U.S. patent application number 11/090061 was filed with the patent office on 2005-08-18 for rapid nucleic acid assay.
This patent application is currently assigned to BioVeris Corporation. Invention is credited to Kenten, John H., Smith, Rodger.
Application Number | 20050181430 11/090061 |
Document ID | / |
Family ID | 34555147 |
Filed Date | 2005-08-18 |
United States Patent
Application |
20050181430 |
Kind Code |
A1 |
Kenten, John H. ; et
al. |
August 18, 2005 |
Rapid nucleic acid assay
Abstract
This invention relates to an improved process for detecting and
quantifying a desired nucleic acid sequence. The process involves
synthesizing single stranded RNA, single stranded DNA,
double-stranded DNA followed by detection using an
electrochemiluminescent labeled binding species.
Inventors: |
Kenten, John H.;
(Gaithersburg, MD) ; Smith, Rodger; (Jefferson,
MD) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER
LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
BioVeris Corporation
Gaithersburg
MD
|
Family ID: |
34555147 |
Appl. No.: |
11/090061 |
Filed: |
March 28, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11090061 |
Mar 28, 2005 |
|
|
|
09480544 |
Jan 10, 2000 |
|
|
|
6890712 |
|
|
|
|
09480544 |
Jan 10, 2000 |
|
|
|
08474927 |
Jun 7, 1995 |
|
|
|
6048687 |
|
|
|
|
08474927 |
Jun 7, 1995 |
|
|
|
08124686 |
Sep 22, 1993 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12; 435/91.2 |
Current CPC
Class: |
C07H 21/00 20130101;
C12Q 1/686 20130101; C07H 23/00 20130101; C12Q 1/6865 20130101;
C12Q 1/6816 20130101; C12Q 1/703 20130101; C12Q 2535/113 20130101;
C12Q 2535/113 20130101; C12Q 2563/113 20130101; C12Q 2563/113
20130101; C12Q 1/6851 20130101; C12Q 1/686 20130101; C12Q 1/6804
20130101; C12Q 1/6865 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
1-20. (canceled)
21. A process for detecting a specific nucleic-acid sequence
comprising: (a) forming a first composition comprising (i) a
sample, (ii) a first oligonucleotide primer which comprises a
promoter sequence, (iii) a second oligonucleotide primer, (iv) a
DNA-directed RNA polymerase, (v) an RNA-directed DNA polymerase,
(vi) a DNA-directed DNA polymerase, and (vii) a ribonuclease that
hydrolyzes RNA of an RNA-DNA hybrid without hydrolyzing single or
double-stranded RNA or DNA; (b) incubating the first composition
for a sufficient time to amplify said specific nucleic acid
sequence to form a mixture comprising an amplified nucleic acid
sequence; (c) forming a second composition by adding to a sample of
said mixture the following reagents (i) at least one detection
probe sequence which specifically hybridizes to said amplified
nucleic-acid sequence, said detection probe sequence being labeled
with an electrochemiluminescent (ECL) species, (ii) at least one
capture probe sequence which specifically hybridizes to said
amplified nucleic-acid sequence, said capture probe sequence being
covalently attached to a solid phase; (d) incubating said second
composition for a time sufficient to allow hybridization of said
probes to said amplified nucleic-acid sequence to form a solid
phase-bound hybridization complex; and (e) detecting said specific
nucleic acid sequence by measuring electrochemiluminescence from
said solid phase-bound hybridization complex.
22. The process of claim 21, wherein said amplified nucleic-acid
sequence is the anti-sense copy of the specific nucleic-acid
sequence and wherein said amplification of said specific
nucleic-acid sequence is carried out under conditions which permit
(i) said second oligonucleotide primer to hybridize to an RNA
template which comprises the specific nucleic-acid sequence or an
anti-sense copy of the specific nucleic-acid sequence, (ii) said
RNA-directed DNA polymerase to utilize said RNA template to
synthesize a DNA template by extension of said second
oligonucleotide primer and thereby form an RNA-DNA hybrid
intermediate, (iii) said ribonuclease to hydrolyze RNA contained in
said RNA-DNA hybrid intermediate, (iv) said first oligonucleotide
primer to hybridize to said DNA template, (v) said DNA-directed DNA
polymerase to utilize said DNA template to synthesize a
double-stranded DNA product by extension of said first
oligonucleotide primer, said double-stranded DNA product comprising
said promoter, and (vi) said DNA-directed RNA polymerase to
recognize said promoter and transcribe said double-stranded DNA
product so as to form more copies of said RNA template.
23. The process of claim 21, wherein said ECL species comprises
ruthenium-tris-bipyridine.
24. The process of claim 21, wherein said solid phase is a
bead.
25. The process of claim 24, wherein said bead is a magnetic
bead.
26. The process of claim 21, wherein ECL-labeled nucleotides are
added to step (b) in sufficient quantity to produce ECL-labeled
amplified target molecules.
27. The process of claim 21, wherein the capture probe or the
detection probe is either the first oligonucleotide primer or the
second oligonucleotide primer.
28. The process of claim 21, wherein said amplified nucleic-acid
sequence is the anti-sense copy of the specific nucleic acid
sequence and wherein said amplification of said specific nucleic
acid sequence is carried out under conditions which permit (i) said
second oligonucleotide primer to hybridize to an RNA template which
comprises the specific nucleic acid sequence or an anti-sense copy
of the specific nucleic acid sequence, (ii) said RNA-directed DNA
polymerase to utilize said RNA template to synthesize a DNA
template by extension of said second oligonucleotide primer and
thereby form an RNA-DNA hybrid intermediate, (iii) said
ribonuclease to hydrolyze RNA contained in said RNA-DNA hybrid
intermediate, (iv) said first oligonucleotide primer to hybridize
to said DNA template, (v) said DNA-directed DNA polymerase to
utilize said DNA template to synthesize a double-stranded DNA
product by extension of said first oligonucleotide primer, said
double-stranded DNA product comprising said promoter, and (vi) said
DNA-directed RNA polymerase to recognize said promoter and
transcribe said double-stranded DNA product so as to form more
copies of said RNA template.
29. A process for detecting a specific nucleic-acid sequence
comprising: (a) forming a first composition comprising (i) a
sample, (ii) a first oligonucleotide primer which comprises a
promoter sequence, (iii) a second oligonucleotide primer, (iv) a
DNA-directed RNA polymerase, (v) an RNA-directed DNA polymerase,
(vi) a DNA-directed DNA polymerase, and (vii) a ribonuclease that
hydrolyzes RNA of an RNA-DNA hybrid without hydrolyzing single or
double-stranded RNA or DNA; (b) incubating the first composition
for a sufficient time to amplify said specific nucleic-acid
sequence to form a mixture comprising an amplified nucleic-acid
sequence; (c) forming a second composition by adding to a sample of
said first composition at least one capture probe sequence which
specifically hybridizes to said amplified nucleic-acid sequence,
said capture probe sequence being covalently attached to a solid
phase to form a solid phase-bound complex and incubating said
second composition for a time sufficient to allow hybridization of
said capture probe to said amplified nucleic-acid sequence; (d)
forming a third composition by adding to a sample of said second
composition at least one detection probe sequence which
specifically hybridizes to said amplified nucleic-acid sequence,
said detection probe sequence being labeled with an ECL species and
incubating said third composition for a time sufficient to allow
hybridization of said detection probe to said amplified
nucleic-acid sequence; and (e) detecting said specific nucleic-acid
sequence by measuring electrochemiluminescence from said solid
phase-bound hybridization complex.
30. A process for detecting a specific nucleic-acid sequence
comprising: (a) forming a first composition comprising (i) a
sample, (ii) a first oligonucleotide primer which comprises a
promoter sequence, (iii) a second oligonucleotide primer, (iv) a
DNA-directed RNA polymerase, (v) an RNA-directed DNA polymerase,
(vi) a DNA-directed DNA polymerase, and (vii) a ribonuclease that
hydrolyzes RNA of an RNA-DNA hybrid without hydrolyzing single or
double-stranded RNA or DNA; (b) incubating the first composition
for a sufficient time to amplify said specific nucleic-acid
sequence to form a mixture comprising an amplified nucleic-acid
sequence; (c) forming a second composition by adding to a sample of
said first composition at least one detection probe sequence which
specifically hybridizes to said amplified nucleic-acid sequence,
said detection probe sequence being labeled with an ECL species and
incubating said second composition for a time sufficient to allow
hybridization of said detection probe to said amplified
nucleic-acid sequence, (d) forming a third composition by adding to
a sample of said second composition at least one capture probe
sequence which specifically hybridizes to said amplified
nucleic-acid sequence, said capture probe sequence being covalently
attached to a solid phase to form a solid phase-bound hybridization
complex and incubating said second composition for a time
sufficient to allow hybridization of said capture probe to said
amplified nucleic-acid sequence; (e) incubating said second
composition for a time sufficient to allow hybridization of said
probes to said amplified nucleic-acid sequence; and (f) detecting
said specific nucleic acid sequence by measuring
electrochemiluminescence from said solid phase-bound hybridization
complex.
