U.S. patent application number 11/021016 was filed with the patent office on 2005-08-11 for polymearase iii-based expression of therapeutic rnas.
This patent application is currently assigned to Sirna Theraputics, Inc.. Invention is credited to Thompson, James D..
Application Number | 20050176038 11/021016 |
Document ID | / |
Family ID | 34108733 |
Filed Date | 2005-08-11 |
United States Patent
Application |
20050176038 |
Kind Code |
A1 |
Thompson, James D. |
August 11, 2005 |
Polymearase III-based expression of therapeutic RNAs
Abstract
A transcribed non-naturally occurring RNA molecule comprising a
desired 10 RNA molecule, wherein the 3+ region of the RNA is able
to base-pair with at least 8 bases at the 5' terminus of the same
RNA molecule.
Inventors: |
Thompson, James D.;
(Lafayette, CO) |
Correspondence
Address: |
MCDONNELL BOEHNEN HULBERT & BERGHOFF LLP
300 S. WACKER DRIVE
32ND FLOOR
CHICAGO
IL
60606
US
|
Assignee: |
Sirna Theraputics, Inc.
Boulder
CO
|
Family ID: |
34108733 |
Appl. No.: |
11/021016 |
Filed: |
December 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11021016 |
Dec 23, 2004 |
|
|
|
09630846 |
Aug 2, 2000 |
|
|
|
6852535 |
|
|
|
|
09630846 |
Aug 2, 2000 |
|
|
|
08512861 |
Aug 7, 1995 |
|
|
|
6146886 |
|
|
|
|
08512861 |
Aug 7, 1995 |
|
|
|
08293520 |
Aug 19, 1994 |
|
|
|
08512861 |
Aug 7, 1995 |
|
|
|
08337608 |
Nov 10, 1994 |
|
|
|
5902880 |
|
|
|
|
Current U.S.
Class: |
435/6.13 ;
536/23.1 |
Current CPC
Class: |
C12N 15/1138 20130101;
C12N 2310/123 20130101; C12N 2310/33 20130101; C12N 2310/126
20130101; C12N 2310/346 20130101; C12N 2310/3527 20130101; C12Y
304/24017 20130101; C12N 15/1131 20130101; C12N 2310/111 20130101;
C12N 2310/122 20130101; C12N 2310/336 20130101; C12N 2310/3523
20130101; C12N 2310/32 20130101; C12N 2310/321 20130101; C07H 21/00
20130101; C12N 15/1137 20130101; A61K 38/00 20130101; C07H 19/10
20130101; C07H 19/20 20130101; C12N 2310/3533 20130101; C12N
2310/3521 20130101; C07H 19/06 20130101; C12N 2310/121 20130101;
C12N 15/113 20130101; A61K 48/00 20130101; C12N 2310/315 20130101;
C12N 2310/321 20130101; C12N 2310/335 20130101; C12N 15/101
20130101; C12N 2310/1241 20130101; C12N 2310/3535 20130101; C12N
15/1136 20130101; C12N 2310/322 20130101; C12N 2310/332 20130101;
C12N 2310/333 20130101; C12N 2310/334 20130101; C12N 2310/127
20130101; C12N 2310/3513 20130101; C07H 19/16 20130101 |
Class at
Publication: |
435/006 ;
536/023.1 |
International
Class: |
C12Q 001/68; C07H
021/02 |
Claims
1. A transcribed non-naturally occurring RNA molecule having
hairpin structure, comprising a desired RNA portion, wherein said
desired RNA portion is present between a 3' region and 5' region,
wherein said 3' region and said 5' region form an intramolecular
stem with each other comprising at least 8 base pairs.
2. The RNA molecule of claim 1, wherein said RNA molecule is
transcribed by a RNA polymerase III based promoter system.
3. The RNA molecule of claim 1, wherein said RNA molecule is
transcribed by a type 2 pol III promoter system.
4. The RNA molecule of claim 1, wherein said RNA molecule is a
chimeric tRNA.
5. The RNA molecule of claim 3, wherein said RNA molecule has A and
B boxes of a type 2 pol III promoter separated by between 0 and 300
bases.
6. The RNA molecule of claim 5, wherein said desired RNA portion is
at the 3' end of said B box of said RNA molecule.
7. The RNA molecule of claim 5, wherein said desired RNA portion is
in between said A and said B box of said RNA molecule.
8. The RNA molecule of claim 5, wherein said desired RNA portion
includes said B box of said RNA molecule.
9. The RNA molecule of claim 1, wherein said desired RNA portion is
selected from the group consisting of antisense RNA, decoy RNA,
therapeutic editing RNA, enzymatic RNA, agonist RNA and antagonist
RNA.
10. The RNA molecule of claim 1, wherein said 5' region of said RNA
molecule is able to base-pair with at least 12 bases of said 3'
region.
11. The RNA molecule of claim 1, wherein the 5' region of said RNA
molecule is able to base-pair with at least 15 bases of said 3'
region.
12. A DNA vector encoding the RNA molecule of claim 1.
13. A RNA vector encoding the RNA molecule of claim 1.
14. The DNA vector of claim 12 wherein the portions of the DNA
vector encoding said RNA molecule function as a RNA pol III
promoter.
15. A cell comprising the vector of claim 12.
16. A cell comprising the vector of claim 13.
17. A cell comprising the RNA of claim 1.
18. A method to provide a desired first RNA molecule having hairpin
structure in a cell, comprising introducing into said cell a second
RNA molecule comprising a 5' region, a 3' region, and said desired
first RNA molecule, wherein said 5' terminus is able to base pair
with at least 8 bases of said 3' region, and wherein said desired
first RNA molecule is present between the bases of the 3' region
and the 5' terminus capable of base pairing in the second RNA
molecule under conditions suitable to provide the desired first RNA
molecule in the cell.
19. The method of claim 18, wherein the introduction of the second
RNA molecule comprises providing a vector encoding said second RNA
molecule.
20. The RNA molecule of claim 1, wherein said RNA molecule is
transcribed by a RNA polymerase II promoter system.
21. The RNA molecule of claim 1, wherein said RNA molecule is
transcribed by a U6 small nuclear RNA promoter system.
22. The RNA molecule of claim 1, wherein said RNA molecule is
transcribed by an adenovirus VA1 RNA promoter system.
23. The RNA molecule of claim 1, wherein said RNA molecule is a
chimeric adenovirus VA1 RNA.
24. The RNA molecule of claim 1, wherein said intramolecular stem
is separated from said desired RNA portion by spacer sequence.
25. The RNA molecule of claim 24, wherein said spacer sequence is
about 5-50 nucleotides.
Description
[0001] This application is a continuation-in-part of James
Thompson, "Improved RNA Polymerase III-Based Expression of
Therapeutic RNAS", U.S. Ser. No. 08/293,520, filed Aug. 19, 1994,
and James Thompson, "Improved RNA Polymerase III-Based Expression
of Therapeutic RNAS", U.S. Ser. No. 08/337,608, filed Nov. 10,
1994, hereby incorporated by reference herein.
BACKGROUND OF THE INVENTION
[0002] This invention relates to RNA polymerase III-based methods
and systems for expression of therapeutic RNAs in cells in vivo or
in vitro.
[0003] The RNA polymerase III (pol III) promoter is one found in
DNA encoding 5S, U6, adenovirus VA1, Vault, telomerase RNA, tRNA
genes, etc., and is transcribed by RNA polymerase III (for a review
see Geiduschek and Tocchini-Valentini, 1988 Annu. Rev. Biochem. 57,
873-914; Willis, 1993 Eur. J. Biochem. 212, 1-11). There are three
major types of pol III promoters: types 1, 2 and 3 (Geiduschek and
Tocchini-Valentini, 1988 supra; Willis, 1993 supra) (see FIG. 1).
Type 1 pol III promoter consists of three cis-acting sequence
elements downstream of the transcriptional start site a) 5'
sequence element (A block); b) an intermediate sequence element (I
block); c) 3' sequence element (C block). 5S ribosomal RNA genes
are transcribed using the type 1 pol III promoter (Specht et al.,
1991 Nucleic Acids Res. 19, 2189-2191.
[0004] The type 2 pol III promoter is characterized by the presence
of two cis-acting sequence elements downstream of the transcription
start site. All Transfer RNA (tRNA), adenovirus VA RNA and Vault
RNA (Kikhoefer et al., 1993, J. Biol. Chem. 268, 7868-7873) genes
are transcribed using this promoter (Geiduschek and
Tocchini-Valentini, 1988 supra; Willis, 1993 supra). The sequence
composition and orientation of the two cis-acting sequence
elements--A box (5' sequence element) and B box (3' sequence
element) are essential for optimal transcription by RNA polymerase
III.
