U.S. patent application number 10/900231 was filed with the patent office on 2005-08-11 for vertebrate telomerase genes and proteins and uses thereof.
This patent application is currently assigned to The Monticello Group, Ltd. Invention is credited to Bowtell, David, Kilian, Andrzej.
Application Number | 20050176022 10/900231 |
Document ID | / |
Family ID | 27535157 |
Filed Date | 2005-08-11 |
United States Patent
Application |
20050176022 |
Kind Code |
A1 |
Kilian, Andrzej ; et
al. |
August 11, 2005 |
Vertebrate telomerase genes and proteins and uses thereof
Abstract
Nucleic acid molecules encoding vertebrate telomerase are
provided. Gene products, expression vectors and host cells suitable
for expressing telomerase are also provided. Methods for
identifying inhibitors of telomerase activity and inhibitor
compositions are disclosed.
Inventors: |
Kilian, Andrzej; (Canberra,
AU) ; Bowtell, David; (Melbourne, AU) |
Correspondence
Address: |
CAROL NOTTENBURG
814 32ND AVE 5
SEATTLE
WA
98144
US
|
Assignee: |
The Monticello Group, Ltd
|
Family ID: |
27535157 |
Appl. No.: |
10/900231 |
Filed: |
July 27, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10900231 |
Jul 27, 2004 |
|
|
|
09502498 |
Feb 11, 2000 |
|
|
|
6846662 |
|
|
|
|
09502498 |
Feb 11, 2000 |
|
|
|
09108401 |
Jun 30, 1998 |
|
|
|
60051410 |
Jul 1, 1997 |
|
|
|
60053018 |
Jul 19, 1997 |
|
|
|
60053329 |
Jul 21, 1997 |
|
|
|
60054642 |
Aug 4, 1997 |
|
|
|
60058287 |
Sep 9, 1997 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
435/199; 435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
C12N 9/1241 20130101;
A61K 38/00 20130101; A01K 2217/05 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/199; 435/320.1; 435/325; 536/023.2 |
International
Class: |
C12Q 001/68; C07H
021/04; C12N 009/22 |
Claims
We claim:
1. An isolated nucleic acid molecule encoding a splice variant of a
reference human telomerase, wherein the reference human telomerase
has the amino acid sequence of SEQ ID NO: 2.
2. An isolated nucleic acid molecule, comprising any of SEQ ID NOS:
34, 36, 38, 41, 43, 45, 47, or 49 or a hybridizes under normal
stringency conditions to the complement of the sequences thereof,
wherein the nucleic acid molecule is not SEQ ID NO:1 or encodes SEQ
ID NO:2.
3. An isolated nucleic acid molecule comprising any of SEQ ID NO:
23, 25, 27, 29, 30, 32, or 33, or hybridizes under normal
stringency conditions to the complement of the sequences thereof,
wherein the nucleic acid molecule is not SEQ ID NO:1 or encodes SEQ
ID NO:2.
4. An oligonucleotide comprising from 10 to 100 contiguous
nucleotides of SEQ ID NO: 23, 25, 27, 29, 30, 32, or 33 or of the
complements thereof or has 90% sequence identity to one of the
sequences or complements.
5. The oligonucleotide of claim 4, wherein the oligonucleotide is
labeled.
6. The oligonucleotide of claim 5, wherein the label is a
radiolabel, a chemiluminescent label, or biotin.
7. An expression vector, comprising a heterologous promoter
operably linked to a nucleic acid molecule according any of claims
1-3.
8. The expression vector of claim 7, wherein the vector is selected
from the group consisting of bacterial vectors, retroviral vectors,
adenoviral vectors and yeast vectors.
9. A host cell containing a vector according to claim 7.
10. The host cell of claim 9, wherein the cell is selected from the
group consisting of human cell, monkey cell, mouse cell, rat cell,
yeast cell and bacterial cell.
11. An isolated protein comprising a splice variant of a reference
human telomerase protein, wherein the reference protein has the
amino acid sequence of SEQ ID NO: 2.
12. The protein of claim 11, wherein the protein comprises one SEQ
ID NOS: 35, 37, 39, 42, 44, 46, 48, or 50, wherein the protein is
not SEQ ID NO: 2.
13. A peptide having one of SEQ ID NOS: 24, 26, 28, or 31 or has a
sequence 90% identical to one of the sequences.
14. A nucleic acid probe that is capable of specifically
hybridizing to SEQ ID NOS: 23, 29, 30, 32 or 33.
15. The probe of claim 14, wherein the probe is from 12 to 200
nucleotides long.
16. The probe of claim 14, wherein the nucleic acid molecule is
labeled.
17. A pair of oligonucleotide primers capable of specifically
amplifying all or a portion of a nucleic acid molecule encoding a
splice variant of a reference human telomerase, wherein the
reference telomerase has SEQ ID NO:1.
18. The primers of claim 17, wherein the splice variant has the
sequence of any of SEQ ID NOS: 23, 25, 27, 29, 30, 32, or 33.
19. The primers of claim 17, wherein the primers flank nucleotide
222, 1950, 2131-2166, 2287-2468, 2843, or 3157 of SEQ ID NO:1.
20. The primers of claim 17, wherein only one of each primer pair
flanks nucleotide 222, 1950, 2131-2166, 2287-2468, 2843, or 3157 of
SEQ ID NO:1 and the other primer of the pair has sequence derived
from one SEQ ID NOS: 23, 25, 27, 29, 30, 32, or 33 or complements
thereof.
21. A method of diagnosing cancer in a patient, comprising
preparing tumor cDNA and amplifying the tumor cDNA using primers
that specifically amplify a splice variant of a reference human
telomerase nucleic acid sequence, wherein the detection of a splice
variant telomerase nucleic acid sequence is indicative of a
diagnosis of cancer.
22. The method of claim 21, wherein the primers flank nucleotide
222, 1950, 2131-2166, 2287-2468, 2843, or 3157 of SEQ ID NO:1. or
wherein one of each primer pair flanks nucleotide 222, 1950,
2131-2166, 2287-2468, 2843, or 3157 of SEQ ID NO:1 and the other
primer of the pair has sequence derived from one SEQ ID NOS: 23,
25, 27, 29, 30, 32, or 33 or complements thereof.
23. A method of determining a pattern of telomerase RNA expression
in cells, comprising preparing cDNA from mRNA isolated from the
cells, amplifying the cDNA using primers that amplify a reference
human telomerase sequence and one or more splice variant telomerase
sequences, therefrom determining the pattern of telomerase RNA
expression.
24. The method of claim 23, further comprising detecting the
amplified product by hybridization with one or more
oligonucleotides having all or part of SEQ ID NO: 23, 25, 27, 29,
30, 32, or 33 or the complements thereof.
25. A method of diagnosing cancer in a patient, comprising
determining a pattern of telomerase RNA expression according to
claim 23, therefrom determining the pattern of telomerase RNA
expression, wherein the pattern is indicative of a diagnosis of
cancer.
26. The method of claim 25, further comprising comparing the
pattern to a pattern obtained from normal cells.
27. A non-human transgenic animal whose cells contain a splice
variant telomerase sequence that is operably linked to a promoter
effective for the expression of the gene.
28. A method of identifying an effector of telomerase activity
comprising: (a) adding a candidate effector to a mixture of a
splice variant of a human telomerase protein, RNA component and
template; (b) detecting telomerase activity; and (c) comparing the
amount of activity in step (b) to the amount of activity in a
control mixture without candidate effector, therefrom identifying
an effector.
Description
CROSS-RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/502,498, filed Feb. 11, 2000; which
application is a continuation of U.S. patent application Ser. No.
09/108,401, filed Jun. 30, 1998; now abandoned; which application
claims the benefit of U.S. Patent Application No. 60/051,410, filed
Jul. 1, 1997; 60/053,018, filed Jul. 19, 1997; 60/053,329, filed
Jul. 21, 1997; 60/054,642, filed Aug. 4, 1997; and 60/058,287,
filed Sep. 9, 1997, all of which are incorporated by reference in
their entirety.
TECHNICAL FIELD
[0002] This invention relates generally to telomerases, and
particularly to the human telomerase gene and protein and uses for
diagnostics and therapy.
BACKGROUND OF THE INVENTION
[0003] Non-circular chromosomes require a specialized mechanism for
maintaining chromosome ends after each cell division because the
polymerases responsible for replication of chromosomal DNA are
unable to fully replicate linear DNA molecules, creating an "end
replicating problem." To meet this challenge, eukaryotic cells
depend upon an enzyme, telomerase, to add short, typically G-rich,
relatively conserved repeats onto chromosomal ends. These repeat
structures are termed telomeres.
[0004] The presence of telomeres is essential for cell viability.
The absence of even a single telomere leads to cell cycle arrest in
yeast, a eukaryotic cell (Sandell and Zakian, Cell 75:729, 1993).
Telomeres shorten during replication; telomerase restores the
telomeres. Thus, as expected, telomerase activity is primarily
detected in actively dividing cells. As such, telomerase activity
is constitutive in unicellular organisms and is regulated in more
complex organisms, relatively abundant in germline and embryonic
tissues and cells as well as tumor cells. In contrast, telomerase
activity is difficult to detect in normal somatic human tissues.
Moreover, rather than cessation of replication resulting in
decreased telomerase, recent data indicate that telomerase
inhibition might be one of the critical events in this transition.
The seemingly direct correlation of telomerase/replication
activities have prompted much speculation that inhibitors of
telomerase could be a "universal" cancer therapeutic, effective for
essentially all tumor types, whereas stimulators of telomerase
could overcome the observed natural senescence of normal cells.
[0005] Spurred by these models, characterization of telomerase for
culmination in isolation and cloning of telomerase has been a high
priority. The mechanism of telomere elongation has been shown to
center on the G-rich strand of the telomeric repeats. This G-rich
strand, which extends to the 3' end of the chromosome, is extended
by telomerase, a ribonucleoprotein, from the RNA component, which
acts as a template. Various components of this complex have been
isolated and cloned. The RNA component of the complex has been
isolated and cloned from many different organisms, including humans
(Feng et al. Science 269: 1236, 1995), mice and other mammalian
species, Saccharomyces cerevisiae, Tetrahymena, Euplotes, and
Oxytricha (see, Singer and Gottschling, Science, 266: 404, 1994;
Lingner et al. Genes & Develop. 8: 1984, 1994; and Romero and
Blackburn, Cell 67: 343, 1994). Protein components have been
relatively refractory to isolation. Recently, the nucleotide
sequences of several protein components have been determined (an 80
kD/95 kD dimeric protein from Tetrahymena, WO 96/19580; and a 67 kD
protein from humans, WO 97/08314).
[0006] The present invention discloses nucleotide and amino acid
sequences of telomerase, uses of these sequences for diagnostics
and therapeutic uses, and further provides other related
advantages.
SUMMARY OF THE INVENTION
[0007] In one aspect, this invention generally provides isolated
nucleic acid molecules encoding vertebrate telomerase (including
variants thereof). Representative examples of vertebrates include
mammals such as humans, old world monkeys (e.g., macaques, chimps,
and baboons), dogs, rats, and mice, as well as non-mammalian
organisms such as birds. In a preferred embodiment, the nucleic
acid molecule encoding a vertebrate telomerase is provided, wherein
the nucleic acid molecule comprises the sequence presented in FIG.
1, or hybridizes under stringent conditions to the complement of
the sequence presented in FIG. 1, provided that the nucleic acid
molecule is not EST AA281296.
[0008] In other preferred embodiments, the nucleic acid molecule
comprises any of the sequences presented in FIG. 11 or encodes any
of the amino acid sequences presented in FIG. 11, or hybridizes
under normal stringency conditions to the complement of the
sequences thereof, provided that the nucleic acid molecule is not
EST AA281296. In other embodiments, the nucleic acid molecule
comprises any of the sequences presented in FIG. 10, or hybridizes
under normal stringency conditions to the complement of the
sequences thereof.
[0009] In another aspect, the invention provides an oligonucleotide
comprising from 10 to 100 contiguous nucleotides from the sequence
presented in FIG. 1 or its complement and from 10 to 100 contiguous
nucleotides from the sequences presented in FIG. 10 or the
complements thereof. The oligonucleotides may be labeled with a
detectable label.
[0010] In yet another aspect, an expression vector is provided,
comprising a heterologous promoter operably linked to a nucleic
acid molecule of human telomerase. The vector may be selected from
the group consisting of bacterial vectors, retroviral vectors,
adenoviral vectors and yeast vectors. Host cells containing such
vectors are also provided.
[0011] In another aspect, the invention provides an isolated
protein comprising a human telomerase protein. The protein may
comprise the amino acid sequence presented in FIG. 1 or variant
thereof or any of the amino acid sequences presented in FIG. 11 or
variant thereof. In a related aspect, the protein is a portion of a
human telomerase protein, which may derive from the sequences
presented in FIG. 1 or 11. In preferred embodiments, the portion is
from 10 to 100 amino acids long.
[0012] In other aspects, antibodies that specifically binds to
human telomerase protein or portions are provided.
[0013] In a preferred aspect, an oligonucleotide (e.g., a nucleic
acid probe or primer) is provided that is capable of specifically
hybridizing to a nucleic acid molecule encoding a human telomerase
under conditions of normal stringency. Within certain embodiments,
the nucleic acid molecule has a detectable label. Within certain
embodiments, the nucleic acid molecule is selected such that it
does not hybridize to nucleotides 1624-2012 presented in FIG. 1.
Within certain embodiments of the invention, the nucleic acid probe
or primer may differ from a wild-type telomerase sequence by one or
more nucleotides.
[0014] In a related aspect, the invention provides a pair of
oligonucleotide primers capable of specifically amplifying all or a
portion of a nucleic acid molecule encoding human telomerase. In
specific embodiments, the nucleic acid molecule comprises the
sequence presented in FIG. 1, FIG. 11, or complements thereof. In
preferred embodiments, the pair of primers is capable of
specifically amplifying sequence comprising all or a part of
alternative intron/exon 1, alternative intron/exon .alpha.,
alternative intron/exon .beta., alternative intron/exon 2,
alternative intron/exon 3, alternative intron/exon X or alternative
intron/exon Y. In a related aspect, the invention provides an
oligonucleotide that hybridizes specifically to a nucleic acid
sequence in alternative intron/exon 1, alternative intron/exon
.alpha., alternative intron/exon .beta., alternative intron/exon 2,
alternative intron/exon 3, alternative intron/exon X or alternative
intron/exon Y.
[0015] Methods for diagnosing cancer in a patent are also provided.
These methods comprise preparing tumor cDNA and amplifying the
tumor cDNA using primers that specifically amplify human telomerase
nucleic acid sequence, wherein the detection of telomerase nucleic
acid sequences is indicative of a diagnosis of cancer. The amount
of detected sequences may be comared to the amount of amplified
telomerase sequence to a control, wherein increase telomerase
nucleic acid sequences over the control is indicative of a
diagnosis of cancer.
[0016] In yet another aspect, a method of determining a pattern of
telomerase RNA expression in cells is provided, comprising
preparing cDNA from mRNA isolated from the cells, amplifying the
cDNA using primers according to claim 35, therefrom determining the
pattern of telomerase RNA expression. In preferred embodiments, the
method further comprises detecting the amplified product by
hybridization with an oligonucleotide having all or part of the
sequence of alternative intron/exon 1, alternative intron/exon
.alpha., alternative intron/exon .beta., alternative intron/exon 2,
alternative intron/exon 3, alternative intron/exon X or alternative
intron/exon Y. These methods may be used to diagnose cancer in a
patient, wherein the pattern is indicative of a diagnosis of
cancer.
[0017] The invention also provides non-human transgenic animals
whose cells contain a human telomerase gene that is operably linked
to a promoter effective for the expression of the gene. In
preferred embodiments, the animal is a mouse and the promoter is
tissue-specific. In a related aspect, the invention provides a
mouse whose cells have an endogenous telomerase gene disrupted by
homologous recombination with a nonfunctional telomerase gene,
wherein the mouse is unable to express endogenous telomerase.
[0018] The invention also provides inhibitors of human telomerase
activity, as well as assays for identifying inhibitors of
telomerase activity wherein the inhibitor binds to telomerase and
is not a nucleoside analogue. The inhibitor may be an antisense
nucleic acid complementary to human telomerase mRNA, a ribozyme and
the like. The inhibitors may be used to treat cancer.
[0019] Also provided are methods for identifying an effector of
telomerase activity, comprising the general steps of (a) adding a
candidate effector to a mixture of telomerase protein, RNA
component and template, wherein the telomerase protein is encoded
by an isolated nucleic acid molecule as described above; (b)
detecting telomerase activity, and (c) comparing the amount of
activity in step (b) to the amount of activity in a control mixture
without candidate effector, therefrom identifying an effector.
Within further embodiments the effector is an inhibitor. With yet
other embodiments the the nucleic acid molecule encodes human
telomerase.
[0020] These and other aspects of the present invention will become
evident upon reference to the following detailed description and
attached drawings. In addition, various references are set forth
below which describe in more detail certain procedures or
compositions (e.g., plasmids, etc.), and are therefore incorporated
by reference in their entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIGS. 1A-E present a DNA sequence (SEQ. ID No:1) and
predicted amino acid sequence (SEQ. ID No:2) of human
telomerase.
[0022] FIGS. 2A and 2B present an alignment of Euplotes aediculatus
p 123 (SEQ. ID No:3), yeast (EST2) (SEQ. ID No:4) and human (HT1)
telomerase protein (amino acids 29-1132; SEQ. ID NO:5) sequences.
Reverse transcriptase motifs are indicated. The region of high
homology among all three proteins is defined as the Telomerase
region. The sequences are aligned with ClustalW.