31. In a cycling DNA/RNA amplification assay involving an initial
nucleic acid template and having at least one amplification cycle
which results in an amplification reaction mixture wherein the
improvement comprises: (a) obtaining at least one sample from the
amplification reaction mixture; (b) adding to said sample the
following reagent mixture comprising, (i) at least one probe
sequence labeled with an ECL species wherein said probe sequence
specifically hybridizes to said initial nucleic acid template; (ii)
at least one capture probe sequence which specifically hybridizes
to said initial nucleic acid template wherein said capture probe
sequence is bound to a solid phase support; (c) providing
conditions of temperature and buffer to allow hybridization of the
probe sequences to said first nucleic acid template to form a solid
phase-bound complex; and then (d) detecting said solid phase-bound
complex using said ECL species.
32. The cycling DNA/RNA amplification assay of claim 31 wherein the
solid phase is a bead.
33. The cycling DNA/RNA amplification assay of claim 32 wherein the
bead is a magnetic bead.
Description
FIELD OF THE INVENTION
[0001] This invention relates to an enhanced process for amplifying
a specific nucleic acid sequence and its rapid detection and
quantitation using electrochemiluminescent labeled binding
species.
BACKGROUND OF THE INVENTION
[0002] Detection and quantitation of a specific nucleic acid
sequence present in a sample is a known diagnostic method with
great specificity. This specificity is based on the knowledge of
the specific sequence and the generation of probes which are
specific and complementary.
[0003] Methods for detection and quantitation of specific nucleic
acid sequences are illustrated by the following patents: (1) U.S.
Pat. No. 5,130,238 is directed toward an improved process for
amplifying a specific nucleic acid sequence. The improvement of the
amplification process involves the addition of dimethylsulfoxide
(DMSO) alone or in combination with bovine serum albumin (BSA); (2)
U.S. Pat. No. 4,683,195 is directed toward a process for amplifying
and detecting any target nucleic acid sequence contained in a
nucleic acid or mixture thereof; (3) U.S. Pat. No. 4,683,202 is
directed toward a process for amplifying any desired specific
nucleic acid sequence contained in a nucleic acid or mixture
thereof; (4) U.S. Pat. No. 4,486,539 is directed toward a method
for identifying nucleic acids by a one-step sandwich hybridization
test; and (5) WO 91/02814 is directed toward a process for
amplifying a specific nucleic acid sequence.
[0004] The use of highly specific nucleic acid probes is in some
cases the only method which can yield accurate results when the
protein is absent, such as is the case for analysis of genetic
defects such as cystic fibrosis. It is also valuable in the case of
a latent viral infection such as HIV1 or herpes where little or no
protein is produced by the infection. The great specificity of the
nucleic acid probes also makes them valuable in the diagnosis of
infectious agents which are difficult,to identify with antibodies
due to cross reaction and lack of cross reaction between isotypes
of these agents. In addition, the analysis of DNA sequences allows
the rapid and effective selection of a probe which will be specific
this is not possible with antibody-based reagents.
[0005] The greatest difficulty and limitation with applying
existing nucleic acid probe technology is the complexity and slow
methodology for the detection of specific sequences. With the
amplification of nucleic acids, the limitations of nucleic acid
probe methods associated with low levels of target molecules have
been solved in U.S. Pat. No. 5,130,238; 4,683,195; 4,683,202,
identified above.
[0006] The use of natural amplification has been used in certain
cases to remove this problem. This is exemplified by the use of
ribosomal RNA with up to 100,000 copies per cell as taught in U.S.
Pat. No. 4,851,330. This method, in order to be effective without
the need to culture the infectious agent, makes use of a rapid
chemiluminescence detection system which requires a number of
incubations and washes. This method, however, is also limited only
to selected cellular pathogens and is of no use in the case of
viral or genetic defects.
[0007] Notwithstanding the amplification processes disclosed in the
prior art, the present invention requires no pretreatment of the
sample such as binding to solid phases or membranes, denaturing of
the sample, purification of the sample by extraction of oil,
protein or by gel electrophoresis and the probes can be added
directly to the amplification mixture hybridized and analyzed. This
is surprising in the light of the potential that the probe
sequences would be modified or cause sample destruction mediated by
the enzymes and conditions in the amplification mixture. For
example, the presence of RNAase H, which degrades hybrids between
DNA and RNA (the basis of the probe hybridization), degrades the
specific hybrids in any attempt to probe the impure amplificate
mix. Also, the presence of reverse transcriptase would use the
probes in the hybridization mixture as primers and remove them from
the specific hybridization complex formation reaction. In addition
to these potential problems, the buffer contains many compounds
which might cause problems both for hybridization and also for the
generation of ECL by the specific chemistries involved, for
example, high levels of salts MgCl.sub.2, KCl, nucleotides,
dithiothreitol, spermidine, dimethyl sulphoxide, glycerol and
proteins. This list contains many substances which interfere with
other nucleic acid probe methods and would need to be removed to
allow these methods to work, thus the present invention was
surprisingly capable of carrying out a nucleic acid probe assay
with such a simple protocol.
SUMMARY OF THE INVENTION
[0008] This invention relates to a diagnostics process for
detection of specific nucleic acid sequences generated by
amplification which is rapid, has fewer steps, and requires less
user time than conventional diagnostic methods. The amplification
takes place at a relatively constant temperature generating a
plurality of single stranded RNA species. The hybridization to
probes follows this amplification and is carried out at a
relatively constant temperature followed by analysis for the bound
or complexed electrochemiluminescent species. Hence, the diagnostic
process is both rapid and sensitive unlike other systems which
require multiple cycles of incubations and multiple washes followed
by multiple incubations for detection of nucleic acid.
[0009] According to one aspect of the invention, a process for
amplifying a specific nucleic acid sequence is used followed by the
addition of two oligonucleotide probes--one with a binding species,
the capture probe (i.e., biotin or antigen) and one with an
electrochemiluminescent label.
[0010] The process involves the synthesis of single stranded RNA,
single stranded DNA, and double stranded DNA. The single stranded
antisense RNA is a first template for a second primer. The single
stranded DNA is a second template for a first primer. The double
stranded DNA is a third template for the synthesis of a plurality
of copies of the first template. A sequence of the first or the
second primer is sufficiently complementary to a sequence of the
specific nucleic acid sequence and a sequence of the first or the
second primer is sufficiently homologous to a sequence of the
specific nucleic acid sequence. A second primer binds to the 3' end
of the first RNA template and generates the second DNA template. A
3' end of the first primer hybridizes to the 3' end of the second
DNA template. The second template is removed from the first
template and is used to generate a complementary DNA strand. The
resulting duplex DNA serves as a third template for synthesizing a
plurality of first templates which in turn repeats the above
described cycle. This process of amplification is described in
detail by the following publications: Kievits et al., 35 J. Vir
Method 273-286 (1991); Bruisten et al., 9 AIDS Res. and Human
Retroviruses 259-265 (1993); EP 0 329 822-A2, WO 91/02818, WO
91/02814 (an essentially similar method is also described in WO
88/10315). On completion of the incubation, as described above,
samples from the said amplification are taken and a mixture of
complementary probes and beads coated in a binding species
complementary to one of the probes in hybridization buffer is added
followed by incubation at a predetermined temperature to allow the
hybridization of the probes to the said first template and the
binding of one of the said probes to the beads via a binding
interaction, i.e., antibody-antigen or biotin-streptavidin. On
completion of the said incubation, a complex is formed which
comprises the said first template generated from the amplification
reaction as above hybridized to two said differing probe, one
containing an electrochemiluminescent label and the other a binding
species. This complex is further complexed to said coated bead
which forms its complementary binding pair with the probe binding
species. The resulting complex contains the amplified first
template, the probe with its electrochemiluminescent label, the
capture probe with its binding species, and the bead with its
coating of binding species (see FIG. 1) all complexed via the
specific interactions of each component. It will also be understood
that the DNA sequences generated during the NASBA cycling will be
targets for hybridization and detection.
