U.S. patent application number 10/991173 was filed with the patent office on 2005-08-18 for method of detecting and treating tuberous sclerosis complex associated disorders.
Invention is credited to Gould-Rothberg, Bonnie, Murphey, Ryan, Rastelli, Luca.
Application Number | 20050181391 10/991173 |
Document ID | / |
Family ID | 22963608 |
Filed Date | 2005-08-18 |
United States Patent
Application |
20050181391 |
Kind Code |
A1 |
Rastelli, Luca ; et
al. |
August 18, 2005 |
Method of detecting and treating tuberous sclerosis complex
associated disorders
Abstract
Disclosed are methods of detecting and treating tuberous
sclerosis complex associated disorders. Also disclosed are methods
of identifying agents for treating tuberous sclerosis complex
associated disorders.
Inventors: |
Rastelli, Luca; (Guilford,
CT) ; Gould-Rothberg, Bonnie; (Guilford, CT) ;
Murphey, Ryan; (West Haven, CT) |
Correspondence
Address: |
Ivor R. Elrifi
Mintz, Levin, Cohn, Ferris,
Glovsky and Popeo, P.C.
One Financial Center
Boston
MA
02111
US
|
Family ID: |
22963608 |
Appl. No.: |
10/991173 |
Filed: |
November 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10991173 |
Nov 16, 2004 |
|
|
|
10016253 |
Dec 10, 2001 |
|
|
|
60254268 |
Dec 8, 2000 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
435/6.1 |
Current CPC
Class: |
C07K 2317/76 20130101;
A61P 17/00 20180101; A61P 31/00 20180101; G01N 2500/10 20130101;
C12N 9/0028 20130101; A61P 13/12 20180101; G01N 33/574 20130101;
A61P 25/00 20180101; A61P 21/00 20180101; C07K 2317/24 20130101;
C12Q 2600/16 20130101; C07K 16/28 20130101; A61P 35/00 20180101;
C12Q 2600/158 20130101; A61P 19/00 20180101; C07K 2/00 20130101;
C12Q 1/6886 20130101; C12Y 105/01006 20130101; A61P 11/00 20180101;
C12Q 2600/118 20130101; C12Q 1/6883 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
What is claimed is:
1. A method of diagnosing or determining the susceptibility to a
tuberous sclerosis complex associated disorder in a subject, the
method comprising: (a) providing from the subject a test cell
population comprising cells capable of expressing one or more
nucleic acid sequences selected from the group consisting of TSC
1-8, 10-12, 15-141 and 142; (b) measuring expression of one or more
of the nucleic acid sequences in the test cell population; and (c)
comparing the expression of the nucleic acid sequences in the test
cell population to the expression of the nucleic acid sequences in
a reference profile comprising at least one cell from a subject not
suffering from a tuberous sclerosis complex associated disorder;
and (d) identifying a difference in expression levels of the
nucleic acid sequences, if present, in the test cell population and
reference profile, thereby diagnosing or determining the
susceptibility to a tuberous sclerosis complex associated disorder
in the subject.
2. The method of claim 1, wherein the subject is a human.
3. The method of claim 1, wherein the tuberous sclerosis complex
associated disorder is selected from the group consisting of
hamartomas, hamartias, renal carcinoma, malignamnt angiomyolipoma,
hypomelanotic macules, facila angiofibroma, shagreen patches and
ungula fibromas.
4. The method of claim 1, wherein the method comprises comparing
the expression of five or more of the nucleic acid sequences.
5. The method of claim 1, wherein the method comprises comparing
the expression of 20 or more of the nucleic acid sequences.
6. The method of claim 1, wherein the method comprises comparing
the expression of 25 or more of the nucleic acid sequences.
7. A method of treating a tuberous sclerosis complex associated
disorder in a subject, the method comprising administering to the
subject an agent that modulates the expression or the activity of
one or more nucleic acids selected from the group consisting of TSC
1-8, 10-12, 15-141 and 142.
8. A method of identifying a candidate therapeutic agent for a
tuberous sclerosis complex associated disorder, the method
comprising; (a) providing a test cell population comprising a cell
capable of expressing one or more nucleic acid sequences selected
from the group consisting of TSC 1-8, 10-12, 15-141 and 142; (b)
contacting the test cell population with a test agent; (c)
measuring expression of one or more of the nucleic acid sequences
in the test cell population; (d) comparing the expression of the
gene in the test cell population to the expression of the nucleic
acid sequences in a reference cell population comprising at least
one cell whose tuberous sclerosis status is known; and (e)
identifying a difference in expression levels of the nucleic acid
sequences, if present, in the test cell population and reference
cell population, thereby identifying a therapeutic agent for a
tuberous sclerosis complex associated disorder.
9. A method of identifying an individualized therapeutic agent
suitable for treating a tuberous sclerosis complex associated
disorder appropriate in a selected subject, the method comprising:
(a) providing from the subject a test cell population comprising
cells capable of expressing one or more nucleic acid sequences
selected from the group consisting of TSC 1-8, 10-12, 15-141 and
142; (b) contacting the test cell population with the therapeutic
agent; (c) measuring expression of one or more of the nucleic acid
sequences in the test cell population; (d) comparing the expression
of the nucleic acid sequences in the test cell population to the
expression of the nucleic acid sequences in a reference cell
population comprising at least one cell whose tuberous sclerosis
complex associated disorder status is known; and (e) identifying a
difference in expression levels of the nucleic acid sequences, if
present, in the test cell population and reference cell population,
thereby identifying a therapeutic agent appropriate for the
subject.
10. A method of assessing the efficacy of a treatment of tuberous
sclerosis complex associated disorder in a subject; the method
comprising: (a) providing from the subject a test cell population
comprising cells capable of expressing one or more nucleic acid
sequences selected from the group consisting of TSC 1-8, 10-12,
15-141 and 142; (b) detecting expression of one or more of the
nucleic acid sequences in the test cell population; (c) comparing
the expression of the nucleic acid sequences in the test cell
population to the expression of the nucleic acid sequences in a
reference cell population comprising at least one cell from a
subject not suffering from atuberous sclerosis complex associated
disorder; and (e) identifying a difference in expression levels of
the nucleic acid sequences, if present, in the test cell population
and reference cell population, thereby assessing the efficacy of
treatment of the tuberous sclerosis complex associated disorder in
the subject.
11. An isolated nucleic acid comprising a nucleic acid sequence
selected from the group consisting of a TSC 1-8, 10-12, 15-25 gene,
or its complement.
12. A vector comprising the nucleic acid of claim 11.
13. A cell comprising the vector of claim 12.
14. A pharmaceutical composition comprising the nucleic acid of
claim 11.
15. A polypeptide encoded by the nucleic acid of claim 11.
16. An antibody which specifically binds to the polypeptide of
claim 15
17. A kit which detects two or more of the nucleic acid sequences
selected from the group consisting of TSC 1-8, 10-12, 15-141 and
142.
18. An array which detects one or more of the nucleic acid selected
from the group consisting of TSC 1-8, 10-12, 15-141 and 142.
19. A plurality of nucleic acid comprising one or more of the
nucleic acid selected from the group consisting of TSC 1-8, 10-12,
15-141 and 142.
Description
RELATED APPLICATIONS
[0001] This application is a Continuation under 37 C.F.R. 1.53(b)
of U.S. Ser. No. 10/016,253, filed Dec. 10, 2001, which is
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The invention relates to methods of detecting and treating
Tuberous Sclerosis Complex (TSC) associated disorders.
BACKGROUND OF THE INVENTION
[0003] The phakomatoses, or `neuro-cutaneous disorders`, are a
group of three Mendelian autosomal dominantly inherited diseases
that present with phenotypes affecting multiple organ systems in
affected individuals. Neuro-cutaneous disorders include for
example, Neurofibromatosis (NF), Tuberous Sclerosis (TSC) and Von
Hippel-Lindau (VHL). These diseases all produce both neurological
and dermatological symptoms.
[0004] Tuberous sclerosis complex (TSC) is an autosomal dominant
tumor-suppressor gene syndrome, characterized by development of
distinctive benign tumors (hamartomas) and malformations
(hamartias) in multiple organ systems. The brain, skin, heart, and
kidneys are commonly affected. TSC lesions occurring in the skin
and kidney contain smooth muscle cells, endothelial cells,
adipocytes, and large neuronal appearing cells. Despite this
complex cellular architecture, kidney and other lesions in TSC
appear to be clonal in nature, based on clonality and loss of
heterozygosity (LOH) analyses. In the brain, TSC produces both
subependymal tubers that line the ventricular sacs and subcortical
hamartomas which serve as foci for epileptic discharges. TSC
produces cardiac rhabdomyomas in the fetus/newborn that
spontaneously regress in the first year of life. TSC is also
associated with renal angiomyolipomas, pulmonary symptoms, and
manifestations in other organ systems. In addition, TSC is also
associated with multiple dermatological features such as
hypomelanotic macules, facial angiofibroma, shagreen patches, and
ungual fibromas.
[0005] A better understanding of the molecular nature of this
disease will provide new therapeutic tools to treat the pathologies
associated with TSC complex not only in TSC patients but also in
non TSC patients afflicted by similar pathologies.
SUMMARY OF THE INVENTION
[0006] The present invention is based in part on the discovery of
changes in expression patterns of multiple nucleic acid sequences
in cells derived from the Tsc2 knockout transgenic mice compared to
the expression pattern found in cells derived from Tsc2+/-
heterozygote and wild type sibling mice. These differentially
expressed nucleic acids include previously undescribed sequences
and nucleic acids sequences that, while previously described, have
not heretofore been identified as TSC modulated.
[0007] In various aspects, the invention includes methods of
diagnosing or determining susceptibility to Tuberous Sclerosis
Complex (TSC) associated disorder, and methods of treating those
disorders. For example, in one aspect, the invention provides a
method of diagnosing determining susceptibility to a tuberous
sclerosis complex associated disorder by providing a test cell
population that includes one or more cells capable of expressing
one or more TSC modulated nucleic acids sequences. Levels of
expression of one or more sequences, termed TSCX sequences, are
then compared to the levels of expression of the corresponding
nucleic acids in a reference cell population. The reference cell
population contains cells whose tuberous sclerosis complex
associated disorder status is known, i.e., the reference cells are
known to have or are known not to have a tuberous sclerosis
associated disorder.
[0008] The invention in another aspect includes a method of
identifying a therapeutic agent for treating a tuberous sclerosis
complex associated disorder. The method includes providing from the
subject a test cell population comprising a cell capable of
expressing one or more TSCX nucleic acids sequences, contacting the
test cell population with the therapeutic agent, and comparing the
expression of the nucleic acids sequences in the test cell
population to the expression of the nucleic acids sequences in a
reference cell population.
[0009] The invention in a further aspect includes a method of
selecting an individualized therapeutic agent appropriate for a
particular subject. The method includes providing from the subject
a test cell population comprising a cell capable of expressing one
or more TSCX nucleic acids sequences, contacting the test cell
population with the therapeutic agent, and comparing the expression
of the nucleic acids sequences in the test cell population to the
expression of the nucleic acids sequences in a reference cell
population.
[0010] Also provided are novel nucleic acids, as well as their
encoded polypeptides, which are tuberous sclerosis complex
modulated.
[0011] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. All
publications, patent applications, patents, and other references
mentioned herein are incorporated by reference in their entirety.
In the case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are illustrative only and not intended to be limiting.
[0012] Other features and advantages of the invention will be
apparent from the following detailed description and claims.
DETAILED DESCRIPTION
[0013] The present invention is based in part on the discovery of
changes in expression patterns of multiple nucleic acid sequences
in cells derived from the Tsc2 knockout transgenic mice compared to
the expression pattern found in cells derived from Tsc2+/-
heterozygote and wild type sibling mice.
[0014] The change is expression pattern was identified by
GeneCalling.TM. analysis (U.S. Pat. No. 5,871,697; Shimkets et al.,
1999 Nature Biotechnology 17:198-803, incorporated herein by
reference in their entireties) of neuronal stem cell (NSC) and
mouse emroyonic fibroblasts (MEF) cell lines established from 10-11
day embryos from mice of the three genotypes (i.e.,).
[0015] A summary of the sequences analyzed are presented in Table
1. The 142 single nucleic acid sequences identified herein, are
referred to herein as TSC 1-142 or TSCX nucleic acids or
polypeptided. Differential expression of TSC 1-142 gene fragments
was confirmed using a unlabeled oligonucleotide competition assay
as described in Shimkets et al., Nature Biotechnology
17:198-803.
[0016] By comparing the genes differentially expressed in both cell
lines it was possible to identify understand common mechanisms in
TSC -/- tumor formation. Whereas, by comparing the the genes
differentially expressed in NSC cell lines it was identify genes
that are expressed in cells that are the originators (i.e.,
progentitors) of TSC tumors. Based on the TSC phenotype, genes that
are up-regulated in the TSC-cells may have a role in cancer
progression, specifically for renal and lung carcinomas.
[0017] Twenty-six sequences (TSC: 1-26) represent novel murine
genes for which the sequence identity to sequences found in public
databases suggesting a putative homology.
[0018] The 116 other sequenced identified have been previously
described. For some of the novel sequences (i.e., TSC: 1-26), a
cloned sequence is provided along with one or more additional
sequence fragments (e.g., ESTs or contigs) which contain sequences
substantially identical to, the cloned sequence. Also provided is a
consensus sequences which includes a composite sequence assembled
from the cloned and additional fragments. For a given TSC sequence,
its expression can be measured using any of the associated nucleic
acid sequences may be used in the methods described herein. For
previously described sequences database accession numbers are
provided. This information allows for one of ordinary skill in the
art to deduce information necessary for detecting and measuring
expression of the TSC nucleic acid sequences.
[0019] A subset of the TSC modulated genes can be further
subdivided into three classes:
[0020] A. Secreted and/or Membrane Bound Proteins that are
Up-Regulated in Cell Derived from Tsc2 Knockout Transgenic Mice
[0021] Proteins in this catagory include, Plasma phospholipid
transfer protein, Lysyl hydroxylase isoform 2, DVS27-related
protein [AB024518], Cathepsin L, Tenascin, ADAMTS1, Tissue
inhibitor of metalloproteinase-2, Integrin beta-5, Thrombospondin 2
(THBS2) Aspartyl protease 1, Cyr61, Tetraspan NET-7, Cysteine-rich
glycoprotein SPARC, neuronal pentraxin receptor, ITM2B-E25B protein
Integral Membrane Protein 2B, transmembrane glycoprotein NMB, and
zinc finger protein These proteins are potential candidates for
antibody screening and antibody-binding therapy for the treatment
of TSC and TSC related diseases.
[0022] B. Secreted and/or Membrane Bound Proteins that are
Down-Regulated in Cell Derived from Tsc2 Knockout Transgenic
Mice
[0023] Proteins in this catacory include, Growth/differentiation
factor 1 (GDF-1), Extracellular matrix associated protein (Sc1),
Membrane-type 2 matrix metalloproteinase and Thrombospondin 1
mice.
[0024] These proteins that are potentail canidates for the
treatment of TSC and TSC related diseases.
[0025] C. Protein with Enzymatic Activies
[0026] Proteins in this catory include Growth factor-inducible
immediate early gene 3CH134/erp, Galactokinase 1, Serum inducible
kinase (SNK), PAF acetylhydrolase Aspartyl protease 1, Lysyl
hydroxylase isoform 2 Peroxisomal D2, and D4-dienoyl-CoA reductase
(Pdcr).
[0027] These proteins are potential candidates for small molecule
screening and small molecule drug therapy for the treatment of TSC
and TSC related diseases.
[0028] The TSC modulated nucleic acids discussed herein include the
following:
1TABLE 1 TSCX MEF +/- TSC2 MEF -/- TSC2 NSC +/- TSC2 NSC -/- TSC2
Assign- SEQ ID vs. +/+ TSC2 vs. +/+ TSC2 vs. +/+ TSC2 vs. +/+ TSC2
Gene Discovered ment NO Acc # (16606) (16607) (16608) (16609) Novel
gene fragment, 2520 bp 1 1 aa914498 .+-.1.0 +1.5 +2 +1.5 Novel gene
fragment, 1863 bp 2 2 aa073509 .+-.1.0 -6 -2 -2 Novel gene
fragment, 750 bp 3 3 AA183535 .+-.1.0 +3 .+-.1.0 +4 Novel gene
fragment, 281 bp, 91% AA 4 4 .+-.1.0 -1.5 .+-.1.0 NEW identity to
rat Steroid sensitivity gene-1 protein [AAF35351] Novel gene
fragment, 1568 bp, 86% SI to 5 5 .+-.1.0 X +2 +6 human Tetraspan
NET-7 [AF120266]/old brain study also Novel gene fragment, 300 bp,
94% SI to rat 6 6 .largecircle. .largecircle. .largecircle. +15
10-formyltetrahydrofolate dehydrogenase [M59861] Novel gene
fragment, 965 bp, 86% SI to rat 7 7 -2 X .+-.1.0 NEW myr3 myosin I
heavy chain [X74815] Novel gene fragment, 408 bp, 97% SI to rat 8 8
.largecircle. .largecircle. .+-.1.0 OFF Limbic system-associated
membrane protein [U31554] Novel gene fragment, 777 bp, 83% SI to
rat 9 .+-.1.0 .+-.1.0 .+-.1.0 NEW neuronal pentraxin receptor
[AF005099] Novel gene fragment, 354 bp, 87% SI to 10 9 .+-.1.0 X -2
-5 human KIAA0631 [AB014531] Novel gene fragment, 955 bp 11 10
.+-.1.0 X -3 -8 Novel gene fragment, 1113 bp 12 11 +2 X .+-.1.0 -9
Novel gene fragment, 918 bp 13 .+-.1.0 .+-.1.0 .+-.1.0 +3 Novel
gene fragment, 1166 bp 14 .+-.1.0 .+-.1.0 +1.0 +10 Novel gene
fragment, 594 bp 15 12 .+-.1.0 .+-.1.0 .+-.1.0 -10 Novel gene
fragment, 713 bp 16 13 .largecircle. .largecircle. .+-.1.0 OFF
Novel gene fragment, 306 bp, 95% SI to rat 17 14 .+-.1.0 -2 .+-.1.0
X ribosomal protein L13a [X68282] Novel gene fragment, 66 bp, 96%
SI to rat 18 15 .+-.1.0 -2 -2 .+-.1.0 ribosomal protein S20
[X51537] Novel gene fragment, 1613 bp 19 16 .+-.1.0 +3 .+-.1.0 -5
Novel gene fragment, 2245 bp 20 17 .+-.1.0 NEW -2 -3 Novel gene
fragment, 171 bp, 86% SI to rat 21 18 .+-.1.0 +1.5 nonmuscle
caldesmon [U18419] Novel gene fragment, 491 bp, 72% SI to 22 19 +10
human DVS27-related protein [AB024518] Novel gene fragment, 659 bp,
72% SI to 23 20 -2 X .+-.1.0 NEW human ATP cassette binding
transporter 1 [AF165281] Novel gene fragment, 341 bp, 84% SI to 24
21 human sorting nexin 5 (SNX5) [AF121855] Novel gene fragment, 53
bp, 84% SI to rat 25 22 calcium-independent alpha-latrotoxin
receptor [U72487] Novel gene fragment, 52 bp, 98% SI to rat 26 -2
Na+, K+-ATPase alpha(+) isoform catalytic subunit [M14512] MEF
& NSC -/- conserved differential expression Ribosomal protein
L8 (RPL8) 27 U67771 -9 OFF -3 OFF Alpha-B crystallin (p23) 28
M63170 .+-.1.0 +20 +2 +7 Tumor cell dnaJ-like protein 1 29 L16953
.+-.1.0 +2 +3 +2 Insulin-like growth factor-binding protein-4 30
S80566 .+-.1.0 -2 +3 OFF Insulin-like growth factor binding protein
5 31 L12447 .+-.1.0 NEW +2 +5 (IGFBP5) Rac1 32 X57277 -2 -1.5 -2 -2
Growth factor-inducible immediate early 33 S64851 .+-.1.0 +2
.+-.1.0 +6 gene 3CH134/erp Phosphatidic acid phosphatase type 2c 34
AF123611 .+-.1.0 -5 .+-.1.0 -4 (Ppap2c) Annexin III 35 AJ001633
.+-.1.0 NEW .+-.1.0 NEW Taipoxin-associated calcium binding protein
36 AF049125 .+-.1.0 -2 .+-.1.0 OFF 49 C-fos oncogene 37 V00727 +2
+1.5 .+-.1.0 NEW Stra13 38 AF010305 +2 +6 .+-.1.0 +2 E1B
19K/Bcl-2-binding protein homolog 39 AF041054 +2 +5 .+-.1.0 +3
(Nip3) Peroxisomal D2,D4-dienoyl-CoA reductase 40 AF155575 +7 NEW
+2 NEW (Pdcr) Galactokinase 1 41 AB027012 .+-.1.0 +4 .+-.1.0 +1.5
Alpha-enolase (2-phospho-D-glycerate 42 X52379 +3 +5 +3 +15
hydrolase) (NNE) Alpha-N-acetylglucosaminidase 43 AF003255 .+-.1.0
+2 .+-.1.0 +3 Uncoupling protein 2 (UCP2) 44 AF111998 .+-.1.0 NEW
+2 NEW ANC1 for adenine nucleotide carrier 45 X74510 .+-.1.0 -1.5
.+-.1.0 -2 Vacuolar ATPase subunit A gene 46 U13837 .+-.1.0 +3
.+-.1.0 +2 S-adenosylmethionine decarboxylase 47 D12780 .+-.1.0 +2
.+-.1.0 +5 Spermidine/spermine N1-acetyltransferase 48 L10244
.+-.1.0 +5 .+-.1.0 +4 (SSAT) Xanthine dehydrogenase 49 X62932
.+-.1.0 +9 .+-.1.0 NEW mBOCT 50 AB012808 .+-.1.0 OFF .+-.1.0 -3
Plasma phospholipid transfer protein 51 U37226 .+-.1.0 +2 -2 +5
Lysyl hydroxylase isoform 2 52 AF080572 +3 +6 .+-.1.0 NEW Cathepsin
L 53 J02583 .+-.1.0 +5 .+-.1.0 +4 Ezrin 54 X60671 +2 +4 .+-.1.0 +4
Thy-1.2 glycoprotein 55 M12379 -2 -4 .+-.1.0 -10 A-X actin 56
J04181 +5 NEW +6 NEW MHC class I heavy chain precursor (H- 57
U47325 +3 +2 .+-.1.0 +4 2D(b)) MHC class I heavy chain precursor
(H- 58 U47328 +2 NEW .+-.1.0 +3 2K(b)) MHC region containing the Q
region of class I 59 AF111103 .+-.1.0 +4 -2 NEW NGF-inducible
protein TIS21 (aka BTG2) 60 M64292 +2 +2 .+-.1.0 NEW Ndr1 61 U60593
+2 +8 .+-.1.0 NEW Gly96 62 X67644 +2 +3 .+-.1.0 +2 p8 protein 63
AF131196 +2 +4 .+-.1.0 +5 MEF & NSC -/- opposite differential
expression Adrenomedullin precursor 64 U77630 .+-.1.0 OFF .+-.1.0
NEW Fibroblast growth factor 65 M65053 .+-.1.0 -3 -2 +2 Serum
inducible kinase (SNK) 66 M96163 .+-.1.0 -3 +2 NEW Annexin VI 67
X13460 .+-.1.0 -2 .+-.1.0 NEW Annexin I 68 X07486 -2 -1.5 +2 +10
Annexin II 69 D10024 .+-.1.0 -4 +2 +2 AP-2 transcription factor 70
X57012 .+-.1.0 OFF .+-.1.0 +20 Jun-B 71 J03236 +2 -4 .+-.1.0 NEW
PAF acetylhydrolase 72 U34277 .+-.1.0 OFF .+-.1.0 +12
Phosphomannomutase 73 AF007267 .+-.1.0 +3 -2 -3 Sodium/potassium
ATPase beta subunit 74 X61433 +3 +8 -2 -12 Thioredoxin 75 X77585
.+-.1.0 +1.5 +2 -3 Spermidine synthase 76 L19311 .+-.1.0 +2 .+-.1.0
-2 Aldehyde dehydrogenase II 77 M74570 +2 NEW .+-.1.0 OFF Voltage
dependent anion channel 2 78 U30838 +2 +2 .+-.1.0 -2 Tenascin 79
D90343 .+-.1.0 -5 +2 +4 ADAMTS1 80 D67076 -2 -2 .+-.1.0 +2 Tissue
inhibitor of metalloproteinase-2 81 M93954 .+-.1.0 -2 .+-.1.0 +3
Integrin beta-5 82 AF022110 .+-.1.0 -3 .+-.1.0 +1.5 Thrombospondin
2 (THBS2) 83 L07803 .+-.1.0 -6 .+-.1.0 NEW Membrane glycoprotein M6
= major CNS 84 S65735 +2 NEW .+-.1.0 -4 myelin protein PLP/DM20
homolog Gelsolin 85 J04953 .+-.1.0 -2 .+-.1.0 NEW Gag = antigen
LEC-A, env 86 S74315 .+-.1.0 -2 .+-.1.0 +5 NSC only 87 Quaking type
I (QKI) 88 U44940 .+-.1.0 .+-.1.0 .+-.1.0 -1.5 mSin3B 89 L38622
.+-.1.0 .+-.1.0 .+-.1.0 +2 Retinoblastoma susceptibility protein
(pp105Rb) 90 M26391 .+-.1.0 .+-.1.0 .+-.1.0 +1.5 Heat shock protein
(hsp-E7I) 91 L40406 .+-.1.0 .+-.1.0 .+-.1.0 +2 Aspartyl protease 1
92 AF216310 .+-.1.0 .+-.1.0 .+-.1.0 +10 Placental growth factor-1
(p1GF) 93 X80171 .+-.1.0 .+-.1.0 .+-.1.0 +3 Growth/differentiation
factor 1 (GDF-1) 94 M62301 .+-.1.0 X .+-.1.0 OFF
Calgizzarin/S100A11 95 U41341 .+-.1.0 .+-.1.0 +2 +15 Cyr61 96
M32490 +2 .+-.1.0 .+-.1.0 +25 ADP-ribosylation factor-directed
GTPase 97 AF075462 .+-.1.0 X -2 -2 activating protein isoform b
(Shag1) Camk-2 mRNA for Ca2+/calmodulin 98 X63615 .+-.1.0 .+-.1.0
.+-.1.0 -10 dependent protein kinase MAPKAPK5 mitogen-activated
protein 99 AF039840 -2 .+-.1.0 -2 -2 kinase-activated protein
kinase Fyn proto-oncogene encoding p59fyn 100 M27266 .+-.1.0
.+-.1.0 .+-.1.0 -2 Beta 1,4N-acetylgalactosaminyltransferase 101
L25885 .+-.1.0 X .+-.1.0 +1.5 Muscle glycogen phosphorylase (Pygm)
102 AF124787 .+-.1.0 X +2 OFF Protein phosphatase 1 binding protein
PTG 103 U89924 .+-.1.0 X .+-.1.0 -4 Argininosuccinate synthetase
(Ass) 104 M31690 +2 X .+-.1.0 NEW Phospholipid hydroperoxide
glutathione 105 AF045769 .+-.1.0 .+-.1.0 .+-.1.0 +5 peroxidase
(Gpx4) GABA transporter (GAT4) 106 L04662 .+-.1.0 .+-.1.0 -2 OFF
Sodium bicarbonate cotransporter NBC1 107 AF141934 -3 X -3 -2 Glial
fibrillary acidic protein (GFAP) 108 K01347 .largecircle.