[0023] FIG. 3 is a scanned image of a Northern analysis showing
that the telomerase catalytic subunit is expressed in LIM 1215
colon carcinoma cells but not in CCD primary fibroblasts. An mRNA
of approximately 3.8 kb hybridizes to the hT1 probe. An additional
cross-hybridizing mRNA of higher molecular weight is indicated by
the top arrowhead. Cross-hybridization to ribosomal RNA present in
the polyA.sup.+ RNA preparation is indicated. The same blot is also
hybridized to a probe from the GAPDH gene as a loading control
(lower panel). Marker sizes are indicated in kb.
[0024] FIG. 4 is a scanned image of a Southern analysis showing
that the telomerase catalytic subunit is encoded by a single gene
and is not amplified in LIM 1215 cells. Genomic DNA isolated from
peripheral human blood and LIM 1215 cell line is probed with a hT1
probe. The blot also contains dilutions of probe plasmid to control
for the sensitivity of detection. The plasmid is diluted to
approximately 10, 5 and 1 genome equivalents. H, Hind III; E, Eco
RI; P, Pst I; X, Xba I; B, Bam HI.
[0025] FIG. 5 shows the results of amplification of cDNAs
synthesized from various tissues. Amplification is performed using
primers from the hT1 cDNA sequence and the products are blotted and
probed with a radiolabeled oligonucleotide from the hT1 sequence.
Amplification is also performed on the same samples with a pair of
primers from the .beta.-actin gene as a loading control. a: hT1
cDNA control; b: human genomic DNA control; c: no template control;
d: normal colon RNA; e: normal testis RNA; f: normal lymphocyte
RNA; g: melanoma RNA (cerebral metastasis); h: melanoma RNA
(subcutaneous ankle metastasis); i: melanoma RNA (liver
metastasis); j: melanoma RNA (lung metastasis); k: melanoma RNA
(axillary lymph node metastasis); l: melanoma RNA (skin
metastasis); m: breast carcinoma RNA; n: breast carcinoma RNA; o:
breast carcinoma RNA; p: breast carcinoma RNA.
[0026] FIG. 6 presents results showing hT1 expression in pre-crisis
cells and post-crisis cell lines. Upper panel: Nested amplification
using primers within the original EST. Lower panel: Control RT-PCR
using .beta.-actin primers. a: BET-3K passage (p) 7 (pre-crisis);
b: BET-3K p32 (post-crisis); c: BFT-3K p14 (pre-crisis); d: BFT-3K
p 22 (post-crisis); e: BFT-3B p15 (pre-crisis); f: BFT-3B p29
(post-crisis); g: GM897 (ALT); h: IIICF/c (ALT); i: IIICF-T/B1
(ALT); j: No template control.
[0027] FIGS. 7A-C show some alternative splicing patterns of the
hT1 transcript. A, Schematic representation of six splicing
variants. B, Combinations of some identified RNA variants (SEQ. ID
NOs:6-17). C, Sequences of putative exon/intron junctions of RNA
variants. Variants are marked as in part A. A complete DNA sequence
(with protein translation) (SEQ. ID NOs:16 and 17) of variant 3 is
presented. Amino acids corresponding to a potential c-Abl/SH3
binding site are underlined. Putative exon/intron junctions are
marked with .vertline. and sequence coordinates are as in FIG. 1.
Putative spliced exons are in lower case and putative unspliced
introns are in bold.
[0028] FIG. 8 shows various splicing patterns of hT1 transcript in
different tumor samples. Nested amplification (14 cycles) is
performed using HT2026F (SEQ ID No: 115) and HT2482R (SEQ ID No:
119) primers on primary RT-PCR products generated with HT1875F (SEQ
ID No: 112) and HT2781R (SEQ ID No: 121) primers. a: Lung
carcinoma; b: Lymphoma; c: Lung carcinoma; d: Medulloblastoma; e:
Lymphoma; f: Lymphoma; g: T47D; h: Pheochromocytoma; i: Lymphoma;
j: Glioma; k: Lymphoma; l: No template control.
[0029] FIG. 9 shows the results of amplification on cDNA
synthesized from LIM 1215 cDNA. As shown, reverse transcriptase
motif A is deleted from splicing variants containing alternative
intron/exon .alpha.. Primer combinations are: a, HTM2028F (SEQ ID
No: 116)+HT2356R (SEQ ID No: 118); b, HT2026F (SEQ ID No:
115)+HT2482R (SEQ ID No: 119); c, HTM2028F (SEQ ID No: 116)+HT2482R
(SEQ ID No: 119); d. HT2026F (SEQ ID No: 115)+HT2482R (SEQ ID No:
119).
[0030] FIGS. 10A-B present DNA sequences of variant regions of
telomerase (SEQ. ID NOs: 18-33).
[0031] FIGS. 11A-P presents DNA and amino acid sequences of
exemplary variant telomerase proteins (SEQ. ID NOs: 2, 34-86 and
155).
[0032] FIG. 12 is a scanned image of a telomerase activity
assay.
[0033] FIGS. 13A-D present a schematic diagram of plasmid pAK128.4
and the DNA sequence of the plasmid (SEQ ID NO:87).
[0034] FIGS. 14A-D present a schematic diagram of plasmid pAK128.7
and the DNA sequence of the plasmid (SEQ. ID NO:88).
[0035] FIGS. 15A-D present a schematic diagram of plasmid pAK128.14
and the DNA sequence of the plasmid (SEQ. ID NO:89).
DETAILED DESCRIPTION OF THE INVENTION
[0036] Prior to setting forth the invention, it may be helpful to
an understanding thereof to define certain terms used herein.
[0037] As used herein, "wild-type telomerase" generally refers to a
polypeptide that enzymatically synthesizes nucleic acid sequences
comprising simple repeat sequences (e.g., CCCTAA, see Zakian,
Science 270: 1601, 1995) to ends of chromosomes. The amino acid
sequence of one representative wild-type telomerase from human has
been deduced and is presented in FIG. 1 (SEQ ID NO:2). Within the
context of this invention, it should be understood that telomerases
of this invention include not only wild-type protein, but also
variants (including alleles) of the wild-type protein sequence.
Such variants may not necessarily exhibit enzymatic function.
Briefly, such variants may result from natural polymorphisms,
including RNA splice variants, generated by genetic recombination,
or be synthesized by recombinant methodology, and moreover, may
differ from wild-type protein by one or more amino acid
substitutions, insertions, deletions, rearrangements or the like.
Typically, when the result of synthesis, amino acid substitutions
are conservative, i.e., substitution of amino acids within groups
of polar, non-polar, aromatic, charged, etc. amino acids. In the
region of homology to the wild-type sequence in the RTase motif
regions variants will preferably have at least 90% amino acid
sequence identity, and within certain embodiments, greater than
92%, 95%, or 97% identity. Outside the RTase motif region, variants
will preferably have 75% amino acid identity, and within certain
embodiments, at least 80%, 85%, 90%, 92%, 95% or 97% identity.
[0038] As will be appreciated by those skilled in the art, a
nucleotide sequence encoding telomerase may differ from the
wild-type sequence presented in the Figures; due to codon
degeneracies, nucleotide polymorphisms, or amino acid differences.
In other embodiments, variants should preferably hybridize to the
wild-type nucleotide sequence at conditions of normal stringency,
which is approximately 25-30.degree. C. below Tm of the native
duplex (e.g., 1 M Na+ at 65.degree. C.; 5.times. SSPE, 0.5% SDS,
5.times. Denhardt's solution, at 65.degree. C. or equivalent
conditions; see generally, Sambrook et al. Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Press, 1987; Ausubel
et al., Current Protocols in Molecular Biology, Greene Publishing,
1987). Tm for other than short oligonucleotides can be calculated
by the formula T.sub.m=81.5+0.41% (G+C)-log(Na+). Low stringency
hybridizations are performed at conditions approximately 40.degree.
C. below Tm, and high stringency hybridizations are performed at
conditions approximately 10.degree. C. below Tm. Variants
preferably have at least 75% nucleotide identity to wild-type
sequence in the RTase motif region, preferably at least 80%, 85%,
and most preferably at least 90% nucleotide identity.
[0039] As used herein, a "promoter" refers to a nucleotide sequence
that contains elements that direct the transcription of a linked
gene. At minimum, a promoter contains an RNA polymerase binding
site. More typically, in eukaryotes, promoter sequences contain
binding sites for other transcriptional factors that control the
rate and timing of gene expression. Such sites include TATA box,
CAAT box, POU box, AP1 binding site, and the like. Promoter regions
may also contain enhancer elements. When a promoter is linked to a
gene so as to enable transcription of the gene, it is "operatively
linked".
[0040] An "isolated nucleic acid molecule" refers to a
polynucleotide molecule in the form of a separate fragment or as a
component of a larger nucleic acid construct, that has been
separated from its source cell (including the chromosome it
normally resides in) at least once in a substantially pure form.
Nucleic acid molecules may be comprised of a wide variety of
nucleotides, including DNA, RNA, nucleotide analogues, or some
combination of these.
[0041] I. Telomerase, Telomerase Genes and Gene Products
[0042] As noted above, the invention provides compositions relating
to vertebrate telomerase genes and gene products, and methods for
the use of the genes and gene products. Given the disclosure
provided herein, a telomerase gene can be isolated from a variety
of cell types that express telomerase, including immortalized or
transformed cells. As exemplified herein, a cDNA and variants
encoding telomerase from human cells are identified, isolated, and
characterized. Telomerase protein is then readily produced by host
cells transfected with an expression vector encoding
telomerase.
[0043] A. Isolation of Telomerase Gene
[0044] As described herein, the invention provides genes encoding
telomerase. Within one embodiment of the invention, a gene encoding
human telomerase can be identified by amplification of a cDNA
library using a primer pair designed from an EST sequence. The EST
sequence GenBank Accession No. AA281296, is identified by sequence
identity and similarity to a Euplotes aediculatus telomerase gene
(GenBank accession no. U95964; Lingner et al., Science 276: 561,
1997). Sequence comparisons between the Euplotes telomerase gene
and the EST show approximately 38% amino acid identity and 59%
amino acid similarity.
[0045] Telomerase genes may be isolated from genomic DNA or cDNA.
Genomic DNA is preferred when the promoter region or other flanking
regions are desired. Genomic DNA libraries constructed in
chromosomal vectors, such as YACs (yeast artificial chromosomes),
bacteriophage vectors, such as .lambda.EMBL3, .lambda.gt10,
cosmids, or plasmids, and cDNA libraries constructed in
bacteriophage vectors (e.g., .lambda.ZAPII), plasmids, or others,
are suitable for screening. Such libraries may be constructed using
methods and techniques known in the art (see Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press,
1989) or purchased from commercial sources (e.g., Clontech, Palo
Alto, Calif.). The DNA may be isolated from vertebrate cells, such
as human cells, mouse cells, other rodent or primatic cells, avian
cells, and the like.
[0046] Within one embodiment, the telomerase gene is isolated by
amplification using cDNA library DNA as templates. Using the
reported EST sequence, human telomerase may be isolated. Briefly,
sets of amplification primers are designed based upon the EST
nucleotide sequence. Examples of such primers are presented in
Table 2 (see also Example 1). Amplification of cDNA libraries made
from cells with high telomerase activity is preferred. The primers
described herein amplify a fragment that has a length predicted
from the EST sequence from a LIM1215 cDNA library. LIM1215 is a
human colon cancer cell line. Confirmation of the nature of the
fragment is obtained by DNA sequence analysis.
[0047] DNA fragments encompassing additional sequence are amplified
in reactions using a primer that hybridizes to vector sequence in
conjunction with one of the EST primers. By using vector primers
from either side of the cloning site in combination with the EST
primers, a 1.6 kb fragment derived from the 3' region of h-TEL
(human telomerase) and a 0.7 kb fragment derived from the 5' region
are isolated. These fragments are verified as containing telomerase
coding sequence by amplification with a pair of primers internal to
the EST sequence. The two fragments are cloned into pBluescript and
subjected to DNA sequence analysis. Additional DNA sequence is
obtained by C-RACE and amplification procedures to obtain the 5'
end of a cDNA as well as by hybridization and isolation of clones
from the cDNA library.
[0048] The compiled DNA sequence and predicted amino acid sequence
of a reference human telomerase are presented in FIG. 1. As shown,
the coding region of the reference telomerase is 3396 bases long
and has an approximately 620 base long 3' untranslated region. The
predicted amino acid sequence is 1132 amino acids long and may be
delineated into four major domains: N-terminal, basic, reverse
transcriptase (RT) and C-terminal. Furthermore, human telomerase
contains regions of homology to other telomerases (e.g., from
Euplotes and S. pombe) and reverse transcriptases. These motifs are
identified herein and in Kilian et al. (Human Molecular Genetics,
12: 2011-2019, 1997) as domains 1, 2, A, B, C, and D, in Nakamura
et al., (Science, 277: 955-959) as domains 1, 2, A, B', C, D, and
E, and in Meyerson et al. (Cell, 90: 785-795, 1997) as motifs 1-6.
Regardless of the name used, these motifs encompass amino acids
621-626 (motif 1) and 631-634 (motif 2), 708-720 (motif A), 827-839
(motif B), 863-871 (motif C), and 895-902 (motif D). Because the
boundaries of these motifs are based on similarity and identity
with other telomerases, the functional boundary of each motif may
be different.
[0049] In addition, variants of the reference telomerase sequence
are obtained by amplifications, which are described herein. Their
DNA and predicted amino acid sequences are presented in FIG. 11 and
discussed in further detail below. Briefly, some of these variants
encode truncated proteins and others have different C-terminal
sequences. These variants likely result from alternative RNA
splicing because telomerase appears to be a single copy gene in
humans (see Example 2).
[0050] Alternatively, other methods may be used to obtain a nucleic
acid molecule that encodes telomerase. For example, a nucleic acid
molecule encoding telomerase may be obtained from an expression
library by screening with an antibody or antibodies reactive to
telomerase (see, Sambrook et al. Molecular Cloning: A Laboratory
Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, NY, 1987;
Ausubel et al. Current Protocols in Molecular Biology, Greene
Publishing Associates and Wiley-Interscience, NY, 1995). In another
embodiment, nucleic acid molecules encoding telomerase may be
isolated by hybridization screening of cDNA or genomic libraries.
Oligonucleotides for hybridization screening may be designed based
on the DNA sequence of human telomerase presented herein.
Oligonucleotides for screening are typically at least 11 bases long
and more usually at least 20 or 25 bases long. In one embodiment,
the oligonucleotide is 20-30 bases long. Such an oligonucleotide
may be synthesized in an automated fashion. To facilitate
detection, the oligonucleotide may be conveniently labeled,
generally at the 5' end, with a reporter molecule, such as a
radionuclide, (e.g., .sup.32P), enzymatic label, protein label,
fluorescent label, or biotin. A library is generally plated as
colonies or phage, depending upon the vector, and the recombinant
DNA is transferred to nylon or nitrocellulose membranes.
Hybridization conditions are tailored to the length and GC content
of the oligonucleotide. Following denaturation, neutralization, and
fixation of the DNA to the membrane, membranes are hybridized with
labeled probe. Suitable hybridization conditions may be found in
Sambrook et al., supra, Ausubel et al., supra, and furthermore
hybridization solutions may contain additives such as
tetramethylammonium chloride or other chaotropic reagents or
hybotropic reagents to increase specificity of hybridization (see
for example, PCT/US97/17413). Following hybridization, suitable
detection methods reveal hybridizing colonies or phage that are
then isolated and propagated. Candidate clones or amplified
fragments may be verified as containing telomerase DNA by any of
various means. For example, the candidate clones may be hybridized
with a second, non-overlapping probe or subjected to DNA sequence
analysis. In these ways, clones containing a telomerase gene or
gene fragment, which are suitable for use in the present invention,
are isolated.
[0051] Telomerase DNA may also be obtained by amplification of cDNA
or genomic DNA. Oligonucleotide primers for amplification of a
full-length cDNA are preferably derived from sequences at the 5'
and 3' ends of the coding region. Amplification of genomic
sequences will use primers that span alternative intron/exon
sequences and may use conditions that favor long amplification
products (see Promega catalogue). Briefly, oligonucleotides used as
amplification primers preferably do not have self-complementary
sequences nor have complementary sequences at their 3' end (to
prevent primer-dimer formation). Preferably, the primers have a GC
content of about 50% and contain restriction sites to facilitate
cloning. Generally, primers are between 15 and 50 nucleotides long,
and more usually between 20 and 35 nucleotides long. The primers
are annealed to cDNA or genomic DNA and sufficient amplification
cycles are performed to yield a detectable product, preferably one
that is readily visualized by gel electrophoresis and staining. The
amplified fragment is purified and inserted into a vector (e.g., a
viral, phagemid or plasmid vector, such as .lambda.gt10 or
pBS(M13+)) and propagated.
[0052] Telomerase genes from a multitude of species can be isolated
using the compositions provided herein. For closely related
species, the human sequence or portion thereof may be utilized as a
probe on a genomic or cDNA library. For example, a fragment of the
telomerase gene that encompasses the catalytic site (approximately
corresponding to amino acids 605-915 of FIG. 1) may be labeled and
used as a probe on a library constructed from mouse, primate, rat,
dog, or other vertebrate, warm-blooded, or mammalian species. An
initial hybridization at normal stringency may yield clones or
fragments encoding telomerase. If no hybridization is observed,
relaxed (low) stringency hybridizations may be pursued. Guidelines
for varying the stringency of the hybridization may be acquired
from Sambrook et al., supra, and other well-known sources. Such
probes may also be used on libraries from evolutionarily diverse
species, such as Drosophila, although hybridization conditions will
typically be more relaxed.