[0011] In another embodiment of the claimed invention, the
interaction between the probe and the bead can be made prior to the
hybridization step by formation of a covalent bond to said bead or
via a binding species (where said binding species is coated either
by covalent or non-covalent methods) interaction or indirectly via
a covalent bond to a species which can non-covalently coat said
bead. An example of this indirect covalent coating could take the
form of the probe being coupled to a carrier such as protein
followed by coating via non-covalent methods to the bead
surface.
[0012] In another embodiment, samples of the amplification would be
mixed with a probe labeled with an ECL species and a bead which is
coated with a binding species specific for the hybrid formed
between said probe to the said amplified first template. For
example, such a hybrid of DNA and RNA may be capture using a
specific antibody. An example would be the use of a anti DNA:RNA
antibody (Miles Inc. U.S. Pat. No. 4,833,084). Other antibodies
which recognize such mixed hybrid molecules would also prove
valuable such as those antibodies raised to hybrids of RNA or DNA
to phosphonate, phosphorothioate, alkyl, or aryl phosphonate based
nucleic acid sequences (Murakami et al., 24 Biochemistry 4041-4046
(1985), also available from Glenn Research, Sterling, Va.). These
methods are based on the formation of a new molecular species on
hybridization which is a binding species for an antibody and
raising antibodies or other binding species to these molecular
species.
[0013] In yet another embodiment, the assay method may also be used
to quantitate the amount of nucleic acid in the starting material.
This is achieved by the addition to the samples of specific `spike`
samples which are amplified during the reaction. The determination
of the spike signal and sample signal allows a ratio to be
calculated, which based on the original spike level, allows the
determination of the sample level. This is most accurately
determined by the use of multiple spikes which range in amount over
the range of the potential sample amounts and allow the
construction of a standard curve to give a reading at a ratio of
1:1 between target and sample. Methods based on this are well
understood--Van Gemen et al., 43 J. Vir. Methods 177-187 (1993);
Siebert and Larrick, 14 Biotechniques 244-249 (1993); Piatak et
al., 14 Biotechniques 70-80 (1993). This method for quantitation is
improved by the use of a rapid and accurate method for detection
and quantitation provided by the use of the ECL labels and methods
with the NASBA amplification.
[0014] The invention further provides a process for the detection
of a specific nucleic acid sequence, comprising the steps of:
[0015] (a) Providing a single reaction medium containing reagents
comprising
[0016] (i) a first oligonucleotide primer,
[0017] (ii) a second oligonucleotide primer comprising an antisense
sequence of a promoter,
[0018] (iii) a DNA-directed RNA polymerase that recognizes said
promoter,
[0019] (iv) an RNA-directed DNA polymerase,
[0020] (v) a DNA-directed DNA polymerase,
[0021] (vi) a ribonuclease that hydrolyses RNA of an RNA-DNA hybrid
without hydrolyzing single or double-stranded RNA or DNA,
[0022] (b) Providing in said reaction medium RNA comprising an RNA
first-template which comprises said specific nucleic acid sequence
or a sequence complementary to said specific nucleic acid sequence,
under conditions such that a cycle ensues wherein
[0023] (i) said first oligonucleotide primer hybridizes to said RNA
first template,
[0024] (ii) said RNA-directed DNA polymerase uses said RNA first
template to synthesize a DNA second template by extension of said
first oligonucleotide primer and thereby forms an RNA-DNA hybrid
intermediate,
[0025] (iii) said ribonuclease hydrolyses RNA which comprises said
RNA-DNA hybrid intermediate,
[0026] (iv) said second oligonucleotide primer hybridizes to said
DNA second template,
[0027] (v) said DNA-directed DNA polymerase uses said second
oligonucleotide primer as template to synthesize said promoter by
extension of said DNA second template; and
[0028] (vi) said DNA-directed RNA polymerase recognizes said
promoter and transcribes said DNA second template, thereby
providing copies of said RNA first template; and thereafter
[0029] (c) Maintaining said conditions for a time sufficient to
achieve a desired amplification of said specific nucleic acid
sequence, followed by the addition of;
[0030] (i) at least one probe sequence complementary to said RNA
first template labeled with an electrochemiluminescent species,
[0031] (ii) at least one second capture probe sequence
complementary to said RNA fist template labeled with a binding
species,
[0032] (iii) a bead coated with a complementary binding species to
said second probe sequence; and thereafter
[0033] (d) Providing conditions of temperature and buffer to allow
the hybridization of the probes to the said RNA first template and
the binding of said binding species on said second capture probe
with the complementary binding species on said bead to from a bead
bound complex; and then
[0034] (e) Detecting said bead bound complex using said
electrochemiluminescent species.
[0035] The invention further provides a process for the detection
of amplified products comprising the steps of:
[0036] (a) amplifying a sample nucleic acid under conditions to
generate amplified product;
[0037] (b) mixing said amplified product with two binding species
comprising
[0038] (i) an ECL labeled binding species which interacts with a
trimolecular complex with the amplified nucleic acid and bivalent
binding species;
[0039] (ii) a bivalent binding species which interacts with a
trimolecular complex with the amplified nucleic acid and ECL
labeled binding species;
[0040] to form a binding complex reaction:
[0041] (c) incubating said binding complex reaction under
conditions which allow the formation of a trimolecular complex of
amplified product, ECL labeled binding species, and bivalent
binding species;
[0042] (d) capturing said trimolecular complex via the bivalent
binding species' remaining binding site to a solid phase: and
[0043] (e) quantitating ECL label captured on the solid phase.
DEFINITIONS
[0044] In order to more clearly understand the invention, certain
terms are defined as follows:
[0045] "Amplified product" means nucleic acid sequences generated
by copying sample nucleic acid sequences multiple times using an
enzymatic reaction.
[0046] "Annealing" refers to hybridization between complementary
single chain nucleic acids when the temperature of a solution
comprising the single chain nucleic acids is lowered below the
melting or denaturing temperature.
[0047] "Binding species" means any species known to bind with
another molecular species and are normally defined as a pair of
species but may be formed from higher complexes, i.e., 3 or 4 which
bind, i.e., antibody:antigen or oligonucleotide:antibody or
oligonucleotide:antigen or DNA:DNA or DNA:RNA or RNA:RNA or
DNA:RNA:DNA or Biotin-DNA:DNA-ECL labeled or receptor:ligand or DNA
binding protein such as restriction enzymes, lac repressor.
[0048] The "complement" to a first nucleotide sequence is well
known to be a second sequence comprising those bases which will
pair by Watson-Crick hybridization with the first sequence. Thus,
the complement to the deoxyribonucleic acid (DNA) sequence 5'ATGC
3' is well known to be 5'-GCAT 3'. For duplex, or double stranded
DNA, each of the two strands are described as complementary to the
other or as a complementary pair. The terms complement and
anticomplement may also be used. With reference to the
identification of the strand of duplex DNA from which transcription
to RNA proceeds, the transcription strand is generally described as
plus and its complement as minus ("+" and "-"), or the
transcription strand may be described as the sense strand, and its
complement as antisense. Two strands each hybridized to the other
having all base pairs complementary, are 100% complementary to each
other. Two strands, each hybridized to the other, have 5% of bases
non-complementary, are 95% complementary (or the two strands have
95% complementarity). In addition, it will also be understood that
nucleic acid sequences can form triple helix structures based on a
specific interaction of three strands which would be considered to
complementary in a specific way to each other within this triple
stranded hybrid.
[0049] The terms "detection" and quantitation" are referred to as
"measurement", it being understood that quantitation may require
preparation of reference compositions and calibrations.
[0050] "Electrochemiluminescent (ECL) species" means any compound
known to electrochemiluminescense;
[0051] "Electrochemiluminescent (ECL) labels" are those which
become luminescent species when acted on electrochemically.
Electrochemiluminescent techniques are an improvement on
chemiluminescent techniques. They provide a sensitive and precise
measurement of the presence and concentration of an analyte of
interest. In such techniques, the sample is exposed to a
voltammetric working electrode in order to trigger luminescence.