.largecircle. .largecircle. NEW Tropomodulin 109 S76831 .+-.1.0 X
.+-.1.0 NEW Cysteine-rich glycoprotein SPARC 110 X04017 .+-.1.0
.+-.1.0 -2 +10 DSD-1-proteoglycan 111 AJ133130 .+-.1.0 .+-.1.0
.+-.1.0 OFF Extracellular matrix associated protein (Sc1) 112
U64827 .+-.1.0 X .+-.1.0 -1.5 Membrane-type 2 matrix
metalloproteinase 113 D86332 .largecircle. .largecircle. -2 -8
Astrotactin 114 U48797 .largecircle. .largecircle. -2 -10 Adipose
differentiation related protein 115 M93275 .+-.1.0 X +2 NEW (ADRP)
Ventral neuron-specific protein 1 NOVA1 116 AF232828 .largecircle.
.+-.1.0 .+-.1.0 OFF Neuronal pentraxin 1 (NPTX1) 117 U62021 -2 X
.+-.1.0 -10 Receptor activity modifying protein 1 118 AF209904
.+-.1.0 .+-.1.0 +2 -7 (Ramp1) Lunatic fringe 119 AF015768 .+-.1.0 X
.+-.1.0 -4 TPA-induced TIS11 120 X14678 +2 .+-.1.0 .+-.1.0 +6 ITM2B
- E25B protein Integral Membrane 121 U76253 .largecircle.
.largecircle. +6 NEW Protein 2B NMB 122 aj251685 -4 X .+-.1.0 NEW
B-cell translocation gene-1 protein (BTG1) 123 L16846 .+-.1.0
.+-.1.0 .+-.1.0 +2 MEF only Keratinocyte growth factor/fibroblast
growth 124 U58503 .+-.1.0 -10 +3 X factor-7 NOV protein 125 Y09257
+2 OFF .+-.1.0 X TGF-beta binding protein-2 126 AF004874 .+-.1.0 -4
+2 X GATA-6 = zinc finger transcription factor 127 S82462 .+-.1.0
+4 .+-.1.0 X PDGF-alpha-receptor (PDGF-alpha-R) 128 M84607 -2 -6
.+-.1.0 X Vascular smooth muscle alpha-actin 129 X13297 .+-.1.0 -6
.+-.1.0 .+-.1.0 Alpha-2 collagen VI 130 X65582 .+-.1.0 -8 .+-.1.0 X
Laminin alpha 4 chain 131 U69176 .+-.1.0 -4 .largecircle.
.largecircle. PGI (biglycan) 132 X53928 .+-.1.0 -5 +2 X
Thrombospondin 1 133 M87276 -2 -4 +2 X Fragile X mental retardation
syndrome 134 L23971 .+-.1.0 +3 .+-.1.0 X protein (Fmr1) Osf-2 for
osteoblast specific factor 2 135 D13664 .+-.1.0 -20 .+-.1.0 X Ndr2
136 AB033921 .+-.1.0 +10 +2 .+-.1.0 P53 137 X00741 .+-.1.0 Tuberin
(Tsc2) 138 U37775 .+-.1.0 X -2 OFF Alpha glucosidase II alpha
subunit 139 U92793 .+-.1.0 .+-.1.0 .+-.1.0 + DAN 140 D50263 .+-.1.0
Q .+-.1.0 +3 intracisternal A-particle element 141 D49812 .+-.1.0
.+-.1.0 +2 +5 Annexin V 142 U29396 +1.5 Key = New = de novo
expression Bold = gene was confirmed in that job +1.0 = no
difference X = no poison Q = in process p = partial poison
.largecircle. = no band
[0029] Below follows additional discussion of nucleic acid
sequences whose expression is differentially regulated.
[0030] TSC1
[0031] TSC1 is a novel 2520 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
2 1
GGCTCTGGCTCGGGCTCGGGCTGGGGCTGGGGCTTGGGCTCCAGCTCGGGCCCTGCACCTGTG-
ACTCGGCGGCGTTGCTC (SEQ ID NO: 1) 81
CTCCGCTGCCCCATGGCCCCGTCCCGGCTGCAGCTCGGCCTCCGCGCCGCCTACTCCGGCTTCAGCTCGGTAG-
CCGGCTT 161 CTCCATCTTCTTCGTCTGGACGGTGGTCTACCGACAACCGGGGACT-
GCGGCGATGGGGGGTCTCGCAGGTGTCCTGGCAC 241
TGTGGGTCTTGGTGACTCACGTGATGTACATGCAGGATTACTGGAGGACCTGGCTCAGAGGGCTGCGCGGCTT-
CTTCTTC 321 GTGGGTGCTCTCTTCTCGGCAGTCTCCGTTTCCGCCTTCTGCACCT-
TCCTGGCATTGGCCATCACCCAGCATCAGAGTCT 401
CAAAGACCCGAACAGCTACTACCTCTCCTGTGTCTGGAGCTTCATTTCCTTCAAGTGGGCCTTCCTACTTAGC-
CTCTACG 481 CCCACCGCTACCGGGCTGACTTTGCGGACATCAGCATCCTTAGTGA-
TTTCTAACCCAGGGAATGAGGTCACCACAGCCTG 561
GGGGCCCTCGGGATCTGGACTCAGCTTCCGAGTCAGCAAGGGAGCTCACCCCAACCCCTGGGGAACTCCAGAA-
CCATGGC 641 AGAGTATATGGGCCCGTTCAGTTTCTCAGAAATCTGTCTGGTCCCC-
TTTTGGGGAAGATATAGAGCTGTTAAAGGGATAC 721
TGCCAATCTGCCCAATCTGCCCGTTAGCCCAGCTAGAGGGCAGCTTAGACCTTTCCAAATAGATCTATTTTCT-
TAGCCCT 801 CTGAGGGATCTCTGTAAGTAGGCCCACGACAATGAATTCAATGGGT-
AGGATTGGAACTATGGCTAGTGACAGGGGCTGGG 881
ACAGGCTTCCTTGCTACCCCAGACTTCATTGAAGCTGTGTGTGGGGGAGGCATCAAAGGTCTGGTCAAGAGAG-
GAATCTT 961 TAGTACAGATCTCCATCCCCTGTTCCCCACCCTGTTACCCTGAAGT-
GTCGGGTAGCCAAACTCACCGGTCCTTAGGGAAT 1041
TGACAATTGGCTCCTTCCCTAAGCAGCACAGTTGGACAGAATCCAGCGTCCGTCCGTCCTACCTTCCCATCCA-
GAGTTTG 1121 TTTCCCATGAGGGTGCTAGCGCCAGCCAACCATTCCCATGTGTCG-
CATATGCACACATGACCACACACACCAGAGCAGGA 1201
CTCCTCGGATGAGGCTAGACTTGAGGACCACAGGAAACACACCCCTGCACTTAGAAGGGCTTTGGGATCGGGG-
GCAACCT 1281 GGTGGGGGCAAGTGGGAGCTCTCCATCTGTACTGAGTCTCCAACC-
TTGCCCCTCACTGCACAAGACCACCCTGACCGTGA 1361
GGACCTCCTCCCTGCACCAGATCCTAACTCTGACCTTTCACCTTCTCTCTCTCCTGAAGGAACTCTTCTGAGT-
GGACATG 1441 GGCCCAAGGCCTTACCTAAGCGGAGAGGGAGGGCAGGGGCTGCTA-
CTTCTCTCTGTAAC CTTCTCTGATGGGTTGTCACT 1521
TTGCACGTCTACTCTTCCACTTGGGCACTGCCCCCAGCTCTCTGCCTTACCTGTGTTATGGGCACTTAAGCAG-
AAATACA 1601 GCGGCCATTTTAACCAGCAAAAAAAAAAAAAAATAGGGGGGTGGG-
CGGTTTTGAGAGGGGACAAGAGTGGGCAAGATGGG 1681
GGCTCTAGCTGTCTGATCATCTCCCTAAGTTTGGGGCTACTAGACGGTATTCCTCATCTCTGGTCCCCTATGG-
GAGACCA 1761 CCAGCTGAGATCTCCTTTGCTCTCCCAGTTCTGTCCCAGCCAGGG-
TTAGGATGCCCACAGACTCAACATCCCTGCAGATT 1841
CCATCTCCCCACCCTAAGCCAAGGTAGATGGGAAAGGGAATCTTTCTTTTTCTACCCCAGCCAGACTACTTGG-
GGCTCCA 1921 AGTTGACCAGGATGTGTGGATTCAGAAGCAGAAAGGCAGGAGCTA-
GCACCTCTCTCACGCTGGGTACACTTGTCCTGGCC 2001
TGTGTTTGCCTCACCCTGGCCTTTACAGTGTAAAAACACCATGGGACTTTAGAGCAGGGAAGGATAAGGAACA-
GTGTCAC 2081 TTCTAGAGCCTTCTGCTGGTAGACGCTCCTACTGATAGAGGAGGT-
AAAGACTACTGACCTCCCGGCTAGGCCTGGCTTAA 2161
GCCAGGCGTGGCCTGCGTCACAACCTTTTGCGGTGTCTTAGCAACCTGAACCTGAGATCTTATTCCCGAATCC-
CACAGGG 2241 CCCAATGTGCAGGGCTCAGCCTGGGGCCATCTCCCTTTTCACCTG-
GGTTGGTGAGCATGTATTTGGAGTGGTTTCTTCCT 2321
GCATGTATTAGCCAAGGAAGGACAAGGGACTAGAGGGTCTGAGTTAGGTCCAGACTTGTCCCCTTTCCCCAGC-
CCATCAC 2401 AGGATGCTGGGTGGACACCCACTCCACTGACGATGTCCCACCAAC-
ATCCAGGAGGCGTTCTCCCAAGGACTTTAAAGCAA 2481
ATAAAACATATATTGTTCAGAAAAAAAAAAAAAAAAAAAA
[0032] TSC2
[0033] TSC2 is a novel 1863 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
3 1
AAGCGTGACCCTAAGTCTAGCCTGGAGCCAGGGCTAGAGTGGTCATTTCTTTGTGGGGTGCTG-
CCAGGGAGGGGCCAGAC (SEQ ID NO: 2) 81
CCACAGGCTACTCAAAGGGCCTAGAGACCCCTCCCCAGGCAGGTGCTGCCCCAGGAGGAGCATGTCCTGGGGT-
CCGGGGA 161 CTGAAGTCCATGTGGCCTCAGCCCCCCACACCCAGAACACCGCTTG-
CCTAAGGTGCTTTTGGCTTTAGTGTGTGATGTTT 241
GCTGTGCTTCTGGGCTGAATTAGCTTCCAAATCAGGACCTGGAGCCTCTACCCTGGCCCAGCCAGCCAGTGTG-
AGCTCTG 321 GTCTGTGAGATGGGCAGCTACGGGCCAGTGGAGCAGCATGTGGTGG-
GAGGGGCAAGGCTGGGACCCAGTGGTTTACAGAC 401
CTGTGCCCCTCCTGGAGCAACCTGGCAGCTACGGATCCCAGAACCCCCTGGGCTTCAGCTCCCCCAGAGGGGA-
GAGGCTC 481 CACGTTGCTTTCCTTCCCCAAAATCCCTTTCTTTGTGCTGGTGTCT-
GGGACCAAAAGGAGTGGGCAGAGGACTCGGAGGG 561
CCTAGGGGTCCCAGTCGGGGCATCTGTAGCTCCTAAGCACGACAAGCATCAGTGCAGGGGACCCTGGCCTTGA-
CTCCAAC 641 TGGCCTGGCGCCAGGAACCTCCAGGGCCAGAGCAGCCCAGCTGCAG-
CCAGCCTGCCCACTATGGGTATGTTCCTGGCCTA 721
AGGTCCGGAGGGAGGTTTGGGGTATCCCTGCCTGGGTGCCTGGGTGTGCCCTGGGGCCTCTCAGAAGCACAAA-
TGCTGCC 801 CCCTGGCCGTGAGCAGGCCACAAGGTGAATGTATATAGCATGAGAG-
GCGGCCACTGCCCAGACGTGGCTGTGAACTTGTG 881
CTGTCTCGGGAGTCCTGACCTTCTGTGCGTGAGTGCCCCCATCTGTGACGTTTCACTCACCGAGGCTGAAGAA-
AGGAAGC 961 AGGGGAAATGAAAGCAGGGGTTTCTCGCCCTGACCCCTGCGGAGGA-
GACGGCTCCTACCACTGCGGTTGGCTTCATTTCG 1041
TTTTCCTGATTTCTGGGGTGCCACTTACCTACTCAATCCCAGTGGTCCACCCCCACATCCCCAGGGAGTGAGC-
AGTCCAG 1121 TGCCAGCTGCCTGTGATTGGTCCCCAGTCCCTATTACCCAAGGGG-
ACCCTACAGCTCTGGTGGGTAACAAGGAGGGCTAA 1201
GCCACCAAACCAGAGCCCGATCCCTTGCCGAGCCAGGAGGAGGGATCTGGCTGAGAAAACTGATAGGACTGGA-
GGCCCCC 1281 ACCCCAACCAACACTCTCTGGTTTATGTGAGTAGCAGAAGATCCC-
GGCCTGGAGCATCCTTCAAGCCCTTCTCCCTGTGC 1361
CCACCCCGCCCCCCCCCCCCCCCATATCACTATGCAATTCTTGACCCCAGCTCCAAAGCTTGCCCTACCCGGT-
CCCAGCT 1441 CTGTCCGGCCCAGAAGGTGGCTAGCTGGTGGGCCACAGGTGACCA-
GGGTCTCTTTGTTT TTCATCACAGCGGTGGTGTGC 1521
CGCACCCTTCCTCCCATATGTGATTTTGTGAGATTGCCTCCCAGTTACGGTCCCTCTGCCTGCATCTGCCCCC-
AGTGGAC 1601 TATGTCATCTGAATCGAGCCAGCCCCAAGTTCCCCTCCAGCCTCT-
GTAGGGCCATGGCTGTGTGTTACTGTTGCTGTGCT 1681
TTCATTTTTTAAACTGGGTTTGGGGTTTGATTTTTATTTCTGTGGGGAACTTTATTTTTCTTGGCAAATAACT-
AAAGTTC 1761 TTGTCCATGTAATTTCTGTGGTCTCTATTCAGCTTGGGTTTCATG-
TTTTAAAATAAACAATTTTAAGAAACAAAAAAAAA 1841 AAAAAAAAAAAAAAAAAAGC
[0034] TSC3
[0035] TSC3 is a novel 750 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
4 CTTGTTTATCCTACTCGGGTAGTTTCCTACTAATTTCAAGACTAGTGTTAACATTCTAAGGTAG-
TTATCTTAGGGTAGAT (SEQ ID NO: 3) 81
TCAAGGTTTTAGATGACTAACAGTTCAGATTTTCTGATCAATTTTTTAAACACTAGAGAATAAAAGTGTACTA-
GAGAATA 161 AAAGCAGCTTCATAGTTAATTCTCACCAATTGGCCCTTTGCTAGCT-
GCTGGCTTTAGGTACACATAGGATAATATGTGTC 241
CACGTTTCTACTTGGAACTGGTAAAAGTTGTCACTGGCTGGAAAATGGTATCTCTCTCTTGTATACAAGATGG-
TCCATTG 321 ACACTGGTACTTTATGAAGCAGTTCTTTGTTTGTTTGATTGAGCTC-
TCTTGAACCTTGTTCATCTTTTAGTTTTTGCTTG 401
GAATGGAATGGAACTGGTTTGAAGTTAAAGGAAATATTCATTTTGAAACTTGTTCATTTTGAAAGGAAATGCA-
AGTTTCA 481 AAATGAAAAATAAAATGAAAAAGGAAATAAATTATTGTCCCAGATG-
GTCACTTGAGTTTTAAAAAATGGCTGCACACAGT 561
AAAACTGCTAAAAACAAAAACTTACCTCATTATTGGTTTGCATCTTTTTTCAGCTACTAATTTTATACCAAAA-
TGTTAAA 641 TATTTATATTGTTTGAGTTTCAATCTTGTATGGAAAAAAATAATTA-
GTAGGTCTAAAAATGCCATGCTTTCCAATAAAGA 721
AGTTAAAAAAATCATCAGTAATGTGAATTT
[0036] TSC4
[0037] TSC4 is a novel 281 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
5 1
GGGCCCCTCCGTCTCAGAGCAACTATACCCTCTACCTCGGAAGGAGCAGCAGAGAGAGAAGCC-
ACAGGCCACCAGGAGGC (SEQ ID NO: 4) 81
CCAGCAAAGCCACCAACTATGGAAGCTTCTCAGCCACCCCACCTCCCACCCTCTGGGAGGTCAGCACAAGAGT-
TGTGGGC 161 ACAAGCCGTTTCCGGGACAACCGGACAGACAAACGGGAACATGGCC-
ATCAGGACCCAAATGTGGTGCCAGGTCCTCACAA 241
GCCAGTAAAGGGGAAGCTGCCCAAAAAGAAGGACAGAATTC
[0038] TSC5
[0039] TSC5 is a novel 1568 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
6 1
CGCGCGGGAGCCAAGATGCCTCGCGGGGACTCGGAGCAGGTGCGCTACTGCGCGCGCTTCTCC-
TATCTTTGGCTCAAGTT (SEQ ID NO: 5) 81
CTCTCTCATCATCTACTCCACCGTGTTCTGGCTGATTGGGGGCCTGGTCCTGTCAGTGGGGATCTACGCAGAG-
GCAGAGC 161 GGCAGAAATACAAAACCCTGGAAGAGTGCCTTCCTGGCCCCCGCCA-
TCATCCTCATCCTCCTGGGGGTGGTCATGTTCAT 241
CGTCTCCTTCATCGGGGTGCTGGCTTCCCTCCCGGACAACCTGTGCCTTCTGCAGTCGTTTATGTATATCCTG-
GGGATCT 321 GCCTGGTCATGGAGCTTATTGGTGGGTCTGTATTTAGGGGCCGCCG-
GAACCAGACTATTGACTTTCTGAACGACAACATC 401
CGGAGAGGAATCGAGAATTACTACGATGATCTGGACTTCAAGAACATCATGGACTTTGTTCAGAAGAAGTTCA-
AGTGCTG 481 TGGCGGGGAGGACTACAGAGACTGGAGCAAAAACCAGTACCATGAC-
TGCAGCGCCCCCGGGCCCCTGGCTGACGGGGTTC 561
CCTACACCTGCTGCATCAGGAACACGATGTTGTCAACACCATGTGTGGCTACAAAACAATCGACAAGGAGCGC-
CTGAATG 641 CACAGAACATCATTCACGTGCGGGGCTGCACCAACGCCGTGTTGAT-
ATGGTTCATGGACAACTATACCATCATGGCGGGC 721
CTTTTACTGGGCATCCTGCTTCCTCAGTTTCTTGGTGTGCTGCTGACCCTACTGTACATCACCCGTGTGGAGG-
ACATTAT 801 CTTGGAGCACTCTGTCACGGATGGATTGCTGGGACCTGGTGCCAAG-
TCCAGAACGGACACAGCAGGCACTGGATGCTGCC 881
TGTGCTATCCCGATTAGCTATGCTGATTGAGCTATCCTGGCCCGGCACAGCAGCTCCCAGCCGGACTGTACTG-
CAAAGTG 961 CATCTAAGACTACACAAGCTGGACAGGACCAGCTGCAGCTCCTCTG-
CCCACCCACGGCGCTGACCAAAGCCCAGGGTGTA 1041
TGTACCTGCGTATAGTGTCTGATGGCCACTCCTCCTAGGGGAAAGCTGAACCCTGTGGGATCCCGGGAACAGG-
GATAGCC 1121 CAGCTCCGGTTCTGAGTCCTGGAGAAGGCAGCTCAGGGCTCCGTG-
TGGGCTCTTTTTCTTTCTGGCAGTGCCTTGGCCAG 1201
TGGTCATTATGCCCCTTCAAGGGCAGTTTTGCAGTGATTATTTTTAAAGGCAAGAAGGGAGTGTATCTGTTCT-
ATAGGGA 1281 AGTCCTGGGTGCAGCCCTGGTACACTACTCTAGATGTGACGTTGG-
ACTGTGTCTCAAATTCCCAGGTGCCTTGAGTCCTC 1361
TGTAAGGCTCCTGCTTTGCCCACCCATTTTCTACATATGTTTTTTTTCTTTTTTTTTTTTAATAACCGTGTTT-
TGTATAC 1441 AATTAACAAGAGTTTCTGGCTATTCAAAACTAGCCACCCCTGACC-
GAGTCCACTCACCC CTCCCCGTTAGTTCATTAATT 1521
GAACAATAAATATGTGTTTTGGGGGGTGGTCTTTAAAAAAAAAAAAAA
[0040] TSC6
[0041] TSC6 is a novel 300 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
7 1 gccggctctt tgtggaggac tccatccatg (SEQ ID NO: 6) accagtttgt
gcagaaagtg gtggaggaag 61 tagggaagat gaaaatcggc gaccccctgg
acagggatac caaccatggc ccgcagaacc 121 atgaggccca cctgaggaag
ctggtggagt attgccaacg tggtgtgaag gaaggggcca 181 cactggtctg
tggtgggaac caagtcccaa ggccaggctt cttctttcag ccaaccgttt 241
tcacagacgt ggaggaccac atgtacatcg ctaaggagga gtccttcggg
cccatcatga
[0042] TSC7
[0043] TSC7 is a novel 965 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
8 1
CCCACAGCTCCTGCCCACTCACCAGGTCCAGGGGAGAGCAGGCGGTGACTCGATGACAAGTGC-
CTTTAGTTGAAGAGCAC (SEQ ID NO: 7) 81
ATCTCACTCATTCCTCTCTCAGTACCTGATACATTCCTCTGTGCTAACCCCCCCTTGGGGAGGACCCACCCTC-
TGGAGGC 161 TGGACTTGGGGCGAACAGGCACTCACCTGTCACTGCCAAGGGCGGG-
CAGGCCATCCTTCCGAGCCCATGGGAGCCGGGAC 241
CACTAAGACTGCTGGTGGGAAGAAGTTGGGTGCTGGGCTGATGGTCTTGCTTTCTCTTGGTCTTCGCTTGTAA-
TGTGGCT 321 GGCCCATGTTGGTTTTATGTTTAATGCTGTGCTTATAATAAGAAAG-
AGCCCCCCCAAGCTGTACATTTATAAAAAGTGAT 401
CATATACTGTATATAGAAAAATCTAGAAGCACATATGAATGCAGCAGGTAGTATTCCACTGTACCCATTCATG-
AAGGTAG 481 GTTTTATTACAGGACTCGCACCAGGTACTTACAGACGCGCCCTCTC-
CTCTTTGCCTAGAGAAACAGTCACTGCATTCCCG 561
CACAGTCCCTCAGACCCCCTTACCCTCTTCCCTGTAGGAAATTCTCCTGTGACCCCTCTGCCGTCCTCCCTTA-
CTTCCTA 641 AATAAATGTAACGGAGTCAGTGCAAAAAAAAAAAAATAAATGACAT-
TTATTGTGGGTTATAATTTTCTCCTAAAAACAAA 721
ACCAGTGGTATGGTCATACCCACCATTGTTTCCCCACTTTCCATGACCGTCACAAACATCTGGGATGAGCACC-
TTGTGAG 801 CAGGAAAAGTTATGCTTTAAGAAATTTCTGGCCAGGCGTGGTGGCA-
TACACCTTTAATCCCAGCACTCGGGAGGCAGAGG 881
CAGGTGGATTTCTGAGTTCGAGGCCACCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-
AACCCTG 961 TCTCG
[0044] TSC8
[0045] TSC8 is a novel 408 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
9 1 gccgggtctg aaaaggacta ggctggcatt (SEQ ID NO: 8) ggtgacaccg
agcttgttgg cagccacaca 61 ggtatagttg ccatagtgtt cctcagtgac
attggtcacc gtcagggagg actggccctc 121 agtgctctta atctcaaggc
catttgcact gtttatcctg gtgtcatccc ggtaccactc 181 aaagtcaggt
gcaggcaccg ctgaggcttc acatttgagg gaagcttgtc gtcctgtggt 241
ggcttcgttg ctcticgact ccgtgatagt gggtggatag ttcacagtga ccttgacttg
301 tttgacatcc gccgaggaga cctcgttggc agccttgcac tcatatttgc
ctgactgttc 361 cctggtgatg cctaggatct ccagatattc ttcttctcct
tcaaatty
[0046] TSC10
[0047] TSC10 is a novel 354 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
10 1 gtgcaccaga tgttctacga ggccctagat (SEQ ID NO: 9) aagtacggga
acctcagtgc tctgggcttc 61 aagcgcaagg acaagtggga gcgtatctct
tactgccagt actacctgat tgcacgcaaa 121 gtagccaaag gcttcttgaa
gctcggccta gagcgtgccc acagcgtggc gatccttggc 181 ttcaactctc
cagaatggtt cttctctgca gtgggcacag tgttcgcagg gggcattgtc 241
actggcatct acaccaccag ctccccggag gcctgccagt acatctctca tgactgccga
301 gccaatgtca tcgtggttga cacacagaag cagctggaaa agatcctgaa
gatct
[0048] TSC11
[0049] TSC11 is a novel 955 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
11 1
CGGATCATCTGGGTCGCGACCTTGAGGCCGGGAATCGAGTTTCCAAACGTGCGGGGGCCTTC-
GCCGGCTCTGCTGCCCCC (SEQ ID NO: 10) 81
TTTCTCTCCATGGCAGCGGCCCGGAACCTGCGCACCGCGTCATATTCGGAGGCTTCATCTCCATGGTCGGCGC-
CGCCTTC 161 TATCCCATCTACTTCCGGCCCCTTATGCGGCTGGAGGAATACCAGA-
AGGAGCAGGCTGTAAATCGAGCTGGTATTGTCCA 241
GGAAGATGTGCAACCGCCAGGTTGAAAGTGTGGTCTGATCCATTTGGCAGGAAATGAGGCTGTCAGCAAGTCT-
GATGAGG 321 AAAGTGGACGTCTTTATCCTGTGCACTCCGCAGTGGGGACAATAGA-
TGCCTCACTGTGGCAGCATGGCATGGAGAGGGAA 401
CTCTCATGCTGCTAGCCAGACCCCTTGTGATAGAGACTGTGTGCAAAGACAGTGCTTCCCTTAACTCCCTGGA-
GAACCTG 481 AACAGATGCCACCATTAGGAAGTGCCTTGCGGCTCCATTGACTTTG-
CAGGAGCAGAGCCAGCCTGCAAGGCTGTTTGTGG 561
AAGATCTGCTGCTCCTGCAGTCTTTATCACTTCCAAGCTGTGATGTGAACACAAGCAACCTGTGGGCTCAAGG-
TCCGTGG 641 CTGCTCTGACACCTTTTGAATAAGCGATTTCAGTGCAAATGGCCTT-
GCCAAGCTGCCTCGCAGGGTTCTTGGAGGATGTT 721
TCAGTTGATAAAACTGTTTGAAGACAGGATCCTTGGCACTGTTTAAGAATATACACTGCTCAGCTTAACCATT-
TCATTGA 801 AAGTCACTGTGTGTGGAAGTGAATAGGGAGCGAGTCACACTAGACT-
ATACCACACACAGTAGATTCCTGCGTGAGGCTGC 881
AGGTATTAAAATGGTTTCTCTTAAAAAAAAAAAAAAAA
[0050] TSC12
[0051] TSC12 is a novel 1113 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
12 1
GGAGACCCAAGATCTGAACCAGCCAGCCAGGTGCTGCACAGCCTCAACTTTGGGAGCAGAGG-
CCCTGTGGGGTTAACTTG (SEQ ID NO: 11) 81
GGTCTGCCAGAAACAGTGCTTCCCGCAGGGAAAATCTTGGGTCAAGATGGAGGCTGCTCTGGAACACTGAGTG-
TTTCAAG 161 GGAGAAAGAGTGGGAACCGTGGCCCTTTGGGCCCAGACCCTGCAGG-
AGCTTGCCTCGCCTTTGAGGAGGAGGCACTGCTC 241
TTCAGGTGCCCTGGAGGGGCTTTTAGTGCCATCCCCACAGCAGAGTAAAGGTGGCGCGTATGTCATCGGGTGG-
CTTTGCG 321 CTGGTAGAACGCTGTTCTCTACCCTGCTGCAGCCTTTCACACTCAC-
ACACACCCAAACACACACTTCTCGGCCCTGTATG 401