[0053] Other methods may alternatively be used to isolate
telomerase genes from non-human species. These methods include, but
are not limited to, amplification using primers derived from
conserved areas (e.g., RTase motifs), amplification using
degenerate primers from various regions of telomerase including the
RTase region, antibody probing of expression libraries, telomerase
RNA probing of expression libraries, and the like. A gene sequence
is identified as a telomerase by amino acid similarity and/or
nucleic acid identity. Generally, amino acid similarity, which
allows for conservative differences, is preferred to identify a
telomerase. From diverse species, amino acid similarity is
generally at least 30% and preferably at least 40% or at least 50%.
Nucleic acid identity may be lower and thus difficult to assess.
Several readily available computer analysis programs, such as
BLASTN and BLASTP, are useful to determine relatedness of genes and
gene products. Candidate telomerase genes are examined for enzyme
activity by one of the functional assays described herein or other
equivalent assays.
[0054] B. Variant Telomerase Genes
[0055] Variants (including alleles) of the telomerase nucleic acid
or amino acid sequence provided herein may be readily isolated from
natural variants (e.g., polymorphisms, splice variants, mutants),
synthesized, or constructed. Depending upon the intended use,
mutants may be constructed to exhibit altered or deficient
telomerase function. Particularly useful telomerase genes encode a
protein lacking enzyme activity but that has a dominant negative
phenotype. The telomerase variants, moreover, may lack one or more
of known telomerase activities, including reverse transcriptase
activity, nucleolytic activity, telomere binding activity, dNTP
binding activity, and telomerase RNA (hTR) binding activity.
[0056] One skilled in the art recognizes that many methods have
been developed for generating mutants (see, generally, Sambrook et
al., supra; Ausubel et al., supra). Briefly, preferred methods for
generating a few nucleotide substitutions utilize an
oligonucleotide that spans the base or bases to be mutated and
contains the mutated base or bases. The oligonucleotide is
hybridized to complementary single stranded nucleic acid and second
strand synthesis is primed from the oligonucleotide. Similarly,
deletions and/or insertions may be constructed by any of a variety
of known methods. For example, the gene can be digested with
restriction enzymes and religated such that some sequence is
deleted or ligated with an isolated fragment having cohesive ends
so that an insertion or large substitution is made. In another
embodiment, variants are generated by "exon shuffling" (see U.S.
Pat. No. 5,605,793). Variant sequences may also be generated by
"molecular evolution" techniques (see U.S. Pat. No. 5,723,323).
Other means to generate variant sequences may be found, for
example, in Sambrook et al. (supra) and Ausubel et al. (supra).
Verification of variant sequences is typically accomplished by
restriction enzyme mapping, sequence analysis, or probe
hybridization, although other methods may be used. The
double-stranded nucleic acid is transformed into host cells,
typically E. coli, but alternatively, other prokaryotes, yeast, or
larger eukaryotes may be used. Standard screening protocols, such
as nucleic acid hybridization, amplification, and DNA sequence
analysis, will identify mutant sequences.
[0057] In preferred embodiments, variant telomerases are inactive
with respect to enzyme activity and impart a dominant negative
phenotype to a host cell. Regardless of the actual mechanism, when
a dominant negative telomerase is expressed in a cell, the native
active telomerase is rendered inactive. In the catalytic domain,
RTase motifs share conserved aspartic acid residues. Human
telomerase also contains these critical residues: Asp 712, Asp 718,
Asp 868, and Asp 869. Mutation of one or more of these Asp residues
to a non-conservative amino acid (e.g., alanine) will likely
destroy enzymatic activity and or affect telomere shortening. For
each of these mutants, dominant negativity is assayed. Preferred
mutants are dominant negative and induce a senescence phenotype in
certain embodiments. Other dominant negative variants may be
generated by deletion of one or more of the RTase motifs or
alteration of the region involved in DNA priming (such as motif E),
binding site for the RNA component, the template binding site, the
metal ion binding site (such as motif C), and the like.
[0058] In other embodiments, the nucleic acid molecule encoding
telomerase may be fused to another nucleic acid molecule. As will
be appreciated, the fusion partner gene may contribute, within
certain embodiments, a coding region. Thus, it may be desirable to
use only the catalytic site of telomerase (e.g., amino acids
609-915), individual RTase motifs (described above), any of the
splicing variant telomerases described herein, the telomerase RNA
binding site and the like. The choice of the fusion partner depends
in part upon the desired application. The fusion partner may be
used to alter specificity of the telomerase, provide a reporter
function, provide a tag sequence for identification or purification
protocols, and the like. The reporter or tag can be any protein
that allows convenient and sensitive measurement or facilitates
isolation of the gene product and does not interfere with the
function of the telomerase. For reporter function,
.beta.-glucuronidase (U.S. Pat. No. 5,268,463), green fluorescent
protein and .beta.-galactosidase are readily available as DNA
sequences. A peptide tag is a short sequence, usually derived from
a native protein, which is recognized by an antibody or other
molecule. Peptide tags include FLAG.RTM., Glu-Glu tag (Chiron
Corp., Emeryville, Calif.) KT3 tag (Chiron Corp.), T7 gene 10 tag
(Invitrogen, La Jolla, Calif.), T7 major capsid protein tag
(Novagen, Madison, Wis.), His.sub.6 (hexa-His), and HSV tag
(Novagen). Besides tags, other types of proteins or peptides, such
as glutathione-S-transferase may be used.
[0059] C. Fragments and Oligonucleotide Derived from Telomerase
Genes
[0060] In addition, portions or fragments of telomerase gene may be
isolated or constructed for use in the present invention. For
example, restriction fragments can be isolated by well-known
techniques from template DNA, e.g., plasmid DNA, and DNA fragments,
including restriction fragments, can be generated by amplification.
Furthermore, oligonucleotides can be synthesized or isolated from
recombinant DNA molecules. One skilled in the art will appreciated
that other methods are available to obtain DNA or RNA molecules
having at least a portion of a telomerase sequence. Moreover, for
particular applications, these nucleic acids may be labeled by
techniques known in the art with a radiolabel (e.g., .sup.32P,
.sup.33P, .sup.35S, .sup.125I, .sup.131I, .sup.3H, .sup.14C),
fluorescent label (e.g., FITC, Cy5, RITC, Texas Red),
chemiluminescent label, enzyme, biotin and the like.
[0061] Methods for obtaining fragments are well-known in the art.
Portions that are particularly useful within the context of this
invention contain the catalytic site, individual RTase motifs, the
putative alternative intron/exon sequences (see FIG. 10), and the
like. Oligonucleotides are generally synthesized by automated
fashion; methods and apparatus for synthesis are readily available
(e.g., Applied Biosystems Inc, CA). Oligonucleotides may contain
non-naturally occurring nucleotides, such as nucleotide analogues,
a modified backbone (e.g., peptide backbone), nucleotide
derivatives (e.g., biotinylated nucleotide), and the like. As used
herein, oligonucleotides refers to a nucleic acid sequence of at
least about 7 nucleotides and generally not longer than about 100
nucleotides. Usually, oligonucleotides are between about 10 and
about 50 bases, more often between about 18 and about 35
nucleotides long. Oligonucleotides can be single-stranded or in
some cases double-stranded. As used herein, portions of a nucleic
acid refer to a polynucleotide that contains less than the entire
parental nucleic acid sequence. For example, a portion of
telomerase coding sequence contains less than a full-length
telomerase sequence. A `portion` is generally at least about seven
nucleotides, and may be as many as 10, 20, 25 or more nucleotides
in length. A fragment refers to a polynucleotide molecule of any
length and can encompass an oligonucleotide, although more usually,
but not to be limiting, the term oligonucleotide is used to denote
short polynucleotides and the term fragment is used to denote
longer polynucleotides.
[0062] Oligonucleotides for use as primers for amplification and
probes for hybridization screening may be designed based on the DNA
sequence of human telomerase presented herein. Oligonucleotide
primers for amplification of a full-length cDNA are preferably
derived from sequences at the 5' and 3' ends. Primers for
amplification of specific regions are chosen to generate products
of an easily detectable size. In preferred embodiments, primers are
chosen that flank the sequences subject to alternative RNA
splicing. In preferred embodiments, one set of primers is chosen
such that both the product that spans spliced-in sequence as well
as the product that spans spliced-out sequence are suitable sizes
to be detected under the same reaction conditions. In other
embodiments, two sets of primers are used to detect the alternative
spliced RNAs. For example, one set of primers flanks the splice
junction in order to detect a spliced-out product. The second set
of primers may be derived very close to the junction (such that a
spliced-out amplification product is the same size or barely larger
than a primer-dimer length) or one or more of the set may be
derived from the spliced-in sequence (such that the spliced-out RNA
would not yield any product).
[0063] Amplification primers preferably do not have
self-complementary sequences nor have complementary sequences at
their 3' end (to prevent primer-dimer formation). Preferably, the
primers have a GC content of about 50% and may contain restriction
sites to facilitate cloning. Amplification primers usually are at
least 15 bases and usually are not longer than 50 bases, although
in some circumstances and conditions shorter or longer lengths can
be used. More usually, primers are from 17 to 40 bases long, 17 to
35 bases long, or 20 to 30 bases long. The primers are annealed to
cDNA or genomic DNA and sufficient amplification cycles, generally
20-40 cycles, are performed to yield a product readily visualized
by gel electrophoresis and staining or by hybridization. The
amplified fragment can be purified and inserted into a vector, such
as .lambda.gt10 or pBS(M13+), and propagated, isolated and
subjected to DNA sequence analysis, subjected to hybridization, or
the like.
[0064] An oligonucleotide hybridization probe suitable for
screening genomic, cDNA or other types (e.g., mutant telomerase
sequences) of libraries, probing southern, northern, or
northwestern blots, amplification products, and the like may be
designed based on the sequences provided herein. Oligonucleotides
for hybridization are typically at least 11 bases long, generally
less than 100 bases long, and preferably at least 15 bases long, at
least 20 bases long, at least 25 bases long, and preferably 20-70,
25-50, or 30-40 bases long. To facilitate detection, the
oligonucleotide may be conveniently labeled, generally at the 5'
end, with a reporter molecule, such as a radionuclide, (e.g.,
.sup.32P), enzymatic label, protein label, fluorescent label, or
biotin. (see Ausubel et al., and Sambrook et al., supra). A library
is generally plated as colonies or phage, depending upon the
vector, and the recombinant DNA is transferred to nylon or
nitrocellulose membranes. Following denaturation, neutralization,
and fixation of the DNA to the membrane, membranes are hybridized
with labeled probe, and washed. Suitable detection methods reveal
hybridizing colonies or phage that are then isolated and
propagated. Methods for transferring nucleic acids to membranes and
performing hybridizations are well known. In certain embodiments,
additives to hybridization solution, such as a chaotrope (e.g.,
tetramethylammonium chloride) or a hybotrope (e.g., ammonium
trichloroacetate; see PCT/US97/17413) are added to increase
sensitivity and specificity of hybridization. A probe specifically
hybridizes to a nucleic acid if it remains detectably annealed
after washing under conditions equivalent to hybridization
conditions (expressed herein as the number of degrees less than
Tm).
[0065] D. Splicing Variants of Human Telomerase
[0066] In addition to the reference telomerase DNA and protein
sequences presented in FIG. 1, several RNA splice variants are
observed. Although some of the variants may reflect incompletely
processed mRNA, it is noteworthy that such variants are abundant in
an RNA sample (LIM1215) preselected for polyadenylated mRNA. These
findings, together with their clustering in the RT domain, suggest
that the insertion variants more likely reflect regulation of hT1
protein expression. For example, variants (see .alpha., .beta.,
FIG. 7) are likely alternative mature coding for variant proteins.
Because these regions are alternatively spliced in or out in the
splice variants disclosed herein they are referred to as
alternative intron/exon 1, 2, 3, .alpha., .beta., X and Y.
Additional evidence in support of alternative proteins comes from
sequence analysis of cDNA clones identified in a LIM1215 cDNA
library that contained both deletions and insertions compared to
the reference sequence.
[0067] At least seven different putative alternative intron/exons
appear to be retained in mRNAs (see FIG. 7, which displays 6 of the
7 alternative intron/exons). The alternative intron/exons may be
independently retained, thus, a particular mRNA may have none, any
one, two, etc. up to seven alternative intron/exons. The maximum
number of different mRNAs resulting from seven independently
spliced alternative intron/exons is 2.sup.7, or 128 different
mRNAs. DNA sequences of these alternative intron/exons are
presented in FIG. 10. The 5' most alternative intron/exon, called
alternative intron/exon "X", is an unknown length, and only a
partial sequence is presented.
[0068] The reference telomerase sequence (FIG. 1) includes
alternative intron/exon .alpha. and alternative intron/exon .beta..
In the following discussion, the effect of presence/absence and
location of each alternative intron/exon is presented on the basis
that it is the only alteration. It will be appreciated that a
particular alternative intron/exon may alter the sequence of the
translated product, regardless of whether other alternative
intron/exons are spliced in or out. For example, the presence of
alternative intron/exon 1 results in a frameshift and truncated
protein, regardless of whether alternative intron/exons .alpha.,
.beta., 2 or 3 are spliced in or out.
[0069] The presence of alternative intron/exon "X" results in a
truncated protein that contains approximately 600 N-terminal amino
acids and lacks all of the RTase motifs. The presence of
alternative intron/exon "Y" at base 222 results in a frameshifted
protein that terminates within three codons past the alternative
intron/exon. As the Y alternative intron/exon is very GC rich,
approximately 78%, which is difficult to sequence, it is possible
that alternative intron/exon Y causes an insertion of about 35
amino acids and not a frameshift.
[0070] Alternative intron/exon 1 at nucleotide 1950 is 38 bp and
its presence in mRNA causes a frame-shift and ultimate translation
of a truncated protein (stop codon at nt 1973). This truncated
protein contains only RTase domains 1 and 2.
[0071] Alternative intron/exon .alpha., located from bases
2131-2166 is frequently observed spliced out of telomerase mRNA. A
protein translated from such an RNA is deleted for 12 amino acids,
removing nearly all of RTase motif A. This motif appears to be
critical for RT function; a single amino acid mutation within this
domain in the yeast EST2 protein results in a protein that
functions as a dominant negative and results in cellular senescence
and telomere shortening.
[0072] Another of the variant sequences, the alternative
intron/exon .beta. deletion at base 2286-2468, encodes a truncated
protein, due to a reading frameshift at base 2287, which is joined
to base 2469, and subsequently a termination codon at base 2605.
This variant protein has RTase domains 1, 2, A, B, and part of C,
but lacks another motif; in addition to the RTase domain motifs,
another sequence motif (AVRIRGKS SEQ. ID NO:90) identified in the P
insert of hT1 matches a P-loop motif consensus AXXXXGK(S) (SEQ. ID
NO:91) (Saraste et al., Trends Biochem. Sci. 15, 430-434, 1990).
This motif is found in a large number of protein families including
a number of kinases, bacterial dnaA, recA, recF, mutS and
ATP-binding helicases (Devereaux et al., Nucleic Acids Res., 12,
387-395, 1984). The P-loop is thus present only in a subpopulation
of the h-TEL mRNAs in most RNA samples analyzed and completely
absent from several tumor samples (FIG. 8).
[0073] Alternative intron/exon 2 at base 2843 contains an in-frame
termination codon, resulting in a truncated protein that has the
entire RTase domain region, but lacks the C-terminus. As the
C-terminus may play a regulatory role, protein activity will likely
be affected. When alternative intron/exon 3 is retained, a smaller
protein is also produced because the alternative intron/exon
contains an in-frame stop codon. Thus, the protein has an altered
C-terminal sequence. What activity such proteins might have is
currently unknown. The crystal structure of the HIV-1 reverse
transcriptase demonstrates that a short form of the protein (p51)
that lacks the RNAase domain is inhibited by the C-terminal
`connection` folding into the catalytic cleft. If hT1 is assumed to
adopt a similar structure to HIV-RT, then C-terminal hT1 protein
variants may reflect a similar mechanism of regulation.
[0074] In addition to variants that lack the reference C-terminal
domain, a variant with alternative intron/exon 3 at base 2157
expresses an alternative C-terminal domain. Furthermore, the coding
region donated by alternative intron/exon 3 has a potential SH3
binding site, SGQPEMEPPRRPSGCVG (SEQ. ID NO:92), which matches the
consensus c-Ab1 SH3 binding peptide (PXXXXPXXP SEQ. ID NO:93) found
in proteins such as ataxia telangiectasia mutated (ATM). A second
example of this motif is found within the N-terminal end of the hT1
protein in the peptide HAGPPSTSRPPRPWDTP (SEQ. ID NO:94). Other
alternative C-terminal domains are found in telomerase cDNAs; the
EST12462 (GenBank Accession No. AA299878) has about 50 bases of
identical sequence up to base 2157 and then diverges from the
reference telomerase sequence as well as alternative intron/exon 3.
This new sequence has an internal stop codon in 50 bases that would
result in a truncated C-terminus.
[0075] The variant detected in one ALT cell line (FIG. 6, lane i)
opens up the possibility that the basic domain of hT1 may
contribute to the ALT mechanism in at least some ALT cell lines.
Interestingly, this ALT cell line expresses the hTR gene. One
possible mechanism of ALT could involve dysregulated telomerase
components that are inactive in the TRAP assay.
[0076] The following table summarizes the splice variants and
resulting proteins. For simplicity, only a single variant is listed
for each resulting protein. Furthermore, as noted above, the
presence of the alternative intron/exon Y appears to cause a
frameshift resulting in a truncated protein, but may cause an
insertion. Thus, each reading frame of the alternative intron/exon
Y is presented and the table is constructed as if the insertion
does not cause a truncated protein. An independent assortment of
these known alternative intron/exons would lead to 128 different
mRNA sequences. The DNA and amino acid sequences for the variants
in Table 1 are presented in FIG. 11.
