U.S. patent application number 10/620795 was filed with the patent office on 2005-08-11 for diagnostic tests for a new spirochete, borrelia lonestari sp. nov..
Invention is credited to Barbour, Alan G., Carter, Carol.
Application Number | 20050176942 10/620795 |
Document ID | / |
Family ID | 23734711 |
Filed Date | 2005-08-11 |
United States Patent
Application |
20050176942 |
Kind Code |
A1 |
Barbour, Alan G. ; et
al. |
August 11, 2005 |
Diagnostic tests for a new spirochete, Borrelia lonestari sp.
nov.
Abstract
Bites from Amblyomma americanum, a hard tick, have been
associated with a Lyme disease-like illness in the southeastern and
south-central United States. Present in 2% of ticks collected in
four states were uncultivable spirochetes. Through use of the
polymerase chain reaction, partial sequences of the flagellin and
16s rRNA genes of microorganisms from Texas and New Jersey were
obtained. The sequences showed that the spirochete was a Borrelia
sp. but distinct from other known members of this genus, including
B. burgdorferi, the agent of Lyme disease. Species-specific
differences in the sequences of the flagellin protein, the
flagellin gene and the 16s rRNA gene between the new Borrelia
species and previously known species provide compositions and
methods for assay for determining the presence of this new
spirochete, or for providing evidence of past or present infection
by this spirochete in animal reservoirs and humans.
Inventors: |
Barbour, Alan G.; (San
Antonio, TX) ; Carter, Carol; (Bulverde, TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
23734711 |
Appl. No.: |
10/620795 |
Filed: |
July 14, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10620795 |
Jul 14, 2003 |
|
|
|
09275506 |
Mar 24, 1999 |
|
|
|
6617441 |
|
|
|
|
09275506 |
Mar 24, 1999 |
|
|
|
08437013 |
May 8, 1995 |
|
|
|
5932220 |
|
|
|
|
Current U.S.
Class: |
536/23.1 |
Current CPC
Class: |
Y10S 530/825 20130101;
C07K 14/20 20130101; Y02A 50/30 20180101; C07K 2319/00 20130101;
Y02A 50/401 20180101; Y10S 436/811 20130101; A61P 33/02 20180101;
A61K 39/00 20130101 |
Class at
Publication: |
536/023.1 |
International
Class: |
C07H 021/02; C07H
021/04 |
Goverment Interests
[0001] The government owns rights in the present invention pursuant
to grant number AI24424 from the National Institutes of Health.
Claims
1-36. (canceled)
37. A purified nucleic acid segment comprising a nucleotide
sequence of at least 14 contiguous nucleotides of SEQ ID NO: 1, or
its complement.
38. The purified nucleic acid segment of claim 37, wherein the
purified nucleic acid segment comprises at least 15 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
39. The purified nucleic acid segment of claim 38, wherein the
purified nucleic acid segment comprises at least 20 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
40. The purified nucleic acid segment of claim 39, wherein the
purified nucleic acid segment comprises at least 30 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
41. The purified nucleic acid segment of claim 40, wherein the
purified nucleic acid segment comprises at least 50 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
42. The purified nucleic acid segment of claim 41, wherein the
purified nucleic acid segment comprises at least 100 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
43. The purified nucleic acid segment of claim 42, wherein the
purified nucleic acid segment comprises at least 200 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
44. The purified nucleic acid segment of claim 43, wherein the
purified nucleic acid segment comprises at least 400 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
45. The purified nucleic acid segment of claim 44, wherein the
purified nucleic acid segment comprises the nucleotide sequence of
SEQ ID NO: 1, or its complement.
46. The purified nucleic acid segment of claim 37, wherein the
purified nucleic acid segment comprises at least one B. lonestari
sp. nov.-specific nucleotide selected from the group consisting of
G70, G96, T141, A193, G199, G228, A231, T269, C270, T271, A273,
A300, T308, G315, A376, G380, A406, G418, G423, G505, A510, G546,
T572, and C603, or its complement.
47. The purified nucleic acid segment of claim 37, wherein the
purified nucleic acid segment comprises the nucleotide sequence of
SEQ ID NO: 7, or its complement.
48. The purified nucleic acid segment of claim 37, wherein the
purified nucleic acid segment comprises the nucleotide sequence of
SEQ ID NO: 8, or its complement.
49. The purified nucleic acid segment of claim 37, wherein the
purified nucleic acid segment encodes a polypeptide comprising the
amino acid sequence of SEQ ID NO: 2, or its complement.
50. An expression vector comprising a nucleic acid segment operably
attached to a promoter, wherein the nucleic acid segment comprises
at least 14 contiguous nucleotides of SEQ ID NO: 1, or its
complement.
51. The expression vector of claim 50, wherein the purified nucleic
acid segment comprises at least 15 contiguous nucleotides of SEQ ID
NO: 1, or its complement.
52. The expression vector of claim 51, wherein the purified nucleic
acid segment comprises at least 20 contiguous nucleotides of SEQ ID
NO: 1, or its complement.
53. The expression vector of claim 52, wherein the purified nucleic
acid segment comprises at least 30 contiguous nucleotides of SEQ ID
NO: 1, or its complement.
54. The expression vector of claim 53, wherein the purified nucleic
acid segment comprises at least 50 contiguous nucleotides of SEQ ID
NO: 1, or its complement.
55. The expression vector of claim 54, wherein the purified nucleic
acid segment comprises at least 100 contiguous nucleotides of SEQ
ID NO: 1, or its complement.
56. The expression vector of claim 55, wherein the purified nucleic
acid segment comprises at least 200 contiguous nucleotides of SEQ
ID NO: 1, or its complement.
57. The expression vector of claim 56, wherein the purified nucleic
acid segment comprises at least 400 contiguous nucleotides of SEQ
ID NO: 1, or its complement.
58. The expression vector of claim 57, wherein the purified nucleic
acid segment comprises the nucleotide sequence of SEQ ID NO: 1, or
its complement.
59. The expression vector of claim 50, further defined as a viral
vector.
60. The viral vector of claim 59, further defined as an adenoviral
vector.
61. The expression vector of claim 50, further defined as a plasmid
vector.
62. A host cell comprising an expression vector comprising a
nucleic acid segment operably attached to a promoter, wherein the
nucleic acid segment comprises at least 14 contiguous nucleotides
of SEQ ID NO: 1, or its complement.
63. The host cell of claim 62, wherein the host cell is E. coli
LE392
64. A kit for the detection of B. lonestari sp. nov. in a sample,
the kit comprising: (a) a carrier adapted to receive a plurality of
containers in close confinement therewith; (b) a first container
comprising a nucleic acid sequence of at least 14 contiguous
nucleotides of SEQ ID NO: 1, or its complement.
65. The nucleic acid sequence of claim 64, wherein the purified
nucleic acid segment comprises at least one B. lonestari sp.
nov.-specific nucleotide selected from the group consisting of G70,
G96, T141, A193, G199, G228, A231, T269, C270, T271, A273, A300,
T308, G315, A376, G380, A406, G418, G423, G505, A510, G546, T572,
and C603.
66. The nucleic acid sequence of claim 65, wherein the purified
nucleic acid segment comprises at least 20 contiguous nucleotides
of SEQ ID NO: 1, or its complement.
67. The nucleic acid sequence of claim 66, wherein the purified
nucleic acid segment comprises at least 100 contiguous nucleotides
of SEQ ID NO: 1, or its complement.
Description
FIELD OF THE INVENTION
[0002] The present invention relates generally to the fields of
infection and disease. More particularly, it concerns the
identification of a new spirochete carried by the hard tick,
Amblyomma americanum, found by the present inventor to be
associated with a Lyme disease-like illness in the southeastern and
south-central United States. Most particularly, the invention
provides compositions, methods, and kits for the identification of
the new spirochete for diagnostic purposes.
DESCRIPTION OF THE RELATED ART
[0003] A paradox about Lyme disease is the report of this
tick-borne infection from areas in which transmission of the
etiologic agent, B. burgdorferi, has not been documented (Sigal et
al., 1991; Barbour et al., 1993). This phenomenon has been reported
from Georgia and Missouri, but may be common in other parts of the
southeastern and south-central United States (Centers for Disease
Control and Prevention, 1989; 1991). The Lyme disease-like illness
is a localized, expanding circular skin rash, sometimes succeeded
by persistent, debilitating systemic symptoms (Masters, 1993;
Donnell, 1992). Many of the patients with this illness have had
negative serologic assays for antibodies to B. burgdorferi, a
finding that has fueled a controversy about so-called "seronegative
Lyme disease" (Sigal et al., 1991; Barbour et al., 1993). Although
Ixodes scapularis ticks, the usual vector of the Lyme disease
agent, has been identified in some of these geographic areas, the
more commonly reported exposure for these patients has been to
another hard tick, A. americanum, known as the "Lone Star tick"
(Centers for Disease Control and Prevention 1989; 1991; Masters,
1993; Donnell, 1992). One conclusion from these observations is
that the disease is caused by something other than B. burgdorferi
and that the vector of the putative agent is A. americanum (Maupin
et al., 1992).
[0004] The incompetence of A. americanum as a vector of B.
burgdorferi has been documented (Piesman et al., 1988; Mather et
al., 1990; Mukolwe et al., 1992; Ryder et al., 1992). Nevertheless,
there have been descriptions in these ticks of spirochetes that
cross-react with antibodies to the Lyme disease agents (Maupin et
al., 1992; Schulze et al., 1984). Until the discovery of B.
burgdorferi and related Borrelia species in Ixodes spp. ticks a
decade ago, Borrelia spp. had almost exclusively been found in soft
or argasid ticks (Barbour et al., 1986).
[0005] Reports from several locations in the southeastern and
south-central regions of the United States indicate that this Lyme
disease-like illness, which is apparently ameliorated by
antibiotics, is associated with bites by the Lone Star tick
(Centers for Disease Control and Prevention, 1989; 1991; Masters,
1993; Donnell, 1992). A. americanum is a common person-biting tick
in these areas (Cooney et al., 1974; Koch et al., 1980; Hair et
al., 1986; Bloemer et al., 1990). Its usual hosts are white-tailed
deer, medium-sized mammals, and ground-feeding birds; rodents are
only rarely infested by A. americanum. The tick's distribution
extends from west-central Texas to Florida and north to Rhode
Island (Cooney et al., 1974; Koch et al., 1980; Hair et al., 1986;
Bloemer et al., 1990).
[0006] Numerous references in the literature relate to aspects of
diagnosing and treating Lyme disease. For example: i) U.S. Pat. No.
5,279,938 relates to a nucleotide sequence of a recombinant clone
containing a specific segment of Borrelia burgdorferi (Bb) DNA, the
causative agent of Lyme disease; ii) an abstract by Barthhold (WPI
Acc. No.: 92-041321/05) relates to OSPA polypeptides
immuno-reactive with antibodies generated by the spirochete
Borrelia burgdorferi; iii) The Weisburg world patent publication
relates to nucleic acid fragments that are used to detect the
etiological agent of Lyme disease, Borrelia; iv) The Oliver et al.
(1993) abstract relates to a study of the isolation and
transmission of the Lyme disease spirochete; v) The Berland et al.
(1991) abstract relates to the characterization of a 41 kDa
flagellin antigen of B. burgdorferi; vi) The Mukolwe et al. (1992)
article relates to attempts to transmit the B. burgdorferi (Bb)
spirochete to three different ticks, one of these being the
Amblyomma americanum tick. The test results report transfer of the
Bb spirochete only to Ixodes scapularis ticks.
[0007] Although there is much known about Lyme disease, there are
currently no means of identification of the new spirochete
associated with the aforedescribed Lyme disease-like pathology and
further, no means of diagnosis of infection, compositions for
clinical tests, or laboratory assays for diagnosing a patient
exhibiting Lyme disease-like symptoms but testing negative for Lyme
disease.
SUMMARY OF THE INVENTION
[0008] The present invention provides compositions, methods, and
kits for the detection of a new spirochete that is associated with
a Lyme disease-like illness. The compositions are based on a
Borrelia lonestari sp. nov.-specific allotype or combination of
allotypes of the flagellin protein, or a Borrelia lonestari sp.
nov.-specific allele or combination of alleles of the flagellin or
16s rRNA genes of the new spirochete. The allotypes and alleles
provided by the present invention have been determined by nucleic
acid sequencing of portions of the flagellin and rRNA genes from
this new spirochete. Detection of a species-specific amino acid or
nucleotide as defined herein, or a species-specific combination of
amino acids or nucleotides as defined herein, in a subject sample
is indicative of infection with Borrelia lonestari sp. nov.
[0009] "Species-specific allotype" or "species-specific amino acid"
or "species-specific epitope" means an amino acid of B. lonestari
sp. nov. that is different at a particular position of the
flagellin protein amino acid sequence than the amino acid at that
position of the flagellin protein of other Borrelia species,
especially those species needing to be distinguished from B.
lonestari sp. nov. Table 1 provides a listing of species-specific
amino acids of this new spirochete in the context of the amino acid
sequence of SEQ ID NO: 2.
[0010] "Species-specific combination of allotypes" or
"species-specific combination of amino acids" or "species-specific
combination of epitopes" is a combination of amino acids of the
flagellin protein of B. lonestari sp. nov. from Table 1 that is not
represented in any of the flagellin proteins of other Borrelia
species, especially those species needing to be distinguished from
B. lonestari sp. nov. Table 1 also provides a listing of amino
acids that may be combined with each other to form a combination
that is unique to B. lonestari sp. nov. in the context of the amino
acid sequence of SEQ ID NO: 2.
[0011] "Species-specific allele" or "species-specific nucleotide"
means a nucleotide of B. lonestari sp. nov. that is different at a
particular position of the flagellin gene sequence or 16s rRNA gene
sequence from the nucleotide at that position of other flagellin
gene sequences or 16s rRNA gene sequences of Borrelia species,
especially the Borrelia species that need to be particularly
distinguished, like B. burgdorferi. Tables 2 and 3 provide a
listing of species-specific nucleotides of this new spirochete in
the context of SEQ ID NO: 1 and 3
[0012] "Species-specific combination of alleles" or
"species-specific combination of nucleotides" is a combination of
nucleotides of the flagellin gene or 16s rRNA gene of B. lonestari
sp. nov. from Table 2 or 3 that is not represented in any of the
flagellin gene sequences or 16s rRNA gene sequences of other
Borrelia species. Tables 2 and 3 provide a listing of nucleotides
that may be combined with each other to form a combination that is
unique to B. lonestari sp. nov. in the context of SEQ ID NO: 1 and
3.
[0013] Species-specific flagellin amino acids of B. lonestari sp.
nov. are listed in Table 1 as the underlined residues in the column
B1 and include Val 24, Thr 65, Ala 67, Phe 90, Ser 91, Thr 92, Gly
99, Val 103, Pro 119, Ile 126, Ser 127, Ile 136, Ala 140, Thr 144,
Asp 174, and Ile 191, of SEQ ID NO:2.
[0014] Species-specific flagellin nucleotides of B. lonestari sp.
nov. are listed in Table 2 as the underlined nucleotides in the
column B1 and include G 70, G 96, T 141, A 193, G 199, G 228, A
231, T 269, C 270, T 271, A 273, A 300, T 308, G 315, A 376, G 380,
A 406, G 418, G 423, G 505, A 510, G 546, T 572, and C 603 of SEQ
ID NO:1.