The light produced by the label is measured and indicates the
presence or quantity of the analyte. Such ECL techniques are
described in PCT published application by Bard et al. PCT Appl. No.
US 85/02153, entitled "Luminescent Metal Chelate Labels and Means
for Detection" and Massey et al. PCT Appl. No. US 87/00987,
entitled "Electrochemiluminescent Assays"; PCT Appl. No. US
88/03947, Publication No. WO 89/04302 "Electrochemiluminescent
Moieties and Methods for Their Use"; Hall et al., "Method and
Apparatus for Conducting Electrochemiluminescent Measurements",
U.S. appl. Ser. No. 744,890 filed Aug. 14, 1991; and Zoski and
Woodward. "Apparatus for Conducting Measurements of
Electrochemiluminescent Phenomena", PCT US 89.04854 corresponding
to pending EPO Appl. No. 89/912913.4, Publication No. 0441880.
[0052] Examples of ECL tags are tag NHS (N-hydroxy-succinimide) and
tag phosphoramidite. The tag-NHS ester is useful for labeling
substances containing free amino groups capable of reaction with
the NHS ester to form an amide bond. (See, for example, WO
86/02734.) The tag phosphoramidite (Gudibande et al. U.S. appl.
Ser. No. 805,537 f entitled "Improved Electrochemiluminescent Label
for DNA Probe Assay" which is hereby incorporated herein by
reference) is useful for labeling substances containing free amino,
sulphydryl, or hydroxyl groups forming phosphor-linkages especially
phosphodiester linkages.
[0053] An "ECL assay buffer" is a general diluent which contains
tripropylamine that is necessary for the electrochemical reaction
on the electrode in an ECL analyzer.
[0054] An "ECL diluent" is a diluent reagent used in diluting
solutions containing labile biomolecules for storage purposes.
[0055] "ECL apparatus" is any apparatus for performing
electrochemiluminescence based assays. Such ECL apparatus are
described in PCT Appl. No. US 85/02153 by Bard et al. entitled
"Luminescent Metal Chelate Labels and Means for Detection" and in
PCT Appl. No. US 87/00987 by Massey et al. entitled
"Electrochemiluminescent Assays"; PCT Appl. No. US 88/03947,
Publication No. WO 89/04302 "Electrochemiluminescent Moieties and
Methods for Their Use"; Hall et al. "Method and Apparatus for
Conducting Electrochemiluminescent Measurements", U.S. appl. Ser.
No. 744,890; and Zoski, G., and S. Woodward. "Apparatus for
Conducting Measurements of Electrochemiluminescent Phenomena", PCT
US 89.04854 corresponding to pending EPO Appl. No. 89/912913.4,
Publication No. 0441880.
[0056] "Homology" between polynucleotide sequences refers to the
degree of sequence similarity between the respective sequences. Two
strands which are identical in sequence have 100% sequence
homology. Two strands which differ by 5% of sequences have 95%
sequence homology. The greater the degree of homology between two
strands A and B, the greater the complementarity between A and the
complement of B.
[0057] "Hybridization" describes the formation of double stranded
or duplex nucleic acid from complementary single stranded nucleic
acids. Hybridization may take place between sufficiently
complementary single stranded DNA and/or RNA to form: DNA:DNA,
DNA:RNA, or RNA:RNA or DNA:RNA:DNA or Biotin-DNA:RNA:DNA-ECL label.
This may also include sequences of nucleotides which are linked
using modified natural chemistries such as phosphonate,
phosphorothioate, alkyl or aryl phosphonate based nucleic acid
sequences (Murakami et al., Biochemistry 24 (1985):4041-4046, also
Glenn Research, Sterling, Va.).
[0058] The term "label" or "labeled" when applied to a nucleic acid
means that the nucleic acid in question is linked to a moiety which
is detectable by its properties which may include: ECL and
luminescence, catalysis of an identifying chemical substrate,
radioactivity, or specific binding properties. Thus, the term
"label" includes ligand moieties unless specifically stated
otherwise.
[0059] It is also well know to the art that the term "nucleic acid"
refers to a polynucleotide of any length, including DNA or RNA
chromosomes or fragments thereof with or without modified bases as
described herein.
[0060] A "nucleotide" is at least one of the following bases:
adenine, cytosine, guanine, thymine or uracil, plus a sugar
(deoxyribose for DNA, ribose for RNA), plus a phosphate. In order
to provide monomers for the DNA polymerization reaction, typically
all four of tie deoxynucleotide triphosphates are required. A
nucleotide, as defined herein, may also include modified bases such
as 5-methyl-dCTP and 7-deaza-dGTP used to improve the action of
polymerase on templates. The term nucleotide as used herein also
includes bases linked to biotin and digoxigenin (Digoxigenin-11-UTP
from Boehringer Mannheim, Indianapolis, Ind.) and biotin-21-UTP and
amino-7-dUTP (Clontech, Palo Alto, Calif.) and ECL labeled
nucleotide (see FIGS. 6 and 7) which may be incorporated directly
into a primer or into a primer extension product during
amplification, to provide for selective binding of amplified
sequences.
[0061] An "oligonucleotide" is a sequence formed of at least two
nucleotides.
[0062] A "polynucleotide" is a long oligonucleotide and may be
either RNA and DNA.
[0063] While the term oligonucleotide is generally used in the art
to denote smaller nucleic acid chains, and "polynucleotide" is
generally used in the art to denote larger nucleic acid chains
including DNA or RNA chromosomes or fragments thereof, the use of
one or the other term herein is not a limitation or description of
size unless expressly stated to be.
[0064] A "primer" is a relatively short segment of oligonucleotide
which is complementary to a portion of the sequence of interest
(the sequence of interest can be a subfragment within a larger
nucleic acid sequence). A primer represents a 5' terminus of the
resulting extension product. A primer which is complementary at its
3' terminus to the sequence of interest on the template strand
enables this 3' terminus to be acted on by a polymerase on
hybridization to the template. It is well known that modifications
to the 3' end will affect the ability of an oligonucleotide to
function as primer. An example is the incorporation of a
dideoxynucleotide as in DNA sequencing thus preventing the action
of DNA polymerases. It is well known that the length of the primer
will depend upon the particular application, but that 20-30 base
pairs is a common size. As is well known, a primer need not be a
perfect complement for successful hybridization to take place. If
the primer is an imperfect complement, an extension product will
result which incorporates the primer sequence, and during a later
cycle, the complement to the primer sequence will be incorporated
into the template sequence. Thus, it is well known that a properly
selected primer having a sequence altered from that of the
complement of the template may be used to provide in vitro
mutagenesis. The primer may incorporate any art known nucleic acid
bases, including any art known modified or labeled bases as defined
above so that the primer extension product will incorporate these
features to permit separation and detection of the primer extension
product. A tag or marker advantageously linked to a primer may
include an ECL fluorescent or luminescent tag, an isotopic (e.g.,
radioisotope or magnetic resonance) label, a dye marker, an enzyme
marker, an antigenic determinant detectable by an antibody, or a
binding moiety such as biotin enabling yet another indicator moiety
such as a streptavidin coated bead to specifically attach to the
primer or any nucleic acid sequence incorporating that primer. When
the labeled or tagged amplification product is formed, that
amplification product may be detected by the characteristic
properties of the tag or label.
[0065] The term "primer extension product" describes the primer
sequence together with the complement to the template produced
during extension of the primer.
[0066] A "probe" is a single or double stranded nucleic acid which
has a sequence complementary to a target nucleic acid sequence of
interest and which has some additional feature enabling the
detection of the probe--target duplex. One skilled in the art will
understand that if the probe and/or the target is double stranded,
the double stranded nucleic acid must undergo strand separation
before hybridization can take place. It is possible, if a triple
strand formation is used, then the double stranded target will not
need to be rendered single stranded prior to hybridization.
[0067] A probe is rendered detectable by an attached tag or marker.
A tag or marker linked to a probe may include a fluorescent, ECL or
luminescent tag, an isotopic (e.g., radioisotope or magnetic
resonance) label, a dye marker, an enzyme marker, an antigenic
determinant detectable by an antibody, or a binding moiety such as
biotin enabling yet another indicator moiety such as a streptavidin
coated bead to specifically attach to the probe. When the labeled
or tagged probe--target duplex is formed, that duplex may be
detected by the characteristic properties of the tag or label.
