U.S. patent application number 11/107481 was filed with the patent office on 2005-08-25 for dorsalin-1 polypeptide and uses thereof.
This patent application is currently assigned to The Trustees of Columbia University in the City of New York. Invention is credited to Basler, Konrad, Jessell, Thomas M., Yamada, Toshiya.
Application Number | 20050186628 11/107481 |
Document ID | / |
Family ID | 22065513 |
Filed Date | 2005-08-25 |
United States Patent
Application |
20050186628 |
Kind Code |
A1 |
Jessell, Thomas M. ; et
al. |
August 25, 2005 |
Dorsalin-1 polypeptide and uses thereof
Abstract
This invention provides an isolated vertebrate nucleic acid
molecule which encodes dorsalin-1. This invention also provides a
nucleic acid probe capable of specifically hybridizing with a
sequence included within the sequence of a nucleic acid molecule
encoding a dorsalin-1. The invention also provides a vector and
host vector system for the production of a polypeptide having the
biological activity of dorsalin-1 which comprises the
above-described vector in a suitable host. This invention also
provides a purified vertebrate dorsalin-1. This invention provides
a method for stimulating neural crest cell differentiation, a
method for regenerating nerve cells, a method for promoting bone
growth, a method for promoting wound healing and a method for
treating neural tumor using purified dorsalin-1. This invention
further provides a pharmaceutical composition comprising purified
dorsalin-1 and a pharmaceutically acceptable carrier. Finally, this
invention provides an antibody capable of binding to
dorsalin-1.
Inventors: |
Jessell, Thomas M.; (New
York, NY) ; Basler, Konrad; (Kusnacht, CH) ;
Yamada, Toshiya; (Fort Lee, NJ) |
Correspondence
Address: |
Cooper & Dunham, LLP
1185 Avenue of the Americas
New York
NY
10036
US
|
Assignee: |
The Trustees of Columbia University
in the City of New York
|
Family ID: |
22065513 |
Appl. No.: |
11/107481 |
Filed: |
April 15, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11107481 |
Apr 15, 2005 |
|
|
|
10002278 |
Nov 2, 2001 |
|
|
|
6916913 |
|
|
|
|
10002278 |
Nov 2, 2001 |
|
|
|
08065844 |
May 20, 1993 |
|
|
|
6333168 |
|
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/320.1; 435/325; 435/69.1; 530/350; 536/23.2 |
Current CPC
Class: |
A61K 38/00 20130101;
A61P 43/00 20180101; A61P 25/00 20180101; C07K 2319/00 20130101;
A61P 35/00 20180101; C07K 14/495 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/320.1; 435/325; 530/350; 536/023.2 |
International
Class: |
C12Q 001/68; C07H
021/04; C07K 014/705 |
Claims
1-19. (canceled)
20. A method for stimulating neural crest cell differentiation
comprising contacting a neural crest cell with a composition, which
composition comprises an amount of an isolated dorsalin-1
polypeptide effective to stimulate neural crest cell
differentiation, so as to thereby stimulate neural crest cell
differentiation.
21. (canceled)
22. A method for regenerating nerve cells in a subject comprising
administering to the subject a composition, which composition
comprises an amount of an isolated dorsalin-1 polypeptide effective
to regenerate nerve cells, so as to thereby regenerate nerve cells
in the subject.
23-24. (canceled)
25. A method for treating a neural tumor in a subject comprising
administering to the subject a composition, which composition
comprises an amount of an isolated dorsalin-1 polypeptide effective
to inhibit tumor cell growth, so as to thereby treat the neural
tumor in the subject.
26. The method of claim 25, wherein the neural tumor is a
neurofibroma.
27. The method of claim 25, wherein the neural tumor is a Schwann
cell tumor.
28-40. (canceled)
Description
BACKGROUND OF THE INVENTION
[0001] Throughout this application various publications are
referenced by the names of the authors and the year of the
publication within parentheses. Full citations for these
publications may be found at the end of the specification
immediately preceding the claims. The disclosures of these
publications in their entireties are hereby incorporated by
reference into this application in order to more fully describe the
state of the art to which this invention pertains.
[0002] Inductive interactions that define the fate of cells within
the neural tube establish the initial pattern of the embryonic
vertebrate nervous system. In the spinal cord, the identity of cell
types is controlled, in part, by signals from two midline cell
groups, the notochord and floor plate which induce neural plate
cells to differentiate into floor plate, motor neurons and other
ventral neuronal types (van Straaten et al. 1988; Placzek et al.
1990, 1993; Yamada et al. 1991; Hatta et al. 1991). The induction
of floor plate cells appears to require a contact-mediated signal
(Placzek et al. 1990a, 1993) whereas motor neurons can be induced
by diffusible factors (Yamada et al., 1993). Thus, the fate of
different ventral cell types may be controlled by distinct signals
that derive from the ventral midline of the neural tube.
[0003] The specification of dorsal cell fates appears not to
require ventral midline signals since the neural tube still gives
rise to dorsal cell types such as sensory relay neurons and neural
crest cells after elimination of the notochord and floor plate
(Yamada et al. 1991; Placzek et al. 1991; Ericson et al. 1992).
Moreover, dorsal cell types are found at more ventral positions in
such embryos (Yamada et al. 1991; Placzek et al. 1991) suggesting
that many or all cells in neural tube have acquired dorsal
characteristics. The acquisition of a dorsal fate could represent a
default pathway in the differentiation of neural plate cells or a
response to inductive factors that are distinct from the
ventralizing signals that derive from the notochord and floor
plate.
[0004] To identify signals that might regulate cell differentiation
within the neural tube, genes encoding secreted factors that are
expressed in a restricted manner along the dorsoventral axis of the
neural tube have been searched. In this application, the
transforming growth factor .beta. (TGF .beta.) family have been
focused since some of its members have been implicated in the
control of cell differentiation and patterning in non-neural
tissues. In frog embryos, for example, the differentiation and
patterning of mesodermal cell types appears to be controlled, in
part, by the action of activin-like molecules (Ruiz i Altaba and
Melton, 1989; Green and Smith, 1990; Thomsen et al. 1990; Green et
al. 1992). In addition, the dorsoventral patterning of cell types
in Drosophila embryos is regulated by the decapentaplegic (dpp)
gene (Ferguson and Anderson, 1992a,b). The dpp protein is closely
related to a subgroup of vertebrate TGF .beta.-like molecules, the
bone morphogenetic proteins (BMPS) (Wozney. et al. 1988), several
members of which are expressed in restricted regions of the
developing embryos (Jones et al. 1991).
[0005] In this application, the cloning and functional
characterization of the dorsalin-1 (dsl-1) gene, which encodes a
novel BMP-like member of the TGF-.beta. superfamily are described.
Dsl-1 is expressed selectively by cells in the dorsal region of the
neural tube and its expression in ventral regions appears to be
inhibited by signals from the notochord. Dsl-1 promotes the
differentiation or migration of neural crest cells and can prevent
the differentiation of motor neurons in neural plate explants. The
combined actions of dsl-1 and ventralizing factors from the
notochord and floor plate may regulate the identity of neural cell
types and their position along the dorsoventral axis of the neural
tube.
SUMMARY OF THE INVENTION
[0006] This invention provides an isolated vertebrate nucleic acid
molecule which encodes dorsalin-1. This invention also provides a
nucleic acid probe comprising a nucleic acid molecule of at least
15 nucleotides capable of specifically hybridizing with a sequence
included within the sequence of a nucleic acid molecule encoding a
dorsalin-1.
[0007] The invention provides a vector which comprises an isolated
nucleic acid molecule of dorsalin-1 operatively linked to a
promoter of RNA transcription. This invention further provides a
host vector system for the production of a polypeptide having the
biological activity of dorsalin-1 which comprises the
above-described vector in a suitable host.
[0008] This invention also provides a method of producing a
polypeptide having the biological activity of dorsalin-1 which
comprises growing the above-described host vector system under
suitable conditions permitting production of the polypeptide and
recovering the polypeptide so produced.
[0009] This invention also provides a purified vertebrate
dorsalin-1. This invention further provides a purified human
dorsalin-1.
[0010] This invention provides a method for stimulating neural
crest cell differentiation in a subject comprising administering to
the subject an amount of a purified dorsalin-1 effective to
stimulate neural crest cell differentiation.
[0011] This invention provides a method for regenerating nerve
cells in a subject comprising administering to the subject an
amount of a purified dorsalin-1 effective to regenerate nerve
cells.
[0012] This invention provides a method for promoting bone growth
in a subject comprising administering to the subject an amount of a
purified dorsalin-1 effective to promote bone growth.
[0013] This invention provides a method for promoting wound healing
in a subject comprising administering to the subject an amount of a
purified dorsalin-1 effective to promote wound healing.
[0014] This invention provides a method for treating neural tumor
in a subject comprising administering to the subject an amount of a
purified dorsalin-1 effective to inhibit the tumor cell growth.
[0015] This invention further provides a pharmaceutical composition
for stimulating neural crest cell differentiation comprising an
amount of a purified dorsalin-1 effective to stimulate neural crest
cell differentiation and a pharmaceutically acceptable carrier.
[0016] This invention provides a pharmaceutical composition for
regenerating nerve cells in a subject comprising an amount of a
purified dorsalin-1 effective to regenerate nerve cells and a
pharmaceutically acceptable carrier.
[0017] This invention provides a pharmaceutical composition for
promoting bone growth in a subject comprising an amount of a
purified dorsalin-1 effective to promote bone growth and a
pharmaceutically acceptable carrier.
[0018] This invention provides a pharmaceutical composition for
promoting wound healing in a subject comprising an amount of a
purified dorsalin-1 effective to promote wound healing and a
pharmaceutically acceptable carrier. This invention provides a
pharmaceutical composition for treating neural tumor in a subject
comprising an amount of a purified dorsalin-1 effective to inhibit
neural tumor cell growth and a pharmaceutically acceptable
carrier.
[0019] This invention provides an antibody capable of binding to
dorsalin-1. This invention also provides an antibody capable of
inhibiting the biological activity of dorsalin-1.
BRIEF DESCRIPTION OF THE DRAWING
[0020] FIG. 1 Nucleotide and Deduced Amino Acid Sequence of
Dorsalin-1 (SEQ. ID No. 1.)
[0021] The numbering of the protein sequence starts with the first
methionine of the long open reading frame. The putative signal
sequence is typed in bold letters. The RSKR (SEQ. ID No. 17)
sequence preceding the proteolytic cleavage site (arrow) is
underlined. The site of insertion of the 10 amino acid c-myc
epitope is marked with an asterisk. The accession number for
dorsalin-1 is L12032.
[0022] FIG. 2 Dorsalin-1 is a Member of the TGF-.beta.
Superfamily
[0023] (A) Alignment of the COOH-terminal amino acid sequences of
dorsalin-1 and some representative members of the TGF-.beta.
superfamily. Residues that are identical in at least 4 of the 7
proteins are printed in white on a black background. The 7
conserved cysteine residues are marked with an asterisk. Gaps
introduced to optimize the alignment are represented by dashes.
Known proteolytic cleavage sites in these proteins are marked with
an arrow head. Numbers at the right indicate the number of amino
acids present in the protein.
[0024] (B) Graphical representation of the sequence relationship
between members of the TGF-.beta. superfamily. This tree
representation has been generated using the program pileup of the
GCG software package (Devereeux et al., 1984). Underneath each
branch the percentage amino acid identity is shown with reference
to dorsalin-1. This value was calculated using the local homology
algorithm of Smith and Waterman (1981) implemented in the program
bestfit (GCG software). For both the tree and the amino acid
identities only the sequence of the COOH-terminal domain was used,
starting with the first of the seven conserved cysteine residues
and ending with COOH-terminal residue. For details of other
TGF-.beta. family members see Lee (1990), Lyons et al. (1991),
Hoffmann, (1991).
[0025] FIG. 3 Affinity Purification and Functional Activity of
Recombinant Dorsalin-1 Protein
[0026] (A) Dorsalin-1.sup.myc protein was purified from cos-7
cell-conditioned medium using a MAb 9E10 affinity column. An
aliquot of the purified protein (CM) was run on a 15%
SDS-polyacrylamide gel and stained with Coomassie Blue. The arrow
points to the major product running at a molecular weight of
.about.15 kDa and minor bands at 45, 47 and 60 kDa are also
evident. NH.sub.2-terminal sequencing of the 15 kDa band confirmed
its identity as processed dorsalin-1.sup.myc protein.
Affinity-purified conditioned medium obtained from mock-transfected
cos-7 cells did not contain any detectable protein on a Coomassie
Blue stained acrylamide gel (not shown). The positions of molecular
weight standards (MW) are shown.
[0027] (B) Induction of Alkaline Phosphatase Activity in W-20-17
Cells by Dorsalin-1. Conditioned medium was harvested from cos-7
transfected with dsl-1 cDNA, with the dsl-1.sup.myc cDNA and added
at different dilutions to W20-17 cells for 72 h and alkaline
phosphatase activity assayed (Thies et al. 1992). As a control for
the presence of BMP-like activity in cos-7 cells, medium was also
obtained from cells transfected with a c-myc tagged construct
encoding the Drosophila decapentaplegic (dpp) gene, a related TGF
.beta. family member since (see FIG. 2B). Dpp.sup.myc is not
detectable in the medium of transfected cos-7 cells. Curves are
from one of three experiments that produced similar results.
Recombinant human BMP-2 (Thies et al. 1992) was used on a positive
control in the assay.
[0028] FIG. 4 Dorsalin-1 mRNA expression in the embryonic chick
spinal cord
[0029] Panels represent pairs of phase-contrast and dark-field
micrographs of sections of embryonic chick neural tube and spinal
cord, processed for localization of dorsalin-1 mRNA by in situ
hybridization with .sup.35S-labelled probe.