[0005] The type 3 pol III promoter contains all of the cis-acting
promoter elements upstream of the transcription start site.
Upstream sequence elements include a traditional TATA box (Mattaj
et al., 1988 Cell 55, 435-442), proximal sequence element (PSE) and
a distal sequence element (DSE; Gupta and Reddy, 1991 Nucleic Acids
Res. 19, 2073-2075). Examples of genes under the control of the
type 3 pol III promoter are U6 small nuclear RNA (U6 snRNA) and
Telomerase RNA genes.
[0006] In addition to the three predominant types of pol III
promoters described above, several other pol III promoter elements
have been reported (Willis, 1993 supra) (see FIG. 1).
Epstein-Barr-virus-encoded RNAs (EBER), Xenopus seleno-cysteine
tRNA and human 7SL RNA are examples of genes that are under the
control of pol III promoters distinct from the aforementioned types
of promoters. EBER genes contain a functional A and B box (similar
to type 2 pol III promoter). In addition they also require an
EBER-specific TATA box and binding sites for ATF transcription
factors (Howe and Shu, 1989 Cell 57, 825-834). The seleno-cysteine
tRNA gene contains a TATA box, PSE and DSE (similar to type 3 pol
III promoter). Unlike most tRNA genes, the seleno-cysteine tRNA
gene lacks a functional A box sequence element. It does require a
functional B box (Lee et al., 1989 J. Biol. Chem. 264, 9696-9702).
The human 7SL RNA gene contains an unique sequence element
downstream of the transcriptional start site. Additionally,
upstream of the transcriptional start site, the 7SL gene contains
binding sites for ATF class of transcription factors and a DSE
(Bredow et al., 1989 Gene 86, 217-225).
[0007] Gilboa WO 89/11539 and Gilboa and Sullenger WO 90/13641
describe transformation of eucaryotic cells with DNA under the
control of a pol III promoter. They state:
[0008] In an attempt to improve antisense RNA synthesis using
stable gene transfer protocols, the use of pol III promoters to
drive the expression of antisense RNA can be considered. The
underlying rationale for the use of pol III promoters is that they
can generate substantially higher levels of RNA transcripts in
cells as compared to pol II promoters. For example, it is estimated
that in a eucaryotic cell there are about 6.times.10.sup.7 t-RNA
molecules and 7.times.10.sup.5 mRNA molecules, i.e., about 100 fold
more pol III transcripts of this class than total pol II
transcripts. Since there are about 100 active t-RNA genes per cell,
each t-RNA gene will generate on the average RNA transcripts equal
in number to total pol II transcripts. Since an abundant pol II
gene transcript represents about 1% of total mRNA while an average
pol II transcript represents about 0.01% of total mRNA, a t-RNA
(pol III) based transcriptional unit may be able to generate 100
fold to 10,000 fold more RNA than a pol II based transcriptional
unit. Several reports have described the use of pol III promoters
to express RNA in eucaryotic cells. Lewis and Manley and Sisodia
have fused the Adenovirus VA-1 promoter to various DNA sequences
(the herpes TK gene, globin and tubulin) and used transfection
protocols to transfer the resulting DNA constructs into cultured
cells which resulted in transient synthesis of RNA in the
transduced cell. De la Pena and Zasloff have expressed a
t-RNA-Herpes TK fusion DNA construct upon microinjection into frog
oocytes. Jennings and Molloy have constructed an antisense RNA
template by fusing the VA-1 gene promoter to a DNA fragment derived
from SV40 based vector which also resulted in transient expression
of antisense RNA and limited inhibition of the target gene".
[Citations omitted.]
[0009] The authors describe a fusion product of a chimeric tRNA and
an RNA product (see FIG. 1C of WO 90/13641). In particular they
describe a human tRNA met.sub.i derivative 3-5. 3-5 was derived
from a cloned human tRNA gene by deleting 19 nucleotides from the
3' end of the gene. The authors indicate that the truncated gene
can be transcribed if a termination signal is provided, but that no
processing of the 3' end of the RNA transcript takes place.
[0010] Adeniyi-Jones et al.,1984 Nucleic Acids Res. 12, 1101-1115,
describe certain constructions which "may serve as the basis for
utilizing the tRNA gene as a `portable promoter` in engineered
genetic constructions." The authors describe the production of a
so-called .DELTA.3'-5 in which 11 nucleotides of the 3'-end of the
mature tRNA.sub.i.sup.met sequence are replaced by a plasmid
sequence, and are not processed to generate a mature tRNA. The
authors state:
[0011] "the properties of the tRNA.sub.i.sup.met 3' deletion
plasmids described in this study suggest their potential use in
certain engineered genetic constructions. The tRNA gene could be
used to promote transcription of theoretically any DNA sequence
fused to the 3' border of the gene, generating a fusion gene which
would utilize the efficient polymerase III promoter of the human
tRNA.sub.i.sup.met gene. By fusion of the DNA sequence to a
tRNA.sub.i.sup.met deletion mutant such as .DELTA.3'-4, a long
read-through transcript would be generated in vivo (dependent, of
course, on the absence of effective RNA polymerase III termination
sequences). Fusion of the DNA sequence to a tRNA.sub.i.sup.met
deletion mutant such as .DELTA.3'-5 would lead to the generation of
a co-transcript from which subsequent processing of the tRNA leader
at the 5' portion of the fused transcript would be blocked. Control
over processing may be of some biological use in engineered
constructions, as suggested by properties of mRNA species bearing
tRNA sequences as 5' leaders in prokaryotes. Such "dual
transcripts" code for several predominant bacterial proteins such
as EF-Tu and may use the tRNA leaders as a means of stabilizing the
transcript from degradation in vivo. The potential use of the
tRNA.sub.i.sup.met gene as a "promoter leader" in eukaryotic
systems has been realized recently in our laboratory. Fusion genes
consisting of the deleted tRNA.sub.i.sup.met sequences contained on
plasmids .DELTA. 3'-4 and .DELTA. 3'-5 in front of a promoter-less
Herpes simplex type I thymidine kinase gene yield viral-specific
enzyme resulting from RNA polymerase Ill dependent transcription in
both X. laevis oocytes and somatic cells". [References
omitted].
[0012] Sullenger et al., 1990 Cell 63, 601-619, describe
over-expression of TAR-containing sequences using a chimeric
tRNA.sub.i.sup.met-TAR transcription unit in a double copy (DC)
murine retroviral vector.
[0013] Sullenger et al., 1990 Molecular and Cellular Bio. 10, 6512,
describe expression of chimeric tRNA driven antisense transcripts.
It indicates:
[0014] "successful use of a tRNA-driven antisense RNA transcription
system was dependent on the use of a particular type of retroviral
vector, the double-copy (DC) vector, in which the chimeric tRNA
gene was inserted in the viral LTR. The use of an RNA pol III-based
transcription system to stably express high levels of foreign RNA
sequences in cells may have other important applications. Foremost,
it may significantly improve the ability to inhibit endogenous
genes in eucaryotic cells for the study of gene expression and
function, whether antisense RNA, ribozymes, or competitors of
sequence-specific binding factors are used. tRNA-driven
transcription systems may be particularly useful for introducing
"mutations" into the germ line, i.e., for generating transgenic
animals or transgenic plants. Since tRNA genes are ubiquitously
expressed in all cell types, the chimeric tRNA genes may be
properly expressed in all tissues of the animal, in contrast to the
more idiosyncratic behavior of RNA pol II-based transcription
units. However, homologous recombination represents a more elegant
although, at present, very cumbersome approach for introducing
mutations into the germ line. In either case, the ability to
generate transgenic animals or plants carrying defined mutations
will be an extremely valuable experimental tool for studying gene
function in a developmental context and for generating animal
models for human genetic disorders. In addition, tRNA-driven gene
inhibition strategies may also be useful in creating
pathogen-resistant livestock and plants. [References omitted.]
[0015] Cotten and Birnstiel,1989 EMBO Jrnl. 8, 3861, describe the
use of tRNA genes to increase intracellular levels of ribozymes.
The authors indicate that the ribozyme coding sequences were placed
between the A and the B box internal promoter sequences of the
Xenopus tRNA.sup.met gene. They also indicate that the targeted
hammerhead ribozymes were active in vivo.
[0016] Yu et al., 1993 Proc. Natl. Acad. Sci. USA 90, 5340,
describe the use of a VAI promoter to express a hairpin ribozyme.