TTCAGGTGAGAGACAAGGGAAGATGGCTCATCATTTTCAGCCATGTCCCCAAAGTGGCCTCTCTTTCATGCTC-
TGTGGGC 481 TTTGGCCTGCAGCTGTTCCAGAGTTAGGGATGTGATTTTTGTCTGT-
GAGGTACCCCTTGCCCTAGTGGATCAGTTACAGG 561
CCTATGTCCAGCACCAGAGTCCCTGTTCCGATATCATCACAGATAGCCTGTTGTTTTCCACAGAGGAGCCAGA-
TGTAAGT 641 CAGACACCTCCAGCCTACCAGTCTCCTGCCATCAGCTTTGGCTCTA-
ATGGGCTCTTGGTGGCCTCCTTGGTGTGTCACTG 721
GTACAGGACAGCAAGTGGCTCAGAAAGGCTGCTTGCTCCTGAGCTCAGCCACTTATTCACATGGTTCAGAGCA-
GATCTTT 801 GTACTCTTCAGACTCAAGTATGGTGATCTGTTTGACAGTAGAGGTC-
TGGCCTACCCCTCACCCTCATTCTCCAGCACCTC 881
TAACAAGAACCACACTCATGCCTCTGGTGTCAGTTTTCTTGTCTGCCTTCCCTGGCCTACCTAGATATTTATT-
TCTTGTG 961 TTTTATGAATAGTTAAGCCCTGCCCATCTGTGCCTTTCAGACGGAA-
ACACAGAAACCTAGGCTGTGCCATTTGTCTTCTC 1041
ACAGTTGTTTAATGAAACCTCAAGGAATATGGAAATAAAGCCTAGACCCTGGAGTGGTGAAAGAGTAAAAAAA
[0052] TSC15
[0053] TSC15 is a novel 594 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
13 1
AGATCTCTGTTTCCTCTTTCTTCTCTCCTCTATGCTCTTCTGTAGCCTACCCTCAGGGTGAT-
CTCTAACCCAAACTAATC (SEQ ID NO: 12) 81
CCGAGGAACAGACACTTGGCTCAGCTCCACCTACTACCTGGCTCACCTGTTCCCAGAATCTCCATAGAAGAGG-
GCACTTT 161 CTTTCTCAAGTTACCCTAACATTCTCTGCAGGATAAAATCATGAGT-
CCAGCCTGTCTGTGGAACTGGGGCCTGTCTGCAG 241
CTTCCCTGCAGAAGTGTCCATTCACTTTGGGTGATCTTCCCGACCAAGATACTTAGGTGTTTTGGCCAGCACC-
AGTATTT 321 CTATGAATTCCTGATCTGGAGTTGAATAGACAGGAATCAAGACCTA-
GGCTTTTCACTGTGTGAACCTGAGCATGTGGCCT 401
GACCTGCTGGAAGCTCCTCTGCTCTTGTGTGAAGCAGGAATGCTGTCAGGCACACAGCACAACACACCAGTGG-
TGGAGAA 481 CGCTAATCCCAACACACAAATTCCACAGAAATGCCACTATCCTCGG-
GTCTCCTGCCTAACCATGGACAAAGCTGAGAATA 561
AACAGTGCTTTACTTTGAAAAAAAAAAAAAAAAA
[0054] TSC16
[0055] TSC16 is a novel 713 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
14 1
CAATTGTTTTTTCTAACCATCTTAGGGAACAATACATTGCAATAATTGATAATAGTGCCATC-
ACTGTAATAAACTTTAGA (SEQ ID NO: 13) 81
GACTTTTTTTAATGTAAAAGTTGTTGGTCACCTTGTTTCCTGTAACCTTCACTCTGTCACACGAGTTGGCTCA-
TAGGTTG 161 TGTTTGTCTATCAGAAATAAGAAAAACACAAGTGAAGAAAATGTTG-
GCATGAAGTCATCCATCTGCAATGAAAAACCTAA 241
AAGACTACGGGTCACTCATGTTATCAATATAATTTATAATCCTGTTCAGTGTACAAAATTGTGGGTTTTGTAC-
TCACCCA 321 AAAGACTAAAACACCAGTTTTTCTTACAGTATCTATCTACAGAGCT-
TATTCTCCCCTATTATTTGGGAAACTCTGAGACT 401
CCATATTGCAGAAGTCAAGGAATAGGCCATATAAGAAAATGTAGCTTGTTTTTATTATTTCTGCATATTTATT-
TCTAGAT 481 CTTGGGCTCATTTGTTAACAGAATAAGTTGTCAAAGGTAAAGTCCT-
TGAGTCTGGGAATGAGCCATCGTTCCAAAACCAA 561
CACACCCTGTGTGGAAATTTTACTTGACTCTGTTTTGCTGCATAGAATTCAGTGTCTCTTGGCCATTCCCCCT-
CATTCCT 641 ATACTAAATTCTTTGAAGACACTGGTAACAGTTTGTGGTAGACTAC-
AGTTGAAAAAACTCAATCCTTATTTCT
[0056] TSC17
[0057] TSC17 is a novel 306 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
15 1 ggatccctcc accctatgac aagaaaaagc (SEQ ID NO: 14) ggatggtggt
ccctgctgct ctcaagggtt 61 gttcgcgctg aagcctacca gaaagtttgc
ttacctgggg cgtctggcgc atgaggtcgg 121 gtggaagtac caggcagtga
cagccactct ggaggagaaa cggaaggaaa aggccaagat 181 gcactatcgg
aagaagaagc agatcttgag gttacggaaa caggcagaaa agaatgtgga 241
gaagaaaatc tgcaagttca cagaggtcct caagaccaac ggactcctgg tgtgaaccca
301 ataaag
[0058] TSC18
[0059] TSC18 is a novel 66 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
16 1 gaattcgaat cacgctcacc agccgcaacg (SEQ ID NO: 15) tgaagtcgct
ggagaaggtt tgtgcggact 61 tgatca
[0060] TSC19
[0061] TSC19 is a novel 1613 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
17 1
CCAGCTCAGAGGTTCTAGGGGCAGCCGGCGCGCTTCTCTAGTTGCAGCTTGGGCGGCTCCTG-
TGGTGGGCGGCTAGGGGC (SEQ ID NO: 16) 81
GAGCCGGGATGGGCTATAGACGCGCGACGTGATCAGTTCGCACGCGGACCCACGCCTCCCATCGCTCTGCCTC-
AAGAGCC 161 TATTCTGTGGGTGCAGGCACGCACCGGACGCAGACCCGGCCGGAGC-
ATGCGGGGTGCGGTGTGGGCGGCCCGGAGGCGCG 241
CGGGGCAGCAGTGCCCTCGGTCCCCGGGCCCTGGGCCGGGTCCGCCCCCGCCGCCACCGCTGCTGTTGCTGCT-
ACTACTG 321 CTGCTGGGCGGCGCGAGCGCTCAGTACTCCAGCGACCTGTGCAGCT-
GGAAGGGGAGTGGGCTCACCCGAGAGGCACGCAG 401
CAAGGAGGTGGAGCAGGTGTACCTGCGCTGCTCCGCAGGCTCTGTGGAGTGGATGTACCCAACTGGGGCGCTC-
ATTGTTA 481 ACTACGGGCCCAACACCTTCTCACCTGCCCAGAACTTGACTGTGTG-
CATCAAGCCTTTCAGGCACTCCTCTGGAGCCAAT 561
ATTTATTTGGAAAAAACTGGAGAACTAAGACTGTTGGTGCGGGACATCAGAGCTGAGCCTGGCCAAGTGCAGT-
GCTTCAG 641 CCTGGAGCAGGGAGGCTTATTTGTGGAGGCGACACCCCAACAGGAC-
ATCAGCAGAAGGACCACAGGCTTCCAGTATGAGC 721
TGATGAGTGGGCAGAGGGGACTGGACCTGCACGTGCTGTCTGCCCCCTGTCGGCCTTGCAGTGACACTGAGGT-
CCTCCTT 801 GCCATCTGTACCAGTGACTTTGTTGTCCGAGGCTTCATTGAGGACG-
TCACACATGTACCAGAACAGCAAGTGTCAGTCAT 881
CTACCTGCGGGTGAACAGGCTTCACAGGCAGAAGAGCAGGGTCTTCCAGCCAGCTCCTGAGGACAGTGGCCAC-
TGGCTGG 961 GCCATGTCACAACACTGCTGCAGTGTGGAGTACGACCAGGGCATGG-
GGAATTCCTCTTCACTGGACATGTGCACTTTGGG 1041
GAGGCACAACTTGGATGTGCCCCACGCTTTAGTGACTTTCAAAGGATGTACAGGAAAGCAGAAGAAATGGGCA-
TAAACCC 1121 CTGTGAAATCAATATGGAGTGACTTGCAGGGTGACACAGTACTGT-
TGTCCTTCAGATGAGCCATGTTTTGTGGGCTCAGT 1201
CGCTCTATCATATCCTGATAGAGATTGCAGACTGGTGGCATGGGCCCAGCCTGGTGCTAGAACTGGGAAGGTA-
CATGCTG 1281 TTCTGACCCCTTAGGTCCCAGCCAAGGATGCCCTGACCCATTGGA-
ACTGCTGTAAAATGCAAACTAAGTTATTATATTTT 1361
TTTTGTAAAAGAAAAAAAAAAAAAAAAAAGAAAACTCCGCGCACAGGGGGGGTACGTCCCAATTCGCCAAAAA-
CAGATGC 1441 TAGAACCCCTGGCGGCCCCCCCACCCCCACGGGAGACACTAGCTA-
ACCAATTAATGCTT GGAAAATCCCTTCTGCACCGG 1521
TAGTACGAAAGGCCCACGATGCCTTCAAAGCTGCCTGGACGGAATGCAAATGAACGCTAATTTCTAATCCGGT-
AATTGTA 1601 ACCGCATTCTACA
[0062] TSC20
[0063] TSC20 is a novel 2245 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
18 1
ACGTGACCGTGAGACCCTAGGAGCAATGGCGGGGCGGCTGGCTGGCTTCCTGATGTTGCTGG-
GGCTCGCGTCGCAGGGGC (SEQ ID NO: 17) 81
CCGCGCCGGCATGTGCCGGGAAGATGAAGGTGGTGGAGGAGCCTAACACATTCGGGCTGAATAACCCGTTCTT-
GCCCCAG 161 GCAAGCCGCCTTCAGCCCAAGAGAGAGCCTTCAGCTGTATCCGGGC-
CCCTGCATCTCTTCAGACTTGCTGGCAAGTGCTT 241
TAGCCTAGTGGAGTCCACGTACAAGTATGAATTCTGCCCTTTCCACAACGTCACCCAGCACGAGCAGACCTTC-
CGCTGGA 321 ATGCCTACAGCGGGATCCTTGGCATCTGGCATGAGTGGGAAATCAT-
CAACAATACCTTCAAGGGCATGTGGATGACTGAT 401
GGGGACTCCTGCCACTCCCGGAGCCGGCAGAGCAAGGTGGAGCTCACCTGTGGAAAGATCAACCGACTGGCCC-
ACGTGTC 481 TGAGCCAAGCACCTGTGTCTATGCATTGACATTCGAGACCCCTCTT-
GTTTGCCATCCCCACTCTTTGTTAGTGTATCCAA 561
CTCTGTCAGAGGCCCTGCAGCAGCGCTGGGACCAGGTGGAACAGGACCTGGCAGATGAACTGATCACACCACA-
GGGCTAT 641 GAGAAGTTGCTAAGGGTACTTTTTCGAGGATGCCGGCTACTTAAAG-
GTCCCAGGAGAAACCCATCCCACCCAGCTGGCAG 721
GAGGTTCCAAGGGCCTAGGGCTTGAGACTCTGGACAACTGTAGAAAGGCACATGCAGAGCTGTCACAGGAGGT-
ACAAAGA 801 CTGACGAGTCTGCTGCAACAGCATGGAATCCCCCACACTCAGCCCA-
CAGAAACCACTCACTCTCAGCACCTGGGTCAGCA 881
GCTCCCCATAGGTGCAATCGCAGCAGAGCATCTGCGGAGTGACCCAGGACTACGTGGGAACATCCTGTGAGCA-
AGGTGGC 961 CACGAAGAATAGAAATATCCTGAGCTTTGAGTGTCCTTTCACAGAG-
TGAACAAAACTGGTGTGGTGTAGACACGGCTTCT 1041
TTTGGCATATTCTAGATCAGACAGTGTCACTGACAAACAAGAGGGACCTGCTGGCCAGCCTTTGTTGTGCCCA-
AAGATCC 1121 AGACAAAATAAAGATTCAAAGTTTTAATTAATTCCATACTGATAA-
AAAATAACTCCATGACTTCTGTAAACCATTGCATA 1201
AATGCTATTGTAAAAAAAATTAAACAAATGTTAACAACTTTAACAATTCACTAAAGTAAATGGTTATGTATTA-
TAAATAT 1281 GACCATCTGGGTTAAGAAGATTCCATTCACATAACATTCTCAACT-
AATTTCTGAAGAACAAATGAACACAAAGGCTTCCA 1361
TAAGTTAATCCACATGCGCATCCATACTGGGGGAAGGCCTGCCAACCAGGTACACAAGACTCTGACACTACCA-
TATACTG 1441 TTACTATTCAACACTAGAGAGTTAGACGACAACAGGCATCAGGAC-
AGTGGTGGGTCCCA GTTCCTAGACCCATGGCCCCA 1521
CCTCCATTACCCACACACGGGCCTTAAGGCTCTCTCTCCCCTTCTTGGCCCTTCCCACCCAGGGTAGATCCTA-
GAAGCCT 1601 CAGCTCCTAAGAGGTCTGGAATGGATGGGAAAAGTGGCCCCTTCT-
GGGACGTTCTTTGGTCCTCCCCTGCACACCTGTCC 1681
TCAGAGCTCAGCCTGATTCCAGAAGAGCAGATGCTCAGGAAAGCTCCCCGCATGGGATGGGACCCAGGGTGCA-
CTACCGC 1761 CTGCCTCCCCAGCCATCACAACAGCCCCAGAACTGCCCAGCCCCA-
GCCTGGAATGTCAGCCCAGGAGGAGTTAACCAGAG 1841
TAGCTTACATACAATCTAAAGCTTAATGTAACTGTATACAACTTGAAATTGTCCCGATGAGCTATCAATCACA-
AACACTG 1921 TCCTGTTACCACAGAGACCAAAAGCCTGACATGGGAAACAGTTCA-
TAAATATGAATAAAAATAAACAATCTTAAACCATG 2001
GTAACAGTAGCACCAAATACACATGATCTAGGTACTGAGCTAATAAATCATTATCACTATAATTAAAAACAAA-
AGTCACT 2081 GAAATCAGGTCAATAGTTACCTTATTAAGTAGTGGGCTAGCTGTG-
GAATGTTGAAGATCCATTTCCTTTAAAATGATATA 2161
GGTCTTTTCTATCAGTTTGTCTTATATTAAAAAATGCTTTTAAATTTCCTACTATATTAAATACATTCTAATT-
TGGTCAC 2241 TGATA
[0064] TSC21
[0065] TSC21 is a novel 171 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
19 1 actagtcacc aaaatgcttg gttctaagtg (SEQ ID NO: 18) gtagagaagg
agacacccta gatataatac 61 aggtcaactt tttgacgtgg ggtgggggtg
ggggtggggg tgggggtgaa catcacggtc 121 gcaaataagc agggtttgag
ctttgtccag attgtagact taataaaatt y
[0066] TSC22
[0067] TSC22 is a novel 491 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
20 1
CAGTTGCAGAAGGGAGAAATCACGGCAGAATCATCGAGAAACCTGAAAAATGAGACCTAGAA-
TGAAGTATTCCAACTCCA (SEQ ID NO: 19) 81
AGATTTCCCCGGCAAAGTTCAGCAGCACCGCAGGCGAAGCCCTGGTCCCGCCTTGCAAAATAAGAAGATCCCA-
ACATAAG 161 ACCAAAGAATTCTGCCATGTCTACTGCATGAGACTCCGTTCTGGCC-
TCACCATAAGAAAGGAGACTAGTTATTTTAGGAA 241
AGAACCCACGAAAAGATATTCACTAAAATCGGGTACCAAGCATGAAGAGAACTTCTCTGCCTATCCACGGGAT-
TCTAGGA 321 AGAGATCCTTGCTTGGCAGTATCCAAGCATTTGCTGCGTCTGTTGA-
CACATTGAGCATCCAAGGAACTTCACTTTTAACA 401
CAGTCTCCTGCCTCCCTGAGTACATACAATGACCAATCTGTTAGTTTTGTTTTGGAGAATGGATGTTATGTGA-
TCAATGT 481 TGACGACTCTG
[0068] TSC23
[0069] TSC23 is a novel 659 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
21 1
ATTTGGAATTTTAAGTTTTATCAATGCTTCTGGAAGCTTAGAACTGTACACGTGTGATGTCA-
GTCACATAGAGGAATGTG (SEQ ID NO: 20) 81
CCCGGACTGCCTCATGCCTTTATTTTCCTTGGTAAATTTGAAGATAGAATGTCTGACTAGCGCAGTGACCAGA-
AAACAAT 161 GTGGTAGTCAACATCTCAGGCCATATTTTAAGATCCTGTAGAGCAC-
TATTCATTTCAGGTTGCAGATGGAGTATTTTTGA 241
AACATCATTACTATGTAGATGCTTGGATAGGAGTGAGGGGGAGCTAGCAGATTTCCTGTGCCATTTATTCAGC-
TGATTGA 321 TGTACAGATGTAGGTTTATTTTGTAAAATCCACTGAAAGAATATGG-
CCACACCCTTGCCTACTTGATAGCATCAATACAG 401
AAGCCAAGAAGGACCACTAAGTAACCCCCTCTTCCCAGGGAGAGCAGCTAGCTTGAAATCTCTCGGATACAAT-
CGATGCG 481 TCTGACCTTTGGGATCCTCACCATATGGGCAAACAATGGGCTTTGC-
AGGATGAGAGACACCCACTTAAACCTCTGACGAT 561
CTCGAATGGTTCATCTCTTCCGTCATTAACCAGTCATGGAAAACAATCAACAAACTCTGCCACGTGAAATATT-
TTTTCAG 641 ACTTTTCTAACCCAAGCTT
[0070] TSC24
[0071] TSC24 is a novel 341 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
22 1 raattcaaac aaagctttgg acaaggcccg gttaaaaagc aaagatgtca
agttggcaga (SEQ ID NO:21) 61 gactcatcag caggaatgct gccagaagtt
tgaacagctt tctgaatctg caaaagaaga 121 gctgataaac ttcaaacgga
agagagtggc agcatttcga aagaacctaa tcgaaatgtc 181 tgaactggaa
ataaagcatg ccagaaacaa cgtctccctg ttgcagagct gcatcgactt 241
attcaagaac aactgacctg tctactctga aggacaccaa tgtgaaagcc agcatcactt
301 gcacttaaat cattactgca aaagaaatag ctttgactag t
[0072] TSC25
[0073] TSC25 is a novel 53 bp gene fragment. The nucleic acid was
initially identified in a cloned fragment having the following
sequence:
23 1 ggatcctgca aggctttggc cagctcagaa gcggcaaccc ctacacacct agg
(SEQ ID NO:22)
[0074] General Methods
[0075] The TSCX nucleic acids and encoded polypeptides can be
identified using the information provide above. In some
embodiments, the TSCX nucleic acids and polypeptide correspond to
nucleic acids or polypeptides which include the various sequences
(referenced by SEQ ID NOs) disclosed for each TSCX polypeptide.
[0076] In its various aspects and embodiments, the invention
includes providing a test cell population which includes at least
one cell that is capable of expressing one or more of the sequences
TSC 1-142. By "capable of expressing" is meant that the gene is
present in an intact form in the cell and can be expressed.
Expression of one, some, or all of the TSCX sequences is then
detected, if present, and, preferably, measured. Using sequence
information provided by the database entries for the known
sequences, or the sequence information for the newly described
sequences, expression of the TSCX sequences can be detected (if
present) and measured using techniques well known to one of
ordinary skill in the art. For example, sequences within the
sequence database entries corresponding to TSCX sequences, or
within the sequences disclosed herein, can be used to construct
probes for detecting TSCX RNA sequences in, e.g., northern blot
hybridization analyses or methods which specifically, and,
preferably, quantitatively amplify specific nucleic acid sequences.
As another example, the sequences can be used to construct primers
for specifically amplifying the TSCX sequences in, e.g.,
amplification-based detection methods such as reverse-transcription
based polymerase chain reaction. When alterations in gene
expression are associated with gene amplification or deletion,
sequence comparisons in test and reference populations can be made
by comparing relative amounts of the examined DNA sequences in the
test and reference cell populations.
[0077] Expression can be also measured at the protein level, i.e.,
by measuring the levels of polypeptides encoded by the gene
products described herein. Such methods are well known in the art
and include, e.g., immunoassays based on antibodies to proteins
encoded by the genes.
[0078] Expression level of the TSCX sequences in the test cell
population is then compared to expression levels of the sequences
in one or more cells from a reference profile. Expression of
sequences in test and control populations of cells can be compared
using any art-recognized method for comparing expression of nucleic
acid sequences. For example, expression can be compared using
GENECALLING.RTM. methods as described in U.S. Pat. No. 5,871,697
and in Shimkets et al., Nat. Biotechnol. 17:798-803. In various
embodiments, the expression of 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20,
25, 35, 40, 50, 100, 150 or all of the sequences represented by TSC
1-142 are measured. If desired, expression of these sequences can
be measured along with other sequences whose expression is known to
be altered according to one of the herein described parameters or
conditions.
[0079] A reference profile is an expression pattern derived from a
single reference population or from a plurality of expression
patterns. The reference profile can be a database of expression
patterns from previously tested cells for which one of the
herein-described conditions (e.g., tuberous sclerosis complex
associated disorder) is known. Tuberous sclerosis complex
assosiated disorders include for example, hamartomas, or hamartias
in multiple organ systens, such as the brain, skin, heart or
kidney, renal carcinoma, malignamnt angiomyolipoma, hypomelanotic
macules, facila angiofibroma, shagreen patches and ungula
fibromas.
[0080] In some embodiments, the test cell will be included in a
cell sample from a subject known to contain, or to be suspected of
having a tuberous sclerosis complex associated disorder. In other
embodiments, the cell sample will be derived from a subject from a
region known to contain, or suspected of containing, a primary
tumor, such as a renal carcinoma. In further embodiments, the cell
sample will be derived from a subject from a region known to
contain, or suspected of containing, a metastasis of a primary
tumor.
[0081] Preferably, cells in the reference profile are derived from
a tissue type as similar as possible to test cell, e.g., brain,
skin, heart or kidney tissue. In some embodiments, the control cell
is derived from the same subject as the test cell, e.g., from a
region proximal to the region of origin of the test cell.
[0082] In some embodiments, the test cell population is compared to
multiple reference profiles. Each of the multiple reference
profiles may differ in the known parameter or condition. Thus, a
test cell population may be compared to a first reference profile
known to have an tuberous sclerosis associated disorder, as well as
a second reference population known not to have a tuberous
sclerosis associated disorder.