[0030] (A,B) Dorsalin-1 mRNA is not expressed in neural cells at
stages before neural tube closure. The dark field micrograph (B)
shows background grain densities.
[0031] (C,D) Dorsalin-1 mRNA is expressed at high levels in the
dorsal third of the neural tube, beginning at the time of neural
tube closure, but not by ventral neural cells or by non-neural
cells. This section is taken from a HH stage 10 embryo at the
future brachial level.
[0032] (E,F) The dorsal restriction of dorsalin-1 mRNA persists in
the spinal cord at stages after the onset of neuronal
differentiation. Section taken from HH stage 22 embryo, at the
brachial level.
[0033] (G,H) At later stages of spinal cord development (HH St 26)
dorsalin-1 mRNA is restricted to the dorsomedial region of the
spinal cord, including but not confined to the roof plate.
[0034] Scale bar: A,B=35 .mu.m, C-F=80 .mu.m, G-H=140 .mu.m.
[0035] FIG. 5 Regulation of dorsalin-1 mRNA expression by
notochord
[0036] (A,B) Phase-contrast and dark-field images of a section of
spinal cord from an operated stage 22 embryo but at a level in
which there is no grafted tissue. The pattern of dorsalin-1 mRNA
expression is similar to that in unoperated embryos at the same
developmental age.
[0037] (C) Phase-contrast micrograph section from an embryo at the
same stage as that shown in A,B, showing the expression of SC1 by
motor neurons and floor plate cells, detected by immunoperoxidase
histochemistry.
[0038] (D,E) Phase-contrast and dark-field images of a section of
spinal cord from an operated stage 22 embryo in which there is a
dorsally-located notochord (n). The expression of dorsalin-1 RNA is
suppressed in the presence of a dorsal notochord graft. Similar
results were obtained in 2 other embryos.
[0039] (F) Phase-contrast micrograph of an adjacent section to that
shown in D,E, showing the ectopic dorsal location of SC1.sup.+
motor neurons that form a bilaterally symmetric continuous column.
SC1.sup.+ motor axons can be seen leaving the dorsal spinal
cord.
[0040] SC1.sup.+ floor plate cells are detected at the dorsal
midline. The position of the grafted notochord is indicated
(n').
[0041] (G,H) Phase-contrast and dark-field micrographs showing that
dorsalin-1 mRNA expression expands to occupy the entire neural
epithelium in embryos from which Hensen's node has been removed at
HH stage 10. In this embryo the operation resulted in a splitting
of the neural tube and this micrograph has been spliced to restore
the ventral apposition of neural tissue. Splitting of the neural
tube occurs frequently after removal of Hensen's node (Darnell et
al. 1992). A partial or complete ventral expansion of dsl-1
expression was detected in a total of 5 embryos with Hensen's node
removal. A ventral expression of dsl-1 expression, occupying 60-70%
of the spinal cord was also detected after notochord removal in 2
embryos.
[0042] Scale bar: A-F=90 .mu.m, G-H=45 .mu.m.
[0043] FIG. 6 Induction of Cell Migration from [i]-Neural Plate
Explants by Dorsalin-1
[0044] [i]-Neural plate explants were grown alone or in the
presence of dsl-1.sup.myc (3.times.10.sup.-11M) 48 h, and migratory
cells analyzed by phase-contrast microscopy and by expression of
surface antigens.
[0045] (A) Phase contrast micrograph of [i]-neural plate explant
grown alone for 48 h.
[0046] (B) Phase contrast micrograph of [i]-neural plate explant
grown in the presence of dsl-1.sup.myc for 48 h. Many cells have
migrated from the explant.
[0047] (C) Phase contrast micrograph of an [i]-neural plate explant
grown in contact with notochord (n) in the presence of
dsl-1.sup.myc for 48 h. Cells still emigrate from the explant
although few cells are located in the vicinity of the notochord
explant.
[0048] (D) Expression of HNK-1 by cells induced to migrate from
[i]-neural plate explant by dsl-1.sup.myc.
[0049] (E) Expression of .beta.1-integrin by cells induced to
emigrate from [i]-neural plate explant. About 30% of migratory
cells expressed p75, although the levels appeared lower than that
detected on neural crest cells derived from the dorsal neural
tube.
[0050] (F) Expression of melanin by cells induced to migrate from
quail [i]-neural plate explants by dsl-1.sup.myc. In these
experiments dsl-1.sup.myc was removed from after 48 h and cultures
grown in the presence of chick embryo extract (CEE) for a further
72 h. About 10-15% of cells in this bright field micrograph exhibit
melanin pigment and typical dendritic morphology. Two different
focal planes of the same field are shown to maintain melanocytes in
focus. Similar results were obtained in 6-8 explants tested. For
details see text.
[0051] (G) Quantitation of cell migration induced by dsl-1. [i]np
indicates [i]-neural plate explant. nc=notochord, fp=floor plate.
Error bars represent the means .+-.s.e.m. of migrated cells for
10-26 different explants.
[0052] Scale bar: A-C=70 .mu.m, D-F=35 .mu.m.
[0053] FIG. 7 Induction of Islet-1 expression in neural plate
explants and suppression by dorsalin-1
[0054] (A-C) Normarski (A) and immunofluorescence (B,C) micrographs
of stage 9-10 chick [i]-neural plate explant grown for 48 h in the
absence of notochord or floor plate. Islet-1.sup.+ cells are not
detected (B) but there is extensive neuronal differentiation as
detected by 3A10 expression (C).
[0055] (D-F) Nomarski (D) and immunofluorescence (E,F) micrographs
of [i]-neural plate explant grown in contact with stage 26 chick
floor plate. Numerous Islet-1.sup.+ cells are present in the
[i]-neural plate explant (np), but not in the floor plate explant
(fp). The explant also contains many 3A10.sup.+ cells (F).
[0056] (G-I) Nomarski (G) and immunofluorescence micrographs (H,I)
of [i]-neural plate explant exposed for 48 h to floor
plate-conditioned medium. Numerous Islet-1.sup.+ cells (H) and
3A10.sup.+ neurons (I) are detected.
[0057] (J-L) Nomarski (J) and immunofluorescence micrograph (K,L)
of an [i]-neural plate and floor plate conjugate exposed for 48 h
to 3.times.10.sup.-11M dorsalin-1.sup.myc. No Islet-1.sup.+ cells
are detected (K) whereas the number of 3A10.sup.+ neurons in the
neural plate explant (L) is not obviously different from that in
the absence of dorsalin-1.sup.myc. In figures D and G, the dashed
line outlines the extent of the neural plate (np) explant.
[0058] Scale bar: A-C=70 .mu.m, D-F=100 .mu.m, G-I=70 .mu.m,
J-L=100 .mu.m.
[0059] FIG. 8 Inhibition of Islet-1.sup.+ Cells by Dorsalin-1
[0060] (A) Histograms showing the induction of Islet-1.sup.+ cells
in [i]-neural plate explants by contact with notochord (nc) or
floor plate (fp), and the inhibition of Islet-1.sup.+ cells by
dorsalin-1.sup.myc (3.times.10.sup.-11M). Each column represents
mean.+-.s.e.m. of 10-22 different explants.
[0061] (B) Dose-dependent inhibition of Islet-1+ cells by
dorsalin-1.sup.myc. Each point represents mean.+-.s.e.m. of 7-23
different explants.
[0062] (C) Induction of Islet-1.sup.+ cells by floor
plate-conditioned medium and the inhibitory action of
dorsalin-1.sup.myc. Each column represents mean.+-.s.e.m. of 7-23
explants.
[0063] [i]np=[i]-neural plate explant grown alone, +nc=neural
plate/notochord conjugate, +fp=neural plate/floor plate conjugate,
fpcm=floor plate-conditioned medium.
[0064] FIG. 9 Potential Functions of Dorsalin-1 in the Control of
Cell Differentiation in the Neural Tube
[0065] Diagrams summarize the possible mechanisms for establishing
the dorsally-restricted expression of dorsalin-1 and potential
functions of dorsalin-1 in the regulation of cell differentiation
along the dorsoventral axis of the neural tube.
[0066] (A) The pattern dorsalin-1 expression appears to be
established by early signals from the notochord. (i) Medial neural
plate cells respond to signals from the underlying notochord which
induce the differentiation of ventral cell types such as floor
plate and motor neurons. (ii) Medial neural plate cells are also
exposed to signals from the notochord that prevent the subsequent
expression of dorsalin-1. The inhibitory signal from the notochord
can, in principle, be identical to the ventralizing signal that
induces ventral cell fates. (iii) The medial region of the neural
plate gives rise to the ventral neural tube. Dorsalin-1 expression
(shaded area) begins at the time of neural tube closure and is
restricted to the dorsal third of the neural tube.
[0067] (B) In vitro assays suggest several possible functions for
dorsalin-1 in the control of neural cell differentiation. (i)
Dorsalin-1 may promote the differentiation of cell types that
derive from the dorsal region of the neural tube. In vitro studies
suggest that neural crest cells represent one population of cells
whose differentiation may be influenced by dorsalin-1. (ii) The
dorsal expression of dorsalin-1 may define the dorsal third of the
neural tube as a domain that is refractory to the long range
influence of ventralizing signals from the notochord and floor
plate. The ventral boundary of dorsalin-1 expression suggests that
ventral midline-derived signals can influence cells over much of
the dorsoventral axis of the neural tube. (iii) Dorsalin-1 protein
may diffuse ventrally to influence the fate of cells in
intermediate regions of the neural tube beyond the domain of
dorsalin-1 mRNA expression. Thus, the combined action of dorsalin-1
and the diffusible ventralizing signal from the notochord and floor
plate could specify the fate of cells over the complete
dorsoventral axis of the neural tube.
[0068] FIG. 10 Amino acid comparison of chick dorsalin-1 (B29) and
mouse (B29m).
DETAILED DESCRIPTION OF THE INVENTION
[0069] This invention provides an isolated vertebrate nucleic acid
molecule encoding dorsalin-1. As used herein, the term dorsalin-1
encompasses any amino acid sequence, polypeptide or protein having
the biological activities provided by dorsalin-1.
[0070] In one embodiment of this invention, the isolated nucleic
acid molecules described hereinabove are DNA. In a further
embodiment, isolated nucleic acid molecules described hereinabove
are cDNAs or genomic DNAs. In the preferred embodiment of this
invention, the isolated nucleic sequence is cDNA as shown in
sequence ID number 1. In another embodiment, the isolated nucleic
acid molecule is RNA.
[0071] This invention also encompasses DNAs and cDNAs which encode
amino acid sequences which differ from those of dorsalin-1, but
which should not produce phenotypic changes. Alternatively, this
invention also encompasses DNAs and cDNAs which hybridize to the
DNA and cDNA of the subject invention. Hybridization methods are
well-known to those of skill in the art.
[0072] The DNA molecules of the subject invention also include DNA
molecules coding for polypeptide analogs, fragments or derivatives
of antigenic polypeptides which differ from naturally-occurring
forms in terms of the identity or location of one or more amino
acid residues (deletion analogs containing less than all of the
residues specified for the protein, substitution analogs wherein
one or more residues specified are replaced by other residues and
addition analogs where in one or more amino acid residues is added
to a terminal or medial portion of the polypeptides) and which
share some or all properties of naturally-occurring forms. These
molecules include: the incorporation of codons "preferred" for
expression by selected non-mammalian host; the provision of sites
for cleavage by restriction endonuclease enzymes; and the provision
of additional initial, terminal or intermediate DNA sequences that
facilitate construction of readily expressed vectors.
[0073] The DNA molecules described and claimed herein are useful
for the information which they provide concerning the amino acid
sequence of the polypeptide and as products for the large scale
synthesis of the polypeptide by a variety of recombinant
techniques. The molecules are useful for generating new cloning and
expression vectors, transformed and transfected procaryotic and
eucaryotic host cells, and new and useful methods for cultured
growth of such host cells capable of expression of the polypeptide
and related products.
[0074] Moreover, the isolated nucleic acid molecules are useful for
the development of probes to study the neurodevelopment.
[0075] Dorsalin-1 may be produced by a variety of vertebrates. In
an embodiment, a human dorsalin-1 nucleic acid molecule is
isolated. In another embodiment, a mouse dorsalin-1 nucleic acid
molecule is isolated. In a further embodiment, a chick dorsalin-1
nucleic acid molecule is provided. The plasmid, pKB502, encoding a
chick dorsalin-1 was deposited on Oct. 5, 1992 with the American
Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville,
Md. 20852, U.S.A. under the provisions of the Budapest Treaty for
the International Recognition of the Deposit of Microorganism for
the Purposes of Patent Procedure. Plasmid, pKB502 was accorded ATCC
Accession number 75321.
[0076] Throughout this application, references to specific
nucleotides are to nucleotides present on the coding strand of the
nucleic acid. The following standard abbreviations are used
throughout the specification to indicate specific nucleotides:
1 C = cytosine A = adenosine T = thymidine G = guanosine
[0077] For the purpose of illustration only, applicants have
isolated and characterized dorsalin-1 cDNA clones from chicken and
mouse. Similar techniques are applicable to isolate and
characterize the dorsalin-1 genes in different vertebrates.
[0078] Dorsalin-1 genes may be isolated using the probe generated
from the chick dorsalin-1 gene. The mouse and human homologous
genes may be cloned by using probe from the chick gene by low
stringency screening of the correspondent embryonic spinal cord
cDNA libraries. A mouse dorsalin-1 was cloned using the above
method. FIG. 10 shows a mouse homolog of the dorsalin-1 which
reveals extensive conservation at the nucleotide and amino acid
level with the chick dorsalin-1. The human dorsalin-1 is likely to
be more closely related to the mouse protein than is the chick
protein. Thus, it should be straightforward to design
oligonucleotide primers to isolate the human dorsalin-1 gene.