1 TABLE 1 Insert sequences Protein Y 1 .alpha. .beta. 2 3 truncated
#1 0 + 0 0 0 0 truncated #2 0 0 + 0 0 0 reference protein 0 0 + + 0
0 truncated #3 0 0 + + + 0 altered C-terminus 0 0 + + 0 + lacks
motif A 0 0 0 + 0 0 truncated #3; lacks motif A 0 0 0 + + 0 lacks
motif A; 0 0 0 + 0 + altered C-terminus truncated #1 (ver 2) + + 0
0 0 0 truncated #2 (ver 2) + 0 + 0 0 0 reference protein (ver 2) +
0 + + 0 0 truncated #3 (ver 2) + 0 + + + 0 altered C-terminus (ver
2) + 0 + + 0 + lacks motif A (ver 2) + 0 0 + 0 0 truncated #3 (ver
2) + 0 0 + + 0 lacks motif A; + 0 0 + 0 + altered C-terminus (ver
2)
[0077] E. Vectors, Host Cells and Means of Expressing and Producing
Protein
[0078] Telomerase protein may be expressed in a variety of host
organisms. In one embodiment, telomerase is produced in bacteria,
such as E. coli, for which many expression vectors have been
developed and are readily available. Other suitable host organisms
include other bacterial species, and eukaryotes, such as yeast
(e.g., Saccharomyces cerevisiae), mammalian cells (e.g., CHO and
COS-7), and insect cells (e.g., Sf9).
[0079] A DNA sequence encoding telomerase, a portion thereof, a
variant, fusion protein or the like, is introduced into an
expression vector appropriate for the host. In certain embodiments,
telomerase is inserted into a vector such that a fusion protein is
produced. The telomerase sequence is derived from an existing
fragment, cDNA clone, or synthesized. A preferred means of
synthesis is amplification of the gene from cDNA using a set of
primers that flank the coding region or the desired portion of the
protein. As discussed above, the telomerase sequence may contain
alternative codons for each amino acid with multiple codons. The
alternative codons can be chosen as "optimal" for the host species.
Restriction sites are typically incorporated into the primer
sequences and are chosen with regard to the cloning site of the
vector. If necessary, translational initiation and termination
codons can be engineered into the primer sequences.
[0080] At minimum, the vector must contain a promoter sequence.
Other regulatory sequences may be included. Such sequences include
a transcription termination signal sequence, secretion signal
sequence, origin of replication, selectable marker, and the like.
The regulatory sequences are operationally associated with one
another to allow transcription or translation.
[0081] The plasmids used herein for expression of telomerase
include a promoter designed for expression of the proteins in a
host cell (e.g., bacterial). Suitable promoters are widely
available and are well known in the art. Inducible or constitutive
promoters are preferred. Such promoters for expression in bacteria
include promoters from the T7 phage and other phages, such as T3,
T5, and SP6, and the trp, lpp, and lac operons. Hybrid promoters
(see, U.S. Pat. No. 4,551,433), such as tac and trc, may also be
used. Promoters for expression in eukaryotic cells include the P10
or polyhedron gene promoter of baculovirus/insect cell expression
systems (see, e.g., U.S. Pat. Nos. 5,243,041, 5,242,687, 5,266,317,
4,745,051, and 5,169,784), MMTV LTR, CMV IE promoter, RSV LTR,
SV40, metallothionein promoter (see, e.g., U.S. Pat. No. 4,870,009)
and other inducible promoters. For expression of the proteins, a
promoter is inserted in operative linkage with the coding region
for the telomerase protein.
[0082] The promoter controlling transcription of the telomerase may
itself be controlled by a repressor. In some systems, the promoter
can be derepressed by altering the physiological conditions of the
cell, for example, by the addition of a molecule that competitively
binds the repressor, or by altering the temperature of the growth
media. Preferred repressor proteins include, but are not limited
to, the E. coli lacI repressor, which is responsive to IPTG
induction, the temperature sensitive .lambda.cI857 repressor, and
the like. The E. coli lacI repressor is preferred.
[0083] In other preferred embodiments, the vector also includes a
transcription terminator sequence, which has either a sequence that
provides a signal that terminates transcription by the polymerase
that recognizes the selected promoter and/or a signal sequence for
polyadenylation.
[0084] Preferably, the vector is capable of replication in the host
cells. Thus, when the host cell is a bacterium, the vector
preferably contains a bacterial origin of replication. Preferred
bacterial origins of replication include the fl-ori and col E1
origins of replication, especially the ori derived from pUC
plasmids. In yeast, ARS or CEN sequences can be used to assure
replication. A well-used system in mammalian cells is SV40 ori.
[0085] The plasmids also preferably include at least one selectable
marker that is functional in the host. A selectable marker gene
includes any gene that confers a phenotype on the host that allows
transformed cells to be identified and selectively grown. Suitable
selectable marker genes for bacterial hosts include the ampicillin
resistance gene (Amp.sup.r), tetracycline resistance gene
(Tc.sup.r) and the kanamycin resistance gene (Kan.sup.r). The
kanamycin resistance gene is presently preferred. Suitable markers
for eukaryotes usually require a complementary deficiency in the
host (e.g., thymidine kinase (tk) in tk- hosts). However, drug
markers are also available (e.g., G418 resistance and hygromycin
resistance).
[0086] The sequence of nucleotides encoding the telomerase may also
include a secretion signal, whereby the resulting peptide is a
synthesized as precursor protein and is subsequently processed and
secreted. The resulting processed protein may be recovered from
periplasmic space or fermentation medium. Secretion signals
suitable for use are widely available and are well known in the art
(von Heijne, J. Mol. Biol. 184:99-105, 1985). Prokaryotic and
eukaryotic secretion signals that are functional in E. coli (or
other host) may be employed. The presently preferred secretion
signals include, but are not limited to, those encoded by the
following E. coli genes: pelB (Lei et al., J. Bacteriol. 169:4379,
1987), phoA, ompA, ompT, ompF, ompC, beta-lactamase, and alkaline
phosphatase.
[0087] One skilled in the art appreciates that there are a wide
variety of suitable vectors for expression in bacterial cells and
which are readily obtainable. Vectors such as the pET series
(Novagen, Madison, Wis.), the tac and trc series (Pharmacia,
Uppsala, Sweden), pTTQ 18 (Amersham International plc, England),
pACYC 177, pGEX series, and the like are suitable for expression of
a telomerase. Baculovirus vectors, such as pBlueBac (see, e.g.,
U.S. Pat. Nos. 5,278,050, 5,244,805, 5,243,041, 5,242,687,
5,266,317, 4,745,051, and 5,169,784; available from Invitrogen, San
Diego) may be used for expression of the telomerase in insect
cells, such as Spodoptera frugiperda sf9 cells (see, U.S. Pat. No.
4,745,051). The choice of a host for the expression of a telomerase
is dictated in part by the vector. Commercially available vectors
are paired with suitable hosts.
[0088] A wide variety of suitable vectors for expression in
eukaryotic cells are available. Such vectors include pCMVLacI, pXT1
(Stratagene Cloning Systems, La Jolla, Calif.); pCDNA series, pREP
series, pEBVHis (Invitrogen, Carlsbad, Calif.). In certain
embodiments, telomerase gene is cloned into a gene targeting
vector, such as pMClneo, a pOG series vector (Stragene).
[0089] Telomerase protein is isolated by standard methods, such as
affinity chromatography, size exclusion chromatography, metal ion
chromatography, ionic exchange chromatography, HPLC, and other
known protein isolation methods. (see generally Ausubel et al.,
supra; Sambrook et al., supra). An isolated purified protein gives
a single band on SDS-PAGE when stained with Coomassie blue.
[0090] In one embodiment, the telomerase protein is expressed as a
hexa-his fusion protein and isolated by metal-containing
chromatography, such as nickel-coupled beads. Briefly, a sequence
encoding His.sub.6 is linked to a DNA sequence encoding a
telomerase. Although the His.sub.6 sequence can be positioned
anywhere in the molecule, preferably it is linked at the 3' end
immediately preceding the termination codon. The His-hTI fusion may
be constructed by any of a variety of methods. A convenient method
is amplification of the TEL gene using a downstream primer that
contains the codons for His.sub.6.
[0091] F. Peptides and Proteins of Telomerase
[0092] In one aspect of the present invention, peptides having
telomerase sequence are provided. Peptides may be used as
immunogens to raise antibodies, as inhibitors or enhancers of
telomerase function, in assays described herein and the like.
Peptides are generally five to 100 amino acids long, and more
usually 10 to 50 amino acids. Peptides are readily chemically
synthesized in an automated fashion (PerkinElmer ABI Peptide
Synthesizer) or may be obtained commercially. Peptides may be
further purified by a variety of methods, including
high-performance liquid chromatography. Furthermore, peptides and
proteins may contain amino acids other than the 20 naturally
occurring amino acids or may contain derivatives and modification
of the amino acids.
[0093] Peptides of particular interest within the context of this
invention have the sequence of the alternative intron/exon
sequences (FIG. 10), the RTase motifs, and the like. In certain
embodiments, telomerase proteins have the amino acid sequences
presented in FIG. 1 or 11, or a portion thereof which is at least 8
amino acids in length (and may be 10, 15, 20 or more amino acids in
length). In other embodiments, the protein has one or more amino
acid substitutions, additions, deletions. In yet other embodiments,
the protein has an amino acid sequence determined by a nucleic acid
sequence that hybridizes under normal stringency conditions to the
complement of any of the sequences in FIG. 11. As indicated above,
variants of telomerase include allelic variants.
[0094] II. Telomerase Assays
[0095] A variety of assays are available to determine telomerase
activity and expression. Such assays include in vitro assays that
measure the ability of telomerase to extend a telomeric DNA
substrate, nucleolytic activity, primer (telomere) binding
activity, dNTP binding activity, telomerase RNA (hTR) binding
activity, in vivo gain-of-function assays, in vivo loss-of function
assays, in situ hybridization, RNase probe protection, Northern
analysis, amplification of cDNA, antibody staining, and the
like.
[0096] A. Assays for Catalytic Activity
[0097] Various assays for catalytic activity are described in U.S.
Pat. Nos. 5,629,154; 5,639,613; 5,645,986 among others. In one
conventional assay for telomerase activity, a single-stranded DNA
primer having the sequence of the host telomere (e.g.,
[TTAGGG].sub.n) and the telomerase enzyme are used (see Shay et
al., Methods in Molecular Genetics 5:263, 1994; Greider and
Blackburn, Cell 43:405, 1985; Morin, Cell 59:521, 1989; U.S. Pat.
No. 5,629,154). A preferred assay incorporates a detergent-based
extraction with an amplification-based assay. This assay, called
TRAP (telomeric repeats amplification protocol), has improved
sensitivity (Kim et al., Science 266: 2011, 1994). Briefly, in
TRAP, telomerase synthesizes extension products, which then serve
as templates for amplification. The telomerase products are
amplified with a primer derived from a non-telomeric region of the
oligonucleotide and a primer derived from the telomeric region.
When the amplification products are analyzed, such as by gel
electrophoresis, a ladder of products is observed when telomerase
activity is present. Permutations of this assay have been described
(Krupp et al., Nuc. Acids Res. 25: 919, 1997; Savoysky et al., Nuc.
Acids Res. 24: 1175, 1996). As well, other telomerase assays are
available (Faraoni et al., J. Chemother 8: 394, 1996, describing an
in vitro chemosensitivity assay; Tatematsu et al., Oncogene 13:
2265, 1996, describing a "stretch PCR assay"; Lin and Zakian, Cell
81: 1127, 1995, describing an in vitro assay for
Saccharomyces).
[0098] In addition, catalytic or other activities may be measured
by an in vitro reconstitution system (see Examples). Briefly, the
assays, such as those described herein, are performed using
purified telomerase protein that is produced by recombinant meant
and other necessary components, such as the telomerase RNA
component, other proteins such as described in WO 98/14593.
[0099] B. Assays for Other Activities
[0100] Nucleolytic activity may be assessed by protocols described
for example in Collins and Grieder, Genes and Development 7: 1364,
1993). The nucleolytic activity is excision of a nucleotide (G from
the telomeric repeat TTAGG) from the 3' end of a nucleotide
sequence that is positioned at the 5' boundary of the DNA template.
Briefly, the activity can be measured by a reaction that uses a
nucleic acid template with a 3' nucleotide that is blocking, i.e.,
cannot serve as a primer for a polymerase, unless removed by
nucleolytic activity.
[0101] Telomere binding activity and assays are described in for
example Harrington et al., J. Biol. Chem. 270: 8893, 1995. In
general, any assay such as a gel-shift assay, that detects
protein-nucleic acid interactions may be used. DNTP and RNA binding
activity assays are described in Morin, Eur. J. Cancer 33: 750 for
example.
[0102] C. Gain and Loss of Function
[0103] In vivo gain-of-function assays may be performed by
transfecting an expression vector encoding telomerase into cells
that have no or little detectable endogenous activity. Activity is
then measured by an in vitro assay, such as those described herein.
Another gain of function assay can be performed in tumor cells or
other cells expressing telomerase or reverse transcriptase. A
telomerase gene is transfected into the cells, expressed at high
levels, and these cells are treated with inhibitors of reverse
transcriptase. Telomerase activity is then observed as decreased
sensitivity to such inhibitors. Furthermore, rescue of function in
the yeast telomerase mutant EST2 may be measured.
[0104] Loss of function may be measured in cells expressing high
levels of telomerase activity, such as LIM 1215 cells or other
tumor cells. In this assay, anti-sense oligonucleotide molecules
are introduced into the cells, generally in an expression vector.
Telomerase gene is verified by diminished telomerase activity. In
another assay, antibodies to telomerase that inhibit function can
be used to demonstrate a functional molecule.
[0105] D. Expression of Telomerase
[0106] Expression of telomerase in various cells may be assayed by
standard assays using the sequences provided herein. For example,
in situ hybridization with radioactive or fluorescent-labeled
probes (fragments or oligonucleotides) may be used on tissue
sections or fixed cells. Alternatively, RNA may be isolated from
the cells and used in Northern, RNase probe protection assays, and
the like. Probes for particular regions and probes that are variant
specific will generate expression profiles of the various
telomerase transcripts.
[0107] In a preferred embodiment, telomerase expression is assayed
by amplification. Primer pairs for telomerase, including primer
pairs for particular variants, are used to amplify cDNA synthesized
from cellular RNA. The cDNA may be synthesized from either total
RNA or poly(A)+ RNA. Methods and protocols for RNA isolation are
well known. The cDNA may be initiated by an oligo(dT) primer,
random primers (e.g., dN.sub.6), telomerase specific primer, and
the like. The choice of a primer will depend at least in part on
the quantity of RNA and the purpose of the assay. Amplification
primers are designed to amplify any one of, particular
combinations, or all of the variants present in vertebrate cells.
Conditions for amplification are chosen to be commensurate with the
primer length, base content, length of amplified product and the
like. Various amplification systems are available (see Lee et al.,
Nucleic Acid Amplification Technologies, BioTechniques Books, Eaton
Publishing, Natick, Mass., 1997; Larrick, The PCR Technique:
Quantitative PCR, BioTechniques Books, Eaton Publishing, Natick,
Mass., 1997).
[0108] Other assays for measuring expression qualitatively and
quantitatively are well known. RNase probe protection and Northern
analysis are amenable when the amount of telomerase mRNA is
sufficient. When very few cells are available, a single cell
analysis is desirable, or when the fraction of telomerase RNA in
the sample is very low, an amplification protocol is preferred.
RNase probe protection, in particular, is well suited for detecting
splice variants, mutations, as well as quantitating these RNAs.
[0109] As discussed above, in preferred embodiments, expression of
the various RNA species is monitored. The different species may be
assayed by any method which distinguishes one of the species over
the others. Thus, length determination by Northern, RNase probe
protection, cloning and amplification are some of the available
methods. In preferred embodiments, RNase probe protection and
amplification are used. For RNase probe protection, the probe will
generally be a fragment derived from the junction of the reference
sequence and the alternative intron/exon sequence or derived from
the sequence surrounding the alternative intron/exon insertion
site. For example, a fragment of the reference telomerase that
spans nucleotide 1950-1951 (e.g., nucleotides 1910-1980) will
protect the reference sequence as a 71 base fragment, but will
protect a telomerase with alternative intron/exon 1 as two
fragments of 41 and 30 bases. In contrast, a fragment that contains
nucleotides 1910-1950 and 30 bases of alternative intron/exon 1
will protect an alternative intron/exon 1 variant as a 71 base
fragment and the reference telomerase as a 41 base fragment.
Fragments for RNase probe protection are chosen usually in the
range of 30 to 400 bases and are positioned to yield readily
distinguishable protection products.
[0110] Another method that can be used to distinguish variants is
amplification. Amplification primer design and strategy are
described above. Briefly, primers that will individually amplify
each spliced-in or spliced-out variant are preferred. Multiple
reactions can be performed to identify variants with more than one
spice-in or splice-out event.
[0111] Methods that measure telomerase protein are also useful
within the context of the present invention. By way of example,
antibodies to telomerase may be used to stain tissue sections or
permeabilized cells. Antibodies may also be used to detect protein
by immunoprecipitation, Western blot and the like. Furthermore,
subcellular localization of telomerase and telomerase variants may
be determined using the antibodies described herein.