[0015] Exemplary species-specific combinations of amino acids where
the amino acid itself is not species-specific are found by
comparing the amino acids of Table 1 and finding a combination of
B1 amino acids that is not represented in any of the other species
listed in the context of the flagellin amino acid sequences of
these organisms. Examples include: amino acid #s 41 and 46, 46 and
108, 117 and 153, 130 and 153, 46 and 147, 152 and 169, 152 and
171, and 46 and 196 of SEQ ID NO:2, for example.
[0016] Of course, Tables 1 and 2 clearly demonstrate the
differences in amino acids and nucleotides of the flagellin
proteins and genes of B. lonestari sp. nov. and B. burgdorferi, the
causative agent of Lyme disease in North America (Barbour and Fish,
1993) and the most relevant organism to distinguish B. lonestari
sp. nov. from in a diagnostic test.
[0017] Exemplary species-specific combinations of nucleotides where
the nucleotide itself is not species-specific are found by
comparing the nucleotides of Table 2 and finding a combination of
B1 nucleotides that is not represented in any of the other species
listed in the context of the sequence of SEQ ID NO: 1. Examples
include: nucleotide NT #30 and 225, 42 and 225, 177 and 297, 303
and 312, 350 and 355, 375 and 419, 432 and 435, 458 and 475, and
501 and 516 of SEQ ID NO:1, for example. With these examples, one
skilled in the art would, upon further examination of Table 2, find
further species-specific combinations of nucleotides in the context
of SEQ ID NO: 1 for identification of B. lonestari sp. nov.
[0018] An embodiment of the present invention is a purified nucleic
acid molecule comprising a nucleotide sequence of about 12 to about
709 nucleotides that encodes a B. lonestari sp. nov. flagellin
peptide having at least one B. lonestari sp. nov.-specific amino
acid or species-specific combination of amino acids from Table 1,
or a complement thereof. In a preferred embodiment, the nucleotide
sequence has the sequence of SEQ ID NO:1, 4 or 26. An even more
preferred embodiment is a purified nucleic acid molecule having a
nucleotide sequence encoding a protein having an amino acid
sequence of SEQ ID NO: 2, a partial sequence of the B. lonestari
sp. nov. flagellin protein.
[0019] Further embodiments include a recombinant molecule
comprising the nucleic acid molecule described above, a host cell
comprising the recombinant molecule and the recombinant molecule is
preferably an expression vector. The nucleic acid segments of the
present invention, regardless of the length of the coding sequence
itself, may be combined with other DNA sequences, such as
promoters, polyadenylation signals, additional restriction enzyme
sites, multiple cloning sites, other coding segments, and the like,
such that their overall length may vary considerably. It is
contemplated that a nucleic acid fragment of almost any length may
be employed, with the total length preferably being limited by the
ease of preparation and use in the intended recombinant DNA
protocol.
[0020] The at least one B. lonestari sp. nov. specific amino acid
may be at position 24, 65, 67, 90, 91, 92, 99, 103, 119, 126, 127,
136, 140, 174, or 191 of SEQ ID NO:2 as shown in Table 1. The at
least one B. lonestari sp. nov.-specific combination of amino acids
is also obtained from Table 1 as described above.
1TABLE 1 Comparison of Amino Acids at Designated Positions of the
Flagellin Protein of Various Borrelia Species Aa#.sup.1 B1.sup.2 Bb
Ba Bh Bc Bz 24 V.sup.3,6 I I I I I 41 S A A A S A 42 A S A A A S 46
K R R K R K 65 T S S A S S 67 A S S S S S 90.sup.4 F Y Y Y Y Y 91 S
A A A A A 92 T A A S A A 99 G S A A S A 103 V A A A A A .DELTA.104
_.sup.5 Q -- -- Q Q .DELTA.105 -- AA -- -- -- AA 108 A V A V A V
112 A V A G A A 117 V A V V A A 119 P Q A A A Q .DELTA.120 -- 5 6 6
6 5 amino amino amino amino amino acids acids acids acids acids 122
A S A A A T 126 I V V V V V 127 S N N N N N 130 I V I I V V 135 A T
A A A T 136 I V V V V V 140 A T M M M T 144 T A A A T A 147 D N D G
D N 152 V I V V I I 153 T S S S T S 169 V I I I V I 171 A N D D A N
174 D E E E E E 191 I T T T T T 196 I V I V I V 199 S A S S S A
.sup.1Aa#: amino acid number from SEQ ID NO: 2.
.sup.2Abbreviations: Bl, Borrelia lonestari sp. nov.; Bb, B.
burgdorferi; Ba, B. anserina; Bh, B. hermsii; Bc, B. crocidurae;
Bz, B afzelii. .sup.3Underline: Amino acid positions that are
species-specific to Bl. .sup.4Italics indicate positions or a range
of amino acid positions where a peptide would be species-specific
for Bl. .sup.5_, deletion. .sup.6Amino acids have three and one
letter designations as follows, either designation may be used
herein: Alanine = Ala (A); Arginine = Arg (R); Aspartate = Asp (D);
Asparagine = Asn (N); Cysteine = Cys (C); Glutamate = Glu (E);
Glutamine = Gln (Q); Glycine = Gly (G); Histidine = His (H);
Isoleucine = Ile (I); Leucine = Leu (L); Lysine = Lys (K);
Methionine = Met (M); # Phenylalanine = Phe (F); Proline = Pro (P);
Serine = Ser (S); Threonine = Thr (T); Tryptophan = Trp (W);
Tyrosine = Tyr (Y); Valine = Val (V).
[0021] The at least one B. lonestari sp. nov.-specific amino acid
or combination of amino acids can be considered an allotype of this
species. Preferably, the length of the oligonucleotide is from
about 12 to about 641 nucleotides; or in other embodiments, from
about 12 to about 330 nucleotides; or 12 to about 300; or 12 to
about 150; or 12 to about 99; and in still other embodiments, from
about 15 to about 30 nucleotides. In other embodiments, the
nucleotide sequence encodes amino acid(s) at and flanking position
24, 65, 67, 90, 91, 92, 99, 103, 119, 126, 127, 136, 140, 174, or
191 of SEQ ID NO:2. Preferably, the sequence encodes amino acids at
and flanking positions 90-92, 103-108, 119-127, 136-144, or 171-174
of SEQ ID NO:2. In another embodiment, the sequence encodes a
species-specific combination of amino acids of Table 1 having
flanking amino acids from SEQ ID NO:2. The oligonucleotide may be
defined further as including a detectable label. Some
oligonucleotides may be defined further as comprising the sequence
GGTGTTCAAGCG, SEQ ID NO:7 or GTTCAACCAGCT, SEQ ID NO:8. These
sequences are unique to B. lonestari sp. nov. due to the presence
of a number of nucleotides at particular positions around 310 and
358 of the flagellin gene of other Borrelia species. These
species-specific oligonucleotides are useful as hybridization
probes for the detection of B. lonestari sp. nov. in a diagnostic
assay.
[0022] A further embodiment of the invention is a purified nucleic
acid molecule comprising a nucleotide sequence represented in SEQ
ID NO:1 or 3 having at least one B. lonestari sp. nov.-specific
nucleotide or species-specific combination of nucleotides from
Table 2 or 3, or a complement thereof. Another embodiment is a
purified flagellin gene of B. lonestari sp. nov. A further
embodiment of the present invention is a nucleic acid segment that
comprises at least a 10-14 nucleotide long stretch that corresponds
to, or is complementary to, the nucleic acid sequence of SEQ ID
NO:1 and includes an allele as described in Table 2. In a more
preferred embodiment, the nucleic acid is further defined as
comprising at least about a 20 nucleotide long stretch, about 30
nucleotide long stretch, about 50 nucleotide long stretch, about
100 nucleotide long stretch, about 200 nucleotide long stretch,
about 400 nucleotide long stretch, about 600 nucleotide long
stretch, or a full length sequence that corresponds to, or is
complementary to, the nucleic acid sequence of SEQ ID NO:1 and
includes an allele as described in Table 2.
2TABLE 2 Comparison of Nucleotides at Designated Positions of the
Flagellin Gene as Listed in SEQ ID NO: 1 for Various Borrelia
Species Nt#.sup.1 B1.sup.2 Bb Ba Bh Bc Bz 30 T A T T T A 42 T A T T
T A 45 A G G G A G 57 T C T T T C 62 T T T C C T 66 C T C C T T
70.sup.3 G.sup.4 A A A A A 81 G A A G A G 90 C T T C T T 96 G A A A
T A 102 T C T T T C 108 A A G G A G 117 A A G G A A 120 A T A A A T
121 T G G G T G 124 G T G G G T 137 A G G A G A 141 T A A A A A 177
T C T C T C 192 A T A A A T 193 A T T G T T 199 G T T T T T 201 A T
A A A T 210 A T A A A T 219 G A A G A A 225 T T A A A T 228 G T T T
T T 231 A T G G T G 234 T A T C T A 261 T A T T T A 269 T A A A A A
270 C T T T T T 271 T G G G G G 273 A G G T G G 295 G T G G T G 297
T T A A A T 300 A T T T T T 303 A G A A G G 306 T A T C T A 308 T C
C C C C .DELTA.310 -- CAA -- -- CAA CAA .DELTA.311 -- ACTGCT -- --
-- GCTGCT 312 A G G G A G 315 G T T T A T 318 T A T T T A 321 A G A
A A T 323 C T C T C T 333 T T A A T T 336 A T A A A T 339 A A A G G
A 342 G G A A A A 350 T C T G C C 355 C C G G G C 356 C A C C C A
.DELTA.358 -- N.sub.15 N.sub.18.sup.5 N.sub.18 N.sub.18 N.sub.15
360 T A T T T A 363 A T A A A T 375 G A G A A A 376 A G G G G G 380
G A A A A A 387 A T A A A T 388 A G A A G G 402 T T T C T T 403 G A
G G G A 405 T A T T T A 406 A G G G G G 418 G A A A A A 419 C C T T
T C 420 A A G G A A 423 G A A A A A 427 A G G G A G 429 A T A A A T
432 G A G G A A 435 T T A A G A 439 G A G G A A 454 G A G G C A 458
C G G G C G 475 C T C C T T 477 T A T T C A 492 T T T C A T 501 G A
A G G A 505 G A A A A A 510 A G G G G G 512 C A A A C A 516 C T C T
A C 519 A T A A G T 522 T G A A T G 537 C T C C T T 538 T C T T T C
546 G A A A T A 561 T A T T A A 570 A T A A C T 572 T C C C A C 585
A G A A A G 586 A G A G T G 595 T G T T T G 597 T A T A T T 603 C T
T T A T 606 C T C C C T 615 G A A G G A 633 T A T T T A .sup.1Nt#:
nucleotide number from SEQ ID NO: 1 .sup.2Abbreviations: Bl,
Borrelia lonestari sp. nov.; Bb, B. burgdorferi; Ba, B. anserina;
Bh, B. hermsii; Bc, B. crocidurae; Bz, B. afzelii. .sup.3Italicized
nucleotide positions indicate a location or range of locations
where an oligonucleotide would be species-specific for Bl.
.sup.4Nucleotide positions at which the nucleotide for Bl is unique
and, therefore, species-specific, are underlined. .sup.5N.sub.15,
18 = a 15 or 18 nucleotide insert is present in these species
compared to B. lonestari sp. nov., therefore, the sequence of
nucleotides at this region of B. lonestari is species-specific.
[0023]
3TABLE 3 B. lonestari sp. nov.-Specific 16s rRNA Gene
Nucleotides.sup.1 Nucleotide #'s of SEQ ID NO: 3 Nucleotide(s) in
16s that provide rRNA gene that provide novel combinations novel
combinations 135, 146, 217 A, T, A 146, 217, 224 T, A, G 217, 224,
267 A, G, T 224, 267, 435 G, T, G 267, 435 T, G 435, 437, 522 G, T,
C 437, 522 T, C 437, 522, 554 T, C, T 522, 554 C, T 522, 554, 564
C, T, T 554, 564 T, T 554, 564, 963 T, T, A .sup.1From Table 6 and
comparison of SEQ ID NO: 3 with sequences presented in sequence
data base such as GenBank having accession numbers corresponding to
those of footnote of Table 5.
[0024] The present invention also encompasses DNA segments which
are complementary, or essentially complementary, to the sequence
set forth in SEQ ID NO:1, 3, 4, 26 or other of the segments
described herein. Nucleic acid sequences which are "complementary"
are those which are capable of base-pairing according to the
standard Watson-Crick complementarity rules. As used herein, the
term "complementary sequences" means nucleic acid sequences which
are substantially complementary, as may be assessed by the same
nucleotide comparison set forth above, or as defined as being
capable of hybridizing to the nucleic acid segment of SEQ ID NO:1,
3, 4 or 26 under relatively stringent conditions such as those
described herein. The B. lonestari sp. nov. nucleotides set forth
in Tables 2 and 3, however, are considered relatively invariant
since they are species-specific or a combination of the nucleotides
is species-specific.
[0025] A purified nucleic acid molecule comprising a nucleotide
sequence encoding a B. lonestari sp. nov. 16s ribosomal RNA is a
further embodiment of the present invention. Preferably, the
nucleotide sequence has a sequence comprising SEQ ID NO:3. The
nucleic acid may be defined further as a recombinant molecule.
[0026] A preferred embodiment of the present invention is a
purified flagellin protein of B. lonestari sp. nov. The protein may
be defined further as an amino acid sequence comprising SEQ ID
NO:2. The term "the amino acid sequence of SEQ ID NO:2" means that
the sequence substantially corresponds to a portion of SEQ ID NO:2
and has relatively few amino acids which are not identical to, or a
biologically functional equivalent of, the amino acids of SEQ ID
NO:2. The term "biologically functional equivalent" is well
understood in the art and is further defined in detail herein as
having the amino acids of SEQ ID NO:2 listed in Table 1, these
amino acids being relatively invariant in their function as
species-specific epitopes or combination of epitopes of B.
lonestari sp. nov. The flagellin protein or portions thereof having
species-specific epitopes or a combination of epitopes is useful in
an immunoassay for the detection of B. lonestari sp. nov.
[0027] A purified peptide having an amino acid sequence comprising
about 6 to about 213 amino acids of SEQ ID NO:2 that includes at
least one B. lonestari sp. nov.-specific amino acid or
species-specific combination of amino acids from Table 1 is a
further embodiment of the present invention. Preferably, the
peptide has from about 6 to about 212 amino acids; more preferably,
from about 6 to about 150 amino acids; and in other embodiments,
from about 6 to about 50 amino acids. The above-described peptide
preferably includes B. lonestari sp. nov. specific amino acid(s) at
and flanking position 24, 65, 67, 90, 91, 92, 99, 103, 119, 126,
127, 136, 140, 174, or 191 of SEQ ID NO:2. Preferably, the peptide
includes amino acid(s) at and flanking positions 90-92, 103-108,
119-127, 136-144, or 171-174 of SEQ ID NO:2. In another embodiment,
the peptide includes a species-specific combination of amino acids
of Table 1 having flanking amino acids from SEQ ID NO:2. In some
embodiments, the peptide may include a detectable label. Preferred
peptides comprise the sequence Gly Val Gln Ala, SEQ ID NO:5 or the
sequence Val Gln Pro. These sequences are unique to B. lonestari
sp. nov. due to the presence of a number of nucleotides at
particular positions of the flagellin gene of other Borrelia
species. These species-specific peptides are useful as epitopes for
the detection of antibodies having specificity for a
species-specific flagellin protein, for the detection of T cells or
B cells having similar specificity, or as antigens in an
immunoassay for the detection of B. lonestari sp. nov. or for the
generation of antibodies to be used in an immunoassay.