[0079] This invention provides a nucleic acid molecule comprising a
nucleic acid molecule of at least 15 nucleotides capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a dorsalin-1. The
above molecule can be used as a probe. As used herein, the phrase
"specifically hybridizing" means the ability of a nucleic acid
molecule to recognize a nucleic acid sequence complementary to its
own and to form double-helical segments through hydrogen bonding
between complementary base pairs.
[0080] Nucleic acid probe technology is well known to those skilled
in the art who will readily appreciate that such probes may vary
greatly in length and may be labeled with a detectable label, such
as a radioisotope or fluorescent dye, to facilitate detection of
the probe. DNA probe molecules may be produced by insertion of a
DNA molecule which encodes dorsalin-1 into suitable vectors, such
as plasmids or bacteriophages, followed by transforming into
suitable bacterial host cells, replication in the transformed
bacterial host cells and harvesting of the DNA probes, using
methods well known in the art. Alternatively, probes may be
generated chemically from DNA synthesizers.
[0081] The probes are useful for `in situ` hybridization or in
order to locate tissues which express this gene, or for other
hybridization assays for the presence of this gene or its mRNA in
various biological tissues.
[0082] Vectors which comprise the isolated nucleic acid molecule
described hereinabove also are provided. Suitable vectors comprise,
but are not limited to, a plasmid or a virus. These vectors may be
transformed into a suitable host cell to form a host cell vector
system for the production of a polypeptide having the biological
activity of dorsalin-1.
[0083] This invention further provides an isolated DNA or cDNA
molecule described hereinabove wherein the host cell is selected
from the group consisting of bacterial cells (such as E. coli),
yeast cells, fungal cells, insect cells and animal cells. Suitable
animal cells include, but are not limited to Vero cells, HeLa
cells, Cos cells, CV1 cells and various primary mammalian
cells.
[0084] This invention provides a method to identify and purify
expressed dorsalin-1. A myc-epitope was introduced into dorsalin-1.
This myc carrying dorsalin-1 was linked to an expression vector.
Such vector may be used to transfect cell and the distribution of
dorsalin-1 in the cell may be detected by reacting myc antibodies
known to be reactive to the introduced myc-epitope with the
transfected cells which is expressing the dorsalin-1 carrying
myc-epitope. Taking advantage of this myc-epitope, dorsalin-1 may
be purified by an antibody affinity column which binds with this
myc-epitope.
[0085] In one embodiment, the expression vector, pKB501 (with myc
epitope), containing chick dorsalin-1 with a myc-epitope was
deposited on Oct. 5, 1992 with the American Type Culture Collection
(ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, U.S.A. under
the provisions of the Budapest Treaty for the International
Recognition of the Deposit of Microorganism for the Purposes of
Patent Procedure. Plasmid, pKB 501 (with myc epitope) was accorded
ATCC designation number 75320.
[0086] The above uses of the myc-epitope for identification and
purification of dorsalin-1 should not be considered limiting only
to the myc-epitope. Other epitopes with specific antibodies against
them which are well known to an ordinary skilled in the art could
be similarly used.
[0087] Also provided by this invention is a purified vertebrate
dorsalin-1. As used herein, the term "purified vertebrate
dorsalin-1" shall mean isolated naturally-occurring dorsalin-1 or
protein (purified from nature or manufactured such that the
primary, secondary and tertiary conformation, and posttranslational
modifications are identical to naturally-occurring material) as
well as non-naturally occurring polypeptides having a primary
structural conformation (i.e. continuous sequence of amino acid
residues). Such polypeptides include derivatives and analogs. In
one embodiment, the purified dorsalin-1 is human dorsalin-1.
[0088] This invention also provides polypeptides encoded by the
above-described isolated vertebrate nucleic acid molecules.
[0089] This invention provides a method for stimulating neural
crest cell differentiation in a culture comprising administering an
amount of the above-described purified dorsalin-1 effective to
stimulate neural crest cell differentiation to the culture.
[0090] This invention also provides a method for stimulating neural
crest cell differentiation in a subject comprising administering to
the subject an amount of the above-described purified dorsalin-1
effective to stimulate neural crest cell differentiation.
[0091] This invention provides a method for regenerating nerve
cells in a subject comprising administering to the subject an
effective amount of the above-described purified dorsalin-1
effective to regenerate nerve cells.
[0092] This invention provides a method for promoting bone growth
in a subject comprising administering to the subject an effective
amount of the above-described purified dorsalin-1 effective to
promote bone growth.
[0093] This invention provides a method for promoting wound healing
in a subject comprising administering to the subject an effective
amount of above-described purified dorsalin-1 effective to promote
wound healing.
[0094] This invention provides a method for treating neural tumor
in a subject comprising administering to the subject an amount of
the above-described purified dorsalin-1 effective to inhibit the
tumor cell growth. In an embodiment, the neural tumor is
neurofibroma. In another embodiment, the neural tumor is Schwann
cell tumor.
[0095] This invention also provides a method for preventing
differentiation of motor neurons in a culture comprising
administering an amount of purified dorsalin-1 neurons to the
culture.
[0096] This invention also provides a method for preventing
differentiation of motor neurons in a subject comprising
administering to the subject an amount of the above-described
dorsalin-1 effective to prevent differentiation of motor
neurons.
[0097] This invention also provides a pharmaceutical composition
for stimulating neural crest cell differentiation comprising an
amount of purified dorsalin-1 of claim 18 effective to stimulate
neural crest cell differentiation and a pharmaceutically acceptable
carrier.
[0098] As used herein, "pharmaceutically acceptable carriers" means
any of the standard pharmaceutically acceptable carriers. Examples
include, but are not limited to, phosphate buffered saline,
physiological saline, water and emulsions, such as oil/water
emulsions.
[0099] This invention provides a pharmaceutical composition for
regenerating nerve cells in a subject comprising an amount of the
above-described purified dorsalin-1 effective to regenerate nerve
cells and a pharmaceutically acceptable carrier.
[0100] This invention provides a pharmaceutical composition for
promoting bone growth in a subject comprising an amount of the
above-described purified dorsalin-1 effective to promote bone
growth and a pharmaceutically acceptable carrier.
[0101] This invention provides a pharmaceutical composition for
promoting wound healing in a subject comprising an amount of the
above-described purified dorsalin-1 effective to promote wound
healing and a pharmaceutically acceptable carrier.
[0102] This invention provides a pharmaceutical composition for
treating neural tumor in a subject comprising an amount of the
above-described purified dorsalin-1 effective to inhibit neural
tumor cell growth and a pharmaceutically acceptable carrier. In an
embodiment of this pharmaceutical composition, the neural tumor is
neurofibroma. In another embodiment of this pharmaceutical
composition, the neural tumor is Schwann cell tumor.
[0103] Also provided by this invention is a method to produce
antibody using the above-described purified dorsalin-1.
[0104] Standard procedures for production of antibodies against
dorsalin-1 are well-known to an ordinary skilled artisan. A
procedure book, entitled "Antibodies, A Laboratory Manual" (1988)
by Ed Harlow and David Lane (published by Cold Spring Harbor
Laboratory) provides such standard procedures. The content of
"Antibodies, A Laboratory Manual" is hereby incorporated in this
application.
[0105] This invention further provides antibody capable of binding
to dorsalin-1. In an embodiment, the antibody is monoclonal.
[0106] This invention further provides an antibody against
dorsalin-1 capable of inhibiting the biological activity of
dorsalin-1.
[0107] This invention further provides a method for inhibiting
dorsalin-1 activity in a subject comprising administering to the
subject an amount of an antibody capable of inhibiting dorsalin-1
activity effective to inhibit the dorsalin-1 activity.
[0108] This invention also provides a pharmaceutical composition
for inhibiting dorsalin-1 activity comprising an amount of antibody
capable of inhibiting dorsalin-1 activity effective to inhibit
dorsalin-1 activity and a pharmaceutically acceptable carrier.
[0109] This invention will be better understood from the
Experimental Details which follow. However, one skilled in the art
will readily appreciate that the specific methods and results
discussed are merely illustrative of the invention as described
more fully in the claims which follow thereafter.
EXPERIMENTAL DETAILS
Experimental Procedures
[0110] RNA Isolation and PCR Amplification
[0111] Spinal cord tissue was dissected from 80 embryonic day (E)
2.5 chicks. Poly (A).sup.+ RNA (20 .mu.g) was isolated from this
tissue using an oligo (dT)-cellulose spin column (Pharmacia.RTM.)
and 1.5 .mu.g was used in two first strand cDNA synthesis reactions
with either oligo (dT) or random hexanucleotides as primers for the
reverse transcriptase reaction. One third of each of the two cDNA
reaction mixture was combined and used as template for PCR
amplification using 100 pmoles of the following degenerate primers
in a reaction volume of 50 .mu.l:
2 (SEQ ID No. 10) 5'TGGAATTCTGG(ACG)A(ACGT)GA(CT)TGGAT(ACT)- (AG)T
(ACGT)GC 3' and (SEQ ID No. 11)
5'GAGGATCCA(AG)(ACGT)GT(CT)TG(ACGT)AC(AGT)AT(ACGT) GC(AG)TG 3'
[0112] where degenerate positions are in parenthesis and
restriction sites underlined. These oligonucleotides correspond to
the dorsalin-1 amino acid positions 339-345 and 377-371,
respectively. The reaction was cycled twice between 940 (50
seconds), 50.degree. (2 minutes), and 72.degree. (2 minutes),
followed by 28 rounds of 94.degree. (50 seconds), 55.degree. (2
minutes), and 72.degree. (1.5 minutes). The reaction products were
purified, digested with BamHI and EcoRI, size selected by agarose
gel electrophoresis and cloned into the bacteriophage vector
M13mp18. 50 clones were picked randomly and analyzed on a
sequencing gel by comparing their G ladders. One member of each
class was sequenced completely.
[0113] DNA Isolation and Sequencing
[0114] An E2.5 chick spinal cord cDNA library of 10.sup.6
independent clones was constructed in lambda ZAPII
(Stratagene.RTM.) using 5 .mu.g of the poly(A)+ RNA described
above. After amplifying the library, 10.sup.6 clones were screened
under standard hybridization conditions and a .sup.32P-labeled PCR
probe derived from the 116 bp insert of M13 clone B29 representing
the dorsalin-1 class. Of approximately 25 positive clones, 4 were
plaque-purified and converted into pBluescript plasmids. Sequence
analysis was performed by a combination of primer walking and
subcloning of small restriction fragments into M13. The sequence
within and adjacent to the long open reading frame was determined
on both strands by the dideoxy chain termination method (Sanger et
al. 1977) using Sequenase.RTM. (U.S. Biochemicals).
[0115] DNA Constructs
[0116] The coding region of dorsalin-1 was isolated using the two
PCR primers ORF-5' (5' TGGAATTCATCGATAACGGAAGCTGAAGC 3'; SEQ ID No.
12) and ORF-3' (5' AGCGTCGACATCGATATTCAGCATATACTACC 3'; SEQ ID No.
13) and cloned into pBS SK-between the EcoRI and SalI sites. To
insert the c-myc epitope (EQKLISEEDL; SEQ. ID No. 18) two internal
primers, each encoding half of the c-myc epitope and dorsalin
sequences from the epitope insertion site (see FIG. 1), were used
to produce two PCR fragments, one encoding dorsalin N-terminal to
the insertion site (with primer ORF-5' and the primer 5'
GCGAATTCGATATCAGCTTCTGCTCTGCTCCTATGCTTCTCTTGC3' [SEQ. ID No. 14])
and the other encoding the C-terminal region with primer 5'
CGGAATTCGATATCCGAGGAGGACCTGAACCACTGTCGGAGAACGTC 3'; SEQ ID No. 15
and primer ORF-3'). These two fragments were joined using their
primer-derived EcoRV sites and cloned the same way as the
unmodified coding region. Using nearby primers this region was
sequenced to confirm that no other mutations had been
introduced.
[0117] A truncated coding region was derived from this construct by
cleavage with HindIII, blunting the ends with T4 DNA polymerase and
subsequent religation. This leads to a frame-shift mutation which
replaces the C-terminal 41 residues of dorsalin with 9 unrelated
ones. The unmodified, the epitope-tagged and the truncated dorsalin
coding regions were then cloned into the Cos-7 cell expression
vector pMT21 between the EcoRI and Xhol sites.
[0118] In Situ Hybridization Histochemistry
[0119] A dorsalin-1 cDNA clone was linearized with XbaI (at amino
acid position 176) and used to generate a 1 kb
[.sup.35S]UTP-labeled antisense RNA probe using T7 RNA polymerase.
This probe encompasses the 3' part of the cDNA. Chick embryos were
fixed in 4% paraformaldehyde and 10 .mu.m cryostat sections were
mounted on 3-aminopropyltriethoxysilane-treated slides. In situ
hybridization was performed essentially as described by Wilkinson,
et al. (1987) with exposure times ranging from 4 to 10 days. The
distribution of dorsalin-1 mRNA was confirmed by whole-mount in
situ hybridization, performed essentially as described by Harland
(1991) using a digoxygenin-11-UTP-labeled RNA probe derived from
the template mentioned above (not shown).
[0120] Chick Embryo Manipulations
[0121] Notochord grafting and deletion in ovo was performed as
described by Yamada et al. (1991). For removal of Hensen's node
from stage 9-10 chick embryos in ovo, the embryo was visualized by
injection of India ink underneath the cavity between the yolk and
embryo. Hensen's node was cut out together with underlying endoderm
using fine tungsten needles. After the operation, the window was
sealed and the embryo was incubated for further 48 h at 37.degree.