The resulting transcript consisted of the first 104 nucleotides of
the VAI RNA, followed by the ribozyme sequence and the terminator
sequence.
[0017] Lieber and Strauss, 1995 Mol. Cellular Bio. 15, 540,
inserted a hammerhead ribozyme sequence in the central domain of a
VAI RNA.
SUMMARY OF THE INVENTION
[0018] Applicant has determined that the level of production of a
foreign RNA, using a RNA polymerase III (pol III) based system, can
be significantly enhanced by ensuring that the RNA is produced with
the 5' terminus and a 3' region of the RNA molecule base-paired
together to form a stable intramolecular stem structure. This stem
structure is formed by hydrogen bond interactions (either
Watson-Crick or non-Watson-Crick) between nucleotides in the 3'
region (at least 8 bases) and complementary nucleotides in the 5'
terminus of the same RNA molecule.
[0019] Although the example provided below involves a type 2 pol
III gene unit, a number of other pol III promoter systems can also
be used, for example, tRNA (Hall et al., 1982 Cell 29, 3-5), 5S RNA
(Nielsen et al., 1993, Nucleic Acids Res. 21, 3631-3636),
adenovirus VA RNA (Fowlkes and Shenk, 1980 Cell 22, 405-413), U6
snRNA (Gupta and Reddy, 1990 Nucleic Acids Res. 19, 2073-2075),
vault RNA (Kickoefer et al., 1993 J. Biol. Chem. 268, 7868-7873),
telomerase RNA (Romero and Blackburn, 1991 Cell 67, 343-353), and
others.
[0020] The construct described in this invention is able to
accumulate RNA to a significantly higher level than other
constructs, even those in which 5' and 3' ends are involved in
hairpin loops. Using such a construct the level of expression of a
foreign RNA can be increased to between 20,000 and 50,000 copies
per cell. This makes such constructs, and the vectors encoding such
constructs, excellent for use in decoy, therapeutic editing and
antisense protocols as well as for ribozyme formation. In addition,
the molecules can be used as agonist or antagonist RNAs (affinity
RNAS). Generally, applicant believes that the intramolecular
base-paired interaction between the 5' terminus and the 3' region
of the RNA should be in a double-stranded structure in order to
achieve enhanced RNA accumulation.
[0021] Thus, in one preferred embodiment the invention features a
pol III promoter system (e.g., a type 2 system) used to synthesize
a chimeric RNA molecule which includes tRNA sequences and a desired
RNA (e.g., a tRNA-based molecule).
[0022] The following exemplifies this invention with a type 2 pol
III promoter and a tRNA gene. Specifically to illustrate the broad
invention, the RNA molecule in the following example has an A box
and a B box of the type 2 pol III promoter system and has a 5'
terminus or region able to base-pair with at least 8 bases of a
complementary 3' end or region of the same RNA molecule. This is
meant to be a specific example. Those in the art will recognize
that this is but one example, and other embodiments can be readily
generated using other pol III promoter systems and techniques
generally known in the art.
[0023] By "terminus" is meant the terminal bases of an RNA
molecule, ending in a 3' hydroxyl or 5' phosphate or 5' cap moiety.
By "region" is meant a stretch of bases 5' or 3' from the terminus
that are involved in base-paired interactions. It need not be
adjacent to the end of the RNA. Applicant has determined that base
pairing of at least one end of the RNA molecule with a region not
more than about 50 bases, and preferably only 20 bases, from the
other end of the molecule provides a useful molecule able to be
expressed at high levels.
[0024] By "3' region" is meant a stretch of bases 3' from the
terminus that are involved in intramolecular base-paired
interaction with complementary nucleotides in the 5' terminus of
the same molecule. The 3' region can be designed to include the 3'
terminus. The 3' region therefore is .gtoreq.0 nucleotides from the
3' terminus. For example, in the S35 construct described in the
present invention (FIG. 7) the 3' region is one nucleotide from the
3' terminus. In another example, the 3' region is .about.43 nt from
3' terminus. These examples are not meant to be limiting. Those in
the art will recognize that other embodiments can be readily
generated using techniques generally known in the art. Generally,
it is preferred to have the 3' region within 100 bases of the 3'
terminus.
[0025] By "tRNA molecule" is meant a type 2 pol III driven RNA
molecule that is generally derived from any recognized tRNA gene.
Those in the art will recognize that DNA encoding such molecules is
readily available and can be modified as desired to alter one or
more bases within the DNA encoding the RNA molecule and/or the
promoter system. Generally, but not always, such molecules include
an A box and a B box that consist of sequences which are well known
in the art (and examples of which can be found throughout the
literature). These A and B boxes have a certain consensus sequence
which is essential for a optimal pol III transcription.
[0026] By "chimeric tRNA molecule" is meant a RNA molecule that
includes a pol III promoter (type 2) region. A chimeric tRNA
molecule, for example, might contain an intramolecular base-paired
structure between the 3' region and complementary 5' terminus of
the molecule, and includes a foreign RNA sequence at any location
within the molecule which does not affect the activity of the type
2 pol III promoter boxes. Thus, such a foreign RNA may be provided
at the 3' end of the B box, or may be provided in between the A and
the B box, with the B box moved to an appropriate location either
within the foreign RNA or another location such that it is
effective to provide pol III transcription. In one example, the RNA
molecule may include a hammerhead ribozyme with the B box of a type
2 pol III promoter provided in stem II of the ribozyme. In a second
example, the B box may be provided in stem IV region of a hairpin
ribozyme. A specific example of such RNA molecules is provided
below. Those in the art will recognize that this is but one
example, and other embodiments can be readily generated using
techniques generally known in the art.
[0027] By "desired RNA" molecule is meant any foreign RNA molecule
which is useful from a therapeutic, diagnostic, or other viewpoint.
Such molecules include antisense RNA molecules, decoy RNA
molecules, enzymatic RNA, therapeutic editing RNA (Woolf and
Stinchcomb, "Oligomer directed In situ reversion (ISR) of genetic
mutations", filed Jul. 6, 1994, U.S. Ser. No. 08/271,280, hereby
incorporated by reference) and agonist and antagonist RNA.
[0028] By "antisense RNA" is meant a non-enzymatic RNA molecule
that binds to another RNA (target RNA) by means of RNA-RNA
interactions and alters the activity of the target RNA (Eguchi et
al., 1991 Annu. Rev. Biochem. 60, 631-652). By "enzymatic RNA" is
meant an RNA molecule with enzymatic activity (Cech, 1988 J.
American. Med. Assoc. 260, 3030-3035). Enzymatic nucleic acids
(ribozymes) act by first binding to a target RNA. Such binding
occurs through the target binding portion of a enzymatic nucleic
acid which is held in close proximity to an enzymatic portion of
the molecule that acts to cleave the target RNA. Thus, the
enzymatic nucleic acid first recognizes and then binds a target RNA
through base-pairing, and once bound to the correct site, acts
enzymatically to cut the target RNA.
[0029] By "decoy RNA" is meant an RNA molecule that mimics the
natural binding domain for a ligand. The decoy RNA therefore
competes with natural binding target for the binding of a specific
ligand. For example, it has been shown that over-expression of HIV
trans-activation response (TAR) RNA can act as a "decoy" and
efficiently binds HIV tat protein, thereby preventing it from
binding to TAR sequences encoded in the HIV RNA (Sullenger et al.,
1990 Cell 63, 601-608). This is meant to be a specific example.
Those in the art will recognize that this is but one example, and
other embodiments can be readily generated using techniques
generally known in the art.
[0030] By "therapeutic editing RNA" is meant an antisense RNA that
can bind to its cellular target (RNA or DNA) and mediate the
modification of a specific base (Woolf and Stinchcomb, supra).
[0031] By "agonist RNA" is meant an RNA molecule that can bind to
protein receptors with high affinity and cause the stimulation of
specific cellular pathways.
[0032] By "antagonist RNA" is meant an RNA molecule that can bind
to cellular proteins and prevent it from performing its normal
biological function (for example, see Tsai et al., 1992 Proc. Natl.
Acad. Sci. USA 89, 8864-8868).
[0033] By "complementary" is meant a RNA sequence that can form
hydrogen bond(s) with other RNA sequence by either traditional
Watson-Crick or other non-traditional types (for example, Hoogsteen
type) of base-pairing interaction.
[0034] In other aspects, the invention includes vectors encoding
RNA molecules as described above, cells including such vectors,
methods for producing the desired RNA, and use of the vectors and
cells to produce this RNA.
[0035] By "vectors" is meant any nucleic acid- and/or viral-based
technique used to deliver a desired nucleic acid.
