U.S. patent application number 10/672932 was filed with the patent office on 2005-09-01 for antibody and chemokine constructs and their use in the treatment of infections of immunological diseases.
This patent application is currently assigned to Micromet AG, a Germany corporation. Invention is credited to Mack, Matthias, Schlondorff, Detlef, Spring, Michael.
Application Number | 20050191702 10/672932 |
Document ID | / |
Family ID | 26052319 |
Filed Date | 2005-09-01 |
United States Patent
Application |
20050191702 |
Kind Code |
A1 |
Mack, Matthias ; et
al. |
September 1, 2005 |
Antibody and chemokine constructs and their use in the treatment of
infections of immunological diseases
Abstract
The invention is directed to chimeric polypeptides, e.g.,
bispecific antibodies, comprising a chemokine receptor binding
domain and a T cell surface polypeptide or cell toxin binding
domain, nucleic acids that encode them, and methods of making and
using them. The chimeric polypeptides of the invention can include,
be bound to, or attached to, a cell toxin. The invention is also
directed to pharmaceutical compositions and methods for making and
using them, including the treatment of immunological disorders,
such as autoimmune diseases, and for the targeted elimination of
cells, e.g., T lymphocytes and other cells latently infected with a
primate immunodeficiency virus, such as a human immunodeficiency
virus, e.g., HIV-1.
Inventors: |
Mack, Matthias; (Munich,
DE) ; Schlondorff, Detlef; (Munich, DE) ;
Spring, Michael; (Alteglofsheim, DE) |
Correspondence
Address: |
MORRISON & FOERSTER LLP
3811 VALLEY CENTRE DRIVE
SUITE 500
SAN DIEGO
CA
92130-2332
US
|
Assignee: |
Micromet AG, a Germany
corporation
|
Family ID: |
26052319 |
Appl. No.: |
10/672932 |
Filed: |
September 26, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10672932 |
Sep 26, 2003 |
|
|
|
09948004 |
Sep 5, 2001 |
|
|
|
6723538 |
|
|
|
|
09948004 |
Sep 5, 2001 |
|
|
|
PCT/EP00/02154 |
Mar 10, 2000 |
|
|
|
Current U.S.
Class: |
435/7.1 ;
435/320.1; 435/325; 435/69.5; 530/351; 536/23.5 |
Current CPC
Class: |
C07K 2317/77 20130101;
A61K 48/00 20130101; C07K 14/523 20130101; A61K 38/00 20130101;
A61K 47/642 20170801; A61K 2039/505 20130101; C07K 2319/00
20130101; C07K 16/2809 20130101; C07K 16/2866 20130101; C07K
2317/34 20130101 |
Class at
Publication: |
435/007.1 ;
435/069.5; 435/320.1; 435/325; 530/351; 536/023.5 |
International
Class: |
G01N 033/53; C07H
021/04; C12P 021/02; C07K 014/52 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 11, 1999 |
DE |
199 10 891.9 |
Sep 8, 2000 |
EP |
00 11 9694.8 |
Claims
1. A chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
2. The chimeric polypeptide of claim 1, wherein the chemokine
receptor is a chemokine receptor 5 (CCR5).
3. The chimeric polypeptide of claim 2, wherein the chemokine
receptor 5 (CCR5) is a human chemokine receptor 5 (CCR5).
4. The chimeric polypeptide of claim 2, wherein the moiety that
specifically binds to the chemokine receptor comprises a RANTES or
a fragment thereof capable of binding to the CCR5 receptor.
5. The chimeric polypeptide of claim 2, wherein the moiety that
specifically binds to the CCR5 chemokine receptor comprises a
MIP-1.alpha. or a fragment thereof capable of binding to the CCR5
receptor.
6. The chimeric polypeptide of claim 2, wherein the moiety that
specifically binds to the CCR5 chemokine receptor comprises
MIP-1.beta., MCP-2, or MCP-3 or a fragment thereof capable of
binding to the CCR5 receptor.
7. The chimeric polypeptide of claim 1, wherein the moiety that
specifically binds to the chemokine receptor comprises an IP-10
(CXCL10), a MIG (CXCL9), an I-TAC (CXCL11) or a fragment thereof
capable of binding to the CXCR3 chemokine receptor.
8. The chimeric polypeptide of claim 1, wherein the chemokine
receptor is a CXCR3.
9. The chimeric polypeptide of claim 1, wherein the chemokine
receptor is a CCR4.
10. The chimeric polypeptide of claim 1, wherein the chemokine
receptor is a CCR6 .
11. The chimeric polypeptide of claim 1, wherein the chemokine
receptor is a CCR10.
12. The chimeric polypeptide of claim 1, wherein the chemokine
receptor is a CXCR4, CCR1, CCR2, CCR3, CCR7, CCR8, CCR9, XCR1, or a
CX3CR1.
13. The chimeric polypeptide of claim 1, wherein the T cell surface
polypeptide comprises a CD3 polypeptide.
14. The chimeric polypeptide of claim 1, wherein the cell toxin
comprises a Pseudomonas exotoxin.
15. The chimeric polypeptide of claim 14, wherein the Pseudomonas
exotoxin comprises a PE38 exotoxin, a PE40 exotoxin or a PE37
exotoxin.
16. The chimeric polypeptide of claim 1, wherein the cell toxin
comprises a diptheria toxin.
17. The chimeric polypeptide of claim 1, wherein the cell toxin is
cross-linked to the chimeric polypeptide.
18. The chimeric polypeptide of claim 1, wherein polypeptide
comprises a recombinant fusion protein.
19. The chimeric polypeptide of claim 1, wherein the moiety that
specifically binds to a chemokine receptor comprises an antigen
binding domain derived from an antibody that specifically binds to
the chemokine receptor.
20. The chimeric polypeptide of claim 1, wherein the moiety that
specifically binds to a T cell surface polypeptide comprises an
antigen binding domain derived from an antibody that specifically
binds to the T cell surface polypeptide.
21. The chimeric polypeptide of claim 1, wherein the moiety that
specifically binds to a cell toxin comprises an antigen binding
domain derived from an antibody that specifically binds to the cell
toxin.
22. A recombinant fusion protein comprising a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
23. A bispecific antibody comprising a first antigen binding domain
that specifically binds to a chemokine receptor; and, a second
antigen binding domain that specifically binds to a T cell surface
polypeptide, a cell toxin, or a third antigen binding domain that
specifically binds to or is linked to a T cell surface polypeptide
or a comprising cell toxin.
24. (canceled)
25. The bispecific antibody of claim 23, wherein the bispecific
antibody is a single chain antibody construct.
26. The bispecific antibody of claim 23, wherein the single chain
antibody construct comprises a V.sub.L and a V.sub.H domain capable
of specifically binding the chemokine receptor and a V.sub.H and a
V.sub.L domain capable of specifically binding a T cell surface
polypeptide.
27. The bispecific antibody of claim 23, wherein the antigen
binding domain that specifically binds to a chemokine receptor
comprises a murine anti-human CCR5 antibody MC-1.
28. The bispecific antibody of claim 27, comprising V.sub.L and
V.sub.H domains arranged in the order
V.sub.L(MC-1)-V.sub.H(MC-1)-V.sub.H(CD3)-V.- sub.L(CD3).
29. The bispecific antibody of claim 27, wherein the V.sub.L(MC-1)
domain comprises an amino acid sequence as set forth in SEQ ID
NO:12.
30. The bispecific antibody of claim 27, wherein the V.sub.H(MC-1)
domain comprises an amino acid sequence as set forth in SEQ ID
NO:16.
31. The bispecific antibody of claim 27, wherein the V.sub.H(CD3)
domain comprises an amino acid sequence as set forth in SEQ ID
NO:26.
32. The bispecific antibody of claim 27, wherein the V.sub.L(CD3)
domain comprises an amino acid sequence as set forth in SEQ ID NO:
28.
33. (canceled)
34. The bispecific antibody of claim 23, wherein the second antigen
binding domain specifically binds to a cell toxin.
35. The bispecific antibody of claim 23, wherein the antibody is
covalently bound to a cell toxin.
36. The bispecific antibody of claim 23, wherein the antibody is
bound to a second antibody that binds to a CD3 antigen or a cell
toxin.
37. A nucleic acid encoding a chimeric polypeptide comprising a
first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin.
38. A vector comprising a nucleic acid encoding a chimeric
polypeptide comprising a first polypeptide domain comprising at
least one moiety that specifically binds to a chemokine receptor;
and, a second polypeptide domain comprising at least one moiety
that specifically binds to a T cell surface polypeptide or a cell
toxin, or, comprising a cell toxin.
39. A transformed cell comprising a nucleic acid encoding a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
40. A pharmaceutical composition comprising a chimeric polypeptide,
a nucleic, a vector, or a transformed cell; and, a pharmaceutically
acceptable excipient; wherein the chimeric polypeptide comprises a
first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the vector comprises a nucleic acid encoding a chimeric polypeptide
comprising a first polypeptide domain comprising at least one
moiety that specifically binds to a chemokine receptor; and, a
second polypeptide domain comprising at least one moiety that
specifically binds to a T cell surface polypeptide or a cell toxin,
or, comprising a cell toxin, wherein the transformed cell comprises
a nucleic acid encoding a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell
toxin.
41. A kit comprising a chimeric polypeptide, a nucleic acid, a
vector, a transformed cell; or a pharmaceutical composition
comprising the chimeric polypeptide, the vector or the cell;
wherein the chimeric polypeptide comprises a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin,
wherein the vector comprises a nucleic acid encoding a chimeric
polypeptide comprising a first polypeptide domain comprising at
least one moiety that specifically binds to a chemokine receptor;
and, a second polypeptide domain comprising at least one moiety
that specifically binds to a T cell surface polypeptide or a cell
toxin, or, comprising a cell toxin, wherein the transformed cell
comprises a nucleic acid encoding a chimeric polypeptide comprising
a first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin.
42. Use of a chimeric polypeptide to prepare a pharmaceutical
composition for the elimination of cells that are latently infected
with a primate immunodeficiency virus; wherein the chimeric
polypeptide comprises a first polypeptide domain comprising at
least one moiety that specifically binds to a chemokine receptor;
and, a second polypeptide domain comprising at least one moiety
that specifically binds to a T cell surface polypeptide or a cell
toxin, or, comprising a cell toxin.
43. Use of a chimeric nucleic acid to prepare a pharmaceutical
composition for the elimination of cells that are latently infected
with a primate immunodeficiency virus, wherein the nucleic acid
encodes a chimeric polypeptide comprising a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
44. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of an
inflammatory renal disease; wherein the chimeric polypeptide
comprises a first polypeptide domain comprising at least one moiety
that specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
45. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of an
allergic reaction; wherein the chimeric polypeptide comprises a
first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
46. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of an
inflammatory bowel disease; wherein the chimeric polypeptide
comprises a first polypeptide domain comprising at least one moiety
that specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
47. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of multiple
sclerosis; wherein the chimeric polypeptide comprises a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin,
wherein the nucleic acid encodes a chimeric polypeptide comprising
a first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin.
48. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of a skin
disease; wherein the chimeric polypeptide comprises a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin,
wherein the nucleic acid encodes a chimeric polypeptide comprising
a first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin.
49. The use of claim 48, wherein the skin disease is skin
inflammation, atopic dermatitis or psoriasis.
50. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of diabetes;
wherein the chimeric polypeptide comprises a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell
toxin.
51. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of a
transplant rejection; wherein the chimeric polypeptide comprises a
first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
52. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of an
inflammatory joint disease; wherein the chimeric polypeptide
comprises a first polypeptide domain comprising at least one moiety
that specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
53. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of a graft
versus host disease; wherein the chimeric polypeptide comprises a
first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
54. Use of a chimeric polypeptide or a chimeric nucleic acid to
prepare a pharmaceutical composition for the treatment of an
autoimmune disease; wherein the chimeric polypeptide comprises a
first polypeptide domain comprising at least one moiety that
specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
55. The use of claim 54, wherein the autoimmune disease is type I
diabetes or rheumatoid arthritis.
56. A method for eliminating a cell infected with a primate
immunodeficiency virus comprising administering a composition
comprising a chimeric polypeptide or a nucleic acid, in amounts
sufficient to kill the cell. wherein the chimeric polypeptide
comprises a first polypeptide domain comprising at least one moiety
that specifically binds to a chemokine receptor; and, a second
polypeptide domain comprising at least one moiety that specifically
binds to a T cell surface polypeptide or a cell toxin, or,
comprising a cell toxin, wherein the nucleic acid encodes a
chimeric polypeptide comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin.
57. The method of claim 56, wherein the primate immunodeficiency
virus is a human immunodeficiency virus.
58. The method of claim 57, wherein the human immunodeficiency
virus is HIV-1.
59. The method of claim 56, wherein the cell is latently infected
with a primate immunodeficiency virus.
60. A method for the treatment of a primate immunodeficiency virus
comprising the following steps: (a) providing a pharmaceutical
composition comprising a chimeric polypeptide or a nucleic acid,
wherein the chimeric polypeptide comprises a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the primate immunodeficiency virus.
61. The method of claim 60, wherein the treatment further comprises
administration of drugs employed in HAART.
62. A method for the treatment of an inflammatory renal disease
comprising the following steps: (a) providing a pharmaceutical
composition comprising a chimeric polypeptide or a nucleic acid,
wherein the chimeric polypeptide comprises a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the inflammatory renal disease.
63. A method for the treatment of an allergic reaction comprising
the following steps: (a) providing a pharmaceutical composition
comprising a chimeric polypeptide or a nucleic acid, wherein the
chimeric polypeptide comprises a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the allergic reaction.
64. A method for the treatment of an inflammatory bowel disease
comprising the following steps: (a) providing a pharmaceutical
composition comprising a chimeric polypeptide or a nucleic acid,
wherein the chimeric polypeptide comprises a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the inflammatory bowel disease.
65. A method for the treatment of multiple sclerosis comprising the
following steps: (a) providing a pharmaceutical composition
comprising a chimeric polypeptide or a nucleic acid, wherein the
chimeric polypeptide comprises a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the multiple sclerosis.
66. A method for the treatment of a skin disease comprising the
following steps: (a) providing a pharmaceutical composition
comprising a chimeric polypeptide or a nucleic acid, wherein the
chimeric polypeptide comprises a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the skin disease.
67. The method of claim 66, wherein the skin disease is skin
inflammation, atopic dermatitis or psoriasis.
68. A method for the treatment of diabetes comprising the following
steps: (a) providing a pharmaceutical composition comprising a
chimeric polypeptide or a nucleic acid, wherein the chimeric
polypeptide comprises a first polypeptide domain comprising at
least one moiety that specifically binds to a chemokine receptor;
and, a second polypeptide domain comprising at least one moiety
that specifically binds to a T cell surface polypeptide or a cell
toxin, or, comprising a cell toxin, wherein the nucleic acid
encodes a chimeric polypeptide comprising a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin; and (b)
administering the pharmaceutical composition in amounts sufficient
to treat the diabetes.
69. A method for the treatment of a transplant rejection comprising
the following steps: (a) providing a pharmaceutical composition
comprising a chimeric polypeptide or a nucleic acid, wherein the
chimeric polypeptide comprises a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the transplant rejection.
70. A method for the treatment of inflammatory joint disease
comprising the following steps: (a) providing a pharmaceutical
composition comprising a chimeric polypeptide or a nucleic acid,
wherein the chimeric polypeptide comprises a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the inflammatory joint disease.
71. The method of claim 70, wherein the inflammatory joint disease
comprises arthritis.
72. A method for the treatment of a graft versus host disease
comprising the following steps: (a) providing a pharmaceutical
composition comprising a chimeric polypeptide or a nucleic acid,
wherein the chimeric polypeptide comprises a first polypeptide
domain comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the transplant rejection.
73. A method for the treatment of an autoimmune disease comprising
the following steps: (a) providing a pharmaceutical composition
comprising a chimeric polypeptide or a nucleic acid, wherein the
chimeric polypeptide comprises a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, comprising a cell toxin, wherein
the nucleic acid encodes a chimeric polypeptide comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, comprising a cell toxin;
and (b) administering the pharmaceutical composition in amounts
sufficient to treat the transplant rejection.
74. The method of claim 73, wherein the autoimmune disease is type
I diabetes or rheumatoid arthritis.
75. A method of making a chimeric composition that can bind to a
chemokine receptor and a cell toxin comprising the following steps:
(a) providing a first polypeptide comprising at least one moiety
that specifically binds to a chemokine receptor and at least one
moiety that specifically binds to a second polypeptide comprising
an antigen binding domain, wherein the antigen comprises a compound
comprising a cell toxin; (b) contacting the first and second
polypeptide with the compound in vivo or in vitro under conditions
wherein the first polypeptide specifically binds to the second
polypeptide, and the second polypeptide specifically binds to the
compound, thereby making the chimeric composition.
76. A method of making a chimeric composition that can bind to a
chemokine receptor and a T cell surface antigen comprising the
following steps: (a) providing a first polypeptide comprising at
least one moiety that specifically binds to a chemokine receptor
and at least one moiety that specifically binds to a second
polypeptide comprising an antigen binding domain, wherein the
antigen comprises a compound comprising a T cell surface antigen
binding domain; (b) contacting the first polypeptide with the
second polypeptide in vivo or in vitro under conditions wherein the
first polypeptide specifically binds to the second polypeptide, and
the second polypeptide specifically binds to the compound, thereby
making a chimeric composition.
77. The method of claim 76, wherein the T cell surface antigen
comprises a CD3 antigen.
78. The method of claim 76, wherein further comprising a cell toxin
covalently bound to the chimeric composition.
79. The method of claim 76, wherein the cell toxin is a truncated
Pseudomonas exotoxin A (PE38).
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part application
("CIP") and under 35 USC .sctn.120 claims priority to Patent
Convention Treaty (PCT) International Application Serial No:
PCT/EP00/02154, filed Mar. 10, 2000, which claims priority to DE
199 10 891.9, filed Mar. 11, 1999; and this application is a CIP of
and under 35 USC .sctn.119 claims priority to EP application no. 00
11 9694.8, filed Sep. 8, 2000. The aforementioned applications are
explicitly incorporated herein by reference in their entirety and
for all purposes.
TECHNICAL FIELD
[0002] This invention relates generally to cell biology, virology
and medicine. In particular, the invention is directed to chimeric
polypeptides, e.g., bispecific antibodies, comprising a chemokine
receptor. binding domain and a T cell surface polypeptide, a cell
toxin, or a cell toxin binding domain, nucleic acids that encode
them, and methods of making and using them. The chimeric
polypeptides of the invention can include, be bound to, or attached
to, a cell toxin. The invention is also directed to making and
using pharmaceutical compositions, for example, for the treatment
of immunological (e.g., autoimmune) disorders and for the targeted
elimination of cells, e.g., T lymphocytes and other cells latently
infected with a primate immunodeficiency virus, such as a human
immunodeficiency virus, e.g., HIV-1. The pharmaceutical
compositions and methods of the invention can be used for the
treatment, prevention and/or alleviation of inflammatory joint and
renal diseases, inflammatory bowel diseases, multiple sclerosis,
skin diseases, diabetes or transplant rejection.
BACKGROUND
[0003] Immunological diseases/disorders, like autoimmune diseases,
inflammation disorders as well as infectious diseases are not only
increasing but represent substantial threats to global health. For
example, in Germany, about 1% of the population suffer from the
autoimmune disease rheumatoid arthritis. In addition, there is a
number of other joint diseases also leading to arthritis.
Currently, three groups of drugs--non-steroidal anti-rheumatics,
cortisone preparations and second-line agents--and TNF.alpha.
blocking agents are used for treating inflammatory joint diseases.
Up to now, the therapy has focused on the local injection of
cortisone preparations in combination with a systemic
administration of anti-phlogistics or second-line agents.
[0004] Non-steroidal anti-rheumatics have a mild analgetic and
anti-inflammatory effect, but they have many side effects when
applied frequently (e.g. gastric ulcers, nephroses). In high
dosages, cortisone preparations have a strong decongestant and
analgetic effect, however, leading to a quick relapse after
discontinuation of the therapy. Moreover, cortisone preparations
cannot stop the destruction process of the joint disease. A
long-term therapy with cortisone usually entails severe side
effects, such as infections, Cushing's phenomenon, osteoporosis,
parchment-like skin, metabolic and hormonal disorders. The local
injection of cortisone also has the essential disadvantage that the
activity of the migrated white blood cells is only reduced. As the
infiltrating cells are not destroyed, a quick relapse occurs after
discontinuation of the therapy. As mentioned above, the same
applies to the systemic application. Rarely, inflammation due to
the irritative effect of cortisone crystals is aggravated after
injection of cortisone. The duration of effect of a cortisone
injection varies tremendously and ranges from primary
ineffectiveness to a duration of effect of several weeks.
[0005] In rheumatology, second-line agents are used to achieve a
long-term suppression of the inflammation and a reduction in
cortisone preparations. Due to the considerable toxicity (e.g.,
allergies, infections, malignant diseases, renal insufficiency,
blood pressure crises, pulmonary diseases) it is necessary for
medical specialists to attend closely to the patients. After
beginning treatment, no therapeutic effect may be apparent for the
first three months. Currently, there are 4 or 5 of such second-line
agents at disposal, which are used individually at first or are
combined if the therapy is not effective. Mostly, there is hardly
anything known about the mode of action of second-line agents. It
is not yet entirely clear whether the application of second-line
agents can diminish the destruction of the joint.
[0006] In recent years, a new group of substances has been
introduced into the treatment of rheumatoid arthritis, which is
based on the blocking of cell signal substances, particularly
TNF.alpha., by means of monoclonal antibodies or soluble receptor
constructs.
[0007] In addition, there are patients that do not respond to
currently available therapies. In other cases, the conventional
therapy has to be stopped due to intolerable side effects.
[0008] A similar situation exists for many other inflammatory and
autoimmune diseases like inflammatory renal diseases, inflammatory
bowel diseases, multiple sclerosis and transplant rejection, where
current treatments have many limitations. For example, agents used
in inflammatory and autoimmune diseases include anti-inflammatory
and immunosuppressive agents like azathioprine, cyclophosphamide,
glucocorticoids like prednisone; immunosuppressants like
cyclosporin A, Tacrolimus (FK506), Sirolimus (Rapamycin); and
protein drugs like calcineurin, beta-interferon, anti-TNF alpha
monoclonal antibodies (remicade). These agents show general
immunomodulating effects and therefore efficacy and side effects
profiles can pose severe limitations for the treatment options;
see, e.g., Harrison's Principles of Internal Medicine, eds. Fauci
et al., 14.sup.th edition, McGraw-Hill publisher.
[0009] Inflammatory bowel diseases, such as Crohn's disease,
ulcerative colitis, are treated with the anti-inflammatory agents
sulfazsalazine (Azulfidine) and glucocorticoids, like prednisone
and, in selected cases, with TNF-.alpha. blocking agents. In
ulcerative colitis immunosuppressive therapy with drugs such as
azathioprine is well established, in severely ill patients the
potent immunosuppressive agent cyclosporine is used (see, e.g.,
Harrison's Principles of Internal Medicine, eds. Fauci et al.,
14.sup.th edition, McGraw-Hill publisher). In many cases no
sufficient reduction of disease activity is achieved with current
drugs, such that even surgical intervention is sometimes
necessary.
[0010] Inflammatory renal diseases (nephritis) are treated with
e.g. glucocorticoids, alkylating agents and/or plasmapheresis.
Additional diseases with similar treatment options include systemic
lupus erythematosus (SLE), Sjogren's syndrome, polymyositis,
dermatomyositis, mixed connective tissue disease,
anti-phospholipid-antibody syndrome.
[0011] For some of these diseases, few therapeutic options have
been available up to now. All these diseases share an inflammatory
component. However, the inflammatory component cannot be
sufficiently suppressed by the currently available drugs. For some
drugs, e.g. alkylating agents a maximal lifetime dose per patient
cannot be exceeded.
[0012] Transplant rejection is treated using immunosuppressive
agents including azathioprine, mycophenolate mofetil,
glucocorticoids, cyclosporine, Tacrolimus (FK506), Sirolimus
(Rapamycin). A combination of steroids and a low dose of mouse
monoclonal antibody OKT3 binding to CD3 on T-cells is used to
anergize and deplete T-cells. Therapy is continued using
immunosuppressants like cyclosporine. Mouse anti-human antibodies
(MAHAs) have common side effects and limit the use of OKT3 (Fauci
et al., supra, pp. 2374-2381).
[0013] Approaches to treat multiple sclerosis include treatments
which effect the overall immune system like anti-inflammatory
agents including azathioprine, cyclophosphamide, prednisone,
corticosteroids, cyclosporin A, calcineurin, Rapamycin,
beta-interferon (see, e.g., Fauci et al., supra, pp. 2415-2419;
Wang (2000) J. Immunol. 165:548-557). In addition, a number of
non-specific treatments are administered that may improve the
quality of life including physical therapy and
psycho-pharmacological agents. None of the treatment options
mentioned above has a curative effect. Even the most promising
compound, .beta.-interferon, leads only to a slower disease
progression, while exhibiting significant side effects.
[0014] Furthermore, human immunodeficiency virus-type 1 (HIV-1),
the most common cause of AIDS, has infected more than 50 million
individuals (including those who have died), and the rate of new
infections is estimated at nearly 6 million per year (AIDS Epidemic
Update: December 1999 (UNAIDS, Geneva, 1999), www.unaids.org).
Equally disturbing are the uncertainties of the epidemic to come.
Although sub-Saharan Africa remains the global epicenter, rates of
infection have increased in recent times in the former Soviet Union
and parts of south and southeast Asia, including India and China,
where literally hundreds of millions of individuals are potentially
at risk. In the United States, new waves of infection have been
recognized in women, minorities, and younger generations of gay
men. Combination antiretroviral therapy has afforded many people
clinical relief, but the costs and toxicities of treatment are
substantial, and HIV-1 infection remains a fatal disease. Moreover,
the vast majority of infected people worldwide do not have access
to these agents. Thus, although the demographics (and, in some
instances, the natural history) of AIDS have changed, the epidemic
is far from over; instead, it is evolving, expanding, and posing
ever greater challenges.
[0015] Human immunodeficiency virus (HIV) cannot enter human cells
unless it first binds to two key molecules on the cell surface, CD4
and a co-receptor. The co-receptor that is initially recognized is
chemokine receptor 5 (CCR5). Later in the life cycle of the virus,
another chemokine receptor, CXCR4, becomes the co-receptor for
HIV-1; see, e.g., D'Souza, Nature Med. 2:1293 (1996); Premack,
Nature Med. 2:1174; Fauci, Nature 384:529 (1996).
[0016] The HIV-1 strains that cause most transmissions of viruses
by sexual contact are called M-tropic viruses. These HIV-1 strains,
also known as NSI primary viruses, can replicate in primary CD4+
T-cells and macrophages and use the chemokine receptor 5 (CCR5),
and, less often, CCR3, as their entry co-receptor. The T-tropic
viruses, sometimes called SI primary, can also replicate in primary
CD4+ T-cells, but can, in addition, infect established CD4+ T-cell
lines in vitro, which they do via the chemokine receptor CXCR4
(fusin). Many of these T-tropic strains can use CCR5 in addition to
CXCR4, and some can enter macrophages via CCR5, at least under
certain in vitro conditions; see, e.g., D'Souza, Nature Med. 2,
1293 (1996); Premack, Nature Med. 2, 1174, Fauci, Nature 384, 529
(1996).
[0017] Whether other co-receptors contribute to HIV-1 pathogenesis
is unresolved, but the existence of another co-receptor for some
T-tropic strains can be inferred from in vitro studies. Because
M-tropic HIV-1 strains are implicated in about 90% of sexual
transmissions of HIV, CCR5 is the predominant co-receptor for the
virus in patients; transmission (or systemic establishment) of
CXCR4-using (T-tropic) strains is rare (D'Souza, Nature Med. 2,
1293 (1996); Premack, Nature Med. 2, 1174; Fauci, Nature 384, 529
(1996), Paxton, Nature Med. 2, 412 (1996); Liu, Cell 86, 367
(1996); Samson, Nature 382, 722 (1996); Dean, Science 273, 1856
(1996); Huang, Nature Med. 2, 1240 (1996)). However, once SI
viruses evolve in vivo (or if they are transmitted), they are
especially virulent and cause faster disease progression; see,
e.g., D'Souza, Nature Med. 2, 1293 (1996); Premack, Nature Med. 2,
1174; Fauci, Nature 384, 529 (1996), Schuitemaker, J. Virol. 66,
1354 (1992); Connor, J. Virol. 67, 1772 (1993); Richman, J. Infect.