[0028] A fusion protein or peptide comprising a segment of SEQ ID
NO:2 having at least one B. lonestari sp. nov.-specific amino acid
or species-specific combination of amino acids of Table 1 is also
an aspect of the present invention. The fusion protein preferably
comprises SEQ ID NO:26, however, one skilled in the art, in light
of the present disclosure, would be able to construct a number of
different fusion proteins from a variety of vectors and the B.
lonestari sp. nov. DNA sequences provided herein. It will also be
understood that amino acid and nucleic acid sequences may include
additional residues, such as additional N-- or C-terminal amino
acids, and yet still be essentially as set forth in one of the
sequences disclosed herein, so long as the sequence meets the
criteria set forth above. Segments of the flagellin gene may be
cloned next to N-- and/or C-terminal sequences of genes for other
proteins, such as, .beta.-galactosidase or maltose binding protein.
A signal peptide that may allow better expression may be optionally
included in the fusion protein. It is not necessary that the
flagellin protein be transported, however, the signal peptide may
help to prevent protease digestion.
[0029] A preferred embodiment of the present invention is a method
of detecting B. lonestari sp. nov. in a subject. The method
comprises the step of contacting a nucleic acid sample from the
subject with an oligonucleotide comprising a nucleotide sequence of
about 12 to about 30 nucleotides from SEQ ID NO:1 that includes at
least one B. lonestari sp. nov.-specific nucleotide or
species-specific combination of nucleotides from Table 2 or 3, or a
complement thereof, under conditions allowing hybridization to form
a duplex, wherein duplex formation indicates the presence of B.
lonestari sp. nov. Preferably, the nucleotide sequence comprises
the sequence GGTGTTCAAGCG, SEQ ID NO:7 or GTTCAACCAGCT, SEQ ID
NO:8. The oligonucleotide may comprise a detectable label and the
complex may then be detected by reference to the label.
[0030] A further method of detecting B. lonestari sp. nov. in a
subject comprises the steps of amplifying a segment of DNA from the
subject using a set of PCR.TM. primers, wherein the segment of DNA
includes at least one B. lonestari sp. nov.-specific nucleotide or
species-specific combination of nucleotides from Table 2 or 3, and
determining the nucleotide sequence of the segment. When the
nucleotide sequence of the segment is found in SEQ ID NO:1 or 3, or
a complement thereof, then B. lonestari sp. nov. is detected. The
PCR.TM. primers may be designed to be complementary to a region of
SEQ ID NO: 1 or 3 or to sequences 5' and 3' to any segment to be
amplified, and the primers may be complementary to a sequence
outside of the herein defined sequences, i.e., in flanking vector
or naturally occurring sequences, for example. It is contemplated
that regions of as few as 20 or 50 bases may be amplified, or as
long as 500 or 1000 bases. One of skill in this art would also
understand, in light of the present disclosure, that other means of
amplification of DNA or RNA segments would also be applicable to
the techniques defined herein.
[0031] The present invention also provides a method of detecting B.
lonestari sp. nov. in a subject comprising the step of analyzing a
DNA sample from the subject for a restriction fragment length
polymorphism that is unique to B. lonestari sp. nov. A preferred
restriction fragment length polymorphism is from an AluI
restriction enzyme digest.
[0032] Another embodiment of the present invention is a method of
detecting a previously elicited immune response to B. lonestari sp.
nov. in a subject. This method may be a cell mediated immunity
test. The method comprises the step of contacting a sample from the
subject with an epitope having at least a partial amino acid
sequence of SEQ ID NO:2 that includes at least one B. lonestari sp.
nov.-specific amino acid or species-specific combination of amino
acids from Table 1, is also an embodiment of the present invention.
Contacting of the sample would be under conditions allowing
epitope-antibody or epitope-T cell binding to occur to form a
complex, and complex formation indicates the presence of a
previously elicited immune response to B. lonestari sp. nov.
Preferably, the epitope is bound to a detectable label, and a
preferred epitope is a flagellin fusion protein. The present
inventors also envision the detection of B cells secreting antibody
having epitope specificity as defined herein.
[0033] A method of detecting B. lonestari sp. nov. in a subject
comprising the step of contacting a sample from the subject with an
antibody having binding specificity for an epitope having an amino
acid sequence from SEQ ID NO:2 that includes at least one B.
lonestari sp. nov.-specific amino acid or species-specific
combination of amino acids from Table 1 is also an embodiment of
the present invention. The contacting is under conditions allowing
epitope-antibody binding to occur to form a complex and complex
formation indicates the presence of B. lonestari sp. nov.
Preferably, the epitope has a number of amino acids less than that
of SEQ ID NO:2. In these immunoassay procedures, a further step of
contacting the complex with a detectably labeled antibody having
binding specificity for the complex may be included.
[0034] Most preferably, the subject of these detection methods is a
human suspected of being infected with B. lonestari sp. nov.,
although suspected animal reservoirs are also preferred. Any animal
that may have been bitten by a tick and that may carry this new
spirochete may be tested, including domestic animals such as dogs,
cats, cattle, or turkeys, for example.
[0035] A test kit for the detection of B. lonestari sp. nov. in a
biological sample is also an aspect of the present invention. A kit
may comprise in packaged combination; a carrier means adapted to
receive a plurality of container means in close confinement
therewith; a first container means including an oligonucleotide
comprising a nucleotide sequence that includes at least one B.
lonestari sp. nov.-specific nucleotide or species-specific
combination of nucleotides from Table 2 or 3, or a complement
thereof; and at least one microtiter plate. The oligonucleotide may
encode all of SEQ ID NO:2 or a portion thereof.
[0036] Alternatively, a kit may have a first container means
including a first antibody having binding specificity for an
epitope, the epitope having a partial or complete amino acid
sequence of SEQ ID NO:2 and including at least one B. lonestari sp.
nov.-specific amino acid or species-specific combination of amino
acids from Table 1; and a second container means including a
quantity of a detectably labelled antibody having binding
specificity for the first antibody.
[0037] A further alternative is where a first container means
includes a peptide epitope, the epitope being a partial or complete
amino acid sequence of SEQ ID NO:2 and including at least one B.
lonestari sp. nov.-specific amino acid or species-specific
combination of amino acids from Table 1; and a second container
means including a quantity of a detectably labelled antibody having
binding specificity for immunoglobulin of the biological
sample.
[0038] In these test kits, the detectably labelled antibody may be
an enzyme-linked antibody, a fluorescently tagged antibody, or a
radiolabeled antibody. Preferably, the detectably labelled antibody
is an enzyme-linked antibody, and the kit further includes a third
container means including a quantity of a substrate for the enzyme
sufficient to produce a visually detectable product.
[0039] A diagnostic kit for determining the presence of B.
lonestari sp. nov., in accordance with the present invention, may
comprise any one or more of the following components:
[0040] 1. Unique components in accordance with the present
invention:
[0041] a. An oligonucleotide complementary to a portion of the
flagellin gene or the 16s rRNA gene at a region having a
species-specific nucleotide or species-specific combination of
nucleotides.
[0042] b. Oligonucleotide primers for PCR.TM. designed to amplify a
sequence of SEQ ID NO:1 or 3 where a first primer has a sequence 5'
to a region of SEQ ID NO:1 or 3 having a species-specific
nucleotide or species-specific combination of nucleotides and a
second primer has a sequence 3' to the region. Primers may be
designed to hybridize outside of the sequences depicted by SEQ ID
NO: 1 or 3, since they may be complementary to vector sequences or
naturally occurring flanking sequences, for example.
[0043] c. A double stranded internal fragment of SEQ ID NO:1 or 3
provided for cloning and DNA sequencing to confirm the identity of
a sequenced test fragment.
[0044] d. DNA comprising the nucleic acid sequence of SEQ ID NO:1,
3 or 4 as a positive control template DNA for hybridization,
sequencing, or RFLP analyses. This DNA may comprise plasmid DNA
from clones described in Examples 2 and 3.
[0045] e. Antibody having binding specificity for a B. lonestari
flagellin species-specific epitope or species-specific combination
of epitopes.
[0046] f. A peptide having an amino acid sequence that includes a
species-specific amino acid or species-specific combination of
amino acids of Table 1.
[0047] 2. Commercially available reagents:
[0048] a. Components of a PCR.TM. reaction protocol.
[0049] b. Components of a dideoxy-based sequencing protocol.
[0050] c. Components of an ELISA protocol.
[0051] The following listing provides an identification of those
sequences provided with sequence identifiers.
4 Identity of Sequences having Sequence Identifiers SEQ ID NO:
Identity of Sequence 1 A composite sequence representing a partial
nucleotide sequence of flagellin gene of new species 2 Partial
amino acid sequence of flagellin protein of new species 3 Partial
nucleotide sequence of 16s rRNA of new species 4 Partial nucleotide
sequence of flagellin gene, initial fragment cloned and obtained by
PCR .TM. amplification, shorter than #1 5 Species-specific epitope
of flagellin at about amino acid 103 6 Species-specific
oligonucleotide of flagellin at about nucleotide 121 7
Species-specific oligonucleotide of flagellin at about nucleotide
304 8 Species-specific oligonucleotide of flagellin at about
nucleotide 349 9 FlaLS primer for PCR .TM. 10 FlaRS primer for PCR
.TM. 11 FlaLL primer for PCR .TM. 12 FlaRL primer for PCR .TM. 13
16RnaL primer for PCR .TM. 14 16RnaR primer for PCR .TM. 15-25
Fragments of flagellin from various spirochetes for alignment
purposes 26 Partial sequence of plasmid encoding fusion protein 27
N-terminal addition to flagellin protein in fusion construct after
cleavage by protease 28 Partial nucleotide sequence of flagellin
gene of clone 70 of a Texas tick of the new species; ATCC # ,
American Type Culture Collection, 12301 Parklawn Drive, Rockville,
Maryland 20852
[0052] It will be understood that this invention is not limited to
the exact nucleic acid and amino acid sequences described herein
except for those species-specific nucleotides and amino acids and
species-specific combinations of nucleotides and amino acids of
Tables 1, 2 and 3. Therefore, DNA segments prepared in accordance
with the present invention may also encode biologically functional
equivalent proteins or peptides which have variant amino acid
sequences. Such sequences may arise as a consequence of codon
redundancy and functional equivalency which are known to occur
naturally within nucleic acid sequences and the proteins thus
encoded. Alternatively, functionally equivalent proteins or
peptides may be created via the application of recombinant DNA
technology, in which changes in the protein structure may be
engineered, based on considerations of the properties of the amino
acids being exchanged.
[0053] The process of selecting and preparing a nucleic acid
segment which includes a sequence from within SEQ ID NO:1 or 3 may
alternatively be described as preparing a nucleic acid fragment. Of
course, fragments may also be obtained by other techniques such as,
e.g., by mechanical shearing or by restriction enzyme digestion.
Small nucleic acid segments or fragments may be readily prepared
by, for example, directly synthesizing the fragment by chemical
means, as is commonly practiced using an automated oligonucleotide
synthesizer. Also, fragments may be obtained by application of
nucleic acid reproduction technology, such as the PCR.TM.
technology of U.S. Pat. No. 4,603,102 (incorporated herein by
reference), by introducing selected sequences into recombinant
vectors for recombinant production, and by other recombinant DNA
techniques generally known to those of skill in the art of
molecular biology.
BRIEF DESCRIPTION OF THE DRAWING
[0054] The following drawing forms part of the present
specification and is included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to this drawing in combination with the
detailed description of specific embodiments presented herein. FIG.
1 shows a distance matrix phylogenetic tree of Borrelia spp. with
Treponema pallidum as the outgroup. 16S rRNA sequences
corresponding to base positions 36 through 1371 of B. burgdorferi
rRNA gene (accession numbers U03396 and X57404) were aligned by the
PileUp algorithm (Genetics Computer Group, Inc). Other sequences
were B. hermsii (M60968 and L10136), B. anserina (M72397 and
M64312), B. miyamotae sp. nov. (D45192), the "Florida canine
borrelia" (L37837), and T. pallidum (M88726). Aligned sequences
were analyzed with the PHYLIP program package, version 3.5
(Felsenstein, 1989, 1993). Distance matrices were calculated with
the Jukes-Cantor option of the DNADIST program. Multiple data sets
were generated with SEQBOOT, unrooted trees were constructed using
the NEIGHBOR program with the Neighbor-Joining option, and a
consensus tree was generated with CONSENSE. Circles numbers
indicate the number of times out of 100 that a particular node was
supported by bootstrap analysis. Approximate evolutionary distances
are measured along line segments; the bar represents a distance by
Jukes-Cantor criteria of 0.005. The calculated distances of the
Amblyomma borrelia from B. hermsii, B. burgdorferi, and T. pallidum
were 0.022, 0.041, and 0.233, respectively. Tree topology was also
examined by subjecting the 100 bootstrapped datum sets to parsimony
analysis with the DNAPARS algorithm. The consensus treefile (New
Hampshire Standard format) from the parsimony analysis was:
(Amblyomma borrelia: 100, B. miyamotae: 100): 94, B. hermsii: 100):
34, Florida canine borrelia: 100): 25, B. anserina 100): 81, B.
burgdorferi: 100): 100, T. pallidum: 100).
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0055] The newly recognized tick-borne disease in Texas, Missouri,
and states in the south central and southeastern United States is
similar to Lyme disease in many respects but cannot be
distinguished from Lyme disease by visual inspection of the rash,
for example. Another Borrelia disease that is difficult to
distinguish from Lyme disease, using the standard laboratory test
for Lyme disease, is relapsing fever which is associated with bites
from Ornithodoros spp. ticks.
[0056] The present invention provides diagnostic tests based on
species-specific regions or species-specific combination of regions
of the flagellin protein, the flagellin gene, or the 16s rRNA of
the new spirochete, named by the present inventors as Borrelia
lonestari sp. nov. The flagellin protein is sufficiently different
from other Borrelia spp. that a serodiagnostic assay based on
flagellin antigen (recombinant, synthetic, or native) is both
sensitive and specific for putative infections. The DNA sequences
of both the flagellin gene and the rRNA gene provide a means for
PCR.TM. and other nucleic acid-based technologies to identify the
organism from skin, body fluid, or cellular specimen of a person,
animal, insect and the like, suspected of being infected. Animal
reservoirs that are particularly suspect include deer and
ground-feeding birds. The diagnostic tests provided herein provide
clinical laboratory differentiation of the new tick-borne disease
from the causative agents of Lyme disease and relapsing fever. The
demonstration of B. lonestari sp. nov. in humans provides the basis
for a diagnosis of infection by this new spirochete.
[0057] B. Lonestari sp. nov.-Species-Specific Amino Acid(s) and
Species-Specific Combinations of Amino Acid(s) from the Flagellin
Protein
[0058] A preferred embodiment of the present invention is a
purified composition comprising a polypeptide having an amino acid
sequence in accordance with SEQ ID NO:2. The term "purified" as
used herein, is intended to refer to a flagellin protein
composition, wherein the flagellin protein is purified to any
degree relative to its naturally-obtainable state, i.e., in this
case, relative to its purity as part of a Borrelia cell extract. A
preferred cell for the isolation of flagellin protein is a B.
lonestari sp. nov. cell, however, this flagellin protein may also
be isolated from the A. americanum tick, patient specimens,
recombinant cells, tissues, and the like, as will be known to those
of skill in the art, in light of the present disclosure. A purified
flagellin protein composition therefore also refers to a
polypeptide comprising the amino acid sequence of SEQ ID NO:2, free
from the environment in which it may naturally occur. The flagellin
protein may be purified by a procedure of Barbour et al. (1986),
for example.