[0112] E. Antibodies to Telomerase
[0113] Antibodies to the telomerase proteins, fragments, or
peptides discussed herein may readily be prepared. Such antibodies
may specifically recognize wild type telomerase protein and not a
mutant (or variant) protein, mutant (or variant) telomerase protein
and not wild type protein, or equally recognize both the mutant (or
variant) and wild-type forms. Antibodies may be used for isolation
of the protein, inhibiting (antagonist) activity of the protein, or
enhancing (agonist) activity of the protein. As well, assays for
small molecules that interact with telomerase will be facilitated
by the development of antibodies.
[0114] Within the context of the present invention, antibodies are
understood to include monoclonal antibodies, polyclonal antibodies,
anti-idiotypic antibodies, antibody fragments (e.g., Fab, and
F(ab').sub.2, F.sub.V variable regions, or complementarity
determining regions). Antibodies are generally accepted as specific
against telomerase protein if they bind with a K.sub.d of greater
than or equal to 10.sup.-7M, preferably greater than of equal to
10.sup.-8M. The affinity of a monoclonal antibody or binding
partner can be readily determined by one of ordinary skill in the
art (see Scatchard, Ann. N.Y. Acad. Sci. 51:660-672, 1949).
[0115] Briefly, a polyclonal antibody preparation may be readily
generated in a variety of warm-blooded animals such as rabbits,
mice, or rats. Typically, an animal is immunized with telomerase
protein or peptide thereof, which is preferably conjugated to a
carrier protein, such as keyhole limpet hemocyanin. Routes of
administration include intraperitoneal, intramuscular, intraocular,
or subcutaneous injections, usually in an adjuvant (e.g., Freund's
complete or incomplete adjuvant). Particularly preferred polyclonal
antisera demonstrate binding in an assay that is at least three
times greater than background.
[0116] Monoclonal antibodies may also be readily generated from
hybridoma cell lines using conventional techniques (see U.S. Pat.
Nos. RE 32,011, 4,902,614, 4,543,439, and 4,411,993; see also
Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold
Spring Harbor Laboratory Press, 1988). Briefly, within one
embodiment, a subject animal such as a rat or mouse is injected
with telomerase or a portion thereof. The protein may be
administered as an emulsion in an adjuvant such as Freund's
complete or incomplete adjuvant in order to increase the immune
response. Between one and three weeks after the initial
immunization the animal is generally boosted and may tested for
reactivity to the protein utilizing well-known assays. The spleen
and/or lymph nodes are harvested and immortalized. Various
immortalization techniques, such as mediated by Epstein-Barr virus
or fusion to produce a hybridoma, may be used. In a preferred
embodiment, immortalization occurs by fusion with a suitable
myeloma cell line to create a hybridoma that secretes monoclonal
antibody. Suitable myeloma lines include, for example, NS-1 (ATCC
No. TIB 18), and P3X63-Ag 8.653 (ATCC No. CRL 1580). The preferred
fusion partners do not express endogenous antibody genes. Following
fusion, the cells are cultured in medium containing a reagent that
selectively allows for the growth of fused spleen and myeloma cells
such as HAT (hypoxanthine, aminopterin, and thymidine). After about
seven days, the hybridomas may be screened for the presence of
antibodies that are reactive against a telomerase protein. A wide
variety of assays may be utilized, including for example
countercurrent immuno-electrophoresis, radioimmunoassays,
radioimmunoprecipitations, enzyme-linked immuno-sorbent assays
(ELISA), dot blot assays, western blots, immunoprecipitation,
inhibition or competition assays, and sandwich assays (see U.S.
Pat. Nos. 4,376,110 and 4,486,530; see also Antibodies: A
Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor
Laboratory Press, 1988).
[0117] Other techniques may also be utilized to construct
monoclonal antibodies (see Huse et al., Science 246:1275-1281,
1989; Sastry et al., Proc. Natl. Acad. Sci. USA 86:5728-5732, 1989;
Alting-Mees et al., Strategies in Molecular Biology 3:1-9, 1990;
describing recombinant techniques). Briefly, mRNA is isolated from
a B cell population and utilized to create heavy and light chain
immunoglobulin cDNA expression libraries in suitable vectors, such
as .lambda.ImmunoZap(H) and .lambda. ImmunoZap(L). These vectors
may be screened individually or co-expressed to form Fab fragments
or antibodies (see Huse et al., supra; Sastry et al., supra).
Positive plaques may subsequently be converted to a non-lytic
plasmid that allows high level expression of monoclonal antibody
fragments from E. coli.
[0118] Similarly, portions or fragments, such as Fab and Fv
fragments, of antibodies may also be constructed utilizing
conventional enzymatic digestion or recombinant DNA techniques to
yield isolated variable regions of an antibody. Within one
embodiment, the genes which encode the variable region from a
hybridoma producing a monoclonal antibody of interest are amplified
using nucleotide primers for the variable region. These primers may
be synthesized by one of ordinary skill in the art, or may be
purchased from commercially available sources (e.g., Stratacyte, La
Jolla, Calif.) Amplification products are inserted into vectors
such as ImmunoZAP.TM. H or ImmunoZAP.TM. L (Stratacyte), which are
then introduced into E. coli, yeast, or mammalian-based systems for
expression. Utilizing these techniques, large amounts of a
single-chain protein containing a fusion of the V.sub.H and V.sub.L
domains may be produced (see Bird et al., Science 242:423-426,
1988). In addition, techniques may be utilized to change a "murine"
antibody to a "human" antibody, without altering the binding
specificity of the antibody.
[0119] Once suitable antibodies have been obtained, they may be
isolated or purified by many techniques well known to those of
ordinary skill in the art (see Antibodies: A Laboratory Manual,
Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988).
Suitable techniques include peptide or protein affinity columns,
HPLC or RP-HPLC, purification on protein A or protein G columns, or
any combination of these techniques.
[0120] F. Proteins that Interact with Telomerase
[0121] Proteins that directly interact with telomerase can be
detected by an assay such as a yeast 2-hybrid binding system.
Briefly, in a two-hybrid system, a fusion of a DNA-binding
domain-telomerase protein (e.g., GAL4-telomerase fusion) is
constructed and transfected into a cell containing a GAL4 binding
site linked to a selectable marker gene. The whole telomerase
protein or subregions of telomerase may be used. A library of cDNAs
fused to the GAL4 activation domain is also constructed and
co-transfected. When the cDNA in the cDNA-GAL4 activation domain
fusion encodes a protein that interacts with telomerase, the
selectable marker is expressed. Cells containing the cDNA are then
grown, the construct isolated and characterized. Other assays may
also be used to identify interacting proteins. Such assays include
ELISA, Western blotting, co-immunoprecipitations and the like.
[0122] III. Inhibitors and Enhancers of Telomerase Activity
[0123] Candidate inhibitors and enhancers (collectively referred to
as "effectors") may be isolated or procured from a variety of
sources, such as bacteria, fingi, plants, parasites, libraries of
chemicals (e.g., combinatorial libraries), random peptides or the
like. Effectors may also be peptides or variant peptides of
telomerase, variants of telomerase, antisense nucleic acids,
antibodies to telomerase, inhibitors of promoter activity of
telomerase, and the like. Inhibitors and enhancers may be also be
rationally designed, based on the protein structure determined from
X-ray crystallography (see, Livnah et al., Science 273:464, 1996).
In certain preferred embodiments, the inhibitor targets a specific
telomerase, such as a variant.
[0124] An inhibitor may act by preventing binding of telomerase to
other components of the ribonucleoprotein complex or to the
telomere, by causing dissociation of the bound proteins, or by
other mechanism. An inhibitor may act directly or indirectly. In
preferred embodiments, inhibitors interfere in the binding of the
telomerase protein to either the telomerase RNA or to the
telomeres. In other preferred embodiments, the inhibitors are small
molecules. In a most preferred embodiment, the inhibitors cause a
cell to cease replication. Inhibitors should have a minimum of side
effects and are preferably non-toxic. Inhibitors that can penetrate
cells are preferred.
[0125] In other preferred embodiments, an effector is a protein or
peptide of telomerase that acts in a dominant negative fashion
(see, Ball et al., Current Biology 7:71, 1997; Current Biology
6:84, 1996). For example, a peptide of telomerase that
competitively inhibits the binding of telomerase to telomeres will
disrupt the lengthening of telomeres. Generally, these peptides
have native sequence, but variants may have increased activity
(see, Ball et al., supra). Variants may be constructed by the
methods described herein. Other peptides may bind telomerase and
inhibit one or more of its activities, but do not have telomerase
amino acid sequence. Such peptides may be identified by the assays
described herein. The proteins or peptides may also increase
telomerase activity. For effective inhibition, peptide inhibitors
are preferably expressed from vectors transfected or infected into
host cells, but may also be introduced by other means, such as
liposome-mediated fusion, and the like. Eukaryotic vectors are well
known and readily available. Vectors include plasmids, viral-based
vectors, and the like.
[0126] In another preferred embodiment, the inhibitor is a
ribozyme. "Ribozyme" refers to a nucleic acid molecule which is
capable of cleaving a telomerase nucleic acid sequence. Ribozymes
may be composed of DNA, RNA, nucleic acid analogues, or any
combination of these (e.g., DNA/RNA hybrids). A "ribozyme gene"
refers to a nucleic acid molecule which, when transcribed into RNA,
yields the ribozyme, and a "ribozyme vector" refers to an assembly
that is capable of transcribing a ribozyme gene of interest, and
may be composed of either DNA or RNA. Within certain embodiments of
the invention, the vector may include one or more restriction
site(s) and selectable marker(s). Furthermore, depending on the
choice of vector and host cell, additional elements such as an
origin of replication, polyadenylation site, and enhancers may be
included in the vectors described herein.
[0127] As noted above, the present invention also provides
ribozymes having the ability to inhibit expression of the
telomerase gene. Briefly, a wide variety of ribozymes may be
generated for use within the present invention, including for
example, hairpin ribozymes (see e.g., Hampel et al., Nucl. Acids
Res. 18:299-304, 1990, EPO 360,257, and U.S. Pat. No. 5,254,678),
hammerhead ribozymes (see e.g., Rossi, J. J. et al., Pharmac. Ther.
50:245-254, 1991; Forster and Symons, Cell 48:211-220, 1987;
Haseloff and Gerlach, Nature 328:596-600, 1988; Walbot and
Bruening, Nature 334:196, 1988; Haseloff and Gerlach, Nature
334:585, 1988; Haseloff et al., U.S. Pat. No. 5,254,678), hepatitis
delta virus ribozymes (see, e.g, Perrotta and Been, Biochem. 31:16,
1992), Group I intron ribozymes such as those based upon the
Tetrahymena ribosomal RNA (see, e.g, Cech et al., U.S. Pat. No.
4,987,071) RNase P ribozymes (see, e.g, Takada et al., Cell 35:849,
1983); as well as a variety of other nucleic acid structures with
the capability to cleave a desired or selected target sequence (see
e.g., WO 95/29241, and WO 95/31551). Within certain embodiments of
the invention, the ribozymes may be altered from their traditional
structure in order to include tetraloops or other structures that
increase stability (see, e.g., Anderson et al., Nucl. Acids Res.
22:1096-1100, 1994; Cheong et al., Nature 346:680-682, 1990), or
which make the ribozyme resistant to RNase or endonuclease activity
(see e.g., Rossi et al., Pharmac. Ther. 50:245-254, 1991).
[0128] Within one embodiment of the invention, hairpin and
hammerhead ribozymes are provided with the capability of cleaving
telomerase nucleic acid sequences. Briefly, hairpin ribozyrnes are
generated so that they recognize the target sequence
N.sub.3XN*GUC(N.sub.>6) (SEQ. ID NO:95), wherein N is G, U, C,
or A, X is G, C, or U, and * is the cleavage site. Similarly,
hammerhead ribozymes are generated so that they recognize the
sequence NUX, wherein N is G, U, C, or A. The additional
nucleotides of the hammerhead ribozyme or hairpin ribozyme is
determined by the target flanking nucleotides and the hammerhead
consensus sequence (see Ruffner et al., Biochemistry
29:10695-10702, 1990). The preparation and use of certain ribozymes
is described in Cech et al. (U.S. Pat. No. 4,987,071). The
ribozymes are preferably expressed from a vector introduced into
the host cells.
[0129] Ribozymes of the present invention, as well as DNA encoding
such ribozymes can be readily generated utilizing published
protocols (e.g., Promega, Madison Wis., Heidenreich et al., J.
FASEB 70:90-6, 1993; Sproat, Curr. Opin. Biotechnol. 4:20-28,
1993). Alternatively, ribozymes may be generated from a DNA or cDNA
molecule which encodes a ribozyme and which is operably linked to a
RNA polymerase promoter (e.g., SP6 or T7). An RNA ribozyme is
generated upon transcription of the DNA or cDNA molecule.
[0130] In other preferred embodiments, inhibitors diminish promoter
activity of telomerase. A eukaryotic promoter comprises sequences
bound by RNA polymerase and other proteins participating in control
of the transcription unit. Telomerase transcription appears to be
highly regulated; the protein is expressed mainly in stem,
embryonic, and cancer cells, and expressed at much lower levels, if
at all, in most somatic cells. Thus, the promoter is a potential
target for inhibitors. The inhibitors may disrupt or prevent
binding of one or more of the factors that control transcription of
telomerase, causing transcription to diminish or cease. The levels
of transcription need only fall to a low enough level that at least
one telomere becomes absent.
[0131] Another inhibitor of the present invention is antisense RNA
or DNA to telomerase coding or non-coding sequence. Antisense
nucleic acids directed to a particular mRNA molecule have been
shown to inhibit protein expression of the encoded protein Based
upon the telomerase sequences presented herein, an antisense
sequence is designed and preferably inserted into a vector suitable
for transfection into host cells and expression of the antisense.
The antisense may bind to any part of the hTI RNA. In certain
embodiments, the antisense is designed to bind specifically to one
or more variants. Specific binding means that under physiological
conditions, the antisense binds to RNAs that have the complementary
sequence, but not other RNAs. Because telomerase RNAs that contain
any particular alternative intron/exon sequence may be a
heterogeneous group of variants due to independent assortment of
splice variants, more than one species of RNA may be bound and
inactivated. The antisense polynucleotides herein are at least 7
nucleotides long and generally not longer than 100 to 200 bases,
and are more typically at least 10 to 50 bases long. Considerations
for design of antisense molecules and means for introduction into
cells are found in U.S. Pat. Nos. 5,681,747; 5,734,033; 5,767,102;
5,756,476; 5,749,847; 5,747,470; 5,744,362; 5,716,846).
[0132] In addition, enhancers of telomerase activity or expression
are desirable in certain circumstances. At times, increasing the
proliferation potential of cells will have a therapeutic effect.
For example, organ regeneration or differentiation after injury or
diseases, nerve cell or brain cell growth following injury,
proliferation of hematopoietic stem cells used in bone marrow
transplantation or other organ stem cells, and the like may be
limiting and thus benefit from an enhancer of telomerase. Enhancers
may stabilize endogenous protein, increase transcription or
translation, or act through other mechanisms. As is apparent to one
skilled in the art, many of the guidelines presented above apply to
the design of enhancers as well.
[0133] Screening assays for inhibitors and enhancers will vary
according to the type of inhibitor and nature of the activity that
is being inhibited. Assays include the TRAP assay or variation, a
non-amplification based polymerase assay, yeast two-hybrid, release
of repression in yeast transfected with a vertebrate telomerase,
and the like. For screening compounds that interact with the
promoter for telomerase, a reporter gene driven assay is
convenient.
[0134] IV. Uses for Telomerase
[0135] Nucleotide sequence for telomerase and telomerase protein
are used in a variety of contexts in this invention. In preferred
embodiments, the compositions of the present invention are used
either as diagnostic reagents or as therapeutics.
[0136] A. Diagnostics
[0137] Expression of mRNA encoding telomerase and/or protein may be
used for detection of dividing cells, especially tumor cells and
stem cells. Detection methods include antibody staining or tagged
telomerase binding compounds for detection of protein, nucleic acid
hybridization in situ for mRNA, hybridization on DNA "chips",
Northern analysis, RNase probe protection, amplification by PCR or
other method, ligase-mediated amplification and the like.
Furthermore, expression of RNA splice variants may be assayed
conveniently by amplification, RNase probe protection, other
disclosed methods and the like. In particular, oligonucleotide
primers surrounding the site of frequent splice variants, such as
the primers described herein (e.g., Htel Intron T and HT 2482R) may
be used to detect splice variants in various cell types. As shown
in the examples, various tumor cell types exhibit different RNA
splice variations. Correlation of the splice variant pattern with
tumor stage, metastasis potential and the like may be determined.
As such, assays for the particular variants may be used as a
diagnostic. Cells with increased telomerase activity, such as
cancer cells or hyperproliferative cells, may be identified by
assaying qualitatively or quantitatively by any of the assays
described herein. Typically, telomerase activity or expression will
be compared between suspect cells and normal counterpart cells from
the same or different individual. Increased activity indicative of
a tumor or excessive proliferation is established by direct
comparison or by detecting activity in cells otherwise known to be
absent in telomerase activity or expression. In addition,
monitoring cancer progression or response to therapy can be
performed using the assays described herein and comparing activity
or expression over a time course.
[0138] The variant detected in one ALT cell line, which expresses
telomerase, suggests that the basic domain of hT1 may contribute to
the ALT mechanism in at least some ALT cell lines. One possible
mechanism of ALT could involve dysregulated telomerase components
that are inactive in the TRAP assay. Thus, identification of the
variants may be useful for following tumorigenesis.
