maximize expression of recombinant
CTLA4-immunoglobulin fusion protein in E. coli is to express the
protein in a host bacteria with an impaired capacity to
proteolytically cleave the recombinant protein (Gottesman, S., Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990) 119-128). Another strategy would be to
alter the nucleotide sequence of the CTLA4-immunoglobulin fusion
protein to be inserted into an expression vector so that the
individual codons for each amino acid would be those preferentially
utilized in highly expressed E. coli proteins (Wada et al., (1992)
Nuc. Acids Res. 20:2111-2118). Such alteration of nucleic acid
sequences are encompassed by the invention and can be carried out
by standard DNA synthesis techniques.
[0054] In another preferred embodiment a soluble CTLA4
extracellular domain is expressed in E coli using an appropriate
expression vector. These forms, although not glycosylated, remain
fully functional and represent an advantage because of the ease
with which bacterial cells are grown.
[0055] Alternatively, a CTLA4-immunoglobulin fusion protein can be
expressed in a eucaryotic host cell, such as mammalian cells (e.g.,
Chinese hamster ovary cells (CHO) or NS0 cells), insect cells
(e.g., using a baculovirus vector) or yeast cells. Other suitable
host cells may be found in Goeddel, (1990) supra or are known to
those skilled in the art. Eucaryotic, rather than procaryotic,
expression of a CTLA4-immunoglobulin fusion protein may be
preferable since expression of eucaryotic proteins in eucaryotic
cells can lead to partial or complete glycosylation and/or
formation of relevant inter- or intra-chain disulfide bonds of a
recombinant protein. For expression in mammalian cells, the
expression vector's control functions are often provided by viral
material. For example, commonly used promoters are derived from
polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. To
express a CTLA4-immunoglobulin fusion protein in mammalian cells,
generally COS cells (Gluzman, Y., (1981) Cell 23:175-182) are used
in conjunction with such vectors as pCDM8 (Seed, B., (1987) Nature
329:840) for transient amplification/expression, while CHO
(dhfr.sup.- Chinese Hamster Ovary) cells are used with vectors such
as pMT2PC (Kaufman et al. (1987), EMBO J. 6:187-195) for stable
amplification/expression in mammalian cells. A preferred cell line
for production of recombinant protein is the NSO myeloma cell line
available from the ECACC (catalog #85110503) and described in
Galfre, G. and Milstein, C. ((1981) Methods in Enzymology
73(13):3-46; and Preparation of Monoclonal Antibodies: Strategies
and Procedures, Academic Press, New York, N.Y.). Examples of
vectors suitable for expression of recombinant proteins in yeast
(e.g., S. cerivisae) include pYepSec1 (Baldari, et al., (1987) Embo
J. 6:229-234). pMFa (Kurjan and Herskowitz, (1982) Cell
30:933-943). pJRY88 (Schultz et al., (1987) Gene 54:113-123), and
pYES2 (Invitrogen Corporation, San Diego, Calif.). Baculovirus
vectors available for expression of proteins in cultured insect
cells (SF 9 cells) include the pAc series (Smith et al., (1983)
Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow, V. A.,
and Summers, M. D., (1989) Virology 170:31-39).
[0056] Vector DNA can be introduced into procaryotic or eucaryotic
cells via conventional transformation or transfection techniques
such as calcium phosphate or calcium choloride co-precipitation.
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming host cells can
be found in Sambrook et al. (Molecular Cloning: A Laboratory
Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)),
and other laboratory textbooks.
[0057] For stable transfection of mammalian cells, it is known
that, depending upon the expression vector and transfection
technique used, only a small faction of cells may integrate DNA
into their genomes. In order to identify and select these
integrants, a gene that encodes a selectable marker (e.g.,
resistance to antibiotics) is generally introduced into the host
cells along with the gene of interest. Preferred selectable markers
include those which confer resistance to drugs, such as G418,
hygromycin and methotrexate. Nucleic acid encoding a selectable
marker may be introduced into a host cell on the same plasmid as
the gene of interest or may be introduced on a separate plasmid.
Cells containing the gene of interest can be identified by drug
selection (e.g., cells that have incorporated the selectable marker
gene will survive, while the other cells die). The surviving cells
can then be screened for production of CTLA4-immunoglobulin fusion
proteins by, for example, immunoprecipitation from cell supernatant
with an anti-CTLA4 monoclonal antibody.
[0058] The invention also features methods of producing
CTLA4-immunoglobulin fusion proteins. For example, a host cell
transfected with a nucleic acid vector directing expression of a
nucleotide sequence encoding a CTLA4-immunoglobulin fusion protein
can be cultured in a medium under appropriate conditions to allow
expression of the protein to occur. In one embodiment, a
recombinant expression vector containing DNA encoding a CTLA4-IgG1
fusion protein having modified constant region-mediated effector
functions is produced. In another embodiment, a recombinant
expression vector containing DNA encoding a CTLA4-IgG4 fusion
protein having modified constant region-mediated effector functions
is produced. In addition, one or more expression vectors containing
DNA encoding, for example, a CTLA4-IgG1 fusion protein and another
fusion protein such as a CTLA4-IgG4 fusion protein can be used to
transfect a host cell to coexpress these fusion proteins. Fusion
proteins produced by recombinant technique may be secreted and
isolated from a mixture of cells and medium containing the protein.
Alternatively, the protein may be retained cytoplasmically and the
cells harvested, lysed and the protein isolated. A cell culture
typically includes host cells, media and other byproducts. Suitable
mediums for cell culture are well known in the art. Protein can be
isolated from cell culture medium, host cells, or both using
techniques known in the art for purifying proteins.
[0059] III. Isolation and Characterization of CTLA4-Immunoglobulin
Fusion Proteins
[0060] Another aspect of the invention pertains to
CTLA4-immunoglobulin fusion proteins having modified effector
functions compared to a CTLA4-IgG1 protein. Such proteins comprise
a first peptide having a CTLA4 activity and a second peptide
comprising an immunoglobulin constant region which is modified to
reduce at least one constant region-mediated biological effector
function relative to a CTLA4-IgG1 fusion protein. A peptide having
a CTLA4 activity has been previously defined herein. In a preferred
embodiment, the first peptide comprises an extracellular domain of
the human CTLA4 protein (e.g., amino acid residues 20-144 of SEQ ID
NO: 24, 26 and 28) and binds B7-1 and/or B7-2. The second peptide
comprising an immunoglobulin constant region preferably includes a
hinge region, a CH2 domain and a CH3 domain derived from C.gamma.1,
C.gamma.2, C.gamma.3, or C.gamma.4. Typically, the CH2 domain is
modified to reduce constant region-mediated biological effector
functions, such as complement activation and/or Fc receptor
interaction as previously described in detail herein.
[0061] Another embodiment of the invention provides a substantially
pure preparation of a CTLA4-immunoglobulin fusion protein as
described herein. Such a preparation is substantially free of
proteins and peptides with which the protein naturally occurs in a
cell or with which it naturally occurs when secreted by a cell.
[0062] CTLA4-immunoglobulin fusion proteins, expressed in mammalian
cells or elsewhere, can be purified according to standard
procedures of the art, including ammonium sulfate precipitation,
fractionation column chromatography (e.g., ion exchange, gel
filtration, electrophoresis, affinity chromatography, etc.) and
ultimately, crystallization (see generally, "Enzyme Purification
and Related Techniques", Methods in Enzymology, 22:233-577 (1971)).
Preferably, the CTLA4-immunoglobulin fusion proteins are purified
using an immobilized protein A column (Repligen Corporation,
Cambridge, Mass.). Once purified, partially or to homogeneity, the
recombinantly produced CTLA4-immunoglobulin fusion proteins or
portions thereof can be utilized in compositions suitable for
pharmaceutical administration as described in detail herein.
[0063] In one embodiment the CTLA4-immunoglobulin fusion protein is
an antibody form in which the heavy and light chains have been
replaced with the extracellular domain of CTLA4. This molecule has
a different valency and higher affinity for CTLA4 ligands, thus
making it possible to obtain similar results while using less of
the agent. The fact that this molecule has a true antibody tail
which is fully glycosylated means that numerous cell lines for
producing the CTLA4Ab fusion protein and data regarding the
clinical use of antibodies may be relied on.
[0064] Screening of CTLA4-immunoglobulin fusion proteins which have
been modified to reduce at least one constant region-mediated
biological effector function as described herein can be
accomplished using one or more of several different assays which
measure different effector functions. For example, to identify a
CTLA4-immunoglobulin fusion protein having reduced Fc receptor
interaction, a monomeric IgG binding assay can be conducted (see
Example 2). A cell which expresses an Fc receptor, such as a
mononuclear phagocyte or the U937 cell line (Fc.gamma.RI
expression), a hematopoietic cell (Fc.gamma.RII expression;
Rosenfeld, S. I., et al. (1985) J. Clin. Invest. 76:2317-2322) or a
neutrophil (Fc.gamma.RIII expression; Fleit, H. B., et al. (1982)
Proc. Natl. Acad. Sci. USA 79:3275-3279 and Petroni, K. C., et al.
(1988) J. Immunol. 140:3467-3472) is contacted with, for example,
.sup.125I-labeled immunoglobulin of the IgG1 isotype in the
presence or absence of a modified CTLA4-immunoglobulin fusion
protein of the invention and in the presence or absence of an
appropriate control molecule (e.g., an unlabeled IgG1 antibody or a
CTLA4-IgG1 fusion protein). The amount of .sup.125I-labeled IgG1
bound to the cells and/or the amount of free .sup.125I-labeled IgG
in the supernatant is determined. A CTLA4-immunoglobulin fusion
protein having reduced Fc receptor binding is identified by a
reduced ability (or lack of ability) to inhibit binding of the
.sup.125I-labeled IgG1 to the cells (relative to the control
molecule). Monomeric IgG binding assay are described further in
Lund, J., et al. (1991) J. Immunol. 147:2657-2662; and Woof, J. M.,
et al. (1986) Mol. Immunol. 23:319.
[0065] To identify a CTLA4-immunoglobulin fusion protein with a
reduced ability to activate the complement cascade, a complement
activation assay such as that described in Example 2 can be used.
In this assay, a cell which expresses a CTLA4 ligand (e.g., B7-1 or
B7-2) on its surface is loaded with a detectable substance, e.g., a
fluorescent dye, and then contacted with the CTLA4-immunoglobulin
fusion protein and a complement source (e.g., purified guinea pig
complement or human serum as a source of human complement). Cell
lysis, as determined by release of the fluorescent dye from the
cells, is determined as an indication of activation of the
complement cascade upon binding of CTLA4-immunoglobulin to the
CTLA4 ligand on the cell surface. Cells which do not express a
CTLA4 ligand on their surface are used as a negative control. A
CTLA4-immunoglobulin fusion protein with reduced ability (or lack
of the ability) to activate complement relative to an appropriate
control molecule (e.g., anti-B7-1 antibody of the IgG1 isotype or a
CTLA4-IgG1 fusion protein) is identified by a reduction in or
absence of cell lysis of labeled, CTLA4 ligand positive cells when
incubated in the presence of the CTLA4-immunoglobulin fusion
protein of the invention and complement compared to cells incubated
in the presence of the control molecule and complement.
[0066] In another complement activation assay, the ability of a
CTLA4-immunoglobulin fusion protein to bind the first component of
the complement cascade, C1q, is assessed. For example, C1q binding
can be determined using a solid phase assay in which
.sup.125I-labeled human C1q is added to an amount of
CTLA4-immunoglobulin fusion protein complexed with a CTLA4 ligand,
such as B7-1 or B7-2, and the amount of bound .sup.125I-labeled
human C1q quantitated. A CTLA4-immunoglobulin fusion protein having
a reduced complement activation activity (or lack of complement
activation activity) is identified by a reduction in or absence of
the ability to bind the .sup.125I-labeled human C1q relative to an
appropriate control molecule (e.g., an IgG1 antibody or a
CTLA4-IgG1 fusion protein). C1q binding assays are described
further in Tan, L. K., et al. (1990) Proc. Natl. Acad. Sci. USA
87:162-166; and Duncan, A. R. and G. Winter (1988) Nature
332:738-740.
[0067] Additional assays for other immunoglobulin constant
region-mediated effector functions, such as opsonization and
phagocytosis, antibody-dependent cellular cytotoxicity and release
of reactive oxygen intermediates, have been described in the art
and are known to the skilled artisan.