Dis. 169, 968 (1994); R. I. Connor (1997) J. Exp. Med. 185:621;
Trkola, Nature 384, 184 (1996).
[0018] The numbers and identity of co-receptor molecules on target
cells, and the ability of HIV-1 strains to likely enter cells via
the different co-receptors, seem to be critical determinants of
disease progression. These factors are major influences on both
host- and virus-dependent aspects of HIV-1 infection. For example,
a homozygous defect (delta 32) in CCR5 correlates strongly with
resistance to HIV-1 infection in vivo and in vitro. Individuals who
are heterozygous for a defective CCR5 allele are not protected
against infection and have only a modestly slowed disease
progression (Paxton, Nature Med. 2, 412 (1996); Liu, Cell 86, 367
(1996); Samson, Nature 382, 722 (1996); Dean, Science 273, 1856
(1996); Huang (1996) Nature Med. 2:1240).
[0019] However, other factors can influence the level of CCR5
expression on activated CD4+ T-cells and thereby affect the
efficiency of HIV-1 infection in vitro (Trkola, Nature 384, 184
(1996); Bleul, Proc. Natl. Acad. Sci. U.S.A. 94, 1925 (1997)). For
reasons that are not yet clear, the amount of CCR5 expression on
the cell surface (as measured by MIP-1 binding) varies by 20-fold
on CD4+ T-cells from individuals with two wild-type CCR5 alleles
(Trkola, Nature 384, 184 (1996)). Staining with a CCR5-specific
monoclonal antibody indicates a similar large variability (Wu, J.
Exp. Med. 186:1373-81 (1997)). Such variation may far outweigh any
effect of one defective allele for CCR5. The causes of this
variation should be the subject of intensive studies, as they point
to controllable factors that could increase resistance to
disease.
[0020] Most primary, clinical isolates of primate immunodeficiency
viruses use the chemokine receptor CCR5 for entry (see, e.g., Feng,
Science 272, 872 (1996); Choe, Cell 85, 1135 (1996); Deng, Nature
381, 661 (1996); Dragic et al., Nature 381, p. 667; Doranz, Cell
85, 1149 (1996); Alkhatib, Science 272, 1955 (1996)). For most
HIV-1 isolates that are transmitted and that predominate during the
early years of infection, CCR5 is an obligate co-receptor, and rare
individuals that are genetically deficient in CCR5 expression are
relatively resistant to HIV-1 infection (see, e.g., Connor, J. Exp.
Med. 185, 621 (1997); Zhang, Nature 383, 768 (1996); Bjorndal, J.
Virol. 71, 7478 (1997); Dean, Science 273, 1856 (1996); Liu, Cell
86, 367 (1996); Paxton, Nature Med. 2, 412 (1996); Samson, Nature
382, 722 (1996)). HIV-1 isolates arising later in the course of
infection often use other chemokine receptors, frequently CXCR4, in
addition to CCR5. Studies of chimeric envelope glycoproteins
demonstrated that the third variable (V3) loop of gp120 is a major
determinant of which chemokine receptor is used as a viral entry
co-receptor (see, e.g., Cocchi, Nature Med. 2, 1244 (1996);
Bieniasz, EMBO J. 16, 2599 (1997); Speck, J. Virol. 71, 7136
(1997)). V3-deleted versions of gp120 do not bind CCR5, even though
CD4 binding occurs at wild-type levels. Antibodies to the V3 loop
interfere with gp120-CCR5 binding (see, e.g., Trkola, Nature 384,
184 (1996); Wu, Nature 384, 179 (1996); Lapham, Science 274, 602
(1996); Bandres, J. Virol. 72, 2500 (1998); Hill, Science 71, 6296
(1997)). These results support an involvement of the V3 loop in
chemokine receptor binding.
[0021] Latency of HIV is established very early in the course of an
infection, when M-tropic strains predominate. M-tropic strains
depend on the presence of CCR5 on the target cell for infection.
The importance of CCR5 as an essential co-receptor for M-tropic
HIV-1 is emphasized by the fact that individuals lacking CCR5 due
to a homozygous 32 base pair deletion (delta32) are highly
resistant to HIV-1 infection. In contrast to other markers like CD4
or CD45RO, CCR5 is only present on a subset of lymphocytes and
other cells that are prone to HIV-1 infection (Rottmann (1997) Am.
J. Pathol. 151:1341-1351; Naif (1998) J. Virol. 72:830-836; Lee
(1999) Proc. Natl Acad. Sci. USA 96:5315-5220).
[0022] Several approaches have been postulated to eliminate latent
infected cells. One strategy is to drive the latently infected
cells to virus production and subsequent cell death. In this
context, one approach is IL-2 (or TNF-alpha or IL-6) administration
in the presence of HAART until the viral reservoir is exhausted
(Chun (1998) J. Exp. Med. 188, 83-91; Chun (1999) Nat. Med. 5,
651-655; Stellbrink (1999) Abstracts of the 6th Conference on
Retroviruses and Opportunistic Infections (Foundation for
Retrovirology and Human Health, Alexandria, Va.), abstr. 356. p.
135; Imamichi (1999) Abstracts of the 6th Conference on
Retroviruses and Opportunistic Infections (Foundation for
Retrovirology and Human Health, Alexandria, Va.), abstr. 358, p.
135). These cells are believed to die after activation. Whether the
entire pool of latent infected cells can be exhausted is
questionable.
[0023] Another strategy tried was to specifically kill latently
infected cells based on gp-120 expression on the cell surface.
Immunotoxins recognizing gp-120 have been proposed but failed for
two reasons. The one construct tested in humans was a protein
consisting of soluble CD4 linked to Pseudomonas aeroginosa exotoxin
A (PE). The clinical results were disappointing due to
dose-limiting hepatotoxicity without showing signs of efficacy and
the program was terminated (Ashom (1990) Proc. Natl Acad. Sci 87,
8889-8893; Berger (1998) Proc. Natl Acad. Sci. 95, 11511-11513).
The second reason for failure was that latent infected cells do not
express viral surface glycoproteins, e.g. gp-120 and gp-41. Thus,
approaches targeting gp-120 or gp-41 for the elimination of
latently infected cells cannot work.
[0024] Other approaches to eliminate latent infected cells are
based on eliminating the entire CD4.sup.+ T-cell compartment
(Berger (1998) Proc. Natl Acad. Sci. 95, 11511-11513), or the
CD25-positive compartment (Bell (1993) Proc. Natl Acad. Sci. 90,
1411-1415), or the CD45RO memory cell compartment (McCoig (1999)
Proc. Natl. Acad. Sci 96, 11482-11485). However these markers do
not adequately include all potentially infected cells. Such cells
also include, besides CD4-positive cells, macrophages, and
non-hematopoietic cells.
[0025] In Wu, et al., WO 98/18826, an antibody directed against the
mammalian (e.g. human) chemokine receptor 5 (CCR5) is described and
said antibody is proposed in a method of inhibiting the interaction
of cell bearing CCR5 with a potential ligand, like HIV. It is
proposed that said method inhibits an HIV infection. Furthermore,
treatment options for inflammatory diseases, autoimmune diseases
and graft rejection are proposed. Yet, all these treatment options
are based on the assumption that specific antibodies, like the
immunoglobulin molecules themselves, or functional portions
thereof, interfere with receptor-ligand interactions. However,
whether these antibodies are capable of depleting the relevant
cells is questionable. Furthermore, WO 98/18826 merely envisages
the prevention of an interaction of HIV and the CCR5 receptor and
thereby preventing an HIV infection.
[0026] Leukocytes, in particular T-cells, are believed to be the
key regulators of the immune response to infective agents and are
critical components for the initiation and maintenance of
inflammatory processes, like inflammatory bowel disease
inflammatory renal diseases, inflammatory joint disease, autoimmune
disorders, like multiple sclerosis and arthritis, skin diseases,
like psoriatic lesions, diabetes and in transplant rejection.
[0027] Thus, there exists a need for novel means and methods which
can lead to the suppression of activated leukocytes involved in
immunological pathologies, like autoimmune diseases, inflammation
process and/or viral infections of immune cells. The present
invention fulfills this and other needs.
SUMMARY
[0028] The invention provides a chimeric polypeptide, e.g., a
bispecific antibody, comprising a first polypeptide domain
comprising at least one moiety that specifically binds to a
chemokine receptor; and, a second polypeptide domain comprising at
least one moiety that specifically binds to a T cell surface
polypeptide or a cell toxin, or, a cell toxin. In one aspect of the
invention, the chemokine receptor is a chemokine receptor 5 (CCR5),
such as a human chemokine receptor 5 (CCR5). In one aspect, the
moiety that specifically binds to the chemokine receptor 5 (CCR5)
can comprise a RANTES ("regulated on activation normal T cell
expressed and secreted") polypeptide, or a fragment thereof capable
of binding to a CCR5 receptor. Alternatively, the moiety that
specifically binds to the CCR5 chemokine receptor can comprise a
MIP-1.alpha., or a fragment thereof capable of binding to a CCR5
receptor. In another aspect, the moiety that specifically binds to
the CCR5 chemokine receptor can comprise a MIP-1.beta., a MCP-2, or
a MCP-3 or a fragment thereof, capable of binding to the CCR5
receptor.
[0029] In one aspect of the chimeric composition of the invention,
the moiety that specifically binds to the chemokine receptor
comprises an IP-10 (CXCL-10) (see, e.g., Agostini (2001) Am. J.
Pathol. 158:1703-1711; Flier (1999) J. Invest. Dermatol.
113:574-578), or a Mig (CXCL9) (see, e.g., Farber (1997) J. Leukoc.
Biol. 61:246-257), or an I-TAC (CXCL11) chemokine ligand (see,
e.g., Gasperini (1999) J. Immunol. 162:4928-4937), or a fragment
thereof (see Table IV), capable of binding to the CXCR3 chemokine
receptor.
[0030] In alternative aspects, the chemokine receptor is CXCR4
(see, e.g., Vila-Coro (1999) FASEB J. 13:1699-1710), CXCR5 (see,
e.g., Legler (1998) J. Exp. Med. 187:655-660), CXCR6 (see, e.g.,
Luttichau (2001) Eur. J. Immunol. 31:1217-1220), CCR1 (see, e.g.,
Hesselgesser (1998) J. Biol. Chem. 273:15687-15692), CCR2 (see,
e.g., Monteclaro (1997) J. Biol. Chem. 272:23186-23190), CCR3 (see,
e.g., Dairaghi (1997) J. Biol. Chem. 272:28206-28209), CCR4 (see,
e.g., Imai (1997) J. Biol. Chem. 272:15036-15042), CCR5 (see, e.g.,
Ganju (2000) J. Biol. Chem. 275:17263-17268), CCR6 (see, e.g., Baba
(1997) J. Biol. Chem. 272:14893-14898), CCR7 (see, e.g., Kim (1999)
Cell Immunol. 193:226-235), CCR8 (see, e.g., Roos (1997) J. Biol.
Chem. 272:17251-17254), CCR9 (see, e.g., Norment (2000) J. Immunol.
164:639-648), CCR10 (see, e.g., Bonini (1997) DNA Cell Biol.
16:1249-1256), XCR1 (GPR5) (see, e.g., Shan (2000) Biochem.
Biophys. Res. Commun. 268:938-941), or CX3CR1 (see, e.g.,
Combadiere (1998) Biochem. Biophys. Res. Commun. 253:728-732); see
Table IV, which includes the corresponding chemokine ligands. The T
cell surface polypeptide can comprise a CD3 polypeptide.
[0031] In one aspect, the chimeric composition of the invention
comprises a cell toxin, or a fragment or domain thereof that
remains toxic to cells. The cell toxin can comprise a Pseudomonas
exotoxin, or toxic fragment thereof. The Pseudomonas exotoxin can
comprise a PE38 exotoxin, a PE40 exotoxin or a PE37 exotoxin.
Alternatively, the cell toxin can comprise a diptheria toxin. The
cell toxin can be non-covalently or covalently, directly or
indirectly, attached or associated with the chimeric composition.
In one aspect, the toxin is cross-linked to the chimeric
polypeptide. Alternatively, the toxin can comprise a recombinant
fusion protein, as all or a portion of the chimeric polypeptide can
comprise a recombinant protein, e.g., it can be a fusion protein.
In one aspect, the moiety that specifically binds to a chemokine
receptor comprises an antigen binding domain derived from an
antibody that specifically binds to the chemokine receptor. The
moiety that specifically binds to a T cell surface polypeptide can
comprise an antigen binding domain derived from an antibody that
specifically binds to the T cell surface polypeptide. The moiety
that specifically binds to a cell toxin can comprise an antigen
binding domain derived from an antibody that specifically binds to
the cell toxin.
[0032] The invention also provides a recombinant fusion protein
comprising a first polypeptide domain comprising at least one
moiety that specifically binds to a chemokine receptor; and, a
second polypeptide domain comprising at least one moiety that
specifically binds to a T cell surface polypeptide or a cell toxin,
or, a cell toxin.
[0033] The invention also provides a bispecific antibody comprising
a first antigen binding domain that specifically binds to a
chemokine receptor; and, a second antigen binding domain that
specifically binds to a T cell surface polypeptide, a cell toxin,
or a third antigen binding domain that specifically binds to or is
linked to a T cell surface polypeptide or a cell toxin. The
bispecific antibody is not limited to two binding domains. The T
cell surface polypeptide can comprise a CD3 antigen.
[0034] In one aspect of the bispecific antibody of the invention,
the bispecific antibody is a single chain antibody construct. The
single chain antibody construct can comprise a V.sub.L and a
V.sub.H domain capable of specifically binding the chemokine
receptor and a V.sub.H and a V.sub.L domain capable of specifically
binding a T cell surface polypeptide. In one aspect, the antigen
binding domain that specifically binds to a chemokine receptor can
comprise a murine anti-human CCR5 antibody MC-1. In one aspect, the
V.sub.L and V.sub.H domains are arranged in the order
V.sub.L(MC-1)-V.sub.H(MC-1)-V.sub.H (CD3)-V.sub.L(CD3). The
V.sub.L(MC-1) domain can comprise an amino acid sequence as set
forth in SEQ ID NO:12. The V.sub.H(MC-1) domain can comprise an
amino acid sequence as set forth in SEQ ID NO:16. The V.sub.H(CD3)
domain can comprise an amino acid sequence as set forth in SEQ ID
NO:26. The V.sub.L(CD3) domain can comprise an amino acid sequence
as set forth in SEQ ID NO: 28. The amino acid sequence of the
bispecific antibody can be encoded by a nucleic acid as set forth
in SEQ ID NO: 17, or comprising an amino acid sequence as set forth
in SEQ ID NO: 18.
[0035] In one aspect of the bispecific antibody, the second antigen
binding domain specifically binds to a cell toxin, or, the second
antigen binding domain specifically binds to another domain (e.g.,
an antibody) that can specifically bind a toxin (or a cell surface
protein). Alternatively, the antibody is covalently bound (directly
or indirectly) to a cell toxin. The antibody can be bound to a
second antibody that binds to a CD3 antigen or a cell toxin.
[0036] The invention provides a nucleic acid encoding a chimeric
polypeptide (e.g., a bispecific antibody) comprising a first
polypeptide domain comprising at least one moiety that specifically
binds to a chemokine receptor; and, a second polypeptide domain
comprising at least one moiety that specifically binds to a T cell
surface polypeptide or a cell toxin, or, a cell toxin.
[0037] The invention provides a vector comprising a nucleic acid
encoding a chimeric polypeptide (e.g., a bispecific antibody)
comprising a first polypeptide domain comprising at least one
moiety that specifically binds to a chemokine receptor; and, a
second polypeptide domain comprising at least one moiety that
specifically binds to a T cell surface polypeptide or a cell toxin,
or, a cell toxin.
[0038] The invention provides a transformed cell comprising a
nucleic acid encoding a chimeric polypeptide (e.g., a bispecific
antibody) comprising a first polypeptide domain comprising at least
one moiety that specifically binds to a chemokine receptor; and, a
second polypeptide domain comprising at least one moiety that
specifically binds to a T cell surface polypeptide or a cell toxin,
or, a cell toxin.
[0039] The invention provides a pharmaceutical composition
comprising a chimeric polypeptide of the invention, a nucleic acid
of the invention, or a vector of the invention, or a transformed
cell of the invention; and, a pharmaceutically acceptable
excipient.
[0040] The invention provides a kit comprising a chimeric
polypeptide (e.g., a bispecific antibody) of the invention, a
nucleic acid of the invention, a vector of the invention, a
transformed cell of the invention, or a pharmaceutical composition
of the invention. The kit can further comprise pharmaceutically
acceptable excipients. The kits can further comprise instructions
on the specific uses of the pharmaceuticals of the invention, as
set forth herein. The kit can further comprise ancillary or other
drugs, e.g., where the kit is intended to be used to treat HIV-1
(e.g., AIDS), drugs employed in HAART also can be included in the
kit.
[0041] The invention provides a use of a chimeric polypeptide
(e.g., a bispecific antibody) or a nucleic acid of the invention
(e.g., a vector of the invention) to prepare a pharmaceutical
composition for the elimination of cells that are latently infected
with a primate (e.g., human) immunodeficiency virus, e.g., HIV-1,
or a lentivirus.
[0042] The invention provides a use of a chimeric polypeptide
(e.g., a bispecific antibody) or a nucleic acid of the invention
(e.g., a vector of the invention) to prepare a pharmaceutical
composition for the treatment of an immunological disorder, such as
an autoimmune disease, an allergic disease, a skin disease, an
inflammatory disease, diabetes, graft versus host disease and
transplant rejections. In alternative aspects, the autoimmune
disease is, e.g., multiple sclerosis, type I diabetes and
rheumatoid arthritis. In alternative aspects, the skin disease is a
skin inflammation, an atopic dermatitis and psoriasis. In
alternative aspects, the inflammatory disease is an inflammatory
joint disease, such as arthritis (e.g., chronic arthritis), an
inflammatory renal disease and an inflammatory bowel disease.
[0043] The invention provides a method for eliminating a cell
infected with a primate immunodeficiency virus comprising
administering a composition comprising a chimeric polypeptide
(e.g., a bispecific antibody) or a nucleic acid of the invention
(e.g., a vector of the invention), in amounts sufficient to kill
the cell. In one aspect, the primate immunodeficiency virus is a
human immunodeficiency virus, such as HIV-1. The cell can be
infected (e.g., latently infected) with a pathogen, e.g., a virus,
such as a primate immunodeficiency virus.
[0044] The invention provides a method for the treatment of a
primate immunodeficiency virus comprising the following steps: (a)
providing a pharmaceutical composition comprising a chimeric
polypeptide (e.g., a bispecific antibody) or a nucleic acid of the
invention (e.g., a vector of the invention), (b) administering the
pharmaceutical composition in amounts sufficient to treat the
primate immunodeficiency virus. The treatment can further comprise
administration of other drugs, e.g., those employed in HAART, or
other treatments.
[0045] The invention provides a method for the treatment of an
inflammatory renal disease comprising the following steps: (a)
providing a pharmaceutical composition comprising a chimeric
polypeptide (e.g., a bispecific antibody) or a nucleic acid of the
invention (e.g., a vector of the invention), (b) administering the
pharmaceutical composition in amounts sufficient to treat the
inflammatory renal disease.
[0046] The invention provides a method for the treatment of an
allergic reaction comprising the following steps: (a) providing a
pharmaceutical composition comprising a chimeric polypeptide (e.g.,
a bispecific antibody) or a nucleic acid of the invention (e.g., a
vector of the invention), (b) administering the pharmaceutical
composition in amounts sufficient to treat the allergic
reaction.
[0047] The invention provides a method for the treatment of an
inflammatory bowel disease comprising the following steps: (a)
providing a pharmaceutical composition comprising a chimeric
polypeptide (e.g., a bispecific antibody) or a nucleic acid of the
invention (e.g., a vector of the invention), (b) administering the
pharmaceutical composition in amounts sufficient to treat the
inflammatory bowel disease.
[0048] The invention provides a method for the treatment of
multiple sclerosis comprising the following steps: (a) providing a
pharmaceutical composition comprising a chimeric polypeptide (e.g.,
a bispecific antibody) or a nucleic acid of the invention (e.g., a
vector of the invention), (b) administering the pharmaceutical
composition in amounts sufficient to treat the multiple
sclerosis.
[0049] The invention provides a method for the treatment of a skin
disease comprising the following steps: (a) providing a
pharmaceutical composition comprising a chimeric polypeptide (e.g.,
a bispecific antibody) or a nucleic acid of the invention (e.g., a
vector of the invention), (b) administering the pharmaceutical
composition in amounts sufficient to treat the skin disease.
[0050] The invention provides a method for the treatment of
diabetes comprising the following steps: (a) providing a
pharmaceutical composition comprising a chimeric polypeptide (e.g.,
a bispecific antibody) or a nucleic acid of the invention (e.g., a
vector of the invention), (b) administering the pharmaceutical
composition in amounts sufficient to treat the diabetes.
[0051] The invention provides a method for the treatment of a
transplant rejection comprising the following steps: (a) providing
a pharmaceutical composition comprising a chimeric polypeptide
(e.g., a bispecific antibody) or a nucleic acid of the invention
(e.g., a vector of the invention), (b) administering the
pharmaceutical composition in amounts sufficient to treat the
transplant rejection.
[0052] The invention provides a method for the treatment of
inflammatory joint disease comprising the following steps: (a)
providing a pharmaceutical composition comprising a chimeric
polypeptide (e.g., a bispecific antibody) or a nucleic acid of the
invention (e.g., a vector of the invention), (b) administering the
pharmaceutical composition in amounts sufficient to treat the
inflammatory joint disease. The inflammatory joint disease can
comprise arthritis, such as rheumatoid arthritis.
[0053] The invention provides a method of making a chimeric
composition that can bind to a chemokine receptor and a cell toxin
comprising the following steps: (a) providing a first polypeptide
comprising at least one moiety that specifically binds to a
chemokine receptor and at least one moiety that specifically binds
to a second polypeptide comprising an antigen binding domain,
wherein the antigen comprises a cell toxin, and a compound
comprising a cell toxin; (b) contacting the first and second
polypeptide with the compound in vivo or in vitro under conditions
wherein the first polypeptide specifically binds to the second
polypeptide, and the second polypeptide specifically binds to the
compound, thereby making the chimeric composition.
[0054] The invention provides a method of making a chimeric
composition that can bind to a chemokine receptor and a T cell
surface antigen comprising the following steps: (a) providing a
first polypeptide comprising at least one moiety that specifically
binds to a chemokine receptor and at least one moiety that
specifically binds to a second polypeptide comprising an antigen
binding domain, wherein the antigen comprises a T cell surface
antigen binding domain; (b) contacting the first polypeptide with
the second polypeptide in vivo or in vitro under conditions wherein
the first polypeptide specifically binds to the second polypeptide,
thereby making a chimeric composition. The T cell surface antigen
can comprise a CD3 antigen.
[0055] The chimeric composition can further comprise a cell toxin
covalently bound to the chimeric composition. The cell toxin can be
a truncated sequence, e.g., a domain, that remains toxic to the
cell, e.g., a Pseudomonas exotoxin A (PE38).
[0056] The present invention relates to the use of an antibody
and/or a chemokine construct which binds to a chemokine receptor.
These compositions are used to eliminate cells that are latently
infected with a primate immunodeficiency virus; accordingly, the
invention is also directed to pharmaceuticals comprising these
compositions. The invention is also directed to use of these
compositions for the preparation pharmaceutical compositions. The
pharmaceutical compositions and methods using these pharmaceuticals
for the treatment, prevention and/or alleviation of inflammatory
renal diseases, inflammatory joint diseases, inflammatory bowel
diseases, multiple sclerosis, skin diseases, diabetes or transplant
rejection.
[0057] Furthermore, the invention relates to antibody constructs
and/or chemokine constructs, in particular, to constructs wherein
said antibody construct comprises a binding site for a chemokine
receptor 5 (CCR5) and a binding site for CD3, wherein said
chemokine construct comprises RANTES ("regulated on activation
normal T cell expressed and secreted") and a toxin. The invention
also describes polynucleotides encoding said antibody- or chemokine
constructs, and vectors and hosts comprising said nucleic acid
molecules. Additionally, the present invention relates to
compositions comprising said antibody constructs, chemokine
constructs, polynucleotides, vectors and/or hosts. The composition
can be a pharmaceutical composition. Described is also the use of
antibody constructs, the chemokine constructs, the polynucleotides,
the hosts and/or the vectors for the preparation of a
pharmaceutical composition for treating, preventing and/or
alleviating an immunological disorder or for eliminating latently
infected cells, wherein said cells are infected with a primate
immunodeficiency virus, like HIV-1.
[0058] The present invention also relates to a method for treating,
preventing and/or alleviating an immunological disorder or for the
elimination cells that are latently infected with a primate
immunodeficiency virus, such as HIV-1. Furthermore, the invention
provides for a kit comprising the compounds of the invention. The
kit can also include instructions on the use of pharmaceuticals in
the kit.
[0059] Several documents are cited throughout the text of this
specification. Each of the documents cited herein (including any
manufacturers specifications, instructions, etc.) and all
publications, patents, patent applications, GenBank sequences and
ATCC deposits, cited herein are hereby expressly incorporated by
reference for all purposes.
[0060] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
[0061] FIG. 1 panels summarize data showing the expression of
various chemokine receptors (indicated on the x-axis) on T cells
(first and second panel), monocytes (third panel) and neutrophils
(fourth panel) in the peripheral blood (white columns) and the
synovial fluid (gray columns) of patients with arthritis other than
gout; as described in detail in the Examples, below. Each dot
represents one patient and mean values are given as bars.
Expression of CXCR1 and CXCR2 on neutrophils is given as
fluorescence intensity on the y-axis, while in all other cases the
percentage of receptor positive cells is depicted.
[0062] FIG. 2 panels represent FACS dot plots showing the
expression of CCR5, CCR2 and CXCR4 on leukocytes in the peripheral
blood (left) and synovial fluid (right) of one patient with
rheumatoid arthritis. The cut-offs were set according to the
isotype controls and are shown as vertical lines. In the synovial
fluid the majority of T-cells and monocytes show a high level of
CCR5 expression, while in the peripheral blood only a minority of
these cells express low levels of CCR5.
[0063] FIG. 3 shows a schematic of the bispecific single-chain
antibody, and its simultaneous binding to a CCR5+ target cell and a
CD3+ T cell, e.g., a cytotoxic T cell. The .alpha.CCR5 single-chain
fragment (CCR5 VL/CCR5 VH) derived from the hybridoma MC-1 is fused
to the N-terminus of a single-chain fragment directed against CD3
(CD3 VH/CD3 VL). Binding of the bispecific antibody to CD3+ T cells
and CCR5 positive target cells results in crosslinkage of CD3,
activation of effector T cells (e.g., cytotoxic T cells) and lysis
of CCR5+ positive target cells.
[0064] FIG. 4 is a representation of an SDS-PAGE of the purified
bispecific single-chain antibody .alpha.CCR5-.alpha.CD3. A single
band of approx. 60 kD is visible under reducing (red.) (left) and
non-reducing ("non-red.") (right) conditions. No degradation or
proteolysis of the bispecific antibody is detectable. Molecular
weight (MW) markers in kilodaltons (kd) are shown to the right.
[0065] FIG. 5 is a schematic of the chemokine-toxin RANTES-PE38.
The chemokine RANTES is fused to the N-terminus of a truncated
version of the Pseudomonas exotoxin A (PE38). While the truncated
toxin alone is unable to bind to eukaryotic cells, the fusion
protein binds with the RANTES moiety to CCR5 and becomes
internalized into the cell and, once intracellular, the toxin can
inhibit protein synthesis and induce cell death.
[0066] FIG. 6 is a representation of an SDS-PAGE (left) and Western
blot (right) of the purified protein RANTES-PE38. A distinct band
with the expected size of approx. 46 kD is visible in the Coomassie
(protein-) stained SDS-PAGE and Western blot. Molecular weight (MW)
markers in kilodaltons (kd) are shown to the right.