[0036] Thus, the invention features a transcribed non-naturally
occuring RNA molecule which includes a desired therapeutic RNA
portion and an intramolecular stem formed by base-pairing
interactions between a 3' region and complementary nucleotides at
the 5' terminus in the RNA. The stem preferably includes at least 8
base pairs, but may have more, for example, 15 or 16 base
pairs.
[0037] In preferred embodiments, the 5' terminus of the chimeric
tRNA includes a portion of the precursor molecule of the primary
tRNA molecule, of which .gtoreq.8 nucleotides are involved in
base-pairing interaction with the 3' region; the chimeric tRNA
contains A and B boxes; natural sequences 3' of the B box are
deleted, which prevents endogenous RNA processing; the desired RNA
molecule is at the 3' end of the B box; the desired RNA molecule is
between the A and the B box; the desired RNA molecule includes the
B box; the desired RNA molecule is selected from the group
consisting of antisense RNA, decoy RNA, therapeutic editing RNA,
enzymatic RNA, agonist RNA and antagonist RNA; the molecule has an
intramolecular stem resulting from a base-paired interaction
between the 5' terminus of the RNA and a complementary 3' region
within the same RNA, and includes at least 8 bases; and the 5'
terminus is able to base pair with at least 15 bases of the 3'
region.
[0038] In most preferred embodiments, the molecule is transcribed
by a RNA polymerase III based promoter system, e.g., a type 2 pol
III promoter system; the molecule is a chimeric tRNA, and may have
the A and B boxes of a type 2 pol III promoter separated by between
0 and 300 bases; DNA vector encoding the RNA molecule of claim
1.
[0039] In other related aspects, the invention features an RNA or
DNA vector encoding the above RNA molecule, with the portions of
the vector encoding the RNA functioning as a RNA pol III promoter;
or a cell containing the vector; or a method to provide a desired
RNA molecule in a cell, by introducing the molecule into a cell
with an RNA molecule as described above. The cells can be derived
from animals, plants or human beings.
[0040] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0041] The drawings will first briefly be described.
DRAWINGS
[0042] FIG. 1. Schematic representation of RNA polymerse III
promoter structure. Arrow indicates the transcription start site
and the direction of coding region. A, B and C, refer to consensus
A, B and C box promoter sequences. I, refers to intermediate
cis-acting promoter sequence. PSE, refers to proximal sequence
element. DSE, refers to distal sequence element. ATF, refers to
activating transcription factor binding element. ?, refers to
cis-acting sequence element that has not been fully characterized.
EBER, Epstein-Barr-virus-encoded-RNA. TATA is a box well known in
the art.
[0043] FIG. 2. Sequence of the primary tRNA.sub.i.sup.met and
.DELTA.3-5 transcripts. The A and B box are internal promoter
regions necessary for pol III transcription. Arrows indicate the
sites of endogenous tRNA processing. The .DELTA.3-5 transcript is a
truncated version of tRNA wherein the sequence 3' of B box has been
deleted (Adeniyi-Jones et al., 1984 supra). This modification
renders the .DELTA. 3-5 RNA resistant to endogenous tRNA
processing.
[0044] FIG. 3. Schematic representation of RNA structural motifs
inserted into the .DELTA.3-5 RNA. .DELTA.3-5/HHI--a hammerhead
(HHI) ribozyme was cloned at the 3' region of .DELTA.3-5 RNA; S3--a
stable stem-loop structure was incorporated at the 3' end of the
.DELTA.3-5/HHI chimera; S5--stable stem-loop structures were
incorporated at the 5' and the 3' ends of .DELTA.3-5/HHI ribozyme
chimera; S35--sequence at the 3' end of the .DELTA.3-5/HHI ribozyme
chimera was altered to enable duplex formation between the 5' end
and a complementary 3' region of the same RNA; S35Plus--in addition
to structural alterations of S35, sequences were altered to
facilitate additional duplex formation within the non-ribozyme
sequence of the .DELTA.3-5/HHI chimera.
[0045] FIG. 4. Northern analysis to quantitate ribozyme expression
in T cell lines transduced with .DELTA.3-5 vectors. A)
.DELTA.3-5/HHI and its variants were cloned individually into the
DC retroviral vector (Sullenger et al., 1990 supra). Northern
analysis of ribozyme chimeras expressed in MT-2 cells was
performed. Total RNA was isolated from cells (Chomczynski &
Sacchi, 1987 Analytical Biochemistry 162, 156-159), and transduced
with various constructs described in FIG. 3. Northern analysis was
carried out using standard protocols (Curr. Protocols Mol. Biol.
1992, ed. Ausubel et al., Wiley & Sons, New York). Nomenclature
is same as in FIG. 3. This assay measures the level of expression
from the type 2 pol III promoter. B) Expression of S35 constructs
in MT2 cells. S35 (+ribozyme), S35 construct containing HHI
ribozyme. S35 (-ribozyme), S35 construct containing no
ribozyme.
[0046] FIG. 5. Ribozyme activity in total RNA extracted from
transduced MT-2 cells. Total RNA was isolated from cells transduced
with .DELTA.3-5 constructs described in FIG. 4. In a standard
ribozyme cleavage reaction, 5 .mu.g total RNA and trace amounts of
5' terminus-labeled ribozyme target RNA were denatured separately
by heating to 90.degree. C. for 2 min in the presence of 50 mM
Tris-HCl, pH 7.5 and 10 mM MgCl.sub.2. RNAs were renatured by
cooling the reaction mixture to 37.degree. C. for 10-15 min.
Cleavage reaction was initiated by mixing the labeled substrate RNA
and total cellular RNA at 37.degree. C. The reaction was allowed to
proceed for .about.18 h, following which the samples were resolved
on a 20% urea-polyacrylamide gel. Bands were visualized by
autoradiography.
[0047] FIG. 6. Ribozyme expression and activity levels in
S35-transduced clonal CEM cell lines. A) Northern analysis of
S35-transduced clonal CEM cell lines. Standard curve was generated
by spiking known concentrations of in vitro transcribed S5 RNA into
total cellular RNA isolated from non-transduced CEM cells. Pool,
contains RNA from pooled cells transduced with S35 construct. Pool
(-G418 for 3 Mo), contains RNA from pooled cells that were
initially selected for resistance to G418 and then grown in the
absence of G418 for 3 months. Lanes A through N contain RNA from
individual clones that were generated from the pooled cells
transduced with S35 construct. tRNA.sub.i.sup.met, refers to the
endogenous tRNA. S35, refers to the position of the ribozyme band.
M, marker lane. B) Activity levels in S35-transduced clonal CEM
cell lines. RNA isolation and cleavage reactions were as described
in FIG. 5. Nomenclature is same as in FIG. 6A except, S, 5'
terminus-labeled substrate RNA. P, 8 nt 5' terminus-labeled
ribozyme-mediated RNA cleavage product.
[0048] FIGS. 7 and 8 are proposed secondary structures of S35 and
S35 containing a desired RNA (HHI), respectively. The position of
HHI ribozyme is indicated in FIG. 8. Intramolecular stem refers to
the stem structure formed due to an intramolecular base-paired
interaction between the 3' sequence and the complementary 5'
terminus. The length of the stem ranges from 15-16 base-pairs.
Location of the A and the B boxes are shown.
[0049] FIGS. 9 and 10 are proposed secondary structures of S35 plus
and S35 plus containing HHI ribozyme.
[0050] FIGS. 11 a,b and 12 a, b are the nucleotide base sequences
of S35, HHIS35, S35 Plus, and HHIS35 Plus respectively.
[0051] FIG. 13 is a general formula for pol III RNA of this
invention.
[0052] FIG. 14 is a digrammatic representation of 5T construct. In
this construct the desired RNA is located 3' of the intramolecular
stem.
[0053] FIGS. 15A and B contain proposed secondary structures of 5T
construct alone and 5T contruct containing a desired RNA (HHI
ribozyme) respectively.
[0054] FIG. 16 is a diagrammatic representation of TRZ-tRNA
chimeras. The site of desired RNA insertion is indicated.
[0055] FIG. 17 A shows the general structure of HHITRZ-A ribozyme
chimera. A hammerhead ribozyme targeted to site I is inserted into
the stem II region of TRZ-tRNA chimera. B shows the general
structure of HPITRZ-A ribozyme chimera. A hairpin ribozyme targeted
to site I is cloned into the indicated region of TRZ-tRNA
chimera.
[0056] FIG. 18 shows a comparison of RNA cleavage activity of
HHITRZ-A, HHITRZ-B and a chemically synthesized HHI hammerhead
ribozymes.