Alternatively, as described for the ECL assays in the following
examples, the probe with its binding moiety allows the capture of
labeled target, via hybridization and duplex formation, allowing
detection by a label or other art known means.
[0068] "Sample" means a mixture containing nucleic acids.
[0069] A "sequence" (e.g., sequence, genetic sequence,
polynucleotide sequence, nucleic acid sequence) refers to the
actual enumerated bases (e.g., ribose or deoxyribose) present in a
polynucleotide strand (e.g., reading from the 5' and 3' direction)
and the relative position of these bases with respect to each
other.
[0070] The term "single primer" means a single, unpaired, specific
or selected primer designed to selectively hybridize with a target
nucleic acid sequence of interest.
[0071] "Specific nucleic acid sequence" means a single stranded or
double stranded nucleic acid which one could use as a probe or
amplify.
[0072] A "specific or selected" nucleotide sequence refers to a
particular sequence distinguishable (i.e., by hybridization
analysis) from other difference sequences (e.g., the specific
nucleotide sequence 5'-ATGCCC-3' is not the same sequence as
5'-AAGCCC-3').
[0073] A specific or selected primer is one which is designed to
hybridize with a particular template sequence to achieve the
desired result by making the primer complementary or approximately
complementary to the 3' terminal of the template sequence. The
specific primer will selectively achieve the desired result even if
the target template sequence is present in a mixture of many other
nucleic acid sequences.
[0074] The specific or selected primer is distinguished from a
"universal primer" which will indiscriminately anneal to any DNA
sequence to which a complementary (to the primer) adaptor terminal
sequence has been attached. With a universal primer, care must be
taken to isolate the nucleic acid of interest, or otherwise direct
the ligation procedure only to the desired DNA sequence of
interest, to avoid randomly attaching the adaptor to all nucleic
acid sequences present.
[0075] A "strand" is a single nucleic acid sequence. Thus, a duplex
or double stranded chromosome, chromosome fragment or other nucleic
acid sequence may be separated into complementary single
strands.
[0076] "Strand separation" refers to the conversion of a double
stranded or duplex nucleic acid to two complementary single
stranded polynucleotide. The separation process may employ well
known techniques including: enzyme mediated separation (e.g., by
the enzyme helicase, physical-chemical separation (pH, ionic
concentration and the like), and thermal separation also known as
thermal denaturing. Thermal denaturing (also referred to as
"melting") is the separation of a double stranded polynucleotide
(fully or partially duplex) into at least two single strands of
polynucleotide by raising the temperature of the solution holding
that polynucleotide.
[0077] "Sufficiently complementary" means that two nucleic acids
are capable of specific interaction which allows either a primer
dependent and template directed synthesis of DNA or a probe to bind
to nucleic acid sequence.
[0078] A "template" is any sequences of nucleic acid upon which a
complementary copy is synthesized. This may, in general, be DNA to
DNA replication, DNA to RNA transcription, or RNA to DNA reverse
transcription. A DNA template provides the sequence information for
extension of the complementary primers by the DNA polymerase
reaction. An RNA template may provide the sequence information for
extension of a complementary DNA primer by an analogous reaction
catalyzed by the enzyme reverse trancriptase As is well known to
the art, the template may be found in a single or double stranded
form. If the template enters the amplification process in the
double stranded form, the template strand will not hybridize to its
complementary primer until it is denatured by the first thermal
denaturing cycle. If the template enters the amplification process
already in the single stranded form, the primer will hybridize
(described as annealing when thermal cycling is utilized) with its
complementary template before the first thermal denaturing
step.
BRIEF DESCRIPTION OF THE DRAWINGS
[0079] FIG. 1 is a general illustration of the nucleic acid
hybridization process.
[0080] FIG. 2 is a general illustration of an alternative nucleic
acid hybridization process.
[0081] FIG. 3 is a general illustration of an alternative nucleic
acid hybridization process.
[0082] FIG. 4 is a general illustration of an alternative nucleic
acid hybridization process.
[0083] FIG. 5 is a general illustration of an alternative nucleic
acid hybridization process.
[0084] FIG. 6 is a general illustration of an alternative nucleic
acid hybridization process.
[0085] FIG. 7 is an ECL labeled nucleotide.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0086] This invention relates to a process for amplifying a
specific nucleic acid sequence and its rapid detection and
quantitation. The amplification involves an alternate synthesis for
DNA and RNA. In this process, single stranded antisense (-) RNA is
convened to single stranded DNA which in turn is converted to dsDNA
and becomes a functional template for the synthesis of a plurality
of copies of the original single stranded RNA. A first and a second
primer are used in the amplification process. A sequence of the
first primer or the second primer is sufficiently complementary to
a sequence of the specific nucleic acid sequence and a sequence of
the first or the second primer is sufficiently homologous to a
sequence of the specific nucleic acid sequence. If the specific
nucleic acid sequence is double stranded, then the primers can both
be complementary and homologous. The detection, of the specific
sequences which are amplified, is achieved by the use of probe
sequences which form hybrids with the amplification products either
DNA or RNA. These probe sequences are generally sufficiently
complementary to a sequence of the specific nucleic acid sequence
which results in the formation of a specific hybrid. These hybrids
are then detected by the use of an ECL detection instrument which
allows the ECL label to generate light in a controlled fashion at
the surface of an electrode allowing both its detection and
quantitation (FIGS. 1, 2, 3, 4, 5, 6).
[0087] The assays for these amplified products is possible using a
number of formats. The preferred method makes use of two probe
molecules after the amplification process one is labeled with a
binding species (i.e., biotin, digoxin, fluorescein), the other
probe is labeled with an ECL label (i.e., Ru chelate, Os chelate,
Re, Rh). These probes are added to the sample from the
amplification reaction which generates a plurality of RNA copies of
the original single stranded RNA or DNA and are complementary or
sufficiently complementary to the plurality of RNA copies of the
original single stranded RNA or DNA. This mixture of probes and
amplified nucleic acid are allowed to hybridize by the control of
the temperature and buffer components which are selected for the
specific probe and plurality of RNA copies of the original single
stranded RNA or DNA using methods known to those skilled in the
art. The formation of these hybrids allows both probes to be linked
in the same hybrid complex. These are then captured from the
incubation by the addition of the magnetic beads which are coated
with a binding species which binds to the binding species on the
capture probe (FIG. 1). For example, with biotin on the probe
streptavidin or avidin might be coated on to the magnetic beads or
with digoxigenin on the probe an antibody specific for digoxigenin
would be coated on the bead. This mixture of the hybrid complex and
the bead would then be incubated under conditions known to promote
the binding interaction of the binding species. These conditions
for binding of binding species are well known to those skilled in
the art; for example, biotin to streptavidin or avidin and antigen
antibody interactions.
[0088] Following the capture of the hybrid complex on the magnetic
beads, the sample may be washed by capture of the beads by a magnet
used in close proximity to the sample tube, or more ideally, the
sample would be sampled directly into an ECL instrument which would
capture the magnetic beads and its bound complex followed by the
electrochemical reaction of the surface bound ECL label. The light
generated from this electrochemical reaction is measured and used
to determine the amount of ECL label which has formed a complex
with the bead. This determination of the relative amounts of ECL
label bound to the beads under certain conditions allows a
determination of the amount of the plurality of RNA copies of the
original single stranded RNA or DNA generated in the amplification.
Using this information regarding the level of amplification of the
specific DNA or RNA allows the diagnosis of the sample DNA or RNA
for the presence of a specific DNA or RNA sequences which determine
the presence of a gene and or organism in a sample.
[0089] Alternative to the above method, we may make use of two
oligonucleotides which are labeled with binding species which allow
the formation of a hybrid complex as described above but without a
ECL label attached directly to the probe oligonucleotide. In this
alternative format, the ECL label is linked to the hybrid complex
either before hybridization to for said complex or after by the
formation of a binding pair complex. Examples of such a system
would be the use of a probe labeled with digoxin (binding species
or antigen) and a probe labeled with biotin (binding species) these
two probes would under well known conditions from a hybrid complex
with the plurality of RNA copies of the original single stranded
RNA or DNA generated in the amplification. After the formation of
this hybrid complex, the addition of ECL labeled anti-digoxin
antibody (complementary binding species or specific antibody) and
streptavidin (complementary binding species) coated magnetic beads
under conditions known to allow the formation of binding
interactions (pH 4-9, 1 mM to 2M salts, 0 to 10% detergents) allows
the linkage of the ECL label to the hybrid complex by the binding
of antigen to antibody. Also the complex is captured onto the
surface of the bead via the binding interaction of streptavidin to
biotin. The resulting extended complex of probes hybridized to the
plurality of RNA copies of the original single stranded RNA or DNA
generated in the amplification is then analyzed by the use of an
ECL analyzer.