[0067] FIG. 7 panels represent FACS histograms showing the binding
of the .alpha.CCR5-.alpha.CD3 bispecific antibody to CD3 on CCR5
deficient lymphocytes. Co-staining of the cells with CD4 specific
antibody and CD8 specific antibody demonstrated that the bispecific
antibody binds to a subpopulation of CD4+/CD8+ T cells. Multicolor
analysis showed that no binding to other cell populations
occurred.
[0068] FIG. 8 summarizes data measuring the binding of the
.alpha.CCR5-.alpha.CD3 bispecific antibody to CCR5 on transfected
CHO cells. CHO cells transfected with CCR5 are shown in black,
while CXCR4 positive CHO cells served as negative control and are
shown in white.
[0069] FIG. 9 summarizes data measuring the binding of the
.alpha.CCR5-.alpha.CD3 bispecific antibody to CCR5 on cultured
monocytes. Monocytes from a CCR5 positive donor are shown in black,
while monocytes from a CCR5 deficient (.DELTA.32/.DELTA.32) donor
served as negative control and are shown in white.
[0070] FIG. 10 summarizes data measuring the binding of CCR5
specific monoclonal antibodies to compare their ability to induce
downmodulation of CCR5, as analyzed by FACS. MAb MC-1 (squares),
the parental antibody of the .alpha.CCR5-.alpha.CD3 bispecific
antibody, showed significant internalization, while MC-4 (triangle)
showed no induction of CCR5 internalization. CHO-CCR5 cells were
incubated with various concentrations for 30 min at 37.degree.
C.
[0071] FIG. 11 summarizes data measuring the downmodulation of CCR5
from the surface of PBMC with RANTES-PE38 (open symbols) and RANTES
(closed symbols). Surface expression of CCR5 was determined on
lymphocytes (squares) and monocytes (circles) and is given as % of
the medium control. The fusion protein RANTES-PE38 is able to
downmodulate CCR5 from the cell surface with a somewhat lower
efficiency than unmodified RANTES.
[0072] FIG. 12 shows data measuring depletion of CCR5 positive
monocytes by a bispecific antibody of the invention. CCR5 deficient
PBMC (.DELTA.32/.DELTA.32) or wild-type PBMC (WT-PBMC) were
cultured overnight and incubated with the bispecific antibody (100
ng/ml) or medium as control for 20 hours (h). Remaining monocytes
(Mo) and lymphocytes (Ly) were identified by their light scatter
properties in FACS. The CCR5 positive wildtype monocytes were
completely depleted by the bispecific antibody, while the CCR5
deficient monocytes survived.
[0073] FIG. 13 summarizes data measuring depletion of CCR5 positive
monocytes by a bispecific antibody of the invention. Dose response
showing depletion of cultured monocytes with various concentrations
of the .alpha.CCR5-.alpha.CD3 bispecific antibody. More than 90% of
monocytes were depleted at a concentration of 33 ng/ml.
[0074] FIG. 14 summarizes data measuring depletion of lymphocytes
and monocytes from the synovial fluid of a patient with chronic
arthritis by the bispecific .alpha.CCR5-.alpha.CD3 antibody of the
invention. Freshly draw synovial fluid was incubated with various
concentrations of the bispecific antibody or medium as control for
20 h and analyzed by FACS. More than 95% of both cell types were
depleted at a concentration of 31 ng/ml.
[0075] FIG. 15 shows data measuring depletion of lymphocytes and
monocytes from the synovial fluid of a patient with chronic
arthritis by the bispecific .alpha.CCR5-.alpha.CD3 antibody of the
invention, as measured by FACS analysis. Freshly draw synovial
fluid was incubated with the bispecific antibody (500 ng/ml) or
medium as control for 20 h and analyzed by FACS (forward and
sideward light scatter analysis). The bispecific antibody
completely depleted the CCR5 positive monocytes and lymphocytes,
while the CCR5 negative granulocytes (PMN) survived. Consistent
with our previous data all monocytes and lymphocytes in this
synovial fluid expressed CCR5, while no expression of CCR5 was
found on granulocytes (PMN).
[0076] FIG. 16 summarizes data measuring the efficacy of the
.alpha.CCR5-.alpha.CD3 bispecific single-chain antibody of the
invention in depleting CCR5 positive monocytes, the antibody was
compared with the efficacy of two unmodified monoclonal antibodies
MC-1 and MC-5. PBMC from two different donors (F and N) were
cultured overnight and then incubated for 24 h with medium in the
presence or absence of antibody construct and antibody.
Concentrations were as indicated. The cells were completely
recovered and analyzed by FACS to quantify surviving monocytes and
lymphocytes. Shown are the results of two experiments per PBMC
donor. Surprisingly only the bispecific antibody was able to
considerably deplete CCR5 positive monocytes, while the unmodified
monoclonal antibodies were largely ineffective.
[0077] FIG. 17 shows examples of the forward and sideward light
scatter analysis of a representative experiment as shown in FIG.
16, indicating that only the .alpha.CCR5-.alpha.CD3 bispecific
single-chain antibody of the invention was capable of depleting the
monocytes in the left lower quadrants. For comparison of the
localization of different cell types also see FIG. 12 left
panel.
[0078] FIG. 18 shows FACS data demonstrating the destruction of
CCR5 positive CHO cells with the chemokine-toxin of the invention,
RANTES-PE38. CCR5 positive CHO cells and CXCR4 positive CHO cells
were incubated for 40 h with the chemokine-toxin (10 nM) and
analyzed by FACS. Dead cells appear in the left upper region of the
forward and sideward light scatter plot. RANTES-PE38 completely
destroyed the CCR5 positive CHO cells while it had no effect on the
CXCR4 positive CHO cells.
[0079] FIG. 19 is a schematic of exemplary antibody and/or
chemokine constructs of the invention binding to chemokine receptor
(CCR) expressing cells that are combined by peptide linkage or by
multimerization domains: (A) shows various examples of antibody and
chemokine constructs that interact with an effector cell by binding
to an effector cell surface antigen, (B) shows examples of antibody
and chemokine constructs that are linked to a toxin, (C) shows
examples of antibody and chemokine constructs, that contain an
antibody binding site for a toxin.
[0080] FIG. 20 graphically summarizes data showing the
concentration dependent binding of scFv CCR5xCD3 to CCR5 expressing
CHO cells, as described in detail in Example 8, below.
[0081] FIG. 21 graphically summarizes data as a dose response curve
showing the specific lysis of CCR5+CHO cells with primary T
lymphocytes as effector cells, as described in detail in Example 9,
below.
[0082] FIG. 22 graphically summarizes data demonstrating the
cytotoxic activity of scFv CCR5xCD3 with the T cell clone CB15 as
effector cells, as described in detail in Example 10, below.
[0083] FIG. 23 graphically summarizes data demonstrating that the
Mab MC-1 exclusively bound to human CCR5 but did not react with
CCR5 derived from rhesus macaques, as described in detail in
Example 11, below.
[0084] Like reference symbols in the various drawings indicate like
elements.
DETAILED DESCRIPTION
[0085] The invention provides chimeric polypeptides (e.g., chimeric
antibodies and chemokines constructs), nucleic acids and vectors
encoding them, and pharmaceuticals comprising these compositions
for the prevention and treatment of infections, e.g., infectious
diseases, including viral infections, such as HIV-1, and autoimmune
diseases. The binding of the antibody and/or chemokine constructs
of the present invention to a chemokine receptor results in the
depletion and/or destruction of a target cell. These target cells
include infected cells, such as cells latently infected with
primate (e.g., human) immunodeficiency viruses, including HIV-1.
Target cells can also include lymphocytes responsible for
autoimmune disease.
[0086] As discussed herein, it was surprisingly be shown that
highly specific antibodies directed against a chemokine receptor
were not able to destroy, lyse and/or deplete cells which express
said chemokine receptor. However, the antibody constructs or
chemokine constructs as described and disclosed in the present
invention specifically interacted with chemokines-receptor positive
cells and were able to deplete these cells. While the invention is
not limited by any particular mechanism of action, this
depletion/destruction may, e.g., be achieved by the attraction of
specific effector cells, such as monocytes, macrophages,
lymphocytes (e.g., T-cells, such as cytotoxic T-cells) or dendritic
cells. Even if monoclonal antibodies had been shown to be
successful in the destruction/depletion of malignant cells (see,
e.g., Maloney (1999), Sem. Oncol. 26, 76-78), they appear to be
ineffective against certain subtypes of leukocytes (comprising
lymphocytes, polynuclear leukocytes and monocytes), especially
CCR5.sup.+ monocytes, T-cells and dendritic cells as documented in
the examples, below.
[0087] In accordance with the present invention, the term "antibody
and/or chemokine construct" not only comprises the molecules and
multifunctional constructs and compounds as described herein, but
also comprises functional fragments thereof. Functional fragments
of the constructs are meant to be fragments which are capable of
binding to/interacting with a desired molecule on a target cell,
e.g., a chemokine receptor on a target cell, thus providing means
for depleting, lysing and/or destroying the target cell.
[0088] Specific chemokine receptors that are targeted by the
compositions of the invention, in accordance with the present
invention comprise, but are not limited to, CXCR3, CXCR4, CXCR5,
CXCR6, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, XCR1,
CCR10 and CX3CR1. Chemokines and/or chemokine ligands binding to
the chemokine receptors are well known in the art; examples of
receptors and corresponding ligands are shown, inter alia, in Table
4. Furthermore, chemokines and their corresponding receptors
(targeted by the compositions of the invention), are disclosed in,
e.g., U.S. Pat. Nos. 6,174,995; 6,172,061; 6,166,015; Murphy (2000)
Pharm. Reviews 52:145-176. The moiety that specifically binds to a
chemokine receptor can be a polypeptide or any other molecule, such
as a synthetic chemical, that specifically binds to a chemokines
receptor.
[0089] The present invention also relates to the use of a chimeric
polypeptide, e.g., an antibody and/or chemokine construct, which
binds to a chemokine receptor and depletes the cells expressing the
receptor for the treatment, prevention and/or alleviation of
inflammatory renal diseases, inflammatory joint diseases,
inflammatory bowel diseases, multiple sclerosis, skin diseases,
allergic reactions diabetes or transplant rejection. Skin diseases
comprise, inter alia, psoriatic disorders, atopic dermatitis or
chronically inflamed skin. CCR6 expression is upregulated in PBMCs
derived from patients with psoriasis. In addition, CCR6 ligand,
CCL20, (equivalent to MIP3alpha) and CCR6 are upregulated in
psoriatic skin. Furthermore, CCL20 expressing keratinocytes
colocalize with skin infiltrating T-cells (Homey (2000) J. Immunol.
164, 6621-6632).
[0090] CCR10 (known previously as orphan G-protein-coupled receptor
GPR2) is expressed by melanocytes, dermal fibroblasts, dermal
endothelial cells, T-cells and skin-derived Langerhans cells but
not keratinocytes. CCR10 ligand (CCL27; CTACK, see, e.g., Pan
(2000) J. Immunol. 165:2943-2949) has a skin associated expression
pattern (Homey (2000) J. Immunol. 164, 3465-3470; Charbonnier
(1999) J. Exp. Med 190, 1755-1768). Another CCR10 ligand,
mucosa-associated epithelial chemokine (MEC), is a novel chemokine
whose mRNA is most abundant in salivary gland, with strong
expression in other mucosal sites, including colon, trachea, and
mammary gland (see, e.g., Pan (2000) supra). Another CCR10 ligand
is CCL28, see, e.g., Wang (2000) J. Biol. Chem.
275:22313-22323.
[0091] CCR4 and its ligand (TARC, MDC) are upregulated in
chronically inflamed skin. Moreover CCR4 is a homing receptor for
T-cells entering the skin. CCR4+ T-cells are only a small
subpopulation of all T cells and therefore depletion of CCR4+
T-cells is indicated for various inflammatory skin diseases
(Campbell (1999) Nature 400, 776-780).
[0092] CCR3 and exotoxin expression is enhanced in atopic
dermatitis and may contribute to the initiation and maintenance of
inflammation (Yawalkar (1999) J. Invest. Dermatol. 113, 43-48).
CCR3 is expressed in epidermis of inflammatory skin lesions such as
atopic dermatitis (see, e.g., Wakugawa (2001) J. Dermatol. Sci.
25:229-235). CCR3 is known to be a ligand for chemokines such as
RANTES, eotaxin and monocyte-chemotactic protein-3 (MCP-3). The
compositions of the invention are also used for the preparation of
pharmaceutical compositions to treat or prevent infections,
inflammatory and other conditions.
[0093] Virtually all T-cells in rheumatoid arthritis, synovial
fluid and in various inflamed tissues such as ulcerative colitis,
chronic vaginitis and sarcoidosis express CXCR3 (see, e.g.,
Agostini (1998) J. Immunol. 161:6413-6420), whereas fewer T-cells
within normal lymph nodes are CXCR3 positive. Thus, chimeric
polypeptides of the invention targeting this CXCR3 chemokine
receptor are used in the treatment or prevention of these
conditions.
[0094] For multiple sclerosis, it was shown that CCR5 and CXCR3 are
predominantly expressed on T-cells infiltrating demyelinating brain
lesions, as well as in the peripheral blood of affected patients.
The corresponding ligands MIP-1.alpha. and IP-10 were also
detectable in the plaques (Balashov (1999) Proc. Natl. Acad. Sci.
96, 6873-6878). Elimination of the T-cells would block the T-cell
arm of this autoimmune disease. Thus, chimeric polypeptides of the
invention targeting CCR5 or CXCR3 chemokine receptors are used in
the treatment or prevention of these conditions.
[0095] Diabetes type I is considered to be a T-cell mediated
autoimmune disease. The expression of CCR5 receptor in the pancreas
was associated with the progression of type I diabetes in relevant
animal models (Cameron (2000) J. Immunol. 165, 1102-1110). In
particular, the CCR5 expression was associated with the development
of insulinitis and spontaneous type I diabetes. Specific chemokines
are associated with T-cell migration in diabetes type I relevant
animal model: RANTES, MCP-1, MCP-3, MCP-5, IP10. These chemokines
lead to a Th1 immune response (Bradley (1999) J. Immunol.
162:2511-2520). Thus, chimeric polypeptides of the invention
targeting receptors for RANTES, MCP-1, MCP-3, MCP-5, IP10 are used
in the treatment or prevention of these conditions.
[0096] The above mentioned inflammatory bowel disease may comprise
Morbus Crohn and colitis ulcerosa. CCR9 is expressed on T-cells
homing to the intestine and may be implied in Morbus Crohn and
colitis ulcerosa. All intestinal lamina propria and intraepithelial
lymphocytes express CCR9 (Zabel (1999) J. Exp. Med. 190,
1241-1256). Thus, chimeric polypeptides of the invention targeting
CCR9 receptors are used in the treatment or prevention of these
conditions.
[0097] Additionally, the antibody- and/or chemokine construct as
described in context of the present invention is also useful for
avoiding complications during and/or after transplants, i.e. to
avoid transplant rejections and graft versus host disease. CCR7 is
expressed on nive T-cells and dendritic cells and mediates cell
migration to lymphatic organs. Elimination of CCR7+ cells would
therefore prevent an immune response to novel antigens, e.g.,
following transplantation. Such a treatment would not be generally
immune suppressing but selective for novel antigens and limited for
the duration of the administration of drugs of the invention
depleting CCR7+ cells (Forster (1999) Cell 99, 23-33). CXCR5 is
expressed on nave B cells in the peripheral blood and tonsils and
memory T-cells. Elimination of CXCR5+ B-cells would prevent the
establishment of a humoral response. Furthermore, elimination of
memory T-cells would reduce the cellular component of the immune
response (Murphy (2000) Pharmacological Reviews 52:145-176).
[0098] In order to provide pharmaceutical compositions for the
treatment of allergies and/or allergic reactions, the antibody-
and/or chemokine constructs as described herein may be employed. It
was shown that CCR3 which binds exotoxin and RANTES, is expressed
on eosinophils, Th2 cells, mast cells, basophils, which are
involved in allergic reactions (Romangnani (1999) Am. J. Pathol.
155, 1195-1204). Thus, chimeric polypeptides of the invention
targeting CCR3 receptors are used in the treatment or prevention of
allergies and/or allergic reactions.
[0099] As far as the above mentioned renal or kidney diseases are
concerned, it has been shown that CCR5 positive T-cells may play a
role in interstitial processes leading to fibrosis. CCR5 positive
cells have been identified in the interstitial infiltrate of
various glomerular and interstitial diseases, as well as transplant
rejection. Said disease comprises acute and chronic nephritis, IgA
nephropathy, and others (Segerer (1999), Kidney Int. 56, 52-64).
Thus, chimeric polypeptides of the invention targeting CCR5
receptors are used in the treatment or prevention renal or kidney
diseases.
[0100] In one embodiment of the present invention, the invention
provides for the use of an antibody and/or chemokine construct
which binds to a chemokine receptor for the preparation of a
pharmaceutical composition as described hereinabove, wherein said
chemokine receptor is the chemokine receptor 5 (CCR5). The CCR5 can
be human CCR5.
[0101] The chemokine receptor CCR5 is a member of a large family of
G protein coupled seven transmembrane domain receptors that binds
the proinflammatory chemokines RANTES, MIP1-.alpha., MIP1-.beta.
and MCP-2. Chemokines act in concert with adhesion molecules to
induce the extravasation of leukocytes and to direct their
migration to sites of tissue injury. The human RANTES polypeptide,
and variations thereof, is described, e.g., in U.S. Pat. Nos.
5,965,697; 6,168,784.
[0102] The CCR5 is expressed on a minority of T-cells and monocytes
and is further the major co-receptor for M-trophic HIV-1 strains
that predominate early in the course of an HIV-infection. The
pharmaceutical composition of the invention is particularly useful
in the depletion of CCR5.sup.+ leukocytes and in the elimination of
cells latently infected with HIV-1 (as demonstrated in by data
discussed in Examples, below). Depletion of CCR5.sup.+ cells by the
compositions and methods of the invention will reduce the number of
cells latently infected with HIV; thus, the pharmaceuticals and
methods of the invention are particularly useful in combination
with active anti-viral, preferably anti-retroviral therapy.
[0103] Regarding the expression of CCR5 in different tissues and in
different diseases, immunochemical analysis of the expression of
the beta-chemokine receptors in post-mortem CNS tissue from
patients with multiple sclerosis revealed that in chronic active
multiple sclerosis (MS) lesions expression of CCR2, CCR3 and CCR5
was associated with foamy macrophages and activated microglia while
low levels of these chemokine receptors were expressed by
microglial cells in control CNS tissue. CCR2 and CCR5 were also
present on large numbers of infiltrating lymphocytes and in 5/14
cases of MS CCR3 and CCR5 were also expressed on astrocytes. The
elevated expression of CCR2, CCR3 and CCR5 in the CNS in MS
suggests these beta-chemokine receptors and their ligands play a
role in the pathogenesis of MS, see, e.g., Simpson (2000)
Neuroimmunol. 108:192-200. Accordingly, the compositions and
methods of the invention can be used to ameliorate MS.
[0104] High expression of CCR3 and CCR5 was also observed in T
cells and B cells of lymph nodes derived from patients with
Hodgkin's disease. While CCR3 was equally distributed in CD4+ and
CD8+ cells, CCR5 was mainly associated with CD4+ cells. These data
suggest that chemokines are involved in the formation of the
non-neoplastic leukocytic infiltrates in Hodgkin disease; see,
e.g., Buri (2001) Blood 97:1543-1548. Accordingly, the compositions
and methods of the invention can be used to ameliorate Hodgkin's
disease.
[0105] Periodontal disease is a peripheral infection involving
species of gram-negative organisms. In patients with moderate to
advanced periodontal disease CCR5 chemokine receptor expressing
cells were found in the inflammatory infiltrates. see, e.g.,
Gamonal (2001) J. Periodontal. Res. 36:194-203; Taubman (2001)
Crit. Rev. Oral. Biol. Med. 12:125-35. Accordingly, the
compositions and methods of the invention can be used to ameliorate
moderate to advanced periodontal disease.
[0106] In a model of transient immune complex glomerulonephritis
(IC-GN), CCR1, CCR2, and CCR5 were expressed early and were already
down-regulated at the peak of proteinuria and leukocyte
infiltration. Expression of CCR5 was located to the glomerulus by
in situ hybridization and quantitative reverse transcription-PCR of
isolated glomeruli (Anders, J. Am. Soc. Nephrol., 2001, 12,
919-31). In kidneys of 38 patients with several renal diseases,
CCR1- and CCR5-positive macrophages and T cells were detected in
both glomeruli and interstitium as shown by immunohistochemistry.
Renal CCR5-positive cells were dramatically decreased during
convalescence induced by glucocorticoids (Furuichi, Am. J.
Nephrol., 2000, 20, 291-9). Accordingly, the compositions and
methods of the invention can be used to ameliorate
glomerulonephritis.
[0107] In another aspect of the invention, the antibody construct
is a bispecific antibody that binds to a desired chemokine
receptor, such as a CCR5 or CCR3, as a first antigen and a CD3
antigen of an effector cell as a second antigen. The CD3 antigen
can be on the surface of a T-cell, such as a cytotoxic T-cell. CD3
is an antigen that is expressed on T cells and may be part of a
multimolecular (T-) cell receptor complex.
[0108] Bispecific antibodies may be constructed by hybrid-hybridoma
techniques, by covalently linking specific antibodies or by other
approaches, like the diabody approach (Kipriyanow, Int. J. Cancer
77 (1998), 763-773). In one aspect of the invention, the bispecific
antibody is a single chain antibody construct.
[0109] As is well known, Fv, the minimum antibody fragment which
contains a complete antigen recognition and binding site, consists
of a dimer of one heavy and one light chain variable domain
(V.sub.H and V.sub.L) in non-covalent association. In this
configuration that corresponds to the one found in native
antibodies the three complementarity determining regions (CDRs) of
each variable domain interact to define an antigen binding site on
the surface of the V.sub.H-V.sub.L dimer. Collectively, the six
CDRs confer antigen binding specificity to the antibody. Frameworks
(FRs) flanking the CDRs have a tertiary structure that is
essentially conserved in native immunoglobulins of species as
diverse as human and mouse. These FRs serve to hold the CDRs in
their appropriate orientation. The constant domains are not
required for binding function, but may aid in stabilizing
V.sub.H-V.sub.L interaction. Even a single variable domain (or half
of an Fv comprising only three CDRs specific for an antigen) has
the ability to recognize and bind antigen, although usually at a
lower affinity than an entire binding site (Painter, Biochem. 11
(1972), 1327-1337). Hence, said domain of the binding site of the
antibody construct as defined and described in the present
invention can be a pair of V.sub.H-V.sub.L, V.sub.H-V.sub.H or
V.sub.L-V.sub.L domains of different immunoglobulins. The order of
V.sub.H and V.sub.L domains within the polypeptide chain is not
decisive for the present invention, the order of domains given
hereinabove may be reversed usually without any loss of function.
It is important, however, that the V.sub.H and V.sub.L domains are
arranged so that the antigen binding site can properly fold.
[0110] Different parts of the antibodies/immunoglobulins can be
joined by means of conventional methods or constructed as a
contiguous protein by means of recombinant DNA techniques, e.g. in
such a way that a nucleic acid molecule coding for a chimeric or
humanized antibody chain is expressed in order to construct a
contiguous protein (e.g., see Mack (1995) Proc. Natl. Acad. Sci.
USA 92:7021-7025).
[0111] In one aspect, a single-chain antibody with the following Fv
fragments is used: sc-Fv fragment of a monoclonal antibody against
the chemokine receptor, such as, e.g., CCR5, and an sc-Fv fragment
of a monoclonal antibody against a T cell surface polypeptide,
e.g., a CD3. In this case, both the Fv fragment directed against
the chemokine receptor and the Fv fragment against CD3 may be
located in N-terminal position. The Fv fragment against CCR5 may be
in N-terminal position. The order of the V.sub.L and V.sub.H
antibody domains can be variable in both constructs, in one aspect,
the order of the Fv fragment against CCR5 is VL-VH and the one of
the Fv fragment against CD3 is VH-VL. The linkers between the
variable domains as well between the two Fv fragments may consist
of peptide linkers, preferably of a hydrophilic flexible glycine-
and serine-containing linker of 1 to 25 amino acids. An additional
epitope tag, e.g., a histidine chain of, e.g., 6.times.His, in C-
or N-terminal position, can be used to simplify purification and
detection.
[0112] Compared to conventional bispecific antibodies, bispecific
single-chain antibodies have the advantage that they consist of
only one protein chain and thus their composition is exactly
defined. They have a low molecular weight of normally <60 kD and
can be produced easily and on a large scale in suitable cell lines,
e.g. in CHO cells, using recombinant techniques. The most essential
advantage, however, is that they have no constant antibody domains
and thus only activate T-lymphocytes to lysis when these are bound
to their target cells, i.e. to the chemokine-receptor expressing
cells. Therefore, single-chain antibodies are often superior to
conventional bispecific antibodies as their clinical use entails
fewer or less severe side effects.
[0113] Therefore, in one aspect, the single chain antibody
construct comprises V.sub.L and V.sub.H domains of a antibody
specific for a chemokine receptor, such as a human CCR5, and
V.sub.H and V.sub.L domains of an antibody specific for a T cell
surface polypeptide, e.g., a CD3 antigen.
[0114] One exemplary antibody specific for the human CCR5 is the
murine anti-human CCR5 antibody MC-1, described, inter alia, in
Mack (1998) J. Exp. Med. 187:1215-1224, and in the appended
examples. MC-1 is the "parental" antibody that detects CCR5 whose
binding fragment was employed in the chimeric construct of
invention. As discussed in detail in Example 11, below, MC-1 was
shown to bind specifically to the first part of the second
extracellular loop of human CCR5 and did not cross-react with CCR5
derived from rhesus macaques.
[0115] Other .alpha.-CCR5 antibodies, like MC-5 (as characterized
in the appended examples and disclosed in Segerer (1999), loc.
cit.) also may be employed in the context of this invention. The
antibody specific for the T cell surface polypeptide, such as a CD3
antigen, may be selected from the group consisting of antibodies
recognizing the gamma, delta, epsilon, zeta chains, such as the CD3
zeta chain (Jakobs (1997) Cancer Immunol Immunother. 44, 257-264;
Mezzanzanica (1991) Cancer Res 51, 5716-5721). Examples of
anti-epsilon chain antibodies are OKT3 (WO 91/09968, Kung (1979)
Science 206:347-349; Van Wauwe, J. Immunol. 124, 2708-2713 (1980);
Transy, Eur. J. Immunol. 19, 947-950 (1989); Woodle, J. Immunol.
148, 2756-2763 (1992); Ada, Human. Antibod. Hybridomas, 41-47
(1994)) and TR66 (Traunecker (1991) EMBO J. 10, 3655-3659).
Examples of monoclonal antibodies against the CD3 zeta chain are
H2D9, TIA2 (both Becton Dickinson), G3 (Serotec Ltd.).
[0116] In one embodiment of the use of the present invention, the
V.sub.L and V.sub.H domains of the single chain antibody as
described above are arranged in the order
V.sub.L(MC-1)-V.sub.H(MC-1)-V.sub.H(CD3)-V.sub.L(CD- 3). In
alternative aspects, the V.sub.L(MC-1) comprises the amino acid
sequence as depicted in SEQ ID NO:12, wherein said V.sub.H(MC-1)
comprises the amino acid sequence as depicted in SEQ ID NO: 16,
wherein said V.sub.H(CD3) comprises the amino acid sequence as
depicted in SEQ ID NO:26 and/or wherein said V.sub.L(CD3) comprises
in SEQ ID NO:28. Specific CDR parts of the MC-1 antibody are shown
in SEQ ID NO:29 to SEQ ID NO:34, wherein SEQ ID NO: 29 shows the
CDR1 of V.sub.L MC-1, SEQ ID NO: 30 shows the CDR2 of V.sub.L MC-1,
SEQ ID NO: 31 shows the CDR3 of V.sub.L-MC-1, SEQ ID NO: 32 shows
the CDR1 of V.sub.H MC-1, SEQ ID NO:33 shows the CDR2 of V.sub.H
MC-1 and SEQ ID NO:34 depicts the CDR 3 of V.sub.H MC-1. Said
bispecific antibody may, inter alia, comprise an amino acid
sequence encoded by the nucleic acid sequence as depicted in SEQ ID
NO: 17 or comprises the amino acid sequence as depicted in SEQ ID
NO: 18.