[0068] Screening for CTLA4-immunoglobulin fusion proteins which
have a CTLA4 activity as described herein can be accomplished using
one or more of several different assays. For example, the fusion
proteins can be screened for specific reactivity with an anti-CTLA4
antibody (e.g., a monoclonal or polyclonal anti-CTLA4 antibody) or
with a soluble form of a CTLA4 ligand, such as a B7-1 or B7-2
fusion protein (e.g., B7-1Ig or B7-2Ig). For example, appropriate
cells, such as CHO or NS0 cells, can be transfected with a DNA
encoding a CTLA4-immunoglobulin fusion protein and the cell
supernatant analyzed for expression of the resulting fusion protein
using an anti-CTLA4 monoclonal antibody or B7-1Ig or B7-2Ig fusion
protein in a standard immunoprecipitation assay. Alternatively, the
binding of a CTLA4-immunoglobulin fusion protein to a cell which
expresses a CTLA4 ligand, such as a B7-1 or B7-2, on its surface
can be assessed. For example, a cell expressing a CTLA4 ligand,
such as a CHO cell transfected to express B7-1, is contacted with
the CTLA4-immunoglobulin fusion protein and binding detected by
indirect immunostaining using, for example, a FITC-conjugated
reagent (e.g., goat anti-mouse Ig serum for murine monoclonal
antibodies or goat anti-human IgC.gamma. serum for fusion proteins)
and fluorescence analyzed by FACS.RTM. analysis (Becton Dickinson
& Co., Mountain View, Calif.).
[0069] Other suitable assays take advantage of the functional
characteristics of the CTLA4-immunoglobulin fusion protein. As
previously set forth, the ability of T cells to synthesize
cytokines depends not only on occupancy or cross-linking of the T
cell receptor for antigen ("the primary activation signal provided
by, for example antigen bound to an MHC molecule, anti-CD3, or
phorbol ester to produce an "activated T cell"), but also on the
induction of a costimulatory signal, in this case, by interaction
of a B7 family protein (e.g., B7-1 or B7-2) with its ligand (CD28
and/or CTLA4) on the surface of T cells. The B7:CD28/CTLA4
interaction has the effect of transmitting a signal to the T cell
that induces the production of increased levels of cytokines,
particularly of interleukin-2, which in turn stimulates the
proliferation of the T lymphocytes. In one embodiment, the
CTLA4-immunoglobulin fusion proteins of the invention have the
functional property of being able to inhibit the B7:CD28/CTLA4
interaction. Accordingly, other screening assays for identifying a
functional CTLA4-immunoglobulin fusion protein involve assaying for
the ability of the fusion protein to inhibit synthesis of
cytokines, such as interleukin-2, interleukin-4 or other known or
unknown novel cytokines and/or the ability to inhibit T cell
proliferation by T cells which have received a primary activation
signal.
[0070] The ability of a CTLA4-immunoglobulin fusion protein of the
invention to inhibit or block an interaction between a B7 family
protein (e.g., B7-1 or B7-2) with its receptor on T cells (e.g.,
CD28 and/or CTLA4) can be assessed in an in vitro T cell culture
system by stimulating T cells with a source of ligand (e.g., cells
expressing B7-1 and/or B7-2 or a secreted form of B7-1 and/or B7-2)
and a primary activation signal such as antigen in association with
Class II MHC (or alternatively, anti-CD3 antibodies or phorbol
ester) in the presence or absence of the CTLA4-immunoglobulin
fusion protein. The culture supernatant is then assayed for
cytokine production, such as interleukin-2, gamma interferon, or
other known or unknown cytokine. For example, any one of several
conventional assays for interleukin-2 can be employed, such as the
assay described in Proc. Natl. Acad. Sci. USA. 86:1333 (1989). An
assay kit for interferon production is also available from Genzyme
Corporation (Cambridge, Mass.). T cell proliferation can be
measured in vitro by determining the amount of .sup.3H-labeled
thymidine incorporated into the replicating DNA of cultured cells.
The rate and amount of DNA synthesis and, in turn, the rate of cell
division can thus be quantified. A lack of or reduction in the
amount of cytokine production and/or T cell proliferation by
stimulated T cells upon culture with a CTLA4-immunoglobulin fusion
protein of the invention indicates that the fusion protein is
capable of inhibiting the delivery of a costimulatory signal to the
T cell by inhibiting an interaction between a CTLA4 ligand (e.g.,
B7-1 and/or B7-2) and a receptor therefor (e.g., CD28 and/or
CTLA4).
[0071] The ability of the CTLAIg fusion protein to induce
antigen-specific T cell unresponsiveness or anergy can also be
assessed using the in vitro T cell culture system described above.
Following stimulation of the T cells with a specific antigen bound
to MHC molecules on an antigen presenting cell surface and CTLA4
ligand (e.g., B7-1 on the antigen presenting cell surface) in the
presence of CTLA4-immunoglobulin fusion protein, the T cells are
subsequently restimulated with the antigen in the absence of
CTLA4-immunoglobulin fusion protein. A lack of cytokine production
and/or T cell proliferation upon antigenic restimulation by T cells
previously treated with a CTLA4-immunoglobulin fusion protein of
the invention indicates that the fusion protein has induced a state
of antigen-specific anergy or non-responsiveness in the T cells.
See. e.g., Gimmi, C. D. et al. (1993) Proc. Natl. Acad. Sci. USA
90:6586-6590; and Schwartz (1990) Science 248:1349-1356, for assay
systems that can used to examine T cell unresponsiveness in
accordance with the present invention.
[0072] In yet another assay, the ability of a CTLA4-immunoglobulin
fusion protein of the invention to inhibit T cell dependent immune
responses in vitro is determined. The effect of a
CTLA4-immunoglobulin fusion protein on T.sub.h-induced
immunoglobulin production by B cells can be assessed by contacting
antigen-specific CD4.sup.+ T cells with syngeneic antigen-specific
B cells, antigen and the CTLA4-immunoglobulin fusion protein. The
cell culture supernatant is assayed for the production of
immunoglobulin, such as IgG or IgM, using, for example, a solid
phase ELISA or a standard plaque assay. Inhibition of B cell
immunoglobulin production by treatment of the culture with the
CTLA4-immunoglobulin fusion protein indicates that the protein is
capable inhibiting T helper cell responses and, consequently, T
cell dependent B cell responses.
[0073] IV. Compositions of CTLA4-Immunoglobulin Fusion Proteins
[0074] The CTLA4-immunoglobulin fusion proteins of the invention
can be incorporated into compositions suitable for administration
to subjects to thereby modulate immune responses or for other
purposes (e.g., antibody production). The CTLA4-immunoglobulin
fusion protein in such compositions is in a biologically compatible
form suitable for pharmaceutical administration in vivo. By
"biologically compatible form suitable for administration in vivo"
is meant a form of the protein to be administered in which any
toxic effects are outweighed by the therapeutic effects of the
protein. The term subject is intended to include living organisms
in which an immune response can be elicited, e.g., mammals.
Examples of subjects include humans, monkeys, dogs, cats, mice,
rats, and transgenic species thereof. Administration of a
CTLA4-immunoglobulin fusion protein as described herein can be in
any pharmacological form including a therapeutically active amount
of protein and a pharmaceutically acceptable carrier.
Administration of a therapeutically active amount of the
therapeutic compositions of the invention is defined as an amount
effective, at dosages and for periods of time necessary to achieve
the desired result. For example, a therapeutically active amount of
a CTLA4-immunoglobulin fusion protein may vary according to factors
such as the disease state, age, sex, and weight of the individual,
and the ability of protein to elicit a desired response in the
individual. Dosage regima may be adjusted to provide the optimum
therapeutic response. For example, several divided doses may be
administered daily or the dose may be proportionally reduced as
indicated by the exigencies of the therapeutic situation.
[0075] The active compound (e.g., CTLA4-immunoglobulin fusion
protein) may be administered in a convenient manner such as by
injection (subcutaneous, intravenous, etc.), oral administration,
inhalation, transdermal application, or rectal administration.
Depending on the route of administration, the active compound may
be coated in a material to protect the compound from the action of
enzymes, acids and other natural conditions which may inactivate
the compound.
[0076] To administer a CTLA4-immunoglobulin fusion protein by other
than parenteral administration, it may be necessary to coat the
protein with, or co-administer the protein with, a material to
prevent its inactivation. For example, a CTLA4-immunoglobulin
fusion protein may be administered to an individual in an
appropriate carrier, diluent or adjuvant, co-administered with
enzyme inhibitors or in an appropriate carrier such as liposomes.
Pharmaceutically acceptable diluents include saline and aqueous
butter solutions. Adjuvant is used in its broadest sense and
includes any immune stimulating compound, such as interferon.
Adjuvants contemplated herein include resorcinols, non-ionic
surfactants such as polyoxyethylene oleyl ether and n-hexadecyl
polyethylene ether. Enzyme inhibitors include pancreatic trypsin
inhibitor, diisopropylfluorophosphate (DEP) and trasylol. Liposomes
include water-in-oil-in-water emulsions as well as conventional
liposomes (Strejan et al., (1984) J. Neuroimmunol 7:27).
[0077] The active compound may also be administered parenterally or
intraperitoneally. Dispersions can also be prepared in glycerol,
liquid polyethylene glycols, and mixtures thereof and in oils.
Under ordinary conditions of storage and use, these preparations
may contain a preservative to prevent the growth of
microorganisms.
[0078] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. In all cases, the
composition must be sterile and must be fluid to the extent that
easy syringability exists. It must be stable under the conditions
of manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polvalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0079] Sterile injectable solutions can be prepared by
incorporating the active compound (e.g., CTLA4-immunoglobulin
fusion protein) in the required amount in an appropriate solvent
with one or a combination of ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the active compound into
a sterile vehicle which contains a basic dispersion medium and the
required other ingredients from those enumerated above. In the case
of sterile powders for the preparation of sterile injectable
solutions, the preferred methods of preparation are vacuum drying,
and freeze-drying which yields a powder of the active ingredient
(e.g., peptide) plus any additional desired ingredient from a
previously sterile-filtered solution thereof.
[0080] When the active compound is suitably protected, as described
above, the protein may be orally administered, for example, with an
inert diluent or an assimilable edible carrier. As used herein
"pharmaceutically acceptable carrier" includes any and all
solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic and absorption delaying agents, and the like. The
use of such media and agents for pharmaceutically active substances
is well known in the art. Except insofar as any conventional media
or agent is incompatible with the active compound, use thereof in
the therapeutic compositions is contemplated. Supplementary active
compounds can also be incorporated into the compositions.
[0081] It is especially advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used herein refers to
physically discrete units suited as unitary dosages for the
mammalian subjects to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on (a) the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and (b) the limitations inherent
in the art of compounding such an active compound for the treatment
of sensitivity in individuals.
[0082] V. Uses of CTLA4-Immunoglobulin Fusion Proteins Having
Reduced IgC Region-Mediated Biological Effector Functions
[0083] A. Immunomodulation
[0084] Given the role of CTLA4 ligands, such as B7-1 and B7-2, in T
cell costimulation and the structure and function of the
CTLA4-immunoglobulin fusion proteins disclosed herein, the
invention provides methods for downregulating immune responses. The
reduced IgC-region mediated biological effector functions exhibited
by the mutated CTLA4-immunoglobulin fusion proteins of the
invention compared to a CTLA4-IgG1 fusion protein may result in
more effective downregulation of immune responses in vivo without
unwanted side effects (e.g., complement activation,
antibody-dependent cellular cytotoxicity, etc.) than if a
CTLA4-IgG1 fusion protein were used. For example, improvements in
mutated forms of CTLA4-immunoglobulin fusion proteins can be
assessed by a variety of assays known to those skilled in the art,
including various animal organ (heart, liver, kidney, bone marrow)
transplantation models and in animal autoimmune disease models
including, but not limited to lupus, multiple sclerosis, diabetes,
and arthritis models.
[0085] Downregulation of an immune response by a
CTLA4-immunoglobulin fusion protein of the invention may be in the
form of inhibiting or blocking an immune response already in
progress or may involve preventing the induction of an immune
response. The functions of activated T cells, such as T cell
proliferation and cytokine (e.g., IL-2) secretion, may be inhibited
by suppressing T cell responses or by inducing specific tolerance
in T cells, or both. Immunosuppression of T cell responses is
generally an active process which requires continuous exposure of
the T cells to the suppressive agent and is often not
antigen-specific. Tolerance, which involves inducing
non-responsiveness or anergy in T cells, is distinguishable from
immunosuppression in that it is generally antigen-specific and
persists after exposure to the tolerizing agent has ceased.
Operationally, T cell unresponsiveness or anergy can be
demonstrated by the lack of a T cell response upon reexposure to
specific antigen in the absence of the tolerizing agent.
Immunosuppression and/or T cell unresponsiveness is achieved by
blocking the interaction of a CTLA4 ligand on an antigen presenting
cell with CTLA4 itself and/or with another receptor for the CTLA4
ligand (e.g., CD28) on the surface of a T cell, e.g., blocking the
interaction of a B7 family protein, such as B7-1 and/or B7-2, with
a counter-receptor, such as CD28 or CTLA4, on the surface of a T
cell. The term "antigen presenting cell" is intended to include B
lymphocytes, professional antigen presenting cells (e.g.,
monocytes, dendritic cells, Langerhan cells) and others cells
(e.g., keratinocytes, endothelial cells, astrocytes, fibroblasts,
oligodendrocytes) which can present antigen to T cells. The
CTLA4-immunoglobulin fusion proteins of the invention can be used
to inhibit CTLA4 ligand/receptor interactions in many clinical
situations, as described further below.