[0090] Alternatively, the formation of a specific complex labeled
with an ECL species could be achieved by the use of a probe
sequence labeled with an ECL species which when hybridized to the
plurality of RNA copies of the original single stranded RNA or DNA
generated in the amplification forms a binding species. This hybrid
complex, or said binding species, is then captured by using
complementary binding species coated magnetic beads followed by
analysis using an ECL analyzer. For example, antibodies to DNA:RNA
hybrids (FIG. 2).
[0091] Alternatively, the amplification could be performed with a
binding species such that said binding species are incorporated
into the plurality of DNA and/or RNA molecules generated during the
amplification process. Methods for this are well known to those
skilled in the art. Examples of this could be the use of a primer
(see primer 2, U.S. Pat. No. 5,130,238) modified to include a
binding species said primer is then incorporated into the DNA+
strand by the action of RT on the RNA- species and primer 2. The
DNA+ product would be a DNA+ species covalently linked to a binding
species molecule. This DNA-binding species molecule could then be
hybridized to an ECL labeled probe and captured onto beads via a
complementary binding species for ECL analysis (FIG. 4). In the
same format, the DNA-binding species molecule could be captured
onto a bead by hybridization, followed by binding to the
DNA-binding species with a complementary binding species labeled
with an ECL label. An example of the binding species could be
biotin and its complementary binding species streptavidin. It will
be understood that the RNA- and DNA+ (FIG. 1) could be labeled with
a binding species by inclusion of a nucleotide as described earlier
which is modified to incorporate a binding species for example
biotin and digoxigenin (Digoxigenin-11-UTP from Boehringer
Mannheim, Indianapolis, Ind.), and biotin-21-UTP and amino-7-dUTP
(Clontech, Palo Alto, Calif.) and ECL labeled nucleotides (FIG. 7)
into the amplification reaction. The resulting DNA+ and/or RNA-
binding species molecules can then be used in the assay formats as
described above (FIG. 3).
[0092] Beads which are used in this assay are typically those from
Dynal M450 and M280 coated with streptavidin but other beads can be
used so long as the beads can be para-magnetic and are in the size
range from 0.5 .mu.m to 10 .mu.m. It will be understood to one of
ordinary skill in the art that the capture oligonucleotide could be
coupled to these beads obviating the need for a binding species
(FIG. 5).
[0093] Having now generally described the invention, the following
examples are included for purposes of illustration and are not
intended to limit the scope of the invention.
EXAMPLES
Example 1
Oligonucleotide Synthesis and Labeling
[0094] The oligonucleotides were made on an Applied Biosystems (San
Jose, Calif.) automated oligonucleotide synthesizer using the
.beta.-cyanoethyl phosphoramidite chemistry (Beaucage and Caruthers
22 Tetrahedron Lett. 1859-62 (1982)). Oligonucleotide amino
modifications to the 5' end occurred at the last coupling step.
Clontech (San Diego, Calif.) supplied the amino modifiers, See U.S.
Pat. No. 5,141,813. The resulting 5' modified oligonucleotides all
contain a six carbon spacer arm to the amino group, designated (C6,
NH2).
[0095] All the synthetic oligonucleotides were purified to remove
any contaminating amino groups by gel filtration on a BIOGEL.TM. P6
(Bio-Rad Labs, Richmond, Calif.) column. Biotin was introduced via
the 5'-amino group of the oligonucleotides using NHS-biotin
(Clontech, San Diego, Calif.). Tag-NHS ester label (an NHS ester of
the Ru tris bipyridyl complex) was introduced via the amino group
of the modified oligonucleotides as follows. The oligonucleotides
(0.1 .mu.mole) in 100 .mu.l of PBS (pH 7.4) were reacted with 0.5
.mu.mole of tag-NHS ester label dissolved in DMSO overnight at room
temperature in the dark. Oligonucleotides were recovered from these
labeling reactions by ethanol precipitation. The modifications to
the oligonucleotide and the labeling are indicated as follows.
Biotin:linker:`oligonucleotide` to indicate an oligonucleotide
modified with a 5' amino group and then reacted with a biotin NHS
reagent to yield a 5' biotinylated oligonucleotide. Also
R:linker:`oligonucleotide` to indicate an oligonucleotide modified
with a 5' amino group and then reacted with the ruthenium tris
bypyidine NHS reagent to yield a 5' ruthenium chelate
oligonucleotide. Also `oligonucleotide`:linker:R to indicate an
oligonucleotide modified with a 3' amino group and then reacted
with the ruthenium tris bypyidine NHS reagent to yield a 3'
ruthenium chelate oligonucleotide.
[0096] Probes for the Pol2 assay were as follows:
1 OT1, TTAAATTTTCCCATTAGCCCTATTGAGACT HIV1 Genbank; HIV BH102
#1900-1929 and OT2, AGAAATCTGTTGACTCAGATTGGT- TGCACT HIV1 Genbank;
HIV BH102 #1869-1898.
[0097] These were made with the following modifications:
2 5OT1, Biotin:linker: TTAAATTTTCCCATTAGCCCTATTGAGACT 35OT1,
R:linker: TTAAATTTTCCCATTAGCCCTATTGAGACT:li- nker:R 5OT2;
Biotin:linker: AGAAATCTGTTGACTCAGATTGGTTGCACT 35OT2, R:linker:
AGAAATCTGTTGACTCAGATTGGTTGCACT:linker:R.
[0098] Amplification was as described in J. Vir. Methods 35
(1991):273.
[0099] Probes for the Gag3 assay were as follows:
[0100] Sequences for analysis of the HIV1 gag gene, Genbank
HIVBH102 #1139-1167
3 AKZO1 TA GAA GAA ATG ATG ACA GCA TGT GAG GGA (29 bases) HIVBH102
#1208-1236 AKZO2 CA ATG AGC CAA GTA ACA AAT ACA GCT ACC (29
bases).
[0101] made as:
[0102] AKZO1, Biotin:linker:TA GAA GAA ATG ATG ACA GCA TGT CAG GGA
(29 bases) and AKZO2, R:linker:CA ATG AGC CAA GTA ACA AAT ACA GCT
ACC:linker:R (29 bases) for the gag3 assays below. The
amplifications were performed or described in Van Gemen et al. 43
J. Vir. Methods 177-187 (1993).
[0103] Further probes for quantitative gag assays were as
follows:
[0104] Probe A: TGT TAA AAG AGA CCA TCA ATG AGG A (25 bases)
genbank ref. HIVBH102 #710-734.
[0105] Probe B: GAA TGG GAT AGA GTG CAT CCA GTG CAT G (29 bases)
genbank ref. HIVBH102 #742-769.
[0106] Probe C: GAC AGT GTA GAT AGA TGA CAG TCG (24 bases) control
sequence for quantitation as described in Van Gemen et al. J. Vir.
Methods (1993).
[0107] The use of these probes A, B, and C would be as follows:
[0108] Using A as capture and B, C as detection or B, C as capture
and A as detection.
[0109] To generate the needed probes, the following sequences were
made incorporating biotin (binding species) and the ruthenium tri
bypyridine complex (ECL label).
[0110] Probe A made as:
[0111] AKZO-A2, R:linker:TGT TAA AAG AGA CCA TCA ATG AGG A:linker:R
and as AKZO-A1, Biotin:linker:TGT TAA AAG AGA CCA TCA ATG AGG.
[0112] Probe B made as:
[0113] AKZO-B2, R:linker:GAA TGG GAT AGA GTG CAT CCA GTG CAT
G:linker:R and as AKZO-B1, Biotin:linker:GAA TGG GAT AGA GTG CAT
CCA GTG CAT G.
[0114] Probe C made as:
[0115] AKZO-C2, R:linker:GAC AGT GTA GAT AGA TGA CAG TCG:linker:R
and as AKZO-C1, Biotin:linker:GAC AGT GTA GAT AGA TGA CAG TCG.