[0117] In another embodiment of the invention, the antibody
construct is a bispecific antibody that binds to a chemokine
receptor as a first antigen and a toxin as a second antigen. The
antibody may be covalently bound to the toxin, and the
antibody-toxin construct may be constructed by chemical coupling,
producing a fusion protein or a mosaic protein from the antibody
and from a modified or unmodified prokaryotic or eukaryotic toxin.
Furthermore, the antibody may be joined to a toxin via
multimerization domains.
[0118] In a further embodiment of the present invention, the
antibody construct can, via a multimerization domain, be bound in
vitro and/or in vivo to a second antibody construct which binds to
a CD3 antigen and/or a toxin. The multimerization may, inter alia,
be obtained via hetero(di)merization. For example, the
hetero(di)merization region of constant immunoglobulin domains may
be employed. Other multi- and/or heterodimerization domains are
known in the art and are based on leucine zippers, .alpha.- and
.beta.-chains of T-cell receptors or MHC-class II molecules.
Furthermore, jun- and fos-based domains may be employed (de Kuif
(1996) J. Biol. Chem. 271:7630-7634; Kostelny (1992), J. Immunol.
148, 1547-1553). Additional examples of multimerization domains are
p53- and MNT-domains as described, e.g., in Sakamoto (1994) Proc.
Natl. Acad. Sci. USA 91, 8974-8978; Lee (1994) Nat. Struct. Biol.
1, 877-890; Jeffrey (1995) Science 267, 1498-5102 or Nooren (1999)
Nat. Struct. Biol. 6, 755-759.
[0119] In another embodiment of the invention, the chimeric
polypeptide of the invention, e.g., a chemokine construct, is a
fusion construct of a modified or an unmodified chemokine with a
modified or an unmodified toxin. The construct may be bound in
vitro and/or in vivo, e.g., by a multimerization domain, to an
antibody construct which binds to a T cell surface polypeptide,
e.g., a CD3 antigen, and/or to a toxin. Suitable multimerization
domains have been described in the art and are described herein.
The chemokine-toxin constructs may, inter alia, result from
chemical coupling, may be recombinantly produced (as shown in the
appended examples), or may be produced as a fusion protein from a
chemokine and a modified or unmodified prokaryotic or eukaryotic
toxin. In one aspect, the moiety that specifically binds to a
chemokine receptor, e.g., a chemokine or fragment thereof, binds to
a human chemokine receptor, e.g., CCR5, and comprises, inter alia,
RANTES, MIP-1.alpha., MIP-1.beta., MCP-2, MCP-3 or (a) fragment(s)
thereof which are capable of binding to the desired chemokine
receptor.
[0120] The compositions of the invention can comprise any cytotoxic
agent. For example, in one aspect, the toxin may be a polypeptide
toxin, e.g., a Pseudomonas exotoxin, like PE38, PE40 or PE37, or a
truncated version thereof, or a ribosome inactivating protein
gelonin (e.g., Boyle (1996) J. Immunol. 18:221-230), and the like.
The compositions of the invention can be conjugated to any
cytotoxic pharmaceuticals, e.g., radiolabeled with a cytotoxic
agents, such as, e.g., .sup.131I (e.g., Shen (1997) Cancer 80(12
Suppl):2553-2557), copper-67 (e.g., Deshpande (1988) J. Nucl. Med.
29:217-225).
[0121] Furthermore, and in accordance with the present invention,
the chemokine construct may comprise the chemokine covalently bound
to an antibody construct which binds to an antibody construct
capable of binding to a T cell surface polypeptide, e.g., a CD3
antigen, and/or which is a covalently bound to a toxin.
[0122] In one embodiment of the present invention, the antibody
and/or chemokine construct is a heterominibody construct comprising
at least an antibody and/or a chemokine which binds to a chemokine
receptor, such as the CCR5 or CCR3 receptor, e.g., a human CCR5 or
CCR3 receptor. The heterominibody construct may comprise at least
one toxin; in one aspect the heterominibody construct binds to the
chemokine receptor as defined hereinabove and/or to a T cell
surface polypeptide, e.g., a CD3 antigen, of an effector cell.
Exemplary chemokines are mentioned hereinabove; exemplary toxins
are described hereinabove, which may be modified or unmodified.
Chemokines are well known in the art and described, inter alia, in
Murphy (1999), loc. cit. Therefore, the chemokine can be selected
from the group consisting of RANTES, MIP-1.beta., MIP-1.alpha.,
MCP-2, and MCP-3 or a functional fragment thereof. In one aspect,
the chemokine is RANTES. Functional fragments of chemokines are
fragments that are capable of binding to or interacting with the
chemokine receptor, e.g., a human CCR5. Heterominibodies are known
in the art and their production is described, inter alia, in WO
00/06605. The heterominibody may be a multifunctional compound
comprising at least one antibody and/or chemokine binding to or
interacting with a chemokine receptor, such as human CCR5 or CCR3,
may (additionally) comprise a toxin as defined herein and/or a
binding site for a T cell surface polypeptide, e.g., the CD3
antigen.
[0123] In one embodiment, the antibody- or chemokine construct is a
fusion (poly)peptide or a mosaic (poly)peptide. The fusion
(poly)peptide may comprise merely the domains of the constructs as
described herein, as well as (a) functional fragment(s) thereof.
However, it is also envisaged that said fusion (poly)peptide
comprises further domains and/or functional stretches. Therefore,
said fusion (poly)peptide can comprise at least one further domain,
this domain being linked by covalent or non-covalent bonds. The
linkage as well as the construction of such constructs, can be
based on genetic fusion according to the methods known in the art
(e.g., Sambrook et al., loc. cit., Ausubel, "Current Protocols in
Molecular Biology", Green Publishing Associates and Wiley
Interscience, N.Y. (1989)) or can be performed by, e.g., chemical
cross-linking as described in, e.g., WO 94/04686. The additional
domain present in the construct may be linked by a flexible linker,
such as a (poly)peptide linker, wherein the (poly)peptide linker
can comprises plural, hydrophilic, peptide-bonded amino acids of a
length sufficient to span the distance between the C-terminal end
of said further domain and the N-terminal end of the peptide,
(poly)peptide or antibody or vice versa. The linker may, inter
alia, be a Glycine, a Serine and/or a Glycine/Serine linker.
Additional linkers comprise oligomerization domains.
Oligomerization domains can facilitate the combination of two or
several autoantigens or fragments thereof in one functional
molecule. Non-limiting examples of oligomerization domains comprise
leucine zippers (like jun-fos, GCN4, E/EBP; Kostelny, J. Immunol.
148 (1992), 1547-1553; Zeng, Proc. Natl. Acad. Sci. USA 94 (1997),
3673-3678, Williams, Genes Dev. 5 (1991), 1553-1563; Suter, "Phage
Display of Peptides and Proteins", Chapter 11, (1996), Academic
Press), antibody-derived oligomerization domains, like constant
domains CH1 and CL (Mueller, FEBS Letters 422 (1998), 259-264)
and/or tetramerization domains like GCN4-LI (Zerangue, Proc. Natl.
Acad. Sci. USA 97 (2000), 3591-3595).
[0124] Furthermore, the antibody- or chemokine construct to be used
in the present invention, as described herein, may comprise at
least one further domain, inter alia, domains which provide for
purification means, like, e.g. histidine stretches. The further
domain(s) may be linked by covalent or non-covalent bonds.
[0125] The linkage can be based on genetic fusion according to the
methods known in the art and described herein or can be performed
by, e.g., chemical cross-linking as described in, e.g., WO
94/04686. The additional domain present in the construct as
described and disclosed in the invention may be linked by a
flexible linker, such as a polypeptide linker to one of the binding
site domains; the polypeptide linker can comprise plural,
hydrophilic or peptide-bonded amino acids of a length sufficient to
span the distance between the C-terminal end of one of said domains
and the N-terminal end of the other of said domains when said
polypeptide assumes a conformation suitable for binding when
disposed in aqueous solution. The polypeptide linker can be a
polypeptide linker as described. The polypeptide of the invention
may further comprise a cleavable linker or cleavage site for
proteinases, such as enterokinase
[0126] It is also envisaged that said constructs disclosed for
uses, compositions and methods of the present invention comprises
(a) further domain(s) which may function as immunomodulators. The
immunomodulators comprise, but are not limited to cytokines,
lymphokines, T cell co-stimulatory ligands, etc.
[0127] Adequate activation resulting in priming of naive T-cells is
critical to primary immunoresponses and depends on two signals
derived from professional APCs (antigen-presenting cells) like
dendritic cells. The first signal is antigen-specific and normally
mediated by stimulation of the clonotypic T-cell antigen receptor
(TCR) that is induced by processed antigen presented in the context
of MHC class-I or MHC class-II molecules. However, this primary
stimulus is insufficient to induce priming responses of naive
T-cells, and the second signal is required which is provided by an
interaction of specific T-cell surface molecules binding to
co-stimulatory ligand molecules on antigen presenting cells (APCs),
further supporting the proliferation of primed T-cells. The term
"T-cell co-stimulatory ligand" therefore denotes in the light of
the present invention molecules, which are able to support priming
of naive T-cells in combination with the primary stimulus and
include, but are not limited to, members of the B7 family of
proteins, including B7-1 (CD80) and 137-2 (CD86).
[0128] The antibody- and/or chemokine construct described herein
may comprise further receptor or ligand function(s), and may
comprise immuno-modulating effector molecule or a fragment thereof.
An immuno-modulating effector molecule positively and/or negatively
influences the humoral and/or cellular immune system, particularly
its cellular and/or non-cellular components, its functions, and/or
its interactions with other physiological systems. The
immuno-modulating effector molecule may be selected from the group
consisting of cytokines, chemokines, macrophage migration
inhibitory factor (MIF; as described, inter alia, in Bernhagen
(1998), Mol Med 76(3-4); 151-61 or Metz (1997), Adv Immunol 66,
197-223), T-cell receptors and soluble MHC molecules. Such
immuno-modulating effector molecules are well known in the art and
are described, inter alia, in Paul, "Fundamental immunology", Raven
Press, New York (1989). In particular, known cytokines and
chemokines are described in Meager, "The Molecular Biology of
Cytokines" (1998), John Wiley & Sons, Ltd., Chichester, West
Sussex, England; (Bacon (1998). Cytokine Growth Factor Rev
9(2):167-73; Oppenheim (1997). Clin Cancer Res 12, 2682-6; Taub,
(1994) Ther. Immunol. 1(4), 229-46 or Michiel, (1992). Semin Cancer
Biol 3(1), 3-15).
[0129] Antibody and/or chemokine constructs of the present
invention can comprise (an) additional functional domain(s) and
may, inter alia, be multifunctional compounds, like
heterominibodies, as described herein.
[0130] The constructs of the present invention may comprise domains
originating from one species, e.g., from mammals, such as human.
However, chimeric and/or humanized constructs are also envisaged
and within the scope of the present invention.
[0131] In one embodiment, the construct of the invention comprises
a cross-linked (poly)peptide construct. As described herein, the
cross-linking may be based on methods known in the art, which
comprise recombinant as well as biochemical methods.
[0132] In embodiment of the present invention, the chimeric
polypeptide, e.g., an antibody construct or a chemokine construct,
comprises at least one toxin. The toxin may be Pseudomonas exotoxin
A, diphtheria toxin and similar toxins. It is envisaged that
truncated toxins are employed, like the PE38 or the PE40 of
Pseudomonas toxin described in the appended examples. The toxin may
be bound to said antibody or chemokine by means as described
herein. It is also envisaged that said toxin is bound to the
chimeric polypeptide (e.g., antibody/chemokines) by means of a
short peptide linker. The linker can comprise a flexible and
hydrophilic amino acid sequence, e.g., of glycines and serines. The
linker can has a length of 1 to about 20 amino acids, or more.
[0133] Several fusion proteins with a truncated version of
Pseudomonas exotoxin A have been designed. Most of them have been
used to target and destroy malignant cells. This toxin becomes
activated upon proteolytic cleavage. A truncated version of the
toxin (PE38) may be employed for the constructs of the present
invention, as the full-length protein binds with its fist domain to
the ubiquitous .alpha.2-macroglobulin receptor and is therefore
toxic to most eukaryotic cells. Yet, this problem may be overcome
by replacing the first domain of Pseudomonas exotoxin A by a
specific sequence in order to alter the binding specificity of the
toxin.
[0134] In one aspect, the present invention relates to the use of a
chemokine construct which binds to a chemokine receptor for the
preparation of a pharmaceutical composition for the elimination of
cells which are latently infected with a primate immunodeficiency
virus, wherein the chemokine construct comprises a amino acid
sequence as depicted in SEQ ID NO:24 or as encoded by the
nucleotide sequence as depicted in SEQ ID NO:23.
[0135] As mentioned herein, in one embodiment the chimeric
polypeptide of the invention (e.g., antibody and/or chemokine
constructs) can bind to or interact with a T cell surface
polypeptide, e.g., the CD3 antigen. The T cell surface polypeptide
(e.g., CD3 antigen) can be on the surface of an effector cell, such
as a T-cell, e.g., a cytotoxic T-cell. In one embodiment, the
antibody construct can comprises a binding site for CCR5 and a
binding site for CD3. In one aspect, the chemokine construct
comprises RANTES and a toxin, e.g., a polypeptide toxin, e.g., a
truncated Pseudomonas exotoxin A (PE38), or equivalent thereof. The
chimeric polypeptides of the present invention, therefore, can
comprise antibody constructs comprising a binding site for CCR5 and
a binding site for CD3 as well as to chemokine constructs
comprising RANTES and the truncated Pseudomonas exotoxin A
(PE38).
[0136] The present invention also relates to a polynucleotide
encoding an antibody-construct as defined hereinabove or a
polynucleotide encoding a chemokine construct as defined herein,
wherein the polynucleotide can comprise a nucleic acid molecule
encoding a polypeptide as depicted in SEQ ID NO:18 or SEQ ID NO:24;
a polynucleotide comprising a nucleic acid molecule as depicted in
SEQ ID NO:17 or SEQ ID NO:23; or a polynucleotide hybridizing under
stringent conditions to a nucleic acid molecule as depicted in SEQ
ID NO:17 or SEQ ID NO:23, such as a complementary strand of on of
these polynucleotides.
[0137] With respect to the polynucleotides/nucleotide sequences of
the invention, the term "hybridizing" in this context is understood
as referring to conventional hybridization conditions, preferably
such as hybridization in 50% formamide/6.times.SSC/0.1% SDS and 100
.mu.g/ml ssDNA, in which temperatures for hybridization are above
37.degree. C. and temperatures for washing in 0.1.times.SSC/0.1%
SDS are above 55.degree. C. Most preferably, the term "hybridizing"
refers to stringent hybridization conditions, for example such as
described in Sambrook., "Molecular Cloning: A Laboratory Manual",
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989. It is envisaged that the polynucleotides identified by
hybridization, as described above, are highly homologous to the
polynucleotides as defined herein (e.g., SEQ ID NO: 17 or SEQ ID
NO: 23) and comprise a homology of at least about 95%, at least
about 97%, or about 99% with the polynucleotides of SEQ ID NO: 17
or SEQ ID NO: 23.
[0138] Polynucleotides as defined and characterized by
hybridization to SEQ ID NO: 17 or SEQ ID NO: 23, therefore, may
encode for polypeptides being highly homologous to the polypeptides
as defined in SEQ ID NO: 18 or SEQ ID NO: 24. The person skilled in
the art can easily test the capacity of such homologous
polypeptides to bind to chemokine receptors, such as a human CCR5
or CCR3 receptor, and the like, and/or to eliminate, deplete and/or
destroy cells, such as infected cells, for example, cells which are
infected by a primate immunodeficiency virus, like HIV-1, or
eliminate, deplete and/or destroy target cells involved in
immunological disorders, as disclosed herein. The person skilled in
the art can easily adopt the in vitro, in vivo and ex vivo
experiments of the appended examples to verify the binding and/or
depletion properties of such constructs.
[0139] Furthermore, the polynucleotide/nucleic acid molecules of
the invention may contain, for example, thioester bonds and/or
nucleotide analogues. The modifications may be useful for the
stabilization of the nucleic acid molecule, e.g., against endo-
and/or exonucleases in the cell. These nucleic acid molecules may
be transcribed by an appropriate vector containing a chimeric gene
which allows for the transcription of said nucleic acid molecule in
the cell. The polynucleotide/nucleic acid molecules of the
invention may be a recombinantly produced chimeric nucleic acid
molecule comprising any of the aforementioned nucleic acid
molecules either alone or in combination. The polynucleotide may
be, e.g., DNA, cDNA, RNA or synthetically produced DNA or RNA or a
recombinantly produced chimeric nucleic acid molecule comprising
any of those polynucleotides either alone or in combination. The
polynucleotide can be part of a vector, e.g., an expression vector,
including, e.g., recombinant viruses. The vectors may comprise
further genes, such as marker genes, that allow for the selection
of the vector in a suitable host cell and under suitable
conditions.
[0140] In one aspect, the polynucleotides of the invention are
operatively linked to expression control sequences allowing
expression in prokaryotic or eukaryotic cells. Expression of the
polynucleotide comprises transcription of the polynucleotide into a
translatable mRNA. Regulatory elements ensuring expression in
cells, including eukaryotic cells, such as mammalian cells, are
well known to those skilled in the art. They usually comprise
regulatory sequences ensuring initiation of transcription, and,
optionally, poly-A signals ensuring termination of transcription
and stabilization of the transcript. Additional regulatory elements
may include transcriptional as well as translational enhancers,
and/or naturally-associated or heterologous promoter regions.
Exemplary regulatory elements permitting expression in prokaryotic
host cells comprise, e.g., the PL, lac, trp or tac promoter in E.
coli, and examples for regulatory elements permitting expression in
eukaryotic host cells are the AOX1 or GAL1 promoter in yeast or the
CMV-, SV40-, RSV-promoter (Rous sarcoma virus), CMV-enhancer,
SV40-enhancer or a globin intron in mammalian and other animal
cells. The nucleic acids of the invention can also comprise, in
addition to elements responsible for the initiation of
transcription, other elements, such regulatory elements and
transcription termination signals, such as the SV40-poly-A site or
the tk-poly-A site (termination sequences are typically downstream
of the polynucleotide coding sequence). Furthermore, depending on
the expression system used, nucleic acid sequences encoding leader
sequences capable of directing the polypeptide to a cellular
compartment, or secreting it into the medium, may be added to the
coding sequence of the polynucleotide of the invention; such leader
sequences are well known in the art; see also, e.g., the appended
examples. The leader sequence(s) is (are) assembled in appropriate
phase with translation, initiation and termination sequences. In
one aspect, the leader sequence is capable of directing secretion
of translated chimeric protein, or a portion thereof, into the
periplasmic space or extracellular medium. Optionally, the
heterologous sequence can encode a fusion protein including an
N-terminal identification peptide imparting desired
characteristics, e.g., stabilization or simplified purification of
expressed recombinant product; see supra. In this context, suitable
expression vectors are known in the art such as Okayama-Berg cDNA
expression vector pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3
(In-vitrogene), or pSPORT1 (GIBCO BRL). Expression control
sequences can be eukaryotic promoter systems in vectors capable of
transforming or transfecting eukaryotic host cells; control
sequences for prokaryotic hosts may also be used. Once the vector
has been incorporated into the appropriate host, the host can be
maintained under conditions suitable for high level expression of
the nucleotide sequences; and, as desired, the collection and
purification of the polypeptide of the invention may follow; see,
e.g., the appended examples.
[0141] As described above, the polynucleotide of the invention can
be used alone or as part of a vector (e.g., an expression vector or
a recombinant virus), or in cells, to express the chimeric
polypeptides of the invention (e.g., antibody- and/or chemokine
constructs); these polynucleotides can be used for, e.g., the
treatment of immunological disorders or to treat infections, e.g.,
in anti-viral therapy. The polynucleotides or vectors containing
the DNA sequence(s) encoding any one of the chimeric polypeptides
of the invention can be introduced into the cells, which in turn
produce the polypeptide of interest. In one aspect, the
polynucleotides and vectors are used for gene therapy. Gene
therapy, which is based on introducing therapeutic genes into cells
by ex vivo or in vivo techniques, is one of the most important
applications of gene transfer. Suitable vectors, methods or
gene-delivery systems for in vitro, ex vivo or in vivo gene therapy
are described in the literature and are known to the person skilled
in the art; see, e.g., Giordano (1996) Nature Medicine 2:534-539;
Schaper, Circ. Res. 79 (1996), 911-919; Anderson, Science 256
(1992), 808-813; Verma, Nature 389 (1994), 239; Isner, Lancet 348
(1996), 370-374; Muhlhauser, Circ. Res. 77 (1995), 1077-1086;
Onodera, Blood 91 (1998), 30-36; Verma, Gene Ther. 5 (1998),
692-699; Nabel, Ann. N.Y. Acad. Sci. 811 (1997), 289-292;
Verzeletti, Hum. Gene Ther. 9 (1998), 2243-51; Wang, Nature
Medicine 2 (1996), 714-716; WO 94/29469; WO 97/00957, U.S. Pat. No.
5,580,859; U.S. Pat. No. 5,589,466; or, Schaper, Current Opinion in
Biotechnology 7 (1996), 635-640, and references cited therein. The
polynucleotides and vectors of the invention may be designed for
direct introduction or for introduction via liposomes, or viral
vectors (e.g., adenoviral, retroviral) into the cell. The cell can
be a germ line cell, an embryonic cell, or an egg cell, or a cell
derived therefrom, e.g., a stem cell. An exemplary embryonic stem
cell is described, e.g., in Nagy (1993) Proc. Natl. Acad. Sci. USA
90:8424-8428.
[0142] The present invention is directed to vectors, e.g.,
plasmids, cosmids, viruses and bacteriophages, or any expression
system used conventionally in genetic engineering, that comprise a
polynucleotide encoding a chimeric polypeptide of the invention.
The vector can be an expression vector and/or a gene transfer or
targeting vector. Expression vectors derived from viruses such as
retroviruses, vaccinia virus, adeno-associated virus, herpes
viruses, or bovine papilloma virus, may be used for delivery of the
polynucleotides or vectors of the invention into targeted cell
populations. Methods which are well known to those skilled in the
art can be used to construct recombinant vectors; see, for example,
the techniques described in Sambrook, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and
Ausubel, Current Protocols in Molecular Biology, Green Publishing
Associates and Wiley Interscience, N.Y. (1989). Alternatively, the
polynucleotides and vectors of the invention can be reconstituted
into liposomes for delivery to target cells. The vectors containing
the polynucleotides of the invention can be transferred into the
host cell by well-known methods, which vary depending on the type
of cellular host. For example, calcium chloride transfection is
commonly utilized for prokaryotic cells, whereas calcium phosphate
treatment or electroporation may be used for other cellular hosts;
see Sambrook, supra.
[0143] Once expressed, the polypeptides of the present invention
can be purified according to standard procedures of the art,
including ammonium sulfate precipitation, affinity columns, column
chromatography, gel electrophoresis and the like; see, Scopes,
"Protein Purification", Springer-Verlag, N.Y. (1982). In
alternative aspects, the invention is directed to substantially
pure chimeric polypeptides of at least about 90% to about 95%
homogeneity; between about 95% to 98% homogeneity; and about 98% to
about 99% or more homogeneity; these "substantially pure"
polypeptides can be used in the preparation of pharmaceuticals.
Once purified, partially or to a homogeneity as desired, the
polypeptides may then be used therapeutically (including
extracorporeally) or in developing and performing assay
procedures.
[0144] In a still further embodiment, the present invention relates
to a cell containing the polynucleotide or vector of the invention,
or to a host cell transformed with a polynucleotide or vector of
the invention. In alternative aspects, the host/cell is a
eukaryotic cell, such as a mammalian cell, particularly if
therapeutic uses of the polypeptide are envisaged. Of course, yeast
and prokaryotic, e.g., bacterial cells, may serve as well, in
particular, if the produced polypeptide is used for
non-pharmaceutical purposes, e.g., as in diagnostic tests or kits
or in screening methods.
[0145] The polynucleotide or vector of the invention that is
present in the host cell may either be integrated into the genome
of the host cell or it may be maintained extrachromosomally, e.g.,
as an episome.
[0146] The term "prokaryotic" is meant to include all bacteria that
can be transformed or transfected with a DNA or RNA molecules for
the expression of a polypeptide of the invention. Prokaryotic hosts
may include gram negative as well as gram positive bacteria such
as, for example, E. coli, S. typhimurium, Serratia marcescens and
Bacillus subtilis. The term "eukaryotic" is meant to include yeast,
higher plant, insect and mammalian cells. Depending upon the host
employed in a recombinant production procedure, the polypeptides of
the present invention may be glycosylated or may be
non-glycosylated. Polypeptides of the invention may also include an
initial methionine amino acid residue. A polynucleotide coding for
a polypeptide of the invention can be used to transform or
transfect the host using any of the techniques commonly known to
those of ordinary skill in the art. In one aspect, the nucleic
acids encoding the chimeric polypeptide of the invention (including
those sequences in vectors, e.g., plasmid or virus) further
comprise, genetically fused thereto, sequences encoding an epitope
tag, e.g., an N-terminal FLAG-tag and/or a C-terminal His-tag. In
one aspect, the length of said FLAG-tag is about 4 to 8 amino
acids; or, is about 8 amino acids in length. Methods for preparing
fused, operably linked genes and expressing them in, e.g.,
mammalian cells and bacteria are well-known in the art (Sambrook,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1989). The genetic constructs
and methods described therein can be utilized for expression of the
polypeptide of the invention in eukaryotic or prokaryotic hosts. In
general, expression vectors containing promoter sequences which
facilitate the efficient transcription of the inserted
polynucleotide are used in connection with the host. The expression
vector typically contains an origin of replication, a promoter, and
a terminator, as well as specific genes which are capable of
providing phenotypic selection of the transformed cells.
Furthermore, transgenic non-human animals, such as mammals (e.g.,
mice, goats), comprising nucleic acids or cells of the invention
may be used for the large scale production of the chimeric
polypeptides (e.g., the antibody- and/or chemokine construct) of
the invention. For example, in one aspect, a transgenic non-human
animal of the invention is used to produce an antibody or a
chemokine construct of the invention.
[0147] In a further embodiment, the invention is directed to a
process for the preparation of a polypeptide of the invention
comprising cultivating a (host) cell of the invention under
conditions suitable for the expression of the antibody- and/or
chemokine construct and isolating the polypeptide from the cell or
the culture medium. The transformed hosts can be grown in
fermentors and cultured according to techniques known in the art to
achieve optimal cell growth. The produced constructs of the
invention can then be isolated from the growth medium, cellular
lysates, or cellular membrane fractions. The isolation and
purification of the expressed polypeptides of the invention (e.g.,
microbially expressed) may be by any conventional means such as,
e.g., preparative chromatographic separations and immunological
separations, such as those involving the use of monoclonal or
polyclonal antibodies directed against, e.g., a tag of the
polypeptide of the invention or as described in the appended
examples.
[0148] Depending on the host cell, renaturation techniques may be
required to attain proper conformation. If necessary, point
substitutions seeking to optimize binding may be made in the DNA
using conventional cassette mutagenesis or other protein
engineering methodology such as is disclosed herein. Preparation of
the polypeptides of the invention may also be dependent on
knowledge of the amino acid sequence (or corresponding DNA or RNA
sequence) of bioactive proteins such as enzymes, toxins, growth
factors, cell differentiation factors, receptors, anti-metabolites,
hormones or various cytokines or lymphokines. Such sequences are
reported in the literature and available through computerized data
banks. The present invention further relates to a chimeric
polypeptide, e.g., an antibody construct or a chemokine construct,
encoded by a polynucleotide of the invention or produced by the
method described hereinabove.
[0149] Additionally, the present invention provides for
compositions comprising the polynucleotide, the vector, the host
cell, the chimeric polypeptide (e.g., antibody construct and/or the
chemokine construct) of the invention.