[0057] FIG. 19 is a diagrammatic representation of a U6-S35
Chimera. The S35 motif and the site of insertion of a desired RNA
are indicated. This chimeric RNA transcript is under the control of
a U6 small nuclear RNA (snRNA) promoter.
[0058] FIG. 20 is a diagrammatic representation of a
U6-S35-ribozyme chimera. The chimera contains a hammerhead ribozyme
targeted to site I (HHI).
[0059] FIG. 21 is a diagrammatic representation of a
U6-S35-ribozyme chimera. The chimera contains a hammerhead ribozyme
targeted to site II (HHII).
[0060] FIG. 22 shows RNA cleavage reaction catalyzed by a synthetic
hammerhead ribozyme (HHI) and by an in vitro transcript of
U6-S35-HHI hammerhead ribozyme.
[0061] FIG. 23 shows stability of U6-S35-HHII RNA transcript in 293
mammalian cells as measured by actinomycin D assay.
[0062] FIG. 24 is a diagrammatic representation of an adenovirus
VA1 RNA. Various domains within the RNA secondary structure are
indicated.
[0063] FIG. 25 A shows a secondary structure model of a VA1-S35
chimeric RNA containing the promoter elements A and B box. The site
of insertion of a desired RNA and the S35 motif are indicated. The
transcription unit also contains a stable stem (S35-like motif) in
the central domain of the VA1 RNA which positions the desired RNA
away from the main transcript as an independent domain. B shows a
VA1 -chimera which consists of the terminal 75 nt of a VA1 RNA
followed by the HHI ribozyme.
[0064] FIG. 26 shows a comparison of stability of VA1-chimeric RNA
vs VA1-S35-chimeric RNA as measured by actinomycin D assay. VA1
-chimera consists of terminal 75 nt of VA1 RNA followed by HHI
ribozyme. VA1-S35-chimera structure and sequence is shown in FIG.
25.
[0065] To make internally-labeled substrate RNA for trans-ribozyme
cleavage reactions, a 613 nt region (containing site I) was
synthesized by PCR using primers that place the T7 RNA promoter
upstream of the amplified sequence. Target RNA was transcribed,
using T7 RNA polymerase, in a standard transcription buffer in the
presence of [.alpha.-.sup.32P]CTP. The reaction mixture was treated
with 15 units of ribonuclease-free DNasel, extracted with phenol
followed chloroform:isoamyl alcohol (25:1), precipitated with
isopropanol and washed with 70% ethanol. The dried pellet was
resuspended in 20 .mu.l DEPC-treated water and stored at
-20.degree. C.
[0066] Unlabeled ribozyme (200 nM) and internally labeled 613 nt
substrate RNA (<10 nM) were denatured and renatured separately
in a standard cleavage buffer (containing 50 mM Tris.cndot.HCl pH
7.5 and 10 mM MgCl.sub.2) by heating to 90.degree. C. for 2 min.
and slow cooling to 37.degree. C. for 10 min. The reaction was
initiated by mixing the ribozyme and substrate mixtures and
incubating at 37.degree. C. Aliquots of 5 .mu.l were taken at
regular time intervals, quenched by adding an equal volume of
2.times. formamide gel loading buffer and frozen on dry ice. The
samples were resolved on 5% polyacrylamide sequencing gel and
results were quantitatively analyzed by radioanalytic imaging of
gels with a Phosphorlmager (Molecular Dynamics, Sunnyvale,
Calif.).
[0067] RNA Therapy
[0068] Few antiviral drug therapies are available that effectively
inhibit established viral infections. Consequently, prophylactic
immunization has become the method of choice for protection against
viral pathogens. However, effective vaccines for divergent viruses
such as those causing the common cold, and HIV, the etiologic agent
of AIDS, may not be feasible. Consequently, new antiviral
strategies are being developed for combating viral infections.
[0069] Gene therapy represents a potential alternative strategy,
where antiviral genes are stably transferred into susceptible
cells. Such gene therapy approaches have been termed "intracellular
immunization" since cells expressing antiviral genes become immune
to viral infection (Baltimore, 1988 Nature 335, 395-396). Numerous
forms of antiviral genes have been developed, including
protein-based antivirals such as transdominant inhibitory proteins
(Malim et al., 1993 J. Exp. Med., Bevec et al., 1992 P.N.A.S. (USA)
89, 9870-9874; Bahner et al., 1993 J. Virol. 67, 3199-3207) and
viral-activated suicide genes (Ashorn et al., 1990 P.N.A.S. (USA)
87, 8889-8893). Although effective in tissue culture, protein-based
antivirals have the potential to be immunogenic in vivo. It is
therefore conceivable that treated cells expressing such foreign
antiviral proteins will be eradicated by normal immune functions.
Alternatives to protein based antivirals are RNA based molecules
such as antisense RNAs, decoy RNAs, agonist RNAs, antagonist RNAs,
therapeutic editing RNAs and ribozymes. RNA is not immunogenic;
therefore, cells expressing such therapeutic RNAs are not
susceptible to immune eradication.
[0070] In order for RNA-based gene therapy approaches to be
effective, sufficient amounts of the therapeutic RNA must
accumulate in the appropriate intracellular compartment of the
treated cells. Accumulation is a function of both promoter strength
of the antiviral gene, and the intracellular stability of the
antiviral RNA. Both RNA polymerase II (pol II) and RNA polymerase
III (pol III) based expression systems have been used to produce
therapeutic RNAs in cells (Sarver & Rossi, 1993 AIDS Res. &
Human Retroviruses 9, 483-487; Yu et al., 1993 P.N.A.S. (USA) 90,
6340-6344). However, pol III based expression cassettes are
theoretically more attractive for use in expressing antiviral RNAs
for the following reasons. Pol II produces messenger RNAs located
exclusively in the cytoplasm, whereas pol III produces functional
RNAs found in both the nucleus and the cytoplasm. Pol II promoters
tend to be more tissue restricted, whereas pol III genes encode
tRNAs and other functional RNAs necessary for basic "housekeeping"
functions in all cell types. Therefore, pol III promoters are
likely to be expressed in all tissue types. Finally, pol III
transcripts from a given gene accumulate to much greater levels in
cells relative to pol II genes.
[0071] Intracellular accumulation of therapeutic RNAs is also
dependent on the method of gene transfer used. For example, the
retroviral vectors presently used to accomplish stable gene
transfer, integrate randomly into the genome of target cells. This
random integration leads to varied expression of the transferred
gene in individual cells comprising the bulk treated cell
population. Therefore, for maximum effectiveness, the transferred
gene must have the capacity to express therapeutic amounts of the
antiviral RNA in the entire treated cell population, regardless of
the integration site.
[0072] Pol III System
[0073] The following is just one non-limiting example of the
invention. A pol III based genetic element derived from a human
tRNA.sub.i.sup.met gene and termed .DELTA.3-5 (FIG. 2;
Adeniyi-Jones et al., 1984 supra), has been adapted to express
antiviral RNAs (Sullenger et al., 1990 Mol. Cell. Biol. 10,
6512-6523). This element was inserted into the DC retroviral vector
(Sullenger et al., 1990 Mol. Cell. Biol. 10, 6512-6523) to
accomplish stable gene transfer, and used to express antisense RNAs
against moloney murine leukemia virus and anti-HIV decoy RNAs
(Sullenger et al., 1990 Mol. Cell. Biol. 10, 6512-6523; Sullenger
et al., 1990 Cell 63, 601-608; Sullenger et al., 1991 J. Virol. 65,
6811-6816; Lee et al., 1992 The New Biologist 4, 66-74). Clonal
lines are expanded from individual cells present in the bulk
population, and therefore express similar amounts of the
therapeutic RNA in all cells. Development of a vector system that
generates therapeutic levels of therapeutic RNA in all treated
cells would represent a significant advancement in RNA based gene
therapy modalities.
[0074] Applicant examined hammerhead (HHI) ribozyme (RNA with
enzymatic activity) expression in human T cell lines using the
.DELTA.3-5 vector system (These constructs are termed
".DELTA.3-5/HHI"; FIG. 3). On average, ribozymes were found to
accumulate to less than 100 copies per cell in the bulk T cell
populations. In an attempt to improve expression levels of the
.DELTA.3-5 chimera, the applicant made a series of modified
.DELTA.3-5 gene units containing enhanced promoter elements to
increase transcription rates, and inserted structural elements to
improve the intracellular stability of the ribozyme transcripts
(FIG. 3). One of these modified gene units, termed S35, gave rise
to more than a 100-fold increase in ribozyme accumulation in bulk T
cell populations relative to the original .DELTA.3-5/HHI vector
system. Ribozyme accumulation in individual clonal lines from the
pooled T cell populations ranged from 10 to greater than 100 fold
more than those achieved with the original .DELTA.3-5/HHI version
of this vector.