[0059] The present inventors have prepared and envision the
preparation of various fusion proteins and peptides, e.g., where
species-specific flagellin gene coding regions or species-specific
combination of flagellin gene coding regions are aligned within the
same expression unit with nucleotide sequences encoding other
proteins or peptides having desired functions, such as for
purification or immunodetection purposes (e.g., proteins which may
be purified by affinity chromatography and enzyme label coding
regions, respectively).
[0060] Table 1 provides a listing of those species-specific amino
acids and species-specific combinations of amino acids of the
partial sequence of the flagellin protein of B. lonestari sp. nov.
provided as SEQ ID NO:2. These amino acids or species-specific
combinations thereof represent variations in their respective
positions compared to the corresponding available sequences of
other Borrelia species.
[0061] The species-specific amino acids or species-specific
combination of amino acids of this new spirochete provide unique
epitopes for assay for identification of the organism. Two types of
immunoassay are contemplated: i) the first uses an epitope
comprising a peptide having a sequence represented in SEQ ID NO:2
and containing a B. lonestari sp. nov.-specific amino acid(s) or
species-specific combination of amino acids of Table 1 to assay for
the presence of antibodies having specificity for that epitope in a
clinical sample and, ii) the second type of immunoassay uses
antibodies that have been raised to such an epitope to assay for
the presence of the epitope in the clinical sample.
[0062] An epitope useful for immunoassay contains at least one of
the B. lonestari sp. nov.-specific amino acids or species-specific
combination of amino acids of Table 1 together with at least about
4, 5, or 6 amino acids that flank that amino acid(s) in the
flagellin protein sequence designated SEQ ID NO:2. Where the
uniqueness of the flagellin protein is due to a deletion of
residues compared to other Borrelia species, then the epitope
contains at least two, and preferably 3 or 4 amino acids from that
region of SEQ ID NO:2 as cited in Table 1 and is flanked with
further amino acids on both sides of the epitope from SEQ ID NO:2.
Such peptide epitopes may be made synthetically, or may be isolated
from natural sequences by enzyme digestion, for example, or may be
produced by recombinant means, described more fully herein.
[0063] As used herein, "an epitope useful for immunoassay" refers
to a peptide or protein antigen which includes a primary, secondary
or tertiary structure similar to an epitope comprising a B.
lonestari sp. nov.-specific amino acid(s) or species-specific
combination of amino acids of Table 1 located within the flagellin
protein of B. lonestari sp. nov. The level of similarity will
generally be to such a degree that monoclonal or polyclonal
antibodies directed against the B. lonestari sp. nov. flagellin
protein will bind to, react with, or otherwise recognize, the
peptide or protein antigen.
[0064] In general, the size of the polypeptide epitope is at least
large enough to carry an identified B. lonestari sp. nov.-specific
amino acid or species-specific combination of amino acids of Table
1. The smallest useful core sequence contemplated by the present
disclosure would generally be on the order of about 6 amino acids
in length. Thus, this size will generally correspond to the
smallest peptide antigens prepared in accordance with the
invention. It is proposed that short peptides that incorporate a
species-specific amino acid or species-specific combination of
amino acids of Table 1 will provide advantages in certain
circumstances, for example, in the preparation of vaccines or in
immunologic detection assays. Exemplary advantages of shorter
peptides include the ease of preparation and purification, and the
relatively low cost and improved reproducibility of production.
However, the size of the epitope may be larger where desired, so
long as it contains a peptide sequence of SEQ ID NO:2 having a B.
lonestari sp. nov.-specific amino acid or species-specific
combination of amino acids of Table 1. Longer peptide epitopes for
use in accordance with the present invention will generally be on
the order of 15 to 30 amino acids in length, and more preferably
about 15 to about 50 amino acids in length.
[0065] Additionally or alternatively, an epitopic sequence of the
present invention is one that elicits antibodies that react with B.
lonestari sp. nov. flagellin protein of SEQ ID NO:2 and the
antibodies do not cross-react with flagellin protein from other
Borrelia species. Thus, epitope sequences of the present invention
may be operationally defined in terms of their ability to compete
with or perhaps displace the binding of the peptide of SEQ ID NO:2
with the corresponding flagellin-directed antisera.
[0066] Syntheses of epitopic peptides are readily achieved using
conventional synthetic techniques such as the solid-phase method
(e.g., through the use of commercially available peptide
synthesizer such as an Applied Biosystems Model 430A Peptide
Synthesizer). Peptide epitopes synthesized in this manner may then
be aliquotted in predetermined amounts and stored in conventional
manners, such as in aqueous solutions or, even more preferably, in
a powder or lyophilized state pending use.
[0067] In general, due to the relative stability of peptides, they
may be readily stored in aqueous solutions for fairly long periods
of time if desired, e.g., up to six months or more, in virtually
any aqueous solution without appreciable degradation or loss of
antigenic activity. However, where extended aqueous storage is
contemplated, it will generally be desirable to include agents
including buffers such as Tris or phosphate buffer to maintain a pH
of 7.0 to 7.5. Moreover, it may be desirable to include agents
which will inhibit microbial growth, such as sodium azide or
merthiolate. For extended storage in an aqueous state it will be
desirable to store the solutions at 4.degree. C., or more
preferably, frozen. Of course, where the peptide(s) are stored in a
lyophilized or powdered state, they may be stored virtually
indefinitely, e.g., in metered aliquots that may be rehydrated with
a predetermined amount of water (preferably distilled) or buffer
prior to use.
[0068] Peptides may be labeled with .sup.125i, .sup.131i, or other
radiolabel as a means for detection, or may be labeled with a
chromophore, such as, for example, biotin, HRP, or alkaline
phosphatase, for detection.
[0069] Antibodies
[0070] In another aspect, the present invention contemplates an
antibody that is immunoreactive with an epitope having a sequence
of SEQ ID NO:2 containing a B. lonestari sp. nov.-specific amino
acid(s) or species-specific combination of amino acids of Table 1.
An antibody can be a polyclonal or a monoclonal antibody. In a
preferred embodiment, an antibody is a monoclonal antibody. Means
for preparing and characterizing antibodies are well known in the
art (See, e.g., Antibodies "A Laboratory Manual, E. Howell and D.
Lane, Cold Spring Harbor Laboratory, 1988).
[0071] Briefly, a polyclonal antibody is prepared by immunizing an
animal with an immunogen comprising an epitope of the present
invention and collecting antisera from that immunized animal. A
wide range of animal species can be used for the production of
antisera. Typically an animal used for production of anti-antisera
is a rabbit, a mouse, a rat, a hamster, a guinea pig, or a goat.
Because of the relatively large blood volume of goats and rabbits,
a goat or rabbit is a preferred choice for production of polyclonal
antibodies.
[0072] Antibodies, both polyclonal and monoclonal, specific for an
epitope of the present invention may be prepared using conventional
immunization techniques, as will be generally known to those of
skill in the art. A composition comprising an epitope having a
sequence represented in SEQ ID NO:2 and containing a B. lonestari
sp. nov.-specific amino acid or species-specific combination of
amino acids of Table 1 can be used to immunize one or more
experimental animals, such as a rabbit or mouse, which will then
proceed to produce specific antibodies against the peptide epitope.
Polyclonal antisera may be obtained, after allowing time for
antibody generation, simply by bleeding the animal and preparing
serum samples from the whole blood.
[0073] To obtain monoclonal antibodies, one would also initially
immunize an experimental animal, preferably a mouse, with the
above-described composition. One would then, after a period of time
sufficient to allow antibody generation, obtain a population of
spleen or lymph cells from the animal. The spleen or lymph cells
can then be fused with cell lines, such as human or mouse myeloma
strains, to produce antibody-secreting hybridomas. These hybridomas
may be isolated to obtain individual clones which can then be
screened for production of antibody to the desired species-specific
epitope or species-specific combination of epitopes of B. lonestari
sp. nov.
[0074] Following immunization, spleen cells are removed and fused,
using a standard fusion protocol (see, e.g., The Cold Spring Harbor
Manual for Hybridoma Development, incorporated herein by reference)
with plasmacytoma cells to produce hybridomas secreting monoclonal
antibodies against a species-specific epitope or species-specific
combination of epitopes. Hybridomas which produce monoclonal
antibodies to the species-specific epitope or species-specific
combination of epitopes are identified using standard techniques,
such as ELISA and Western blot methods.
[0075] Hybridoma clones can then be cultured in liquid media and
the culture supernatants purified to provide the B. lonestari sp.
nov.-specific monoclonal antibodies. In general, for uses in
accordance with the present invention, one will preferably desire
to select those hybridomas that secrete antibodies having a high
affinity for the species-specific epitopes or species-specific
combination of epitopes of flagellin protein, and exhibit minimal
binding to other Borrelia species flagellin protein.
[0076] Monoclonal antibodies to the desired B. lonestari sp.
nov.-specific flagellin epitopes or species-specific combination of
flagellin epitopes can be used in the diagnosis of infections
caused by the Amblyomma tick and that are Lyme disease-like but
test negative for Lyme disease.
[0077] It is proposed that the monoclonal antibodies of the present
invention will find useful application in standard immunochemical
procedures, such as ELISA and Western blot methods, as well as
other procedures, such as immunohistology of tissues, that may
utilize antibody specific to the species-specific epitopes or
species-specific combination of epitopes of the present invention.
Additionally, species-specific monoclonal antibodies may be useful
in immunoadsorbent protocols for purifying native or recombinant B.
lonestari sp. nov. flagellin protein or minor variants thereof.
[0078] Both poly- and monoclonal antibodies may be employed in
antibody cloning protocols to obtain genes encoding B. lonestari
sp. nov. flagellin or related proteins. Species-specific
anti-flagellin antibodies will also be useful in immunolocalization
studies to analyze the distribution of flagellin protein during
various cellular events, for example, to determine the cellular and
membrane distribution during flagella assembly. A particularly
useful application of such antibodies is in purifying native or
recombinant flagellin protein, for example, using an antibody
affinity column. The operation of all such immunological techniques
will be known to those of skill in the art in light of the present
disclosure.
[0079] Immunoassays
[0080] The present invention envisions the use of immunoassays for
the detection of B. lonestari sp. nov.-specific epitopes or
species-specific combination of epitopes for the diagnosis of the
presence of B. lonestari sp nov. Various immunoassay methods may be
employed, such as, for example, Western blotting, ELISA, RIA, and
the like, all of which are known to those of skill in the art.
[0081] Enzyme linked immunoadsorbent assays (ELISAs) may be used in
conjunction with the invention. In an ELISA assay, proteins or
peptides incorporating species-specific sequences or
species-specific combination of sequences are immobilized onto a
selected surface, preferably a surface exhibiting a protein
affinity such as the wells of a polystyrene microtiter plate. After
washing to remove incompletely adsorbed material, it is desirable
to bind or coat the assay plate wells with a nonspecific protein
that is known to be antigenically neutral with regard to the test
antisera such as bovine serum albumin (BSA), casein or solutions of
milk powder. This allows for blocking of nonspecific adsorption
sites on the immobilizing surface and thus reduces the background
caused by nonspecific binding of antisera onto the surface.
[0082] After binding of antigenic material to the well, coating
with a non-reactive material to reduce background, and washing to
remove unbound material, the immobilizing surface is contacted with
the antisera or clinical or biological extract to be tested in a
manner conducive to immune complex (antigen/antibody) formation.
Such conditions preferably include diluting the antisera with
diluents such as BSA, bovine gamma globulin (BGG) and phosphate
buffered saline (PBS)/Tween. These added agents also tend to assist
in the reduction of nonspecific background. The layered antisera is
then allowed to incubate for from 2 to 4 hours, at temperatures
preferably on the order of 250 to 270.degree. C. Following
incubation, the antisera-contacted surface is washed so as to
remove non-immunocomplexed material. A preferred washing procedure
includes washing with a solution such as PBS/Tween, or borate
buffer.
[0083] Following formation of specific immunocomplexes between the
test sample and the bound antigen, and subsequent washing; the
occurrence and even amount of immunocomplex formation may be
determined by subjecting same to a second antibody having
specificity for the first. To provide a detecting means, the second
antibody will preferably have an associated enzyme that will
generate a color development upon incubating with an appropriate
chromogenic substrate. Thus, for example, one will desire to
contact and incubate the antisera-bound surface with a urease or
peroxidase-conjugated anti-appropriate-animal IgG for a period of
time and under conditions which favor the development of
immunocomplex formation (e.g., incubation for 2 hours at room
temperature in a PBS-containing solution such as PBS-Tween).
[0084] After incubation with the second enzyme-tagged antibody, and
subsequent to washing to remove unbound material, the amount of
label is quantified by incubation with a chromogenic substrate such
as urea and bromocresol purple or
2,2'-azino-di-(3-ethyl-benzthiazoline-6-sulfonic acid [ABTS] and
H.sub.2O.sub.2, in the case of peroxidase as the enzyme label.
Quantification is then achieved by measuring the degree of color
generation, e.g., using a visible spectra spectrophotometer.
[0085] The antibody compositions of the present invention find
great use in immunoblot or Western blot analysis. The antibodies
may be used as high affinity primary reagents for the
identification of proteins immobilized onto a solid support matrix,
such as nitrocellulose, polyacrylamide, nylon, or the like. In
conjunction with gel electrophoresis and immunoprecipitation, the
antibodies may be used as a single step reagent for use in
detecting species-specific epitopes of B. lonestari sp. nov.
Immunologically-based detection methods for use in conjunction with
Western blotting include enzymatically-, radiolabel-, or
fluorescently-tagged secondary antibodies against the primary
antibody moiety are considered to be of particular use in this
regard.
[0086] Other methods for detection of antigens and antibodies well
known in a clinical laboratory setting are contemplated by the
present invention, including: immunodiffusion, electrophoresis and
immunoelectrophoresis, immunochemical and physicochemical methods,
binder-ligand assays, immunohistochemical techniques
(immunofluorescence), agglutination, IgG and IgM capture assay
test, competitive inhibition assays for antibodies, or complement
assays.
[0087] Immunodetection Kits
[0088] In still further embodiments, the present invention concerns
immunodetection methods and associated kits. It is proposed that
the B. lonestari sp. nov.-specific peptides or species-specific
combination of peptides of the present invention may be employed to
detect antibodies having reactivity therewith, or, alternatively,
antibodies prepared in accordance with the present invention, may
be employed to detect species-specific proteins or peptides or
species-specific combinations thereof. In general, these methods
will include first obtaining a sample suspected of containing such
a protein, peptide or antibody, contacting the sample with an
antibody or species-specific protein or peptide or species-specific
combination of protein or peptide in accordance with the present
invention, as the case may be, under conditions effective to allow
the formation of an immunocomplex, and then detecting the presence
of the immunocomplex.
[0089] In general, the detection of immunocomplex formation is
quite well known in the art and may be achieved through the
application of numerous approaches. For example, the present
invention contemplates the application of ELISA, RIA, immunoblot,
dot blot, indirect immunofluorescence techniques and the like.