[0150] The term "composition", in context of this invention,
comprises at least one polynucleotide, vector, host cell, chimeric
polypeptide (e.g., antibody construct and/or chemokine construct)
of the invention, as described herein. Said composition,
optionally, further comprises other molecules, either alone or in
combination, such as molecules which are capable of modulating
and/or interfering with the immune system. The composition may be
in solid, liquid or gaseous form and may be, inter alia, in a form
of a powder(s), a tablet(s), a solution(s) or an aerosol(s). In
alternative embodiments, the composition comprises at least two, at
least three, at least four, or more than four, compounds of the
invention. The composition can be a pharmaceutical composition
further comprising, optionally, a pharmaceutically acceptable
carrier, diluent and/or excipient.
[0151] Examples of suitable pharmaceutical carriers are well known
in the art and include phosphate buffered saline solutions, water,
emulsions, such as oil/water emulsions, various types of wetting
agents, sterile solutions, etc. Compositions comprising such
carriers can be formulated by well known conventional methods.
These pharmaceutical compositions can be administered to the
subject at a suitable dose. Administration of the suitable
compositions may be effected by different ways, e.g., by
intravenous, intraperitoneal, subcutaneous, intramuscular, topical,
intra-articular (including into or near the joint space) or
intradermal administration. The dosage regiment can be determined
by the attending physician and clinical factors. As is well known
in the medical arts, dosages for any one patient depends upon many
factors, including the patient's size, body surface area, age, the
particular compound to be administered, sex, time and route of
administration, general health, and other drugs being administered
concurrently. Generally, the regimen as a regular administration of
the pharmaceutical composition should be in the range of about 1
.mu.g to 10 mg units per day. If the regimen is a continuous
infusion, it can also be in the range of about 1 .mu.g to 10 mg
units per kilogram of body weight per minute, respectively. An
alternative dosage for continuous infusion may be in the range of
about 0.01 .mu.g to 10 mg units per kilogram of body weight per
hour. Other exemplary dosages are recited herein below. Progress
can be monitored by periodic assessment. Dosages will vary; for
example, a dosage for intravenous administration of DNA can be from
approximately 10.sup.6 to 10.sup.12 copies of the DNA molecule. The
compositions of the invention may be administered locally or
systematically. Administration can be parenterally, e.g.,
intravenously; and, by external administration. DNA may also be
administered directed to the target site, e.g., by biolistic
delivery to an internal or external target site or by catheter to a
site in an artery. Preparations for parenteral administration
include sterile aqueous or non-aqueous solutions, suspensions, and
emulsions. Examples of non-aqueous solvents are propylene glycol,
polyethylene glycol, vegetable oils such as olive oil, and
injectable organic esters such as ethyl oleate. Aqueous carriers
include water, alcoholic/aqueous solutions, emulsions or
suspensions, including saline and buffered media. Parenteral
vehicles include sodium chloride solution, Ringer's dextrose,
dextrose and sodium chloride, lactated Ringer's, or fixed oils.
Intravenous vehicles include fluid and nutrient replenishes,
electrolyte replenishers (such as those based on Ringer's
dextrose), and the like. Preservatives and other additives may also
be present such as, for example, antimicrobials, anti-oxidants,
chelating agents, and inert gases and the like. In addition, the
pharmaceutical composition of the present invention may comprise
proteinaceous carriers, like, e.g., serum albumin or
immunoglobulin, including those of human origin. Furthermore, it is
envisaged that the pharmaceutical composition of the invention may
comprise further biologically active agents, depending on the
intended use of the pharmaceutical composition. Such agents might
be drugs acting on the immunological system, drugs used in
anti-viral treatment, in particular in HIV-treatment (for example,
HAART) and AIDS management and/or anti-inflammatory drugs. It is,
for example, envisaged that patients are treated as early as
possible with HAART until viral load is below detection level for
several weeks to months. Early treatment of infected patients with
HAART prevents the transition of viral strains from usage of CCR5
to other chemokine receptors, like CXCR4 (Connor (1997) J. Exp.
Med. 185, 621-628). Pharmaceuticals of the present invention, for
example, one comprising a CCR5xCD3 construct is administered in
addition to HAART to eliminate latently infected cells, as well as
cells that are prone to reinfection by HIV-1. The procedures for
the depletion of CCR5.sup.+ cells can be repeated from one to about
10 or more times. Doses of CCR5xCD3 can be in the range of about
0.5 .mu.g/m.sup.2 to 10 mg/m.sup.2, or between about 10
.mu.g/m.sup.2 to 100 .mu.g/m.sup.2. Doses can be administered
intravenously, subcutaneously and/or into the cerebra-spinal fluid.
After several treatment cycles with the bispecific antibody HAART
is discontinued and viral load is closely monitored. If viral load
increases above detection level, a new cycle of HAART and the
bispecific antibody is initiated as described above.
[0152] In one aspect, the various polynucleotides and vectors of
the invention are administered either alone or in any combination
using standard vectors and/or gene delivery systems, and,
optionally, together with a pharmaceutically acceptable carrier or
excipient. Subsequent to administration, the polynucleotides or
vectors may be stably integrated into the genome of the subject,
such as a human.
[0153] Alternatively, pharmaceutical compositions, including, e.g.,
vectors, such as viral vectors, of the invention are designed to be
specific for (e.g., "target to") certain cells or tissues; they can
also be designed to persist in cells. Suitable pharmaceutical
carriers and excipients are well known in the art. The
pharmaceutical compositions of the invention can be used for the
prevention or treatment or delaying of different kinds of
immunological diseases, e.g., autoimmune diseases, which may be
related to inflammation, such as inflammatory bowel diseases,
inflammatory renal diseases, inflammatory joint diseases like
arthritis, e.g., chronic arthritis. Furthermore, the pharmaceutical
composition of the invention may be employed to eliminate cells
which are infected, e.g., with a virus, such as cells latently
infected with a virus, e.g., a lentivirus or a primate
immunodeficiency virus, as HIV-1.
[0154] Furthermore, it is possible to use a pharmaceutical
composition of the invention comprising a polynucleotide or vector
of the invention in gene therapy. Suitable gene delivery systems
may include liposomes, receptor-mediated delivery systems, naked
DNA, and viral vectors such as herpes viruses, retroviruses,
adenoviruses, and adeno-associated viruses, among others. Delivery
of nucleic acids to a specific site in the body for gene therapy
may also be accomplished using a biolistic delivery system, such as
that described by Williams (Proc. Natl. Acad. Sci. USA 88 (1991),
2726-2729). Further methods for the delivery of nucleic acids
comprise particle-mediated gene transfer as, e.g., described in
Verma, Gene Ther. 15 (1998), 692-699.
[0155] It is to be understood that the introduced polynucleotides
and vectors express a gene product after introduction into the
cell; they can remain in this status during the lifetime of the
cell. For example, cell lines that stably express the
polynucleotide under the control of appropriate regulatory
sequences may be engineered according to methods well known to
those skilled in the art. Rather than using expression vectors that
contain viral origins of replication, host cells can be transformed
with the polynucleotide of the invention and a selectable marker,
either on the same or separate plasmids. Following the introduction
of foreign DNA, engineered cells may be allowed to grow for about 1
to 2 days in an enriched media, and then are switched to a
selective media. The selectable marker in the recombinant plasmid
confers resistance to the selection. This allows for the selection
of cells having stably integrated the plasmid into their
chromosomes; the selected cells grow to form foci, which, in turn,
can be cloned and expanded into cell lines.
[0156] A number of selection systems may be used, including but not
limited to, the herpes simplex virus thymidine kinase (Wigler, Cell
11 (1977), 223), hypoxanthine-guanine phosphoribosyltransferase
(Szybalska, Proc. Natl. Acad. Sci. USA 48 (1962), 2026), and
adenine phosphoribosyltransferase (Lowy, Cell 22 (1980), 817) in
tk.sup.-, hgprt.sup.- or aprt.sup.- cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
dhfr, which confers resistance to methotrexate (Wigler, Proc. Natl.
Acad. Sci. USA 77 (1980), 3567; O'Hare, Proc. Natl. Acad. Sci. USA
78 (1981), 1527), gpt, which confers resistance to mycophenolic
acid (Mulligan, Proc. Natl. Acad. Sci. USA 78 (1981), 2072); neo,
which confers resistance to the aminoglycoside G-418
(Colberre-Garapin, J. Mol. Biol. 150 (1981), 1); hygro, which
confers resistance to hygromycin (Santerre (1984) Gene 30:147); or
puromycin (pat, puromycin N-acetyl transferase). Additional
selectable genes have been described, e.g., trpB, which allows
cells to utilize indole in place of tryptophan, hisD, which allows
cells to utilize histinol in place of histidine (Hartman, Proc.
Natl. Acad. Sci. USA 85 (1988), 8047); and ODC (ornithine
decarboxylase) which confers resistance to the ornithine
decarboxylase inhibitor, 2-(difluoromethyl)-DL-ornithine- , DFMO
(McCologue, 1987, In: Current Communications in Molecular Biology,
Cold Spring Harbor Laboratory ed.).
[0157] In a further embodiment, the invention relates to a
composition, such as a pharmaceutical composition, as described
hereinabove, which further comprises a medicament for the treatment
or prevention of an immunological (e.g., autoimmune) disorder or a
medicament for treating or preventing an infection, e.g., an
anti-HIV treatment. The anti-HIV treatment may comprise HAART.
HAART therapy consists of a cocktail of three classes anti-viral
drugs. The classes are, e.g., nucleosidal reverse transcriptase
inhibitors (NRTI), non-nucleosidal reverse transcriptase inhibitors
(NNRTI) and protease inhibitors (PI). Usually 2 to 4 drugs from
preferentially more than one class are combined to reduce viral
load to almost non-detectable levels. Products, dosing schedules
and common side effects are given in appended Tables I to III.
[0158] The treatment of an immunological disorder may comprise
anti-inflammatory agents and immunosuppressive agents.
Anti-inflammatory agents may be selected from the group consisting
of azathioprine, cyclophosphamide, glucocorticoids like prednisone
and corticosteroids. Immunosuppressive agents may comprise
cyclosporin A, Tacrolimus (FK506), Sirolimus (Rapamycin). Protein
drugs may comprise calcineurin, beta-interferon, anti-TNF alpha
monoclonal antibodies (remicade). Dosing and use of
anti-inflammatory agents and immunosuppressive agents is described,
inter alia, in Fauci et al., sic. Further treatment options are
known to the skilled artisan and, inter alia, described
hereinabove.
[0159] In one embodiment, the invention relates to a method for
treating, preventing and/or alleviating an immunological disorder,
or for the elimination of infected cells, e.g., cells which are
infected with a virus, e.g., cells latently infected with a primate
immunodeficiency virus, comprising administering to a subject in
need of such a treatment, prevention and/or alleviation, an
effective amount of a compound and/or composition of the invention,
such as a pharmaceutical composition of the present invention.
[0160] The constructs described herein are particularly useful in
specifically destroying chemokine receptor-positive cells. For
example, a bispecific antibody, binding simultaneously to CCR5 on
target cells and to CD3 on T-cells, redirects cytotoxic T-cells to
the CCR5 positive target cells. As shown in the appended examples
the antibody construct specifically depletes CCR5 positive T-cells
and monocytes, but is inactive against cells that do not express
CCR5, such as CCR5 deficient .DELTA.32/.DELTA.32 PBMC. Furthermore,
in vitro/ex vivo experiments, the bispecific antibody construct
eliminated more than 95% of CCR5 positive monocytes and T-cells
from the synovial fluid of patients with arthritis.
[0161] Other constructs, like chemokine constructs, for example, a
fusion protein of the chemokine RANTES and a truncated version of
the Pseudomonas exotoxin A (PE38), are able to bind to CCR5 and to
downmodulate the receptor from the cell surface, as exemplified in
the appended examples. Within 48 hours, RANTES-PE38 completely
destroyed CCR5 positive CHO cells at a concentration of 2 nM. No
cytotoxic effect was detectable against CCR5 negative CHO cells.
Based on the predominance of CCR5 positive T-cells and monocytes in
the infiltrate of chronically inflamed tissue, the specific
depletion of CCR5 positive cells represents a new concept in the
treatment of immunological disorders.
[0162] As described herein, due to the fact that specific chemokine
receptors are present on immunodeficiency virus-infected cells
(e.g., HIV-infected cells), such as CCR5, the compounds and
compositions of the invention are particularly useful for the
depletion/elimination of cells latently infected with primate
immunodeficiency virus.
[0163] The present invention also relates to the use of the
polynucleotide. the vector, the host, the chimeric polypeptides
(e.g., antibody constructs and/or chemokine constructs) of the
present invention for the preparation of a pharmaceutical
composition for treating, preventing and/or alleviating an
immunological disorder, or for the preparation of a pharmaceutical
composition for treating infected cells, e.g., virally infected
cells, e.g., eliminating latently infected cells, such as cells
infected with a primate immunodeficiency virus, e.g., a human
immunodeficiency virus, such as HIV-1.
[0164] The immunological disorders may be autoimmune diseases, skin
diseases, allergic diseases, inflammatory diseases, diabetes and
transplant rejections, wherein said autoimmune disease is selected
from the group consisting of multiple sclerosis, type I diabetes,
rheumatoid arthritis. Said skin diseases, may comprise psoriatic
lesions, psoriasis, atrophic dermatitis and the like. Inflammatory
disease are mentioned hereinabove is selected from the group
consisting of inflammatory joint diseases, inflammatory renal
diseases, inflammatory bowel diseases. In particular, said
inflammatory bowel disease may comprise Morbus Crohn, sarcoidosis,
systemic sclerosis, collagenosis, myositis, neuritis. Inflammatory
renal diseases may comprise nephritis, glomerulonephritis, lupus
nephritis, or IgA nephropathy.
[0165] In a variety of chronic inflammatory diseases, an impressive
accumulation of CCR5 positive T-cells and macrophages is found at
the site of inflammation. An accumulation of CCR5.sup.+ cells has
been demonstrated in several types of inflammatory diseases, like
arthritis, inflammatory renal diseases, transplant rejection,
auto-immune diseases like multiple sclerosis and inflammatory bowel
diseases. In contrast, in the peripheral blood of these patients,
only a minority of T-cells and monocytes express CCR5. Therefore,
CCR5 appears to be an excellent marker to identify and target
leukocytes that are involved in chronic inflammation. The
occurrence of a 32 bp deletion in the CCR5 gene that prevents
expression of CCR5 facilitates the study the pathophysiological
role of CCR5 in chronic inflammatory diseases. In patients with
rheumatoid arthritis, the frequency of CCR5 deficient
(.DELTA.32/.DELTA.32) individuals is significantly reduced.
Moreover, the mean survival of the kidney transplants is
significantly longer in CCR5-.DELTA.32/.DELTA.32 patients. These
results make CCR5 a target for therapeutic intervention.
Furthermore, the prevalence of CCR5 positive leukocytes in the
diseased tissue, in contrast to the rare expression of CCR5 on the
peripheral blood leukocytes, means that a specific elimination of
CCR5 positive leukocytes may be therapeutically useful by reducing
the number of infiltrating cells in chronic inflammation,
transplant rejection and autoimmune disease, like multiple
sclerosis, without significantly depleting peripheral blood
leukocytes. Eliminating CCR5 positive leukocytes from the
inflammatory infiltrate will be of greater therapeutic benefit than
simply blocking chemokine receptors of these cells, as they have
already infiltrated the tissue.
[0166] As documented in the appended examples, the antibody and/or
chemokine constructs of the invention are useful in the treatment,
prevention and/or alleviation of inflammatory joint diseases.
Therefore, the compositions of the present invention are useful for
the treatment of inflammatory joint diseases, like arthritis,
including, chronic arthritis.
[0167] The present invention furthermore, provides for medical
methods and uses, wherein the composition, e.g., a pharmaceutical
composition of the invention, is to be administered in combination
with antiviral agents and/or in combination with drugs to be
employed in AIDS management. As mentioned hereinabove, the main
problem in AIDS management is the occurrence of latently
HIV-infected cells. The current treatment options are based on
anti-viral agents interfering with two enzymes of the HIV-1 virus,
its protease and reverse transcriptase. The protease is essential
to cleave the inactive viral pre-proteins to form the active
products, while the reverse transcriptase is required to generate a
DNA intermediate of the viral RNA genome. The DNA intermediate can
then integrate into the host genome and remain there in a silent,
i.e., latent, form. The most efficient treatment option consists of
highly active antiretroviral therapy (HAART); this a treatment
regimen that usually consists of a combination of three or more
anti-retroviral drugs, usually including at least one drug of the
protease inhibitor class. The advent of highly active
anti-retroviral therapy (HAART) has had a significant impact on
HIV-1-infected individuals, lowering circulating virus to
undetectable levels (Oxenius (2000) Proc. Natl Acad. Sci. 97,
3383-3387; Perelson (1997) Nature (London) 387, 188-191; Hammer
(1997) N. Engl. J. Med. 337, 725-733; Gulick (1997) N. Engl. J.
Med. 337:734-739). Despite this, latently infected cells can remain
in these individuals for significant periods of time (Chun (1997)
Nature (London) 387, 183-188; Chun (1998) Proc. Natl. Acad. Sci.
USA 95, 8869-8873; Zhang (1999) N. Engl. J. Med. 340, 1605-1613);
if HAART is withdrawn, these cells can produce virus (Harrigan
(1999) AIDS 13, F59-F62). A pool of latently infected cells is
generated early during primary HIV-1 infection (Chun (1998) Proc.
Natl. Acad. Sci. 95, 8869-8873). Considering the postulated long
half-life of latent viral reservoirs (Zhang (1999) N. Engl. J. Med.
340, 1605-1613, Finzi (1 999) Nat. Med 5, 512-517) and the side
effects and cost of chronic HAART (Flexner (1998) N. Engl. J. Med.
338, 1281-1292; Carr (1998) Lancet 351, 1881-1883), it is important
to develop new strategies to eliminate the latent reservoir. While
HAART treatment has been highly successful in suppressing plasma
viremia in HIV-infected individuals, there are still persistent
reservoirs of HIV including in latently infected CD4+ T-cells and
other cells in the brain, gut associated lymphoid tissue and the
genital tract (Chun (1999) Proc. Natl. Acad. Sci. 96, 10958-10961).
Re-emergence of plasma viremia after discontinuation of HAART is
due to those pre-existing viral reservoirs and HAART cannot
eliminate those reservoirs (Chun (2000) Nature Med. 6, 757-761).
Therefore, even HAART merely suppresses viral replication and
reduces the viral load but does not prevent the occurrence of
latent infected cells or eliminates such cells.
[0168] Transmission of HIV-1 depends on the presence of CCR5, as
individuals with a homozygous .DELTA.32 deletion of the CCR5 allele
are highly resistant against infection with HIV-1. Although highly
active antiretroviral therapy can efficiently suppress replication
of HIV-1, complete eradication of HIV has not been achieved to
date. The main obstacle appears to be the inactivity of
antiretroviral therapy against latently infected cells that can
survive for several years and function as endogenous source for
HIV-1. Many of these cells fail to express viral proteins and can
evade the immune response. However, the majority of latently
infected cells may still express CCR5, as this receptor is
necessary for their initial infection. Thus, the compounds of the
present invention are useful in the depletion of CCR5.sup.+ cells
and in the significant reduction of the number of latently infected
HIV.sup.+-cells. Other strategies to eliminate HIV-1 infected cells
that depend on a specific recognition of viral proteins, e.g.,
surface expressed gp120, would be less effective against latently
infected cells, as the virus is dormant in these cells.
[0169] Therefore, the compositions of the invention are useful in
co-therapy approaches, which lead to a depletion of HIV-infected
cells, such as CCR5-positive cells. In one aspect, the composition
of the present invention is employed in combination with HAART.
Products, dosing schedules and common side effects of HAART are
known and illustrated, inter alia, in Tables I, II and III. The
combination treatments may comprise co-administration, as well as
an administration before or after treatment, with other anti-viral,
preferably anti-retroviral (e.g. anti-HIV) medication.
[0170] The present invention also provides for a kit comprising a
polynucleotide, a vector, a host cell, a chimeric polypeptide
(e.g., an antibody construct and/or a chemokine construct) of the
present invention. The kit of the invention may further comprise a
storage solution(s) and/or other reagents or materials required for
the conduct of scientific or therapeutic methods. The kit may,
inter alia, comprise drugs and/or medicaments employed in the
treatment of immunological disorders as defined herein and/or in
AIDS management. Furthermore, parts of the kit of the invention can
be packaged individually in vials or bottles or in combination in
containers or multicontainer units. The kits may further comprise
instructions for using the compositions of the invention in the
treatment or prevention of infections or immune-related diseases,
their use in screening or diagnostic procedures, or other methods
and protocols.
EXAMPLES
[0171] The following example is offered to illustrate, but not to
limit the claimed invention.
Example 1
Cloning, Recombinant Expression and Characterization of Nucleic
Acids and Polypeptides of the Invention
[0172] The following example describes the initial cloning and
recombinant expression of exemplary nucleic acids and polypeptides
of the invention and their characterization.
[0173] 1.1 Generation of a CHO Cell Line Expressing Human CCR5
[0174] The cDNA sequence of CCR5 was amplified from genomic DNA of
human peripheral blood mononuclear cells (PBMC) by PCR with
Pfu-polymerase (Stratagene, San Diego, Calif.), oligonucleotide
primers were:
1 SEQ ID NO. 1: 5' GGA ACA AGA TGG ATT ATC AAG TGT C 3' SEQ ID NO.
2: 5' CTG TGT ATG AAA ACT AAG CCA TGT G 3'
[0175] The amplified fragment was gel purified, ligated into the
PCR-Script Amp Sk(+) script vector (Stratagene) and sequenced.
After subcloning into the PEF-DHFR vector, DHFR-deficient CHO cells
were transfected by electroporation and selected for stable
expression in nucleoside free MEM medium with 10% dialyzed FCS as
described. The CHO/CCR5 transfected cells were shown to be
homogeneous by FACS-analysis.
[0176] 1.2 PBMC Purification
[0177] PBMC were isolated from buffy coats or full blood of healthy
donors by Ficoll density gradient centrifugation. Where indicated
PBMC were used from donors with a homozygous 32 base pair deletion
in the CCR5 allele (.DELTA.32/.DELTA.32) preventing surface
expression of CCR5. Specifically, buffy coats were diluted 1:2 in
0.9% NaCl, and 35 ml were layered onto 15 ml of Ficoll Paque and
centrifuged for 25 min at 400 g. The white interphase was harvested
and thrombocytes depleted by three subsequent washing and
centrifugation steps at 100 g for 6 min in RPMI with 10% FCS.
Freshly isolated monocytes expressed a very low level of CCR5, but
expression was strongly induced after culture of PBMC in RPMI with
10% FCS for 24 to 48 h at 37.degree. C. The amount of FCS did not
influence this induction. The expression of CCR5 on lymphocytes was
not altered during culture.
[0178] 1.3 Synovial Fluid
[0179] Synovial fluid of patients with arthritis was obtained from
diagnostic or therapeutic arthrocentesis and used for the
experiments without further preparation. Informed consent was
obtained from all patients. Synovial fluid and blood samples were
simultaneously obtained from 23 patients who presented with
gonarthritis for diagnostic or therapeutic arthrocentesis.
Diagnoses included rheumatoid arthritis (7), reactive arthritis
(3), undifferentiated gonarthritis (4), psoriatic arthritis (3),
osteoarthritis (2), ancylosing spondylitis (1) and gout (3)
according to ACR criteria, where applicable. Written informed
consent was obtained from all patients. Synovial fluid was analyzed
by light microscopy. Crystals were identified by polarized light
microscopy. Student's t-test and paired t-test was applied for
statistical analysis.
[0180] 1.4 Analysis of Chemokine Receptor Expression in Whole Blood
Samples and Synovial Fluid
[0181] Immediately after arthrocentesis SF (synovial fluid)
leukocytes were isolated by two washing steps with 5% PBS in NaCl
0.9%. Synovial fluid cells and whole blood (containing 1 mM EDTA)
were incubated on ice with monoclonal antibodies against chemokine
receptors and the appropriate isotype controls at a concentration
of 10 .mu.g/ml. The antibodies were for CCR5: MC-1 (Mack (1998) J.
Exp. Med. 187, 1215-1224), for CCR2: DOC-3, which specifically
binds to CCR2 (9), for CCR1: Clone 53504 (R&D-Systems), for
CXCR1: 5A12 (Pharmingen), for CXCR2: 6C6 (Pharmingen), and for
CXCR4 12G5 (Pharmingen), IgG1-, IgG2a- and IgG2b-isotype controls
(Sigma). After two washing steps cells were incubated for 30 min on
ice with a PE-conjugated rabbit-anti-mouse F(ab)2 fragment (R439,
DAKO). Cells were washed twice and incubated with 10% mouse serum
followed by a combination of CD4-FITC, CD8-PECy5 and CD14-APC
(Immunotech). After lysis of erythrocytes, cells were immediately
analyzed by flow cytometry (Becton-Dickinson). Calculations were
performed with Cell Quest.TM. analysis software. Helper T cells,
cytotoxic T cells, monocytes and neutrophils were identified by
their light scatter properties and the expression or absence of
CD4, CD8 and CD14. Chemokine receptor expression was calculated
after defining a cutoff according to the isotype control.
[0182] In both acute and chronic joint effusions, a consistently
increased percentage of CD4+ and CD8+ T cells that expressed the
chemokine receptor CCR5 was found, compared to the peripheral
blood. These data are in good agreement with previous reports (Mack
(1999) Arthritis Rheum. 42, 981-988; Qin (1998) J. Clin. Invest.
101, 746-754).
[0183] Chemokine receptor expression on T cells in non-crystal
induced arthritis: Approximately 88% of CD4+ T cells and 93% of the
CD8+ T cells from the synovial fluid stained positive for the
chemokine receptor CCR5. Similarly, a major proportion of CD8+ and
CD4+ T cells in the SF expressed CCR2 (66% and 48%) (FIG. 1). In
contrast, in the peripheral blood only a minority of T cells
expressed the chemokine receptors CCR5 or CCR2. The enrichment in
the synovial fluid was most pronounced for the CCR5+ helper-T cells
(blood:SF ratio=1:4). The majority of T lymphocytes stained
positive for CXCR4 in both compartments. CXCR1, CXCR2 and CCR1 were
only expressed by a minor and variable percentage of T cells (FIG.
1). A typical example of one patient is shown in FIG. 2, showing
the expression of CCR5, CCR2 and CXCR4 on leukocytes in the
peripheral blood and synovial fluid.
[0184] Chemokine receptor expression on monocytes in non-crystal
induced arthritis: Consistent with previous data, the majority of
monocytes in the synovial fluid (SF) expressed CCR5. In addition, a
reduced expression of CXCR1, CXCR2, CXCR4 and CCR1 is here reported
on monocytes in the synovial fluid compared to the peripheral blood
(FIGS. 1, 2). Not only was a lower frequency of receptor positive
cells found, but also a lower density of chemokine receptors on the
cell surface (data not shown). No differences could be detected in
relation to the underlying diagnoses, duration of joint effusion or
pretreatment. CCR2 was equally expressed by all monocytes in both
compartments (FIGS. 1, 2).
[0185] Chemokine receptor expression on neutrophils in non-crystal
induced arthritis: Acute arthritis is characterized by a rapid
influx of neutrophils into the inflamed joint. Therefore, the
chemokine receptor expression on neutrophils from inflamed joint
effusions was analyzed. For the first time a high expression of
CXCR4 is described on a large fraction of neutrophils (60%) from
the synovial fluid of patients with acute and chronic arthritis,
while a much lower expression was found in the peripheral blood
(24%) (FIGS. 1, 2). In arthritis other than gout CXCR1 and CXCR2
was reduced on neutrophils from the synovial fluid by approximately
50% compared to the peripheral blood. CCR1 was expressed only by a
minority of neutrophils in both compartments.
[0186] 1.5 Determination of CCR5 Genotype
[0187] Genomic DNA was prepared from frozen blood samples by
affinity chromatography (Roche Diagnostics). Subsequently a
fragment of the CCR5 gene containing the potential 32 base pair
deletion was amplified by a 40 cycle PCR with Taq polymerase. The
primers were
2 SEQ ID NO. 3: 5' TTT ACC AGA TCT CAA AAA GAA G 3' SEQ ID NO. 4:
5' GGA GAA GGA CAA TGT TGT AGG 3'
[0188] Differences in the length of the PCR fragments (274 or 242
bp) allowed to identify CCR5-wildtype and CCR5-.DELTA.32
alleles.