C. in the humidified incubator. Embryos were then fixed with 4%
paraformaldehyde overnight at 4.degree. C. and embedded in paraffin
for in situ hybridization as described above.
[0122] Cos-7 Cell Transfections
[0123] Cos-7 cells were transfected by the DEAE-Dextran method as
described by Klar, et al. 1992). For small scale cultures 60 to 100
.mu.m dishes were used and conditioned medium was prepared by
incubating cells expressing dorsalin-1 for 48 h in 3 or 6 ml of
OPTI-MEM (BRL.RTM.), respectively. Large-scale transfections for
affinity-purification of dorsalin-1 comprised 15.times.150 mm
dishes for transfection with dorsalin.sup.myc DNA (bearing the myc
epitope) and an equal number of dpp or mock-transfected plates.
This yielded 150 ml of dorsalin.sup.myc conditioned medium and 150
ml of cos-7 conditioned control medium. The BMP-4 expression
plasmids was provided by R. Derynck.
[0124] Affinity Purification and Sequence Analysis of
Dorsalin-1.sup.myc
[0125] Conditioned medium (50 ml) containing dsl-1.sup.myc was
clarified by centrifugation at 30,000.times.g and affinity-purified
on 1 ml of a monoclonal 9E10 (anti-myc) antibody column (Affi-Gel,
Biorad.RTM.). Dsl-1.sup.myc protein was eluted with 0.1 M
glycine-HCI (pH 2.5) and immediately neutralized with 3 M Tris
base. The eluate was concentrated and desalted over a 2 ml
Centricon-10 microconcentrator (Amicon). The protein concentration
of the final fraction (volume approximately 130 .mu.l), as
determined by amino acid analysis, was 0.1 .mu.g/ml.
[0126] For SDS-polyacrylamide gel electrophoresis, 10 Ml of
concentrated protein was loaded on a 15% Biorad Mini-Protean II gel
and stained with Coomassie Blue. 60 .mu.l was used on a preparative
gel and blotted onto Immobilon membrane in the absence of glycine.
The blot was stained briefly with Coomassie Blue and the major band
at 15 kD was excised and subjected to N-terminal protein sequencing
on a Applied Biosystems 470A gas phase sequencer/120A PTH analyzer.
The minor protein migrating slightly slower on the gel (at 16.5 kD)
was also sequenced and had the identical N-terminus, Suggesting
that it is an alternately glycosylated form of dsl-1.
Affinity-purified conditioned medium from mock-transfected cos-7
cells did not contain any detectable protein on a Coomassie-stained
acrylamide gel.
[0127] The concentration of dorsalin-1.sup.myc used for bioassays
was determined on the assumption that all activity resides in the
.about.15 kDa band which represents about 50% of the protein
recovered after affinity-purification. The total protein in the
affinity-purified fraction determined by amino acid analysis was
found to be 100 ng/.mu.l, of which 50 ng/.mu.l is assumed to
represent active protein. The stock concentration of Dsl-1.sup.myc
was therefore 3.times.10.sup.-6M. This stock was then diluted
10.sup.5 fold for most assays to give a final condition of
3.times.10.sup.-11M, assuming negligible losses.
[0128] Islet-1 Induction Assay
[0129] The assay for induction of Islet-1+ cells was carried out as
described in detail in Yamada et al. 1993. [i]-Neural plate
explants were isolated from Hamburger Hamilton HH stage 10 chick
embryos (Yamada et al. 1993) and grown in collagen gels alone or
with HH stage 10 notochord, HH stage 26 floor plate or with floor
plate-conditioned medium in F12-N3 defined culture medium
(Tessier-Lavigne et al. 1988) at 37.degree. C. for 48 to 120 h.
Floor plate-conditioned medium was obtained by culturing 30 HH
stage 25-26 floor plate fragments in 1 ml of F12 N3 medium for 48
h.
[0130] After incubation, explants were fixed with 4%
paraformaldehyde at 4.degree. C. for 1-2 h, washed with PBS at
4.degree. C. and gently peeled from the bottom of the dish and
excess collagen gel was trimmed. Explants were incubated with
primary antibodies overnight at 4.degree. C. with gentle agitation.
Rabbit anti-Islet-1 antibodies (Thor et al. 1991, Ericson et al.
1992) and MAb SC1 (Tanaka and Obata, 1984) were used for detection
of differentiating motor neurons and MAb 3A10 as a general neuronal
marker (Dodd et al., 1988). After washing with PBS for 2 h at
22.degree. C., the explants were incubated with Texas Red
conjugated goat anti-rabbit antibodies (Molecular Probes) or
FITC-conjugated goat anti-mouse Ig (Boehringer Mannheim) for 1-2 h.
Explants were washed with PBS at 22.degree. C. for 2 h with at
least two changes of buffer and mounted on slides in 50% glycerol
with paraphenylene diamine (1 mg/ml). The number of Islet-1.sup.+
and 3A10.sup.+ cells was determined on a Zeiss Axiophot microscope
equipped with epifluorescence optics. Double labeling with
anti-Islet-1 and anti-SCI antibodies was analyzed using BioRad
confocal microscope.
[0131] Analysis of Neural Crest Differentiation
[0132] [i]-Neural plate explants from stage 10 chick embryos were
grown in collagen gels as described for analysis of Islet-1
induction. The number of migratory cells was determined by
phase-contrast microscopy. Cells were scored as migratory if they
were greater than two cell body diameters away from the mass of the
[i]-neural plate explant. Identification of surface antigens was
performed on cultures fixed with 4% paraformaldehyde using MAb 7412
against chick p75 (Tanaka et al. 1989); MAb HNK1 (Abo and Balch,
1981), and MAb JG22 (anti-.beta.1 integrin; Greve and Gottlieb,
1982). For analysis of melanocyte differentiation, [i]-neural plate
explants were isolated from HH st. 10 quail (Coturnix coturnix
japonica) embryos as described for equivalent chick explants
(Yamada et al. 1993) and grown in vitro in collagen gels. Explants
were treated with dsl-1.sup.myc (3.times.10.sup.-11M) for 48 h in
F12-N3 medium at which time the medium was removed, explants washed
and placed in F12-N3 medium containing 10% chick embryo extract and
10% fetal calf serum for a further 72 h. Dsl-1 was removed after 48
h because members of the TGF .beta. family have been found to
inhibit the differentiation of neural crest cells into melanocytes
(Stocker et al., 1991; Roger et al. 1992). CEE and serum were added
after 48 h to permit the differentiation of neural crest cells into
melanocytes (Barofio et al. 1988; Maxwell et al. 1988).
[0133] Dorsal neural tube and [i]-neural plate explants grown in
dsl-1.sup.myc for 48 h followed by defined medium lacking CEE or
serum for a further 72 h gave rise to few, if any, melanocytes.
Thus the presence of CEE and serum appears necessary to support
melanocyte differentiation under these conditions. When CEE and
serum was included in the medium from the onset of culture, cells
migrated from [i]-neural plate explants and after 120 h,
melanocytes were observed.
[0134] To prepare chick embryo extract, white leghorn chicken eggs
were incubated for 11 days at 38.degree. C. in a humidified
atmosphere. Embryos were removed and homogenized in minimal
essential medium by passage through a 30 ml syringe, stirred at
40.degree. C. for 1 h, and then centrifuged for 5 h at
30,000.times.g. The supernatants was collected, filtered and stored
at -80.degree. C. until used.
[0135] Alkaline Phosphatase Induction in W-20-17 Cells
[0136] Induction of alkaline phosphatase activity by dsl-1 was
assayed in W-20-17 cells as described (Thies et al. 1992) using
recombinant human BMP-2 as a positive control.
[0137] Results
[0138] Isolation and Characterization of Dorsalin-1
[0139] Degenerate oligonucleotides directed against conserved
sequences present in the subfamily of TGF-.beta. members that
includes the BMPs, Vg1 and dpp were used to isolate novel members
of the TGF-.beta. family (Wharton et al., 1991). oligonucleotides
were used as primers in a polymerase chain reaction (PCR) to
amplify sequences derived from HH stage 16-18 (embryonic day 2.5)
chick spinal cord cDNA. The PCR products were cloned and 37 of 50
clones had inserts encoding Vg-1/dpp/BMP-related peptides. Although
most clones encoded chick homologues of previously characterized
BMP genes, one class encoded a novel sequence. A 116 bp fragment
encoding this sequence was used as probe to screen an E 2.5 chick
spinal cord cDNA library and to define a clone containing a 3.5 kb
insert with an open reading frame that encoded a protein of 427
amino acids (FIG. 1).
[0140] The predicted amino acid sequence identifies this protein,
dorsalin-1 (dsl-1), as a new member of the TGF-.beta. superfamily.
The N-terminal domain of dsl-1 contains a stretch of hydrophobic
residues that could serve as a signal sequence. A comparison of
COOH-terminal 109 amino acids with those of other members of this
family reveals that dsl-1 contains most of the conserved amino
acids present in the other family members, including seven
characteristic cysteine residues (FIG. 2A). The structure of
TGF-.beta.2 (Daopin et al., 1992; Schlunegger and Grutter, 1992)
suggests that in dsl-1, intrachain disulfide bonds are formed
between cysteines 7 and 73, 36 and 106, 40 and 108, and that
cysteine 72 is involved in dimer stabilization through formation of
an interchain disulfide bond. The NH.sup.2 terminal domain of the
dsl-1 precursor does not exhibit any significant similarity to
other members of the TGF-.beta. family.
[0141] Dsl-1 is more related to members of the Vg-1/dpp/BMP
subfamily than to the TGF-.beta., activin or MIS subfamilies (FIG.
2B). Given the high degree of sequence conservation of individual
members of the BMP family identified in different species (FIG. 2),
the divergence in sequence between dsl-1 and mammalian TGF-.beta.
family members suggests that the dsl-1 gene encodes a novel member
of this superfamily. The sequence of the mouse dsl-1 gene (Cox and
Basler, unpublished findings) supports this idea.
[0142] As with other family members, the conserved COOH-terminal
region is immediately preceded by a series of basic residues that
could serve as a site for proteolytic cleavage of the precursor
protein (Celeste et al., 1990; Barr, 1991). An epitope-tagged
derivative, dsl-1.sup.myc, which contains a 10 amino acid insert
derived from the human c-myc proto-oncogene (Evan et al., 1985) was
generated to determine the site of cleavage of the dsl-1 precursor.
The c-myc sequence was inserted two residues upstream of the first
conserved cysteine in a region of the protein that exhibits no
conservation with other members of the TGF-.beta. family (FIG. 2A).
cDNAs encoding native and epitope-modified dsl-1 were cloned into
the expression vector pMT 21 and transfected separately into cos-7
cells.
[0143] Medium from cells transfected with the epitope-modified
dsl-1 construct was passed over a MAb 9E10 (Evan et al., 1985) anti
c-myc affinity column. Affinity purified proteins were analyzed by
gel electrophoresis, revealing a major 15 kDa band and minor bands
at 45, 47 and .about.60 kDa (FIG. 3A). The bands at 45 and 47 kDa
correspond in size to those predicted for the unproceesed dsl-1
protein and the 15 kDa band to that expected for a
proteolytically-cleaved product. To establish the identity of the
15 kDa band and to determine the site for proteolytic cleavage of
the precursor protein, the 15 kDa band was blotted onto Immobilon
membranes and subjected to sequence analysis. The NH.sub.2-terminal
sequence obtained, SIGAEQKLIS (SEQ ID No. 16), corresponds to
residues 319-322 of the predicted dsl-1 sequence followed by the
first 6 residues of the human c-myc epitope. This result shows that
the R-S-K-R (SEQ ID No. 17) sequence at residues 315-318 is the
site of proteolytic processing of the dsl-1 precursor (arrow in
FIG. 1), at least in the presence of the c-myc peptide.
[0144] To determine whether recombinant dsl-1 secreted by cos-7
cells has BMP-like activity, a biochemical assay of osteoblast
differentiation was used in which BMPs induce alkaline phosphatase
activity (Thies et al. 1992). Recombinant BMP-2 produced a
dose-dependent increase in alkaline phosphatase activity in W-20-17
osteoblast cells over a concentration range of 10-1000 ng/nl (not
shown; Thies et al. 1992). Conditioned-medium obtained from cos-7
cells transfected with dsl-1 produced an increase in alkaline
phosphatase similar to that of BMP-2 at dilutions of 1:10 to 1:1000
(FIG. 3B). Moreover, medium derived from cos-7 cells transfected
with dsl-1.sup.myc cDNA, was effective as medium derived from cells
transfected with unmodified dsl-1 cDNA (FIG. 3B). In control
experiments, cos-7 cells were transfected with a c-myc tagged
version of the Drosophila decapentaplegic (dpp) gene, which encodes
a related TGF-.beta. family member (FIG. 2b). Cos-7 cells do not
secret dpp protein (Basler, unpublished observations) and medium
derived from dpp transfectants did not induce alkaline phosphatase
activity, providing evidence that cos-7 cells subjected to the same
transfection protocol do not secrete a BMP-like activity (FIG. 3B).
These results show that dsl-1 can be expressed in cos-7 cells in
functional form, that dsl-1 mimics the activity of BMPs in this
assay and that the activity of dsl-1 is not reduced by insertion of
the c-myc peptide.
[0145] Expression of dsl-1 RNA in the Developing Nervous System
[0146] Dsl-1 mRNA was localized in developing chick embryos by in
situ hybridization to examine the expression of dsl-1 during neural
development. Dsl-1 mRNA was not expressed by cells in the neural
plate (FIGS. 4A, B) and first appeared at the time of closure of
the neural tube. At this stage, dsl-1 was expressed at high levels
in the dorsal third of the neural tube but was absent from more
ventral regions (FIGS. 4C, D). Dsl-1 mRNA was restricted to the
nervous system at this stage of development (not shown).