[0139] Alternative mRNA splicing is a common mechanism for
regulating gene expression in higher eukaryotes and there are many
examples of tissue-specific, development-specific and sex-specific
alterations in splicing events. Importantly, 15% of mutations
linked to disease states in mammals affect splicing patterns
(Horowitz and Krainer Trends Genet., 10, 100-106, 1994). Changes in
cell physiology can also induce altered splicing patterns. Indeed,
tumorigenesis itself has been suggested to enhance the expression
of mRNA spliced variants by compromising the alternative splicing
mechanisms. Although other, novel minor alternatively spliced hT1
variants may play a role in tumor development, the altered relative
expression levels of the major transcripts found in various tumors
compared to normal cells, and in post-crisis cell lines compared to
limited life-span pre-crisis cells, are likely to play a major role
in the establishment and progression of cancers. In addition, the
existence of the alternative spliced variants of hT1 that are seen
in both testis and colonic crypt, as well as tumor cell lines,
suggests complex regulation of this gene in normal development.
[0140] Expression of the major hT1 products is found in most tumors
and in all telomerase-positive immortalized cell lines.
Transcriptional control of hT1 may therefore be a major aspect of
the regulation of telomerase activity, in addition to other
functions. For example, telomerase may be involved in the healing
of chromosome breaks in addition to its role in maintaining
telomere length in the germline. The composition of telomerase may
vary according to these functional roles.
[0141] Therefore, the alternative intron/exon sequences may be
especially useful for diagnostic applications. For example,
detection and identification of diseases, such as cancer, aging,
wound healing, neuronal regeneration, regenerative cells (e.g.,
stem cells), may be important preludes to determining effective
therapy. In this regard, detection of wound healing can facilitate
development and identification of an ameliorative compound.
Currently, wound healing assays are expensive and time consuming,
whereas an amplification or hybridization-based assay would be
quick and cost effective. In any of these applications, detection
may be quantitative or qualitative. In a qualitative assay, a
particular amplification primer pair or hybridization probe for one
of the variant sequences (e.g., alternative intron/exons that are
variably spliced) can be used to detect the presence or absence of
the variant sequence.
[0142] Probes useful in the context of the present invention
include nucleic acid molecules that hybridize to the sequences
presented in FIG. 10 or to their complements. Probes for
hybridization are generally at least 24 bases, but may range from
12 to full-length sequence. The probes may comprise additional
sequence that does not hybridize to hT1 DNA or RNA. Probes are
generally DNA, but may be RNA, PNA, or derivatives thereof.
Hybridization conditions will be chosen appropriate for the length
of the probe and method of hybridization (e.g., on nylon support,
on silicon-based chip). Conditions are well known in the art. One
of the sequences in FIG. 10 is a genomic sequence, not found in
telomerase mRNA. A probe derived from this sequence may be used to
detect genomic DNA in RNA preparations and amplification reactions.
Hybridization probes may be labeled with a radiolabel,
chemiluminescent label, or any of the myriad other known
labels.
[0143] Hybridization can be performed on mRNA preparations, cDNA
preparations, affixed to a solid support, in solution, or in situ
tissues, and the like. One type of hybridization analysis is
annealing to oligonucleotides immobilized on a solid substrate,
such as a functionalized glass slide or silicon chip. Such chips
may be commercially procured or made according to methods and
procedures set out in e.g., PCT/US94/12282; U.S. Pat. No.
5,405,783; U.S. Pat. No. 5,412,087; U.S. Pat. No. 5,424,186; U.S.
Pat. No. 5,436,327; U.S. Pat. No. 5,429,807; U.S. Pat. No.
5,510,270; WO 95/35505; U.S. Pat. No. 5,474,796. Oligonucleotides
are generally arranged in an array form, such that the position of
each oligonucleotide sequence can be determined.
[0144] For amplification assays, primer pairs that either flank the
alternative intron/exons or require the presence of the alternative
intron/exon for amplification are desirable. Many such primer pairs
are disclosed herein. Others may be designed from the sequences
presented herein. Generally, the primer pairs are designed to only
allow amplification of a single alternative intron/exon, however,
in some circumstances detection of multiple alternative
intron/exons in the same RNA preparation may be preferred.
[0145] Other diagnostic assays, such as in situ hybridization,
RNase protection, and the like may be used alternatively or in
addition to the assays discussed above. The principles that guide
these assays are provided by the present invention, while the
techniques are well known.
[0146] Transgenic mice and mice that are null mutants (e.g.,
"knockout mice") may be constructed to facilitate testing of
candidate inhibitors. The telomerase gene is preferably under
control of a tissue-specific promoter for transgenic mice vector
constructs. Mice that overexpress telomerase can be used as a model
system for testing inhibitors. In these mice, cells overexpressing
telomerase are expected to be continuously proliferating.
Administration of candidate inhibitors is followed by observation
and measurement of cell growth. Inhibitors that slow or diminish
growth are candidate therapeutic agents.
[0147] Telomerase may also be transfected into cells to immortalize
various cell types. Transient immortalization may be achieved by
non-stable transfection of an expression vector containing
telomerase. Alternatively, proliferation of stable transformants of
telomerase gene under control of an inducible promoter can be
turned on and off by the addition and absence of the inducer.
Similarly, the presence and absence of an inhibitor of telomerase
activity may be used to selectively immortalize cells. Expression
of part of all of the protein in yeast may act as a dominant
negative, as many human proteins interact with components of a
complex in yeast, but do so imperfectly and therefore
unproductively. As such, these genes act as dominant negatives.
Thus, the yeast will eventually senesce. Such cells may be used in
screens for inhibitory drugs, which will allow growth of yeast past
the time of senescence.
[0148] Purified telomerase protein, reference variant protein, or
fragments, may be used in assays to screen for inhibitory drugs.
These assays will typically be performed in vitro and utilize any
of the methods described above or that are known in the art. The
protein may also be crystallized and subjected to X-ray analysis to
determine its 3-dimensional structure.
[0149] B. Therapeutics
[0150] The compositions and methods disclosed herein may also be
used as therapeutics in the treatment of diseases and disorders to
effect any of the telomerase activities in a cell. Treatment means
any amelioration of the disease or disorder, such as alleviating
symptoms of the disease or disorder, reduction of tumor cell mass
and the like. For example, inhibitors of enzyme activity may be
used to restrict proliferation of cells.
[0151] Many diseases and disorders are tightly associated with
proliferation and proliferative potential. One of the most apparent
diseases involving unwanted proliferation is cancer. The methods
and compositions described herein may be used to treat cancers,
such as melanomas, other skin cancers, neuroblastomas, breast
carcinomas, colon carcinomas, leukemias, lymphomas, osteosarcomas,
and the like. Other diseases and disorders amenable for treatment
within the context of the present invention include those of
excessive cell proliferation (increased proliferation rate over
normal counterpart cells from the same or different individual)
such as smooth muscle cell hyperplasias, skin growths, and the
like. Yet other diseases and disorders would benefit from increased
telomerase activity. Enhancers of telomerase may be used to
stimulate stem cell proliferation and possibly differentiation. As
such, expansion of hematopoietic stem cells could be administered
in the bone marrow transplant context. As well, many tissues have
stem cells. Proliferation of these cells may be beneficial for
wound healing, hair growth, treatment of diseases, such as Wilm's
tumor, and the like.
[0152] Certain of the inhibitors or enhancers may be administered
by way of an expression vector. Many techniques for introduction of
nucleic acids into cells are known. Such methods include retroviral
vectors and subsequent retrovirus infection, adenovirals or
adeno-associated viral vectors and subsequent infection, complexes
of nucleic acid with a condensing agent (e.g., poly-lysine), these
complexes or viral vectors may be targeted to particular cell types
by way of an incorporated ligand. Many ligands specific for tumor
cells and other cells are well known in the art.
[0153] As noted above, within certain aspects of the present
invention, nucleic acids encoding ribozymes, antisense,
dominant-negative telomerases, portions of telomerase and the like
may be utilized to inhibit telomerase activity by introducing a
functional gene to a cell of interest. This may be accomplished by
either delivering a synthesized gene to the cell or by delivery of
DNA or cDNA capable of in vivo transcription of the gene product.
More specifically, in order to produce products in vivo, a nucleic
acid sequence coding for the product is placed under the control of
a eukaryotic promoter (e.g., a pol III promoter, CMV or SV40
promoter). Where it is desired to more specifically control
transcription, the gene may be placed under the control of a tissue
or cell specific promoter (e.g., to target cells in the liver), or
an inducible promoter.
[0154] A wide variety of vectors may be utilized within the context
of the present invention, including for example, plasmids, viruses,
retrotransposons and cosmids. Representative examples include
adenoviral vectors (e.g., WO 94/26914, WO 93/9191; Yei et al., Gene
Therapy 1:192-200, 1994; Kolls et al., PNAS 91(1): 215-219, 1994;
Kass-Eisler et al., PNAS 90(24): 11498-502, 1993; Guzman et al.,
Circulation 88(6):2838-48, 1993; Guzman et al., Cir. Res.
73(6):1202-1207, 1993; Zabner et al., Cell 75(2):207-216, 1993; Li
et al., Hum Gene Ther. 4(4):403-409, 1993; Caillaud et al., Eur. J.
Neurosci. 5(10):1287-1291, 1993), adeno-associated type 1 ("AAV-1")
or adeno-associated type 2 ("AAV-2") vectors (see WO 95/13365;
Flotte et al., PNAS 90(22):10613-10617, 1993), hepatitis delta
vectors, live, attenuated delta viruses and herpes viral vectors
(e.g., U.S. Pat. No. 5,288,641), as well as vectors which are
disclosed within U.S. Pat. No. 5,166,320. Other representative
vectors include retroviral vectors (e.g., EP 0 415 731; WO
90/07936; WO 91/02805; WO 94/03622; WO 93/25698; WO 93/25234; U.S.
Pat. No. 5,219,740; WO 93/11230; WO 93/10218. For methods and other
compositions, see U.S. Pat. Nos. 5,756,264; 5,741,486; 5,733,761;
5,707,618; 5,702,384; 5,656,465; 5,547,932; 5,529,774; 5,672,510;
5,399,346, and 5,712,378.)
[0155] Within certain aspects of the invention, nucleic acid
molecules may be introduced into a host cell utilizing a vehicle,
or by various physical methods. Representative examples of such
methods include transformation using calcium phosphate
precipitation (Dubensky et al., PNAS 81:7529-7533, 1984), direct
microinjection of such nucleic acid molecules into intact target
cells (Acsadi et al., Nature 352:815-818, 1991), and
electroporation whereby cells suspended in a conducting solution
are subjected to an intense electric field in order to transiently
polarize the membrane, allowing entry of the nucleic acid
molecules. Other procedures include the use of nucleic acid
molecules linked to an inactive adenovirus (Cotton et al., PNAS
89:6094, 1990), lipofection (Felgner et al., Proc. Natl. Acad. Sci.
USA 84:7413-7417, 1989), microprojectile bombardment (Williams et
al., PNAS 88:2726-2730, 1991), polycation compounds such as
polylysine, receptor specific ligands, liposomes entrapping the
nucleic acid molecules, spheroplast fusion whereby E. coli
containing the nucleic acid molecules are stripped of their outer
cell walls and fused to animal cells using polyethylene glycol,
viral transduction, (Cline et al., Pharmac. Ther. 29:69, 1985; and
Friedmann et al., Science 244:1275, 1989), and DNA ligand (Wu et
al, J. of Biol. Chem. 264:16985-16987, 1989), as well as psoralen
inactivated viruses such as Sendai or Adenovirus. In one
embodiment, the nucleic acid molecule is introduced into the host
cell using a liposome.
[0156] Administration of effectors will generally follow
established protocols.
[0157] The compounds of the present invention may be administered
either alone, or as a pharmaceutical composition. Briefly,
pharmaceutical compositions of the present invention may comprise
one or more of the inhibitors or enhancers as described herein, in
combination with one or more pharmaceutically or physiologically
acceptable carriers, diluents or excipients. Such compositions may
comprise buffers such as neutral buffered saline, phosphate
buffered saline and the like, carbohydrates such as glucose,
mannose, sucrose or dextrans, mannitol, proteins, polypeptides or
amino acids such as glycine, antioxidants, chelating agents such as
EDTA or glutathione, adjuvants (e.g., aluminum hydroxide) and
preservatives. In addition, pharmaceutical compositions of the
present invention may also contain one or more additional active
ingredients. Effectors may be further coupled with a targeting
moiety that binds a cell surface receptor specific to the
proliferating cells.
[0158] Compositions of the present invention may be formulated for
the manner of administration indicated, including for example, for
oral, nasal, venous, intracranial, intraperitoneal, subcutaneous,
or intramuscular administration. Within other embodiments of the
invention, the compositions described herein may be administered as
part of a sustained release implant. Within yet other embodiments,
compositions of the present invention may be formulized as a
lyophilizate, utilizing appropriate excipients which provide
stability as a lyophilizate, and subsequent to rehydration.
[0159] As noted above, pharmaceutical compositions also are
provided by this invention. These compositions contain any of the
above described ribozymes, DNA molecules, proteins, chemicals,
vectors, or host cells, along with a pharmaceutically or
physiologically acceptable carrier, excipients or diluents.
Generally, such carriers should be nontoxic to recipients at the
dosages and concentrations employed. Ordinarily, the preparation of
such compositions entails combining the therapeutic agent with
buffers, antioxidants such as ascorbic acid, low molecular weight
(less than about 10 residues) polypeptides, proteins, amino acids,
carbohydrates including glucose, sucrose or dextrins, chelating
agents such as EDTA, glutathione and other stabilizers and
excipients. Neutral buffered saline or saline mixed with
nonspecific serum albumin are exemplary appropriate diluents.
[0160] In addition, the pharmaceutical compositions of the present
invention may be prepared as medicaments for administration by a
variety of different routes, including for example
intraarticularly, intracranially, intradermally, intrahepatically,
intramuscularly, intraocularly, intraperitoneally, intrathecally,
intravenously, subcutaneously or even directly into a tumor. In
addition, pharmaceutical compositions of the present invention may
be placed within containers, along with packaging material which
provides instructions regarding the use of such pharmaceutical
compositions. Generally, such instructions will include a tangible
expression describing the reagent concentration, as well as within
certain embodiments, relative amounts of excipient ingredients or
diluents (e.g., water, saline or PBS) which may be necessary to
reconstitute the pharmaceutical composition. Pharmaceutical
compositions are useful for both diagnostic or therapeutic
purposes.
[0161] Pharmaceutical compositions of the present invention may be
administered in a manner appropriate to the disease to be treated
(or prevented). The quantity and frequency of administration will
be determined by such factors as the condition of the patient, and
the type and severity of the patient's disease. Dosages may be
determined most accurately during clinical trials. Patients may be
monitored for therapeutic effectiveness by appropriate technology,
including signs of clinical exacerbation, imaging and the like.
[0162] The following examples are offered by way of illustration,
and not by way of limitation.
EXAMPLES
Example 1
Identification and Isolation of the Human Telomerase Gene
[0163] A human telomerase gene is identified in a cDNA library
constructed from a cancer cell line. The cDNA is subjected to DNA
sequence analysis (Kilian et al., supra).
[0164] An EST sequence, GenBank Accession No. AA281296, is
identified as partial telomerase gene sequence by a BLAST search
against the Euplotes telomerase sequence, GenBank Accession No.
U95964 (p=3.2.times.10.sup.-6)- . Amino acid sequence identity
between the two sequences is approximately 38% and amino acid
sequence similarity is approximately 60%.
[0165] To obtain longer clones of hT1, a number of cDNA libraries
prepared from tumor cells are screened by amplification using
primers from within the EST sequence. Primers HT1553F (SEQ ID No:
108) and HT1920R (SEQ ID No: 114), based on the EST sequence, are
used to amplify an approximately 350 bp fragment in a variety of
cDNA libraries. The amplification reaction is performed under "hot
start" conditions. Amplification cycles are 4 min at 95.degree. C.;
1 min at 80.degree. C.; 30 cycles of 30 sec at 94.degree. C., 30
sec at 55.degree. C., 1 min at 72.degree. C.; and 5 min at
72.degree. C. An amplified product of the expected size (.about.350
bp) is detected in only 3 of the 12 libraries screened. No fragment
is detectable in a testis cDNA library, somatic cell libraries, and
a variety of cancer cell cDNA libraries. However, an abundant 350
bp fragment is detected in a cDNA library from LIM 1215 cells, a
colon cancer cell line. In this library, and in several others, an
additional fragment of around 170 bp was amplified.
[0166] Two approaches are followed to obtain longer clones from the
LIM1215 library: screening plaques with a .sup.32-P-labeled EST
probe and amplification on library DNA. A single positive plaque,
designated 53.2, with a 1.9 kb insert is obtained by hybridization
of the library with the EST probe. DNA sequence analysis of this
clone demonstrates that it extends both 5' and 3' of the EST
sequence, but did not contain a single open reading frame (ORF). A
fragment obtained from amplification analysis of the library is
similar in sequence to the 53.2 fragment but also contains two
additional sequences of 36 bp and >300 bp. Both insertions
demonstrate characteristics of splice acceptor and donor sequences
at their boundaries relative to the 53.2 sequence and may represent
unspliced introns. Amplification using primers T7 and HT1553F (SEQ
ID No: 108), yields an approximately 1.6 kb fragment; and using
primers T3 and HT1893R (SEQ ID No: 113), yields an approximately
0.7 kb fragment. Each of these fragments support amplification of a
320 bp fragment using primers HTEL1553F (SEQ ID No: 108) and
HT1893R (SEQ ID No: 113).
[0167] Longer clones may also be obtained by amplification of mRNA
samples. Reverse transcriptase PCR (RT-PCR) on LIM1215 mRNA
identifies a number of additional PCR products, including one with
a 182 bp insertion relative to 53.2 that results in a single open
reading frame (ORF). cDNA is synthesized from RNAs isolated from
normal and tumor tissues. RT-PCR followed by nested amplification
is performed using the Titan RT-PCR system (Boehringer-Mannheim).