Example 2
Construction of an Exemplary Bispecific Antibody of the
Invention
[0189] The following example describes the construction of an
exemplary bispecific antibody of the invention and its
characterization.
[0190] 2.1 Generation of Monoclonal Antibodies Against Human
CCR5
[0191] To generate monoclonal antibodies against human CCR5, five
BALB/c mice were immunized intraperitoneally (i.p.) at four week
intervals, first with 1.times.10.sup.7 PBMC cultured for 10 days in
IL-2 (100 U/ml) and six subsequent i.p. injections of
1.times.10.sup.7 CHO cells expressing high levels of CCR5. For this
purpose, CCR5 transfected CHO cells were grown in the presence of
20 nM methotrexate to amplify expression of CCR5 and one clone
expressing high levels of CCR5 was chosen. Four days after the last
i.p. injection of CHO/CCR5 cells, the spleens were removed and the
cells fused with the P3X63-Ag8 cell line. Supernatants from
approximately 6000 hybridomas were screened per fusion by flow
cytometry on stable CHO/CCR5 cells and monoclonal antibodies
against CCR5 (MC-1, MC-4, MC-5) were detected after the third
fusion. The specificity of MC-1 (IgG1), MC-4, MC-5 were tested on
CHO cells stably transfected with CCR1-3 and CXCR4. In all cases no
binding was detected. In addition the antibodies did not react with
freshly isolated PBMCs and cultured PBMCs from a donor homozygous
for the .DELTA.32 deletion in the CCR5 gene.
[0192] 2.2 Cloning of the Variable Domains of MAb MC-1 Against
CCR5
[0193] The light (VL) and heavy (VH) variable domains from the
.alpha.CCR5 hybridoma MC-1 were cloned using PCR amplification
(Orlandi (1989) Proc. Natl. Acad. Sci. 86, 3833). Reverse
transcription was carried out with random hexamer nucleotides and
SuperScript reverse transcriptase (Gibco). The variable domains
were amplified by PCR with Pfu-polymerase, subcloned into the
vector PCR-script Amp SK+ (Stratagene) and sequenced.
[0194] For PCR amplification of VL(1) the following primers were
used:
3 SEQ ID NO. 5: 5' GACATTCAGC TGACCCAGTC TCCA 3' SEQ ID NO. 6: 5'
GTTTTATTTC CAGCTTGGTC CC 3'
[0195] For PCR amplification of VH(1) the following primers were
used:
4 SEQ ID NO. 7: 5' ACCATGGGAT GGAGCTGTGT CATGCTCTT and SEQ ID NO.
8: 5' TGAGGAGACG GTGACCGTGG TCCCTTGGCC CCAG
[0196] The nucleotide sequence of VL(1) obtained by RT PCR is SEQ
ID NO. 9:
5 1 GACATTCAGC TGACCCAGTC TCCAGCCTCC CTATCTGCAT CTGTGGGAGA
AACTGTCACC 61 ATCACATGTC GAGCAAGTGA GAATATTTAC AGTTATTTAG
CATGGTATCA GCAGAAACAG 121 GGAAAATCTC CTCAACTCCT GGTCTATAAT
GCAAAAACCT TAACAGAAGG TGTGCCATCA 181 AGGTTCAGTG GCAGTGGATC
AGGCACACAG TTTTCTCTGA AGATCAACAG CCTGCAGCCT 241 GAAGATTTTG
GGAATTATTT CTGTCAACAT CATTATGATA CTCCTCGGAC GTTCGGTGGA 301
GGGACCAAGC TGGAAATAAA AC
[0197] The corresponding translated protein sequence to VL(1) is
SEQ ID NO. 10:
6 1 D I Q L T Q S P A S L S A S V G E T V T I T C R A S E N I Y 31
S Y L A W Y Q Q K Q G K S P Q L L V Y N A K T L T E G V P S 61 R F
S G S G S G T Q F S L K I N S L Q P E D F G N Y F C Q H 91 H Y D T
P R T F G G G T K L E I K
[0198] The nucleotide sequence of VL(1) without the primer
sequences used for amplification, SEQ ID NO. 11:
7 1 GCCTCCCTAT CTGCATCTGT GGGAGAAACT GTCACCATCA CATGTCGAGC
AAGTGAGAAT 61 ATTTACAGTT ATTTAGCATG GTATCAGCAG AAACAGGGAA
AATCTCCTCA ACTCCTGGTC 121 TATAATGCAA AAACCTTAAC AGAAGGTGTG
CCATCAAGGT TCAGTGGCAG TGGATCAGGC 181 ACACAGTTTT CTCTGAAGAT
CAACAGCCTG CAGCCTGAAG ATTTTGGGAA TTATTTCTGT 241 CAACATCATT
ATGATACTCC TCGGACGTTC GGTGGA
[0199] The corresponding translated protein sequence to SEQ ID NO.
11: of VL(1) is SEQ ID NO. 12:
8 1 A S L S A S V G E T V T I T C R A S E N I Y S Y L A W Y Q Q 31
K Q G K S P Q L L V Y N A K T L T E G V P S R F S G S G S G 61 T Q
F S L K I N S L Q P E D F G N Y F C Q H H Y D T P R T F 91 G G
[0200] The sequence of VH(1) including the leader sequence obtained
by RT PCR is SEQ ID NO. 13:
9 1 ATGGGATGGA GCTGTGTCAT GCTCTTCTTG GTAGCAACAG CTACAGGTGT
CCACTCCCAG 61 GTCCAACTGC AGCAGCCTGG GGCTGGGAGG GTGAGGCCTG
GAGCTTCAGT GAAGCTGTCC 121 TGCAAGGCTT CTGGCTACTC CTTCACCAGT
TACTGGATGA ACTGGGTGAA GCAGAGGCCT 181 GGACAAGGCC TTGAGTGGAT
TGGCATGATT CATCCTTCCG ATAGTGAAAC TAGGTTAAAT 241 CAGAAGTTCA
ACGACAGGGC CACATTGACT GTTGACAAAT ATTCCAGCAC AGCCTATATA 301
CAACTCAGCA GCCCGACATC TGAGGACTCT GCGGTCTATT ACTGTGCAAG AGGAGAATAT
361 TACTACGGTA TATTTGACTA CTGGGGCCAA GGGACCACGG TCACCGTCTC CTCA
[0201] The corresponding translated protein sequence to VH(1) is
SEQ ID NO. 14:
10 1 M G W S C V M L F L V A T A T G V H S Q V Q L Q Q P G A G R 31
V R P G A S V K L S C K A S G Y S F T S Y W M N W V K Q R P 61 G Q
G L E W I G M I H P S D S E T R L N Q K F N D R A T L T 91 V D K Y
S S T A Y I Q L S S P T S E D S A V Y Y C A R G E Y 121 Y Y G I F D
Y W G Q G T T V T V S S
[0202] The nucleotide sequence of VH(1) without the leader sequence
and primer sequences used for amplification, SEQ ID NO. 15:
11 1 CTTGGTAGCA ACAGCTACAG GTGTCCACTC CCAGGTCCAA CTGCAGCAGC
CTGGGGCTGG 61 GAGGGTGAGG CCTGGAGCTT CAGTGAAGCT GTCCTGCAAG
GGTTCTGGCT ACTCCTTCAC 121 CAGTTACTGG ATGAACTGGG TGAAGCAGAG
GCCTGGACAA GGCCTTGAGT GGATTGGCAT 181 GATTCATCCT TCCGATAGTG
AAACTAGGTT AAATCAGAAG TTCAACGACA GGGCCACATT 241 GACTGTTGAC
AAATATTCCA GCACAGCCTA TATACAACTC AGCAGCCCGA CATCTGAGGA 301
CTCTGCGGTC TATTACTGTG CAAGAGGAGA ATATTACTAC GGTATATTTG ACTA
[0203] The corresponding translated protein sequence to SEQ ID NO.
15 of VH(1) is SEQ ID NO. 16:
12 1 L V A T A T G V H S Q V Q L Q Q P G A G R V R P G A S V K L 31
S C K A S G Y S F T S Y W M N W V K Q R P G Q G L E W I G M 61 I H
P S D S E T R L N Q K F N D R A T L T V D K Y S S T A Y 91 I Q L S
S P T S E D S A V Y Y C A R G E Y Y Y G I F D
[0204] 2.3 Construction and Expression of the Bispecific Single
Chain Antibody CCR5.times.CD3,
[0205] A schematic depiction of structure and mode of action of the
CCR5xCD3 bispecific single chain antibody is shown in FIG. 3. As
described previously, the light and heavy variable domains were
joined to a single-chain fragment using a (Gly4Ser1)3 linker and
expressed in the periplasmic space of E. coli to test binding of
the recombinant protein to CCR5. Subsequently, the DNA sequence of
the .alpha.CCR5 single-chain fragment was subcloned with BsrG1 and
BspE1 into an eukaryotic expression vector (pEF-DHFR) that already
contained a single-chain fragment directed against CD3 with a
C-terminally attached tail of 6 histidine residues (Mack (1995)
Proc. Natl. Acad. Sci. 92, 7021). The .alpha.CCR5 and .alpha.CD3
single-chain fragments were joined by a linker coding for Gly4Ser1
(see FIG. 3).
[0206] The following order of the domains is chosen:
VL(1)-VH(1)-VH(2)-VL(2), with (1) being the specificity against
CCR5 and (2) the specificity against CD3.
[0207] The bispecific CCR5xCD3 antibody has the following
nucleotide sequence, SEQ ID NO:17:
13 1 ATGGGATGGA GCTGTATCAT CCTCTTCTTG GTAGCAACAG CTACAGGTGT
ACACTCCGAT 61 ATCGTGCTGA CCCAGTCTCC AGCCTCCCTA TCTGCATCTG
TGGGAGAAAC TGTCACCATC 121 ACATGTCGAG CAAGTGAGAA TATTTACAGT
TATTTAGCAT GGTATCAGCA GAAACAGGGA 181 AAATCTCCTC AACTCCTGGT
CTATAATGCA AAAACCTTAA CAGAAGGTGT GCCATCAAGG 241 TTCAGTGGCA
GTGGATCAGG CACACAGTTT TCTCTGAAGA TCAACAGCCT GCAGCCTGAA 301
GATTTTGGGA ATTATTTCTG TCAACATCAT TATGATACTC CTCGGACGTT CGGTGGAGGG
361 ACCAAGCTCG AGATCAAAGG TGGTGGTGGT TCTGGCGGCG GCGGCTCCGG
TGGTGGTGGT 421 TCTCAGGTCC AACTGCAGCA GCCTGGGGCT GGGAGGGTGA
GGCCTGGAGC TTCAGTGAAG 481 CTGTCCTGCA AGGCTTCTGG CTACTCCTTC
ACCAGTTACT GGATGAACTG GGTGAAGCAG 541 AGGCCTGGAC AAGGCCTTGA
GTGGATTGGC ATGATTCATC CTTCCGATAG TGAAACTAGG 601 TTAAATCAGA
AGTTCAACGA CAGGGCCACA TTGACTGTTG ACAAATATTC CAGCACAGCC 661
TATATACAAC TCAGCAGCCC GACATCTGAG GACTCTGCGG TCTATTACTG TGCAAGAGGA
721 GAATATTACT ACGGTATATT TGACTACTGG GGCCAAGGGA CCACGGTCAC
CGTCTCCTCC 781 GGAGGTGGTG GATCCGATAT CAAACTGCAG CAGTCAGGGG
CTGAACTGGC AAGACCTGGG 841 GCCTCAGTGA AGATGTCCTG CAAGACTTCT
GGCTACACCT TTACTAGGTA CACGATGCAC 901 TGGGTAAAAC AGAGGCCTGG
ACAGGGTCTG GAATGGATTG GATACATTAA TCCTAGCCGT 961 GGTTATACTA
ATTACAATCA GAAGTTCAAG GACAAGGCCA CATTGACTAC AGACAAATCC 1021
TCCAGCACAG CCTACATGCA ACTGAGCAGC CTGACATCTG AGGACTCTGC AGTCTATTAC
1081 TGTGCAAGAT ATTATGATGA TCATTACTGC CTTGACTACT GGCGCCAAGG
CACCACTCTC 1141 ACAGTCTCCT CAGTCGAAGG TGGAAGTGGA GGTTCTGGTG
GAAGTGGAGG TTCAGGTGGA 1201 GTCGACGACA TTCAGCTGAC CCAGTCTCCA
GCAATCATGT CTGCATCTCC AGGGGAGAAG 1261 GTCACCATGA CCTGCAGAGC
CAGTTCAAGT GTAAGTTACA TGAACTGGTA CCAGCAGAAG 1321 TCAGGCACCT
CCCCCAAAAG ATGGATTTAT GACACATCCA AAGTGGCTTC TGGAGTCCCT 1381
TATCGCTTCA GTGGCAGTGG GTCTGGGACC TCATACTCTC TCACAATCAG CAGCATGGAG
1441 GCTGAAGATG CTGCCACTTA TTACTGCCAA CAGTGGAGTA GTAACCCGCT
CACGTTCGGA 1501 GCTGGGACCA AGCTGGAGCT GAAACATCAT CACCATCATC
ATTAG
[0208] The bispecific CCR5xCD3 antibody has the following protein
sequence, SEQ ID NO:18:
14 1 D I V L T Q S P A S L S A S V G E T V T I T C R A S E N I Y 31
S Y L A W Y Q Q K Q G K S P Q L L V Y N A K T L T E G V P S 61 R F
S G S G S G T Q F S L K I N S L Q P E D F G N Y F C Q H 91 H Y D T
P R T F G G G T K L E I K G G G G S G G G G S G G G 121 G S Q V Q L
Q Q P G A G R V R P G A S V K L S C K A S G Y S 151 F T S Y W M N W
V K Q R P G Q G L E W I G M I H P S D S E T 181 R L N Q K F N D R A
T L T V D K Y S S T A Y I Q L S S P T S 211 E D S A V Y Y C A R G E
Y Y Y G I F D Y W G Q G T T V T V S 241 S G G G G S D I K L Q Q S G
A E L A R P G A S V K M S C K T 271 S G Y T F T R Y T M H W V K Q R
P G Q G L E W I G Y I N P S 301 R G Y T N Y N Q K F K D K A T L T T
D K S S S T A Y M Q L S 331 S L T S E D S A V Y Y C A R Y Y D D H Y
C L D Y W R Q G T T 361 L T V S S V E G G S G G S G G S G G S G G V
D D I Q L T Q S 391 P A I M S A S P G E K V T M T C R A S S S V S Y
M N W Y Q Q 421 K S G T S P K R W I Y D T S K V A S G V P Y R F S G
S G S G 451 T S Y S L T I S S M E A E D A A T Y Y C Q Q W S S N P L
T F 481 G A G T K L E L K H H H H H H *
[0209] The bispecific antibody was expressed in DHFR-deficient CHO
cells and purified from the culture supernatant by affinity
chromatography on immobilized Ni.sup.2+ ions (Hochuli (1988)
Biotechnology 6:1321-1325; Ni-NTA, Qiagen, Valencia, Calif.).
[0210] In summary, for the construction of bispecific antibodies,
for example, the single-chain technique may be used, see, e.g.,
Mack (1995) Proc. Natl. Acad. Sci. USA 92:7021-7025; Mack (1997) J.
Immunol. 158:3965-3970. In this case, as shown schematically in
FIGS. 3 (top), the variable domains of the light (VL) and the heavy
(VH) immunoglobulin chains of two different antibodies are fused in
a particular order, optionally a histidine chain of 6.times.His is
attached in addition. The fusion is effected on a DNA basis so that
a protein chain with four different variable domains is formed
after expression (cf. FIG. 3 (top)). The attached histidine chain
enables a simple and efficient purification via immobilized Ni ions
in one step. FIG. 3 (top) shows a preferred embodiment of the
bispecific antibody binding to the CD3 antigen on the surface of
the effector cell and the human CCR5 on the surface of leukocytes
as target cells.
[0211] Subsequently, a single-chain antibody with a specificity is
generated by means of fusion PCR by inserting a linker of
(Gly.sub.4Ser.sub.1).sub.3 between the two variable antibody
domains. In a further fusion PCR, the antibody fragment against
CCR5 is fused to the already published antibody fragment against
CD3, with a linker consisting of Gly.sub.4Ser.sub.1 is inserted
(cf. Mack et al. supra).
[0212] In order to express the bispecific antibody, the
corresponding DNA sequence is subcloned in a eukaryotic expression
vector (e.g. PEF-DHFR, Mack (1995) PNAS, supra) and transfected in
DHFR-deficient CHO cells by means of electroporation. The
bispecific antibody is purified from the supernatant of stably
transfected CHO cells by means of affinity chromatography at
Ni-NTA, with elution taking place by lowering the pH value.
Subsequently, the pH is adjusted and the protein is adjusted to a
suitable concentration. Overall purification yield was approx. 900
.mu.g/l culture supernatant. SDS-PAGE showed a single band of
approx. 60 kD under reducing and non-reducing conditions without
any detectable proteolysis or degradation of the protein (FIG.
4).
Example 3
Expression and Purification of an Exemplary Chemokine-Toxin Fusion
Protein of the Invention
[0213] The following example describes the expression and
purification of an exemplary chemokine-toxin fusion protein of the
invention and its characterization.
[0214] A schematic depiction of structure and mode of action of the
RANTES-PE38 chemokine-toxin fusion protein is shown in FIG. 5. A
PCR fragment of RANTES, generated with the primers P1 and P2, was
subcloned with StuI and SalI into a vector for periplasmic
expression in E. coli (Mack (1995) Proc. Natl. Acad. Sci. 92,
7021). The restriction site StuI had previously been introduced at
the 3' terminus of the OmpA signal sequence. The DNA of a truncated
version of Pseudomonas exotoxin A (PE38; Theuer (1993) Cancer Res.
53, 340), was amplified by PCR with Pfu-polymerase using the
primers P3 and P4 and subcloned with BspE1 and Hind III into the
vector that already contained the cDNA of RANTES. Primer P4 also
added a tail of 6 histidine residues at the 3' terminus of PE38.
During the periplasmic expression the OmpA signal sequence is
cleaved off such that the recombinant protein starts with the first
amino acid of RANTES. The C-terminally attached tail of 6 histidine
residues allowed purification by affinity chromatography on Ni-NTA
(Qiagen).
[0215] List of primers:
15 SEQ ID NO. 19: 5' AAAGGCCTCCCCATATTCCTCGGA SEQ ID NO. 20: 5'
AAAGTCGACTCCGGACATCTCCAAAGAGTTGATGTAC SEQ ID NO. 21: 5'
AATCCGGAGGCGGCAGCCTGGCCGC SEQ ID NO: 22: 5'
GGGAAGCTTAGTGATGGTGATGGTGATGCTTCAGGTCCTCGCGCGG
[0216] As described in the above, the DNA sequence of RANTES was
fused with the sequence of a truncated version of the Pseudomonas
exotoxin A (PE38) (Theuer (1993) Cancer Res. 53, 340). In a first
version of the construct a Gly-Ser linker was spaced between RANTES
and PE 38. However, this resulted in a considerable proteolytic
degradation of the fusion protein during expression in E. coli
(data not shown). In an attempt to stabilize the construct the
linker and the fist three amino acids of PE38 were removed. The new
fusion protein showed no proteolysis during expression in the
periplasmic space of E. coli as demonstrated by SDS-PAGE (FIG. 6
left panel) and Western-blot (FIG. 6 right panel). The
corresponding constructs are depicted in SEQ ID NOs: 23 and 24,
respectively.
Example 4
Binding of an Exemplary Bispecific Antibody of the Invention to the
Target Antigens CCR5 and CD3
[0217] The following example describes the binding of an exemplary
bispecific antibody to the target antigens CCR5 and CD3.
[0218] Binding of the bispecific single-chain antibody to CHO cells
or PBMC was determined by FACS-analysis (FIG. 7 to 9). The cells
were incubated with the bispecific antibody for 60 min on ice
followed by an antibody against 6.times.His (Dianova, Hamburg,
Germany) and a PE-conjugated polyclonal rabbit-anti mouse F(ab)2
fragment (R439, Dako, Hamburg, Germany). As the bispecific antibody
would also bind to CCR5, an analysis using PBMC that lack
expression of CCR5 (due to a homozygous 32 base pair deletion in
the CCR5 alleles) was performed. The antibody showed good binding
to a subpopulation of lymphocytes. Co-staining with antibodies
against CD4 and CD8 identified this subpopulation as CD4 and CD8
positive T lymphocytes (FIG. 7). In addition, the bispecific
antibody competed with the monoclonal CD3 antibody OKT-3 for
binding to T cells (data not shown).
[0219] Binding of the bispecific antibody to CCR5 was demonstrated
on CCR5 overexpressing CHO cells and human monocytes (FIGS. 8 and
9). The antibody showed excellent binding to CCR5 transfected CHO
cells (FIG. 8) and cultured monocytes (FIG. 9), while no binding
was detectable on CHO cells transfected with CXCR4 or on cultured
monocytes from a donor with a homozygous CCR5-.DELTA.32/.DELTA.32
deletion. Overnight cultivation of monocytes induces expression of
CCR5 on wild-type monocytes, while monocytes from donors with a
homozygous CCR5-.DELTA.32/.DELTA.32 deletion fail to express CCR5.
Moreover, it was demonstrated that the CCR5 signal detectable with
the bispecific antibody on cultured monocytes could be reduced to
values below 15% by preincubation of monocytes for 30 min at
37.degree. C. with AOP-RANTES (data not shown) that is known to
efficiently induce internalization of CCR5 and reduce binding of
CCR5 antibodies (25).
Example 5
Downmodulation of Chemokines Receptors Using an Exemplary
Bispecific Antibody of the Invention
[0220] The following example describes the downmodulation of
chemokines receptors using an exemplary bispecific antibody of the
invention.
[0221] 5.1 Downmodulation of CCR5 with mAb MC-1 Against CCR5
[0222] The effect of MC-1 one on the surface expression of human
CCR5 was measured. For comparison a different monoclonal antibody
MC-4 against CCR5 was used. CHO-CCR5 cells were incubated with
various concentrations of antibody MC-1 and MC-4 for 30 min. at
37.degree. C. Cells were placed on ice and stained with MC-1 and
MC-4 respectively at a concentration of 15 ug/ml for one hour on
ice, followed by detection with a secondary antibody (rabbit
anti-mouse FITC, F313 from DAKO). Analysis was performed on a
FACSCalibur. Incubation with MC-1 at 37.degree. C. for 30 min
resulted in a downmodulation of human CCR5 by 40% at a
concentration of 10 ug/ml (FIG. 10).
[0223] 5.2 Downmodulation of CCR5 by Chemokine-Toxin
[0224] The fusion of RANTES to the N-terminus of a truncated
version of the Pseudomonas exotoxin A is supposed to result in
specific binding of the construct to cells expressing RANTES
receptors such as CCR5, CCR1 and CCR3. Internalization of the
chemokine receptors upon binding of the modified toxin would
enhance the cellular uptake and cytotoxic activity of the construct
(FIG. 5 lower panel). Therefore, it was analyzed whether
RANTES-PE38 is able to internalize CCR5 from the surface of primary
monocytes and T cells (FIG. 11, open symbols). Internalization of
CCR5 would indicate that the construct is able to bind to CCR5 and
that RANTES remains functionally active after fusion to PE38. As
shown in FIG. 11 the construct is able to internalize CCR5 from the
surface of monocytes and lymphocytes. Unmodified RANTES served as
positive control and was somewhat more efficient than RANTES-PE38
(FIG. 11, closed symbols).
[0225] PBMC were incubated for 30 min at 37.degree. C. with various
concentrations of RANTES or RANTES-PE38 diluted in RPMI with 10%
FCS in a volume of 100 .mu.l. Medium alone was used as control. The
cells were then stained on ice for surface CCR5 expression using
the monoclonal antibody MC-1 or medium as negative control followed
by the PE-conjugated anti-mouse antibody R439. The FACS-analysis
was performed on a FACSCalibur.TM. (Becton Dickinson) and
CellQuest.TM. software. Lymphocytes and monocytes were
distinguished by their forward and sideward light scatter
properties and expression of CD14, CD4 and CD8. Relative surface
CCR5 expression was calculated as [mean channel fluorescence
(exp.)-mean channel fluorescence (negative control)]/[mean channel
fluorescence (medium)-mean channel fluorescence (negative
control)].
Example 6
Depletion of Cells with the Exemplary Chimeric Polypeptide:
Bispecific CCR5xCD3 Antibody and RANTES-PE38
[0226] The following example describes the depletion of cells with
the exemplary bispecific chimeric polypeptide of the invention
comprising the bispecific CCR5xCD3 antibody and RANTES-PE38.
[0227] 6.1 CCR5 Specific Depletion of Monocytes from Cultured
PBMCs
[0228] PBMC from CCR5-wildtype (WT) or CCR5 deficient
(.DELTA.32/.DELTA.32) donors were incubated over night to induce
expression of CCR5 on monocytes. Cultured PBMC were incubated with
different concentrations of purified .alpha.CCR5-.alpha.CD3
bispecific antibodies or medium as control for 20 h. Surviving
cells were analyzed on a FACSCalibur and counted.
[0229] In order to test the ability of the .alpha.CCR5-.alpha.CD3
bispecific single-chain antibody to deplete CCR5 positive primary
cells, human PBMC were incubated with the antibody (FIG. 12). Prior
to incubation the PBMC were cultured overnight to upregulate CCR5
expression on monocytes. By retargeting cytotoxic T cells the
bispecific antibody depleted the majority of monocytes within 20 h
in a concentration dependent manner (FIG. 13) with an almost
complete elimination of CCR5 positive cells at concentration of 10
ng/ml. To verify that the depletion of monocytes was due to their
induced expression of CCR5, the same experiment was performed with
PBMC from a donor with a homozygous 32 bp deletion in the CCR5
allele that prevents surface expression of CCR5. No depletion of
CCR5 deficient monocytes was detectable after 20 h, indicating that
the depletion of cells with the bispecific antibody is restricted
to monocytes that express CCR5 (FIG. 12), compare lower right panel
to upper right panel, left panels serve as negative controls.
Monocytes (Mo) and lymphocytes (Ly) were identified by their
forward and sidewards light scatter properties. Monocytes appear in
the lower left quadrant see arrows.
[0230] 6.2 Depletion of Monocytes and T Lymphocytes from the
Synovial Fluid of Patients with Arthritis
[0231] Freshly drawn synovial fluid of patients with arthritis were
incubated with different concentrations of purified
.alpha.CCR5-.alpha.CD3 bispecific antibodies or medium as control
for 20 h. Surviving cells were analyzed on a FACSCalibur.TM. and
counted.
[0232] The bispecific single-chain antibody could potentially be
applied to deplete CCR5 positive T cells and monocytes from the
inflamed joints of patients with arthritis. Therefore, the
depletion of CCR5 positive cells from the synovial fluid of
patients with various types of arthritis was determined. It was
shown previously that the majority of T cells and monocytes in the
inflamed synovial fluid express CCR5 (Mack (1999) loc. cit.). In
synovial samples obtained before depletion experiments, it was
confirmed by FACS analysis that the majority of lymphocytes and
monocytes express CCR5, while no expression of CCR5 was detectable
on granulocytes (data not shown).
[0233] For the depletion experiments the synovial fluid was
incubated ex vivo with different concentrations of the bispecific
antibody for 20 h (FIG. 14). The synovial fluid was incubated
immediately after puncture without any preparation to ensure that
the conditions in vitro resemble most closely the situation in vivo
when the antibody would be present within inflamed joints. As shown
in FIG. 14 the bispecific antibody induced a depletion of the
majority of lymphocytes and monocytes from the synovial fluid,
while granulocytes that do not express CCR5 remained unaffected. A
representative FACS analysis of the depletion of monocytes and
lymphocytes in synovial fluid at a concentration of 0.5 ug/ml
CCR5xCD3 is shown in FIG. 15. Only the CCR5 negative neutrophils
(PMN: polymorpho-nuclear cells) are unaffected by the bispecific
antibody.