[0086] 1. Organ Transplantation/GVHD: Inhibition of T cell
responses by a CTLA4-immunoglobulin fusion protein of the invention
is useful in situations of cellular, tissue, skin and organ
transplantation and in bone marrow transplantation (e.g., to
inhibit graft-versus-host disease (GVHD)). For example, inhibition
of T cell proliferation and/or cytokine secretion may result in
reduced tissue destruction in tissue transplantation and induction
of antigen-specific T cell unresponsiveness may result in long-term
graft acceptance without the need for generalized
immunosuppression. Typically, in tissue transplants, rejection of
the graft is initiated through its recognition as foreign by T
cells, followed by an immune reaction that destroys the graft.
Administration of a CTLA4-immunoglobulin fusion protein of the
invention to a transplant recipient inhibits triggering of a
costimulatory signal in alloantigen-specific T cells, thereby
inhibiting T cell responses to alloantigens and, moreover, may
induce graft-specific T cell unresponsiveness in the recipient. The
transplant recipient can be treated with the CTLA4-immunoglobulin
fusion protein alone or together with one or more additional agents
that inhibit the generation of stimulatory signals in the T cells
(e.g., anti-B7-1 and/or anti-B7-2 antibodies, an anti-IL-2 receptor
antibody) or induce general immunosuppression (e.g., cyclosporin A
or FK506).
[0087] Use of a CTLA4-immunoglobulin fusion protein to inhibit
triggering of a costimulatory signal in T cells can similarly be
applied to the situation of bone marrow transplantation to
specifically inhibit the responses of alloreactive T cells present
in donor bone marrow and thus inhibit GVHD. A CTLA4-immunoglobulin
fusion protein can be administered to a bone marrow transplant
recipient to inhibit the alloreactivity of donor T cells.
Additionally or alternatively, donor T cells within the bone marrow
graft can be tolerized to recipient alloantigens ex vivo prior to
transplantation. For example, donor bone marrow can be cultured
with cells from the recipient (e.g., irradiated hematopoietic
cells) in the presence of a CTLA4-immunoglobulin fusion protein of
the invention prior to transplantation. Additional agents that
inhibit the generation of stimulatory signals in the T cells (e.g.,
anti-B7-1 and/or anti-B7-2 antibodies, an anti-IL-2R antibody etc.,
as described above) can be included in the culture. After
transplantation, the recipient may be further treated by in vivo
administration of CTLA4-immunoglobulin (alone or together with
another agent(s) which inhibits the generation of a costimulatory
signal in T cells in the recipient or inhibits the production or
function of a T cell growth factor(s) (e.g., IL-2) in the
recipient).
[0088] The efficacy of a particular CTLA4-immunoglobulin fusion
protein in inhibiting organ transplant rejection or GVHD can be
assessed using animal models that may be predictive of efficacy in
humans. Given the homology between CTLA4 molecules of different
species, the functionally important aspects of CTLA4 are believed
to be conserved structurally among species thus allowing animal
systems to be used as models for efficacy in humans. Examples of
appropriate systems which can be used include allogeneic cardiac
grafts in rats and xenogeneic pancreatic islet cell grafts in mice,
both of which have been used to examine the immunosuppressive
effects of CTLA4-IgG1 fusion proteins in vivo as described in
Lenschow et al., Science, 257: 789-792 (1992) and Turka et al.,
Proc. Natl. Acad. Sci. USA. 89: 11102-11105 (1992). In addition,
murine models of GVHD (see Paul ed., Fundamental Immunology, Raven
Press, New York, 1989, pp. 846-847) can be used to determine the
effect of treatment with a CTLA4-immunoglobulin fusion protein of
the invention on the development of that disease.
[0089] As an illustrative embodiment, a CTLA4-immunoglobulin fusion
protein of the invention can be used in a rat model of organ
transplantation to ascertain the ability of the fusion protein to
inhibit alloantigen responses in vivo. Recipient Lewis rats receive
a Brown-Norway rat strain cardiac allograft which is anastamosed to
vessels in the neck as described in Bolling, S. F. et al.,
Transplant, 453:283-286 (1992). Grafts are monitored for mechanical
function by palpation and for electrophysiologic function by
electrocardiogram. Graft rejection is said to occur on the last day
of palpable contractile function. As an initial test, animals are
treated with daily injections of a CTLA4-immunoglobulin fusion
protein of interest, an isotype-matched control Ig fusion protein
and/or CTLA4-IgG1 (for comparison purposes) for 7 days. Fusion
proteins are administered at a dosage range between approximately
0.015 mg/day and 0.5 mg/day. Untreated Lewis rats typically reject
heterotopic Brown-Norway allografts in about 7 days. The rejection
of allografts by fusion protein-treated animals is assessed in
comparison to untreated controls.
[0090] An untreated animal and a fusion protein-treated animal are
sacrificed for histological examination. Cardiac allografts are
removed from the untreated animal and the treated animal four days
after transplantation. Allografts are fixed in formalin, and tissue
sections are stained with hematoxylin-eosin. The heart tissue of
the untreated and treated animals is examined histologically for
severe acute cellular rejection including a prominent interstitial
mononuclear cell infiltrate with edema formation, myocyte
destruction, and infiltration of arterlolar walls. The
effectiveness of the fusion protein treatment in inhibiting graft
rejection is supported by a lack of an acute cellular rejection in
the heart tissue of the fusion protein treated animals.
[0091] To determine whether fusion protein therapy establishes long
term graft acceptance that persists following treatment, animals
treated for 7 days with daily injections of fusion protein are
observed without additional therapy until cessation of graft
function. Graft survival is assessed daily as described above.
Allografts are examined histologically from animals in which the
graft stops functioning as described above. Induction of graft
tolerance by fusion protein treatment is indicated by the continued
functioning of the graft following the cessation of treatment with
the fusion protein.
[0092] After prolonged graft acceptance, a fusion protein-treated
animal can be sacrificed and the lymphocytes from the recipient can
be tested for their functional responses. These responses are
compared with those of lymphocytes from a control
(non-transplanted) Lewis rat, and results are normalized as a
percentage of the control response. The T cell proliferative
response to ConA and to cells from a Brown-Norway rat and a third
party ACI rat can be examined. Additionally, the thymus and spleen
from the untreated and treated animals can be compared in size,
cell number and cell type (e.g. by flow cytometic analyses of
thymus, lymph nodes and spleen cells). Specific nonresponsiveness
in the treated animals to alloantigens, as a result of specific
clonal deletion of alloreactive cells, is indicated by the ability
of the T cells to respond to ConA and third party stimulators
(e.g., ACI rat cells) but not to Brown-Norway rat cells. Prolonged
acceptance of allografts, including continued graft acceptance
following CTLA4-immunoglobulin treatment, in this model system may
be predictive of the therapeutic efficacy of the
CTLA4-immunoglobulin fusion proteins of the invention in human
transplant situations.
[0093] 2. Autoimmune Diseases: Inhibition of T cell responses by a
CTLA4-immunoglobulin fusion protein of the invention may also be
therapeutically useful for treating autoimmune diseases. Many
autoimmune disorders are the result of inappropriate activation of
T cells that are reactive against self tissue (i.e., reactive
against autoantigens) and which promote the production of cytokines
and autoantibodies involved in the pathology of the diseases.
Preventing the activation of autoreactive T cells thus may reduce
or eliminate disease symptoms. Administration of a
CTLA4-immunoglobulin fusion protein of the invention to a subject
suffering from or susceptible to an autoimmune disorder may inhibit
autoantigen-specific T cell responses and induce
autoantigen-specific T cell unresponsiveness, thereby inhibiting or
preventing production of autoantibodies or T cell-derived cytokines
which may be involved in the disease process.
[0094] To treat an autoimmune disorder, a CTLA4-immunoglobulin
fusion protein of the invention is administered to a subject in
need of treatment. For autoimmune disorders with a known
autoantigen, it may be desirable to coadminister the autoantigen
with the CTLA4-immunoglobulin to the subject. This method can be
used to treat a variety of autoimmune diseases and disorders having
an autoimmune component, including diabetes mellitus, arthritis
(including rheumatoid arthritis, juvenile rheumatoid arthritis,
osteoarthritis, psoriatic arthritis), multiple sclerosis,
myasthenia gravis, systemic lupus erythematosis, autoimmune
thyroiditis, dermatitis (including atopic dermatitis and eczematous
dermatitis), psoriasis, Sjogren's Syndrome, including
keratoconjunctivitis sicca secondary to Sjogren's Syndrome,
alopecia areata, allergic responses due to arthropod bite
reactions, Crohn's disease, aphthous ulcer, iritis, conjunctivitis,
keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma,
cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis,
drug eruptions, leprosy reversal reactions, erythema nodosum
leprosum, autoimmune uveitis, allergic encephalomyelitis, acute
necrotizing hemorrhagic encephalopathy, idiopathic bilateral
progressive sensorineural hearing loss, aplastic anemia, pure red
cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's
granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome,
idiopathic sprue, lichen planus, Crohn's disease, Graves
ophthalmopathy, sarcoidosis, primary biliary cirrhosis, uveitis
posterior, and interstitial lung fibrosis.
[0095] The efficacy of a CTLA4-immunoglobulin fusion protein of the
invention in preventing or alleviating autoimmune disorders can be
determined using a number of well-characterized animal models of
human autoimmune diseases. Examples include murine experimental
autoimmune encephalitis, systemic lupus erythmatosis in MRL/lpr/lpr
mice or NZB hybrid mice, murine autoimmune collagen arthritis,
diabetes mellitus in NOD mice and BB rats, and murine experimental
myasthenia gravis (see Paul ed., Fundamental Immunology, Raven
Press, New York, 1989, pp. 840-856).
[0096] Experimental Autoimmune Encephalomyelitis (EAE) is a rodent
and primate model for multiple sclerosis. In an illustrative
embodiment utilizing the passive EAE model, donor mice are
immunized with 0.4 mg Myelin Basic Protein (MBP) in Complete
Freund's Adjuvant (CFA), divided over four quadrants. The draining
axillary and inguinal lymph nodes are removed eleven days later.
Lymph node cells (4.times.10.sup.6/ml) are plated in 2 ml cultures
in 24 well plates, in the presence of 25 .mu.g/ml MBP. After four
days in culture, 30.times.10.sup.6 of the treated cells are
injected into the tail vein of each naive, syngeneic recipient
mouse.
[0097] The recipient mice develop a remitting, relapsing disease
and are evaluated utilizing the following criteria:
[0098] 0 normal, healthy
[0099] 1 limp tail, incontinence; occasionally the first sign of
the disease is a "tilt"
[0100] 2 hind limb weakness, clumsiness
[0101] 3 mild paraparesis
[0102] 4 severe paraparesis
[0103] 5 quadriplegia
[0104] 6 death
[0105] Using the passive model of EAE, the effect of
CTLA4-immunoglobulin treatment of the donor cells on resulting
disease severity in a recipient animal is tested in mice (e.g., the
PLSJLF1/J strain). Culture of lymph node cells in vitro with MBP is
performed either in the presence or the absence of about 30
.mu.g/ml of a CTLA4-immunoglobulin fusion protein of the invention,
an isotype matched control Ig fusion protein or CTLA4IgG1 (for
comparison purposes). The treated cells are then introduced into a
syngeneic recipient mouse. The effect of fusion protein treatment
of donor cells on the severity of the recipient's first episode of
disease as compared to mice receiving untreated cells can be
determined using the above-described criteria to assess disease
severity. In addition, ensuing relapses in the mice receiving
fusion protein-treated cells versus untreated cells can be assessed
using the above-described criteria.
[0106] The effect of treating both the donor mice and the cultured
donor cells with CTLA4-immunoglobulin on the clinical disease
severity in the recipient can further be assessed. In these
experiments, donor mice (e.g., of the SJL/J strain) immunized with
MBP are given either 100 .mu.g of CTLA4-immunoglobulin fusion
protein, an isotype matched control Ig fusion protein or CTLA4-IgG1
(for comparison) intraperitoneally each day for eleven days. Cells
are then isolated from lymph nodes of these donors and cultured
with MBP in vitro in the presence of either 30 .mu.g/ml of
CTLA4-immunoglobulin fusion protein or control fusion proteins. The
treated cells are then introduced into a syngeneic recipient. The
effect of fusion protein treatment on the severity of the ensuing
disease in the recipient is then assessed using the above-described
criteria.