[0083] In various embodiments, the expression of one or more
sequences encoding genes of expressed in distinct gene profiles, as
listed in Table 1, is compared. These gene profile include, e.g.,
"MEF and NSC -/- conserved differential expression" (such as, TSC
1-9), "MEF and NSC -/- opposite differential expression" (TSC
10-18), "NSC Only", (TSC 19-44), and "MEF Only" (TSC 45-57). In
some embodiments, expression of members of two or more gene
profiles are compared.
[0084] Whether or not comparison of the gene expression profile in
the test cell population to the reference profile reveals the
presence, or degree, of the measured condition depends on the
composition of the reference profile. For example, if the profile
is composed of cells that have an tuberous sclerosis associated
disorder, a similar gene expression level in the test cell
population and a reference profile indicates the presence of the
tuberous sclerosis associated disorder in the test cell population.
Conversely, if the reference profile is composed of cells that do
not have an tuberous sclerosis associated disorder, a similar gene
expression profile between the test cell population and the
reference profile indicates the absence of the tuberous sclerosis
associated disorder in the test cell population.
[0085] In various embodiments, the TSCX sequence in a test cell
population is considered comparable in expression level to the
expression level of the antileukoprotease sequence if its
expression level varies within a factor of 2.0, 1.5, or 1.0 fold to
the level of the TSCX transcript in the reference profile. In
various embodiments, a TSC sequence in a test cell population can
be considered altered in levels of expression if its expression
level varies from the reference cell population by more than 1.0,
1.5, 2.0 or more fold from the expression level of the
corresponding antileukoprotease sequence in the reference cell
population.
[0086] If desired, comparison of differentially expressed sequences
between a test cell population and a reference profile can be done
with respect to a control nucleic acid whose expression is
independent of the parameter or condition being measured.
Expression levels of the control nucleic acid in the test and
reference nucleic acid can be used to normalize signal levels in
the compared populations.
[0087] The test cell population can be any number of cells, i.e.,
one or more cells, and can be provided in vitro, in vivo, or ex
vivo.
[0088] In other embodiments, the test cell population can be
divided into two or more subpopulations. The subpopulations can be
created by dividing the first population of cells to create as
identical a subpopulation as possible. This will be suitable, in,
for example, in vitro or ex vivo screening methods. In some
embodiments, various sub populations can be exposed to a control
agent, and/or a test agent, multiple test agents, or, e.g., varying
dosages of one or multiple test agents administered together, or in
various combinations.
[0089] The subject is preferably a mammal. The mammal can be, e.g.,
a human, non-human primate, mouse, rat, dog, cat, horse, or
cow.
[0090] Diagnosing a Tuberous Sclerosis Complex Associated
Disorder
[0091] The invention provides a method of diagnosing or determining
the susceptibility of a tuberous sclerosis complex associated
disorder, e.g., hamartomas, or hamartias in multiple organ systens,
such as the brain, skin, heart or kidney, renal carcinoma,
malignant angiomyolipoma, hypomelanotic macules, facila
angiofibroma, shagreen patches and ungula fibromas. A tuberous
sclerosis complex associated disorder is diagnosed by examining the
expression of a nucleic acid encoding a TSCX nucleic acid from a
test population of cells from a subject suspected of having a
tuberous sclerosis complex associated disorder. The population of
cells may contain cells of the brain, or may alternatively may
contain cells the eye, skin, heart, or kidney.
[0092] Expression of a TSCX nucleic acid is measured in the test
cell and compared to the expression of the sequence in the
reference profile. A reference profile can be a TSC disorder
positive reference profile. By "TSC disorder positive reference
profile" is meant that the reference profile contains cells derived
from tissues with a tuberous sclerosis complex associated disorder.
Alternatively, the reference profile can be an TSC disorder
negative reference profile. By "TSC negative reference profile" is
meant that the reference profile contains cells derived from
tissues without a tuberous sclerosis complex associated
disorder.
[0093] When a reference profile is an TSC disorder positive
reference profile, a similarity in expression between TSCX
sequences in the test population and the reference profile
indicates the presence of a tuberous sclerosis complex associated
disorder in the subject. Conversely, a difference in expression in
the test cell population between TSCX sequences in the test
population and the TSC disorder positive reference profile
indicates the absence of a tuberous sclerosis complex associated
disorder in the subject.
[0094] When the reference profile is TSC disorder negative
reference profile, an difference in expression pattern between the
test cell population and the TSC disorder negative reference
profile indicates the presence of a tuberous sclerosis complex
associated disorder. Conversely, a similarity in expression
expression between TSCX sequences in the test population and the
TSC disorder negative reference profile indicates the absence of a
tuberous sclerosis complex associated disorder in the subject.
[0095] Methods of Treating Disorders Associated with Tuberous
Sclerosis Complex
[0096] The invention provides a method for treating tuberous
sclerosis complex associated disorders in a subject by
administering to a subject in need thereof a compound that
modulates the expression of one or more TSCX nucleic acids or
polypeptides. Administration can be prophylactic or therapeutic to
a subject at risk of (or susceptible to) tuberous sclerosis complex
associated disorder. The tuberous sclerosis associated disorder can
be, e.g., hamartomas, or hamartias in multiple organ systens, such
as the brain, skin, heart or kidney, renal carcinoma, malignant
angiomyolipoma, hypomelanotic macules, facila angiofibroma,
shagreen patches and ungula fibromas.
[0097] The therapeutic method includes decreasing or inhibiting the
expression, or function, or TSCX nucleic acids in the diseased cell
relative to normal cells of the tissue type from which the diseased
cells are derived. In these methods, the subject is treated with an
effective amount of a compound, which decreases the amount of a
TSCX nucleic acid or polypeptide in the subject. Administration can
be systemic or local, e.g., in the immediate vicinity of, the
subject's diseased cells. Expression can be inhibited in any of
several ways known in the art. For example, expression can be
inhibited by administering to the subject a nucleic acid that
inhibits, or antagonizes, the expression of the TSCX. In one
embodiment, an antisense oligonucleotide can be administered which
disrupts expression of a TSCX nucleic acid.
[0098] Alternatively, the function a TSCX can be inhibited by
administering a compound that binds to or otherwise inhibits the
function of the TSCX gene products. The compound can be, e.g., an
antibody to a polypeptide encoded by a TSCX nucleic acid.
[0099] These modulatory methods can be performed ex vivo or in
vitro (e.g., by culturing the cell with the agent) or,
alternatively, in vivo (e.g., by administering the agent to a
subject). As such, the present invention provides methods of
treating an individual afflicted with a disease or disorder
characterized by aberrant expression or activity TSCX proteins or
nucleic acid molecules. In one embodiment, the method involves
administering an agent (e.g., an agent identified by a screening
assay described herein), or combination of agents that modulates
(e.g., upregulates or downregulates) expression or activity of TSCX
nucleic acids or polypeptides. In another embodiment, the method
involves administering a protein or combination of proteins or a
nucleic acid molecule or combination of nucleic acid, molecules as
therapy to compensate for aberrant expression or activity of a TSCX
nucleic acid.
[0100] Therapeutics that may be utilized include, e.g., (i) a
polypeptide, or analogs, derivatives, fragments or homologs thereof
of the overexpressed sequence; (ii) antibodies to the overexpressed
sequence; (iii) antisense nucleic acids or nucleic acids that are
"dysfunctional" (i.e., due to a heterologous insertion within the
coding sequences of coding sequences of one or more overexpressed
or underexpressed sequences); or (v) modulators (i.e., inhibitors,
agonists and antagonists that alter the interaction between an
overexpressed polypeptide and its binding partner. The
dysfunctional antisense molecules are utilized to "knockout"
endogenous function of a polypeptide by homologous recombination
(see, e.g., Capecchi, Science 244: 1288-1292 1989).
[0101] Increased or decreased levels can be readily detected by
quantifying peptide and/or RNA, by obtaining a patient tissue
sample (e.g., from biopsy tissue) and assaying it in vitro for RNA
or peptide levels, structure and/or activity of the expressed
peptides (or mRNAs of a gene whose expression is altered). Methods
that are well-known within the art include, but are not limited to,
immunoassays (e.g., by Western blot analysis, immunoprecipitation
followed by sodium dodecyl sulfate (SDS) polyacrylamide gel
electrophoresis, immunocytochemistry, etc.) and/or hybridization
assays to detect expression of mRNAs (e.g., Northern assays, dot
blots, in situ hybridization, etc.).
[0102] Administration of a prophylactic agent can occur prior to
the manifestation of symptoms characteristic of aberrant gene
expression, such that a disease or disorder is prevented or,
alternatively, delayed in its progression. Depending on the type of
aberrant expression detected, the agent can be used for treating
the subject. The appropriate agent can be determined based on
screening assays described herein.
[0103] Screening Assays for Identifying a Candidate Therapeutic
Agent for Treating or Preventing Tuberous Sclerosis Associated
Disorder
[0104] The differentially expressed sequences disclosed herein can
also be used to identify candidate therapeutic agents to treat or
prevent tuberous sclerosis associated disorders. The therapeutic
agent can be identified by providing a cell population that
includes cells capable of expressing TSCX nucelic acids. Expression
of the nucleic acid sequences in the test cell population is then
compared to the expression of the nucleic acid sequences in a
reference cell population, which is a cell population that has not
been exposed to the test agent, or, in some embodiments, a cell
population exposed the test agent. Comparison can be performed on
test and reference samples measured concurrently or at temporally
distinct times. An example of the latter is the use of compiled
expression information, e.g., a sequence database, which assembles
information about expression levels of known sequences following
administration of various agents. For example, alteration of
expression levels following administration of test agent can be
compared to the expression changes observed in the nucleic acid
sequences following administration of a control agent.
[0105] An decrease in expression of the nucleic acid sequence in
the test cell population compared to the expression of the nucleic
acid sequence in the reference cell population that has not been
exposed to the test agent indicates the test agent is a canidate
therapuetic agent.
[0106] The test agent can be a compound not previously described or
can be a previously known compound but which is not known to be an
agent for treating tuberous sclerosis complex disorders.
[0107] The invention also includes a compound identified according
to this screening method.
[0108] An agent effective in stimulating expression of
underexpressed genes, or in suppressing expression of overexpressed
genes can be further tested for its ability to prevent the tuberous
sclerosis complex associated disorders, and as a potential
therapeutic useful for the treatment of such pathophysiology.
Further evaluation of the clinical usefulness of such a compound
can be performed using standard methods of evaluating toxicity and
clinical effectiveness.
[0109] Selecting a Therapeutic Agent for Treating Tuberous
Sclerosis Complex Associated Disorder that is Appropriate for a
Particular Individual
[0110] Differences in the genetic makeup of individuals can result
in differences in their relative abilities to metabolize various
drugs. An agent that is metabolized in a subject to act as a
therapeutic agent can manifest itself by inducing a change in gene
expression pattern from that characteristic of a pathophysiologic
state to a gene expression pattern characteristic of a
non-pathophysiologic state. Accordingly, the differentially
expressed TSCX sequences disclosed herein allow for a putative
therapeutic or prophylactic agent to be tested in a test cell
population from a selected subject in order to determine if the
agent is a suitable therapeutic agent in the subject.
[0111] To identify a therapeutic agent, that is appropriate for a
specific subject, a test cell population from the subject is
exposed to a therapeutic agent, and the expression of one or more
of TSCX 1-141.
[0112] In some embodiments, the agent is first mixed with a cell
extract, which contains enzymes that metabolize drugs into an
active form. The activated form of the therapeutic agent can then
be mixed with the test cell population and gene expression
measured. Preferably, the cell population is contacted ex vivo with
the agent or activated form of the agent.
[0113] Expression of the nucleic acid sequences in the test cell
population is then compared to the expression of the nucleic acid
sequences a reference cell population. The reference cell
population includes at least one cell whose tuberous sclerosis
complex status is known. By "tuberous sclerosis complex status is
meant, whether or not the reference cell population contains cells
known to have tuberous sclerosis complex subject.
[0114] The test agent can be any compound or composition.
[0115] Assessing Efficacy of Treatment of a Tuberous Sclerosis
Complex Associated Disorder in a Subject
[0116] The differentially expressed TSCX sequences identified
herein also allow for the course of treatment of a tuberous
sclerosis complex associated disorder to be monitored. In this
method, a test cell population is provided from a subject
undergoing treatment for a tuberous sclerosis complex associated
disorder. If desired, test cell populations can be taken from the
subject at various time points before, during, or after treatment.