Amplification conditions are as follows: 95.degree. C. for 2 min,
two cycles of 94.degree. C. for 30 sec, 65.degree. C. for 30 sec
and 68.degree. C. for 3 min, 2 cycles of 94.degree. C. for 30 sec,
63.degree. C. for 30 sec, 68.degree. C. for 3 min, 34 cycles of
94.degree. C. for 30 sec, 60.degree. C. for 30 sec and 68.degree.
C. for 3 min. RT-PCR products are diluted 100 fold, and 1 .mu.l is
used for nested amplification using Taq polymerase with buffer Q
(Qiagen). Amplification conditions are as above, except that the
final step is 14 cycles. For normal tissues and tumors,
amplification products are resolved by electrophoresis in 1.5%
agarose gel, transferred to Zetaprobe membrane and probed with
radiolabeled oligonucleotide HT1691F (SEQ ID No: 111).
[0168] The DNA sequence is also extended 5' and 3' using a
combination of cRACE and 3' RACE, respectively, on LIM1215 mRNA to
give a fragment of 3871 bp designated hT1 (FIG. 1). Two rounds of
cRACE are carried out to extend the sequence of hT1 and map the
transcription initiation site. 500 ng LIM1215 polyA+ RNA is used as
the template. First strand cDNA synthesis is primed using the
HT1576R (SEQ ID No: 109) primer. The first round of amplification
on the ligation product (using the XL-PCR system) employs the
HT1157R (SEQ ID No: 107) and HT1262F (SEQ ID No: 105) primers.
Amplification products are purified using Qiagen columns, and
further amplified using primers HT1114R (SEQ ID No: 106) and
HT1553F (SEQ ID No: 108). A resulting 1.4 kb band is subjected to
DNA sequence analysis, and a new set of primers are designed based
on this sequence. For the second round of cRACE, the first strand
cDNA is primed with the HT220R (SEQ ID No: 104) primer. The first
round of amplification utilizes the HT0142R (SEQ ID No: 102) and
HT0141F (SEQ ID No: 101) primers. Products are purified as above
and amplified using HT0093 (SEQ ID No: 100) and HT0163F (SEQ ID No:
103) primers. A product of 100 bp is observed and subjected to
sequence analysis in two independent experiments to define the 5'
end of the hT1 transcript. The 5' end of the transcript is also
obtained by amplification using primer HtelFulcodT
5'-AGGAGATCTCGCGATGCCGCGCGCTC-3' (SEQ. ID NO:96) and HtelFulcodB
5'-TCCACGCGTCCTGCCCGGGTG-3' (SEQ. ID NO:97) on LIM1215 RNA. The
resulting amplified product was digested with Mlu I and Bgl II and
ligated to the remaining telomerase cDNA sequence.
[0169] The 3'-most sequences of the transcript are obtained by two
rounds of amplification (XL-PCR system) using EBHT18 (SEQ ID No:
125) in both rounds as the reverse primer, and HT2761F (SEQ ID No:
120) and HT3114F (SEQ ID No: 122) as the forward primers in the
first and second rounds, respectively.
[0170] The size of hT1 accords well with the size estimated from
the Northern blot (see below) for the most abundant RNA species in
LIM1215 RNA. Approximately 3.9 kb of DNA sequence is presented in
FIG. 1. The sequence found in the EST is located from nucleotides
1624-2012. The predicted amino acid sequence of the largest open
reading frame is also presented in FIG. 1. As presented, the
protein is 1132 amino acids.
2TABLE 2 Name Oligo Sequence HT0028F 5' - GCTGGTGCAGCGCGGGGACC
(SEQ. ID NO:98) HT 5'Met 5' -
CACAAGCTTGAATTCACATCTCACCATGAAGGAGCTGGTGGCCCGAGT (SEQ. ID NO:99)
HT0093R 5' - GGCACGCACACCAGGCACTG (SEQ. ID NO:100) HT0141F 5' -
CCTGCCTGAAGGAGCTGGTG (SEQ. ID NO:101) HT0142R 5' -
GGACACCTGGCGGAAGGAG (SEQ. ID NO:102) HT0163F 5' -
CCGAGTGCTGCAGAGGCTGT (SEQ. ID NO:103) HT0220R 5' -
GAAGCCGAAGGCCAGCACGTTCTT (SEQ. ID NO:104) HT1262F 5' -
GTGCAGCTGCTCCGCCAGCACA (SEQ. ID NO:105) HT1114R 5' -
GTTCCCAAGCAGCTCCAGAAACAG (SEQ. ID NO:106) HT1157R 5' -
GGCAGTGCGTCTTGAGGAGCA (SEQ. ID NO:107) HT1553F 5' -
CACTGGCTGATGAGTGTGTAC (SEQ. ID NO:108) HT1576R 5' -
GACGTACACACTCATCAGCCAG (SEQ. ID NO:109) HT1590F 5' -
GGTCTTTCTTTTATGTCACGGAG (SEQ. ID NO:110) HT1691F 5' -
CACTTGAAGAGGGTGCAGCT (SEQ. ID NO:111) HT1875F 5' -
GTCTCACCTCGAGGGTGAAG (SEQ. ID NO:112) HT1893R 5' -
TTCACCCTCGAGGTGAGACGCT (SEQ. ID NO:113) HT1920R 5' -
TCGTAGTTGAGCACGCTGAAC (SEQ. ID NO:114) HT2026F 5' -
GCCTGAGCTGTACTTTGTCAA (SEQ. ID NO:115) HTM2028F 5' -
CTGAGCTGTACTTTGTCAAGGACA (SEQ. ID NO:116) HT2230F 5' -
GTACATGCGACAGTTCGTGGCTCA (SEQ. ID NO:117) HT2356R 5' -
CATGAAGCGTAGGAAGACGTCGAAGA (SEQ. ID NO:118) HT2482R 5' -
CGCAAACAGCTTGTTCTCCATGTC (SEQ. ID NO:119) HT2761F 5' -
CTATGCCCGGACCTCCATCAGA (SEQ. ID NO:120) HT2781R 5' -
CTGATGGAGGTCCGGGCATAG (SEQ. ID NO:121) HT3114F 5' -
CCTCCGAGGCCGTGCAGT (SEQ. ID NO:122) HT3292B 5' -
CACCTCAAGCTTTCTAGATCAGTCCAGGATGGTCTTGAAGTCA (SEQ. ID NO:123)
HT3689R 5' - GGAAGGCAAAGGAGGGCAGGGCGA (SEQ. ID NO:124) EBHT18 5' -
CACGAATTCGGATCCAAGCTTTTTTTTTTTTTTTTTT (SEQ. ID NO:125) HT-RNA-F 5'
- GGGTTGCGGAGGGTGGGC (SEQ. ID NO:126) HT-RNA451R 5' -
GCAGTGGTGAGCCGAGTCCTG (SEQ. ID NO:127) HT-RNA598F 5' -
CGACTTTGGAGGTGCCTTCA (SEQ. ID NO:128) HTel 5'T 5' -
GCTGGTGCAGCGCGGGGACC (SEQ. ID NO:129) HTel979T 5' -
GAGGTGCAGAGCGACTACTCCA (SEQ. ID NO:130) HTell335T 5' -
GTCTCACCTCGAGGGTGAAG (SEQ. ID NO:131) HTel71T 5' -
GGCTGCTCCTGCGTTTGGTGGA (SEQ. ID NO:132) HTel21B (Top) 5' -
GCCAGAGATGGAGCCACCC (SEQ. ID NO:133) HTel21TBot) 5' -
GGGTGGCTCCATCTCTGGC (SEQ. ID NO:134) HTel-7B 5' -
CCGCACGCTCATCTTCCACGT (SEQ. ID NO:135) HTel + 256B 5' -
GCTTGGGGATGAAGCGGTC (SEQ. ID NO:136) HtelIntronT 5' -
CGCCTGAGCTGTACTTTGTCA (SEQ. ID NO:137) Htel 3'CODB 5' -
CACCTCAAGCTTTCTAGATCAGCTAGCGGCCCAGCCCAACTCCCCT (SEQ. ID NO:138)
Htel 1210B 5' - GCAGCACACATGCGTGAAACCTGT (SEQ. ID NO:139) Htel
1274B 5' - GTGTCAGAGATGACGCGCAGGAA (SEQ. ID NO:140) Htel 1624b 5' -
ACCCACACTTGCCTGTCCTGAGT (SEQ. ID NO:141) hTR TAC 5' -
ACTGGATCCTTGACAATTAATGCATCGGCTCGTATA- ATGTGTGGAGGG (SEQ. ID NO:142)
TTGCGGAGGGTGGGC hTR 5'T7 5' -
CTGTAATACGACTCACTATAGGGTTGCGGAGGGTGGGC (SEQ. ID NO:143) hTR 3'PstI
5' - CACCTGCAGACATGCGTTTCGTCCTCACGGACTCATCAGGCCAGCTGG (SEQ. ID
NO:144) CGACGCATGTGTGAGCCGAGTCCTG BT-177 5' -
GGATCCGCCGCAGAGCACCGTCTG (SEQ. ID NO:145) BT-178 5' -
CGAAGCTTTCAGTGGGCCGGCATCTGAAC (SEQ. ID NO:146) BT-179 5' -
CGAAGCTTTCACAGGCCCAGCCCAACTCC (SEQ. ID NO:147) BT-182 5' -
GCGGATCCAGAGCCACGTCCTACGTC (SEQ. ID NO:148) BT-183 5' -
GCGGATCCGTTCAGATGCCGGCCCAC (SEQ. ID NO:149)
Example 2
hT1 Sequence and Alignment with Other Telomerases
[0171] Multiple sequence alignment demonstrates that the predicted
hT1 protein is co-linear with the Euplotes and S. cerevisae
telomerase catalytic subunits over their entire lengths (FIG. 2).
Although the overall homology between the three proteins is
relatively low (approximately 40% similarity in all pairwise
combinations) the overall structure of the protein seems to be well
conserved. Four major domains: N-terminal, basic, reverse
transcriptase (RT) and C-terminal are present in all three
proteins. The highest area of sequence similarity is within the RT
domain. Notably, all the motifs characteristic of the Euplotes RT
domain are present and all amino acid residues implicated in RT
catalysis are conserved in the hT1 sequence (Lingner et al.,
Science 276: 561-567, 1997).
[0172] Recently, protein phosphatase 2A treatment of human breast
cancer cell extracts has been shown to inhibit telomerase activity
(Li et al., J. Biol. Chem. 272: 16729-16732, 1997). It is not known
whether this effect is direct, but it raises the possibility of
regulation of telomerase activity by protein phosphorylation. The
predicted hT1 protein does contain numerous potential
phosphorylation sites, including 11 SP or TP dipeptides, which are
potential sites for cell cycle dependent kinases.
Example 3
Characterization of Telomerase Gene
[0173] Northern analysis and Southern analysis are performed to
determine the size of the telomerase transcript and whether
telomerase gene is amplified in tumors cells.
[0174] For Northern analysis, polyA mRNA is isolated from LIM 1215
cells and from CCD fibroblasts. CCD is a primary human fibroblast
cell line. Briefly cells are lysed by homogenization in a buffered
solution (0.1 M NaCl, 10 mM Tris, pH 7.4, 1 mM EDTA) containing
detergent (0.1% SDS) and 200 .mu.g/ml of proteinase K. SDS is added
to the lysate to a final concentration of 0.5%, and the lysate is
incubated at 60.degree. C. for 1 hr and 37.degree. C. for 20 min.
The lysate is then incubated for 1 hr with a slurry oligo
dT-cellulose that has been pre-cycled in 0.1 M NaOH and
equilibrated in 0.5 M NaCl, 10 mM Tris pH 7.4, 1 mM EDTA, and 0.1%
SDS. The resin is collected by centrifugation, batch washed in the
equilibration buffer, and loaded into a column. The mRNA is eluted
with warmed (37.degree. C.) buffer (10 mM Tris pH 7.4, 0.1 mM EDTA)
and ethanol precipitated.
[0175] Approximately 3 .mu.g of polyadenylated RNA is
electrophoresed in a 0.85% formaldehyde-agarose gel (see Sampbrook
et al., supra) and transferred overnight to Genescreen plus
(Bio-Rad, Calif.). The membrane is hybridized with a
.sup.32P-labeled telomerase-specific probe (390 bp insert
corresponding to the EST sequence). After washing the blot at high
stringency, a prominent .about.3.8 kb band is observed in mRNA from
LIM 1215, but not in mRNA from CCD fibroblasts (FIG. 3). Subsequent
hybridization of the same membrane with a probe for glyceraldehyde
6-phosphate dehydrogenate demonstrated an equivalently strong band
in both mRNAs, indicating that each lane contained a similar amount
of high quality RNA. The presence of larger transcripts (especially
a 8 kb heterodispersed band) is also visible only in LIM1215 RNA
(FIG. 10, upper panel.). These findings provide an indication of
additional hT1-specific mRNA and also that hT1 may be
preferentially expressed in tumor versus normal cells.
[0176] For Southern analysis, DNA is isolated from human peripheral
blood mononuclear cells and LIM 1215. Approximately 10 .mu.g of
DNAs are digested with Hind III, Xba I, Eco RI, BamHI, and PstI,
electrophoresed in a 1% agarose gel, and transferred to a nylon
membrane. For controls, plasmid DNA containing human telomerase is
titrated to approximately the equivalent of 10 copies, 5 copies,
and 1 copy per 10 .mu.g genomic DNA and electrophoresed on the same
gel. A 390 bp fragment of telomerase gene (containing the EST
sequence) is .sup.32P-labeled and hybridized under normal
stringency conditions. The filter is washed in 2.times. SSC, 0.1%
SDS at 55.degree. C. A scanned phosphor image is presented in FIG.
4. As shown, the telomerase gene does not appear to be amplified or
rearranged in LIM1215 as there is not significant difference in the
pattern or intensity of hybridization when comparing LIM 1215 to
PBMC DNA, Moreover, telomerase appears to be a single copy gene, as
all digestions except Pst I yielded a single band.
Example 4
hT1 Expression Patterns
[0177] Although telomerase activity has been widely associated with
tumor cells and the germline, it has only recently been recognized
that certain normal mammalian tissues express low levels of
telomerase activity. hT1 expression is not detected in primary
fibroblast RNA, and amplification of several commercially available
cDNA libraries from lung, heart, liver, pancreas, hippocampus,
fetal brain, and testis using primers for the EST region, did not
reveal any products.
[0178] However, the expression of hT1 in normal tissues that have
previously been shown to have telomerase activity (colon, testis
and peripheral blood lymphocytes) are examined, as well as a number
of melanoma and breast cancer samples. RNA is isolated from normal
human colon, testis and circulating lymphocytes, and from tissue
sections of tumor samples, and subjected to RT-PCR analysis.
Amplification products from cDNA are easily distinguished from
products resulting from contaminating genomic DNA, as a product of
.about.300 bp is observed using cDNA as a template and a product of
2.7 kb is observed using genomic DNA as a template. hT1 transcripts
are detected in both colon and testis, in the majority of tumor
samples, and very weakly in the lymphocyte RNA (FIG. 5, upper
panel). Interestingly, two of the breast cancer samples are
negative for hT1 expression, despite containing comparable amounts
of RNA to the other samples, as judged by amplification of
.beta.-actin as a positive control (FIG. 5, lower panel).
[0179] Acquisition of telomerase activity appears to be an
important aspect of the immortalization process. The expression of
hT1 in a number of matched pairs of pre-crisis cell cultures and
post-crisis cell lines is determined using RT-PCR followed by
amplification from nested primers (FIG. 6, upper panel). These cell
lines are telomerase negative (pre-crisis cell line) and positive
(post-crisis cell lines), respectively, using the TRAP assay (Bryan
et al., EMBO J. 14: 4240-4248, 1995). In two matched pairs, BFT-3B
and BET-3K, hT1 is detected only in the post-crisis cell lines
(compare lanes a and b, lanes e and f). While the post-crisis line
(lanes d, f) in the BFT-3K set shows an abundant hT1 band, a
fragment of the same size is also weakly present in the pre-crisis
(lanes c, e) culture sample. In addition, two of the three
post-crisis cell lines demonstrate the presence of an additional
unexpected fragment of 320 bp, and this product is also observed
when colon and testis mRNA are analyzed on high resolution
gels.
[0180] Three immortalized telomerase-negative (ALT) cell lines are
also analyzed for hT1 expression (FIG. 6, lanes g, h, i). Two of
the lines appear negative for hT1 expression, but in one line
(IIICF-T/B1), a product of approximately 320 bp is again amplified
(FIG. 6, lane i), similar to the post-crisis, colon and testis
samples. DNA sequence analysis of the 320 bp product from the line
IIICF-T/B1 (ALT) reveals the presence of a 38 bp insertion,
relative to the expected product. The possibility that this is an
amplification from genomic DNA rather than mRNA is ruled out by
performing amplification with the same primers but using genomic
DNA as the template. Under these conditions, a 2.7 kb fragment is
amplified and its authenticity confirmed by partial sequence
analysis.
Example 5
Identification of Alternative Splicing Patterns of Telomerase
mRNA
[0181] DNA sequence analysis of clones from the LIM1215 cDNA
library and the RT-PCR data presented above for the pre-crisis and
post-crisis cultures indicated that there is a number of different
sequence variants within the hT1 transcript. To systematically
survey for variants, RT-PCR is performed using primer pairs
covering the whole sequence. No variants are observed in the
N-terminal and the basic domains, but several variants are observed
in the RT domain and, to a lesser extent, the C-terminal domain.