[0107] Studies using a direct (active) model of EAE can also
conducted. In these experiments, a CTLA4-immunoglobulin fusion
protein of the invention or control fusion protein is directly
administered to mice immunized with MBP and treated with pertussis
toxin (PT). Mice (e.g., the PLSJLFI/J strain) are immunized with
MBP on day 0, injected with PT intravenously on days 0 and 2, and
given either a CTLA4-immunoglobulin fusion protein of the invention
or a control fusion protein on days 0 to 7. The effect of direct
fusion protein treatment of the MBP-immunized mice on the severity
of the ensuing disease is then assessed using the above-described
criteria. A reduced severity in disease symptoms in the passive
and/or active EAE model as a result of CTLA4-immunoglobulin
treatment may be predictive of the therapeutic efficacy of the
CTLA4-immunoglobulin fusion proteins of the invention in human
autoimmune diseases.
[0108] 3. Allergy:
[0109] The IgE antibody response in atopic allergy is highly T cell
dependent and, thus, inhibition of CTLA4 ligand/receptor induced T
cell activation may be useful therapeutically in the treatment of
allergy and allergic reactions. A CTLA4-immunoglobulin fusion
protein of the invention can be administered to an allergic subject
to inhibit T cell mediated allergic responses in the subject.
Inhibition of costimulation of T cells through inhibition of a
CTLA4 ligand/receptor interaction may be accompanied by exposure to
allergen in conjunction with appropriate MHC molecules. Exposure to
the allergen may be environmental or may involve administering the
allergen to the subject. Allergic reactions may be systemic or
local in nature, depending on the route of entry of the allergen
and the pattern of deposition of IgE on mast cells or basophils.
Thus, it may be necessary to inhibit T cell mediated allergic
responses locally or systemically by proper administration of a
CTLA4-immunoglobulin fusion protein of the invention. For example,
in one embodiment, a CTLA4-immunoglobulin fusion protein of the
invention and an allergen are coadminstered subcutaneously to an
allergic subject.
[0110] 4. Virally Infected or Malignant T Cells: Inhibition of T
cell activation through blockage of the interaction of a CTLA4
ligand with a receptor therefor on T cells may also be important
therapeutically in viral infections of T cells. For example, in the
acquired immune deficiency syndrome (AIDS), viral replication is
stimulated by T cell activation. Blocking a CTLA4 ligand/receptor
interaction, such as the interaction of B7-1 and/or B7-2 with CD28
and/or CTLA4 could lead to a lower level of viral replication and
thereby ameliorate the course of AIDS. Surprisingly, HTLV-I
infected T cells express B7-1 and B7-2. This expression may be
important in the growth of HTLV-I infected T cells and the blockage
of B7-1 function together with the function of B7-2 with a
CTLA4-immunoglobulin fusion protein, possibly in conjunction with
another blocking reagent (such as an anti-B7-2 blocking antibody or
a CD28Ig fusion protein) may slow the growth of HTLV-I induced
leukemias. In addition, some tumor cells are responsive to
cytokines and the inhibition of T cell activation and cytokine
production could help to inhibit the growth of these types of
cancer cells.
[0111] 5. Antigen-Specific T Cell Unresponsiveness: The methods of
the invention for inhibiting T cell responses can essentially be
applied to any antigen (e.g., protein) to clonally delete T cells
responsive to that antigen in a subject. For example, in one study,
administration of a CTLA4-IgG1 fusion protein to mice in vivo
suppressed primary and secondary T cell-dependent antibody
responses to antigen (Linsley P. S., et al. (1992) Science 257,
792-795). Thus, a subject treated with a molecule capable of
inducing a T cell response can be treated with CTLA4-immunoglobulin
fusion protein to inhibit T cell responses to the molecule. This
basic approach has widespread application as an adjunct to
therapies which utilize a potentially immunogenic molecule for
therapeutic purposes. For example, an increasing number of
therapeutic approaches utilize a proteinaceous molecule, such as an
antibody, fusion protein or the like, for treatment of a clinical
disorder. A limitation to the use of such molecules therapeutically
is that they can elicit an immune response directed against the
therapeutic molecule in the subject being treated (e.g., the
efficacy of murine monoclonal antibodies in human subjects is
hindered by the induction of an immune response against the
antobodies in the human subject). Administration of a
CTLA4-immunoglobulin fusion protein to inhibit antigen-specific T
cell responses can be applied to these therapeutic situations to
enable long term usage of the therapeutic molecule in the subject
without elicitation of an immune response. For example, a
therapeutic antibody (e.g., murine mAb) is administered to a
subject (e.g., human), which typically activates T cells specific
for the antibody in the subject. To inhibit the T cell response
against the therapeutic antibody, the therapeutic antibody is
administered to the subject together with a CTLA4-immunoglobulin
fusion protein of the invention.
[0112] When used therapeutically, a CTLA4-immunoglobulin fusion
protein of the invention can be used alone or in conjunction with
one or more other reagents that influence immune responses. A
CTLA4-immunoglobulin fusion protein and another immunomodulating
reagent can be combined as a single composition or administered
separately (simultaneously or sequentially) to downregulate T cell
mediated immune responses in a subject. Examples of other
immunomodulating reagents include blocking antibodies, e.g.,
against B7-1, B7-2 or other B cell surface antigens or cytokines,
other fusion proteins, e.g., CD28Ig, or immunosuppressive drugs,
e.g., cyclosporine A or FK506.
[0113] The CTLA4-immunoglobulin fusion proteins of the invention
may also be useful in the construction of therapeutic agents which
block immune cell function by destruction of the cell. For example,
by linking a CTLA4-immunoglobulin fusion protein to a toxin such as
ricin or diptheria toxin, an agent capable of preventing immune
cell activation would be made. Infusion of one or a combination of
immunotoxins into a patient would result in the death of immune
cells, particularly of activated B cells that express higher
amounts of B7-1 and/or B7-2.
[0114] B. Screening Assays
[0115] Another application of the CTLA4-immunoglobulin fusion
proteins of the invention is the use the protein in screening
assays to discover as yet undefined molecules which inhibit an
interaction between CTLA4 and a CTLA4 ligand, such as B7-1 or B7-2.
For example, the CTLA4-immunoglobulin fusion protein can be used in
a solid-phase binding assay in which panels of molecules are
tested. In one embodiment, the screening method of the invention
involves contacting a CTLA4-immunoglobulin fusion protein of the
invention with a CTLA4 ligand and a molecule to be tested. Either
the CTLA4-immunoglobulin fusion protein or the CTLA4 ligand is
labeled with a detectable substance, such as a radiolabel or
biotin, which allows for detection and quantitation of the amount
of binding of CTLA4-immunoglobulin to the CTLA4 ligand. After
allowing CTLA4-immunoglobulin and the CTLA4 ligand to interact in
the presence of the molecule to be tested, unbound labeled
CTLA4-immunoglobulin fusion protein or unbound labeled CTLA4 ligand
is removed and the amount of CTLA4-immunoglobulin fusion protein
bound to the CTLA4 ligand is determined. A reduced amount of
binding of CTLA4-immunoglobulin fusion protein to the CTLA4 ligand
in the presence of the molecule tested relative to the amount of
binding in the absence of the molecule is indicative of an ability
of the molecule to inhibit binding of CTLA4 to the CTLA4 ligand.
Suitable CTLA4 ligands for use in the screening assay include B7-1
or B7-2 (e.g., B7-1Ig or B7-2Ig fusion proteins can be used).
Preferably, either the unlabeled CTLA4-immunoglobulin fusion
protein or the unlabeled CTLA4 ligand is immobilized on a solid
phase support, such as a polystyrene plate or bead, to facilitate
removal of the unbound labeled protein from the bound labeled
protein.
[0116] C. Antibody Production
[0117] The CTLA4-immunoglobulin fusion proteins produced from the
nucleic acid molecules of the invention can also be used to produce
antibodies specifically reactive with the fusion protein and in
particular with the CTLA4 moiety thereof (i.e., anti-CTLA4
antibodies). For example, by immunization with a
CTLA4-immunoglobulin fusion protein, anti-CTLA4 polyclonal antisera
or monoclonal antibodies can be made using standard methods. A
mammal, (e.g., a mouse, hamster, or rabbit) can be immunized with
an immunogenic form of the fusion protein which elicits an antibody
response in the mammal. Techniques for conferring immunogenicity on
a protein include conjugation to carriers or other techniques well
known in the art. For example, the protein can be administered in
the presence of adjuvant. The progress of immunization can be
monitored by detection of antibody titers in plasma or serum.
Standard ELISA or other immunoassay can be used with the immunogen
as antigen to assess the levels of antibodies. An ELISA or other
immunoassay which distinguishes antibodies reactive with the CTLA4
portion of the fusion protein from those which react with the IgC
region are preferred (e.g., the extracellular domain of CTLA4 alone
can be used in a standard ELISA to detect anti-CTLA4
antibodies).
[0118] Following immunization, antisera can be obtained and, if
desired, polyclonal antibodies isolated from the sera. To produce
monoclonal antibodies, antibody producing cells (lymphocytes) can
be harvested from an immunized animal and fused with myeloma cells
by standard somatic cell fusion procedures thus immortalizing these
cells and yielding hybridoma cells. Such techniques are well known
in the art. Examples include the hybridoma technique originally
developed by Kohler and Milstein (Nature (1975) 256:495-497) as
well as other techniques such as the human B-cell hybridoma
technique (Kozbar et al., Immunol. Today (1983) 4:72), the
EBV-hybridoma technique to produce human monoclonal antibodies
(Cole et al. Monoclonal Antibodies in Cancer Therapy (1985) (Allen
R. Bliss, Inc., pages 77-96), and screening of combinatorial
antibody libraries (Huse et al., Science (1989) 246:1275).
Hybridoma cells can be screened immunochemically for production of
antibodies specifically reactive with CTLA4 and monoclonal
antibodies isolated.
[0119] The term antibody as used herein is intended to include
fragments thereof which are also specifically reactive with a
CTLA4-immunoglobulin fusion protein as described herein. Antibodies
can be fragmented using conventional techniques and the fragments
screened for utility in the same manner as described above for
whole antibodies. For example, F(ab').sub.2 fragments can be
generated by treating antibody with pepsin. The resulting
F(ab').sub.2 fragment can be treated to reduce disulfide bridges to
produce Fab' fragments. The term "antibody" is further intended to
include bispecific and chimeric molecules having an
anti-CTLA4-immunoglobulin fusion protein portion, chimeric antibody
derivatives, i.e., antibody molecules that combine a non-human
animal variable region and a human constant region, and humanized
antibodies in which parts of the variable regions, especially the
conserved framework regions of the antigen-binding domain, are of
human origin and only the hypervariable regions are of non-human
origin. Techniques for preparing chimeric or humanized antibodies
are well known in the art (see e.g., Morrison et al., Proc. Natl.
Acad. Sci. U.S.A. 81:6851 (1985); Takeda et al., Nature 314:452
(1985), Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al., U.S.
Pat. No. 4,816,397; Tanaguchi et al., European Patent Publication
EP171496; European Patent Publication 0173494, United Kingdom
Patent GB 2177096B, Teng et al., Proc. Natl. Acad. Sci. U.S.A.,
80:7308-7312 (1983); Kozbor et al., Immunology Today, 4:7279
(1983); Olsson et al., Meth. Enzymol., 92:3-16 (1982); PCT
Publication WO92/06193 and EP 0239400). Another method of
generating specific antibodies, or antibody fragments, reactive
against a CTLA4-immunoglobulin fusion protein is to screen
expression libraries encoding immunoglobulin genes, or portions
thereof, expressed in bacteria with a fusion protein produced from
the nucleic acid molecules of the invention. For example, complete
Fab fragments, V.sub.H regions, F.sub.V regions and single chain
F.sub.V regions can be expressed in bacteria using phage expression
libraries. See for example Ward et al., Nature, 341: 544-546:
(1989); Huse et al., Science, 246: 1275-1281 (1989); and McCafferty
et al., Nature, 348: 552-554 (1990). Screening such libraries with,
for example, a CTLA4-immunoglobulin fusion protein can identify
immunoglobin fragments reactive with the protein, in particular the
CTLA4 portion thereof.
[0120] An anti-CTLA4 antibody generated using the
CTLA4-immunoglobulin fusion proteins described herein can be used
therapeutically to inhibit immune cell activation through blocking
receptor:ligand interactions necessary for stimulation of the cell.
These so-called "blocking antibodies" can be identified by their
ability to inhibit T cell proliferation and/or cytokine production
when added to an in vitro costimulation assay as described herein.
The ability of blocking antibodies to inhibit T cell functions may
result in immunosuppression and/or tolerance when these antibodies
are administered in vivo.
[0121] D. Protein Purification
[0122] The CTLA4-immunoglobulin fusion proteins of the invention
can be used to isolate CTLA4 ligands from cell extracts or other
preparations. For example, a CTLA4-immunoglobulin fusion protein
can be used to immunoprecipitate B7-1, B7-2 or an as yet unknown
CTLA4 ligand from a whole cell, cytosolic or membrane protein
extract prepared from B cells or other antigen presenting cell
using standard techniques. Additionally, anti-CTLA4 polyclonal or
monoclonal antibodies prepared as described herein using a
CTLA4-immunoglobulin fusion protein as an immunogen can be used to
isolate the native CTLA4 antigen from cells. For example,
antibodies reactive with the CTLA4 portion of the
CTLA4-immunoglobulin fusion protein can be used to isolate the
naturally-occurring or native form of CTLA4 from activated T
lymphocytes by immunoaffinity chromatography using standard
techniques.