[0147] The restricted expression of dsl-1 mRNA in the spinal cord
persisted after the onset of neuronal differentiation (FIGS. 4E-F),
and by E5, the latest stage examined, the domain of expression of
dsl-1 mRNA was confined to the dorsomedial region of the spinal
cord including, but not restricted to, the roof plate (FIGS. 4G,
H). Dsl-1 mRNA was also expressed in dorsal regions of the
hindbrain after neural tube closure (not shown). From E3 to E5, the
only non-neural tissue types that expressed detectable levels of
dsl-1 mRNA were kidney and myotomal cells (not shown) although the
level of mRNA expression in these tissues was much lower than that
in the nervous system.
[0148] Regulation of Dsl-1 Expression by the Notochord
[0149] The expression of antigenic markers that are restricted to
dorsal neural tube cells is regulated by signals from the notochord
and floor plate (Yamada et al. 1991; Placzek et al. 1991) raising
the possibility that dsl-1 mRNA expression is controlled in a
similar manner. To examine this possibility, segments of stage 10
chick notochord were grafted into the lumen of the neural groove of
host embryos prior to the onset of dsl-1 mRNA expression. Embryos
were incubated for a further 48 h, during which time the graft was
displaced dorsally, such that it is eventually located at the
dorsal midline of the neural tube and spinal cord. Dsl-1 mRNA
expression, determined by in situ hybridization, was absent from
the spinal cord of embryos with dorsal notochord grafts (FIGS.
5D,E) whereas the spinal cord of operated embryos at rostrocaudal
levels that were not adjacent to the dorsal notochord graft
exhibited the normal pattern of dsl-1 mRNA expression (FIGS.
5A,B).
[0150] To correlate changes in dsl-1 mRNA expression with neural
cell pattern, sections of operated embryos adjacent to those used
for in situ hybridization were examined for expression of SC1, an
immunoglobulin-like protein present on floor plate cells and motor
neurons (FIG. 5C) (Tanaka and Obata, 1984; Yamada et al., 1991). In
embryos in which dsl-1 mRNA was absent from the spinal cord, SC1
expression revealed the presence of dorsal motor neurons and
sometimes a floor plate at the dorsal midline of the spinal cord
(FIG. 5F). Thus, dorsal notochord grafts abolish the expression of
dsl-1 mRNA and ventralize the dorsal spinal cord.
[0151] The ability of the notochord to inhibit dsl-1 mRNA
expression suggests that the notochord might normally have a role
in restricting the expression of dsl-1 within the neural tube.
Elimination of ventral midline-derived signals might therefore
result in an expansion in the domain of dsl-1 expression. To test
this, Hensen's node, the precursor of the notochord, was removed
from stage 10 chick embryos, thus preventing the formation of the
notochord and ensuring that an early source of ventral
midline-derived signals (Yamada et al. 1993) is eliminated prior to
neural tube formation. The spinal cords of such embryos have been
shown to lack a floor plate and ventral neurons (Grabowski, 1956;
Hirano et al., 1991; Darnell et al. 1992; Yamada, unpublished). In
embryos from which Hensen's node had been removed, the domain of
dsl-1 mRNA expression expanded ventrally, and in extreme cases
included the entire dorsoventral extent of the neuroepithelium
(FIGS. 5G,H). In a second series of experiments, the notochord was
removed from the caudal region of stage 10 embryos, which were then
permitted to develop for an additional 48 h. At levels of the
spinal cord lacking a floor plate and motor neurons, as assessed by
SC1 labelling, the domain dsl-1 expression expanded ventrally to
occupy about two thirds of the spinal cord, although, the most
ventral region never expressed dsl-1 (not shown). The more limited
ventral expansion of dsl-1 observed after removal of the notochord
compared with Hensen's node removal is consistent with other
studies (Yamada et al. 1993) suggesting that ventralizing signals
from the notochord begin to act soon after the neural plate has
formed.
[0152] Taken together, these experiments suggest that the
expression of dsl-1 mRNA in ventral regions of the neural tube is
normally inhibited by signals form the notochord.
[0153] Dsl-1 Regulates Neural Differentiation In Vitro
[0154] The dorsal restriction of dsl-1 mRNA suggests two ways in
which dsl-1 protein could regulate cell differentiation along the
dorso-ventral axis of the neural tube. One function of dsl-1 could
be to promote the differentiation of cell types generated in the
dorsal neural tube. A second function of dsl-1 could be to
counteract the influence of ventralizing signals that derive from
the notochord and floor plate. The actions of dsl-1 on the
differentiation of defined cell types in neural plate explants
grown in vitro have been examined to test the possible functions of
dsl-1. In the following sections, we provide evidence first that
dsl-1 can promote the differentiation of cells with neural
crest-like properties and second that dsl-1 can inhibit the
differentiation of motor neurons in response to inductive signals
from the notochord and floor plate.
[0155] Neural Crest Cell Differentiation: Neural crest cells are
generated from precursors located in the dorsal neural tube
(Bronner-Fraser and Fraser, 1988). They can be identified in vitro
by their ability to migrate from the neural tube, by their
expression of several cell surface markers including the HNK-1
epitope (Maxwell et al. 1988), B1 integrin (Delannet and Duband,
1992), the low-affinity neurotrophin receptor subunit p75 (Bernd,
1985; Stemple and Anderson, 1992) and by their ability to
differentiate into cell types such as neurons, glial cells and
melanocytes (Sieber-Blum and Cohen 1980; Baroffio et al, 1988;
Stocker et al. 1991).
[0156] To examine whether dsl-1 might regulate the differentiation
or migration of neural crest cells, the intermediate ([i]) region
of the neural plate was isolated from stage 10 embryos and grown as
explants in vitro (Yamada et al. 1993). As described (Yamada et al.
1993) few cells migrated from [i]-neural plate explants grown in
isolation for 48 h (FIGS. 6A, G). Addition of dsl-1.sup.myc
(3.times.10.sup.-11M) for 48 h resulted in a 15-fold increase in
the number of cells that migrated from [i]-neural plate explants
(FIGS. 6B,G). To examine whether these migratory cells share
surface properties with chick neural crest cells, cultures grown
for 48 h in the presence of dsl-1.sup.myc were labeled with
monoclonal antibodies directed against HNK-1, the .beta.1 integrin
subunit and chick p75. Over 90% of cells that had migrated from the
[i]-neural plate explants in the presence of dsl-1.sup.myc
expressed HNK-1 and .beta.1 integrin on their surface (FIG. 6D,E)
and about 30% expressed p75 (not shown). These results show that
cells induced to migrate from [i]-neural plate explants have the
properties of neural crest cells.
[0157] To determine whether the cells that are induced to migrate
from [i]-neural plate explants by dsl-1 can differentiate into cell
types known to derive from the neural crest, the generation of
melanocytes, which can be identified unambiguously in vitro by the
presence of lemanin pigmentation was studied. In these experiments
we used [i]-neural plate explants from quail embryos which exhibit
properties in vitro similar to those of equivalently staged
[i]-neural plate explants from the non-pigmented chick strain used
for all other experiments were used (not shown). Melanocyte
differentiation from neural crest cells in vitro has been shown to
require permissive factors that can be provided in the form of
chick embryo extract (CEE) or serum (Baroffio et al. 1988; Maxwell
et al. 1988). [i]-Neural plate explants were therefore grown in
dsl-1.sup.myc (3.times.10.sup.-11M) for 48 h to promote the
migration of cells, after which dsl-1.sup.myc was removed and the
medium supplemented with 10% CEE and 10% fetal calf serum and grown
for a further 72 h. Under these conditions, 10-15% of the cells
that had emigrated from [i]-neural plate explants expressed melanin
pigment and exhibited dendritic morphology (FIG. 6F) indicating the
presence of melanocytes. Control experiments showed that addition
of CEE and serum after exposure of [i]-neural plate explants to
dsl-1.sup.myc for 48 h did not increase further the number of
migratory cells (not shown). Moreover, melanocytes were not
observed when [i]-neural plate explants were exposed to medium
containing CEE and serum for 72 h in the absence of dsl-1.sup.myc
(not shown). These results indicate that cells induced to migrate
from [i]-neural plate explants by dsl-1.sup.myc can differentiate
into at least one cell type known to derive from the neural
crest.
[0158] In contrast to neural crest cells that derive from the
dorsal neural tube d]-neural plate explants (Yamada et al. 1993),
cells that had been induced to migrate from [i]-neural plate
explants by dsl-1.sup.myc did not express neuronal markers or
exhibit neuronal morphology when examined after 48 h (not shown).
This result suggest that dsl-1 can promote the initial
differentiation of neural crest cells from neural plate cells, but
that dsl-1 alone does not support the subsequent differentiation of
these cells into neurons.
[0159] The presence of migratory neural crest-like cells was also
monitored to address the fate of cells in [i]-neural plate explants
that have been exposed both to ventralizing signals and to
dsl-1.sup.myc. [i]-Neural plate explants grown in contact with the
notochord or floor plate for 48 h in the presence of
dsl-1.sup.myc(3.times.10.sup.-11M) exhibited a 12-15 fold increase
in the number of migratory cells, similar to that observed when
isolated [i]-neural plate explants were exposed to dsl-1.sup.myc
(FIG. 6G). These cells also expressed HNK-1, .beta.1 integrin and
p75 on their surface (not shown). These findings suggest that
dsl-1.sup.myc promotes the initial differentiation of neural crest
cells in the presence of ventralizing signals from the notochord
and floor plate.
[0160] At present, the lack of selective markers has forbidden
studies of whether dsl-1 promotes the differentiation of other
neural cell types that derive from the dorsal neural tube.
[0161] Regulation of Motor Neuron Differentiation: To examine
whether dsl-1 also influences the differentiation of ventral cell
types, expression of the LIM homeodomain protein Islet-1 (Karlson
et al 1990; Ericson et al. 1992), which provides a marker for the
induction of motor neurons in [i]-neural plate explants in response
to diffusible signal from the notochord or floor plate was
monitored (Yamada et al., 1993).
[0162] [i]-Neural plate explants grown in vitro for 48 h contained
few (usually <5) Islet-1+ cells (FIGS. 7A, B; 8A, C). In
contrast, [i]-neural plate explants grown in contact with notochord
or floor plate exhibited a 50-100-fold increase in Isl-1+ cells
(FIGS. 7D, E; 8A). Addition of dsl-1.sup.myc to recombinates of
[i]-neural plate with notochord or floor plate produced a
concentration-dependent decrease in the number of Islet-1+ cells
present in explants (FIGS. 7J, K; 8A, B). At concentrations of
dsl-1.sup.myc of 3.times.10.sup.-11 M or greater, the
differentiation of Islet-1+ cells was suppressed by over 95% (FIG.
8B). Dsl-1.sup.myc also abolished the expression of SC1 from
regions of the [i]-neural plate explant distant from the junction
with the inducing tissue (not shown) suggesting that dsl-1.sup.myc
suppresses motor neuron properties other than Isl-1. Addition of
dsl-1.sup.myc to neural plate explants grown alone did not induce
Islet-1+ cells (not shown).
[0163] A truncated dsl-1 cDNA in cos-7 cells was expressed and
compared its activity with that of native dsl-1 or dsl-1.sup.myc to
control for the presence of cos-7 cell-derived inhibitory
contaminants in preparation of affinity-purified dsl-1.sup.myc. The
induction of Islet-1+ cells by floor plate was suppressed over 95%
by a 1:1000 dilution of conditioned medium from cos-7 cells
transfected either with unmodified dsl-1 or with dsl-1.sup.myc
cDNAs (not shown). In contrast, medium derived from cos-7 cells
expressing the truncated dsl-1 cDNA did not significantly reduce
the number of Islet-1+ cells induced by floor plate (364.+-.62
cells in the absence and 287.+-.45 cell in the presence of medium
containing truncated dsl-1, mean.+-.s.e.m., n=4, p>0.10).
[0164] Dsl-1 could inhibit the generation of Islet-1+ cells by
preventing [i]-neural plate cells from responding to inductive
signals or by inhibiting the production of this signal by the
notochord and floor plate. The effects of dsl-1.sup.myc on Islet-1+
cells in [i]-neural plate explants exposed to floor
plate-conditioned medium were examined to distinguish these
possibilities (Yamada et al. 1993). A 1:10 dilution of floor
plate-conditioned medium produced a .about.30 fold increase in the
number of Isl-1+ cells (FIGS. 7G, H; 8C). Addition of both
dsl-1.sup.myc and floor plate-conditioned medium to neural plate
explants grown alone resulted in a 76% decrease in the number of
Islet-1+ cells (FIG. 8C). This result indicates that the inhibition
of Islet-1+ cells results, at least in part, from a direct action
of dsl-1 on [i]-neural plate cells.
[0165] To examine whether the suppression of Islet-1+ cells is
accompanied by a more general inhibition of neuronal
differentiation, explants processed for Islet-1 expression were
double-labelled with MAb 3A10, a general neuronal marker (Furley et
al., 1990). Although the labelling of both cell bodies and axons by
3A10 made it difficult to count the number of neurons accurately,
there was no obvious difference in the number of 3A10+ cells in
[i]-neural plate explants exposed to concentrations of
dsl-1.sup.myc that almost completely suppressed the differentiation
of Islet-1+ cells (Compare FIGS. 7I and 7L). These results show
that extensive neuronal differentiation still occur under
conditions in which the induction of Islet-1+ cells is
suppressed.