[0234] The chimeric antibodies were incubated with synovial fluid
for one or several days. After 24 hours, the CCR5 positive
lymphocytes and monocytes have already almost disappeared. When the
medium is controlled after longer incubation, the monocytes have
differentiated into macrophages which are visible at the bottom of
the culture flask. After an appropriate incubation with the
bispecific antibody, no macrophages are visible.
[0235] A corresponding result can be obtained when cultivated PBMC
are incubated with the bispecific antibody as described above. In
this case, there is an almost complete depletion of CCR5 positive
monocytes and an almost complete depletion of CCR5 positive
T-lymphocytes. The depletion of CCR5 positive T-cells and monocytes
is shown in FIG. 15. The results show that the construct of the
present invention is capable of destroying CCR5 positive monocytes.
This applies to both monocytes from the joint aspirate and blood
monocytes which express CCR5 when being differentiated into
macrophages. Depletion of the monocytes/macrophages takes place
within a few hours (<24 hrs). In particular, the depletion of
monocytes/macrophages in the joint is of great advantage in therapy
since it is these cells that are mainly responsible for the joint
destruction. Moreover, for the activation of T-lymphocytes an
interaction with macrophages is also required so that, at the same
time, the function of the T-lymphocytes is suppressed. In addition
to the depletion of monocytes/macrophages, a considerable reduction
in the number of CCR5 positive T-lymphocytes could be observed.
[0236] 6.3 Comparison of the Efficacy of the Exemplary Bispecific
Antibody CCR5xCD3 Versus Monoclonal Antibodies
[0237] The efficacy of the exemplary .alpha.CCR5-.alpha.CD3
bispecific single-chain antibody in depleting CCR5 positive
monocytes was compared with the efficacy of two unmodified
monoclonal antibodies. PBMC from two different donors (F and N)
were cultured overnight and then incubated for 24 h with medium,
the bispecific single-chain antibody (125 ng/ml), MC-1 (5 .mu.g/ml)
and MC-5 (5 .mu.g/ml). The monoclonal antibody MC-1, the parental
antibody for the bispecific single-chain antibody has the isotype
mouse IgG-1 and the antibody MC-5 has the isotype IgG-2a. The cells
were completely recovered and analyzed by FACS to quantify
surviving monocytes and lymphocytes.
[0238] FIG. 16 shows that surprisingly only the bispecific antibody
was able to considerably deplete CCR5 positive monocytes, while the
unmodified monoclonal antibodies were largely ineffective, even
when used in a 40 fold excess over the bispecific antibody
CCR5xCD3. By FACS analysis using forward and sideward light scatter
properties of lymphocytes and monocytes demonstrates that only the
CCR5xCD3 bispecific antibody, but not the monoclonal antibodies are
capable of depleting cultured monocytes (FIG. 17 compare right
upper panel to lower panels).
[0239] 6.4 Depletion of Chemokine Receptor Expressing Cells with
RANTES-PE38
[0240] CHO cells expressing CCR5 or CXCR4 were grown to
subconfluence on 24 well culture plates and incubated with
different concentrations of purified RANTES-PE38 or medium as
control. After 40 hours the adherent and non-adherent cells were
recovered and analyzed by FACS to measure the percentage of dead
cells. It was previously established that dead (propidium iodide
positive) CHO cells can be identified by their light scatter
properties.
[0241] The cytotoxic activity of RANTES-PE38 was further analyzed.
For that purpose, CHO cells expressing human CCR5, murine CCR5 and
human CXCR4 were incubated with various concentrations of the
chemokine-toxin or medium. No surviving (adherent) human or murine
CCR5 positive CHO cells were detectable by light microscopy after
40 h incubation with as little as 10 nM RANTES-PE38. In contrast,
regular growth and survival was observed where the CCR5 positive
cells were incubated with medium or when CXCR4 positive CHO cells
were incubated with equal concentrations of the chemokine-toxin
(data not shown). To quantify the percentage of dead cells, the
adherent and non-adherent cells were analyzed by FACS. It was
previously established that living and dead CHO cells can be
identified by their light scatter properties, the position of dead
and alive cells is indicated by arrows (FIG. 18). As shown in FIG.
18 no cytotoxic effect of RANTES-PE38 was seen on CHO cells
expressing CXCR4, while CHO cells expressing human CCR5 were
completely killed by 10 nM RANTES-PE38.
[0242] These experiments show that RANTES-PE 38 is able to
internalize CCR5 from the surface of cells and induces depletion of
cells expressing the RANTES receptors hCCR5 or mCCR5. The
inactivity of the construct against CXCR4 positive CHO cells
demonstrates that the cytotoxic activity of the construct is
restricted to cells that express specific chemokine receptors.
Example 7
Viral Infection Assay with Stably Transfected Cells
[0243] The following example describes a virus infection assay with
stably transfected cells.
[0244] GHOST 34 CCR5 cells were derived from HOS/CD4 cells stably
expressing CCR5 and were provided by Dan Littman (Skirball
Institute, New York). 2.5.times.104 cells in 48-well trays were
exposed to 100 .mu.l of chemokine at appropriate dilution for 30
min at 37.degree. C. 100 .mu.l of the NSI, CCR5-dependent HIV-1
strain, SF162 was added at 1000 focus forming units/ml (FFU/ml) and
the cells incubated for a further 3 h. The cells were then washed
and incubated in medium containing the appropriate chemokine for 4
days before fixing, staining in situ for p24 production and
estimating foci of infection as previously described.
16TABLE I Nucleosidal Reverse Transcriptase Inhibitors (nucleoside
analogs, NRTI) Common Side Effects and General Substance Tradename
Dosing Schedule Remarks Zidovudine Retrovir 300 mg, 2.times. daily
Initial gastrointestinal (GI) side effects, (AZT) anemia,
neutropenia, myopathy Lamivudine Epivir 150 mg, 2.times. daily
Generally well tolerated. Effective against (3TC) hepatitis
Zidovudine, Combivir 1 tablet 2.times. daily Combination-tablet
containing 300 mg AZT Lamiduvine and 150 mg 3TC (AZT + 3TC)
Didanosine Videx 200 mg, 2.times. daily or 15% peripheral
neuropathy, pancreatitis; (ddI) 400 mg, 1.times. daily avoid
alcohol. on an empty Contents alcohol: could be given stomach
(>60 kg simultaneously with all NRTIs, Adefovir, weight)
Nevirapine, and Efavirence; Delavirdine and Indinavir should be
given at least 1 hour before ddI; Nelfinavir to be given 1 hour
after ddI. Zalcitabine Hivid 0.375-0.75 mg, 3.times. 17-31%
peripheral neuropathy in different (ddC) daily studies; aphteous
ulcerations Stavudine Zerit 20-40 mg, 2.times. daily Peripheral
neuropathy (1-4% in earlier (d4T) studies; 24% in `expanded access`
patients with CD4 > 50) Abacavir Ziagen 300 mg, 2.times. daily
About 3% reaction for hypersensitivity: fever, (ABA) indisposition,
possibly transient rash, gastrointestinal side effects.
[0245]
17TABLE II Protease Inhibitors Dosing Common Side Effects and
General Substance Tradename Schedule Remarks Saquinavir Invirase
600 mg, 3.times. daily, take with Well tolerated. Limited efficacy
(hard gelatine high-fat meal due to poor resorption. capsule,
SQV-H) Saquinavir Fortovase 1200 mg, 3.times. daily, take with
Improved resorption compared to (soft gelatine high-fat meal
(>28 g) Invirase. capsule, SQV-S) Ritonavir Norvir 600 mg, (6
cap./7.5 ml) 2.times. Nausea and numb lips for up to 5 (RTV) daily.
Start with 300 mg, 2.times. weeks. Occasionally hepatitis. Not
daily, then increase within tolerated by up to 50% of the 10 days
to 600 mg, 2.times. daily; patients. Indinavir Crixivan 800 mg,
every 8 hours on an Neural calculus with 6-8%; requires (IDV) empty
stomach or with large liquid intake. Occasionally snack (<2 g
fat) nausea and gastrointestinal side effects. Nelfinavir Viracept
750 mg, 3.times. daily, or 1250 mg, Often diarrhea, sometimes
nausea. (NFV) 2.times. daily with meals
[0246]
18TABLE III Non-Nucleosidal Reverse Transcriptase Inhibitors
(NNRTI) Dosing Common Side Effects Substance Tradename Schedule and
General Remarks Nevirapine Viramune 200 mg, 1.times. daily
Transient skin, (NVP) hepatitis, induced liver enzymes P450 3A4
Delavirdine Rescriptor 400 mg, 3.times. daily Transient skin, sup-
(DLV) presses P450 3A4 Efavirence Sustiva 600 mg, 1.times. daily in
Initially dizziness, (EFV) the evening insomnia, momentary
transient skin: In- duces P450 3A4; avoid Claritithromycin.
[0247]
19TABLE IV Chemokine receptors and chemokine ligands Chemokine
Receptors Chemokine Ligands CXCR3 I-TAC (CXCL11), IP-10 (CXCL-10),
Mig (CXCL9) CXCR4 SDF-1 (CXCL12) CXCR5 BCA1 (CXCL13) CXCR6 CXCL76
CCR1 MIP1 alpha (CCL3), RANTES (CCL5), MCP-3 (CCL7), MCP-4 (CCL13),
HCC1 (CCL14), LKN1 (CCL15) CCR2 MCP-1 (CCL2), MCP-2 (CCL8), MCP-3
(CCL7), MCP-4 (CCL13) CCR3 RANTES (CCL5), MCP-2 (CCL8), MCP-3
(CCL7), MCP-4 (CCL13), eotaxin (CCL11), LKN1 (CCL15), MPIF-2
(CCL24), eotaxin-3 (CCL26) CCR4 TARC (CCL17), MDC (CCL22) CCR5 MIP1
alpha (CCL3), MIP1 beta (CCL4), RANTES (CCL5), MCP-2 (CCL8), MCP-3
(CCL7), MCP-4 (CCL13), eotaxin (CCL11) CCR6 LARC (CCL20) CCR7 ELC
(CCL19), SLC (CCL21) CCR8 I-309 (CCL1), MIP1 beta (CCL4), TARC
(CCL17) CCR9 TECK (CCL25) XCR1 XCL1, XCL2 CCR10 CTACK (CCL27),
MEC
Example 8
Concentration Dependent Binding of CCR5xCD3 to CCR5 Expressing CHO
Cells
[0248] The following example describes the concentration dependent
binding of the bispecific scFv CCR5xCD3 to CCR5-expressing CHO
cells.
[0249] Chinese hamster ovary cells stably transfected with CCR5
(CCR5+CHO) were used as target cells of binding studies of
bispecific scFv CCR5xCD3 (as described in Example 2 and FIG. 3).
These cells were negative for CD3 and >95% positive for CCR5 as
evaluated by binding assays with the parental antibody MC-1 (as
described in Example 5 and FIG. 10). Binding was evaluated by a
flow cytometry based binding assay.
[0250] 4.times.10.sup.5 CCR5+CHO cells were resuspended in 50 .mu.l
FACS buffer (PBS with 1% fetal calf serum (FCS) and 0.05% sodium
azide) containing different dilutions of scFV CCR5xCD3 ranging from
20 .mu.g/ml to 19.5 ng/ml.
[0251] 4.times.10.sup.5 CCR5+CHO cells were incubated with 19.5
ng/ml scFV CCR5xCD3 for 30 minutes at 4.degree. C. after washing
cells were incubated for 45 minutes at 4.degree. C. with 20
.mu.g/ml anti-His-Tag monoclonal antibody. In FIG. 20, cells were
incubated in a 96 well microtiter plate for 30 minutes at 4.degree.
C. Cells were washed twice with FACS buffer and incubated for 45
minutes at 4.degree. C. with 20 .mu.g/ml anti-His-Tag monoclonal
antibody (Dianova GmbH, Hamburg). Specifically bound scFV CCR5xCD3
was detected with a monoclonal goat anti-mouse IgG F(ab')2-PE
conjugated antibody (Dianova). After washing, the cells were
analyzed in a flow cytometer (FACSCalibur.TM., Becton Dickinson)
using the CellQuest.TM. software (Becton Dickinson, Franklin Lakes,
N.J.) to calculate the median values of the fluorescence
intensities of the different concentration samples. Nonlinear
regression analysis was performed with GraphPad Prizm.TM. (Version
3.02) (San Diego, Calif.). Concentration dependent binding of scFv
CCR5xCD3 to CCR5 expressing CHO cells was observed with a K.sub.D
value of 0.86 .mu.g/ml (FIG. 20).
Example 9
Cytotoxic Activity of CCR5xCD3 with Primary T Lymphocytes as
Effector Cells
[0252] The following example demonstrates the cytotoxic activity of
the scFv CCR5xCD3 with primary T lymphocytes as effector cells;
and, that no cytotoxic effect of scFv CCR5xCD3 was observed using
CXCR4+CHO cells as target cells.
[0253] The capacity of scFv CCR5xCD3 (as described in Example 2 and
FIG. 3) to mediate cytotoxicity to CCR5-positive cells was tested
using stably transfected CCR5+CHO as target cells and CD3 positive
T-lymphocytes derived from peripheral blood as effector cells. For
detection of cytotoxicity, a FACS based assay was performed.
[0254] CD3+ T-cells (include CD4+ and CD8+ cells) were isolated
from peripheral blood by negative selection using a human T cell
enrichment column (R&D Systems, Minneapolis, Minn.). For this
purpose, PBMC were prepared by standard Ficoll-Hypaque density
gradient separation and applied to the column. B cells and
monocytes were bound to the column matrix, while T cells were
eluted. The enriched T cells were washed in medium and used as
effector cells.
[0255] For discrimination of target cells from effector cells by
flow cytometry, CCR5+CHO cells were labeled with the aliphatic
membrane dye PKH26 (Sigma, St. Louis, Mo.) in a final concentration
of 12 .mu.M. 0.5.times.10.sup.5 labeled CCR5+CHO cells and
2.5.times.10.sup.5 CD3+ T-cells were seeded in a 96-well microtiter
plate in a effector:target ratio of 5:1. 100 .mu.l dilutions of
scFv CCR5xCD3 ranging from 320 ng/ml to 0.3 .mu.g/ml were incubated
with the cells for 16 hours at 37.degree. C. in a humified
atmosphere at 5% CO.sub.2. Subsequently cells were centrifuged for
3 minutes at 600.times.g, and the cell pellets were resuspended in
200 .mu.l FACS buffer (PBS, 1% FCS, 0.05% sodium azide). After
staining with 1 .mu.g/ml propidium iodine (PI), cells were analyzed
in duplicate in a flow cytometer (FACSCalibur.TM., Becton
Dickinson).
[0256] The cytotoxic activity of scFv CCR5xCD3 was tested in a FACS
based assay with CCR5+CHO as target and CD3+ T-lymphocytes as
effector cells. CD3+ T-cells were isolated from peripheral blood.
CCR5+CHO cells were labeled with 12 .mu.M PKH26. Effector:target
cells in a ratio of 5:1 were incubated with dilutions of scFv
CCR5xCD3 ranging from 320 ng/ml to 0.3 pg/ml for 16 hours at
37.degree. C. and 5% CO.sub.2. After staining with 1 .mu.g/ml
propidium iodine (PI), cells were analyzed by flow cytometry.
[0257] In order to verify the specificity of scFv CCR5xCD3 mediated
lysis, stably CXCR4 transfected CHO cells were used as negative
control target cells. The cytotoxicity assay was performed under
identical conditions as described for CCR5+CHO cells.
[0258] Specific lysis of CCR5+CHO cells was calculated using the
CellQuest.TM. software (Becton Dickinson) and a nonlinear
regression analysis was performed with GraphPad Prizm. A sigmoidal
dose response curve was obtained (FIG. 21) revealing an EC50 value
of 912 pg/ml. No cytotoxic effect of scFv CCR5xCD3 was observed
using CXCR4+ CHO cells as target cells.
Example 10
Cytotoxic Activity of CCR5xCD3 with T Cell Clones as Effector
Cells
[0259] This example demonstrates the cytotoxic activity of scFv
CCR5xCD3 with the T cell clone CB15 as effector cells; and, that
specific lysis mediated by scFv CCR5xCD3 is not restricted to the
cytotoxic activity of CD8+ CTL but that CD4+ T cells are also
involved in this process. The cytotoxic activity of scFv CCR5xCD3
on CCR5-positive cells was tested using the CD3 positive T-cell
line CB15 as effector cells in a FACS based assay.
[0260] The cytotoxic activity of scFv CCR5xCD3 (as described in
Example 2 and FIG. 3) on CCR5-positive cells was also tested using
the CD3 positive T-cell line CB15 (CD4+) as effector cells. For
detection of cytotoxicity, a FACS based assay was performed with
CCR5 transfected CHO cells (CCR5+CHO) as target cells.
[0261] CCR5+CHO target cells labeled with 10 .mu.M PKH26 were used
in a effector:target ratio of 10:1. CCR5+CHO cells were labeled
with the aliphatic membrane dye PKH26 (Sigma) in a final
concentration of 10 .mu.M. Effector and target cells were incubated
in a microtiter plate in a ratio of 10:1 with 100 .mu.l of scFv
CCR5xCD3 in dilutions ranging from 40 .mu.g/ml to 0.15 ng/ml for 6
hours at 37.degree. C. in a humified atmosphere with 5% CO.sub.2.
Cells were centrifuged for 3 minutes at 600.times.g and the cell
pellets were resuspended in 200 .mu.l FACS buffer (PBS, 1% FCS,
0.05% sodium azide). Cells were stained with 1 .mu.g/ml propidium
iodine (PI) and analyzed in duplicate in a flow cytometer
(FACSCalibur.TM., Becton Dickinson).
[0262] Specific lysis of CCR5+CHO cells was calculated using the
CellQuest.TM. software (Becton Dickinson) and a nonlinear
regression analysis was performed with GraphPad Prizm.TM.. A
sigmoidal dose response curve was obtained (FIG. 22) revealing an
EC50 value of 12.8 ng/ml.
[0263] The results obtained with T cell clone CB15 as effector
cells in bioactivity assay demonstrate that specific lysis mediated
by scFv CCR5xCD3 is not restricted to the cytotoxic activity of
CD8+ CTL but that CD4+ T cells are also involved in this
process.
Example 11
Epitope Mapping of Parental CCR5 Specific Monoclonal Antibody
MC-1
[0264] The following example describes the epitope mapping of
parental CCR5 specific monoclonal antibody MC-1 used for
construction of scFv CCR5xCD3. These data show that the epitope
recognized by MC-1 is specific for human CCR5 and that lysine at
position aa (amino acid residue) 171 and isoleucine at position aa
198 in human CCR5 sequence are essential for this specificity.
[0265] Epitope of parental CCR5 specific monoclonal antibody (Mab)
MC-1 used for construction of scFv CCR5xCD3 (as described in
Example 2 and FIG. 3) was mapped by flow cytometry using a panel of
about 70 CHO-K1 cell lines stably expressing chimeric and point
mutant receptors (Sartson, J. Biol. Chem., 1997, 272, 24934-24941;
Lee, J. Biol. Chem., 1999, 274, 9617-9626; Blanpain, J. Biol.
Chem., 1999, 274, 34719-34727; Blanpain, Blood, 2000, 96,
1638-1645). Cells were incubated for 30 min on ice with Mab MC-1,
washed and stained with PE-conjugated anti-mouse Ig antibody
(Sigma). CHO-K1 cells expressing CCR2b were used as negative
control. MC-1 was shown to recognize the first part of the second
extracellular loop (ECL2) of the CCR5 molecule. ECL2 ranges from aa
168-199; RSQ KEGLHYTCSS HFPYSQYQFW KNFQTLKIV (SEQ ID NO:35) and is
located between the transmembrane regions 4 and 5 of CCR5 as
described by Chen, J. Virol., 1997, 71, 2705-2714.
[0266] The amino acid sequences of human and rhesus macaque CCR5
differ in eight amino acids with two amino acid changes are
situated at position aa 171 (K.fwdarw.R) and aa 198 (I.fwdarw.M) in
the ECL2 (Chen, J. Virol., 1997, 71, 2705-2714). Due to these amino
acid changes, potential cross-reactivity of MC-1 with the ECL2 of
rhesus macaque CCR5 was analyzed with human and rhesus PBMCs in a
FACS based assay. PBMC of both species were isolated by standard
Ficoll gradient centrifugation. 5.times.10.sup.5 cells were
suspended in 50 .mu.l FACS buffer and 50 .mu.g/ml of MC-1 was
added. After 30 min incubation at 4.degree. C., the cells were
washed and stained with goat anti-mouse IgG F(ab')2-PE conjugated
monoclonal antibody (Dianova) for 30 min at 4.degree. C. in the
dark. Cells were washed and analyzed in a flow cytometer
(FACSCalibur.TM., Becton Dickinson).
[0267] In FIG. 23, reactivity of MC-1 with A) human PBMC and B)
rhesus PBMC. PBMC (solid line), PBMC with PE conjugated goat
anti-mouse antibody (dotted line) and PBMC with MC-1 and PE
conjugated goat anti-mouse antibody (solid bold line). Binding of
MC-1 to human PBMC (A), but not to rhesus PBMC (B) is indicated by
the M1 marker line.
[0268] As shown in FIG. 23 MC-1 exclusively bound to human CCR5 but
did not react with CCR5 derived from rhesus macaques. These data
show that the epitope recognized by MC-1 is specific for human CCR5
arid that lysine at position aa 171 and isoleucine at position aa
198 in human CCR5 sequence are essential for this specificity.
Especially lysine at position aa 171 which is located in the first
part of ECL2 contributes to the specific recognition of the human
epitope of CCR5 by Mab MC-1.
Example 12
scFv CCR5xCD3 Mediated Reduction of Virus Production in HIV-1
Infected Monocytes
[0269] The following example demonstrates the scFv CCR5xCD3
mediated reduction of virus production in HIV-1 infected
monocytes.
[0270] Peripheral blood mononuclear cells (PBMC) were prepared from
fresh buffy coats of healthy donors by Ficoll density
centrifugation and monocytes were isolated by over night adherence
to culture flasks. Remaining PBL were removed and cultured
separately at 37.degree. C. in a humidified atmosphere at 5%
CO.sub.2.
[0271] Monocytes were seeded into a 48 well microtiter plate at a
density of 5.times.10.sup.4 cells/well and infected with the
M-tropic HIV-1 strain BaL (moi=1) overnight at 37.degree. C. in a
humidified atmosphere at 5% CO.sub.2. The virus was removed by
washing and the monocytes were further cultured with unstimulated
PBL (15.times.10.sup.4 per well)+scFv CCR5xCD3 (1 .mu.g/ml)+AZT (75
.mu.M) or with unstimulated PBL (15.times.10.sup.4 per well) alone
as negative control. 5 days post infection (p.i.) monocytes were
washed and cultured in the absence of AZT or antibody. Supernatant
was harvested on day 15 p.i. and HIV-1 replication was quantified
by measurement of p24 in an ELISA. This demonstrates that the scFv
CCR5xCD3 of the invention led to a reduction of virus replication
of 75% in samples containing scFV CCR5xCD3 (75 ng/ml p24) compared
to the control without scFv CCR5xCD3 (300 ng/ml p24).
[0272] A number of embodiments of the invention have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the invention. Accordingly, other embodiments are within
the scope of the following claims.
Sequence CWU 1
1
34 1 25 DNA Artificial Sequence Description of Artificial Sequence
primer 1 ggaacaagat ggattatcaa gtgtc 25 2 25 DNA Artificial
Sequence Description of Artificial Sequence primer 2 ctgtgtatga
aaactaagcc atgtg 25 3 22 DNA Artificial Sequence Description of
Artificial Sequence primer 3 tttaccagat ctcaaaaaga ag 22 4 21 DNA
Artificial Sequence Description of Artificial Sequence primer 4
ggagaaggac aatgttgtag g 21 5 24 DNA Artificial Sequence Description
of Artificial Sequence primer 5 gacattcagc tgacccagtc tcca 24 6 22
DNA Artificial Sequence Description of Artificial Sequence primer 6
gttttatttc cagcttggtc cc 22 7 29 DNA Artificial Sequence
Description of Artificial Sequence primer 7 accatgggat ggagctgtgt
catgctctt 29 8 34 DNA Artificial Sequence Description of Artificial
Sequence primer 8 tgaggagacg gtgaccgtgg tcccttggcc ccag 34 9 322
DNA Mus sp. CDS (1)..(321) 9 gac att cag ctg acc cag tct cca gcc
tcc cta tct gca tct gtg gga 48 Asp Ile Gln Leu Thr Gln Ser Pro Ala
Ser Leu Ser Ala Ser Val Gly 1 5 10 15 gaa act gtc acc atc aca tgt
cga gca agt gag aat att tac agt tat 96 Glu Thr Val Thr Ile Thr Cys
Arg Ala Ser Glu Asn Ile Tyr Ser Tyr 20 25 30 tta gca tgg tat cag
cag aaa cag gga aaa tct cct caa ctc ctg gtc 144 Leu Ala Trp Tyr Gln
Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val 35 40 45 tat aat gca
aaa acc tta aca gaa ggt gtg cca tca agg ttc agt ggc 192 Tyr Asn Ala
Lys Thr Leu Thr Glu Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 agt
gga tca ggc aca cag ttt tct ctg aag atc aac agc ctg cag cct 240 Ser
Gly Ser Gly Thr Gln Phe Ser Leu Lys Ile Asn Ser Leu Gln Pro 65 70
75 80 gaa gat ttt ggg aat tat ttc tgt caa cat cat tat gat act cct
cgg 288 Glu Asp Phe Gly Asn Tyr Phe Cys Gln His His Tyr Asp Thr Pro
Arg 85 90 95 acg ttc ggt gga ggg acc aag ctg gaa ata aaa c 322 Thr
Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 10 107 PRT Mus sp.