[0123] This invention is further illustrated by the following
examples which should not be construed as limiting. The contents of
all references and published patent applications cited throughout
this application are hereby incorporated by reference.
EXAMPLE 1
Preparation of CTLA4-Immunoglobulin Fusion Proteins with Reduced
Effector Function
[0124] The extracellular portion of the T cell surface receptor
CTLA4 was prepared as a fusion protein coupled to an immunoglobulin
constant region. The immunoglobulin constant region was genetically
modified to reduce or eliminate effector activity inherent in the
immunoglobulin structure. Briefly, DNA encoding the extracellular
portion of CTLA4 was joined to DNA encoding the hinge, CH2 and CH3
regions of human IgC.gamma.1 or IgC.gamma.4 modified by directed
mutagenesis. This was accomplished as follows:
[0125] Preparation of Gene Fusions
[0126] DNA fragments corresponding to the DNA sequences of interest
were prepared by polymerase chain reaction (PCR) using primer pairs
described below. In general, PCR reactions were prepared in 100
.mu.l final volume composed of Taq polymerase buffer (Gene Amp PCR
Kit, Perkin-Elmer/Cetus, Norwalk, Conn.) containing primers (1
.mu.M each). dNTPs (200 .mu.M each), 1 ng of template DNA, and Taq
polymerase (Saiki, R. K., et al. (1988) Science 239:487-491). PCR
DNA amplifications were run on a thermocycler (Ericomp, San Diego,
Calif.) for 25 to 30 cycles each composed of a denaturation step (1
minute at 94.degree. C.), a renaturation step (30 seconds at
54.degree. C.), and a chain elongation step (1 minute at 72.degree.
C.).
[0127] To create gene fusions encoding hybrid proteins, "zip up"
PCR was used. This procedure is diagrammed schematically in FIG. 1.
A first set of forward (A) and reverse (C) primers was used to
amplify the first gene segment of the gene fusion. A second set of
forward (B) and reverse (D) primers was used to amplify the second
gene segment of the gene fusion. Primers B and C were designed such
that they contained complimentary sequences capable of annealing.
The PCR products amplified by primers A+C and B+D are combined,
annealed and extended ("zipped up"). The full-length gene fusion
was then amplified in a third PCR reaction using the "zip up"
fragment as the template and primers A and D as the forward and
reverse primers, respectively.
[0128] The structure of each CTLA4 genetic fusion consisted of a
signal sequence, to facilitate secretion, coupled to the
extracellular domain of CTLA4 and the hinge, CH2 and CH3 domains of
human IgC.gamma.1 or IgC.gamma.4. The IgC.gamma.1 and IgC.gamma.4
sequences were modified to contain nucleotide changes within the
hinge region to replace cysteine residues available for disulfide
bond formation and to contain nucleotide changes in the CH2 domain
to replace amino acids thought to be required for IgC binding to Fc
receptors and complement activation. The hinge region and CH2
domain amino acid mutations introduced into IgC.gamma.1 and
IgC.gamma.4 are illustrated in FIGS. 2A and 2B, respectively.
[0129] A. Construction of CTLA4-Ig Fusion Genes
[0130] 1. Preparation of the Signal Sequence Gene Segment
[0131] PCR amplification was used to generate an immunoglobulin
signal sequence suitable for secretion of the CTLA4-Ig fusion
protein from mammalian cells. The Ig signal sequence was prepared
from a plasmid containing the murine IgG heavy chain gene
(described in Orlandi, R., et al. (1989) Proc. Natl. Acad. Sci. USA
86:3833-3837) using the oligonucleotide
5'CATTCTAGAACCTCGACAAGCTTGAGATCACAGTTCTCTCTAC-3' (SEQ ID NO: 1) as
the forward primer and the oligonucleotide
5'CAGCAGGCTGGGCCACGTGCATT GCGGAGTGGACACCTGTGGAGAG-3' (SEQ ID NO: 2)
as the reverse PCR primer. The forward PCR primer (SEQ ID NO: 1)
contains recognition sequences for restriction enzymes XbaI and
HindIII and is homologous to sequences 5' to the initiating
methionine of the Ig signal sequence. The reverse PCR primer (SEQ
ID NO: 2) is composed of sequences derived from the 5' end of the
extracellular domain of CTLA4 and the 3' end of the Ig signal
sequence. PCR amplification of the murine Ig signal template DNA
using these primers resulted in a 233 bp product which is composed
of XbaI and HindIII restriction sites followed by the sequence of
the Ig signal region fused to the first 25 nt of the coding
sequence of the extracellular domain of CTLA4. The junction between
the signal sequence and CTLA4 is such that protein translation
beginning at the signal sequence will continue into and through
CTLA4 in the correct reading frame.
[0132] 2. Preparation of the CTLA4 Gene Segment
[0133] The extracellular domain of the CTLA4 gene was prepared by
PCR amplification of plasmid phCTLA4. This plasmid contained the
sequences corresponding to the human CTLA4 cDNA (see Darivach, P.,
et al., (1988) Eur. J. Immunol. 18:1901 1905; Harper, K., et al.,
(1991) J. Immunol. 147: 1047-1044) inserted into the multiple
cloning site of vector pBluescript (Stratagene, La Jolla, Calif.)
and served as the template for a PCR amplification using the
oligonucleotide 5'-CTCTCCACAGGTGTCCACTCCGCA- ATGCACGTGG
CCCAGCCTGCTG-3' (SEQ ID NO: 3) as the forward PCR primer and the
oligonucleotide
5'-TGTGTGTGGAATTCTCATTACTGATCAGAATCTGGGCACGGTTCTG-3' (SEQ ID NO: 4)
as the reverse PCR primer. The forward PCR primer (SEQ ID NO: 3)
was composed of sequences derived from the 3' end of the Ig signal
sequence and the 5' end of the extracellular domain of CTLA4. This
PCR primer is the complementary to murine Ig signal reverse PCR
primer (SEQ ID NO: 2). The reverse PCR primer (SEQ ID NO: 4) was
homologous to the 3' end of the extracellular domain of CTLA4,
added a BclI restriction site and an additional G nucleotide at the
end of the extracellular domain. This created a unique BclI
restriction site and added a glutamine codon to the C-terminus of
the extracellular domain. The final PCR product was 413 bp.
[0134] 3. Fusion of the Immunoglobulin Signal Sequence and CTLA4
Gene Segments
[0135] The PCR fragments containing the signal and CTLA4 sequences
were joined together via a third PCR reaction. Both PCR fragments
(1 ng each) were mixed together along with the Ig signal forward
PCR primer (SEQ ID NO: 1) and the CTLA4 reverse PCR primer (SEQ ID
NO: 4) and PCR amplified as described. In this reaction, the 3' end
of the Ig signal fragment hybridizes with the 5' end of the CTLA4
fragment and the two strands are extended to yield a full length
600 bp fragment. Subsequent PCR amplification of this fragment
using forward (SEQ ID NO: 1) and reverse (SEQ ID NO: 4) yielded
sufficient amounts of the signal-CTLA4 gene fusion fragment for
cloning. This fragment contains a 5' XbaI and a 3' BclI restriction
sites flanking the Ig signalCTLA4 gene fusion segment for
subsequent cloning.
[0136] 4. Cloning of Immunoylobulin Constant Domain Gene
Segments
[0137] Plasmid pSP72IgG1 was prepared by cloning the 2000 bp
segment of human IgG1 heavy chain genomic DNA (Ellison, J. W., et
al., (1982) Nucl. Acids. Res. 10:4071-4079) into the multiple
cloning site of cloning vector pSP72 (Promega, Madison, Wis.).
Plasmid pSP72IgG1 contained genomic DNA encoding the CH1, hinge,
CH2 and CH3 domain of the heavy chain human IgC.gamma.1 gene. PCR
primers designed to amplify the hinge-CH2-CH3 portion of the heavy
chain along with the intervening genomic DNA were prepared as
follows. The forward PCR primer, 5'-GCATTTTAAGCTTTTTCCTGATCAGGAGCC
CAAATCTTCTGACAAAACTCACACATCTCCACCGTCTCC- AGGTAAGCC-3' (SEQ ID NO:
5), contained HindIII and BclI restriction sites and was homologous
to the hinge domain sequence except for five nucleotide
substitutions which changed the three cysteine residues to serines.
The reverse PCR primer, 5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO: 6),
was identical to the commercially available T7 primer (Promega,
Madison, Wis.). Amplification with these primers yielded a 1050 bp
fragment bounded on the 5' end by HindIII and BclI restriction
sites and on the 3' end by BamHI, SmaI, KpnI, SacI, EcoRI, ClaI,
EcoR5 and BglII restriction sites. This fragment contained the
IgC.gamma.1 hinge domain in which the three cysteine codons had
been replaced by serine codons followed by an intron, the CH2
domain, an intron, the CH3 domain and additional 3' sequences.
After PCR amplification, the DNA fragment was digested with HindIII
and EcoRI and cloned into expression vector pNRDSH (Repligen;
Cambridge, Mass. (diagrammed in FIG. 3)) digested with the same
restriction enzymes. This created plasmid pNRDSH/IgG1.
[0138] A similar PCR based strategy was used to clone the
hinge-CH2-CH3 domains of human IgC.gamma.4 constant regions. A
plasmid, p428D (Medical Research Council, London, England)
containing the complete IgC.gamma.4 heavy chain genomic sequence
(Ellison. J., et al., (1981) DNA 1: 11-18) was used as a template
for PCR amplification using oligonucleotide
5'GAGCATTTTCCTGATCAGGAGTCCAAATATGGTCCCCCACCCC
ATCATCCCCAGGTAAGCCAACCC-3' (SEQ ID NO: 7) as the forward PCR primer
and oligonucleotide 5'GCAGAGGAATTCGAGCTCGGTACCCGGGGATCCCCAGTGTGGGG
ACAGTGGGACCCGCTCTGCCTCCC-3- ' (SEQ ID NO: 8) as the reverse PCR
primer. The forward PCR primer (SEQ ID NO: 7) contains a BclI
restriction site followed by the coding sequence for the hinge
domain of IgC.gamma.4. Nucleotide substitutions have been made in
the hinge region to replace the cysteines residues with serines.
The reverse PCR primer (SEQ ID NO: 8) contains a PspAI restriction
site. PCR amplification with these primers results in a 1179 bp DNA
fragment. The PCR product was digested with BclI and PspAI and
ligated to pNRDSH/IgG1 digested with the same restriction enzymes
to yield plasmid pNRDSH/IgG4. In this reaction, the IgC.gamma.4
domain replaced the IgC.gamma.1 domain present in pNRDSH/IgG1.
[0139] 5. Modification of Immunoglobulin Constant Domain Gene
Segments
[0140] Modification of the CH2 domain in IgC to replace amino acids
thought to be involved in binding to Fc receptor was accomplished
as follows. Plasmid pNRDSH/IgG1 served as template for
modifications of the IgC.gamma.1 CH2 domain and plasmid pNRDSH/IgG4
served as template for modifications of the IgC.gamma.4 CH2 domain.
Plasmid pNRDSH/IgG1 was PCR amplified using a forward PCR primer
(SEQ ID NO: 5) and oligonucleotide 5'-GGGTTTT
GGGGGGAAGAGGAAGACTGACGGTGCCCCC TCGGCTTCAGGTGCTGAGGAAG-3' (SEQ ID
NO: 9) as the reverse PCR primer. The forward PCR primer (SEQ ID
NO: 5) has been previously described and the reverse PCR primer
(SEQ ID NO: 9) was homologous to the amino terminal portion of the
CH2 domain of IgG1 except for five nucleotide substitutions
designed to change amino acids 234, 235, and 237 from Leu to Ala,
Leu to Glu, and Gly to Ala, respectively (Canfield, S. M. and
Morrison, S. L. (1991) J. Exp. Med. 173: 1483-1491; see FIG. 2A).
Amplification with these PCR primers will yield a 239 bp DNA
fragment consisting of a modified hinge domain, an intron and
modified portion of the CH2 domain.
[0141] Plasmid pNRDSH/IgG1 was also PCR amplified with the
oligonucleotide
5'-CATCTCTTCCTCAGCACCTGAAGCCGAGGGGGCACCGTCAGTCTTCCTCTTCCC CC-3'
(SEQ ID NO: 10) as the forward primer and oligonucleotide (SEQ ID
NO: 6) as the reverse PCR primer. The forward PCR primer (SEQ ID
NO: 10) is complementary to primer (SEQ ID NO: 9) and contains the
five complementary nucleotide changes necessary for the CH2 amino
acid replacements. The reverse PCR primer (SEQ ID NO: 6) has been
previously described. Amplification with these primers yields a 875
bp fragment consisting of the modified portion of the CH2 domain,
an intron, the CH3 domain, and 3' additional sequences.