[0075] The S35 gene unit may be used to express other therapeutic
RNAs including, but not limited to, ribozymes, antisense, decoy,
therapeutic editing, agonist and antagonist RNAs. Application of
the S35 gene unit would not be limited to antiviral therapies, but
also to other diseases, such as cancer, in which therapeutic RNAs
may be effective. The S35 gene unit may be used in the context of
other vector systems besides retroviral vectors, including but not
limited to, other stable gene transfer systems such as
adeno-associated virus (AAV; Carter, 1992 Curr. Opin. Genet. Dev.
3, 74), as well as transient vector systems such as plasmid
delivery and adenoviral vectors (Berkner, 1988 BioTechniques 6,
616-629).
[0076] As described below, the S35 vector encodes a truncated
version of a tRNA wherein the 3' region of the RNA is base-paired
to complementary nucleotides at the 5' terminus, which includes the
5' precursor portion that is normally processed off during tRNA
maturation. Without being bound by any theory, Applicant believes
this feature is important in the level of expression observed.
Thus, those in the art can now design equivalent RNA molecules with
such high expression levels. Below are provided examples of the
methodology by which such vectors and tRNA molecules can be
made.
[0077] .DELTA.3-5 Vectors
[0078] The use of a truncated human tRNA.sub.i.sup.met gene, termed
.DELTA.3-5 (FIG. 2; Adeniyi-Jones et al., 1984 supra), to drive
expression of antisense RNAs, and subsequently decoy RNAs
(Sullenger et al., 1990 supra) has recently been reported. Because
tRNA genes utilize internal pol III promoters, the antisense and
decoy RNA sequences were expressed as chimeras containing
tRNA.sub.i.sup.met sequences. The truncated tRNA genes were placed
into the U3 region of the 3' moloney murine leukemia virus vector
LTR (Sullenger et al., 1990 supra).
[0079] Base-Paired Structures
[0080] Since the .DELTA.3-5 vector combination has been
successfully used to express inhibitory levels of both antisense
and decoy RNAs, applicant cloned ribozyme-encoding sequences
(termed as ".DELTA.3-5/HHI") into this vector to explore its
utility for expressing therapeutic ribozymes. However, low ribozyme
accumulation in human T cell lines stably transduced with this
vector was observed (FIG. 4A). To try and improve accumulation of
the ribozyme, applicant incorporated various RNA structural
elements (FIG. 3) into one of the ribozyme chimeras
(.DELTA.3-5/HHI).
[0081] Two strategies were used to try and protect the termini of
the chimeric transcripts from exonucleolytic degredation. One
strategy involved the incorporation of stem-loop structures into
the termini of the transcript. Two such constructs were cloned, S3
which contains a stem-loop structure at the 3' end, and S5 which
contains stem-loop structures at both ends of the transcript (FIG.
3). The second strategy involved modification of the 3' terminal
sequences such that the 5' terminus and the 3' end sequences can
form a stable base-paired stem. Two such constructs were made: S35
in which the 3' end was altered to hybridize to the 5' leader and
acceptor stem of the tRNA.sub.i.sup.met domain, and S35Plus which
was identical to S35 but included more extensive structure
formation within the non-ribozyme portion of the .DELTA.3-5
chimeras (FIG. 3). These stem-loop structures are also intended to
sequester non-ribozyme sequences in structures that will prevent
them from interfering with the catalytic activity of the ribozyme.
These constructs were cloned, producer cell lines were generated,
and stably-transduced human MT2 (Harada et al., 1985 supra) and CEM
(Nara & Fischinger, 1988 supra) cell lines were established
(Curr. Protocols Mol. Biol. 1992, ed. Ausubel et al., Wiley &
Sons, New York). The RNA sequences and structure of S35 and S35
Plus are provided in. FIGS. 7-12.
[0082] Referring to FIG. 13, there is provided a general structure
for a chimeric RNA molecule of this invention. Each N independently
represents none or a number of bases which may or may not be base
paired. The A and B boxes are optional and can be any known A or B
box, or a consensus sequence as exemplified in the figure. The
desired nucleic acid to be expressed can be any location in the
molecule, but preferably is on those places shown adjacent to or
between the A and B boxes (designated by arrows). FIG. 14 shows one
example of such a structure in which a desired RNA is provided 3'
of the intramolecular stem. A specific example of such a construct
is provided in FIGS. 15a and 15b.
EXAMPLE 1
Cloning of .DELTA.3-5-Ribozyme Chimera
[0083] Oligonucleotides encoding the S35 insert that overlap by at
least 15 nucleotides were designed (5' GATCCACTCTGCTGTTCTGTTTTTGA
3' and 5' CGCGTCAAAAACAGAACAGCAGAGTG 3'). The oligonucleotides (10
.mu.M each) were denatured by boiling for 5 min in a buffer
containing 40 mM Tris.HCl, pH 8.0. The oligonucleotides were
allowed to anneal by snap cooling on ice for 10-15 min.
[0084] The annealed oligonucleotide mixture was converted into a
double-stranded molecule using Sequenase.RTM. enzyme (US
Biochemicals) in a buffer containing 40 mM Tris.HCl, pH 7.5, 20 mM
MgCl.sub.2, 50 mM NaCl, 0.5 mM each of the four deoxyribonucleotide
triphosphates, 10 mM DTT. The reaction was allowed to proceed at
37.degree. C. for 30 min. The reaction was stopped by heating to
70.degree. C. for 15 min.
[0085] The double stranded DNA was digested with appropriate
restriction endonucleases (BamHI and MluI) to generate ends that
were suitable for cloning into the .DELTA.3-5 vector.
[0086] The double-stranded insert DNA was ligated to the .DELTA.3-5
vector DNA by incubating at room temperature (about 20.degree. C.)
for 60 min in a buffer containing 66 mM Tris.HCl, pH 7.6, 6.6 mM
MgCl.sub.2, 10 mM DTT, 0.066 .mu.M ATP and 0.1U/.mu.l T4 DNA Ligase
(US Biochemicals).
[0087] Competent E. coli bacterial strain was transformed with the
recombinant vector DNA by mixing the cells and DNA on ice for 60
min. The mixture was heat-shocked by heating to 37.degree. C. for 1
min. The reaction mixture was diluted with LB media and the cells
were allowed to recover for 60 min at 37.degree. C. The cells were
plated on LB agar plates and incubated at 37.degree. C. for
.about.18 h.
[0088] Plasmid DNA was isolated from an overnight culture of
recombinant clones using standard protocols (Ausubel et al., Curr.
Protocols Mol. Biology 1990, Wiley & Sons, New York).
[0089] The identity of the clones were determined by sequencing the
plasmid DNA using the Sequenase.RTM. DNA sequencing kit (US
Biochemicals).
[0090] The resulting recombinant .DELTA.3-5 vector contains the S35
sequence. The HHI encoding DNA was cloned into this .DELTA.3-5-S35
containing vector using SacII and BamHI restriction sites.
EXAMPLE 2
Northern Analysis
[0091] RNA from the transduced MT2 cells were extracted and the
presence of .DELTA.3-5/ribozyme chimeric transcripts were assayed
by Northern analysis (Curr. Protocols Mol. Biol. 1992, ed. Ausubel
et al., Wiley & Sons, New York). Northern analysis of RNA
extracted from MT2 transductants showed that .DELTA.3-5/ribozyme
chimeras of appropriate sizes were expressed (FIG. 4). In addition,
these results demonstrated the relative differences in accumulation
among the different constructs (FIG. 4). The pattern of expression
seen from the .DELTA.3-5/HHI ribozyme chimera was similar to 12
other ribozymes cloned into the .DELTA.3-5 vector (not shown). In
MT-2 cell line, .DELTA.3-5/HHI ribozyme chimeras accumulated, on
average, to less than 100 copies per cell.
[0092] Addition of a stem-loop onto the 3' end of .DELTA.3-5/HHI
did not lead to increased .DELTA.3-5 levels (S3 in FIG. 4). The S5
construct containing both 5' and 3' stem-loop structures also did
not lead to increased ribozyme levels (FIG. 4).
[0093] Interestingly, the S35 construct expression in MT2 cells was
about 100-fold more abundant relative to the original
.DELTA.3-5/HHI vector transcripts (FIG. 4). This may be due to
increased stability of the S35 transcript.