[0116] Where R is the ruthenium trisbypyridine N-hydroxy
succinamide ester reacted to an amino group on the oligonucleotide.
The amino group introduced during synthesis.
Example 2
Preparation of Streptavidin Magnetic Beads
[0117] To 15 mg of BSA (in 2-3 ml PBS), 105 .mu.l of
dimethylsulfoxide containing 50 mg/ml of biotin-x-NHS (Clontech,
San Diego, Calif.) was added followed by mixing and incubation at
room temperature for 30 minutes. The reaction was stopped by adding
30 .mu.l of 1M glycine and incubation at room temperature for 10
minutes. The reaction mix was purified by gel filtration
chromatography (Bio-Gel P6, Bio-rad Labs, Richmond, Calif.). This
biotin-BSA was filtered using a 0.2 .mu.m filter and syringe. 5 mg
biotin-BSA in 10 ml of 0.2 M sodium carbonate/bicarbonate buffer pH
9.6 was added to 300 mg of DYNABEADS.TM. (DYNAL No. 14002)
(DYNABEADS is a trademark of DYNAL, Great Neck, N.Y.) The beads
comprise either:
[0118] (i) Dynal M-450 Dynabeads, 4.5 .mu.m diameter
superparamagnetic particles, 30 mg/mL, obtained from Dynal, 45
North Station Plaza, Great Neck, N.Y. 11021; or
[0119] (ii) Dynal M-280 Dynabeads, 2.8 .mu.m diameter
superparamagnetic particles, 10 mg/mL, obtained from Dynal, 45
North Station Plaza, Great Neck, N.Y. 11021).
[0120] and washed with carbonate/bicarbonate. This mixture was
vortexed and incubated overnight at room temperature with mixing.
The beads were magnetically separated followed by the addition of
10 ml ECL diluent (37.5 mM KH.sub.2PO.sub.4, 109.2 mM
K.sub.2HPO.sub.4 3H.sub.2O, 151.7 mM CaCl, 0.65 mM NaN.sub.3, 0.43
mM bovine serum albumin in H.sub.2O) and 100 .mu.l tRNA (10 mg/ml).
This mixture was incubated for 3-4 hours at room temperature with
mixing. The beads were washed once with 10 ml of ECL diluent and
resuspended in 10 ml of ECL diluent and 100 .mu.l tRNA (10 mg/ml).
This mixture was mixed and incubated at 2-6.degree. C. overnight to
stabilize proteins on beads. The beads were magnetically separated
and suspended in 10 ml of phosphate buffered saline (PBS)
containing 15 mg of streptavidin (Scripps Laboratories, San Diego,
Calif., Catalog No. S1214) followed by mixing for one hour. The
beads were washed 4 times in 10 ml ECL diluent, with 5 minutes
mixing for each wash. The beads were finally resuspended in 29.7 ml
of ECL diluent and 300 .mu.l tRNA (10 mg/ml) to a final
concentration of 10 mg/ml particles+100 .mu.g/ml tRNA.
Example 3
Pol 2 Assay
[0121] Probe solution I: for 50 assays we combined:
[0122] 50 .mu.l of 35OT1 (ECL oligo at 1 .mu.g/ml),
[0123] 50 .mu.l 5OT2 (biotin labeled oligonucleotide at 2
.mu.g/ml).
[0124] Amplifications were carried out using primers OT188 and OT42
following methods described in J. Vir. Method 35 (1991):273.
[0125] The samples were prepared by either of two methods:
[0126] A) 4 .mu.l of sample from amplification add 16 .mu.l of AKZO
buffer containing 0.1% SDS, 20 mM EDTA and heat for 5 minutes at
95.degree. C.
[0127] B) 20 .mu.l of sample add 1.8 .mu.l of 1.25% SDS, 240 mM
EDTA and heat for 5 minutes at 95.degree. C.
[0128] In an assay tube, the following were combined: 5 .mu.l of
probe solution I and 5 .mu.l of sample from above. These samples
were incubated at 50.degree. C. for 30 minutes followed by the
addition of 5 .mu.l of beads (20 .mu.g Dynal 450) and mixed for 60
minutes. To this mixture 485 .mu.l of ECL assay buffer was added
and the samples assayed in an ECL analyzer. The samples tested were
`NT` a no template control, `A` 10 copies of HIV1 and `B` 10,000
copies of HIV1. These were 1 .mu.l aliqoutes from the amplification
reaction.
[0129] The results were as follows:
4 Sample ECL signal Background signal 204 NT 1908 1884 1913 A 1952
1862 1911 B 175679 179986 167539
[0130] The results demonstrated the ability of the amplification
and ECL to rapidly and sensitively detect the HIV 1 sequences.
Example 4
Gag3 and Pol 2 Assay
[0131] To improve on the assay system as demonstrated above, we
made use of more probe and beads to provide an assay with
unparalleled range. Amplifications were carved out as in Example 3
and using primers OT83 and OT82 as described in 35 J. Vir. Method
273 (1991) for the gag gene.
[0132] Probe solution I: for 50 pol2 assays we combined:
[0133] 50 .mu.l of 35OT1 (ECL oligo at 20 .mu.g/ml),
[0134] 50 .mu.l 50T2 (biotin labelled oligonucleotide at 20
.mu.g/ml).
[0135] Probe solution 2: for 50 gag3 assays we combined:
[0136] 50 .mu.l of AKZO2 (ECL oligo at 20 .mu.g/ml),
[0137] 50 .mu.l of AKZO1 (biotin labelled oligonucleotide at 20
.mu.g/ml).
[0138] The samples were prepared by either of two methods:
[0139] A) 4 .mu.l of sample from amplification add 16 .mu.l of AKZO
buffer containing 0.1% SDS, 20 mM EDTA and heat for 5 minutes at
95.degree. C.
[0140] B) 20 .mu.L of sample add 1.8 .mu.l of 1.25% SDS, 240 mM
EDTA and heat for 5 minutes at 95.degree. C.
[0141] Initial assay protocol in assay tube combine in the
following order:
[0142] 5 .mu.l of probe
[0143] 5 .mu.l of sample.
[0144] Incubate at 50.degree. C. for 30 minutes followed by the
addition of 10 .mu.l of beads (40 .mu.g) and shaking for 60
minutes. These samples were diluted with ECL assay buffer 485 .mu.l
and analyzed on an ECL analyzer. The samples tested were gag3
`G11`, 10.sup.11 copies of HIV1; `G10`, 10.sup.10 copies of HIV1;
`G9`, 10.sup.9 copies of HIV1; `G8`, 10.sup.8 copies of HIV1; and
`BB` buffer blank for hybridization background.
[0145] These were samples of pure RNA generated as test samples
containing this number of RNA molecules in the assay.
[0146] The results were as follows:
5 Sample ECL signal Background signal 82 G11 249559 252442 G10
12783 16059 G9 1427 1429 G8 334 330 BB 250 250
[0147] and pol2 samples from an amplification reaction which had
used 10,000 copies of starting HIV1 sequences and estimated at
5.times.10.sup.10 copies per .mu.l based on gel electrophoresis
after amplification. This sample was diluted to determine the range
of the new assay format for this sample. Samples were `P10`,
5.times.10.sup.10; `P9`, 5.times.10.sup.9; `P8`, 5.times.10.sup.8;
`P7`, 5.times.10.sup.7; `P6`, 5.times.10.sup.6, and `BB` sample
which has no amplified sample and controls for the non-specific
binding in the assay.
[0148] The results were as follows:
6 Sample ECL signal Background signal 82 P10 58762 62039 P9 4696
4391 P8 677 665 P7 330 319 P6 254 263 BB 250 250
[0149] This experiment demonstrated the ability of the new assay
format to function over at least 3.5 logs of sample concentrations
and give a good linear response.
Example 5
Gag3
[0150] To improve on the assay system as demonstrated above we made
use of more probe and beads to provide an assay with unparalleled
range.
[0151] Probe solution 2: for 50 gag3 assays we combined:
[0152] 50 .mu.l of AKZO2 (ECL oligo at 20 .mu.g/ml),
[0153] 50 .mu.l of AKZO1 (biotin labeled oligonucleotide at 20
.mu.g/ml).