[0142] The complete IgC.gamma.1 segment consisting of modified
hinge domain, modified CH2 domain and CH3 domain was prepared by an
additional PCR reaction. The purified products of the two PCR
reactions above were mixed, denatured (95.degree. C., 1 minute) and
then renatured (54.degree. C., 30 seconds) to allow complementary
ends of the two fragments to anneal. The strands were filled in
using dNTP and Taq polymerase and the entire fragment amplified
using forward PCR primer (SEQ ID NO: 5) and reverse PCR primer (SEQ
ID NO: 6). The resulting fragment of 1050 bp was purified, digested
with HindIII and EcoRI and ligated to pNRDSH previously digested
with the same restriction enzymes to yield plasmid
pNRDSH/IgG1m.
[0143] Two amino acids at immunoglobulin positions 235 and 237 were
changed from Leu to Glu and Gly to Ala, respectively within the
IgC.gamma.4 CH2 domain to eliminate Fc receptor binding (see FIG.
2B). Plasmid pNRDSH/IgG4 was PCR amplified using the forward primer
(SEQ ID NO: 7) and the oligonucleotide 5'CGCACGTGACCTCAGGGGTCCGGG
AGATCATGAGAGTGTCCTTGGGTTTTGGGGGGAACAGGAAGACTGATG
GTGCCCCCTCGAACTCAGGTGCTG- AGG-3' (SEQ ID NO: 11) as the reverse
primer. The forward primer has been previously described and the
reverse primer was homologous to the amino terminal portion of the
CH2 domain, except for three nucleotide substitutions designed to
replace the amino acids described above. This primer also contained
a PmlI restriction site for subsequent cloning. Amplification with
these primers yields a 265 bp fragment composed of the modified
hinge region, and intron, and the modified 5' portion of the CH2
domain.
[0144] Plasmid pNRDSH/IgG4 was also PCR amplified with the
oligonucleotide
5'-CCTCAGCACCTGAGTTCGAGGGGGCACCATCAGTCTTCCTGTTCCCCCC
AAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTGAGGTCACGTGCG-3' (SEQ ID NO:
12) as the forward primer and oligonucleotide (SEQ ID NO: 8) as the
reverse PCR primer. The forward PCR primer (SEQ ID NO: 12) is
complementary to primer (SEQ ID NO: 11) and contains the three
complementary nucleotide changes necessary for the CH2 amino acid
replacements. The reverse PCR primer (SEQ ID NO: 8) has been
previously described. Amplification with these primers yields a
1012 bp fragment consisting of the modified portion of the CH2
domain, an intron, the CH3 domain, and 3' additional sequences.
[0145] The complete IgC.gamma.4 segment consisting of modified
hinge domain, modified CH2 domain and CH3 domain was prepared by an
additional PCR reaction. The purified products of the two PCR
reactions above were mixed, denatured (95.degree. C., 1 minute) and
then renatured (54.degree. C., 30 seconds) to allow complementary
ends of the two fragments to anneal. The strands were filled in
using dNTP and Taq polymerase and the entire fragment amplified
using forward PCR primer (SEQ ID NO: 7) and reverse PCR primer (SEQ
ID NO: 8). The resulting fragment of 1179 bp was purified digested
with BclI and PspAI and ligated to pNRDSH previously digested with
the same restriction enzymes to yield plasmid pNRDSH/IgG4m.
[0146] 6. Assembly of CTLA4-Immunoglobulin Fusion Genes
[0147] The PCR fragment corresponding to the Ig signal-CTLA4 gene
fusion prepared as described above (sections 1-3) was digested with
HindIII and BclI restriction enzymes and ligated to pNRDSH/IgG1,
pNRDSH/IgG1m, pNRDSH/IgG4, and pNRDSH/IgG4m previously digested
with the same restriction enzymes to create expression plasmids in
which the signal-CTLA4-IgG gene fusion segment is placed under the
control of the CMV promoter. The ligated plasmids were transformed
into E. coli JM109 using CaCl.sub.2 competent cells and
transformants were selected on L-agar containing ampicillin (50
.mu.g/ml; as described in Molecular Cloning: A Laboratory Manual
(1982) Eds. Maniatis, T., Fritsch, E. E., and Sambrook, J. Cold
Spring Harbor Laboratory). Plasmids isolated from the transformed
E. coli were analyzed by restriction enzyme digestion. Plasmids
with the expected restriction pattern were sequenced to verify all
portions of the signal-CTLA4-IgG gene fusion segments. The final
plasmids were named pNRDSH/sigCTLA4-IgG1, pNRDSH/sigCTLA4-IgG1m,
pNRDSH/sigCTLA4-IgG4 and pNRDSH/sigCTLA4-IgG4m. The
signal-CTLA4-IgG gene fusion segments from each of these constructs
were also transferred to the pEE12 expression vector (Biotechnology
(1992) 10:169-175).
[0148] The nucleotide and predicted amino acid sequences of the
signal-CTLA4-IgG gene fusion segments are shown in the Sequence
Listing as follows: sigCTLA4-IgGm--SEQ ID NOS: 23 and 24,
sigCTLA4-IgG4--SEQ ID NOS: 25 and 26 and sigCTLA4-IgG4m--SEQ ID
NOS: 27 and 28.
[0149] B. Construction of a CTLA4Ab Fusion Gene
[0150] The extracellular domain of CTLA4 is an immunoglobulin
superfamily member and is responsible for binding to its ligands
B7-1 and B7-2. The replacement of the heavy and light chain
variable domains of an antibody molecule with the extracellular
domain of CTLA4 will result in an antibody-like protein which can
bind specifically to B7-1, B7-2 and other CTLA4 ligands with high
affinity. The construction of such a molecule using human IgG1
antibody heavy and light chains is described below.
[0151] 1. Construction of the Heavy Chain Gene
[0152] The Ig signal sequence was prepared from template plasmid
pSP72IgG1 by PCR amplification using oligonucleotide
5'CATTCGCTTACCTCGACAAGCTTGAGAT- CAC AGTTCTCTCTAC-3' (SEQ ID NO: 13)
as the forward PCR primer and oligonucleotide
5'-GGAGTGGACACCTGTGGAGAG-3' (SEQ ID NO: 14) as the reverse primer.
The forward PCR primer (SEQ ID NO: 13) contains a HindIII
restriction site and part of the 5' untranslated segment of the Ig
signal domain. The reverse PCR primer (SEQ ID NO: 14) corresponds
to the C-terminus of the natural Ig signal peptide. Amplification
with these primers resulted in a 208 bp fragment encoding the
entire Ig signal sequence.
[0153] The CTLA4 extracellular domain was prepared from plasmid
phCTLA4, which contained the entire CTLA4 cDNA sequences by PCR
amplification using oligonucleotide
5'-CTCCACAGGTGTCCACTCCGCAATGCACGTGGCCCAGCC-3' (SEQ ID NO: 15) as
the forward PCR primer and oligonucleotide
5'GAGGTTGTAAGGACTCACCTGAAA TCTGGGCTCCGTTGC-3' (SEQ ID NO: 16) as
the reverse primer. The forward primer (SEQ ID NO: 15) contained
sequences homologous to the 5' end of the CTLA4 extracellular
domain and to the 3' end of the Ig signal domain. The reverse
primer (SEQ ID NO: 16) contained the 3' end of the CTLA4
extracellular domain and intervening sequences, including a splice
acceptor site. Amplification with these primers yielded a 379 bp
fragment containing the CTLA4 extracellular domain.
[0154] An intervening sequence DNA fragment derived from the intron
between the antibody variable and constant (CH1) domains was
prepared by PCR amplification using oligonucleotide
5'GCAACGGAGCCCAGATTTCAGGTGAGTCCTT- ACAACCTC-3' (SEQ ID NO: 17) as
the forward PCR primer and oligonucleotide 5'GGCTAGATATCTCTAGACT
ATAAATCTCTGGCCATGAAG-3' (SEQ ID NO: 18) as the reverse PCR primer.
The forward PCR primer (SEQ ID NO: 17) contains intron sequence and
is complementary to the 3' end of the extracellular domain of CTLA4
and is complimentary to the CTLA4 reverse PCR primer (SEQ ID NO:
16). The reverse primer (SEQ ID NO: 18) contains intron sequences
and an additional XbaI restriction site. Amplification with these
primers yields a 197 bp fragment.
[0155] The PCR fragments encoding the Ig signal, CTLA4
extracellular domain and the intervening sequence were mixed,
denatured and renatured to allow hybridization of complementary
ends. The strands were filled in and the product amplified using
forward (SEQ ID NO: 13) and reverse (SEQ ID NO: 18) PCR primers.
The product was a 764 bp fragment which encoded the Ig signal, the
CTLA4 extracellular domain, an intron sequence flanked by HindIII
and XbaI restriction sites. This DNA fragment was digested with
HindIII and XbaI and ligated to pSP72IgG1, resulting in the CTLA4
extracellular domain being linked to a 5' Ig signal sequence and a
3' antibody CH1, hinge, CH2, and CH3 domains.
[0156] The nucleotide and predicted amino acid sequences of the
assembled CTLA4-heavy chain are shown in SEQ ID NOS: 29 and 30,
respectively.
[0157] 2. Construction of the Light Chain Gene
[0158] The replacement of a human immunoglobulin antibody light
chain variable domain (Hieter, P. A., et al., (1980) Cell 22:197)
with the CTLA4 extracellular domain proceeded as follows. The Ig
signal fragment was prepared as for the heavy chain replacement,
described above. The CTLA4 extracellular domain was prepared using
a forward PCR primer (SEQ ID NO: 15) previously described and
oligonucleotide 5'GGCACTAGGTCGACTCTAGAAA
CTGAGGAAGCAAAGTTTAAATTCTACTCACGTTTAATCTGGGCTCCGT- TGC-3' (SEQ ID
NO: 19) as the reverse primer. The reverse primer contained
sequences of the 3' end of the CTLA4 extracellular domain, a splice
receptor, and intervening sequence DNA containing an XbaI
restriction site. The Ig signal fragment and the CTLA4
extracellular domain were joined by mixing the DNA fragment,
denaturing, and renaturing to anneal their complementary ends. The
strands were filled in and the fragment PCR amplified using forward
(SEQ ID NO: 13) and reverse (SEQ ID NO: 19) PCR primers previously
described. The resulting DNA fragment was digested with the HindIII
and XbaI and ligated to immunoglobulin light chain vector
p.alpha.LYS17 digested with the same enzymes. The resulting plasmid
pCTLA4kappa contains an Ig signal sequence, an intron, the CTLA4
extracellular domain, an intron, and the light chain (kappa)
constant domain.
[0159] The nucleotide and predicted amino acid sequences of the
assembled CTLA4-light chain are shown in SEQ ID NOS: 31 and 32,
respectively.
[0160] The DNA segments encoding the recombinant heavy and light
chains were transferred to the pEE12 vector or the pNRDSH vector
and stable NSO or CHO expression cell lines established as
described below. CHO and NSO supernatants were assayed for the
production of CTLA4 light chain and CTLA4 heavy chain fusion
proteins by ELISA and binding to B7-1 was measured using CHO/hB7-1
expressing cells and FACS (as described in Example 2). It is also
contemplated that the heavy and light chain constructs of the
present invention be expressed in the same vector and host cells
transfected in one step.
[0161] C. Expression of CTLA4 Fusion Proteins in CHO and NSO
cells
[0162] The various CTLA4-immunoglobulin fusion proteins were
expressed in CHO cells as follows. Briefly, 5.times.10.sup.5
CHO-DG44 cells (subline of CHO-K1, available from ATCC) were
transfected with 10 .mu.g of the appropriate expression plasmid
(pNRDSH series) by the calcium phosphate method (described in
Molecular Cloning: A Laboratory Manual (1982) Eds. Maniatis, T.,
Fritsch, E. E., and Sambrook, J. Cold Spring Harbor Laboratory)
using a commercially available kit (5 Prime to 3' Prime Inc.,
Boulder, Colo.) according to the manufacturer's instructions. The
transfected cells were allowed to recover in nonselective media
(alpha MEM medium containing 10% heat inactivate fetal bovine serum
(FBS), Gibco/BRL, Gaithersburg, Md.) for two days and then plated
in selective media (alpha MEM minus nucleoside medium containing
10% FBS and 550 .mu.g/ml G418; Gibco/BRL, Gaithersburg, Md.).
Individual subclones were obtained by dilution cloning in selective
media. Culture media was assayed for the presence of secreted
CTLA4-immunoglobulin by a standard ELISA designed to detect human
IgG.