10 Asp Ile Gln Leu Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Val Gly
1 5 10 15 Glu Thr Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr
Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Gln Gly Lys Ser Pro
Gln Leu Leu Val 35 40 45 Tyr Asn Ala Lys Thr Leu Thr Glu Gly Val
Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Gln Phe Ser
Leu Lys Ile Asn Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Gly Asn Tyr
Phe Cys Gln His His Tyr Asp Thr Pro Arg 85 90 95 Thr Phe Gly Gly
Gly Thr Lys Leu Glu Ile Lys 100 105 11 276 DNA Mus sp. CDS
(1)..(276) 11 gcc tcc cta tct gca tct gtg gga gaa act gtc acc atc
aca tgt cga 48 Ala Ser Leu Ser Ala Ser Val Gly Glu Thr Val Thr Ile
Thr Cys Arg 1 5 10 15 gca agt gag aat att tac agt tat tta gca tgg
tat cag cag aaa cag 96 Ala Ser Glu Asn Ile Tyr Ser Tyr Leu Ala Trp
Tyr Gln Gln Lys Gln 20 25 30 gga aaa tct cct caa ctc ctg gtc tat
aat gca aaa acc tta aca gaa 144 Gly Lys Ser Pro Gln Leu Leu Val Tyr
Asn Ala Lys Thr Leu Thr Glu 35 40 45 ggt gtg cca tca agg ttc agt
ggc agt gga tca ggc aca cag ttt tct 192 Gly Val Pro Ser Arg Phe Ser
Gly Ser Gly Ser Gly Thr Gln Phe Ser 50 55 60 ctg aag atc aac agc
ctg cag cct gaa gat ttt ggg aat tat ttc tgt 240 Leu Lys Ile Asn Ser
Leu Gln Pro Glu Asp Phe Gly Asn Tyr Phe Cys 65 70 75 80 caa cat cat
tat gat act cct cgg acg ttc ggt gga 276 Gln His His Tyr Asp Thr Pro
Arg Thr Phe Gly Gly 85 90 12 92 PRT Mus sp. 12 Ala Ser Leu Ser Ala
Ser Val Gly Glu Thr Val Thr Ile Thr Cys Arg 1 5 10 15 Ala Ser Glu
Asn Ile Tyr Ser Tyr Leu Ala Trp Tyr Gln Gln Lys Gln 20 25 30 Gly
Lys Ser Pro Gln Leu Leu Val Tyr Asn Ala Lys Thr Leu Thr Glu 35 40
45 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Phe Ser
50 55 60 Leu Lys Ile Asn Ser Leu Gln Pro Glu Asp Phe Gly Asn Tyr
Phe Cys 65 70 75 80 Gln His His Tyr Asp Thr Pro Arg Thr Phe Gly Gly
85 90 13 414 DNA Mus sp. CDS (1)..(414) 13 atg gga tgg agc tgt gtc
atg ctc ttc ttg gta gca aca gct aca ggt 48 Met Gly Trp Ser Cys Val
Met Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 gtc cac tcc cag
gtc caa ctg cag cag cct ggg gct ggg agg gtg agg 96 Val His Ser Gln
Val Gln Leu Gln Gln Pro Gly Ala Gly Arg Val Arg 20 25 30 cct gga
gct tca gtg aag ctg tcc tgc aag gct tct ggc tac tcc ttc 144 Pro Gly
Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Ser Phe 35 40 45
acc agt tac tgg atg aac tgg gtg aag cag agg cct gga caa ggc ctt 192
Thr Ser Tyr Trp Met Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50
55 60 gag tgg att ggc atg att cat cct tcc gat agt gaa act agg tta
aat 240 Glu Trp Ile Gly Met Ile His Pro Ser Asp Ser Glu Thr Arg Leu
Asn 65 70 75 80 cag aag ttc aac gac agg gcc aca ttg act gtt gac aaa
tat tcc agc 288 Gln Lys Phe Asn Asp Arg Ala Thr Leu Thr Val Asp Lys
Tyr Ser Ser 85 90 95 aca gcc tat ata caa ctc agc agc ccg aca tct
gag gac tct gcg gtc 336 Thr Ala Tyr Ile Gln Leu Ser Ser Pro Thr Ser
Glu Asp Ser Ala Val 100 105 110 tat tac tgt gca aga gga gaa tat tac
tac ggt ata ttt gac tac tgg 384 Tyr Tyr Cys Ala Arg Gly Glu Tyr Tyr
Tyr Gly Ile Phe Asp Tyr Trp 115 120 125 ggc caa ggg acc acg gtc acc
gtc tcc tca 414 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 130 135 14
138 PRT Mus sp. 14 Met Gly Trp Ser Cys Val Met Leu Phe Leu Val Ala
Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Pro
Gly Ala Gly Arg Val Arg 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser
Cys Lys Ala Ser Gly Tyr Ser Phe 35 40 45 Thr Ser Tyr Trp Met Asn
Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly
Met Ile His Pro Ser Asp Ser Glu Thr Arg Leu Asn 65 70 75 80 Gln Lys
Phe Asn Asp Arg Ala Thr Leu Thr Val Asp Lys Tyr Ser Ser 85 90 95
Thr Ala Tyr Ile Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val 100
105 110 Tyr Tyr Cys Ala Arg Gly Glu Tyr Tyr Tyr Gly Ile Phe Asp Tyr
Trp 115 120 125 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 130 135 15
354 DNA Mus sp. CDS (2)..(352) 15 c ttg gta gca aca gct aca ggt gtc
cac tcc cag gtc caa ctg cag cag 49 Leu Val Ala Thr Ala Thr Gly Val
His Ser Gln Val Gln Leu Gln Gln 1 5 10 15 cct ggg gct ggg agg gtg
agg cct gga gct tca gtg aag ctg tcc tgc 97 Pro Gly Ala Gly Arg Val
Arg Pro Gly Ala Ser Val Lys Leu Ser Cys 20 25 30 aag gct tct ggc
tac tcc ttc acc agt tac tgg atg aac tgg gtg aag 145 Lys Ala Ser Gly
Tyr Ser Phe Thr Ser Tyr Trp Met Asn Trp Val Lys 35 40 45 cag agg
cct gga caa ggc ctt gag tgg att ggc atg att cat cct tcc 193 Gln Arg
Pro Gly Gln Gly Leu Glu Trp Ile Gly Met Ile His Pro Ser 50 55 60
gat agt gaa act agg tta aat cag aag ttc aac gac agg gcc aca ttg 241
Asp Ser Glu Thr Arg Leu Asn Gln Lys Phe Asn Asp Arg Ala Thr Leu 65
70 75 80 act gtt gac aaa tat tcc agc aca gcc tat ata caa ctc agc
agc ccg 289 Thr Val Asp Lys Tyr Ser Ser Thr Ala Tyr Ile Gln Leu Ser
Ser Pro 85 90 95 aca tct gag gac tct gcg gtc tat tac tgt gca aga
gga gaa tat tac 337 Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg
Gly Glu Tyr Tyr 100 105 110 tac ggt ata ttt gac ta 354 Tyr Gly Ile
Phe Asp 115 16 117 PRT Mus sp. 16 Leu Val Ala Thr Ala Thr Gly Val
His Ser Gln Val Gln Leu Gln Gln 1 5 10 15 Pro Gly Ala Gly Arg Val
Arg Pro Gly Ala Ser Val Lys Leu Ser Cys 20 25 30 Lys Ala Ser Gly
Tyr Ser Phe Thr Ser Tyr Trp Met Asn Trp Val Lys 35 40 45 Gln Arg
Pro Gly Gln Gly Leu Glu Trp Ile Gly Met Ile His Pro Ser 50 55 60
Asp Ser Glu Thr Arg Leu Asn Gln Lys Phe Asn Asp Arg Ala Thr Leu 65
70 75 80 Thr Val Asp Lys Tyr Ser Ser Thr Ala Tyr Ile Gln Leu Ser
Ser Pro 85 90 95 Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg
Gly Glu Tyr Tyr 100 105 110 Tyr Gly Ile Phe Asp 115 17 1545 DNA Mus
sp. CDS (58)..(1545) 17 atgggatgga gctgtatcat cctcttcttg gtagcaacag
ctacaggtgt acactcc 57 gat atc gtg ctg acc cag tct cca gcc tcc cta
tct gca tct gtg gga 105 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu
Ser Ala Ser Val Gly 1 5 10 15 gaa act gtc acc atc aca tgt cga gca
agt gag aat att tac agt tat 153 Glu Thr Val Thr Ile Thr Cys Arg Ala
Ser Glu Asn Ile Tyr Ser Tyr 20 25 30 tta gca tgg tat cag cag aaa
cag gga aaa tct cct caa ctc ctg gtc 201 Leu Ala Trp Tyr Gln Gln Lys
Gln Gly Lys Ser Pro Gln Leu Leu Val 35 40 45 tat aat gca aaa acc
tta aca gaa ggt gtg cca tca agg ttc agt ggc 249 Tyr Asn Ala Lys Thr
Leu Thr Glu Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 agt gga tca
ggc aca cag ttt tct ctg aag atc aac agc ctg cag cct 297 Ser Gly Ser
Gly Thr Gln Phe Ser Leu Lys Ile Asn Ser Leu Gln Pro 65 70 75 80 gaa
gat ttt ggg aat tat ttc tgt caa cat cat tat gat act cct cgg 345 Glu
Asp Phe Gly Asn Tyr Phe Cys Gln His His Tyr Asp Thr Pro Arg 85 90
95 acg ttc ggt gga ggg acc aag ctc gag atc aaa ggt ggt ggt ggt tct
393 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser
100 105 110 ggc ggc ggc ggc tcc ggt ggt ggt ggt tct cag gtc caa ctg
cag cag 441 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu
Gln Gln 115 120 125 cct ggg gct ggg agg gtg agg cct gga gct tca gtg
aag ctg tcc tgc 489 Pro Gly Ala Gly Arg Val Arg Pro Gly Ala Ser Val
Lys Leu Ser Cys 130 135 140 aag gct tct ggc tac tcc ttc acc agt tac
tgg atg aac tgg gtg aag 537 Lys Ala Ser Gly Tyr Ser Phe Thr Ser Tyr
Trp Met Asn Trp Val Lys 145 150 155 160 cag agg cct gga caa ggc ctt
gag tgg att ggc atg att cat cct tcc 585 Gln Arg Pro Gly Gln Gly Leu
Glu Trp Ile Gly Met Ile His Pro Ser 165 170 175 gat agt gaa act agg
tta aat cag aag ttc aac gac agg gcc aca ttg 633 Asp Ser Glu Thr Arg
Leu Asn Gln Lys Phe Asn Asp Arg Ala Thr Leu 180 185 190 act gtt gac
aaa tat tcc agc aca gcc tat ata caa ctc agc agc ccg 681 Thr Val Asp
Lys Tyr Ser Ser Thr Ala Tyr Ile Gln Leu Ser Ser Pro 195 200 205 aca
tct gag gac tct gcg gtc tat tac tgt gca aga gga gaa tat tac 729 Thr
Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Gly Glu Tyr Tyr 210 215
220 tac ggt ata ttt gac tac tgg ggc caa ggg acc acg gtc acc gtc tcc
777 Tyr Gly Ile Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser
225 230 235 240 tcc gga ggt ggt gga tcc gat atc aaa ctg cag cag tca
ggg gct gaa 825 Ser Gly Gly Gly Gly Ser Asp Ile Lys Leu Gln Gln Ser
Gly Ala Glu 245 250 255 ctg gca aga cct ggg gcc tca gtg aag atg tcc
tgc aag act tct ggc 873 Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser
Cys Lys Thr Ser Gly 260 265 270 tac acc ttt act agg tac acg atg cac
tgg gta aaa cag agg cct gga 921 Tyr Thr Phe Thr Arg Tyr Thr Met His
Trp Val Lys Gln Arg Pro Gly 275 280 285 cag ggt ctg gaa tgg att gga
tac att aat cct agc cgt ggt tat act 969 Gln Gly Leu Glu Trp Ile Gly
Tyr Ile Asn Pro Ser Arg Gly Tyr Thr 290 295 300 aat tac aat cag aag
ttc aag gac aag gcc aca ttg act aca gac aaa 1017 Asn Tyr Asn Gln
Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys 305 310 315 320 tcc
tcc agc aca gcc tac atg caa ctg agc agc ctg aca tct gag gac 1065
Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp 325
330 335 tct gca gtc tat tac tgt gca aga tat tat gat gat cat tac tgc
ctt 1113 Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr
Cys Leu 340 345 350 gac tac tgg cgc caa ggc acc act ctc aca gtc tcc
tca gtc gaa ggt 1161 Asp Tyr Trp Arg Gln Gly Thr Thr Leu Thr Val
Ser Ser Val Glu Gly 355 360 365 gga agt gga ggt tct ggt gga agt gga
ggt tca ggt gga gtc gac gac 1209 Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly Ser Gly Gly Val Asp Asp 370 375 380 att cag ctg acc cag tct
cca gca atc atg tct gca tct cca ggg gag 1257 Ile Gln Leu Thr Gln
Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu 385 390 395 400 aag gtc
acc atg acc tgc aga gcc agt tca agt gta agt tac atg aac 1305 Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn 405 410
415 tgg tac cag cag aag tca ggc acc tcc ccc aaa aga tgg att tat gac
1353 Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr
Asp 420 425 430 aca tcc aaa gtg gct tct gga gtc cct tat cgc ttc agt
ggc agt ggg 1401 Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe
Ser Gly Ser Gly 435 440 445 tct ggg acc tca tac tct ctc aca atc agc
agc atg gag gct gaa gat 1449 Ser Gly Thr Ser Tyr Ser Leu Thr Ile
Ser Ser Met Glu Ala Glu Asp 450 455 460 gct gcc act tat tac tgc caa
cag tgg agt agt aac ccg ctc acg ttc 1497 Ala Ala Thr Tyr Tyr Cys
Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe 465 470 475 480 gga gct ggg
acc aag ctg gag ctg aaa cat cat cac cat cat cat tag 1545 Gly Ala
Gly Thr Lys Leu Glu Leu Lys His His His His His His 485 490 495 18
495 PRT Mus sp. 18 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ser
Ala Ser Val Gly 1 5 10 15 Glu Thr Val Thr Ile Thr Cys Arg Ala Ser
Glu Asn Ile Tyr Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Gln
Gly Lys Ser Pro Gln Leu Leu Val 35 40 45 Tyr Asn Ala Lys Thr Leu
Thr Glu Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly
Thr Gln Phe Ser Leu Lys Ile Asn Ser Leu Gln Pro 65 70 75 80 Glu Asp
Phe Gly Asn Tyr Phe Cys Gln His His Tyr Asp Thr Pro Arg 85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser 100
105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln
Gln 115 120 125 Pro Gly Ala Gly Arg Val Arg Pro Gly Ala Ser Val Lys
Leu Ser Cys 130 135 140 Lys Ala Ser Gly Tyr Ser Phe Thr Ser Tyr Trp
Met Asn Trp Val Lys 145 150 155 160 Gln Arg Pro Gly Gln Gly Leu Glu
Trp Ile Gly Met Ile His Pro Ser 165 170 175 Asp Ser Glu Thr Arg Leu
Asn Gln Lys Phe Asn Asp Arg Ala Thr Leu 180 185 190 Thr Val Asp Lys
Tyr Ser Ser Thr Ala Tyr Ile Gln Leu Ser Ser Pro 195 200 205 Thr Ser
Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Gly Glu Tyr Tyr 210 215 220
Tyr Gly Ile Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser 225
230 235 240 Ser Gly Gly Gly Gly Ser Asp Ile Lys Leu Gln Gln Ser Gly
Ala Glu
245 250 255 Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr
Ser Gly 260 265 270 Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys
Gln Arg Pro Gly 275 280 285 Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn
Pro Ser Arg Gly Tyr Thr 290 295 300 Asn Tyr Asn Gln Lys Phe Lys Asp
Lys Ala Thr Leu Thr Thr Asp Lys 305 310 315 320 Ser Ser Ser Thr Ala
Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp 325 330 335 Ser Ala Val
Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Cys Leu 340 345 350 Asp
Tyr Trp Arg Gln Gly Thr Thr Leu Thr Val Ser Ser Val Glu Gly 355 360
365 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Val Asp Asp
370 375 380 Ile Gln Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro
Gly Glu 385 390 395 400 Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser
Val Ser Tyr Met Asn 405 410 415 Trp Tyr Gln Gln Lys Ser Gly Thr Ser
Pro Lys Arg Trp Ile Tyr Asp 420 425 430 Thr Ser Lys Val Ala Ser Gly
Val Pro Tyr Arg Phe Ser Gly Ser Gly 435 440 445 Ser Gly Thr Ser Tyr
Ser Leu Thr Ile Ser Ser Met Glu Ala Glu Asp 450 455 460 Ala Ala Thr
Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe 465 470 475 480
Gly Ala Gly Thr Lys Leu Glu Leu Lys His His His His His His 485 490
495 19 24 DNA Mus sp. 19 aaaggcctcc ccatattcct cgga 24 20 37 DNA
Mus sp. 20 aaagtcgact ccggacatct ccaaagagtt gatgtac 37 21 25 DNA
Mus sp. 21 aatccggagg cggcagcctg gccgc 25 22 46 DNA Mus sp. 22
gggaagctta gtgatggtga tggtgatgct tcaggtcctc gcgcgg 46 23 1245 DNA
Mus sp. CDS (1)..(1245) 23 tcc cca tat tcc tcg gac acc aca ccc tgc
tgc ttt gcc tac att gcc 48 Ser Pro Tyr Ser Ser Asp Thr Thr Pro Cys
Cys Phe Ala Tyr Ile Ala 1 5 10 15 cgc cca ctg ccc cgt gcc cac atc
aag gag tat ttc tac acc agt ggc 96 Arg Pro Leu Pro Arg Ala His Ile
Lys Glu Tyr Phe Tyr Thr Ser Gly 20 25 30 aag tgc tcc aac cca gca
gtc gtc ttt gtc acc cga aag aac cgc caa 144 Lys Cys Ser Asn Pro Ala
Val Val Phe Val Thr Arg Lys Asn Arg Gln 35 40 45 gtg tgt gcc aac
cca gag aag aaa tgg gtt cgg gag tac atc aac tct 192 Val Cys Ala Asn
Pro Glu Lys Lys Trp Val Arg Glu Tyr Ile Asn Ser 50 55 60 ttg gag
atg tcc gga ggc ggc agc ctg gcc gcg ctg acc gcg cac cag 240 Leu Glu
Met Ser Gly Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gln 65 70 75 80
gct tgc cac ctg ccg ctg gag act ttc acc cgt cat cgc cag ccg cgc 288
Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gln Pro Arg 85
90 95 ggc tgg gaa caa ctg gag cag tgc ggc tat ccg gtg cag cgg ctg
gtc 336 Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu
Val 100 105 110 gcc ctc tac ctg gcg gcg cgg ctg tcg tgg aac cag gtc
gac cag gtg 384 Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val
Asp Gln Val 115 120 125 atc cgc aac gcc ctg gcc agc ccc ggc agc ggc
ggc gac ctg ggc gaa 432 Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly
Gly Asp Leu Gly Glu 130 135 140 gcg atc cgc gag cag ccg gag cag gcc
cgt ctg gcc ctg acc ctg gcc 480 Ala Ile Arg Glu Gln Pro Glu Gln Ala
Arg Leu Ala Leu Thr Leu Ala 145 150 155 160 gcc gcc gag agc gag cgc
ttc gtc cgg cag ggc acc ggc aac gac gag 528 Ala Ala Glu Ser Glu Arg
Phe Val Arg Gln Gly Thr Gly Asn Asp Glu 165 170 175 gcc ggc gcg gcc
aac ggc ccg gcg gac agc ggc gac gcc ctg ctg gag 576 Ala Gly Ala Ala
Asn Gly Pro Ala Asp Ser Gly Asp Ala Leu Leu Glu 180 185 190 cgc aac
tat ccc act ggc gcg gag ttc ctc ggc gac ggc ggc gac gtc 624 Arg Asn
Tyr Pro Thr Gly Ala Glu Phe Leu Gly Asp Gly Gly Asp Val 195 200 205
agc ttc agc acc cgc ggc acg cag aac tgg acg gtg gag cgg ctg ctc 672
Ser Phe Ser Thr Arg Gly Thr Gln Asn Trp Thr Val Glu Arg Leu Leu 210
215 220 cag gcg cac cgc caa ctg gag gag cgc ggc tat gtg ttc gtc ggc
tac 720 Gln Ala His Arg Gln Leu Glu Glu Arg Gly Tyr Val Phe Val Gly
Tyr 225 230 235 240 cac ggc acc ttc ctc gaa gcg gcg caa agc atc gtc
ttc ggc ggg gtg 768 His Gly Thr Phe Leu Glu Ala Ala Gln Ser Ile Val
Phe Gly Gly Val 245 250 255 cgc gcg cgc agc cag gac ctc gac gcg atc
tgg cgc ggt ttc tat atc 816 Arg Ala Arg Ser Gln Asp Leu Asp Ala Ile
Trp Arg Gly Phe Tyr Ile 260 265 270 gcc ggc gat ccg gcg ctg gcc tac
ggc tac gcc cag gac cag gaa ccc 864 Ala Gly Asp Pro Ala Leu Ala Tyr
Gly Tyr Ala Gln Asp Gln Glu Pro 275 280 285 gac gca cgc ggc cgg atc
cgc aac ggt gcc ctg ctg cgg gtc tat gtg 912 Asp Ala Arg Gly Arg Ile
Arg Asn Gly Ala Leu Leu Arg Val Tyr Val 290 295 300 ccg cgc tcg agc
ctg ccg ggc ttc tac cgc acc agc ctg acc ctg gcc 960 Pro Arg Ser Ser
Leu Pro Gly Phe Tyr Arg Thr Ser Leu Thr Leu Ala 305 310 315 320 gcg
ccg gag gcg gcg ggc gag gtc gaa cgg ctg atc ggc cat ccg ctg 1008
Ala Pro Glu Ala Ala Gly Glu Val Glu Arg Leu Ile Gly His Pro Leu 325
330 335 ccg ctg cgc ctg gac gcc atc acc ggc ccc gag gag gaa ggc ggg
cgc 1056 Pro Leu Arg Leu Asp Ala Ile Thr Gly Pro Glu Glu Glu Gly
Gly Arg 340 345 350 ctg gag acc att ctc ggc tgg ccg ctg gcc gag cgc
acc gtg gtg att 1104 Leu Glu Thr Ile Leu Gly Trp Pro Leu Ala Glu
Arg Thr Val Val Ile 355 360 365 ccc tcg gcg atc ccc acc gac ccg cgc
aac gtc ggc ggc gac ctc gac 1152 Pro Ser Ala Ile Pro Thr Asp Pro
Arg Asn Val Gly Gly Asp Leu Asp 370 375 380 ccg tcc agc atc ccc gac
aag gaa cag gcg atc agc gcc ctg ccg gac 1200 Pro Ser Ser Ile Pro
Asp Lys Glu Gln Ala Ile Ser Ala Leu Pro Asp 385 390 395 400 tac gcc
agc cag ccc ggc aaa ccg ccg cgc gag gac ctg aag taa 1245 Tyr Ala
Ser Gln Pro Gly Lys Pro Pro Arg Glu Asp Leu Lys 405 410 415 24 414
PRT Mus sp. 24 Ser Pro Tyr Ser Ser Asp Thr Thr Pro Cys Cys Phe Ala
Tyr Ile Ala 1 5 10 15 Arg Pro Leu Pro Arg Ala His Ile Lys Glu Tyr
Phe Tyr Thr Ser Gly 20 25 30 Lys Cys Ser Asn Pro Ala Val Val Phe
Val Thr Arg Lys Asn Arg Gln 35 40 45 Val Cys Ala Asn Pro Glu Lys
Lys Trp Val Arg Glu Tyr Ile Asn Ser 50 55 60 Leu Glu Met Ser Gly
Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gln 65 70 75 80 Ala Cys His
Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gln Pro Arg 85 90 95 Gly
Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val 100 105
110 Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val
115 120 125 Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu
Gly Glu 130 135 140 Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala
Leu Thr Leu Ala 145 150 155 160 Ala Ala Glu Ser Glu Arg Phe Val Arg
Gln Gly Thr Gly Asn Asp Glu 165 170 175 Ala Gly Ala Ala Asn Gly Pro
Ala Asp Ser Gly Asp Ala Leu Leu Glu 180 185 190 Arg Asn Tyr Pro Thr
Gly Ala Glu Phe Leu Gly Asp Gly Gly Asp Val 195 200 205 Ser Phe Ser
Thr Arg Gly Thr Gln Asn Trp Thr Val Glu Arg Leu Leu 210 215 220 Gln
Ala His Arg Gln Leu Glu Glu Arg Gly Tyr Val Phe Val Gly Tyr 225 230
235 240 His Gly Thr Phe Leu Glu Ala Ala Gln Ser Ile Val Phe Gly Gly
Val 245 250 255 Arg Ala Arg Ser Gln Asp Leu Asp Ala Ile Trp Arg Gly
Phe Tyr Ile 260 265 270 Ala Gly Asp Pro Ala Leu Ala Tyr Gly Tyr Ala
Gln Asp Gln Glu Pro 275 280 285 Asp Ala Arg Gly Arg Ile Arg Asn Gly
Ala Leu Leu Arg Val Tyr Val 290 295 300 Pro Arg Ser Ser Leu Pro Gly
Phe Tyr Arg Thr Ser Leu Thr Leu Ala 305 310 315 320 Ala Pro Glu Ala
Ala Gly Glu Val Glu Arg Leu Ile Gly His Pro Leu 325 330 335 Pro Leu
Arg Leu Asp Ala Ile Thr Gly Pro Glu Glu Glu Gly Gly Arg 340 345 350
Leu Glu Thr Ile Leu Gly Trp Pro Leu Ala Glu Arg Thr Val Val Ile 355
360 365 Pro Ser Ala Ile Pro Thr Asp Pro Arg Asn Val Gly Gly Asp Leu
Asp 370 375 380 Pro Ser Ser Ile Pro Asp Lys Glu Gln Ala Ile Ser Ala
Leu Pro Asp 385 390 395 400 Tyr Ala Ser Gln Pro Gly Lys Pro Pro Arg
Glu Asp Leu Lys 405 410 25 363 DNA Mus sp. CDS (1)..(363) 25 gat
atc aaa ctg cag cag tca ggg gct gaa ctg gca aga cct ggg gcc 48 Asp
Ile Lys Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala 1 5 10
15 tca gtg aag atg tcc tgc aag act tct ggc tac acc ttt act agg tac
96 Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr
20 25 30 acg atg cac tgg gta aaa cag agg cct gga cag ggt ctg gaa
tgg att 144 Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu
Trp Ile 35 40 45 gga tac att aat cct agc cgt ggt tat act aat tac
aat cag aag ttc 192 Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
Asn Gln Lys Phe 50 55 60 aag gac aag gcc aca ttg act aca gac aaa
tcc tcc agc aca gcc tac 240 Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser Ser Thr Ala Tyr 65 70 75 80 atg caa ctg agc agc ctg aca tct
gag gac tct gca gtc tat tac tgt 288 Met Gln Leu Ser Ser Leu Thr Ser
Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 gca aga tat tat gat gat
cat tac tgc ctt gac tac tgg cgc caa ggc 336 Ala Arg Tyr Tyr Asp Asp
His Tyr Cys Leu Asp Tyr Trp Arg Gln Gly 100 105 110 acc act ctc aca
gtc tcc tca gtc gaa 363 Thr Thr Leu Thr Val Ser Ser Val Glu 115 120
26 121 PRT Mus sp. 26 Asp Ile Lys Leu Gln Gln Ser Gly Ala Glu Leu
Ala Arg Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Thr Ser
Gly Tyr Thr Phe Thr Arg Tyr 20 25 30 Thr Met His Trp Val Lys Gln
Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Asn Pro
Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe 50 55 60 Lys Asp Lys
Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met
Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90
95 Ala Arg Tyr Tyr Asp Asp His Tyr Cys Leu Asp Tyr Trp Arg Gln Gly
100 105 110 Thr Thr Leu Thr Val Ser Ser Val Glu 115 120 27 324 DNA
Mus sp. CDS (1)..(324) 27 gtc gac gac att cag ctg acc cag tct cca
gca atc atg tct gca tct 48 Val Asp Asp Ile Gln Leu Thr Gln Ser Pro
Ala Ile Met Ser Ala Ser 1 5 10 15 cca ggg gag aag gtc acc atg acc
tgc aga gcc agt tca agt gta agt 96 Pro Gly Glu Lys Val Thr Met Thr
Cys Arg Ala Ser Ser Ser Val Ser 20 25 30 tac atg aac tgg tac cag
cag aag tca ggc acc tcc ccc aaa aga tgg 144 Tyr Met Asn Trp Tyr Gln
Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp 35 40 45 att tat gac aca
tcc aaa gtg gct tct gga gtc cct tat cgc ttc agt 192 Ile Tyr Asp Thr
Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser 50 55 60 ggc agt
ggg tct ggg acc tca tac tct ctc aca atc agc agc atg gag 240 Gly Ser
Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu 65 70 75 80
gct gaa gat gct gcc act tat tac tgc caa cag tgg agt agt aac ccg 288
Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro 85
90 95 ctc acg ttc gga gct ggg acc aag ctg gag ctg aaa 324 Leu Thr
Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 28 108 PRT Mus sp.
28 Val Asp Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser
1 5 10 15 Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser
Val Ser 20 25 30 Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser
Pro Lys Arg Trp 35 40 45 Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly
Val Pro Tyr Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr
Ser Leu Thr Ile Ser Ser Met Glu 65 70 75 80 Ala Glu Asp Ala Ala Thr
Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro 85 90 95 Leu Thr Phe Gly
Ala Gly Thr Lys Leu Glu Leu Lys 100 105 29 11 PRT Artificial
Sequence Description of Artificial Sequence peptide 29 Arg Ala Ser
Glu Asn Ile Tyr Ser Tyr Leu Ala 1 5 10 30 7 PRT Artificial Sequence
Description of Artificial Sequence peptide 30 Asn Ala Lys Thr Leu
Thr Glu 1 5 31 9 PRT Artificial Sequence Description of Artificial
Sequence peptide 31 Gln His His Tyr Asp Thr Pro Arg Thr 1 5 32 4
PRT Artificial Sequence Description of Artificial Sequence peptide
32 Tyr Trp Met Asn 1 33 19 PRT Artificial Sequence Description of
Artificial Sequence peptide 33 Gly Met Ile His Pro Ser Asp Ser Glu
Thr Arg Leu Asn Gln Lys Phe 1 5 10 15 Asn Asp Arg 34 10 PRT
Artificial Sequence Description of Artificial Sequence peptide 34
Gly Glu Tyr Tyr Tyr Gly Ile Phe Asp Tyr 1 5 10
* * * * *
References