Generally, immunocomplex formation will be detected through the use
of a label, such as a radiolabel or an enzyme tag (such as alkaline
phosphatase, horseradish peroxidase, or the like). Of course, one
may find additional advantages through the use of a secondary
binding ligand such as a second antibody or a biotin/avidin ligand
binding arrangement, as is known in the art.
[0090] For diagnostic purposes, it is proposed that virtually any
sample suspected of comprising either the species-specific protein
or peptide or antibody sought to be detected, as the case may be,
may be employed. Exemplary samples include the tick suspected of
harboring the new Borrelia species, and clinical samples obtained
from a patient such as blood or serum samples, a skin biopsy,
cerebrospinal fluid, or urine samples. For antigen or DNA testing,
a blood, CSF, or urine sample is preferred. A preferred sample for
antibody tests is a blood or CSF sample. Furthermore, it is
contemplated that such embodiments may have application to
non-clinical samples, such as in the titering of antigen or
antibody samples, in the selection of hybridomas, and the like.
[0091] In related embodiments, the present invention contemplates
the preparation of kits that may be employed to detect the presence
of species-specific proteins or peptides and/or antibodies in a
sample. Generally speaking, kits in accordance with the present
invention will include a suitable B. lonestari sp. nov.-specific
protein or peptide, or species-specific combination thereof, or
antibody directed against such a protein or peptide or
species-specific combination thereof, together with an
immunodetection reagent and a means for containing the antibody or
antigen and reagent. The immunodetection reagent will typically
comprise a label associated with the antibody or antigen, or
associated with a secondary binding ligand. Exemplary ligands might
include a secondary antibody directed against the first antibody or
antigen or a biotin or avidin (or streptavidin) ligand having an
associated label. Of course, as noted above, a number of exemplary
labels are known in the art and all such labels may be employed in
connection with the present invention.
[0092] The container means will generally include a vial into which
the antibody, antigen or detection reagent may be placed, and
preferably suitably aliquotted. The kits of the present invention
will also typically include a means for containing the antibody,
antigen, and reagent containers in close confinement for commercial
sale. Such containers may include injection or blow-molded plastic
containers into which the desired vials are retained.
[0093] B. lonestari sp. nov.-Specific Nucleotides and
Species-Specific Combination of Nucleotides of the flagellin and
16s rRNA Genes.
[0094] Further preferred embodiments of the present invention
include a purified composition comprising a nucleic acid having a
nucleotide sequence in accordance with SEQ ID NOS:1, 3 or 4. The
term "purified" as used herein, is intended to refer to a nucleic
acid composition, in this case, a flagellin gene or segment
thereof, or a rRNA gene or segment thereof, wherein the nucleic
acid is purified to any degree relative to its naturally-obtainable
state, i.e., in this case, relative to its purity as part of a
Borrelia cell extract. A preferred cell for the isolation of this
nucleic acid is a B. lonestari sp. nov. cell, however, this nucleic
acid may also be isolated from the A. americanum tick, patient
specimens, recombinant cells, tissues, and the like, as will be
known to those of skill in the art, in light of the present
disclosure. A purified nucleic acid composition therefore also
refers to a nucleic acid comprising the nucleotide sequence of SEQ
ID NO:1, 3 or 4, free from the environment in which it may
naturally occur.
[0095] The present inventors have prepared and envision the
preparation of various recombinant products comprising nucleotide
segments representing whole or partial sequences of SEQ ID NO:1, 3
or 4, e.g., where species-specific flagellin gene coding regions or
species-specific combination(s) of flagellin gene coding regions
are aligned within the same expression unit with nucleotide
sequences encoding other proteins or peptides to construct a fusion
protein as herein described. Recombinant products include the
vectors themselves, including, for example, plasmids, cosmids,
phage, viruses, and the like. It will be understood that the
present invention also encompasses sequences which are
complementary to the sequences listed herein, along with biological
functional equivalents thereof, including naturally occurring
variants and genetically engineered mutants.
[0096] As used herein, the term "recombinant" is intended to refer
to a vector or host cell into which a foreign piece of DNA, such as
a gene encoding a B. lonestari sp. nov. nucleic acid, has been
introduced. Therefore, engineered cells are distinguishable from
naturally occurring cells that do not contain a recombinantly
introduced gene. Engineered cells are thus cells having a gene or
genes introduced through the hand of man. Recombinantly introduced
genes will either be in the form of a copy of a genomic gene, or
will include genes positioned adjacent to a promoter not naturally
associated with the particular introduced gene.
[0097] Prokaryotic hosts may be used for expression of a B.
lonestari sp. nov. protein. Some examples of prokaryotic hosts are:
E. coli, such as for example, strain RR1, E. coli LE392, E. coli B,
E. coli X 1776 (ATCC No. 31537, American Type Culture Collection,
12301 Parklawn Drive, Rockville, Md. 20852) as well as E. coli
W3110 (F-, lambda-, prototrophic, ATCC No. 273325, American Type
Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852);
other enterobacteriaceae such as Salmonella typhimurium or Serratia
marcescens; bacilli such as Bacillus subtilis; various Pseudomonas
species, Mycobacterium species such as bovis, Streptomyces species,
or Clostridium species may be used.
[0098] In general, plasmid vectors containing replicon and control
sequences that are derived from species compatible with the host
cell are used in connection with these hosts. The vector ordinarily
carries a replication site, as well as marking sequences which are
capable of providing phenotypic-selection in transformed cells. For
example, E. coli is typically transformed using pBR322, a plasmid
derived from an E. coli species. pBR322 contains genes for
ampicillin and tetracycline resistance and thus provides easy means
for identifying transformed cells. The pBR plasmid, or other
microbial plasmid or phage must also contain, or be modified to
contain, promoters which can be used by the microbial organism for
expression of its own proteins.
[0099] In addition, phage vectors containing replicon and control
sequences that are compatible with the host microorganism can be
used as transforming vectors in connection with these hosts. For
example, the phage lambda GEM.TM.-11 may be utilized in making a
recombinant phage vector which can be used to transform host cells,
such as E. coli LE392.
[0100] Those promoters most commonly used in recombinant DNA
construction include the B-lactamase (penicillinase), lactose
promoter systems, and a tryptophan (trp) promoter system. While
these are the most commonly used, other microbial promoters have
been discovered and utilized, and details concerning their
nucleotide sequences have been published, enabling a skilled worker
to ligate them functionally with plasmid vectors (Sambrook et al.,
1989).
[0101] It is similarly believed that almost any eukaryotic
expression system may be utilized for the expression of the
flagellin gene; e.g., Saccharomyces, Baculovirus, SV40, Adenovirus,
glutamine synthase-based or dihydrofolate reductase-based systems
could be employed. For example, plasmid vectors incorporating an
origin of replication and an efficient eukaryotic promoter will be
of most use. Advantages of a eukaryotic expression system include
the ease of producing a large amount of protein and avoidance of
contamination with any bacterial products that may be bound by
antibodies in sera.
[0102] For expression in this manner, one would position the coding
sequences adjacent to and under the control of the promoter. It is
understood in the art that to bring a coding sequence under the
control of a promoter, one positions the 5' end of the
transcription initiation site of the transcriptional reading frame
of the protein between about 1 and about 50 nucleotides
"downstream" of (i.e., 3' of) the chosen promoter.
[0103] Where eukaryotic expression is contemplated, one will also
typically desire to incorporate into the transcriptional unit which
includes the flagellin gene, an appropriate polyadenylation site
(e.g., 5'-AATAAA-3') if one was not contained within the original
cloned segment. Typically, the poly A addition site is placed about
30 to 2000 nucleotides "downstream" of the termination site of the
protein at a position prior to transcription termination.
[0104] Table 2 provides a listing of those B. lonestari sp.
nov.-specific nucleotides and species-specific combination(s) of
nucleotides of the flagellin gene of B. lonestari sp. nov. These
nucleotides represent variations in their respective positions
compared to the corresponding available sequences of other Borrelia
species.
[0105] Table 3 provides a listing of those species-specific
nucleotides and species-specific combination(s) of nucleotides of
the 16s rRNA gene of B. lonestari sp. nov. These nucleotides
represent variations in their respective positions compared to the
corresponding available rRNA sequences of other Borrelia
species.
[0106] The B. lonestari sp. nov.-specific nucleotides or
species-specific combination of nucleotides of this new spirochete,
both from the flagellin and the rRNA genes, provide unique
nucleotide targets for assay for identification of the organism.
Nucleotide assays that are contemplated include:
[0107] i) For both the flagellin and rRNA genes, the nucleotide
sequence of a segment containing any of the species-specific
nucleotides or species-specific combination of nucleotides of
Tables 2 or 3 clearly determines the identity of the sample being
examined. A region containing the species-specific nucleotides or
species-specific combination of nucleotides would be amplified by a
polymerase chain reaction (PCR.TM.) and used for standard
nucleotide sequence analysis as described in Example 2 and 3.
[0108] ii) For the flagellin gene, hybridization of
species-specific oligonucleotide probes to a sample being analyzed
will identify the sample. The species-specific nucleotide probe
would be complementary to and would hybridize with areas of the
nucleotide sequence provided in SEQ ID NO:1 having a
species-specific nucleotide or species-specific combination of
nucleotides as shown in Table 2. Preferred nucleotide probes would
be complementary to and, therefore, hybridize with those regions of
the B. lonestari sp. nov. sequence that are species-specific due to
deletions of nucleotides from the flagellin gene of related
Borrelia species (Table 2).
[0109] iii) Restriction fragment length polymorphism analysis of a
sample of DNA from an infected human, or DNA from a tick or the
spirochete will determine identity of the Borrelia species.
[0110] Each of these nucleotide assay embodiments is discussed in
further detail as follows.
[0111] PCR.TM. Amplification and DNA Sequence Analysis
[0112] DNA primers that would be useful in PCR.TM. may be derived
from any portion of SEQ ID NOS:1 or 3 as long as one primer is 5'
to a species-specific nucleotide or species-specific combination of
nucleotides and a second primer is 3' to the same species-specific
nucleotide or combination. PCR.TM. primers generally are about at
least 13 nucleotides in length and may be up to 20 or 25 or 30
nucleotides or even longer, and the region primed and amplified may
range from about 50 nucleotides to about 2000 nucleotides. A
preferred amplified product is about 100 to 300 or 400 nucleotides
long.
[0113] Nucleic acid sequencing is carried out using the dideoxy
chain termination technique (Sanger et al., 1977, and Sambrook et
al., 1989). One skilled in this art would be familiar with the
PCR.TM. amplification procedure and nucleic acid sequencing and
would know, in light of the present disclosure, how to use the
sequences provided herein to amplify regions of the flagellin gene
and the rRNA gene to obtain PCR.TM. products for nucleotide
sequencing. Examples of these procedures are provided in Examples 2
and 3.
[0114] Oligonucleotide Probes for Hybridization
[0115] An oligonucleotide probe of the present invention for
hybridization to determine identity of a clinical sample is a
nucleotide sequence of SEQ ID NO:1 that is complementary to a
region of the flagellin gene having a B. lonestari sp.
nov.-specific nucleotide or species-specific combination of
nucleotides of Table 2 within that region. One skilled in this art
would also realize that the complement of the oligonucleotide would
also detect that region of sequence by binding to the opposite
strand of DNA.
[0116] The probe may be from about 13 nucleotides in length up to
and including the full length sequence, preferably is about 13-30
nucleotides in length and is most preferably from about 15 to about
18, 19, 20 or 21 nucleotides in length. The oligonucleotide binds
to its complement under standard hybridization conditions. The term
"standard hybridization conditions" as used herein, is used to
describe those conditions under which substantially complementary
nucleic acid segments will form standard Watson-Crick base-pairing.
A number of factor are known that determine the specificity of
binding or hybridization, such as pH, salt concentration, the
presence of chaotropic agents (e.g. formamide and dimethyl
sulfoxide), the length of the segments that are hybridizing, and
the like.
[0117] For use with the present invention, standard hybridization
conditions for relatively large segments, that is segments longer
than about 100 nucleotides, will include a hybridization mixture
having between about 0.3 to 0.6 M NaCl, a divalent cation chelator
(e.g. EDTA at about 0.05mM to about 0.5 mM), and a buffering agent
(e.g. Na.sub.2PO.sub.4 at about 10 mM to 100 mM, pH 7.2), at a
temperature of about 65.degree. C. The preferred conditions for
hybridization are a hybridization mixture comprising 0.5 M NaCl, 5
mM EDTA, 0.1 M Na.sub.2PO.sub.4, pH 7.2 and 1% N-lauryl sarcosine,
at a temperature of 65.degree. C. Naturally, conditions that affect
the hybridization temperature, such as the addition of chaotropic
agents, such as formamide, will be known to those of skill in the
art, and are encompassed by the present invention.
[0118] When it is contemplated that shorter nucleic acid segments
will be used for hybridization, for example fragments between about
15 and about 30 nucleotides, salt and temperature conditions will
be altered to increase the specificity of nucleic acid segment
binding. Preferred conditions for the hybridization of short
nucleic acid segments include lowering the hybridization
temperature to about 37.degree. C., and increasing the salt
concentration to about 0.5 to 1.5 M NaCl with 1.5 M NaCl being
particularly preferred.
[0119] For applications requiring high selectivity, one will
typically desire to employ relatively stringent conditions to form
the hybrids, e.g., one will select relatively low salt
and.backslash.or high temperature conditions, such as provided by
0.02 M-0.15 M NaCl at temperatures of 50.degree. C. to 70.degree.
C. Such selective conditions tolerate little, if any, mismatch
between the probe and the template or target strand, and would be
particularly suitable for a diagnostic assay.
[0120] Oligonucleotides for use as probes may be readily prepared
by, for example, directly synthesizing the fragment by chemical
means, by application of nucleic acid reproduction technology, such
as the PCR.TM. technology of U.S. Pat. Nos. 4,683,202 and 4,683,195
(herein incorporated by reference) or by introducing selected
sequences into recombinant vectors for recombinant production.
[0121] In certain embodiments, it will be advantageous to employ
nucleic acid sequences of the present invention in combination with
an appropriate means, such as a label, for determining
hybridization. A wide variety of appropriate indicator means are
known in the art, including fluorescent, radioactive, enzymatic or
other ligands, such as avidin/biotin, that are capable of giving a
detectable signal. In preferred embodiments, one will likely desire
to employ a fluorescent label or an enzyme tag, such as urease,
alkaline phosphatase or peroxidase, instead of radioactive or other
environmental undesirable reagents. In the case of enzyme tags,
colorimetric indicator substrates are known which can be employed
to provide a means visible to the human eye or
spectrophotometrically, to identify specific hybridization with
complementary nucleic acid-containing samples.
[0122] In general, it is envisioned that the hybridization probes
described herein will be useful both as reagents in solution
hybridization as well as in embodiments employing a solid phase. In
embodiments involving a solid phase, the test DNA (or RNA) is
adsorbed or otherwise affixed to a selected matrix or surface. This
fixed, single-stranded nucleic acid is then subjected to specific
hybridization with selected probes under desired conditions. The
selected conditions will depend on the particular circumstances
based on the particular criteria required (depending, for example,
on the G+C content, type of target nucleic acid, source of nucleic
acid, size of hybridization probe, etc.). Following washing of the
hybridized surface so as to remove nonspecifically bound probe
molecules, specific hybridization is detected, or even quantified,
by means of the label.