[0163] The various CTLA4-immunoglobulin and CTLA4Ab fusion proteins
were expressed in NSO cells (Golfre, G. and Milstein C.P. (1981)
Methods Enzymol. 73B: 3-46) as follows. Briefly, 10.sup.7 NSO cells
were transfected by electroporation (using a BioRad Gene Pulser,
Hercules, Calif.) with 40 .mu.g of the appropriate expression
plasmid (pEE12 series) previously linearized by digestion with SalI
restriction endonuclease. The transfected cells were selected using
DMEM media deficient in glutamine (Gibco/BRL, Gaithersberg Md.).
Individual subclones were isolated by dilution cloning in selective
media. Culture media assayed for the presence of secreted CTLA4-Ig
or CTLA4Ab fusion protein by a standard ELISA assay designed to
detect human IgG.
[0164] As a representative example, transfection of either the
pNRDSH/sigCTLA4-IgG4m and pEE12/sigCTLA4-IgG4m expression vector
into CHO or NSO host cells resulted in selected subclones that
secreted hCTLA4IgG4m fusion protein into culture supernatants at a
concentration of 75-100 .mu.g/ml.
[0165] D. Purification of CTLA4 Fusion Proteins
[0166] The CTLA4-Ig and CTLA4Ab fusion proteins are purified from
the culture medium of transfected CHO or NSO cells as follows.
Culture medium was concentrated 10 fold by ultra filtration
(Ultrasette, Filtron Technology Corp., Northborough, Mass.) and
batch bound overnight to immobilized protein A (IPA-300, Repligen
Corp., Cambridge, Mass.). The protein-bound resin was poured into a
chromatography column, washed with 10 column volumes of optimal
binding buffer (1.5 M glycine, 3M NaCl, pH 8.9) and the bound
CTLA4-Ig or CTLA4Ab was eluted by the addition of 0.1 M Na citrate,
pH 3.0. Fractions were collected and neutralized with the addition
of 1 M Tris base to pH of 7.0. The Abs.sub.280 nm was monitored for
each fraction and peak fractions were analyzed by SDS-PAGE,
followed by Coomassie Blue staining and Western blot analysis using
an anti-CTLA4 polyclonal antiserum (described in Lindsten, T. et
al. (1993) J. Immunol. 151:3489-3499). Fractions containing
CTLA4-Ig or CTLA4Ab were pooled and dialyzed against 200 volumes of
0.5.times.PBS overnight at 4.degree. C. The purified protein was
assayed for binding to its ligand (B7-1 and/or B7-2) as described
in Example 2.
EXAMPLE 2
Characterization of CTLA4 Fusion Proteins
[0167] The ability of the various CTLA4-Ig forms and CTLA4Ab to
bind to their counter receptors B7-1 (Freeman, G. F., et al. (1988)
J. Immunol. 143:2714-2722) and B7-2 (Freeman, G. F., et al., (1993)
Science 262: 909-911) was demonstrated using the following
assays.
[0168] A. Fluorescence Activated Cell Staining (FACS).
[0169] Purified preparations of the various recombinant CTLA4 forms
were tested for their ability to bind to transfected COS cell
transiently expressing hB7-1 or hB7-2 or transfected CHO cells
stably expressing hB7-1 or hB7-2. The recombinant CTLA4 protein (10
.mu.g/ml) was incubated with B7 expressing cells (2.times.10.sup.6
cells) for 1 hr on ice in FACS wash solution (1% bovine serum
albumin in PBS). The cells were washed 3 times with FACS wash
solution. The cell bound CTLA4 was detected by reaction with
anti-human Ig-FITC (Dako Corporation, Carpintera, Calif.) or
protein A-FITC (Dako) for 30 mintues on ice in the dark. The cells
were washed twice with FACS wash solution and then fixed in 1%
paraformaldehyde in PBS. The cells were analyzed for fluorescence
intensity using a Becton Dickinson (San Jose, Calif.) FACS
analyzer. Murine anti-human mAbs reactive with either hB7-1 or
hB7-2 served as positive control reagents for the hB7-1 and hB7-2
receptor expressing cells. These mAbs were detected using goat
anti-murine IgG-FITC (Dako corporation, Carpintera, Calif.) and
analyzed as above. Untransfected COS and CHO cells served as
negative controls for each cell line. The results of this
experiment demonstrated that CTLA4 immunoglobulin fusion proteins
bind to CHO cells transfected to express CTLA4 ligands.
[0170] B. Competitive Binding ELISA
[0171] The ability of the various recombinant CTLA4 forms to bind
to hB7-1 or hB7-2 was assessed in a competitive binding ELISA
assay. This assay was established as follows. Purified recombinant
hB7-Ig (50 .mu.l at 20 .mu.g/ml in PBS) was bound to a Costar
EIA/RIA 96 well microtiter dish (Costar Corp, Cambridge Mass., USA)
overnight at room temperature. The wells were washed three times
with 200 .mu.l of PBS and the unbound sites blocked by the addition
of 1% BSA in PBS (200 .mu.l/well) for 1 hour at room temperature.
The wells were washed again as above. Biotinylated hCTLA4-IgG1
(prepared according to manufacturers instructions (Pierce,
Rockford, Ill.) at 10 .mu.g/ml serially diluted in twofold steps to
15.6 ng/ml: 50 .mu.l/well) was added to each well and incubated for
2.5 hours at room temperature. The wells were washed again as
above. The bound biotinylated hCTLA4IgG1 was detected by the
addition of 50 .mu.l of a 1:2000 dilution of streptavidin-HRP
(Pierce Chemical Co., Rockford, Ill.) for 30 minutes at room
temperature. The wells were washed as above and 50 .mu.l of ABTS
(Zymed, Calif.) added and the developing blue color monitored at
405 nm after 30 min.
[0172] The ability of the various forms of CTLA4 to compete with
biotinylated CTLA4-IgG1 was assessed by mixing varying amounts of
the competing protein with a quantity of biotinylated CTLA4-IgG1
shown to be non-saturating (i.e., 70 ng/ml; 1.5 nM) and performing
the binding assays as described above. A reduction in the signal
(Abs.sub.405 nm) expected for biotinylated CTLA4-IgG1 indicated a
competition for binding to plate-bound hB7-1 or hB7-2. A graphic
representation of a typical binding assay illustrating the
competition of biotinylated hCTLA4-IgG1 with hCTLA4-IgG1 (itself)
or hCTLA4-IgG4m is shown in FIG. 4A for binding to hB7-1 and FIG.
4B for binding to hB7-2. The competition curves show that the
mutant IgG4 form competes with hCTLA4-IgG1 for binding to B7-1 or
B7-2 with the same binding kinetics as the unlabeled IgG1 form
itself. Accordingly, mutation of the hinge region and CH2 domain of
IgC.gamma.4 in the CTLA4 fusion protein as described herein does
not detrimentally affect the ligand binding activity of the CTLA4
fusion protein.
[0173] C. SDS-PAGE and Western Blotting
[0174] The various CTLA4 forms were analyzed by SDS-PAGE followed
by detection using Coomassie Blue staining or Western blotting. The
CTLA4 proteins were separated on both reducing and non-reducing
SDS-PAGE gels (9, 12, or 15% gels with 5% stacking gel) and stained
with Coomassie Blue using standard methods. Protein size was
estimated from comparison to commercial size standards (BioRad,
Hercules, Calif.). Western blots were performed using standard
procedures and Immobilon blotting membranes (Millipore, New
Bedford, Mass.). The CTLA4 was detected using a polyclonal antisera
raised in rabbit immunized with the extracellular domain of CTLA4
produced in E. coli (described in Lindsten, T. et al. (1993) J.
Immunol. 151:3489-3499). The CTLA4 was visualized using
[.sup.125I]-protein A (Dupont NEN, Boston, Mass.) followed by
autoradiography or using protein A-HRP. The results indicated the
presence of an immunoreactive band at approximately 50 kD.
[0175] D. Measurement of Fc Receptor Binding
[0176] The binding of the various CTLA4-Ig forms and CTLA4Ab to Fc
receptors was assessed by using a competitive binding assay as
described in Alegre, M.-L., et al., (1992) J. Immunol. 148:3461
3468. Human cell line U937 was used as a source of the FcRI and
FcRII receptors (Looney, R. J., et al., (1986) J. Immunol.
136:1641). U937 cells were grown with 500 U/ml IFN-.gamma. to
upregulate expression of FcR1. The U937 cells were used at a
concentration of 6.25.times.10.sup.6 cells/ml. Preparations of
unlabeled CTLA4-IgG1, CTLA4-IgG4 and human IgG1 were serially
diluted to a concentration of 2.times.10.sup.-10 M. To each serial
dilution, a fixed amount of .sup.125I-labeled protein (e.g.,
CTLA4-IgG1, CTLA4-IgG4 or human IgG1) was added. The U937 cells
were then added to the mixture and incubated for three hours. The
cells were separated from unbound labeled and unlabeled protein by
centrifugation through silicone oil for one minute at
14000.times.g. The tips of the tubes with the pelleted cells were
then cut off and analyzed in a gamma counter. Maximal binding of
labeled protein to U937 cells was determined in the absence of
unlabeled competitor protein. Percent specific activity represents
the percentage of labeled protein bound in the presence of
unlabeled competitor protein relative to maximal binding. FIG. 5A
graphically illustrates the amount of labeled CTLA4-IgG1 bound to
U937 cells (expressed in counts per minute) in the presence of
unlabeled CTLA4-IgG1 or CTLA4-IgG4. Unlabeled CTLA4-IgG1 was able
to compete with labeled CTLA4-IgG for binding to FcRI on U937 cells
(i.e., the amount of bound labeled protein was reduced), whereas
unlabeled CTLA4-IgG4 did not compete for binding. FIG. 5B
graphically illustrates the percent specific activity of labeled
human IgG1, CTLA4-IgG1 and CTLA4-IgG4 being competed with
themselves (unlabeled). The IC.sub.50 for human IgG1 was
approximately 7.5.times.10.sup.-8 M. The IC.sub.50 for CTLA4-IgG1
was approximately 7.times.10.sup.-8 M. An IC.sub.50 for CTLA4-IgG4
could not be determined because this protein did not bind to the
FcRI. These results demonstrate that use of an IgC.gamma.4 constant
region in a CTLA4-Ig fusion protein essentially eliminates the
ability of the fusion protein to bind to Fc receptors.
[0177] E. Measurement of Complement Activation
[0178] CTLA4-immunoglobulin forms were tested in a ligand-specific
assay for complement activation. CHO cells expressing hB7-1 on
their surface were grown to confluence in tissue culture dishes.
After washing away serum and medium, the cells were exposed to
BCECF/AM ([2',7-bis-(carboxyethyl)-5,(6')-carboxylfluorescein
acetoxymethyl)-ester] Calbiochem, La Jolla, Calif.) a fluorescent
dye that irreversibly loads into the cells. The cells
(5.times.10.sup.5) were then incubated with hCTLA4-immunoglobulin
fusion proteins or a monoclonal antibody specific for hB7-1 (4B2).
Unbound protein was washed away and a complement source was added
and allowed to react with the cells for 30 minutes. Complement
sources tested included guinea pig complement and human serum (as a
source of human complement). After incubation with the complement
source, lysis was measured by monitoring the release of the
fluorescent dye from the cells using a fluorometer. Controls
included parallel experiments with hB7-1 negative CHO cells.
Identical cultures were also tested for their ability to bind the
hCTLA4 forms under similar assay conditions. Additionally, to
distinguish a lack of an ability to activate complement from a lack
of an ability to bind B7-1, an ELISA-type assay of CTLA4 binding to
CHO-B7-1 cells was performed as a control (described further
below).
[0179] The results of typical complement activation assays are
shown in FIGS. 6A-C. FIG. 6A graphically illustrates guinea pig
complement-mediated lysis of CHO-B7-1 cells by CTLA4-IgG1,
CTLA4-IgG4m and the anti-B7-1 monoclonal antibody 4B2. hCTLA4-IgG1
reproducibly activated guinea pig complement as well or better than
the 4B2 mAb. The hCTLA4-IgG4m did not activate complement in this
assay, even at concentration 100-fold higher than that needed for
CTLA4-IgG1. The results were confirmed by repeating the work with
human serum as the complement source, shown in FIG. 6B. Human
complement produced a higher percentage lysis than the guinea pig
complement, however, otherwise the results were the same, with the
hCTLA4-IgG4m exhibiting a markedly reduced ability to activate
complement in comparison to CTLA4-IgG1. The effect of the CTLA4
fusion proteins on complement activation is specific for the B7-1
ligand, as untransfected CHO cells were not substrates for
complement activation by any of the proteins tested, illustrated in
FIG. 6C (using guinea pig complement as the complement source).
[0180] In order to verify that the hCTLA4-IgG4m form was still able
to bind to membrane bound hB7-1, an experiment was performed by a
similar method as for the complement activation study. Antibody or
hCTLA4 forms were bound to washed CHO-B7-1 cells under conditions
identical to those used in the complement activation studies except
that instead of adding complement in the final step, an
HRP-conjugated anti-Ig Fc (Calbiochem, La Jolla, Calif.) was used.