Expression of one or more of the TSCX sequences, e.g., TSCXs:
1-142, in the cell population is then measured and compared to a
reference cell population which includes cells whose
pathophysiologic state is known. Preferably, the reference cells
not been exposed to the treatment.
[0117] If the reference cell population contains no cells exposed
to the treatment, a similarity in expression between TSCX sequences
in the test cell population and the reference cell population
indicates that the treatment is efficacious. However, a difference
in expression between TSCX sequences in the test population and
this reference cell population indicates the treatment is not
efficacious.
[0118] By "efficacious" is meant that the treatment leads to a
decrease in the pathophysiology in a subject. When treatment is
applied prophylactically, "efficacious" means that the treatment
retards or prevents a pathophysiology.
[0119] Efficaciousness can be determined in association with any
known method for treating the particular pathophysiology.
[0120] Assessing the Prognosis of a Subject with a Tuberous
Sclerosis Complex Associated Disorder
[0121] Also provided is a method of assessing the prognosis of a
subject with a tuberous sclerosis compelx associated disorder by
comparing the expression of a TSCX nucleic acid in a test cell
population to the expression of the sequences in a reference
profile derived from patients over a spectrum of disease stages. By
comparing gene expression of a TSCX nucleic acid in the test cell
population and the reference profile, or by comparing the pattern
of gene expression overtime in test cell populations derived from
the subject, the prognosis of the subject can be assessed.
[0122] The reference profile includes primarily noncancerous or
cancerous cells. A reference profile which includes primarily
noncancerous cells is a non-cancer reference profile. A reference
profile which includes primarily cancerous cells is a cancer
reference profile. In some embodiments the cancer reference profile
includes primarily disseminated cancerous cells. When the reference
profile includes primarily noncancerous cells, an increase of
expression of TSCX nucleic acids in the test cell population,
indicates less favorable prognosis. Conversely, when the reference
profile includes primarily cancerous cells, an decrease of
expression of TSCX nucleic acids in the test cell population,
indicates more favorable prognosis.
[0123] Pharmaceutical Compositions
[0124] In another aspect the invention includes pharmaceutical, or
therapeutic, compositions containing one or more therapeutic
compounds described herein. Pharmaceutical formulations may include
those suitable for oral, rectal, nasal, topical (including buccal
and sub-lingual), vaginal or parenteral (including intramuscular,
sub-cutaneous and intravenous) administration, or for
administration by inhalation or insufflation. The formulations may,
where appropriate, be conveniently presented in discrete dosage
units and may be prepared by any of the methods well known in the
art of pharmacy. All such pharmacy methods include the steps of
bringing into association the active compound with liquid carriers
or finely divided solid carriers or both as needed and then, if
necessary, shaping the product into the desired formulation.
[0125] Pharmaceutical formulations suitable for oral administration
may conveniently be presented as discrete units, such as capsules,
cachets or tablets, each containing a predetermined amount of the
active ingredient; as a powder or granules; or as a solution, a
suspension or as an emulsion. The active ingredient may also be
presented as a bolus electuary or paste, and be in a pure form,
i.e., without a carrier. Tablets and capsules for oral
administration may contain conventional excipients such as binding
agents, fillers, lubricants, disintegrant or wetting agents. A
tablet may be made by compression or molding, optionally with one
or more formulational ingredients. Compressed tablets may be
prepared by compressing in a suitable machine the active
ingredients in a free-flowing form such as a powder or granules,
optionally mixed with a binder, lubricant, inert diluent,
lubricating, surface active or dispersing agent. Molded tablets may
be made by molding in a suitable machine a mixture of the powdered
compound moistened with an inert liquid diluent. The tablets may be
coated according to methods well known in the art. Oral fluid
preparations may be in the form of, for example, aqueous or oily
suspensions, solutions, emulsions, syrups or elixirs, or may be
presented as a dry product for constitution with water or other
suitable vehicle before use. Such liquid preparations may contain
conventional additives such as suspending agents, emulsifying
agents, non-aqueous vehicles (which may include edible oils), or
preservatives. The tablets may optionally be formulated so as to
provide slow or controlled release of the active ingredient
therein.
[0126] Formulations for parenteral administration include aqueous
and non-aqueous sterile injection solutions which may contain
anti-oxidants, buffers, bacteriostats and solutes which render the
formulation isotonic with the blood of the intended recipient; and
aqueous and non-aqueous sterile suspensions which may include
suspending agents and thickening agents. The formulations may be
presented in unit dose or multi-dose containers, for example sealed
ampoules and vials, and may be stored in a freeze-dried
(lyophilized) condition requiring only the addition of the sterile
liquid carrier, for example, saline, water-for-injection,
immediately prior to use. Alternatively, the formulations may be
presented for continuous infusion. Extemporaneous injection
solutions and suspensions may be prepared from sterile powders,
granules and tablets of the kind previously described.
[0127] Formulations for rectal administration may be presented as a
suppository with the usual carriers such as cocoa butter or
polyethylene glycol. Formulations for topical administration in the
mouth, for example buccally or sublingually, include lozenges,
comprising the active ingredient in a flavored base such as sucrose
and acacia or tragacanth, and pastilles comprising the active
ingredient in a base such as gelatin and glycerin or sucrose and
acacia. For intra-nasal administration the compounds of the
invention may be used as a liquid spray or dispersible powder or in
the form of drops. Drops may be formulated with an aqueous or
non-aqueous base also comprising one or more dispersing agents,
solubilizing agents or suspending agents. Liquid sprays are
conveniently delivered from pressurized packs.
[0128] For administration by inhalation the compounds are
conveniently delivered from an insufflator, nebulizer, pressurized
packs or other convenient means of delivering an aerosol spray.
Pressurized packs may comprise a suitable propellant such as
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol, the dosage unit may be
determined by providing a valve to deliver a metered amount.
[0129] Alternatively, for administration by inhalation or
insufflation, the compounds may take the form of a dry powder
composition, for example a powder mix of the compound and a
suitable powder base such as lactose or starch. The powder
composition may be presented in unit dosage form, in for example,
capsules, cartridges, gelatin or blister packs from which the
powder may be administered with the aid of an inhalator or
insuffiator.
[0130] When desired, the above described formulations, adapted to
give sustained release of the active ingredient, may be employed.
The pharmaceutical compositions may also contain other active
ingredients such as antimicrobial agents, immunosuppressants or
preservatives.
[0131] It should be understood that in addition to the ingredients
particularly mentioned above, the formulations of this invention
may include other agents conventional in the art having regard to
the type of formulation in question, for example, those suitable
for oral administration may include flavoring agents.
[0132] Preferred unit dosage formulations are those containing an
effective dose, as recited below, or an appropriate fraction
thereof, of the active ingredient.
[0133] For each of the aforementioned conditions, the compositions
may be administered orally or via injection at a dose of from about
0.1 to about 250 mg/kg per day. The dose range for adult humans is
generally from about 5 mg to about 17.5 g/day, preferably about 5
mg to about 10 g/day, and most preferably about 100 mg to about 3
g/day. Tablets or other unit dosage forms of presentation provided
in discrete units may conveniently contain an amount which is
effective at such dosage or as a multiple of the same, for
instance, units containing about 5 mg to about 500 mg, usually from
about 100 mg to about 500 mg.
[0134] The pharmaceutical composition preferably is administered
orally or by injection (intravenous or subcutaneous), and the
precise amount administered to a subject will be the responsibility
of the attendant physician. However, the dose employed will depend
upon a number of factors, including the age and sex of the subject,
the precise disorder being treated, and its severity. Also the
route of administration may vary depending upon the condition and
its severity.
[0135] TSCX Nucleic Acids
[0136] Also provided in the invention are novel nucleic acid
comprising a nucleic acid sequence selected from the group
consisting of TSC: 1-8, 10-12, and 15-25 (SEQ ID NO: 1-22) or its
complement, as well as vectors and cells including these nucleic
acids.
[0137] Thus, one aspect of the invention pertains to isolated TSCX
nucleic acid molecules that encode TSCX proteins or biologically
active portions thereof. Also included are nucleic acid fragments
sufficient for use as hybridization probes to identify
TSCX-encoding nucleic acids (e.g., TSCX mRNA) and fragments for use
as polymerase chain reaction (PCR) primers for the amplification or
mutation of TSCX nucleic acid molecules. As used herein, the term
"nucleic acid molecule" is intended to include DNA molecules (e.g.,
cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the
DNA or RNA generated using nucleotide analogs, and derivatives,
fragments and homologs thereof. The nucleic acid molecule can be
single-stranded or double-stranded, but preferably is
double-stranded DNA.
[0138] "Probes" refer to nucleic acid sequences of variable length,
preferably between at least about 10 nucleotides (nt) or as many as
about, e.g., 6,000 nt, depending on use. Probes are used in the
detection of identical, similar, or complementary nucleic acid
sequences. Longer length probes are usually obtained from a natural
or recombinant source, are highly specific and much slower to
hybridize than oligomers. Probes may be single- or double-stranded
and designed to have specificity in PCR, membrane-based
hybridization technologies, or ELISA-like technologies.
[0139] An "isolated" nucleic acid molecule is one that is separated
from other nucleic acid molecules which are present in the natural
source of the nucleic acid. Examples of isolated nucleic acid
molecules include, but are not limited to, recombinant DNA
molecules contained in a vector, recombinant DNA molecules
maintained in a heterologous host cell, partially or substantially
purified nucleic acid molecules, and synthetic DNA or RNA
molecules.
[0140] Preferably, an "isolated" nucleic acid is free of sequences
which naturally flank the nucleic acid (i.e., sequences located at
the 5' and 3' ends of the nucleic acid) in the genomic DNA of the
organism from which the nucleic acid is derived. For example, in
various embodiments, the isolated TSCX nucleic acid molecule can
contain less than about 50 kb, 25 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb,
0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the
nucleic acid molecule in genomic DNA of the cell from which the
nucleic acid is derived. Moreover, an "isolated" nucleic acid
molecule, such as a cDNA molecule, can be substantially free of
other cellular material or culture medium when produced by
recombinant techniques, or of chemical precursors or other
chemicals when chemically synthesized.
[0141] A nucleic acid molecule of the present invention, e.g., a
nucleic acid molecule having the nucleotide sequence of any of TSC:
1-8, 10-12, and 15-25, or a complement of any of these nucleotide
sequences, can be isolated using standard molecular biology
techniques and the sequence information provided herein. Using all
or a portion of these nucleic acid sequences as a hybridization
probe, TSCX nucleic acid sequences can be isolated using standard
hybridization and cloning techniques (e.g., as described in
Sambrook et al., eds., MOLECULAR CLONING: A LABORATORY MANUAL
2.sup.nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989; and Ausubel, et al., eds., CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y.,
1993.)
[0142] A nucleic acid of the invention can be amplified using cDNA,
mRNA or alternatively, genomic DNA, as a template and appropriate
oligonucleotide primers according to standard PCR amplification
techniques. The nucleic acid so amplified can be cloned into an
appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to TSCX nucleotide
sequences can be prepared by standard synthetic techniques, e.g.,
using an automated DNA synthesizer.
[0143] As used herein, the term "oligonucleotide" refers to a
series of linked nucleotide residues, which oligonucleotide has a
sufficient number of nucleotide bases to be used in a PCR reaction.
A short oligonucleotide sequence may be based on, or designed from,
a genomic or cDNA sequence and is used to amplify, confirm, or
reveal the presence of an identical, similar or complementary DNA
or RNA in a particular cell or tissue. Oligonucleotides comprise
portions of a nucleic acid sequence having at least about 10 nt and
as many as 50 nt, preferably about 15 nt to 30 nt. They may be
chemically synthesized and may be used as probes.
[0144] In another embodiment, an isolated nucleic acid molecule of
the invention comprises a nucleic acid molecule that is a
complement of the nucleotide sequence shown in TSCX: .delta. 1-7,
10-13, 19-34, 45-53, 58-85, 111-113, 120, 130, 132-134 and 138. In
another embodiment, an isolated nucleic acid molecule of the
invention comprises a nucleic acid molecule that is a complement of
the nucleotide sequence shown in any of these sequences, or a
portion of any of these nucleotide sequences. A nucleic acid
molecule that is complementary to the nucleotide sequence shown in
TSC: 1-8, 10-12, and 15-25 is one that is sufficiently
complementary to the nucleotide sequence shown, such that it can
hydrogen bond with little or no mismatches to the nucleotide
sequences shown, thereby forming a stable duplex.
[0145] As used herein, the term "complementary" refers to
Watson-Crick or Hoogsteen base pairing between nucleotides units of
a nucleic acid molecule, and the term "binding" means the physical
or chemical interaction between two polypeptides or compounds or
associated polypeptides or compounds or combinations thereof.
Binding includes ionic, non-ionic, Von der Waals, hydrophobic
interactions, etc. A physical interaction can be either direct or
indirect. Indirect interactions may be through or due to the
effects of another polypeptide or compound. Direct binding refers
to interactions that do not take place through, or due to, the
effect of another polypeptide or compound, but instead are without
other substantial chemical intermediates.
[0146] Moreover, the nucleic acid molecule of the invention can
comprise only a portion of the nucleic acid sequence of TSC: 1-8,
10-12, and 15-25 e.g., a fragment that can be used as a probe or
primer or a fragment encoding a biologically active portion of
TSCX. Fragments provided herein are defined as sequences of at
least 6 (contiguous) nucleic acids or at least 4 (contiguous) amino
acids, a length sufficient to allow for specific hybridization in
the case of nucleic acids or for specific recognition of an epitope
in the case of amino acids, respectively, and are at most some
portion less than a full length sequence. Fragments may be derived
from any contiguous portion of a nucleic acid or amino acid
sequence of choice. Derivatives are nucleic acid sequences or amino
acid sequences formed from the native compounds either directly or
by modification or partial substitution. Analogs are nucleic acid
sequences or amino acid sequences that have a structure similar to,
but not identical to, the native compound but differs from it in
respect to certain components or side chains. Analogs may be
synthetic or from a different evolutionary origin and may have a
similar or opposite metabolic activity compared to wild type.
[0147] Derivatives and analogs may be full length or other than
full length, if the derivative or analog contains a modified
nucleic acid or amino acid, as described below. Derivatives or
analogs of the nucleic acids or proteins of the invention include,
but are not limited to, molecules comprising regions that are
substantially homologous to the nucleic acids or proteins of the
invention, in various embodiments, by at least about 45%, 50%, 70%,
80%, 95%, 98%, or even 99% identity (with a preferred identity of
80-99%) over a nucleic acid or amino acid sequence of identical
size or when compared to an aligned sequence in which the alignment
is done by a computer homology program known in the art, or whose
encoding nucleic acid is capable of hybridizing to the complement
of a sequence encoding the aforementioned proteins under stringent,
moderately stringent, or low stringent conditions. See e.g.
Ausubel, et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley
& Sons, New York, N.Y., 1993, and below. An exemplary program
is the Gap program (Wisconsin Sequence Analysis Package, Version 8
for UNIX, Genetics Computer Group, University Research Park,
Madison, Wis.) using the default settings, which uses the algorithm
of Smith and Waterman (Adv. Appl. Math., 1981, 2: 482-489, which in
incorporated herein by reference in its entirety).
[0148] A "homologous nucleic acid sequence" or "homologous amino
acid sequence," or variations thereof, refer to sequences
characterized by a homology at the nucleotide level or amino acid
level as discussed above. Homologous nucleotide sequences encode
those sequences coding for isoforms of a TSCX polypeptide. Isoforms
can be expressed in different tissues of the same organism as a
result of, for example, alternative splicing of RNA. Alternatively,
isoforms can be encoded by different genes. In the present
invention, homologous nucleotide sequences include nucleotide
sequences encoding for a TSCX polypeptide of species other than
humans, including, but not limited to, mammals, and thus can
include, e.g., mouse, rat, rabbit, dog, cat cow, horse, and other
organisms. Homologous nucleotide sequences also include, but are
not limited to, naturally occurring allelic variations and
mutations of the nucleotide sequences set forth herein. A
homologous nucleotide sequence does not, however, include the
nucleotide sequence encoding a human TSCX protein. Homologous
nucleic acid sequences include those nucleic acid sequences that
encode conservative amino acid substitutions (see below) in a TSCX
polypeptide, as well as a polypeptide having a TSCX activity. A
homologous amino acid sequence does not encode the amino acid
sequence of a human TSCX polypeptide.
[0149] The nucleotide sequence determined from the cloning of human
TSCX genes allows for the generation of probes and primers designed
for use in identifying and/or cloning TSCX homologues in other cell
types, e.g., from other tissues, as well as TSCX homologues from
other mammals. The probe/primer typically comprises a substantially
purified oligonucleotide. The oligonucleotide typically comprises a
region of nucleotide sequence that hybridizes under stringent
conditions to at least about 12, 25, 50, 100, 150, 200, 250, 300,
350 or 400 consecutive sense strand nucleotide sequence of a
nucleic acid comprising a TSCX sequence, or an anti-sense strand
nucleotide sequence of a nucleic acid comprising a TSCX sequence,
or of a naturally occurring mutant of these sequences.
[0150] Probes based on human TSCX nucleotide sequences can be used
to detect transcripts or genomic sequences encoding the same or
homologous proteins. In various embodiments, the probe further
comprises a label group attached thereto, e.g., the label group can
be a radioisotope, a fluorescent compound, an enzyme, or an enzyme
co-factor. Such probes can be used as a part of a diagnostic test
kit for identifying cells or tissue which misexpress a TSCX
protein, such as by measuring a level of a TSCX-encoding nucleic
acid in a sample of cells from a subject e.g., detecting TSCX mRNA
levels or determining whether a genomic TSCX gene has been mutated
or deleted.
[0151] "A polypeptide having a biologically active portion of TSCX"
refers to polypeptides exhibiting activity similar, but not
necessarily identical to, an activity of a polypeptide of the
present invention, including mature forms, as measured in a
particular biological assay, with or without dose dependency. A
nucleic acid fragment encoding a "biologically active portion of
TSCX" can be prepared by isolating a portion of TSC: 1-8, 10-12,
and 15-25, that encodes a polypeptide having a TSCX biological
activity, expressing the encoded portion of TSCX protein (e.g., by
recombinant expression in vitro) and assessing the activity of the
encoded portion of TSCX. For example, a nucleic acid fragment
encoding a biologically active portion of a TSCX polypeptide can
optionally include an ATP-binding domain. In another embodiment, a
nucleic acid fragment encoding a biologically active portion of
TSCX includes one or more regions.
[0152] TSCX Variants
[0153] The invention further encompasses nucleic acid molecules
that differ from the disclosed or referenced TSCX nucleotide
sequences due to degeneracy of the genetic code. These nucleic
acids thus encode the same TSCX protein as that encoded by
nucleotide sequence comprising a TSCX nucleic acid as shown in,
e.g., TSC: 1-8, 10-12, and 15-25.
[0154] In addition to the rat TSCX nucleotide sequence shown in
TSC: 1-8, 10-12, and 15-25, it will be appreciated by those skilled
in the art that DNA sequence polymorphisms that lead to changes in
the amino acid sequences of a TSCX polypeptide may exist within a
population (e.g., the human population). Such genetic polymorphism
in the TSCX gene may exist among individuals within a population
due to natural allelic variation. As used herein, the terms "gene"
and "recombinant gene" refer to nucleic acid molecules comprising
an open reading frame encoding a TSCX protein, preferably a
mammalian TSCX protein. Such natural allelic variations can
typically result in 1-5% variance in the nucleotide sequence of the
TSCX gene. Any and all such nucleotide variations and resulting
amino acid polymorphisms in TSCX that are the result of natural
allelic variation and that do not alter the functional activity of
TSCX are intended to be within the scope of the invention.
[0155] Moreover, nucleic acid molecules encoding TSCX proteins from
other species, and thus that have a nucleotide sequence that
differs from the human sequence of TSC: 1-8, 10-12, and 15-25, are
intended to be within the scope of the invention. Nucleic acid
molecules corresponding to natural allelic variants and homologues
of the TSCX DNAs of the invention can be isolated based on their
homology to the human TSCX nucleic acids disclosed herein using the
human cDNAs, or a portion thereof, as a hybridization probe
according to standard hybridization techniques under stringent
hybridization conditions. For example, a soluble human TSCX DNA can
be isolated based on its homology to human membrane-bound TSCX.
Likewise, a membrane-bound human TSCX DNA can be isolated based on
its homology to soluble human TSCX.
[0156] Accordingly, in another embodiment, an isolated nucleic acid
molecule of the invention is at least 6 nucleotides in length and
hybridizes under stringent conditions to the nucleic acid molecule
comprising the nucleotide sequence of TSC: 1-8, 10-12, and 15-25.
In another embodiment, the nucleic acid is at least 10, 25, 50,
100, 250 or 500 nucleotides in length. In another embodiment, an
isolated nucleic acid molecule of the invention hybridizes to the
coding region. As used herein, the term "hybridizes under stringent
conditions" is intended to describe conditions for hybridization
and washing under which nucleotide sequences at least 60%
homologous to each other typically remain hybridized to each
other.
[0157] Homologs (i.e., nucleic acids encoding TSCX proteins derived
from species other than human) or other related sequences (e.g.,
paralogs) can be obtained by low, moderate or high stringency
hybridization with all or a portion of the particular human
sequence as a probe using methods well known in the art for nucleic
acid hybridization and cloning.
[0158] As used herein, the phrase "stringent hybridization
conditions" refers to conditions under which a probe, primer or
oligonucleotide will hybridize to its target sequence, but to no
other sequences. Stringent conditions are sequence-dependent and
will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures than shorter
sequences. Generally, stringent conditions are selected to be about
5.degree. C. lower than the thermal melting point (Tm) for the
specific sequence at a defined ionic strength and pH. The Tm is the
temperature (under defined ionic strength, pH and nucleic acid
concentration) at which 50% of the probes complementary to the
target sequence hybridize to the target sequence at equilibrium.
Since the target sequences are generally present at excess, at Tm,
50% of the probes are occupied at equilibrium. Typically, stringent
conditions will be those in which the salt concentration is less
than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium
ion (or other salts) at pH 7.0 to 8.3 and the temperature is at
least about 30.degree. C. for short probes, primers or
oligonucleotides (e.g., 10 nt to 50 nt) and at least about
60.degree. C. for longer probes, primers and oligonucleotides.
Stringent conditions may also be achieved with the addition of
destabilizing agents, such as formamide.
[0159] Stringent conditions are known to those skilled in the art
and can be found in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John
Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Preferably, the
conditions are such that sequences at least about 65%, 70%, 75%,
85%, 90%, 95%, 98%, or 99% homologous to each other typically
remain hybridized to each other. A non-limiting example of
stringent hybridization conditions is hybridization in a high salt
buffer comprising 6.times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA,
0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg/ml denatured salmon
sperm DNA at 65.degree. C. This hybridization is followed by one or
more washes in 0.2.times.SSC, 0.01% BSA at 50.degree. C. An
isolated nucleic acid molecule of the invention that hybridizes
under stringent conditions to the sequence of TSC: 1-8, 10-12, and
15-25 corresponds to a naturally occurring nucleic acid molecule.