Experimental Discussion
[0166] Dorsoventral patterning within the neural tube appear to
begin at the neural plate stage and to involve the action of both
contact-mediated and diffusible inductive signals that derive
initially from the notochord and later from the floor plate. A
contact-mediated signal appears to be required for floor plate
differentiation whereas motor neuron differentiation can be induced
by diffusible factors (Placzek et al. 1993; Yamada et al. 1993).
The specification of dorsal cell types may, however, require
different factors since dorsal cell types persist in the spinal
cord of embryos in which the notochord and floor plate have been
eliminated.
[0167] To begin to define factors involved in specifying the fate
of cells in the dorsal neural tube, a novel member of the TGF.beta.
gene family, dorsalin-1 (dsl), the expression of which is
restricted to the dorsal neural tube was cloned and characterized.
The dorsal restriction in expression of dsl-1 appears to be
established by signals from the notochord which act on overlying
neural plate cells prior to the onset of dsl-1 transcription to
prevent ventral expression of the gene after closure of the neural
tube (FIG. 9A). The persistence of dsl-1 mRNA expression in the
absence of the notochord and floor plate provides evidence that the
expression of genes that are restricted to the dorsal neural tube
is independent of ventralizing signals. Dorsal cell fates may be
specified by the exposure of neural plate cells to early
dorsalizing signals, perhaps from adjacent non-neural ectoderm
(Takahashi et al. 1992) which induce the potential to express dsl-1
and other dorsal genes.
[0168] Once the dorsal expression of dsl-1 is established, dsl-1
protein could function in several different ways to control cell
differentiation in the neural tube. First, dsl-1 may promote the
differentiation of cell types that derive from the dorsal neural
tube (FIG. 9Bi). Second, the expression of dsl-1 could ensure that
the dorsal neural tube is refractory to ventralizing signals from
the notochord (FIG. 9Bii). Finally, dsl-1 protein could diffuse and
influence the fate of cells in more ventral regions of the neural
tube (FIG. 9ABiii). The interactions of dsl-1 and other factors
from the dorsal neural tube with ventralizing signals from the
ventral midline could, therefore control the identity of cell types
and the position at which they are generated along the entire
dorsoventral axis of the neural tube.
[0169] Dsl-1 May Promote Neural Crest Cell Differentiation
[0170] One function of dsl-1 suggested by the pattern of expression
of dsl-1 mRNA could be to promote the differentiation of cell types
that are generated in the dorsal neural tube. Neural crest cells
constitute one of the major cell types that derive from precursors
located in the dorsal neural tube. The present in vitro studies
provide evidence that dsl-1 promotes the initial differentiation of
cells with neural crest-like properties from [i]-neural plate
explants, but that cells exposed to dsl-1 alone appear unable to
progress to fully differentiated cell types such as neurons or
melanocytes. One possible reason for this is that dsl-1 itself may
inhibit neural crest cells from further differentiation. In support
of this, TGF.beta. 1 has been shown to inhibit the differentiation
of neural crest cells into melanocytes (Stocker et al. 1991; Rogers
et al. 1992) and to promote the production of extracellular matrix
components such as fibronectin (Rogers et al. 1992) that can
inhibit neuronal differentiation (Stemple and Anderson, 1992).
Alternatively other dorsally-restricted factors that are absent
from [i]-neural plate explants may be required for the progression
of neural crest cell differentiation.
[0171] TGF.beta. 1 has also been shown to accelerate the migration
of neural crest cells from premigratory regions of the neural tube
(Delannet and Duband, 1992). The action of dsl-1 to promote the
migration of neural crest-like cells from [i]-neural plate explants
differs from this effect in that cells in these explants do not
give rise to neural crest cells in the absence of dsl-1 even when
maintained in vitro for 96 h (Yamada, unpublished observations).
Nevertheless, dsl-1 may mimic the ability of TGF.beta. 1 to
accelerate neural crest migration and could therefore be involved
both in specifying the fate of premigratory neural crest precursors
and in inducing the migration of these cells from the dorsal neural
tube.
[0172] It remains unclear whether the differentiation of other
classes of dorsal neurons is regulated by dsl-1. Neurons with the
properties of dorsal commissural neurons can differentiate in rat
neural plate explants grown in isolation (Placzek et al. 1993).
Thus it is possible that some dorsal cell types can differentiate
independently of dsl-1. Alternatively, neural plate explants grown
in vitro may begin to express dsl-1 at levels sufficient to drive
the differentiation of some but not all dorsal cell types.
[0173] Dsl-1 as an Inhibitor of Ventral Cell Type
[0174] Differentiation
[0175] Dsl-1 suppresses the differentiation of motor neurons in
[l]-neural plate explants exposed to ventralizing signals from the
notochord or floor plate. This finding raises the possibility that
dsl-1 interacts with ventralizing signals to control cell fate
along the dorsoventral axis of the neural tube. Although, dsl-1
expression occurs after signals from the notochord and floor plate
have begun to specify ventral cell fates (Yamada et al. 1993), its
expression precedes the overt differentiation of motor neurons and
other ventral neurons (Ericson et al. 1992). Indeed, the first
marker of motor neuron differentiation, Islet-1, is not expressed
until stage 15 (Ericson et al. 1992), or about 18-20 h after neural
tube closure and the onset of dsl-1 expression. Thus, in the period
between the initial specification and overt differentiation of
neurons, dsl-1 may accumulate to levels that are sufficient to
influence neuronal differentiation.
[0176] The ability of dsl-1 to inhibit motor neuron differentiation
could be involved in preventing the generation of motor neurons and
other ventral cell types in the dorsal neural tube. This
presupposes that ventralizing signals from the notochord and floor
plate can influence dorsal regions of the neural tube. Secreted
factors from the floor plate have been shown to diffuse over long
distances through the neuroepithelium (Placzek et al. 1990).
Moreover the position of the ventral boundary of the domain of
dsl-1 expression suggests that signals from the notochord can
influence at least two third of the neural tube. Thus, expression
of dsl-1 within the dorsal third of the neural tube could make
cells in this region refractory to long range ventralizing signals
from the notochord and floor plate.
[0177] The potential contributions of dsl-1 to cell differentiation
along the dorso-ventral axis of the neural tube will also depend on
the range of action of dsl-1 itself. Since dsl-1 is readily
secreted from cells in vitro, dsl-1 may diffuse ventrally, beyond
the domain of dsl-1 mRNA expression, to influence the response of
cells in intermediate regions of the neural tube. Again, the
ability of dsl-1 to antagonize the response of neural cells to
ventralizing signals from the notochord and floor plate could be
relevant both to the differentiation of motor neurons and to other
ventral cell types.
[0178] Prevention of Dsl-1 Expression Ventrally May be Required for
Ventral Cell Type Differentiation
[0179] Dsl-1 promotes neural crest cell migration and inhibits
motor neuron differentiation in the presence of the notochord or
floor plate. These findings suggest that the actions of dsl-1
dominate over ventralizing signals. Thus, the inhibition of dsl-1
expression from ventral regions of the neural tube that is achieved
by early signals from the notochord may be necessary for the
differentiation of ventral cell types. The absence of ventral cell
types in the neural tube of embryos lacking a notochord could,
therefore, result either from a ventral expansion in the domain of
dsl-1 expression or from the loss of ventralizing signals. However,
in such operated embryos the neural tube is reduced in size (van
Straaten and Hekking, 1991), thus, the death (Homma and Oppenheim,
1992) or arrested division (Placzek et al. 1993) of ventral cells
could also contribute to the presence of dorsal cell types in
regions of the neural tube that appear to be ventral.
[0180] Dsl-1 and the TGF.beta. Family
[0181] In addition to dsl-1, several other members of the BMP (DVR)
subfamily of TGF.beta.-like genes are expressed in the embryonic
nervous system. Other BMP-like proteins may therefore mimic the
actions of dsl-1 on neural cell differentiation. In preliminary
studies, the induction of motor neurons was found to be also
suppressed by cos-7 cell-derived BMP-4 (Basler et al. unpublished).
In the spinal cord and hindbrain, the BMP-4 (DVR-4) gene is
expressed selectively by cells in the roof plate whereas in the
diencephalon, the gene is found at the ventral midline (Jones et
al., 1991). The expression of BMP-4 in the ventral diencephalon
coincides with, and could perhaps contribute to the absence of
motor neurons from the embryonic forebrain. The embryonic
distribution of most other BMP genes is not known although Vgr-1
(BMP-6/DVR-6) is expressed by cells immediately adjacent to the
floor plate in the spinal cord (Jones et al., 1991) and GDF-1
appears to be expressed widely throughout the embryonic nervous
system (Lee, 1990, 1991). Studies to determine whether widely
distributed proteins such as GDF-1 mimic the actions of dsl-1 will
be important in evaluating the role of this gene family in neural
patterning.
[0182] The involvement of dsl-1 in the control of cell
differentiation along the dorsoventral axis of the neural tube
extends the range of activities described for members of the
TGF.beta. family during embryonic development. Studies in Xenopus
embryos have provided evidence that activin can control the
identity of mesodermal cell types in a concentration-dependent
manner (Ruiz i Altaba and Melton, 1989; Green et al. 1992). In
addition, the pattern of expression and possible functions of dsl-1
in the neural tube has parallels with that of the decapentaplegic
gene (dpp) in Drosophila embryonic development (Ferguson and
Anderson, 1992a,b). Dorsoventral patterning in the early Drosophila
embryo involves a dorsal restriction of dpp expression (St.
Johnston and Gelbart, 1987) that is achieved by ventral-midline
derived signals that inhibit dpp expression ventrally (Ray et al.
1991). Genetic inactivation of this ventral signalling pathway or
introduction of dpp activity ventrally, changes the fate of cells
along the dorsoventral axis of the embryo (Ferguson and Anderson,
1992b). In the neural tube, the dorsal restriction of dsl-1 mRNA by
early signals from the notochord could generate a gradient of dsl-1
activity along the dorsoventral axis of the neural tube. Alone, or
in conjunction with ventralizing signals from the notochord and
floor plate, a gradient of dsl-1 could influence the fate of cells
according to their dorsoventral position within the neural
tube.
[0183] References
[0184] Abo, T. and Balch, C. M. (1981) A differentitation antigen
of human NK and K cells identified by a monoclonal antibody (HNK-1)
J. Immun. 127:1024-1029.
[0185] Barr, P. J. (1991) Mammalian subtilisins: The long-sought
after dibasic processing endoproteases. Cell 66:1-3.
[0186] Baroffio, A., Dupin, E. and LeDouarin, N. M. (1988)
Clone-forming ability and differentiation potential of migratory
neural crest cells. Proc. Natl. Acad. Sci. 85:5325-5329.
[0187] Bernd, P. (1985) Appearance of nerve growth factor receptors
on cultured neural crest cell. Devl. Biol. 112:145-156.
[0188] Bronner, Fraser, M. and Fraser, S. (1988) Cell lineage
analysis shows multipotentiality of some avian neural crest cells.
Nature 335:161-164.
[0189] Celeste, A. J., Iannazzi, J. A., Taylor, R. C., Hewick, R.
M., Rosen, V., Wang, E. A. and Wozney, J. M. (1990) Identification
of transforming growth factor .beta. family members present in
bone-inductive protein purified from bovine bone. Proc. Natl. Acad.
Sci. 87:9843-9847.
[0190] Daopin, S., Piez, K. A., Ogawa, Y. and Davies, D. R. (1992)
Crystal structure of transforming growth factor-.beta.2: An unusual
fold for the superfamily. Science 257:369-373.
[0191] Darnell, D. K., Schoenwold, G. C. and Ordahl, C. P. (1992)
Changes in dorsoventral but not rostrocaudal regionalization of the
chick neural tube in the absence of cranial notochord, as revealed
by expression of engrailed-2. Dev. Dyn. 193:389-396.
[0192] Delannet, M. and Duband, J-L. (1992) Transforming growth
factor-.beta. control of cell-substratum adhesion during avian
neural crest cell emigration in vitro. Dev. 116:275-287.
[0193] Devereux, J., Haeberli, P. and Smithies, O. (1984) A
comprehensive set tf sequence analysis programs for the VAX. Nucl.
Acid Res 12:387-395.
[0194] Dodd, J., Morton, S. B., Karagoegeos, D., Yamamoto, M., and
Jessell, T. M. (1988) Spatial regulation of axonal glycoprotein
expression on subsets of embryonic spinal neurons. Neuron
1:105-116.
[0195] Ericson, J., Thor, S., Edlund, T., Jessell, T. M. and
Yamada, T. (1992) Early stages of motor neuron differentiation
revealed by expression of homeobox gene Islet-1. Science
256:1555-1560.
[0196] Evan, G. I., Lewis, G. K., Ramsay, G. and Bishop, J. M.
(1985) Isolation of monoclonal antibodies specific for humanc-myc
protooncogene product. Mol. Cell Biol. 5:3610-3616.
[0197] Ferguson, E. L. and Anderson, K. V. (1992a) Localized
enhancement and repression of the activity of the TGF-.beta.0
family member, decapentaplegic, is necessary for dorsal-ventral
pattern formation in the Drosophila embryo. Development
114:583,597.
[0198] Ferguson, E. L. and Anderson, K. V. (1992b) Decapentaplegic
acts as a morphogen to organize dorsal-ventral pattern in the
Drosophila embryo. Cell 71:451-461.
[0199] Furley, A. J., Morton, S. B., Manalo, D., Karagogeos, D.,
Dodd, J. and Jessell, T. M. (1990) The axonal glycoprotein TAG-1 is
an immunoglobulin superfamily member with neurite
outgrowth-promoting activity. Cell 61:157-170.
[0200] Grabowski, C. T. (1956) The effects of the excision of
Hensen's Node on the early development of the chick embryo. J. Exp.