Bound HRP was detected by washing the cells, adding ABTS substrate
and measuring absorbence at 405 nm (as described above for the
competition ELISA assay). The results are shown graphically in FIG.
7. All three B7-1 specific proteins (mAb 4B2. hCTLA4-IgG1 and
hCTLA4-IgG4m) bound to the cells. The corresponding experiment
using untransfected CHO cells showed no binding of the proteins to
the cells. The difference in the maximal O.D. signals for the
different proteins is likely due to the different affinities of the
forms of Fc regions for the HRP-conjugated secondary
antibodies.
[0181] F. Inhibition of T Cell Proliferation
[0182] The ability of the CTLA4-Ig forms and CTLA4Ab to inhibit the
proliferation of T cells in a costimulation proliferation assay was
measured. CD4.sup.+ T cells are prepared from human blood by
density gradient centrifugation on Ficoll-Hypaque (Sigma, St.
Louis, Mo.). Monocytes were removed by adherence to plastic and the
CD4.sup.+ cells further enriched by removal of residual monocytes,
B cells, NK cells and CD8+ T cells by lysis with complement and
mAbs (anti-CD14, antiCD11b, anti-CD20, anti-CD16 and anti-CD8) or
by negative selection using the same immunomagnetic beads (Advanced
Magnetics, Cambridge, Mass.) (as described in Boussioutis, V. A.,
et al., (1993) J. Exp. Med. 178:1758-1763). CD4.sup.+ T cells
(10.sup.5) were cultured in the presence of immobilized anti-CD3
mAb (coated at 1 ug/well, overnight) and CHO cells expressing hB7-1
or hB7-2 (2.times.10.sup.4) in a microtiter plate with or without
one of the CTLA4 forms and incubated for 3 days. Thymidine
incorporation as a measure of mitogenic activity was assessed after
overnight incubation in the presence of [.sup.3H] thymidine (Gimmi,
C. D., et al., (1991) Proc. Natl. Acad. Sci USA 88:6575-6579).
Inhibition was calculated as a percent of proliferation in control
cultures. The data show that both the CTLA4IgG1 and CTLA4Ig4m
performed well, inhibiting T cell proliferation to the same extent
when used in equivalent amounts, i.e. the two compounds were
indistinguishable in potentcy.
[0183] G. Pharmacokinetic Studies
[0184] The effect of mutating the IgG4 heavy chain, as described
herein, on the pharmacokinetics of a CTLA4Ig in rats was examined.
Pharmacokinetics were performed on two CTLA4If differing only in
their heavy chain constant domains, where one form contained the
wild type human IgG1Ig (referred to as hCTLA4IgG1) and the second
antibody contained the mutated version of human IgG4 (referred to
as hCTLA4IgG4m). Two Sprague-Dawley male rats weighing 0.3-0.4 kg
were used for each protein. The CTLA4Ig forms were infused at a
dose of 2 mg/kg via a Teflon angiocath which was placed in the
marginal ear vein. Two control animals received an infusion of PBS
(Ca.sup.++Mg.sup.++ free) in the same manner. Blood samples were
drawn at 0, 15, 30, 60, 90, 360, 480 minutes, 24, 36, 48 hours, 7,
14 and 28 days. The concentration of free antibody in heparinized
plasma was determined by a standard ELISA. Antibody clearance rates
were determined, .alpha. and .beta. t1/2 values were calculated
using the P-Fit subroutine of the BIOSOFT Fig-p figure
processor/parameter fitter. The results are shown below:
[0185] hCTLA4IgG1
[0186] .alpha. t1/2=4.2 min
[0187] .beta. t1/2=288 min
[0188] hCTLA4IgG4m
[0189] .alpha. t1/2=16.6 min
[0190] .beta. t 1/2=214.2 min
[0191] Both CTLA4IgG1 and CTLA4IgG4m have similar clearance rates,
with a rapid (4-16 min) .alpha. phase and a more prolonged (214-288
min) .beta. phase indicating a serum half life of approximately 4
hours.
EXAMPLE 3
Preparation of E. coli-Expressed Human CTLA4
[0192] A. Intracellular Expression of CTLA4 in E. coli
[0193] 1. Cloning and Expression of CTLA4 Extracellular Domain
[0194] The extracellular domain of CTLA4 was expressed in E. coli
after cloning into expression vector pETCm11a. This vector was
derived from expression vector pET-11a (Novagen Inc., Madison Wis.)
by cloning a chloramphenicol resistance gene cassette into the ScaI
restriction site within the ampicillin resistance gene. The
extracellular domain of CTLA4 was prepared from plasmid phCTLA4 by
PCR amplification using oligonucleotide 5'GCAGAGAGACAT
ATGGCAATGCACGTGGCCCAGCCTGCTGTGG-3' (SEQ ID NO: 20) as forward
primer and oligonucleotide 5'-GCAGAGAGAGGATCCTCAGTCAGT- TAGT
CAGAATCTGGGCACGGTTCTGG-3' (SEQID NO: 21) as reverse primer. The
forward PCR primer (SEQ ID NO: 20) contains an NdeI restriction
site in which the ATG sequence in the NdeI restriction site is
followed immediately by the codon for the first amino acid of
mature CTLA4 (Dariavach, P., et al. (1988) Eur. J. Immunol.
18:1901). The reverse PCR primer (SEQ ID NO: 21) contains a BamHI
restriction site preceded by translation stop codons in all three
reading frames preceded by the last amino acid just prior to the
CTLA4 transmembrane domain. PCR amplification with these primer
yields a 416 bp fragment bounded by NdeI and BamHI restriction
sites which contains DNA sequences encoding the extracellular
domain of CTLA4 preceded by a methionine codon. The PCR product was
digested with NdeI plus BamHI and ligated to expression vector
pETCm11a digested with the same restriction enzymes.
[0195] The ligated DNA was transfected into E. coli strains BL21,
HMS174, RGN714 and RGN715 containing the lambda DE3 helper phage by
standard techniques. Transformants were selected in L-agar
containing chloramphenicol at 50 ug/ml. Individual transformants
were selected and tested for CTLA4 expression after induction by
treatment of cells with 0.5 mM IPTG. Whole cell extracts were
analyzed on SDS-PAGE gel followed by Coomassie Blue staining and
Western blot analysis. The majority of the CTLA4 protein in these
cells was found in inclusion bodies.
[0196] 2. Purification of CTLA4 from Inclusion Bodies
[0197] Recombinant CTLA4 was recovered from cell pellets by
treating the washed cells in lysis buffer (50 mM Tris-HCl pH 8.0, 1
mM PMSF, 5 mM EDTA, 0.5% Triton X-100, and lysozyme at 0.3 mg/ml)
followed by sonication. The inclusion bodies were recovered by
centrifugation at 20,000.times.g and solubilized by treatment with
solubilization buffer (50 mM Tris-HCl pH8.0, 8 M urea, 50 mM
2-mercaptoethanol (2-ME)). The solubilization was assisted by
mixing for two hours at room temperature. The soluble fraction
contained CTLA4. The CTLA4 was purified by chromatography on
S-sepharose (Pharmacia, Piscataway, N.J.) as follows. The CTLA4
containing supernatant was adjusted to pH 3.4 by the addition of
glacial acetic and applied to a S-sepharose column equilibrated in
column buffer (100 mM Na-acetate, pH6.5, 8 M urea, 50 mM 2-ME, and
5 mM EDTA). The column was washed with column buffer and the bound
CTLA4 eluted with a linear salt gradient (NaCl, 0 to 1 M) prepared
in column buffer. Peak fractions exhibiting high Abs.sub.280 nm
values were pooled and dialyzed against dialysis buffer (100 mM
Tris-HCl, pH8.0, 8 M urea, 50 mM, 2-ME, 5 mM EDTA). Remaining
contaminating proteins were eliminated by chromatography on a
Sephacryl S-100 (Pharmacia, Piscataway, N.J.) sizing column. The
resulting preparation was greater than 95% pure CTLA4 as estimated
by SDS-PAGE followed by Coomassie Blue staining and Western blot
analysis. Since the estimated size of monomeric recombinant CTLA4
produced in E. coli was approximately 15 kDa, all steps of the
purification protocol were tested for the presence of a 15 kDa
protein by SDS-PAGE and the presence of CTLA4 verified by Western
blotting.
[0198] 3. Refolding of Denatured CTLA4
[0199] The CTLA4 protein purified from inclusion bodies is fully
reduced and denatured and must be properly refolded in a
physiological buffer, with intact disulfide bridges. to be in
"active" form (i.e., able to bind hB7-1). To avoid solubility
problems a step gradient dialysis procedure was used to remove
urea, detergents and reductants. The most successful refolding was
obtained when the secondary and tertiary protein structure was
encouraged first, by gradient dialysis, removing all urea and
detergent while in the presence of the reductant DTT. Subsequent
slow removal of the DTT appeared to reduce the number of random
intradisulfide bonds. As a control, a sample of CTLA4 was dialyzed
directly from gel filtration buffer to PBS.
[0200] The success of refolding was estimated by
immunoprecipitation, 5 .mu.g of hB7-1-Ig, bound to protein A resin,
was used to pull down active CTLA4 from a 10 .mu.g aliquot of each
refolding trial. Precipitated protein was run on a reducing
SDS-PAGE, transferred to an Immobilon membrane (Millipore, New
Bedford, Mass.) and probed with polyclonal antisera to CTLA4
(antisera 1438, described in Lindsten, T. et al. (1993) J.
Immumnol. 151:3489-3499). The relative amount of protein detected
at 15 kDa was indicative of the success of the refolding process.
Refolding was also evaluated by assaying CTLA4 binding activity in
a competition ELISA as described in Example 2. A successful
refolding consisted of approximately 5% active protein, or about 2
mg of active protein from a 1 L bacterial culture.
[0201] B. Preparation of Secreted CTLA4 from E. coli
[0202] A secreted form of CTLA4 was prepared from E. coli as
follows. The extracellular domain of CTLA4 was joined to the pelB
signal sequence (Lei, S.-P., et al., (1987) J. Bacteriol. 169:
4379-4383) by PCR using plasmid phCTLA4 as template and
oligonucleotide 5'GGCACTAGTCATGAAATACCTAT-
TGCCTACGGCAGCCGCTGGATTGTTATTACT
CGCTGCCCAACCAGCGATGGCCGCAGCAATGCACGTGGCCCA- GCCTGCTGTGG3' (SEQ ID
NO: 20) as the forward primer and a reverse primer (SEQ ID NO: 21)
previously described. The forward PCR primer
5'-GGCACTAGTCATGAAATACCTATTGCCT
ACGGCAGCCGCTGGATTGTTATTACTCGCTGCCCAACCAGC- GATGGCCGCAGCA
ATGCACGTGGCCCAGCCTGCTGTGG-3' (SEQ ID NO: 22) contains a unique
BspHI restriction site, the complete pelB signal sequence and the
5' end of the extracellular domain of CTLA4. The reverse PCR primer
(SEQ ID NO: 21) contains a unique BamH1 restriction site preceded
by translational stop codons in all three reading frames preceded
by the last amino acid before the transmembrane domain of CTLA4.
PCR amplification with these primers yielded a 480 by fragment
bounded by unique BspHI and BamHI restriction sites encoding the
pelB signal sequence joined to the CTLA4 extracellular domain.
[0203] After PCR amplification, the DNA fragment was digested with
BspHI and BamHI and ligated to expression vector pTrc99A
(Pharmacia, Piscataway, N.J.) previously digested with NcoI and
BamHI. This resulted in a plasmid in which the expression of the
pelB-CTLA4 protein was driven by the pTrc promoter present in the
pTrc99A expression vector. E. coli host strains transformed with
the ligated DNA were selected on L-agar containing ampicillin (50
.mu.g/ml) and individual clones isolated. The expression of CTLA4
in these strains was induced by the treatment of exponentially
growing cultures with IPTG (0.5 mM) overnight. Extracts were
prepared from the culture medium after concentration or by release
from periplasm. To prepare periplasmic extracts, cells were
incubated in 20% sucrose, 10 mM Tris-HCl pH7.5 for 15 minutes at
room temperature, collected by centrifugation, and resuspended in
4.degree. C. water and held on ice for 10 min. Extracts were
assayed for the presence of CTLA4 by SDS-PAGE, Western blotting and
competitive B7-1binding ELISA (as described in Example 2). As shown
in FIG. 8, soluble CTLA4 prepared from periplasmic extracts of E.
coli or from the media of these cultures was able to compete for
binding to B7-1 with unlabelled CTLA4Ig. In contrast, periplasmic
extracts from E. coli transfected with the vector alone or media
from these cultures was not able to compete for binding to
B7-1.
EQUIVALENTS
[0204] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
* * * * *