As used herein, a "naturally-occurring" nucleic acid molecule
refers to an RNA or DNA molecule having a nucleotide sequence that
occurs in nature (e.g., encodes a natural protein).
[0160] In a second embodiment, a nucleic acid sequence that is
hybridizable to the nucleic acid molecule comprising the nucleotide
sequence of TSC: 1-8, 10-12, and 15-25 or fragments, analogs or
derivatives thereof, under conditions of moderate stringency is
provided. A non-limiting example of moderate stringency
hybridization conditions are hybridization in 6.times.SSC, 5.times.
Denhardt's solution, 0.5% SDS and 100 mg/ml denatured salmon sperm
DNA at 55.degree. C., followed by one or more washes in
1.times.SSC, 0.1% SDS at 37.degree. C. Other conditions of moderate
stringency that may be used are well known in the art. See, e.g.,
Ausubel et al. (eds.), 1993, CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley & Sons, NY, and Kriegler, 1990, GENE
TRANSFER AND EXPRESSION, A LABORATORY MANUAL, Stockton Press,
NY.
[0161] In a third embodiment, a nucleic acid that is hybridizable
to the nucleic acid molecule comprising the nucleotide sequence of
TSC: 1-8, 10-12, and 15-25 or fragments, analogs or derivatives
thereof, under conditions of low stringency, is provided. A
non-limiting example of low stringency hybridization conditions are
hybridization in 35% formamide, 5.times.SSC, 50 mM Tris-HCl (pH
7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 mg/ml
denatured salmon sperm DNA, 10% (wt/vol) dextran sulfate at
40.degree. C., followed by one or more washes in 2.times.SSC, 25 mM
Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS at 50.degree. C. Other
conditions of low stringency that may be used are well known in the
art (e.g., as employed for cross-species hybridizations). See,
e.g., Ausubel et al. (eds.), 1993, CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley & Sons, NY, and Kriegler, 1990, GENE
TRANSFER AND EXPRESSION, A LABORATORY MANUAL, Stockton Press, NY;
Shilo et al., 1981, Proc Natl Acad Sci USA 78: 6789-6792.
[0162] Conservative Mutations
[0163] In addition to naturally-occurring allelic variants of the
TSCX sequence that may exist in the population, the skilled artisan
will further appreciate that changes can be introduced into an TSCX
nucleic acid or directly into an TSCX polypeptide sequence without
altering the functional ability of the TSCX protein. In some
embodiments, the nucleotide sequence of TSC: 1-8, 10-12, and 15-25
will be altered, thereby leading to changes in the amino acid
sequence of the encoded TSCX protein. For example, nucleotide
substitutions that result in amino acid substitutions at various
"non-essential" amino acid residues can be made in the sequence of
TSC: 1-8, 10-12, and 15-25. A "non-essential" amino acid residue is
a residue that can be altered from the wild-type sequence of TSCX
without altering the biological activity, whereas an "essential"
amino acid residue is required for biological activity. For
example, amino acid residues that are conserved among the TSCX
proteins of the present invention, are predicted to be particularly
unamenable to alteration.
[0164] In addition, amino acid residues that are conserved among
family members of the TSCX proteins of the present invention, are
also predicted to be particularly unamenable to alteration. As
such, these conserved domains are not likely to be amenable to
mutation. Other amino acid residues, however, (e.g., those that are
not conserved or only semi-conserved among members of the TSCX
proteins) may not be essential for activity and thus are likely to
be amenable to alteration.
[0165] Another aspect of the invention pertains to nucleic acid
molecules encoding TSCX proteins that contain changes in amino acid
residues that are not essential for activity. Such TSCX proteins
differ in amino acid sequence from the amino acid sequences of
polypeptides encoded by nucleic acids containing TSC: 1-8, 10-12,
and 15-25, yet retain biological activity. In one embodiment, the
isolated nucleic acid molecule comprises a nucleotide sequence
encoding a protein, wherein the protein comprises an amino acid
sequence at least about 45% homologous, more preferably 60%, and
still more preferably at least about 70%, 80%, 90%, 95%, 98%, and
most preferably at least about 99% homologous to the amino acid
sequence of the amino acid sequences of polypeptides encoded by
nucleic acids comprising TSC: 1-8, 10-12, and 15-25.
[0166] An isolated nucleic acid molecule encoding a TSCX protein
homologous to can be created by introducing one or more nucleotide
substitutions, additions or deletions into the nucleotide sequence
of a nucleic acid comprising TSC: 1-8, 10-12, and 15-25, such that
one or more amino acid substitutions, additions or deletions are
introduced into the encoded protein.
[0167] Mutations can be introduced into a nucleic acid comprising
TSC: 1-8, 10-12, and 15-25 by standard techniques, such as
site-directed mutagenesis and PCR-mediated mutagenesis. Preferably,
conservative amino acid substitutions are made at one or more
predicted non-essential amino acid residues. A "conservative amino
acid substitution" is one in which the amino acid residue is
replaced with an amino acid residue having a similar side chain.
Families of amino acid residues having similar side chains have
been defined in the art. These families include amino acids with
basic side chains (e.g., lysine, arginine, histidine), acidic side
chains (e.g., aspartic acid, glutamic acid), uncharged polar side
chains (e.g., glycine, asparagine, glutamine, serine, threonine,
tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine,
leucine, isoleucine, proline, phenylalanine, methionine,
tryptophan), beta-branched side chains (e.g., threonine, valine,
isoleucine) and aromatic side chains (e.g., tyrosine,
phenylalanine, tryptophan, histidine). Thus, a predicted
nonessential amino acid residue in TSCX is replaced with another
amino acid residue from the same side chain family. Alternatively,
in another embodiment, mutations can be introduced randomly along
all or part of a TSCX coding sequence, such as by saturation
mutagenesis, and the resultant mutants can be screened for TSCX
biological activity to identify mutants that retain activity.
Following mutagenesis of the nucleic acid, the encoded protein can
be expressed by any recombinant technology known in the art and the
activity of the protein can be determined.
[0168] In one embodiment, a mutant TSCX protein can be assayed for
(1) the ability to form protein:protein interactions with other
TSCX proteins, other cell-surface proteins, or biologically active
portions thereof, (2) complex formation between a mutant TSCX
protein and a TSCX ligand; (3) the ability of a mutant TSCX protein
to bind to an intracellular target protein or biologically active
portion thereof; (e.g., avidin proteins); (4) the ability to bind
ATP; or (5) the ability to specifically bind a TSCX protein
antibody.
[0169] In other specific embodiments, the nucleic acid is RNA or
DNA. The fragment or the fragment of the complementary
polynucleotide sequence is between about 10 and about 100
nucleotides in length, e.g., between about 10 and about 90
nucleotides in length, or about 10 and about 75 nucleotides in
length, about 10 and about 50 bases in length, about 10 and about
40 bases in length, or about 15 and about 30 bases in length.
[0170] Antisense
[0171] Another aspect of the invention pertains to isolated
antisense nucleic acid molecules that are hybridizable to or
complementary to the nucleic acid molecule comprising the
nucleotide sequence of a TSCX sequence or fragments, analogs or
derivatives thereof. An "antisense" nucleic acid comprises a
nucleotide sequence that is complementary to a "sense" nucleic acid
encoding a protein, e.g., complementary to the coding strand of a
double-stranded cDNA molecule or complementary to an mRNA sequence.
In specific aspects, antisense nucleic acid molecules are provided
that comprise a sequence complementary to at least about 10, 25,
50, 100, 250 or 500 nucleotides or an entire TSCX coding strand, or
to only a portion thereof. Nucleic acid molecules encoding
fragments, homologs, derivatives and analogs of a TSCX protein, or
antisense nucleic acids complementary to a nucleic acid comprising
a TSCX nucleic acid sequence are additionally provided.
[0172] In one embodiment, an antisense nucleic acid molecule is
antisense to a "coding region" of the coding strand of a nucleotide
sequence encoding TSCX. The term "coding region" refers to the
region of the nucleotide sequence comprising codons which are
translated into amino acid residues. In another embodiment, the
antisense nucleic acid molecule is antisense to a "noncoding
region" of the coding strand of a nucleotide sequence encoding
TSCX. The term "noncoding region" refers to 5' and 3' sequences
which flank the coding region that are not translated into amino
acids (i.e., also referred to as 5' and 3' untranslated
regions).
[0173] Given the coding strand sequences encoding TSCX disclosed
herein, antisense nucleic acids of the invention can be designed
according to the rules of Watson and Crick or Hoogsteen base
pairing. The antisense nucleic acid molecule can be complementary
to the entire coding region of TSCX mRNA, but more preferably is an
oligonucleotide that is antisense to only a portion of the coding
or noncoding region of TSCX mRNA. For example, the antisense
oligonucleotide can be complementary to the region surrounding the
translation start site of TSCX mRNA. An antisense oligonucleotide
can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50
nucleotides in length. An antisense nucleic acid of the invention
can be constructed using chemical synthesis or enzymatic ligation
reactions using procedures known in the art. For example, an
antisense nucleic acid (e.g., an antisense oligonucleotide) can be
chemically synthesized using naturally occurring nucleotides or
variously modified nucleotides designed to increase the biological
stability of the molecules or to increase the physical stability of
the duplex formed between the antisense and sense nucleic acids,
e.g., phosphorothioate derivatives and acridine substituted
nucleotides can be used.
[0174] Examples of modified nucleotides that can be used to
generate the antisense nucleic acid include: 5-fluorouracil,
5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridin- e,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiour- acil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleic acid can be
produced biologically using an expression vector into which a
nucleic acid has been subcloned in an antisense orientation (i.e.,
RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest,
described further in the following subsection).
[0175] The antisense nucleic acid molecules of the invention are
typically administered to a subject or generated in situ such that
they hybridize with or bind to cellular mRNA and/or genomic DNA
encoding a TSCX protein to thereby inhibit expression of the
protein, e.g., by inhibiting transcription and/or translation. The
hybridization can be by conventional nucleotide complementarity to
form a stable duplex, or, for example, in the case of an antisense
nucleic acid molecule that binds to DNA duplexes, through specific
interactions in the major groove of the double helix. An example of
a route of administration of antisense nucleic acid molecules of
the invention includes direct injection at a tissue site.
Alternatively, antisense nucleic acid molecules can be modified to
target selected cells and then administered systemically. For
example, for systemic administration, antisense molecules can be
modified such that they specifically bind to receptors or antigens
expressed on a selected cell surface, e.g., by linking the
antisense nucleic acid molecules to peptides or antibodies that
bind to cell surface receptors or antigens. The antisense nucleic
acid molecules can also be delivered to cells using the vectors
described herein. To achieve sufficient intracellular
concentrations of antisense molecules, vector constructs in which
the antisense nucleic acid molecule is placed under the control of
a strong pol II or pol III promoter are preferred.
[0176] In yet another embodiment, the antisense nucleic acid
molecule of the invention is an .alpha.-anomeric nucleic acid
molecule. An .alpha.-anomeric nucleic acid molecule forms specific
double-stranded hybrids with complementary RNA in which, contrary
to the usual .beta.-units, the strands run parallel to each other
(Gaultier et al. (1987) Nucleic Acids Res 15: 6625-6641). The
antisense nucleic acid molecule can also comprise a
2'-o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res
15: 6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987)
FEBS Lett 215: 327-330).
[0177] Ribozymes and PNA Moieties
[0178] In still another embodiment, an antisense nucleic acid of
the invention is a ribozyme. Ribozymes are catalytic RNA molecules
with ribonuclease activity that are capable of cleaving a
single-stranded nucleic acid, such as an mRNA, to which they have a
complementary region. Thus, ribozymes (e.g., hammerhead ribozymes
(described in Haselhoff and Gerlach (1988) Nature 334:585-591)) can
be used to catalytically cleave TSCX mRNA transcripts to thereby
inhibit translation of TSCX mRNA. A ribozyme having specificity for
a TSCX-encoding nucleic acid can be designed based upon the
nucleotide sequence of a TSCX DNA disclosed herein. For example, a
derivative of a Tetrahymena L-19 IVS RNA can be constructed in
which the nucleotide sequence of the active site is complementary
to the nucleotide sequence to be cleaved in a TSCX-encoding mRNA.
See, e.g., Cech et al. U.S. Pat. No. 4,987,071; and Cech et al.
U.S. Pat. No. 5,116,742. Alternatively, TSCX mRNA can be used to
select a catalytic RNA having a specific ribonuclease activity from
a pool of RNA molecules. See, e.g., Bartel et al., (1993) Science
261:1411-1418.
[0179] Alternatively, TSCX gene expression can be inhibited by
targeting nucleotide sequences complementary to the regulatory
region of a TSCX nucleic acid (e.g., the TSCX promoter and/or
enhancers) to form triple helical structures that prevent
transcription of the TSCX gene in target cells. See generally,
Helene. (1991) Anticancer Drug Des. 6: 569-84; Helene. et al.
(1992) Ann. N.Y. Acad. Sci. 660:27-36; and Maher (1992) Bioassays
14: 807-15.
[0180] In various embodiments, the nucleic acids of TSCX can be
modified at the base moiety, sugar moiety or phosphate backbone to
improve, e.g., the stability, hybridization, or solubility of the
molecule. For example, the deoxyribose phosphate backbone of the
nucleic acids can be modified to generate peptide nucleic acids
(see Hyrup et al. (1996) Bioorg Med Chem 4: 5-23). As used herein,
the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid
mimics, e.g., DNA mimics, in which the deoxyribose phosphate
backbone is replaced by a pseudopeptide backbone and only the four
natural nucleobases are retained. The neutral backbone of PNAs has
been shown to allow for specific hybridization to DNA and RNA under
conditions of low ionic strength. The synthesis of PNA oligomers
can be performed using standard solid phase peptide synthesis
protocols as described in Hyrup et al. (1996) above; Perry-OKeefe
et al. (1996) PNAS 93: 14670-675.
[0181] PNAs of TSCX can be used in therapeutic and diagnostic
applications. For example, PNAs can be used as antisense or
antigene agents for sequence-specific modulation of gene expression
by, e.g., inducing transcription or translation arrest or
inhibiting replication. PNAs of TSCX can also be used, e.g., in the
analysis of single base pair mutations in a gene by, e.g., PNA
directed PCR clamping; as artificial restriction enzymes when used
in combination with other enzymes, e.g., S1 nucleases (Hyrup B.
(1996) above); or as probes or primers for DNA sequence and
hybridization (Hyrup et al. (1996), above; Perry-OKeefe (1996),
above).
[0182] In another embodiment, PNAs of TSCX can be modified, e.g.,
to enhance their stability or cellular uptake, by attaching
lipophilic or other helper groups to PNA, by the formation of
PNA-DNA chimeras, or by the use of liposomes or other techniques of
drug delivery known in the art. For example, PNA-DNA chimeras of
TSCX can be generated that may combine the advantageous properties
of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g.,
RNase H and DNA polymerases, to interact with the DNA portion while
the PNA portion would provide high binding affinity and
specificity. PNA-DNA chimeras can be linked using linkers of
appropriate lengths selected in terms of base stacking, number of
bonds between the nucleobases, and orientation (Hyrup (1996)
above). The synthesis of PNA-DNA chimeras can be performed as
described in Hyrup (1996) above and Finn et al. (1996) Nucl Acids
Res 24: 3357-63. For example, a DNA chain can be synthesized on a
solid support using standard phosphoramidite coupling chemistry,
and modified nucleoside analogs, e.g.,
5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can
be used between the PNA and the 5'end of DNA (Mag et al. (1989)
Nucl Acid Res 17: 5973-88). PNA monomers are then coupled in a
stepwise manner to produce a chimeric molecule with a 5' PNA
segment and a 3' DNA segment (Finn et al. (1996) above).
Alternatively, chimeric molecules can be synthesized with a 5' DNA
segment and a 3'PNA segment. See, Petersen et al. (1975) Bioorg Med
Chem Lett5: 1119-11124.
[0183] In other embodiments, the oligonucleotide may include other
appended groups such as peptides (e.g., for targeting host cell
receptors in vivo), or agents facilitating transport across the
cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad.
Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad.
Sci. 84:648-652; PCT Publication No. WO88/09810) or the blood-brain
barrier (see, e.g., PCT Publication No. WO89/10134). In addition,
oligonucleotides can be modified with hybridization triggered
cleavage agents (See, e.g., Krol et al., 1988, BioTechniques
6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm.
Res. 5: 539-549). To this end, the oligonucleotide may be
conjugated to another molecule, e.g., a peptide, a hybridization
triggered cross-linking agent, a transport agent, a
hybridization-triggered cleavage agent, etc.
[0184] TSCX Polypeptides
[0185] One aspect of the invention pertains to isolated TSCX
proteins, and biologically active portions thereof, or derivatives,
fragments, analogs or homologs thereof. Also provided are
polypeptide fragments suitable for use as immunogens to raise
anti-TSCX antibodies. In one embodiment, native TSCX proteins can
be isolated from cells or tissue sources by an appropriate
purification scheme using standard protein purification techniques.
In another embodiment, TSCX proteins are produced by recombinant
DNA techniques. Alternative to recombinant expression, a TSCX
protein or polypeptide can be synthesized chemically using standard
peptide synthesis techniques.
[0186] An "isolated" or "purified" protein or biologically active
portion thereof is substantially free of cellular material or other
contaminating proteins from the cell or tissue source from which
the TSCX protein is derived, or substantially free from chemical
precursors or other chemicals when chemically synthesized. The
language "substantially free of cellular material" includes
preparations of TSCX protein in which the protein is separated from
cellular components of the cells from which it is isolated or
recombinantly produced. In one embodiment, the language
"substantially free of cellular material" includes preparations of
TSCX protein having less than about 30% (by dry weight) of non-TSCX
protein (also referred to herein as a "contaminating protein"),
more preferably less than about 20% of non-TSCX protein, still more
preferably less than about 10% of non-TSCX protein, and most
preferably less than about 5% non-TSCX protein. When the TSCX
protein or biologically active portion thereof is recombinantly
produced, it is also preferably substantially free of culture
medium, i.e., culture medium represents less than about 20%, more
preferably less than about 10%, and most preferably less than about
5% of the volume of the protein preparation.
[0187] The language "substantially free of chemical precursors or
other chemicals" includes preparations of TSCX protein in which the
protein is separated from chemical precursors or other chemicals
that are involved in the synthesis of the protein. In one
embodiment, the language "substantially free of chemical precursors
or other chemicals" includes preparations of TSCX protein having
less than about 30% (by dry weight) of chemical precursors or
non-TSCX chemicals, more preferably less than about 20% chemical
precursors or non-TSCX chemicals, still more preferably less than
about 10% chemical precursors or non-TSCX chemicals, and most
preferably less than about 5% chemical precursors or non-TSCX
chemicals.
[0188] Biologically active portions of a TSCX protein include
peptides comprising amino acid sequences sufficiently homologous to
or derived from the amino acid sequence of the TSCX protein, e.g.,
the amino acid sequence encoded by a nucleic acid comprising TSCX
1-20 that include fewer amino acids than the full length TSCX
proteins, and exhibit at least one activity of a TSCX protein.
Typically, biologically active portions comprise a domain or motif
with at least one activity of the TSCX protein. A biologically
active portion of a TSCX protein can be a polypeptide which is, for
example, 10, 25, 50, 100 or more amino acids in length.
[0189] A biologically active portion of a TSCX protein of the
present invention may contain at least one of the above-identified
domains conserved between the TSCX proteins. An alternative
biologically active portion of a TSCX protein may contain at least
two of the above-identified domains. Another biologically active
portion of a TSCX protein may contain at least three of the
above-identified domains. Yet another biologically active portion
of a TSCX protein of the present invention may contain at least
four of the above-identified domains.
[0190] Moreover, other biologically active portions, in which other
regions of the protein are deleted, can be prepared by recombinant
techniques and evaluated for one or more of the functional
activities of a native TSCX protein.
[0191] In some embodiments, the TSCX protein is substantially
homologous to one of these TSCX proteins and retains its the
functional activity, yet differs in amino acid sequence due to
natural allelic variation or mutagenesis, as described in detail
below.
[0192] In specific embodiments, the invention includes an isolated
polypeptide comprising an amino acid sequence that is 80% or more
identical to the sequence of a polypeptide whose expression is
modulated in a mammal to which TSCXic agent is administered.
[0193] Determining Homology Between Two or More Sequences
[0194] To determine the percent homology of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes (e.g., gaps can be introduced in the
sequence of a first amino acid or nucleic acid sequence for optimal
alignment with a second amino or nucleic acid sequence). The amino
acid residues or nucleotides at corresponding amino acid positions
or nucleotide positions are then compared. When a position in the
first sequence is occupied by the same amino acid residue or
nucleotide as the corresponding position in the second sequence,
then the molecules are homologous at that position (i.e., as used
herein amino acid or nucleic acid "homology" is equivalent to amino
acid or nucleic acid "identity").
[0195] The nucleic acid sequence homology may be determined as the
degree of identity between two sequences. The homology may be
determined using computer programs known in the art, such as GAP
software provided in the GCG program package. See Needleman and
Wunsch 1970 J Mol Biol 48: 443-453. Using GCG GAP software with the
following settings for nucleic acid sequence comparison: GAP
creation penalty of 5.0 and GAP extension penalty of 0.3, the
coding region of the analogous nucleic acid sequences referred to
above exhibits a degree of identity preferably of at least 70%,
75%, 80%, 85%, 90%, 95%, 98%, or 99%, with the CDS (encoding) part
of a DNA sequence comprising TSCX::1-7, 10-13, 19-34, 45-53, 58-85,
111-113, 120, 130, 132-134 and 138.
[0196] The term "sequence identity" refers to the degree to which
two polynucleotide or polypeptide sequences are identical on a
residue-by-residue basis over a particular region of comparison.
The term "percentage of sequence identity" is calculated by
comparing two optimally aligned sequences over that region of
comparison, determining the number of positions at which the
identical nucleic acid base (e.g., A, T, C, G, U, or I, in the case
of nucleic acids) occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the region of comparison (i.e., the
window size), and multiplying the result by 100 to yield the
percentage of sequence identity. The term "substantial identity" as
used herein denotes a characteristic of a polynucleotide sequence,
wherein the polynucleotide comprises a sequence that has at least
80 percent sequence identity, preferably at least 85 percent
identity and often 90 to 95 percent sequence identity, more usually
at least 99 percent sequence identity as compared to a reference
sequence over a comparison region.