Most notably, there are several RNA variants between RT Motif A and
RT Motif B (FIG. 7A).
[0182] Samples of mRNA are prepared from several different tumors
using conventional protocols. The tumors are: (1) SLL lung
carcinoma, (2) Lymphoma C, (3) Lung carcinoma, (4) Medullablastoma
A, (5) Lymphoma B, (6) Lymphoma E, (7) Tumor sample 47D, (8)
Pheochromocystoma, (9) Lymphoma F, (10) Glioma, and (11) Lymphoma
G. The mRNAs from these samples are first reverse transcribed to
cDNAs and then amplified using primers HT1875F (SEQ ID No: 112) and
HT2781R (SEQ ID No: 121), followed by amplification with nested
primers HT2026F (SEQ ID No: 115) and HT2482R (SEQ ID No: 119). Four
different amplified products are observed in FIG. 8: 220 bp (band
1), 250 bp (band 2), 400 bp (band 3) and 430 bp (band 4).
Strikingly, there is considerable variation among the tumor samples
tested both in the total number of amplified products and in the
quantitative distribution among the products.
[0183] Three of these products are isolated from a number of tumor
tissues and subjected to DNA sequence analysis. One of them, a 220
bp fragment, is equivalent to the 53.2 cDNA from the LIM1215
library. The fragment of the .about.250 bp (band 2) contains a 36
bp in-frame insertion, the same insertion that was identified in an
amplified product from a LIM1215 cDNA library. As the RT-PCR
product had the same sequence as the product from the cDNA library,
it is apparent that the 36 bp insertion is not an artifact
generated during library construction. The largest product (band 4)
contains a 182 bp insertion (the same as the larger product
amplified earlier from LIM1215 RNA) compared to the 250 bp
amplicon. Unambiguous sequence for the 400 bp band (band 3) is not
obtained. Based on its size, it may contain the 182 bp insert but
missing the 36 bp insertion present in bands 2 and 4 and absent
from band 1.
[0184] To test the hypothesis that such a transcript exists, a
primer, HTM2028F, is designed such that amplification ensues only
when the 36 bp fragment was missing. Amplification using HTM2028F
(SEQ ID No: 116) and HT2026F (SEQ ID No: 115) primers in
combination with HT2356R (SEQ ID No: 118) demonstrate that
transcripts containing the 182 bp fragment but missing the 36 bp
fragment are present in LIM1215 RNA (FIG. 9, lanes a and b). The
same top strand primers (HTM2028F (SEQ ID No: 116) and HT2026F (SEQ
ID No: 115)) in combination with HT2482R (SEQ ID No: 119) primer
amplify a number of products from LIM1215 RNA (FIG. 9, lanes c and
d), most of which represent bands 1-4 as determined by direct
sequence analysis of PCR products. An amplified fragment of 650 bp
using HTM2028F (SEQ ID No: 116) and HT2482R (SEQ ID No: 119)
primers represents another, not yet fully characterized,
alternatively spliced telomerase variant in the RT-MotifA/RT Motif
B region. For clarity of presentation, the protein sequence giving
the best match with Euplotes and S. cerevisiae proteins is
presented in FIG. 2 as the reference sequence.
[0185] Specifically, there are at least seven inserts that can be
present (or absent) from telomerase RNA. (1) The 5'-most sequence
(Y) is located between bases 222 and 223. (2) the insert (X) is
located between bases 1766 and 1767. A partial sequence is
determined and is presented in FIG. 10. Termination codons are
present in all three reading frames. Thus, a truncated protein
without any of the Rtase motifs would be produced. (2) A sequence,
indicated as "1" in FIG. 7, is located between bases 1950 and 1951.
This sequence is 38 bp (FIG. 10) and appears to be present in ALT
and most tumor lines. The presence of this sequence adds 13 amino
acids and shifts the reading frame, such that a termination codon
(TGA) is in frame at nucleotide 1973. (3) A sequence, indicated as
".alpha." in FIG. 7, is located between bases 2130 and 2167. This
sequence is 36 bp (FIG. 10) and its absence removes RTase motif "A"
but does not alter the reading frame. (4) A sequence, indicated as
".beta." in FIG. 7 is present between bases 2286 and 2469. The
insert is 182 bases (FIG. 10) and its absence causes a reading
frame-shift and a termination codon in RTase motif 5 at nucleotide
2604. (5) The sequence "2" in FIG. 7 is present between bases 2823
and 2824. Its length is undetermined; its partial sequence is
presented in FIG. 10. The presence of this insert causes a
truncated telomerase protein, as the first codon of the insert is a
termination codon. (6) The sequence "3" is a 159 bp insert (FIG.
10) between bases 3157 and 3158. Its presence leads to a telomerase
protein with an altered COOH-terminus. The insert contains a stop
codon. Moreover, sequence "3" has a putative binding site for the
SH3 domain of c-abl (PXXXXPXXP; PEMEPPRRP) (SEQ. ID NOs:93 and 150
respectively).
[0186] The transcript that most closely aligns with Euplotes and
yeast telomerases by amino acid similarity contains sequences A and
B, and does not contain sequence C. The nucleotide and amino acid
sequences of eight variants resulting from mRNAs comprising
combinations of sequences A, B, and C are presented in FIG. 8.
Example 6
Recombinant Expression of Human Telomerase
[0187] Human telomerase is cloned into bacterial expression
vectors. The sequence shown in FIG. 1 is amplified from LIM 1215
mRNA in two pieces and then ligated together.
[0188] For the amplification, first strand cDNA is synthesized and
used in an amplification reaction (Titan system, Boehringer, Ind.)
with a mixture of DNA polymerases, such that a proofreading
thermostable enzyme (e.g., rTth) is used with Taq DNA polymerase.
As much of the mRNA in LIM 1215 lacks sequence B (FIG. 9), the
amplification primers are designed such that one primer of each
pair is within sequence B, on either side of the Sac I site at
nucleotide 2271 (FIG. 1). The 5' portion is first amplified from
cDNA using HT2356R (SEQ ID No: 118) and HT0028F (SEQ ID No: 98)
primers (cycle conditions: 70.degree. C., 2 min; then added primer
sequences equilibrated to 50.degree. C.; 50.degree. C., 30 min;
95.degree. C., 2 min; 2 cycles of 94.degree. C., 30 sec; 65.degree.
C., 30 sec; 3 cycles of 94.degree. C., 30 sec; 63.degree. C., 30
sec; 68.degree. C. 3 min; 32 cycles of 94.degree. C., 30 sec;
60.degree. C., 30 sec; 68.degree. C., 3 min). The extreme 5'
portion of the telomerase gene is then ligated in Eco RI/Sac I
digested pTTQ18 (Amersham International plc, Buckinghamshire,
England) and pBluescriptII KS+, and the sequence verified.
[0189] To obtain the 3' end, LIM 1215 cDNA is amplified using
HT2230F (SEQ ID No: 117) and a HT3292B (SEQ ID No: 123) primer that
is complementary to the sequence encoding the very C-terminus of
telomerase. The amplification products are digested with Hind III
and Sac I and inserted into pTTQ18 and pBluescript II KS+. The 5'
and 3' ends are also cloned joined at the native Sac I site in
pTTQ18 both as a Hexa-His fusion and a non-fusion protein.
[0190] The plasmid pTTQ18-Htel is transfected into bacterial cells
(e.g., BL21(DE3)). Over expression of the protein is accomplished
upon induction with IPTG. The bacteria are collected by
centrifugation and lysed in lysis buffer (20 mM NaPO.sub.4, pH 7.0,
5 mM EDTA, 5 mM EGTA, 1 mM DTT, 0.5 .mu.g/ml leupeptin, 1 .mu.g/ml
aprotinin, 0.7 .mu.g/ml pepstatin). This mixture is evenly
suspended via a Polytron homogenizer and the cells are broken open
by agitation with glass beads or passage through a microfluidizer.
The resulting lysate is centrifuged at 50,000 rpm for 45 min. The
supernatant is diluted with 20 mM NaPO.sub.4, 1 mM EDTA, pH 7.0
(buffer A). The diluted lysate supernatant is then loaded onto a
SP-Sepharose or equivalent column, and a linear gradient of 0 to
30% SP Buffer B (1 M NaCl, 20 mM NaPO.sub.4, 1 mM EDTA, pH 7.0) in
Buffer A with a total of 6 column volumes is applied. Fractions
containing telomerase are combined. Further purifications can be
performed.
[0191] For hexa-His fusion proteins, the lysate is clarified by
centrifugation and batch absorbed on a Ni-IDA-Sepharose column. The
matrix is poured into a column and washed with buffer, typically
either 50 mM Tris pH 7.6, 1 mM DTT; 50 mM MES pH 7.0, or IMAC
buffer (for hexa-his fusions). The telomerase protein bound to the
matrix is eluted in NaCl containing buffer.
Example 7
Recombinant Expression of Human Telomerase RNA Component
[0192] The human telomerase RNA component is first isolated by
amplification from genomic DNA. The amplification primers are
telRNA T (SEQ ID No: 126) and telRNA 598B (SEQ ID No: 128) (FIG.
5). Amplification conditions are 95.degree. C., 3 min; addition of
polymerase; 80.degree. C. 2 min; 35 cycles of 94.degree. C., 30
sec; 68.degree. C., 2 min.
[0193] The amplified product is inserted into pBluescript after
another amplification using hTR TAC (SEQ ID No: 142) (has a tac
promoter sequence) and hTR 3'Pst (SEQ ID No: 144) (has a cis-acting
ribozyme sequence) primers. The pBluescript insert is then isolated
and ligated to pACYC177.
Example 8
Expression of Human Telomerase Subregions
[0194] The RTase domain of human telomerase is determined by
sequence comparison with Moloney MuLV reverse transcriptase. The
fingers/palm region of Moloney MuLV reverse transcriptase forms a
stable unit for crystallization (Georgiadis et al., Structure 3:
879, 1995). A number of residues and motifs are conserved in the
active site of both proteins. Primers are designed to amplify the
RTase domain and the fingers/palm domain for insertion into an
expression vector and subsequent protein isolation.
3 Fragment ID Primers Amino acids I BT-177/BT-178 AAEH . . .
.fwdarw. . . . VQMPAH (SEQ ID No: 145)/(SEQ ID No: 146) (SEQ ID No:
151) . . . .fwdarw. . . . (SEQ ID No: 152) II BT-177/BT-179 AAEH .
. . .fwdarw. . . . VGLGL (SEQ ID No: 145)/(SEQ ID No: 147) (SEQ ID
No: 151) . . . .fwdarw. . . . (SEQ ID No: 153) III BT-182/BT-179
RATS . . . .fwdarw. . . . VGLGL (SEQ ID No: 148)/(SEQ ID No: 147)
(SEQ ID No: 154) . . . .fwdarw. . . . (SEQ ID No: 153) IV
BT-183/BT-179 VQMPAH . . . .fwdarw. . . . VGLGL (SEQ ID No:
149)/(SEQ ID No: 147) (SEQ ID No: 152) . . . .fwdarw. . . . (SEQ ID
No: 153)
[0195] Fragment I encodes the "fingers and palm" domain that
corresponds to MoMuLV. The C-terminal "thumb" and "connection"
(see, Kohlstaedt et al., Science 256: 1783, 1992) are deleted.
Fragment II encodes the telomerase reverse transcriptase domain, as
well as the C-terminal "connection" domain. The N-terminus is
chosen by size comparison with the MoMuLV RTase structure. Fragment
III encodes the C-terminus of the protein. The RATS sequence is
located within the RTase domain (palm region) of the protein.
Fragment IV encodes the C-terminal region containing the "thumb"
and "connection" domains and may function as a regulatory element.
The connection domain in HIV-1 is able to block the catalytic cleft
of HIV RTase in the absence of the RNase domain (Kohlstaedt et al,
supra). In an analogous fashion, the C-terminal region may be
useful as a regulatory (inhibitory) fragment. Moreover, sequence C
has a putative binding site for the SH3 domain of c-abl (PXXXXPXXP
(SEQ ID No: 93); PEMEPPRRP (SEQ ID No: 150), see variant 2 sequence
of FIG. 8). c-abl protein interacts directly with the ATM (ataxia
telangiectasia) protein (Shafman et al., Nature 389: 520, 1997), a
protein apparently involved in cell-cycle control, meiotic
recombination, telomer length monitoring and DNA damage response.
Binding of c-abl protein may be assessed in standard
protein-protein interaction methods. As such, an interaction of
telomerase and c-abl or other SH3-domain containing proteins (e.g.,
erb2) and regulation by movement of the telomerase C-terminus in
and out of the catalytic cleft may be controllable using the
constructs and products described herein. In one instance,
regulation may be mediated by phosphorylation/dephosphorylation
reactions.
[0196] All primers have either a Hind III or a Bam HI site. The
amplification reaction is performed in 1.times. Pfu buffer, 250
.mu.M dNTPs, 100 ng each primer, clone 53.2 template DNA using the
following cycling conditions: 94.degree. C. for 2 min; 25 cycles of
either 55.degree. C., 60.degree. C., or 65.degree. C. for 2 min,
72.degree. C. for 2 min, 94.degree. C. for 1 min; followed by
72.degree. C. for 10 min. Products of the predicted length are
obtained (966 bp for BT-177/BT-178; 1479 bp for BT-177/BT-179; 824
bp for BT-182/BT-179; 529 bp for BT-183/BT-179). The amplified
products are extracted with phenol:CHCL3 and precipitated with
ethanol. The products are resuspended and digested with the
appropriate enzyme that cleaves in the primer sequence.
[0197] The digested products are ligated to pBluescript that is
digested with enzymes that leave compatible ends. The inserts are
digested with Hind III and partially digested with Bam HI for
ligation to pGEX. The plasmid is transfected in BL21(DE3) cells and
selected on ampicillin plates. Colonies are picked and grown
overnight in liquid broth. An aliquot is diluted in Terrific Broth
with 100 .mu.g/ml ampicillin. The cells are grown at 37.degree. C.
and induced with 0.5 mM IPTG at approximately O.D. 0.8. Growth is
continued for 5 hours. Cells are collected by centrifugation and
may be processed immediately or frozen at -70.degree. C. until
needed.
[0198] Protein is purified from lysed cells. Cell pellets are lysed
by vortexing in 50 mM Tris pH 8.0, 10 mM 2-ME, 1 mg/ml lysozyme,
0.5% Triton X-100, 1 .mu.g/ml pepstatin, 10 .mu.g/ml leupeptin, 10
.mu.g/ml aprotinin, 0.5 mM PMSF, and 2 mM EDTA and a freeze/thaw
cycle. Lysates are clarified by centrifugation. Supernatant is
added to a 50% slurry of GSH-Sepharose, rotated at 4.degree. C. for
2 hr. The matrix is washed twice with lysis buffer, followed by 50
mM Tris, pH 8.0, 10 mM 2-ME. For analysis by SDS-PAGE gel
electrophoresis, sample buffer with 150 mM 2-ME is added and the
samples boiled.
Example 9
Isolation of Murine Telomerase Gene
[0199] The murine telomerase gene is isolated from genomic or cDNA
library. A mouse genomic library is constructed in .lambda.FIX II
vector from strain 129 DNA. The library is plated, and plaques are
lifted onto nylon membranes. The membranes are hybridized with the
insert from clone 53.1 (1.9 kb) under normal stringency conditions.
Six hybridizing plaques are chosen for further analysis.
Example 10
Demonstration of Telomerase Activity Using HT-1 and Telomerase
Variants
[0200] Full-length hT-1 sequence is cloned into an expression
vector and the resulting protein is assayed for telomerase
activity. Vector pRc/CMV2 (Invitrogen, Carlsbad, Calif.) is a
eukaryotic expression vector that has a multi-cloning site
positioned between a promoter, the RSV LTR, and a polyadenylation
signal and transcription termination sequences from the bovine
growth hormone gene. Telomerase sequence in which Leu49 codon was
converted to a Met codon was inserted into pRc/CMV2. One clone,
phTC51, is chosen for further study. The DNA sequence of the 5'
junction was determined and confirmed the orientation of the
insert. Subsequently, the sequence of the 3' junction was
determined and showed a deletion of the polyA signal, but no
deletion of telomerase coding sequence.
[0201] The clone is transfected into HeLa GM847 cells at passages
44 and 68, SUSM-1 cells at passage 18, and RKF-T/A6 cells at
passage 40. Cell extracts are assayed for telomerase activity by
the TRAP assay as described herein. As shown in FIG. 12, a ladder
of products indicative of telomerase activity is seen at the 1:100
dilution of extract from SUSM-1 cells and is not seen in control
cells. A ladder is not readily detectable at the higher
concentration of extract, which may be due to nuclease activity in
the extract.
[0202] Three telomerase variants are constructed: pAKI.4 is
telomerase with the alternative intron/exon beta region spliced out
(FIG. 13); pAKI.7 is telomerase with the alternative C-terminus
alternative intron/exon 3 (FIG. 14); and pAKI.14 is telomerase with
the alternative intron/exon alpha spliced out (FIG. 15). The 5' end
of the telomerase gene was inserted into each of these three
vectors and the inserts moved to pCIneo expression vector. The
variants, along with reference telomerase in pCIneo are transiently
transfected into GM847 cells, which are ALT cells having no
detectable telomerase activity but which express the RNA subunit.
Cell extracts are tested in a TRAP assay. The reference telomerase
exhibits activity, as well as the telomerase with insert 3 (pAKI.7
insert), but the other variants do not express activity.
[0203] From the foregoing it will be appreciated that, although
specific embodiments of the invention have been described herein
for purposes of illustration, various modifications may be made
without deviating from the spirit and scope of the invention.
Accordingly, the invention is not limited except as by the appended
claims.
* * * * *