[0123] Restriction Fragment Length Polymorphism
[0124] Analyses of the sequence provided in SEQ ID NOS:1 and 3
indicate that different patterns of products are found when the B.
lonestari sp. nov. DNA is cleaved by a restriction enzyme compared
to the restriction patterns obtained from other species of
Borrelia. In particular, as shown in Example 2, an AluI digest of
an about 330 bp PCR.TM. product (SEQ ID NO:4) and electrophoretic
analysis of the enzyme digest yielded characteristic restriction
fragments for different species of Borrelia, including B.
burgdorferi B31, from two North American relapsing fever agents B.
hermsii HS1 and B. turicatae "Ozona", and from
immunofluorescence-positive Amblyomma ticks from Texas and New
Jersey. The gel patterns of the two Amblyomma tick samples both
differed from the digested products from B. burgdorferi, B.
hermsii, and B. turicatae. Further enzyme digests that demonstrate
polymorphisms are shown in Table 7 of Example 5. DNA is prepared
from a sample for RFLP analysis as described in Examples 2 and 3.
Primers are hybridized to the DNA and the PCR.TM. reaction carried
out also substantially as described in those examples. One skilled
in the art would know that other primers may be used, especially if
the DNA fragment to be amplified is cloned into a vector of known
sequence. A restriction enzyme digest is carried out choosing from
those enzymes of Table 7, and the digest applied to, preferably, an
agarose gel. Visualization of the restriction enzyme fragments and
comparison of their sizes with those listed in Table 7 provide
identification of the Borrelia species.
[0125] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
EXAMPLE 1
Evidence for a Spirochete in A. americanum that Cross-Reacts with
Anti-B. burgdorfei Antiserum
[0126] The present example provides evidence for a spirochete in A.
americanum that cross-reacts with anti-B. Burgdorfei antiserum at
high concentrations of the antiserum.
[0127] For the present study, A. americanum ticks were collected
from field locations in Missouri, New Jersey, New York, North
Carolina, and Texas and examined with anti-B. burgdorferi
polyclonal antisera in concentrations giving cross-reactions with
other Borrelia spp. (Maupin et al., 1991). Fluorescent
photomicrographs were taken of B. turicatae, a relapsing fever
agent, and spirochetes in the crushed midgut of an A. americanum
tick stained with a 1:10 dilution of fluorescein
isothiocyanate-conjugated rabbit antibodies to B. burgdorferi
(Maupin et al., 1991). Approximately 2% of the ticks, both nymphs
and adults, in Missouri, New Jersey, New York, and North Carolina
contained immunoreactive spirochetes of between 10 and 20 Am in
length as shown in Table 4. The results for the Texas organisms
were similar.
5TABLE 4 Presence of immunofluorescence-reactive spirochetes in
Amblyomma americanum nymphal and adult ticks* LOCATION # POSITIVE
(adults) # EXAMINED (adults) Monmouth Co., NJ 3 (2) 110 (50)
Suffolk Co., NY 10 (9) 375 (318) Currituck Co., NC 1 (0) 95 (26)
Southeast MO.sup..dagger. 6 (0) 295 (29) Total 20 (11) 875 (423) %
positive [range] 2.3% [1.1-2.7%] *Reactive with 1:10 dilution of
fluorescein-conjugated antiserum to B. burgdorferi (Maupin et al.,
1991). The spirochete was not detected with a 1:100 dilution of the
antiserum. .sup..dagger.Bollinger Co., Pulaski Co., and Stoddard
Co., MO
[0128] To characterize the A. americanum spirochete, attempts were
made to cultivate it in media that supports the growth of several
Borrelia spp., including those that cause Lyme disease and several
that cause relapsing fever (Barbour, 1984). In addition, some
samples with the suspected agent were injected into laboratory
mice, which were subsequently examined for illness and their organs
were cultured. These attempts, like those in the past (Schulze et
al., 1984; Kocan et al., 1992), failed to isolate the organism in
the laboratory.
EXAMPLE 2
The A. americanum Spirochete is a New Borrelia Species, B.
lonestari sp. Nov.
[0129] The present example describes the inventors' analysis of the
A. americanum spirochete that led to their determination that the
spirochete is a new Borrelia species.
[0130] The present inventors used the polymerase chain reaction
(PCR.TM.) and amplification of conserved genes using primers
designed on the basis of sequences of possibly-related organisms
(Relman, 1993). The genes for 16S rRNA and flagellin, the major
structural protein of flagella, of several Borrelia spp. were
available, and alignment revealed regions of genus-specific
sequences.
[0131] A. americanum ticks were collected in New Jersey and New
York from the field by flagging. Flagging is a technique described
in Maupin et al., (1991) which reference is specifically
incorporated herein by reference. A. americanum ticks from Texas
had been removed from human hosts and submitted to the Department
of Health. Ticks were dissected with sterile instruments, and
portions of their midguts were examined by direct fluorescent
microscopy with polyclonal antiserum to B. burgdorferi (Maupin et
al., 1991). DNA from positive and negative ticks was extracted at
two locations using different extraction methods: (a) Ticks from
New York and New Jersey were individually placed in sterile plastic
bags, frozen, and crushed. To the homogenate was added, first, 0.5
ml of 10 mM Tris, pH 8.0-1 mM EDTA (TE) with 0.1 mg/ml of yeast
tRNA and 1% sodium dodecyl sulfate (SDS) and, then, 0.5 ml of
phenol. The aqueous phase was extracted with ether. (b) Ticks from
Texas were placed in sterile microfuge tubes. To the tube was added
0.2 ml of 10 mM Tris, pH 8.0-50 mM EDTA-2% SDS. The suspension was
heated to 64.degree. C. for 20 min, extracted with phenol, and
twice with chloroform. The DNA obtained by both methods was
precipitated with ethanol and resuspended in TE. The investigator
who performed the PCR.TM. was blind to the findings of the tick
examinations.
[0132] The sequence of a first set of PCR.TM. primers (FlaLS and
FlaRS) was based on identical sequences in flagellin of Borrelia
spp. The positions listed in parentheses following the sequence
refer to B. burgdorferi flagellin (Fla) gene:
6 FlaLS: SEQ ID NO:9 5'AACAGCTGAAGAGCTTGGAATG3' (438-459); FlaRS:
SEQ ID NO:10 3'CGATAATCTTACTATTCACTAGTTTC5' (766-791);.
[0133] The primers differed in sequence at two or more positions
from homologous sequences of other spirochetes and bacteria. This
first set of primers was expected to amplify a .about.330 base-pair
fragment of the flagellin gene of any Borrelia spp.
[0134] PCR.TM. primers were synthesized as follows. PCR.TM.
reactions in volumes of 100 .mu.l containing 2.5 U of Taq DNA
polymerase (Boehringer-Mannheim), 50 pmole of each primer, 200
.mu.M of each dNTP, 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM
MgCl.sub.2, and 0.001% gelatin were carried out in
Perkin-Elmer-Cetus thermal cycler. The reaction program was first
95.degree. C. for 3 min and then 40 cycles of 95.degree. C. for 1
min, 55.degree. C. for 1 min., and 75.degree. C. for 1 min.
[0135] Subsequent AluI restriction enzyme digestion of the PCR.TM.
products and electrophoretic analysis of the enzyme digest (4%
NuSieve.TM. gel, FMC, (Rockland, Me.) with Tris-acetate-EDTA
buffer) yielded characteristic restriction fragments for different
species of Borrelia, including B. burgdorferi B31, from two North
American relapsing fever agents B. hermsii HS1 and B. turicatae
"Ozona", and from immunofluorescence-positive Amblyomma ticks from
Texas and New Jersey. The gel patterns of the two Amblyomma tick
samples revealed fragments of about 117, 85 and 55 base pairs; from
B. burgdorferi, about 130 and 106 base pairs; from B. hermsii,
about 160, 100 and 75 base pairs; and from B. turicatae, about 110
and 75 base pairs.
[0136] PCR.TM. products from one of the Texas ticks and one of the
New Jersey ticks were cloned into vector pCRII.TM. using the TA
Cloning System and E. coli strain INV.alpha.F' (Invitrogen, San
Diego, Calif.). Sequences of both strands from at least two clones
of each PCR.TM. product were determined from double-stranded DNA
using SEQUENASE.TM. version 2.0 (U.S. Biochemical, Amersham Life
Sci, Arlington Heights, Ill.) and custom-synthesized primers. The
sequence of this .about.330 base region is provided as SEQ ID NO:4.
Both sequences were confirmed to be the central portion of a
flagellin gene, but they were not identical to comparable regions
of other Borrelia spp. flagellin genes in the sequence databases
(see Example 3).
[0137] To assess the specificity of the PCR.TM. reaction,
additional extracts from A. americanum ticks from New York were
examined. For this study, extracted DNA was subjected to PCR.TM.
with primer pairs FlaSL and FlaSR. The PCR.TM. products were
subjected to Southern blot analysis by separating the products in a
0.9% GTG.TM. agarose gel (FMC) in Tris-borate-EDTA buffer, and,
after transfer to 0.22 mm Nytran.TM. membranes (Schleicher &
Schuell, Keene, N.H.), probed with the PCR.TM. product from the
Texas tick. The probe was labeled with [.sup.32P]-dATP using a nick
translation kit (Gibco/BRL, Gathersburg, Md.). Prehybridization was
carried out in hybridization medium (6.times.SSC, 5.times.
Denhardt's, 0.5% SDS, 100 .mu.g/ml denatured salmon sperm DNA, 50%
formamide to 200 ml with water) for 1-4 h at 37.degree.. The probe
was added and hybridization was carried out overnight at
37.degree.. The first and second washes were with 2.times.SSC, 0.1%
SDS, 1 mM EDTA, for 5 min at room temperature. The third and fourth
washes were with 100-200 ml of 0.1.times.SSC, 0.1% SDS, 1 mM EDTA,
for 15-30 min at 64.degree. C. The final wash was with
0.1.times.SSC at room temperature. X-ray film was exposed with an
intensifying screen. Nine of 10 extracts from ticks that were
positive by direct fluorescence assay with conjugated rabbit
antibody to B. burgdorferi (Maupin et al., 1991) had products that
detectably hybridized with the probe; none of 11 ticks that were
negative by the direct fluorescence assay hybridized with the probe
(p<0.0001 by two-tailed Fisher exact test). This test indicates
that the DNA obtained by the PCR.TM. reaction was specific for
anti-Borrelia-positive spirochetes. This new Borrelia species was
named B. lonestari sp. nov. The anti-B. burgdorferi antibody, at
high concentrations, cross-reacts with all Borrelia species,
whereas a DNA probe of the present invention is expected to bind
only B. lonestari sp. nov. samples.
EXAMPLE 3
Regions of B. lonestari sp. Nov. Flagellin Gene and rRNA Gene
Sequences Differ from Those of Other Borrelia sp.
[0138] The present example describes those regions of the B.
lonestari sp. nov. flagellin amino acid and rRNA sequences that
differ from those of other Borrelia sp.
[0139] With the inventors' collection of evidence that the
Amblyomma spirochete was a new Borrelia sp., sets of primers were
used to amplify a larger region of the flagellin gene and most of
the 16S rRNA gene. The primers were based on identical sequences in
flagellin and 16S rRNA genes of Borrelia spp. The primers differed
in sequence at two or more positions from homologous sequences of
other spirochetes and bacteria. In the following primer sequences,
the positions listed in parentheses refer to B. burgdorferi
flagellin (Fla) and 16S rRNA (16Rna) genes:
7 FlaLL, SEQ ID NO:11 5'ACATATTCAGATGCAGACAGAGGT3' (301-324);
FlaRL, SEQ ID NO:12 3'TGTTAGACGTTACCGTTACTAACG5' (942-965); 16RnaL,
SEQ ID NO:13 5'CTGGCAGTGCGTCTTAAGCA3' (36-55); 16RnaR, SEQ ID NO:14
3'CATATAGTCTTACTATGCCACTTAG5' (1346-1368).
[0140] PCR.TM. primers were synthesized as described in Example
2.
[0141] PCR.TM. products from organisms in ticks from Texas and New
Jersey were sequenced over both strands and as different
recombinant clones. PCR.TM. products were obtained with primer
pairs FlaLS+FlaRS, FlaLL+FlaRL, and 16RnaR+16RnaL and cloned into
vector pCRII.TM. using the TA Cloning System and E. coli strain
INVaF' (Invitrogen). Sequences of both strands from at least two
clones of each PCR.TM. product were determined from double-stranded
DNA using Sequenase version 2.0 (U. S. Biochemical) and
custom-synthesized primers. The nucleotide sequence of the
flagellin fragment is assigned SEQ ID NO:1 and contains about 70%
of the flagellin gene; the deduced amino acid sequence is assigned
SEQ ID NO:2. This fragment contains the variable portion of the
sequence of bacterial flagellin genes and is the region that
contains species-specific epitopes or species-specific combination
of epitopes of the flagellin protein.
[0142] Three PCR.TM. clones of the Texas tick, positioned in the
vector pCRII.TM. and in the host E. coli strain INV.alpha.F'
(Invitrogen), were sequenced for comparison to neutralize errors
made by the polymerase enzyme in this method. These clones are
designated as follows: i) clone 70, named pTxfla70, deposited with
the American Type Culture Collection, 12301 Parklawn Drive,
Rockville, Md., 20852 as ATCC# ; the sequence from this tick is SEQ
ID NO: 28 and has a "A" at position 345 instead of a "G" as shown
in SEQ ID NO: 1; ii) clone 69 which has an "A" at position 345, a
"C" at position 573, and a "T" at position 586 compared to SEQ ID
NO: 1; and iii) clone 5 which has a "T" at position 3, and a "T"
missing at position 24 compared to SEQ ID NO: 1. A composite
sequence, obtained by comparison of these clones, and comparison
with other Borrelia sequences, is provided as SEQ ID NO: 1.
[0143] The sequence of the new spirochete from New Jersey differed
from that of the Texas tick in two locations, 1) base #345 of SEQ
ID NO:1 is an A for the New Jersey tick, but a G for the Texas
tick; this change does not alter the encoded amino acid; 2) base
#591 of SEQ ID NO:1 is a G for the New Jersey tick, but an A for
the Texas tick; this change also does not alter the amino acid
sequence. Neither variation is near part of the flagellin gene
where species-specific nucleotides are found or where
species-specific amino acids are encoded. This variation may be
considered an idiotype among this species.
[0144] The obtained nucleotide and deduced amino acid sequences
were used to search by the BLAST algorithm the daily-updated
sequence databases managed by the National Center for Biotechnology
Information (Altschul et al., 1990). No identical matches were
found to flagellin and rRNA genes of Borrelia spp.
[0145] The alignment of the deduced partial flagellin proteins of
Amblyomma spirochete strains from Texas and New Jersey is shown in
Table 5 with the comparable variable regions of the flagellin
proteins of eight Borrelia spp.