EXAMPLE 3
Cleavage Activity
[0094] To assay whether ribozymes transcribed in the transduced
cells contained cleavage activity, total RNA extracted from the
transduced MT2 T cells were incubated with a labeled substrate
containing the HHI cleavage site (FIG. 5). Ribozyme activity in all
but the S35 constructs, was too low to detect. However, ribozyme
activity was detectable in S35-transduced T cell RNA. Comparison of
the activity observed in the S35-transduced MT2 RNA with that seen
with MT2 RNA in which varying amounts of in vitro transcribed S5
ribozyme chimeras, indicated that between 1-3 nM of S35 ribozyme
was present in S35-transduced MT2 RNA. This level of activity
corresponds to an intracellular concentration of 5,000-15,000
ribozyme molecules per cell.
EXAMPLE 5
Clonal Variation
[0095] Variation in the ribozyme expression levels among cells
making up the bulk population was determined by generating several
clonal cell lines from the bulk S35 transduced CEM line (Curr.
Protocols Mol. Biol. 1992, ed. Ausubel et al., Wiley & Sons,
New York) and the ribozyme expression and activity levels in the
individual clones were measured (FIG. 6). All the individual clones
were found to express active ribozyme. The ribozyme activity
detected from each clone correlated well with the relative amounts
of ribozyme observed by Northern analysis. Steady state ribozyme
levels among the clones ranged from approximately 1,000 molecules
per cell in clone G to 11,000 molecules per cell in clone H (FIG.
6A). The mean accumulation among the clones, calculated by
averaging the ribozyme levels of the clones, exactly equaled the
level measured in the parent bulk population. This suggests that
the individual clones are representative of the variation present
in the bulk population.
[0096] The fact that all 14 clones were found to express ribozyme
indicate that the percentage of cells in the bulk population
expressing ribozyme is also very high. In addition, the lowest
level of expression in the clones was still more than 10-fold that
seen in bulk cells transduced with the original .DELTA.3-5 vector.
Therefore, the S35 gene unit should be much more effective in a
gene therapy setting in which bulk cells are removed, transduced
and then reintroduced back into a patient.
EXAMPLE 6
Stability
[0097] Finally, the bulk S35-transduced line, resistant to G418,
was propagated for a period of 3 months (in the absence of G418) to
determine if ribozyme expression was stable over extended periods
of time. This situation mimicks that found in the clinic in which
bulk cells are transduced and then reintroduced into the patient
and allowed to propogate. There was a modest 30% reduction of
ribozyme expression after 3 months. This difference probably arose
from cells with varying amount of ribozyme expression and
exhibiting different growth rates in the culture becoming slightly
more prevalent in the culture. However, ribozyme expression is
apparently stable for at least this period of time.
EXAMPLE 7
Design and Construction of TRZ-tRNA Chimera
[0098] A transcription unit, termed TRZ, is designed that contains
the S35 motif (FIG. 16). A desired RNA (e.g. ribozyme) can be
inserted into the indicated region of TRZ tRNA chimera. This
construct might provide additional stability to the desired RNA.
TRZ-A and TRZ-B are non-limiting examples of the TRZ-tRNA
chimera.
[0099] Referring to FIG. 17, a hammerhead ribozyme targeted to site
I (HHITRZ-A; FIG. 17A) and a hairpin ribozyme (HPITRZ-A; FIG. 17B),
also targeted to site I, is cloned individually into the indicated
region of TRZ tRNA chimera. The resulting ribozyme trancripts
retain full RNA cleavage activity (see for example FIG. 18).
Applicant has shown that efficient expression of these TRZ tRNA
chimera can be achieved in mammalian cells.
[0100] Besides ribozymes, desired RNAs like antisense, therapeutic
editing RNAs, decoys, can be readily inserted into the indicated
region of TRZ-tRNA chimera to achieve therapeutic levels of RNA
expression in mammalian cells.
EXAMPLE 8
Design and Construction of U6-S35 Chimera
[0101] A transcription unit, termed U6-S35, is designed that
contains the characteristic intramolecular stem of a S35 motif (see
FIG. 13). As shown in FIGS. 19, 20 and 21 a desired RNA (e.g.
ribozyme) can be inserted into the indicated region of U6-S35
chimera. This construct is under the control of a type 3 pol III
promoter, such as a mammalian U6 small nuclear RNA (snRNA) promoter
(see FIG. 1). U6-S35-HHI and U6-S35-HHII are non-limiting examples
of the U6-S35 chimera.
[0102] As a non-limiting example, applicant has constructed a
stable, active ribozyme RNA driven from a eukaryotic U6 promoter
(FIG. 20). For stability, applicant incorporated a S35 motif as
described in FIG. 13 and FIG. 19. A ribozyme sequence is inserted
at the top of the stem, such that the ribozyme is separated from
the S35 motif by an unstructured spacer sequence (FIGS. 19, 20,
21). The spacer sequence can be customized for each desired RNA
sequence. U6-S35 chimera is meant to be a non-limiting example and
those skilled in the art will recognize that the structure
disclosed in the FIGS. 19, 20 and 21 can be driven by any of the
known RNA polymerase promoters and are within the scope of this
invention. All that is necessary is for the 5' region of a
transcript to interact with its 3' region to form a stable
intramolecular structure (S35 motif) and that the S35 motif is
separated from the desired RNA by a stretch of unstructured spacer
sequence. The spacer sequence appears to improve the effectiveness
of the desired RNA.
[0103] By "unstructured" is meant lack of a secondary and tertiary
structure such as lack of any stable base-paired structure within
the sequence itself, and preferably with other sequences in the
attached RNA.
[0104] By "spacer sequence" is meant any unstructured RNA sequence
that separates the S35 domain from the desired RNA. The spacer
sequence can be greater than or equal to one nucleotide.
[0105] In vitro Catalytic Activity of U6-S35-Ribozyme Chimeras
[0106] U6-S35-HHI ribozyme RNA was synthesized using T7 RNA
polymerase. HHI RNA was chemically synthesized using RNA
phosphoramidite chemistry as described in Wincott et al., 1995
Nucleic Acids Res. (in press). The ribozyme RNAs were gel-purified
and the purified ribozyme RNAs were heated to 55.degree. C. for 5
min. Target RNA used was .about.650 nucleotide long.
Internally-.sup.32P-labeled target RNA was prepared as described
above. The target RNA was pre-heated to 37.degree. C. in 50 mM
Tris.HCl, 10 mM MgCl.sub.2 and then mixed at time zero with the
ribozyme RNAs (to give 200 nM final concentration of ribozyme). At
appropriate times an aliquot was removed and the reaction was
stopped by dilution in 95% formamide. Samples were resolved on a
denaturing urea-polyacrylamide gel and products were quantitated on
a phospholmager.RTM..
[0107] As shown in FIG. 22, the U6-S35-HHI ribozyme chimera cleaved
its target RNA as efficiently as a chemically synthesized HHI
ribozyme. In fact, it appears that the U6-S35-HHI ribozyme chimera
may be more efficient than the synthetic ribozyme.
[0108] Accumulation of U6-S35-ribozyme Transcripts
[0109] An Actinomycin D assay was used to measure accumulation of
the transcript in mammalian cells. Cells were transfected overnight
with plasmids encoding the appropriate transcription units (2 .mu.g
bNA/well of 6 well plate) using calcium phosphate precipitation
method (Maniatis et al., 1982 Molecular Cloning Cold Spring Harbor
Laboratory Press, New York). After the overnight transfection,
media was replaced and the cells were incubated an additional 24
hours. Cells were then incubated in media containing 5 .mu.g/ml
Actinomycin D. At the times indicated, cells were lysed in
guanidinium isothiocyanate, and total RNA was purified by
phenol/chloroform extraction and isopropanol precipitation as
described by Chomczynski and Sacchi, 1987 Anal. Biochem., 162, 156.
RNA was analyzed by northen blot analysis and the levels of
specific RNAs were radioanalyticaly quantitated on a
phospholmager.RTM.. The level of RNA at time zero was set to be
100%.
[0110] As shown in FIG. 23, the U6-S35-HHII ribozyme shown in FIG.
21 is fairly stable in 293 mammalian cells with an approximate
half-life of about 2 hours.
EXAMPLE 9
Design and Construction of VA1-S35 Chimera
[0111] Refering to FIG. 25A, In order to express ribozymes from a
VAI promoter, applicant has constructed a transcription unit
consisting of a wild type VA1 sequence with two modifications: a
"S35-like" motif extends from a loop in the central domain (FIG.