Zool. 133:301-343.
[0201] Green, J. B. and Smith, J. C. (1990) Graded changes in dose
of a Xenopus activin A homologue elicit stepwise transitions in
embryonic cell fate. Nature 347:391-394.
[0202] Green, J. B., New, H. V. and Smith, J. C. (1992) Responses
of embryonic xenopus cells to activin and FGF are separated by
multiple dose thresholds and correspond to distinct axes of the
mesoderm. Cell 71:731-739.
[0203] Greve, J. M. and Gottlieb, D. I. (1982) Monoclonal
antibodies which alter the morphology of cultured chick myogenic
cells. J. Cell. Biochem. 18:221-229.
[0204] Hamburger, V. and Hamilton, H. (1951) A series of normal
stages in the development of chick embryo. J. Morph. 88:49-92.
[0205] Harland, R. M. (1991) In situ hybridization: an improved
whole mount method for Xenopus embryos. Meth. Enxymol.
36:675-685.
[0206] Hatta, K., Kimmel, C. B., Ho, R. K. and Walker, C. (1991)
The cyclops mutation blocks specification of the floor plate of the
zebrafish central nervous system. Nature 350:339-341.
[0207] Hirano, S., Fuse, S. and Sohal, G. S. (1991) The effect of
the floor plate of pattern and polarity in the developing central
nervous system. Science 251:310-313.
[0208] Hoffman, F. M. (1991) Transforming growth
factor-.beta.-related genes in Drosophila and vertebrate
development. Current Opinion in Cell Biology 3:947-952.
[0209] Homma, S. and Oppenheim, R. W. (1992) Notochord dependent
cell survival in the ventral half of the chick neural tube. Soc.
Neurosc. Abst. 43.
[0210] Jones, C. M., Lyons, K. M. and Hogan, B. L. M. (1991)
Involvement of bone morphogenetic protein-4 (BMP-4) and Vgr-1 in
morphogenesis and neurogenesis in the mouse. Development
111:531-542.
[0211] Karlsson, O., Thor, S., Norbert, T., Ohlsson, H., and
Edlund, T. (1990) Insulin gene enhancer binding protein Isl-1 is a
member of a novel class of proteins containing both a homeo- and a
Cys-His domain. Nature 344:879-882.
[0212] Klar, A., Baldassare, M. and Jessell, T. M. (1992)
F-spondin: A gene expressed at high levels in the floor plate
encodes a secreted protein that promotes neural cell adhesion and
neurite extension. Cell 69:95-110.
[0213] Lee, S. J. (1990 Identification of a novel member (GDF-1) of
the transforming growth factor-b superfamily. Molecular
Endocrinology 4:1034-1040.
[0214] Lee, S. J. (1991) Expression of growth/differentiation
factor 1 in the nervous system: Conservation of a bicistronic
structure. Proc. Natl. Acad. Sci. 88:4250-4254.
[0215] Lyons, K. M., Jones, C. M. and Hogan, B. L. M. (1991) The
DVR gene family in embryonic development. Trends Genet.
7:408-412.
[0216] Maxwell, G. D., Forbes, M. E. and Christie, D. S. (1988)
Analysis of the development of cellular subsets present in the
neural crest using cell sorting and cell culture. Neuron
1:557-568.
[0217] Placzek, M., Tessier-Lavigne, M., Yamada, T., Jessell, T. M.
and Dodd, J. (1990a). Mesodermal control of neural cell identity:
floor plate induction by the notochord. Science 250:985-988.
[0218] Placzek, M., Tessier-Lavigne, M., Jessell, T. M. and Dodd,
J. (1990b) Orientation of commissural axons in vitro in response to
a floor plate-derived chemoattractant. Development 110:19-30.
[0219] Placzek, M., Yamada, T., Tessier-Lavigne, M., Jessell, T. M.
and Dodd, J. (1991) Control of dorso-ventral pattern in vertebrate
neural development: induction and polarizing properties of the
floor plate. Development. Suppl. 2:105-122.
[0220] Placzek, M., Jessell, T. M. and Dodd, J. (1993) Induction of
floor plate differentiation by contact-dependent, homeogenetic
signals. Development 117 (In Press).
[0221] Ray, R. P., Arora, K., Nusslein-Volhard, C. and Gelbart, W.
M. (1991) The control of cell fate along the dorsal-ventral axis of
the Drosophila embryo. Development 113:35-54.
[0222] Rogers, S. L., Gegick, P. J., Alexander, S. M. and McGuire,
P. G. (1992) Transforming growth factor-.beta. alters
differentiation in cultures of avian neural crest-derived cells:
effects on cell morphology, proliferation, fibronectin expression
and melanogenesis. Dev. Biol. 151:192-203.
[0223] Ruizi Altaba, A. and Melton, D. A. (1989) Interaction
between peptide growth factors and homeobox genes in the
establishment of anteriro-posterior polarity in frog embryos.
Nature 341:33-38.
[0224] Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA
sequencing with chain-terminating inhibitors. Proc. Natl. Acad.
Sci. USA 74:5463-5467.
[0225] Schlunegger, M. P. and Grutter, M. G. (1992) An unusual
feature revealed by the crystal structure of 2.2A resolution of
human transforming growth factor-.beta.2. Nature 358:430.
[0226] Sieber-Blum, M. and Cohen, A. M. (1980) Clonal analysis of
quail neural crest cells: They are pluripotent and differentiate in
vitro in the absence of non-crest cells Devl. Biol. 80:96-106.
[0227] Smith, T. F. and Waterman, M. S. (1981) Identification of
common molecular subsequences. J. of Mol. Biol. 147:195-197.
[0228] Smith, J. L. and Schoenwolf, G. C. (1989) Notochordal
induction of cell wedging in the chick neural plate and its role in
neural tube formation. J. Exp. Zool. 250:49-62.
[0229] Smith-Thomas, L. C. and Fawcett, J. W. (1989) Expression of
Schwann cell markers by mammalian neural crest cells. Development
105:251-262.
[0230] Stemple, D. L. and Anderson, D. J. (1992) Isolation of a
Stem Cell For Neurons and Glia from the Mammalian Neural Crest.
Cell 71:973-985.
[0231] St. Johnson, R. D. and Gelbart, W. M. (1987) Decapentaplegic
transcripts are localized along the dorsal-ventral axis of the
Drosophila embryo. The EMBO Journal 6:2785-2791.
[0232] Stocker, K. M., Sherman, L., Rees, S. and Ciment, G. (1991)
Basic FGF and TGF-.beta.1 influence commitment to melanogenesis in
neural crest-derived cells of avian embryos. Dev. 111:635-645.
[0233] Takahashi, Y., Monsoro-Burq, A-H., Bontoux, M. and Le
Douarin, N. M. (1992) A role for Quox-8 in the establishment of the
dorsoventral pattern during vertebrate development. Proc. Natl.
Acad. Sci. 89:10237-10241.
[0234] Tanaka, H. and Obata, K. (1984) Developmental changes in
unique cell surface antigens of chick embryo spinal motor neurons
and ganglion cells. Devl. Biol. 106:26-37.
[0235] Tanaka, H., Agata, A. and Obata, K. (1984) A new membrane
antigen revealed by monoclonal antibodies is associated with
motoneuron axonal pathways. Dev. Biol. 132:419-435.
[0236] Tessier-Lavinge, M., Placzek, M., Lumsden, A. G. S., Dodd,
J. and Jessell, T. M. (1988) Chemotropic guidance of developing
axons in the mammalian central nervous system. Nature
336:775-778.
[0237] Thies, R. S., Bauduy, M., Ashton, B. A., Kurtzberg, L.,
Wozney, J. M. and Rosen, V. (1992) Recombinant human bone
morphogenetic protein-1 induces osteoblastic differentiation in
W-20-17 stromal cells. Endocrinology 130:1318-1324.
[0238] Thomsen, G., Woolf, T., Whitman, M., Sokol, S., Vaughan, J.,
Vale, W. and Melton, D. A. (1990) Activins are expressed early in
Xenopus embryogenesis and can induce axial mesoderm and anterior
structures. Cell 63:485-493.
[0239] Thor, S., Ericson, J., Brannstrom, T. and Edlund, T. (1991)
The homeodomain LIM protein Isl-1 is expressed in subsets of
neurons and endocrine cells in the adult rat. Neuron 7:881-889.
[0240] van Straaten, H. M. W., Hekking, J. W. M., Wiertz-Hoessels,
E. L., Thors, F. and Drukker, J. (1988) Effect of the notochord on
the differentiation of a floor plate area in the neural tube of the
chick embryo. Anat. Embryol. 177:317-324.
[0241] van Straaten, H. M. W. and Hekking, J. W. M. (1991)
Development of floor plate, neurons and axonal outgrowth pattern in
the early spinal cord of the notochord-deficient chick embryo.
Anat. Embryol. 184:55-63.
[0242] Wharton, K. A., Thomsen, G. H. and Gelbart, W. M. (1991)
Drosophila 60A gene, another transforming growth factor .beta.
family member, is closely related to human bone morphogenetic
proteins. Proc. Natl. Acad. Sci. 88:9214-9218.
[0243] Wilkinson, D. G., Bailes, J. A. and McMahon, A. P. (1987)
Expression of the proto-oncogene int-1 is restricted to specific
neural cells in the developing mouse embryo. Cell 58:79-88.
[0244] Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M.,
Whitters, M. J., Driz, R. W., Hewick, R. M. and Wang, E. A. (1988)
Novel regulators of bone formation: molecular clones and
activities. Science 242:1528-1534.
[0245] Yamada, T., Placzek, M., Tanaka, H., Dodd, J. and Jessell,
T. M. (1991) Control of cell pattern in the developing nervous
system: polarizing activity of the floor plate and notochord. Cell
64:635-647.