8TABLE 5 Alignment of variable regions of spirochete flagellin
proteins, sequences in bold type have sequence identifiers as
indicated.sup.1. 73* 80 90 100 110 120 130 AbTx_Fla.sup..dagger.,:
LRVQVGANQDEAIAVNIFSTNVANLFGGEGV...QAAPAQEGAQQEGVQ-
P......APAQGGISSPINVTTAIDAN AbNJ_Fla:
--------------------------------------------------------------------------
--- Bt_Fla: ---H-------------YAA------A---A----VS----------
---AAPAPAA------VN--V----T---- Bp_Fla:
---H-------------YAS------A---A----VS------------AAPAPAA------VN--V----TV-
--- Ba_Fla: ---H-------------YAA------A---A----------------
---ATPAPVA---P--VN-----I--V--- Bh_Fla:
---H-------------YAS------A---A-------V--IG---EG-AAPAPAA------VN--------V-
--- Bc_Fla: ---H-------------YAA------S---AQ---V-----------
-A-AAPAPAS------VN--V-----V--- Bz_Fla:
---H-------------YAA------A---AQAA----V-----E--A-Q-PTPAT--T---VN--V----TV-
--- Bg_Fla: ---H-------------YAA------S---AQAA-TA-V--------
-A-Q-PAPVT--S---VN--V----TV--- Bb_Fla:
---H-------------YAA------S---AQTA----V---V----A-Q-PAPAT--S---VN--V----TV-
--- .sup.1LRVQVGANQDEAIAVNIFSTNVANLFGGEGV; SEQ ID NO:15
QAAPAQEGAQQEGVQP; SEQ ID NO:16 APAQGGISSPINVTTAIDAN; SEQ ID NO:17
AAPAPAA; SEQ ID NO:18 ATPAPVA; SEQ ID NO:19 AAPAPAS; SEQ ID NO:20
AQAA; SEQ ID NO:21 PTPAT; SEQ ID NO:22 PAPVT; SEQ ID NO:23 AQTA;
SEQ ID NO:24 PAPAT; SEQ ID NO:25 *Numbers correspond to amino acid
positions of B. lonestari sp. nov. flagellin protein fragment of
SEQ ID NO:2. .sup..dagger.Abbreviations and sources (accession
numbers) Ab, Amblyomma borrelia strains from Texas and New Jersey;
Bt, B. turicatae (M67462); Bp, B. parkeri (M67461); Ba, B. anserina
(X75201); Bh, B. hermsii (A44894 and M67460); Bc, B. crocidurae
(X75204); Bz, B. afzelii; Bg, B. garinii (X75203); Bb, B.
burgdorferi (X69611 and P11089); and Fla, flagellin.
[0146] The flagellin proteins of these organisms differed from
other borrelial flagellins at several positions and, uniquely among
the Borrelia spp., lacked most of a proline-alanine-rich region
beginning around nucleotide residue 119 of SEQ ID NO:2.
[0147] Phylogenetic classification was provided by distance matrix
analysis and by comparison of 16S rRNA gene sequences (Table
6).
9TABLE 6 Signature base positions of 16S rRNA genes of Borrelia
spp..sup.1 Base.sup.2: 42 91 135 146 217 224 267 435 437 522 554
564 963 1074 1143 1215 Base.sup.3: 77 126 170 181 253 260 303 471
473 558 590 600 999 1110 1179 1251 Ab_rna: T C A T A G T G T C T T
A G A T Bm_rna: T C A A G G T A C C C T A G A T Bf_rna: C T G A A G
A G T T T C G A G T Bh_rna: C T G A A A A A T T C C G A A T Ba_rna:
C T G A G A A A C T C C G A G A Bb_rna: C T G T A A A A T T T C A G
A A .sup.1The GenBank accession number for the 16s rRNA gene
sequence is U23211. Abbreviations: Ab, Amblyomma tick borrelia,
Texas and New Jersey strains; Bm, B. miyamotae sp. nov.; Bf,
Florida canine borrelia; Bh, B. hermsii; Ba, B. anserina; Bb, B.
burgdorferi. Sources for sequences are given in legend for Table 5.
.sup.2Base position corresponding to SEQ ID NO:3, the partial 16s
rRNA sequence of B. lonestari sp. nov. .sup.3Base positions
correspond to positions of 16S rRNA gene of B. burgdorferi. Nine of
the 16 positions are predicted to be in non-base paired regions of
the 16S rRNA.
[0148] The 16S rRNA gene sequences of the Texas and New Jersey
strains differed at only 2 out of 1336 nucleotide positions.
Positions 733 and 739 have a T and G in those positions,
respectively, in the Texas strain but a C and C in those positions,
respectively, for the New Jersey strain. These residues are not
considered to be species-specific nucleotides. A clone of the Texas
strain designated pTxrna20, positioned in the vector pCRII.TM. and
in the host E. coli strain INV.alpha.F' (Invitrogen), was deposited
in the American Type Culture Collection, 12301 Parklawn Drive,
Rockville, Md., 20852 as ATCC# . By distance matrix and parsimony
analyses of the aligned sequences, the Amblyomma spirochetes
represented a different species of Borrelia. The organism is in a
group containing relapsing fever species. Parsimony analysis of
base positions that were polymorphic in at least two of 6 species
yielded a similar result (Table 6). Among the 6 sequences
represented in Table 6, there were 49 aligned positions at which
only one of the 6 species differed; 27 (53%) of these differences
were in B. burgdorferi.
[0149] Other organisms in the relapsing fever group are the bird
pathogen B. anserina, an unnamed organism recovered from the blood
of two dogs in Florida, and a bacterium identified as B. miyamotae
sp. nov. and isolated from I. persulcatus ticks in Japan (accession
number D45192). By both distance matrix and parsimony analysis, B.
lonestari sp. nov. is most closely related to B. miyamotae sp.
nov., another Borrelia associated with hard rather than soft ticks.
All Borrelia sp. identified to date infect vertebrates as well as
arthropods (Barbour et al., 1986).
EXAMPLE 4
A Fusion Protein Comprising a Portion of B. lonestari sp. Nov.
Flagellin
[0150] The present example describes the placement of the
nucleotide sequence represented by SEQ ID NO:1 into a construct to
provide a fusion protein for immunoassay. This construct supplies
an N-terminus and a C-terminus for the recombinant fusion protein.
The pMAL.TM. p2 expression vector, obtained from New England
Biolabs, (Beverly, Mass.) and encoding the maltose binding protein,
was used for this construct. The vector was digested with EcoRI and
XbaI, ligated to the nucleic acid having SEQ ID NO:1, and having an
in-frame stop codon and synthetic EcoRI and XbaI sequences added;
and the recombinant molecule transfected into E. coli JM103.
Methods for protein fusion and purification are described in the
New England Biolabs brochure (1992). The resulting construct is
represented by the partial sequence of SEQ ID NO:26. A fusion
protein is made that, when cleaved with a blood protease factor Xa,
releases flagellin protein having an additional Ile Ser Glu Phe
(SEQ ID NO:27) sequence at the N-terminus and an additional Ala Val
sequence at the C terminal end.
[0151] An antigen with minimal or no cross-reactivity with B.
burgdorferi is desirable since the Lyme disease would be in the
differential diagnosis. Therefore, a Borrelia gene encoding a
flagellin protein, such as, Borrelia crocidurae, a relapsing fever
agent of Eurasia, could provide the N- and C-terminal structure for
the incorporation of the nucleotide sequence of the B. lonestari
sp. nov. The resultant fused protein product, a recombinant,
chimeric flagellin, would minimize cross-reactivity with antibodies
to other Borrelia and spirochetes among patients samples in North
America and would be a principal reagent in an ELISA test, Western
blot assay or similar assay for antibodies to B. lonestari sp. nov.
in patients and domestic animals suspected of harboring this agent.
An advantage of a B. lonestari sp. nov. fusion protein having N--
and C-terminal ends from another flagellin protein is that the
fusion protein will more likely fold properly as a flagellin
protein, its conformation will be more likely like that of the
natural form, and it is expected to be easier to purify. The fusion
protein may be purified according to Barbour et al., for
example.
EXAMPLE 5
Restriction Fragment Length Polymorphisms for Assay of Specimens
for Presence of B. lonestari sp. Nov.
[0152] The present Example provides for analyses of the sequences
provided in SEQ ID NOS:1 and 3 to indicate that different patterns
of products are found when the B. lonestari sp. nov. DNA is cleaved
by a restriction enzyme compared to the restriction patterns
obtained from other species of Borrelia. This method allows for the
identification not only of the new spirochete, but also of the
other Borrelia species.
[0153] As shown in Example 2, an AluI digest of an about 330 bp
PCR.andgate. product (SEQ ID NO:4) and electrophoretic analysis of
the enzyme digest yielded characteristic restriction fragments for
different species of Borrelia, including B. burgdorferi B31, from
two North American relapsing fever agents B. hermsii HS1 and B.
turicatae "Ozona", and from immunofluorescence-positive Amblyomma
ticks from Texas and New Jersey. The gel patterns of the two
Amblyomma tick samples revealed fragments of about 117, 85 and 55
base pairs; from B. burgdorferi, about 130 and 106 base pairs; from
B. hermsii, about 160, 100 and 75 base pairs; and from B.
turicatae, about 110 and 75 base pairs. Therefore, when appropriate
size standards are included in an electrophoretic gel analysis, an
approximation of the sizes and numbers of restriction fragments is
sufficient to identify the Borrelia species.
[0154] Further enzyme digests that demonstrate polymorphisms are
shown in Table 7. The data provided in Table 7 are for a PCR.TM.
amplified product using PCR.TM. primers of SEQ ID NO. 11 and 12 or
are from the whole gene (Ba, Bc, Bz).
10TABLE 7 Restriction Fragment Length Polymorphisms for the
Flagellin Gene of Various Borrelia Species.sup.1 BlT Bb Bh BlNJ Ba
Bc Bz AluI 150 352 346 150 323 176 261 131 130 160 131 177 166 237
130 106 100 130 159 159 137 117 50 55 117 132 147 92 55 31 55 69
138 69 36 36 55 92 69 48 69 62 42 55 55 39 45 45 36 33 NdeI 540 --
467 540 604 607 -- 101 101 101 508 508 90 NheI 511 -- -- 511 604
945 -- 130 130 508 176 DpnI 384 407 460 384 373 357 489 180 180 131
180 281 284 287 77 77 67 77 226 226 226 121 117 121 111 81 40
.sup.1Sizes of fragments in base pairs are shown for each enzyme
digest of a PCR .TM. amplified product using SEQ ID NO: 11 and 12
as PCR .TM. primers or from the whole gene (Ba, Bc, Bz). Fragments
shorter than 30 base pairs are not listed. Abbreviations and
sources (accession numbers): BlT, BlNJ Borrelia lonestari strains #
from Texas and New Jersey; Bb, B. burgdorferi (X69611 and P11089);
Bh, B. hermsii (A44894 and M67460); Ba, B. anserina (X75201); Bc,
B. crocidurae (X75204); Bz, B. afzelii.
EXAMPLE 6
Method of Assaying a Clinical Sample
[0155] The present Example provides methods for the assay of a
clinical sample for the determination of the presence or absence of
B. lonestari sp. nov. A clinical sample may be a tick suspected of
harboring the new Borrelia species, for example, or clinical
samples obtained from a patient such as blood or serum samples, a
skin biopsy, cerebrospinal fluid, or urine samples. A preferred
sample is a blood or CSF sample for antibody or T cell assays. An
immunoassay would be carried out on a patient sample of whole cells
or sonicated cell extract, for example, using flagellin specific
antiserum to test for the present of species-specific antigens. For
nucleic acid assays, the nucleic acid, either RNA or DNA, would be
amplified using a PCR.TM. reaction, for example, or an
amplification procedure that would achieve a similar end, and the
product analyzed as described herein. Reverse transcriptase may be
used to make a cDNA copy of a messenger RNA molecule for
amplification or ribosomal RNA may be obtained in a straightforward
manner since it is abundant in the cell.
EXAMPLE 7
Vaccines for Protection Against B. lonestari sp. Nov. Infection
[0156] The present inventors contemplate vaccines for use in both
active and passive immunization embodiments. Immunogenic
compositions, proposed to be suitable for use as a vaccine, may be
prepared most readily directly from immunogenic B. lonestari sp.
nov.-specific surface antigens, such as Vmp or Osp lipoprotein.
Preferably, the antigenic material is purified by column
chromatography, such as HPLC. The material may be dialyzed to
remove undesired small molecular weight molecules and/or
lyophilized for ready formulation into a desired vehicle.
[0157] The preparation of vaccines that contain peptide sequences
as active ingredients is generally well understood in the art, as
exemplified by U.S. Pat. Nos. 4,608,251; 4,601,903; 4,599,231;
4,599,230; 4,596,792; and 4.578,770, all incorporated herein by
reference. Typically, such vaccines are prepared as injectables,
either as liquid solutions or suspensions. Solid forms suitable for
solution in, or suspension in, liquid prior to injection may also
be prepared. The preparation may also be emulsified. The active
immunogenic ingredient is often mixed with excipients that are
pharmaceutically acceptable and compatible with the active
ingredient. Suitable excipients are, for example, water, saline,
dextrose, glycerol, ethanol, or the like, and combinations thereof.
In addition, if desired, the vaccine may contain minor amounts of
auxiliary substances such as wetting or emulsifying agents, pH
buffering agents, or adjuvants which enhance the effectiveness of
the vaccines.
[0158] Vaccines may be conventionally administered parenterally, by
injection, for example, either subcutaneously or intramuscularly.
Additional formulations which are suitable for other modes of
administration include suppositories and, in some cases, oral
formulations. For suppositories, traditional binders and carriers
may include, for example, polyalkylene glycols or triglycerides:
such suppositories may be formed from mixtures containing the
active ingredient in the range of 0.5% to 10%, preferably 1-2%.
Oral formulations include such normally employed excipients as, for
example, pharmaceutical grades of mannitol, lactose, starch,
magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate and the like. These compositions take the form of
solutions, suspensions, tablets, pills, capsules, sustained release
formulations or powders and contain 10-95% of active ingredient,
preferably 25-70%.
[0159] The proteins or peptides may be formulated into the vaccine
as neutral or salt forms. Pharmaceutically acceptable salts,
include the acid addition salts (formed with the free amino groups
of the peptide) and those which are formed with inorganic acids
such as, for example, hydrochloric or phosphoric acids, or such
organic acids as acetic, oxalic, tartaric, mandelic, and the like.
Salts formed with the free carboxyl groups may also be derived from
inorganic bases such as, for example, sodium, potassium, ammonium,
calcium, or ferric hydroxides, and such organic bases as
isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine,
procaine, and the like.
[0160] The vaccines are administered in a manner compatible with
the dosage formulation, and in such amount as will be
therapeutically effective and immunogenic. The quantity to be
administered depends on the subject to be treated, including, e.g.,
the capacity of the individual's immune system to synthesize
antibodies, and the degree of protection desired. Precise amounts
of active ingredient required to be administered depend on the
judgment of the practitioner. However, suitable dosage ranges are
of the order of several hundred micrograms active ingredient per
vaccination. Suitable regimes for initial administration and
booster shots are also variable, but are typified by an initial
administration followed by subsequent inoculations or other
administrations.
[0161] The manner of application may be varied widely. Any of the
conventional methods for administration of a vaccine are
applicable. These are believed to include oral application on a
solid physiologically acceptable base or in a physiologically
acceptable dispersion, parenterally, by injection or the like. The
dosage of the vaccine will depend on the route of administration
and will vary according to the size of the host.
[0162] Various methods of achieving adjuvant effect for the vaccine
includes use of agents such as aluminum hydroxide or phosphate
(alum), commonly used as 0.05 to 0.1 percent solution in phosphate
buffered saline, admixture with synthetic polymers of sugars
(Carbopol) used as 0.25 percent solution, aggregation of the
protein in the vaccine by heat treatment with temperatures ranging
between 70.degree. to 101.degree. C. for 30 second to 2 minute
periods respectively. Aggregation by reactivating with pepsin
treated (Fab) antibodies to albumin, mixture with bacterial cells
such as C. parvum or endotoxins or lipopolysaccharide components of
gram-negative bacteria, emulsion in physiologically acceptable oil
vehicles such as mannide mono-oleate (Aracel A) or emulsion with 20
percent solution of a perfluorocarbon (Fluosol-DA) used as a block
substitute may also be employed.