24); the 3' terminus is changed such that there is a more complete
interaction between the 5' and the 3' region of the transcript
(specifically, an "A-C" bulge is changed to an "A-U base pair and
the termination sequence is part of the stem of S35 motif).
[0112] Accumulation of VA1-S35-ribozyme Transcripts
[0113] An Actinomycin D assay was used to measure accumulation of
the transcript in mammalian cells as described above. As shown in
FIG. 26, the VA1-S35-chimera, shown in FIG. 25A, has approximately
10-fold higher stability in 293 mammalian cells compared to
VA1-chimera, shown in FIG. 25B that lacks the intramolecular S35
motif.
[0114] Besides ribozymes, desired RNAs like antisense, therapeutic
editing RNAs, decoys, can be readily inserted into the indicated
U6-S35 or VA1-S35 chimera to achieve therapeutic levels of RNA
expression in mammalian cells.
[0115] Sequences listed in the Figures are meant to be non-limiting
examples. Those skilled in the art will recognize that variants
(mutations, insertions and deletions) of the above examples can be
readily generated using techniques known in the art, are within the
scope of the present invention.
METHOD FOR ADMINISTRATION AND USE
[0116] References cited herein, as well as Draper WO 93/23569,
94/02495, 94/06331, Sullenger WO 93/12657, Thompson WO 93/04573,
and Sullivan WO 94/04609, and 93/11253 describe methods for use of
vectors decribed herein, and are incorporated by reference herein.
In particular these vectors are useful for administration of
antisense and decoy RNA molecules.
[0117] Other embodiments are within the following claims.
Sequence CWU 1
1
22 1 88 RNA Homo sapiens misc_feature (83) n represents
ribothymidine. 1 ggcagaacag cagaguggcg cagcggaagc gugcugggcc
cauaacccag aggucgaugg 60 aucgaaacca uccucugcua ggnccnnn 88 2 70 RNA
Artificial Sequence Description of Artificial Sequence a truncated
version of tRNA. 2 ggcagaacca gcagaguggc gcagcggaag cgugcugggc
ccauaaccca gaggucgaug 60 gaucgaaacc 70 3 108 RNA Artificial
Sequence Description of Artificial Sequence S35 tRNA Chimera (S35).
3 ggcagaacag cagaguggcg cagcggaagc gugcugggcc cauaacccag aggucgaugg
60 aucgaaaccc cggaucguac cgcggggauc cacucugcug uucuguuu 180 4 146
RNA Artificial Sequence Description of Artificial Sequence S35
Ribozyme Chimera (HHIS35). 4 ggcagaacag cagaguggcg cagcggaagc
gugcugggcc cauaacccag aggucgaugg 60 aucgaaaccc cggaucguac
cgcggcacaa cacugaugag gaccgaaagg uccgaaacgg 120 gcaggaucca
cucugcuguu cuguuu 146 5 133 RNA Artificial Sequence Description of
Artificial Sequence S35 Plus tRNA Chimera (S35 Plus). 5 ggcagaacag
cagaguggcg cagcggaagc gugcugggcc cauaacccag aggucgaugg 60
aucgaaaccc cggaucguac cgcggggauc cuaacgaucc ggggugucga uccaucacuc
120 ugcuguucug uuu 133 6 171 RNA Artificial Sequence Description of
Artificial Sequence S35 Plus Ribozyme Chimera (HHIS35 Plus). 6
ggcagaacag cagaguggcg cagcggaagc gugcugggcc cauaacccag aggucgaugg
60 aucgaaaccc cggaucguac cgcggcacaa cacugaugag gaccgaaagg
uccgaaacgg 120 gcaggauccu aacgauccgg ggugucgauc caucacucug
cuguucuguu u 171 7 11 RNA Artificial Sequence Description of
Artificial Sequence A BOX consensus sequence. 7 urgcnnagyg g 11 8
11 RNA Artificial Sequence Description of Artificial Sequence B BOX
consensus sequence. 8 gguucganuc c 11 9 129 RNA Artificial Sequence
Description of Artificial Sequence 5T tRNA Chimera (5T). 9
ggcagaacag cagaguggcg cagcggaagc gugcugggcc cauaacccag aggucgaugg
60 aucgaaacca uccucugcug uucugccgcg gcgaaagccg caaacacaca
aaaaccccca 120 aaccccuuu 129 10 167 RNA Artificial Sequence
Description of Artificial Sequence 5T Ribozyme Chimera (HHI5T). 10
ggcagaacag cagaguggcg cagcggaagc gugcugggcc cauaacccag aggucgaugg
60 aucgaaacca uccucugcug uucugccgcg gcgaaagccg caaacacaac
acugaugagg 120 accgaaaggu ccgaaacggg cacacacaaa aacggcgaaa gccguuu
167 11 112 RNA Artificial Sequence Description of Artificial
Sequence TRZ-A tRNA Chimera. 11 ggcagaacag ucgaguggcg cagcggaagc
gugcugggcc cauaacccag aggucgaugg 60 aucgaacacu gcgccacucc
ugaugagccg caaaggcgau acuguucugu uu 112 12 112 RNA Artificial
Sequence Description of Artificial Sequence TRZ-B tRNA Chimera. 12
ggcagaacag ucgaguggcg cagcggaagc gugcugggcc caraacccag aggucgaugg
60 aucgaacacu gcgccacuca aaaaaagccg caaaggcgau acuguucugu uu 112 13
148 RNA Artificial Sequence Description of Artificial Sequence
HHITRZ-A Ribozyme Chimera. 13 ggcagaacag ucgaguggcg cagcggaagc
gugcugggcc cauaacccag aggucgaugg 60 aucgaacacu gcgccacucc
ugaugagccg cacacaacac ugaugagccg aaaggcgaaa 120 cgggcacaca
ggcgauacug uucuguuu 148 14 169 RNA Artificial Sequence Description
of Artificial Sequence HPITRZ-A Ribozyme Chimera. 14 ggcagaacag
ucgaguggcg cagcggaagc gugcuugggc ccauaaccca gaggucgaug 60
gaucgaacac ugcgccacuc cugaugagcc gcacacaaca agaaggcaca accagagaaa
120 cacaggcgaa agccugguac auuaccuggu aggcgauacu guucuguuu 169 15 64
RNA Artificial Sequence Description of Artificial Sequence a U6-S35
chimera. 15 gggcacncga anncaagcac aaacaaaaan aaaccaccaa acaaagcnng
agnncgagng 60 nnnn 64 16 104 RNA Artificial Sequence Description of
Artificial Sequence a U6-S35 ribozyme chimera containing a
hammerhead ribozyme targeted to site I (HHI). 16 gggcacncga
anncaagcac aaacaaaaaa cacaacacng angagccgaa aggcgaaacg 60
ggcacacana aaaccaccaa acaaagcnng agnncgagng nnnn 104 17 102 RNA
Artificial Sequence Description of Artificial Sequence a
U6-S35-ribozyme chimera containing a hammerhead ribozyme targeted
to site II (HHII). 17 gggcacucga auucaagcac aaacacaaca auuucuuccu
gaugagccga aaggcgaaaa 60 aaccgaacca cacaacaaac aaagcuugag
uucgaguguu uu 102 18 161 RNA Adenovirus VA1 RNA. 18 uuucccgggc
acucuuccgu ggucuggugg auaaauucgc aaggguauca uggcggacga 60
ccgggguucg aaccccggau cccggccguc cgccgugauc caugcgguua ccgcccgcgu
120 gucgaaccca ggugugcgac gucagacaac gggggagcgc u 161 19 175 RNA
Artificial Sequence Description of Artificial Sequence VA1-S35
Chimera. 19 gggcacucuu ccguggucug guagauaaau ucgcaagggu aucauggcgg
acgaccgggg 60 uucgaacccc ggauccggcc guccgccgug auccaugcgg
uuaccgcgaa uucaagcgaa 120 agcuugaauu cgcgguaacc caggugugcg
agcucagaca acgggggagu guuuu 175 20 72 RNA Artificial Sequence
Description of Artificial Sequence VA1 Chimera. 20 gggcaccucu
uccguggucu gguagauuaa auucgcaagg guaucauggc ggacgaccgg 60
gguucgaacc cc 72 21 26 DNA Artificial Sequence Description of
Artificial Sequence Oligonucleotide encoding the S35 insert. 21
gatccactct gctgttctgt ttttga 26 22 26 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide encoding the S35
insert. 22 cgcgtcaaaa acagaacagc agagtg 26
* * * * *