[0197] Chimeric and Fusion Proteins
[0198] The invention also provides TSCX chimeric or fusion
proteins. As used herein, an TSCX "chimeric protein" or "fusion
protein" comprises an TSCX polypeptide operatively linked to a
non-TSCX polypeptide. A "TSCX polypeptide" refers to a polypeptide
having an amino acid sequence corresponding to TSCX, whereas a
"non-TSCX polypeptide" refers to a polypeptide having an amino acid
sequence corresponding to a protein that is not substantially
homologous to the TSCX protein, e.g., a protein that is different
from the TSCX protein and that is derived from the same or a
different organism. Within an TSCX fusion protein the TSCX
polypeptide can correspond to all or a portion of an TSCX protein.
In one embodiment, an TSCX fusion protein comprises at least one
biologically active portion of an TSCX protein. In another
embodiment, an TSCX fusion protein comprises at least two
biologically active portions of an TSCX protein. In yet another
embodiment, an TSCX fusion protein comprises at least three
biologically active portions of an TSCX protein. Within the fusion
protein, the term "operatively linked" is intended to indicate that
the TSCX polypeptide and the non-TSCX polypeptide are fused
in-frame to each other. The non-TSCX polypeptide can be fused to
the N-terminus or C-terminus of the TSCX polypeptide.
[0199] For example, in one embodiment an TSCX fusion protein
comprises an TSCX domain operably linked to the extracellular
domain of a second protein. Such fusion proteins can be further
utilized in screening assays for compounds which modulate TSCX
activity (such assays are described in detail below).
[0200] In yet another embodiment, the fusion protein is a GST-TSCX
fusion protein in which the TSCX sequences are fused to the
C-terminus of the GST (i.e., glutathione S-transferase) sequences.
Such fusion proteins can facilitate the purification of recombinant
TSCX.
[0201] In another embodiment, the fusion protein is an TSCX protein
containing a heterologous signal sequence at its N-terminus. For
example, a native TSCX signal sequence can be removed and replaced
with a signal sequence from another protein. In certain host cells
(e.g., mammalian host cells), expression and/or secretion of TSCX
can be increased through use of a heterologous signal sequence.
[0202] In yet another embodiment, the fusion protein is an
TSCX-immunoglobulin fusion protein in which the TSCX sequences
comprising one or more domains are fused to sequences derived from
a member of the immunoglobulin protein family. The
TSCX-immunoglobulin fusion proteins of the invention can be
incorporated into pharmaceutical compositions and administered to a
subject to inhibit an interaction between a TSCX ligand and a TSCX
protein on the surface of a cell, to thereby suppress TSCX-mediated
signal transduction in vivo. The TSCX-immunoglobulin fusion
proteins can be used to affect the bioavailability of an TSCX
cognate ligand. Inhibition of the TSCX ligand/TSCX interaction may
be useful therapeutically for both the treatments of proliferative
and differentiative disorders, as well as modulating (e.g.
promoting or inhibiting) cell survival. Moreover, the
TSCX-immunoglobulin fusion proteins of the invention can be used as
immunogens to produce anti-TSCX antibodies in a subject, to purify
TSCX ligands, and in screening assays to identify molecules that
inhibit the interaction of TSCX with a TSCX ligand.
[0203] An TSCX chimeric or fusion protein of the invention can be
produced by standard recombinant DNA techniques. For example, DNA
fragments coding for the different polypeptide sequences are
ligated together in-frame in accordance with conventional
techniques, e.g., by employing blunt-ended or stagger-ended termini
for ligation, restriction enzyme digestion to provide for
appropriate termini, filling-in of cohesive ends as appropriate,
alkaline phosphatase treatment to avoid undesirable joining, and
enzymatic ligation. In another embodiment, the fusion gene can be
synthesized by conventional techniques including automated DNA
synthesizers. Alternatively, PCR amplification of gene fragments
can be carried out using anchor primers that give rise to
complementary overhangs between two consecutive gene fragments that
can subsequently be annealed and reamplified to generate a chimeric
gene sequence (see, for example, Ausubel et al. (eds.) CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, 1992).
Moreover, many expression vectors are commercially available that
already encode a fusion moiety (e.g., a GST polypeptide). An
TSCX-encoding nucleic acid can be cloned into such an expression
vector such that the fusion moiety is linked in-frame to the TSCX
protein.
[0204] TSCX Agonists and Antagonists
[0205] The present invention also pertains to variants of the TSCX
proteins that function as either TSCX agonists (mimetics) or as
TSCX antagonists. Variants of the TSCX protein can be generated by
mutagenesis, e.g., discrete point mutation or truncation of the
TSCX protein. An agonist of the TSCX protein can retain
substantially the same, or a subset of, the biological activities
of the naturally occurring form of the TSCX protein. An antagonist
of the TSCX protein can inhibit one or more of the activities of
the naturally occurring form of the TSCX protein by, for example,
competitively binding to a downstream or upstream member of a
cellular signaling cascade which includes the TSCX protein. Thus,
specific biological effects can be elicited by treatment with a
variant of limited function. In one embodiment, treatment of a
subject with a variant having a subset of the biological activities
of the naturally occurring form of the protein has fewer side
effects in a subject relative to treatment with the naturally
occurring form of the TSCX proteins.
[0206] Variants of the TSCX protein that function as either TSCX
agonists (mimetics) or as TSCX antagonists can be identified by
screening combinatorial libraries of mutants, e.g., truncation
mutants, of the TSCX protein for TSCX protein agonist or antagonist
activity. In one embodiment, a variegated library of TSCX variants
is generated by combinatorial mutagenesis at the nucleic acid level
and is encoded by a variegated gene library. A variegated library
of TSCX variants can be produced by, for example, enzymatically
ligating a mixture of synthetic oligonucleotides into gene
sequences such that a degenerate set of potential TSCX sequences is
expressible as individual polypeptides, or alternatively, as a set
of larger fusion proteins (e.g., for phage display) containing the
set of TSCX sequences therein. There are a variety of methods which
can be used to produce libraries of potential TSCX variants from a
degenerate oligonucleotide sequence. Chemical synthesis of a
degenerate gene sequence can be performed in an automatic DNA
synthesizer, and the synthetic gene then ligated into an
appropriate expression vector. Use of a degenerate set of genes
allows for the provision, in one mixture, of all of the sequences
encoding the desired set of potential TSCX sequences. Methods for
synthesizing degenerate oligonucleotides are known in the art (see,
e.g., Narang (1983) Tetrahedron 39:3; Itakura et al. (1984) Annu
Rev Biochem 53:323; Itakura et al. (1984) Science 198:1056; Ike et
al. (1983) Nucl Acid Res 11:477.
[0207] Polypeptide Libraries
[0208] In addition, libraries of fragments of the TSCX protein
coding sequence can be used to generate a variegated population of
TSCX fragments for screening and subsequent selection of variants
of an TSCX protein. In one embodiment, a library of coding sequence
fragments can be generated by treating a double stranded PCR
fragment of a TSCX coding sequence with a nuclease under conditions
wherein nicking occurs only about once per molecule, denaturing the
double stranded DNA, renaturing the DNA to form double stranded DNA
that can include sense/antisense pairs from different nicked
products, removing single stranded portions from reformed duplexes
by treatment with S1 nuclease, and ligating the resulting fragment
library into an expression vector. By this method, an expression
library can be derived which encodes N-terminal and internal
fragments of various sizes of the TSCX protein.
[0209] Several techniques are known in the art for screening gene
products of combinatorial libraries made by point mutations or
truncation, and for screening cDNA libraries for gene products
having a selected property. Such techniques are adaptable for rapid
screening of the gene libraries generated by the combinatorial
mutagenesis of TSCX proteins. The most widely used techniques,
which are amenable to high throughput analysis, for screening large
gene libraries typically include cloning the gene library into
replicable expression vectors, transforming appropriate cells with
the resulting library of vectors, and expressing the combinatorial
genes under conditions in which detection of a desired activity
facilitates isolation of the vector encoding the gene whose product
was detected. Recursive ensemble mutagenesis (REM), a new technique
that enhances the frequency of functional mutants in the libraries,
can be used in combination with the screening assays to identify
TSCX variants (Arkin and Yourvan (1992) PNAS 89:7811-7815; Delgrave
et al. (1993) Protein Engineering 6:327-331).
[0210] Anti-TSCX Antibodies
[0211] An isolated TSCX protein, or a portion or fragment thereof,
can be used as an immunogen to generate antibodies that bind TSCX
using standard techniques for polyclonal and monoclonal antibody
preparation. The full-length TSCX protein can be used or,
alternatively, the invention provides antigenic peptide fragments
of TSCX for use as immunogens. The antigenic peptide of TSCX
comprises at least 8 amino acid residues of the amino acid sequence
encoded by a nucleic acid comprising the nucleic acid sequence
shown in TSC: 1-8, 10-12, and 15-25 and encompasses an epitope of
TSCX such that an antibody raised against the peptide forms a
specific immune complex with TSCX. Preferably, the antigenic
peptide comprises at least 10 amino acid residues, more preferably
at least 15 amino acid residues, even more preferably at least 20
amino acid residues, and most preferably at least 30 amino acid
residues. Preferred epitopes encompassed by the antigenic peptide
are regions of TSCX that are located on the surface of the protein,
e.g., hydrophilic regions. As a means for targeting antibody
production, hydropathy plots showing regions of hydrophilicity and
hydrophobicity may be generated by any method well known in the
art, including, for example, the Kyte Doolittle or the Hopp Woods
methods, either with or without Fourier transformation. See, e.g.,
Hopp and Woods, 1981, Proc. Nat. Acad. Sci. USA 78: 3824-3828; Kyte
and Doolittle 1982, J. Mol. Biol. 157: 105-142, each incorporated
herein by reference in their entirety.
[0212] TSCX polypeptides or derivatives, fragments, analogs or
homologs thereof, may be utilized as immunogens in the generation
of antibodies that immunospecifically-bind these protein
components. The term "antibody" as used herein refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an antigen
binding site that specifically binds (immunoreacts with) an
antigen. Such antibodies include, but are not limited to,
polyclonal, monoclonal, chimeric, single chain, F.sub.ab and
F.sub.(ab')2 fragments, and an F.sub.ab expression library. Various
procedures known within the art may be used for the production of
polyclonal or monoclonal antibodies to an TSCX protein sequence, or
derivatives, fragments, analogs or homologs thereof. Some of these
proteins are discussed below.
[0213] For the production of polyclonal antibodies, various
suitable host animals (e.g., rabbit, goat, mouse or other mammal)
may be immunized by injection with the native protein, or a
synthetic variant thereof, or a derivative of the foregoing. An
appropriate immunogenic preparation can contain, for example,
recombinantly expressed TSCX protein or a chemically synthesized
TSCX polypeptide. The preparation can further include an adjuvant.
Various adjuvants used to increase the immunological response
include, but are not limited to, Freund's (complete and
incomplete), mineral gels (e.g., aluminum hydroxide), surface
active substances (e.g., lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, dinitrophenol, etc.), human
adjuvants such as Bacille Calmette-Guerin and Corynebacterium
parvum, or similar immunostimulatory agents. If desired, the
antibody molecules directed against TSCX can be isolated from the
mammal (e.g., from the blood) and further purified by well known
techniques, such as protein A chromatography to obtain the IgG
fraction.
[0214] The term "monoclonal antibody" or "monoclonal antibody
composition", as used herein, refers to a population of antibody
molecules that contain only one species of an antigen binding site
capable of immunoreacting with a particular epitope of TSCX. A
monoclonal antibody composition thus typically displays a single
binding affinity for a particular TSCX protein with which it
immunoreacts. For preparation of monoclonal antibodies directed
towards a particular TSCX protein, or derivatives, fragments,
analogs or homologs thereof, any technique that provides for the
production of antibody molecules by continuous cell line culture
may be utilized. Such techniques include, but are not limited to,
the hybridoma technique (see Kohler & Milstein, 1975 Nature
256: 495-497); the trioma technique; the human B-cell hybridoma
technique (see Kozbor, et al., 1983 Immunol Today 4: 72) and the
EBV hybridoma technique to produce human monoclonal antibodies (see
Cole, et al., 1985 In: MONOCLONAL ANTIBODIES AND CANCER THERAPY,
Alan R. Liss, Inc., pp. 77-96). Human monoclonal antibodies may be
utilized in the practice of the present invention and may be
produced by using human hybridomas (see Cote, et al., 1983. Proc
Natl Acad Sci USA 80: 2026-2030) or by transforming human B-cells
with Epstein Barr Virus in vitro (see Cole, et al., 1985 In:
MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp.
77-96).
[0215] According to the invention, techniques can be adapted for
the production of single-chain antibodies specific to a TSCX
protein (see e.g., U.S. Pat. No. 4,946,778). In addition, methods
can be adapted for the construction of F.sub.ab expression
libraries (see e.g., Huse, et al., 1989 Science 246: 1275-1281) to
allow rapid and effective identification of monoclonal F.sub.ab
fragments with the desired specificity for a TSCX protein or
derivatives, fragments, analogs or homologs thereof. Non-human
antibodies can be "humanized" by techniques well known in the art.
See e.g., U.S. Pat. No. 5,225,539. Antibody fragments that contain
the idiotypes to a TSCX protein may be produced by techniques known
in the art including, but not limited to: (i) an F.sub.(ab')2
fragment produced by pepsin digestion of an antibody molecule; (ii)
an F.sub.ab fragment generated by reducing the disulfide bridges of
an F.sub.(ab')2 fragment; (iii) an F.sub.ab fragment generated by
the treatment of the antibody molecule with papain and a reducing
agent and (iv) F.sub.v fragments.
[0216] Additionally, recombinant anti-TSCX antibodies, such as
chimeric and humanized monoclonal antibodies, comprising both human
and non-human portions, which can be made using standard
recombinant DNA techniques, are within the scope of the invention.
Such chimeric and humanized monoclonal antibodies can be produced
by recombinant DNA techniques known in the art, for example using
methods described in PCT International Application No.
PCT/US86/02269; European Patent Application No. 184,187; European
Patent Application No. 171,496; European Patent Application No.
173,494; PCT International Publication No. WO 86/01533; U.S. Pat.
No. 4,816,567; European Patent Application No. 125,023; Better et
al. (1988) Science 240:1041-1043; Liu et al. (1987) PNAS
84:3439-3443; Liu et al. (1987) J Immunol. 139:3521-3526; Sun et
al. (1987) PNAS84:214-218; Nishimuraetal. (1987) Cancer Res
47:999-1005; Wood et al. (1985) Nature 314:446-449; Shaw et al.
(1988) J Natl Cancer Inst. 80:1553-1559); Morrison (1985) Science
229:1202-1207; Oi et al. (1986) BioTechniques 4:214; U.S. Pat. No.
5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al.
(1988) Science 239:1534; and Beidler et al. (1988) J Immunol
141:4053-4060.
[0217] In one embodiment, methods for the screening of antibodies
that possess the desired specificity include, but are not limited
to, enzyme-linked immunosorbent assay (ELISA) and other
immunologically-mediated techniques known within the art. In a
specific embodiment, selection of antibodies that are specific to a
particular domain of a TSCX protein is facilitated by generation of
hybridomas that bind to the fragment of a TSCX protein possessing
such a domain. Antibodies that are specific for one or more domains
within a TSCX protein, e.g., domains spanning the above-identified
conserved regions of TSCX family proteins, or derivatives,
fragments, analogs or homologs thereof, are also provided
herein.
[0218] Anti-TSCX antibodies may be used in methods known within the
art relating to the localization and/or quantitation of a TSCX
protein (e.g., for use in measuring levels of the TSCX protein
within appropriate physiological samples, for use in diagnostic
methods, for use in imaging the protein, and the like). In a given
embodiment, antibodies for TSCX proteins, or derivatives,
fragments, analogs or homologs thereof, that contain the antibody
derived binding domain, are utilized as pharmacologically-active
compounds [hereinafter "Therapeutics"].
[0219] An anti-TSCX antibody (e.g., monoclonal antibody) can be
used to isolate TSCX by standard techniques, such as affinity
chromatography or immunoprecipitation. An anti-TSCX antibody can
facilitate the purification of natural TSCX from cells and of
recombinantly produced TSCX expressed in host cells. Moreover, an
anti-TSCX antibody can be used to detect TSCX protein (e.g., in a
cellular lysate or cell supernatant) in order to evaluate the
abundance and pattern of expression of the TSCX protein. Anti-TSCX
antibodies can be used diagnostically to monitor protein levels in
tissue as part of a clinical testing procedure, e.g., to, for
example, determine the efficacy of a given treatment regimen.
Detection can be facilitated by coupling (i.e., physically linking)
the antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials, and
radioactive materials. Examples of suitable enzymes include
horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase,
or acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin, and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0220] TSCX Recombinant Expression Vectors and Host Cells
[0221] Another aspect of the invention pertains to vectors,
preferably expression vectors, containing a nucleic acid encoding
TSCX protein, or derivatives, fragments, analogs or homologs
thereof. As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a "plasmid", which refers to
a linear or circular double stranded DNA loop into which additional
DNA segments can be ligated. Another type of vector is a viral
vector, wherein additional DNA segments can be ligated into the
viral genome. Certain vectors are capable of autonomous replication
in a host cell into which they are introduced (e.g., bacterial
vectors having a bacterial origin of replication and episomal
mammalian vectors). Other vectors (e.g., non-episomal mammalian
vectors) are integrated into the genome of a host cell upon
introduction into the host cell, and thereby are replicated along
with the host genome. Moreover, certain vectors are capable of
directing the expression of genes to which they are operatively
linked. Such vectors are referred to herein as "expression
vectors". In general, expression vectors of utility in recombinant
DNA techniques are often in the form of plasmids. In the present
specification, "plasmid" and "vector" can be used interchangeably
as the plasmid is the most commonly used form of vector. However,
the invention is intended to include such other forms of expression
vectors, such as viral vectors (e.g., replication defective
retroviruses, adenoviruses and adeno-associated viruses), which
serve equivalent functions.
[0222] The recombinant expression vectors of the invention comprise
a nucleic acid of the invention in a form suitable for expression
of the nucleic acid in a host cell, which means that the
recombinant expression vectors include one or more regulatory
sequences, selected on the basis of the host cells to be used for
expression, that is operatively linked to the nucleic acid sequence
to be expressed. Within a recombinant expression vector, "operably
linked" is intended to mean that the nucleotide sequence of
interest is linked to the regulatory sequence(s) in a manner that
allows for expression of the nucleotide sequence (e.g., in an in
vitro transcription/translation system or in a host cell when the
vector is introduced into the host cell). The term "regulatory
sequence" is intended to includes promoters, enhancers and other
expression control elements (e.g., polyadenylation signals). Such
regulatory sequences are described, for example, in Goeddel; GENE
EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press,
San Diego, Calif. (1990). Regulatory sequences include those that
direct constitutive expression of a nucleotide sequence in many
types of host cell and those that direct expression of the
nucleotide sequence only in certain host cells (e.g.,
tissue-specific regulatory sequences). It will be appreciated by
those skilled in the art that the design of the expression vector
can depend on such factors as the choice of the host cell to be
transformed, the level of expression of protein desired, etc. The
expression vectors of the invention can be introduced into host
cells to thereby produce proteins or peptides, including fusion
proteins or peptides, encoded by nucleic acids as described herein
(e.g., TSCX proteins, mutant forms of TSCX, fusion proteins,
etc.).
[0223] The recombinant expression vectors of the invention can be
designed for expression of TSCX in prokaryotic or eukaryotic cells.
For example, TSCX can be expressed in bacterial cells such as E.
coli, insect cells (using baculovirus expression vectors) yeast
cells or mammalian cells. Suitable host cells are discussed further
in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185,
Academic Press, San Diego, Calif. (1990). Alternatively, the
recombinant expression vector can be transcribed and translated in
vitro, for example using T7 promoter regulatory sequences and T7
polymerase.
[0224] Expression of proteins in prokaryotes is most often carried
out in E. coli with vectors containing constitutive or inducible
promoters directing the expression of either fusion or non-fusion
proteins. Fusion vectors add a number of amino acids to a protein
encoded therein, usually to the amino terminus of the recombinant
protein. Such fusion vectors typically serve three purposes: (1) to
increase expression of recombinant protein; (2) to increase the
solubility of the recombinant protein; and (3) to aid in the
purification of the recombinant protein by acting as a ligand in
affinity purification. Often, in fusion expression vectors, a
proteolytic cleavage site is introduced at the junction of the
fusion moiety and the recombinant protein to enable separation of
the recombinant protein from the fusion moiety subsequent to
purification of the fusion protein. Such enzymes, and their cognate
recognition sequences, include Factor Xa, thrombin and
enterokinase. Typical fusion expression vectors include pGEX
(Pharmacia Biotech Inc; Smith and Johnson (1988) Gene 67:31-40),
pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia,
Piscataway, N.J.) that fuse glutathione S-transferase (GST),
maltose E binding protein, or protein A, respectively, to the
target recombinant protein.
[0225] Examples of suitable inducible non-fusion E. coli expression
vectors include pTrc (Amrann et al., (1988) Gene 69:301-315) and
pET 11d (Studier et al., GENE EXPRESSION TECHNOLOGY: METHODS IN
ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990)
60-89).
[0226] One strategy to maximize recombinant protein expression in
E. coli is to express the protein in a host bacteria with an
impaired capacity to proteolytically cleave the recombinant
protein. See, Gottesman, GENE EXPRESSION TECHNOLOGY: METHODS IN
ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 119-128.
Another strategy is to alter the nucleic acid sequence of the
nucleic acid to be inserted into an expression vector so that the
individual codons for each amino acid are those preferentially
utilized in E. coli (Wada et al., (1992) Nucleic Acids Res.
20:211:1-7, 10-13, 19-34, 45-53, 58-85, 111-113, 120, 130, 132-134
and 13518). Such alteration of nucleic acid sequences of the
invention can be carried out by standard DNA synthesis
techniques.
[0227] In another embodiment, the TSCX expression vector is a yeast
expression vector. Examples of vectors for expression in yeast S.
cerevisiae include pYepSec1 (Baldari, et al., (1987) EMBO J.
6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943),
pJRY88 (Schultz et al., (1987) Gene 54:113-123), pYES2 (Invitrogen
Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San
Diego, Calif.).
[0228] Alternatively, TSCX can be expressed in insect cells using
baculovirus expression vectors. Baculovirus vectors available for
expression of proteins in cultured insect cells (e.g., SF9 cells)
include the pAc series (Smith et al. (1983) Mol Cell Biol
3:2156-2165) and the pVL series (Lucklow and Summers (1989)
Virology 170:31-39).
[0229] In yet another embodiment, a nucleic acid of the invention
is expressed in mammalian cells using a mammalian expression
vector. Examples of mammalian expression vectors include pCDM8
(Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO
J 6: 187-195). When used in mammalian cells, the expression
vector's control functions are often provided by viral regulatory
elements. For example, commonly used promoters are derived from
polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For
other suitable expression systems for both prokaryotic and
eukaryotic cells. See, e.g., Chapters 16 and 17 of Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989.
[0230] In another embodiment, the recombinant mammalian expression
vector is capable of directing expression of the nucleic acid
preferentially in a particular cell type (e.g., tissue-specific
regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory elements are known in the art.