[0246] Yamada, T., Pfaff, S., Edlund, T. and Jessell, T. M. (1993)
Control of cell pattern in the neural tube: Motor neuron induction
by diffusible factors from notochord and floor plate. Cell
Submitted
Sequence CWU 1
1
18 1 1603 DNA Chick 1 cctttcctct gtctgtaaag attcaacatt tttaatcagt
taaaatactt tgtcctcttg 60 tctctccatc agaaagtaaa tacataagaa
atgcattatt ttggagtatt agctgcactg 120 tctgttttca atatcattgc
ctgcctgaca agaggcaagc ctttggaaaa ctggaaaaag 180 ctaccagtta
tggaagagtc tgatgcattc tttcatgatc ctggggaagt ggaacatgac 240
acccactttg actttaaatc tttcttggag aatatgaaga cagatttact aagaagtctg
300 aatttatcaa gggtcccctc acaagtgaag accaaagaag agccaccaca
gttcatgatt 360 gatttataca acagatatac agcggacaag tcctccatcc
ctgcatccaa catcgtgagg 420 agcttcagca ctgaagatgt tgtttcttta
atttcaccag aagaacactc atttcagaaa 480 cacatcttgc tcttcaacat
ctctattcca cgatatgagg aagtcaccag agctgaactg 540 agaatcttta
tctcctgtca caaggaagtt gggtctccct ccagactgga aggcaacatg 600
gtcatttatg atgttctaga tggagaccat tgggaaaaca aagaaagtac caaatcttta
660 cttgtctctc acagtattca ggactgtggc tgggagatgt ttgaggtgtc
cagcgctgtg 720 aaaagatggg tcaaggcaga caagatgaag actaaaaaca
agctagaggt tgttatagag 780 agtaaggatc tgagtggttt tccttgtggg
aagctggata ttactgttac tcatgacact 840 aaaaatctgc ccctattaat
agtgttctcc aatgatcgca gcaatgggac aaaagagacc 900 aaagtggagc
tccgggagat gattgttcat gaacaagaaa gtgtgctaaa caaattagga 960
aagaacgact cttcatctga agaagaacag agagaagaaa aagccattgc taggccccgt
1020 cagcattcct ccagaagcaa gagaagcata ggagcaaacc actgtcggag
aacgtcactc 1080 catgtgaact ttaaagaaat aggttgggat tcttggatca
ttgcacccaa agattatgag 1140 gcttttgagt gtaaaggagg ttgcttcttc
cccctcacag ataatgttac gccaaccaaa 1200 catgctattg tccagactct
ggtgcatctc caaaacccaa agaaagcttc caaggcctgt 1260 tgtgttccaa
ctaaattgga tgcaatctct attctttata aggatgatgc tggtgtgccc 1320
actttgatat ataactatga agggatgaaa gtggcagaat gtggctgcag gtagtatatg
1380 ctgaatatct aagaatatac tcttttctgc tgtctgtgaa actgtacatt
agtgatgcaa 1440 atgaaaatcc ttgcaaacaa ggtttggagc acggcatggg
gctggttgtt gttgctgctt 1500 ttaaaggaaa gatggcattt aaagaatggc
aatcactgta aataccctgc attatatacc 1560 attaattaaa actttgtgag
attgaaaaaa aaaaaaaaaa aaa 1603 2 427 PRT Chick 2 Met His Tyr Phe
Gly Val Leu Ala Ala Leu Ser Val Phe Asn Ile Ile 1 5 10 15 Ala Cys
Leu Thr Arg Gly Lys Pro Leu Glu Asn Trp Lys Lys Leu Pro 20 25 30
Val Met Glu Glu Ser Asp Ala Phe Phe His Asp Pro Gly Glu Val Glu 35
40 45 His Asp Thr His Phe Asp Phe Lys Ser Phe Leu Glu Asn Met Lys
Thr 50 55 60 Asp Leu Leu Arg Ser Leu Asn Leu Ser Arg Val Pro Ser
Gln Val Lys 65 70 75 80 Thr Lys Glu Glu Pro Pro Gln Phe Met Ile Asp
Leu Tyr Asn Arg Tyr 85 90 95 Thr Ala Asp Lys Ser Ser Ile Pro Ala
Ser Asn Ile Val Arg Ser Phe 100 105 110 Ser Thr Glu Asp Val Val Ser
Leu Ile Ser Pro Glu Glu His Ser Phe 115 120 125 Gln Lys His Ile Leu
Leu Phe Asn Ile Ser Ile Pro Arg Tyr Glu Glu 130 135 140 Val Thr Arg
Ala Glu Leu Arg Ile Phe Ile Ser Cys His Lys Glu Val 145 150 155 160
Gly Ser Pro Ser Arg Leu Glu Gly Asn Met Val Ile Tyr Asp Val Leu 165
170 175 Asp Gly Asp His Trp Glu Asn Lys Glu Ser Thr Lys Ser Leu Leu
Val 180 185 190 Ser His Ser Ile Gln Asp Cys Gly Trp Glu Met Phe Glu
Val Ser Ser 195 200 205 Ala Val Lys Arg Trp Val Lys Ala Asp Lys Met
Lys Thr Lys Asn Lys 210 215 220 Leu Glu Val Val Ile Glu Ser Lys Asp
Leu Ser Gly Phe Pro Cys Gly 225 230 235 240 Lys Leu Asp Ile Thr Val
Thr His Asp Thr Lys Asn Leu Pro Leu Leu 245 250 255 Ile Val Phe Ser
Asn Asp Arg Ser Asn Gly Thr Lys Glu Thr Lys Val 260 265 270 Glu Leu
Arg Glu Met Ile Val His Glu Gln Glu Ser Val Leu Asn Lys 275 280 285
Leu Gly Lys Asn Asp Ser Ser Ser Glu Glu Glu Gln Arg Glu Glu Lys 290
295 300 Ala Ile Ala Arg Pro Arg Gln His Ser Ser Arg Ser Lys Arg Ser
Ile 305 310 315 320 Gly Ala Asn His Cys Arg Arg Thr Ser Leu His Val
Asn Phe Lys Glu 325 330 335 Ile Gly Trp Asp Ser Trp Ile Ile Ala Pro
Lys Asp Tyr Glu Ala Phe 340 345 350 Glu Cys Lys Gly Gly Cys Phe Phe
Pro Leu Thr Asp Asn Val Thr Pro 355 360 365 Thr Lys His Ala Ile Val
Gln Thr Leu Val His Leu Gln Asn Pro Lys 370 375 380 Lys Ala Ser Lys
Ala Cys Cys Val Pro Thr Lys Leu Asp Ala Ile Ser 385 390 395 400 Ile
Leu Tyr Lys Asp Asp Ala Gly Val Pro Thr Leu Ile Tyr Asn Tyr 405 410
415 Glu Gly Met Lys Val Ala Glu Cys Gly Cys Arg 420 425 3 143 PRT
Artificial Sequence COOH-terminus of BMP-2 3 Glu His Ser Trp Ser
Gln Ile Arg Pro Leu Leu Val Thr Phe Gly His 1 5 10 15 Asp Gly Lys
Gly His Pro Leu His Lys Arg Glu Lys Arg Gln Ala Lys 20 25 30 His
Lys Gln Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu 35 40
45 Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro
50 55 60 Pro Gly Tyr His Ala Phe Tyr Cys His Gly Glu Cys Pro Phe
Pro Leu 65 70 75 80 Ala Asp His Leu Asn Ser Thr Asn His Ala Ile Val
Gln Thr Leu Val 85 90 95 Asn Ser Val Asn Ser Lys Ile Pro Lys Ala
Cys Cys Val Pro Thr Glu 100 105 110 Leu Ser Ala Ile Ser Met Leu Tyr
Leu Asp Glu Asn Glu Lys Val Val 115 120 125 Leu Lys Asn Tyr Gln Asp
Met Val Val Glu Gly Cys Gly Cys Arg 130 135 140 4 143 PRT
Artificial Sequence COOH-terminus of DPP 4 Asp Asp Gly Arg His Lys
Ala Arg Ser Ile Arg Asp Val Ser Gly Gly 1 5 10 15 Glu Gly Gly Gly
Lys Gly Gly Arg Asn Lys Arg His Ala Arg Arg Pro 20 25 30 Thr Arg
Arg Lys Asn His Asp Asp Thr Cys Arg Arg His Ser Leu Tyr 35 40 45
Val Asp Phe Ser Asp Val Gly Trp Asp Asp Trp Ile Val Ala Pro Leu 50
55 60 Gly Tyr Asp Ala Tyr Tyr Cys His Gly Lys Cys Pro Phe Pro Leu
Ala 65 70 75 80 Asp His Phe Asn Ser Thr Asn His Ala Val Val Gln Thr
Leu Val Asn 85 90 95 Asn Met Asn Pro Gly Lys Val Pro Lys Ala Cys
Cys Val Pro Thr Gln 100 105 110 Leu Asp Ser Val Ala Met Leu Tyr Leu
Asn Asp Gln Ser Thr Val Val 115 120 125 Leu Lys Asn Tyr Gln Glu Met
Thr Val Val Gly Cys Gly Cys Arg 130 135 140 5 143 PRT Artificial
Sequence COOH-terminus of BMP-6 5 Arg Thr Thr Arg Ser Ala Ser Ser
Arg Arg Arg Gln Gln Ser Arg Asn 1 5 10 15 Arg Ser Thr Gln Ser Gln
Asp Val Ala Arg Val Ser Ser Ala Ser Asp 20 25 30 Tyr Asn Ser Ser
Glu Leu Lys Thr Ala Cys Arg Lys His Glu Leu Tyr 35 40 45 Val Ser
Phe Gln Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Pro Lys 50 55 60
Gly Tyr Ala Ala Asn Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu Asn 65
70 75 80 Ala His Met Asn Ala Thr Asn His Ala Ile Val Gln Thr Leu
Val His 85 90 95 Leu Met Asn Pro Glu Tyr Val Pro Lys Pro Cys Cys
Ala Pro Thr Lys 100 105 110 Leu Asn Ala Ile Ser Val Leu Tyr Phe Asp
Asp Asn Ser Asn Val Ile 115 120 125 Leu Lys Lys Tyr Arg Asn Met Val
Val Arg Ala Cys Gly Cys His 130 135 140 6 144 PRT Artificial
Sequence COOH-terminus of VG-1 6 Glu Cys Lys Asp Ile Gln Thr Phe
Leu Tyr Thr Ser Leu Leu Thr Val 1 5 10 15 Thr Leu Asn Pro Leu Arg
Cys Lys Arg Pro Arg Arg Lys Arg Ser Tyr 20 25 30 Ser Lys Leu Pro
Phe Thr Ala Ser Asn Ile Cys Lys Lys Arg His Leu 35 40 45 Tyr Val
Glu Phe Lys Asp Val Gly Trp Gln Asn Trp Val Ile Ala Pro 50 55 60
Gln Gly Tyr Met Ala Asn Tyr Cys Tyr Gly Glu Cys Pro Tyr Pro Leu 65
70 75 80 Thr Glu Ile Leu Asn Gly Ser Asn His Ala Ile Leu Gln Thr
Leu Val 85 90 95 His Ser Ile Glu Pro Glu Asp Ile Pro Leu Pro Cys
Cys Val Pro Thr 100 105 110 Lys Met Ser Pro Ile Ser Met Leu Phe Tyr
Asp Asn Asn Asp Asn Val 115 120 125 Val Leu Arg His Tyr Glu Asn Met
Ala Val Asp Glu Cys Gly Cys Arg 130 135 140 7 147 PRT Artificial
Sequence COOH-terminus of Activin-A 7 Gly Ala Asp Glu Glu Lys Glu
Gln Ser His Arg Pro Phe Leu Met Leu 1 5 10 15 Gln Ala Arg Gln Ser
Glu Asp His Pro His Arg Arg Arg Arg Arg Gly 20 25 30 Leu Glu Cys
Asp Gly Lys Val Asn Ile Cys Cys Lys Lys Gln Phe Phe 35 40 45 Val
Ser Phe Lys Asp Ile Gly Trp Asn Asp Trp Ile Ile Ala Pro Ser 50 55
60 Gly Tyr His Ala Asn Tyr Cys Glu Gly Glu Cys Pro Ser His Ile Ala
65 70 75 80 Gly Thr Ser Gly Ser Ser Leu Ser Phe His Ser Thr Val Ile
Asn His 85 90 95 Tyr Arg Met Arg Gly His Ser Pro Phe Ala Asn Leu
Lys Ser Cys Cys 100 105 110 Val Pro Thr Lys Leu Arg Pro Met Ser Met
Leu Tyr Tyr Asp Asp Gly 115 120 125 Gln Asn Ile Ile Lys Lys Asp Ile
Gln Asn Met Ile Val Glu Glu Cys 130 135 140 Gly Cys Ser 145 8 139
PRT Artificial Sequence COOH-terminus of TGF-Beta 1 8 Gly Met Asn
Arg Pro Phe Leu Leu Leu Met Ala Thr Pro Leu Glu Arg 1 5 10 15 Ala
Gln His Leu Gln Ser Ser Arg His Arg Arg Ala Leu Asp Thr Asn 20 25
30 Tyr Cys Phe Ser Ser Thr Glu Lys Asn Cys Cys Val Arg Gln Leu Tyr
35 40 45 Ile Asp Phe Arg Lys Asp Leu Gly Trp Lys Trp Ile His Glu
Pro Lys 50 55 60 Gly Tyr His Ala Asn Phe Cys Leu Gly Pro Cys Pro
Tyr Ile Trp Ser 65 70 75 80 Leu Asp Thr Gln Tyr Ser Lys Val Leu Ala
Leu Tyr Asn Gln His Asn 85 90 95 Pro Gly Ala Ser Ala Ala Pro Cys
Cys Val Pro Gln Ala Leu Glu Pro 100 105 110 Leu Pro Ile Val Tyr Tyr
Val Gly Arg Lys Pro Lys Val Glu Gln Leu 115 120 125 Ser Asn Met Ile
Val Arg Ser Cys Lys Cys Ser 130 135 9 257 PRT Mouse 9 Asp Val Leu
Glu Asp Ser Glu Thr Trp Asp Gln Ala Thr Gly Thr Lys 1 5 10 15 Thr
Phe Leu Val Ser Gln Asp Ile Arg Asp Glu Gly Trp Glu Thr Leu 20 25
30 Glu Val Ser Ser Ala Val Lys Arg Trp Val Arg Ala Asp Ser Thr Thr
35 40 45 Asn Lys Asn Lys Leu Glu Val Thr Val Gln Ser His Arg Glu
Ser Cys 50 55 60 Asp Thr Leu Asp Ile Ser Val Pro Pro Gly Ser Lys
Asn Leu Pro Phe 65 70 75 80 Phe Val Val Phe Ser Asn Asp Arg Ser Asn
Gly Thr Lys Glu Thr Arg 85 90 95 Leu Asp Leu Leu Lys Glu Met Ile
Gly His Glu Gln Glu Thr Met Leu 100 105 110 Val Lys Thr Ala Lys Asn
Ala Tyr Gln Gly Ala Gly Glu Ser Gln Glu 115 120 125 Glu Glu Gly Leu
Asp Gly Tyr Thr Ala Val Gly Pro Leu Leu Ala Arg 130 135 140 Arg Lys
Arg Ser Thr Gly Ala Ser Ser His Cys Gln Lys Thr Ser Leu 145 150 155
160 Arg Val Asn Phe Glu Asp Ile Gly Trp Asp Ser Trp Ile Ile Ala Pro
165 170 175 Lys Glu Tyr Asp Ala Tyr Glu Cys Lys Gly Gly Cys Phe Phe
Pro Leu 180 185 190 Ala Asp Asp Val Thr Pro Thr Lys His Ala Ile Val
Gln Thr Leu Val 195 200 205 His Leu Lys Phe Pro Thr Lys Val Gly Lys
Ala Cys Cys Val Pro Thr 210 215 220 Lys Leu Ser Pro Ile Ser Ile Leu
Tyr Lys Asp Asp Met Gly Val Pro 225 230 235 240 Thr Leu Lys Tyr His
Tyr Glu Gly Met Ser Val Ala Glu Cys Gly Cys 245 250 255 Arg 10 40
DNA Artificial Sequence Oligonucleotide corresponding to dorsalin-1
amino acid positions 339-345 10 tggaattctg gacgaacgtg acttggatac
tagtacgtgc 40 11 42 DNA Artificial Sequence Oligonucleotide
corresponding to dorsalin-1 amino acid positions 377-371 11
gaggatccaa gacgtgtctt gacgtacagt atacgtgcag tg 42 12 29 DNA
Artificial Sequence ORF-5' FEATURE 12 tggaattcat cgataacgga
agctgaagc 29 13 32 DNA Artificial Sequence ORF-3' 13 agcgtcgaca
tcgatattca gcatatacta cc 32 14 45 DNA Artificial Sequence PCR
Fragment encoding dorsalin-1 N-terminus 14 gcgaattcga tatcagcttc
tgctctgctc ctatgcttct cttgc 45 15 47 DNA Artificial Sequence PCR
fragment encoding dorsalin-1 C-terminus 15 cggaattcga tatccgagga
ggacctgaac cactgtcgga gaacgtc 47 16 10 PRT Chick 16 Ser Ile Gly Ala
Glu Gln Lys Leu Ile Ser 1 5 10 17 4 PRT Chick 17 Arg Ser Lys Arg 1
18 10 PRT Artificial Sequence c-myc epitope 18 Glu Gln Lys Leu Ile
Ser Glu Glu Asp Leu 1 5 10
* * * * *