[0154] The samples were prepared by either of two methods:
[0155] A) 4 .mu.l of sample from amplification add 16 .mu.l of AKZO
buffer containing 0.1% SDS, 20 mM EDTA and heat for 5 minutes at
95.degree. C.
[0156] B) 20 .mu.l of sample add 1.8 .mu.l of 1.25% SDS, 240 mM
EDTA and heat for 5 minutes at 95.degree. C.
[0157] Initial assay protocol: in assay tube combine in the
following order:
[0158] 5 .mu.l of probe solution 2
[0159] 5 .mu.l of sample.
[0160] Incubate at 50.degree. C. for 30 minutes followed by the
addition of 10 .mu.L of beads (40 .mu.g) and shaking for 60
minutes. These samples were diluted with ECL assay buffer 485 .mu.l
and analyzed on an ECL analyzer. The samples tested were gag3 `G6`,
10.sup.6 copies of HIV1; `G5`, 105 copies of HIV1; `G4`, 10.sup.4
copies of HIV1; `G3`, 10.sup.3 copies of HIV1; `G2`, 10.sup.2
copies of HIV1; `G1`, 10.sup.1 copies of HIV1; and `NT1`; `N2`,
`NT3` no template controls for background. The samples of these
copy numbers were amplified as in Example 4 and 1 .mu.l analyzed
for the presence of amplified sequences. Also a `BB` sample which
has no amplified sample and controls for the non-specific binding
in the assay.
[0161] The results were as follows:
7 Sample ECL signal G6 55870 56541 G5 57798 58354 G4 66316 59120 G3
74763 71190 G2 75315 69284 G1 301 296 NT1 276 285 NT2 283 295 NT3
312 283 BB 272 289
Example 6
Patient Correlation Study
[0162] Samples of patients blood were fractionated and extracted to
yield RNA for amplification. As in Example 4. This yielded samples
from Whole blood (V), Platelets (T), Macrophages (M) and Plasma
(P). These samples were amplified and subjected to Southern blot
analysis with specific probes to determine the level and nature of
the amplification from these samples. Samples from this
amplification analysis were then subjected to analysis by the ECL
system. In addition, standard samples generated in vitro were used
as positive controls C2, 10.sup.2; C3 10.sup.3; C4, 10.sup.4;
[0163] Probe solution 2: for 50 gag3 assays we combined:
[0164] 50 .mu.l of AKZO2 (ECL oligo at 20 .mu.g/ml),
[0165] 50 .mu.l of AKZO1 (biotin labeled oligonucleotide at 20
.mu.g/ml).
[0166] The 1 .mu.l samples were diluted to 5 .mu.l and made 0.1%
SDS, 20 mM EDTA and heated for 5 minutes at 95.degree. C. This was
followed by the addition of 5 .mu.l of probe solution. Incubated at
50.degree. C. for 30 minutes followed by the addition of 10 .mu.l
of beads (40 .mu.g) and shaking for 60 minutes. These samples were
diluted with ECL assay buffer 485 .mu.l and analyzed on an ECL
analyzer.
8 ECL counts Patient Number T M P V 203 100124 316769 154032 581
204 499 227775 52619 310007 205 581 98188 501 75430 206 510 368765
101581 524 207 7990 251266 115186 81173 208 533 254802 81832 288289
C2 66644 C3 138150 C4 146093 C5 125322 NT2 207099 NT3 581 BB 605
605
[0167] Further patient samples were analyzed.
9 ECL counts Patient Number T M P V 209 648 777 813 670 210 672
261234 142876 162615 211 237886 242394 187486 228249 212 676 796
697 2802 213 699 8004 152223 143648 228 592 173790 609 539 C2
169992 C3 128430 C4 157989 C5 142345 NT 575 NT2 209712
[0168] All of this data correlated with the northern blot
hybridization studies carried out on the amplified samples
including the problems with the no templates showing problems with
contamination. The assay did show evidence of a hook effect in
sample 204P which gave higher results after dilution than with the
1 .mu.l of sample. This sample most likely has greater than the
10.sup.12 limit for the present assays linear response.
[0169] This data was followed up with assays on plasma isolated
samples, split for gag3 assays and pol2 assays. Also samples were
made from whole blood (V) and macrophages (M) where indicated.
[0170] GAG3 assay ECL peak signals.
10 Sample volume used in the assay nl Sample 20 1,000 114 869 602
115 747 674 116 756 646 117 792 770 118 735 709 201 V 878 9651 201
943 11149 202 V 756 1592 202 722 671 203 21370 196556 204 11450
229730 205 686 686 206 11930 269703 207 13996 151126 208 13217
259667 209 663 585 210 663 608 211 30663 174421 212 684 690 213
21257 227918 228 703 568 NT 869 627 C2 3383 181566 C3 37989 103653
C4 31531 106488 37 V 1156 20282 37 M 1602 53922 41 V 8716 262440 41
M 3579 192855 42 V 747 863 42 M 739 806
[0171] POL2 assay ECL peak signals.
11 Sample volume used in the assay nl Samples: 20 1,000 203 183 191
204 24301 >300000 205 236 234 206 217 278 207 190 558 208 16232
>300000 209 15150 >300000 210 204 516 211 3493 254728 212 192
335 213 358 7773 228 200 404 NT 221 398 C2 202 404 C3 11893
>300000 C4 17613 >300000
[0172] This patient data correlated with previous northern blot
analysis (Van Gemen et al., 45 J. Vir. Method (1993)).
Example 7
[0173] In addition to the above assay formats, we ran a set of
samples in which all the components were added and hybridized,
i.e., sample probes and beads these were incubated at 50.degree. C.
as previously and samples taken from this mix at 5 through 30
minutes the signal was maximal at the 5 minute time point
indicating the speed of the hybridization and flexibility of the
assay system. The samples were a mix of two control amplified
samples from 10.sup.2 and 10.sup.3 input template molecules these
samples had been tested positive earlier. The NT was a sample which
was negative.
12 Sample Time (min) ECL signal C2/C3mix 5.40 39200 16.15 49025
29.25 42960 NT 7.40 863 22.15 1008 >30 853
[0174]
Sequence CWU 1
1
19 1 30 DNA Artificial synthetic oligonucleotide 1 ttaaattttc
ccattagccc tattgagact 30 2 30 DNA Artificial synthetic
oligonucleotide 2 agaaatctgt tgactcagat tggttgcact 30 3 30 DNA
Artificial synthetic oligonucleotide 3 ttaaattttc ccattagccc
tattgagact 30 4 30 DNA Artificial synthetic oligonucleotide 4
ttaaattttc ccattagccc tattgagact 30 5 30 DNA Artificial synthetic
oligonucleotide 5 agaaatctgt tgactcagat tggttgcact 30 6 30 DNA
Artificial synthetic oligonucleotide 6 agaaatctgt tgactcagat
tggttgcact 30 7 29 DNA Artificial synthetic oligonucleotide 7
tagaagaaat gatgacagca tgtcaggga 29 8 29 DNA Artificial synthetic
oligonucleotide 8 caatgagcca agtaacaaat acagctacc 29 9 29 DNA
Artificial synthetic oligonucleotide 9 tagaagaaat gatgacagca
tgtcaggga 29 10 29 DNA Artificial synthetic oligonucleotide 10
caatgagcca agtaacaaat acagctacc 29 11 25 DNA Artificial synthetic
oligonucleotide 11 tgttaaaaga gaccatcaat gagga 25 12 28 DNA
Artificial synthetic oligonucleotide 12 gaatgggata gagtgcatcc
agtgcatg 28 13 24 DNA Artificial synthetic oligonucleotide 13
gacagtgtag atagatgaca gtcg 24 14 25 DNA Artificial synthetic
oligonucleotide 14 tgttaaaaga gaccatcaat gagga 25 15 24 DNA
Artificial synthetic oligonucleotide 15 tgttaaaaga gaccatcaat gagg
24 16 28 DNA Artificial synthetic oligonucleotide 16 gaatgggata
gagtgcatcc agtgcatg 28 17 28 DNA Artificial synthetic
oligonucleotide 17 gaatgggata gagtgcatcc agtgcatg 28 18 24 DNA
Artificial synthetic oligonucleotide 18 gacagtgtag atagatgaca gtcg
24 19 24 DNA Artificial synthetic oligonucleotide 19 gacagtgtag
atagatgaca gtcg 24
* * * * *