[0163] In many instances, it will be desirable to have multiple
administrations of the vaccine, usually not exceeding six
vaccinations, more usually not exceeding four vaccinations and
preferably one or more, usually at least about three vaccinations.
The vaccinations will normally be at from two to twelve week
intervals, more usually from three to five week intervals. Periodic
boosters at intervals of 1-5 years, usually three years, will be
desirable to maintain protective levels of the antibodies. The
course of the immunization may be followed by assays for antibodies
for the supernatant antigens. The assays may be performed by
labeling with conventional labels, such as radionuclides, enzymes,
fluorescers, and the like. These techniques are well known and may
be found in a wide variety of patents, such as U.S. Pat. Nos.
3,791,932; 4,174,384 and 3,949,064, as illustrative of these types
of assays.
[0164] All of the compositions and methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the composition, methods and in the
steps or in the sequence of steps of the method described herein
without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
REFERENCES
[0165] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0166] Altschul et al., J. Mol. Biol. 215, 403 (1990).
[0167] Barbour, Yale J. Biol. Med. 57, 521 (1984).
[0168] Barbour and Fish, Science 260, 1610 (1993).
[0169] Barbour and Hayes, Microbiol. Rev. 50, 381 (1986).
[0170] Barbour et al., Infection and Immunity, 52, 549 (1986).
[0171] Berland, et al., Infect. Immun. (United States),
59(10):3531-35 (1991).
[0172] Berland et al., Infect. Immun. 59, 3531 (1991).
[0173] Bloemer et al., J. Med. Entomol. 27, 543 (1990).
[0174] Centers for Disease Control and Prevention, MMWR 39, 397
(1989).
[0175] Centers for Disease Control and Prevention, MMWR 40, 417
(1991).
[0176] Cooney and Burgdorfer. Am. J. Trop. Med. Hyg. 23, 99
(1974).
[0177] Donnell, Missouri Med 89, 714 (1992).
[0178] Felsenstein, Cladistics 5, 164 (1989).
[0179] Felsenstein, PHYLIP (Phylogeny Inference Package) version
3.5c (Department of Genetics, University of Washington, Seattle,
1993).
[0180] Hair and Bowman, in Morphology, Physiology, and Behavioral
Biology of Ticks, J. R. Sauer and J. A. Hair, Eds. (Ellis Horwood
Ltd., Chichester, U.K., 1986), chap. 18.
[0181] K. Hansen et al., J. Clin. Microbiol. 26, 338 (1988).
[0182] Kocan et al., J. Med. Entomol. 29, 630 (1992).
[0183] Koch and Dunn, Southwestern Entomologist 5, 214 (1980).
[0184] Masters, Postgrad. Med. 94, 133 (1993).
[0185] Mather, T. N. and Mather, M. E., J. Med. Entomol. 27, 646
(1990).
[0186] Maupin et al., 5th International Conference of Lyme
Borreliosis, Arlington, Va. 30 May to 2 June, 1992, p. A259.
[0187] Maupin et al., Am. J. Epidemiol. 133, 1105 (1991).
[0188] Mukolwe et al., J. Med. Entomol. 29(4):673:677 (1992).
[0189] Mukolwe et al., J. Med. Entomol. 29, 673 (1992).
[0190] Oliver et al., Proc. Natl. Acad. Sci., U.S.A.,
90(15):7371-7375, 1993.
[0191] Piesman and Sinsky, J. Med. Entomol. 25, 336 (1988).
[0192] Protein Fusion and Purification System, New England Biolabs
Technical Brochure, 1992.
[0193] Relman, J. Infect. Dis. 168, 1 (1993).
[0194] Ryder et al., J. Med. Entomol. 29, 525 (1992).
[0195] Sambrook et al. (1989). Molecular cloning: A laboratory
manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, N.Y.
[0196] Sanger et al. Proc. Natl. Acad. Sci. USA 74:5463-5467
(1977). Schulze et al., Science 224, 601 (1984).
[0197] Sigal and Curran, Annu. Rev. Public Health 12, 85
(1991).
[0198] U.S. Pat. No. 5,279,938-Rosa (1994).
[0199] W.P.I. Acc. No.: 92-041321/05-Barthhold, et al. (1992).
[0200] W.P.I. Acc. No.: 91-103941/15-Weisburg, W. G. (1991).
[0201] This Application is a continuation of prior co-pending U.S.
application Ser. No. 09/275,506, filed Mar. 24, 1999, which is a
divisional application of prior U.S. application Ser. No.
08/437,013 filed on May 8, 1995, now issued as U.S. Pat. No.
5,932,220.
Sequence CWU 1
1
28 1 641 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 1 acatattcag atgcagacag aggttctatt caaattgaaa
ttgaacaact tacagatgaa 60 attaacagag ttgctgatca ggctcaatac
aaccagatgc atatgttatc taacaaatca 120 tctgctcaaa atgtaaaaac
tgctgaagag cttggaatgc aacctgcaaa aattaataca 180 ccagcatcac
taactggagc acaagcttca tggacattga gagttcaggt aggtgcaaat 240
caggatgaag caattgctgt taatattttc tcaactaatg ttgcaaatct ttttggtgga
300 gaaggtgttc aagcggctcc agctcaagag ggtgcacaac aggagggagt
tcaaccagct 360 ccagctcaag gtgggattag ctctccaatt aatgttacaa
ctgctattga tgctaatgca 420 tcgcttacaa agattgaaga tgctattaga
atggtaactg atcaaagagc aaatcttggt 480 gctttccaaa atagacttga
gtctgttaaa gctagcacag attatgctat tgaaaactta 540 aaagcgtctt
atgctcaaat taaagatgca ataatgacag atgaaattgt agcatctaca 600
accaacagta ttttgacaca atctgcaatg gctatgattg c 641 2 213 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 2 Thr Tyr Ser Asp Ala Asp Arg Gly Ser Ile Gln Ile Glu Ile
Glu Gln 1 5 10 15 Leu Thr Asp Glu Ile Asn Arg Val Ala Asp Gln Ala
Gln Tyr Asn Gln 20 25 30 Met His Met Leu Ser Asn Lys Ser Ser Ala
Gln Asn Val Lys Thr Ala 35 40 45 Glu Glu Leu Gly Met Gln Pro Ala
Lys Ile Asn Thr Pro Ala Ser Leu 50 55 60 Thr Gly Ala Gln Ala Ser
Trp Thr Leu Arg Val Gln Val Gly Ala Asn 65 70 75 80 Gln Asp Glu Ala
Ile Ala Val Asn Ile Phe Ser Thr Asn Val Ala Asn 85 90 95 Leu Phe
Gly Gly Glu Gly Val Gln Ala Ala Pro Ala Gln Glu Gly Ala 100 105 110
Gln Gln Glu Gly Val Gln Pro Ala Pro Ala Gln Gly Gly Ile Ser Ser 115
120 125 Pro Ile Asn Val Thr Thr Ala Ile Asp Ala Asn Ala Ser Leu Thr
Lys 130 135 140 Ile Glu Asp Ala Ile Arg Met Val Thr Asp Gln Arg Ala
Asn Leu Gly 145 150 155 160 Ala Phe Gln Asn Arg Leu Glu Ser Val Lys
Ala Ser Thr Asp Tyr Ala 165 170 175 Ile Glu Asn Leu Lys Ala Ser Tyr
Ala Gln Ile Lys Asp Ala Ile Met 180 185 190 Thr Asp Glu Ile Val Ala
Ser Thr Thr Asn Ser Ile Leu Thr Gln Ser 195 200 205 Ala Met Ala Met
Ile 210 3 1336 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 3 ctggcagtgc gtcttaagca tgcaagtcag
acggaatgta gtaatacatt cagtggcgaa 60 cgggtgagta acgcgtggat
aatctgccta cgagatgggg ataactatta gaaataatag 120 ctaataccga
ataaagtcaa ttgagttgtt agttgatgaa aggaagcctt taaagcttcg 180
cttgtagatg agtctgcgtc ttattagcta gttggtaggg taagagccta ccaaggctat
240 gataagtaac cggcctgaga gggtgatcgg tcacactgga actgagatac
ggtccagact 300 cctacgggag gcagcagcta agaatcttcc gcaatgggcg
aaagcctgac ggagcgacac 360 tgcgtgaacg aagaaggtcg aaagattgta
aagttctttt ataaatgagg aataagcttt 420 gtaggaaatg acaaggtgat
gacgttaatt tatgaataag ccccggctaa ttacgtgcca 480 gcagccgcgg
taatacgtaa ggggcgagcg ttgttcggga tcattgggcg taaagggtga 540
gtaggcggat atgtaagtct atgtgtaaaa taccacggct caactgtgga actatgctag
600 aaactgcatg actagagtct gataggggaa gttagaattc ctggtgtaag
ggtggaatct 660 gttgatatca ggaagaatac cagaggcgaa agcgaacctc
taggtcaaga ctgacgctga 720 gtcacgaaag cgtagggagc aaacaggatt
agataccctg gtagtctacg ctgtaaacga 780 tgcacacttg gtgttaatcg
aaaggttagt accgaagcta acgtgttaag tgtgccgcct 840 ggggagtatg
ctcgcaagag tgaaactcaa aggaattgac gggggcccgc acaagcggtg 900
gagcatgtgg tttaattcga tgatacgcga ggaaccttac cagggcttga catatacagg
960 atatagttag agataactac tctccgtttg gggtctgtat acaggtgctg
catggttgtc 1020 gtcagctcgt gctgtgaggt gttgggttaa gtcccgcaac
gagcgcaacc cttgttgtct 1080 gttaccagca tgtaaagatg gggactcaga
cgagactgcc ggtgataagc cggaggaagg 1140 tgaggatgac gtcaaatcat
catggccctt atgtcctggg ctacacacgt gctacaatgg 1200 cctgtacaaa
gcgatgcgaa acagtgatgt gaagcaaaac gcataaagca ggtctcagtc 1260
cagattgaag tctgaaactc gacttcatga agttggaatc gctagtaatc gtatatcaga
1320 atgatacggt gaatac 1336 4 330 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 4 aactgctgaa
gagcttggaa tgcaacctgc aaaaattaat acaccagcat cactaactgg 60
agcacaagct tcatggacat tgagagttca ggtaggtgca aatcaggatg aagcaattgc
120 tgttaatatt ttctcaacta atgttgcaaa tctttttggt ggagaaggtg
ttcaagcggc 180 tccagctcaa gagggtgcac aacaggaggg agttcaacca
gctccagctc aaggtgggat 240 tagctctcca attaatgtta caactgctat
tgatgctaat gcatcgctta caaagattga 300 agatgctatt agaatggtaa
ctgatcaaag 330 5 4 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 5 Gly Val Gln Ala 1 6 9 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 6 tctgctcaa 9 7 12 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 7 ggtgttcaag cg 12 8 12 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 8 gttcaaccag ct 12 9 22 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 9 aacagctgaa gagcttggaa tg
22 10 26 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 10 cgataatctt actattcact agtttc 26 11 24 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 11 acatattcag atgcagacag aggt 24 12 24 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 12
tgttagacgt taccgttact aacg 24 13 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 13 ctggcagtgc
gtcttaagca 20 14 25 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 14 catatagtct tactatgcca cttag
25 15 31 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 15 Leu Arg Val Gln Val Gly Ala Asn Gln Asp Glu
Ala Ile Ala Val Asn 1 5 10 15 Ile Phe Ser Thr Asn Val Ala Asn Leu
Phe Gly Gly Glu Gly Val 20 25 30 16 16 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 16 Gln Ala Ala
Pro Ala Gln Glu Gly Ala Gln Gln Glu Gly Val Gln Pro 1 5 10 15 17 20
PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 17 Ala Pro Ala Gln Gly Gly Ile Ser Ser Pro Ile
Asn Val Thr Thr Ala 1 5 10 15 Ile Asp Ala Asn 20 18 7 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 18 Ala Ala Pro Ala Pro Ala Ala 1 5 19 7 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 19
Ala Thr Pro Ala Pro Val Ala 1 5 20 7 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 20 Ala Ala Pro
Ala Pro Ala Ser 1 5 21 4 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 21 Ala Gln Ala Ala 1 22 5 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 22 Pro Thr Pro Ala Thr 1 5 23 5 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 23 Pro Ala Pro
Val Thr 1 5 24 4 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 24 Ala Gln Thr Ala 1 25 5 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 25
Pro Ala Pro Ala Thr 1 5 26 709 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 26 aacaacaacc tcgggatcga
gggaaggatt tcagaattca catattcaga tgcagacaga 60 ggttctattc
aaattgaaat tgaacaactt acagatgaaa ttaacagagt tgctgatcag 120
gctcaataca accagatgca tatgttatct aacaaatcat ctgctcaaaa tgtaaaaact
180 gctgaagagc ttggaatgca acctgcaaaa attaatacac cagcatcact
aactggagca 240 caagcttcat ggacattgag agttcaggta ggtgcaaatc
aggatgaagc aattgctgtt 300 aatattttct caactaatgt tgcaaatctt
tttggtggag aaggtgttca agcggctcca 360 gctcaagagg gtgcacaaca
ggaaggagtt caaccagctc cagctcaagg tgggattagc 420 tctccaatta
atgttacaac tgctattgat gctaatgcat cgcttacaaa gattgaagat 480
gctattagaa tggtaactga tcaaagagca aatcttggtg ctttccaaaa tagacttgag
540 tctgttaaag ctagcacaga ttatgctatt gaaaacttaa aagcgtctta
tcgtcaaatt 600 aaagatgcaa taatgacaga tgaaattgta gcatctacaa
ccaacagtat tttgacacaa 660 tctgcaatgg ctatgattgc agtctagagt
cgacctgcag gcaagcttg 709 27 4 PRT Artificial Sequence Description
of Artificial Sequence Synthetic Peptide 27 Ile Ser Glu Phe 1 28
641 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 28 acatattcag atgcagacag aggttctatt caaattgaaa
ttgaacaact tacagatgaa 60 attaacagag ttgctgatca ggctcaatac
aaccagatgc atatgttatc taacaaatca 120 tctgctcaaa atgtaaaaac
tgctgaagag cttggaatgc aacctgcaaa aattaataca 180 ccagcatcac
taactggagc acaagcttca tggacattga gagttcaggt aggtgcaaat 240
caggatgaag caattgctgt taatattttc tcaactaatg ttgcaaatct ttttggtgga
300 gaaggtgttc aagcggctcc agctcaagag ggtgcacaac aggaaggagt
tcaaccagct 360 ccagctcaag gtgggattag ctctccaatt aatgttacaa
ctgctattga tgctaatgca 420 tcgcttacaa agattgaaga tgctattaga
atggtaactg atcaaagagc aaatcttggt 480 gctttccaaa atagacttga
gtctgttaaa gctagcacag attatgctat tgaaaactta 540 aaagcgtctt
atgctcaaat taaagatgca ataatgacag atgaaattgt agcatctaca 600
accaacagta ttttgacaca atctgcaatg gctatgatgg c 641
* * * * *