Non-limiting examples of suitable tissue-specific promoters include
the albumin promoter (liver-specific; Pinkert et al. (1987) Genes
Dev 1:268-277), lymphoid-specific promoters (Calame and Eaton
(1988) Adv Immunol 43:235-275), in particular promoters of T cell
receptors (Winoto and Baltimore (1989) EMBO J 8:729-733) and
immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and
Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g.,
the neurofilament promoter; Byrne and Ruddle (1989) PNAS
86:5473-5477), pancreas-specific promoters (Edlund et al. (1985)
Science 230:912-916), and mammary gland-specific promoters (e.g.,
milk whey promoter; U.S. Pat. No. 4,873,316 and European
Application Publication No. 264,166). Developmentally-regulated
promoters are also encompassed, e.g., the murine hox promoters
(Kessel and Gruss (1990) Science 249:374-379) and the a-fetoprotein
promoter (Campes and Tilghman (1989) Genes Dev 3:537-546).
[0231] The invention further provides a recombinant expression
vector comprising a DNA molecule of the invention cloned into the
expression vector in an antisense orientation. That is, the DNA
molecule is operatively linked to a regulatory sequence in a manner
that allows for expression (by transcription of the DNA molecule)
of an RNA molecule that is antisense to TSCX mRNA. Regulatory
sequences operatively linked to a nucleic acid cloned in the
antisense orientation can be chosen that direct the continuous
expression of the antisense RNA molecule in a variety of cell
types, for instance viral promoters and/or enhancers, or regulatory
sequences can be chosen that direct constitutive, tissue specific
or cell type specific expression of antisense RNA. The antisense
expression vector can be in the form of a recombinant plasmid,
phagemid or attenuated virus in which antisense nucleic acids are
produced under the control of a high efficiency regulatory region,
the activity of which can be determined by the cell type into which
the vector is introduced. For a discussion of the regulation of
gene expression using antisense genes see Weintraub et al.,
"Antisense RNA as a molecular tool for genetic analysis,"
Reviews--Trends in Genetics, Vol. 1(1) 1986.
[0232] Another aspect of the invention pertains to host cells into
which a recombinant expression vector of the invention has been
introduced. The terms "host cell" and "recombinant host cell" are
used interchangeably herein. It is understood that such terms refer
not only to the particular subject cell but also to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0233] A host cell can be any prokaryotic or eukaryotic cell. For
example, TSCX protein can be expressed in bacterial cells such as
E. coli, insect cells, yeast or mammalian cells (such as Chinese
hamster ovary cells (CHO) or COS cells). Other suitable host cells
are known to those skilled in the art.
[0234] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" are
intended to refer to a variety of art-recognized techniques for
introducing foreign nucleic acid (e.g., DNA) into a host cell,
including calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting
host cells can be found in Sambrook, et al. (MOLECULAR CLONING: A
LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989),
and other laboratory manuals.
[0235] For stable transfection of mammalian cells, it is known
that, depending upon the expression vector and transfection
technique used, only a small fraction of cells may integrate the
foreign DNA into their genome. In order to identify and select
these integrants, a gene that encodes a selectable marker (e.g.,
resistance to antibiotics) is generally introduced into the host
cells along with the gene of interest. Various selectable markers
include those that confer resistance to drugs, such as G418,
hygromycin and methotrexate. Nucleic acid encoding a selectable
marker can be introduced into a host cell on the same vector as
that encoding TSCX or can be introduced on a separate vector. Cells
stably transfected with the introduced nucleic acid can be
identified by drug selection (e.g., cells that have incorporated
the selectable marker gene will survive, while the other cells
die).
[0236] A host cell of the invention, such as a prokaryotic or
eukaryotic host cell in culture, can be used to produce (i.e.,
express) an TSCX protein. Accordingly, the invention further
provides methods for producing TSCX protein using the host cells of
the invention. In one embodiment, the method comprises culturing
the host cell of invention (into which a recombinant expression
vector encoding TSCX has been introduced) in a suitable medium such
that TSCX protein is produced. In another embodiment, the method
further comprises isolating TSCX from the medium or the host
cell.
[0237] Kits and Nucleic Acid Collections for Identifying TSCX
Nucleic Acids
[0238] In another aspect, the invention provides a kit useful for
examining TSCXicity of agents. The kit can include nucleic acids
that detect two or more TSCX sequences. In preferred embodiments,
the kit includes reagents which detect 3, 4, 5, 6, 8, 10, 12, 15,
20, 25, 50, 100 or all of the TSCX nucleic acid sequences.
[0239] The invention also includes an isolated plurality of
sequences which can identify one or more TSCX responsive nucleic
acid sequences. The kit or plurality may include, e.g., sequence
homologous to TSCX nucleic acid sequences, or sequences which can
specifically identify one or more TSCX nucleic acid sequences.
EXAMPLES
Example 1
Expression Analysis of Antileukoprotease in Various Tissues
[0240] The quantitative expression of NMB (GenBank Accession No:
X04470; Table 1; TSC) was assessed using microtiter plates
containing RNA samples from a variety of normal and
pathology-derived cells, cell lines and tissues using real time
quantitative PCR (RTQ PCR; TAQMAN.RTM.). RTQ PCR was performed on a
Perkin-Elmer Biosystems ABI PRISM.RTM. 7700 Sequence Detection
System. Various collections of samples are assembled on the plates,
and referred to as Panel 1 (containing cells and cell lines from
normal and cancer sources), and Panel 2 (containing samples derived
from tissues, in particular from surgical samples, from normal and
cancer sources).
[0241] First, the RNA samples were normalized to constitutively
expressed genes such as .beta.-actin and GAPDH. RNA (.about.50 ng
total or .about.1 ng polyA+) was converted to cDNA using the
TAQMAN.RTM. Reverse Transcription Reagents Kit (PE Biosystems,
Foster City, Calif.; Catalog No. N808-0234) and random hexamers
according to the manufacturer's protocol. Reactions were performed
in 20 ul and incubated for 30 min. at 48.degree. C. cDNA (5 ul) was
then transferred to a separate plate for the TAQMAN.RTM. reaction
using .beta.-actin and GAPDH TAQMAN.RTM. Assay Reagents (PE
Biosystems; Catalog Nos. 4310881E and 4310884E, respectively) and
TAQMAN.RTM. universal PCR Master Mix (PE Biosystems; Catalog No.
4304447) according to the manufacturer's protocol. Reactions were
performed in 25 ul using the following parameters: 2 min. at
50.degree. C.; 10 min. at 95.degree. C.; 15 sec. at 95.degree. C./1
min. at 60.degree. C. (40 cycles). Results were recorded as CT
values (cycle at which a given sample crosses a threshold level of
fluorescence) using a log scale, with the difference in RNA
concentration between a given sample and the sample with the lowest
CT value being represented as 2 to the power of delta CT. The
percent relative expression is then obtained by taking the
reciprocal of this RNA difference and multiplying by 100. The
average CT values obtained for .beta.-actin and GAPDH were used to
normalize RNA samples. The RNA sample generating the highest CT
value required no further diluting, while all other samples were
diluted relative to this sample according to their
.beta.-actin/GAPDH average CT values.
[0242] Normalized RNA (5 ul) was converted to cDNA and analyzed via
TAQMAN.RTM. using One Step RT-PCR Master Mix Reagents (PE
Biosystems; Catalog No. 4309169) and gene-specific primers
according to the manufacturer's instructions. Probes and primers
were designed for each assay according to Perkin Elmer Biosystem's
Primer Express Software package (version I for Apple Computer's
Macintosh Power PC) or a similar algorithm using the target
sequence as input. Default settings were used for reaction
conditions and the following parameters were set before selecting
primers: primer concentration=250 nM, primer melting temperature
(T.sub.m) range=58.degree.-60.degree. C., primer optimal
Tm=59.degree. C., maximum primer difference=2.degree. C., probe
does not have 5' G, probe T.sub.m must be 10.degree. C. greater
than primer T.sub.m, amplicon size 75 bp to 100 bp. The probes and
primers selected (see below) were synthesized by Synthegen
(Houston, Tex., USA). Probes were double purified by HPLC to remove
uncoupled dye and evaluated by mass spectroscopy to verify coupling
of reporter and quencher dyes to the 5' and 3' ends of the probe,
respectively. Their final concentrations were: forward and reverse
primers, 900 nM each, and probe, 200 nM.
[0243] PCR conditions: Normalized RNA from each tissue and each
cell line was spotted in each well of a 96 well PCR plate (Perkin
Elmer Biosystems). PCR cocktails including two probes (a probe
specific for the target clone and another gene-specific probe
multiplexed with the target probe) were set up using 1.times.
TaqMan.TM. PCR Master Mix for the PE Biosystems 7700, with 5 mM
MgCl2, dNTPs (dA, G, C, U at 1:1:1:2 ratios), 0.25 U/ml AmpliTaq
Gold.TM. (PE Biosystems), and 0.4 U/.mu.l RNase inhibitor, and 0.25
U/l reverse transcriptase. Reverse transcription was performed at
48.degree. C. for 30 minutes followed by amplification/PCR cycles
as follows: 95.degree. C. 10 min, then 40 cycles of 95.degree. C.
for 15 seconds, 60.degree. C. for 1 minute.
[0244] In the results for Panel 1, the following abbreviations are
used:
[0245] ca.=carcinoma,
[0246] *=established from metastasis,
[0247] met=metastasis,
[0248] s cell var=small cell variant,
[0249] non-s=non-sm=non-small,
[0250] squam=squamous,
[0251] pl. eff=pl effusion=pleural effusion,
[0252] glio=glioma,
[0253] astro=astrocytoma, and
[0254] neuro=neuroblastoma.
[0255] Panel 2
[0256] The plates for Panel 2 generally include 2 control wells and
94 test samples composed of RNA or cDNA isolated from human tissue
procured by surgeons working in close cooperation with the National
Cancer Institute's Cooperative Human Tissue Network (CHTN) or the
National Disease Research Initiative (NDRI). The tissues are
derived from human malignancies and in cases where indicated many
malignant tissues have "matched margins" obtained from noncancerous
tissue just adjacent to the tumor. These are termed normal adjacent
tissues and are denoted "NAT" in the results below. The tumor
tissue and the "matched margins" are evaluated by two independent
pathologists (the surgical pathologists and again by a pathologists
at NDRI or CHTN). This analysis provides a gross histopathological
assessment of tumor differentiation grade. Moreover, most samples
include the original surgical pathology report that provides
information regarding the clinical stage of the patient. These
matched margins are taken from the tissue surrounding (i.e.
immediately proximal) to the zone of surgery (designated "NAT", for
normal adjacent tissue, in Table 4). In addition, RNA and cDNA
samples were obtained from various human tissues derived from
autopsies performed on elderly people or sudden death victims
(accidents, etc.). These tissue were ascertained to be free of
disease and were purchased from various commercial sources such as
Clontech (Palo Alto, Calif.), Research Genetics, and
Invitrogen.
[0257] RNA integrity from all samples is controlled for quality by
visual assessment of agarose gel electropherograms using 28S and
18S ribosomal RNA staining intensity ratio as a guide (2:1 to 2.5:1
28s:18s) and the absence of low molecular weight RNAs that would be
indicative of degradation products. Samples are controlled against
genomic DNA contamination by RTQ PCR reactions run in the absence
of reverse transcriptase using probe and primer sets designed to
amplify across the span of a single exon.
[0258] The TaqMan.TM. expression profiles of NMB were generated
using a specific gene probes and primer set (Ag 817) as shown
below:
24 Ag 817 forward: 5'-TCAATGGAACCTTCAGCCTTA-3' ProbeTET:
5'-CTCACTGTGAAAGCTGCAGCACCAG-3'-TAMRA Reverse:
5'-GAAGGGGTGGGTTTTGAAG-3'
[0259] The results shown in Table 2 (see below) relate to 41 normal
human tissues and 55 human cancer cell lines and demonstrate the
high expression of NMB in melanomas cell lines and overexpression
in the breast cancer cell line MDA-N. The results shown in Table 3
(see below) relate to additional tumor tissues, many of which are
matched with normal adjacent tissue (NAT), as defined by the
operating surgeon that obtained the samples. It reveals that NMB is
overexpressed in 9/9 kidney tumors compared either with normal
kidney or NAT. This analysis corroborates the GeneCalling.TM.
results which originally identified the expression of NMB that NMB
is also overexpressed in some of the lung carcinoma tissues
compared with NATs and 2 melanoma metastasis compared with NAT.
[0260] NCI's CGAP Sage analysis indicates that NMB is expressed in
several glioblastoma (H392, pooled GBM, GBMH1110), and in 1
malignant breast tumor (SKBR3), in accordance with panel 1 TaqMan
analysis. NCI data for EST expression, called "body map", reveals
that NMB is expressed in Schwann cells, in adenocarcinoma and
s.cell carcinoma.
[0261] Based on NMB's gene expression profile and its homology with
pMEL17, it is anticipated that for a subset of human tumors
including renal cell carcinomas, lung carcinomas, melanomas and CNS
cancers, successful targeting of NMB using a monoclonal antibody
will have an inhibitory effect on tumor growth, matrix invasion and
metastatic dissemination. Furthermore, targeting of NMB will have a
therapeutic effect on the TSC disease.
[0262] Furthermore, in consideration of NMB potential enzymatic
activity, NMB could be used as a target for screening a small
molecule drug.
[0263] In summary, these results demonstate the relevance of NMB as
a therapeutic target for the treatment of TSC is strenghtened by
its expression/overexpression in several tissues that are affected
in TSC.
Example 2
Therapeutic Targeting of CYR61
[0264] Based on CYR61's gene expression profile, it is anticipated
that for a subset of human tumors including renal cell carcinomas,
lung carcinomas, melanomas and CNS cancers, successful targeting of
CYR61 using a monoclonal antibody will have an inhibitory effect on
tumor growth, matrix invasion and metastatic dissemination.
Furthermore, targeting of CYR61 will have a therapeutic effect on
the TSC disease.
Example 3
Therapeutic Targeting of NET-7
[0265] NET-7 is overexpressed by a breast cancer cell lines and it
is regulated by estradiol treatment of a ER positive cell line
MCF7. Based on NET-7's gene expression profile, it is anticipated
that for a subset of human tumors specifically breast tumors,
successful targeting of NET-7 using a monoclonal antibody will have
an inhibitory effect on tumor growth, matrix invasion and
metastatic dissemination. Furthermore, targeting of NET-7 will have
a therapeutic effect on the TSC disease adrenomedullin precursor
(and Receptor activity modifying protein 1).
[0266] NET-7 has potent and long-lasting vasodilatory effects in
several vascular systems. In addition to adrenomedullin, another
hypotensive peptide, proadrenomedullin-derived peptide (PAMP), was
also found to be processed from the adrenomedullin precursor. PAMP
inhibits neural transmission at peripheral sympathetic nerve
endings, although adrenomedullin directly dilates vascular smooth
muscle. Adrenomedullin might participate in the pathogenesis of
hypertension, renal failure and congestive heart failure. Receptor
activity-modifying proteins (RAMPs) are single-transmembrane
proteins that transport the calcitonin receptor-like receptor
(CRLR) to the cell surface. RAMP 1-transported CRLR is a calcitonin
gene-related peptide (CGRP) receptor. RAMP1 is downregulated in
NSC. Because of its activities, overexpression of adrenomedullin
precursor by TSC patients might explain some of the TSC.
Other Embodiments
[0267] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
25 Rel. Expr., % Tissue Name 1.2tm958t_ag817 Endothelial cells 0
Heart (fetal) 5.4 Pancreas 6 Pancreatic ca. CAPAN 2 0 Adrenal Gland
(new lot*) 2.7 Thyroid 19.3 Salavary gland 2.7 Pituitary gland 3.7
Brain (fetal) 0.8 Brain (whole) 2.4 Brain (amygdala) 1.6 Brain
(cerebellum) 0.4 Brain (hippocampus) 1.3 Brain (thalamus) 1.1
Cerebral Cortex 1.2 Spinal cord 7.6 CNS ca. (glio/astro) U87-MG
27.2 CNS ca. (glio/astro) U-118-MG 13.5 CNS ca. (astro) SW1783 0.4
CNS ca.* (neuro; met) SK-N-AS 0.7 CNS ca. (astro) SF-539 52.9 CNS
ca. (astro) SNB-75 7 CNS ca. (glio) SNB-19 1.3 CNS ca. (glio) U251
4.9 CNS ca. (glio) SF-295 11 Heart 17.1 Skeletal Muscle (new lot*)
5.7 Bone marrow 0.8 Thymus 9.9 Spleen 5 Lymph node 25.7 Colorectal
8.2 Stomach 5.6 Small intestine 8.1 Colon ca. SW480 0 Colon ca.*
(SW480 met)SW620 0 Colon ca. HT29 0 Colon ca. HCT-116 0 Colon ca.
CaCo-2 0 83219 CC Well to Mod Diff 2.4 (ODO3866) Colon ca. HCC-2998
0.1 Gastric ca.* (liver met) NCI-N87 18.2 Bladder 8.1 Trachea 7.4
Kidney 3.1 Kidney (fetal) 1.7 Renal ca. 786-0 0 Renal ca. A498 4.7
Renal ca. RXF 393 1.5 Renal ca. ACHN 0 Renal ca. UO-31 1.8 Renal
ca. TK-10 0 Liver 2.5 Liver (fetal) 2.3 Liver ca. (hepatoblast)
HepG2 0
[0268]
26TABLE 3 Taq Man Results for Panel 2 Rel. Expr., % Tissue Name
2tm1063t_ag817 Normal Colon GENPAK 061003 11.8 83219 CC Well to Mod
Diff (ODO3866) 0 83220 CC NAT (ODO3866) 9.1 83221 CC Gr.2
rectosigmoid (ODO3868) 1.4 83222 CC NAT (ODO3868) 7.1 83235 CC Mod
Diff (ODO3920) 1.2 83236 CC NAT (ODO3920) 1.2 83237 CC Gr.2 ascend
colon (ODO3921) 4.8 83238 CC NAT (ODO3921) 5.8 83241 CC from
Partial Hepatectomy (ODO4309) 7.8 83242 Liver NAT (ODO4309) 2.9
87472 Colon mets to lung (OD04451-01) 14.6 87473 Lung NAT
(OD04451-02) 19.8 Normal Prostate Clontech A+ 6546-1 8.8 84140
Prostate Cancer (OD04410) 2.9 84141 Prostate NAT (OD04410) 0.7
87073 Prostate Cancer (OD04720-01) 1 87074 Prostate NAT
(OD04720-02) 1.5 Normal Lung GENPAK 061010 49.3 83239 Lung Met to
Muscle (ODO4286) 74.7 83240 Muscle NAT (ODO4286) 6.5 84136 Lung
Malignant Cancer (OD03126) 10.4 84137 Lung NAT (OD03126) 4.6 84871
Lung Cancer (OD04404) 27.7 84872 Lung NAT (OD04404) 7.9 84875 Lung
Cancer (OD04565) 41.8 84876 Lung NAT (OD04565)** 3.8 85950 Lung
Cancer (OD04237-01) 10.1 85970 Lung NAT (OD04237-02) 1.5 83255
Ocular Mel Met to Liver (ODO4310) 77.4 83256 Liver NAT (ODO4310)
1.8 84139 Melanoma Mets to Lung (OD04321) 53.6 84138 Lung NAT
(OD04321) 5.8 Normal Kidney GENPAK 061008 10.1 83786 Kidney Ca,
Nuclear grade 2 (OD04338) 22.5 83787 Kidney NAT (OD04338) 1.3 83788
Kidney Ca Nuclear grade 1/2 (OD04339) 17.2 83789 Kidney NAT
(OD04339) 2 83790 Kidney Ca, Clear cell type (OD04340) 11.3 83791
Kidney NAT (OD04340) 3.7 83792 Kidney Ca, Nuclear grade (OD04348)
12.1 83793 Kidney NAT (OD04348) 1.9 87474 Kidney Cancer
(OD04622-01) 19.6 87475 Kidney NAT (OD04622-03) 9 85973 Kidney
Cancer (OD04450-01) 54.7 85974 Kidney NAT (OD04450-03) 2.7 Kidney
Cancer Clontech 8120613 67.8 Kidney NAT Clontech 8120614 5.8 Kidney
Cancer Clontech 9010320 56.3 Kidney NAT Clontech 9010321 7.2 Kidney
Cancer Clontech 8120607 100 Kidney NAT Clontech 8120608 10.2 Normal
Uterus GENPAK 061018 11.5 Uterus Cancer GENPAK 064011 2 Normal
Thyroid Clontech A+ 6570-1** 44.4 Thyroid Cancer GENPAK 064010 90.1
Thyroid Cancer INVITROGEN A302152 10.9 Thyroid NAT INVITROGEN
A302153 8.3 Normal Breast GENPAK 061019 2.4 84877 Breast Cancer
(OD04566) 5.5 Breast Cancer Res. Gen. 1024 7.1 85975 Breast Cancer
(OD04590-01) 1.7 85976 Breast Cancer Mets (OD04590-03) 2 87070
Breast Cancer Metastasis (OD04655-05) 1.6 GENPAK Breast Cancer
064006 3.4 Breast Cancer Clontech 9100266 11.1 Breast NAT Clontech
9100265 7.7 Breast Cancer INVITROGEN A209073 11 Breast NAT
INVITROGEN A2090734 3.2 Normal Liver GENPAK 061009 6 Liver Cancer
Research Genetics RNA 1026 36.3 Liver Cancer Research Genetics RNA
1025 4 Paired Liver Cancer Tissue Research Genetics 10.4 RNA 6004-T
Paired Liver Tissue Research Genetics RNA 6004-N 32.1 Paired Liver
Cancer Tissue Research Genetics RNA 44.4 6005-T Paired Liver Tissue
Research Genetics RNA 6005-N 40.6 Liver Cancer GENPAK 064003 18.4
Normal Bladder GENPAK 061001 19.9 Bladder Cancer Research Genetics
RNA 1023 17 87071 Bladder Cancer (OD04718-01) 1.4 87072 Bladder
Normal Adjacent (OD04718-03) 0.9 Bladder Cancer INVITROGEN A302173
43.8 Normal Ovary Res. Gen. 39.5 Ovarian Cancer GENPAK 064008 10.8
87492 Ovary Cancer (OD04768-07) 5 87493 Ovary NAT (OD04768-08) 6.2
Normal Stomach GENPAK 061017 37.4 Gastric Cancer Clontech 9060358**
7.4 NAT Stomach Clontech 9060359 14.6 Gastric Cancer Clontech
9060397 40.9 NAT Stomach Clontech 9060396 9.9 Gastric Cancer
Clontech 9060395 20.9 NAT Stomach Clontech 9060394 22.2 Gastric
Cancer GENPAK 064005 8.6 genomic DNA control 4.5 Chemistry Control
0.1
[0269]
Sequence CWU 0
0
* * * * *